Professional Documents
Culture Documents
Enzymes that modify DNA are useful because they allow the investigator to manipulate DNA in defined ways - Polymerases elongate DNA molecules by adding free nucleotides to the 3 ends (usually according to an opposite template strand) - Endonucleases cut DNA fragments in the middle of the molecule - Exonucleases degrade DNA from the ends - Ligases join loose ends of DNA together
DNA polymerases
DNA polymerases exonuclease activities: - Activity 35 exonuclease. ( proofreading activity) allows the polymerase to correct errors by removing a nucleotide that has been inserted incorrectly. - Activity 53 exonuclease activity is possessed by some DNA polymerases.
Proof reading activity of the 3 to 5 exonuclease. DNAPI stalls if the incorrect ntd is added - it cant add the next ntd in the chain
Proof reading activity is slow compared to polymerizing activity, but the stalling of DNAP I after insertion of an incorrect base allows the proofreading activity to catch up with the polymerizing activity and remove the incorrect base.
The types of DNA polymerases used in research: DNA polymerase I: Unmodified E. coli enzyme . Use: DNA labeling . Klenow polymerase: Modified version of E.coli DNA polymerase I Use: DNA labeling
The Enzymology
of DNA Replication
In 1957, Arthur Kornberg demonstrated the existence of a DNA polymerase - DNA polymerase I DNA Polymerase I has THREE different enzymatic activities in a single polypeptide: a 5 to 3 DNA polymerizing activity a 3 to 5 exonuclease activity a 5 to 3 exonuclease activity
Functional domains in the Klenow Fragment (left) and DNA Polymerase I (right).
DNA polymerase I
Nick Translation
Nucleases
Exonucleases
Figure. 1 Lambda Exonuclease selectively digests the strand of a PCR product produced using a PCR primer with a 5-phosphate. The resulting singlestranded PCR product can be used for SSCP analysis or sequencing.
Nucleases
Endonucleases
Endonucleases
I. Non specific
e.g. S1 nuclease, from the fungus Aspergillus oryzae And Deoxyribonuclease I (DNaseI), from Escherichia coli
II. Specific
e.g. Restriction endonucleases, from many sources
Endonucleases
I. Non specific - S1 nuclease (Endonuclease specific for singlestranded DNA and RNA, from the fungus Aspergillus oryzae Use:Transcript mapping - Deoxyribonuclease I (DNaseI) Endonuclease specific for double stranded DNA and RNA, from Escherichia coli Use:Nuclease footprinting
S1 nuclease protection digests only single-stranded RNA and DNA Find introns: intron
exon 1
Endonucleases
II. Specific e.g. Restriction endonucleases: Sequencespecific DNA endonucleases, from many sources Use:Many applications
Restriction endonuclease
Restriction Endonucleases - Also called restriction enzymes - Recognize, bind to, and cleave DNA molecules at specific sequences (usually 4-6 base pairs in length) but there are some that are 5, 8, or longer - The double strand breaks can create ends that are: * Blunt, cutting both strands in the same place * Sticky, with overhanging nucleotides on the 5 or 3 ends
Restriction endonuclease
Restriction enzymes Over 10,000 bacteria species have been screened for restriction enzymes Over 2,500 restriction enzymes have been found Over 250 distinct specificities Occasionally enzymes with novel DNA sequence specificities are still found while most now prove to be duplicates (isoschizomers) of already discovered specificities.
Restriction endonuclease
There are three types of restriction enzymes. With Types I and III there is no strict control over the position of the cut relative to the specific sequence in the DNA molecule that is recognized by the enzyme. These enzymes are therefore less useful . Type II enzymes do not suffer from this disadvantage because the cut is always at the same place, either within the recognition sequence or very close to it
Type II Restriction enzymes are endonucleases that cut DNA at specific sites, and are most useful for molecular biology research
Restriction enzymes
Restriction enzymes
Restriction Enzymes scan the DNA code Find a very specific set of nucleotides Make a specific cut
Restriction enzymes
Restriction enzymes recognize and make a cut within specific palindromic sequences, known as restriction sites, in the genetic code. This is usually a 4- or 6 base pair sequence.
Picking a palindrome
Words that read the same forwards as backwards hannaH Hannah Level Madam leveL madaM
Restriction enzymes
Restriction Enzyme Recognition Sites Restriction sites are general palindromic: Able was I, ere, I saw Elba
HaeIII
HaeIII is a restriction enzyme that searches the DNA molecule until it finds this sequence of four nitrogen bases.
