International Congress of Canine Practice on Modern Concepts in Canine Health and Diseases of Human Concern and IXthAnnual Convention

of Indian Society for advancement of canine practice

9th- 11th February 2012 At Hotel Lallgarh Palace, Bikaner

Lead Papers, Abstracts and Proceedings

Editors

Dr. Anil Ahuja Dr. A. K. Kataria Dr. G. N. Purohit Dr. Deepika Dhuria Gargi Parihar

Compilation

K. K. Acharya

College of Veterinary and Animal Sciences, Bikaner

Rajasthan University of Veterinary and Animal Sciences, Bikaner (334001) Rajasthan, India
1

International Congress on "Modern Concepts in Canine Health and Diseases of Human Concern"
Patron

Prof. A.K.Gahlot
Vice-chancellor, RAJUVAS, Bikaner

ORGANISING COMMITTEE
Chairman : Dr. B.K.Beniwal, Dean, CVAS Co-chairman :Dr. R.K.Tanwar, Director Clinics Organizing Secretary : Dr. Anil Ahuja, Head, Deptt. of Clinical Vety. Medicine, Ethics and Jurisprudence Treasurer : Dr. Fakhruddin , Associate Professor, Deptt. ofVety. Epidemiology & Preventive Medicine EXECUTIVES : Dr. C.K.Murdia, Director Extension , RAJUVAS & Head , Deptt. of ABG. Dr. R.N.Kachhawah,Dean Student Welfare & Head , Deptt. of LPT. Dr. R. Rao, Director Research (VAS) Dr. S.S.Soni, COE and Associate Professor, Microbiology Dr. G.S.Manohar, Dean, PG studies &Head ,Deptt. of Vety. Parasitology. Dr. T.K.Gahlot,Head, Deptt. ofVety. Surgery and Radiology. Dr. S.K.Kashyap,Head ,Deptt. ofVety. Microbiology and Biotechnology. Dr. P.D.Swami, Head, Deptt. of Extension. Dr. S.C.Goswami, Head, Deptt. of LPM. Dr. RakeshMathur, Head, Deptt. of Vety. Anatomy. Dr.NaliniKataria, Head, Deptt. ofVety. Physiology. Dr.TribhuvanSharma,Director, PME Cell &Head, Deptt. of Animal Nutrition. Dr. HemantDadhich,Head, Deptt. ofVety. Pathology. Dr.J.S.Mehta,Head , Deptt.ofVety.Obst.&Gynae. Dr.P.K.Mehrotra, Head , Deptt.ofVety.Microbiology,PGIERCLHP,Jaipur. State liaison committee Dr.P.K.Mehrotra- Convener Dr.D.S.Meena Registration committee Dr. Fakhrudin- Convener Dr. AnjuChahar Dr. A.P.Singh Dr. Basant Bais Dr. Sunil Maherchandani Dr. DeepikaGoklaney Invitation committee Dr. D.K.Bihani - Convener Dr. AakashMaheshwari Accommodation committee Dr. C.K.Murdia- Convener Dr. C.S.Dhaka Transport committee Dr. V.K.Chaudhary- Convener Dr. Anil Moolchandani Catering committee Dr. T.K.Gahlot- Convener Dr. R.N.Kachhawa Dr. Tribhuvan Sharma Dr. R. K.Dhuria Scientific and Publication committee Dr. R.K.Tanwar- Convener Dr. Anil Ahuja Dr. T.K.Gahlot Dr. A.K.Kataria Dr. G.N.Purohit COMMITTEES Resource generation committee Dr. A.P.Singh - Convener Dr. J.S.Mehta Purchase committee Dr. R.N.Kachhawa,Convener Dr. P.D.swami Dr. H.Dadhich Technical session committee Dr. S. K. Kashyap - Convener Dr. A.K.Kataria Dr. Rajneesh Dr.AshokDangi Poster/ Exhibition committee Dr. S.K.Kashyap - Convener Dr. B.N.Shringi Press and Media committee Dr. R.N.Kachwaha - Convener Dr. R. K. Dhuria Stage and inauguration committee Dr. Tribhuvan Sharma - Convener Dr. HemantDadhich Cultural programme committee Dr. RakeshMathur- Convener Dr. Dinesh Bihani Dr. HemantDadhich Dr. Rajni Joshi

IX ANNUAL CONVENTION OF INDIAN SOCIETY FOR ADVANCEMENT OF CANINE PRACTICE

President Dr. Surendra Kumar Ray Bhubaneswar. Vice President Prof. Vijai Kumar Sinha Patna. Treasurer Dr. RajeshVarshneya Lucknow. Secretary General Dr. Arvind Kumar Srivastava Lucknow.

EXECUTIVE MEMBERS Dr. AdarshRatan Joshi, Delhi. Dr. Dipak Kumar De, Kolkata. Dr. Gustavo J.F.D.R. Pinto, Panji. Dr. Hemant T. Jain, Nagpur. Dr. O. S. Prakash, Shimoga. Dr. Rajesh RavindraRohi, Mumbai. Dr. R. K. Anand, New Delhi. Dr. Shyam K. Venugopal, Thrissur. Dr. Shrish Chandra, Allahabad. Dr. Vinod Kumar Sharma, Dehradun. Dr. Y. Kaspa Reddy, Guntur.

International Canine Congress & IX Annual Convention of ISACP 9th to 11th Feb. 2012

OUR SPONSORS

Indian Council of Agricultural Research (ICAR) Indian Council of Medical Research (ICMR) Department of Biotechnology (DBT) Council of Scientific and Industrial Research (CSIR)

RAJUVAS : ATA GLANCE

The Rajasthan University of Veterinary and Animal Sciences (RAJUVAS), Bikaner is a newly constituted body established under subsection (3) of section Iof the Rajasthan University of Veterinary and Animal Sciences, Act, 2010 consequent to carving out of units pertaing to veterinary and animal sciences from Swami Keshvanand Rajasthan Agricultural University, Bikaner and MaharanaPratap University of Agricultural and technology, Udaipur. The University came into existence on 13th May 2010. With His Excellency TheGoverner of Rajasthan as Chancellor of the University. Professor A.K. Gahlot has appointed as first Vice Chancellor of University. With in a short period after its establishment university has constituted its statuary bodies like Board of Management, Academic Council, Research Council and ExtensionCouncil etc. Before constitution such bodies Honorable Vice Chancellor has also constituted bodies like Core Advisory Committee, Public Relation Cell and Placement Cell and also appointed Dean Post Graduate Studies, Controller of Examination, Dean Student Welfare, Director Clinics, Director Extension Education, Director PME etc. The university has been established for the purpose of development of veterinary and animal sciences in the state of Rajasthan by ensuring proper and systemic instruction, training, research and extension. RAJUVAS family looks forward to a new zest vigor and interest in one and all to work for better living of animals and their owners. The university plays an important role in the state by training students at the Bachelor's, Master's and Doctoral level in various disciplines related to Veterinary sciences and Animal Husbandry and allied sciences, Rajasthan University of Veterinary and Animal Sciences educates and trains students through its various educational and training programs to develop knowledge and leadership to make them skilled professional courses to face the challenges of global economic policy and systems. The Rajasthan University of Veterinary and Animal Sciences is offering a 5 years Bachelor's degree of B.V.SC. & A.H., two years Master's degree M.V.Sc in 15 subjects and 3 years Doctoral degree PhD in 11 subjects and two years Animal Husbandry Diploma programme, Disease investigation lab, biotechnology usage in animal sciences and refresher courses for vets and paravetsof Rajasthan and other states are also working. The oldest constituent college of university is College of Veterinary and Animal Sciences, Bikaner established in 1954 is the oldest Veterinary College in the state. It has sanctioned strength of 104 faculty out of which 94 are in teaching and 13 in research the other constituent college of this university is the College of Veterinary and Animal Sciences, Navania, Vallabhnager (Udaipur). Recently a new Veterinary Colleges at Jodhpur has been sanctioned by the GOR. There are 7 private colleges affiliated to RAJUVAS. The university has also 49 institutes providing 2 years diploma in Animal Husbandry after 10+2 providing about 250 paravetsannually. Total students strength in constituent colleges of RAJUVAS is about 700, out of which around 79% are pursuing B.V.SC. & A.H., 10% M.V.SC, 1% Ph.D and 10% Animal husbandry diploma programme. Student welfare is well institutional and regular activities of NCC, NSS, Games aspects Research, union etc. taken care of.

In realization of the importance of Animal husbandry in rural economy and its contribution to the state exchequer, aseparate Directorate of researchfor Veterinary and Animal Science was established, the aim and objectives of research is to increase the overall production from livestock and to raise the living standards of weaker section Various livestockdevelopment programmes are aimed to increasing the productivity of the animals on sound and latest scientific methodology. There are various projects are there under RKVY to improve the quality of cattle breed viz. Tharparkar at LRS, Chandhan, Rathi at LRS Bikaner,Kankrej at LRS Kodamdesar and Gir at LRS Vallabhnagar, A programme on improvement of SurtiBuffalo at LRS Vallabhnagar, A project sponsored by ICAR on improvement of Magra sheep, A project on sheep and wool improvement scheme, Feed blocks using non conventional and conventional feed, A project in collaboration with university of tuftsBoston (USA) on anti bioticregistivity Pattern of bacteria. Treatment of all types of ailments and operations are being regularly carried out by the faculty of RAJUVAS for benefit of farmers&pet owners. In out door clinical centremore than 35,000 animals are diagnosed and treated annually. There are well equipped laboratories for blood, urine and stool testing there are sophisticated sonography and radiography machines through which high level of examinations are done. Under extensionprogrammecamps are organized in which 20000 animals are treated annually. A booklet for fore warning of disease is published and disseminated, Apex center conducts various training programmes for vets as well as paravets periodically, high level facilities on artificial insemination and embryo transfer technologies are also available, A museum is being develop in SadulSadan with display of different scientific models, audio-visual aids, posters, charts publications, photographs of extension activities etc. University is also planning to develop fodder banking technology. The main activities and programmes are breed improvementprogrammes using superior germ plasms, Production of Livestock feed and fodder, animal health care, nutrition and management aspects. RAJUVAS governs the research activities at its on campus and off campus in different disciplines at College of Veterinary and Animal Sciences, Bikaner.

Rajasthan University of Veterinary and Animal Sciences, Bikaner College of Veterinary and Animal Sciences,Bikaner International Congress on "Modern Concepts in Canine Health and Diseases of Human Concern" and IX Annual Convention of Indian Society for Advancement of Canine Practice 9-11 February 2012 09-02-2012
8:00-10:00 8:30-9:30 10:00-11:30 11:30-12:00 12:00 - 13:30 Chair : Prof. P. R. Jatkar Co-Chair: Prof. S.K. Gupta Rapporteur : Dr Hemant Dadhich Lead Papers Registration Breakfast Inaugural Function Inaugural Tea Theme Session:Modern concepts in canine health and diseases of human concern Prof. V. K. Sinha, Patna Prof. A.K.Gahlot, Bikaner Dr. R. V. Barar, Bikaner Dr. R.A. Bumb, Bikaner

Oral Presentation 13:30-14:30 14:30 - 16:30 Chair : Prof. N.R. Pradhan Co-Chair: Dr. ShamsulHaque Rapporteur :Dr. D.K. Bihani Lunch Session - 2: Canine Medicine Prof.H.A.Upendra,, Karnataka Dr. S. S. Randhawa , Ludhiana Dr. S. Haque, Ranchi. Dr. J.P.Varshney, Surat Dr. Surjit Singh Makker, Punjab Dr. S.K.Gupta, Jammu Dr. J.S. Soodan, Jammu

Lead Papers

Oral Presentation 16:30-16:40 16:40 - 18.30 Chair : Prof. A.C. Varshney Co-Chair: Prof. Dipak Kumar De Rapporteur : Dr. T.K.Gahlot Tea break Session - 3: Canine Surgery Dr. N. S. Saini, Ludhiana, Dr. Naveen Kumar, Izatnagar Dr.Amarpal, Izatnagar Prof. A.K. Srivastava, Ethiopia Dr.IndramaniNath , Bhubaneswar Dr. V.P. Chandrapuria, Jabalpur Prof. D.K. De, Kolkata

Lead Papers

Oral Presentation

10-02-2012
8:00-9:00 9:00 - 10:45 Chair : Dr. B.K. Beniwal Co-Chair: Prof. R.K. Chandolia Rapporteur :Dr. G.N.Purohit Breakfast Session - 4: Canine Reproduction and Breeding Dr.R.K. Chandolia, Hisar Dr. V. Chandrashekara Murthy, Bangalore Dr. Sudha G, Bangalore Dr. H K Verma, Ludhiana Dr.Paramjit Singh Mavi, Ludhiana Dr. S. P. Shukla, Rewa Dr. G. N.Purohit, Bikaner

Lead Papers

Oral Presentation 10:45-11:00 Tea break

11:00 - 13:30 Chair : Dr. P. N. Diewedi Co-Chair: Prof. J.C. Jena Rapporteur : Dr. S.K. Kashyap Lead Papers

Session - 5: Canine Microbiology, Virology, Immunology and Pathology. Dr. S. Nandi, Izatnagar Dr. P.N.Dwivedi, Ludhiana Dr. S.K.Kashyap, Bikaner Dr. Nitin Bhatia, Gujrat

Oral Presentation 13:30 - 14:30 14:30 - 16:00 Lunch Session - 6: Canine Nutrition, Hygiene and Management, Canine Behavior & welfare Lead Papers Dr. G. S. Nag, Bikaner Dr. ChandanLodh, Kolkata

Chair : Dr. N.V. Patil Co-Chair: Dr. SatyaBakshi Rapporteur : Dr. Tribhuwan Sharma

Oral Presentation 16:00 - 16:15 Tea Break

16:15 - 18:00

Chair : Dr. Hala El Miniawy Co-Chair: Prof. Dr. Saber Abu Zeid Rapporteur : Dr.R.K.Dhuria

Lead Papers

Session - 7: Applied subjects (Anatomy, Biochemistry, Parasitology, Pharmacology and Physiology) Prof. ZafarIqbalChaudhry, Pakistan Dr. A. Manimaran, Karnal Prof. A.K. Srivastava, Mathura

Oral Presentation

11-02-2012
8:00-9:00 Breakfast

9:00 - 10:30 Chair : Prof. S.B.S. Yadav Co-Chair: Dr. R.K. Tanwar Rapporteur :Dr. F.C. Tuteja

Lead Papers

Session - 8: Human ,Canine interaction & Zoonosis Dr. P.K. Kapoor, Hisar Prof. B.K.Tyagi, Madurai Prof. N.R. Pradhan, Kolkata Dr.R.K. Tanwar, Bikaner

Oral Presentation 10:30-10:45 Tea Break

10:45 - 11:30 Chair : Prof. P.K. Kapoor Co-Chair: Dr. C.K. Murdia Rapporteur : Dr. A.P. Singh 11:30 - 13:30 13:30-14:30 14:30

Session - 9: Poster Session Poster Presentation

Valedictory Session Lunch Local Visits Participants shall be escorted to visit National Re search Centre on Camel, National Research Centre on Equines and various temples

Index
Paper & Author Name Page No.

THEME SESSION - I
Key Note
Prof V.K.SINHA,

TL 1 : I Cutaneous Leishmaniasis Our Experience at Bikaner

RA Bumb, RD Mehta and BC Ghiya

TL 2 : I Hydatid cyst in Human being - A zoonotic alarm

Gunjan Soni

SESSION - II
LP 1 : II Canine pancreatitis disease that goes unnoticed
H.A.Upendra,

LP 2 : II Recent advances in the diagnosis and management of chronic gastrointestinal diseases of canines
S. S. Randhawa and N. Chand

LP 3 : II Veterinary hemodialysis : Advances in management of renal failure in dogs

S. Haque

16

LP 4 : II Electrocardiography-a noninvasive diagnostic tool for evaluation of cardiovascular system

J.P.Varshney

20

LP 5 : II Role of Alternative Medicine in Dental Diseases in Dogs

Surjit Singh Makker

24

LP 6 : II Scenario of Parvo dog infection in canines

S.K.Gupta, V. S. Wazir Rajesh Kalha and Rajiv Singh

28

LP 7 : II Canine Infectious Dermatitis and Its Management

J.S.Soodan, S.K.Sharma and V.S.Wazir

31

Abst 1 : II Hepatozoon canis infection in a bitch

Agnihotri ,Divya, Jain, V.K., Deepika and Singh,Gyan

36

Abst 2 : II Epidemiology and hemato-biochemistry in naturally occurring cases of canine monocytic ehrlichiosis in and around bareilly, india
Behera, S.K. and Dimri, U.

36

Abst 3 : II A retrospective study of Borrelia burgdorferi antibodies in dogs in minnesota

Aneela Z. Durrani, Sagar M. Goyal

37

Abst 4 : II Canine husbadry in Saudi Arabia: An over review

Bakhsh, A.

37

Abst 5: II Canine monocytic ehrlichiosis, its occurrence and clinico-therapeutic attributes

Kumar Abhishek and Haque S.

37

Abst 6 : II Clinical, haemato-biochemical characterization and therapeutic management of canine parvo-viral enteritis
Sharma, S.K., Joshi, Monika, S.K. Vyas and Singh, Shakti

38

Abst 7 : II Symptomatic bradycardia in dogs its treatment with abis nigra30c

Varshney, J.P.; Chaudhary, P.S., Deshmukh, V.V. and Prajwalita T. Sutaria

38

Abst 8 : II Parvo Virus Infection in Dog- A Case Report

Rawat Ashwani Kumar, Asopa Shesh, Rani Sunita, Vyas Indu, and Gupta Anuradha

39

Abst 9 : II Purulent conjunctivitis in Kitten

Chetan Kumar G K and N. Nagaraju

39

Abst 10 : II Therapeutic management of clinical case of epilepsy in a dog

Sridhar, Rakesh Kumar, V.K.Jain and Yudhbir Singh

39

Abst 11 : II Studies on the epidemiology, diagnosis and therapeutic mangement of fungal dermatitis in canines of jammu region
R.K.Bhardwaj, Sabhat Gazal, A.K.Taku and M.A.Bhatt

40

Abst 12 : II A report of Lead poisoning in two mixed-German shepherd dogs in Babolsar, North of Iran
Ghanbari Kalahrudi Kh., Aldavood S.J. and Naderi nezhad F.

40

Abst 13 : II Oral papilloma and its treatment with azithromycin in dogs

R.K.Bhardwaj, Indu Bushan and Rishi Sharma

41

Abst 14 : II Chocolate poisoning in four Terrier dogs in Tehran

Bitaraf M. , Aldavood S.J., Alyari A., Ahmadi bozorg M.J.

41

Abst 15 : II Prevalence of hypothyroidism in dogs in hisar, haryana

Gulzar,S., Khurana,R., Agnihotri,D., Aggarwal, A. and Narang,G.

42

Abst 16 : II Management of chronic epiphora in dogs

Kumar, A. and Goel, P.

42

Abst 17 : II Herbal management of rickets in pups

Praveen Kumar, Amit Prasad , Niddhi Arora and Tarun Kumar

43

Abst 18 : II Babesiosis and its therapeutic management in a dog A case report

Ahuja Anil, Varshney J.P.,Singh Naveen Kumar, Bihani D.K., Gokhalany, Deepika

43

Abst 19 : II Determination of Electrocardiographic reference ranges in Labrador retriever

M.B. Gugjoo, M. Hoque, M.C. Sharma, A.C. Saxena, M.M.S. Zama and A.M. Pawde

43

Abst 20 : II Epidemiological analysis of major dermatological disorders in dogs

Khurana, R., Khatak, N. and Agnihotri D.

44

Abst 21 : II Case report of canine dermatitis in ri-bhoi district of meghalaya

Puro, K., Sunjukta, R., Dubal, Z.B., Ghatak, S., Shakuntala, I., Laha, R and Sen, A.

44

Abst 22 : II Trypanosomiasis in a bakerwali dog-a case report

R.K.Bhardwaj, Himalini, Ramandeep Singh, Virampal Singh and Manoj Sinsinwar

45

Abst 23 : II Demodicosis in dog: A case report

Chetan Kumar G K

45

10

Abst 24 : II Cardiogenic pulmonary edema in a dog A case report

Ramesh P.T., Nandini M.K., Malatesh D.S and PoonamVishwakarma

45

Abst 25 : II A rare case of Malassezia pachydermatis stomatitis in a spitz dog

R.K.Bhardwaj, Sabhat Gazal, A.K.Taku and M.A.Bhatt

46

Abst 26 : II Trypanosomosis in a dog A case report

Priyanka , Choudhary D., Kumar S. and Vyas S.K.

46

Abst 27 : II Snake bite in a dog - A case report

Bihani, D.K., Gahlot, A.K., Ahuja, A. and Tanwar, R.K.

46

Abst 28 : II Comparative evaluation of therapeutic efficacy of different drug combinations in clinical cases of pyoderma in dogs
Anju Bala, Anshu Sharma, V. K. Jain, Rakesh Kumar, Sridhar, N. K. Rakha,

47

Abst 29 : II Epidemiological and Haematological Studies onDogs suffering from Pyoderma

Anju Bala, Anshu Sharma, V. K. Jain, Rakesh Kumar, Sridhar, N. K. Rakha,

47

Abst 30 : II Treatment of concomitant infection of CME andPiroplasmosis in Boxer dog: Case report
Deepak Verma and PK Prusty

48

Abst 31 : II Demodicosis and its therapeutic management in a dog - A case report

Ahuja Anil, Singh Naveen Kumar, Bihani D.K. and Gokhlany, Deepika

48

Abst 32 : II Chronic renal failure in a dog - A case report

Deepika Gokhlany, Naveen Kumar Singh, Akash Maheshwari and Anil Ahuja

48

Abst 33 : II Haemato- Biochemical Studies in Canine Hemorrhagic gastroenteritis - A Case Report

Deepika Gokhlany, D.K. Bhiani, A.P. Singh and Urmila Pannu

49

Abst 34 : II Baesiosis in a dog- A case report

A. Maheshwari, A.P. Singh, Deepika Gokhlany and Sandhya Morwal

49

Abst 35 : II Canine babesiosis- A case report

Priyanka, Ahuja Anil,Dhuria Deepika, Naveen Kumar and Bihani D.K.

49

Abst 36 : II Haematological and therapeutic studies on canine distemper infected dogs

Saini, D.K., Kumar, S., Bihani, D.K., Khinchi, R.K.

50

Abst 37 : II Canine parvo virus infection in a dog - A case report

Priyanka, Ahuja Anil, Meena D.S. and Singh R.K.

50

Abst 38 : II Amitraz poisoning in canine - A case report

Surender Kumar, D. Singh, D.K.Saini, D.K. Bihani, A.Chahar

50

Abst 39 : II Drug induced hepatitis in a spitz dog

Gopal Krishan, Asmita Narang, Niddhi Arora, Tarun Kumar and Hemant Mehra

51

Abst 40 : II Successful management of cystitis in a bitch

Pramila Umrao,Vivek kumar saroz, Pratima Singh and Mukesh Srivastava

51

Abst 41 : II Therapeutic management of demodectic mange in dogs

Choudhary Sheela and Singh Ajay

52

11

Abst 42 : II Organophosphorus compound poisoning in dog - A case report

Prajapati R. S., Prajapati Madhu and Murdia C.K.

52

Abst 43 : II Hypothyroidism in a dog - A case report

Singh Naveen Kumar, Ahuja Anil, Deepika Goklaney ,Kachhawa J.P.

52

Abst 44 : II Efficacy of Radiofrequency Heat Therapy in treatment of Human and Canine cutaneous leishmaniasis
Neha Prasad, R A Bumb and Ahuja Anil

53

Abst 45 : II Gingivitis in a spitz dog - A case report

N. K. Mudgal, A. P. Singh, Anil Ahuja, D. K. Choudhary and J. Kachhawa

53

Abst 46 : II Clinical studies on canine parvovirus (cpv) infection in dogs

Bargujar, J., Ahuja, Anil, Bihani, D.K., Soni, S.S., Kataria, N., Sharma, S.K. and Rathore, Bhavana3

54

Abst 47 : II Lymphosarcoma in a dog

R.K. Tanwar, S.N. Mishra, Fakhruddin and Anju Chahar

54

Abst 48 : II Otitis media in canines

J.P. Kachhawa, A.P. Singh, Dinesh Choudhary, N.K. Singh, N. K. Mudgal and R.K. Dedar

55

Abst 49 : II Management of hind limb paresis in german shepherd dog - A case study
D. K. Choudhary, A. P. Singh, N. K. Mudgal and J. Kachhawa

55

SESSION - III
LP 1 : III Osteosynthesis for fracture management in small animal practice
N. S. Saini and M. Raghunath

57

LP 2 : III Diagnostic and Therapeutic Laparoscopy in Canine Patients

Naveen Kumar

65

LP 3 : III Recent advances and potential application of mesenchymal stem cells in canine surgery
Amarpal

71

LP 4 : III Canine ascites

Chandrapuria, V. P.

76

LP 5 : III Current Concepts in Canine Anaesthesia

Ashok Kumar

81

LP 6 : III Stem cell therapy for clinical wound healing in dogs

Indramani Nath and Subharaj Samantara

87

LP 7 : III Latest concepts of acupuncture for physiotherapy in canine practice

A.K. Srivastava

90

Abst 1 : III Removal of thoracic oesophageal obstruction through gastrotomy approach in a dog under IITV control
T K Gahlot, M C Parashar, K Kachwaha and S M Qureshi

96

Abst 2 : III Surgical Management of Multiple Intestinal Obstruction and The intussuseption in a German Shepherd Dog
Mrunali Kamble, S. V. Upadheye, M. S. Dhakate and Balwant Meshram

96

12

Abst 3 : III Successful management of mucocele in a dog

K. Kachawaha, SM Qureshi, MC Parashar and TK Gahlot

97

Abst 4 : III Surgical management of mammary tumor in old aged bitch: A case report
Mrunali Kamble and Balwant Meshram

97

Abst 5 : III Comparative evaluation of surgical and semisurgical procedures for prostatic hyperplasia in canine
Gupta Satyendra Kumar, Chandrapuria V. P., Singh R.and Shahi Apra

97

Abst 6 : III Successful Surgical Management of Pyometra in a Female Dog: A Case Report
Mrunali Kamble, S. V. Upadhey, M. S. Dhakate, B. M. Gahlod and Rani Tantrapade

98

Abst 7 : III Prepubertal sterilization in dogs for the control of over population
M.K.Narayanan and K.Rajankutty

98

Abst 8 : III Relation of Diet with Urinary Bladder Stone Formation in Dog
M. Molazem, SH. Asadi, R. Hashemzade

99

Abst 9 : III Surgical management of sebaceous adnexal tumour in a dog

L. Ranganath, V. Mahesh and Ramesh Rathod.

99

Abst 10 : III Surgical excision of large fibroma from metatarsal region in a dog A case report
Ramesh Rathod, B. Nandeesh Kumar and L. Ranganath

100

Abst 11 : III Surgical management of large perianal gland tumour in a dog

Ramesh Rathod and L. Ranganath

100

Abst 12 : III Surgical management of gastro-intestinal obstruction caused by a wire mesh in a dog
V. Mahesh, Ramesh Rathod and L. Ranganath

101

Abst 13 : III Surgical management of intestinal adenocarcinoma in a dog A case report

L. Ranganath, V. Mahesh and Ramesh Rathod.

101

Abst 14 : III Umbilical hernia in an adult pug- A case report

Ramesh Rathod, Namratha Poonacha and L. Ranganath

102

Abst 15 : III Successful treatment of osteoclastoma in a golden retriever dog by cell based therapy
Das, Jayakrushna., Nath, I., Routray, P. and Purohit, G.K.

102

Abst 16 : III Amputation of necrotic penis due to post coital paraphimosis in a castrated dog A case report
L. Ranganath, V. Mahesh, Ramesh Rathod and Namratha Poonacha

103

Abst 17 : III Eight cases of Gastric Dilation Volvulus in dog.

Jain H.T. and S.V.Upadhye

103

Abst 18 : III Correction of diaphragmatic hernia in nondescript dogs

Chaudhary, P.S.; Varshney, J.P., Deshmukh, V.V. and Prajwalita T. Sutaria

104

Abst 19 : III Differential diagnosis of prostate disorders

Gupta Satyendra Kumar1, Chandrapuria V. P., Shahi Apra and Singh R.

104

Abst 20 : III Retrieval of foreign bodies in dogs

Chaudhary, P.S.; Varshney, J.P.,Deshmukh, V.V. and Prajwalita T. Sutaria

104

13

Abst 21 : III Surgical management of venereal tumour in a male mixed breed dog
Das, Jayakrushna., Nayak, S., Behera, S S., Sika, P. and Sahu, A.

105

Abst 22 : III Surgical management of pyometra-case studies in 27 bitches

Jayakrushna Das, Sadananda Nayak, Sidhartha Sankar Behera, Soumyaranjan Pati and Monalisa Behera

105

Abst 23 : III Successful treatment of cystolith in a labrador dog

Das, Jayakrushna., Behera, S S., Sika, P., Sahu, A., Surey, A.

106

Abst 24 : III Failures and Success of Caesarian Section in Dogs

O .S. Prakash

106

Abst 25 : III Cardioplasty for management omegaoesophagus consequent to gastroesophageal stricture in a dog
Dinesh P.T., Vinu David P and Jayakrishnan

106

Abst 26 : III Colorectal small cell carcinoma in Canine: A case report.

P.T. Dinesh, Sindhu O.K. and T.M. Divya

107

Abst 27 : III Successful management of intestinal necrosis and rupture in a dog- a case report
Jayakrushna Das, Sidhartha Sankar Behera, Prasanta Kumar Sika and Ananta Hembram

107

Abst 28 : III Management of tartar in dogs

M. Nagar. M.C. Parashar, K. Kachawaha, M. Agrawal, B.M. Meena and T.K. Gahlot

107

Abst 29 : III Rehabilitation of Coxofemoral luxations and pelvic fracture in dogs A report of 12 clinical cases.
A.K. Maji, D.Ghosh, Arnab Kr. Majie and Munmun De

108

Abst 30 : III Bilateral gravid uterine prolapse in bitch and their management
D. Ghosh, D. Chakraborty and A Nath

108

Abst 31 : III Oesophageal choke by a bone in a dog A case report

Ramesh Rathod and L. Ranganath

109

Abst 32 : III Endoscopic examination of oesophagus and stomach in 56 dogs with womitting
Syam K.Venugopal., Anoop,S., Narayanan, M.K., John Martin,K.D and Devanand, C.B

109

Abst 33 : III Surgical removal of gastric foreign bodies from a Labrador dog
Brijesh Kumari Meena, M C Parashar, A. K. Palai, K Kachwaha, S M Qureshi, M Nagar and T K Gahlot

109

Abst 34 : III An overview of some unusual surgical affections in canine patients

J. Singh, Madhu, D.N., A.C.Saxena, P. Kinjavdekar, Amarpal, H.P. Aithal,

110

Abst 35 : III Ocular disorders and their surgico-therapeutic management in companion animals
I.P. Sarode, Madhu D.N., J. Singh, A.M. Pawde, P. Kinjavdekar, Amarpal, H.P. Aithal,

110

Abst 36 : III Incidence and therapeutic management of maggot wounds in dogs: A review of 100 cases
Sivanarayanan T.B, Madhu, D.N., J. Singh, D. Bodh, A.M. Pawde, Amarpal, H.P. Aithal,

111

Abst 37 : III Multiple cystic calculi in dogs A case report

M C Parashar, A. K. Palai, K Kachwaha, S M Qureshi, M Nagar and T K Gahlot,

111

Abst 38 : III The removal of a tissue ring of meat food around the tongue in a cat
Brijesh Kumari Meena, M C Parashar, A K Palai, K Kachwaha, S M Qureshi

112

14

SESSION - IV
LP 1 : IV Advances of three dimensional and four dimensional ultrasonography in the field of canine practice
R.K. Chandolia and Jinsa George

113

LP 2 : IV Prediction of parturition date in bitches

V. Chandrashekara Murthy

118

LP 3 : IV Advances in medical management of canine pyometra

Sudha, G

122

LP 4 : IV Common Neoplasms-Venereal and Mammary Tumours of Canines

Harish Verma and R K Sharma

125

LP 5 : IV Reproduction Management in the bitch

Paramjit Singh Mavi

130

LP 6 : IV Recent Advances In canine Pyometra

S. P. Shukla, N. K. Bajaj and M. K. Shukla

134

LP 7 : IV Management of post partum genital complications in the bitch

G N Purohit, DK Bihani and AA Gauri

139

Abst 1 : IV Canine pyometra- study of twelve cases

S.V.Upadhye, H.T.Jain and Gauri Khante

145

Abst 2 : IV Vaginal hyperplasia- A case report of six female dogs

Chandrapuria V.P., Gupta S. K., Dhakre H. S., Rai Somil

145

Abst 3 : IV Functional evaluation of chilled canine ejaculates with priority given to the morphological abnormalities of spermatozoa
Thapak S., L. Sharma B.L., Shrivasatava O.P., Shahi A., Bharadwaj V., Tripathi S.M., Sankhala L.N.

145

Abst 4 : IV Cystic ovarian follicular disease in two spitz bitches: a case study
Bhoi, H., Das, S., Mohanty, D. N. and Pattanayak, T.K.

146

Abst 5 : IV Management of vaginal prolapse in a bitch- A case report

Sudershan Kumar,Ankur Sharma, H.R.Bhardwaj, A.K. Pandey &Ashok Kumar

147

Abst 6 : IV Metritis In Bitch- A Case Report

Asopa Shesh, Rawat Ashwani Kumar, Rani Sunita, Vyas Indu, and Gupta Anuradha

147

Abst 7 : IV Studies on semen collection behaviour and seminal characteristics in the dog
Sumit Prakash Yadav, J.S. Mehta

147

Abst 8 : IV Vaginal hyperplasia in bitch and its treatment

A.K.Nahak, S.Sahoo, I.Mohanty, B.K.Patra and D. N.Mohanty

148

Abst 9 : IV Evaluation of extenders and cryopreservatives for cooling and cryopreservation of spermatozoa from the German Shepherd dogs
Thapak S., Sharma B.L., Shrivasatava O.P., Shahi A., Bharadwaj V., Tripathi S.M., . Sankhala L.N.

148

Abst 10 : IV Estrous induction in bitches using oral bromocriptine

Pramod Kumar, G.N.Purohit, J.S. Mehta, Sunanda Sharma, Sumit Prakash Yadav, Amit Kansujia,

149

15

Abst 11 : IV A Clinico-pathological study of the effect of Vincristine Sulphate Chemotherapy in Transmissible Venereal Tumour in Dogs
Naresh Mitharwal, R.K.Joshi, J.S.Mehta, Amit Kumar4and Pradeep Kumar

149

Abst 12 : IV Retrieval of emphysematous pup via caesarean section

Harpreet Kour, Smita, Gurmeet Singh, M. H. Jan, S.T. Bashir and Jasmeet Singh

150

Abst 13 : IV Diabetes mellitus: A genetic disease in canine

Prajapati Madhu, Prajapati R. S., Murdia C. K., Pannu Urmila and Saini B. S.

150

Abst 14 : IV Subinvolution of placental sites (SIPS), in a bitch A case report

Pramod Kumar, G.N.Purohit, J.S.Mehta, Sunanda Sharma, Sumit Prakash Yadav,

151

Abst 15 : IV Unilateral uterine prolapse and its management in a bitch

S.T. Bashir, M.H. Jan, Mahak Singh, J. Singh, A.C. Saxena and A.M. Pawde

151

Abst 16 : IV Mummified fetus and a live eviscerated intestines pup in a pug bitch: A case report
Pandey A. K., Sharma Utsav, Gupta Ajay, Gupta Pankaj, Kumar Sharad, Diwedi D. K., Kushvaha R. B., Kumar Sudershan, Rao M. M., Razzaque W. A. A. and Kumar Sudhir

152

SESSION - V
LP 1 : V NEW DEVELOPMENT IN ANTIRABIES VACCINES FOR ANIMALS
S. Nandi, Vishal Chander, Chintu Ravishankar, T.K. Mahapatra and R. Verma

153

LP 2 : V Emerging and Reemerging Viral diseases of Canines

P.N.Dwivedi, Gurpreet Kaur and Ramneek

159

LP 3 : V Immunization strategies for rabies control in global perspective

S.K.Kashyap

162

LP 4 : V Advances in Diagnosis of Diseases in India with Special Emphasis to Companion Animals

Nitin Bhatia and Abhishek Garg

167

Abst 1 : V Standardization of differential PCR for diagnosis of infectious canine hepatitis (ICH) and infectious canine tracheobronchitis virus (ICTB)
Vishal Chander, S. Nandi and Rishendra Verma

170

Abst 2 : V Antibody prevalence to canine distemper virus (cdv) in unvaccinated rural dogs of torkaman county in iran
Rostami A, Namroodi S., Bahonar A.R. and Barin A

170

Abst 3 : V Serological Evidence of Leishmania donovani Infection in Apparently Healthy Dogs using Direct Agglutination Test (DAT) and rk39 Dipstick Tests in Kafta Humera, north-west Ethiopia
S. Kalayou, H. Tadelle, A. Bsrat, N. Abebe, M. Haileselassie, H. D. F. H. Schallig

171

Abst 4 : V Antimicrobial susceptibility patterns of microbes isolated from otitis externa of dogs
Kruthikaben D., Sharma S.K., Maherchandani S., Shringi B.N., Kashyap S.K.

171

Abst 5 : V Resistotyping of E. coli isolated from rectal swab samples of enteritic dogs
Sharma S.K., Kruthikaben D., Maherchandani S., Shringi B.N., Kashyap S.K.

172

Abst 6 : V Canine pyometra and its antibiogram pattern

Bassessar V., Verma Y., Swamy M., Tripathi S.M., Sankhala L.N., Trivedi M.S.

172

16

Abst 7 : V Sporotrichosis in cats

Ranjit Kaur Mendhir

172

Abst 8 : V Random Amplified Polymorphic DNA typing of Aeromonas species isolates from foods of animal origin, water and clinical cases from Jammu Province, Jammu & Kashmir
Bakshi, S.B; Kotwal, S.K and Taku, A.K.

173

Abst 9 : V Antimicrobial sensitivity testing of bacteria isolated from skin of dogs suffering from pyoderma
Anju Bbala, Anshu Sharma, V. K. Jain, Rakesh Kumar, Sridhar, N. K. Rakha,

173

Abst 10 : V A retrospective study on status of canine diseases in Rajasthan State

A.K.Kataria, N. Kataria, Ruchi Pachaury, Rajneesh and A.K.Gahlot

174

Abst 11 : V Assessment of canine plasma for its suitability in coagulase test with Staphylococcus aureus
V. Khichar and A.K.Kataria

174

Abst 12 : V A survey study on status of brucellosis and haematoprotozoan infections in stray dogs
A.K.Kataria, N.Kataria, Rajneesh, P.Nathawat, Ishrat-Ullah Ansari and Diane Blanger

174

SESSION - VI
LP 1 : VI Role of Dogs In Security
G S Nag, Deputy Commandant BSF, Bikaner

175

LP 2 : VI Impact of Vitamins and Minerals on Canine Health

Chandan Lodh

177

Abst 1 : VI Food Animal lvermectin Overdose in a Local Dog

Shaba, P.

181

Abst 2 : VI Flourishing dog meat cuisines in Kaduna metropolis, Nigeria.

Shaba, P.

181

Abst 3 : VI Animal Welfare organization working at border area

Rajiv Sharma

182

Abst 4 : VI Geriatrics the problem of ageing and diseases of elderly dogs

Basant Bais and Garima Choudhary

182

Abst 5 : VI A Case study of Cypermethrin shampoo licking poisoning using indigenous novelty based probiotic drink for dog
Gopal Krishna

183

Abst 6 : VI Management of obsessive compulsive tail chasing and biting in a dog a report
Madhavan Unny N, John Martin K D, Manju K Mathew and Ajithkumar S

183

Abst 7 : VI Can Dogs Help Keep You Healthy? Exploring the Human-Animal Bond
Om Prakash Choudhary, Aditya Godara, Sorabh Kr. Amarwal

184

Abst 8 : VI Grooming an enjoyable interaction between dog and owner

Basant Bais and Devendra singh

184

Abst 9 : VI Noahs ark animal rescue, Ipoh Malaysia

Ranjit Kaur Mendhir

184

17

Abst 10 : VI Environmental enrichment of dogs

Sankhala L.N., Tripathi S.M and Joshi A.

185

Abst 11 : VI They died and you paid for it : Cosmetics and Unneccessary Painful Testing
Gupta,S

185

Abst 12 : VI Behavioral problems of pups and training

Choudhary G.

185

SESSION - VII
LP 1 : VII Vector Identification and their Role in Epidemiology of Canine Babesiosis
Zafar Iqbal Chaudhry, Muhammad Ali and Isma Bashir Nazli

187

LP 2 : VII Drug delivery system in canines

A. Manimaran and A. K. Srivastava

193

LP 3 : VII Pathology and pathogenesis of canine flu

A.K. Srivastava

197

Abst 1 : VII Angiographgy of arterial vascular pattern of some pelvic limb muscles as a guide for experimental muscle transplantation in dogs
Abuzeid, S.M.S.; Awad, M.A.; Ahmed, I.H. and El-Daharwy, M.H.

201

Abst 2 : VII Inhibition of oxidative stress and apoptosis in peripheral blood of dogs with canine monocytic ehrlichiosis
S.K. Behera, U. Dimri, R. Jhambh and A.M. Kumara

201

Abst 3 : VII Parasites diagnosed in local dogs from 2009 to 2011 in the Veterinary Research Institute, Ipoh, Malaysia
Chandrawathani P., Nurulaini R., ErwanasAsmar, I., Adnan M., Premaalatha B., Muhammad Hazmi Y., Zaini C. M.,Fazly Ann Z., Jamnah O., Masrin A.&Ramlan, M.

202

Abst 4 : VII A Study of correlation between hematological values and chronic skin infections in dogs
Raheela Akhtar, Faheem Afzal, Muhammad Younus, Qamarun Nisa and Fariha Akhtar

202

Abst 5 : VII Effect of Treadmill Exercise on Creatine kinase and Lactate dehydrogenase enzyme level in German Shepherd Dogs
N. S. Rathore, A. Moolchandani, M. Sareen and D. S. Rajput

203

Abst 6 : VII Pathology of Diffuse Interstitial Nephritis in Kidney Lesions of Dog

Goyal Sanjay, Rani Sunita, Vyas Indu, Rawat Ashwani Kumar and Asopa Shesh

203

Abst 7 : VII Pathology of hemorrhagic enteritis in dog

Vyas Indu, Rani Sunita, Rawat Ashwani Kumar and Asopa Shesh

203

Abst 8 : VII Pathological observations of fatty changes in liver of dog

Agarwal Manish, Rani Sunita, Vyas Indu, Rawat Ashwani Kumar and Asopa Shesh

204

Abst 9 : VII Pathology of Chronic Renal Failure in Dog

Rani Sunita, Vyas Indu, Rawat Ashwani Kumar, Asopa Shesh and Gupta Anuradha

204

Abst 10 : VII Hemato-biochemical alterations in canine pyometra

Bassessar V., Verma Y., Swamy M., Sharma B.L., Tripathi S. M., Sankhala L. N., Trivedi M.S.

204

18

Abst 11 : VII Clinical studies in naturally occurring cases of canine trypanosomiasis in surat (Gujarat)
Deshmukh, V.V.; Varshney, J.P., Chaudhary, P.S. and Prajwalita T. Sutaria

205

Abst 12 : VII Assessment of stress due to hot ambience in dogs from arid tracts in India
N. Kataria and A.K.Kataria

205

Abst 13 : VII Physico-chemical properties and microbial load in refinery effluenta source of drinking water to street dogs
Pratima Singh, Pragati Swarnkar, Shivam Chaturvedi, Rajendra Singh and A.K. Srivastava

206

Abst 14 : VII Canine Dirofilariasis - A clinical case report

Mohanty, I., Gupta, A.R., Sardar,K.K., Palai, S., Rout, S. and Nahak, A.K.

206

Abst 15 : VII Effect of age on serum chemistry profile and thyroid hormones in German Shephered dogs
Sareen, M. and Moolchandani, A.

207

Abst 16 : VII Gross and histopathological observations of hepatic abscesses in dogs (Canis familaris)
M. Mathur, M. Agrawal; H. Dadhich, S. K. Goyal and A. P. Singh

207

Abst 17 : VII Heartworm in dogs

Ranjit Kaur Mendhir

207

Abst 18 : VII T3 and T4 Estimation as marker of hypothyroidism induced dermatological disorders

P. T. Ramesh

208

Abst 19 : VII Gross and biometrical studies on os penis ofindian wolf (Canis lupus pallipes)
Om Prakash Choudhary, Arun Sanadhya

208

Abst 20 : VII Gross and histopathological observations of hydronephrosis in dogs

S. K. Goyal, H. Dadhich, M. Mathur, R. Khanna and A. P. Singh

208

Abst 21 : VII Influence of age, breed, and exercise on thyroid hormonal status in dogs
A. Moolchandani and M.Sareen

209

Abst 22 : VII Pathological observations on Toxic Hepatitis in Dogs (Canis Familaris)

M. Agrawal, H. Dadhich, M. Mathur, S. K. Goyal and A. P. Singh

209

Abst 23 : VII Nodular dermatitis in dog- A case report

A. P. Singh, M. Mathur, H. Dadhich and A. Maheshwari

209

Abst 24 : VII Pathological and haemato-biochemical observations on basal cell tumor in dogs
H. Dadhich; R. Khanna; M. Mathur and A. P. Singh

210

Abst 25 : VII Assessment of oxidative stress in brucella affected stray dogs

A.K.Kataria, N.Kataria, T. Bhati, Ishrat-Ullah Ansari and Diane Blanger

210

Abst 26 : VII Laboratory evaluation of health status of stray dogs

N.Kataria, A.K.Kataria, Ishrat-Ullah Ansari and Diane Blanger

211

Abst 27 : VII Fuelling of TCA cycle in hepatic cells of dogs during cold ambience
N. Kataria, A. Joshi, N. Pandey , S. Soren, Abhimanu and L.N. Sankhala1

211

Abst 28 : VII Biomarkers of physiological defense against reactive oxygen species during ambient stress in dogs
N. Kataria, S. Arora, S. Soren, N. Pandey, A. Joshi and L.N. Sankhala

212

19

Abst 29 : VII A study of erythron function test of stray dogs

N.Kataria, N. Pandey, A. Joshi, Abhimanu and L.N. Sankhala1

212

Abst 30 : VII Survey of mortality in pet dogs

Singh,Pratima, Singh, Rajendra, Shivam,Chaturvedi and Srivastava, A.K.

213

Abst 31 : VII Nodular lymphoid hyperplasia of the spleen in dog- A case report
Shagufta Azmi, Shafiqur Rahman, Tanveer Ahmad, Ajaz Ahmad, Navdeep Kourand and N. A. Sudhan

213

Abst 32 : VII Gross and Histopathological Observation on Hepatitis in Dogs

Goverdhan Singh, N. Sharma, Pushpa, H. Dadhich, M. Mathur, T. Sharma and A. P. Singh

213

Abst 33 : VII Gross and histopathological observations on enteritis in dogs

Goverdhan singh, H. Choudhary, J. Yadav, H. Dadhich, M. Mathur, T. Sharma and A. P. Singh

214

Abst 34 : VII Prevalence of gastro-intestinal helminthes in stray dogs in Jodhpur

Anju Chahar, R.K. Tanwar, Fakhruddin, J.K. Mathuria,

214

Abst 35 : VII Effect of Treadmill Exercise on plasma concentrations of triglycerides and cholesterol in German shepherd Dogs
Narendra Singh Rathore, Anil Moolchandani, Meenaxi Sareen and Devi Singh Rajput

214

SESSION - VIII
LP 1 : VIII Dog-Associated Zoonoses in India
P.K. Kapoor, Ashok Kumar and Renu Gupta

215

LP 2 : VIII Vector-borne disease interaction between human and canines

B.K. Tyagi

216

LP 3 : VIII Hook worm infection- a challenge to canine health and a disease of human concern
N.R. Pradhan

217

LP 4 : VIII Interaction between human, dogs and farm animals in relation to diseases
R.K. Tanwar

220

Abst 1 : VIII Rabies control: mass vaccination and aniimal welfare

Sankey, C., Eckman, H., Mitchell, R.

223

Abst 2 : VIII Canine echinococcosis and risk perception of zoonotic infection to community
Gupta V.K., Bist B., Agrawal R.D., Gupta P., Maharana B.R.

223

Abst 3 : VIII Echinococcus granulosus metacestodiasis in sheep of kashmir Valleywith relation to canine human zoonosis
Shahnawaz M., ShahardarR.A., WaniZ.A. and Bhat1S.A.

224

Abst 4 : VIII Studies on cutaneous leishmaniasis in dogs and human beings in and around Bikaner city, Rajasthan
Rajani Joshi, Rakesh Rao, Jagbir Singh and Shruti Shree Joshi

224

Abst 5 : VIII Canines in diagnosis of cancer

Choudhary G.

224

20

SESSION - IX
Poster 1 : IX Celebration of World Rabies Day at Mekelle University College of Veterinary Medicine for the control and prevention of Rabies since 2009 to 2011
Habtamu Taddele, Yohannes Tekle, Abreha Tesfaye, Yisehak Tsegaye, Guesh Negash, Netsanet Berhe, Biruk Mekonnen, Birhan Mengiste, Birhanu Hadush, Gebrehiwot Tadesse, Wubishet Mengiste, Tihtina Alemayehu, Etsay Kebede, Gebregiorgis Ashebir, Berihun Afera, Berihu Gebrekidan

225

Poster 2 : IX Ultrasonographic evaluation of uterine involution following induction of abortion in bitch

S Soroori, H Ghasemzadeh-Nava,M Molazem,N Sayyah, M Asghari

225

Poster 3 : IX Three Dimensional Power Doppler Ultrasonography of Flunixin Induced Inflamed Kidney in Dog
L. Mohammadyar, M. Molazem, P. Sadeghian

226

Poster 4 : IX Study of Skeleton of Leopard

Pankaj Thanvi and Hemant Joshi

226

Poster 5 : IX Therapeutic management of canine ehrlichiosis

Gupta, S. R., Yadav, R., Sharma, C.S. and Sharma, Y.K.

227

Poster 6 : IX Bactriolgy and antibiogram profile of canine pyometra

Singathia Rajesh,Yadav Rajendra, Dutta Pankaj, Gangil Rakhi, Gupta Sita Ram and Lakhotia R. L.

227

Poster 7 : IX Canine Mastitis

Virendra Kumar, N.K. Jeph, M. Ashfaque, A. Gahlot, R.K. Tanwar, Anju Chahar, Fakhruddin

228

Poster 8 : IX Agalactia in bitches

Virendra Kumar, N.K. Jeph, M. Ashfaque, R.K. Tanwar, Anju Chahar, Fakhruddin

228

Poster 9 : IX Anaphylactic shock in dog - A case report

Surender Kumar, Richa Gaur, Shadab A. Khan, R. Kumar, D.K.Saini

229

Poster 10 : IX Ascites in dog- A case Report

A.P. Singh, A. Maheshwari, Deepika Gokhlani, S. K. Vyas, D.S. Meena, J.P.Kachhawa and N.K. Mudgal

229

Poster 11 : IX Epiphora in dogs

Maini Ankush , Chandrapuria V. P., Jawre Shobha , Rai Somil

230

Poster 12 : IX Prevalence of different infectious and systemic diseases in Dogs in Bikaner

Nirmal Kumar Jeph, M. Ashfaque, V. Kumar, R.K. Tanwar, Anju Chahar, Fakhruddin

230

Poster 13 : IX A case report of haemorrhagic gastroenteritis in Canines

Rajendra Kumar, N.K.Jeph, Mahesh Nehra, surendra Kumar, R.K. Tanwar, Anju Chahar & fakhruddin

230

Poster 14 : IX A Case Report of Coprophagia in Pomeranian Dog and Response to Pancreatic Extract.
R.K.Dedar

231

Poster 15 : IX Eye Cancer and its management in a dog - A case report

Sanjeev Nehru

231

Poster 16 : IX An approch to blood transfusion in dogs - A clinical study

AK Palei, MC Parashar, K. Kachhawa, M. Nagar, M. Agarwal, TK Gahlot

231

Poster 17 : IX Benefits of Pregnancy determination in the bitch by ultrasonography

Sanjeev Nehru

232

21

Poster 18 : IX Mitral valve insufficiency and its therapeutic management in a dog - A case report
Khinchi R.K., Singh Naveen Kumar, Bihani D.K., Ahuja Anil

232

Poster 19 : IX Hookworm infestation in pup - A case report

Lenin Bhatt1, Sandeep Meel and Vikas Sharma

232

Poster 20 : IX Detection of canine distemper in a dog - A case report

Dhuria Deepika, Singh Naveen Kumar, Ahuja Anil, Khinchi R

232

Poster 21 : IX Importance of dental hygiene for dogs health

N. K. Mudgal, A. P. Singh, D. K. Choudhary, S. K. Sharma and N.K.Jeph

233

Poster 22 : IX Scooting problem in dog

Urmila Pannu, Anju Chahar and V.S. Netra

233

Poster 23 : IX Milk composition of stray bitches

R. A. Legha1, Yash Pal and R K Dedar

233

Poster 24 : IX Surgical correction of rectal diverticulum with and without perineal hernia in dogs A report of two cases
A.K.Maji, Sabyasachi Konar and H.Palui

234

Poster 25 : IX Surgical Management of Pyometra in Bitches

Mahendra Tanwar, K. Kachawaha, M.C. Parashar, S.M. Qureshi , T.K. Gahlot

234

Poster 26 : IX Hematology of indigenous stray puppies at Bikaner

Yash Pal, R. A. Legha, R K Dedar

234

22

Theme Session-I
Modern concepts in canine health and diseases of human concern

23

Key Note
Prof V.K.SINHA, Former Prof & Head, Medicine Bihar Veterinary College, Patna

Foundation of Animal Welfare and Biodiversity was laid when other civilizations were in their infancy: Edicts of Ashoka 1- XI in Shahbazgarhi is a village in Mardan District of Khyber-Pakhtunkhwa province of Pakistan. The Mauryan Empire was the first Indian empire to unify the country and it had a clear -cut policy of exploiting as well as protecting natural resources with specific officials tasked with protection duty. When Ashoka embraced Buddhism in the latter part of his reign, he brought about significant changes in his style of governance, which included providing protection to fauna, and even relinquished the royal hunt. He was perhaps the first ruler in history to advocate conservation measures for wildlife. Reference to these can be seen inscribed on the stone edicts. Twenty six years after the coronation various animals were declared to be protected- parrots,mainas,aruna,ruddygeese,wild ducks, nandimukhas, gelatasbats, queen ants, terrapins,boneless fish,vedareyaka,gangapuputaka,ankiya fish,tortoises, porcupines, squirrels,deer,bulls,okapinda,wild asses,wild pigeons,domestic pigeons and all four-footed creatures that are neither useful nor edible.Those nanny goats,ewes and sows which are with young or giving milk to their young are protected, and so are young ones less than six months old. Cocks are not to be caponized, huskshididngliving beings are not to be burnt and forests are not to be burnt either without reason or to kill creatures. One animal is not to be fed to another (Edict on Fifth Pillar) The edicts also proclaim that many followed the king's example in giving up the slaughter of animals: one of them proudly states: Our king killed very few animals.(Edict on Fifth Pillar) Emperor did not completely prohibit the killing of animals; he prohibited gratuitous killings (such as for religious sacrifices he advocated restraint in the number that had to be killed for consumption, [protected some of them, and in general condemned violent acts against animals, even castration. These evidences are best examples of developing Farm Animal Welfare, Wild Animal Welfare and Aquatic Animal Welfare courses the Ashoka Edicts on Fifth Pillar found near Peshawar tell the ecological wisdom available during 250 B.C. is now being realized by western board nearly 2500 years later. In India dogs, parrots and cats are pre dominantly housed as companion animals. Dog is one of the most important laboratory animal models for medical research as to test insulin for Diabetes, organ transplantation, skin grafting,CATscans, corneal transplant and carcinogenic. Veterinarians with specialized training in laboratory animal medicine are an integral part of medical research team. The fact of the matter, though painful to know, is the dubious distinction of India being the paradise of stray dogs with an estimated 25 million of them freely roaming and relaxing in the countryside; a perennial source of zoonotic diseases and food born illness. The World Health Organization (WHO) indicates that about 20,000 people die of rabies in India every year. All rabies patients will die, and so far, there are no reported cases of survival. The need of the hour is to control the stray dog population through various measures like staerilization, chemical and immune contraception and placing them in safe and healthy quarantine. The conference is expected to discuss on various emerging topics, like human canine zoonosis, pet animal medicine, surgical techniques, contraception and sterilization, canine nutrition and food born diseases, management, behaviour and welfare. The application of cutting edge technologies like biotechnology, nanotechnology, Gene therapy would also review for drug designing in human health sector especially in the treatment of cancer. Issues which will be highlighted include owner expectations of veterinary services to match human health care, use of pets as commodities e.g. 'rent-a-dog;. Handbag dogs and 'legal weapons' and puppy farming not only in India but also in other countries.

24

TL 1 : I

Cutaneous Leishmaniasis Our Experience at Bikaner

RA Bumb, RD Mehta and BC Ghiya Department of Dermatology and STD, SP Medical College, Bikaner, Rajasthan.

Cutaneous Leishmaniasis is a wide spread tropical infectious disease caused by haemoflagellate protozoan parasite of the Leishmania genus, characterized by a chronic, asymptomatic, erythematous nodule, plaque or ulcer which usually heals slowly. Epidemiology at Bikaner During 1996 to 2011, we have seen 1511 microscopically confirmed cases of cutaneous leishmaniasis, age ranged between 6 months to 60 years, mostly from urban area with male preponderance. The most common clinical pattern was erythematous plaque over exposed area of body. Diagnosis of cutaneous leishmaniasis and its causative speciesSlit skin smear for LT bodies was positive in 1239 cases. We established L.tropica as the causative agent in our city Bikaner, both in rural and urban areas by internal transcribed spacer 1 (ITS1) polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP), kDNA-PCR test. Pathogenesis We explored - In 2009, we studied the correlation of parasitic load with interleukin-4 response to cutaneous leishmaniasis due to L.tropica infection using Real-time PCR, pretreatment and post treatment. The up regulation of IL-4 was correlated with a higher parasite burden in early lesions of CL, which may be involved in the pathogenesis of CL by inhibiting a protective immune response. Other study based on Intralesional transcripts (interferon- , TNF- , interleukin-1 , IL-8, IL-10 and IL-4) suggests that IL-8 is an effector immune determinant in progression of CL, whereas NO facilitates parasite killing by macrophages via MCP-1 mediated stimulation. It was a first immunological and molecular study from India. Treatment Modalities Experience with Rifampicin - We assessed efficacy of Rifampicin in the treatment of CL in three studies at Bikaner. In all studies Rifampicin was found to be highly effective in dosage of 1200mg/day for 4-6 weeks. It was more effective in ulcerative lesions than nodular lesions. Experience with Antimonials- In 2009-10, we conducted a study on comparative efficacy of once and twice weekly intralesional sodium stibogluconate in treatment of cutaneous leishmaniasis. We found that twice a week intralesional SSG was as effective as once a week. Experience with Radiofrequency - One of our study compared Radiofrequency Heat Therapy (RFH) with twice weekly intralesional injection of sodium stibogluconate showed complete cure rate of 98% and 92% respectively. RFH is a noninvasive, painless, battery operated method, required a single session and is cosmetically more acceptable. HIV and CL - In 2010, we reported two HIV positive cases of CL due to L. tropica which failed to respond to conventional intralesional/intramuscular SSG injections. We treated them with RFT with complete healing of lesions in 12 weeks. RFH therapy should be considered as first line of treatment for CL in HIV-infected patients. We also reported three cases of unresponsive cutaneous leishmaniasis and HIV co-infection. We concluded that sodium stibogluconate resistant cutaneous leishmaniasis is emerging as an opportunistic infection associated with HIV/AIDS in an endemic area. HIV and DCL- In 2010, we reported a HIV positive case presenting as Disseminated Cutaneous Leishmaniasis without involvement of mucous membranes and systemic organs. Hence, HIV infection should be considered in all patients presenting with DCL.

25

TL 2 : I

Hydatid cyst in Human being - A zoonotic alarm

Gunjan Soni Department of Pulmonary Medicine, S.P.Medical College, Bikaner

Hydatid cyst is caused by echinococcusgranulosus.Dogs and other carnivorous animals are definitive host while herbivorous animals are intermediate host.Man is accidental intermediate host for parasite.It is more common in childrens.It occurs due to handling of animals or contact with soil that contains eggs of parasite.It can occur in any organ but liver (60%), lung (20-30%) are commonly affected.It may be incidental finding on x-raychest.Presence of cyst is usually asymptomatic but may be symptomatic either by rupture, pressure effect or secondary infection.If cyst ruptures patient c/o coughing of salty fluid,breathlessness , chest pain,anaphylactic reaction.It can be detected by x-ray,USG, CT-scan and serological tests.ELISA is most sensitive and specific test to diagnose hydatid cyst. Surgery is treatment of choice. Presently we are reporting ten cases of hydatid cyst presented and confirmed by Elisa Test during 2011 in Department of Pulmonary Medicine,S.P.Medical college, Bikaner

26

Client education - An inevitable component of practice in maintaining health of companion animals as well as family
Prof. (Dr.) & Col. A. K. Gahlot, FISACP Vice Chancellor RAJUVAS, Bikaner

Bondage between man and companion animal is as old as human civilization. The relationship between human & pet is an incredible source of pleasure. Pets enrich people in many ways and keeping companion animals has always played an important role in life of human being. It is proved that companion animals are of immense importance to human health and their social behavior. Reports indicate that the growth and development of children is better in those families who keep companion animals. Moreover, some comparative studies have also indicated that people having pet animals had lower B.P. and cholesterol in comparison to non owners of pet animals. "The One World One Health" concept is now a worldwide strategy to control inter-species, inter-kingdom and environmentally transmissible diseases. Close intimate contact between man and dog may lead to transmission of some Zoonotic diseases. Further, modes of transmission of Zoonotic diseases are so wide that it may be direct contact, ingestion, famine, aerosols and vector. The world health organization indicates that about 20,000 people die of rabies in India every year and the severity of disease is such that we are yet to see a patient surviving after suffering from rabies. But, pet owners need not to be afraid of these figures, as there is hardly any case noticed in India, where human rabies has been caused through pet dogs. I think, the vets are playing commendable role in educating clients and informing them the need to consult physician and go for antirabic vaccination, as the case may be. Nevertheless, mere example of this one disease is more than enough to explain the significance and relevance of client education in maintaining health of pet as well as family persons. On the basis of etiological agents, important Zoonotic diseases can be classified asViral: Influenza, Rabies. Bacterial:Leptospirosis, Campylobacteriosis, Salmonelosis, Eherlichiosis, Lyme disease, Brucellosis etc. Parasitic:Giardiasis, Toxocariasis, Tuberoses infestation, Leishmaniasis, mange etc. Fungal:Ringworm etc. It is proved that host is responsible for spread of Zoonotic diseases among human beings and being a veterinarian we owe the responsibility to maintain bondage between man & dog, as well as make aware the owners regarding maintaining preventive measures. For this we must enhance client education and simultaneously we must work in cooperation with medical practitioners on Zoonotic disease control. Practically we should follow some common rescue actions which are generally overlooked. Some these may be- Always maintain a perfect personal hygiene while handling a pet dog. - Regular and periodical de-worming & vaccination. - Pet should be groomed regularly. - Children should not be allowed to play with sick dog.

27

Feeding utensils of pets should be kept separately and cleaned properly. Spray of insecticides in surrounding areas / courtyards must be practiced to check the parasitic infestation. - Stray dogs should not be allowed to wander into premises. - Incase of owing another companion animal of same species or different species, equal health care of all household animals be provided. - Incase of similar signs and symptoms in companion animal and family members, consult vet and family doctor simultaneously to allow them to interpret the possibility of common pathogen. - Pup or dog should not be allowed to mix with stray dogs. - Meat from diseased animal should not be given to pets. - Keep animal area and surroundings vector free. - Dogs should not be permitted to lick the face of children. - Get new canines from a reputed source which provides progenies from known and healthy parents. At last, don't forget keep the confidence level of pet owners very high as, preventive measures are enough to avoid risk of Zoonotic disease transmission. Companionship is essential for social bondage, for which paying, in terms of money as well as care, is virtually nothing.

28

TL 4 : I

Rabies -A Zoonotic Disease

Dr. Rajnish Vijay Barar Dept. of Community Medicine S.P. Medical College,Bikaner,Rajasthan,India

Rabies is an Ancient Disease but remains a Modern Problem. Though it is 100% fatal, it is also a 100% Preventable Disease. It is the leading viral zoonosis as regards to global public health significance. Public Health Importance From an Indian point of view Rabies is a very important disease, as 36% (20,000 of an estimated global annual 55,000 rabies deaths globally) of the world's rabies deaths occur in India each year. Threequarters of them occur in rural areas. Between 30% and 60% of the victims of dog bites are children under the age of 15 in countries where rabies is endemic. Main constraint to rabies elimination in India is the lack of coordination and the lack of a comprehensive National Programme. However, even today Rabies is classified as a 'NEGLECTED' Tropical Disease. One of the reasons the disease has been neglected is because "deaths are scattered" and never amount to the kind of crisis that get epidemics top billing. Nevertheless, the basic principles of dog rabies control are relatively simple. It is necessary to vaccinate 70% of the total dog population in a short period of time and then maintain that immune coverage and protect the area from spill over through control of dog movement from affected adjacent areas. Definition Rabies is an acute, progressive encephalomyelitis. The case fatality rate is the highest of any infectious disease. It is one of the oldest described diseases. Etiology Rabies is caused by bullet shaped RNA virus fro. m Family Rhabdoviridae, Genus Lyssavirus. 6 other lyssavirus species or genotypes cause rabies. Rabies Virus The Rabies virus is bullet shaped (130-240nm * 80nm). It has a phospholipid envelope with glycoprotein surface spikes which bind to cells. It has 5 Structural Proteins : G, M, N, L, S and 12,000 Nucleotides, SS RNA and is non-segmented and non-polar. The Nucleocapsid core has Matrix (M) protein, viral nucleoprotein (N) and viral RNA, Transcriptase (L) protein, non-structural protein (NS), Hosts All warm-blooded vertebrates are susceptible to experimental infection. Mammals are the natural hosts of rabies. Reservoirs consist of the Carnivora (canids, skunks, raccoons, mongoose, etc.) and Chiroptera (bats) Vector transmission The Rabies virus can be transmitted by either Spill over from Rabid animals among same & other species like Humans; Compartmentalisation wherein specific virus variants within a genotype perpetuate among particular hosts in different geographic areas; Localized viral evolution due to geographic barriers or Occasional caused by emergence of viral variants with extended host range. Transmission The Rabies Virus is shed in the saliva during, before or after clinical symptoms of the infected animal and is inoculated through the animal saliva by bite or scratch or via contact with mucous membrane or transdermal exposure. Human-Human transmission has been reported as few cases following corneal transplantation. There can also be Aerosol transmission as in caves containing bats or lab work accident.

29

Pathogenesis The risk of acquisition of Rabies virus is 5-80% from bite and 0.1-1.0% from scratch and is Lyssavirus genotype dependent. The virus is present in saliva of infected mammal and entry is via an animal bite, scratch, lick on broken skin. It then enters local muscle and multiplies. Budding from the plasma membrane of muscle cells into unmyelinated nerve endings it attaches itself to the nerve endings and travels by retrograde axoplasmic flow to the CNS. There is virus replication in dorsal root ganglia (DRG) and anterior horn cells. Prophylaxis at this stage cannot prevent death. The rate of travel to CNS is 8-20mm/day. Neuromuscular junction is the major site of entry into neurons. Receptors on nerves that are used by the virus are Nicotinic acetylcholine, neural adhesion molecule (CD56), NGF (p75 neurotrophin) receptor. Viral spread to other neural cells is via G-protein. In brain it multiplies rampantly and travels back to all organs from nerves and is secreted in all secretions. Eventually, the virus spreads centrifugally from the CNS to the heart, skin, salivary and serous glands in the tongue. All major organs may contain the virus (except blood). Organs from patients with unexplained neurologic disease may transmit rabies by transplantation Once symptoms occur, death is inevitable. Diagnosis Diagnosis of Rabies is based upon history of animal exposure and typical neurological clinical signs. Postmortem demonstration of viral antigen in CNS is gold standard. In humans, ante-mortem detection of virus or viral amplicons, antibodies, or antigens (sera, CSF, saliva, nuchal biopsy) are useful diagnostic aids. Incubation Period Incubation period is variable in rabies. It ranges from as short as 4 days to several years. In majority cases it is 30-90 days. Factors Affecting the Incubation Period include viral load, severity of exposure ( e.g. multiple bites), localization of exposure (e.g. well innervated areas like fingers, head, face) and age group (shorter incubation period in smaller children) Children are at a greater risk of being bitten by animals because they are more involved in provocative acts and fail to recognize warning signals given by the animals. Clinical Manifestation In Humans In humans Rabies is manifested in either of two types Furious (80%) or Paralytic (20%). Most cases are males less than 15 yrs of age. In both types there is tingling/numbness at the site of bite with non-specific symptoms like fever, malaise headache, etc. Death in both is due to cardio-respiratory failure. However, in Furious type there is Hydrophobia, Aerophobia and photophobia. Whereas in Paralytic type there is Ascending paralysis with subsequent coma. Survival in Furious type is shorter (3-5 days) as compared to Paralytic type (7-21 days). 4 phases of illness First phase: asymptomatic : Virus Incubation Period : 10-90 days (4d-19yr) Second (prodromal) phase : 2-10 days with viral invasion of CNS (limbic system, spinal cord, brain stem) and respiratory, gastrointestinal, Behavioral & emotional symptoms. There is local pain, itching, numbness in 50% cases. Third phase: neurologic signs : Widespread infection of the brain "Furious": Hyperactive form with aggressiveness, biting, yelling, hallucinating triggered by sensory stimuli. There is hydrophobia, aerophobia, violent diaphragmatic contractions, hyper-reflexia, cholinergic manifestations lacrimation, salivation, mydriasis, pyrexia. "Paralytic" form: 20% of patients. There is flaccid paralysis and paresis, Mimics GBS, transverse myelitis Inflammation is more extensive and severe and spinal cord markedly involved with neuropathic pain, radicular pain, objective sensory and motor deficits. There are Choreiform movements of the bitten limb during prodromal phase and focal brain stem signs, myoclonus hemiparesis, hemisensory loss, ataxia, vertigo, Horner's syndrome, Seizures, ataxia.