Once the recognition site was found HaeIII could go to work cutting (cleaving) the DNA 5 TGACGGGTTCGAGGCCAG 3 3 ACTGCCCAAGGTCCGGTC 5
Restriction enzymes
Restriction enzymes are named based on the bacteria in which they are isolated in the following example for the enzyme EcoRI: E Escherichia (genus) co coli (species) R RY13 (strain) I First identified Order ID'd in bacterium
Restriction enzymes
Nomenclature of Restriction Enzymes The 1st letter (in capital and italics) = first initial of Genus name (from which the enzyme was isolated The 2nd and 3rd (in italics) = the first 2 letters of the species name e.g. Hin = Haemophilus influenzae The 4th letter (sometimes in italics) = strain or type e.g. Hind = Haemophilus influenzae Rd The roman number followed is given to distinguish different restriction and modification system in the same strain e.g. HindIII
EcoRII
.....CCWGG GGWCC.....
W=A or T
Restriction enzymes
Single stranded nick
Some more examples of restriction sites of restriction enzymes with their cut sites: HindIII: 5 AAGCTT 3 3 TTCGAA 5 BamHI: 5 GGATCC 3 3 CCTAGG 5 AluI: 5 AGCT 3 3 TCGA 5
Sau3A
5 G-A-T-C C-T-A-G 5
BamHI
5 G-G-A-T-C-C C-C-T-A-G-G 5
Isoschizomers: In certain cases, two or more different enzymes may recognize identical sites. (e.g. MboI also cleaves at GATC, and so is an isochizomer of Sau3A.)
Restriction enzymes
Frequency of cutting of recognition enzymes Sau 3A (GATC) cuts ()()()() = once every 256 base pairs (assuming G/C = A/T, which is often does not) BamH1 (GGATCC) cuts ()()()()()() = once every ~4Kb HindII (GTPyPuAC) cuts ()()()()()() = once every ~1Kb
http://tools.neb.com/NEBcutter2/index.php
PO4-A-A-T-T-C-A-G-C-T-A-C-G-3 HO-G-T-C-G-A-T-G-C-5
5-A-C-G-G-T-A-C-T-A-G-A-A-T-T-C-A-G-C-T-A-C-G-3 3-T-G-C-C-A-T-G-A-T-C-T-T-A-A-G-T-C-G-A-T-G-C-5
Exercise1
HindIII 1/ 6160
Eagl 542
YIP M
Apal 2035 PvuII 3547 SmaI 2860 SmaI 5 ccc ggg 3 How many base pairs in this plasmid? How mamy fragments will be produced if this plasmid is digested with PvuII?
_
DNA is negatively charged from the phosphate backbone Agarose mesh
Visualize DNA with ethidium bromide fluoresces orange ONLY when bound to DNA
Gel electrophoresis
Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Agarose gel electrophoresis is routinely used for the preparation and analysis of DNA. Gel electrophoresis is a procedure that separates molecules on the basis of their rate of movement through a gel under the influence of an electrical field.
46
Summary
Restriction endonucleases recognize specific sequences in DNA molecules and make cuts in both strands This allows very specific cutting of DNAs 4-7 The cuts in the two strands are frequently staggered, so restriction enzymes can create sticky ends that help to link together 2 DNAs to form a recombinant DNA in vitro
Exercise
(a) Sequence of a polylinker that includes one copy of the recognition site, indicated by brackets, for each of the 10 restriction enzymes indicated. Polylinkers are chemically synthesized and then are inserted into a plasmid vector. Only one strand is shown
1. The nucleotide sequence of a polylinker in a particular plasmid vector is GAATTCCCGGGGATCCTCTAGAGTCGACCTGCAGG CATGCThis polylinker contains restriction sites for BamHI , EcoRI , PstI , SalI , SmaI , SphI , and XbaI . Indicate the location of each restriction site in this sequence. 2. A vector has a polylinker containing restriction sites in the following order: HindIII , SacI , XhoI , BglII , XbaI , and ClaI . - Give a possible nucleotide sequence for the polylinker .
Enzyme BamHI EcoRI PstI SacI SalI SmaI SphI XbaI XmaI
Recognition Sequence G GATCC G AATTC CTGCA G GAGCT C G TCGAC CCC GGG GCATG C T CTAGA C CCGGG
Nucleases
RNases
Ribonuclease H (RNase H)
Replacement Synthesis
DNA ligases
DNA fragments that have been generated by treatment with a restriction endonuclease can be joined back together again, or attached to a new partner, by a DNA ligase. The reaction requires energy, which is provided by adding either ATP or NAD to the reaction mixture, depending on the type of ligase that is being used.
DNA ligases
DNA polymerase
Reverse transcriptase
Reverse transcriptase
- An enzyme that catalyses the synthesis of a DNA strand from an RNA template. - The produced DNA called complementry DNA (cDNA) * Present in retro virus & other RNA viruses * Application: Used in RT-PCR (e.g. detection of HCV-Ag)
Reverse transcriptase