30

Both forms may have fever, nuchal rigidity, paresthesia, fasiculations, convulsions, hypersalivation, hyperventilation, Fourth phase: Coma Coma is due to Extensive cortical virus spread. Death usually in 7 days resulting from respiratory arrest and myocarditisThere are inspiratory spasms, Sinus tachycardia, supraventricular and ventricular arrhythmias. There is reduced ejection fraction in all cases due to viral invasion of sinus node, A-V node and Myocarditis. Main cause of death is Circulatory collapse. There is Hematemesis in 30-60% of patients 6-12 hrs before death. Mortality depends on severity of injury, location of the wound - face,head, neck, hand - short IP and virus conc. in saliva . Rabies Survivors Survival once symptoms appear is rare and death is inevitable. Only 5 cases of survival have been recorded from millions but no clear treatment has been documented as of date Timely Prevention is the only cure. Diagnosis Diagnosis of Rabies is frequently missed as Lab tests are non diagnostic. CSF may show viral meningoencephalitis, EEG and head CT may be normal early in illness, MRI has abnormal, ill defined, increase signal intensity on T-2 images, Godalinium enhancement is only in late stages. Diagnosis/Culture Viral culture may be done from skin biopsy of the hair follicles at nape of the neck, saliva, CSF, urine, respiratory secretions in mice or in mouse neuroblastoma cell line. The Sensitivity is 50-94% and specificity 100%. Diagnosis/Tissue studies More pathognomic are Brain tissue: culture, histology for Negri bodies: but yield may be low. Immunohistochemistry on Brain tissue like Immunostain gives higher yield. Other studies include Rabies specific antibodies in serum or CSF (RFFIT), serology positive in serum in 7 days of symptoms, serology positive in CSF in 13 days of symptoms. Rabies vaccine does not cause positive CSF antibodies. Molecular studies, monoclonal antibodies in epidemiologic studies may be undertaken. Differential Diagnosis Differential diagnosis of Rabies includes Meningitis/Encephalitis: Japanese, eastern equine, West Nile V., enterovirus 71, Nipah V., Epilepsy, Drug toxicity, Acute hepatic porphyria, neuropsychiatric disturbances, substance abuse, acute serotonin syndrome, Tetanus. Paralytic rabies may be confused with GBS, Inflammatory polyneuropathy. Other to exclude are side effects of nerve tissue vaccines: Semple vaccine, mouse brain vaccine. Prevention Pre-exposure prophylaxis: vaccination of people in high risk groups (Veterinarians, Animal handlers, Certain lab workers, Travel to areas where canine rabies is common). Pre-exposure prophylaxisis by vaccination: intramuscular, 1ml (3 doses): at 0, 7, 21-28 days. Antibodies usually persist for 2 yrs. Repeat titers at 6-24 months depending on level of exposure and acceptable titer levels are 1:5 or 0.5 IU/ml (RIFFT). WHO Classification of Rabies Exposure For the convenience in providing better treatment WHO has categorized animal bite wound into 3 categories.

31

Category- I : Nature of exposure : Touching or feeding an animal, Licking by dog on healthy skin with no open wound, No documented contact of dog saliva. Treatment: None, if reliable case history is available Category II : Nature of exposure : Nibbling of uncovered skin, Licks on broken skin, Superficial scratch that does not break the skin. Treatment : Administer Vaccine immediately. Category III : Nature of exposure : Single or multiple transdermal bites or scratches which penetrate the skin, Licking over mucous membrane. Treatment : Administer Rabies Immunoglobulin (RIG) and a Vaccine immediately. If RIG is not available, administer two doses of ARV on Day 0 vaccine types Three types are used : Human Diploid Cell Vaccine (HDCV), Rabies Vaccine adsorbed (RVA), Purified chicken embryo cell (PCEC). Rabies Post-Exposure Management Post Exposure Management rests on the triage - Wound Treatment, Rabies vaccine, Rabies Immunoglobulin (RIG) in category III exposure. Anti-rabies Vaccination Essen Schedule is followed in which 5 Doses Intramuscularly are administered on Day 0, 3, 7, 14, and 28 in Deltoid Muscle in arm or anteriolateral thigh. Never inject in Gluteus Muscle as there is high fat deposition which could delay absorption of vaccine and hence slow antibody production. In category-3 give RIG Rabies Immunoglobulin on the 1st day of bite. In case RIG is unavailable give 2 doses of vaccine on Day 0 as a next best alternative. Dose of RIG is : HRIG- 20 IU/kg body weight or ERIG - 40 IU/kg body weight. Rabies Vaccine Adverse effects Adverse effects from Rabies vaccine are less common in children than adults and include local rxn. (15-25%), mild systemic reaction (10-20%), neurologic illness resembling GBS, acute generalized transient neurologic syndrome: not causally related, or Immune-complex reactions with booster doses of HDCV: 6%. Causes of Treatment Failures Treatment failure may be due to insufficient wound treatment, non administration of RIG, incomplete infiltration of all wounds with RIG, RIG given intramuscularly and not around wound, delay in starting and incomplete treatment or intra-gluteal injection of cell culture vaccine. Rabies Vaccine variations Attempts to reduce the cost of PEP and / or to increase the effectiveness there are Reduced IM regimen (2-1-1); Intradermal regimens : 8 site regimen: 8-0-4-0-1-1 (0.1ml doses), 2 site regimen: 2-2-20-1-1 (each=20% of IM dose). IEC Prevention of Rabies involves educating children to avoid contact with stray or wild animals, avoid trying to capture or provoke stray animals, avoid touching animal carcasses, secure garbage, chimneys, other entrances should be covered and International travelers should : avoid contact with stray dogs and consider PEP Future developments Research is underway for developing DNA vaccines, Recombinant vaccines, Plant biotechnology for production of Ag and development of neutralizing monoclonal antibodies.

32

Session-II
Canine Medicine

33

LP 1 : II

Canine pancreatitis disease that goes unnoticed

H.A.Upendra, Dept of Medicine, Veterinary college, KVAFSU, Hebbal, Bangalore Karnataka

Introduction: Pancreas is an organ with important exocrine and endocrine function which is located in the cranial abdomen caudal to the stomach. The exocrine pancrease secretes important digestives enzymes, bicarbonate and intrinsic factor into the proximal duodenum and makes up about 98% of the pancreatic mass. The endocrine islets secrete insulin, glucagon and other hormones involved in metabolism and make up only 2% of the pancreatic mass. Pancreatitis is the inflammation of the pancreas which is usually sterile. It can further be defined as acute pancreatitis or chronic pancreatitis but this classification is based on histopathological changes but not on clinical manifestation. Chronic pancreatitis is defined as a continuing inflammatory disease of the pancreas parenchyma and progressive loss of function. Eventually dogs with chronic pancreatitis may develop exocrine pancreatic insufficiency. Acute pancreatitis, on the other hand, is potentially completely reversible, condition, provided the animal does not develop EPI. The clinical signs of acute and chronic pancreatitis may overlap and clinician may find it difficult to differentiate between these two manifestations based on regular laboratory diagnostic tools. Furthermore, there is a tendency for dogs with chronic pancreatitis to have a long period of sub clinical, clinically silent disease culminating in an acute pancreatitis, by which time there is already a significant loss of pancreatic function. However, it may not be rally necessary to clinically differentiate between acute and chronic pancreatitis as most of the time the treatment is symptomatic. Incidence: The true prevalence of canine pancreatitis is unknown as the gold standard for diagnosis of pancreatitis is histopathology which is rarely performed or indicated. No other diagnostic tests have 100% sensitivity and specificity. However acute pancreatitis is recognized by the clinicians on regular basis and chronic pancreatitis is detected only when the histopathological examinations are carried out. Etiology: Inappropriate early activation of the zymogen trypsinogen to trysin within the pancreatic acini, with resultant digestion of the organ is believed to be the final common pathway triggering pancreatic inflammation in most cases. This leads on to peri-pancreatic fat necrosis, systemic inflammation and potentially the development of systemic inflammatory response syndrome (SIRS) and disseminated intravascular coagulation (DIC). In addition to early activation of trypsin, other factors can be involved in triggering pancreatitis, particularly in chronic disease, where immune-mediated disease and duct destruction become more important. The reason why trypsin activates early within the pancreas is often unknown in dogs. It may be due to underlying genetic susceptibility in some dogs. It is likely that there is an inherited element to pancreatitis in dogs. Certain breeds of dogs are repeatedly recognized to suffer from the disease whereas other breeds such as greyhounds very rarely suffer from pancratitis. Acute pancreatitis is more commonly reported in small breed dogs particularly terriers and chronic pancreatitis has been recognized more frequently in breeds such as Cocker Spaniels, Boxers and Collies. A number of risk factors have been suggested for pancreatitis in dogs which include duct obstruction, hyperglyceridaemia, pancreatic ischemia, hypercalcaemia, obesity, high fat diets, certain drugs such as organophosphates, furosemide, sulphas, tetracycline, procainamide, estrogens. All of these factors have been reported as precipitating factors either clinically or experimentally but their relative importance is unclear. Some may be true causes but many are likely triggers in susceptible dogs. However, many of them may be triggering the disease in an already genetically susceptible individual.

34

Clinical presentation & clinical examination: The clinical presentation of pancreatitis in animals varies enormously according to the degree of pancreatic disease. In the mildest cases there may be sub-clinical and self-limiting signs. If the disease is recurrent, this may lead to chronic pancreatitis in due course of time. Animals with more severe pancreatitis mainly presented with anorexia, vomiting, weakness, abdominal pain, dehydration and diarrhea. The most severe cases also usually resent with fever, respiratory distress, jaundice and cardiovascular shock. Pancreatitis can affect dogs of any age, although the incidence appears to be higher in overweight and adult dogs. Clinical history collection should include information regarding current medication, diet and other predisposing factors such as concomitant disease such as hyperadrenocorticism, hypothyroidism or diabetes mellitus. Clinical examination of a suspected case should include examination of cardiovascular system, respiratory system, Hepatobiliary system, intestinal condition, abdominal palpation and presence of signs of DIC (patechiae, ecchymoses in mm or skin, acute respiratory distress) as the involvement of different organs and systems is associated with more severe pancratitis and therefore with a worse prognosis. Laboratory Diagnosis: Hematological parameters are not specific for diagnosis of pancreatitis although it may be useful to assess the animals general condition and to rule out other possible causes of abdominal pain and vomiting. Blood count mayshow changes that are compatible with an acute inflammatory response. Blood biochemistry usually shows moderate elevations of pancreatic enzymes namely lipase and amylase and electrolyte changes, azotemia, hypoalbunimaemia, hypocalcaemia and hyperglycaemia. Lipase has been reported to be a useful test in diagnosis of pancreatitis but it has major limitations and it is suggested that a 3-5 fold increase above the reference range should be observd in order to consider it to be a case of pancreatitis. A sensitivity of 73% and specificity of 55% have been reported for lipase. Amylase is fairly similar to lipase, since sensitivity (62%) and specificity ( 57%) are not optimum. Hence both lipase and amylase are not considered to be very reliable tests to diagnose pancratitis. Further, increased lipase and amylase lvels are not reliable indicators of prognosis of the disease. TLI is another test which also has low sensitivity and hence is not considered as a reliable test. A specific pancreatic lipase assay has recently been introduced and this test has very good sensitivity (83%). However falsely high levels of this lipase may be seen in cases such as gastritis, chronic renal failure and usage of antiseizure drugs such as bromide and Phenobarbital. Diagnostic image techniques: Diagnostic imaging techniques are good tools in the hands of clinician in making diagnosis of pancreatitis. Abdominal X rays may show loss of details in the cranial abdomen. The characteristic radiographic signs are lateral shift of the duodenum and caudal shift of the transverse colon. Abdominal ultrasound is considered as being very specific in detecting pancratitis. However 30% of animals with pancreatitis may have normal abdominal ultrasound. Pancreatitis cannot be diagnosed simply by observing hypoechoic lesion in the pancreas, because the same appearance is found in animals with portal hypertension and hypoalbuminaemia. panncratitis has many different appearances on ultrasound, depending on severity, duration and spread of pancreatic and peripancratic tissue inflammation. The sensitivity of ultrasound clearly depends on the equipment used and the sonographers skill. It is estimated that ultrasound has high sensitivity (68%) in diagnosing pancratitis. The best combination for the specific diagnosis of pancreatitis in dogs is elevated cPLI and ultrasound findings compatible with pancreatitis. Biopsy is considered as being the most definitive test in the diagnosis of pancratitis. Pancreases size is no indicative of absence of disease. In cases of pancretitis, the biopsy may not always be diagnosed because it depends on the site where the biopsy sample is taken in order to observe the characteristic changes. Cytology is a useful technique if a pancreatic tumor is suspected, especially in the case of adenocarcinoma. Cytology can also be used study cystic cavities in the pancreas, because degenerative

35

neutrophils may be observed on a protein background, suggesting pancreatic abscess or pancreatic cyst. Cytology is useful in assessing abdominal effusions and pancreatic aspirates especially to rule of neoplasia. Treatment: 1. Resolve any predisposing factors: A diet that is too rich in fats should be corrected. Certain drugs can trigger pancreatitis and these should be discontinued. It is also important to correct hypercalcaemia. 2. Maintain Vascular filling: The maintaince of adequate intravascular volume via the administration of appropriate intravenous fluid therapy is essential. Maintaince requirements of 40-60 ml/kg/day should be covered. Additionally the volume needed to correct dehydration and compensation for any estimated losses is to be administered. Potassium supplementation is based on the serum potassium concentration. A lactated Ringers solution with additional potassium should be chosen to correct the metabolic acidosis. 3. Pain relief: Major visceral pain can exacerbate the state of shock and provoke cardiac rhythm disorders. Analgesia is systematically administered for acute pancretitis. Non steroidal anti-inflammatory drugs should be avoided due to the risk of gastroduodenal ulceration. If the animal is in severe pain, a continous intravenous infusion of Morphine, Lidocaine or ketamine may be required. 4. Control Vomition: Metoclopramide may reduce pancreatic perfusion due to its anti-dopaminergic properties. Instead chlorpromazine is recommended for the symptomatic treatment of vomiting. 5. Treat any bacterial complications: The use of antibiotic remains controversial in Veterinary medicine since the etiology of pancratitis inflammation has been shown to be chemical rather than septic. However antibiotic is useful in treating any possible GI bacterial translocation. The administration of a betalactam antibiotic (amoxicillin, ampicillin, cephalexin) along with metronidazole is the most commonly used combination. 6. Reintroduction of food: It has been clearly demonstrated that starvation induces a reduction in the total thickness of the intestinal mucosa and the height of the villi. Intestinal permeability is also increased exposing the animal to septic complications via bacterial translocation. Hence food should be reintroduced as soon as possible. Ideally food should be reintroduced at the same time as the instigation of the other treatments such as fluid therapy, analgesia etc. Food is withheld for 12-24 hours until the medical treatments have started to take effect. Food should be reintroduced very progressively in terms of calories, lipids and proteins so as to avoid stimulating pancreatic secretion. In practice, the ration given on the first day corresponds to 1/5 of the maintenance requirements for the current or optimal weight. 7. Other treatments: Corticosteriods, antacids, plasma transfusion, heparin therapy, administration of antiproteases, treatment of diabetic ketoacidosis and supplementation with pancreatic enzymes are taken up as other treatments based on the criteria of individual cases.

36

LP 2 : II

Recent advances in the diagnosis and management of chronic gastrointestinal diseases of canines
S. S. Randhawa and N. Chand* Director of Research cum Dean PGS, GADVASU, Ludhiana-141 004.

*Department of Clinical Veterinary Medicine Ethics and Jurisprudence Chronic gastrointestinal disorders, collectively known as inflammatory bowel diseases (IBD), are common in canine general practice. They are characterized by persistent or recurrent gastrointestinal signs and inflammation of GI tract. It is widely accepted that chronic enteropathies involves a complex interplay among host genetics, the intestinal microenvironment, the immune system and the environmental triggers of intestinal inflammation(Packey and Sartor, 2008). Many of theses diseases do not have clearly defined underlying cause despite thorough diagnostic investigation. This paper describes recent developments on etiology, diagnosis and therapeutic management of various chronic enteropathies that are associated with chronic diarrhea in dogs. (a)LymphocyticPlasmacytic Enterocolitis Lymphocyticplasmacytic enterocolitis (LPE) is the most common form of IBD. A breed predilection has not been confirmed, although purebred dogs seem to be overrepresented in the veterinary literature. Varying degrees of vomiting, weight loss, and diarrhea are observed clinically. Although most clinical signs are referable to small intestinal disease, any part of the GI tract can be affected. Intestinal inflammation with altered lymphatic function can cause GI protein loss, resulting in panhypoproteinemia. The pathophysiology of this disease is incompletely understood. An increased number of IgG- and IgA-producing plasma cells and T lymphocytes have been identified in dogs with LPE compared with control dogs. Furthermore overproduction of nitric oxide in dogs with LPE is suggested by increased colonic luminal nitrite levels and increased mucosal expression and concentrations of inducible nitric oxide synthase in endoscopic biopsy specimens. (Ettinger and Feldman, 2005, Simpson and Jergens, 2011). (b)Eosinophilic Enterocolitis Eosinophilic enterocolitis (EE) is less common than LPE in dogs. It is clinically indistinguishable from LPE, although eosinophilia is sometimes found on a complete blood count. Eosinophilic infiltration can occur anywhere along the GI tract. Eosinophilic intestinal disease has been reported in mixed-breed and a variety of purebred dogs. Rottweilers and German shepherds may be predisposed to EE. One report suggests that most affected dogs are younger than 5 years of age. However, the exact sex and age distributions are uncertain. (Ettinger and Feldman, 2005, Simpson and Jergens, 2011). Clinical signs The most frequently observed clinical signs in dogs and cats are chronic diarrhea (large volume) accompanied by weight loss or vomiting. IBD of the small intestine is characterized by small bowel disorder, which involves a large volume of stool, a mild increase in frequency of defecation, and little or no straining, mucus, or blood present. The vomit often contains bile. If the large bowel is involved, there may be mucus, blood, and straining at defecation with little matter produced. There are other clinical signs such as changes in appetite, excessive burbling noises in the intestine (borborygmi), and abdominal discomfort. It is important for owners to understand that the severity of inflammatory bowel disease is variable, ranging from intermittent diarrhea and vomiting in mild cases to intractable diarrhea, refusal to eat, and weight loss in severe cases. The severity of the disease is believed to reflect the degree of cellular infiltrate into the intestine. (Simpson and Jergens, 2011).

37

Diagnosis Initial diagnostic approach to chronic diarrhea Integrate signalment, history and physical examinationBreed predisposition, environment, diet, other clinical signs, localizing findings. Fecal analysis for endoparasites and enteric pathogen ( eg Giardia) Clinical pathology Detect non GI disease- CBC, biochemistry profile, urinalysis, ACTH stimulation test, Free T4/TSH levels, bile acid levels. Detect GI disease- Hypoproteinemia, hypocalcemia, hypocholestrolemia, leucopenia, leucocytosis, low cobalamin or folate levels. Diagnostic imaging Detect non GI disease- Radiography, ultrasonography of liver, spleen, pancreas, lymph node, masses and effusions ,obstruction intussusceptions, focal masses, thickening, loss of layering, hypoechoic appearance, hyperechoic striations. The clinical severity of intestinal disease can be quantified by determining the clinical disease activity index( eg attitude, activity, appetite, vomiting stool consistency, stool frequency, weight loss). Measurement of C- reactive protein (CRP) levels has been shown to correlate with clinical activity disease activity index. (Grutzner et al, 2011, Simpson and Jergens, 2011). Measurement of serum cobalamin and folate concentration can help determine the need for intestinal biopsy, localize the site of intestinal disease, determining the need of cobalamin supplementation and establish a prognosis(Grutzner et al, 2011). Intestinal biopsy It is noteworthy that in some but not all studies the endoscopic appearance of the small intestine correlate better with outcome than the histopathologic appearance. If there is suspicion of ileal involvement, transcolonic ileoscopy is performed in addition to the standard upper GI tract endoscopic examination. Cellular infiltrate-Intestinal infiltration with macrophages or neutrophils raises the possibility of an infectious process and culture, special staining and FISH are indicated. The presence of moderate to large number of eosinophils in intestinal biopsy samples, often accompanied by circulating eosinophils, suggests possible parasitic infestation or dietary intolerance. Increased numbers of lymphocytes and plasma cells, indicate lymphoplasmacytic enteritis(Simpson and Jergens, 2011). Treatment Empirical treatment of giardia and helminths if not already initiated. Cobalamin and folate supplementation if their levels are subnormal. Dietary modification pending biopsy result; concurrent dietary modification( hydrolyzed or antigen restricted diet), antibiotics and immunosuppression. If there is poor response, reappraise before considering escalating immunosuppression. The use of elemental diets and partial parenteral nutrition may be indicated in some dogs that have severe protein losing enteropathy. (c)Granulomatous colitis of boxer dogs It is an uncommon type of inflammatory bowel disease, predominant in boxer dogs younger than 4 years. There are sporadic reports of GC in other dog breeds, particularly young French bulldogs. Affected dogs typically present with signs of colitis, hematochezia and weight loss progressing to cachexia in severe cases. GC and invasive Escherichia coli- The application of culture independent molecular methods like immunohistochemistry and fluorescent in situ hybridization (FISH) enabled the indentification of mucosaly invasive E. coli. Also immunostaining of colonic mucosa gave positive results with antibodies against Salmonella, Campylobacter and Lawsonia intracellularis. (Simpson et al , 2006, Mansfield et al, 2009). Genetics- Because GC is breed specific and rare, it is suspected to be an autosomal recessive genetic defect involving the immune system that confers susceptibility to E. coli invasion. Research is currently being undertaken to identify the genetic basis of GC and a genome wide association scan(GWAS) is under way. (Craven et al ,2010, Craven et al ,2011).

38

Clinical features GC typically affects Boxer dogs younger than 4 years with no sex predilection and some reports describe clinical signs in animals as young as 6 weeks. Clinical signs are typical of colitis that is frequent small volume diarrhea, hematochezia, mucoid feces and tenesmus. The degree of hematochezia is often significantly greater than for other types of colitis, and affected dogs may fail to thrive or may loss weight. Affected dogs are usually clinically well and afebrile but may be lethargic with severe disease (Craven et al 2011). Diagnosis Diagnosis could reflect anemia of chronic disease or hemorrhage if hematochezia is severe. Hypoalbuminemia may also occur in some affected dogs because of hemorrhage, protein exudation via diffusely ulcerated mucosa, anorexia and inflammation. Definitive diagnosis is usually achieved by ruling out other causes of clinical signs and histologic confirmation on colonic mucosal biopsies. The histologic appearance of GC is unique relative to other types of colitis in dogs because of severe mucosal ulceration and infiltration of the submucosa and lamina propria with macrophages that stain positive with PAS. (Craven et al ,2011). FISH analysis- Demonstration of invasive E.coli in GC is now integral to disease diagnosis and management and is best accomplished using FISH. Antimicrobial susceptibility testing- It is also necessary to culture colonic mucosa, particularly when invasive E. coli are documented in order to determine antimicrobial susceptibility. Treatment The administration of enrofloxacin alone, 5mg/kg once daily for a total of 6-8 weeks daily has been associated with long term remission. Currently, the suggested treatment regimen for cases with enrofloxacin sensitive E. coli is 5-10mg/kg every 24 hour for a minimum of 6 weeks. Post treatment colonoscopy and biopsy are advisable to demonstrate remission of disease and successful eradication of E. coli invasion. Aside from the spectrum of activity, it is of critical importance that the antimicrobial used is capable of penetrating macrophages. Agents likely to do so include chloramphenicol, florfenicol, TMPS, tetracyclins, clarithromycin, and refampin. When a multi drug resistant strain of E. coli is present, the recommendation is to use combination of antimicrobial protocol, to include a fluroquinolone and several others of these macrophage penetrating agents..( Mansfield et al, 2009, Craven et al 2011) (d)Chronic idiopathic large bowel diarrhea (CILBD) In dogs, large bowel diarrhea is usually characterized by small amount of feces often admixed with mucus and/or fresh blood, frequent defecation with urgency and tenesmus. These signs reflect colonic dysfunction with decreased water reabsorption and decreased fecal storage capacity as well as mucosal damage and response to inflammation. Acute colitis is most commonly associated with whipworm infestation, dietary indiscretion and Clostridium perfingins and Clostridium difficile infections. Clinicopathological findings The clinical signs displayed by dogs with CILBD are indicative of a large bowel disorder, but are in no way pathognomonic. Unlike what has been reported earlier, hematochezia occurs in large proportion of dogs with CILBD, even in those with behavioral disorders. Therefore, CILBD is a diagnosis that can only be made by exclusion of all other causes of large bowel diarrhea. In one study, colonoscopy revealed minimal mucosal changes in slightly less than half of dogs, which included very slight focal increases in friability, granularity or hyperemia, decreased or increased numbers of lymphoid follicles, decreased visualization of submucosal blood vessels, localized colonic spasm, and localized small superficial erosions. It is noteworthy that many dogs with CILBD occasionally vomit, have a decreased appetite and show abdominal pain during episodes of diarrhea(Khan and Chang, 2010).

39

Diagnosis Chronic or recurring diarrhea for at least 4 weeks.Diarrhea of large bowel origin with increased frequency, excess mucus, tenesmus and hematochezia.No abnormal findings on physical examination, CBC, biochemical profile and urinalysis or if minor changes observed on physical examination, CBC count, chemistry panel, urinalysis, absence of a severe systemic disorder. No identifiable cause of large bowel diarrhea. No or only minimal changes are observed on colonoscopy.Histopathologic evaluation of colonic mucosal; biopsies unremarkable. Treatment Fiber- Psyllium- daily dose- 0.5T for toy breeds, 1T for small breed dogs, 2T for medium breed dogs, 3T for large breed dogs. Special diets commercially available supplemented with fiber. Motility modifying agents- loperamide- 0.1mg/kgPO q6-8h, Diphenoxylate- 0.1mg/kgPO q6-8h. Antispasmodics( neurotropic)chlordiazepoxide( 5mg)and clidinium bromide( 2.5mg)- 0.1-0.25mg/kg clidinium PO q 8-12h for few days. Given at time of onset of clinical signs or when stressful situations are anticipated for a few days only. Propantheline- 0.25mg/kg PO TID, Hyoscyamine- 0.003-0.006mg/kg PO BID to TID, Dicyclomine- 0.15mg/ kg BID to TID. Antispasmodics( musculotropics)- Mebeverine- 2.5-5mg/kg PO BID, Pinaverium- 1mg/kg PO BID, Trimebutine- 0.33mg/kg PO TID. Behavior modifying agents- Selegiline- starting dose 0.5mg/ kgPO once daily. Dose can be increased upto 2mg/kg once daily if no response after 2 months. Clomipramine- starting dose 1 mg/kg PO BID. Increase gradually upto 3 mg/kg PO BID if necessary after 14 days. Tryptic hydrolysate of alpha casein- 15mg/kg PO once daily. (e)Protein losing enteropathies in dogs Protein losing enteropathy( PLE) is a syndrome associated with an abnormal loss of albumin through the gastrointestinal mucosa. PLE is identified when hypoalbuminemia occurs because the loss of albumin can not be compensated by liver synthesis. Inflammatory bowel disease PLE is associated with IBD in dogs. Recently colonic IBD in dogs has been associated in dogs with upregulation of claudin, a protein associated with paracellular colonocytes junctions suggesting that alterations of paracellular intestinal permeability may occur in canine IBD. Crypt disease Recently PLE has been associated with crypt disease. The hallmark of crypt disease is a severe dilation of the intestinal crypts that are filled with mucus, sloughed epithelial cells and some times inflammatory cells. Regional enteritis It is characterized by focal transmural granulomatous infiltration mostly localized in the distal small intestine. It has been associated with hypoproteinemia in dogs. Infectious diseases associated with PLE GI tract infection with Histoplasma capsulatum can induce severe granulomatous intestinal infiltration and secondary PLE in dogs. In patients with histoplasmosis, hypoalbuminemia is frequently associated with hyperglobulinemia(Dossin and Lavoue, 2011). Parasitism Severe intestinal parasitism especially hookworm infestation may induce PLE with ascites and edema. It has been suggested that parasites may induce an inflammatory reaction that eventually lead to IBD. In humans, giardiasis has been associated with PLE.

40

Gastrointestinal neoplasia Mild to marked hypoalbuminemia is reported in dogs with alimentary lymphoma. The prevalence seems high, with 11 of 18 dogs and 24 of 30 dogs affected in two different studies. (Dossin and Lavoue, 2011). Clinical findings The classical clinical presentation of PLE is a combination of chronic relapsing digestive signs with weight loss and edematous signs associated with chronic hypoalbuminemia. Some affected dogs have concurrent abdominal and pleural effusions, chylothorax, or even isolated pleural effusion. Pleural effusion is especially prevalent in Yorkshire terrier with PLE. PLE should always be considered in hypoalbuminemic dogs, even in the absence of digestive signs. Other less frequent clinical signs are related to complications resulting from the protein loss(Dijkstra et al, 2010). Complications A hypercoagulable state may occur in dogs with PLE. It has been associated with reduced anti thrombin III plasma concentration, increased thrombin-antithrombin complexes or an abnormal thromboelastogram. Hypocalcemia may be associated with hypomagnesemia that may induce secondary hypoparathyroidism. Granulomatous lymphangitis and gut wall edema are other possible complication of canine PLE .(Dijkstra et al, 2010, Dossin and Lavoue, 2011). Diagnosis Identifying the origin of the protein loss The only available test for GI protein loss is the measurement of fecal alpha1- proteinase inhibitor. 1- PI is a protease inhibitor of similar size to albumin and is also synthesized in the liver. 1- PI is neither actively absorbed nor secreted in the normal gut. It can leak with other protein through the gut. Fecal 1- PI is increased in dogs with chronic GI signs but does not correlate with plasma albumin.Hypoalbuminemia is the hallmark of PLE and concurrent hypocholestrolemia, hypoglobulinemia, and lymphopenia are frequently observed. Fecal parasite screening with floatation, and antigen test for giardia using 3 different samples should be performed. A coagulation panel including prothrombin time , activated partial thromboplastin time , AT III and D- dimmers is recommended to evaluate patient for hypercoagulability and thrombosis(Simpson and Jergens, 2011). (Grutzner et al, 2011).Perinuclear antineutrophil cytoplasmic autoantibodies( pANCAs) are early markers of PLE in soft coated wheaten terriers. Serum pANCAs are positive in affected dogs on average 2.4 years before the onset of hypoalbuminemia but unfortunately this test is not routinely available(Mancho et al, 2010). Diagnostic imaging Abdominal ultrasound is essential in most cases of PLE. Abdominal ultrasound is a prerequisite to select the biopsy method, identification of focal or patchy lesions that can not be reached by an endoscope provides a good indication for surgical biopsy. Specific findings such as hyperechoic mucosal striations can be suggestive of PLE. (Umar and DiBaise, 2010). Intestinal biopsies Bidirectional endoscopy including gastric , duodenal and ileal biopsies is the preferred method because histologic diagnosis can be different between duodenal and ileal samples in upto 73% of the cases of canine IBD and lymphangiectasia may only be found on ileal biopsies in some cases. Deeper lesions especially those located in the muscularis or serosa, may not always be associated with more superficial changes in the mucosa and may not appear in endoscopic biopsies. For the same reason, diagnosis of crypt disease requires good endoscopic biopsies that include sufficient numbers of intestinal crypts.

41

Treatment Providing nutritional support Dogs with PLE are usually in severe negative energetic and protein balance. The goal of the nutritional support is to provide a high energy density with a combined low fat and high carbohydrate content. Current recommendations for dogs with PLE are below 10-15% of fat, above 25-30% of protein, less than 5% of crude fibers and above 87% and 90% digestibility for the protein and fat/carbohydrate sources, respectively.. Intramuscular injection of an adequate vitamin supplement solution with 300 IU of vitamin E, 100,000 IU of vitamin A. and 10,000 IU of vitamin D should be sufficient for 3 months in dogs(Peterson and Willard, 2003, Dijkstra et al, 2010, Dossin and Lavoue, 2011). Providing oncotic support Hydroxylethyl starches are used at a maximal dosage rate of 20-30ml/kg/day, although they provide short term oncotic support only. Aggressive oncotic support is also advocated in case of PLE associated with severe gut edema that may further worsen GI protein loss. Albumin can be provided through plasma transfusion. Canine purified albumin has recently become available in 5 g vials and might be a good option to benefit from the colloid support while avoiding allergic reaction to human albumin(Peterson and Willard, 2003). Addressing complications Coagulation should be monitored in patients with PLE because hypercoagulability and thrombosis have been reported. When antithrombin is severely reduced, supplementation with fresh frozen plasma transfusion may be beneficial. In case of suspected thrombosis, heparin( 200-250 IU/kg s/c 3 times a day) treatment combined with low dosage of aspirin( 0.5mg/kg/day orally in dogs) is recommended. If plasma antithrombin III is decreased, fresh frozen plasma combined with 10 IU/kg of standard heparin should be administered before starting heparin therapy. Vitamin K is a fat soluble vitamin whose absorption may be decreased in dogs with PLE. Intravenous supplementation with calcium and magnesium salts is required in cases of hypocalcemia and /or hypomagnesemia. (Peterson and Willard, 2003, Dossin and Lavoue, 2011). Treating intestinal lesions Standard treatment includes steroids at immune suppressive dosages or azathioprine. A recent study demonstrated the efficacy of cyclosporine( 5mg/kg/d) orally in dogs with steroid refractory PLE. Sodium chromoglycate( 100mg/dog 3 or 4 times daily orally) has been recommended in soft coated wheaten terriers with PLE. An antibiotic trial with metronidazole or tylosin is probably a reasonable option when starting treatment of PLE in antibiotic responsive cases. (Dijkstra et al, 2010, Dossin and Lavoue, 2011). (f)Lymphangiectasia Lymphangiectasia is caused by abnormal dilation of the mucosal and submucosal lymphatics within the GI tract. The two basic classifications are primary and acquired lymphangiectasia. Primary lymphangiectasia is caused by abnormally formed lymphatics and is considered a congenital disorder. Acquired lymphangiectasia results from lymphatic blockage or elevated venous pressure. Lymphatic blockage is caused by inflammatory or neoplastic infiltrates. Clinico-pathological findings Diarrhea seems to be the most consistent clinical finding in dogs with lymphangiectasia. Small bowel diarrhea is more common; however, large bowel diarrhea or a combination of both may occur. Vomiting, weight loss, and ascites occur frequently but may not be present in all cases. Abnormal laboratory findings, including hypoalbuminemia, hypoglobulinemia, lymphopenia, hypocholesterolemia, and hypocalcemia, may not always be present. The severity of hypoalbuminemia roughly correlates with the

42

severity of histopathologic lesions. Hypocalcemia consistently occurs in dogs with lymphangiectasia and appears to be multifactorial. (Kull et al 2001). Diagnosis A diagnosis of lymphangiectasia can be made following evaluation of intestinal biopsy specimens, which can be obtained endoscopically or surgically; each method has advantages and disadvantages. Affected dogs that are fasted before anesthesia can have empty, undilated lymphatics. Feeding a small amount of corn oil or cream the night before anesthesia may make the dilated lymphatics more visible on gross and, possibly, histopathologic examination (Kull et al ,2001). Treatment The treatment of primary lymphangiectasia is targeted mainly toward reducing the amount of fat in the diet. Diet should be highly digestible, restricted antigen, or hydolysate. Fat restriction has been emphasized as a mainstay of treatment. Commercial fat-restricted diets are the logical choice in treating less severe cases. Prednisolone, 1mg/kg every 24 hour is often administerted orally and may work by decreasing lipogranulomatous inflammation or concurrent mucosal inflammation. Aspirin 0.5mg/kg every 24 hour is often given orally to dogs with low antithrombin III levels if they are considered at risk for thromboembolism. Diuretics are used if ascites is problematic (Simpson and Jergens, 2011). (g)Canine alimentary lymphoma Alimentary lymphoma are less common in dogs than in cats, representing only 7% of all canine lymphomas. Alimentary lymphoma in dogs may be part of the syndrome of multicentric lymphoma but most commonly it is confined to the GI tract. The majority of dogs have rapidly progressive clinical signs associated with lymphoblastic lymphoma including vomiting, diarrhea, weight loss, anorexia and lethargy. (Rassnick et al, 2009) . Chemotherapy and supportive treatment are the mainstays of the treatment of alimentary lymphomas in dogs. The overall response rate to treatment with a multidrug chemotherapy protocol was 56% in the largest published study of dogs with alimentary lymphoma. For the responders, the overall median first remission duration was 86 days and the MST was117 days (Rassnick et al, 2009). (h)Antibiotic-Responsive Enteropathy and Diarrhea A recent trend in the veterinary literature is to rename or redefine the syndrome known as small intestinal bacterial overgrowth (SIBO) as ARD. This is because of a lack of consensus on what defines SIBO, and patients that are responsive to antibiotic therapy may not have bacterial overgrowth. ARD/SIBO may be secondary to other disease processes, such as exocrine pancreatic insufficiency or IBD. Greater than 105 CFU/ml of aerobic bacteria or 104 CFU/ml of anaerobic bacteria cultured from duodenal juice was historically considered to be consistent with SIBO. The clinical relevance of these numbers is questionable because many healthy dogs have had much higher culture results. In addition, cobalamin (vitamin B12) and folate concentrations have not been found to reliably correlate with bacterial culture results or a response to antibiotic therapy. (German et al 2003, Ettinger and Feldman, 2005). References Craven, M., Gao, C., Ackland, G. et al (2010). Genome wide analysis of granulomatous colitis in the boxer dog. Research report. Forum of the ACVIM. Craven, M., Mansfield, C.S. and Simpson, K.W(2011). Granulomatous colitis in boxer dogs. Veterrinary clinics of North America. 41: 433-445. Dijkstra, M., Kraus, J.S. and Bosje, J.T.( 2010). Protein losing enteropathies in rottweilers. Tijdschr Diergeneeskd. 135(10):406-12. Dossin, O., and Lavoue, R.( 2011). Protein losing enteropathies in dogs. Veterinary clinics of north America. 41:399-418.

43

Ettinger, S.J., Feldman, E.C.(2005) Textbook of Veterinary Internal Medicine. St. Louis, Elsevier Saunders. German AJ, Day MJ, Ruaux CG, et al(2003) Comparison of direct and indirect tests for small intestinal bacterial overgrowth and antibiotic-responsive diarrhea in dogs. Journal Veterinary Internal Medicine 17:3343. Grutzner, N., Bishop M.A. and Suchodolski, M.(2010). Association study of cobalmine deficiency in the Chinese Shar pie. Journal of Hereditary. 101(2):211-7. Khan, S. and Chang, L.( 2010). Diagnosis and management of IBS. Nat. Review Gastroenterology and Hepatology 7(10):565-81. Kull, P.A., Hess, R.S., Craig, L.E. et al.(2001). Clinical, clinicopathological, radiographic and ultrasonoigraphic characteristics of intestinal lymphangiectasia in dogs:17 cases. Journal of American Veterinary Medical Association 219(2):197-202. Mancho, C, Sainz, A. and Garcia-Sancho, M.(2010). Detection of perinuclear antineutrophilic cytoplasmic antibodies and antinuclear antibodies in the diagnosis of canine inflammatory bowel disease. Journal of veterinary diagnostic investigation.22(4):553-8. Mansfield C.S., James, F.E. and Craven M. (2009). Remission of histeocytic ulcerative colitis in boxer dogs correlates with eradication of invasive intramucosal Escherichia coli. Journal of veterinary internal medicine. 23(5):964-9. Packey, C. D. and Sartor, R.B.( 2008). Interplay of commensal and pathogenic bacteria, genetic mutations, and immunoregulatory defects in the pathogenesis of inflammatory diseases. Journal of internal medicine 236(6):597-606. Peterson, P.B. and Willard, M.D.(2003). Protein losing enteropathies. Veterinary clinics of North America: Small animal practice. 33(5):1061-82. Rassnick, K.M., Moore, A.S., Collister, K.E. et al(2009). Efficacy of combination chemotherapy for treatment of gastrointestinal lymphoma in dogs. Journal of veterinary internal medicine. 23: 317-22. Simpson, K.W., Dogan, B., and Rishniw, M.(2006). Adherent and invasive Escherichia coli is associated with granulomatous colitis in boxer dogs. Journal of veterinary internal medicine. 17(1): 33-43. Simpson, K.W., Jergens, A.E.( 2011). Pit falls and progress in the diagnosis and management of canine inflammatory bowel disease. Veterinary clinics of North America. 41:381-398.

44

LP 3 : II

Veterinary hemodialysis : Advances in management of renal failure in dogs

S. Haque Department of Medicine, Ranchi Veterinary College, B.A.U, Kanke , Ranchi 834006

In medicine, dialysis (from Greek dialusis, meaning dissolution, dia, meaning through, and lysis, meaning loosening) is a process for removing waste and excess water from the blood, and is primarily used to provide an artificial replacement for lost kidney function in renal failure. Veterinary hemodialysis is a mechanism of blood filtration, cleaning the plasma from toxins, urea, creatinine , phosphorus and others external toxins that acumulates inside the body when kindeys looses its normal function. With hemodialysis, we are able to clean the body through an artificial kidney , regulate the hydro-eletrolytic balance, bringing the phisiology to its normal levels. Hemodialysis (HD) is a renal replacement therapy that can enable recovery of patients in acute kidney failure and prolong survival for patients with end-stage kidney failure. HD is also uniquely suited for management of refractory volume overload and removal of certain toxins from the bloodstream. Over the last decade, veterinary experience with HD has deepened and refined and its geographic availability has increased. As awareness of the usefulness and availability of dialytic therapy increases among veterinarians and pet owners and the number of veterinary dialysis facilities increases, dialytic management will become the standard of advanced care for animals with severe intractable uremia. Hemodialysis is a therapeutic procedure that integrates the physical principles of diffusion, convention, and ultra filtration to correct the disorders of body fluid volume, electrolytes, and acid-base, and the toxicities associated with uremia. The composition of the uremic blood is normalized by exposure to a contrived solution, the dialysate, across a semipermeable membrane in a device called a hemodialyzer. During hemodialysis water and small molecular weight solutes and uremia toxins pass readily through the membrane pores (diffusion channels) along diffusive and hydrostatic gradients, but the movement of larger solutes, plasma proteins, and the cellular components of blood are limited by the size of the pores. Excessive body water and additional solute can forced through the membrane by ultrafiltration produced by hydrostatic or osmotic forces imposed across the dialysis membrane. Net removal of uremic solutes is influenced by: (1) the concentration gradient for diffusion, (2) the diffusivity of the solute, (3) permeability characteristics and surface area of the membrane, (4) blood and dialysate flow within the dialyzer, (5) the duration of dialysis, (6) the distribution volume of the solutes, and (7) amount of ultrafiltration (convective transfer). Hemodialysis procedure used in animals are the same concepurally as those used for dialysis in humans. The delivery of hemodialysis is technically demanding and requires: (1) access to the patient vasculature, (2) a hemodialyzer, (3) an extracorporeal blood circuit, (4) a dialysis delivery system to formulate and deliver the dialysate, control blood flow in the extracorporeal circuit, deliver anticoagulant, and monitor the integrity and safety of the entire dialysis process, (5) physiologic monitoring equipment, (6) a source of purified water, and (7) a specifically trained and dedicated nursing and professional staff. HISTORY OF HEMODIALYSIS: Dr. Willem Kolff, a Dutch physician, constructed the first working dialyzer in 1943 during the Nazi occupation of the Netherlands. Due to the scarcity of available resources, Kolff had to improvise and build the initial machine using sausage casings, beverage cans, a washing machine and various other items which were available at the time. Over the following two years, Kolff used his machine to treat 16 patients who suffered from acute kidney failure, but the results were unsuccessful. Then, in 1945, a 67-year-old woman in uremic coma regained consciousness following 11 hours of hemodialysis with the dialyzer, and lived for another seven years before dying of an unrelated condition. She was the first-ever patient who was successfully treated with dialysis.

45

PRINCIPLES OF HEMODIALYSIS: Hemodialysis is done with a filter called capillar. It is a piece made with many little tubes that the blood passes through it. During hemodialysis, the blood passes through a line called arterial line that brings the dirty blood from the patient to the machine , passes through the capillar, where it get in touch with 2 solutions called acid and basic baths. Through osmosys, the toxins like urea, creatinine, phosphrus and others passes between the pores of the capillar and are expelled with the bath. The clean blood come back to organism through the venous line. Hemodialysis clean the blood faster and more efficiently and reduces the work overload of damaged kidney which help in returning back to its normal functional capacity. INDICATIONS AND CLINICAL APPLICATIONS OF HEMODIALYSIS : The major clinical application of hemodialysis in veterinary therapeutics is for the supportive management of acute and chronic uremia when conventional therapies are not effective. For severe or refractory uremia, no other therapy can match the efficacy, efficiency, and clinical benefits of hemodialysis. Hemodialysis should be instituted when the morbidity or pending mortality from severe uremia cannot be alleviated by conventional therapeutic means. Hemodialysis is indicated in following conditions: 1. Acute Uremia , 2. Chronic Uremia , 3. Acute Intoxications and Fluid Overloads 1. Acute Uremia Acute uremia is the most common indication for hemodialysis in dogs and cats. Without dialysis, animals with severe acute renal failure generally die within 4 to 6 days from complications of uremia before there is opportunity for renal regeneration or repair of the injury to alleviate the uremia. Hemodialysis alleviates most of the clinical consequences of acute uremia and extends the life expectancy of these animals to permit their potential for recovery. Hemodialysis should be initiated when the clinical consequences of the uremia cannot be managed effectively with medical therapy alone. Animals with severe oliguria or anuria in which an effective dieresis cannot be maintained with replacement fluids, osmotic or chemical diuretics, and renal vasodilators should be transferred immediately to a referral center where hemodialysis can be performed. Delays imposed by continued conservative therapies result in deterioration of the animals condition and predisposition to life-theratening azotemia, hypervolemia, hyperkalemia, and metabolic acidosis. With dialytic support, the temporal definition of reversible versus irreversible renal failure may extend to 4 to 6 months rather than the conventional benchmark of 1 to 4 weeks. 2. Chronic Uremia Hemodialysis is also indicated and effective for the management of uremia in animals with endstage renal disease (ESRD) as in human patients but is used less commonly due to its expense and limited availability. The efficacy of medical treatment for chronic uremia become limited as the serum creatinine exceeds 7 mg/dl, and the clinical manifestations of uremia become overt as the BUN exceeds 90 to 100 mg/dl. At this stage of renal insufficiency, hemodialysis can ameliorate the azotemia, electrolyte, mineral and acid base disorders, nutritional deficiencies, and systemic hypertension complicating ESRD. Hemodialysis is required indefinitely for these animals; however, many pet owners desire short periods of dialytic support to adjust emotionally to the inevitability of the animals disease. An intensive hemodialysis prescription provided every 2 to 4 days can supplement the residual excretory function to promote a predialysis BUN less than 90 mg/dl, a post-dialysis BUN less than 10 mg/dl, a time-averaged BUN less than 60 mg/dl over the dialysis interval, and promote good quality of life. Although medically justified, the decision to initiate chronic dialysis therapy in an animal whose serum creatinine is less than 5 mg/dl is generally outweighed by the effectiveness of conventional management and cost of indefinite dialysis. Animals supported with maintenance hemodialysis still require comprehensive medical therapy to manage the nutritional deficiencies, anemia, mineral disturbances, acidosis, and hypertension associated with severe renal failure. The prolonged survival afforded with hemodialysis will often promote manifestations of chronic renal failure (hyperkalemia, fluid retention, renal ostedystrophy, and refractory hypertension) rarely identified in animal patients managed solely with medical therapy.

46

3. Acute Intoxications and Fluid Overloads Hemodialysis should be considered for the management of acute poisoning or drug overdose when the toxin is readily dialyzable, when antidotal therapy has been delayed, or when there is no specific antidote to the intoxication. Dialysis hastens elimination of the toxin (or drug) or its metabolites according to its diffusibility, molecular size, concentration in extracellular fluid, distribution pool, and degree of protein binding. Hemodialysis is indicated for the treatment of common poisonings including: ethylene glycol, methanol, salicylate, lithium, ethanol, Phenobarbital, acetaminophen, theophylline, aminoglycosides, tricyclic antidepressants, and possibly metaldehyde. Hemodialysis will secondarily correct acid-base or electrolyte abnormalities which may accompany the intoxication (ethylene glycol and salicylate). Hemodialysis should be initiated once conventional treatments are deemed to be ineffective and continued until the concentration of the toxin has decreased to an acceptable level and the clinical manifestations of the toxicity have disappeared. Dialysis treatments may need to be continued for prolonged periods to remove toxins with delayed toxicity (Paraquat) and low blood concentrations due to slow absorption or compartmentalization within tissues with poor diffusion. Ethylene glycol (antifreeze poisoning) is the most common intoxications encountered in companion animals. Clinical signs develop within minutes and progress variably in 12 to 24 hours to acute oliguric or anuric renal failure. The goals for hemodialysis are to eliminate the antifreeze and its metabolites from the animal as quickly as possible and to support the accompanying fluid, electrolyte, and acid-base disorders and attending uremia. Intoxicated animals that have developed oliguric acute renal failure have an impaired ability to excrete ethylene glycol or its metabolites and may have persistent toxic concentrations as late as 7 days following exposure despite appropriate administration of either alcohol or 4- methylpyrazole. Institution of hemodialysis at these delayed times will eliminate the residual toxins and preclude ongoing renal injury. For suspected cases, hemodialysis should be initiated without delay to insure elimination of the toxin from the animal regardless of previous antidotal therapy or the absence of clinical signs. For an acute poisoning (within 5-6 hours), it is possible to remove all the toxin with a single dialysis treatment. If the treatment is delayed beyond this window, renal injury may have already resulted and a variable series of dialysis treatments must be provided to support the uremia and renal repair. Ethylene glycol poisoning causes severe renal damage which may require many months of dialytic care. After such extended periods of dialytic management, some animals recover normal or nearly normal renal function, some remain renal insufficient but not dialysis dependant, and some never regain renal function. Overhydration associated with systemic hypertension, ascites, peripheral and pulmonary edema, plural effusion, and congestive heart failure is a common complication of aggressive fluid therapy in animals with acute uremia. Circulatory overload may be life threatening and fail to resolve with conventional therapy. Overhydration is a consistent feature of end-stage renal disease when animals have insufficient excretory ability to eliminate intravenous or subcutaneous fluid treatments, oral fluid supplements, or dietary water. These excessive fluid loads can be removed readily by the ultrafiltration capability of hemodialysis. Ultrafiltration is essential for the management of iatrogenic overhydration, life-threatening pulmonary edema, congestive heart failure, or therapies (like parenteral nutrition) requiring delivery of large volumes of fluid in animals with limited excretory capacity. Ultrafiltration without dialysis also can be used to treat noniatrogenic conditions associated with circulatory overload including cardiomyopathy and congestive heart failure. Usually, hemodialysis is done from one to four times in acute and chronic cases. Each procedure takes from two to four hours. It may vary, according to size, breed, general state and vascullar access. Animals with chronic kidney insufficiency do not get obligated to perform hemodialysis forever! Hemodialysis are performed until cretinine and BUN levels are back to normal . A few cases are of total renal failure. In these cases, , hemodialysis will keep the animal in good conditions untill the animal gets a kidney implantation. After the kidney implantation, hemodialysis plays an importante role to keep the blood clean, untill this new kidney gets functioning properly. Animals suffering from other ailments as leptospirosis, hepatic diseases, intoxications and poisoning usually recover after one or two hemodialysis sessions.

47

Usually , the animal behave very well , either because he feels good with the treatment , or because he is very ill and cannot fight the treatment. It is of most importance to have a team work between the veterinria who send the patient to hemodialysis and the hemodialysis group. Good results are obtain with these team work and with the owner help, bringing the animal for weekly check-ups, blood testing and right diet untill the dog is fully recovered. CONCLUSIONS: With modern technology and techniques, hemodialysis is technically feasible, safe, efficacious, and indispensable for the management of both dogs and cats with life-threatening uremia. The very nature of its complexity, costs, and narrowly targated applications will restrict widespread application of hemodialysis in veterinary practice. However, there is no alternative therapy as efficacious for animals with severe uremia, refractory oliguria, life-threatening hypervolemia, or acute poisoning. The increased awareness and acceptance of dialysis by primary care veterinarians, the increased sophistication of specially veterinary practice and academic centers, increased training of veterinary internists with interest and knowledge in nephrology, and the increased demand by pet owners for this service promises its further expansion and availability on a regional basis countrywide. REFERENCES: Cowgrill LD, Elliott DA: Hemodialysis. In DiBartola SP (ed): Fluid Therapy in Small Animal Practice, 2nd Edition, WB Saunders Company, Philadelphia, PA, 2000. Pendse S, Singh A, Zawada E. Initiation of Dialysis. In: Handbook of Dialysis. 4th ed. New York, NY; 2008:14 21. Ahmad S, Misra M, Hoenich N, Daugirdas J. Hemodialysis Apparatus. In: Handbook of Dialysis. 4th ed. New York, NY; 2008:59-78.

48

LP 4: II

Electrocardiography-a noninvasive diagnostic tool for evaluation of cardiovascular system

J.P.Varshney Nandini Veterinary Hospital, Surat-395007

What is electrocardiography Electrocardiography is a non-invasive diagnostic tool that is used to recordings of the activity of the heart in man and animals. It provides a graphic record of the voltage produced by cardiac muscle cells during atrial and ventricular depolarization and repolarization plotted against time. A normal electrocardiogram does not rule out cardiac malformation or other cardiac changes. An abnormal ECG may suggest side of the heart affected , disturbance of rhythm or rate . Uses of Electrocardiography Electrocardiography can be used for routine health checkup, cardiac monitoring during anesthesia and surgery, evaluation of trauma, evaluation of heart size, shape , rhythm and rate,. evaluation of electrolyte disorders, routine presurgical examination and for preventive health check up for geriatric dogs and cats. Utility of Electrocardiography It adds a new dimension to the diagnosis and treatment of disease states. It is non-invasive and quick tool easy to read and results are immediately available. It can provide differential diagnosis of arrhythmias. Cardiac patients can be evaluated in a better way.ECG provides visual records of patients cardiac status. The electrocardiograph and Recording Machine The Electrocardiograph is a sensitive voltage metering instrument capable of recording differences of electrical potential of the order of 1,000th of a volt i.e. 1 mV. The voltage meter and amplifier is combined with a strip recording device to give a permanent record. That is created by the movement of a heated stylus on heat sensitive recording paper. The machine can be run at the paper speed of 25 or 50 mm per second and sensitivity of 0.5, 1 or 2. Electrodes There are five separate wire electrodes in standard electrocardiographic cable and are labeled as right arm (RA)- red coloured, left arm (LA)-yellow coloured, right foot or leg (RL)-black coloured, left leg or foot ( LL)- green coloured and V lead or exploring chest lead ( consisting of 6 separate leads marked as V1,V2,V3,V4,V5 and V6). Lead Systems A. Bipolar Standard lead system consists of lead I, II and III. These leads compare potential difference of two limbs and evaluate activation of the heart in the frontal plane. B. Augmented unipolar limb lead system- The augmented unipolar limb leads ( aVR, aVL and aVF) are the additional leads . An augmented leads compares the electrical potential at the reference limb to the sum of electrical activity at the other two limbs. C. Special Lead System-Unipolar precordial chest leads (CV5RL, CV6LL, CV6LU and V10) view the heart from the transverse plane and provides important information for the diagnosis of heart enlargement ( right or left),bundle branch blocks, ischaemic heart changes and arrhythmias.

49

Electrocardiographic paper It is a graph paper lined into boxes . Horizontal lines are 1 mm apart that represents 0 .1 mV when ECG is set to the sensitivity of 1 ( i.e. 1cm = 1 mV).The vertical lines are also 1 mm apart and represents the time interval of 0.04 sec when recording is done at the speed of 25 mm per second . Position and restrain of dogs Dogs are positioned on a wooden table in right lateral recumbency. The forelimbs are kept perpendicular to the long axis of the body. Generally no chemical or drug is used to restrain the dog. With the presence of the owner at the table most of the dogs calm down and feel comfortable. Placement of the electrode. Before putting the electrodes both electrode and skin are moistened with electrocardiographic gel, paste, or alcohol. .Electrodes are attached directly to the skin. RA & LA - Electrodes are attached proximal to the olecranon on the caudal aspect of the respective forelimbs. RL & LL - Electrodes are attached over patellar ligament on the anterior aspect of the respective hind limbs. V leads or unipolar precordial chest leads are attached as follows: Lead CV5RL (rV2)- at 5th right intercostals space near edge of sternum Lead CV6LL (V2)- at 6th left intercostals space near edge of sternum. Lead CV6LU (V4) - at 6th left intercostals space at costo-chondral junction. Lead V10 - over dorsal spinous process of 7th thoracic vertebra. Recording of the Electrocardiogram Turn power on. Set the sensitivity usually at position 1 and paper speed at 25 mm per second. And press auto recording..Remove the lead electrodes from the dog. Write case number, details of the dog, owners name and date of the tracings. Common Artifacts and their management ECG abnormalities unrelated to cardiac disorders are termed as artifacts.These defects may arise from technical or mechanical errors or from malfunctioning during ECG recording. Electrical interference: These are also called 60 cycle interference owing to their appearance as a regular sequence of 60 sharp up and down waves per second. Regular saw tooth appearance of the base line results from improper grounding of the patient, electrocardiograph or electrical source. These can be corrected by ensuring that power cord is properly grounded, electrodes are properly secured, avoiding over saturation of leads with alcohol or gel,ensure that dogs legs are held apart and clips are not touching each other and remove collars or halters with metalp parts. Muscle tremor : Trembling of the body of the dog can also produce artifacts. These can be reduced by ensuring comfortable position of the dog, placing hand over the chest during the recording and mild tranquilizer to uncooperative dogs. What to expect from an ECG ECG is a tool, and not as an end in itself. It is essential for the diagnosis and treatment of cardiac arrhythmias. Since treatment of arrhythmias is specific, error in diagnosis may result in fatalities. ECG is no panacea as it has its own limitations. It can not detect mechanical status of the heart; pathology of valves, coronary arteries, endocardium and pericardium; and predict prognosis always. Therefore, always consider ECG as a part of clinical findings and interpretate in conjunction with history, clinical findings and other laboratory investigations.

50

Electrocardiogram It is a graphic representation of the voltage and direction of electrical activity produced during depolarization and repolarization of cardiac muscle cells plotted against time. ECG provides an information about heart rate, its rhythm, enlargement of chambers, conduction defects, myocardial diseases or ischaemia, certain electrolyte imbalances (hypocalcaemia, hypopotessaemia, hypercalcaemia or hyperkalaemia) and some drug toxicities. The shape of the ECG In ECG atrium depolarization is represented by P wave. The ventricular mass is large, so there is a large deflection of the stylus during ventricular contraction leading to formation of QRS complex. Repolarization of ventricular mass leads to formation of T wave. Clinical indications for taking ECG - Arrhythmias ( Tachycardia, or Bradycardia or irregular heart beat) - Shock - Sudden onset of Dyspnoea, syncope or seizures. - Cardiac murmurs - Increased auscultation area of the heart. - Renal disease. - Endocrinopathies (Additions disease, Cuchings syndrome, thyroid dysfunctions). - Systemic diseases (Pyometra, pancreatitis, uremia, neoplasms) affecting heart. - Acid-base and or ionic imbalances. Limitations of electrocardiogram - ECG serves as a rough guide for evaluating the heart and should , therefore, be interpretated in conjunction with clinical state of the ailing dog as its interpretation in isolation may be misleading. - It reflects functional status of the heart only and not of mechanical status. - Pathology of valves (mitral, tricuspid, pulmonary, and aortic), coronary arteries, endocardium or pericardium can not be diagnosed by ECG. - Significant cardiac disease may sometimes produce only minor changes or no change at all in electrocardiogram. Hence it should be used in conjunction with complete clinical history, clinical examination and other diagnostic procedures. - Body conformation and breeds of the dog may alter mean accepted measurements. Hence standard measurements for different breeds are to be worked out. Normal Cardiac Waveforms: Wave Forms Interpretation P P-R interval Atrial depolarization. Normally positive in lead II and aVF. Time from onset of atrial muscle depolarization through conduction over AV node, Bundle of His and Purkinjee fibers. Depolarization of ventricular muscle. Q is first negative deflection, R the first positive deflection and S the second negative deflection. End of QRS complex Period of phase-2 of action potential. entricular muscle repolarization. Total time of ventricular depolarization and repolarization.

QRScomplex

J Point S-Tsegment T Q-T interval

51

References : Allen, D.G., Kruth,S.A. and Gravey, M.S. (1994). Small Animal Medicine. J.B. Lippincott Company, Philadelphia Bolton, G.R.(1975). Handbook of Canine Electrocardiography.W.B.Saunders, Philadelphia. Detweiler,D.K.(1989). The dog electrocardiogram: a critical review. In : Comprehensive Electrocardiography. MacFariane, P.W. and Veitch-Laurie, T.D (eds), Pergamon Press NewYork, pp 1267-1297. Tilley,L.P.(1992).Analysis of the canine P-QRS-T deflections.In: Tilley,L.P. (edit.) Essentials of Canine and Feline Electrocardiography. Interpretations and Treatment. 3rd edn.Lea and Febiger, Philadelphia, pp. 59-99.

52

LP 5: II

Role of Alternative Medicine in Dental Diseases in Dogs

Surjit Singh Makker Member, Faculty of Homeopathy, Malaysia

Introduction Alternative veterinary medicine can be defined as the utilization of alternative therapies in the treatment of diseased animals. Alternative therapies include modalities such as homeopathy, acupuncture , Herbs,physiotherapy, Reiki and phototherapy. Homeopathy is believed to be the alternative therapy most commonly applied in dairy herds, Horses, Ponies, Dogs, Cats. Alternative therapies are commonly regarded as holistic. Homeopathy is a truly holistic therapy and uses the principle discovered and developed during the eighteenth and early nineteenth centuries by Dr Samuel Hahnemann, in Saxony. In literal terms, the name homeopathy means similar to the disease or the treatment of disease using a substance which has the power to provoke similar symptoms when administered to a healthy body. What a substance can cause or provoke in health, it can cure in disease. The symptoms that a substance can induce are discovered by means of a proving (Prfung) - a test on healthy human beings. Hahnemann later developed the extreme dilutions (potencies) which remain, to this day, In circa 1813, in Leipzig, Hahnemann lectured on the use of his medical system on animals. He stressed that the principles were the same as in humans and these principles guide homeopathic vets to this day. Hahnemanns writings and teachings were fundamentally truly holistic in practice and methodology and have stood the test of time. Hahnemanns work was way in advance of what was on offer at the time and, if truth were told, ahead of much of todays non-holistic (reductionist) thinking. Homeopathy is a truly holistic therapy, working with mind and body in the context of its environment and lifestyle and has been used in animals for at least 190 years. All species and all types of animals respond, from cats and dogs to farm animals. Keywords: Alternative medicine, homeopathy, dogs, Cats, animal health and welfare Dental disease occurs very commonly in dogs and cats with most small animals greater than 4 years of age having significant dental problems. Dental problems can also occur in young dogs and cats. Certain dental problems, such as retained deciduous teeth or malocclusions, can occur in puppies and kittens. A variety of clinical signs may be evident in animals with dental disease. Dental care for pets is just as important as in people. By the age of three years seven out of ten pets have dental disease. Dental problems show up as; bad breath, reddened gums and tartar. Pets require regular dental checkups.The adult dog has forty-two teeth, twenty in the superior, and twenty-two in the inferior jaw. They are divided into incisors, canine, and molars. Common Dog Dental Problems Dental Abscesses Where the animal presents significant facial swelling, the remedy Myristica 30cshould be given immediately, followed by a further dose after about 30 minutes, and a subsequent dose one hour later. This will generally reduce the swelling and discomfort, and an incision may be avoided. Bad breath, or halitosis, is caused by bacteria in the mouth. The highest concentration of bacteria, and the biggest problem, is beneath the gum line. In addition, bacteria are present on teeth; and, if there is bleeding from the gums, a thick layer of bacteria mingles with the blood. Plaque Food particles, hair, and bacteria collect along the gumline to form plaque, a common cause of peridontal disease. To prevent plaque from developing into tartar and thus causing more serious gum disease, such as gingivitis, we should give our dogs daily brushing to remove the plaque. Tartar If plaque is not removed, minerals in the saliva will combine with the plaque and form tartar. The tartar is irritating to the gums and causes an inflammation called gingivitis. The gums adjacent to the teeth

53

will become red and inflammed, causing bad breath and swollen gums. At this point it is necessary to visit a veterinarian for the removal of the tartar. Periodontal Disease If the tartar is not removed, it builds up under the gums, causing further inflammation, pulling away and receding gums. A pocket opens up between the teeth and the gums, collecting more debris and encouraging even more bacterial growth. At this point the damage is irreversible - the dogs teeth will loosen and fall out. In serious cases, it is very painful and can cause complications such as the development of abscesses, bone loss or infection. Common Signs of a Dental Problem: Changes in eating habits Halitosis (bad breath) Pawing at the mouth Abnormal salivation Oral hypersensitivity Facial swelling Oral hemorrhage Sneezing and nasal discharge Abnormal behavior Grade 1: Inflammation, Grade 2: Inflammation, edema, gingival bleeding upon probing Grade 3:- Inflammation, edema, gingival bleeding upon probing, pustular discharge slight to moderate bone loss Grade 4 Inflammation, edema, gingival bleeding upon probing, pustular discharge, mobility severe bone loss Causes Gingivitis - (dogs) streptococcus and actinomyces species Periodontitis - (dogs) pigmented and non pigmented Bacteroides (Porphyromonas Gingivalis, Prevoltella sp., Bacteroides sp.), Fusobacterium Cats: Peptostreptococcus sp., actinomyces, and porphyromonas SP. Diet: soft diet promotes periodontal disease through accumulation of plaque. Risk Factors Toy breeds with crowded teeth Dogs that groom themselves causing hair to be imbedded in the gingival sulcus Other debilitating illnesses Poor nutrition state Differential Diagnosis - phemphigus, lupus, oral neoplasia, stomatitis Tests CBC/CHEM/U/A - N/A Imaging - Radiography an important diagnostic tool used in evaluating periodontal disease. As much as, 60% of disease is hidden below the gum line. Advantages of Homeopathic Medicines When properly used, homeopathic remedies offer the individual a: Non-invasive approach Means of curing the underlying problem Cost effective treatment Quicker recovery period Reduced risk of adverse side effects HOMOEO DRUG HERE USED AS ABSCESS - TOOTH OR GUM Belladonna - Best used for early dental abscess accompanied by redness and throbbing. Bryonia - Use for acute inflammation or if pricking pain is relieved by firm pressure. Hepar Sulphuris - Use for abscess accompanied by pus formation. Myristica - Use when swelling is accompanied by numbness of the area.

54

Pulsatilla - Use when the pain is accentuated by heat and relieved by cold water. Pyrogenium - Use when pus is present without drainage. Silicea - Use to hasten the discharge when pus is draining. GINGIVITIS, PERIODONTITIS AND ALVEOLITIS Arsenicum album - Use for unhealthy, bleeding gums. China -Use for gum tissue that is bleeding. Ferrum phosphoricum - Use for poor gum tone or gums that bleed after brushing. Hypericum - Use for tender gum tissue and to promote healing. Kali chloricum - Use for acute ulcerative tissue. Naturium muriaticum - Tissue integrity. Hepar sulphuris - Tissue with suppuration, chronic abcesses. Silicea - Periodontal abscess with swollen glands. Staphysagria - Loose teeth, pain increased by pressure. Symphytum - Injuries to periosteum. Stimulates growth of epithelium on ulcerated surfaces. Mercurius solubilis - Use for acute ulcerative tissue with a coated tongue and metallic taste in the mouth. Nux vomica - Use for swollen painful gums when the back of the tongue has a whitish coating and when the patient consumes a lot of stimulants such as coffee and tea. Phosphorus - Use on swollen gums that bleed easily, and when theres an overproduction of saliva. Ruta graveolens - Use for injured bone and alveolitis (dry socket). HAEMORRHAGE Arnica - Use for bleeding accompanied by bruised soreness. Ferrum phosphoricum - Use when there is bright red bleeding. Phosphorus - Use for persistent bleeding. NEURALGIA Aconite - Trigeminal neuralgia Aranea diadema - Use for radiating pain in the right side of the face that is aggravated by cold. Also use for sudden, severe pain in the teeth at night after lying down. Cuprum metallicum - Use for cramping of muscles. Gelsemium sempervirens - Use to relieve headache and pain of the upper back and neck, which extends over the head and for dizziness and numbness. Ignacia - Use for headache as if a nail were driven through the side of the head. Lachesis - Left-sided complaints Lycopodium - Right-sided complaints Magnesia phosphorus - Use for spasmodic pains made worse by cold water and made better by heat and rubbing. Sanguinaria - Right-sided neuralgia- facial migraine. Spigelia - Use for pain involving the eye, cheek, and left temple areas. Zincum phosphoricum - Sharp pains on right side of head. Zincum valerian - Sharp pains on left side of head. POST OPERATIVE DISCOMFORT Apis mellifica - Good for post-injection soreness after dental work. Chamomilla - Give one hour prior to dental appointrnent for patients with a low pain threshold. It also expedites the wearing off of the numbness following the dental appointment. Hypericum - Use where there is an injured nerve. Ledum - Use for puncture wounds and soreness resulting from a dental injection. Magnesia phosphorica - Use for stiff, sore jaws following prolonged dental work when the muscles are

55

cramped and feel better with warmth. Staphysagria - Use for incision-type wounds after soft tissue surgery. Symphytum - Use for trauma of bone and periosteum. Discussion: Food particles, hair, and bacteria collect along the gumline to form plaque, If plaque is not removed, minerals in the saliva will combine with the plaque and form tartar. The tartar is irritating to the gums and causes an inflammation called gingivitis , The gums adjacent to the teeth will become red and inflammed, causing bad breath and swollen gums. If the tartar is not removed, it builds up under the gums, causing further inflammation, pulling away and receding gums. A pocket opens up between the teeth and the gums, collecting more debris and encouraging even more bacterial growth. At this point the damage is irreversible - the dogs teeth will loosen and fall out. In serious cases, it is very painful and can cause complications such as the development of abscesses, bone loss or infection. Case Report: Case no 1 : labrador dog, age 7years, the owner Pritam Singh Mehta from Nagpur reported via e. mail on 10-05-2011with symptoms that his dog has bad breath. Snagys breath smells like rotten eggs, the gums are red and bleeding and there is the presence of pus at the gum line, and the vet diagnosed this as gingivitis. He was advised with Antibiotics .but of no use. So on the basis of symptoms of bad breath,swollen and bleeding I advised him Merc.sol 30 three times a day for 2 days. On 13-05-2011 , I found a thanks letter that his dog is ok now. Case No. 2 : On 6th July 2010,I got a e. mail from a Lady In Hongkong that her Chinese dog about 6 years old, who has a history of distemper, and was treated in the old way. Since then there has been a constant dribbling of saliva from the corners of the mouth; the saliva hangs in strings to the ground; and the animal has been in consequence of the nuisance banished from the house and kept in the stable. The breath is most offensive, and several of the teeth are decayed. There is a constant jerking movement of the whole body, sometimes better sometimes worse. On the basis of these symptoms I advised Hepar Sulph 6 1-2 drops night and morning. On 7th July I was that the dog began perceptibly to improve after the first dose, and I now find the dog quite well. Continue medicine once a-day, for a few days longer. On 10th, July,Slight cold; discharge from nose and eyes; mattery discharge from mouth. To have Argentum nitricun - two drops of the mother tincture to four ounces of water; of this a dessertspoonful night and morning. On 13th, July I was informed that All is well now. Conclusion:There are more than 100 homoeopathy remedies which give great relief in various dental diseases in dogs and cats.However, the correct choice and the resulting relief is a matter of experience and right judgment on the part of the Vet homeopathic doctor. The treatment is decided after thorough case taking of the patient. Treatment involves a thorough teeth cleaning, as well as daily toothbrushing, If that is not practical, there are specialty chew toys designed to clean the teeth and stimulate the gums, and these can be quite effective. It is obvious therefore, that providing our dogs with regular canine dental care is essential for the maintenance of strong, healthy teeth and gums. References:http://petremedycharts.blogspot.com/2011/01/homeopathy-in-veterinary-dentistry.html, www.shirleys-wellness-cafe.com/ahomeo.htm, www.homeovet.net/content/lifestyle/section1.html, www.theavh.org/petowners/01092006.php, Homeopathic Remedies for Dental Problems by Dr Wolfe DDS NMD,

56

LP 6: II

Scenario of Parvo dog infection in canines

S.K.Gupta, V. S. Wazir Rajesh Kalha and Rajiv Singh Faculty of Vety. Sciences & A.H R.S.Pura, 181102, SKUAST-Jammu (J&K)

Since the beginning of civilization, the dogs have been selected and bred for different purposes like protection against stranger, sports, companionship and hunting, besides serving mankind in different areas. There is a little doubt about the contribution of a dog to the human civilization. The friendly association between them has been in existence from time immemorial, as dog is the best friend and faithful companion of man because of its fidelity, loyalty, obedience and pleasant disposition. It is said that the dog appeared on earth about 20 million years ago and its domestication started ten to fifteen thousand years ago in parts of the world when man learnt to cultivate wild grains and started living in communities. The unemployed, educated youth as such is, therefore, bring attracted to opt for breeding kennels in metropolitan cities to cater to the ever increasing demand of pet lovers and is now becoming an industry. In rural remote and hilly areas in our country especially of J & K state, the nomadic farmers, sheep and goat breeders, i.e. Chopans, Gaddis, Bakerwals; Gujars are also in habit of keeping dogs to watch and ward their households, farm animals and standing crops especially during long migration. The health maintenance is considered as an important component in dog management. Gastroenteritis, a common illness affecting all species of animals is much more severe in monogastric animals especially canine. The patho-physiology of inflammation of the stomach and intestine is quite diverse depending upon the specific etiology. The causes of canine gastroenteritis may be dietary, viral, bacterial, rickettsial, parasitic and miscellaneous. The etilogical distribution of canine diarrhoeic cases in a survey conducted by Panda(2006) suggested that Parvo alone contributes 30 percent, Parvo concomitant with bacteria 29 percent followed by 7 percent only bacterial and the rest 34 percent enteritis cases were caused by parasitic and other unknown etiologies. Canine parvovirus (CPV) infection, at present has got world wide distribution and is widely prevalent in Asia (Khaldikar et al., 1994). Parvo virus is relatively new disease that appeared in the late seventies and first recognized in 1978 and spreaded world wide in one to two years. The first case was reported in India by Balu and Thangraj(1981). Ramadass and Khader (1982) were first to isolate the virus in India and since then, it has been reported from various states of India except Jammu and Kashmir. Commonly called as hemorrhagic gastro-enteritis (HGE) remains one of the most important, often fatal, disease affecting dogs of all dogs especially young ones. This infection spreads by contact at places where dog congregate. The source of infection is faeces of infected dogs that contain large amount of virus. The virus primarily replicates in actively dividing cells of intestinal lining there by killing or destroying the epithelium and ends up with often bloody diarrhea and vomition, depression and suppression of white blood cells. Since 1978, the diseases has been studied and revived regularly, but it still remains a challenge for a veterinarian to diagnose and suggest effective therapeutic managemental practices to cure the disease. Goddard and Leisewitz(2010) in a latest review opined that the continued incidence of Parvo dog enteritis was due to the virus capability to reinvent and evolve into new more virulent and resistant subspecies. Now CPV has broken continental barriers and made its presence felt all over the world observed that the canine minute virus(CMV) was most closely related to bovine parvovirus(BPV) and both could possibly by classified into a new clade in the parvovirinae subfamily. The canine parvovirus was very similar to the feline panleukopenia virus (FPV) and milk enteritis virus (MEV) with more than 98 percent sequence homology, (Chang et al, 1992). Canine parvovirus (CPV) and feline panleukopenia virus (FPV) were observed as significant pathogens for domestic dogs and cats as well as for various wild carnivore species. These viruses were classified as host range variants among feline Parvo viruses of genus parvoviruses in the family parvoviridae(Siegl et al., 1985). Veijaleinen(1988) was of the opinion that the actual origin of CPV-2 was unknown; however, one of the fox species((Arctic fox) might be likely intermediate.

57

The canine parvovirus is an extremely hardy virus stable to adverse environmental conditions such as extreme pH, temperature, ether, lipid solvents, chloroform and common disinfectants. The properties of the CPV were studied by means of physico-chemical treatments, biological tests and experimental infection of domestic dogs. It can survive up to 15 minutes at 800 C, 1 hour at 600 C, 24 hours at 560 C, 2 weeks at 370 C, 3 months at 200 C and 6 months at 40 C. The virus remained alive in faeces, in environment for many years (Pollock and Carmichael1981). It has been established that this virus can be inactivated by 0.5 percent formalin, 1.32 dilution of hypochlorite, solution of beta-propiolactone, hydroxylamine, oxidizing agents and UV radiation (Afshar, 1981). The CPV infection occurs primarily by ingestion and direct contact. CPV is present in high contribution in the faeces of dog during acute stage of infection and faeces may remain constant source for other dogs for several weeks following clinical recovery. Since minimal dose required for infection is very small, so in a situation where there is continuous introduction of susceptible pups through births(kennels) or imports(pet shops) and where environmental sanitation is difficult to maintain, dogs are likely to be constantly exposed to CPV. The maximum viral excretion is during first week of infection and it ceases by three weeks post infection. Virus excreted in the faeces is extremely resistant to inactivation and survives for several years in the environment contaminated by infected faeces (Johnson and Spradbrow, 1979). CPV infection typically occurs in pups from weaning to about 20 weeks of age at a low but constant rate in kennels and pet shops. Outbreak of CPV enteritis with high rates of morbidity and mortality are not unusual due to either interruptions in the vaccination programme or any lapse in hygiene. Serological evidence suggests that in many kennels virtually all unvaccinated dogs will be naturally infected with CPV. The dogs of different breeds differ in their susceptibility to this infection. Breeds at a higher risk include Doberman, Pinschers, Rottweillers, German shepherd, pointers and Springer spaniels, seters. The toy poodles and cocker spaniels are at lower risk compared to mixed breeds of dogs (Houstan et al., 1996). Everman et al(1983) reported that impounded stray dogs and those housed in kennels were at a higher risk than family pets in contracting the disease. Similarly in a study on prevalence 28.6 percent of the pet dogs and 91 percent of the stray ones were positive for CPV infection (Udupa and Sastry, 1997a). CPV infection is mainly a disease of dogs less than one year of age with greatest severity in pups from weaning to about 20 weeks of age (Ernst et al., 1988; Houstan et al., 1996). Archana et al., (2009) recorded maximum (56.90 percent) prevalence in non-descript dogs followed by Doberman (44.44 percent), German Shepherd(38.5 percent), Pomeranian(37.5 percent), Labrador (28.6 percent) and Dalmatian (20 percent).Further the incidence was maximum (70.20 percent)in dogs up to 6 months of age. Kempf et al., (2010) opined that younger age group of dogs usually suffer more from parvovirus infection as compared to older ones which suffer more from other enteric viruses. Mosallanejad et al., (2008) have reported more prevalence in dogs less than 6 months of age (21.95 percent) and concluded that breeds of Terriers had 26.31 percent prevalence followed by German Shepherd (21 percent), Doberman, Pinschers and mixed ones but there was no significant difference between age groups and breeds. Parthiban et al., (2010) examined 128 faecal samples for canine parvovirus enteritis in puducherry (India) and reported 83.8 percent prevalence in young puppies of 0-6 months of age group followed by 8.8 percent in 7-12 months age group and the least (7.4 percent) was in the age group above 12 months. Whereas, no significant relationship of breed and age in this infection in Iranian canine population was reported by Firoozjaii et al (2011). The main clinical features of Parvo dog infection include two distinct presentations cardiac and intestinal forms mainly and sick animals generally show vomition with dysentery. Diagnosis is made through detection of Parvo virus in faeces either by HAV or electron microscopy. PCR can also be used when potentially less virus are shed in faeces that are not detectable either by EIA or HA. Clinically this infection is confused with corona virus or other forms of enteritis. CPV infection is easily detected when there is vomition along with bloody dysenteric faeces. Prevention is the only way to ensure that a puppy remains healthy because the disease is extremely virulent and contagious. The virus is extremely hardy and has been found to survive in faeces and other organic material such as soil for over a year. It survives extremely cold and hot temperatures. The only household disinfectant can kill is bleach.

58

Ongoing infection risk is primarily from fecal contamination of the environment due to the viruss ability to survive many months in the environment. Neighbors and family members with dogs should be notified, so that it can be ensured dogs are vaccinated or tested for immunity. The vaccine will take up to 2 weeks to reach effective levels of immunity; the contagious individual should remain in quarantine until other healthy pets are protected. Survival rate depends upon how quickly Parvo virus is diagnosed and how aggressive is the treatment. It also involves extensive hospitalization with immediate symptomatic treatment for clinical manifestation exhibited. The treatment mainly comprises of IV fluids with antiemetics with broad spectrum antibiotics to check secondary bacterial complications. References: Afshar, A. (1981). Canine Parvovirus infections-a review. Veterinary Bulletin (London). 51: 605-612. Archana, Shukla, P.C., Gupta, D. K. and Bhoopendra Kumar (2009). Epidemiology of canine parvovirus infection Indian Journal of Veterinary Research. 18(2): 42-44. Balu, P. A. and Thangaraj, T. M (1981). Canine virul gastroentreritis. A clinical report. Indian Journal of Veterinary Medicine 1:73-77. Chang, S. F., Segro, J. Y. and Parish, C.R.(1992). Multiple amino acids in the capsid structure of canine parvovirus coordinately determine the canine host range and specific antigenic and haemagglutination properties journal of Virology, 66(12): 6858-6867. Ernst, S; Montes, S. and Martin, R.(1988). A retrospective epidemiological study of the risk factors associated with the occurrence of parvovirus infection in a canine hospital population. Archivos de Medicina Veterinaria, Chile. 20:38. Ettinger, Stephen J., Fieldman, Edward C. (1995). Textbook of Veterinary Internal Medicine (4th Ed.) W. B. Saunders Company. ISBN-7216-6795-3. Everman, J.F., Stann, S., Di Giacomo, R. F., Bergstram, P.K., McKeirhan, A. J. and Giddens, W.E. Jr(1983). Epizootiologic and diagnostic features of canine diarrhoeal disease in high and low risk dog populations. Proceedings of Animal Meetings of American Association of Veterinary Laboratory Diagnosticians. 25:229. Firoozjaii, H. A., Shoorijeh, S. T., Mohammadi, A., Tamadon, A. (2011). Characterization of Iranian isolates of canine parvovirus in faecal samples using polymerase chain reaction orange. Iranian Journal of Biotechnology. 9(1): 63-68, 74. Goddard, A. and Leisewitz, A. L.(2010). Canine parvovirus. Journal of Veterinary Clinicians of North America, Small Animal Practice. 40(6): 1041-1053. Houston, D. M., Ribble, C.S. and Head, L.L. (1996). Risk factors associated with parvovirus enteritis in dogs: 283 cases (1982-1991). Journal of American Veterinary Medicine Association. 208:542. Johnson, R. H. and Spradbrow, P. B. (1979). Isolation from dogs with severe enteritis of a parvovirus related to feline panleucopenia virus. Australian Veterinary Journal 55:151. Kempf, C., Schulz, B., Strauch, C, Sauter-Louis, C, Truyen, U. and Hartman, K. (2010). Virus detection, clinical signs and laboratory findings in dogs with acute hemorrhagic diarrhea. A retrospective study of 935 cases. Tierarztliche praxis. Ausgabe K. Kleintiere/ Heimtiere. 38(2): 79-86. Khadilkar, M. V., Batra, P. and Singhvi, N.M.(1994). Journal of Remount Veterinary Corps. 33:81. Parthiban, S., Mukhopadhya, H. K., Antony, P. X. and Pillai, R. M. (2010). Epidemiology of canine parvovirus enteritis in pet dogs in Puducherry(India). Animal Science Reporter, 4(3): July 2010. Pollock, R. V. H. and Carmichael, L.E. (1981). Canine viral enteritis: Recent developments. Medical Veterinary Medicine. 60:375. Siegl, G., Bates, R. C., Berns, K. L., Carter, B. J., Kelly, D. C., Kurstak, E. and Tattersall, P. (1985). Characteristics and taxonomy of prvoviridae. Intervirology 23:61-73. Veijaleinen, P. (1988). Characterization of biological and antigenic properties of raccoon dog and blue fox Parvoviruses. A monoclonal antibody study. Veterinary Microbiology. 16: 219-230.

59

L P 7 : II

Canine Infectious Dermatitis and Its Management

J.S.Soodan, S.K.Sharma and V.S.Wazir Division of Teaching Veterinary Clinical Complex, Faculty of Vety. Science &AH, SKUAST-J,R.S.Pura-Jammu-181 002

Dermatological diseases assumes great importance in canines due to their effect such as distress, irritation and offensive smell besides being a potential source of a number of zoonotic diseases (Parish and Schwartzman, 1993). Skin diseases are one of the most common diseases of dogs. These are either infectious (bacterial, viral, fungal, and parasitic) or non infectious (allergic, immune mediated, due to mineral or hormonal imbalance). Occurrence of skin diseases in different regions may vary with the season, climatic factors and managemental practices adopted in particular area. Besides age, breed, sex and color may also affect the incidence of certain problems (Scott et al., 1995). Bacterial dermatitis is widely prevalent in canine. The bacteria responsible could be resident or transient, depending on their ability to multiply in that habitat. A number of bacterial organisms have been isolated from canine skin diseases (Swain et al., 2002 and Seena et al., 2005, Sharma et.al.,2008,Beigh,2010) which are either primary pathogens or secondary invaders and their sensitivity pattern also varies with location. Of the thousands of different species of fungi, only few have the ability, to cause disease in animals. The diseases produced by these fungi are grouped as dermatophytosis caused by species of Microsporum, Trichophyton or Epidermophyton or dermatomycosis which include Alternaria, Aspergillus, Aureobasidium, Cladosporium, Mucor, Penicillium and Rhizopus. These fungal infections could be primary or secondary to an underlying condition, atopy or depletion of immunocompetence (Wilkinson and Harvey, 1994). Skin is also exposed to attack by many kinds of parasites which produce mild effect as in case of an isolated fly or mosquito bite or severe as in case of mange. Mange infestation is a serious, debilitating, persistent and problematic skin disease of canine. The chronicity and recurrence of these ailments poses a lot of challenge to the physician. Diagnosis and treatment of skin infections continues to be one of the most difficult tasks in small animal practice even when the whole skin is open for visual examination and palpation. In this lecture, the common infectious dermatitis i.e. bacterial, parasitic and fungal and their management is discussed. Bacterial Dermatitis : The skin of normal dogs is populated with small numbers of Micrococcus, alpha-hemolytic streptococci, Propionibacterium acnes, Acinetobacter and Staphylococcus spp.. Staph. intermedius can frequently be isolated from the hair coat of normal dogs and might serve as the reservoir for infectious organisms of the skin. S. intermedius is involved in approximately 90% of canine bacterial pyodermas. In addition to Staphylococcus, gram-negative bacteria such as Proteus, Pseudomonas, or Escheria coli can often be cultured. (Scott et.al.,1995). In a study, We have isolated Staph. intermedius (44.83%), Staph. aureus (20.69%), Staph. epidermidis (10.34%), Pseudomonas sp. (6.89%) and Streptococcus sp. (3.45%) from the canine dermatitis cases from Jammu region. Bacterial pyodermas are usually classified based on the depth of involvement from surface to cellulitis. A surface infection or colonization involves the stratum corneum. In surface pyoderma, bacteria play a relatively small part in the pathogenesis of disease, and attention should be directed at the underlying causes. Surface pyodermas include pyotraumatic dermatitis (acute moist dermatitis, hot spots) and skin fold dermatitis (intertrigo). (White and Ihrke,1987) Clinically, these diseases are characterized with various degrees of alopecia, erythema, erosions, and ulcerations caused by self trauma and pruritus can be intense. Protraumatic Dermatitis: Pyotraumatic dermatitis occurs most frequently in warm months and is seen in long-coated breeds usually distributed over the dorsal lumbosacral area. Flea allergy dermatitis is the most common cause although other allergies, ectoparasites, poor hygiene, otitis externa, anal sac problems and any irritating stimulus can be involved. Skin Fold Pyoderma: Skin fold dermatitis occurs anywhere on the body where loose skin and folds create

60

an anatomic predisposition. The continuous friction, warmth, darkness and moisture encourage bacterial proliferation. Superficial pyoderma is the most common canine bacterial skin disease. The infection involves the epidermis below the stratum corneum and/or extends into the hair follicle. Impetigo, superficial folliculitis and superficial spreading pyoderma are examples of this type of infection. Impetigo is a coagulasepositive staphylococcal disease that is seen in young dogs and is usually located in the groin or inguinal area. Pustules are nonfollicular in orientation, are located just beneath the stratum corneum, and may progress to dry, yellowish crusts. This disease is often self-limiting. Folliculitis:This bacterial infection is located in the hair follicle and does not involve deeper tissue. Papules and pustules will be follicular in orientation with a hair protruding from the center. As a pustule ruptures and matures, it may leave an expanding area of alopecia with a peripheral rim of scale or an epidermal collarette. Any vesicular or pustular lesion can create and epidermal collarette, but the vast majority of these lesions are indicative of a bacterial pyoderma. A deep pyoderma occurs when the infection extends through the epidermis or hair follicle and involves a pyogenic inflammation of the dermis of subcutis. While underlying causes of deep pyoderma often affect the immune system (demodicosis, hypothyroidism, hyperadrenocortism), many of these cases are idiopathic. Hair follicles frequently rupture (furunculosis), causing a foreign body reaction in surrounding tissues. When the infection transects through tissue planes, it is termed a cellulitis. Deep pyodermas include local as well as generalized infections. Recurrent pyoderma is defined as a bacterial infection of the skin that responds entirely to appropriate systemic and/or topical therapy but recurs within a short period of cessation of therapy, usually within a month. Pyodermas may be secondary to conditions that increase the bacterial population on the skin (poor hygiene, seborrhea), to pruritic diseases that break down the skins barrier to bacteria (ectoparasites such as Cheyletiella, Sarcoptes, Pelodera; allergies [flea, food, atopy, contact, intestinal parasite]); or to disease that may compromise immune function (endocrine diseases such as hypothyroidism and hyperadrenocortism, nutritional abnormalities, and metabolic disorders). Pyodermas may also be idiopathic. For the management of bacterial pyoderma , First of all after proper cleaning and shaving of the area, an antimicrobial shampoo containing benzyl peroxide or chlorhexidine or benzal konium chloride may be applied. Use of astringents are indicated where exudation is excessive. For pruritis most common topical antipruritic agent is 1% hydrocortisone. Topical combination of antibiotic agents with glucocorticoids are the most effective and promote quick healing. Most dogs with bacterial infection require systemic antibiotic therapy for a minimum of 14 days which should be continued for 7-10 days beyond clinical cure. The best among these are Cephalexin(20mg/kg bwt.12hrly )amoxicillin clauvulanate (15-20mg/kg bwt.12hrly),and enrofloxacillin (5mg/kg 24hrly).The use of glucorticoids is contraindicated but if need to be used as anti-inflammatory 1mg/kg bwt. for 3 day only should be preferred. Prevalence bacterial dermatitis at Jammu region of J & K state was observed to be 28.43 per cent and the sensitivity pattern of the organism revealed that cephalexin was 100 per cent effective in treatment of bacterial dermatitis due to Staphylococcus spp. followed by ciprofloxacin, gentamicin, lincomycin, penicillin G, amoxicillin, cloxacillin and erythromycin. Ciprofloxacin and gentamicin inhibited the growth in 90.91 and 86.36 per cent cases, respectively.(Sharma et.al.2008) Parasitic Dermatitis: Parasitic mites are members of the order Acarina. They are most important as ectoparasites that cause a variety of dermatoses in domestic animals. Pruritus with self trauma and secondary bacterial infection is the most common clinical presentation. However, in severe cases, a mite infestation may be debilitating and life-threatening.In a study, prevalence of parasitic dermatitis in canine was observed to be 33.33% and has also been reported in leopards (Sharma et.al.2009, Soodan et.al., 2000)The common diseases caused by these mites are canine demodicosis and canine scabies. Canine Demodicosis: Canine demodicosis is an inflammatory, parasitic skin disease caused by follicular mite, Demodex canis. In very small numbers, the Demodex canis mite is a normal inhabitant of

61

the skin of most dogs. The mites reside in hair follicles and occasionally in sebaceous glands and apocrine sweat glands.) The life cycle is between 20 and 35 days and transmission of mites in all dogs occurs by direct contact during the first 72 hours after birth while the pup is nursing from the dam. The disease is manifested in two major clinical forms. The localized form is characterized by one or more discrete, small focal areas of alopecia with varying degrees of scaling, erythema, follicular plugging and hyperpigmentation,. Pruritus and secondary pyoderma are uncommon.(Sarma et.al.,2005 and Soodan et.al., 2005) The lesions are usually confined to the head, neck and forelimbs, although any area of the body may be involved. Generalized demodicosis : Approximately 10 per cent of localized cases of demodicosis may rapidly or gradually progress to generalized disease. There is usually generalized patchy or diffuse alopecia, erthema, edema, seborrhea, crusting, follicular plugging, lichenification, and a secondary pyoderma. The pyoderma may be mild and superficial or severe and deep with furunculosis and cellulitis. Pruritus and a generalized peripheral lymphadenopathy are usually present. Those animals with deep pyoderma may show signs of septicemia and be febrile, anorexic, lethargic, and severely debilitated. Demodicosis is best diagnosed by demonstrating the mites on deep skin scrapings. Hair should be clipped in the area to be scraped and the skin squeezed gently to help extrude the mites from their residence in the hair follicles. A large number of live adult mites or immature forms and eggs are necessary to confirm the diagnosis because on occasional mite may be found on scrapings from normal dogs. In rare situations, a biopsy may be needed to confirm the diagnosis. This may happen when dealing with chronic generalized demodicosis with hyperkeratotic, lichenified scarred skin. Management of localized and generalized demodicosis require different modes of therapy. However, with both forms of the disease, corticosteroids should never be used, and secondary pyoderma must be controlled with topical medications and systemic antibiotics. The dog should be in good general health with an adequate diet, proper immunization, negative fecal examination, negative heartworm status and be receiving heartworm preventive medication. Over 90 per cent of dogs with localized demodicosis will spontaneously cure with disappearance of lesions in 3 to 8 weeks. Canine Scabies: Canine scabies also reffered as sarcoptic mange is a non seasonal ,intense pruritic, highly contagious, transmissible canine dermatosis caused by Sarcoptes scabiei var.canis. This mite is fairly host-specific and spends its entire life cycle of 17 to 21 days on the dog. The mites generally prefer skin with only a small amount of hair, so they can most commonly be found on the elbows, ears, abdomen and hocks. They become more active at higher temperatures, but optimal, survivability was found to occur at 10oC in a laboratory setting. Humidity is more important form survivability and mites usually die within a few days of departing from the host due to dehydration.(Soulsby,2005) Intense pruritus is common clinical presentation for canine scabies and is most likely a result of an allergic hypersensitivity reaction. Clinical lesions consist of alopecia with reddish popular eruptions covered by thick, yellowish crusts. Secondary lesions consisting of bleeding, hemorrhagic crusts and secondary bacterial infection usually follow. The typical distribution pattern includes the ventral abdomen, chest, legs, ears, elbows and hocks. With time, the condition may become generalized. Chronic changes result from connective tissue proliferation with thickening, drying and wrinkling of the skin. Other signs include peripheral lymphadenopathy, emaciation, debilitation and death. For diagnosis, the history of a rapid onset of pruritus, possible exposure, and involvement of other dog and people is highly suggestive of scabies. A definitive diagnosis is often difficult to make because scabies mites are hard to find. Ten or more extensive superficial skin scrapings may be necessary to find a single mite or egg. Even with multiple scrapings, the parasite is found in only 50 per cent of cases, which eventually respond to therapy. A flotation technique may facilitate the examination of large quantities of scraped material. The material is added to a small beaker containing a few milliliters of 10 per cent potassium hydroxide solution. After gentle heating to digest keratin, the mixture is added to a saturated sugar solution and centrifuged. A few drops of the surface solution can then be examined microscopically for mites and eggs. For the management of mite infestation, weekly dipping of Amitraz, a monoamine oxidase inhibitor

62

at 0.025 per cent concentration should be used along with parenteral injections of ivermectin or doramectin (400mg/kg SC at weekly intervals). Oral suuplementation of ivermectin (600 ug/kg) give better results. For better efficacy ,the entire coat should be clipped and all dippings of amitraj should be proceeded by application of benzyl peroxide shampoo for its follicular flushing activity to allow better penetration of miticide.Treatment should be continued 3-4 weeks after negative scrapings. Fungal dermatitis : Also called as dermatophytosis is an infection of keratinized tissue caused by one of the 3 genera of fungi collectively called dermatophytes -Epidermophyton, Microsporum, and Trichphyton. Out of these M. gypseum and .T terrestre are geophilic and cause disease in animals exposedo soil while digging. Contact with a dermatophyte does not always result in infection. Whether infection is established depends on the fungal species and on host factors, including age, immunocompetence, condition of exposed skin surfaces, on host grooming behavior and nutritional status. Infection elicits specific immunity, both humoral and cellular, that confers incomplete and short-lived resistance to subsequent infection or disease.(Kahn et.al. ,2005)) In a study on clinical cases of dermatitis at jammu , overall prevalence of fungal dermatitis was observed to be 11.76 per cent.(Sharma ,2006) Dermatophytes grow only in kertinized tissue and Infection begins in a growing hair or in the stratum corneum, where threadlike hyphae develop from the infective arthrospores or fungal hypal elements. Hyphae can penetrate the hair shaft and weaken it, which, together with follicular inflammation, leads to patchy hair loss. As inflammation and host immunity develop, further spread of infection is inhibited thus, for most healthy adult hosts, dermatophyte infections are self-limiting. The Woods lamp is useful in establishing a tentative diagnosis of dermatophytosis in dogs and cats but cannot be used to rule out this type of infection. Definitive diagnosis is established by DTM culture. Detection of infection is asymptomatic carrier animals is facilitated by brushing the coat with a new toothbrush and then inoculating a culture plate by pressing the bristles to the surface of the medium. Lesions in dogs are classically alopecic, scaly patches with broken hairs. Dogs may also develop regional or generalized folliculitis and furunculosis with papules and pustules. A focal nodular form of dermatophytosis in dogs is the kerion reaction. Generalized ringworm in adult dog is uncommon and is usually accompanied by immunodeficiency, especially endogenous or iatrogenic hyperadrenocorticism. Different diagnoses in dogs for classic ringworm lesions include demodicosis, bacterial folliculitis, and seborrheic dermatitis. Fungal Skin lesions in dogs may be spot treated with topical antifungal creams or lotions(miconazole/ ketokonazone/clotrimazole). Corticosteroids should not be used as anti-inflammatory property of steroid inhibit resolution of infection. (White and Medleau,1995 )Moreover, follicular atrophy,alopecia and thinning of skin could also result with the use of corticosteroids. In our study on management of fungal dermatitis, the dogs treated with ketoconazole (10mg/kg sid PO)showed complete recovery after 21 days and was found to be better than griseofulvin (10 mg/kg sid PO ). References: Beigh,S.A.(2010)Diagnostic and therapeutic studies on canine dermatitis with particular reference to nutritional deficiencies. M.V.Sc. thesis ,SKUAST-J,Jammu. Kahn,C.M.et.al.(2005)The Merck Veterinary Manual,9th ed.Pub. Merck & Co,nc,USA. Parish, L.C. and Schwartzman, R.M. (1993). Zoonoses of dermatological interest. Semin. Dermatol. 12(1): 57-64. Sarma, K., Borthakr, S.K. and Kalita, G. (2005). Incidence of mange mite infestation in dogs A report. Journal of Veterinary Parasitology. 19(2): 147-148. Scott, D.W., Miller, W.H. and Griffin, C.E. (1995). Muller and Kirks Small Animal Dermatology. 5th ed. W. B. Saunders Company. Seena, .B., Kumari, K.N., Singari, N.A. and Sreedevi, B. (2005). Clinico-diagnostic and therapeutic studies in canine pyoderma. Indian Journal of Veterinary Medicine. 25(2): 121-122. Sharma,S.K.(2006) Etiology, hematobiochemical status and therapeutics of skin diseases in canine.M.V.Sc. Thesis submitted to SKUAST-J, Jammu .

63

Sharma, S. K., Soodan, J. S., Raina, B.B., Gupta, S.K. and Yadav, A. (2008) Prevalence of skin infections in canines. Indian J.Vet. Med. 28:137-138 Sharma S. K., Soodan, J.S., Dutta T.K., Raina, B. B. and Tikoo, A.(2008) Occurrence of bacterial dermatitis in canines and their antibiogram. Indian J.Vety.Med. 28 (2):126-127 Sharma, S.K., Soodan, J.S., Bal, M.S., Khajuria, J.K.and Upadhyay,S.R.(2009) Parasitic dermatitis in canines of Jammu region. J.Vet. Parasitol 23 (1) :65-67 Soodan, J.S., Yadav, A. and Khajuria, J.K. (2005). Comparative efficacy of some acaricides against demodicosis in dogs. Intas Polivet. 6(2): 335-337. Soodan, J.S., Sharma, R.K. and Bhadwal, M.S. (2000). Demodicosis in leopard in Manda Wild Life Sanctury, Jammu. Journal of Veterinary Parasitology. 14(2): 177-178. Soulsby, E.J.L. (2005). Helminths, Arthropods and Protozoa of Domesticated Animals. 7thed. Bailliere Tindall. Swain, S.B., Sahoo, N., Ray, S.K., Kar, B.C. and Sardar, K.K., (2002). Identification and antimicrobial sensitivity pattern of bacterial isolates from primary pyoderma in dogs. Indian J. Comp. Microbial Immunol. Infect. Dis. 23(1): 97. Wilkinson, G.T. and Harvey, R.G. (1994). Color atlas of small animal dermatology. 2nded. Mosby-Wolfe, Philadelphia. White-Weithers ,N .and Medleau,L (1995)Evaluation of topical therapies for the treatment of dermatophyte infected hairsfrom dog and cats. J. Am. Anim. Hosp. Assoc. 31: 250. White,SD., IHrke,PJ (1987) Pyoderma.In Nesbitt GH (ed.)Contempory issues in small animal practice: Dermatology, New York pp:95-121

64

Abst 1 : II

Hepatozoon canis infection in a bitch

Agnihotri ,Divya, Jain, V.K., Deepika and Singh,Gyan College of Veterinary Science, Lala Lajpat Rai University of Veterinary and Animal Science, Hisar, Haryana-125 004

Hepatozoonosis is a tick borne protozoan infection of carnivores caused by Hepatozoon canis. It is transmitted by a brown dog tick Rhipicephalus sanguineus. The dogs contract the disease by ingesting the infected tick and not from being bitten by the tick. A six year old cocker spaniel bitch was admitted to the canine section of COVS, LLRUVAS with a history of recurrent and intermittent fever, inappetence, tick infestation and severe joint pain in the limbs since three weeks. The owner was concerned about the reduced appetite and gradual weight loss of the bitch. On clinical examination the bitch appeared dull and was having difficulty to stand and sit. Rectal temperature was 104.8F, mucous membranes were congested and the bitch was hyperaesthetic. The bitch was subjected to the hemogram analysis and peripheral blood smear examination as the history and symptoms were suggestive of some hemoprotozoan infection. The results were indicative of the chronic infection with low haemoglobin, non regenerative anaemia, neutrophillia, hypoalbuminemia, hypoglycaemia and reduced alkaline phosphatase. Serum SGOT and SGPT were also decreased while platelet count was slightly high. Peripheral blood smear examination revealed intraleucocytic gamonts of the parasite Hepatozoon canis. The pet was treated with the single dose of Diaminazine aceturate @ 5mg/kg b.wt. i/m, along with the oral administration of Tab Doxycycline @ 10mg/ Kg b.wt. for two weeks. Intramuscular injection of vetalgin was administered for a period of one week to alleviate acute pain and joint inflammation . Supportive therapy was followed with oral medications of liver extract, vitamin C and B complex and iron preparation for a period of three weeks. The pet started recovering steadily as the temperature subsided on the second day after the administration of diaminazine aceturate. There was a gradual reduction of joint pain which completely subsided after two weeks. Abst 2 : II

Epidemiology and hemato-biochemistry in naturally occurring cases of canine monocytic ehrlichiosis in and around bareilly, india
Behera, S.K. and Dimri, U. Division of Veterinary Medicine, Indian Veterinary Research Institute, Izatnagar-243 122, Uttar Pradesh, India

The purpose of this study was to conduct clinico-molecular epidemiology and hemato- biochemistry in natural cases of canine monocytic ehrlichiosis (CME) in and around Bareilly city. CME is caused by obligatory, intracellular gram-negative bacterium, Ehrlichia canis. The organism is most well-studied, prevalent and pathogenic. A total of 833 dogs suspected for different tick-borne diseases were screened, out of which 70 found positive cytologically in peripheral blood smear and/or buffy coat examination making it an incidence rate of 8.40%. Efficacy of buffy coat and blood smear examination in diagnosing acute form of CME found to be 75.71% (53/70) and 48.57% (34/70) respectively. When comparison was made between different cytological and molecular methods, in diagnosing acute form of CME, sensitivity was highest in favor of nested PCR i.e., 47.42% (21/44) followed by buffy coat 27.27% (12/44) and blood smear examination 20.45% (9/44). Season-wise distribution revealed highest incidence in the months of summer (54.28%) followed by winter (24.28%) and monsoon (21.42%). Out of 70 confirmed positive cases, 52 (74.28%) were pure cases of CME, rest 18 (25.71%) were of mixed infections with Hepatozoon canis, Trypanosoma evansi, Babesia gibsoni, Anaplasma phagocytophilum, B. canis and Leptospira icterohaemorrhagiae. Hematological observations showed a wide range of variation with significant (P<0.01) nadir in the levels of Hb, hematocrit, TEC, monocyte and platelet count in diseased dogs as compared to healthy control. With respect to plasma biochemistry, significantly (P<0.01) decreased values in the form hypoproteinemia, hypoalbuminemia, hypoglobulinemia and significantly (P<0.05) increased levels of BUN and ALT were observed as compared to healthy control. However, ALP and creatinine levels were non-significant when compared to healthy control.

65

Abst 3 : II

A retrospective study of Borrelia burgdorferi antibodies in dogs in minnesota

Aneela Z. Durrani , Sagar M. Goyal* Department of Clinical Medicine and Surgery, University of Veterinary and Animal Sciences, Out fall Road,Lahore, Pakistan.092-42-5324111

To determine the seroprevalence of Borrelia burgdorferi antibodies in suspected dogs in Minnesota, the database of Veterinary Diagnostic Laboratory, University of Minnesota, was searched over a ten year period (2001- June 2010). A total of 1081 serum samples from dogs suspected for borreliosis were submitted by 112 private veterinary clinics. The samples were tested using an indirect fluorescent antibody (IFA) test. Samples with titers of >1:320 were considered positive. The rate of seroprevalence of antibodies was 88%. The increase in rate of yearly seroprevalence of Borrelia burgdorferi antibodies in dogs was comparable with human borelliosis in Minnesota.
*College of Veterinary Medicine, University of Minnesota. USA

Abst 4: II

Canine husbadry in Saudi Arabia: An over review

Bakhsh ,A. Department of Clinical Studies and Department of Pathology ,College of veterinary Medicine and Animal Resources, King Faisal University ,P O Box 55001, Al-Ahsa 31982, Kingdom of Saudi Arabia

Dogs have been provided substantial care in terms of management in Saudi Arabia .Their numbers are estimated around 1000 . Standard vaccines are applied as following : Parvovirus ,Distemper , Infectious Canine Hepatitis ,Kennel cough , Leptospirosis and Rabies . Many diseases have been identified affecting digestive , respiratory , internal parasites , eye affection , metabolic disturbances , toxicities and other affections .In all, canine husbandry in Saudi Arabia is organized and different sectors participate and play full roles according to the specified law to each. Abst 5 : II

Canine monocytic ehrlichiosis, its occurrence and clinico-therapeutic attributes

Kumar Abhishek and Haque S. Ranchi Veterinary College, Kanke, Ranchi. (Jharkhand)

Out of 816 canine cases presented during the study period, a total of 24 (2.94%) were diagnosed as ehrilichiosis on the basis of history and clinical findings. The occurrence of disease was found clustered in two seasons i.e. in June to August (79.2%) and November to January (20.8%). The maximum number (62.5%) of dogs affected were under the age group of 1 to 3 years. Four cases out of 24 revealed characteristic ehrlichia morulae in monocytes in giemsa stained blood smear which accounts 16.67% of total suspected cases. All the 8 cases selected for haematological examination showed reduced TEC and haemoglobin level. There was mild elevation of BUN and creatinine level indicating renal involvement. The level of ALP, ALT and AST was elevated. The hyperglobulinaemia along with hyperprotenaemia was also observed which comes to normalcy after following treatment with Oxytetracycline followed by Doxycycline.

66

Abst 6 : II

Clinical, haemato-biochemical characterization and therapeutic management of canine parvo-viral enteritis

Sharma, S.K., Joshi, Monika1 S.K. Vyas and Singh, Shakti2 College of Veterinary and Animal Science & Livestock Research Station Vallabhnagar, Udaipur, Rajasthan 313 601 India

Parvo-viral enteritis is highly contagious disease of dogs. It is generally seen in pups below six months of age. Clinical cases had been observed by different clinicians in different cities of Rajasthan. The common clinical signs observed were fever, vomiting, severe haemorrhagic and foetid diarrhoea followed by marked dehydration and weakness. The animal become anorectic, dull and depressed. The haematological parameters like mean haemoglobin concentration, mean PCV %, mean total erythrocytes count and mean total leucocytes count were 8.350.67 gm/dl, 36.651.43 %, 4.890.36 10 6 l and 9.10.5 10 3 l, respectively in affected dogs. The values of biochemical parameters like mean serum glucose, mean total serum proteins, mean serum albumin, mean serum globulin and mean A:G ratio were 38.91.34 mg/dl, 4.170.13 gm/dl, 2.990.04 gm/dl, 1.360.07 gm/dl and 2.2 0.09, respectively. The treatment regimen comprising of Ringer lactate solution and 5% Dextrose normal saline @ 10 ml/kg b.wt. i.v. for 3-5 days, antibiotic ceftriaxone @ 20 mg/ kg b.wt. i.m. for 5 days, anti-emetic metacloprimide @ 0.2 mg/kg b.wt. i.m., antacid ranitidine @ 0.5 mg/kg b.wt., haemostatic haemocoagulase 0.5-1 ml i.m. and vitamin B-complex were found effective to treat the animal patients.
1 2

Veterinary Officer, Govt. Veterinary Hospital, Karanpur, Udaipur Veterinary Officer, Govt. Veterinary Polyclinic, Udaipur

Abst 7 : II

Symptomatic bradycardia in dogs its treatment with abis nigra30c

Varshney, J.P.; Chaudhary, P.S., Deshmukh, V.V. and Prajwalita T. Sutaria Shree Surat Panjarapole, Nandini Veterinary Hospital Ghod Dod Road, Surat 395 001 (G.S.)

Ten dogs (Pomeranian 6, Crossbred 3 and Dachshund 1) with the history of sudden weakness and exertion were diagnosed with symptomatic Bradycardia on the basis of clinical signs such as extreme weakness, lethargy, prostration, slow and weak pulse, shortness of breath, anorexia, hypothermia (rectal temperature = 950F in 3 dogs), dehydration; electrocardiogram showing heart rate as = 60 bpm, constant P-R interval (0.06 0.08 seconds) with or without varying R-R interval; and normal cardiac silhouette in chest radiographs. Neither, the dogs were athletic nor having respiratory or gastro-intestinal disorders. It seems that hypothermia, trauma or dehydration might have led to Bradycardia in these dogs. Because of impending risk of cardiac arrest, an emergency therapy with DNS @ 80 100 ml/kg iv (for 3 days) and homeopathic Abis nigra 30 C potency 4 drops QID orally (for 7 days) was initiated trough cardiac monitoring with auscultation daily and electrocardiogram at 0, 4 and 7th day. Heart rate started improving within an hour, attained normalcy (90 to 105) in 4 days and became stable by 7th days. It appears that homeopathic Abis nigra 30 C could be an effective alternative in the management of Canine Bradycardia.

67

Abst 8 : II

Parvo Virus Infection in Dog- A Case Report

Rawat Ashwani Kumar, Asopa Shesh, Rani Sunita, Vyas Indu, and Gupta Anuradha Department of Veterinary Medicine, College of Veterinary and Animal Science, Rajasthan University of Veterinary and Animal Sciences, Bikaner.

A clinical case of Parvo virus infection was brought to Gogagate Clinic, Bikaner. The dog was 1.5 yrs old. Owner reported that it was almost off feed for last 5 days. It was suffering from bloody diarrhoea, bloody vomiting and foul smelling faeces. It was lethargic, dehydrated and was having very high fever. Treatment which was provided is as follows- Antibiotic Monocef (0.5gm) which contains Ceftriaxone was provided intravenously for 5 days. Antibiotic injection Metrozil (100ml) which contains Metronidazole was provided intravenously for 5 days. Besides this; analgesics, antihistaminic, antiemetic, antacids and liver extract were also provided as symptomatic treatment. Injection Ringer Lactate (250ml) and DNS (250ml) also given intravenously. Abst 9 : II

Purulent conjunctivitis in Kitten

Chetan Kumar G K and N. Nagaraju1 Veterinary officer, Veterinary Dispensary, Aroodi, Doddaballapur taluk, Bangalore (RD)

A kitten was presented to Veterinary Dispensary, Aroodi, Doddaballpura taluk, Bangalore rural district with history of discharge of pus from both eyes. On clinical examination body temperature of animal was high (103.1F), mucus membranes were congested and thick secretions was crusted the eyelids. Case was tentatively diagnosed as purulent conjunctivitis. Animal was treated with ampicillin-cloxacillin oral suspension and ciprofloxacin-dexamethsone eye drop for 5 days and the eye was cleansed twice daily with a dilute solution of boric powder. Kitten was recovered uneventfully.
1

Veterinary officer, Veterinary Hospital, Doddaballapur, Bangalore Rural District

Abst 10 : II

Therapeutic management of clinical case of epilepsy in a dog

Sridhar, Rakesh Kumar, V.K.Jain and Yudhbir Singh Department of Veterinary Medicine LLR University of Veterinary and Animal Sciences HISAR-125004 (Haryana)

A Labrador male dog was brought to Pet Animal Section of Teaching Veterinary Clinical Complex (TVCC) with a history of convulsive seizure almost every alternate day since about one year. After 10-15 minutes of the seizure which was characterized by falling on the ground, frothing from mouth, abnormal vocal sounds and struggling, the animal became almost normal. But progressive emaciation was setting in the animal due to mild inappetance. The case was tentatively diagnosed to be of chronic epilepsy on the basis of clinical signs. The animal was treated with phenobarbitone (2.0 mg/kg body weight orally twice daily) and potassium bromide (20mg/kg body weight orally once daily) for 3 months initially. The frequency of seizures was reduced significantly to 1-2 per month after one month of therapy. In the subsequent months no seizures occurred till reports last came in.

68

Abst 11 : II

Studies on the epidemiology, diagnosis and therapeutic mangement of fungal dermatitis in canines of jammu region
R.K.Bhardwaj, Sabhat Gazal, A.K.Taku and M.A.Bhatt Division of Veterinary Clinical Medicine and Jurisprudence F.V.Sc & A.H R.S.Pura, 181102, SKUAST-Jammu (J&K)

A total of 345 cases of skin out of which 124 dogs with circular alopecic lesions, erythema and dandruff were screened to study the epidemiology, diagnosis and therapeutic management of fungal dermatitis in canines presented at university clinic, private clinic from January, 2011- December, 2011. Clinical examination revealed circular alopecia, itching, pityriasis, surface to superficial pyodermic, erythematic lesions on ears, other parts of body. Overall prevalence of fungal dermatitis was 22.31percent. Skin scrapings were collected in 10% KOH for examination and hair with follicle were collected for culture on DTM and SCA media Microscopic examination of skin scraping was found positive for presence of hyphae and condia of fungi in 35 percent cases. On DTM 41.55 percent samples were found positive which were identified as Trichophyton spp., Microsporum spp.and Epidermophyton spp on SCA, whereas 23.37 percent hair samples were found positive for presence of Malassezia pachydermatis. Other kertainophilic fungi isolated were Aphanoascus fulvescens and Nattrassia mangifera. Non dermatophytes/ non kertainophillic fungi isolated were Aspergillus niger, Fusarium sp. ,Curvularia spp., Bipolaris spp., Syncephalastrum spp. and Sepedonium spp. Incidence was higher in male than females. Incidence was higher in young dogs. Concurrent fungal and demodicosis was observed in 23.37 percent dogs. Higher incidence was recorded during July to October. Therapeutic management will be discussed in the presentation. Abst 12 : II

A report of Lead poisoning in two mixed-German shepherd dogs in Babolsar, North of Iran
Small animal veterinary association Department Clinical science,Faculty of Veterinary Medicine ,University of Tehran,Tehran-Iran 3 Faculty of Veterinary Medicine ,University of Tehran,Tehran-Iran
2 1

Ghanbari Kalahrudi Kh.1, Aldavood S.J.2 and Naderi nezhad F.3

In veterinary medicine, lead poisoning is most common in dogs and cattle. Some sources of lead include: paint, linoleum, grease, lead weights, lead shot and etc. absorption of lead is greater in young animals and low dietary calcium may increase absorption. Lead may cross the blood-brain barrier in greater amounts in young animals. Lead has profound effect on sulfhydryl-containing enzymes and tissues rich in mitochondria, which is reflected in the clinical syndrome. The prominent clinical signs are associated with the GI and nervous system. In the summer of 2007, two mixed-German shepherd dogs (ages: 14 & 16 months) which were being held as guard dogs in a creel making factory, were referred to a clinician in Babolsar. Their abnormal signs were: convulsions, unusual behavior such as continuous running and barking, and pressing their heads to walls and other hard surfaces. Taking the history and epidemiological inspections of the factory revealed that the animals were concealing their bone meal (as their bad habit) in to the lead soil which was being collected at the corner of the factory yard. Thus, that is resulted in providing a base for continuous exposure and digestion of lead for them. Consequently, chelation therapy was initiated by use of D-penicillamine (100 mg/kg/day po. For 7 days). Additionally, Diazepam (0.27 mg/kg/day for 3 days) was administered to dogs in order to alleviate their convulsions. Fluid therapy and corticosteroids were also used as supportive treatment. Partially Improvement was seen by 3days and all of the clinical signs were completely suppressed one week later.

69

Abst 13 : II

Oral papilloma and its treatment with azithromycin in dogs

R.K.Bhardwaj, Indu Bushan and Rishi Sharma Division of Veterinary Clinical Medicine and Jurisprudence F.V.Sc & A.H R.S.Pura, 181102, SKUAST-Jammu (J&K)

Oral papillomas are common in dogs. Efficacy of different drugs has been reported for treatment of papilloma. The present study was conducted on three dogs with oral papilloma and its treatment with Aizthromycin. Clinical examination revealed papillomas which appeared as whitish, verrucous, hyperkeratotic papules of different size on lips and buccal mucosa. All the three dogs were initially treated with ivermectin @ 0.2 mg/ kg b.wt S/C for 4-weeks. But no regression in the papilloma was observed. Later on, All the three dogs were treated with Aizthromycin @ 10 mg/kg orally O.D post cibum for 10 days. Azithromycin treatment significantly regressed papillomas by 10-15 days of treatment in all the dogs. No recurrence of papilloma was reported in any one of dog. The present study concludes, azithromycin can be a safe and effective treatment for oral papilloma of dogs. Abst 14 : II

Chocolate poisoning in four Terrier dogs in Tehran

Bitaraf M.* , Aldavood S.J., Alyari A., Ahmadi bozorg M.J. Clinical science, Faculty of Veterinary Medicine ,University of Tehran, Tehran, Iran

Chocolate poisoning occurs most commonly in dogs, although many species are susceptible. Chocolate toxicosis may result in potentially life-threatening cardiac arrhythmias and CNS dysfunction Contributing factors include indiscriminate eating habits and readily available sources of chocolate. Deaths have also been reported in livestock fedcocoa byproducts and in animals consuming mulch from cocoabeanhulls.Chocolate is derived from the roasted seeds of Theobromacacao.The toxic principles in chocolate are the methylxanthinestheobromine & caffein.Although the concentration of theobromine inchocolate is 310 times that of caffeine, both constituents contribute to the clinical syndrome seen in chocolate toxicosis.However,in general, the total methylxanthine concentration of dry cocoa powder is28.5 mg/g unsweetened(baker,s)chocolate is 16 mg/g,semisweetchocolate and sweet dark chocolate is 5.4-5.7 mg/ g, and milk chocolateis 2.3 mg/g.The LD50 of caffeine and theobromine are reportedly 100-200mg/kg, but severe signs and deaths may occur at much lower doses and individual sensitivity to methylxanthines varies. In general, mild signs may be seen in dogs ingesting 20 mg/kg, cardiotoxic effects maybe seen at 40-50 mg/kg, and seizures may occur at doses of 60 mg/kg. The half-lives of theobromine and caffeine in dogs are 17.5 hr and 4.5hr.In the summer of 2007 four (2male & 2 female) Terrier dogs were referred to a private veterinary clinic in Tehran because of their subnormal signs, such as polydipsia, vomiting, diarrhea, abdominaldistention, restlessness, hyperactivity, polyuria, ataxia, tremors, andseizures. In ECG, tachycardia and premature ventricular contractions(pvc) were seen. Diagnosis is based on history of exposure, along withclinical signs that occurred in 8-12 hr of ingestion.Methocarbamol (100mg/kg, slow IV) and diazepam (0.5 mg/kg, slow IV) administered fortremors and/or mild seizures. Arrhythmias treated propranolol (0.05mg/kg).Fluid diuresis used for stabilizing cardiovascular function andhasten urinary excretion of methylxanthines. Partially Improvement was seen by 3days & all of the clinical signs were completely suppressed one week later.

70

Abst 15 : II

Prevalence of hypothyroidism in dogs in hisar, haryana

Gulzar,S., Khurana,R., Agnihotri,D., Aggarwal,A. and Narang,G. Teaching Veterinary Clinical Complex Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar-125004

Dog has been the companion of man since time immemorial and has been termed as best friend of man. Due to this association, man has been ever since trying to reduce the sufferings of this animal. The most common hormonal problem encountered in canines is hypothyroidism. Hypothyroidism is caused due to impaired production and secretion of thyroid hormones from thyroid gland which results in decreased metabolic rate. Thus, the deficiency of thyroid hormones results in lethargy, mental dullness, weight gain and dermatological manifestations. Prevalence of hypothyroidism was studied in adult dogs brought to pet section of Teaching Veterinary Clinical Complex (TVCC), LLRUVAS, Hisar. The study was undertaken from September 2010 to March 2011 i.e. for a period of seven months. A total of 1728 dogs were presented at the pet clinic for various health reasons. These dogs were clinically examined and 325 dogs were diagnosed having one or more skin related problem. Out of these, a total of 43 dogs suspected for hypothyroidism on the basis of clinical signs, lesions, age, and body weight were taken for the study. Four dogs having weight improper to their age were also taken for the study. Similarly, three female dogs having problem like anoestrus and abortion were also included in the study. All the dogs used for the study were of the age group of one year or greater. A blood sample was taken from each dog and serum was used for the estimation of tri-iodothyronine (T3), thyroxine (T4) and thyroid stimulating hormone (TSH). Quantitative measurement of T3, T4 and TSH was done by Electrochemiluminescence Immunoassay (ECLIA) technique using COBAS-E immunoassay analyzer. On the basis of low levels of T3, T4 and higher levels of TSH, a total of six dogs were diagnosed with hypothyroidism. All these six dogs were having T3, T4 levels less than the normal range of 48.00-154.00 ng/dl and 1.50-3.60 g/dl respectively. The level of TSH was found to be greater than the normal range of 0.30-0.60 ng/ml in all these hypothyroid dogs. Abst 16 : II

Management of chronic epiphora in dogs

Kumar, A. and Goel, P.* Veterinary Medicine, College of Veterinary Sciences, Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar-125004

Chronic epiphora is a very common problem reported mostly in miniature long haired breeds of dogs but also seen in medium and large hairy breeds of dogs. Most common causes seen were obstruction of the nasolacrimal duct, dermatitis and anal sacculitis etc. It was observed that in dermatitis and sacculitis, the dogs in order to relieve themselves from itching and irritation, licks and chew the affected area as a result of which the body hairs enters into the eye leading to conjunctivitis and ultimately resulting into epiphora. The study was conducted on 28 dogs of different breeds such as Spitz, Pomeranian, Lhasa Apso, Poodles, German Shepherd and Golden Retrievers showing the brownish staining of hairs alongside the nostrils starting from medial canthus of eyes. The most common organisms isolated from ocular swabs were Staphyloccus aureus and Streptococcus sp., so these dogs were treated with eye-preparations containing dexamethasone, chloramphenicol, gentamicin and gatifloxacin as these antibiotics were found sensitive in all these cases. The owner was advised to apply Vaseline alongside the nostrils so that the hairs do not get brownish colour due to lacrimal secretions and also to flush the eyes with warm saline twice daily to clear the debris, dirt and foreign material if any. All the cases responded well to treatment and were cured in 7-10 days. * Director, National Institute of Animal Welfare (Ministry of Environment & Forest) Delhi-Agra Road, NH-2, Ballabhgarh, Faridabad (Haryana)

71

Abst 17 : II

Herbal management of rickets in pups

Praveen Kumar, Amit Prasad , Niddhi Arora and Tarun Kumar Deptt. of Clinical Medicine, C.V.A.Sc, GBPUA&T, Pantnagar, Uttrakhand, 263145 Dept. of Veterinary Medicine, Ranchi Veterinary College, Kanke, Ranchi, Jharkhand- 834006

A total of 7 pups were treated for rickets. The pups were divided into 2 groups. Group 1 was treated with calcium and phosphorus and vitamin D and group 2 was treated with extract of Moringa oleifera in addition to treatment given to group 1. Fast recovery was observed in group treated with extract of Moringa oliefera suggesting that it is a rich source of calcium and it enhances calcium obsorption as well.

Abst 18 : II

Babesiosis and its therapeutic management in a dog A case report

Ahuja Anil, Varshney J.P1.,Singh Naveen Kumar, Bihani D.K., Gokhalany, Deepika Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Sciences, Bikaner (Rajasthan) 334001

A Labrador dog aged 2 years weighing 22 Kg. with the symptoms of anorexia, vomiting, lethargy, lymphedenomegaly and high temperature was presented to the clinic. Peripheral blood examination revealed presence of Babesia gibsoni. The dog was successfully treated with Diminazeneaceturate(Berenil) and Clindamycin leads to complete recovery within 10 days of start of treatment.
1

Nandini Veterinary Hospital, Surat (Gujrat)

Abst 19 : II

Determination of Electrocardiographic reference ranges in Labrador retriever

M.B. Gugjoo, M. Hoque, M.C. Sharma, A.C. Saxena, M.M.S. Zama and A.M. Pawde Indian Veterinary Research Institute, Izatnagar-243 122, Bareilly (UP)

Electrocardiographic values vary in each dog breed due to differences in the body size and conformation. The present study was conducted in 24 clinically healthy, adult Labrador retriever dogs of both sexes (12 males and 12 females) to determine the electrocardiographic reference ranges and to study the effect of body weight, heart rate and sex on such parameters. Measurements were taken from three Bipolar Standard limb leads (Lead I, Lead II and Lead III) and three Unipolar Augmented limb leads (aVR, aVF and aVL). Amplitude and duration of P wave, QRS complex, T wave and Mean electrical axis were calculated. All the electrocardiographic values were found to be in the range specified for other dog breeds. Amplitude of P wave, Q wave, R wave, S wave and T wave in Limb Lead II were 0.210.009, 0.470.026, 1.950.07, 0.180.017 and 0.330.03 mV, respectively and duration of P wave, PR interval, QRS interval and QT interval were 0.040.00, 0.0990.001, 0.050.001 and 0.210.007 sec, respectively. Although Q wave was deep in Lead I, II and aVF. All the electrocardiographic parameters had non-significant effect on heart rate, gender and body weight.

72

Abst 20 : II

Epidemiological analysis of major dermatological disorders in dogs

Khurana, R., Khatak, N. and Agnihotri D. Teaching Veterinary Clinical Complex Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar-125004

Like other animals, canines are also susceptible to diseases with various etiologies like infectious, nutritional or hormonal. About one third of these constitute dermatological problems worldwide. The epidemiological data of the skin diseases in dogs collected from January 2004 to December 2008 brought at Teaching Veterinary Clinical Complex (TVCC), College of Veterinary Sciences, Lala Lajpat Rai University of Veterinary and Animal Sciences (LLRUVAS), Hisar for a period of five years was analyzed with respect to host, agent and environment determinants like age, sex, breed, month, quarters and year. A total of 2749 cases of dogs were diagnosed suffering from various skin disorders. Sarcoptic mange was diagnosed in 816 (29.7%) dogs, demodectic mange in 177 (6.4%) of dogs and dermatomycosis in 199 (7.2%) dogs. Demodectic mange was recorded highest in German Shepherd breed (49.7%) followed by Spitz (20.9%) and nondescript breeds (11.9%). Spitz (57.5%) and German Shepherd (25.4%) were the most affected breeds with sarcoptic mange. Similarly, dermatomycosis was also seen more in Spitz (28.1%) and German Shepherd (21.6%) breeds followed by Labrador (20.6%) and non-descript breeds (15.6%). All three problems were diagnosed more in males as compared to females. Demodectic mange was most prevalent in July (18.6%) and least in October (4.5%). Sarcoptic mange was maximum in July (12.7%) and minimum in December (5.3%). Similarly, dermatomycosis was observed most in August (17.6%) and least in January (3%). Age-wise, demodectic mange was observed maximum in 1-2 year age group (27.1%) followed by 24 years (19.2%) and 6 months -12 months age group (18.1%). However, less than 6 months age group was most affected age group with sarcoptic mange (24.4%) followed by 2-4 years (22.4%). Dermatomycosis affected all the age groups but was seen maximum in dogs of less than 6 months of age (24.6%). Skin disorder cases which were examined in the five years were categorized into quarters. In 3rd quarter (JulySept.), the prevalence of all three diseases was highest i.e. 37.3%, 30.9% and 44.7% for demodicosis, sarcoptic mange and dermatomycosis, respectively. Abst 21 : II

Case report of canine dermatitis in ri-bhoi district of meghalaya

Puro, K., Sunjukta, R., Dubal, Z.B., Ghatak, S., Shakuntala, I., Laha, R and Sen, A. Animal Health Division, ICAR-RC for NEH Region, Umiam 793103, Meghalaya

A total of 9 cases of canine dermatitis were reported in the Animal Health Division, ICAR at Umiam, Ri-bhoi district of Meghalaya during 2010-2011. All these cases were between 8 months to three years old and include Alsatian (2), Pomeranian (1) and non-descript local breeds (6). Except the local breeds, the other three pet dogs were properly dewormed and vaccinated. As per the complaints of owner, all these dogs were examined properly, which shows signs of alopecia, itching, restlessness, otitis, and scratches behind the ears, neck, and skin. The skin scrappings were collected aseptically as the dogs were suspected of parasitic infestation. These scrapings were boiled with 12% KOH for 5 min and examined under microscope which revealed Sarcoptes scabiei in 3 dogs and Demodex canis in 1 dog. The animals were treated with S/C ivermectin @ 200g/Kg body weight along with multivitamin supplementation (Nutricoat @ 5-10 gm/ day). It was also advised to use Notix shampoo for bath twice a week. The animals usually recovered with a single shot of ivermectin except one case where the second dose has to be given after 15 days for complete recovery. The general awareness about the health of the dog is still to reach the rural mass where timely vaccination and regular deworming along with proper diet and hygiene is necessary to keep the pet dog in good health. There could be a public health significance attached to the disease as most of the Scabies/demodectic mange infection could be transmitted to human. Hence the magnitude of the problem is of high priority especially in villages of Meghalaya.

73

Abst 22 : II

Trypanosomiasis in a bakerwali dog-a case report

R.K.Bhardwaj, Himalini, Ramandeep Singh, Virampal Singh and Manoj Sinsinwar Division of Veterinary Clinical Medicine and Jurisprudence F.V.Sc & A.H R.S.Pura, 181102, SKUAST-Jammu (J&K)

A Bakerwali male dog of 3 years was presented to the university clinic with history of inappetance, generalized weakness lethargy and pyrexia of 106F recorded by field veterinarian and referred to clinic. Clinical examination revealed rectal temperature of 105F, generalized weakness, moderate dehydration, pharyngeal edema and papery white conjunctivae mucous membrane. Blood samples were collected for haemato-biochemical parameters estimation. Blood smears were prepared fixed and Giemsa stained. Hematology revealed Hb-6.5 gm%, PCV-19 % and TEC-5.78 million/cumm, TLC-8570/ cumm and platelets10000/ cumm. Biochemical parameters revealed glucose-52mg/dl, ALT-157U/l, AST-145U/l, ALP-690U/l , BUN-45mg/dl, and creatinine-1.98mg/dl. Blood smear examination revealed heavy parasitemia of Trypanosoma evansi. Dog was treated with Inj. Vetalgin- 3ml I/V followed by Inj. Dextrose (25%)-100ml and Inj.DNS-250ml I/V , Inj. Anistamin-2ml I/M followed by Inj Berenil-RTU @ 5mg/kg b.wt deep I/M 20 minutes after administration of Inj. Anistamin.Supportive treatment included multivitamins injection and Susp. Dexaorange-1tsf orally b.i.d for 15-days. Subsequent examination of blood smear revealed no trypanosomes. Abst 23 : II

Demodicosis in dog: A case report

Chetan Kumar G K Veterinary Dispensary, Aroodi, Doddaballapur taluk, Bangalore (R D)

Demodicosis is a common skin disorder of dogs caused by demodex canis. These are normal habitants of the skin. A two year old Great Dane was presented with history of loss of hairs around the margins of eye and lipfold areas. Deep Skin scrapings were collected from five different areas. On microscopic examination (10X) plenty of demodex mites were observed, case was treated with ivermectin orally @ 500 micrograms/ kg and amitraz dip with benzyl peroxide bath. First negative skin scraping was obtained after 18 days of treatment and treatment was continued for another 30 days to avoid possible reoccurrence.

Abst 24 : II

Cardiogenic pulmonary edema in a dog A case report

Ramesh P.T., Nandini M.K., Malatesh D.S and PoonamVishwakarma Department of Veterinary Medicine, Veterinary College, Hebbal, Bangalore 560024

A three and half year old, male Great Dane was brought with history of anorexia and haemoptysis since 2 days, orthopnea and dullness. The clinical examination revealed high rectal temperature (104.90F), tachycardia and gallop rhythm on auscultation. ECG revealed tall P waves, QRS complex, sagging of ST segment and thoracic radiograph revealed generalized cardiomegaly with prominent pulmonary vessels suggestive of cardiogenic pulmonary edema. The dog was treated with Frusemide @ the dose of 4mg/kg im once followed by Lasilactone @ 2mg/kg po for 5 days and Digoxin @ 0.005mg/kg po. Ultimately the dog died after 4 days of treatment.

74

Abst 25 : II

A rare case of Malassezia pachydermatis stomatitis in a spitz dog

R.K.Bhardwaj, Sabhat Gazal, A.K.Taku and M.A.Bhatt Division of Veterinary Clinical Medicine and Jurisprudence F.V.Sc & A.H R.S.Pura, 181102, SKUAST-Jammu (J&K)

A four years male dog was presented in university clinic with the history of salivation, halitosis and normal feed intake. Animal had been undergoing various treatments of stomatitis for last six months,however, problem was continuing. Oral swabs were collected for fungal culture. Swab sample was inoculated on Sabourauds Chloramphenicol agar (in duplicate) and incubated at 37oC and 25oC. After 4 days of aerobic incubation, cream colored/off white convex colonies of approx. 2-3mm diameter were obtained in pure culture. The yeast colonies were obtained both at 37oC and 25oC thus ruling out the presence of any dimorphic fungus.Grams staining (and staining with Methylene blue) of the yeast revealed bottle shaped budding yeasts with budding from broad end, confirming Malassezia sp. As only one species of Malassezia viz. M. pachydermatis can grow in Sabourauds Chloramphenicol Agar, thus the species was identified as M. pachydermatis. Animal was treated with Ketoconazole @ 5-10 mg/kg b.wt orally b.i.d for 15 days with supportive vitamin C and Multivitamins. Animal showed remarkable recovery on 15th day of treatment however treatment was continued for one month resulted in complete recovery. Abst 26 : II

Trypanosomosis in a dog A case report

Priyanka , Choudhary D., Kumar S. and Vyas S.K. Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS Bikaner

A mix breed male dog aged 11 years brought to clinic with history of debility and dyspepsia. Animal had a temperature 103 F. blood smear was positive for Trypanosome evansi. Brady arrhythmia and variations in R-R interval were the important observation in electrocardiography. Hemoglobin was 10 mg% Blood urea nitrogen was 298.56 mg/dl, serum creatinine was 6.9 mg/dl, and blood sugar was 55.6 mg/dl. That dog treated with Avil IM (Pheniramine maleate-20mg), Nilberry IM (diminazeneaceturate @ 8mg/kg body weight), divided into equal doses given at one hour interval), ringers lactate (@ 20 ml/kg body weight I/V slowly for 3 days.). Health of the dog improved in 5 days and after 5 days there were no Trypanosoma evansi infection found in blood smear. Abst 27 : II

Snake bite in a dog - A case report

Bihani, D.K., Gahlot, A.K.1, Ahuja, A. and Tanwar, R.K.2 Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS Bikaner

A three year old Labrador with the history of being bitten by a snake was reported to the clinic of Veterinary College, Bikaner. It had vomiting, twitching of muscles, salivation, panting, dilated pupil and blood in urine. However the site of bite could not be located except that left hind limb appeared swollen above the knee joint. The values of Hb, PCV reduced significantly. However there was delayed blood clotting time. The biochemical values showed an increase in alanine aminotransferase and creatinine. This dog was treated with reconstituted polyvalent anti snake venom 10 ml slow I/V, injection Dexamethasone 1mg/kg b.wt.I/ M,injection Botropase 1ml I/M and injectionAmoxirum forte300 mg I/M b.i.d. on first day. Injection Dexamethasone, injection Botropase and injection Amoxirum forte were repeated in the above mentioned doses and schedule for two more days. The treated dog recovered fully on forth day. 1 Vice-chancellor RAJUVAS, Bikaner 2 Dept. of Vet. Prev. Medicine

75

Abst 28 : II

Comparative evaluation of therapeutic efficacy of different drug combinations in clinical cases of pyoderma in dogs
Anju Bala, Anshu Sharma, V. K. Jain, Rakesh Kumar, Sridhar, N. K. Rakha, Rajesh Khurana, Divya Agnihotry, Neelesh Sindhu and Sushma Yadav Department of Veterinary Medicine, LLRUVAS, Hisar 125 004 (Haryana)

The present investigation was carried out on 45 clinical cases of pyoderma in dogs. Staphylococci with predominance of Staphylococcus intermedius was the most common bacteria isolated from pyoderma. Azithromycin and cephalexin (po) were tested for their efficacy either alone and also each in combination with topical application of diluted mother tincture(m.t.) of calendula or diluted m.t. of cynadon, or ointment consisting of ofloxacin, miconazole and clobetasol propionate. Azithromycin administered po in combination with topical application of diluted m.t. of calendula took an average of 10.60 days to treat the clinical cases of pyoderma, 11. 40 (average) days in combination with topical application of diluted m.t.of cynadon, 13. 40 (average) days in combination with topical application of (ofloxacin, miconazole and clobetasol propionate) ointment and 14.60 (average) days when used alone to treat the clinical cases of pyoderma. On the other hand, among cephalexin group, cephalexin when used in combination with topical application of diluted m.t.of cynadon took an average of 12.63 days, 18.00 (average) days in combination with topical application of diluted m.t.of calendula, 18.33 (average) days in combination with (ofloxacin, miconazole and clobetasol propionate) ointment and cephalexin alone took 19.00 (average) days to treat the clinical cases of pyoderma. Thus in the present study Azithromycin po used in combination with diluted mother tincture of calendula (applied topically) took the minimum time period for cure of pyoderma. Abst 29 : II

Epidemiological and Haematological Studies on Dogs suffering from Pyoderma

Anju Bala, Anshu Sharma, V. K. Jain, Rakesh Kumar, Sridhar, N. K. Rakha, Rajesh Khurana, DivyaAgnihotry, NeeleshSindhu and SushmaYadav Department of Veterinary Medicine, LLRUVAS, Hisar 125 004 (Haryana)

Skin conditions are among the most frequent problems in companion animal practice and may account for more than 20 percent of patients seen at Veterinary clinics. Pyoderma is a commonly encountered problem in small animal practice and can often cause frustration for the owner and the clinician. The present investigation was carried out on 45 clinical cases of pyoderma in dogs examined during the study period, which were further categorized into 37 cases of primary pyoderma and 8 cases of secondary pyoderma viz. sarcoptic mange (2 cases) demodectic mange (3 cases) and allergic dermatitis (3cases). Cases of pyoderma were encountered more frequently in males than females. Cases of pyoderma were encountered more frequently in younger dogs and pups in comparison to older dogs. Cases of pyoderma were reported maximum in Labrador retriever breed followed by Spitz and least in Rottweiler, Dachshund, Dalmatian, Doberman, Neapolitan mastiff and Pug breeds.The maximum numbers of clinical cases of pyoderma were of surface pyoderma (44.44%) followed by superficial (33.33%) and deep ( 22.22%) pyoderma. Lesions of pyoderma in general, were reported more frequently on abdomen and back and least on lips and groin. There was no significant difference in haemoglobin values in all the three types of pyoderma. However, there was significant leukocytosis in surface and deep pyoderma in comparison to healthy controls. There was significant neutrophilia and lypmphopenia in all the three types of pyoderma.

76

Abst 30 : II

Treatment of concomitant infection of CME and Piroplasmosis in Boxer dog: Case report
Deepak Verma1 and PK Prusty2

A four year old male boxer dog was presented during monsoon season in north eastern India with a history of anorexia, occasional epistaxis, oedema of hind legs and scrotum, lameness and stiffness of hind legs and arched back. Clinical examination revealed high rise of temperature (1040F), pale conjunctiva and tachycardia. The dog was suspected for canine ehrlichiosis as history was suggestive of tick infestation. However, after examining Geimsas stained smear of peripheral blood from ear vein indicated Babesia spp. merozoites in the erythrocytes and Geimsas stained lymphocytes in buffy coat smear detected with Ehrlichia spp. morulae, hence concluding mixed infection. Further, haematological picture revealed decreased haemoglobin with mild normochromic, normocytic, non regenerative anaemia with thrombocytopenia and slight increase of neutrophills. Biochemical tests were indicative of reverse A: G ratio with hypoalbuminemia and hyperglobinemia and alarming increase in alanine amino transferases (ALT). Oral administration of DEM (Doxycycline @ 10 mg/kg body wt, enrofloxacin @ 2 mg/kg body wt and metronidazole @10 mg/kg body wt at 12 hourly intervals) for 6 weeks along with two deep intramuscular injection of diminazine aceturate @ 3 mg/kg body wt at weekly interval has successfully treated the animal. Parentral antipyretic, Vit K, haematinics and oral rehydration fluid were also given as part of the supportive therapy.The peripheral blood and buffy coat examination after 6 weeks of therapy showed blood cells returning to normal with no parasite visible. The treatment regime of oral DEM along with parentral diminazine aceturate for six weeks is successful in treating uncomplicated concomitant infection of Ehrlichia and Babesia in dog. 1 .V. O., 390 Coy ASC (Sup) Type B C/O 56 APO 2 . Dir RVS, HQ SW Comd, Jaipur Abst 31 : II

Demodicosis and its therapeutic management in a dog - A case report

Ahuja Anil, Singh Naveen Kumar, Bihani D.K. and Gokhlany, Deepika Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Sciences, RAJUVAS, Bikaner (Rajasthan) 334001

A Pug dog aged 6 months weighing 5 Kg. with the symptoms of anorexia, excessive itching, hair loss, redness of skin on face and ventral aspects of neck was presented to the clinic. Skin scraping revealed presence of Demodex canis. The dog was treated with Ivermectin, benzoyl Peroxide and Amitraz with complete clinical recovery within 15 days of start of treatment. Abst 32 : II

Chronic renal failure in a dog - A case report

DeepikaGokhlany,Naveen Kumar Singh,Akash Maheshwari and Anil Ahuja Department of Clinical Veterinary Medicine College of Veterinary and Animal Science,RAJUVAS, Bikaner(Rajasthan)-334001

A Spitz dog aged 10 years with symptoms of epilepsy and anorexia was presented to the clinic. The dog was anaemic and serum level of blood urea nitrogen and creatinine were very high. The dog was treated for chronic renal failure with the drugs - cefotaxime, calcium gluconate, frusemide, nurokind plus vet. After 5 days of treatment the condition of dog was improved.

77

Abst 33 : II

Haemato- Biochemical Studies in Canine Hemorrhagic gastroenteritis - A Case Report

Deepika Gokhlany, D.K. Bhiani, A.P. Singh and Urmila Pannu1 Department of Clinical Veterinary Medicine College of Veterinary and Animal Science, RAJUVAS, Bikaner (Rajasthan)-334001

The present study was conducted on 10 dogs suffering with gastroenteritis brought to the veterinary college clinic, Bikaner. The mean value of Hb,PCV and TEC decreased significantly and were 8.18 +0.249, 26.9+1.049 and 4.94+0.255 as compared to normal value. Similarly the mean value of Na.K ,blood glucose ,Ca and P decreased significantly when compared to normal value and were 105.27+2.45, 2.55+0.103, 55.81+0.872, 7.318+0.327, 3.066+0.1665 respectively. The mean value of AST and BUN increased and were 72.02+2.20 and 29.25+1.30 as compared to normal value.
1

Department of Animal Breeding And Genetics

Abst 34 : II

Baesiosis in a dog- A case report

A. Maheshwari, A.P. Singh, Deepika Gokhlany and Sandhya Morwal Department of Clinical Veterinary Medicine, E & J College of Veterinary and Animal Science, RAJUVAS, Bikaner 334001

A three year old Labrador dog was brought to Medicine outdoor of College of Veterinary and Animal Science, Bikaner, with a history of debility, dog reluctance to walk, taking only water, otherwise complete off feed since last three days with urine dark in colour. On examination the temperature was 104F, there was pallor mucous membrane. Blood examination revealed haemoglobin 8.8 g%, PCV 27%, TEC 5.1 millions/ cumm, TLC 8.4 th/cumm. Examination of blood smears revealed presence of Babesia organisms within the red blood cells paired piriform bodies. The dog was treated with Injection Berenil RTU 2 ml i/m for 2 days, Injection Triboost 2 ml i/m for 5 days, Injection Oxytetracycline 5 ml i/v, slowly for 3 days, Injection ParagIn (Inj of Analgin 150 mg and Paracetamol 150 mg) 1.5 ml i/m administered only once on the first day. The dog had dramatic recovery. Temperature subsided on first day itself, colour of urine changed to normal within 2 days. Blood smear taken from the dog, one week after treatment revealed no babesial organism. Abst 35 : II

Canine babesiosis- A case report

Priyanka, Ahuja Anil,Dhuria Deepika, Naveen Kumar and Bihani D.K. Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001

A Labrador female dog brought to clinic of medicine department. It was having heavy tick infestation. Blood smear was positive for babesiosis. Her haemoglobin, WBC count, platelet count,PCV, TRBC,blood urea nitrogen, serum creatinine, SGOT, SGPT were 2.10%, 5200/ml, 1.80lac/ml, 6.2%, 0.95million/ml, 158.8mgm%, 3.67mgm%, 31.2U/L, 55.8U/L respectively, in electrocardiography low voltage complexes were main finding. That bitch treated with Avil IM (Pheniramine maleate @ 20mg), Nilberry IM (diminazene aceturate @ 8mg/kg body weight), divided into equal doses given at one hour interval), ringers lactate (@20 ml/kg body weight I/V slowly), lasix (frusemide@4mg/kg body weight). Blood transfusion also performed in the bitch. But after 5 days bitch collapsed.

78

Abst 36 : II

Haematological and therapeutic studies on canine distemper infected dogs

Saini, D.K., Kumar, S., Bihani, D.K., Khinchi, R.K. Department of Clinical Veterinary Medicine College of Veterinary and Animal Science, RAJUVAS, Bikaner (Rajasthan)-334001

A total of 5 dogs (6 month of age, irrespective of sex) infected with Canine Distemper (diagnosed on the basis of history, clinical signs and Rapigen Canine Distemper Ag test kits) were included for the present study, brought to the Medicine Clinic,CVAS,Bikaner. Five apparently healthy dogs of same age group were kept as control.Haematological parameters included haemoglobin, total erythrocyte count, packed cell volume and total leucocyte count estimated on first and fifth day of treatment.Canine Distemper infected dogs on first day had significantly higher values of haemoglobin, total erythrocyte count, packed cell volume and total leucocyte count as compared to healthy control. These values decreasesingnificantly on fifth day of treatment in these cases and appeared almost near to healthy control. All the positive cases are treated with injection Ceftriaxone and Tazobactum (Intaceftazo) @ 25mg/kg b.wt. I/V, injection Metoclopromide (Perinorm) @0.4mg/kg b.wt.I/M, injection Ranitidine (Rantac) @ 2.2 mg/kg b.wt. I/V,injection 5% DNS @25ml mg/kg b.wt. I/V, injectionRingers lactate 50ml/kg b.wt. I/V,injection Ascorbic acid 500mg/dog I/V, injection Isopredone acetate (Isoflud) @ 2mg/dogI/V and GriptolN (Levofloxacin and Ornidazole) @ 1ml/5 kg b.wt. orally. All the canine distemper affected dogs recovered clinically on fifth day. Abst 37 : II

Canine parvo virus infection in a dog - A case report

Priyanka, Ahuja Anil, Meena D.S. and Singh R.K. Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS Bikaner

A pug aged 3 month of 2 kg brought to clinic ,suffering with hemorrhagic gastroenteritis. Positive haemagglutination test confirmed parvo virus infection. In electrocardiography there is sinus tachycardia and right ventricular enlargement were main findings. Pup was treated with Intacef (Ceftrioxon@ 20mg/kg body I/V weight), Rantac (Ranitidine@0.5 mg/kg body weight), Perinorm (Metaclopromide@ 0.4mg/kg body weight) 5% DNS and ringers lactate (20 ml/kg body weight I/V),Ascorbic acid @ 500 mg ,Botropause @1ml. after 5 days health of the dog improved. Abst 38 : II

Amitraz poisoning in canine-a case report

Surender Kumar, D. Singh, D.K.Saini, D.K.Bihani, A.Chahar Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001, Rajasthan

A two year old spitz with the history of an accidental oral consumption of amitraz (Ridd 12.5 per cent) reported to the clinic of Veterinary College, Bikaner. It had discomfort with little crying, ataxia, mild salivation, bradycardia, coldness of extrimities. This dog was treated with injection 250ml 5% DNS I/V, injection Isopredone acetate (Isoflud) 2mg I/V, injection adrenaline (1:1000) 0.5ml S/C, injection Tribivet (Thiamine hydrochloride 50mg, pyridoxine 50mg and cyanocobalamin 500mcg/ml) 2ml I/M. The treatment was given for 3 days. On the second day the dog had diarrhoea for which suspension Griptol-N (Levofloxacin and Ornidazole) @ tsf b.i.d. was given orally for 3 days. On third day dog recovered from ataxia but was anorectic for which syrup Liv-52 Vet 1 tsf b.i.d. was given for 2 days. On fifth day dog became clinically active and started usual feeding.

79

Abst 39 : II

Drug induced hepatitis in a spitz dog

Gopal Krishan, Asmita Narang, Niddhi Arora, Tarun Kumar and Hemant Mehra Veterinary Medicine, College of Veterinary and Animal Sciences G.B.Pant University of Agriculture and Technology, Pantnagar-263145, U.S.Nagar, Uttarakhand

A three and a half years old male spitz dog was brought to Veterinary Teaching Hospital with the history of inappetence, slight respiratory distress and pain on touching of the abdominal area. Animal was treated previously with penicillin G, ranitidine, paracetamol and albendazole over a period of one month. On clinical examination it was found that rectal temperature was 1040F, pulse rate was 92/min. On abdominal palpation, pain evinced and slight liver involvement was observed. No abnormal sounds were heard on auscultation of lungs and heart. Haematological examination revealed, 15 gm/dL Hb, 13,200 cells/cumm TLC, 73% neutrophils, 24% lymphocytes and 3% eosinophils. Biochemical analysis revealed significant increased levels of ALT-577 IU/L, AST-102 IU/L, serum lipase-657 IU/L and serum ALP-2730 IU/L. The other parameters like BUN, serum creatinine and serum amylase were within normal range. Blood smear examination did not reveal any haemoprotozoan. With the above findings it was concluded that it was a case of hepatitis due to a long therapy of paracetamol and albendazole. The treatment regimen included amoxicillin and sulbactam (for 3 days twice daily), pheniramine maleate(for 3 days once daily), lactobacilli and hepatic protectants(for 2 weeks twice daily). Animal responded well with therapy. Abst 40 : II

Successful management of cystitis in a bitch

Pramila Umrao,Vivek kumar saroz, Pratima Singh and Mukesh Srivastava Department of Veterinary Medicine and Department of Veterinary Pathology DUVASU, Mathura (UP)

A two year old Doberman non-pregnant bitch weighing about 25 kg was presented to Teaching Veterinary Clinical Complex of DUVASU, Mathura with the complaint of pollakuria, taking more time in urinating, remain in urinating posture even after cessation of urination, red colour of urine and restlessness during urination. As per owner the bitch came in heat two month back and after heat period above mentioned problem started and treated with enrofloxacin, botropase along with supportive therapy but bitch not responded for the treatment. The bitch was regularly dewormed and vaccinated. Clinical examination was unremarkable regarding vital parameters, hydration. Vaginal examination revealed absence of any growth. Ultrasonography revealed slight thickening of bladder. Hematological examination was unremarkable except leucocytosis (18.25 x103). Urinalysis showed high leucocytes (++++), protein (+++), RBCs (+), pH (7.5), Specific gravity (1.030), absence of glucose and ketones. Microscopic examination of urine showed crystals of struvite. On the basis of clinical and laboratory investigation case was diagnosed for cystitis and early stage of struvite urolithiasis. Treatment was started with antibiotic amoxicillin and clavulonic acid @ 25 mg/kg. b.d, tab. Neeri 1 tab b.d., Inj. of Vitamin A, E, D (VitaceptR) 0.5 ml twice weekly, Inj. of Ethymslate 1 ml I/M b.d, Tab. Celin 500 mg tab o.d. along with fluid therapy. After 10 days of treatment appreciable improvement was seen in relation to symptoms of cystitis, but the treatment was extended for one week to avoid the chances of recurrence. After the period of therapy bitch again underwent hematological and urinalysis and discharge on the basis of normal findings with the advice to bring back after one month for follow up to observe and recurrence.

80

Abst 41 : II

Therapeutic management of demodectic mange in dogs

Choudhary Sheela and Singh Ajay Post Graduate Institute & Research Centre for Livestock Health and Production (Rajasthan University of Veterinary & Animal Sciences) B-2 Bypass, Shipra Path, Agarwal Farm, Mansarover, Jaipur, Rajashan, INDIA

Generalised demodicosis is the single most important, persistent and resistant canine skin disease. Eight dogs with a history of itching and alopecia were used for the study. The dogs were selected irrespective of age, breed and sex. Clinical examination showed normal temperature, moderately higher heart rate and pale conjunctiva. Skin examination revealed severe crusting, scaling and large areas of alopecia along with erythema. Hair were brittle in appearance. Haematology of the cases exhibited anaemia, eosinophelia and relative lymphopenia. Laboratory examination of the skin scrapping indicated the presence of Demodex mites. The important histopathological findings of skin biopsy in generalised demodicosis were folliculitis, perifolliculitis, focal acanthosis and marked dilation of hair follicles. Ivermectin injection @ 0.3 mg/kg body weight was given at weekly intervals. Benzoyl peroxide shampoo 2.5 per cent and amitraz 12.5 per cent solution @ 4ml/lit were also applied on the entire body at weekly intervals. This regimen was continued until the dogs were clinically normal and multiple skin scrapings were negative for mites at two weeks intervals. Antibiotic course was given to five dogs to treat secondary pyoderma. Abst 42 : II

Organophosphorus compound poisoning in dog - A case report

Prajapati R. S., Prajapati Madhu and Murdia C.K. Veterinary Hospital Jhabua-457770, Madhya-Pradesh

The Organophosphates comprise large and diverse group of chemicals with insecticidal, acaricidal and helminthicidal Properties. Two Labrador dogs aged around 8 months were presented to Veterinary Hospital, Jhabua, Madhya Pradesh with signs of severe shivering, in co-ordination, recumbancy and not taking food and water. Upon clinical examination the temperature, heart rate and respiration rate were within in normal range. History revealed that the owner has sprayed chlorpyrifos which is an organophos-phorous compound for the plants in his garden where the dogs were left free. Blood sample was collected sent for lab for routine haematological and biochemical parameter like TLC, Hb, DC, SGPT, Creatinine and BUN. Based on the history and clinical sings it was diagnosed as Organophosphorus compound poisoning and treatment was started with immediately atropine sulphate was injected intravenously@0.2mg/kg b.wt followed by 2PAM (pralidoxime) @30 mg/kg b.wt slow i/v along with 500 ml of 5% dextrose i/v twice daily. The blood parameters were within the normal range. The dogs improved on the second day of treatment and were able to walk, take food and water normally without any sings of poisoning. Abst 43 : II

Hypothyroidism in a dog - A case report

Singh Naveen Kumar, Ahuja Anil, Deepika Goklaney ,Kachhawa J.P. Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Sciences, RAJUVAS, Bikaner (Rajasthan) 334001

A Non descriptive male dog aged 6 years weighing 18 Kg. with the symptoms of lethargy, fatigue, obesity, dry, sparse hair coat with symmetrical hair loss and rat tailed appearance was presented to the clinic. The diagnosis of case was done by clinical examination as hypothyroidism. The animal was successfully treated with Thyroxine (Tab. Eltroxin) and shampoo Micodin (Miconazole + Chlorhexidine).

81

Abst 44 : II

Efficacy of Radiofrequency Heat Therapy in treatment of Human and Canine cutaneous leishmaniasis
Neha Prasad, R A Bumb and Ahuja Anil1 Department of Dermatology, S P Medical College, Bikaner, Rajasthan.

Cutaneous leishmaniasis (CL) is a vector borne zoonotic disease caused by various species of Leishmania. In India, CL is endemic in The Thar desert of Rajasthan, particularly in Bikaner, causative organism being L. tropica.. There is no host specificity with leishmania species, humans and animals can be infected. Infected dogs also serve as parasite reservoirs and contribute to human transmission of CL. Human and canine cutaneous leishmaniasis become a significant health problem. Effective control of leishmaniasis requires treatment of both humans and animals in this endemic areas. Use of antimonial are limited due to its toxicity, extended systemic administration and increased emergence of drug-resistant organisms, there is a strong need of new treatment regimen which is safe, painless and effective in inducing long-term cure, easier to administer in the field conditions and without side effects. Excellent results have been shown in the past with radiofrequency heat therapy (RFHT) in few human studies. We conducted trials of radio-frequency induced heat (RFH) therapy to treat CL in humans and dogs. One hundred fresh untreated, microscopically confirmed patients with 155 lesions of Human CL were included in the one study. Patients below 5 years of age, pregnant, lactating females and patients associated with systemic illness were excluded. Alternate patients were included in Group A and B (50 patients in each) with 81 and 74 lesions respectively. Group A patients were treated with RFHT by heat therapy machine (Thermomed Inc 1.8) at 50C for 30 seconds under local anaesthesia with 2% lignocaine and group B with twice weekly seven intralesional SSG (50mg/cm2, Albert David). Clinical cure and side effects were evaluated at 6th, 8th, 10th 12th, 16th, 20th and 24th weeks. Statistical analyses of complete cure rates at different periods in both groups were assessed by chi-square test. In a another veterinary study, two pet dogs with multiple ulcerative mucocutaneous lesions on snout were treated with RFHT by same method as applied in humans. In study of Human CL, cure rate of lesions at 6th , 8th, 10th , 12th ,16th , 20th and 24th weeks were 24%, 42%, 50%, 82% , 92%, 96% and 96% in group A and 30%, 44%, 56%, 76%, 88%, 92% and 92% in group B respectively (p >0.05). The resolution of lesions was associated with fine scarring and post-inflammatory hyperpigmentation, which was more in Group B than in Group A. There was no recurrence up to two years follow up. In the study of Canine CL both dogs showed partial lesional healing by day 25 post-treatment. By day 45, both animals completely resolved their lesions with minimal or no scarring. They have remained disease-free for the last 12 months with no evidence of recurrence. 1 Dept. of Clin. Vet. Med., CVAS, Bikaner Abst 45 : II

Gingivitis in a spitz dog - a case report

N. K. Mudgal, A. P. Singh, Anil Ahuja, D. K. Choudhary and J. Kachhawa Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, Bikaner

A 6 year old female Spitz dog weighing 9.5 kg was brought to Veterinary Medicine Clinic of College of Veterinary and Animal Science, Bikaner with complaint of foul odour coming from mouth. On examination, gums were hyperaemic and inflammed, tar was present on teeth. Temperature of dog was 102F. The patient was prescribed inj Intacef 250 mg i/m b.i.d. inj Prednisolone 20 mg i/m and inj. Tribivet 1 ml i/m, Flagyl 2 TSF orally b.i.d. The owner was advised to give mouth wash with 1% solution of hydrogen peroxide. The treatment was administered for 5 days and the dog recovered completely.

82

Abst 46 : II

Clinical studies on canine parvovirus (cpv) infection in dogs

Bargujar, J., Ahuja, Anil, Bihani, D.K., Soni, S.S.1, Kataria, N2., Sharma, S.K. and Rathore, Bhavana3 Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary & Animal Science, RAJUVAS, Bikaner, Rajasthan, India.

This study was conducted to find out canine parvovirus infection in dogs in early stage by using BIOCBD canine parvovirus Ag test kit at Medicine clinic of college of veterinary and animal science, Bikaner. The overall prevalence of canine parvovirus was recorded as 30.00%. Out of 60 dogs examined, 18 dogs were suffering from canine parvovirus. CPV infection was also observed in vaccinated dogs (four dogs out of 18 dogs, 22.22%). The highest incidence (50%)was found in pups upto six months age. Rottweiler was found to be most commonly affected breed of dogs with incidence of 27.7%, followed by German Shepherd (22.2%), Dobermann (16.6%), Greatdane (11.1%), Labrador (11.1%), Spitz (5.5%) and Mongrel (5.5%). Mortality rate observed in canine parvovirus was 27.77%. The clinico-physiological parameters (Temperature, Pulse rate and Respiration rate) showed significant increase on 1st day of treatment and were with in normal physiological limits on 5th day of treatment. Haematological parameters viz Hb, PCV, TLC and TEC showed significant decrease before treatment with increase up to control values had been seen after treatment. A significant decrease in neutrophils was observed on 1st day of treatment, which increased and decreased in group-I and group-II, respectively on 5th day of treatment. A significant increase in eosinophils and monocytes were observed on 1st day of treatment which decreased on 5th day of treatment. Lymphocyte were non significantly variable. Blood biochemistry revealed increase in serum catalase, super oxide dismutase, sodium, potassium, calcium, phosphorus, aspartate amino transferase, alanine amino transferase, alkaline phosphatase, total protein and serum creatinine of both groups than healthy control group on 1st day of treatment. There was non significantly variation in value of serum urea of both groups than healthy control group on 1st and 5th day of treatment. Electrocardiographic study revealed significant decrease value of R-amplitude and non significantly variation in value of P-duration, P-R interval, QRS complex, Q-T interval and P- amplitude of both groups than healthy control group on 1st and 5th day of treatment. The present study recommend clinical management of dogs affected with CPV infection with ceftriaxone, metaclopromide, ranitidine, Haemocoagulase enzyme, DNS 5%, Ringers lactate, combination of levofloxacin and ornidazole, and ascorbic acid as per symptoms. 1 Deptt. of Veterinary Microbiology and Biotechnology, 2 Deptt. of Veterinary Physiology, 3 Deptt. of Veterinary Parasitology Abst 47 : II

Lymphosarcoma in a dog
R.K. Tanwar, S.N. Mishra, Fakhruddin and Anju Chahar College of Veterinary and Animal Science, RAJUVAS, Bikaner

Lymphosarcoma was diagnosed in a 7 years old male Fox Terrier. The dog had generalized enlargement of multiple lymph nodes on both sides of the body. The dog was dull, depressed and partially off feed. The hemoglobin and platelets count were significantly low where as total leucocytes count were significantly high, Aspirate from enlarged lymph node revealed a monomorphic population of large immature lymphocytes with small to moderate amounts of blue cytoplasm and a large nucleus with fine chromatin and prominent nucleoli. Cytologic evaluation of a aspirate is a commonly used and valuable method for diagnosing canine lymphosarcoma.

83

Abst 48 : II

Otitis media in canines

J.P. Kachhawa, A.P. Singh, Dinesh Choudhary, N.K. Singh, N. K. Mudgal and R.K. Dedar Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001, Rajasthan

Three cases were presented to the Medicine clinic of College of Veterinary and Animal Science, Bikaner, and diagnosed as Otitis media in two Germen shepherd (both male were of 3 year age), dogs and Otitis externa in Spitz female dog (age 2 yrs). The samples were taken for culture and sensitivity and revealed the presence of Staphylococcus and Enterobactor each in both of the German Shepard dog and Staphylococcus in Spitzs. The sensitivity pattern recorded was Gentamicin +++, Ciprofloxacine ++, Amikacin ++, Tetracycline ++, Trimethoprim +++, Clindamicine +++. The dogs were treated with Gentamicin. The sensitivity was observed in all the three cases for Gentamicin. All the three dogs were treated by using injection Gentamicin @ 4 mg/kg body weight i/m bid, inj. Ploxcin 3 mg/kg body wt. i/m, along with injection Prednisolone @ 1.1 mg/kg body weight i/m and Pomisol ear drops were used as 5-6 drops thrice daily. The injection Ploxcin was already started before sensitivity. The treatment was administered 7-9 days. The affected ears were cleaned aseptically. Two patients were recovered after 7 days and Spitz dog recovered in nine days. Abst 49 : II

Management of hind limb paresis in german shepherd dog - A case study

D. K. Choudhary, A. P. Singh, N. K. Mudgal and J. Kachhawa Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, Bikaner

A 12 year old male German shepherd dog, weighing 24.0 kg was brought to Medicine clinic of College of Veterinary and Animal Science, Bikaner, with the history of hind limb weakness and inability to stand on hind limbs since last fifteen to twenty days. Clinical examination revealed partial sensation of both the hind limbs. Temperature of dog was 1020F. Haemato-biochemical examination revealed haemoglobin 12.2 g%, PCV, 38%, TEC 6.8 million/cumm, TLC 9.0 thousand/cumm, serum calcium 10.8 mg%, inorganic phosphorus 4.0 mg%, sodium 145 m Eq/L, and potassium 4.4 mEq/L, respectively. The patient was prescribed with inj 5% DNS 750 ml i/v, inj Optineuron 3 ml i/v, inj Dexona 3 ml i/v, inj Amoxirum forte 300 mg i/v b.i.d, inj Melonex 1 ml i/m for 7 days, inj Decadurabolin 25 mg i/m, was also administered and repeated at bi-weekly interval for 5 times. Along with the treatment the owner was advised for mild hot fomentation of the hind legs along with exercise. After 7 days patient recovered very well.

84

Session-III
Canine Surgery

85

LP1: III

Osteosynthesis for fracture management in small animal practice

N. S. Saini and M. Raghunath Department of Veterinary Surgery & Radiology Center of Advanced Faculty Training in Surgery and Radiology, GADVASU, Ludhiana, 141004, Punjab

Fractures in small animals are due to high-energy trauma and therefore could be both life threatening and cause of severe permanent disability. Remarkable improvements in fracture fixation have improved the clinical outcome and rehabilitation of such patients. The ideal objective of fracture treatment is to provide a pain free ambulation to the patient as quickly as possible. The present paper details about the different methods of fracture fixation in small animals with their indications, biomechanics and complications. INTRAMEDULLARY FIXATION: Intramedullary fixation, with all of its attendant problems, is the most readily used system of internal fixation in small animals. The techniques used in veterinary medicine include simple intramedullary pinning, Kirschner wire, Rush pin, Kuntscher nail, cross-pinning, intramedullary cross pinning, and intra medullary interlocking nailing. The Rush pin and Kuntscher nail are not used extensively. 1. SIMPLE INTRAMEDULLARY PINNING: Indications Intramedullary pinning with a single Steinmann pin may be indicated in fractures throughout the length of a long bone. It is best for transverse and short oblique fractures of the middle third of long bones. It can be applied in conjunction with cerclage and hemicerclage wiring, which will extend its indications considerably. Biomechanics The Steinmann pin, while the most commonly used intramedullary device in veterinary medicine, is the least sophisticated. Because it is placed in the medullary cavity, it resists bending in all directions. Its strength is related to its diameter, and its ability to restrict motion of the fracture fragment is related to its contact with the surrounding bony cortex. A small intramedullary pin in a large medullary cavity has been shown to be a successful method of producing nonunions. Complications of intramedullary pinning with Steinmann pins can often be traced to mechanical factors such as pin migration, bending, or catastrophic failure. Delayed union and nonunion after intramedullary pinning may also be a result of mechanical factors. Since the medullary cavities of most bones in the dog vary widely in diameter, the Steinmann pin is usually used in three-point fixation. It is anchored at the point of introduction, has contact with the fractured surfaces and/or the isthmus of the medullary canal, and is impacted into the distal cancellous bone. A round intramedullary pin can do little to prevent torsional instability in fracture fixation. The Steinmann pin may allow torsional stability only when it leads to interdigitation of the fracture fragments. In general, when an intramedullary Steinmann pin is placed alone for reduction and stability of a fractured long bone, it should contact as much of the medullary cortex as possible in order to provide some torsional stability. If intramedullary fixation does not present adequate stability against rotation, multiple pinning, cerclage wiring, hemicerclage wiring, or external fixation must be used in conjunction with the pinning. Intramedullary devices provide no longitudinal support; the fracture fixation is dependent upon the stability of the fracture fragments themselves. Therefore, when comminution or cracks exist, there is a definite possibility for further collapse and telescoping of the fracture fragments over the Steinmann pin. Contraindications and Complications Single Steinmann pins are usually contraindicated in severely comminuted fractures except when cerclage or hemicerclage wiring is added. Intramedullary pins are not good devices to use in the presence

86

of sepsis. Insertion of a Steinmann pin into the marrow cavity of a septic fracture may cause the extension of infection throughout the medullary cavity and make the treatment of this infection very difficult. Steinmann pinning should be attempted only when the fracture can be made stable. Inadequate technique of Steinmann pin placement with improper seating in the distal fragment or instability of the fracture will lead to the complication of pin migration, the most common problem associated with intramedullary pinning. 2.MULTIPLE STEINMANN PINS:(STACKED PINNING) Indications Multiple Steinmann pinning is useful in transverse and short oblique fractures in the middle half of the long bone. The technique is especially useful when trying to optimize torsional stability of the fracture site with round pins in large medullary cavities. The concept of multiple pinning is to fill the medullary cavity with an implant so that strong frictional forces between the pins and the inner cortical surface of the medullary cavity will prevent rotation. Multiple Steinmann pinning can be used in extensively comminuted fractures along with cerclage wiring. Biomechanics The mechanics of multiple intramedullary fixation are similar to those of single intramedullary fixation except that the pins are packed into the marrow cavity in such a way that they are tightly adherent to one another and to the inner diameter of the cortical bone. Contraindications and Complications Multiple Steinmann pinning has few contraindications. Longitudinal fragments may represent a hazard when using multiple Steinmann pinning techniques, but these can usually be controlled with the use of cerclage wires. As with single Steinmann pinning, pin loosening or migration is a complication but can be minimized by using many pins. In general, when fixation has been accomplished with multiple Steinmann pins, only one or two pins will start to migrate, thereby saving the integrity of the fracture. It is important that these fractures be restabilized quickly before further comminution or pin migration occurs. Clinical experience suggests that pin migration is less common when smaller pins (and hence more pins) are used. 3.RUSH PINS: Indications Rush pinning when used in pairs, are for fractures of the distal humerus and distal femur including supracondylar fractures. The advantage of this technique is migration of pins could be avoided as the distal tips of the pins are hooked into the bone. Biomechanics The Rush pin is a specially tempered, round intramedullary device that is supposed to be quite springy. It has a hooked end that is used to drive and seat the pin into the bone and a tapered end that should bounce off the inner cortex of the bone as it is inserted so that it fits snugly against the inner wall of the medullary cavity. It is through the elastic bending of this intramedullary pin that the rigid fixation is accomplished. Since each pin usually gives two points of fixation, Rush pins are most commonly used in pairs. It is important that the pins themselves bend elastically during their insertion, rather than cause a change in the axis of the bone. Contraindications and Complications Since Rush pins are actively inserted into the marrow cavity by tapping with a mallet, it is of utmost importance that the cortex be relatively mature, dense, and without cracks. These pins are contraindicated in very young animals (under 4 to 6 months of age) in whom the marrow cavity is large and the cortex is

87

soft and may be easily penetrated by the Rush pin instead of allowing the pin to glide over its inner surface. Contraindications include any animal that has had a long episode of disuse atrophy in which the soft cortical bone may not be sufficient to support the Rush pin. In very young animals the distal epiphysis is very soft and may be damaged as the pin is driven through it during seating. Premature closure of the physeal growth plate can also occur in young dogs subjected to Rush pinning. To prevent this, the literature suggests early removal of the pins if used in young animals. 4. DYNAMIC INTRAMEDULLARY CROSS PINNIG: Indications Stable fractures in relatively mature animals involving supracondylar fractutres of the femur and distal fractures of humerus. Biomechanics The technique is same as in rush pins but the difference is the proximal ends of the pins are allowed to exit from the trochanteric fossa of the femur to facilitate their removal. The two pins exerts three point contact and could neutralize angular, rotational and torsional forces at fracture site. Contraindications and Complications The technique is not indicated in comminuted fracture. In very young animals passing of the pins may cause comminution of the condyles or tearing of the growth plate resulting in premature closure. 5. CROSS PINNING: Indications The technique is specifically used in supracondylar fractures of young dogs and cats. The fracture is reduced and either K wires are simple intramedullary pins are passed from cranio lateral and cranio medial sides of the femoral condyles crossing the fracture line and exiting the femoral cortex from the opposite side. It has been found that using of four pins instead of two provides a better stability. Biomechanics The stability is achieved by two-point fixation and in very distal fractures this technique is most suitable as other techniques as simple intra medullary pinning or stacked pinning cannot provide the required stability. Contraindications and Complications Cannot be used in heavy dogs and migration of pins can result to dislodgement of the fracture. Complications involving the stifle joint like stiffness are common post operatively. 6. KUNTSCHER NAILING: Indications Use of V shaped or clover shaped Kuntscher nailing is indicated for middle third, transverse, or short oblique fractures of the humerus, tibia, and femur when no longitudinal cracks or fissures of the bony cortex are present. Biomechanics The Kuntscher nail is designed to stabilize the bony fragments by filling the marrow cavity and contacting as much of the cortical bony surface as possible. In the dog, intramedullary reaming is contraindicated because the cortices are relatively thin and the diameter of the marrow cavity changes markedly throughout the length of the diaphysis. Therefore, in the dog the Kuntscher nail is usually used as a three-

88

point fixation device. The initial point of fixation is the penetration of the nail through the proximal portion of the bone. The nail is then stabilized in the central portion of the fracture site, usually at the area of the isthmus of the marrow cavity, and distally is anchored in the cancellous portion of the bone of the distal diaphysis. The concept of the triangular or cloverleaf shape of the Kuntscher nail allows contact to be made along the marrow cavity in at least these three places. This is the one advantage of the Kuntscher nail over a firm-fitting round intramedullary pin of the Steinmann type. The Kuntscher nail allows point contact on the inner medullary surface of the cortex, which will help prevent rotation of the bone fragments. Contraindications and Complications The Kuntscher nail should never be used when there are longitudinal, cortical cracks in either the proximal or distal fragments of the bone involved. Occasionally these cracks cannot be appreciated radiographically and are seen only on careful scrutiny at the time of open reduction of the fracture fragments. Although full cerclage wiring can be used in such instances. The Kuntscher nail has only limited value in comminuted fractures. Most of the complications of Kuntscher nailing are related to improper technique and occur at the time of insertion. These include the positioning of the nail through retrograde placement, which can result in avascular necrosis of the femoral head and neck; impingement of the nail in the hip joint; laceration or mutilation of the sciatic nerve; and wedging of the nail in the marrow cavity, causing comminution upon insertion. 7. SCREWS AND PLATES: Indications Screws can be used by themselves for fractures of the femoral neck and for intercondylar fractures of the distal humerus and femur. In these situations one screw is often used together with a Kirschner wire to prevent rotation. Screws should never be used alone for diaphyseal fractures, since weight bearing will cause loosening and collapse of the fracture site. Screws are used together with plates for diaphyseal fractures and all comminuted fractures of long bones, including fractures into joints. There are two basic types of screws the fully threaded cortical screw and the partially threaded cancellous screw. Both screws are available in a wide variety of sizes necessary for the varied problems that arise in small- animal orthopaedics. The efficacy of the various screws depends on the location where they are used and on the function that is expected of them. In general, canine bone is relatively hard and the use of a cancellous screw at any location is rarely necessary. Cortical screws are adequate for nearly all applications in the dog, except in some young, growing dogs and dogs with disuse osteoporosis, as well as those with metabolic bone disease. Cancellous screws should be used only when failure (stripping) of a cortical screw has occurred or in an animal in which previous drill holes have indicated that failure of the cortical screw is likely to occur. Biomechanics The selection of a plate for internal fixation of a long bone must be made carefully because of the wide variety of type of plates available. There are six major cross-sectional area size plates and two basic hole types. It is important to choose a plate of correct length, also. When using a plate with a round-hole design, the proper size plate must be chosen so that the tension device can be used at the end of the plate. When using the dynamic compression system, the tension device need not be applied; therefore, a plate approximately one or two hole lengths longer can be used. After determining its proper size and length, the plate should be contoured to the bone very accurately. This is done using a bending press so that the plate is made to lie directly on the surface of the bone. The plate is then placed on the fracture site and centered over the fracture so that a hole can be drilled through the bone approximately 1 cm from its fractured end. The plate is placed over this hole in order that the screw length can be measured taking into account the thickness of the plate. The hole is then measured and tapped through both cortices using the tap. The correct length screw is chosen and inserted, loosely attaching the plate to the bone. The fracture is then reduced and secured with the bone-holding forceps after the plate is aligned with the long axis of the bone.

89

The tension device is tightened slightly to align the plate with the long axis of the bone and to approximate the ends of the fracture fragment. The tension device should not be tightened completely at this time. The remaining holes are drilled through the plate in the fracture fragment where the first screw was placed using the proper drill guide. These holes are drilled, measured, and tapped as previously described. The screws are inserted and tightened completely. After tightening the first screw, which was loosely inserted, the tension device is tightened completely with a socket wrench then with an open-end wrench if necessary. Now the holes are drilled, measured, tapped, and the screws inserted individually and tightened in the fracture fragment held by the tension device. After loosening and removal of the tension device, the remaining screw holes at the end of the plate are drilled, measured, and tapped and the screws are inserted. The dynamic compression plate (DCP) can be used in the same manner as described previously for the round-hole plate. It can, however, also be used as a self-compressing plate, since the round holes have been replaced with oval ones that contain an inclined plane, which allows the screws to produce plate translocation upon tightening. The first hole must be drilled using the yellow load guide with the arrow of the guide pointed toward the fracture site. This is important, since the load guide contains an eccentrically placed hole that will allow the screw being used to compress the fractured bone end by translocation of the plate. This hole is measured, tapped and a screw of the proper size inserted. The bone clamp is removed, and upon tightening both of these first screws on either side of the fracture alternately the fracture gap is closed and the fragments reduced with good stability. The remaining holes on both sides of the fracture site may be drilled using the green neutral drill guide. This drill guide has the hole in the center and causes additional loading of the fracture site since the screw is placed 0.1- mm up the incline hole, thereby adding to the compressive effect. In this way, all the screws placed in the plate are loaded at least to some degree. The holes are measured, tapped, and the screws inserted. Alternate tightening of the screws from the center outward to ensure that all screws are tight is necessary. This procedure should be repeated two or three times, since movement of any one screw may cause plate translocation and hence loosening of another screw. In most animal bones, the plate chosen should be as long as possible. It is necessary to have at least six cortices or three fully threaded screws on either side of the fracture site to be minimally safe when using plate and screw fixation. Eight cortices on each side of the fracture site is quite comforting. Occasionally at the end of a bone only four cortices (two screws) will be used. When this happens, external fixation should be considered as a possible addition. Contraindications and Complications The use of either under sized or over sized plates lead to implant related complications like plate dislodgement, screw back out etc. As plate act only as stress bearer and will never allow the weight bearing stresses to travel through the fracture site, the most common complication after plate application is osteoporosis. The part of the bone under the plate is always stress protected and will be osteoporotic and may lead to refracture after the removal of the implant. 8. ORTHOPAEDIC WIRE TECHNIQUES: Orthopaedic wiring of fractures has long been popular in veterinary medicine. Use of orthopaedic wire, like all other techniques, is successful when the indications are proper and the techniques are adequate. The problems associated with orthopaedic wiring and the poor results that are sometimes obtained can usually be traced to improper technique or indications. FULL CERCLAGE WIRING Indications Full cerclage wires can be used in long oblique fractures, spiral fractures, or in fractures that have longitudinal cracks. The wires are used most easily in middiaphyseal locations where the diameter of the bone is most constant. Complications and Contraindications

90

Complications of full cerclage wiring include loosening of the wire and collapse of the fracture fragments. These complications can usually be traced to failure to adhere to the techniques described above or to inappropriate selection of cases for wiring. HEMICERCLAGE WIRING The wire is passed through a small hole in one fracture fragment, passes across the fracture site, and comes out through a small hole in the opposite fracture fragment. The wire is twisted together in the same manner as in full cerclage wiring and may or may not be bent over in place, depending on its application. Complications Most of the complications associated with hemicerclage wiring involve breaking of the wire as a result of use of too small a wire or using wire beyond its limitations. TENSION BAND WIRING Tension band wiring is a form of hemicerclage wiring that is usually used in conjunction with Steinmann pins to achieve stable internal fixation by opposing the pull of muscular attachments on bone. Tension band wiring or figure-of-eight wiring can also be used in a middiaphysis of bone on the tension band surface to help minimize distraction and provide increased stability in nonunions and/or initial fixation after osteotomy. Indications Tension band wiring has been reported in the dog and is commonly used to fix fractures or osteotomies of the olecranon, greater trochanter of the femur, patella, fibular tarsal bone, tibial tuberosity, acromion of the scapula, coracoid process of the scapula, medial malleolus of the tibia, and any other traction apophysis. Biomechanics In tension band wiring the distractive forces produced by the pull of the muscles are converted into the compressive forces between the fracture fragments and result in the healing. The stainless steel wire passed in figure of eight fashion around the K wires counter acts effectively the pull of the insertion muscles and creates compression. Complications Complications of tension band wiring occur when only one pin is introduced into the fracture site, allowing rotation of the fracture fragment. In this case a figure- of-eight wire rapidly fatigues and breaks, resulting in a nonunion. Other problems include pin or wire protrusion through the skin and pain associated with palpation over the device after fracture healing has been accomplished. Complications commonly result from the use of wire of too small a diameter. 9. EXTERNAL SKELETAL FIXATION: Indications Indications for external fixation in the dog are the tibia and radius and ulna, where there is very little contracting muscle between the frame and the bone itself. The devices have been used in the humerus and femur, but it is important to attempt pin placement where there is little movement of soft tissue beneath the pins. The external frame is used advantageously in third-degree open fractures when large amounts of soft tissue or bone are lost or mutilated and in chronic osteomyelitis where surgical intervention requires removal of bony sequestrum, sometimes leaving defects or large gaps. Biomechanics

91

The purpose of an external skeletal fixation frame is to immobilize the fracture so that healing can take place. Current information about fracture healing indicates that relatively rigid stabilization is preferred initially to allow bony union of the fracture fragments. As the fracture matures and healing progresses, a gradual reduction in the rigidity of stabilization may be advantageous to impart strength to the healing fracture and to prevent bony resorption due to stress protection. Complications Pin tract sequestra have been reported to be a result of faulty technique, that is, thermal necrosis produced by drilling the pin through the bone, although this etiology has not been proven. A sequestrum, if present, is usually treated by surgical removal. Local infections of the pin tract can occur with the use of paracutaneous pins. The infrequency with which these infections occur does not lessen the fact that they are more easily prevented than treated. Prevention of pin tract infections is related to the stability of the pin in the bone. If the pin is tight in the bone, pin tract infections are relatively uncommon. Once the pin loosens, the only treatment for the infection is removal of the pin. Bending of the transfixation pins is a complication of too much weight bearing or insufficient number or size of pins penetrating the cortex. If the pin is not badly bent, movement of the pins single fixation clamp on the longitudinal bar may be adequate to provide restabilization of the fracture fragments. If this is not possible, the bent pin should be exchanged for a straight one. Additional pins may be placed to prevent the overload failure that is occurring in the system. 10. INTRAMEDULLARY INTERLOCKING NAILING: Intramedullary interlocking nailing (IILN) an improved nailing technique used in human orthopedics and proved to be a versatile system for the treatment of all long bone fractures has been adopted in veterinary orthopedics and has become an effective means of fracture fixation in femur, tibia and humerus. The advent of aiming devices which help to drill the holes in correspondence with the holes in the nail has circumvented the use of high cost equipment like intra operative image intensifying systems which most of the veterinary institutes lack. Indications ILN is mainly used in diaphyseal fractures of long bones except radius ulna. Fracture configuration may be transverse, oblique or comminuted but must not involve the metaphyseal region of the bone, which are where the trans fixation screws are placed. Biomechanics As the implant is placed in the neutral axis of the bone it provides shear, axial and rotational stability to fracture without extensive soft tissue dissection. Interlocking screws, which lock the implant with the bone, add tortional and axial stability. The intramedullary nail act as both a load bearer and load sharer, there can be no chances of stress protection and so improves the bone quality during healing. May also be used in non-union fractures. Complications In spite of its wide range of indications and good clinical outcome, certain implant related complications like nail breakage, failure to the match holes with screws, screw back out, screw bending and screw breakage are encountered with minimal effects on the clinical outcome. 11. JAW FRACTURE MANAGEMENT Various techniques can be utilized in the management of jaw fractures. Adherence to basic principles of ja jaw fracture management can help provide a successful outcome regardless of the technique utilized. These basic principles include the following: (1) restoration of occlusion and anatomic reduction of the fracture, (2) neutralization of forces on the fracture line and stable fixation, (3) avoidance of soft tissue

92

entrapment by the fixation technique, (4) avoidance of further dental trauma, (5) proper assessment of tistissue viability, (6) removal of diseased teeth within the fracture, (7) avoidance of excessive elevation of sosoft tissue from the surface of the bone and covering of exposed bone with soft tissue, and (8) rapid rerestoration of function. Numerous techniques for reduction of mandibular and maxillary fractures in small animals have been des escribed previously. Techniques frequently utilized in the management of jaw fractures include 1. Tape muzzles are an inexpensive, noninvasive technique of aligning and stabilizing jaw fractures. They can be used to temporarily stabilize jaw fractures prior to definitive repair. Tape muzzles can also be utilized as the primary repair technique in minimally displaced stable fractures especially fractures of the mandibular ramus or fractures occurring in young animals in which bone healing occurs rapidly. 2. Circumferential wiring involves placing a wire around a bone or bones to achieve stabilization of a frfracture. The most common indication for circumferential wiring in small animal jaw fractures is sysimphyseal fractures. 3. Utilization of bone plates in the management of jaw fractures has several advantages and disadvantages.The advantages of bone plates include rigid stabilization of the fracture and rapid return to normal function. Fractures stabilized with bone plates heal with little or no callus formation. However, there are multiple disadvantages associated with the utilization of bone plates for jaw fractures. Specialized expensive equipment and increased surgical expertise is required for bone plating. Significant soft tissue elevation is necessary for the placement of bone plates, which may further compromise the blood supply to the fractured bone. It is also difficult to apply a bone plate to a fractured mandible or maxilla without further traumatizing tooth roots or neurovascular structures. It is very difficult to achieve normal postoperative occlusion using plates for jaw fracture repair because even slight errors in reduction of a fracture particularly in caudal fractures will result in a significant malocclusion with inability of the patient to close its mouth. Miniplates have been recently utilized in the repair of mandibular and maxillary fractures in dogs and cats. The small size of these implants allows placement close to the alveolar border and the screws may be angled to avoid impingement on tooth roots. 4. Partial mandibulectomy can be utilized in the management of mandibular fractures when extensive trauma or infection precludes reduction or adequate fixation. Partial mandibulectomy techniques should be limited to cases in which primary fracture repair is likely to fail or cases in which primary fracture repair has resulted in an inability to eat and drink. REFERENCES Brinker WO: The use of intramedullary pins in small animal fractures. North Am Vet 29:292,1948 Brinker WO, Flo GL: Principles and application of external skeletal fixation. Vet Clin North Am 5:197, 1975 Brinker WO, Hohn RB, Prieur WD: Manual of Internal Fixation for Small Animals. New York Ehmer EA: Bone pinning in fractures of small animals. J Am Vet Med Assoc 110:14, 1947 Ehmer EA: Traumatic injuries in small animals. J Am Vet Med Assoc 112: 246, 1948. Hinko PJ, Rhinelander FW: Effective use of cerclage in the treatment of long bone fractures in the dog. J Am Vet Med Assoc 166:520, 1975 Jenny J: Kuntschers medullary nailing in femur fractures of the dog. J Am Vet Med Assoc 117:381, 1950 Chambers JN: Principles of management of mandibular fractures in the dog and cat. J Vet Orth 2:26, 1981. Lantz GC, Salisbury SK: Partial mandibulectomy for treatment of mandibular fractures in dogs: Eight cases (1981-1984). J Am Vet Med Assoc;191:243-245, 1987

93

LP 2 : III

Diagnostic and Therapeutic Laparoscopy in Canine Patients

Naveen Kumar Division of Surgery, Indian Veterinary Research Institute, Izatnagar-243122, UP

A surgical procedure performed through very small incisions in the abdomen, using specialized instruments called laparoscopy. It allows direct viewing of the abdominal and pelvic organs on a TV monitor with minor surgical interference and negligible trauma. Laparoscopy is done with the help of a pencilthin instrument called a laparoscope. The term laparoscope derived from Greek word Laparo meaning flank, which is the side of the body between the ribs and hips (abdomen) and scope means to look at or examine. Laparoscope is used in laparoscopy and laparoscopic surgery; it has lenses like a telescope to magnify body structures, a powerful light to illuminate them, and a miniature video camera. Specialized surgical instruments can be inserted through the laparoscope. Laparoscopy is an endoscopic procedure for the visual examination of the abdominal cavity and its contents for the diagnosis or treatment (or both) of a number of different diseases and conditions. Laparoscopy is a surgical procedure in which a small incision is made, usually in the abdomen, through which laparoscope is inserted. The laparoscope has a small camera on the eyepiece. This allows the surgeon to examine the abdominal and pelvic organs on a video monitor connected to the laparoscope. Other small incisions can be made to insert instruments to perform procedures. The advantage of laparoscopy is that only a small incision (minimally invasive technique) is required; this is why laparoscopy is also known as keyhole surgery. Direct laparoscopic visualization of intra-abdominal pathologies has advantages over the logical assumption of the same by radiography and ultrasonography. Laparoscopy has been a beneficial diagnostic apparatus in human medicine for many years and is now being increasingly popularizing in veterinary medicine. Diagnostic laparoscopy is a procedure that allows to look directly at the contents of a patients abdomen or pelvis, including the fallopian tubes, ovaries, uterus, small bowel, large bowel, appendix, liver, and gallbladder. Diagnostic laparoscopy is indicated in any situation when inspection of the abdomen will help establish a diagnosis and to define subsequent treatment. Patients that are to undergo endoscopic surgery should have a complete pre-operative evaluation prior to scheduling the surgery. The preoperative evaluation often includes laboratory and echographic exams in order to determine the clear indication for surgery. Minimally invasive surgery is a collective term for surgical techniques designed to minimize the extent of an anatomic approach while maintaining precision and efficiency. This type of surgery was made possible through an extensive collaboration between physicians and industry in developing the tools and technology that enabled the procedures to be performed safely. Most of the minimally invasive procedures are technically feasible in veterinary medicine and may be accepted as standard procedure in future. The benefits of minimally invasive approaches are well documented in human surgery. However, many of the techniques have not been applied in clinical settings and dramatic patient benefits seen in human surgery have not been validated in animals. Prior to the advent of laparoscopy veterinary surgeons had to make large openings and cut through layers of tissues in order to examine internal organs also known as diagnostic laparotomy. Laparoscopy greatly reduces the patients recovery time. Minimally invasive spinal surgery, plastic and reconstructive procedures, and cardiovascular procedures are examples of applications performed in human that will probably not see wide adaptation in veterinary medicine. Equipments/Instruments used in the laparoscopy Equipments 1. Surgical table 2. Video-imaging equipments (a). Laparoscope 00 or 300 forward angle lens system (10 mm diameter for large breeds)

94

(b). Laparoscope 00 or 300 forward angle lens system (5 mm diameter for small breeds) 3. Video-endoscopic systems (a). Video camera (b). Video camera control unit (c). Light source (Halogen light, 400 watts) (d). Fiber optic light cable (e). Monitor (f). Recording devices (g). Video cart (h). Carbon dioxide insufflator (automatically regulated for pressure and flow rate) (i). Carbon dioxide gas cylinder 4. High flow irrigation and aspiration system 6. Laparotomy surgical pack Instruments 1. Insufflation needle (Veres needle) 2.Trocar and canula (10-12 mm, 5-8 mm) 3. Reducers 5. Exposure, retraction and tissue handling instruments (a). Atraumatic grasping forceps (b). Dissecting forceps (c). Laparoscopic scissors (d). Smooth forceps design for grasping tubes (e). Clip applicator (f). Titanium clips and staples Sterilization of the laparoscopic instruments Laparoscopic surgery required expensive surgical instruments that are inherently difficult to clean. Instruments that can be taken apart must be disassembled prior to washing. Formaldehyde has a broad spectrum of action on microorganisms. Formaldehyde (0.2% conc.) with contact time of 60-180 minutes is used to disinfect the instruments. Formaldehyde works best at a relative humidity of >70%-80% and at higher temperatures. Formalin tablets were used to sterilize the equipments/instruments. These tablets were placed in sterilization chamber for 8-10 hours. Glutaraldehyde can also be used to disinfect the instruments. Laparoscopic Procedure Positioning of the patient/anesthesia The patient is transported to the operating room and general anesthesia performed. Care should be taken to avoid nerve injury by mal positioning the patient, particularly along the politely fossa and brachial plexus. If any part of the patient is in contact with a metal object, patient may be at risk of electro surgical burns. General anesthesia is preferred for laparoscopy as it provides adequate muscle relaxation and assisted respiration particularly as the patient is in Trendelemburg position. Position of the operating team and equipment The surgeon must be familiar with the mechanics and operation of each piece of equipment. Prior to anesthetizing the patient the operating team must check that the insufflators is functioning and has an adequate supply of gas, the light source is functioning, and the video equipment is in working order. This will prevent avoidable malfunctions, which may result in serious complications and surgical delays. Mobile racks for camera and TV monitor, video recorder, light source and insufflators are available and help organize the operating room equipment. The surgeon stands on the left side of the patient and the assistant on the opposite side. From here, the surgeon is able to continuously monitor all of the equipment (insufflators, light-source, irrigation system, electric generator). Alternatively, the surgeon and his assistant

95

may both stand to the left of the patient with the video monitor on the opposite side. The TV monitor should be located so that each member of the operating team may follow the procedure. Pneumoperitoneum Insert the Veres needle through a vertical, 0.5 cm intraumbilical incision. In general a 7 cm length is sufficient although a 15 cm needle is also available. Prior to insertion the spring mechanism is checked on the needle to avoid visceral puncture. To insert the Veres needle the abdominal wall is lifted with one hand and the needle passed through the incision. Intraperitoneal placement is confirmed by injecting 5 ml of saline through the Veres needle. The solution should flow without resistance and should not return when trying to aspirate. To check the correct positioning of the needle deposits a drop of saline on the external os of the needle. It should fall into the needle hub when negative pressure is created by lifting the anterior abdominal wall. Next, insufflate carbon dioxide at a low flow rate of 2 L/min, allowing the patient to adapt gradually to the pneumoperitoneum, When pressure of 12 mm Hg is obtained, place the machine on automatic flow in order to maintain this pressure. Most machines will automatically adjust the flow rate (usually at a maximum flow of 6 L/min.). Placement of trocar After attaining a sufficient pneumoperitoneum, place one 10-12 mm umbilical trocar through the Veres needle incision. The distal tip of the trocar must be sharp. During insertion of the trocar, compress the upper abdominal wall with the free hand to make the lower abdominal wall tense, giving a firm platform against which to insert the trocar and cannula. Direct the trocar towards the pelvis to avoid injury to major vessels. Pass the laparoscope through the trocar sleeve and immediately confirm correct intraperitoneal placement. Standard diagnostic laparoscopes vary in diameter form 5-10 mm. The 5 mm laparoscope is adequate for inspection but is not sufficient for more complex procedures. The light source is also an essential element. In general the standard 150 watt light source is sufficient only for diagnostic laparoscopy. Complex procedures require a more powerful light (250-40 watt halogen lamp). Next, place the patient in Trendelenburg position in order to allow for the gravitational effect to move the bowel out of the pelvic cavity. Then insert two or three 5 mm trocars under direct vision at ancillary puncture sites for instruments. These secondary trocars are inserted supra-publically, taking care to avoid the epigastria vessels laterally and the bladder medially. Collaboration with the anesthetist The pressure of the pneumoperitoneum and the extent of the Trendelemburg position must be adapted to the haemodynamic and respiratory demands of each individual patient. Continued communication and collaboration with the anesthetist throughout the procedure is mandatory. This is extremely important because it may be necessary to reduce the Trendelenburg position, lower the intra-abdominal pressure, or even convert to lapatotomy at any time during the procedure. Closure of abdominal incisions After completing the evaluation of the pelvis or endoscopic procedure, in more advanced cases, the laparoscopy is completed as follows. Remove the ancillary ports, examining the incisions internally for bleeding. Then the patient out of Trendelenburg position in order to optimize the decompression of the pneumoperitoneum. Close the small lower abdominal incisions with non-absorbable suture to be removed in 5-7 days. It is wise to place an absorbabel fascial suture in the larger>10mm umbilical incision followed by a cutaneous non-absorbable suture. Advantage and disadvantage of laparoscopy Lapraroscopy is a unique surgical approach that shares characteristics of both minor and major surgery. To patients, laparoscopic procedures are often considered minor surgery because of the small incisions, relatively small amount of postoperative pain and short convalescent period. At its essence, laparoscopy remains an intra-abdominal procedure. Therefore, it shares all intraop-

96

erative and postoperative rsks of laparotomy, including indection and injury to adjacent intra-abdominal structures. When major intra-abdominal procedures are performed laparoscopically (e.g. hysterectomy), the resultant postoperative pain and morbidity are still significant. However, because a large abdominal incision is unnecessary, the postoperative pain and morbidity are always less significant than similar major surgery performed by routine laparotomy. Laparoscopic procedures have unique risks, which are related to methods used for the placement of abdominal wall ports and to the pneumoperitoneum required for laparoscopy. These risks include injury to bowel, bladder or major blood vessels and intravascular insufflations. In addition, increased intra-abdominal pressures associated with laparoscopy increase anesthesia-related risks such as aspiration and increased difficulty ventilating the patient. Although the risk of blood loss is relatively low of most procedures, potentially massive blood loss may occur and is complicated by the fact that control for blood loss may be delayed by the time taken to perform and emergency lapatotomy. Contraindications Laparoscopy and organ biopsy should not be performed in animals with coagulopathy. Extensive intra abdominal adhesions from previous surgery or disease can result in visceral puncture during laparoscopy; therefore exploratory lapatotomy is recommended in these individuals. Profound ascites can complicate laparoscopy and increases the likelihood of visceral puncture. Bacterial peritonitis and abdominal herniation (diaphragmatic or inguinal ) are obvious contraindications. Complications During establishment of the pneumoperitoneum, puncture of hollow organ (Stomach, urinary bladder, intestine) can occur and results in gas distension of the organ. The occurrence of gas embolization has been found aftr placement of Veres needle within a major vessel, spleen or vascular tumours. Subcutaneous or body wall emphysema also can result if the Veres needle is not introduced completely into the abdomen. Excessive pneumoperitoneum can result in cardiopulmonary compromise. Improper technique in inserting the trocar cannula carries the greatest risk of immediate severe complications. Significant trauma to the abdominal viscera or wall can occur . . Examination of the organs of different body cavity Laparoscopy has been used for the examinations of the organs of the different body cavity for their anatomy, whether normal or abnormal, if found abnormal then their simultaneous diagnosis whatever may be. Liver, gall-bladder, stomach, abdominal esophagus, small and large intestine, spleen, kidney etc. are examined foe their shape, size, location, color and even consistency. The intra-peritoneum pathologies diagnosed by laparoscopic examination includes intestinal torsion, intestinal intussusception, intestinal adhesion, intestinal impaction, mummified fetus, polycystic ovary, persistent corpus luteum, spleenomegaly, splenic abscess, hepatitis, cirrhosis, hepatomegaly, liposarcoma of liver and bridging fibrosis of liver. Evaluation of laparoscopic guided liver biopsy Biopsy of the diseased organs was taken using biopsy forceps wherever necessary followed by electro coagulation. The biopsy specimens were subjected to histopathological examination for confirmatory diagnosis. The study was conducted in 18 clinically healthy adult dogs and 5 clinical cases suffering from various liver ailments. Laparoscopic guided biopsy was also compared with the ultrasound-guided percutaneous biopsy. The technique of laparoscopic liver biopsy was found to be having minimal stress to the animals as not much variation was sen in clinico-biochemical parameters. On comparison to ultrasound guided biopsy technique, the laparoscopic technique did not cause any added stress to the animals even though it is a surgical procedure. Laparoscopic guided ancillary diagnostic procedures In modern medical science, the laparoscopy guided ancillary diagnostic procedures like cholecys-

97

tography, splenopotography, splenic pulp pressure measurement etc have become amore reliable and chosen methods for diagnosis of diseases like portosystemetic shunts (congenital and acquired), extrahepatic bile duct obstructions, cholelithiasis etc in human medicine. Considering this one can hope that in coming years these may take a major role in assisting veterinary surgical procedures. So it is high time to standardize these techniques in order to implement them with confidence. Laparoscopic guided collection of bile and cholecystocholangiograpphy was performed and compared with intravenous cholecystography. The laparoscopic guided bile collection and cholecystography were found to be superior to conventional techniques for safety, convenience and diagnostic quality. Laparoscopic sterilization techniques in bitches Three different sterilization techniques viz. bilateral oophorectomy, ovario-hysterectomy by electrocautery and ovario-hysterectomy by endoclipping and electrocautery were performed and evaluated in forty five mongrel bitches. Laparoscopic ovario-hysterectomy by endoclipping and electrocautery was found mot superior and this technique was successfully applied in many clinical cases. Laparoscopic sterilization techniques in male dogs Two different sterilization tedchniques viz. laparoscopic bilateral vasectomy and laparoscopic bilateral vasectomy along with occlusion of testicular vessels by endoclipping and electrocautery were evaluated and compared with conventional open castration in thirty male mongrel dogs. The laparoscopic sterilization techniques were found superior in terms of post surgery complications and animals pain and successfully used in many clinical cases. Imparting training to post graduate students/scientists/field veterinarians Gaining laparoscopic skills is not an easy task. Skill in conventional procedure does not necessarily confer skills in laparoscopic surgery. The training was aimed with the following objectives. 1. To master the tactile sensation, altered hand and eye coordination due to the length and design of instruments and the absence of depth perception due to the two dimensional representation of the three dimensional abdominal cavity by using endo-trainer. 2. Familiarization with specialized endoscopic equipments and instrumentation. 3. To absorb the principle of laparoscopic surgery. 4. To know the indications, contraindications and limitations of laparoscopic surgery. 5. Perform abdominal insufflation. 6. To perform Laparoscopic procedures on live animals. Under the training programme all the students of the division had accessed these laparoscopic equipments and instruments. Hand and eye coordination exercises were done on endo-trainer by picking up the board pins from one Petri disc to another by working hand and vice-versa by non working hand. This will help in hand and eye coordination due to the length and design of instruments and the absence of depth perception due to the two dimensional representation of the three dimensional abdominal cavity. Cutting of strings of beads, picking, holding and cutting of biomaterials lying in Petri disc and knot tying exercises was also performed. A short term training programme of 10 days was regularly organized in the month of September-October for the field veterinarians. Any veterinarian having MVSc degree in Surgery and Radiology can join and having training in laparoscopy. For training programme in laparoscopic surgery they can contact either Joint Director (Academic) or Head, Division of Surgery, IVRI, Izatnagar. In the future, the laparoscopic surgery in veterinary medicine will became more widely known and appreciated, as today in human medicine is routinely practiced for diagnostic and therapeutic purposes. Suggested Readings Naveen Kumar, Sharma, A. K., Maiti, S. K. and Singh, G. R. (2005). Final Report: Institute Project on Application of Laparoscopy in Clinical Diagnosis and Therapeutics in Veterinary Patients, Division of Surgery, IVRI, Izatnagar, Uttarpradesh-243122.

98

Maiti, S. K., Naveen Kumar, Hoque, M. and Singh, G. R. (2007). Final Report: ICAR Ad-hoc Scheme on Studies on laparoscoic guided biopsy in animals, Division of Surgery, IVRI, Izatnagar, Uttarpradesh243122. Maiti, S. K., Ajith, P., Dutta, A., Naveen Kumar Sharma, A. K. and Ashok K. Sharma (2008). Laparoscopic liver biopsy through cauterization in dogs. The Indian Journal of Animal Sciences, 78: 1338-1341. Anburaja M., Naveen Kumar, S. K. Maiti, A. K. Sharma, Umesh Dimri, Meena Kataria (2009). Laparoscopic sterilization vs. open method sterilization in dogs: a comparison of two techniques, Turkish Journal of Veterinary and Animal Sciences, 33: 427-436. Dutta, A., Maiti, S.K., Ajith, P. and Naveen Kumar (2010). Evaluation of different laparoscopic sterilization techniques in a canine birth control programme. Turkish Journal of Veterinary and Animal Sciences, 34: 393- 402. Ajith, P., Maiti, S.K., Kumar, N. and Sharma, A.K. (2010) Comparative evaluation of laparoscopic vs. ultrasound guided liver biopsy techniques in canines, The Indian Journal of Animal Sciences, 80: 405409. Maiti, S.K., Ajith, P. Dutta, A., Naveen Kumar and Sharma, A. K. (2011). Laparoscopic-assisted olecystocentesis and cholecystocholangiography in canines. Journal of Applied Animal Research, 39: 29-32.

99

LP 3 : III

Recent advances and potential application of mesenchymal stem cells in canine surgery
Amarpal Division of Surgery, Indian Veterinary Research Institute, Izatnagar-243122 (UP)

The subject of stem cell research has attracted tremendous interest of scientists and medical and veterinary professionals in the recent past due to potential application of stem cells in numerous incurable diseases. Stem cells are defined as unspecialized cells having capacity of self-renewal by cell division even after long periods of inactivity, to proliferate extensively, if not indefinitely, and to differentiate into one or more cell/tissue types (Odorico et al., 2001; Pittenger et al., 1999; Koch et al., 2008). Stem cells can be categorized broadly as embryonic stem cells and, adult or tissue-specific stem cells that exist in a number of different fetal and adult tissues. Some specialized adult cells can be reprogrammed genetically to assume a stem cell-like state, called induced pluripotent stem cells (iPSCs). Stem cells can also be classified according to their potency as uni-, multi-, pluri-, and totipotent cells. Mesenchymal stem cells Mesenchymal stem cells (MSCs), originally defined as colony forming units-fibroblastic (CFU-F), were first identified in guinea pig bone marrow in 1970. MSCs have now been isolated from both bone marrow and many other tissue sources, including adipose tissue, synovial membrane, hair follicle, skeletal muscle, dermis, pericytes, trabecular bone, human umbilical cord blood, placenta, lung, dental pulp, amniotic fluid, fetal liver and spleen, and even peripheral blood, suggesting that MSCs are diversely distributed in vivo (Campagnoli et al., 2001; Erices et al., 2000; Int Anker et al., 2004; Lee et al., 2004. The Mesenchymal and Tissue Stem Cell Committee of the International Society for Cellular Therapy proposed a minimal criterion to define human MSCs. First, MSCs must be plastic-adherent when maintained in standard culture conditions. Second, MSCs must be lineage-negative and express (CD105(+)/CD90(+)/ CD73(+), CD34(-)/CD45(-) /CD11b(-) or CD14(-)/CD19(-) or CD79(-) /HLA-DR1(-)). Third, MSCs must differentiate to at least osteoblasts, adipocytes, and chondroblasts in vitro (Brooke et al., 2007) MSCs may differentiate into tissues of mesodermal origin, such as adipocytes, osteoblasts, chondrocytes, tenocytes, skeletal myocytes and visceral stromal cells (Barry et al., 2004; Pittenger et al. 1999). Recent studies indicated that MSCs can also differentiate into tissues of ectodermal (such as neurons) and endodermal origin, such as hepatocytes, thus resembling embryonic stem cells. Cells may be expanded without differentiating up to 40 generations. Use of autologous culture-derived cells requires delayed administration of cells in order to grow a sufficient quantity of cells, while allogeneic cells are associated with risk of rejection and transmission of infectious disease. Interestingly, marrow-derived stem cells appear to enjoy a degree of immune privilege and their use may require minimal need for immunosuppressive drugs (Jung et al., 2005). Mesenchymal stromal cells (MSC) thus show great promise as a biological therapeutic for a diverse range of unmet medical needs. Potential uses in canine surgery Any condition in which there is tissue degeneration can be a potential candidate for stem cell therapies, including spinal cord injury, stroke, burns, heart disease, Type 1 diabetes, osteoarthritis, rheumatoid arthritis, muscular dystrophies, compound fracture, wounds, ligament and tendon injuries, retinal degeneration and liver diseases. Wound healing Culture expanded bone marrow-derived mesenchymal stem cells (BM-MSCs) have been shown to promote the healing of diabetic wounds, implying a profound therapeutic potential for skin defects such as chronic wounds and burns. BMMSC- treated wounds exhibited significantly faster wound closure, with

100

increased re-epithelialization, cellularity, and angiogenesis. In addition to differentiating into keratinocytes and forming appendage-like structures, BM-MSCs in the wound enhance the proliferation of endogenous keratinocytes and increase the number of regenerating appendage-like structures (Wu et al., 2007; Wu et al., 2010). More recently, allogeneic BM-MSCs exhibited similar survival, engraftment, and effect as syngeneic BMMSCs in promoting wound healing. These data are of particular significance in developing MSC based therapies, as recent studies have shown that biological activities and therapeutic potential of BM-MSCs are impaired in elderly individuals and patients with chronic diseases such as diabetes (Urban et al., 2008). Mesenchymal stem cells cooperate with bone marrow cells in therapy of diabetes. Stem Cells 26:244 253). Bone healing On the basis of in vitro observation that MSCs can differentiate into osteocytes and chondrocytes, many attempts have been made to use expanded MSCs for in vivo tissue repair (Krampera et al., 2006). The use of culture-expanded or otherwise purified and concentrated MSCs may therefore be desirable in order to obtain a sufficient number of cells with appropriate osteogenic potential. A number of reports have evaluated the in vitro potential of MSCs from various tissue sources to differentiate towards the osteogenic cell lineages, but the in vivo use of culture-expanded or purified MSCs in clinical cases for enhanced bone repair is scarcely reported. Autologous adipose derived stem cells (ADSCs) (3.2 107 cells) seeded on a composition scaffold made from hydroxyapatite (HA) and chitosan (CH) fibers has been successfully used for the treatment of nonunion of radius/ulna in a cross bred dog (Lee et al., 2009). In one of our studies, 2X106 bone marrow derived stem cells were injected at the site of nonunion in a non-healing fracture of humerus in a Doberman dog. One month later, the animals showed good bony union without the signs of lameness. Cartilage repair MSCs have been used in vivo to repair full-thickness, joint cartilage defects in animal models using various carrier matrices (Wakitani et al., 1994; Sellers et al., 2000). In rabbits, repair of full-thickness defects of joint cartilage was observed after transplantation of autologous MSCs dispersed in a type I collagen gel (Yan and Yu, 2007). Similarly, in the same animal model, encouraging results have been obtained by injecting calcium phosphate and hyaluronan sponge, previously loaded with autologous bonemarrow derived MSCs, in knees with osteochondral defects. Recently, MSCs have been used directly for the repair of OA knees in humans. Potential use of MSCs has been also investigated in a meniscectomy OA model. Local injection of MSCs isolated from caprine bone marrow and labelled with green fluorescent protein (GFP), together with hyaluronic acid, stimulated regeneration of meniscal tissue and retarded the progressive cartilage destruction normally seen in this model of OA. The presence of fluorescent cells in the newly formed menisci testified the contribution of MSC to the repair process. In dogs there are sporadic reports on the beneficial effects of MSC transplantation on osteoarthritis, however, controlled clinical trials are yet to be reported. Ligament and Tendon injuries Induction of MSC differentiation into connective tissues other than bone and cartilage, such as tendons and ligaments, has been investigated for a potential clinical application. Smith et al. (2003) were the first to report on the reimplantation of culture-expanded autologous bone marrow-derived MSCs into a spontaneously occurring core lesion of the superficial digital flexor tendon. This case demonstrated the feasibility of using culture-expanded MSCs therapeutically. Spinal Cord injuries Several studies have suggested that bone marrow cells are a potential source of neural progenitor cells and are clinically important in applications for neuronal tissue repairing (Kim and, 2009 Aug

101

1;87(10):2183-200). Bone marrow-derived MSCs are capable of in vitro differentiation into neurons. They can become neural cells that may support anatomical/functional recovery. A recent study has shown that canine bone marrow-derived MSC can form neurosphere-like clumps and differentiate into neuron-like cells expressing neuronal markers (Tewarie et al., 2009). This makes mesenchymal bone marrow stromal stem cells interesting for strategies for repair of the injured spinal cord in canine. The mesenchymal stem cells were found to have ability to differentiate into oligodendrocytes and other cell types needed to restore neuronal function. Alternatively, they may secrete growth factors that could support neuroprotection and/or axon regeneration. The potential of stem cells to support spinal cord repair has been studied extensively (Harris, 2008). In our study we have recorded functional recovery in several clinical cases of SCI in dogs treated using autologous and allogenic bone marrow derived mesenchymal stem cells. Ischeamic brain injury Damage caused by stroke injury to the central nervous system (CNS) is also a major cause of death and disability worldwide in humans. It was found that transplantation of MSC directly into adult rodent brain was safe and reduced functional deficits associated with stroke (Harris, 2008). This supports the notion that mesoderm-derived cells can adopt neural cell fates and are not limited in their multipotential capacity suggesting that MSC are feasible candidates for the treatment of stroke injury (Burns et al., 2009) . Exogenous stem cells offer the complementary advantages of being available in unlimited numbers with additional control over fate, cell number, timing, and site of delivery. The fact that substantial functional gains have been observed in animal models after delivery of cells of both neural and non-neural origin in preclinical models of ischemic brain injury is encouraging. Myocardial infarcts In dogs, cardiac disease causes significant morbidity and mortality, contributing to over 50% of mortalities in some breeds such as the Cavalier King Charles spaniel. The stem cell therapy would have the following activities; it would minimize loss of cardiomyocytes by reducing cell death, promote return of stunned and hibernating myocardium to normal function, stimulate revascularization of the damaged region by enhancing angiogenesis, and regenerate viable cardiomyocytes thereby preserving contractile function and reducing the opportunity for scarring. In a canine acute myocardial ischemia model, 100106 MSCs were delivered 7 days after acute myocardial infarction (AMI) via intracoronary (IC) and transendocardial (TE) routes. This study suggested that MSC treatment is probably safe and effective after AMI. TE group showed higher cell retention (clusters even in the injury center of the infarct) with an increased vascularity and greater functional improvement than did the IC group (no clusters; cells at the border of the infarct). The higher local cell density in the TE group may be important for therapeutic effectiveness (Emerson et al., 2008). Hepatic applications The existence of liver stem cells within the adult bone marrow was first reported in 1999 and since then it has been confirmed in multiple further studies. MSC can be induced to a hepatic lineage by incubation with specific growth factors such as hepatocyte growth factor (HGF) and have not only been isolated from bone marrow, but can also be obtained from a number of other tissues such as umbilical cord blood and adipose tissue. The effectiveness of systemically administered MSC in the repair and regeneration of liver tissue has been most extensively studied in the carbon tetrachloride (CCl4) model of progressive liver fibrosis in mice (Oyagi et al., 2006; Sakaida et al., 2004; Zhao et al., 2005). The studies documented only limited engraftment of donor MSC in the damaged liver. Applications in solid organ transplantation The use of MSC for preventing acute rejection following solid organ transplantation may have significant advantages, as immunosuppression is coupled with the ability to repair ischaemic damage and therefore MSC transplantation has the potential to target both inflammatory and alloimmune pathways.

102

MSCs exert immunomodulatory effect towards a large number of immune effector cells, including CD4+ and CD8+ T cells, NK cells, B cells, monocytes and dendritic cells (Peroni and Borjesson, 2011). However, results on prolongation of graft survival have been conflicting. Control of infection Sepsis is well recognized in people and dogs and is associated with high mortality rates. In dogs, for instance, reported mortality rates associated with septic peritonitis range from 21% to 68% (Butler and Campbell, 2010). In a study bacteria from the gut were released into the abdomen, resulting in severe infection, inflammation and organ damage throughout the body. Six hours after inducing the infection, approximately half the mice were given an intravenous injection of mouse mesenchymal stem cells, while the other half received a control injection of a saline solution. Both groups of animals also received antibiotics, the standard treatment for sepsis. After five days, 50 per cent of the animals that received the cells were alive, compared to just 15 per cent of the control animals that did not receive the cells. MSCs may have potential application as adjuvant therapy in canines with severe bacterial infection and sepsis. Safety considerations of stem cell-based therapies The safety, both short-term and, in particular, long-term, of stem cell technologies is largely unknown. To date, there have not been any reports of significant adverse reactions to transplantation of BMSCs. However, this could be due to reporting bias. Until clinical efficacy and safety of stem cell therapy is proven, at least, we can assume that these procedures do no harm. Safety concerns to consider include aberrant cell development, teratoma formation and other undesired tissues, and tissue or vehicle contamination with infectious agents or foreign biological and nonbiological substances used in the laboratory processing of the stem cells. Transmission of infectious diseases is of special concern if allogenous cells are being used. The possibility of adult stem cells harboring agents of latent chronic diseases has not been studied and possibility of viral transmission should be considered. Summary It has been shown that MSC may demonstrate plasticity beyond their traditional mesodermal lineage, in that they have been induced to generate, in vitro at least, into tissues of both ectodermal (neurons) and endodermal (hepatocytes) nature, in addition to the mesodermal tissues. Their ease and reproducibility of isolation, high expansion potential and capacity for useful modification using molecular biological engineering techniques, make them good candidates for the repair and regeneration of a large variety of tissues. They have been shown to improve myocardial function, cerebral function (after cerebral infarction), liver damage and joint damage, fracture and nonunion, wound healing, tendon and ligament repair etc. MSC appear to exert their effects through a diverse array of biological mechanisms including transdifferentiation into highly specialised cells and paracrine effects. Their ability to avoid allogenic immunorejection and property to retain their growth and differentiation capability upon prolonged cryopreservation make them prospective off the shelf biological therapeutic agent. References Burns TC, Verfaillie CM and Low WC. (2009). Stem cells for ischemic brain injury: a critical review. J Comp Neurol. 515(1):125-44. Butler, A. L. and Campbell, V. L. (2010). Assessment of oxygen transport and utilization in dogs with naturally occurring sepsis J. Am. Vet. Med. Assoc. 237:167173. Coulter S, Fernandes M R, Willerson J T. (2008). Comparison of intracoronary and transendocardial delivery of allogeneic mesenchymal cells in a canine model of acute myocardial infarction J. Mol. Cell. Cardiol. 44 486495. Harris DT. (2008). Cord Blood Stem Cells: A Review of Potential Neurological Applications. Stem Cell Rev. 4:269274.).

103

Kim SU and de Vellis J. (2009). Stem cell-based cell therapy in neurological diseases: a review. J. Neurosci Res. Aug 87(10):2183-200. Koch TG, Berg LC, Betts DH. (2008). Concepts for the clinical use of stem cells in equine medicine. Can. Vet. J. 49:10091017. Krampera M, Pizzolo G, Aprili G, and Franchini M. (2006). Mesenchymal stem cells for bone, cartilage, tendon and skeletal muscle repair. Bone 39: 678683) Lee HB, Chung YS, Heo SY, Kim NS. (2009). Augmentation of bone healing of nonunion fracture using stem cell based tissue engineering in a dog:a case report. Veterinarni Medicina, 54, (4): 198203 Odorico JS, Kaufman DS, Thomson JA. (2001). Multilineage differentiation from human embryonic stem cell lines. Stem Cells 19:193204. Oyagi S, Hirose M, Kojima M, Okuyama M, Kawase M, Nakamura T, et al. (2006). Therapeutic effect of transplanting HGF-treated bone marrow mesenchymal cells into CCl4-injured rats. J. Hepatol. 44:7428. Peroni, J. F. and Borjesson, D. L. (2011). Inflammatory and immunomodulatory activities of stem cells. Vet Clin Equine 27: 351362. Pittenger MF, Mackay AM, Beck SC, et al. (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284:143147. Ryan J, Barry F, Murphy J, Mahon B. (2005). Mesenchymal stem cells avoid allogeneic rejection. J. Inflammation 2:111.) . Sakaida I, Terai S, Yamamoto N, Aoyama K, Ishikawa T, Nishina H, et al. (2004). Transplantation of bone marrow cells reduces CCl4- induced liver fibrosis in mice. Hepatology 40:130411. Sellers RS, Zhang R, Glasson SS, Kim HD, Peluso D, DAugusta DA, Beckwith K, Morris EA. (2000). Repair of articular cartilage defects one year after treatment with recombinant human bone morphogenetic protein-2 (rhBMP-2), J. Bone Jt. Surg., Am. Vol. 82 151160. Tewarie RSN, Hurtado A, Bartels R H, Grotenhuis A. and Oudega M. ( 2009). Stem CellBased Therapies for Spinal Cord Injury. J. Spinal Cord Med. 32(2):105114) Urban, V. S., Kiss, J., Kovacs, J., Gocza, E., Vas, V., Monostori, E. And Uher, F. (2008). Mesenchymal stem cells cooperate with bone marrow cells in therapy of diabetes. Stem Cells 26:244253.) Wakitani S, Goto T, Pineda SJ, Young RG, Mansour JM, Caplan AI, Goldberg VM. (1994). Mesenchymal cell-based repair of large, full-thickness defects of articular cartilage, J. Bone Jt. Surg. Am. Vol. 76 579592. Wu, Y., Chen, L., Scott, P. G. Edward, E. T. (2007). Mesenchymal stem cells enhance wound healing through differentiation and angiogenesis. Stem Cells: July 2007;doi: 10.1634. Wu, Y., Zhao, R. H. and Tredget, E. E. (2010). Concise review: bone marrow-derived stem/progenitor cells in cutaneous repair and regeneration. Stem Cells 28: 905915. Yan H and Yu C. (2007). Repair of full-thickness cartilage defects with cells of different origin in a rabbit model.Arthroscopy 23, 178187. Zhao DC, Lei JX, Chen R,YuWH,Zhang XM, Li SN, et al. (2005). Bone marrow derived mesenchymal stem cells protect against experimental liver fibrosis in rats. World J Gastroenterol 11:343140.

104

LP 4: III

Canine ascites
Chandrapuria, V. P. Department of Surgery and Radiology, college of veterinary science and A.H. Jabalpur

DEFINITION True ascites refer to accumulation of serous or serosanguinous fluid in peritoneal space attributed to chronic hepatic failure, congestive heart failure, nephritic syndrome, malnutrition, ankylostomiasis, any space occupying lesion in abdominal cavity and protein losing enteropathy in canine. Ascites is always a sign of disease. The leakage of such fluids may derive from blood vessels, internal organs, abdominal masses and lymph nodes. It is common in dogs and endangers the dogs life in extreme cases where large amount of fluid is produced, or rapidly produced. In dog the ascitic fluid may go upto 20 liters. CAUSES Severe liver diseases like hepatitis and liver cirrhosis leads to decreased albumin production or by increased resistance to blood flow within the liver. Congestive cardiac failure, cardiac insufficiency. Peritonitis- inflammation of peritoneum which causes leakage of intestinal contents. Compression of mesenteric vein and lymphatic vessels by large tumor and cyst Infestation of dog by heart worms causing cardiac failure. Bleeding disorder which might be inherited or due to ingestion of poison. Malabsorption of protein and excessive loss of protein through faeces. Retention of sodium due to renal insufficiency. SIGNS Swollen abdomen or abdominal distention will be seen in dog and it may assume a pear shaped appearance. The dog is anemic, pale, and weak with sunken eyes and the ribs are visible very prominently. Dog refuses to eat food and there is increase heart rate. Temperature may remain within the normal range with accelerated respiration rate. Breathing difficulty is seen in the dog and the dog is inclined to lie down. PATHOGENESIS & CLASSIFICATION Liver disease, especially cirrhosis, is the most common cause of ascites, accounting for over 80% of cases. Cancer is the second most common cause, with gastrointestinal tumors, hepatoma, and breast and ovarian cancers being the most frequently encountered malignant lesions. Other causes combined account for less than 10% of cases. With improved diagnosis and treatment of cardiac diseases, heart failure due to ischemia, valvular disease, constrictive pericarditis, and chronic pulmonary disease are less commonly associated with ascites than in the past. Infections such as tuberculosis and chlamydia account for a few cases. Rare causes of ascites include those associated with nephrotic syndrome and chronic pancreatitis. Occasionally, ascites of unclear origin is seen in patients on chronic hemodialysis. Ascites Due to Liver Disease In cirrhosis, ascites develops in the presence of portal hypertension, peripheral vasodilatation, and renal sodium retention. With progression of portal hypertension, the capacity of the lymphatic system is exceeded, resulting in fluid leakage into the peritoneal cavity with formation of ascites. In addition, ascites formation would be further facilitated by hypoalbuminernia resulting in reduced intravascular oncotic forces. By decreasing the intravascular volume, ascites formation would cause sodium and water retention by the kidneys, initiating a cycle of sodium retention and ascites formation. The initial stimulus for sodium retention may arise from hepatic nerve afferents or from altered hormonal levels as a consequence of liver disease. Various neurohumoral mechanisms are activated, stimulating the kidneys to retain sodium and water. Total plasma volume is expanded and ascites develops when a critical expansion occurs in the presence of portal hypertension. The source of these substances may lie in the splanchnic bed, gaining access to the systemic circulation via portosystemic shunts.

105

Ascites Not Associated with Liver Disease In ascites associated with nonhepatic malignant disease, the pathogenesis depends on the type and location of the tumor. In peritoneal carcinomatosis, the most common cause of malignant ascites, leakage of protein-rich fluid from the malignant cells causes exudation of extracellular fluid into the peritoneal cavity. Obstruction of lymph channels by malignant disease may lead to lymphatic rupture and leakage of chyle into the peritoneum. In cardiac failure, elevation of pressure in the right side of the heart results in congestion of the hepatic sinusoids and leakage of fluid from the liver surface. In addition, reduction in effective blood volume leads to sodium and water retention by the kidneys. Pancreatic ascites results from rupture of the pancreatic duct or leakage of pancreatic juice from a pseudocyst. Irritation of the peritoneum by the pancreatic juice can cause pentoneal accumulation of a protein-rich exudate. Biliary ascites forms by similar mechanisms. Chylous ascites forms after transection of lymphatics, such as after abdominal surgery or from obstruction of lymphatic channels by malignant disease, especially lymphoma. Ascites caused by infections such as tuberculosis and chlamydia is probably caused by mechanisms similar to those in penitoneal carcinomatosis. DIAGNOSIS History The history of any toxic diet, long term therapy of drugs or any sevear trauma to dog be relevant. The onset of signs or progression of disease that is acute or chronic is also helpful. Physical Examination Abdominal distention can also be caused by tumors and cysts, bowel obstruction, and excessive intestinal gas. The accuracy of physical examination in detecting ascites depends largely on the amount of fluid present. Flank dullness, which is present in over 90% of patients, is the most sensitive physical sign of ascites. Radiographic Studies Radiologic studies are used if the presence of ascites needs to be confirmed. They also may be helpful in determining the cause of fluid accumulation. Abdominal sonography may detect as little as 100 ml of ascites. This study may help determine the cause of ascites; the appearance of the liver may suggest cirrhosis, a pancreatic pseudocyst can be visualized, and intraabdominal tumors can be detected in the case of malignant ascites. Doppler sonography can detect thrombosis of the portal or hepatic veins. CT is also a sensitive tool in detecting ascites and may provide information that can be difficult to obtain by sonography, such as evidence of peritoneal carcinomatosis, abscesses, and focal liver lesions. Diagnostic Paracentesis Abdominal paracentesis performed to obtain a sample of fluid for analysis is the single most important procedure in evaluating the patient with ascites. Analysis of the Ascites Fluid 1. Gross appearance 2. Protein concentration 3. Portal pressure 4. Cell count 5. Culture 6. Staining 7. Serum assay 8. Cytology

106

Laparoscopy Tuberculous peritonitis can often be diagnosed by laparoscopy only; the procedure should be performed promptly if the clinical picture and analysis of ascitic fluid suggest this disease. Typical peritoneal tubercles are found in most patients and peritoneal biopsies show caseating granulomas in all and acidfast bacilli in 74% of biopsy material. Chlamydial peritonitis may have a similar appearance. This procedure is rarely needed to detect penitoneal carcinomatosis because of the sensitivity of cytology. Complications of Ascites I.Spontaneous Bacterial Peritonitis By definition, SBP results from spontaneous bacterial infection of the ascitic fluid without an apparent intra abdominal source. Most cases are seen in patients in whom ascites is due to cirrhosis of the liver and portal hypertension. II.Hepatic Hydrothorax Hepatic hydrothorax is defined as the presence of a large pleural effusion in a patient with cirrhosis but without primary heart or pulmonary disease. The effusion is usually unilateral on the right side. Ascites is usually detectable but may be absent. III.Umbilical Hernia Abdominal wall hernias, usually umbilical, are common in patients with ascites. Complications such as incarceration, ulceration of the skin, and frank rupture of the hernia can be serious events in a decompensated patient. MANAGEMENT Medical Surgical Preventive Ascites Not Due to Liver Disease Treatment of noncirrhotic ascites is directed at the underlying disease whenever possible. Tuberculous ascites is treated with appropriate antibiotics. Chlamydia-associated ascites is cured by antibiotics and carries a good prognosis. Some patients may respond to medical treatment such as IV hyper alimentation, salt restriction, and diuretics. Infusion of somatostatin, a hormone that decreases pancreatic exocrine secretion, was reported to stop ascites formation in a patient with alcoholic pancreatitis. Surgical or endoscopic intervention may be needed. Ascites Due to Liver Disease Diet and diuretics-Sodium restriction and diuretics are the corner stone of the treatment of cirrhotic ascites. Although one study reported asymptomatic electrolyte and renal impairment after large-volume paracentesis without colloid infusion, other studies have not found such adverse effects. Albumin is given IV in doses of 6-10 g pen I of fluid removed. Alternatively, dextran-70 can be given. Usually 4-6 I are removed daily; however, one study reported the safety of total paracentesis (with albumin infusion) removing up to 22 I in one session. Management of Refractory Ascites Refractory ascites is defined as either persistence of ascites in spite of maximal diuretic therapy and adherence to salt restriction or development of renal insufficiency, electrolyte abnormalities, or other complications of diuretics. Most patients with refractory ascites require large-volume paracentesis at intervals of 2-3 weeks depending on the severity of sodium retention and the amount of fluid removed at each session.

107

Peritoneovenous Shunt The LeVeen shunt was introduced in 1974 for management of ascites. One limb of the shunt lies in the penitoneal cavity and the other in the superior vena cava close to the entrance of the right atrium. A valve at the venous end prevents backflow of blood into the tubing. Peritoneovenous shunts result in rapid resolution of ascites in most patients but are associated with a large number of complications such as disseminated intravascular coagulation, highoutput heart failure, and sepsis. Shunt occlusion with reaccumulation of ascites occurs in 50% of patients within a year. Portosystemic Shunts Surgical portosystemic shunts where the portal vein is used as an outflow tract (such as the sideto-side portacaval shunt and the mesocaval shunt) relieve portal hypertension and are effective in clearing ascites. However, because of the high incidence of hepatic encephalopathy (50% in one study) and of the high surgical mortality in patients with advanced liver disease, this approach is seldom used. Removal of portal flow can be deleterious in a failing liver, and hepatic insufficiency can be precipitated. Transjugular Intrahepatic Portosystemic Shunt Procedure The recently introduced TIPS procedure is a popular treatment for the complications of portal hypertension. In this procedure, a tract is created between branches of the hepatic and portal veins, resulting in an intrahepatic portosystemic shunt with a concomitant reduction in portal pressure. TIPS was also reported to relieve ascites in patients with Budd-Chiari syndrome. Technical complications include hemobilia and biliary vascular fistula, liver hematoma, stent migration, and intraabdominal bleeding. Shunt occlusion or stenosis is a major problem, occurring in close to 50% of patients within a year. Complications related to portosystemic shunting include hepatic encephalopathy, worsening of the hyperdynamic circulatory state, and precipitation of liver failure. PROGNOSIS It is highly unlikely that a dog with chronic hepatitis will ever be cured. The outlook for most dogs with hepatitis is guarded to fair. The prognosis is influenced by the clinical signs of disease at the time the dog is diagnosed, as well as by the extent of liver damage that then exists. If hepatitis is diagnosed early in the course of the disease, and if treatment is started early, survival times may be prolonged. Unfortunately, most dogs with hepatitis are diagnosed only after they develop noticeable symptoms, and this usually happens only after the disease is quite advanced. In those cases, the prognosis for long-term survival is guarded to grave. CONCLUSION Cirrhotic patients with ascites that is not controlled by medical therapy present a serious management problem. History, physical examination, and analysis of the ascitic fluid exclude other causes of ascites. Systemic hemodynamic factors and intra renal abnormalities contribute to the pathogenesis of intractable ascites. Once a patient has been deemed a failure of medical therapy, the decision of surgical therapy, to place a shunt for intractable ascites should weigh the patients functional status as well as the management of post-shunt liver failure. The results of controlled trials now in progress are eagerly awaited. BIBILOGRAPHY Bunch S.E., S.E. Johnson and J.M. Cullen (2001) Idiopathic noncirrhotic portal hypertension in dogs33 cases 1982 -98.J.Am.Vet.med.assoc.218: 3,392-99 Boothe H.W., J.C. Lay and K.J. mareland (1991) Sclerosing encapsulating peritonitis in three dogs J.AmVet.Med.Asssoc.198:2,267-70 Drazner F.H. (1985) The Liver and Billiary Tract, Cited by Gourley I.M. and Vasseur P.B. in General Small Animal Surgery, JB Lippincott Co. Philadelphia pp413-35

108

Franks J.N., Howe L.M. (2000) Evaluation and management of acute abdomen Vet. Med.95 (1):56-69., Hirschberger J. and U.G. Sauer (1991) Clinico-chemical study of body cavity effusions. Tierarztl Prax 19:4,43134 Ingh, TSVD and J. Rothuizen (1982) Hepatoportal fibrosis in three young dogs Vet. Rec.110:25,575-77 Pradhan M. S., Dakshinkar N.P., Waghaye U.G. and Bodkhe A.M., Successful treatment of Ascites of hepatic origin in Dog, Veterinary World, 1(1):23 Dr. Michael Reems The acute abdomen: part I (diagnosis & pathophysiology) & part ii (specific conditions and treatment) Florida Veterinary Medical Association2011 Colin F. Burrows, B.Vet.Med., The Acute Abdomen Canine Portal Caval Shunt from Health Research by Vicki Cooper reprinted from the ASTC Bulletin, NovDec 94. Angelica M. Galezowski, Elisabeth C. R. Snead, Beverly A. Kidney, Marion L. Jackson (2010) C-Reactive Protein as a Prognostic Indicator in Dogs with Acute Abdomen Syndrome Journal of Veterinary Diagnostic Investigation ) 22: 3 ,395-401 Porto systemic shunts in the dog and cat Grace Steenburgen, 2001 edited by Evan Janovitz Orloff J.M., Colin w. and 0. Windsor, (1966) Effect of Portacaval Shunt on Gastric Acid Secretion in Dogs with Liver Disease, Portal Hypertension and Massive Ascites. 164: 1 Rodriguez L.C., M.J.N. San and R.F. Pons (1982) Laparoscopic diagnosis of tubercolous ascites Endoscopy 14:5,178-79 Szatmari, V.P., Stonyi, B. Fenyves and K. Sotonyi (2000) Doppler Ultrasonographic detection of retrograde pulsatile flow in the caudal vene cava of a puppy with cor triatrium dexter Vet Rec 147:3,68-72 Salgado A.B.(2002) ultrasonographic identification of canine liver lobes identificacao das regioes correspondents aos lobos hepatecos de caes por meio da ultra sonografia,83 Tobias K.M.: Portosystemic shunts and other hepatic vascular anomalies. 2003 In Slatter D, ed: Textbook of small animal surgery, ed 3, Saunders, Phil adelphia, , p 727. Tobias K.M., and Rohrbach B.W. (2003) Proportional diagnosis of congenital portosystemic shunts in dogs accessed by veterinary teaching hospitals: 1980-2002, J Am Vet Med Assoc 223:1636, . Upadhaya Sachin kumar (2007) studies on diagnostic modalities for canine ascites M.V.Sc. and A.H. thesis submitted to JNKVV Jabalpur Von Herbay A, Frieling T, Haussinger D. J (2000)Color Doppler sonographic evaluation of spontaneous portosystemic shunts and inversion of portal venous flow in patients with cirrhosis. Clin Ultrasound.; 28(7):332-9 Yvonnne M and D Ross(2004) Management of peritonitis in dogs and Cats In Practice 26;358-67 ZentekJK,Buhl,S,Nolte and Pohlenz(2001) Copper accumulation and liver cirrhosis in german Sepherds with normal dietary copper intake In: Vitamin und der Emahrung von Mensch und Tiergermany pp239-44. Yadav M.P. (2007) Role played by canine as companion pet in the services of mankind in : 4th annual symposium of isacp feb 7 to 9, nagpur Gelen S.G. and L.G. King (1992) post oprative complication and prognostic indicators in dogs with septic peritonitis, 23 cases. J.Am. vet. med. assoc. 204 : 407-14 Hunt G.B. (1993) Ascites and portal hypertension in three dogs with nonfibrosing liver disease. J. small anim. pract. 34:428-33 Sevelius E. (1995) diagnosis and prognosis of cheonic hepatitis and cirrhosis in dogs. J. small anim. pract. 36:12,521-28 Runyon BA, Hoefs JC, Morgan TR. Ascitic fluid analysis in malignancy related ascites. Hepatology 1988; 8 1104-1109 Witte MH, Witte CL, Dumont AE. Progress in liver disease: physiological factors involved in the causation of cirrhotic ascites. Gastroenterology 1971 ;61 :742-750 Lieberman FL Denison EK, Reynolds TB. The relationship of plasma volume, portal hypertension, ascites, and renal sodium retention in cirrhosis: the overflow theory of ascites formation. Ann N YAcadScil97O;70:202-206 Levy M, Wexler MJ. Hepatic denervation alters first-phase urinary sodium excretion in dogs with cirrhosis. Am J Physioll9S7;253:F664-F671

109

L P 5 : III

Current Concepts in Canine Anaesthesia

Ashok Kumar Department of Veterinary Surgery & Radiology College of Veterinary Science, Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar-125004, Haryana

Robert Smith : There are no safe anesthetic agents; there are no safe anesthetic procedures; there are only safe anesthetists The word anaesthesia was coined by Oliver Wendell Holmes, Sr. in 1846. Anaesthesia (Greek anwithout + aisthesis sensation), means the condition of having the feeling of pain and other sensations blocked. This allows patients to undergo surgery and other procedures without the distress and pain they would otherwise experience. Another definition is a reversible lack of awareness, whether this is a total lack of awareness (general anaesthesia) or a lack of awareness of a part of the body such as a spinal anaesthesia or another nerve block would cause (local anaesthesia). Majority of animals fears and resists the restraint necessary for the administration of anaesthetics, thereby increasing not only the technical difficulties associated with administration but also the dangers inseparable from the use of anaesthetics. Anaesthesia is a key component of veterinary medicine for two major reasons: 1. The humanitarian care of surgical patients (Gentle handing and minimal restraint-minimize apprehension and protect the struggling animal from possible injury), and 2. Technical efficiency (Facilitation of procedure to be carried out on animal, and protecting personnel while developing modern surgical science from bites, scratches or kicks as well as the risks of accidental or deliberate self injection with dangerous or addictive drugs. Personnel also need protection from possible harmful effects of breathing air contaminated with very low concentrations of inhalation anaesthetic agents). Anaesthesia is a state of unconsciousness produced by a process of controlled, reversible druginduced intoxication of the central nervous system in which the patient neither perceives nor recalls noxious stimuli. General anaesthesia induces immobilization, relaxation, unconsciousness, and freedom from pain. Anaesthesia is an all-or-none state and there can not be degrees of anaesthesia nor variable depths of anaesthesia. (Hall and Clarke, 1991) Both central nervous system stimulants and depressants can be used as general anaesthetics (Tranquilli et al., 2007). Like surgery, anaesthesia is basically a practical subject and although becoming increasingly based on science, it still retains some of the attributes of an art. PREANAESTHETIC CONSIDERATIONS A comprehensive history and physical examination are the most important components of the preanaesthetic evaluation. Breed Characteristics The Sight hounds are sensitive to barbiturates than mixed-breeds dogs. Brachycephalic breeds have their associated airway problems and can present anaesthetic problems. Toy breeds require special attention to maintenance of body heat. Furthermore, a toy breed requires a relatively greater drug dose per kilogram than does a giant breed. Sex Generally, there is no sex-related difference in the response to anaesthesia. A history of the estrous cycle identifies recent estrus and its associated enlarged and vascularized uterus, which would cause concern for potential blood loss during an ovariohysterectomy.

110

Age Age is an important anaesthetic consideration. Generally the very young (one week) and the aged (more than 80% of the expected life span) do not metabolize anaesthetic drugs as well as the young, healthy patient does (Short, 1984). Healthy geriatric patients should receive sedatives, hypnotics, and tranquilizers at 15 to 30% of the dose given to a comparable young healthy animal. Geriatric dogs should receive intravenous fluids perioperatively to maintain optimal perfusion of the vital organs. In addition to questions concerning organ system function, the owner should be asked about any previous anaesthetic episodes and past and current medication history, including heartworm prophylaxis. The time since the last feeding should be noted. Physical Examination The preanaesthetic physical examination should be methodical together with all body systems, and this should be followed up with the appropriate laboratory test or other suitable diagnostic test(s). The assessment of the animals temperament is critical. A ferocious or aggressive dog requires a different approach to anaesthesia than the quiet relaxed individual. Laboratory Evaluation Young healthy dogs require minimal laboratory tests, haemoglobin (Hb), packed cell volume (PCV) and plasma protein. Middle-aged to older animals should be checked for kidney functions by doing blood urea nitrogen and creatinine. Anaesthetic Risk Anaesthesia is not a naturally occurring state and its induction with drugs is always a threat to the life of the patient. The state of health of the animal: Animals presented for anaesthesia may be fit and healthy or suffering from disease; they may be presented for elective surgery or as emergency cases requiring immediate attention. Physical status of patients should be classified according to relative anaesthetic risk. A system of classification has been adapted from suggestions by the American Society of Anesthesiologists (Dripps et al., 1961). At physical stage I or II, patients are at less risk for anesthetic complications. At physical stage III through V, patients are at relatively greater anesthetic risk. This is not to imply, however, that stage I and II patients are at no risk of unanticipated anaesthetic mishaps. Category I Category II Category III Category IV Category V Category E Normal healthy patient with no detectable disease (e.g. elective neutering) Slight or moderate systemic disease causing no obvious incapacity (e.g. simple fractures) Slight to moderate systemic disease causing mild symptoms (e.g. moderate pyrexia, anaemia or hypovolaemia) Extreme systemic disease constituting a threat to life (e.g. toxaemia, uraemia, severe hypovolaemia, cardiac failure) Moribund or dying patients (e.g. severe uncompensated systemic disturbance) Emergency patient (e.g. accident)

This classification refers only to the physical status of the patient and is not necessarily a classification of risk because additional factors such as species, breed and temperament of the patient add to the risk involved for any particular animal. The surgeon: Inexperienced surgeons may take much longer time to perform a surgery and by rough handling of tissues produce severe and extensive injury to tissues, thereby causing a greater metabolic disturbance. The available facilities: Crises arising during anaesthesia are usually more easily overcome in a well equipped veterinary hospital than under the primitive conditions which may be encountered on farms or field conditions.

111

The anaesthetist: The proficiency and knowledge of the anaesthetist have a profound effect on the extent of risk. Familiarity with anaesthetic techniques leads to greater efficiency and the art of anaesthetic administration is developed only with experience. Concurrent Drug therapy The details of previous drug therapy should be sought as the interactions between drugs are quite common in canine anaesthesia. PREPARATION OF PATIENT Fasting: Healthy dogs should be fasted for at least six hours before being anaesthetized. Water should be withheld for 2 to 4 hours of anaesthesia. Stabilization of Patient: Life-threatening disorders (severe dehydration, hypoproteinemia, anaemia, acidbase and electrolyte disturbances, pneumothorax, oliguria or anuria, congestive heart failure, cardiac arrythmias) should be corrected before administering anaesthesia as far as possible. Venous Access: Advantages of having an intravenous catheter in place include: G Tissue-toxic drugs, such as the thiopentone, can be administered without perivascular administration and subsequent slough. G Intravenous fluid administration is facilitated. G The circulation is immediately accessible in emergency. The most common site for catheter insertion is the cephalic vein. The lateral and medial saphenous veins are also easily accessible. The jugular vein can also be used. Fluid Therapy: The purpose of perianaesthetic administration of intravenous fluids is to maintain vascular volume, which is decreased as a result of anaesthetic drugs, blood loss, and insensible fluid loss. For routine use, a balanced electrolyte solution such as lactated Ringers solution is most suitable, because most fluid loss during anaesthesia is isotonic. The patients disease process may necessitate the use of other fluids, such as normal saline, fluids containing dextrose, or a colloid solution (e.g., whole blood, plasma, or a plasma expander). PREMEDICATION Preanaesthetic drugs aid in restraint, reduce apprehension, decrease the quantity of potentially more dangerous drugs used to produce general anaesthesia, facilitate induction, enhance analgesia, and reduce autonomic reflex activity. Drugs for premedication are usually administered intramuscularly or subcutaneously 15 to 20 minutes before induction. The choice of premedication depends on species, temperament, physical stage, the procedure to be performed, and clinicians preference. For procedures associated with significant postoperative pain, premedication should include an analgesic such as an opioid or alpha2-agonist. When analgesia is provided before initiation of a painful stimulus (pre-emptive analgesia), need for postoperative analgesics is lessened. Antocholinergics, Tranquilizers and Sedatives Drug Atropine Glycopyrrolate Acepromazine Xylazine Medetomidine Diazepam Midazolam Dosage (mg/kg) 0.02-0.04, IV, IM 0.01-0.02, IV, IM 0.025-0.2; IV, IM 0.3-2.2; IV, IM 0.01-0.02; IV, IM 0.2-0.4; IV 0.1-0.3; IV, IM Comments Duration of action is 30 minutes after IV injection Duration of action is 2 to 4 hours minutes after IM injection Mild to moderate sedation, duration 1-2 hours Moderate to deep sedation and analgesia, duration 20-60 minutes Duration of sedation and analgesia is 1-3 hours Most useful when combined with other sedatives, opioids, or ketamine Similar to diazepam

112

Opioids and Neuroleptanalgesic Combinations Drug Morphine Butorphanol Buprenorphine Pentazocine Fentanyl Acepromazine-Butorphanol Comments Mild sedation when used alone, duration 1-4 hours Minimal sedation when used alone Long duration of action, 6 to 8 hours Duration 2 hours Duration 20-30 minutes Can be combined in same syringe, duration 15-60 minutes Acepromazine-Buprenorphine 0.3/0.01; IV, IM Moderate sedation, duration 2-3 hours Midazolam-Butorphanol 0.1-0.2/0.2; IV, IM Can be combined in same syringe, duration 15-40 minutes Xylazine- Butorphanol 0.4-0.6/0.2-0.4; IV, IM Both drugs are reversible, duration 30-40 minutes Fentanyl-Droperidol 0.001-0.007/0.125-0.5 Excellent for aggressive dogs, dose dependent (1.0 ml/10-30 kg); IV, IM sedation, duration 30-60 minutes ANAESTHETIC PLAN The anaesthetic technique depends upon a number of considerations. Some of the commonly used techniques are: 1. Local anaesthesia is usually accompanied by mild to strong sedation. The techniques most commonly used are lumbosacral epidural block, local infiltration or linear block. 2. Injectable anaesthesia may be induced by either the intramuscular or intravenous routes. The intramuscular route is often used with opioids, ketamine, and benzodiazepines. The thiobarbiturates and propofol are always given intravenously. 3. Inhalation anaesthesia is usually initiated after induction of injectable anaesthetics but may be administered from an induction chamber or by use of a face mask. 4. For procedures less than fifteen minutes in duration, the following methods can be used: a. Thiobarbiturates: Thiopentone is relatively inexpensive and suitable for short-term restraint of healthy dogs. The disadvantage of thiopentone is that full recovery usually takes up to one hour and can be associated with ataxia and disorientation. These effects are reduced when the thiopentone is preceded by a tranquilizer, such as acepromazine. Another disadvantage is that it must be administered intravenouslywhich is a problem in fractious or uncooperative animals. b. Propofol/etomidate: These drugs are more expensive than thiopentone and the duration after one bolus dose is shorter, generally less than ten minutes. A sedative or tranquilizer such as acepromazine, xylazine, or diazepam decreases the dose and improves the quality of recovery. c. Neuroleptanalgesic combinations are suitable for short-term restraint for mild invasive procedures or for procedures not requiring general anaesthesia. An advantage is that one or both components of neuroleptanalgesia are reversible, allowing rapid recovery. d. The relatively cumbersome nature of inhalation anaesthesia makes it less suitable for very short procedures. The rapid induction and recovery associated with isoflurane, however, make it the most suitable of the approved inhalants for short-term restraint. 5. For procedures between fifteen to sixty minutes (intermediate duration), the drugs described above can be used and re-dosed to effect. One-third to one-half the original dose is administered to prolong the anaesthetic effect. Inhalation anaesthesia is more appropriate for procedures of intermediate duration. 6. Procedures more than sixty minutes (long duration) are best managed with inhalation anaesthesia. Recovery from halothane and isoflurane anaesthesia is rapid. Even sick and debilitated patients recover from prolonged periods of inhalational anaesthesia relatively quickly. Dosage (mg/kg) 0.2-0.6; SC, IV, IM 0.2-0.4; SC, IV, IM 0.005-0.01; IV, IM 1-3 mg; IM 0.001-0.007; IV 0.05/0.2; IV, IM

113

INDUCTION Induction is usually carried out with thiopentone or propofol. Advantages to this method of induction include rapid loss of consciousness and ability to quickly intubate the patient. Injectable Anaesthetic Drugs Drug Thiopentone Propofol Dosage (mg/kg) 8.0-20.0; IV 4.0-6.0; IV Comments Use lower dosage after premedication 0.4-0.8 mg/kg/minute Duration 5-10 minutes after single bolus dose, apnoea with rapid injection Not useful alone in dogs, lasts 5-30 minutes

Ketamine

2.0-10.0; IV, IM

MAINTENANCE After the loss of consciousness, a properly sized cuffed endotracheal tube is inserted. The initial and subsequent anaesthetic vaporizer settings vary with the condition of the patient, the type of vaporizer, the type of breathing circuit, and the fresh gas flow rate. The relatively high fresh gas flow rate and vaporizer setting that are initially used after induction are decreased to maintenance settings when the palpebral reflex disappears and the heart rate begins to decrease. The vaporizer setting is adjusted according to signs of anaesthetic depth, which include muscle tone (assessed by opening the mouth to its full extent), heart and respiratory rates, and systemic blood pressure. Drug Induction Phase (%) 3 3 4-5 3 Maintenance Phase (%) 1-2 1.5-2.5 2-4 0.5-1.5 Vapour Pressure 243 240 157 23 Blood:Gas solubility coefficient 2.54 1.46 0.68 15.0 MAC (%)

Halothane Isoflurane Sevoflurane Methoxyflurane

0.8-0.9 1.3 2.10-2.36 0.23

RECOVERY Recovery begins when the procedure for which the patient has been anaesthetized is finished and the anaesthetic drugs have been discontinued. Antagonists of Various Classes of Sedative Drugs Drugs Dosage, mg/kg Alpha2 Adrenoceptors Yohimbine 0.1-0.2; IV, IM Atipamizole 0.04-0.05, IM Tolazoline 0.2-1.0, IV Benzodiazepines Flumazenil 0.2-5.0; IV Opioids Naloxone 0.003-0.01; IV, IM Monitoring of patient should be regularly done during the recovery period until the patient is alert and extubated and the heart rate, respiratory rate, and body temperature have returned to normal. Sick or debilitated dogs should get additional oxygen during recovery. Shivering signifies increased oxygen consumption. Some loss of body heat is unavoidable during anaesthesia and surgery, and the patient should be warmed during recovery. The endotracheal tube cuff should be deflated and the gauze securing the tube should be untied when the patient is disconnected from the anaesthetic machine. This permits extubation when the patient

114

rapidly awakens and begins chewing the tube. Dogs should be extubated as soon as the swallowing reflex returns, unless there is some specific contraindication to removing the endotracheal tube. Dogs should be constantly observed when the endotracheal tube is still in place. REFERENCES Short, C. (1984). Drug disposition in neonatal animals. J Am Vet Med Assoc. 184: 1161-1162. Dripps, R.D.; Lamont, A. and Eckenhoff, J.E. (1961). The role of anesthesia in surgical mortality. J. Am. Med. Assoc. 178: 261-266. Hall, L.W. and Clarke, K.W. 1991. Veterinary Anaesthesia. 9th edition, Bailliere Tindall, UK. Tranquilli, W.J.; Thurmon, J.C and Grimm, K.A. 2007. Lumb & Jones Veterinary Anesthesia and Analgesia. 4th edition. Blackwell Publishing, Iowa, USA.

115

L P 6 : III

Stem cell therapy for clinical wound healing in dogs

Indramani Nath and Subharaj Samantara Department of Veterinary Surgery and Radiology, College of Veterinary Science and Animal Husbandry, Odisha University of Agriculture and Technology, Bhubaneswar 751 003, Odisha,

Introduction Stem cell therapy is an evolving specialty, todays most challenging task of the scientists across the globe - medical, veterinary, dental, biotechnology and life sciences. Although many successful achievements have been made to alleviate pain and diseases, stem cell therapy is yet to gain the expected levels of momentum to be translated clinically or address the apprehensions of the common man due to various issues like ethical, scientific, legal, cost factor as well as clinical trials. This is one science where in the above scientists work on a single common platform to benefit the human and veterinary patients. Unlike remedies in the form of (i) a pill or injection which would destroy an organism causing an infection by making available, a chemical at a prescribed concentration in the serum or (ii) a surgery which would remove an abnormal growth or correct a birth defect or (iii) an Interventional procedure which will remove the block in a heart vessel to treat an ischemic heart disease or (iv) a radiotherapy or hyperthermia which delivers radiation or heat waves to destroy a tumor, the stem cell therapy deals with cellular damages using cells themselves as a tool for treatment, thereby adding an additional tool of stem cells or progenitor cells or mature adult cells with regenerative capability to physicians, surgeons, interventional specialists or radiotherapists to tackle diseases which otherwise dont have a definitive treatment with any of the four above mentioned existing modalities of allopathic treatment. What Are Stem Cells? Stem cells are the raw material from which all of the bodys mature, differentiated cells are made. These are a special group of undifferentiated cells possessing two basic properties. They are capable of self maintenance and differentiating into specialized tissue forming cells and have considerable proliferative potential which allows them to divide several times and to be maintained as a cell population throughout the life of multi-cellular body. Unlike when a normal cell divides which divides into two daughter cells of similar nature, stem cell divides into one daughter stem cell and another progenitor cell. By this asymmetric division which is one of the hallmarks of stem cells, the stem cell lineage is maintained for a long duration of time. In addition in many tissues they serve as a sort of internal repair system, dividing essentially without limit to replenish other cells as long as the animal is still alive. Types of Stem Cells There are two types of stem cells Embryonic (also called pluripotent) stem cells are capable of developing into all the cell types of the body. Adult stem cells are less versatile and more difficult to identify, isolate, and purify. 1. Mechanism of stem cell therapies 1.1. The 4R phenomenon Stem cell therapy tries to set right the damages that has occurred to those cells by (i) Replacing the damaged or lost cells with new cells. or (ii) Making directly or indirectly, new cells grow in the same area thereby regenerating the tissue to undertake the work load of the damaged or lost cells. or (iii) By rejuvenation of existing cells. or (iv) By repairing of the damaged cells. The cells used for the above tasks of replacement, regeneration, rejuvenation or repair could be achieved by one of the following methods

116

Multipotent or Pluripotent cells which upon transfusion into the area of the damage could convert themselves into the damaged or lost cells; (ii) Differentiating the multipotent/ pluripotent cells in vitro into the cells damaged which then could be directly transplanted to the affected area without further need for differentiation in situ. (iii) Taking the Unipotent cells from normal tissue of same type, in vitro expand them and apply in the affected area of the same type of tissue. (iv) Mature adult cells which are either defective or lesser in quantity or degenerate with aging could be taken from the same patient, expanded in the lab and reinjected. 1.2. Bone marrow (BM) derived mesenchymal stem cells (MSCs) BM derived MSCs represent a promising population for supporting new concepts in cellular therapy. Autologous bone marrow derived stem cells is one of the major sources of the stem cells in post-natal life which has been shown to differentiate into most of the adult organ cells which is the source of our clinical wound healing. The bone marrow contains two major group of stem cells 1. Hematopoietic stem cells (HSC) and Mesenchymal stem cells (MSC) or Bone marrow stromal cells. Though HSCs are known for producing vascular components and blood cells and MSCs for the capabilities to help in organogenesis, the research groups working on each of them have recently come out with experimental findings that each of them can perform both vasculogenesis and organogenesis. Adult bone marrow (BM) contains nonhematopoietic mesenchymal stem cells (MSCs), a population of multipotent progenitors capable of differentiating into cells of numerous tissue lineages in the appropriate microenvironment. 1.2.1. Collection of Bone Marrow (BM) BM sample should be aspirated aseptically from the shaft of long bones like femur, humerus, tibia and radius of the canine patients under sedation in a syringe and should be poured in a vaccumised EDTA container and mixed thoroughly to prevent clotting. The vials should be placed in 4 0C temperature and sent to the laboratory. 1.2.2. Culture of the collected bone marrow stem cells The collected sample should be layered on histopaque and centrifuged at 2000 rpm for 20 min, and the supernatant should be discarded. After centrifugation buffy coat layer can be collected in a pipette. MNCs can be isolated from buffy coat cells by layering onto a Ficoll-Hypaque density gradient and can be plated onto T75-cm3 flasks and can be seeded in two wells of gelatin coated plates in a culture medium containing Dulbecco-modified Eagle medium (DMEM), low-glucose medium, 15% knock-out serum, 200mM Glutamax, penicillin (100 unit/mL), and streptomycin (100 mg/mL) at a temperature of 370C in a humidified atmosphere, containing 5% CO2 in such a manner so that the seeding density should be 1 x 105 cells per ml and one well can be left as control. The BMMNCs cultured in DMEMlow-glucose medium will maintain typical morphology until P1. After seeding, plates should be placed in incubator. Cells should be observed regularly under an inverted microscope and the non-adherent cells should be removed after 48h of culture and fresh medium should be added subsequently after every 48h. At day 2, the rounded cells will show attachment and small elongated morphology, and at day 3 of culture they will attain confluence. On day 5 of culture, many of the plates will contain spindle-shaped cells, and within a week the cells will reach around 90%confluent. Once the cells become 80% confluent (phase contrast view at 10 x), they should be counted with a hemocytometer and dissociated with 0.25% trypsin/0.53mM EDTA and reseeded at the rate of 1X105 cells/cm2 plated on a T75-cm2 flask. The population doubling time is generally 72 h after seeding of cells. Culture medium should be sampled via a sampling port 48 h prior to harvest to test for bacterial, fungal, and endotoxin contaminants. The short-term culture plates at days 5 and 7 should be tested with the Trypan Blue dye exclusion test for viability and then used in cell therapy after screening for presence of any endotoxin. 1.2.3. Harvesting of the cultured bone marrow stem cells The cultured cells suspension should be harvested by a standard trypsinization method at days 5 7 according to their viability and confluence. Cell count should be done before implantation and it should be around 4560X106/mL of suspension at the time of harvesting. The harvested cells then can be washed several times with Dulbecco phosphate-buffered saline (DPBS) to remove any culture contaminants. The cell pellet then can be washed several times in preservative-free saline solution and finally should be

(i)

117

suspended in 56mL of normal saline to be applied to the wound. Then it should be spun at 2000 rpm for 5 minutes in spinner. The bone marrow derived stem cells can be collected in sterilized Eppendorf tube and dispatched in 40C. 1.2.4. Implantation of stem cells into the chronic non-healing wounds Prior to the application of cultured cells, the wound should be properly debrided to allow cultured cells to come into contact with viable wound tissue. The MSC suspension can be administered via a syringe with a 25-gauge needle along the edges of chronic non-healing wounds on the average of >1X106 cells applied per cm2 of wound area. Cultured cells can also be placed topically on the wound. The aspirate should be held in place with a dressing, and a bolster of rolled gauge pads can be placed over the dressing and around the wound to prevent leakage of the cells. The dressing should be replaced every day in the same manner till healing of the wound. 2. BM derived mesenchymal stem cells (MSCs) and their clinical application MSCs are thought to be promising candidates for novel cell-based therapeutic strategies, such as the repair of mesenchyme derived tissues. In veterinary practice stem cell therapy is mainly used for chronic wound healing at present. These can also be used for regeneration of spinal cord injury due to their plasticity, availability, ease in isolation, expansion, lack of potential to form tumors and their unique characteristics of immunosuppressive property MSCs also secrete a variety of bioactive factors enabling tropic activity and reconstructing of the regenerative micro environment. The stem cells transplanted into the injured lesions differentiates into oligodendrocytes and astrocytes, integrate into axonal pathways and regenerate and remyelinate the injured axons. 3. Advantages of stem cell therapies in chronic wound healing MSCs are the best therapeutic agents for chronic non-healing wounds because of their homing mechanism to the site of injury and quick healing ability. BM-derived MSCs also contribute to vascular healing and remodeling under physiologic and pathologic conditions. In chronic wound healing, the effect of delivering BMderived cells to wounds affect primarily the dermis and subcutaneous tissues accounting for the wound healing. 4. Ethical and Scientific issues concerned with Stem cell therapy In India, the ethical and scientific issues concerned are governed by a guideline issued by the Indian Council of Medical Research (ICMR) according to which adult autologous stem cells in clinical applications are under permissible category as an experimental therapy and to be approved by the Institutional Ethics Committee (IEC) and the Institutional Committee for stem cell research and therapy (IC-SCRT). 5. Conclusion Although there is growing enthusiasm for therapeutic and diagnostic application of BM-derived progenitors, there is a possibility that transplanted precursors or BM cells may participate in the pathogenesis of unexpected diseases. Recent, reports suggest that the autologous transplantation of BM MSCs is safe and effective for achievement of therapeutic angiogenesis in chronic wound healing. We have founded that autologous implantation of BM-derived MSCs is a simple, safe, and effective therapy for chronic nonhealing wounds. References Abraham, S.J.K., Basics of stem cells, regenerative medicine and induced pluripotency. Second International Seminar on Frontiers of Stem Cell and Biotechnology in Human and Veterinary Medicine, pp: 1-7, 18th19th July 2011. Madras Veterinary College, Chennai 600 007, India. Das NR, Dash SN, Routray P, Mohapatra S and Mohapatra PC. 2009. Targeting Nonhealing Ulcers of Lower Extremity in Human through Autologous Bone Marrow-Derived Mesenchymal Stem Cells. Rejuvenation Research. 12(5): 359-366. www.stemcellaction.org

118

L P 7 : III

Latest concepts of acupuncture for physiotherapy in canine practice

A.K. Srivastava Department of Veterinary Surgery, Faculty of Veterinary Medicine, JIGJIGA University, JIGJIGA, Ethiopia.

Animal Physiotherapy (Physical Therapy) is a complementary therapy. It is the vets job to diagnose an injury and treat it accordingly. The physiotherapist can then be brought in and under the vets guidance, continue after care and aid healing. Animal Physiotherapy is an essential reference guide for physiotherapists looking to apply the proven benefits of physiotherapy to the treatment of companion and performance animals. Animal Physiotherapy is a growing profession of physiotherapists who have broadened their expertise from the well-established human sphere to animals. The positive perception of physiotherapy in the human sphere, together with an increased awareness of options and expertise available for animals has resulted in a strong demand for physiotherapy for animals. Physiotherapy encompasses many different techniques. These include both the skilled use of the physiotherapists hands and the use of modern therapeutic modalities Physiotherapy encompasses many different techniques. These include both the skilled use of the physiotherapists hands and the use of modern therapeutic modalities. The one of important modalities is Acupuncture. Brief explanation of mechanisms of acupuncture Acupuncture is a very old therapy, which has been based upon traditional Chinese philosophy and has been practised for 5000 years for pain relief and treatment of clinical disorders in man and domestic animals (Rogers et al 1977, Glardon 1982, He 1987). Traditional Chinese philosophy is a completely different kind of knowledge from western scientific methods, with a singular philosophical concept, which does not come within the bounds of the common scientific understanding. Acupuncture is a remarkable subject, given its ability to have survived thousands of years supported by explanations and concepts that are far from western scientific beliefs. Scepticism is unhelpful and proper scientific investigation is a good approach to bring acupuncture to its rightful place in order to make a widespread use of its therapeutic properties. Extensive literature concerning the effects of acupuncture and its possible mechanism of action has been published and good reviews regarding the hormones and neurotransmitters involved in the acupuncture effect can be found in Han et al (1980), He (1987) and Kho and Robertson (1997). Acupuncture-induced hypoalgesia is the aspect that has been most widely studied, probably because this is one of acupunctures most important effects and is relatively easy to demonstrate. In the western world, Kothbauer (1975) was the first one to describe the use of acupuncture analgesia for caesarean section in cows. In the last two decades, attempts have been made to place acupuncture in a form understandable by western mentality and a substantial part of the studies designed to explain the physiological basis of acupuncture have been involved with pain assessment. Acupuncture is not able to abolish pain completely, but the hypoalgesia produced can be sufficient for certain surgical procedures and is very useful for treatment of pain originating from a variety of disorders (He 1987). The first point to be discussed however, regards the acupuncture point. Why is necessary to needle a specific point to produce the acupuncture effect? Why should needling of non-acupuncture points not cause the same effect? Needling itself may increase the pain threshold but needling the acupuncture point is more effective in elevating pain threshold and tolerance (Berlin et al 1975, Pauser et al 1975, Stacher et al 1975, Stewart et al 1977). Injection of micro-doses of prostaglandin was successful to induce luteolysis in mid-luteal phase mares, only when administered at specific acupoints. Luteolysis was not induced when higher doses were injected in non-acupunture points close to real points (Alvarenga et al 1998). False acupoints located very close to real acupoints did not increase gastric motility and pressure as did real acupoints (Luna & Joaquim 1998, Luna et al 1999).

119

The acupuncture point shows some different physical, physiological and histological aspects when compared with the surrounding areas. They have a lower electrical resistance, even in dead tissue, and they have a different microscopic structure with regard to the nervous and vascular supply (Rabischong et al 1975). When compared to surrounding areas, the acupoints have a greater concentration of mastocytes, linfatic vessels, capilaries, vennules, arterioles and nervous endings. They are composed of spiral vases surrounded by cholinergic fibers and the diameter ranges from 2 to 8 mm (Kho & Robertson 1997). Needling of acupoints produce release of bradicinine, hystamine, substance P, leucotriens, prostaglandin and platelet activation factor. Studies performed with cintigraphy demonstrated that radioative isotopes, like Tecnecium, injected at acupoints may be distributed along meridians (Kovacs et al 1992). The hypodermic injection of 99mTc into points of low electrical resistance was distributed to a specific pathway, with rapid and longitudinal migration, which was not a result of diffusion of the tracer through nerves, veins or lymphatic vessels, and the trajectory coincided with the acupuncture meridian. Involvement of the nervous system in the acupuncture effect Acupuncture action appears to be related to a combination of neurological and humoral mechanisms (McLennan et al 1977, Rogers et al 1977). The acupuncture meridians usually follow the main nerves and acupoints are closely related to the nerve branches. Acupuncture analgesia fails to develop after local anaesthetic infiltration, nerve block of the nerves inervating the site of the needle application, spinal block or nerve section proximal to the point, implying a dependence on peripheral sensory receptors (Rogers et al 1977, Kitchell 1980). Needling of isolated nerves may produce the same analgesic effect than needling the acupoint. Acupuncture stimuli from the peripheral nerve may affect many sites in the central nervous system, both spinal and supra spinal, among them: spinal cord, the nucleus raphe magnus in the ventromedial medulla, arcuate nucleus and preoptic area in the diencephalon, caudate nucleus and limbic nucleus in the forebrain, periaqueductal grey, nuclei magno-cellularis, parafascicular nucleus, hypothalamus, thalamus, reticular formation and others, implicating an intricate pain complex in the CNS (McLennan, Gilfillan and Heap 1977, Pomeranz, Cheng and Law 1977, Han et al 1980, Zou et al 1980, He and Xu 1981, He 1987). Acupuncture analgesia and stress A major factor that might be associated with the endocrine aspects of acupuncture is stressinduced analgesia. Electroacupuncture is a stimulus that could be considered unpleasant, and thus act as a stressor. Needles are inserted and an electrical potential may be applied, usually in a strange environment. Pro-opiomelanocortin-derived peptides (ACTH and -endorphin ) are released during stress and these are known to produce analgesia (Takeshige et al 1992). The hypothesis that acupuncture leads to stress-induced analgesia has been raised (Liao et al 1979, Lee et al 1982) and plasma cortisol, which is known to increase in response to a stressor, was elevated in man (Stellpflug et al 1978) and horses (Cheng et al 1980, Bossut et al 1983) submitted to acupuncture. Like acupuncture, stress-induced analgesia can also be opioid and non-opioid related. The two different kinds of analgesia usually occur in sequence, a temporary non-opioid analgesia accompanied by a prolonged and intense opioid one, according to the intensity and duration of the stress-induced stimulus. Acupuncture on its own can increase pituitary adrenocortical activity and secretion of ACTH and cortisol, which could indicate a stress response (Liao et al 1979, Lee et al 1982). Increases in plasma cortisol concentrations were observed in horses submitted to acupuncture (Cheng et al 1980, Bossut et al 1983). Plasma cortisol concentrations during gynaecological operations with conventional anaesthesia using enflurane were markedly lower than with electroacupuncture analgesia (Stellpflug et al 1978). Chapman et al (1983) and Umino et al (1984) suggested that the -endorphin release during acupuncture could be related to stress. Luna et al (1999) aimed to study the potential role of endogenous opioids in mediating some effects of acupuncture by measuring central (cerebrospinal fluid), pituitary (pituitary venous effluent) and periph-

120

eral opioid concentrations in response to acupuncture, including evaluation of the relationship and relative contribution of each of these sources. Secondly, was to investigate whether acupuncture per se caused any stress response that would suggest its effect dependent on stress-induced analgesia, as suggested by some studies in horses (Cheng et al 1980, Bossut et al 1983). Finally the relation of the hormonal response to the frequency of stimulus was studied. Electrical stimulation of Lung 1 (Qiang Feng), Bladder 23 (Shenshu) and Stomach 36 (Tsu San Li) acupoints, using a square waveform, biphasic alternating current 9V stimulus was performed for 50 minutes. A frequency of 9 Hz was used for 30 minutes, followed by 55 Hz for 20 minutes. Opioids, other peptides, cortisol and catecholamines were measured before and during electroacupuncture at the cerebrospinal fluid and pituitary effluent and peripheral blood. Few changes were observed for -endorphin and dynorphin, but peripheral plasma met-enkephalin concentration increased 100% after 50 minutes, which suggests that acupuncture caused met-enkephalin release from peripheral sources only (Stein et al 1997), showing that this opioid appears to be one of the most important for electroacupuncture-induced analgesia (Han et al 1984b, Zhou et al 1990, Chen and Han 1992). The frequency of stimulation did not seem crucial in terms of selective release of met-enkephalin or dynorphin in ponies. Pituitary is unlikely to be important in contributing to the analgesic effect of acupuncture in ponies. Fu et al (1980) showed that hypophysectomy did not change the inhibition of writhing caused by electroacupuncture in mice. CSF, peripheral and pituitary ACTH, catecholamines and cortisol concentrations were not modified by electroacupuncture, suggesting that electroacupuncture is not stress-induced analgesia and does not cause any endocrine response which could be related to stress. Color Light Therapy OR Color Acupuncture This is a new and growing practice. Just as acupuncture is a very old system of medicine being rediscovered, so is light therapy, or phototherapy, a new old system, which promises to come further into the limelight. Phototherapy was practiced in ancient Egypt, Greece, China, and India. The Egyptians utilized sunlight as well as color for healing. In the past 120 years, great strides have been made in research and development of colored light as well as full spectrum light therapy. Conclusions Acupuncture (Physiotherapy) is an exciting and rapidly expanding area that will become increasingly important over the next decade, particularly as the general population and pet owners become more interested in natural remedies rather than constant drug therapy. Acupuncture has survived for 5000 years and is still in use as one therapeutic option for a wide range of diseases. It has merits which cannot be ignored, but it is an individual therapy, where each case must be considered on its own merits, because standard prescriptions do not work for all patients. Although traditional Chinese medicine is not compatible with modern western medical thinking, acupuncture is based upon a search for the equilibrium or cure of disease and usually cannot be expected to create an imbalance in the organism. The above considerations suggest that working with healthy animals may lead to unsatisfactory results with acupuncture, which does not mean that acupuncture does not work in sick animals. Although it is difficult to comprehend fully its mechanism of action, it is necessary to treat acupuncture with respect. The mechanism of action of many drugs has not been explained yet (e.g. volatile anaesthetics), but they are largely used. More research on acupuncture is needed in order to comprehend its mechanism of action, but other approaches should be considered, such as more controlled clinical trials and unconventional methods of evaluation. Usually simple studies lead to better conclusions. The exchange of ideas and experience is vital, and as acupuncture is basically a method of diagnosis and therapeutics, studies should be applicable to clinical practice and clinical studies should be encouraged. Creation and intuition are part of acupuncture, and maybe some acupunturists have a greater ability to heal than others, but with standard methods, acupuncture will be used in a larger scale, being beneficial to a larger number of patients.

121

ACUPOINTS USED FOR ANALGESIA IN SMALL ANIMALS Region HEAD Teeth Points General: Li4, Li7 Lower teeth: St6 and St18 Upper teeth: St5 TH5, TH21, Si19, GB2, Li4, B60, GB34 St36, Sp6, Li4, Bai Hui St36, Sp6, Sp9, Li4, Bai Hui Sp6 St36, Sp6, Pc6, Li4, GB34, B11 Local points cranial and caudal to the lesion, extra points TH14, B11, Si3, Si9, Li4 Li15, Si11, GB20, GB34 TH5 TH3, Si8, Li15, H3, Pc3, L5 Li15, Pc3, Pc6 TH3, Si8, Pc6, Pc8, Li7 Si3, Li11 Li3, Li4 B11, B40, GB34 B 40, B54, GB29, GB30, L3, GV1, GV3 GB33, L8, Sp9, St35 B40, B60, S35, St41, GB39, Sp6, Sp9 B62, Sp3, Sp6, St41, St44, B60, K3

Mandible ABDOMEN Laparotomy Cesarean Vagina THORAX Toracothomy (pos-operative analgesia) LUMBAR FORELIMB General Scapula Humerus Humerus radial joint Radius/ulna Carpus Distal lateral side Distal medial side HIND LIMB General Hip joint and femur Stifle joint Tibia/fbula Tarsus Local points should also be used

Reference Alvarenga, M.A., Ferreira, J.E.P., Meira, C., Luna, S.P.L., Burns, P.J. (1998) Induction of luteolysis in mares utililizing a micro-dose of prostaglandin in the sacral lumbar space (Bai Hui Acupoint). Equine Vet Sci 18: 167-168. Berlin, F.S., Bartlett, R and Black, J.D. (1975). Acupuncture and placebo: effects on delaying the terminating response to a painful stimulus. -Anesthesiology, 42: 527531. Bossut, D.F.B., Leshin, L.S., Stromberg, M.W. and Malven, p.v. (1983). Plasma cor1isol and beta-endorphin in horses subjected to electroacupuncture for cutaneous analgesia. Peptides, 4: 501-557. Chapman, C.R, Benedetti, C., Colpitts, Y.M. and Gerlach, R (1983). Naloxone fails to reverse pain threshold elevated by acupuncture: acupuncture analgesia reconsidered. Pain, 16: 13-31. Chen, X.H. and Han, J.S. (1992). All three types of opioid receptors in the spinal cord are important for 2/15 Hz electroacupuncture analgesia. Eur. J. Pharmac., 211: 203210.

122

Cheng, R, McKibbin, L., Roy, B. and Pomeranz, B. (1980). Electroacupuncture elevates blood cortisol levels in naive horses; sham treatment has no effect. Int. J. Neurosci., 10: 95-97. Fu, T.C., Halenda, S.P. and Dewey, W.L. (1980). The effect of hypophysectomy on acupuncture analgesia in the mouse. Brain Res., 202: 33-39. Glardon, O. (1982). Pain relief with acupuncture. J Ass. vet. Anaesth., 10: 68-72. Glardon, O. (1988). Variation du taux de cortisol plasmatique chez Ie cheval apres acupuncture. Prato Vet. Equi., 20: 32-34. Han, J.S., Tang, J., Ren, M.F., Zhou, Z.F., Fan, S.G. and Qiu, X.C. (1980). Central neurotransmitters and acupuncture analgesia. Am. J. Chin. Med., 8: 331-48 .. Han, J. S., Xie, G.X., Zhou, Z.F., Folkesson, R. and Terenius, L. (1984b). Acupuncture mechanisms in rabbits studied with microinjection of antibodies against beta-endorphin, enkephalin and substance P. Neuropharmacology, 23: 1-5. He, L. (1987). Involvement of endogenous opioid peptides in acupuncture analgesia. Pain, 31: 99-121. He, L. and Xu, S. (1981). Caudate nudeus and acupuncture analgesia. Acupunct. Electrother. Res., 6: 169182. Kho, H-G. & Robertson, E.N. (1997) The mechanisms of acupuncture analgesia: review and update. Am. J. Acup., 25: 261-281. Kothbauer, O. (1975) Ein kaiserschnitt bei einer Kuh unter Akupunkturaanalesie. Wiener Teirarztliche Monatsschrift, 62: 394-396. Kovacs, F.M., Gotzens, V., Garcia, A, Garcia, F., Mufraggi, N., Prandi, D., Setoain, J., Roman, F.S. (1992) J. Nucl. Med., 33: 403-407. Lee, S.C., Yin, S.J., Lee, M.L., Tsai, W.J. and Sim, C.B. (1982). Effects of acupuncture on serum cortisol level and dopamine beta-hydroxylase activity in normal chinese. Am. J. Chin. Med., 10: 62-69. Liao, Y.Y., Seto, K., Saito, H., Fujita, M., Kawakami, M. (1979). Effect of acupuncture on adrenocortical hormone production: I. Variation in the ability for adrenocortical hormone production in relation to the duration of acupuncture stimulation. Am. J. Chin. Med., 7: 362-371. Luna, S.P.L. & Joaquim, J.G.F (1998) Effect of electroacupuncture on intestinal motility in dogs. Proc 24th Ann International Congress on Vet Acup, Chitou, Taiwan, 1998, pp 134-136. Luna, S.P.L., Miranda, J.RA, Joaquim, J.G., Morais, R, Stelzer, M., Gomes, F.R. (1999) Effect of acupuncture and electroacupuncture on gastric contraction activity measured by alternate current susceptometry and manometry in dogs. Proceedings of the I Brazilian Congress of Veterinary Acupuncture, Sao Paulo, Brazil, 1999. McLennan, H., Gilfillan, K. and Heap, Y. (1977). Some pharmacological observations on the analgesia induced by acupuncture in rabbits. Pain, 3: 229-238. Pauser, G., Reichmann, C., Baum, M., Benzer, H., Haider, W. and Thoma, H. (1975). The influence of acupuncture analgesia on the sensation and feeling of pain and the autonomic state of the organism. Wien KJin. Wochenschr., 87: 25-28.

123

Pomeranz, B., Cheng, R and Law, P. (1977). Acupuncture reduces electrophysiological and behavioural responses to noxious stimuli: pituitary is implicated. Expl. Neurol., 54: 172-178. Rabischong, P., Niboyet, J.E., Terral, C., Senelar, R. and Casez, R. (1975). Experimental basis of acupuncture analgesia. Nouv. Presse Med., 4: 2021-2026. Rogers, P.AM., White, S.S. and Ottaway, C.W. (1977). Stimulation of the acupuncture points in relation to therapy of analgesia and clinical disorders in animals. Vet. Annual, 17: 258-279. Stacher, G., Wancura, I., Bauer, P., Lahoda, L. and Schulze, D. (1975). Effect of acupuncture on pain threshold and pain tolerance determined by electrical stimulation of the skin: a controlled study. Am. J. Chin. Med., 3: 143-149. Stein, D.J., Birnbach, D.J., Danzer, B.I., Kuroda, M.M., Grunebaum, A, Thys, D.M. (1997) Acupressure versus intravenous metoclopramide to prevent nausea and vomiting during spinal anetshesia for cesarean section. Anesth. Ana/g., 84: 342-345. Stellpflug, H., Wickings, E.J. and Nieschlag, E. (1978). Operative stress during electroacupuncture and enfluorane anaesthesia assessed by serum cortisol. Prakt. Anaesth., 13: 483-488. Stewart, D., Thomson, J. and Oswald, I. (1977). Acupuncture analgesia: an experimental investigation. Br. Med. J., 1: 67-70. Takeshige, C., Nakamura, A, Asamoto, A and Arai, 1. (1992). Positive feedback action of pituitary betaendorphin on acupuncture afferent pathway. Brain Res. Bull., 29: 3744. Umino, M., Shimada, M. and Kubota, Y. (1984). Effects of acupuncture anesthesia on the pituitary gland. Bull. Tokyo Med. Dent. Univ., 31: 93-98. Zhou, Y., Luo, F., and Han, J. (1990). Enkephalinase inhibitors acetorphan and SCH34826 potentiate the analgesic effect of low frequency acupuncture in rats. Chen Tzu Yen Chiu., 15: 310-314. Zou, G., Yi, Q.G., Wu, S.X., Lu, Y.X., Wang, F.S., Yu, Y.G., Ji, X.Q., Zhang, Z.X. and Zhao, D.O. (1980). Enkephalin involvement in acupuncture analgesia-radioimmunoassay. Sci. Sin., 23: 1197-1207.

124

Abst1: III

Removal of thoracic oesophageal obstruction through gastrotomy approach in a dog under IITV control
T K Gahlot, M C Parashar, K Kachwaha and S M Qureshi Department of Veterinary Surgery and Radiology College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001, Rajasthan. INDIA

A male bull dog aged 4 years was brought to surgery clinic with history of ingestion of rubber ball causing obstruction to the thoracic oesophagus. A lateral radiograph of thoracic region confirms the diagnosis. An attempt to push the ball by a goats stomach tube through the cardia in to the stomach under the general anaesthesia was not successful. A gastrotomy operation was performed through left flank under general anaesthesia. The stomach tube was again passed in to the oesophagus per orally and ball was pushed up to the cardia. Vulsellum forceps was introduced in to the cardia and ball was grasped between the jaws of forceps. The forceps was then pulled out with gradual rotary movements given clock and anticlockwise. A few attempts made successful retrieval of the rubber ball. The gastrotomy and laparotomy wounds were closed in a routine manner. Dog was kept on fluid therapy for five days, followed by blend diet for two weeks. Post operatively dog was administrated Ceftrixone with tazobactum 562.50 mg bid for seven days, paracetamol 100 mg i/m for three days, ranitidine 50 mg bid for 10 days. Skin sutures were removed on 10th post operative days. Dog made an uneventful recovery and routine diet was given after three weeks of operation. Abst 2 : III

Surgical Management of Multiple Intestinal Obstruction and The intussuseption in a German Shepherd Dog
Mrunali Kamble, S. V. Upadheye, M. S. Dhakate and Balwant Meshram Department of Surgery and Radiology, Nagpur Veterinary College, Nagpur- 6 (M. S.)

A German Shepherd male Dog of 9 months age was presented to the clinic. It was presented with complaints of recurrent vomition, anorexia and progressive decline in his health. These serious complications were noticed since a week but previously the patient was treated at local veterinary clinic where the response to medication was not satisfactory. The plain radiographic examination had not shown any of the obstruction at intestinal level. The owners request insisted to choose the exploratory lapratomy as the tool as one of the attempt to save the life of animal. The premedication was undertaken and administered general anaesthesia with Ketamine and Diazepam combination. Took all aseptic precautions and opened the abdomen. As the wonder the obstruction was found associated with a thread (Manza) at 4 places and also with the intussusception at 3 places. While treating the obstruction, incision was given over the intestine and closed it as per routine procedure. In case of the intussuseption, at two places it were removed manually but at one place anastomosis was done to meet the essentiality. The lapratomy incision was closed by routine standard surgical procedure. Post operatively, the dog was maintained on Inj D5 and RL twice a day for consecutive 6 days. Antibiotics, analgesics and the b-complex therapy was administered for 5 days along with Inj. Vit C . The dog was forced for liquid diet from 3rd day after surgical intervention and forcefully brought on normal diet after 6 days when it showed the normal defecation. Sutures were removed on 12th day post-oprativively by which the complete recovery could be achieved.

125

Abst 3 : III

Successful management of mucocele in a dog

K. Kachawaha, SM Qureshi, MC Parashar and TK Gahlot Department of Veterinary Surgery and Radiology College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001, Rajasthan. INDIA

A non-descript dog aged 8 years was bought to the surgery clinic with a history of swelling developed at sub-mandibular region, however, a cystic swelling also appeared from one side of base of tongue upon per oral examination. A paracentesis of sub-mandibular swelling revealed blood tinged viscous fluid analogous to saliva, hence was diagnosed as mucocele. Dissection of mandibular and lingual salivary glands was done under general anaesthesia. A careful ligation of ducts of these glands was also done. The subcutaneous wound was apposed using Vicryl no. 1/0 in a simple continuous pattern and skin wound was closed in routine manner. Post-operatively dog was administered Inj Ceftriazone 1 gm IM bid for 7 days and Inj Meloxicam 10 mg IM for 3 days. Skin sutures were removed on 10th post operative day. There was no reoccurrence of swelling till a 1 year follow up. Abst 4 : III

Surgical management of mammary tumor in old aged bitch: A case report

Mrunali Kamble and Balwant Meshram, Pets Clinic, Ganeshnagar,Nagpur 440 009.

A Pomeranian bitch of about twelve years of age who was weighing about 7 kg was presented in clinic with the history of persistent coughing and anorexia since a week. The bitch has shown large growth of hard mass at lateral side. It had the history of gradual increase from last 2-3 months with occasional vomiting with loss of condition but doesnt put the response to medicinal treatment. Clinical examination revealed a dyspnoea with body temperature upto 103.80F. The SGOT and SGPT levels were elevated which showed 127 IU/L and 169 IU/L respectively. Achieved all the aseptic precautions under general anaesthesia and tumor was removed. It was weighing 2 kgs and 150 gm. The biopsy examination of the tumor has showed spindle shaped cells forming concentric reticulin and collagenous fibers around juvenile vessels which were indicative of the true progressive fibrosarcoma. Postoperatively, the dog was maintained on fluid, antibiotic and b-complex therapy for 5 days, sutures were removed on 10th day which was resulted the uneventful recovery. Abst 5 : III

Comparative evaluation of surgical and semisurgical procedures for prostatic hyperplasia in canine
Gupta Satyendra Kumar1, Chandrapuria V. P., Singh R.and Shahi Apra Veterinary Surgery and Radiology, College of Veterinary Science & A.H., Jabalpur (MP), India

The study was carried out to evaluate the effect of partial prostatectomy and the influence of 96% ethanol injection on hyperplastic prostate. The study was conducted on 12 clinical cases of dogs using fillet prostatectomy and ethanol injections into the prostate. Observations were made on 0,7th, 21st and 40th day after surgery. Ethanol injections were used on 6 dogs and ultrasonographic feature of prostatic tissues were evaluated to measure the effect of ethanol. The fillet method is technically simpler, shorter and the tissues of the prostate heal more quickly. Ethanol injection induces multi-focular coagulative necrosis, followed by fibrosis and atrophy of the prostate. It is simpler and easier because there are no sections through prostate tissues. To avoid a section of the abdominal wall, a transurethral catheter can be used for the ethanol injection. 1 .M.V.Sc. Scholar, Part of thesis research work

126

Abst 6 : III

Successful Surgical Management of Pyometra in a Female Dog: A Case Report

Mrunali Kamble, S. V. Upadhey, M. S. Dhakate, B. M. Gahlod and Rani Tantrapade Department of Surgery and Radiology, Nagpur Veterinary College, Nagpur- 6 (M. S.)

An old Dalmatian female dog of 7.5 yrs age with body weight of about 9 kgs was presented to the TVCC. It had the history of recent abortion of 1 months pregnancy, vaginal discharge and anorexia since a week. There was no vomition. The clinical examination showed a temperature of 102.40F and on abdominal palpation the distended abdomen was found tensed which was exhibited painful condition of the same. Ultrasonographically it was confirmed as pyometra with chronic endometrial hyperplasia. By taking all aseptic precautions the dog was prepared for surgical intervention and also administered an injection of 5 % dextrose to overcome the preoperative dehydration. Under Atropine-Xylazine premedication and general anaesthesia in combination with Ketamine and Diazepam panhysterectomy was performed through midventral lapratomy. In attempt to record the quantity of seropurulent semi-thick fluid from the exteriorized uterus, it got evacuated and measured which found 2.75 liter with 2.1 Kgs as the weight of uterus. Postoperatively, the dog was maintained on fluid therapy for more than a week and choosed antibiotic, analgesic and b-complex therapy for 5 days. Sutures were removed on 10th day postoperatively to find the uneventful recovery. Abst 7 : III

Prepubertal sterilization in dogs for the control of over population

M.K.Narayanan and K.Rajankutty Kerala veterinary and Animal Sciences University, Kerala, 680 021.

India is a country with an open garbage handling system where there is availability of plenty of food to stray dogs and other animals. In such situations, especially in urban areas, the population growth of stray dog is rapid and uncontrollable. The potential areas that may harbour stray dog population are constantly expanding. The traditional method of control of overpopulation by mass euthanasia is not a preferred approach in a civilized society. In 1990 the World Health Organization (WHO) and the World Society for the Protection of Animals (WSPA) collaborated on the publication of Guidelines for Dog Population Management, which proposed a new, long-term method for the control of urban dog populations in a more humane manner. The method advocates systematic sterilization programme rather than the mass euthanasia. At present the ABC programme is being practiced in adult female and male dogs but could not achieve the target of control of over population of dogs due to so many reasons relating to its capture, maintenance etc. To overcome such problems, early neutering at the age of 6-12 weeks has become a preferred substitute to adult sterilization.Countries like USA and Australia are following early neutering in dogs since1980s and 1990s respectively and recommended it as a safe and non deleterious means to control over population. Animal Husbandry Department, Kerala Project on Prepubertal Sterilization in dogs for the control of over population is an ongoing project at University Veterinary Hospital, Kokkalai, Thrissur, Kerala. The project is now named as END( Early Neutering in Dogs) programme. END programme is a project for tackling the stray dog menace in a humane manner. The specialty of the project is that it is the first of this kind in India, which provide rehabilitation by adopting the puppies which will reduce the number of abandoned puppies in the street there by reducing the number of stray dogs in future

127

Abst 8 : III

Relation of Diet with Urinary Bladder Stone Formation in Dog

M. Molazem1, SH. Asadi, R. Hashemzade1 Dep. of Veterinary Radiology, University of Tehran, Tehran, Iran

Bladder stones are abnormal accumulations of minerals and other substances in the urinary bladder. Stones can occur in any part of the urinary tract, from the kidneys to the ureters to the urinary bladder and ultimately to the urethra. In dogs, urinary stones are most commonly formed in the bladder and then may become stuck in the urethra. When the urine becomes too concentrated urine dissolved salts can precipitate out of the fluid to form crystals. These crystals can damage the lining of the urinary tract, causing blood in the urine (hematuria), and can predispose affected dogs to developing bacterial urinary tract infections. Crystals can coalesce to form calculi. The pH of urine contributes to stone formation and it can be affected by diet, hydration, the presence of bacteria/urinary tract infections, certain medications, conformation of urinary tract structures and genetics. In the present paper the relation between diet and urinary bladder stone formation is evaluating. A comparative survey of feeding habits and food intake was undertaken in 30 dogs (15 normal and 15 suffering from urinary bladder stone) with different forms of urinary bladder calculi. They were all fed by a same diet for at least 1 year.Differences in foods consumed were as follows: commercial pet foods, animal products, and vegetables and fruits; different forms of types of urinary bladder stone were struvite (3 cases), calcium oxalate (7 cases), urate (2 cases), and calcium phosphate (3 cases).The study showed that most of the stones (14 cases) formed in the patients with imbalanced diet with high protein and high vegetables and fruits intake. There was also a significant relation between vegetable intake and calcium oxalate stones. The cases with commercial food diet were all free of any stones. Any obstruction of the canine urinary tract is potentially fatal. The results of this study showed that a wellbalanced, high-quality diet and restricted protein and vegetables can promote urinary tract health. It is also important to keep dogs well-hydrated, because dehydration increases the concentration of canine urine and predisposes the dog to developing crystals and urinary stones. Urinary tract infections predispose dogs to development of stones in their urinary tracts too but it was not a factor in this study. 1 Persian Pet Clinic, Tehran, Iran(Email: mmolazem@ut.ac.ir) Abst 9 : III

Surgical management of sebaceous adnexal tumour in a dog

L. Ranganath, V. Mahesh and Ramesh Rathod. Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore 560024

An eighteen month old dog was presented to the Veterinary College Hospital, Bangalore with a history of swelling over the left thorax region since two months which did not respond to medical treatment given by a local Veterinarian. On physical examination animal was pyrexic with elevated heart and respiratory rate. On physical palpation hard mass was felt, not adhering to bony tissue suggestive of soft tissue tumour. It was decided for surgical excision under general anesthesia. Two curvilinear incisions were made on the mass in such a way that both incisions were joined on each side to make it crescent shaped. Mass was separated from its attachment by blunt dissection. All bleeding points were arrested by ligation with chromic catgut size-0. Subcutaneous suturing was done with chromic catgut size-0 in simple continuous manner and skin was apposed with linex size-0 in horizontal mattress pattern. The excised mass upon examination was hard and weighing about 500gms which was preserved in neutral buffer solution and sent for histopathology which was confirmed as malignant adnexial sebaceous gland tumor. Post-operatively, ceftriaxone (20mg/kg) was administered for 7 days systemically. Skin sutures were removed on 10th post-operative day and Animal recovered uneventfully.

128

Abst 10 : III

Surgical excision of large fibroma from metatarsal region in a dog A case report
Ramesh Rathod, B. Nandeesh Kumar and L. Ranganath Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore

A eight year old Great Dane dog was presented to the Veterinary College Hospital, Bangalore with a history of lump on its left hind limb growing for last two years. On observation hard mass was present on the lateral aspect of the left hind limb. The growth was free without the involvement of the bony tissue and was ulcerated. On physical examination animal was having pyrexic with elevated heart and respiratory rate. Hemato-biochemical examination revealed leucocytosis and other parameters were within normal range. It was decided for surgical excision after suitable preparation. Elliptical incision was made around the fibroma using no. 24 BP blade. The mass was undermined to separate the normal and the tumor tissue by blunt dissection. Tumour mass was excised along with the skin, all bleeding vessels were ligated using no.1-0 catgut. Skin was opposed to closure proximity. Wound was cleaned and dressed every alternate day post-operatively. The excised mass upon examination was hard and weighing about 350gms which was preserved in neutral buffer solution and sent for histopathology which was confirmed as fibroma showing vascular growth with histiocytes and collagen producing fibroblast like cells. Post-operatively, ceftriaxone (20mg/kg) was administered for 7 days systemically. Skin sutures were removed on 15th postoperative day and animal recovered uneventfully. Abst 11 : III

Surgical management of large perianal gland tumour in a dog

Ramesh Rathod and L. Ranganath Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore 560024

An eight year old male boxer dog was presented to the Veterinary College Hospital, Bangalore with a history of swelling over the right perianal region since two months which was refractory to medical treatment. Owner also complained of dyschezia and weakness of hindquarter. On physical examination animal was pyrexic with elevated heart and respiratory rate. On physical palpation hard mass free from bony attachment was felt and it was ulerated. Hemato-biochemical parameters revealed hemoconcentration, leukocytosis and elevated creatinine. It was decided for surgical excision. Anal opening was closed temporarily by Purse string suture. Two curvilinear incisions were made on the mass in such a way that both incisions were joined on each side to make it crescent shaped. Mass was separated from its attachment by blunt dissection. All bleeding points were arrested by ligation with chromic catgut size-0. Excess skin was trimmed to avoid dead space. Subcutaneous suturing was done with chromic catgut size-0 in simple interrupted manner and skin was opposed with linex size-0 in horizontal mattress. Animal was castrated by pre-scrotal incision to reduce testosterone hormone release. The excised mass upon examination was weighing about 500gms which was preserved in neutral buffer solution and sent for histopathology which was confirmed as hepatoid carcinoma showing undifferentiated neoplastic cells of Hepatoid component with eosinophilic cytoplasm and prominent nucleolus. Post-operatively, ceftriaxone (20mg/kg), meloxicam 0.5 mg/kg was administered for 7 days systemically. Skin sutures were removed on 10th post-operative day and Animal recovered uneventfully.

129

Abst 12 : III

Surgical management of gastro-intestinal obstruction caused by a wire mesh in a dog

V. Mahesh, Ramesh Rathod and L. Ranganath Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore 560024

A two year old male non-descrip dog was presented to the Veterinary College Hospital, Bangalore with a history of anorexia, vomition and dyschesia since one week and not responding to the medical treatment. On abdominal palpation a soft mass was felt at cranial abdomen with severe pain and intestinal loops appeared distended. Survey radiography of lateral abdomen did not reveal any abnormality. Tour barium contrast radiograph of lateral abdomen revealed stasis of barium in the stomach and jejunal loops confirmed intestinal obstruction. Therefore it was decided for exploratory laparotomy. Celiotomy was performed to explore the abdomen then intestinal loops were examined which revealed coiled jejunal loops and following the intestinal loops cranially, towards the stomach revealed foreign body in it. Therefore gastrotomy was performed and foreign body was removed, it revealed a mash but we failed to remove completely as a linear foreign body was continued caudally. Therefore enterotomy was performed at ilial region to remove remaining foreign body. Gastrotomy wound was closed by lamberts followed by cushings pattern. The abdomen was flushed with warm normal saline and closed by using No.1 polyglactin 910, subcutaneous and skin were opposed in routine manner. Post-operatively, ceftriaxone (20mg/kg) was given for 7 days intramuscularly BID. The animal was maintained on parenteral alimentation with ringers lactate 300 ml and Dextrose 5%, 300 ml daily twice along with Metronidazole 100 ml intravenous for three days. Animal was allowed for liquid diet on 4th post-operative day and solids on 7th post-operative day. Skin sutures were removed on 10th post-operative day and animal recovered uneventfully. Abst 13 : III

Surgical management of intestinal adenocarcinoma in a dog A case report

L. Ranganath, V. Mahesh and Ramesh Rathod. Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore-24

A nine year old Female dog was presented to the Veterinary College Hospital, Bangalore with a history of anorexia, vomition, diarrhoea, weight loss, dyschezia and melena since 15 days and not responding to the medical treatment given by a local veterinarian. On physical examination animal had high fever, other parameters like heart rate, respiratory rate were within normal range. On abdominal palpation a hard mass was felt at cranial abdomen. Plain radiography of lateral abdomen revealed radiodense irregular mass which was further confirmed by barium study. Hematological parameters revealed Leukocytosis, characterized by neutrophilia and lymphopenia. Therefore, it was decided for exploratory laparotomy. Coeliotomy was performed and upon exploration, intramural mass occluding the lumen was found at ascending part of colon. Extend of the involvement was delineated and Enterectomy and Enteroanastamosis was accomplished. Abdomen was lavaged with warm normal saline followed by closing with No.1 polyglactin 910 (Vicryl No. 1 Johnson and Johnson, Aurangabad) in simple interrupted pattern, subcutaneous tissue and skin were approximated as per standard procedure. The excised mass upon examination, was hard with occlusion of intestinal lumen to the extent of 90%. The excised mass was preserved in neutral buffer solution and sent for histopathology which was confirmed as Adenocarcinoma. Post-operatively, ceftriaxone (20mg/kg) was administered for 7 days systemically. The animal was maintained on parental alimentation of ringers lactate 250 ml and Dextrose 5%, 250 ml daily twice along with Metranidazole 100 ml intravenous for three days. Animal was allowed to have liquid diet on 4th post-operative day and solids on 7th postoperative day. Skin sutures were removed on 10th post-operative day and Animal recovered uneventfully.

130

Abst 14 : III

Umbilical hernia in an adult pug- A case report

Ramesh Rathod, Namratha Poonacha and L. Ranganath Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore- 560024.

A 6.5 kg male pug aged three years had a swelling in its ventral abdomen at the umbilical region which was painful and had increased in size since the past three days. Pet had not passed faeces since three days and was unable to sit down properly because of pain at the area of the swelling. Owner was not aware of any trauma that could have led to the swelling. On palpation the mass appeared very hard and hernial ring couldnt be palpated. The site of the hernia was bruised suggesting trauma leading to the herniation. The temperature, pulse, heart rate and respiratory rate were all within normal limits and the mass was ruled out to be an abscess or cyst. The case was diagnosed as umbilical hernia. A linear incision was made on the mass, subcutaneous tissue and fascias were separated. On exposing the hernial ring found blood clots and omental fat was herniating through the umbilical ring. Affected omentum was separated from the surrounding intestines and resected. Herniorrhaphy was done by simple interrupted pattern of suturing using polyglactin 910 no.1-0, subcutaneous and skin were opposed in a routine manner. Herniation of abdominal contents through umbilical area due to imperfect closure of the linea alba and associated structure has appeared in both sexes either at birth or later in life. Skin sutures were removed on 10th post operative day and later animal made uneventful recovery. Abst 15 : III

Successful treatment of osteoclastoma in a golden retriever dog by cell based therapy

Das, Jayakrushna., Nath, I., Routray, P. and Purohit, G.K. Department of Surgery and Radiology, College of Veterinary Science and Animal Husbandry, OUAT, Bhubaneswar-751003

A Golden Retriever dog of 2.5 years old weighing 27 kg bodyweight was presented at the Department of Surgery and Radiology with complaint of swelling at lateral side of left hock showing lameness. On palpation it was revealed that, one hard rounded swollen mass, which was fixed to the lateral side of hock region. For differential diagnosis it was aspirated which showed presence of blood. Clinico-laboratory investigation was done for different parameters of blood and serum. After two days of puncture done for aspiration of blood, the swelling continued to increase in size. So it was decided for excision of the mass. The excised mass was sent for histo-pathological study. Up to 3 days after operation it was in normal state to look but afterwards it again restarted growing in size very quickly. So it was thought for cauterization and was done with liquid nitrogen (LN2) for 3 times in 4 to 5 days interval .But it was not subsided rather continued to grow in size and look very odd. The histo-pathological study revealed it as osteoclastoma which is very rare case of bone tumour .Since it has not responded to the previous surgical treatment so chemotherapy was done with injection of Vincrysticine two times at a week interval, which also gave no result .Lastly we thought for cell based therapy for trial. For the same 15 ml of bone marrow was collected from femur at gluteal region by bone drilling. It was sent to CIFA, Kausalyagang for culture and multiplication .Then the cultured stem cell sample was transplanted by intradermal inj. at that site and also given as intravenous route. After 3 days of stem cell application, it started towards healing. After 25 days of stem cell therapy the swollen mass was subsided and the animal successfully regained its normal gait. The stem cells act as killer cells for malignant tumour which can be used for benefit of livestock and human society.

131

Abst 16 : III

Amputation of necrotic penis due to post coital paraphimosis in a castrated dog A case report
L. Ranganath, V. Mahesh, Ramesh Rathod and Namratha Poonacha Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore- 560024.

A four year old golden retriever male dog was presented to the Veterinary College, Bangalore with a complaint of wound over penis. Visual inspection revealed paraphimosis along with swollen, edematous and hyperaemic penis protruding from the prepuce and a necrosed area was noted in the centre of the protruding penile tissue. History revealed that the dog developed this condition post coitus. Interestingly, the dog had been castrated two years ago but the owner was not aware if the pet was a cryptorchid which could explain the libido post castration. On palpation, testes couldnt be found at scrotum or inguinal area, suggesting to be in the abdomen. It was decided for penile amputation under general anaesthesia. Skin around the prepuce was incised in an elliptical fashion. The penis was amputated distal to the os penis. The penile stump was closed in a simple interrupted suture pattern using chromic catgut 1-0. The urethra was incised over the catheter and a urethrostomy was created by apposing urethral mucosa and skin in a simple interrupted suture pattern using 1-0 polyamide suture material. Post-operatively cefalexin 600 mg bid for seven days was given along with regular cleaning to prevent urine scalding. Pet had an uneventful recovery by 10th post operative day. Abst 17 : III

Eight cases of Gastric Dilation Volvulus in dog.

Jain H.T. and S.V.Upadhye Nagpur (Maharashtra)

Eight dogs suffering from the signs of acute gastric discomfort were reported for treatment. The most common symptoms were retching(07) with no success in five dogs and frothy mucus in vomitus in two cases, abduction of cranial limbs and open mouth breathing (06), severe distension of abdomen (07), respiratory distress (07 cases), and reluctance to move (06). The most common predisposing factor was some exercise within 2 hours of feeding (04), whereas in two cases, the dog was used for mating immediately after feeding. In one dog no such predisposing factor could be observed. The condition does not seem to have age or sex predilection. Dogs with wide or deep chest were found to suffer (07). The radiographic findings included distended gas filled stomach of varying degrees, with typical Reaglers circle indicative of gastric dilation with volvulus in six cases, however, in one case only a white ground glass appearance of abdomen with no gas shadow was observed. Passing the gastric tube could be successful through oral cavity in one case, wherein the dilation was partial, however, it failed to relieve the distension completely. The dogs were subjected to surgical intervention with cranial mid ventral laparotomy to relieve volvulus. In four cases gastropexy was performed at the cranial end of the incision and splenectomy was performed in two cases. Seven dogs showed uneventful recovery with no recurrence while in one dog died on second day post operatively. Clinical parameters like HR, RR and rectal temperature was found significantly increased. The hematobiochemical studies revealed significant leucocytosis, erythrocytosis, neutrophilia, lymphocytosis, monocytosis, eosinophilia, Hb, packed cell volume and platelets. The biochemical parameters viz. serum sodium, potassium, chloride were also affected.

132

Abst 18 : III

Correction of diaphragmatic hernia in nondescript dogs

Chaudhary, P.S.; Varshney, J.P., Deshmukh, V.V. and Prajwalita T. Sutaria Shree Surat Panjarapole, Nandini Veterinary Hospital, Ghod Dod Road Surat 395 001 (G.S.)

Two cases of diaphragmatic hernia in non-descript dogs were diagnosed on radiographic, sonographic and on clinical symptoms like coughing, vomition, dyspnoea, tachycardia, weight loss, muffled heart and lung sounds along with intestinal sound in thorax. Part of liver lobe was herniated in one dog, whereas spleen, intestines, stomach and omentum in the other dog. The use of plain and contrast radiograph from different angles in conjunction with thorough ultrasound examination facilitated the diagnosis. Both the dog were anaesthetized with diazepam @0.27 mg/kg iv and Ketamine @ 5.5 mg/kg iv and maintained on isoflurane. Ventral midline celiotomy and left paracostal approach was adopted for repair of diaphragmatic hernia. The rent was closed with 1-0 polypropylene suture in continuous suturing pattern. Both the dogs showed uneventful recovery. Abst 19 : III

Differential diagnosis of prostate disorders

Gupta Satyendra Kumar1, Chandrapuria V. P., Shahi Apra and Singh R. Veterinary Surgery and Radiology, College of Veterinary Science & A.H., Jabalpur (MP), India

The study was carried out to establish the differential diagnosis of various prostatic disorders. The study was conducted on 12 clinical cases of dogs using clinical examination, haematology, radiography, ultrasonogrphy and histopathological examination. The above parameters were recorded on 0, 7th,, 21st and 40th day after surgery. The confirmation was done by histopathological examination of prostate tissue. Haemato biochemical investigation revealed neutrophillia in cases of prostatitis. ultrasonography provided promising diagnosis for BPH and related affections but it is poor in confirmatory diagnosis for differentiation between prostatitis and neoplasia. Histopathological examination provided confirmatory diagnosis for prostate disorders. 1 M.V.Sc. Scholar, Part of thesis research work

Abst 20 : III

Retrieval of foreign bodies in dogs

Chaudhary, P.S.; Varshney, J.P.,Deshmukh, V.V. and Prajwalita T. Sutaria Shree Surat Panjarapole, Nandini Veterinary Hospital, Ghod Dod Road, Surat 395 001 (G.S.)

Ten cases of dogs (aged 5 month to 6 years) with symptoms of vomition, retching, uneasiness, diarrhoea/ constipation were presented to hospital and diagnosed for presence of foreign bodies with the help of radiography and ultrasonography. The major sites of foreign body lodgements were buccal cavity, cervical oesophagus, stomach and intestines. Sewing needle, rubber material, plastic wares, coins, metallic materials (shaving blades, key rings, bottle tap etc), leather piece, clothes and phytofecoliths were retrieved from these dogs. All the dogs were operated under Xylazine and Ketamine anesthesia. All dogs showed uneventful recovery after retrieval of foreign bodies.

133

Abst 21 : III

Surgical management of venereal tumour in a male mixed breed dog

Das, Jayakrushna., Nayak, S., Behera, S S., Sika, P. and Sahu, A. Department of Surgery and Radiology, College of Veterinary Science and Animal Husbandry, OUAT, Bhubaneswar-751003

Venereal tumour or infective sarcomata are commonly seen in the dog affecting the surface of penis. The commonest site of growth is at base of the penis along with body and sheath also. The condition appears to be of bacterial origin, but no actual causal organism has been found (O Connor, 1985). A dog with complaint of sanguinolent discharge from the prepuce was seen since 10-15 days from the date of presentation at the Dept. of Veterinary Surgery and Radiology, C.V.Sc and AH, Bhubaneswar. On examination it was revealed as a case of venereal tumour affecting more at the glans area along with body and base of the penis. Under general anaesthesia of ketamine, xylazine and atropine the penis was tried to retract from the prepuce, but it was not possible. So local excision of the tumour mass was done by introducing the haemostastic forceps to the prepuce and then the penis was retracted. The glans area was fully encircled with large tumour masses along with over body and base region. After catheterization the tumour masses were excised and cauterized with silver nitrate and neutralized by NSS. Then the injured sites were sutured with chromic catgut no. 2/0. Then the part was cleaned with NSS, terramycine topical was applied and inj. adrenalin was sprinkled over it to stop local bleeding. After 10 days it was again prepared for surgical excision of remnant tumour mass at glans area and cauterized with silver nitrate sticks. After 30 days the animal recovered well from the condition. Abst 22 : III

Surgical management of pyometra-case studies in 27 bitches

Jayakrushna Das, Sadananda Nayak, Sidhartha Sankar Behera, Soumyaranjan Pati and Monalisa Behera Department of Surgery and Radiology, College of Veterinary Science and Animal Husbandry, OUAT, Bhubaneswar-751003

Owing to the seasonal breeder and existence of peculiarity of pseudopregnancy the bitches tend to suffer from different pathological condition of genital organ in general and affection of uterine horns in particular. Pyometra following parturition or abortion is seldom observed. But this condition mostly seen in animals over six years of age and is commonly associated with diffuse endometrial hyperplasia due to prolonged hormonal stimulation (Hafeez, 2002., Roberts, 2004). Twenty seven bitches of different breeds, age ranges from two years to ten years with condition of pyometra were presented during the period of July to Nov. 2011 at the Dept. of Veterinary Surgery and Radiology, C.V.Sc and AH, OUAT, Bhubaneswar. Among different breeds, Spitz was the highest in no. followed by German shepherd, Labrador, Dachshund, Golden retriever, Great Dane and others. From the signs and symptoms, clinical examination, C-arm examination and clinic-laboratory investigation the cases were diagnosed as pyometra condition. Out of these, 15 bitches were in acute pyometra with close type followed by 8 acute with open type and 4 were in chronic condition. The white blood count in pyometra is usually over 25,000 cells/cmm and most of the leucocyte are neutrophils. As the ovariohysterectomy is the procedure of choice for the treatment of pyometra(Slatter D,2003.,O Connor, 1985), so it was done in all the cases. In 10 no. of cases prior to operation NSS, glucose and antibiotic with supportive therapy were administered for stabilization of patient to overcome both anaesthetic and surgical stress. All the cases showed good prognosis with proper post-operative care and management practices.

134

Abst 23 : III

Successful treatment of cystolith in a labrador dog

Das, Jayakrushna., Behera, S S., Sika, P., Sahu, A., Surey, A. Department of Surgery and Radiology, College of Veterinary Science and Animal Husbandry, OUAT, Bhubaneswar-751003

A Labrador dog of 10 years age weighing 32 kg bodyweight was presented at TVCC, C.V.Sc and AH, Bhubaneswar with complaint of haematuria and incontinence of urine. From history it was revealed that since 1 year it was suffering from mild urinary problem of haematuria at times. Presence of cystolith was seen on C-arm examination and owing to reluctancy for surgical treatment it was tried with Cystone tablets for 6 to 7 months. On the day of presentation by C-arm examination with pneumocystography it was revealed that a numbers of large sized stones were present in the urinary bladder with hyperplastic and inflamed bladder wall condition. So it was decided for cystotomy under GA of Atropine, Ketamine and Xylazine. After laparotomy, on palpation the urinary bladder showed fully tensed, inflamed and packed with hard and gritty substances. With proper care cystotomy was done and seen that number of urinary stones were fully packed in urinary bladder without any urine. The bladder wall showed fully inflamed with hyperplastic condition. The stones were sent for study under electron microscope and scanning. The urinary bladder was flushed with NSS and Metronidazole with Povidone iodine solution. Nasogastric feeding tube no.8 was fixed to the urinary bladder for catheterization and routine closure of bladder and laparotomy site was done. Post-operatively proper care and management was taken with flushing of urinary bladder with NSS and Metronidazole with Povidone iodine solution. After 6 days the catheter was removed and after 12 days the sutures were removed. Finally the dog recovered uneventfully. Abst 24 : III

Failures and Success of Caesarian Section in Dogs

O .S. Prakash Veterinary Specialty Center (Dog Clinic), Krishi Nagar, Shivamogga, Karnataka

Observing from the 24 cases of advanced pregnancy, it is better to wait till the female exhibit pain (act of delivery), recording body temperature and foetal movements . Once the body temperature falls subnormal caeserian section is performed (without inducing with oxytocin, epidocin and calcium sandoz), maintaining with 5% dextrose will be successful, safe to the animal, profitable, and cost effective to the dog owner. Abst 25 : III

Cardioplasty for management omegaoesophagus consequent to gastroesophageal stricture in a dog

Dinesh P.T., Vinu David P1 and Jayakrishnan2 Dept. of Surgery and Radiology, College of Veterinary & Animal Sciences, Pookode, Wayanad, Kerala

Megaoesophagus is an acquired condition seen in dogs which may be a sequellae of stricture of gastroesophageal junction. A case of acquired megaesophagus in a 5 year old male Labrador retriever dog as a sequellae to stricture of gastroesophageal junction is reported. The condition was diagnosed on oesophagoscopy. Anaesthesia was induced using a combination of Atropine sulphate (@0.045mg/Kg) Xylaxin @1mg/Kg) and Ketamine (@5 mg/Kg) combination and maintained using halothane. Hellers myotomy was performed through the resection of 11th rib on left side for the correction of the condition. Postoperatively the animal was managed on neostigmine tablets for two weeks. Symptoms ceased by two weeks and animal had an uneventful recovery. 1 Dept. of Clinical Veterinary Medicine 2 Internship trainee.

135

Abst 26 : III

Colorectal small cell carcinoma in Canine: A case report.

P.T. Dinesh, Sindhu O.K.1 and T.M. Divya2 Department of Veterinary Surgery & Radiology, College Veterinary and Animal sciences Pookode, Wayanad, Kerala

A case of colorectal small cell carcinoma in a four year old male Rottweiler is reported. Diagnosis of this case was done by physical examination. Exfoliative cytology of the case was suggestive of tumour and radical removal of the mass was performed. Macroscopically it was a nodular soft tissue mass measuring 6x6x5 cm. Histopathological examination revealed extensive hemorrhages of colonic mucosa. Microscopic examination of sub-mucosa revealed the neoplasm consisting of small cells arranged in sheets, groups, cords with occasional acinar pattern. Tumour cells were having eosinophilic granular cytoplasm and vesicular deep stained nucleus. 1 Veterinary Surgeon, Regional Clinical Laboratory, Kozhikode 2 PG Scholar, Dept. of Pharmacology Abst 27 : III

Successful management of intestinal necrosis and rupture in a dog- a case report

Jayakrushna Das, Sidhartha Sankar Behera, Prasanta Kumar Sika and Ananta Hembram Department of Surgery and Radiology, College of Veterinary Science and Animal Husbandry, OUAT, Bhubaneswar-751003

A dog weighing 4 kg body weight was presented at the Dept. of Veterinary Surgery and Radiology, C.V.Sc and AH, OUAT, Bhubaneswar with complaint of anorexia, dull, depression, emaciation, stoppage of defecation and vomiting symptoms with fever. Clinical examination with clinico-laboratory investigations were done with C-arm examination. To get a clear picture of intestinal obstruction or strangulation constrast Carm examination was done by administering Barium meal. But after 4 hours the dog was vomited the same. So it was decided for doing exploratory laparotomy under GA with Atropinne, Xylazine and Ketamine. By careful examination of intestinal loops it was found that a portion of intestine measuring 2 inches long was necrosed and nearby this another piece measuring 2.5 inches long was also in gangrene condition with rupture of intestinal wall. With utmost care surgical drapes were placed around the affected intestine. After clamping with Doyens intestinal clamp the affected part was excised and intestinal anastomosis was done. Alongwith this the other portion was also excised and removed. The abdomen was flushed with NSS and Metronindazole solution. The laparotomy site was closed as per routine manner. Post-operative medication with care and management was taken with vitailzer, appetizer and I/V dextrose infusion. After 10 days the sutures were removed and after 15 days the animal recovered well. Abst 28 : III

Management of tartar in dogs

M. Nagar. M.C. Parashar, K. Kachawaha, M. Agrawal, B.M. Meena and T.K. Gahlot College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001

Tartar was diagnosed in 10 dogs aged between 8-12 years. These dogs had a history of halitosis. A peroral examination revealed presence of tartar and varying degrees of decay in few teeth. These animals were given general anaesthesia using atropine, xylazine and Ketamine. All loose teeth were identified and were extracted out by molar extractor. The crust of tartar was removed by ultrasonic scalar. The teeth were cleaned with 2% hydrogen peroxide solution and povidone iodine mouth was applied. Animals were administered broad spectrum antibiotic for 5-7 days and NSAID 3 days. The antiseptic mouth wash continued for 2 weeks.

136

Abst 29 : III

Rehabilitation of Coxofemoral luxations and pelvic fracture in dogs A report of 12 clinical cases.
A.K. Maji, D.Ghosh, Arnab Kr. Majie and Munmun De Department of Veterinary Surgery & Radiology, Faculty of Veterinary & Animal Sciences West Bengal University of Animal & Fishery Sciences, Kolkata - 700037

Eight adult purebred, crossbred and mongrel dogs of either sex having craniodorsal, obturator compressing caudoventral either unilateral or bilateral coxofemoral luxations with normal or displasic hips diagnosed clinically and radio-graphically were treated by conservative techniques. Closed reduction under XylazineKetamine- Calmpose anaesthesia and application of modified Ehmer Sling bandage either by Leucoplast or by Gypsona plaster were made and left for 15 days rest followed by reapplication of the same in 7 cases of unilateral luxations. Alternate 6 attempts were made for bilateral luxations at an interval of 10 days, diet control if necessary, antibiotic and analgesic for 3 days, glucosamine and chondroitin sulphate alongwith Vitamin D were administered post- reduction. Radiographs were taken after removal of sling bandage under anaesthesia with positive result. The animals were advised for confinement and swimming if possible for another two months until final report of complete rehabilitation. Four adult dogs of G.S.D., Labrador Retriever and mongrel breed having illial wing fracture with traumatic haematuria and sacroiliac fracture luxations having urinary incontinence, dyschezia and posterior paraplegia were treated with urinary local and systemic antibiotics, Vitamin B complex, steroid and laxatives with advice of complete rest for 1.5 months to 2 months until monthly radiological evidence of healing and normal biomechanical use of the hind limbs. Abst 30 : III

Bilateral gravid uterine prolapse in bitch and their management

D. Ghosh, D. Chakraborty and A Nath1 Department of Surgery, Faculty of Vety. and Animal Sciences, WBUAFS, Kolkata.

Eversion and protrusion of a portion, or whole part of uterus through the cervix into the vagina during or near parturition, is defined as uterine prolapse (Fossum, 2007). Uterine prolapse is common in cow and ewe and rare in bitch (Arhter, 1996). In bitch unilateral uterine prolapse is associated with parturition during prolonged labour or upto 48 hours after parturition. Bilateral uterine prolapse occurrence is very rare and usually occurs when both uterine horns emptied after parturition (Slatter, 2002). Manual reduction and reposition of everted uterus is generally impossible in bitch thereforeindicatingforoveriohysterectomyunder general or epidural anaesthesia (Benesch, 2001). Mongrel bitch which has delivered three pups was presented to the clinicswith bilateral uterineprolapse. There was blackish discolouration in some part of the body and horns of uterus indicating local haemorrhage and necrosis due to rapture of blood vessels. There was moderate abdominal straining with slightly increased rectal temperature and heart rate. The attempt to reposition the uterus manually was futile ultimately necessitating for laparotomy by midline abdominal incision, for performing overiohysterectomy. The prolapse mass was so extensive that even after overiohysterectomy the stump remained relaxed with tendency to prolapse through vagina and warranted for hysteriopexy. Post operatively animal was cared in routine manner and showed uneventful recovery 1 Department of Gynaecology and Obstetrics

137

Abst 31: III

Oesophageal choke by a bone in a dog A case report

Ramesh Rathod and L. Ranganath Department of Veterinary Surgery and Radiology, Veterinary College, Bangalore-24

An eight month old Female dog was presented to the Veterinary College Hospital, Bangalore with a history of anorexia, Increased salivation, odonophagia, retching since two days and not responding to the medical treatment. Owner also mentioned that the dog was fed with non vegetarian diet two days back. On physical examination animal was having high fever, other parameters like heart rate, respiratory rate were within normal range. On cervical oesophageal palpation abnormal hard structure was felt which was confirmed by radiograph. Therefore, it was decided to relieve the obstruction under general anesthesia.Dog was restrained in right lateral recumbency. Tongue was pulled out by opening the mouth for visualization of foreign body. Throat forceps was inserted slowly into the oesophagus. Bone piece was located and taken out by gently under C-arm guidance. Retrieval of foreign body resolved the symptoms and the dog made uneventful recovery. Abst 32 : III

Endoscopic examination of oesophagus and stomach in 56 dogs with womitting

Syam K.Venugopal., Anoop,S., Narayanan, M.K., John Martin,K.D and Devanand, C.B Department of Veterinary Surgery and Radiology College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala state- 680 651

Fifty six dogs presented to the Veterinary College Hospital, Mannuthy referred with the history of persistent vomiting/regurgitation even after routine medical treatment, were subjected to endoscopic examination of the oesophagus and stomach. Thirteen dogs were having varying degrees of mega oesophagus and one dog each were having foreign body obstruction of oesophagus with chicken bone and fish bone. Three dogs exhibited lesions of reflux oesophagitis and four dogs were having distal oesophageal ulcers. One dog having intractable vomiting was suffering from hiatal hernia. Out of thirty three dogs underwent gstroscopy, ten dogs were having gastritis of varying degrees. Five dogs exhibited ulcerations in the fundic stomach and one dog showed ulcerations in the pyloric antrum. Four dogs were having foreign bodies in the stomach and in remaining nine dogs, no apparent abnormality could be detected. Among the fourteen cases which were subjected to endoscopic biopsy, one case could be diagnosed as lymphocytic plasmacytic gastritis, a rarely diagnosed form of immune mediated gastritis. Following diagnosis, all the cases were treated with specific medical treatment protocols and feeding management techniques. Foreign bodies were removed endoscopically. Abst 33 : III

Surgical removal of gastric foreign bodies from a Labrador dog

Brijesh Kumari Meena, M C Parashar, A. K. Palai, K Kachwaha, S M Qureshi, M Nagar and T K Gahlot Department of Veterinary Surgery and Radiology College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001, Rajasthan. INDIA

A male Labrador dog aged 3 years was presented with a history of ingestion of foreign bodies and frequent vomition since two days.Lateral and dorso-ventral radiographs of the abdomen revealed presence of multiple foreign bodies in the stomach. These included sharp foreign bodies as well. The gastrotomy operation was performed under general anaesthesia and foreign bodies were removed from the stomach. These included wrist bands, hair bands, leather neck belt and hairs. Post operatively fluid therapy was followed twice a day along with the Ceftrixone with tazobactum 562.50 mg bid for seven days, paracetamol 100 mg i/m for three days, ranitidine 150 mg bid for 10 days and tribivet 2ml i.m. bid for 5 days. A blend diet was given after 5 days. Skin sutures were removed on 10th post operative days. Dog made an uneventful recovery and routine diet was given after three weeks of operation. The dog recovered uneventfully.

138

Abst 34 : III

An overview of some unusual surgical affections in canine patients

J. Singh, Madhu, D.N., A.C.Saxena, P. Kinjavdekar, Amarpal, H.P. Aithal, A. Gopinathan,A.M. Pawde and M.M.S. Zama Division of Surgery, Indian Veterinary Research Institute, Izatnagar-243122

Surgical techniques are routinely performed on emergent as well as elective basis and involve different type of procedures carried out on various body systems with varying degree of invasiveness. The present communication deals with different surgical maladies not routinely encountered and their management as carried out in Referral Veterinary Polyclinic, IVRI, Izatnagar on companion animals over a period of one year (January to December, 2011). Different breeds of canine patients of varying age groups were taken for the study. Most of these cases were referred ones which were already being treated with either minor surgical or therapeutic intervention but failed to yield positive results. Different surgical procedures included, scrotal ablation for testicular injuries, removal of perianal gland tumorous growth, recurrent urolithiasis, asymptomatic foreign body in stomach, intestinal trichobezoar, colopexy for recurrent intestinal prolapse, dermoid cyst excision, caecolith removal from large intestine, unusually large urolith, enteroplication for intussusception, large tumorous growth on face, eye lacerated wound, testicular tumour mass, large sized wound, pyometra, rhabdomyosarcoma over shoulder region, train accident injury, seroma formation as fracture management complication, snooze injury, reconstructive vulvoplasty, esophageal obstruction, oral, aural, rectal and penile myiasis, uterine rupture, bullet retrieval, mating injury, rubber ball ingestion, dystocia associated with polycystic ovarian syndrome, hypospadiasis, bilateral perineal hernia and dorsal laminectomy. The surgical procedures, findings and clinical outcome are discussed. Abst 35 : III

Ocular disorders and their surgico-therapeutic management in companion animals

I.P. Sarode, Madhu D.N., J. Singh, A.M. Pawde, P. Kinjavdekar, Amarpal, H.P. Aithal, A. C. Saxena and M.M.S. Zama Division of Surgery, Indian Veterinary Research Institute, Izatnagar-243122

Diagnosis and clinical assessment of visual changes are important aspects of small animal practice. The stress due to impaired vision affects the nutrition, physiology, utility as well as reproduction in small animals. In the ocular region, the eyelids, cornea/conjunctiva and lens may be affected with various physical/ functional abnormalities, traumatic injuries and certain congenital or acquired disorders which may lead to complete loss of vision. The study was conducted on 57 clinical cases of different breeds of canine patients presented to Referral Veterinary Polyclinic, Izatnagar reported for ocular problems during period from March 2010 to June 2010. Out of various species of animals presented with the affections of eyes, incidence was found to be highest in canine patients. The highest cases of eye affections were seen in animals of 2-4 years of age (24.56%). In canines highest cases were recorded in spitz breed (30.23%) which might have been due to more number of animals of this breed presented to our clinics in this area. Males suffered more frequently than females from ocular affections (61.40%). Among all of these affections, the cases of corneal opacity were highest among eye affections. Ocular affections were treated by medical management and by surgical treatment as per the need of the case with the variable rate of success. Other clinical situations encountered during the study period included varied number of affections like cherry eye, squamous cell carcinoma, traumatic proptosis, prolapse of third eyelid, dermoid cyst, eyelid laceration and cataract which were treated surgically. However, clinical affections like corneal ulcer, keratoconjunctivitis, epiphora and glaucoma were treated by both oral and topical administration of drugs. The outcome of cases and comparative efficacy of different treatment modalities will be discussed in the paper.

139

Abst 36 : III

Incidence and therapeutic management of maggot wounds in dogs: A review of 100 cases
Sivanarayanan T.B, Madhu, D.N., J. Singh, D. Bodh, A.M. Pawde, Amarpal, H.P. Aithal, P. Kinjavdekar and M.M.S. Zama Division of Surgery, Indian Veterinary Research Institute, Izatnagar-243122

The present study was carried on the clinical cases of maggot infested wounds in companion animals referred to the Division of Surgery, IVRI, Izatnagar. Anamnesis of each clinical case was recorded in order to determine the initiating cause, duration of the disease followed by its management in two different phases. The information data regarding species, breed, age and sex of animal was collected in all cases from the owner. The analysis revealed that the condition accounted for a significant number of clinical cases of wounds particularly in companion animals than other domestic animals which might be due to more incidence of bite wound injuries encountered in the canines. The maximum incidence was present in animals of age group of 2-4 years (56%) while the incidence in the age range of 1-2 years was 23%, 6 years and above (14%) while animals with age group 4-6 years and above contributed only a marginal 7% incidence rate respectively. Breed wise incidence was maximum in non-descript dogs (43%) followed by spitz breed which accounted 32% incidence; mongrel breed (19%) while other breeds accounted an incidence rate of 6% respectively. The sex wise incidence was more in females 57% as compared to male dogs (43%). In the next stage of study, the study was carried out to evaluate the chemotherapeutic management of the condition using subcutaneous administration of single dose of ivermectin@200 g/kg body weight along with plugging of wound with turpentine soaked gauze (Group A) and along with topical application of herbal fly repellant spray (Group B) daily for 5 days. The results were evaluated on the basis of presence of live maggots (if any), fluid discharge from the wound and time for complete healing of wound over 7 days post treatment. It was observed that both treatment protocols appeared to be fruitful in recovering from the condition but the results were slightly better in group B but it was not found to be significantly different from the group A animals. It was found that maggots were absent in most of the cases (86%) from 3rd day onwards while only a few cases (4%) required application of respective treatment for another 2 days and rest 10% cases could not be followed up for the complete study period as non-return cases. No major complications were observed during the healing of wound. The details of various cases will be delivered at full length in the paper. Abst 37 : III

Multiple cystic calculi in dogs A case report

M C Parashar, A. K. Palai, K Kachwaha, S M Qureshi, M Nagar and T K Gahlot, Department of Veterinary Surgery and Radiology, College of Veterinary and Animal Science, RAJUVAS,Bikaner-334001, Rajasthan. INDIA

Cystic calculi were diagnosed in four male dogs out of which one was Dalmatian (4 Years), two were Doberman ( age 3 and 4 years) and one was German Shepherd (age 5 Years). All the dogs had history of difficult and prolonged micturation. The catheterization of urethra revealed no obstruction in urethra. The lateral radiograph of abdomen revealed presence of multiple cystic calculi in these cases. These dogs were subjected to laparo- cystotomy and calculi were removed under general anaesthesia. A baby feeding tube was used as a catheter and its other end was kept in side the bladder passed in to the urethra to the external urethral orifice. Post operatively dogs were kept on Ceftrixone with tazobactum 562.50 mg bid for seven days, meloxicam 50 mg i/m for three days and urinary alkalizer one tea spoon bid orally. Skin sutures were removed after 10th days in all the cases. A follow up of these cases was made up to 6 months and reoccurrence was not common.

140

Abst 38 : III

The removal of a tissue ring of meat food around the tongue in a cat
Brijesh Kumari Meena, M C Parashar, A K Palai, K Kachwaha, S M Qureshi M Tanwar, N.R. Purohit and T K Gahlot Department of Veterinary Surgery and Radiology College of Veterinary and Animal Science, RAJUVAS, Bikaner

A domestic cat age a 2years was presented to the surgery clinic with a history of dullness and salivation. A personal examination revealed presence of a tissue ring of meat food around the base of tongue. The cat was sedated using xylazine and ketamine and the tissue rings were removed by pulling these with the help of artery forceps. These tissue rings were part of goat's meat being offered to the cat.

141

Session-IV
Canine Reproduction and Breeding

142

LP 1 : IV

Advances of three dimensional and four dimensional ultrasonography in the field of canine practice
R.K. Chandolia and Jinsa George Department of Vety. Gynaecology & Obstetrics, Lala Lajpat Rai University of Vety. & Animal Sciences, Hisar 125004

Ultrasonography has an importance place in human practice and veterinary field especially in canine practice. Since many years two dimensional ultrasound has been used for scanning purposes both in human and animal practice. But the scenario has changed in human practice with development of three dimensional technology and later four dimensional ultrasonography has developed which shows movements of the objects being scanned especially in the case of fetuses. Nowadays it has been common to use these advanced technology in the human practices. Yet these technologies are in the childhood stage in the veterinary field. High cost of 3D/4D ultrasound equipment, operational difficulties in non sedated animals & lack of specific knowledge about the operation of volume scanning hinder the use of this technology in the veterinary field. Better understanding of the different application of these technologies can be made to use in research areas for the better understanding of the abnormalities, post therapeutics as well in the diagnosis of the diseases Principle of three dimensional and four dimensional ultrasonography Sound waves of frequency higher than human audible frequency usually ranges from 2-13 MHz are used in ultrasonography. Depending upon on depth of tissue from the scanning surfaces frequency is selected. Three dimensional ultrasonography gives three dimensional images of the volume being scanned .it works on the same principle of 2D ultrasonography but ultrasonographic beams are sent different angles to get three dimensional image of object being scanned. Volume information is obtained either directly using 2D array probe or by reconstructing three dimensional volume from a series of continuous or noncontinuous 2D images by using software (Fenster and Downey, 2000). An advancement of 3D technology is 4D ultrasound. Four dimensional ultrasound adds the fourth dimension as time and gives a dynamic real-time 3D ultrasonography of the concerned organ with a continuous volume image acquisition and rendering process. (Khurana and Dahiya, 2004) Acquisition of volume data Acquisition and storage of a three- dimensional ultrasound scan can be completed taking less time by an experienced person. But the movement of the animals, probe, panting will affect image quality so better restraining of animals are necessary for the better image quality. Three dimensional ultrasound data can be obtained with mechanical volume probes or by tracking of continuous or non continuous images with conventional two dimensional transducers [Downey et al., 2000 Kratochwil et al., 1998]. Mechanical probe having rapid oscillation technology is used conventionally in most of the machines. It takes images by rotating the piezoelectric crystals with the help of motor inside the probe and these images are reconstructed in the scanner automatically (Deng and Rodeck, 2004). Freehand systems involve optical or more commonly magnetic field tracking attached to 2D transducer as position sensors. The new generation two dimensional matrix array probes with piezoelectric crystals arranged in two dimensional arrays use electronic scanning to sweep an ultrasound beam over the volume-of-interest to produce 3D images in real time. In 2D matrix array by maintaining the transducer in a fixed position and rotating the volume using the system trackball a 360 rotation and examination of selected structures can be possible Such that an object with its two sides can be visualized in real time with better spatial resolution. (Gonalves et al., 2006) Image interpretation There are several display techniques that can be for analyzes of three-dimensional ultrasound data

143

(Rankin et al., 1993). The three basic types of rendering techniques in use are multiplanar imaging, surface rendering, and volume rendering. By multiplanar imaging, the data is visualized in three orthogonal scan planes. While viewing through each two-dimensional scan plane, the corresponding orthogonal planes are displayed immediately. Coronal view can be obtained by rotating the acquired volume (Jurkovic, 2002). In a surface rendering technique, the boundaries of a structure identified are shaded and illuminated giving shape to the surface of the structures. Volume rendering casts rays through volume data and projects the results into a 2D plane. Depending on the algorithm wide spectrum of visual effects can be produced. Minimum- and maximum-intensity projections as well as x-ray (translucency) projections are available which allows visualization of echo poor or echo rich structures. Maximum transparency mode visualizes echo rich structures obtained by scanning with reduced gain. In minimum transparency mode the organs with high transparency are highlighted against more echogenic area. But overlapping of hypo echoic structures can be come as artifacts (Lee et al., 2002). X ray mode displays bony structures by decreasing the ultrasound gain to suppress the muscles and soft tissue imaging surrounding it (Lee, 2003).Tomographic ultrasound imaging cut volume data into number of equal parts and represented in two dimensional representations allowing topographic identification of the volume of interest. The width of each slice and number of the images at a time in the monitor can be adjusted by the operator (Hildebrandt et al., 2009). Fourdimensional images of bones can be obtained by decreasing gain settings only, with no need for cropping. With color Doppler imaging, four-dimensional reconstruction of vascular structures is possible with this new technology. (Goncalves et al., 2006) Application The multiplanar presentation and niche mode are quite useful to determine extend of nodules, cysts or tumors and to check whether these are present inside or outside of an organ. Hildebrandt et al (2009) used multiplanar presentation mode for the parallel measurements of head (top left), yolk sac diameter (top right) and crown-rump-length (bottom left) in a canine embryo. Niche mode is a cut open view of volume image used to visualize the data inside the volume in a particular plane and can be applied for study of the placental investigation in canine pregnancy. Surface rendering can be used for evaluating the embryonic and foetal integrity in canines (Hildebrandt et al., 2009).The volume measurement of irregular structures are better assessed with 3D and studies can be performed for assessment of growth in order to decide medical or surgical treatment and for the follow up of treatment. The use of this technology in applying color doppler, in guiding needles for different puncture procedures as well in evaluating the fetal heart are currently under close research in human practice and shows future in canine practice also (Purandare C N, 2006). If used along with color Doppler, transparency mode can be used for the study of three dimensional architecture of growing mammary complex in pregnant bitches (Hildebrandt et al., 2009).3D ultrasonography offers a more ample image of anatomical structures and pathological conditions in human practice and also permits observation of the exact spatial relationships( Lees W., 2001 Timor-Tritsch et al., 2002) studies have to undergone more in this area in animal practice with these newer technology . 3D power Doppler ultrasound offers investigation of intratumor vascularization and volume of cervical cancer more easily(. Hsu SC et al., 2004). Ultrasonography seems to have many applications for diagnosing of ocular diseases according to anatomical structure of the eye (Janos N., 1997). Caudal ocular ultrasonography is difficult with two-dimensional ultrasound because of the wrong probe positioning and angle. The size and distribution of the tumors are better visible in 3DU especially in the caudal region of the orbit (Romero and Finger 1998) Lesions of the caudal portion of the orbit (e.g. optic nerve atrophy) are better visualized by this technique. A study conducted by Vosough et al (2007) 3D ultrasonography of the eye in dogs showed marked advantages in image acquisition for interpretation of all aspects of the ocular structures and suggested that the 3Dultrasound gives useful images for teaching and diagnostic purpose and Lesions of the caudal portion of the orbit (e.g. optic nerve atrophy)can be better visualized by this technique. 3D/4D is widely used to identify fetal anomalies (Tonni et al., 2005, Dyson et al., 2005) in human obstetrics. Increased diagnosis of fetal anomalies has been reported by this technique compared

144

with conventional sonography in human practice (Merz. and Welter, 2005). By offering detailed information about pregnancy status and birth prediction, 3D/4D technology improved the diagnostic confidence. Fetal resorption in animal, ectopic pregnancy can be better studied and can be easily identified .( Hildebrandt et al. ,2009) and also aid in better visualization of needle during biopsy(Won.,et al., 2003) .Soft tissue like heart, kidneys, liver, pancreas, gall bladder, eye, and thyroid (Slapa et al., 2011) can also be better visualized. Advantages There are some features to three dimensional ultrasonography with several universally applicable advantages. In a 3D acquisition, as the sonographer scans the region of interest with a single sweep of volumetric transducer, it will take no longer to acquire multiple image series through the organ of interest, so scan times can be greatly reduced. Data can be stored which can be worked out later also. Virtual planes which cannot be obtained in conventional two dimensional ultrasonography available in 3D ultrasonography. The ability to give better qualitative and quantitative information helps in effective diagnosis. 3D surface visualization is accomplished by this technique improves Detailed anatomical and pathological studies. Precise volume measurement of organs with irregular shape will help in the detection of progression of the diseases and response to the treatment. This may have applications in follicle monitoring in the future (Goncalves et al., 2006).With four dimensional ultrasonography, movement of the internal structures and improved visualization of biopsy devices by more perceptible information on the spatial relationship between the biopsy needle and the target lesion can be obtained(Won.,et al., 2003). 2D matrix array may become an attractive alternative to examine anatomic structures of the adult as well as fetuses, especially fetal hearts enabling view of two different planes of section of the same structure, in real time, without resolution loss (Goncalves et al., 2006). Contrast-enhanced 4D-US can be done for the visualization of the staining of the tumors and the blood flow of surrounding organs three -dimensionally. Limitation Although 3D and 4D ultrasonography offers promising future, some limitation has to be overcome by this technology to make it routine in clinical practice. As 3D image acquisition is not fundamentally different from 2D ultrasound, contrast limitations still apply to 3D also. So if there is inadequate amniotic fluid surrounding the fetus, or if the fetus has its face in the posterior position in the uterus, there will be difficulty visualizing structures and the face. False positives can be increased if we ignore this (Maymon et al 2000, Fernandez et al 2006., Leung et al 2005). Breathing and motion artifacts make difficulty to get a clear image with three dimensional ultrasonography. While the artifacts with the breathing movements are not affected by the four dimensional ultrasonography. To date there are no three dimensional / four dimensional ultrasound machines are available only for veterinary practice and hence slow acquisition time and software settings optimized for the human body hinders the resolution of the data obtained. Available Trans abdominal volume probes are bulkier posing some handling difficulty. 4D ultrasound scanner with transvaginal probes are available but are costlier (Hildebrandt et al., 2009). Determination of image orientation becomes difficult to determine as no standardized display convention has emerged till now for the reconstructed images. Rendering of data in 3D using volume or surface rendering techniques introduces an additional layer of potential artifacts and lack of standardized review. Finally, while 3D images are qualitatively more intuitive than traditional 2D sections, data as to the quantitative clinical benefits of 3D ultrasound imaging are limited, particularly compared with the vast volume of literature and expertise available for 2D imaging ( Lazebnik. R.S and Desser, T.S 2007). In the 4D ultrasonography with 2D matrix array probe, due to lower transducer frequencies it gives lower resolution than mechanical volumetric transducers and has narrow volume display (Goncalves et al., 2006). Conclusion Three dimensional and four dimensional ultrasonography an emerging modality in human practice and veterinary practice . Still it is considered as an adjunct to conventional 2D ultrasonography (Bega et al.,

145

2001). Unlike 2D ultrasound, 3D technology is only in its infancy. higher cost of the machine, limited knowledge concerning the operational skills and difficulty in managing the motional artifacts in the animal, make development of this imaging technique difficult in veterinary practice . Reduced amount of fetal fluid in the small animal compared to human fetus hinders the clarity of the imageswith the machines intented for human practice. Technological refinement and increased standardization of 3D ultrasound evaluation in the coming decades may offer a new opportunity to overcome breathing artifact and motion artifacts during 3D/4D scanning (Hildebrandt et al., 2007).there ismuch research has to be done in veterinary to explore its applicability in the veterinary practice. Reference: Bega, G.; Lev-Toaff, A.; Kuhlman, K.; Kurtz A,; Goldberg, B. and Wapner, R.(2001). Three dimensional ultrasonographic imaging in obstetrics: present and future. J Ultrasound Med., 20:391408. Deng, J. and Rodeck, C.H.(2004). New fetal cardiac imaging techniques. Prenat Diagn., 24:10921103 Downey, D.B.; Fenster, A. and Williams, J.C. (2000) Clinical utility of three dimensional US. Radiographics. 20: 559-71. Dyson, R. L.; Pretorius, D. H. and Budorick, N. E et al., (2000).Three-dimensional ultrasound in the evaluation of fetal anomalies, Ultrasound Obstet. Gynecol. 16:321328. Fenster, A. and Downey, D.B. (2000) Three-dimensional ultrasound imaging. Annu Rev Biomed Eng. 2:457-475. Fernandez, L.J.; Aguilar, A. and Pardi, S. (2004) Three-dimensional ultrasound in small parts: Is it just a nice picture? Ultrasound Quarterly.;20:119-25 Goncalves, L. F.; Nien, J. K.; Espinoza, J.; Kusanovic, J. P.; Lee, W.;, Swope B, Soto,E.; Treadwell, M.C. and Romero, R. (2006). What does 2-dimensional imaging add to 3- and 4-dimensional obstetric ultrasonography?. J Ultrasound Med., 25(6):691-699. Gonalves, L. F.; Espinoza, J.; Kusanovic, J. P.; Lee, W.; Nien, J. K.; Forgas, J. S.; Mari,G.; Treadwell, M.C. and Romero, R. (2006) Applications of 2-Dimensional Matrix Array for 3- and 4-Dimensional Examination of the Fetus. J Ultrasound Med., 25:745755. Hildebrandt, T.B.; Drews, B.; Kurz, J.; Rollig, K.; Yang, S. and Goritz, F. (2007). 3D and 4D Ultrasonography: a new tool in veterinary research. BIR News., 1: 810. Hildebrandt, T. B.; Drews, B.; Kurz, J.; Rollig, K.; Yang, S. and Goritz, F.(2009) Pregnancy monitoring in dogs and cats using 3D and 4D Ultrasonography. Reprod.Dom.Anim ., 4:123-125 Hsu, K.F.; Su, J.M. and Huang, S.C. et al. (2004) Three-dimensional power Doppler imaging of early-stage cervical cancer. Ultrasound Obstet Gynecol ;24:664-71 Janos, N. (1997) Three dimensional ultrasonogeraphy of the eyeball and orbit. Ophthalmology. 34:84-88. Jurkovic, D. (2002). Three-dimensional ultrasound in gynecology: a critical evaluation. Ultrasound. Obstet. Gyneco., l19:09117. Kratochwil, A. (1992) Attempt at three-dimensional imaging in obstetrics.Ultraschall Med. 13: 183-6. Khurana, A, and Dahiya, N. (2004). 3D and 4D Ultrasound: A Text and Atlas. first ed., Anshan, U.K. Lazebnik, R. S. and Desser, T. S.(2007) Clinical 3D ultrasound imaging: beyond obstetrical appliacations.SCME ultrasound Lee, H. J.; Choi, B. i.; Han, J. K.; Kim, A.Y.; Kim, K. W.; Park, S. H.; Jeong, J. Y. and Kang, J.W. (2002). Three-dimensional Ultrasonography Using the Minimum Transparent Mode in Obstructive Biliary Diseases. J. Ultrasound. Med., 21: 443453. Lee, W. (2003).3D fetal ultrasonography. Clin. Obstet. Gynecol., 46: 850867. Lees, W. (2001) Ultrasound imaging in three and four dimensions. Seminars in Ultrasound, CT & MR.;22:85-105.

146

Leung, K.Y, Ngai, C.S.W, and Chan, B.C. et al. ( 2005 )Three-dimensional extended imaging: a new display modality for three-dimensional ultrasound examination. Ultrasound Obstet Gynecol; 26:244-51 Maymon, R.; Herman, A. and Ariely, S. et al. (2000) Three-dimensional vaginal sonography in obstetrics and gynaecology. Hum Reprod Update; 6:475-84. Purandare, C. N. (2006) 3D 4D Ultrasound in Obstetrics and Gynecology J Obstet Gynecol India.. 56(1):22-24 Rankin, R.N.; Fenster, A and Downey, D.B, et al. (1993)Three dimensional sonographic reconstruction: techniques and diagnostic application. Am J Roentgenol; 161: 695-702. Slapa, R. Z.; Jakubowski, W. S.; Srzednicka, J. S. and Szopinski, K.T. (2011). Advantages and is advantages of 3D ultrasound of thyroid nodules including thin slice volume Rendering. Thyroid Research. 4:1 Timor-Tritsch, I.E.; Han, E. and Platt, L.D. (2002) Three-dimensional ultrasound experience in obstetrics. Curr Opin Obstet Gynecol.14:569- 75. Tonni, G.; Centini, G. and Rosignoli, L. (2005). Prenatal screening for fetal face and clefting in a prospective study on low-risk population: can 3- and 4-dimensional ultrasound enhance visualization and detection rate?. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod., 100: 420426. Vosough,D.; Masoudifard,M.; Veshkini.A; Vajhi, A. R.; Sorouri,S (2007) Three Dimensional Ultrasonography of the Eye and Measurement of Optical Nerve Sheet Diameter in Dog. Iranian j. veterinary surgery 2 (2 ) :73-77. Won, H. J.; Han, J. K.; Do, K. H.; Le, K. H.; Kim, K.W.; Kim, S. H.;Yoon, C. J.; Kim, Y J,; Park, C. M, and Choi, B. I. (2003). Value of Four-dimensional Ultrasonography in Ultrasonographically Guided Biopsy of Hepatic Masses. J. Ultrasound. Med .,22:215220, Romero JM, Finger PT. Three dimensional ultrasonogeraphy of measurement of choroidal melanoma. Am J Ophthalmol 1998; 126:842-846.

147

LP 2 : IV

Prediction of parturition date in bitches

V. Chandrashekara Murthy Department of Veterinary Gynaecology and Obstetrics, Veterinary College, Hebbal, Bangalore.

Introduction In the recent years, canine breeding has rapidly developed into an organised and highly lucrative industry and consequently, there has been tremendous increase in breeding of the pedigree dogs with breeders even importing dogs at fancy price. Therefore, determination of gestational age and prediction of the parturition date could be important for both the breeder and for veterinary obstetrician. Further, accurate determination of the expected parturition date will allow the clinicians to document premature birth and determine the earliest premature delivery date that is compatible with puppy survival. Whelping is reported to occur over wide range of 57 to 72 days (Concannon et al., 1983; Moiser , 1986), making it extremely difficult to predict the parturition accurately. The wide variation in the canine gestation length is reported to be due to long period of receptivity of the bitch, the great individual variation between onset of oestrus and ovulation and long survival of sperms in the uterus of estrus bitch (Wildt et al., 1978; Johnston et al., 1988). Canine gestation length timed from the day of luteinizing hormone surge showed very little variation (concannon et al., 1975). However, in clinical set up, prediction of parturition date which focuses on the identification of LH surge during the mating time, could be very expensive and time consuming and therefore, is generally not preferred by the practicing clinician. The preovulatory rise in serum progesterone levels have shown to be a reliable physiological land mark for prediction of the parturition date at the timing of mating. Transabdominal ultrasonography has been widely used to determine the gestational age, asses the foetal viability and predict the date of labour. However, concerns have been raised regarding the accuracy of prediction of parturition date in bitches, in view of the wide range of their body size. The present study was conducted to evaluate the efficacy of various methods for accurate prediction of parturition date in bitches. Materials and methods 1. The objective of study was to determine the accuracy of prediction of parturition on the basis of initial preovulatory rise in serum progesterone concentration. For this purpose 107 bitches belonging to 13 different breed ,ranged between 0 to 3 parity, were utilised which conceived following recommendation of mating on the basis of serum progesterone concentration. The serum progesterone concentration was determined by using enzyme linked fluorescent assay (ELFA). 2. The objective was to determine whether it was possible to accurately predict parturition date in bitches on the basis of ultrasonographic measurements of the gestational sac or foetal head diameter. This part of study was carried on 113 bitches which were between 30 to 35 days after their 1st mating and diagnosed pregnant on presentation by their owners. Scanning was carried out using B-mode ultrasound equipped with multi frequency probe of 3.5, 5 and 7.5 MHz. A. Formula for the calculation of gestational age and prediction of date of parturition in bitches using ultrasonographic measurements of gestational sac diameter (GSD). Gestational age = gestational sac diameter 6+20 Predicted date of parturition = 65days gestational age B. Formula for the calculation of gestational age and prediction of date of parturition in bitches using ultrasonographic measurements of foetal head diameter (HD). Gestational age =head diameter 15+20 Predicted date of parturition = 65days gestational age 3. Prediction of parturition on the basis of physical and behavioural changes. In this study eleven pregnant mongrels were closely monitored for behavioural and genital changes. The changes

148

4.

considered were nesting signs, panting, onset of lactation, and presence of vaginal mucus discharge and relaxation of the vulva. The number of animal exhibiting behavioural and genital changes and the time of onset of changes in relation to the actual day of parturition were determined. Prediction of parturition date on the basis of changes in the rectal temperature. Same eleven pregnant mongrels were utilised to identify any prepartum drop in rectal temperature and to establish feasibility of using changes in rectal temperature for predicting date of parturition. The temperatures were taken 1st 7AM, 1PM and 7PM during advanced pregnancy.

Results and Discussion Accuracy of prediction of parturition date on the basis of initial rise in preovulatory serum progesterone concentration (n=107) preovulatory serum progesterone concentration (ng/ml) Mean Range 3.0103ng/ml 2.023.95ng/ml Accuracy of prediction of parturition date in relation to expected date (%) Same day(65) 1 day(66-64) 2 days(63-67) 16.82(18) 65.42(70) 87.85(94)

Comparison of accuracy of prediction of parturition date between different sized breeds of bitches on the basis of ultrasonic measurement of gestational sac diameter Date of parturition Percentage accuracy of prediction of parturition date X2 Value Size of the breed Small to medium Large Giant (n=8) (n=21) (n=15) nil 4.76(1) 6.66(1) 20.71* nil 23.8(5) 53.33(8) 76.09* nil 42.85(9) 66.66(10) 99.23*

Same day(65th) days (64-66) 2 days(63-67)

*Accuracy of prediction varied significantly between different sized breeds (p<0.05) Comparison of accuracy of prediction of parturition date between different sized breeds of bitches on the basis of ultrasonic measurement of foetal head diameter Date of parturation Percentage accuracy of prediction of parturition date X2 Value Size of the breed Small to medium Large Giant (n=40) (n=18) (n=11) 5.00(2) 11.11(2) 18.18(2) 8.43* 10.00(4) 38.88(7) 45.45(5) 33.67* 17.5(7) 61.11(11) 63.63(7) 53.10*

Same day(65th) days (64-66) 2 days(63-67)

*Accuracy of prediction varied significantly between different sized breeds (p<0.05) Comparison of the accuracy of the method of prediction of parturition date using ultrasonography measurements (gestational sac diameter or foetal head diameter) between different sized breeds of bitches (n=113) Date of parturation Same day 1 day 2day Methods GSD HD GSD HD GSD HD Small to medium(%) 0(0) 5.0(2) 0(0) 10.0(4) 0(0) 17.5(7) large(%) 4.76(1) 11.11(2) 23.80(5) 38.88(7) 42.85(8) 61.11(11) Giant (%) 6.66(1) 18.18(2) 53.53(8) 45.45(5) 66.66(10) 63.63(7)

149

Behavioural signs exhibited by pregnant Mongrel bitches in relation to the day of parturition (n=11) Behavioural signs Excessive nesting behaviour Panting % of bitches showing behavioural signs(n) 36.30(5) 54.50(6) Time of onset of behavioural signs in relation to the day of parturition -20 to 0 days -1to 0 days

Mammary and genital changes exhibited by pregnant Mongrel bitches in relation to the day of parturition (n=11) Mammary and genital changes Onset of lactation Mucoid vaginal discharges Vulval relaxation % of bitches showing changes(n) 36.3(3) 45.45(5) 63.3(8)
0

Time of onset of behavioural signs in relation to the day of parturation -15 to 0days -10 to -3 days -3 to -1 days

Changes in rectal temperature ( F) during the last week of pregnancy in Mongrel bitches (n=11) Days prior to parturation
Temperature Mean SE Range -6 101.70.02 100.9-102.3 -5 101.50.01 100.1102.7 -4 101.60.01 101.1102.3 -3 101.50.01 99.8 102 -2 101.30.03 100.3 102.5 -1 100.60.02 98.2 100.1 0 101.40.01 100102.6

During the course of present investigation, 113 bitches were diagnosed pregnant on ultrasound examination and all these bitches had been mated on predetermined dates. These bitches delivered at variable times from the day of first mating and the interval from the first mating to parturition date ranged between 59 to 72 days and only 9.7% of bitches whelped between 62 to 64 day after the first day of mating. The range of gestation length observed in the present study agrees with the reports of Doak, et al.,(1967); Phemister (1973);Wildt et al (1978) and concannon (1986) and emphasize the inaccuracy of predicting the date of parturition as the interval from the day of first mating to the day of whelping is quite variable. The influence of the breed on the gestation length has been controversial. Okkens et al., (1993) reported that breed influenced the duration of gestation in bitches. Likewise, litter size is another factor which has been studied for its influence on the length of gestation in bitches. The mean preovulatory serum P4 concentration in the present study was recorded to range between 2.02 to 3.95 ng/ml with a mean of 3.01 0.03ng/ml. This finding is in close agreement with the reports of wright(1990)(2 to 4ng/ml) and Renton et al., (1991)( 3ng/ml). In other reports, the preovulatory serum p4 concentration was determined to be much lower (Johnston and Root,1995 : 1.9ng/ml;Kutzler et al .,2003:2.021.8ng/ml). In the present study, parturition occurred over wide range of 59 to 68 days and the average gestation length was determined as 64.290.14 days. These figures are closer to the predicted date of parturition (65) than those in the (61.41.5days) reports of Okkens t al (1993). In the present investigation, 65.42% of the animals delivered within 1 day and the accuracy of predicting parturition within 2 day was fairly high (87.85%). The result of the present investigation is in very close agreement with the reports of Kutzler et al.,(2003) who recorded 67.90% and 90% within 1 and 2days respectively. Ultrasonography has been widely used as method of diagnosing early pregnancy and foetal viablityin the bitch (Johntson et al., 1983; England and Allen,1990). In the present study, parturition date predicted through measurement of gestational sac diameter in 44 bitches was same as the actual date of parturition in only 4.5% of the animals. Poor correlations were observed between the parturition date predicted through measurement of head diameter in 69 other animals and actual parturition date. Further the accuracy of

150

predicting the parturition date within 1 day and 2 days were also very poor with measurement of both gestational sac diameter as well as head diameter. On the other hand Luvoni and Grioni (2000) reported that, measurement on gestational sac diameter was 90.9% accurate and that of biparietal head diameter was 70.8% accurate for determining the date of parturition to within 1 day. In the present study, the onset of behavioural, mammary and genital changes in relation to parturition date in bitches was most unpredictable. While some bitches exhibited nesting behaviour as early as 20 days before parturition, in others, it was either not noticed or noticed only on the day of parturition. The result of present study indicates that they are not reliable signs for predicting the parturition date. The present study documented that 81.8% of the animal showed significant decline in rectal temperature 12 to 24 hour before whelping. The finding of the present study with regard to prepartum drop in temperature has also been documented in earlier studies (Concannon, 2000; Johnston et al., 2001). Disadvantage associated with the monitoring rectal temperature is that, it may need frequent recording and drop in temperature may be transient and may be missed. Conclusion In conclusion, the present study revealed that it is difficult to predict exact date of parturition with the available techniques. Prepartum fall in rectal temperature and onset of physical, behavioural and mammary changes are not accurate technique to determine the accurate parturition date. There is clearly a need to establish parturition prediction table using ultrasonographic measurements for each breed of dog. However, Prediction of parturition date on the basis of initial rise in preovulatory serum progesterone concentration was accurate to the extent of 2 days in nearly 90 % of the animals. Unlike ultrasonography which requires, experience in interpretation, besides the initial cost of equipment, progesterone assay can be easily carried out in many clinical laboratories. It is less expensive, rapid and accurate.

151

L P 3 : IV

Advances in medical management of canine pyometra

Sudha, G Department of Veterinary Gynecology and Obstetrics Veterinary College, KVAFSU, Bangalore- 560 024

Cystic Endometrial HyperplasiaPyometra Complex is an acute or chronic post-estrual disease of adult intact bitches. Pyometra leads to inflammatory exudates in the uterus that is associated with variable clinical and pathological signs. The incidence of pyometra increases with age in intact bitches and may be as close as 66 percent in bitches over 9 years of age. Substantial improvement in the treatment of pyometra has been made in the last decade. Results are good with better availability of medication to achieve the goal of luteolysis and prevention of progesterone effect, uterine contraction and evacuation, uterine regeneration and inhibition of bacterial growth. In combination with good supportive and intensive care during period of treatment, any patient of pyometra weather valuable breeding stock or not, may benefit from medical approach to pyometra. Pathogenesis: Pyometra is progesterone mediated uterine disease that is initiated or occurs during diestrus, by an interaction of hormonal influence and uterine bacteria. Endometrium is physiologically altered due to repeated exposure to progesterone and this results in an eventual atypical response to this hormone. Increased endometrial growth and glandular secretion stimulated by elevated progesterone concentration following ovulation may predispose the uterus to pyometra during luteal phase. The decreased activity of the myometrium under the progesterone influence combined with accumulation of glandular secretion with in the uterine lumen may enhance the growth of intrauterine bacteria. Types of pyometra: Type I- Uncomplicated cystic endometrial hyperplasia, where the clinical signs will be mucoid vulvar discharge during metoestrus Type II- consists of cystic endometrial hyperplasia and diffuse plasma cell infiltration. The clinical sign present will be vulvar discharge between days 40-70 following oestrus Type III- are animals with acute endometritis and cystic endometrial hyperplasia. The animals will be clinically ill and uterus distended. The WBC count of between 19000 to 145000 per cu mm have been observed. The lesions are present between days 40 + 14 days following estrus. Type IV animals exhibit a chronic endometritis with systemic illness. The severity of illness was seen to be dependent on the degree of cervical opening. The lesion was observed between 55 and 90 days following heat. Unilateral and segmental pyometra are also reported. Signalment: CEH is primarily a disease of older bitches. Although pyometra can occur at any time, most bitches are reportedly presented during first four weeks following estrus. Overall mean age reported for pyometra is 7.5years with a range of 4 months to 16 years. Pyometra can result in the death of the bitch if not treated promptly, especially after systemic signs are present. In addition to age other predisposing factors related for occurrence of pyometra include CEH, Uterine bacteria, diestrus, estrogen administration and progesterone administration. Diagnosis: History: The important information to be collected include the whelping history, prior treatment with oestrogenic or progestogenic drugs for estrus suppression or induction, contraception or pregnancy termination, length of time from the most recent estrus. Clinical Signs: Clinical signs of pyometra vary with the patency of cervix. The first and more classical one is that of

152

open cervix pyometra, that have vulval discharge, depression, reduced appetitie, polydipsia, polyuria. Increase or decreased body temperature, vomiting dehydration, coma and /or shock. The vulval discharge can be copius, mucoid to purulent, varying in color from red brown to yellow green, and usually foul smelling. Bitches with closed cervix have minimal or no vulval discharge, They are more likely to present with abdominal distension as a result of enlargement of uterus. This type of pyometra is the one where the owner has noted nothing unusual and had the bitch bred at the previous heat. The pyometra is diagnosed at the time the bitch is presented to determine pregnancy status or for failing to whelp. Bitches with either history will have had and estrus with in 3 months. Physical examination: The physical examination should include careful examination vulvar region and vagina to asses presence of purulent discharge. Abdominal palpation should be done carefully to asses the uterine tone and size. The abdomen may be difficult to palpate in obese, tense or in dogs with abdominal distension resulting from uterine enlargement. Unilateral pyometra occasionally is observed in bitches with normal pregnancy in contralateral horn. On palpation the uterus may be diffusely enlarged or may contain annular constrictions, similar to that of pregnancy. Dogs may be febrile on presentation. Severely ill dogs and dogs with endotoxemia are hypothermic. Severe endotoxaemia is associated with high operative mortality at OHE. Laboratory findings: The remarkable characteristic accompanying most pyometra is the elevated white blood cells, accompanied by degenerative shift to left. WBC count may range from 2500 to 196800 cells/mm3. One should also remember that pyometra can also occur with a normal or near normal white blood cell count. Urine specific gravity may be concentrated or isosthenuric or hyposthenuric. Endotoxins from E. Coli can interfere with sodium and chloride resorption and so result in polyuria and polydipsia. Abnormalities evident on serum biochemical profile include azotemia, hyperalbuminemia. Blood urea nitrogen and creatinine values are reported to be elevated. Diagnostic imaging: Radiography does not differentiate between uterine enlargements caused by pyometra from that of pregnancy until after fetal mineralization occurs (43 to 54 days after breeding. Ultrasonography is the preferred imaging technique for diagnosis of pyometra. Pyometra appears as an enlarged uterus with convoluted, tubular horns filled with anechoic to hypoechoic fluid. Differntial diagnosis: Differnential diagnosis of open or closed pyometra include those of uterine enlargement especially pregnancy. In cases of polyurea and polydipsia differentiate between diabetes mellitus, hyperadrenocorticism, renal failure and diabetes insipides. and or vulval discharge. Causes of polyuria and polydipsia other than pyometra usually are not associated with neutrophilia. Treatment: Historically, Pyometra has more commonly been treated by ovariohisterectomy, but in the last decade new approaches have been proposed with successful results. The protocols used have the same goals 1. Preventing progesterone effects by either inducing luteolysis or preventing progesterone binding to its receptors. Protocols for use of PGF alone or in combination with dopamine agonists or progesterone receptor antagonists have been used 2. Promotion of cervical relaxation in closed pyometra to allow for the expulsion of the uterine contents. This achieved by administration of PGF or progesterone receptor antagonists 3. Induction of uterine contractions and emptying, either directly through the use of PGF, or indirectly via progesterone receptor antagonists 4. Inhibition of bacterial growth and development through the use of broad spectrum antibiotics

153

5. Facilitating uterine regeneration in animals with clear signs of uterine degeneration. This is accomplished by prolonging anestrus. The androgen receptor agonist, mibolerone is used for this purpose. Luteolysis, cervical opening and uterine contractions: PGF2: Treatment with PGF, apart from its luteolytic effect , mediates functional opening of the cervix , which permits drainage of exudateand promotes myometrial contraction, facilitating uterine drainage. Treatment at dose of 10-50 mcg/kg (SC or IM, dinoprost tromethamine) administered three to five times daily for 3-7 days have been successful either alone or in combination. Natural prostaglandins is preferred to prostaglandin analogues, as it not only induces substantial luteolysis, but results in more uterine contractions. Synthetic prostaglandins such a scloprostenol can be used instead of natural prostaglandins, but they have a reduced ability to induce uterine contractions, resulting in slower evacuation of uterus.The classic side effects of vomittion are dose dependent and are known to diminish with repetition of treatment. Progesteronereceptor antagonists: The progesterone receptor antagonists, mifeprestone or agleprestone, binding to progesterone receptor and block them, preventing biological activity. This mimics the action of luteolysis and bring the relaxation of cervix. Progesteronereceptor antagonists in combination with PGF have been found to be more effective. Unlike the action of PGF, progesterone anatagonists are not expected to induce myometrial contraction . Some studies hypothesize that uterine contractions are indirectly induced by local uterine release of endogenous prostaglandins as a consequence of endometrial inflammatory process associated with the pyometra. The use in combination with PGF results in both uterine contractions and induction of luteolysis. Prostaglandin E: The increase in oestradiol receptor concentrations during periovulatory period are thought to increase PGE synthesis and receptors which allows for relaxation of cervix. Mesoprostaol helps to improve cervical patency and penetrability at the end of estrus. PGE in combination with progesterone receptor anatagonists helps in cervical relaxation and evacuation of uterus. Antimicrobial therapy: Concomitant broad spectrum antimicrobial therapy should be administered during any treatment protocol. Amoxicillin, amoxicillin plus clavulonic acid, cephalosporin or potentiated sulfonamides are good initial choice. The final choice should always be based on culture, identification and sensitivity of bacteria. It is recommended that the antimicrobial therapy be continued for 10-14 days after complete resolution of pyometra, as assessed by ultrasonography, physical examination and blood examination. The bitch should be reevaluated two weeks after completion of treatment, by ultrasonographic examination and if vaginal discharge, fever or neutrophilia are still present , a prolonged course of antibiotic therapy is recommended. Uterine regeneration: To avoid recurrence of pyometra, particularly in animals with clear signs of uterine degenerative process age related, it is essential to facilitate uterine regeneration during post treatment anoestrus. The regeneration of endometrial can be achieved by administration of an androgen receptor agonist such as mibolerone. Postponing the next cycle for a few months will prolong the healing period and facilitate regeneration in uterus Recurrence of Pyometra: The percentage of recurrence after medical treatment is decreasing over time with improvements in therapeutic approaches and treatments. In cases of recurrence there were cystic changes in ovaries and endometrium. The recurrence rate can be minimized by selection of bitches without ovarian cyst and Cystic endometrial hyperplasia. As pyometra is often seen in older bitches, breeding should be attempted at first oestrus following treatment and at every subsequent oestrus. The fertility after treatment is reported to be good. References: Verstegen, J , G. Dhaliwal, K. Verstegen-Onclin. (2008). Mucometra, cystic endometrial hyperplasia, and pyometra inthe bitch: Advances in treatment and assessment of future reproductive success. Theriogenology. 70 364374. S.D. Pretzer. (2008) Clinical presentation of canine pyometra and mucometra: A review. Theriogenology. 70 359363

154

L P 4 : IV

Common Neoplasms-Venereal and Mammary Tumours of Canines

Harish Verma? and R K Sharma Department of Veterinary and Animal Husbandry Extension Education Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana-141 004

Neoplasm is one of the most common causes of illness and death in dogs. Among all the tumours, canine transmissible venereal tumour (CTVT) and canine mammary neoplasm are the most frequent neoplasms in female dogs. This paper will focus mainly on the clinical sign, diagnosis and treatment aspects of these two common tumours of dogs. Canine Transmissible Venereal Tumour (CTVT): CTVT contributes a major segment (67.3 %) to various pathological reproductive problems in canines (Gandotra et al., 1993). It was first reported by Huzzard in 1820 and later on Novinsky in 1876 demonstrated its transmissibility from one dog to another by infecting them with tumor cells (Martins et al., 2005). CTVT has been described by many names like infectious sarcoma, venereal granuloma, transmissible lymphosarcoma and Stickers sarcoma. CTVT is a naturally occurring neoplastic disease that affects the external genitalia of both the sexes and is transmitted during coitus due to transplantation of viable tumor cells from the affected partner. Injuries to vaginal and penile mucosa usually occur following coitus. These injuries provide bed for transplantation of tumour cells. CTVT can also affect the skin through direct implantation of tumour cells during contact between skin and tumour mass (Das and Das, 2000). Young dogs, stray dogs and sexually active dogs are most frequently affected by this neoplasm (Rogers et al., 1998; MacEwen, 2001). Females are more susceptible than males; however, breed predilection is not so prominent (Baer et al., 1989; Fujinaga et al., 1989). It is most common in the age group of 2-5 years (Brown et al., 1980). Singh (1993) observed 574 cases and found maximum cases in summer (33.06 %), followed by winter (23.60 %), spring (23.46 %) and rainy season (22.05%). It has a worldwide distribution and the incidence is highest in tropical and subtropical regions (Stockmann et al., 2011) CTVT tumor cells are generally classified as round cell neoplasms, mastocytomas, histiocytomas, plasmacytomas and lymphomas (Vermooten, 1987). Tumor cells may have fewer chromosomes (57-64) than the normal cells (78) (Mello Martins et al., 2005). There is no evidence that tumor is caused by a virus or a virus like organism. Tumor cells are themselves the infectious agents. This theory lends credence from the fact that experimental tumour transplantation can occur by using living tumour cells only (Cohen, 1985). CTVT is most commonly found on the external genitalia of both male and female dogs. Grossly, it is found as single or multiple, small or large, firm or soft, friable, grey to grey red, sessile or pedunculated, nodular or papillary mass on the caudal part of the penis (base of penis), the glans penis or occasionally in the adjacent prepuce. In females, the tumors are usually solitary and are found beneath the mucosa in any part of the vagina, often involve the adjoining vestibule and may even spread to the labia involving urethral opening (Cohen, 1985; Vermooten, 1987; Rogers et al., 1998; Das and Das, 2000). Their size varies from small nodule to large masses, which may occlude the vulvo-vaginal lumen or may protrude between the labia. Tumour may ulcerate and slough, bleed easily. It is often associated with a serous, hemorrhagic or purulent prepucial or vaginal discharge (Bloom et al., 1951; Feldman and Nelson, 1987). CTVT has also been observed in other locations such as skin, face, nasal and oral cavities, around anus, and eyes. In these instances, the neoplasm is well circumscribed and is usually spread by social behaviour of animals including sniffing and licking. Metastasis is uncommon, but has been reported only in 5 per cent of the reported cases (Singh, 1993). CTVT is relatively firm but fragile. It appears pink to bright red due to rich blood supply. Hemorrhages are common and are associated with tumor fragility. Other clinical signs may include obnoxious genital discharge, abnormal odor, and excessive licking (Fujinaga et al., 1989). The owners usually be-

155

come panicky due to continuous bleeding and protruding mass. The cases are usually presented to the veterinarian one to four months after the initial signs of bleeding. A review of history and clinical examination of the suspected animal helps in the diagnosis of the disease. CTVT is the first disease to be suspected in cases having cauliflower like growth or pedunculated mass on external genitalia or metastatic growth in eyes, skin or other part of the body. Impression smears stained with Wright-Leishman stain or Giemsa stain are highly cellular and often bloody. Individual neoplastic cells have a round nucleus with fine to granular chromatin pattern and a single prominent nucleolus. The cytoplasm is pale blue and moderately abundant. The most prominent cytological feature of CTVTs is the presence of distinct, clear, cytoplasmic vacuoles (Duncan and Prasse, 1979). CTVT cells that lack cytoplasmic vacuole may be confused with other round cell tumors. The morphological appearance and location of the tumor, however, are helpful in diagnosis. Histological examination usually reveals that the CTVT cells grow in compact masses or confluent sheets. As the tumor mass increases, the cells become tightly packed and they become irregular in shape and fibroblasts appear among them (Kennedy et al., 1977). On histological examination, CTVT can be confused with histiocytoma, lymphosarcoma, neuroblastoma and reticular cell carcinoma. However, it can be confirmed by transplanting the cells onto the susceptible dogs or by correlating histological findings with clinical symptoms. The prognosis for CTVTs is very good. After surgical intervention, the recurrence was recorded in 27 to 38 per cent animals (Brodey and Rozel, 1967). Chemotherapy gives more promising results and up to 100 per cent remission can be achieved (Amber et al., 1990). Antimitotic agents such as vincristine, vinblastine, methotrexate, doxorubicin, or cyclophosphamide are the chemotherapeutic agents to treat CTVT. Vincristine sulphate administed @ 0.025 mg Kg-1 body weight at weekly interval is the treatment of choice. In metastatic cases, the cure rate is over 90 per cent (Calvert et al., 1982). The mean number of treatments required for complete recovery was 3.3. Dyspepsia, emesis and diarrhoea are the few side effects which have been observed within 48 hours after the institution of the treatment (Calvert et al., 1982; Amber et al., 1990). These side effects can be easily controlled through supportive symptomatic treatment. However, some dogs take longer time to resume their normal diet and behavior. Proper nursing is the key to successful recovery in such cases. Administration of vincristine in the subcutaneous tissue results in its sloughing. Padilha and his co-workrers (1988) observed suppression of spermatogenesis in dogs and oogenesis in bitches after vincristine administration. However, administration of levamisole @ 2.5 mg Kg-1 body weight subcutaneously on alternate days for three times, one week prior to initiation of vincristine therapy cause early regression of timorous mass with fewer side effects (Singh, 1995). Doxorubicin @ 30 mg/ m2 of body surface area (1 m2 surface area = 0.5 Kg body weight) is the most effective chemotherapeutic agent for tumors that are resistant to vincristine. Other chemotherapeutic agents employed in CTVT are cyclophosphamide @ 1 mg Kg-1 body weight orally daily or 50 mg/ m2 orally on even numbered days. Cyclophosphamide is partially successful to treat CTVT (Amber et al., 1990). Methotrixate @ 0.3 to 0.5 mg Kg-1 body weight intravenously at weekly interval or 2.5 mg/ m2 orally on odd numbered days has also been used in CTVT, however, alone it did not show much response (Amber et al., 1990). Vinblastine @ 0.1 mg Kg-1 body weight intravenously on 4 to 6 occasions at weekly interval also gave good results, however, with side effects of anorexia, depression and emesis, 2 to 3 days after the start of treatment (Wasecki and Mazur, 1977). 5- Fluro Uracil (5 FU) has been found to be ineffective but toxic to the dogs (Singh, 1995). CTVTs have also been shown to be very sensitive to radiation therapy (Maleo, 1997) but it requires specialized equipments and trained personnel. Canine Mammary Tumour (CMT): CMT usually affects relatively old female dogs that are sexually intact. Spaying before two years of age will significantly reduce the occurrence of these tumours. The risk of a dog developing a mammary tumour is only 0.5 per cent if spayed before their first heat (approximately 6 months of age), 8 per cent after their first heat, and 26 per cent after their second heat. Spaying does not provide a protective effect against mammary tumour development after 2 years of age.

156

Dogs treated for pseudocyasis and mismating with certain hormonal drugs such as oestrogens and progestins, may be at an increased risk of developing mammary tumours. Diet has also been implicated with mammary tumours, it being more common in obese dogs and dogs fed home-made meals consisting of higher proportion of pork and lower proportion of chicken meat. Breeds such as Poodle, Pointer, Fox Terrier, Boston Terrier, Cocker Spaniel and Llahasa Apso are at greater risk. The exact causes for the development of canine mammary tumours are not fully understood. However, hormones of the estrous cycle seem to be involved. CMT mostly occur as circumscribed nodules of variable dimensions and consistency. There may be a single mass or multiple masses. In fact, over 50 per cent of dogs with mammary tumours will have more than one tumour. Dogs have 5 pairs of mammary glands which are numbered 1 through 5 from front to back. Although any gland can be affected, the majority (greater than 65%) of mammary tumours develop in the fourth and fifth mammary glands. Benign tumors are often small, well-circumscribed, and firm. Malignant tumors can be similar to benign tumors, but may also exhibit more aggressive behavior, such as rapid growth, poorly defined borders, fixation to skin or underlying tissue, and inflammation or ulceration. Other signs may include inappetence, weight loss, generalized weakness and swelling of one or both hind legs. Disease-related complications can be local or metastatic. Abnormal mammary growth is the first sign for suspicion of CMT. The other local problems are most often associated with rapidly-growing malignant tumours and include inflammation, ulceration, and infection. If left untreated, this can progress to systemic illness with poor appetite, weakness, and lethargy. Malignant mammary tumours have the potential to metastasize to draining lymph nodes, liver, lungs, and other sites. Clinical signs associated with metastatic disease may not be apparent and depend on the site of metastasis. The local signs often resemble dermatitis, mastitis or abscess. However, histopathological examination of the growth will confirm the diagnosis of CMT. Radiography and computed tomography can establish metastasis. The observation of distant metastases points to grave prognosis (Sorenmo, 2003). The lung is the most common site for distant metastasis, however, regional lymph nodes or liver may also get involved (Kumar et al., 2011). Surgical excision (mastectomy in most cases) of the abnormal growth is the treatment of choice till date provided there is no indication of metastasis (Cassali et al., 2011). When metastasis and malignancy is suspected, chemotherapy should be instituted as an adjunct therapy. Doxorubicin, cyclophosphamide, cisplatin or carboplatin are some of the drugs tested in CMTs (Morrison, 1998). The mammary tumour and draining lymph node should be submitted to a veterinary pathology laboratory for diagnosis, grading, and assessment of surgical margins. This will provide information on whether or not further treatment is required. The role of spaying in female dogs with mammary tumours is controversial. The majority of studies have shown no beneficial effect of spaying in preventing the development of new mammary tumours or influencing the aggressiveness or metastatic potential of existing mammary tumours. However, spaying at the time of mammary tumour resection should be considered as it may have a beneficial effect in dogs with mammary tumours (based on recent studies) and may prevent unrelated diseases, such as pyometra. A number of factors influence the prognosis following surgery. These prognostic factors include tumour size, clinical stage, histological diagnosis and grade, and various other histological criteria. Tumours greater than 3.00 cm have poor prognosis (Cassali et al., 2011). Determination of mitotic index will help in estimating the rate of proliferation (Dutra et al., 2008). Higher rate of proliferation indicates poor prognosis of CMTs. Benign tumours are cured by complete surgical resection, although the development of new mammary tumours (both benign and malignant) is possible. For malignant tumors, inflammatory mammary carcinoma, ductular carcinoma, carcinosarcoma, and sarcomas have a poorer prognosis than other types of malignant mammary tumors. The median survival time for dogs with non-metastatic mammary adenocarcinoma is greater than 420 days, compared to 25 days for dogs with inflammatory mammary carcinoma and approximately 180 days for mammary sarcomas. Furthermore, less than 15 per cent of dogs with mammary adenocarcinoma will die as a result of their tumour, compared to 65 per cent with ductular carcinoma and 100 per cent with carcinosarcoma and inflammatory mammary carcinoma.

157

Conclusions: Mammary tumours can be prevented by spaying before 6 month of age. The risk of developing a mammary tumour is 0.5 per cent in dogs spayed before 6 months of age (or their first heat) compared to 26 per cent (and up to 71% in some reports) if spayed after 2 years of age. Other factors that may reduce the incidence of mammary tumours include feeding a well-balanced diet and avoiding obesity and the administration of hormones (particularly progesterone or mixed oestrogen-progesterone drugs). CTVT can be prevented by not allowing the oestrous bitch to stray dogs. The hormone suppression of oestrous cycle, misalliance or unnecessary use of hormones should not be undertaken as it predisposes the bitch to tumours. If there is any change in the oestrous behaviour of the bitch, the veterinarian should be immediately consulted. Timely decision of taking a litter- nil, one or two from a bitch can prevent the female dog from such serious reproductive complication, ovario-hysterectomy/surgery prevents both. But,the awareness is needed for the same among the pet owners for preventing such common complications among canines. REFERENCES Amber, E I, Henderson, R A, Adeyanju, J B and Gyang, E O (1990) Single drug chemotherapy of canine transmissible venereal tumor with Cyclophosphamide, Methotrexate or Vincristine. J Vet Int Med 4: 144-47. Baer, K E, Patnaik, A K, Gilbertson, S R, Hurvitzm A I (1989) Cutaneous plasmacytomas in dogs: A morphologic and immunohistochemical study. Vet Pathol 26: 216-21. Bloom, F, Paff, G H and Noback, C R (1951) The transmissible venereal tumor of the dog. Am J Pathol 27: 119-39. Brodey, R S and Rozel, J F (1967) Neoplasm of the canine uterus, vagina and vulva: A clinicopathologic survey of 90 cases. J Am Vet Med Assoc 151: 1294-1307. Brown, N O, Calvert, C and MacEwen, E G (1980) Chemotherapeutic management of transmissible venereal tumor in 30 dogs. J Am Vet Med Assoc 176: 983-86. Calvert, C A, Leifer, C E, MacEwen E G (1982) Vincristine for treatment of transmissible venereal tumor in the dog. J Am Vet Med Assoc 181: 163-64. Cassali, G D, Lavalle, G E, Nardi, A B et al (2011) Consensus for the diagnosis, prognosis and treatment of canine mammary tumors. Braz J Vet Pathol 4(2): 153-80. Cohen, D (1985) The canine transmissible venereal tumour: a unique result of tumour progression. Adv Cancer Res 43: 075-112. Das, U and Das, A K (2000) Review of canine transmissible venereal sarcoma. Vet Res Commun 24: 545-56. Duncan, J R and Prasse, K W (1979) Cytology of canine cutaneous round cell tumors. Vet Pathol 16: 67379. Dutra, A P, Azevedo, G M (Jr), Schmitt, F C and Cassali, G D (2008) Assessment of cell proliferation and prognostic factors in canine mammary gland tumors. Arq Bras Med Vet Zootec 60: 1403-12. Feldman, E C and Nelson, R W (1987) Canine and Feline Endocrinology and Reproduction. W B Saunders Company, Philadelphia. Pp 475-77. Fujinaga, T, Yamashita, M, Yoshida, M C, Miuno, S, Okamoto, Y, Tajima, M and Otomo, K (1989) Chromosome analysis of canine transmissible sarcoma cells. J Vet Med A 36: 481-89. Gandotra, V K, Prabhakar, S, Singla, V K, Chauhan, F S and Sharma, R D (1993) Incidence of physiopathological reproductive problems in canines. Indian Vet J 70: 467. Higgins, D A (1966) Observations on canine transmissible venereal tumor as seen in the Bahamas. Vet Rec 79 (3): 67-71. Kennedy, J R, Yang, T J and Allen, P L (1977) Canine transmissible venereal sarcoma: electron microscopic changes with time after transplantation. Br J Cancer 36: 375-85. Kumar, K R A, Rao, G V S and Balachandran, C (2011) Incidence, cytology, gross pathology and histopathology of mammary tumours in dogs of Chennai. Intl J Pharma Bio Sci 2(3): 399-405.

158

MacEwen, E G (2001) Transmissible venereal tumor, In: Withrow S J and MacEwen (Ed) Small Animal Clinical Oncology. J B Lippincott, Philadelphia, Pp 651-55. Maleo, K A (1997) Tumors of the skin and associated structures. Vet Clin N Amer 27: 73-94. Morrison, W B (1998) Canine and feline mammary tumors. In: Morrison, W B (Ed.), Cancer in Dogs and Cats; Medical and Surgical Management. Philadelphia: Linppincott Willians & Wilkins, 591-98. Mello Martins, M I, de Souza, F F and Gobello, C (2005) Canine transmissible venereal tumor: Etiology, pathology, diagnosis and treatment. Recent Adv in Small Anim Reprod. Retrieved on 2006, 05-25. Ndiritu, C G, Mbogwa, S W and Sayer, P D (1977) Extragenitally located transmissible venereal tumor in dogs. Modern Vet Practice 58: 940-46. Padilha, F J G, Comacho, A A, Daleck, C R and Ihi, R A (1988) Study on the reproductive changes and other side effects following Vincristine treatment in dogs. Ars Veterinaria 4(1): 25-31. Rogers, K S, Walker, M A and Dillon, H B (1998) Transmissible venereal tumor: a retrospective study of 29 cases. J Am Anim Hosp Assoc 34: 463-70. Singh, J (1993) Studies on transmissible venereal tumor in dogs. M V Sc Thesis, Punjab Agricultural University, Ludhiana, Punjab, India. Singh, T P (1995) Studies on chemotherapeutic treatment of transmissible venereal tumor in dogs. M V Sc Thesis, Punjab Agricultural University, Ludhiana, Punjab, India. Sorenmo, K (2003) Canine mammary gland tumors. Vet Clin North Am Small Anim Pract 33: 573-96. Stockmann, D, Ferrari, H F, Andrade, A L, Lopes, R A, Cardoso, T C and Luvizotto, M C R (2011) Canine transmissible Venereal Tumors: Aspects related to programmed cell death. Braz J Vet Pathol 4(1): 67-75. Vermooten, M I (1987) Canine transmissible venereal tumor (TVT): a review. J S Afr Vet Assoc 58(3): 14750. Wasecki, A and Mazur, O (1977) Use of Vinblastine in the treatment of Stickers transmissible venereal tumours. Medyena Westernaryjna 33(3): 142-43 (fide: Vet. Bull. 47: 6288 Abstr).

159

L P 5: IV

Reproduction Management in the bitch

Paramjit Singh Mavi Department of Teaching Veterinary Clinical Complex, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana (Punjab)

In the 21st century the trend of keeping dogs as pet animal has been increasing day by day in north India. Due to nucleus families, people are inclined to keep pet animals as a companion, for security purpose, status symbol and even start breeding dogs which become an additional source of income by way of selling the pups. The demand for a good pedigree dogs by security forces, civilians is more than the availability of healthy pet dogs. Therefore to get maximum no of healthy pups from a bitch in her life time it become important to know the breeding behavior of the bitch due to its wide range of age of puberty (6-14 months), pro-estrous (3-17 days), estrous (3-21 days), its nutritional requirement and health management before and after breeding. Physiology of Reproductive cycle in a bitch: The age of puberty in a bitch varies from 6 months to 14 months. At around puberty, pituitary begins to secrete higher level of FSH (follicle stimulating hormone) and LH (luteal hormone) which initiate the sexual cycle. When FSH and LH from the pituitary gland begin to be secreted in high quantities during onset of sexual maturity (puberty), the ovaries and the follicles within them begins to grow. Estrogen hormone is a biologic chemical that produces physiologic and social/ behavioral effects within the bitch which make the bitch ready to mate. Two days prior to ovulation, there is a surge in the secretion of LH by the pituitary gland preceded by graffian follicle. This LH surge is of critical importance because in its absence, even with the other hormonal physiologic effects taking place, ovulation will not occur. Additionally, the LH surge causes the ovarian cells to switch over to secret progesterone hormone rather than estrogen. As a result, there is an increase in progesterone levels, and a decrease in estrogen levels. Within two days of the LH surge, the follicle reaches the surface of the ovary and bursts, thereby releasing the ovum into a capsule that surrounds the ovary. This process is referred to as ovulation. If the bitch is bred, then sperm will subsequently fertilize each of the released ova. In addition to producing progesterone, which maintains the pregnancy, the corpus luteum also produces inhibin, the hormone that signal the pituitary gland to decrease production of FSH and LH. Increase concentration of inhibin ends the mating period. The normal reproductive cycle of the bitch is comprised of four stages: proestrus, estrus, diestrus, and anestrus. Optimum breeding time in relation to ovulation: The average bitch will experience the LH surge on Day 10 from the first day the bloody discharge is observed, ovulate on Day 12, and, therefore, optimally conceive on Day 14. Traditionally, bitches were usually bred on the 14th day following onset of pro-estrus. This was because it was observed that most bitches would display tail flagging, defined as the lateral deviation of the tail with elevation of the vulva, and standing heat, defined as the bitches behavior in allowing the male to mount and breed, at this point in time. Additionally, other physical changes such as a softening of the flesh of the swollen vulva were external signs indicating the onset of ovulation. Later, when it became the norm to perform multiple mating, the bitch was bred on Days 12 and 14 , or Days 11, 13, and 15 Though these schedules are still adequate for insuring optimal breeding and litter size in the average bitch, not all bitches ovulate on Day 12 following pro-estrus onset. Some may ovulate as early as Day 5 or as late as Day 25 in which case utilizing this standard mating schedule will result in breeding failure. Using receptive behavior of the female as an indicator for ovulation and therefore, a method for determining mating schedule has many limitations. Some bitches may display little or no outward signs of bloody discharge, etc. making it difficult to estimate the average date of ovulation, may flag and appear receptive to males throughout pro-estrus, or may remain unwilling to mate even following ovulation. The differences observed from bitch to bitch in regard to mating signs and behavior as well as the fact that unsuccessful mating will result in a 6-month or longer wait to try again. Additionally, even cytological analysis, which can be used to determine onset of estrus, is often a poor predictor for ovulation since LH surge, a key precursor to ovulation, may occur 3 to 5 days before to 5 days after the onset of estrus. Therefore, a clinical

160

screening test that accurately predicts ovulation in the bitch and therefore serves to optimize breeding schedule, is used frequently by many breeders. The serum progesterone enzyme-linked immunosorbent assay (ELISA) is an accurate predictor for ovulation. For this assay, vaginal smears are examined periodically at the onset of pro-estrus to monitor cornification of the vaginal epithelial cells, which occurs as a result of increasing estrogen hormone. When the cells of the vaginal wall are approximately 60% cornified, testing with the serum-progesterone ELISA should commence. Blood samples are drawn every 2 days, ideally, every day, and whole blood or serum (depending on the test kit utilized) is added to a test indicator that has been treated with monoclonal antibodies specific for progesterone. Late in pro-estrus, the level of estrogen will decrease and levels of LH will surge. This LH surge is concurrent with an increase in progesterone levels, which will rise above 1 ng/ ml on the same day. Therefore, detection of increased serum progesterone corresponds to the LH surge. This is an important indicator, since ovulation occurs 2 days following the LH surge. The serum progesterone ELISA manufactured by International Canine Genetics, a division of Synbiotics (Malvern, PA) provides a qualitative color change to indicate when the progesterone level in the bitches serum rises. Early in proestrus, the test indicator will produce a strong blue color indicating low levels of progesterone (between 0.0 to 1.0 ng/ml). For determination of LH surge, the first appearance of a fading of the test color (as compared to an internal low-progesterone control indicator) to a light blue (approximately 2.0 ng/ml) indicates the LH surge. Two days later upon ovulation, progesterone levels will further increase to 5.0 ng / ml or above, at which point the test color will appear white, confirming ovulation. Though different kits utilize different testing methods and procedures, the concept of each kit is virtually identical and provides the means for determining ovulation. However, limitations to the sensitivity of ELISA testing may sometimes result in false-positive and false-negative results. This is because the greatest inaccuracy in measuring serum progesterone levels occurs in the range of 1.5 to 3.0 ng/ml of progesterone, the concentration range of importance for determining the LH surge. Greater accuracy occurs in the high range of greater than 5.0 ng/ml. Occasionally, a test will indicate a medium level of progesterone one day (suggesting LH surge), but may indicate a low level of progesterone when taken on the next day. This suggests that the former test demonstrated a false-positive because once progesterone levels rise; they should remain elevated and increase throughout ovulation. Therefore, to reduce incidence of in optimal mating due to false-positives, two consecutive days of testing, whereby increased progesterone levels are indicated on both days, should be obtained prior to establishing the mating schedule. Additionally, a post-ovulatory testing should be performed on a day that mating is performed to confirm high levels of progesterone (5.0 ng/ml or greater), which indicates that ovulation has occurred. Though the LH ELISA may be used alone for determining ovulation, the major limitation with the LH ELISA occurs as a result of the brief time in which the LH concentration is elevated in the serum. Unlike progesterone concentration, which continues to increase, LH peaks within 24 hours and then quickly dissipates. As such, it is possible to miss the LH surge if one does not test on a consistent, daily basis.. For example, on the first day that the progesterone ELISA indicates a rise in serum progesterone levels, one may confirm the concurrent LH surge by retesting serum using the LH ELISA. If both tests are positive, then there is less likelihood of false-positive results. Once the day of the LH surge is determined (to be considered Day 0), ovulation will occur on Day 2. Maximal litter size is achieved when the bitch is bred 2 days after ovulation (Day 4 following the LH surge). A single insemination 2 to 3 days following ovulation will result in pregnancy in the healthy reproductive bitch. The reason that optimal conception occurs 2 days following ovulation is because when ovulation occurs, the ova are immature (primary oocytes) and must undergo two meiotic divisions before they can be fertilized. These divisions can take up to 48 to 72 hours to occur. Once matured, the ova remain viable for another 2 to 3 days. Because normal sperm (spermatozoa) of the male delivered by natural insemination can live in the reproductive tract for at least 5 to 6 days, successful conception may occur if a bitch is bred from 2 days prior to ovulation to 4 days after ovulation. Artificial insemination in canine breeding offers a solution to a number of situations that may prohibit or complicate natural breeding. Such situations include i) Anatomical deterrents (such as a narrow vulva and vagina in a virgin bitch). ii) Unwillingness to breed (dominant/aggressive behavior of the bitch or submissiveness in the male). iii) Weakness or pain in

161

the spine or hind limbs (in geriatric studs still providing service), iv) Reducing risk of sexually transmitted disease to the stud (brucellosis), v) Geographical distance between stud and bitch. When using the method of artificial insemination, timing of insemination is a critical factor for ensuring successful conception. Freshly collected or chilled semen should be introduced by means of intravaginal insemination at least 2 days after ovulation has occurred in the bitch. Secondly, frozen-thawed sperm are insufficiently mobile to reach the ova if introduced by intravaginal insemination. For his reason, higher rates of conception with frozen semen have been achieved using intrauterine insemination. Though some breeders may rely on several external signs such as mammary-gland development, increased appetite, etc. for confirmation of breeding success, these methods are unreliable because many pseudo-pregnant bitches will display these signs as well. Therefore, more accurate methods are to be used to confirm pregnancy. Health Care of breeding Bitch: External and /or internal parasite infections should be diagnosed and treated prior to breeding. Additionally, the bitch should be brought up-to-date on all vaccinations before breeding. A vaginal examination should be performed to confirm normal anatomy that could present complications to the actual mating, conception, gestation or delivery. Additionally, vaginal cultures may be obtained for the purpose of screening for increased levels of organisms (mycoplasma, E. coli, etc) In addition to the routine blood screening to insure that the bitch is not infected with brucellosis prior to breeding, Maintenance energy requirement (MER) can be calculated: MER Kcal/day = 144+62.2 x (Bwt kg). Five weeks post-breeding, increase the food of the bitch each day to achieve a 50 percent increase in energy by the end of sixth week. Thus by the time the puppies are born, the bitch should be eating 60 per cent more calories than she did during the early stages of pregnancy. However, a good thumb rule would be to target up-to 25 per cent weight gain in the bitch by the end of week 8 post breeding. A food of bitch must contain 4 g of digestible protein / 100 K cal ME. Greatest success has been achieved feeding a diet consisting approximately 30% protein (animal source-based) and 20% fat with omega-6. In addition to ensuring a healthy pregnancy, proper diet and exercise prior to breeding increases the conception rate of bitches. Large quantities of food at a given feeding, however, may result in discomfort to the bitch particularly in the last several weeks of pregnancy when the expanding uterus is putting pressure on the stomach and other digestive organs. Therefore, multiple feedings of small meals is recommended to circumvent this problem. Dietary supplementation of the pregnant bitches usual food with vitamins and other minerals is a practice discouraged by veterinarians in recent year. For example, excess vitamin A is associated with congenital defects such as cleft palate, and vitamin D may compromise the calcium mobilization within the bitch. Excess vitamin C may interfere with normal processes of bone development, and because dogs produce sufficient amounts of this vitamin, supplementation with vitamin C is simply unnecessary. Although bitches do need to increase their calcium intake, this added source of calcium will be attained by simply increasing the quantity of food they consume. Excessive levels of calcium in the body, which usually occurs when a bitch is supplemented with calcium above the amount found in a high-quality dog food, interferes with the normal processes of calcium storage and metabolism by suppressing parathyroid hormone production. Ironically, therefore, calcium supplementation actually has the opposite effect of its intended purpose because excess calcium interferes with calcium storage and places the bitch at risk for developing hypocalcemia (pre-eclampsia or eclampsia), an often fatal metabolic disorder caused by insufficient calcium availability in pregnant and nursing bitches, respectively. In addition to contraindications for vitamin and mineral supplementation, administration of any type of medication is not recommended between days 13 and 30 of the pregnancy. In addition to proper diet, exercise is essential for maintaining fitness. Pregnant bitches that are maintained in good physical condition have fewer complications during whelping. Walking is considered the ideal form of exercise for the pregnant bitch. Late in pregnancy, however, length of walks should be shortened because the bitch will usually tire easily, especially when carrying large litters. Though low-impact exercise is recommended, more demanding physical exertion, such as is required of working bitches used in hunting, herding, agility, or advanced obedience, is discouraged. Conclusion: a bitch has a wide range of proestrus (3-17days) and estrus (3-21 days). To get optimum results, bitch should be mated two days after ovulation which can be determined by vaginal cytology

162

along with LH or Progesterone estimation. More litter size is achieved when bitch is bred 2 days after ovulation (4 days following LH surge).Bitch should be vaccinated before breeding since administration of vaccine to a pregnant bitch is contra- indicated. Proper diet and exercise prior to breeding increases the conception rate so a good thumb rule is to target upto 25% weight gain in bitch by end of 8 week post breeding. Obesity decrease conception rate and increase risk of whelping complications. Excess of dietary supplements like vitamin A is associated with congenital defects where as excess of calcium places bitch at risk for developing pre-eccampsia or eclamsia. Waking is an ideal for pregnant bitch to maintain good physical condition to have fewer complications during whelping. Reference: Evans JM and White K. 1997. Book of the Bitch. A Complete Guide to under stand standing and caring for bitches. New York: Howell Book House. Feldman EC and Nelson RW. 1996. Sexual behavior and breeding management of the bitch. In Canine and Feline Endocrinology and Reproduction. W.B. Co.Philadelphia. Gulavane SU 2001. Nutrition and fertility in pet animals. In Proc. 2nd National workshop on pet animals, Banglore. India. Hegstad RL and Johnston SD. 1992. Use of serum progesterone ELISA tests in Canine breeding management. In Kirk RW. Gonagura JD (eds): Current Veterinary Therapy XI Philadelphia. WB Saunder Co. Mosier JE. 1977. Nutritional recommendations for gestation and lactation in the dog. Vet. Clin. N. Am. 7: 683-692.

163

L P 6 : IV

Recent Advances In canine Pyometra

S. P. Shukla, N. K. Bajaj and M. K. Shukla College of Veterinary Science and Animal Husbandry, Rewa (M.P.)

Canine pyometra is a common pathological affliction of intact bitches (Predominantly nulliparous bitches) depicting pus in the uterus (Chastain et al., 1999). The early changes due to disease are generally not so noticeable and hence the disease generally remains undiagnosed till 4 weeks. Kustritz (2010) categorised pyometra as two step process: A. First Step is Cystic Endometrial Hyperplasia (CEH): Thickening of uterine endometrial lining occurring secondary to repeated oestrus cycles. Estrous cycle in bitches is unique with high serum estrogen followed by elevation in progesterone concentration after every cycle promoting hyperreactivity of endometrium and gradual cystic hyperplasia. Development of cystic endometrial hyperplasia is continuous but it remains a mystery why some bitches develop pyometra with minimal CEH while others with severe CEH do not. B. Second step is infection: Infection generally occurs due to microorganisms that are normal vaginal microflora of canine. Escherichia Coli subtypes are the most common isolates found in infection cases. Pyometra is most commonly reported in intact bitches, which suggest that pregnancy may have some protective effect probably at endometrial level. Pathophysiology of Pyometra: Normal plasma progesterone concentration in anoestrus bitches is less than 0.5 ng/ml (Nelson et al., 1982). The progesterone concentration post-ovulation increases for approximately 2 months generally and exceeds 40 ng/ml. The repetitive cyclicity of bitches involves a period of uterine estrogen stimulation followed by prolonged intervals of progesterone dominance (Dadarwal, 2007). Estrogen promotes endometrial growth, vascularity and oedema, cervical relaxation and dilation and migration of polymorphonuclear leucocytes to the lumen (Hardy and Osborne, 1974). While progesterone stimulation results in proliferation and secretory activity of endometrial glands, maintains functional closure of cervix and inhibits myometrial contractility. Normal vaginal microflora/bacteria ascend from the vagina to the cervix during the proestrus and estrus phase. The altered uterine environment prevents complete expulsion of organisms before end of oestrus resulting in entrapment of organisms in the uterus in diestrual bitch due to closure of cervical Os. Bacterial growth in progesterone primed uterus is further supported by leucocytes inhibition and secretions of endometrial glands. Progesteronal effect is further amplified by estrogen upregulaion of endometrial progesterone receptors. The endometrium thus becomes hyper reactive, exacerbating the hyperplasia. Infection develops with creation of pool of purulent intrauterine fluid.The factors determining cervical patency is still a mystery. According to De Cock et al., (2002) insulin-like growth factor I located in and around the epithelial cells of endometrium in dogs with CEH may play an important role in development of pyometra. Renal complications are common sequel to pyometra. Endotoxins released from the cell wall of gram negative bacteria inhibit normal renal tubular function (Kustritz, 2010). These changes being reversible are controlled as soon as infection is taken care. Stages of Disease: Dow (1958) histologically classified canine endometrial hyperplasia-pyometra complex into four stages: 1. Stage-I (Uncomplicated CEH): This stage is marked by thickened endometrial surface with multiple irregular cystic lesions giving it cable stone appearance. 2. Stage-II: Infiltration of plasma cells occurs in cystic endometrial tissue. 3. Stage-III: (CEH overlying acute endometritis): Gross lesions includes ulceration and haemorrhage of endometrium and uterus and may contain red-brown to yellow-green pus. Acute endometritis is characterised by congestion, oedema and superficial and deep infiltration of neutrophils into endometrium. Myosis may also be seen in some cases.

164

4. Stage-IV (CEH with chronic endometritis): Open cervix pyometra is characterised by collapse and grossly thick walled uterus wall with minimum discharge. The endometrium is atrophied while the myometrium is hypertrophied and fibrotic. While in closed cervix pyometra both endometrium and myometrium of distended uterus are atrophied. Bacteriology: Mostly the infection ascends from the vagina through the patent cervix into uterus during the proestrus and estrus phase and is cleared off within 5 days post inoculation (Dadarwal, 2007). But in females with CEH the expulsion of organisms is not complete before end of estrus due to which secondary infection flares up. These organisms infecting uterus are normal inhabitants of vagina. E. Coli is found to be most common (70% cases) while the other isolates like streptococcus Spp., Staphylococcus Spp., Klebsiella Spp., Proteus Spp., Pseudomonas Spp., Corynebacterium Spp., Enerococcus Spp., Pasteurella Spp., Serratia Spp., Haemophillus Spp., and Bacillus Spp., are also reported (Vandeplassche et al., 1991). Clinical Signs: History in pyometra cases reveals that the bitch was in oestrus a few weeks (2-12 weeks) prior to illness. Clinical signs in pyometric bitches vary with cervical patency. At times in open cervix pyometra continuous sanguineous to mucopurrulent vulval discharge may be seen for years. Colour and consistency of the discharge vary considerably. In most of the cases light chocolate brown coloured discharge of thin consistency with its characteristic odour may be seen. While in some cases it may be yellow coloured with blood tinge with watery to creamy consistency. Closed cervix pyometra cases can become open at any time but continuously discharging open cases rarely become closed one. Sometimes no vaginal discharge is seen despite owners history; this may be due to flushing of vestibular area from recent urination. Elevated body temperature is common feature of closed cervix pyometra while body temperature may be normal or slightly elevated in open cervix pyometra. Temperature may be subnormal in toxaemic cases. Peri-vulvar tissue is discoloured or scalded with vulvar enlargement. In advanced cases polydypsia may be seen due to reduced permeability for water in the distal convoluted tubule of the kidney (Asheim, 1964). Renal dysfunction results due to formation of immune complexes (Sandhlom et al., 1975). Other symptoms include lethargy, depression, inappetence, polyuria and vomiting. Abdominal distension is a variable feature. If the condition is not life threatening and animal is valuable for breeding purpose or if surgical intervention is not possible due to intercurrent disease than medicinal regimes can be considered. Uterine fluid draining by use of catheter via cervix and by surgery (Hysterotomy) drains has been tried by transcervical route by different workers (Gourley, 1975). Since pyometra is a disease of luteal phase use of prostaglandins to initiate luteolysis as well as to initiate uterine spasmogenic action has been used successfully for treatment of open-cervix pyometra (Gilbert et al., 1989; Wheaton and Barbee, 1993). Diagnosis: Diagnosis of pyometra is confirmed when the appropriate clinical signs are reported by the owner are present in conjunction with abnormalities with physical examination, laboratory examination, radiographic evaluation and ultrasonography. Diagnosis of stump pyometra is difficult (when discharge is not present) and refers to inflammation and bacterial infection of the post-Ovariohystrectomy remnant of uterine body. This remnant tissue can result in occurrence of oestrus cycle, progesterone secretion, uterine secretion and inflammation. The following methods are commonly used for diagnosis of pyometra in canines. A. Abdominal Palpation: Care must be taken while manipulating the febrile uterus. Abdominal palpation in open-cervix pyometra cases may reveal thickening of uterine cornua, slightly irregular and turgid structures from 1 to 3 cm in diameter. Some areas of uterine horns are turgid and solid to palpate while others distended with pus may be indistinguishable from the surrounding bowel. In closed cervix cases abdominal palpation may reveal greater degree of abdominal enlargement.

165

B.

Radiography: It is less traumatic means to visualise the status of uterus as compared to abdominal palpation but it can only gives brief idea about uterine enlargement but cannot be used to differentiate diseased animals from pregnant animals. Radiographic visualisation of abdomen for confirmation of pyometra reveals fluid-dense tubular structure in ventral and caudal abdomen displacing loops of intestine dorsally and cranially. Radiographic examination will also reveal presence or absence of peritonitis from a uterine rupture and retained fetal tissue from previous pregnancy. C. Haematology: Leucocytosis and neutrophilia (specially in closed cervix pyometra) with regenerative shift to left and monocytes is observed in cases of closed cervix pyometra and is less marked in cases of open cervix pyometra. D. Cytology: Cytology of vulvar exudates reveals degenerative polymorphonuclear cells (PMNs), bacteria and non-cornified epithelial cells (small intermediate epithelial cells, large intermediate epithelial cells). E. Ultrasonography: Ultrasonography is a valuable aid in diagnosis of pyometra especially when radiographs are inconclusive like in cases of stump pyometra. It permits the operator to see and identify the free fluid inside the uterus. Uterus reveals increase in thickness (relatively hypoechoic) and diameter and folding on itself so as many sections of each horn may be imaged in a single plane. Uterine diameter may vary depending upon whether the cervix is open or closed. Uterine lumen is grossly dilated with anaechoic fluid with small echogenic particles. Pregnancy can easily be identified and definitively differentiated from pyometra 24 to 25 days post ovulation. Limitations of ultrasound are that it cannot be used to determine if intrauterine fluid is purulent.

Treatment: Choice of treatment (medical or surgical) is made on the basis of patients clinical condition and owners intention regarding future breeding. But Ovariohystrectomy is treatment of choice (MacIntire, 2004) in most of the cases unless the animal is valuable for breeding purpose. Surgical removal of the infected uterus results in immediate clearance of endotoxins from the body along with return of WBC count returning to normal by 7 days post-surgery. Medical therapy is indicated (Kustritz, 2010) only when: G Cervix is patent. G Azotemia is absent or mild enough to be attributed to dehydration or other pre-renal causes. G Female dog is of breeding age (less than 6 years) G Bitch is valuable and is to be used for breeding purpose Medicinal therapy by different drug like estrogen, androgens, ergot alkaloids, quinine and oxytocin have been tried but failed to show promising results. PGF2 therapy has shown promising results. PGF2 treatment results in contraction of myometrium (immediate effect), Luteolysis (delayed effect) and relaxation of cervix (least consistent effect). However PGF2 should be used with caution in closed cervix pyometra because of risk of expulsion of uterine exudates into the peritoneal cavity resulting in peritonitis. Corpus Luteum in bitches is refractory to PGF2 action for first 1-2 weeks and after 1-2 weeks it takes at least 5 days until luteolysis is achieved. Medicinal treatment with a combination of antibiotics and prostaglandin F2 alpha can be initiated with following protocol: G Assessment of uterine size in repeatable manner (abdominal palpation, radiography and ultrasonography). G Collect vulvar discharge for aerobic culture and antibiotic sensitivity test. G Initiate treatment with antibiotic like amoxicillin/clavulanate and than change the antibiotic (Quinolones like enrofloxacin or Cephalosporines) if necessary on the basis of culture sensitivity results. G Measure serum progesterone for initiating prostaglandin therapy. If serum progesterone is less than 2 ng/ml than once daily and if serum progesterone is more than 2 ng/ml than twice daily prostaglandin therapy is effective for lysis of CL and decrease serum progesterone and initiates uterine contractions.

166

PGF2 should be 0.1-0.25 mg/kg once or twice daily subcutaneously. PG treatment should be given till uterine size returns to normal or until there is no visible free intra uterine fluid. G Antibiotic therapy should be continued for a month or until there is no visible vulvar discharge for at least for a week. An alternative 7 day natural prostaglandin therapy (94% recovery rate in open cervix and 31% in closed cervix cases) includes PGF2 treatment at the dose rate of 0.1 mg/kg sub-cutaneously followed by 0.2 mg/kg body wt. on day 2 and subsequently 0.25 mg/kg from day 3-7 along with 14 day antibiotic course. Animal should be revaluated at day 7 and 14 and retreatment should be done in case of persistence of purulent vaginal discharge, fever, increased WBC or fluid filled uterus (Feldman and Nelson, 2004). Breeding in first cycle post-treatment is strongy recommended to avoid the risk of recurrence as pregnant bitches are less susceptible and there is no benefit in skipping a cycle. Dose dependent side effects of PGF2 therapy have been noticed which decrease and disappear with repeated administrations include restlessness, pacing, hypersalivation, panting, vomiting, abdominal pain or cramping, tachycardia, fever, defecation and uterine evacuation. Other therapies used include use of antiprogestins and anti-prolactins. Antiprogestins exert their action on female reproductive tract in the presence of progesterone resulting in opening of cervix (day 1-3 after initiation of treatment), stopping the progestative inhibitory effect to myometrial contractions and stopping the progestative immunosuppressive effect. They have no luteolytic effect. Wehrend et al (2003) reported successful treatment of closed cervix pyometra in all the bitches treated with antiprogestin (aglepristone, 10mg/kg subcutaneously 1, 2and 7 or as long as natural progesterone is present, along with antibiotic therapy). Gobello et al (2003) and Trasch et al., (2003) reported that open cervix pyometra can be successfully treated independent of initial progesterone level when a combination of synthetic prostaglandin (Cloprostenol) along with antiprogestin (aglepristone) is used. Anti-prolactin (Dopaminergic drugs) act via causing luteolysis (delayed action comparable with PGF2 ) and blocking prolactin production (if present). Synthetic prostaglandins (Cloprostenol; 5 g/kg every third day subcutaneously), Antiprolactin/ prolactin inhibitor (Cabergoline; 5 g/kg once daily per os for 7-10 days) and antibiotics combination has also been found to be successful in treating open- or closed-cervix pyometra (Kustritz, 2010). Fieni et al., (2001) reported success rate of 87% and 63% when antiprogstin were used with Cloprostenol and without cloprostenol, respectively. Supportive therapy depends on general condition and CBC reports. Intravenous fluid therapy (Ringers lactate/5% dextrose) should be given immediately to minimize the renal toxic effects. Efforts should be made to restore plasma electrolytes and acid-base balance. H2 blocker like metaclopromide is also indicated in case of vomiting and gastric injury. Antiinflammatory drugs/ NSAIDs are also useful Intravenous fluid therapy along with broad spectrum antibiotics is ideally recommended as it is not always possible to stabilize patients before surgery. Relapse rate of at least 20 per cent has been reported during the first two years after treatment.
G

Conclusions: Canine pyometra is a common pathological condition of intact bitches (Predominantly nulliparous bitches) depicting pus in the uterus. Organisms infecting uterus are normal inhabitants of vagina while E. Coli is found to be most common (70% cases). Clinical signs in pyometric bitches vary with cervical patency. Ultrasonography is an important definitive diagnostic tool. Ovariohystrectomy is the therapy of choice for canine pyometra as high relapse rate upto 20 % in medical treatment has been reported. Medical treatment is not recommended to treat bitches with uterine ruptures and or renal diseases. Medical treatment has best outcomes in young bitches without history or signs of ovarian diseases. Use of antiprogestins is treatment of choice in closed cervix and high progesterone situations. Use of PGF2 in low progesterone cases or during antiprogestin treatment may improve success rate. References:

167

Asheim, A. (1964). Pathogenesis of renal damage and polydypsia in dog with pyometra. Journal of Am. Vet. Med. Assoc. 147: 736. Chastain, C. B., Panicera, D. and Waters, C. (1999). Association between age, parity, hormonal therapy breed, and pyometra in Finnish dogs. Small Animal Endorinology 9: 8. Dadarwal, D. (2007). Cystic Endometrial Hyperplasia-Pyometra Complex. Controlled Reproduction in Canines. CAS in Veterinary Gynaecology and Reproduction, GADVASU (Ludhiana) 55-58. De Cock, H., Ducatelle, R. Tilmant, K. and De Schepper, J. (2002). Possible role by insulin-like growth factor-I in the pathogenesis of cystic endometrial hyperplasia pyometra complex in the bitch. Theriogenology 57: 2271-2287.Hardy, R. M. and Osborne, C. A. (1974). Canine Pyometra: pathogenesis, physiology, diagnosis and treatment of uterine and extra uterine lesions. Journal of American Animal Hospital Association 10: 245-268. Dow, C. (1958). The cystic hyperplasia-pyometra complex in the bitch. Veterinary Record: 1102-1108. Feldman, E. C. and Nelson, R.W. (1987) Canine and Feline Endocrinology and Reproduction, W. B. Saunders. Philadelphia: p. 399. Fieni, F. (2006). Clinical evaluation of the use of aglepristone, with or without cloprostenol, to treat cystic endometrial hyperplasia-pyometra complex in bitches. Theriogenology 66, 1550-1556. Gilbert, R. O., Nothling, J. O. and Oettle, E. E. (1989). A retrospective study of 40 cases of canine pyometra-metritis treated with prostaglandin F-2alpha and broad-spectrum antibacterial drugs. Gobello, C., Castrex, G., Klima, L., Rodriguez, R. and Corrada, Y. (2003). A study of two protocols combining aglepristone and cloprostenol to treat open cervix pyometra in the bitch. Theriogenology 60, 901-908. Gourley, I. M. (1975). Current techniques in small animal Surgery. Lea and Febiger, Philadelphia. Kustritz, M. V. R. (2010). Clinical Canine and Feline Reproduction: Evidence based Answers. Wiley Blackwell Publishers, Iowa, USA. MacIntire, D. K.(2004). Reproductive emergencies. Presentation to participants at western Veterinary Conference. Las Vegas, US Nelson, R. W., Feldman, E. C. and Stabenfeldt, G. H. (1982). Treatment of canine pyometra and endometritis with prostaglandin F. J. Am. Vet. Med. Assoc. 181: 899. Sandhlom, M., Vesenius, H. and Kivisto, A. K. (1975). Pathogenesis of canine pyometra. Journal of Am. Vet. Med. Assoc. 167: 1006. Wehrend, A., Trasch, K. and Bostedt, H. (2003). Behandlung der geschlossenen Form der caninen Pyometra mit dem Antigestagen Aglepristone. Kleintierpraxis 48, 657-724. Wheaton, L. G. and Barbee, D. D. (1993). Comparison of two dosages of prostaglandin F2a on canine uterine motility. Theriogenology 40: 111-120

168

L P 7 : IV

Management of post partum genital complications in the bitch G N Purohit, DK Bihani1and AA Gauri2
Department of Veterinary Gynecology and Obstetrics Rajasthan University of Veterinary and Animal Science, Bikaner Rajasthan 334001
1 2

Department of Veterinary Medicine Directorate of Research

Canine post-partum problems are different from other domestic animals. The parturition is prolonged in the bitch (second stage of labor sometimes requiring up to 24 hours) hence the first thing a clinician must look for is the presence of any fetus. A novice owner may think that the whelping is completed when the bitch is taking rest after delivery of a few fetuses and would be worried when the bitch is again straining to deliver the remaining pups. Alternatively, a bitch may deliver a part of the litter and then show no signs of delivery although she may still have some pups retained. In canines, normal postpartum discharge is dark green or greenish black in colour for the first 1 to 2 days which then becomes bloody and persists for 1 or 2 weeks or even up to 1 month. There is usually a lot of discharge for the first 5 to 7 days. It should gradually decrease in volume and become thick and clear or grey by day 10. Abnormal, excessive or foul smelling vaginal discharge may indicate an infection. Discharge having an offensive odour, bright red colour, profuse or lasting longer than 3 weeks requires immediate attention. Post partum haemorrhage Some degree of post-partum haemorrhage is inevitable but when the blood loss is profuse it is a matter of serious concern. True maternal blood loss should never exceed a slow drip from the vulva and any level greater than this should be investigated (Jackson, 2004). Uterine or vaginal injury resulting from the treatment of dystocia is the most likely source of blood loss. The anterior vagina can only be inspected if a long speculum or paediatric endoscope is available. The bleeding points in the vagina when accessible should be located and standard haemostatic procedures adopted. However, when this is not possible cotton wool soaked with adrenaline must be placed in the vagina. Blood loss when suspected to be of uterine origin, a dose of oxytocin would be helpful in reducing the size of the uterus and stopping the bleeding. Incidence The incidence of the post partum complications in the bitch appears to be low. At our referral centre the number of bitches presented with some or other complications was merely 17 in a period of two years (Table 1). All except one bitch presented for therapy of eclampsia were of the Pomeranian breed. Retained foetal membrane This is not a common condition in the bitch but may be difficult to diagnose. Placentae are usually passed within 15 min of a birth of a puppy. Many a times placental retention is suspected when in fact it has been eaten by the mother. The condition is common in toy dog breeds. Initially there are no systemic signs. Placental retention is often suspected if a green or black discharge persists after labour. The uterus may appear distended on palpation and occasionally a portion of placenta can be felt on vaginal examination. Radiographic and sonographic examination is suggested for complicated cases. Primary treatment involves administration of oxytocin injection (0.5 U/Kg up to 20 U IM) when retention is suspected for the first 24-48 hours. If the placenta can be palpated in the vagina it should be removed by gentle traction using artery or whelping forceps (Jackson, 2004). If a bitch develops signs of systemic illness because of metri-

169

tis that infrequently develops, surgical removal is indicated. If metritis develops, the prognosis for future reproduction is fair to poor (Smith, 1986). Sub involution of placental sites (SIPS) Some degree of vulval discharge is normal for a week or so after whelping. However the persistence of a serosanguineous to hemorrhagic vaginal discharge beyond 16 weeks post partum indicate subinvolution of the placental sites of attachment (SIPS) in the bitch. SIPS is a disorder that occurs in healthy bitches post-whelping (Beck and Mc Entee, 1966). It is characterised by a bright red (fresh) bloody discharge passing through the vulva for 7-12 weeks post-whelping (Mshella and Chaudhari, 2001) and sometimes excessive uterine bleeding (metrorrhagia) (Dickie and Arbeiter, 1993; Al-Mehaisen et al., 2008). Young bitches (less than 3 years of age) are most commonly affected following the first whelping (Burke, 1977; Al-Bassam et al., 1981a; Wheeler, 1986). The etiology of the condition continues to be obscure, although some of the predisposing factors described include obesity, high calcium and low zinc in the diet, sub-clinical hypoglycaemia, uterine inertia and premature birth (Mshella and Chaudhari, 2001). Normally, at whelping the placenta separates from the endometrium through the spongy layer due to some degenerative changes in the endometrium (Priedkalns, 1981). However, in SIPS the uterus continues to supply blood to these tissue tags (Olson et al., 1984) resulting in the bloody discharges seen in SIPS. The trophoblastic cells do not regress or degenerate normally, and instead they continue to invade deep into the glandular layer or even up to the myometrium, preventing normal uterine involution (Slatter, 1985). The trophoblastic cells are considered to be of fetal origin (Fernandez et al., 1998) and characteristic to SIPS (Sontas et al., 2011). There is lack of thrombosis of endometrial vessels, failure of exposed placental blood vessels to occlude and damage to the uterine vessels. This results into continued haemorrhage. The dogs are generally healthy in other respects except a vaginal discharge. Sometimes progressive weakness, anaemia and death may occur following perforation of the uterus (Wheeler, 1986). Abdominal palpation may reveal pain. Vaginal cytology differentiates SIPS from metritis and lochial discharges by the predominant presence of erythrocytes and decidua-like cells in the smear (Dickie and Arbeiter, 1993; Orfanou et al., 2008). Additionally sonographic features of diagnosis have been described (Davidson and Baker, 2009a) besides the histopathological changes described previously (Al-Bassam et al., 1981b). Histological examination of the uterus is indicated to confirm the diagnosis. The condition is said to be self-limiting, bitches are mildly febrile, but systematically healthy and hence treatment is generally not necessary, as recovery is spontaneous and fertility is not affected (Schall et al., 1971). In the uncommon situation where vaginal bleeding from SIPS is copious enough to cause serious anaemia, coagulopathies (likely defects in the intrinsic pathway or thrombocytopenia / thrombocytopathies), trauma, neoplasia of the genitourinary tract, metritis and proestrus should be ruled out. Vaginal cytology, vaginoscopy, coagulation testing and abdominal ultrasound assist in the diagnosis. Treatment in these cases can be attempted with ergonovine (0.2 mg/15kg IM) administered once or twice (Orfanou et al., 2008; Davidson and Baker, 2009b). The benefit of therapeutic prostaglandins and/or oxytocin is questionable and not proven in any controlled study. The preventative value of oxytocin given in the immediate postpartum period is also unproven. Ergonovine maleate 0.2 mg/15 Kg single to multiple IM doses have been suggested with limited success (Reberg et al., 1992). A single injection of progestagens (Arbeiter, 1975) like Niagestin (25-50 mg per bitch) (Dickie and Arbeiter, 1993) or medroxy-progesterone acetate (2 mg/Kg) (Jackson, 2004) are considered good for treating the condition, but have the potential dangers of predisposing the uterus to infection. Laparotomy with curettage of selected sites can be done or ovario-hysterectomy performed when further breeding is not required or when anaemia due to blood loss is life threatening. Post partum metritis Metritis is an acute infection of the postpartum uterine endometrium. It is a serious condition and

170

sometimes preceded by dystocia, contaminated obstetrical manipulations, or retained fetuses and/or placentae (Orfanou et al., 2008). Unlike pyometra, metritis in the bitch is most often a bacterial uterine infection that develops in the immediate postpartum period and occasionally after an abortion. It is often associated with retained fetus or placentas. Bacterial ascension from the lower genitor-urinary tract is more common than haematogenous spread, and Escherichia coli is the most common causative organism in bitches (Orfanou et al., 2008; Davidson and Baker, 2009b) although infections with Streptococcus and Staphylococcus are also seen (Magne, 1986). Affected bitches normally present with a foul smelling red discharge from the vulva (Magne, 1986). They are lethargic, depressed, off food, initially have a temperature rise and produce no milk. Haematological and biochemical changes often suggest septicaemia, systemic inflammatory reaction and endotoxemia (Orfanou et al., 2008; Davidson and Baker, 2009b). Vaginal cytology shows a hemorrhagic to purulent septic discharge. Ultrasound of the abdomen allows evaluation of intrauterine contents and the uterine wall (Davidson and Baker, 2009a). Retained fetuses and placentae can also be identified with ultrasound. A guarded cranial vaginal culture is likely representative of intrauterine flora and should be submitted for both aerobic and anaerobic culture and sensitivities, and permits retrospective assessment of empirically selected antibiotic therapy. Hysteroscopic visualization of the bitch uterus is possible up to day 17-23 post whelping and specimens can be collected from the uterus for microbiology and cytology to confirm the diagnosis (Watts and Wright, 1995; Watts et al., 1997) however, sufficient expertise is required for such procedures. The therapy of metritis consists of intravenous fluid and electrolyte support, appropriate broad spectrum antibiotic administration and pharmacologic uterine evacuation, usually with prostaglandin F2 alpha (0.10-0.20 mg/Kg every 12-24 h for 3-5 days). An ovariohysterectomy may be indicated if the bitchs condition permits, and she is poorly responsive to medical management (Bencharif et al., 2010). Ergonovine (0.2 mg/15 kg given once IM or repeated twice daily for 2-3 days) is also an effective ecbolic agent (Magne, 1986), but may cause rupture of a friable uterine wall (Orfanou et al., 2008). Synthetic prostaglandins offer more uterine specific therapy where available. Oxytocin is unlikely to promote effective uterine evacuation when administered >2448 hours postpartum. Metritis can become chronic and cause infertility (Smith, 1986). The intra-uterine administration of antibiotics is not possible with the routine techniques because of the anatomy of the cervix. Vaginitis Occasionally a genital infection involving only the vagina is seen in bitches after parturition (Jackson, 2004). A vaginal discharge is present but examination reveals no evidence of uterine or urinary tract infection. It is usually due to bacterial infection. The most common clinical sign is a vulvar discharge. Licking of the vulva, attraction of males and frequent micturition may also be seen. Signs of systemic illness are not present, and the hemogram and biochemical profile are normal. The absence of these abnormalities helps differentiate vaginitis from metritis, the most important differential diagnosis. The diagnostic evaluation should include a digital examination of the vagina, vaginoscopy, cytology and culture of the exudates (Johnson, 1991), endoscopy (Lindsay, 1983) and if necessary, abdominal radiographs or ultrasonography to evaluate the uterus. An anterior vaginal culture may be obtained using a guarded sterile culture swab. The vagina contains normal bacterial flora; therefore, culture results must be interpreted cautiously. A heavy growth, especially of one organism, is probably more significant than a light growth of several organisms (Bjurstrom, 1993). Bacterial infection may respond to local treatment (i.e., vaginal douches), with antibiotics. Systemic, broad-spectrum, bactericidal antibiotics may be needed for persistent infections. Prolapsed uterus/ Uterine rupture Complete or partial prolapse of the uterus is an uncommon postpartum condition in the bitch (Grundy, 1980; Honparkhe et al., 2006; Orfanou et al., 2008), and usually results because of obstetric manipulations or intense tenesmus. Uterine prolapse with associated rupture has been recorded in a bitch (PavanCarreira et al., 2011) The prolapse may involve one or both uterine horns (Grundy, 1980) and occurs during

171

or after parturition or abortion, when the cervix is dilated (Woods, 1986; Deori et al., 2009). The diagnosis is based on palpation of a firm, tubular mass protruding from the vulva postpartum, and inability to identify the uterus with abdominal ultrasonography. Vaginal discharge, abdominal pain and restlessness may be evident subsequent to uterine prolapse (Woods, 1986; Honparkhe et al., 2006). Vaginal hyperplasia and prolapse, secondary to a hypersensitivity of focal (peri-urethral) vaginal mucosa to estrogens, can recur near parturition and should be ruled out by physical examination, vaginoscopy, or contrast radiography. The prolapsed uterine tissues are at risk for maceration and infection from exposure and contamination. When possible the prolapsed portion must be replaced under sedation or general anaesthesia however, the size of most bitches precludes manual replacement; laparotomy and ovariohysterectomy are usually indicated. Two to five IU of oxytocin must be given after replacement and general care of the animal should be done including administration of antibiotics, analgesics and antihistamines wherever required (Davidson and Baker, 2009b). Rupture of the uterus occurs most commonly with very large litters causing marked stretching and thinning of the uterine wall, especially in multiparous dams with dystocia (Hayes, 2004; Davidson and Baker, 2009b). The condition is considered an obstetrical emergency (Biddle and Mcintire, 2000). External trauma is also a common cause. Rupture during or after birth is most likely to occur in cases where the uterine wall is compromised by the presence of infection, a dead fetus, uterine torsion, tumors (NewellFugate and Lane, 2009) or careless obstetric procedures (Bomzon, 1977; Dunn and Foster, 1977). It is also known to be caused by excessively large doses of oxytocin (Humm et al., 2010). Immediate laparotomy for retrieval of fetuses and repair or removal of the uterus, as well as culture and lavage of the abdominal cavity, is indicated (Davidson and Baker, 2009b). Eclampsia (hypocalcaemia or puerperal tetany) Eclampsia is an acute, life-threatening disease affecting bitches (Mudaliar and Hussain, 1967; Jirima, 1974; Austad and Bjerkas, 1976; Aroch et al., 1999; Drobatz and Casey, 2000) and caused by low calcium levels. It is most often seen in small to medium-sized bitches at peak lactation, although it can be seen in late pregnancy through 45 days postpartum. The disorder is more likely in small bitches with a heavy litter (Kaufman, 1986) and generally occurs when the puppies are 2 to 5 weeks of age. Excessive prepartal calcium supplementation can lead to development of puerperal tetany by promoting parathyroid gland atrophy and inhibiting parathyroid hormone release, thus interfering with the normal physiologic mechanisms to mobilize adequate calcium stores and utilize dietary calcium sources (Davidson and Baker, 2009b). Metabolic conditions favouring protein binding of serum calcium can promote or exacerbate hypocalcaemia, such as alkalosis resulting from prolonged hyperpnoea during prolonged labor or dystocia. Hypoglycaemia and hyperthermia can occur concurrently. The initial signs may be subtle and vague, such as restlessness, nervousness, and pacing, panting, whining, loss of maternal behaviour, high body temperature (1070 F), irritability, increased salivation, stiff gait, in coordination, muscle tremors, and pain. The bitch can progress quickly (minutes to hours) to tetany and seizures. Hyperthermia is primarily caused by increased muscular activity (Kaufman, 1986). The diagnosis is based on history and clinical signs. Blood tests will confirm a low blood calcium. Eclampsia can be rapidly fatal and hence represents a medical emergency. The immediate goal is to return the serum calcium level to normal by slow intravenous infusion of 10% calcium gluconate (1-20 mL) given to effect. Cardiac monitoring for bradycardia should accompany the administration and their presence warrants temporary discontinuation of therapy and a slower subsequent infusion rate (Davidson and Baker, 2009b). A response should be seen within 15 minutes. Other treatments include glucose, anticonvulsants and lowering of body temperature may be required. Because cerebral edema can occur from uncontrolled seizures; diazepam (1-5 mg IV) can be used to control persistent seizures. Mannitol may be indicated for reducing cerebral inflammation and swelling. Corticosteroids must be avoided as they promote calciuria and decrease intestinal calcium absorption. Once the neurologic signs are controlled, a subcutaneous infusion of an equal volume of calcium gluconate, diluted 50% with saline, should be given and repeated every 6-8 h till the dam is stable and able to take oral

172

supplementation (Davidson and Baker, 2009b). Calcium gluconate or carbonate (10-30 mg/Kg every 8 h) should be given orally for a couple of days. Once detected and treated it is important not to put the puppies back on the mother because further feeding from the mother will cause another eclampsia episode. The puppies need to be hand reared until weaning. Diets high in legumes (soy beans) or cottage cheese may tie up calcium and should therefore be avoided in the lactating bitch. Table 1 Incidence of post-partum genital complications in bitches at referral centre between 2008-2010
Clinical condition Retained fetal membranes Sub involution of placental sites Metritis Uterine prolapse Eclampsia Total Number of cases 1 4 6 1 5 17 Breed German Shepherd German Shepherd 2; Pomeranian 1; Labrador 1 Non-descript 4; Pomeranian 2 Non-descript 1 Pomeranian 4; Doberman 1 % age of cases 5.88% 23.52% 35.29% 5.88% 29.41%

References Al-Bassam MA, Thomson RG, ODonnell L (1981a). Normal postpartum involution of the uterus in the dog Can J Comp Med 45:217. Al-Bassam MA, Thomson RG, ODonnell L (1981b). Involution abnormalities in the postpartum uterus of the bitch. Vet Pathol 18:208-18. Al-Mehaisen L, Al-Kuran O, Amarin ZO, Beitawi S, Muhtaseb A (2008) Secondary postpartum hemorrhage following placental site vessel subinvolution: a case report. Arch Gynecol Obstet 278: 585-87. Arbeiter K (1975). The use of progestins in the treatment of persistent uterine hemorrhage in the postpartum bitch and cow: a clinical report. Theriogenol 4:11-13. Aroch I, Srebo H, Shpigel NY (1999). Serum electrolyte concentrations in bitches with eclampsia Vet Rec 145:318-20. Austad R, Bjerkas E (1976) Eclampsia in the bitch. J Small Anim Pract 17:793-98. Beck A M, Mc Entee K (1966). Subinvolution of placental sites in a postpartum bitch. A case report. Cornell Vet 56: 269-277. Bencharif D, Amirat L, Annabelle G, Tainturier D (2010) Ovariohysterectomy in the bitch. Obst Gynecol Int 2010:542693. Biddle D, Mcintire DK (2000) Obstetrical emergencies. Clin Tech Small Anim Pract 15:88-93. Bjurstrom L (1993). Aerobic bacteria occurring in the vagina of bitches with reproductive disorders. Acta Vet Scand 34:29-34. Bomzon L (1977). Rupture of the uterus following caesarean section in a bitch. Vet Rec 101:38. Burke TJ (1977). Postparturient problems in the bitch. Vet Clin North Am 7:695. Davidson AP, Baker TW (2009a) Reproductive ultrasound of the bitch and queen. Topics Companion Anim Med 24:55-63. Davidson AP, Baker TW (2009b). Postpartum disorders in bitches, queens and neonates. Topics Companion Anim Med 24:105-63. Deori S, Sarkar M, Debnath M (2009). Post parturient uterine prolapse in a bitch-A case report. Indian J Anim Reprod 30:78. Dickie MB, Arbeiter K (1993). Diagnosis and therapy of the subinvolution of placental sites in the bitch. J Reprod Fertil Suppl 47:471-5. Drobatz KJ, Casey KK (2000). Eclampsia in dogs: 31 cases (1995-1998). J Am Vet Med Assoc 217:2169. Dunn TJ, Foster RC (1977). Perforated uterus in a bitch. Mod Vet Pract 58:240-41.

173

Fernandez PE, Portiansky EL, Barbeito CG, Gimeno EJ (1998) Characterisation of cytotrophoblastic-like cells present in subinvolutioned placental sites of the bitch. Histol Histopathol 13:995-1000. Grundy AM (1980). Partial uterine prolapse in a bitch. Vet Rec 106:420-21. Hayes G (2004). Asymptomatic uterine rupture in a bitch. Vet Rec 154: 438-39. Honparkhe M, Singla VK, Singh J, Bedi M, Sathya A (2006). Post parturient uterine prolapse in a bitch. Indian J Anim Reprod 27:91-92. Humm KR, Adamantos SE, Benigni L, Armitage-Chan EA, Brockman DJ, Chan DL (2010) Uterine rupture and septic peritonitis following dystocia and assisted delivery in a Great Dane bitch. J Am Anim Hosp Assoc 46: 353-357. Jackson PGG (2004). Ed. Postparturient problems in the dog and cat. Handbook of Veterinary Obstetrics. Saunders Elsevier. Pp 233. Jirima K (1974). Therapy of canine eclampsia. Berl Tierarztl Wochenschr 87:15-16. Johnson CA (1991). Diagnosis and treatment of chronic vaginitis in the bitch. Vet Clin North Am Small Anim Pract 21:523-31. Kaufman J (1986). Eclampsia in the bitch. In: Morrow DA eds. Current Therapy in Theriogenology. Phildelphia, WB Saunders Co pp 511. Lindsay FEF (1983) The normal endoscopic appearance of the caudal reproductive tract of the cyclic and non-cyclic bitch: post-uterine endoscopy. J Small Anim Pract 24: 1-15. Magne ML (1986). Acute metritis in the bitch. In: Morrow DA eds. Current Therapy in Theriogenology. Phildelphia, WB Saunders Co pp 505. Mshella GD, Chaudhari SUR (2001). Sub-involution of placental sites (SIPS): Possible predisposing factors and consequences on the fertility of bitch. Int J Agri Biol 3:263-65. Mudaliar RAS, Hussain MM (1967). Peurperal tetany in a bitch. Indian Vet J 44:804-5. Newell-Fugate A, Lane E (2009). Intrapartum uterine rupture with coincidental uterine adenomyosis in an African wild dog (Lycaon pictus). J Zoo Wildl Med 40:791-95. Olson PN, Nett TM, Bowen RA, Thrall MA, Wykes PM, Husted PW, Sawyer HR (1984). Vaginal cytology II: Its use in diagnosing canine reproductive disorders. Comp Cont Edu 6:385-90. Orfanou CD, Ververidis NH, Fthenakis CG (2008). Post-partum pathological conditions in the bitch-Part II. J Hellenic Vet Med Soc 59:126-138. Pavan-Carreira R, Albuquerque C, Abreu H, Maltez I (2011) Uterine Prolapse with Associated Rupture in a Podengo Bitch. Reprod Domest Anim doi: 10.1111/j.1439-0531.2011.01944.x. Priedkalns J (1981). Female reproductive system. In: Delman H, Brown EM eds. Textbook of Veterinary Histology 2nd ed. Philadelphia Lea & Febriger pp 309-36. Reberg SR, Peter AT, Blevins WE (1992). Subinvolution of placental sites in dogs. Comp Cont Edu Pract Vet 14:789-93. Schall WD, Duncan JR, Finco DR, Knecht CD (1971). Spontaneous recovery after subinvolution of placental sites in a bitch. J Am Vet Med Assoc 159:1780-2. Slatter DH (1985). Ed Textbook of Small Animal Surgery Vol 2. Philadelphia WB Saunders Co. pp1665. Smith FO (1986). Postpartum diseases Vet Clin North Am Small Anim Pract 16:521-4. Sontas HB, Stelletta C, Milani C, Mollo A, Romagnoli S (2011) Full recovery of subinvolution of placental sites in an American Staffordshire terrier bitch. J Small Anim Pract 52:42-45. Watts JR, Wright PJ (1995). Investigating uterine disease in the bitch: uterine cannulation for cytology, microbiology and hysteroscopy. J Small Anim Pract 36:201-06. Watts JR, Wright PJ, Lee CS, Whithear KG (1997). New techniques using transcervical uterine cannulation for the diagnosis of uterine disorders in bitches. J Reprod Fert Suppl 51:283-93. Wheeler SL (1986). Subinvolution of placental sites in the bitch. In: Morrow DA eds. Current Therapy in Theriogenology. Phildelphia, WB Saunders Co pp 513-15. Woods DS (1986). Canine uterine prolapse. In:Morrow DA eds. Current Therapy in Theriogenology. Phildelphia, WB Saunders Co pp 510.

174

Abst 1 : IV

Canine pyometra- study of twelve cases

S.V.Upadhye, H.T.Jain and Gauri Khante Nagpur (Maharashtra)

Chronic endometrial hyperplasia and pyometra is one of the most common surgical condition reported in dogs. Twelve cases of canine pyometra were treated during the year July 2011 to August 2011. All the cases were confirmed with the sonography. The condition was observed more in age group of 4-6 years(08) and in nulliparous females (09). In two cases, mammary toumrs were also noted. Mostly, the condition was associated with cystic ovaries (08), whereas cysts were noted on uterine serosa in three cases. One bitch had unilateral distension. Major symptoms noted were Anorexia to inappetance (10), vomiting (06), polydypsia and polyurea (05), distension of abdomen (06), and per veginal discharge. Conservative supportive treatment in all cases. Hormonal therapy was instituted in three cases. However, ovarohysterectomy was required in all the cases. Eleven bitched recovered successfully, whereas one bitch could not recover from the anaesthesia died within first 24 hours postoperatively. Abst 2: IV

Vaginal hyperplasia- A case report of six female dogs

Chandrapuria V.P., Gupta S. K., Dhakre H. S., Rai Somil Department of Surgery and Radiology,College of veterinary science and A.H. Jabalpur

Vaginal hyperplasia occurs in young bitches during the follicular stage of the first to third estrous cycle. The folds of the vaginal mucosa protrude into the vaginal lumen which expands caudally over the urethral meatus. Canine vaginal hyperplasia involves only the mucosa. Vaginal hyperplasia can be distinguished from a vaginal tumor because it originates from the vaginal floor cranial to the urethral meatus. A two year old female Bullmastiff, 8 month old Labrador, 3 year old Pomeranian, 6.5 year old Pomeranian, 2 years old Labrador bitch and 8 year old pomeranian bitch were brought to the Jabalpur pet clinic. Frequent bleeding was observed due to self incited trauma. Medicinal treatment was given but was not effective. A mass protruding from the vulva must be kept clean and protected from drying. All six cases were treated surgically, the treatment consisted the catheterization and diagnosis of the depth of the hyperplastic tissue. Episiotomy is performed. The growth was incised and the typical band of hyperplastic tissue is identified and separated. Ligation and removal of growth is done. All cases responded well and recovered without any pre or post operative complications. Abst 3 : IV

Functional evaluation of chilled canine ejaculates with priority given to the morphological abnormalities of spermatozoa
Thapak S., L. Sharma B.L., Shrivasatava O.P., Shahi A., Bharadwaj V., Tripathi S.M., Sankhala L.N. Department of animal reproduction, gynecology and obstetrics College of Veterinary Science and Animal Husbandry Madhya Pradesh Pashu Chikitsa Vigyan VishwaVidyalaya, Jabalpur-482001 (MP), India

Sixty ejaculates of dogs of German Shepherd breed from 2 to 5 years old were preserved in three different extenders and examined in 72 hrs after freeze preservation for survival. The examination focused on the functional parameters of sperm (motility, percentage of live spermatozoa) and their morphology. The levels of relationship between individual criteria of sperm analysis were demonstrated. Statistically highly significant correlations between motility and ratio of live spermatozoa were proven. Our findings revealed the better preservability of semen. Strict morphological sperm analysis provides important information about the rise in qualitative alterations of chilled ejaculates in different extenders caused by changes in superficial structures during the course of 72 hrs of preservation.

175

Abst 4 : IV

Cystic ovarian follicular disease in two spitz bitches: a case study

Bhoi, H., Das, S.1, Mohanty, D. N. and Pattanayak, T.K.2 Department of Animal Reproduction, Gynaecology and Obstetrics College of Veterinary Science and Animal Husbandry, O.U.A.T. Bhubaneswar-751003

Two spitz bitches of 8 and 10 years of age with sound health were presented in the Teaching Veterinary Clinical Complex, College of Veterinary Science And Animal Husbandry ,Bhubaneswar with the complaint of progressively heavier long period of vaginal bleeding beyond one month. There was progressive nonpruritic bilaterally symmetrical alopecia of the perineal region. The abdominal cavity was distended with no wounds or masses in vulva and caudal vaginal regions. Rosy pink, edematous vaginal mucosa, characteristic of proestrus was present. Digital vaginal examination and vaginonscopy did not reveal any abnormalities such as presence of foreign bodies or any growth of fungal or bacterial origin. Hematological Examination revealed Hb (%) TLC (1000/ml) and neutrophil (%) as 8.8, 8.1; 34000, 37000 and 78, 84 respectively. Vaginal cytology indicated presence of cornified vaginal epithelium, indicative of elevated serum estrogen concentration. Besides, there was presence of cellular derbies, RBC, PMN cells and bacterial colonies. Fluroscopic investigation by C-Arm showed focal hypo echoic to anechoic cystic structure caudal to kidney, within the ovary measuring about 10 cm in diameter. There was visualization of the thickened uterine endothelium, indicative of cystic endometrial hyperplasia. The bitches were diagnosed for cystic ovarian degeneration with associated CEH. Ovariohysterectomy under standard surgical procedure was carried out. Post operatively, ceftriaxone @ 10mg / kg body weight and meloxicam @ 0.05 mg / kg body weight were administered intramuscularly for 7 days. The surgical wound was dressed on alternate days with povidone iodine and local application of Neosporin ointment until healing. The skin sutures were removed on the 10th day. The bitches recovered uneventfully. Vaginal edema was relieved by 7th day. New hairs started to grow at the site of alopecia by 15th-20th day. On gross examination, both the ovaries had multicystic appearance. They contained about 250 millilitre of clear, serous fluid. Histopathological studies revealed that the cystic wall was lined with granulosa cells and degenerating cumulus oophorus cells but no oocyte. Uterine epithelium was lined with increased number and size of endometrial glands. The bitches were diagnosed for cystic ovarian degeneration with associated CEH. Ovariohysterectomy under standard surgical procedure was carried out. Post operatively, ceftriaxone @ 10mg / kg body weight and meloxicam @ 0.05 mg / kg body weight were administered intramuscularly for 7 days with alternate day dressing with povidone The skin sutures were removed on the 10th day. The bitches recovered uneventfully. Vaginal edema was relieved by 7th day. New hairs started to grow at the site of alopecia by 15th-20th day. On gross examination, both the ovaries had multicystic appearance. containing 250 ml of clear, serous fluid. Histopathological studies revealed that the cystic wall was lined with granulosa cells and degenerating cumulus oophorus cells but no oocyte. Uterine epithelium was lined with increased number and size of endometrial glands. 1 Director, Central Clinics, CVSc & AH, Bhubaneswar 2 Dept. of Surgery and Radiology, CVSc & AH, Bhubaneswar

176

Abst 5 : IV

Management of vaginal prolapse in a bitch- a case report

Sudershan Kumar,Ankur Sharma, H.R.Bhardwaj, A.K. Pandey &Ashok Kumar Division of Animal Reproduction Gynaecology & Obstetrics , FVSc and AH, Sher-e-Kashmir University of Agricultural Sciences and Technology-Jammu R.S.Pura, Jammu-181102

A 5-year old ovariohysterectomised German shepherd bitch with signs of vaginal Prolapse was presented to the Dog Clinic. History revealed that eversion of vaginal mass occurred during several previous heat periods. On examination, the exposed vaginal tissue waspink in colour, oedematous and 9 cms in diameter. Clinical parameters were within the normal physiological range. The exposed vaginal mass was flushed with NSS and thoroughly cleansed with antiseptic solution. Catheterization of the urethra was done and ice-cubes were applied to the mass to reduce the swelling. Lignocaine jelly was applied liberally and mass was repositioned to the normal location. Under local infiltration with 2% lignocaine HCl solution, Purse string suture was applied. Inj.Intamox-500mgfor 5 daysand Inj. Melonex @0.2mg/kg b.wt for 3 days were administered intramuscularly. Inj.Progesterone@250mg intramuscularly was administered on alternate days for 3 days. The skin suture was removed on 12th day post operatively. The bitch showed an uneventful recovery. Abst 6 :IV

Metritis In Bitch- A Case Report

Asopa Shesh, Rawat Ashwani Kumar, Rani Sunita, Vyas Indu, and Gupta Anuradha Department of Veterinary Pathology, College of Veterinary and Animal Science, RAJUVAS, Bikaner.

A clinical case of metritis was brought to Gogagate Clinic, Bikaner. The bitch was 2 yrs old. Owner reported that it was almost off feed for last 5 days. Foul smelling Discharge was oozing from vagina. It was sticky and greenish to white in colour. Swelling and licking of vagina was also present. Treatment which was provided is as follows- Antibiotic Oxytetracycline (10ml) with Furea bolus (half) which contained urea and Metronidazole was provided intrauterine for 3 days. Antibiotic injection Byrosin which contain Enrofloxacin was provided as one shot (1.5ml) intramuscularly for 3 days. Besides this; analgesics, antihistaminic and multivitamins were also provided as symptomatic treatment. Abst 7: IV

Studies on semen collection behaviour and seminal characteristics in the dog

Sumit Prakash Yadav, J.S. Mehta Department of Veterinary Gynaecology & Obstetrics, College of Veterinary & Animal science, RAJUVAS, Bikaner

Semen from adult German Shepherd (n=3) and Labrador (n=3) dogs was collected by digital manipulation and the ejaculates obtained (n=36) were subjected to evaluation of physical characters. Semen was diluted in egg yolk citrate (EYC) and tris fructose citrate and kept at 50C for 3 days for evaluation of keeping quality. The overall mean value for sperm motility, sperm concentration, live sperm, sperm abnormalities, damaged acrosome, hypo osmotic swelling and cold shock resistant sperm was 64.44%, 394.25 million/ ml, 79.83%, 15.00%, 7.39%, 68.97% and 31.86%, respectively. EYC proved to be better to TFC subsequent to the first day of storage.

177

Abst 8 : IV

Vaginal hyperplasia in bitch and its treatment

A.K.Nahak, S.Sahoo, I.Mohanty, B.K.Patra and D. N.Mohanty Department of Animal Reproduction, Gynaecology and Obstetrics, College of Vety. Sc. and Animal Husbandry, OUAT, Bhubaneswar-3

Vaginal hyperplasia more commonly vaginal prolapse, the protrusion of swollen (edematous) vaginal mucosal tissue through the vulva giving the exposed part a donut-shaped appearance,is a common phenomenon in bitches during follicular phase,generally proestrous and oestrous. Sometimes the mass is mistaken as a tumour. Estrogenicstimulation,genetic predisposition and forced extraction of the male during coitus contribute to vaginal hyperplasia. The present case report describes a 3yr old indigenous bitch presentedat TVCC, College of Veterinary Science and A.H., Bhubaneswar with a history of vaginal prolapse. The diagnosis was made from the history and the stage of oestrus cycle.On physical examination a pear shaped brightred vaginal mass originating just cranial to urethral tubercle was found which was ascertained to be type II vaginal prolapse. The prolapsed mass was repositioned by giving digital pressure following cleansing the perineum and prolapsed part with normal saline and BIPP. A course of antibiotics, progesterone(P-Depot) injection, intramuscularly was injected on three occasions at 72hr interval. The recovery of the animal was uneventful without any reoccurrence of prolapse. The procedure for treatment and subsequent recovery was recorded through photograph. Abst 9 : IV

Evaluation of extenders and cryopreservatives for cooling and cryopreservation of spermatozoa from the German Shepherd dogs
Thapak S., Sharma B.L., Shrivasatava O.P., Shahi A., Bharadwaj V., Tripathi S.M., . Sankhala L.N. Department of animal reproduction, gynecology and obstetrics College of Veterinary Science and Animal Husbandry Madhya Pradesh Pashu Chikitsa Vigyan VishwaVidyalaya, Jabalpur-482001 (MP), India

Semen was collected from eight German Shepherd dogs to compare three extenders in the semen freezing process. Each ejaculate was divided in three parts and added to Sodium citrate egg yolk (EYC), Trisfructose-citric acid (TFC) and Coconut Milk extenders (CME). The semen was diluted at 37C in extenders without glycerol, in the ratio 1:10 and cooled for 60 minutes to reach a 5C refrigeration temperature. Then, extenders with glycerol in the ratio of 2:1 were added to give the final prefreezing concentration of 4% of glycerol. The diluted semen with the cryoprotectant was maintained for a further 60 minutes in refrigeration to equilibrate the spermatozoa in the glycerol and packaged in 0.5 ml plastic straws. The straws were maintained for 30 minutes in vapor, plunged and stored in liquid nitrogen. Sperm morphology was evaluated before and 72 hrs after freezing, whereas progressive motility (%) and velocity of forward progression (0-5) were appraised in different periods (0, 24, 48 and 72 hours) of the freezing process. The extender EYC showed the best (86.320.57, 73.040.27, 62.65? 0.43 and 55.40.53% respectively) post thaw progressive motility and velocity of forward progression compared to the TFC and CME extenders (86.310.58, 65.930.31, 52.960.51 and 43.430.56%, and 85.390.60, 59.140.67, 46.870.26 and 35.540.38%) respectively. Semen freezing increased major sperm morphological abnormalities, regardless of the extender.

178

Abst 10 : IV

Estrous induction in bitches using oral bromocriptine

Pramod Kumar, G.N.Purohit, J.S. Mehta, Sunanda Sharma, Sumit Prakash Yadav, Amit Kansujia, Sunil Raiya and Ramsingh Saran Department of Veterinary Gynaecology and Obstetrics College of Veterinary and Animal Science, RAJUVAS,Bikaner

The effect of oral administration of bromocriptine, an anti-prolactin drug on the induction of fertile estrus in bitches belonging to different breeds and age groups (n=40) is described. Anestrus bitches ( Pugh 15, Labrador 10, Germen Sephered 10 and Great Dane 5) were treated with bromocriptine @ 50 g/kg body weight orally for 7 consecutive days and 80% (n=32) responded to the treatment within 8 days ( range, 7 to 10). The side effect noticed was vomition which was more pronounced in the Pugh breed. Oral administration of 1mg/Kg of promethazene was suggested before administration of bromocriptine to bitches with severe vomition. The duration of proestrus and estrous was found to be 10.11 0.68 (range, 8 to 12) and 8 0.29 (range, 6 to 9) days respectively. The conception rate in relation to the number of bitches responding to the estrous induction treatment was 87.50 % (28 out of 32) and the overall conception rate in relation to the number of animals subjected to the estrous induction trial was 70% (28 out of 40). It was concluded that bromocriptine can be given to bitches for induction of a fertile estrus. Abst 11 : IV

A Clinico-pathological study of the effect of Vincristine Sulphate Chemotherapy in Transmissible Venereal Tumour in Dogs
Naresh Mitharwal1, R.K.Joshi2, J.S.Mehta3, Amit Kumar4and Pradeep Kumar5 College of Veterinary and Animal Science, RAJUVAS, Bikaner

Transmissible venereal tumour (TVT) is a coitally transmitted neoplasm of dogs affecting both sexes. Eleven cases of dogs (9 female& 2 males) naturally occurring transmissible venereal tumour were studied.5 female dogs were Pomeranian, 2 Germanshepherd, 2 Rottweiler& 2 male dogs (1 Germanshepherd& 1 mongrel). Occurrence of TVT in male dogs was at the glans penis & prepuce and in females external genitalia and vagina. Cauliflower like friable mass was found up to 6 cm diameter at genital organs. The anatomical site, clinical history and cell morphology were typical of TVT. Biopsy specimens were collected from tumours during growth phase before chemotherapy and during regression induced by chemotherapy & radiotherapy. Intravenous administration of vincristine sulphate @ 0.025 mg/kg b.wt.in normal saline by repeated four doses at 9 days interval. A complete tumour disappearance was observed by vincristine sulphate in 10 dogs while one female dog was treated by radiation therapy which was resistant or nonresponsive to vincristine sulphate. Side effects due to vincristine in few cases like vomiting, mild depression &partial anorexia were disappeared after complete regression of tumour. Slight anaemia & leukopenia was observed in few dogs due to anti-mitotic effect of vincristine on bone marrow haemopoiesis. These effects of vincristine were decreased by low doses and well-spaced duration of therapy. 1,3,4 Department of Veterinary Gynaecology &Obstetrics 2,5 Department of Animal Breeding and Genetics

179

Abst 12 : IV

Retrieval of emphysematous pup via caesarean section

Harpreet Kour, Smita, Gurmeet Singh, M. H. Jan, S.T. Bashir and Jasmeet Singh Vet Care Centre, 1-P Extension Trikuta Nagar, Jammu- 180012

The clinical cases of emphysematous foetus are less frequently encountered in small animal practice because of personal care and affection of pet owners towards their companion animal. However, it can be seen in cases of unnoticed cases of dystocia or premature death of foetus inside uterine cavity where bitch fails to show any signs of toxemia or labor pain. The present case report deals with a 3 years old Labrador retriever bitch which was presented with the history of delivery of 3 dead pups a week ago but there was continuous blackish coloured vaginal discharge which was treated with oxytocic drugs and broad spectrum antibiotics which seemed to be unfruitful. The bitch was subjected to radiographic examination which revealed the presence of a large sized foetus lying in transverse position. Hence, it was decided to perform caesarotomy to remove the dead pup. Preoperatively, ceftriaxone and tazobactum combination 562.5mg, metronidazole 250mg and dexamethasone admixed in dextrose normal saline (300 ml) followed by preanaesthetic administration of diazepam (1mg/kg i.v.) and 10 minutes later on by ketamine (7.5mg/kg i.v.) was carried out in a routine manner. Standard laparotomy was done which revealed a dead foetus with blackish coloured placental attachment in the right uterine horn. The foetus along with necrotic foetal membrane was removed after taking all necessary precautions to avoid spillage inside abdominal cavity. Thorough lavage of the abdominal cavity was done with normal saline and metronidazole. Uterine incision was sutured using catgut no. 1 in double layer of Lembert suture pattern followed by closure of laparotomy and skin incision in a routine manner. The complete details of the case will be discussed in the paper. Abst 13 : IV

Diabetes mellitus: A genetic disease in canine

Prajapati Madhu, Prajapati R. S., Murdia C. K., Pannu Urmila and Saini B. S. Department of Animal Breeding and Genetics, College of Veterinary and Animal Science, RAJUVAS, Bikaner-334001

Diabetes mellitus is complex metabolic disorder caused by deficiency of insulin, usually after destruction of pancreatic islet of-cells, with disturbance in carbohydrates, lipids and protein metabolism related to either an absolute or relative deficiency of insulin, resulting in hyperglycemia with glycosuria. The role of genetics remains to be determined. Genetic predispositions for diabetes have been suggested by familial associations in dogs. Breeds that are predisposed are Australia Terrier, Poodles, Dachshunds, Pug, Cocker, Collies, Dobermans, Labrador and German shepherd dogs. Diabetes mellitus is of common occurrence with a reported frequency of one in 100 to one in 500. This disease occurs more in females at the age of 6-7 years. In the diabetic dogs establishing control of hypoglycemia can be accomplished with insulin, diet, exercise, prevention or control of concurrent insulin antagonistic diseases and discontinuation of medication that cause insulin resistance. Complication resulting from diabetes or its treatment in diabetic dogs is blindness and anterior uveitis resulting from cataract formation, hypoglycemia, chronic pancreatitis, recurring infections, poor glycemic control and ketoacidosis. The veterinarian must balance the benefits of tight glucose control obtainable with aggressive insulin therapy against the risk of hypoglycemia. The prognosis depends on owner commitment to treat the disorder. Mean survival time for diabetic dogs is approximately 3 years from the time of diagnosis, although diabetic dogs that survive the first 6 months can easily maintain a good quality of life for longer then 5 years with proper care.

180

Abst 14 : IV

Subinvolution of placental sites (SIPS), in a bitch a case report

Pramod Kumar, G.N.Purohit, J.S.Mehta, Sunanda Sharma, Sumit Prakash Yadav, Amit Kumar, Sunil Raiya and Ramsingh Saran Department of Veterinary Gynaecology and Obstetrics College of Veterinary and Animal Science, RAJUVAS,Bikaner

(SIPS), a condition wherein the sites of placental attachment do not revert to their normal, nonpregnant state, occurs occasionally in bitches younger than 2.5 years of age. The etiology of SIPS is yet unclear, however, it is known that the trophoblasts do not regress or degenerate normally; they continue to invade deep into the glandular layer or even the myometrium, preventing normal involution. Factors responsible for prolonged or premature parturition may be predisposing to SIPS. Two to three year-old bitches (N=3) were presented in clinics with the history of post partum persistant hemorrhage (bright red blood discharge) from the genital tract beyond 14-18 weeks of whelping. The tentative diagnosis of subinvolution of placental sites was made by syncythial trophoblast like cells were identified in the specimen collected through the opening of the cervix and also made by ultrasound. Bitches treated with Inj- Nexbolic 1ml I/M (Intas pharma) for 3 to 5 days and Inj-Prostodin 135 g I/M (Astra Zeneca pharma). Out of three cases two were respond while one is not respond and refer for surgery. Subinvolution sites normally heal on their own; however, if necrosis becomes severe, the uterus can rupture, requiring immediate surgery. Abst 15 : IV

Unilateral uterine prolapse and its management in a bitch

S.T. Bashir, M.H. Jan, Mahak Singh, J. Singh, A.C. Saxena and A.M. Pawde Indian Veterinary Research Institute, Izatnagar, Bareilly-243122, U.P.

Prolapse of the uterus occurs infrequently in companion animals and it usually occurs during or within 48 hours of normal parturition, prolonged parturition or abortion. Prolapse of the whole uterus has been reported but the cases of prolapse of one uterine horn are considered to be very rare in occurrence. Various methods of treatment have been described including amputation of the everted uterus; manual reduction and repositioning by abdominal palpation and use of infusion; and manual reduction of the prolapse through a laparotomy incision, followed by ovariohysterectomy. An 18 months old bitch of non-descript breed was presented with the history of a large mass protruding from the vulva since 7 days. On examination, the uterus was found to have unilaterally prolapsed. The exposed uterine mucosa was brownish-pink with varying degree of necrosis and grossly enlarged. The animal was premedicated with atrophine sulfate (0.04 mg/kg, SC) and xylazine hydrochloride (1 mg/kg, IM). Following intramuscular administration of ketamine hydrochloride (5 mg/kg), the bitch was positioned in dorsal recumbency. After the usual surgical preparation of the operation site, a ventral midline laparotomy was performed. Inspection of the abdominal cavity revealed that the right uterine horn had detached from the body and left uterine horn and the ipsilateral ovary got exteriorized through the vent. The prolapsed mass was tried to reduce manually but all attempts failed. Hence it was decided to go for amputation of prolapsed horn. Afterwards, an ovariohysterectomy was performed and the abdomen was closed in usual manner. After surgery, the bitch was treated twice a day for 5 days with ceftriaxone (500 mg IM) and liquid diet was supplied for 4 days. Inspection of the excised organ revealed no implantation zones in the lumen. The right horn, which was removed by ovariohysterecetomy, was observed in normal measurements. Seven days after the operation, the skin sutures were removed and the bitch recovered uneventfully.

181

Abst 16 : IV

Mummified fetus and a live eviscerated intestines pup in a pug bitch: A case report
Pandey A K 1, Sharma Utsav 2, Gupta Ajay 3, Gupta Pankaj 3, Kumar Sharad 2, Diwedi D K3, Kushvaha R B2 , Kumar Sudershan1, Rao M M1, Razzaque W A A1 and Kumar Sudhir1 Faculty of Veterinary Science & Animal Husbandry, SKUAST-J, RS Pura-181102, Jammu (J & K)

A dystocia case of eighteen month old primipara pug bitch was presented at Veterinary Clinics and Teaching Hospital with the history of full term pregnancy that whelped two dead fetus in early hours. On per vaginal palpation one dead fetus was palpated and was removed manually. Then the bitch delivered one live fetus with evisceration of intestine which died after 3 hours. When straining stopped, an X ray was performed which revealed two more fetus still in uterus. On caesarean section two mummified fetus were removed. Bitch was treated with antibiotic and I/V fluids and recovered well.
1 2

Division of Animal Reproduction, Gynaecology and obstetrics, Division of Veterinary Clinics and Teaching Hospital 3 Division of Veterinary Surgery and Radiology

182

Session-V
Canine Microiology, Virology, Immunology and Pathology

183

LP 1 : V

NEW DEVELOPMENT IN ANTIRABIES VACCINES FOR ANIMALS

S. Nandi, Vishal Chander, Chintu Ravishankar, T.K. Mahapatra and R. Verma Indian Veterinary research Institute, Izatnagar- UP

Rabies is an acute fatal encephalomyelitis and the most important viral zoonosis from a global perspective. It is a viral disease under the genus Lyssavirus and family Rhabdoviridae. All the warm blooded animals are susceptible starting from a small mouse to a massive elephant. Considering the global distribution, incidence, human and veterinary health costs, and severe case fatality ratio associated with the disease, rabies remains the most important viral zoonosis recognized today, despite its historical occurrence for millennia. (Wild animals, including bats, raccoons, skunks and foxes are the important rabies vectors and transmit the disease to the domestic animals while dogs are by far the most important rabies vector in the world in the context of human infections. Although potent and efficacious vaccines are available to control the rabies in pet dogs and cats, stray dogs and cats are often left unvaccinated and act as vectors for rabies virus and transmit the disease to humans and other animals. Rabies in India is an endemic malady and considered a serious concern for veterinary and medical fraternity. It is an extremely dangerous disease with a frequently long incubation period and high distressing symptoms. With the exception of Andaman and Nicobar and Lakshadweep and to some extent Nagaland rabies cases are reported from all over the country and throughout the year (Nandi and Yadav, 2011 ; Nagarajan et al., 2006 ; Singh and Sandhu, 2007 ; Knobel, et al., 2005 : Sudarshan, 2004). Rabies is a dreadful and terrifying disease for which there is no treatment once the symptoms have appeared. Vaccination is the only way to combat the disease before and after exposure or infection. In spite of widespread vaccination of domestic dogs, against rabies to prevent the incidence of human rabies, the number of human deaths worldwide is greater than that of the combined deaths from polio, meningococcal meningitis, Japanese encephalitis, yellow fever, SARS and birdflu. So, it is the prime time to look into the matter and to devise strategy for successful vaccination campaign to control rabies in animals. Rabies is endemic in 100 countries where more than 2.5 thousand million people live. Rabies is enzootic in both wild and domestic animals and poses a potential threat to human beings. Some of the island states such as Iceland, Japan, U.K. and the European states such as Belgium, Finland, France, Greece, Norway, Portugal, Spain, Sweden, Switzerland etc are now considered free of rabies ( Pastoret and Brochier, 1999 ; Kihm et al., 1992). Although all mammals are susceptible to rabies, only member of the canid, viverrid (skunks and raccoons) and chiropteran (bats) species are considered as the most efficient vectors of the disease. Dogs are the main source of human infection however the epidemiology of rabies virus varies according to the geographical areas of the world. The susceptibility to rabies shows considerable variation among species. All mammals are susceptible to rabies infection though differences in susceptibility exist between species. Cattle, cats and foxes are highly susceptible, whereas skunks, opossums and fowl are relatively resistant. Human and dogs occupy an intermediate position. The rabies in pet dogs and cats are controlled by vaccinating them with a potent and efficacious anti-rabies vaccines whereas stray dogs, feral dogs, stray cats, feral cats and other wild animals are left unvaccinated. These animals constitute a reservoir of rabies often transmit the disease to domestic animals and human beings. Recently development has been made in the area of vaccine development against rabies for use in animals and systematic and judicious use of the same will definitely reduce the incidences of rabies which in turn lead to control of the rabies to a great extent (Nandi, 2008 : Tang et al., 2005). Etiology: Rabies is caused by a number of different strains of the large, bullet shaped with one end rounded or conical and other planar or concave, single stranded negative sense RNA viruses of the genus Lyssavirus, family Rhabdoviridae. The rabies virus measures approximately 180X75 nm. The RNA genome encodes 5 proteins: the glycoprotein G is the primary structural component of the surface spikes embedded in the

184

viral envelope and is associated with the smaller M protein. Enclosed by the host cell derived envelope is an infectious viral core of nucleocapsid (N) proteins, thus encapsidating the viral genome and the RNA polymerases. The NS protein is associated with the nucleocapsid (Murphy et al., 1999 : Bourhy et al., 1993). Control : Each year more than 55,000 people are reported to die from rabies and the WHO estimates that 10-12 million receive post-exposure treatment. More than 90% of all human cases of rabies are believed to be associated with dog and rest with other domestic animals. The control of rabies largely depends on the prevention of infection of dogs and cats by vaccination in endemic areas and the control of their movement, including measures of quarantine and vaccination in rabies free countries. Eradication programmes also require the adoption of appropriate strategies for eliminating or reducing infection in wildlife reservoirs of the virus. In many parts of the world, where the main source of human infection is dogs, mass vaccination and reduction of the number of stray dogs remain the most effective means of control. In Europe, control of rabies largely aims to eliminate infection in foxes by vaccination. In south America mass vaccination of cattle, together with measures to reduce the number of vampire bats is often required to reduce the incidence of vampire bat rabies ( Slater, 2001 ; Kihm et al., 1992 ; Slate et al., 2009). Vaccination: Vaccination is the most effective and economical way to control a disease. It is to be considered about the main sources of infection and the main reservoirs of infection for man. The main threat to humans and to domestic animals is classical rabies virus. The conventional vaccines currently used for the vaccination of humans and domestic and free living animals are derived from fixed type virus of genotype 1 and serotype 1 (Haupt, 1999). Mass vaccination of dogs remains the main strategy for controlling urban rabies in endemic areas. In order to avoid maternally derived immunity, vaccines are better given when the animal is young but not less than 3 months of age in dogs. Primary vaccination can be a single injection (live attenuated vaccines) or two inoculations 1 month apart. After that vaccines are given annually, biannually or triennially to boost their immunity depending on the efficacy of the vaccine (Coleman and Dye, 1996; Cleveland et al., 2006; Nandi and Maiti, 1995). The WHO Expert committee of Rabies advises that vaccines prepared from cell cultures should replace the nervous tissue vaccines as soon as possible. BHK 21 are the most commonly used continuous cell lines for the production of vaccines for animals. Antirabies vaccines for animals : First generation animal vaccine : In 1885, Louis Pasteur demonstrated that the virus could be attenuated by serial passage in rabbits intracranially. On 6th July, 1885, the first human was treated by giving 13 consecutive and increasingly virulent doses of a dessicated spinal cord suspension from a rabid animal. The boy Joseph Meister was survived. Pasteurs crude vaccine was later modified by Fermi and Semple. In 1927, the First International Conference recommended that fixed virus for canine vaccines be completely inactivated or attenuated so that they cause no disease in dogs vaccinated either S/C or I/M. For the next several decades, all nervous tissue vaccines were inactivated by phenol described by Semple. The nervous tissue vaccines currently in use for mass vaccination campaign in Africa, Latin America and Caribbean are produced from virus infected suckling mouse brains or lamb brains. However, nervous tissue vaccines for dogs and other animals often caused post vaccinal nervous symptoms and death in some vaccinated animals (Rupprecht and Gibbon, 2004). Embryonated chicken eggs were used by Koprowski and Cox for serial passage of the Flury strain. The virus was initially passaged 136 times in 1 day old chicks followed by passage in embryonated chicken egg. At 40th to 50th chicken embryo passage lost its viscerotropic properties but retained some neurotropic properties and named LEP. It could be safely used in dogs but occasionally caused rabies in

185

young pups, cats and cattle. The LEP was further passaged in embronated chicken eggs to increase the safety by Koprowski and associates and at 205th passage level it was safe for I/M use in cats, cattle as well as puppies 3 months of age (Sudarshan et al., 2005). Parenteral modified live virus vaccine : The Flury and Kelev strains of rabies virus are used to produce chick embryo origin modified live virus (MLV) vaccines. Street Alabama Dufferin (SAD) adapted in hamster kidney cells and Evelyn Rokitnicki Abelseth (ERA) strains grown on porcine kidney cells were used to produce tissue culture based modified live vaccine for parenteral use in animals against rabies. These vaccines are used in carnivores including dogs and cats in Asia, Africa and parts of Europe. Oral modified live vaccine : Modified live vaccines are not recommended for parenteral immunization against in animals as infection can occur as a result of vaccine strain. Several types of MLV with various levels of attenuation have been developed for oral immunization of wildlife. SAD B19 and SAD P5/88 vaccines are produced by several cell culture passage of the SAD Berne strain, which is a cell culture adapted derivative of ERA strain. The SAG ( Street Alabama Gif) 2 vaccine was selected from the SAD Berne strain. No adverse effects following the oral administration of 10 times the field dose of SAG2 were reported in target species (red fox, dog, raccoon dog and arctic fox) or in non-target species including baboons, different rodent species, two species of corvids, wild boars, badgers, goats, ferrets, hedgehogs and diurnal and nocturnal birds. Red foxes, raccoon dogs and dogs were protected from virulent challenge after immunization with one single SAG 2 bait. No salivary excretion of infective SAG2 virus strain was detected dogs after vaccination. In bait, SAG2 is either contained in a capsule as a viral suspension or in the bait matrix as freeze dried suspension (Slate et al., 2009 ; Cathy and Patricia, 1999). Oral live vaccinia virus glycoprotein recombinant vectored vaccine : A recombinant vaccinia virus expressing the virus G glycoprotein gene (V-RG) has been developed by inserting the cDNA of the glycoprotein gene of the ERA strain into the thymidine kinase gene of the Copenhagen strain of vaccinia virus. The vaccine fulfilled all the criteria such as readily accepted by target species but rabies virus free, thermostable and genetically stable and provides protection against rabies but no risks of developing rabies if ingested and safe for contact with humans. The vaccine was used in USA and France to immunize raccoons, coyotes, wild dogs, fox, jackals etc. The vaccine is produced only by Merial Inc, Athens, GA, USA as Raboral V-RGTM. The vaccine can be given in fish meal or poultry based bait which contains 150 mg of Tetracycline HCl as a bone biomarker and a plastic sachet container 1.8 ml of vaccine. The vaccine has been found highly effective in wildlife containment or near elimination of wildlife rabies in USA and France (Broncher, 1989 ; Estrada et al., 2001). Parenteral live vaccinia virus glycoprotein recombinant vectored vaccine : A canary pox rabies glycoprotein recombinant vaccine has been developed and found to be effective as other poxvirus rabies glycoprotein recombinants. Live canarypox virus that expresses the rabies virus glycoprotein has been licensed in the USA as a parenteral monovalent vaccine for cats and as a combination rabies vaccines for cats with feline panleukopenia virus, feline parvovirus, feline calicivirus vaccines included in the product. A recombinant adenovirus vectored vaccine expressing rabies virus glycoprotein was shown to be capable of inducing antibody response in greyhound dogs immunized either S/C or I/M. This vaccine holds promise as a virus vaccine for dogs. When administered orally by direct instillation into the oral cavity or in a bait a dose of 108 TCID50 of VRG elicits titres of virus neutralizing antibodies and confers protective immune response against rabies virus challenge in a number of carnivorous or omnivorous mammalian species ( red fox, arctic fox, coyote, raccoon, raccoon dog, domestic dog and golden jackals). In the field, VRG vaccine strain is stable above 56oC and melting point of bait case is > 60oC. Safety studies conducted in over 50 mammalian and

186

10 avian species ( most of them are rabies vectors) have not revealed any residual pathogenicity. More than 75 million doses of VRG have been used to successfully control or reduce wildlife or canine in a variety of animal species such as red foxes ( Belgium, France, Israel, Luxemburg and Ukraine), raccoon dogs ( Republic of Korea), coyotes, raccoons and grey foxes ( Canada and USA) and domestic dogs ( Sri Lanka) ( WHO, 1997 ; Li et al., 2006; Hu et al., 2007 ; Tordo et al., 2008) Parenteral inactivated cell culture vaccine : In inactivated vaccines, rabies virus strain (CVS, PM or PV) is grown in rabbit brain, suckling mouse brain, guinea pig brain, chicken embryo fibroblast, BHK-21 or Vero cells. Neonatal mice lack the myelin that causes allergic reactions occasionally in animals vaccinated earlier with suckling mouse brain nervous tissue origin killed vaccines. On the other hand, tissue culture based rabies vaccines are less allergenic but more immunogenic. Although a number of inactivating agents namely phenol, HCHO, UV light, AEI or other amines can be used, BPL is most commonly used. After inactivation, adjuvants namely Al(OH)3, AlPO4, saponin (cattle vaccines) and rarely oil adjuvants are used to improve the immunogenicity of the vaccine. The vaccine is available along with canine distemper, canine adenovirus I, Leptospira and parvovirus in canines and feline parvovirus, feline panleukopenia virus and feline calicivirus for use in cats or FMD for use in cattle, sheep and goat (Wilde and Hemachuda, 2006 ; WHO, 1997). Immunization in animals : Prophylactic anti-rabies vaccination of dogs is one of the most effective measure to control the disease as 80-90% dogs are accessible. The immunization of at least 80% dogs with antirabies vaccines maintain the herd immunity sufficient to break the disease chain. All dogs should be given at regular intervals. BPL inactivated nervous tissue vaccine (20%) is effective in mass vaccination against rabies in dogs and cats. The dose is 5 ml for dogs and 3 ml for cats. Revaccination is advised after 6 months and subsequently every 3 years. Now-a-days cell culture based rabies vaccines are available as combined vaccines for use in canines and felines along with other virus and bacterial diseases. An animal can be considered to be protected against rabies 28 days after the primary rabies vaccination which is consistent with a peak antibody response (Cleaveland et al., 2006). Post vaccination complications : Due to higher antigenic mass and use of adjuvants inactivated vaccines produce local and systemic reactions. The most common are soreness, lameness, regional lymphadenopathy in the injected limb, focal vasculitis, granulomas and sarcoma. However, the new generation vectored recombinant vaccines produce few allergic or neoplastic reactions. Potency requirement for animal vaccines : Inactivated anti-rabies vaccines for animals should have a potency of 1.0 I.U./dose as measured by NIH test or other recognized Pharmacopoeia test. The duration of immunity should be at least 1 year. Conclusion : Rabies is continually evolving throughout the world. Significant advances have been made by the multi-disciplinary sectors of immunology, vaccinology, molecular virology and epidemiology thus allowing a far greater understanding of rabies virus circulation. Rabies is a disease for which all the necessary remedies exist unlike the situation with many other diseases. It is possible to prevent, control and treat rabies with anti-rabies vaccines or anti-rabies globulins. In India, like other developing countries, the disease is still endemic and lot of outbreaks are reported from all parts of the country throughout the year. The rabies in animals particularly dogs is a real problem in India and lot of efforts have been attempted to control the disease. A number of cases are still reported with a certain percentage of casualties. The main constraints to success are involvement of a large number of animal species, no legislative control on animal movement, prohibitive costs of the new generation vaccines and inaccessibility of all the animals

187

under immunization umbrella. However, the incidence of the dog rabies can be largely controlled by compulsory vaccination with a potent and efficacious vaccine which in turn lead to diminution of human exposure to rabies virus. The control programme against rabies should be properly planned, executed and implemented to bring the susceptible animals under the immunization umbrella in order to reduce the incidence of the disease to a great extent (Wilde et al., 2005). References : Bourhy, H., Kissi, B. and Tordo, N. (1993). Molecular diversity of the lyssavirus genus. Virol. 194: 70-81. Broncher, (1989). Use of recombinant vaccinia-rabies virus glycoprotein for oral vaccination of wild life against rabies , innocuity to several non target consumer species. J. of Wildlife Dis. 25: 540-547. Cathy, A.O. and Patricia, A.W. (1999). Oral rabies vaccine contact by raccoons and nontarget species in a field trial in florida. J. Wildlife Dis. 35(4): 687695. Cleaveland, S., Kaare, M., Knobel, D. and Laurenson, M.K. (2006). Canine vaccination Providing broader benefits for disease control. Vet. Microbiol. 117(1): 43-50. Coleman, P.G. and Dye, C. (1996). Immunization coverage required to prevent outbreaks of dog rabies. Vaccine. 14(3): 185-186. Slate, Dennis., Timothy, P. A., Kathleen, M. N., Richard, B. C., Dennis, D., Jesse, D. B., Michael, N. and Rupprecht, C. E. (2009). Oral Rabies Vaccination in North America: Opportunities, Complexities, and Challenges. PLos Neglected Tropical Diseases. 3:12: 549. Estrada, R., Vos, A., Leon, R.D. and Mueller, T. (2001). Field trial with oral vaccination of dogs against rabies in the Philippines. BMC Infect Dis. 1: 23. Haupt, W. (1999). Rabiesrisk of exposure and current trends in prevention of human cases. Vaccine. 17(13-14): 1742-1749. Hu, R.L., Liu, Y., Zhang, S.F., Zhang, F., Fooks, A.R. (2007). Experimental immunization of cats with a recombinant rabies-canine adenovirus vaccine elicits a long-lasting neutralizing antibody response against rabies. Vaccine. 25: 53015307. Kihm, U., Flamand, A., Pastoret, P.P. and Peterhans, E. (1992). Round table on epidemiology and control of fox rabies. Vet. Microbiol. 33(1-4): 297-301. Knobel, D.L., Cleaveland, S., Coleman, P.G., Fevre, E.M., Meltzer, M.I., Miranda, M.E., Shaw, A., Zinsstag, J. and Meslin, F.X. (2005). Reevaluating the burden of rabies in Africa and Asia. Bull. W. H. O. 83: 360-368. Li, J., Faber, M., Papaneri, A., Faber, M.L., McGettigan, J.P.(2006) A single immunization with a recombinant canine adenovirus expressing the rabies virus G protein confers protective immunity against rabies in mice. Virology. 356: 147154. Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C. and Studdert, M.J. (1999). Veterinary Virology Third Ed, 1999; Academic Press, New York. Nagarajan, T., Mohansubramanian, B., Sehagiri, E.V., Nagendrakumar, S.B., Saseendranath, M.R. and Srinivasan, V.A. (2006). Molecular epidemiology of Rabies virus isolates in India. J. Clin. Microbiol. 44: 3218-3224. Nandi, S. (2008). Molecular basis of rabies virus virulence with special reference to wildlife. Global meet on Veterinary Public Health and Symposium on New Horizons in Food Security with special reference to Veterinary Public Health and Hygiene Evolving Strategies with Global Perspectives and 8th Convention of APHV held at, Lucknow from November 19-21, pp 196-204. Nandi, S. and Maiti, S.K. (1995). When should your pets get vaccination against rabies. Asian Livestock (FAO). 20(4): 46-48. Nandi, S. and Yadav, J.S. (2011). Control of rabies in India. Indian Farming. (Accepted). Pastoret, P.P. and Brochier, B. (1999). Epidemiology and control of fox rabies in Europe. Vac., 17(13-14): 1750-1754. Rupprecht, C.E. and Gibbons, R.V. (2004). Prophylaxis against Rabies. N. Engl. J. Med., 351(25): 2626 2635.

188

Singh, C.K. and Sandhu, B.S. (2007). Epidemiological investigation of rabies in Punjab. Indian J. Anim. Sci., 77: 653-658. Slater, M.R. (2001). The role of veterinary epidemiology in the study of free-roaming dogs and cats. Prev. Vet. Med., 48(4): 273-286. Sudarshan, M.K. (2004). Assessing burden of rabies in India. WHO sponsored national multi-centric rabies survey. Assoc. Prev. Control Rabies India J., 6: 44-45. Sudarshan, M.K., Madhusudana, S.N., Mahendra, B.J., Narayana, D.H.A., Giri, M.S.A., Popova, O. and Vakil, H.B. (2005). Evaluation of a new five-injection, two-site, intradermal schedule for purified chick embryo cell rabies vaccine: A randomized, open-label, active-controlled trial in healthy adult volunteers in India. Cur. Therap. Res. Clin. Exper. 66(4): 323-334. Tang, X., Luo, M., Zhang, S., Fooks, A.R., Hu, R. and Tu, C. (2005). Pivotal role of dogs in rabies transmission, China. Emerg. Infect. Dis. 11(12): 1970-1972. Tordo, N., Foumier, A., Jallet, C., Szelechowski, M. and Klonjkowski, B. (2008). Canine adenovirus based rabies vaccines. Dev. Biol. 131: 467476. W.H.O. (1997). (WHO recommendations on rabies post-exposure treatment and the correct technique of intradermal immunization against rabies. Geneva. World Health Organization, 1997. Wilde, H. and Hemachudha, T. (2006). How far can the antigen content of tissue culture rabies vaccine be reduced safely? Vaccine. 24(10): 1489. Wilde, H., Khawplod, P., Khamoltham, T., Hemachudha, T., Tepsumethanon, V., Lumlerdacha, B., Mitmoonpitak, C. and Sitprija, V. (2005). Rabies control in South and Southeast Asia. Vaccine. 23(17-18): 2284-2289.

189

L P 2: V

Emerging and Reemerging Viral diseases of Canines

P.N.Dwivedi, Gurpreet Kaur and Ramneek1 Department of Veterinary Microbiology, GADVASU, Ludhiana 1 School of Animal Biotechnology

Introduction: Dog has been one of the best companion of man since time immemorial. It has been domesticated for roughly 12,000 years. Pet dogs shared human lives for the centuries and their beneficial effects have been known for at least 200 years. Close contact with dog is a part of everyday life for large number of people in the world. Dogs are used in therapy as a predictor for human epilepsy. Many of the infectious canine diseases of viral origin are still significant in the current scenario as for as their impact on pet health and economics are concerned Canine Distemper : This is the disease of canines caused by the virus belonging to family Paramyxoviridae. The virus is very fragile ad can be easily inactivated by light, heat and most disinfectants. The disease is more common in pups between 4-5 months of age particularly when the maternal antibodies are no more available. It has a seasonal occurrence in autumn and winter, due to the factor that the virus is able to survive in cold weather. The virus gets transmitted from infectd to a healthy host via respiratory tract due to aerosols (airborne ) exposure or through oral route and ocular mucous membrane. The virus causing distemper attacks the following body systems; Central Nervous system Respiratory system Gastrointestinal system Skin During the incubation period of 3-10 days, the virus replicates and travels via the lymphatic system to the lymph nodes, spleen, thymus and bone marrow. During the presence of the virus in the lymph nodes the body temperature rises to 39 and 40 C for 2-4 days. About half of the all puppies infected are capable of mounting an adequate immune response and produce antibodies to clear the virus from the body. If the virus persists in the body it replicates in the epithelium, other visceral organs and central nervous system. This leads to secondary bacterial infections. The main symptoms observed during the infections are; Lack of appetite Nasal and ocular discharge Coughing Diarrhea and vomiting Hardening of the foot pads Inco ordination Paralysis and epileptic type fits If the puppy survives the respiratory or gastrointestinal stage of the disease, the neurological signs develop four weeks later. Older dogs shows only neurological signs (old dog encephalitis). This stage is usually fatal. Vaccination gives good protection but it is not lifelong immunity so boosters vaccinations are essential. Infectious canine hepatitis : Caused by the canine adenovirus type 1 (CAV 1). Transmission is through oral and nasal passage after exposure to infected materials. The virus is resistant and survives outside the body for upto 11 days in bedding, feeding bowls, urine and feces. The virus can resist freezing, ultraviolet light and most disinfectants but is destroyed by heat. Immediately after the exposure the virus localizes in the tonsils and lymph nodes and the primary replication of the virus occurs at these sites. Then the virus travels through lymph

190

and reaches to the blood stream. It has special affinity to the cells of liver and kidneys where the further replication of the virus occurs.. After that the live virus particles are shed in the urine and feces. The incubation period of the disease is 5-9 days. The recovered animals can shed the virus in their urine and feces for months together. The important clinical signs of the disease is as under; High temperature Death occurs within hours In older dogs blood stained diarrhea and vomition Severe abdominal pain In some dogs blue eye; a clouding of the cornea of the eye occurs up to three weeks after acute infection. For prevention, the vaccination and annual boosters are essential. Canine Parvovirus : Canine parvovirus is closely related to the feline panleucopenia virus. The virus is very resistant to inactivation by most disinfectants except bleach and formalin based chemicals and can survive for months in the environment. The virus mainly affects the lymphatic tissue and the lining of the intestinal epithelium. It is heavily excreted in feces and vomit of infected pups and causes myocarditis and mild to severe haemorrhagic enteritis. The route of infection is by fecal or oral route. Damage to the bone marrow results in the lack of WBC and the infection spreads from lymph cells in the gut tissues. The incubation period is 5-10 days. Young pups are more susceptible. The clinical signs include Dullness and depression Anorexia High fever Vomiting blood stained gastric juice Blood stained diarrhea 24 hours later Rapid dehydration For prevention of the disease annual vaccination is needed. Kennel cough syndrome This syndrome is a complex disease linked to a number of viruses which includes Canine adenovirus type 2 (CAV 2), Canine para influenza virus (CPIV) and Canine distemper virus (CDV). The CAV 2 and CPIV are quite common pathogens and are highly contagious. They affect the respiratory tract of the dogs of all ages. They cause nasal and tracheal inflammation which lasts for 5-14 days and then normally resolve. The virus is heavily shed in all the respiratory secretion and excretions. The clinical signs include Cough Sneezing and nasal discharge Depression Transmission of the virus from dog to dog can be minimized by isolation of the affected dog and by improving the kennel ventilation and disinfection. Rabies Rabies is caused by rhabdovirus. It is a bullet shaped virus and is very fragile surviving only for the short time in the environment and is destroyed by most of the disinfectants, heat and light. Transmission of the virus occurs through the saliva of the infected animal. The virus replicate in the muscle cell at the site of the entry then travels via peripheral nerves to the spinal cord and then to the brain. Once it is located in the central nervous tissues, neurological signs are observed. The virus also then travels to the salivary gland, where it is shed to infect other animals and human. Incubation period is 10 days to four months but it depends upon the site of the bite, that how near it is from the central nervous system. There are three phases or stages to the disease symptoms. However, not all will necessarily occur in all affected animal.

191

1. Preclinical stage:

Lasting 2-3 days with a raised body temperature, show eye reflexes and signs of irritation at the site of the original injury/bite. 2. Excitable stage: Lasting up to one week with the animal becoming irritable, aggressive and Disorientated, having difficulty standing and epileptic type fits. 3. Dumb stage Lasting 2-4 days during which the animal becomes progressively Paralysed due to paralysis of pharyngeal nerve. The throat and skeletal Muscles are paralysed leading to excessive salivation, respiratory distress Coma and death. In some cases preclinical stage lasts for several months during which the virus is shed in the saliva. <dwivedi_micro@yahoo.co.in>

192

LP3:V

Immunization strategies for rabies control in global perspective

S.K.Kashyap Dept of Veterinary Microbiology and Biotechnology, College of Veterinary and Animal Science, RAJUVAS, Bikaner

Rabies is a fatal zoonotic viral disease, transmitted to humans through bites and scratches with infected domestic or wild animals and is present in all continents with endemicity in most African and Asian countries,. The disease occurs in more than 100 countries spread in different continents. In industrialised countries including the United Kingdom, Ireland, Sweden, Norway, Iceland, Japan, Australia, New Zealand, Singapore, most of Malaysia, Papua New Guinea, the Pacific Islands and some islands in Indonesia have been free of the classical rabies and in urban areas of developing countries either the disease has been eliminated or the number of cases has reduced to very low levels thanks to the mass vaccination of pet and stray dogs and other measure of control such as education, spreading awareness among the population at risk and emphasis on post exposure vaccination.(1) All mammals are susceptible to rabies. There are many strains of the rabies virus; each strain is maintained in particular reservoir host. Important maintenance hosts include members of the Canidae (dogs, jackals, coyotes, wolves, foxes and raccoon dogs), Mustelidae (skunks, martens, weasels and stoats), Viverridae (mongooses and meerkats), and Procyonidae (raccoons), and the order Chiroptera (bats). Cat-adapted rabies variants have not been seen, although cats are often infected with rabies viruses from other hosts, and they can readily transmit the virus. The important reservoir hosts vary with the area. Virus Properties and replication Rabies virus belongs to the order Mononegavirales, viruses with a nonsegmented, negative-stranded RNA genomes. Within this group, viruses with a distinct bullet shape are classified in the Rhabdoviridae family, which includes at least three genera of animal viruses, Lyssavirus, Ephemerovirus, and Vesiculovirus. The genus Lyssavirus includes rabies virus, Lagos bat, Mokola virus, Duvenhage virus, European bat virus 1 & 2 and Australian bat virus. Rabies virions are bullet-shaped with 10-nm spike-like glycoprotein peplomers covering the surface. Rhabdoviruses are approximately 180 nm long and 75 nm wide. The rabies genome encodes five proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and polymerase (L). All rhabdoviruses are have two major structural components: a helical ribonucleoprotein core (RNP) and a surrounding envelope. In the RNP, genomic RNA is tightly encased by the nucleoprotein. Two other viral proteins, the phospoprotein and the large protein (L-protein or polymerase) are associated with the RNP. The glycoprotein forms approximately 400 trimeric spikes which are tightly arranged on the surface of the virus. The M protein is associated both with the envelope and the RNP and may be the central protein of rhabdovirus assembly. The rabies virus genome is single-stranded, antisense, nonsegmented, RNA of approximately 12 kb. There is a leader-sequence of approximately 50 nucleotides, followed by N, P, M, G, and L genes. (2) The fusion of the rabies virus envelope to the host cell membrane (adsorption) initiates the infection process. The interaction of the G protein and specific cell surface receptors may be involved. After adsorption, the virus penetrates the host cell and enters the cytoplasm by pinocytosis (via clathrin-coated pits). The virions aggregate in the large endosomes (cytoplasmic vesicles). The viral membranes fuse to the endosomal membranes, causing the release of viral RNP into the cytoplasm (uncoating). Because lyssaviruses have a linear single-negative-stranded ribonucleic acid (RNA) genome, messenger RNAs (mRNAs) must be transcribed to permit virus replication. A viral-encoded polymerase (L gene) transcribes the genomic strand of rabies RNA into leader RNA and five capped and polyadenylated mRNAs, which are translated into proteins. Translation, which involves the synthesis of the N, P, M, G and L proteins, occurs on free ribosomes in the cytoplasm. Although G protein synthesis is initiated on free ribosomes, completion of synthesis and glycosylation (processing of the glycoprotein), occurs in the endoplasmic reticulum

193

(ER) and Golgi apparatus. The intracellular ratio of leader RNA to N protein regulates the switch from transcription to replication. When this switch is activated, replication of the viral genome begins. The first step in viral replication is synthesis of full-length copies (positive strands) of the viral genome. When the switch to replication occurs, RNA transcription becomes non-stop and stop codons are ignored. The viral polymerase enters a single site on the 3 end of the genome, and proceeds to synthesize full-length copies of the genome. These positive strands of rabies RNA serve as templates for synthesis of full-length negative strands of the viral genome. During the assembly process, the N-P-L complex encapsulates negative-stranded genomic RNA to form the RNP core, and the M protein forms a capsule, or matrix, around the RNP. The RNP-M complex migrates to an area of the plasma membrane containing glycoprotein inserts, and the M-protein initiates coiling. The M-RNP complex binds with the glycoprotein, and the completed virus buds from the plasma membrane. Within the central nervous system (CNS), there is preferential viral budding from plasma membranes. Conversely, virus in the salivary glands buds primarily from the cell membrane into the acinar lumen. Viral budding into the salivary gland and virus-induced aggressive biting-behaviour in the host animal maximize chances of viral infection of a new host. (3) Rabies vaccines for human Cell-culture and embryonated egg-based vaccines These vaccines consist of rabies virus that has been propagated in cell substrates such as human diploid cells (embryonic fibroblast cells), foetal rhesus diploid cells, Vero cells (kidney cells from the African green monkey), primary Syrian hamster kidney cells, primary chick embryo cells or in embryonated duck eggs. The more recently developed vaccines based on chick embryo cells and Vero cells have safety and efficacy records comparable to those of the human diploid cell vaccines and are less expensive. Following growth in the respective cell cultures (or embryonic egg), the viral harvest is concentrated, purified, inactivated and lyophilized. Some of the vaccines use human albumin or processed gelatine as a stabilizer. No rabies vaccines are supplied in multidose vials for intramuscular injection. Rabies vaccines prequalified by WHO do not contain preservatives such as thimerosal. The shelf-life of these vaccines is =3 years, provided they are stored at +2C to +8C and protected from sunlight. Following reconstitution with the accompanying sterile diluent, the vaccines should be used immediately, or within 68 hours if kept at the correct temperature. All such vaccines should comply with the WHO recommended potency of =2.5 IU per single intramuscular dose (0.5 ml or 1.0 ml volume after reconstitution, depending upon the type of vaccine. Intramuscular and intradermal administration The cost of cell culture vaccines for intramuscular administration limits their widespread use in many areas where canine rabies is prevalent. Intradermal administration offers an equally safe and immunogenic alternative that requires only 12 vials of vaccine to complete a full course of postexposure prophylaxis, thereby reducing the volume used and the direct cost of vaccine by 6080% compared with standard intramuscular vaccination. There is no evidence that intradermal administration requires vaccines with potency higher than that recommended for intramuscularly-administered rabies vaccines. (4) Post exposure vaccines in human: Post-exposure prophylaxis depends on the type of contact with the suspected rabid animal. As per WHO guidelines, the levels of exposure include ; category I touching or feeding animals, licks on intact skin (that is, no exposure); category II nibbling of uncovered skin, minor scratches or abrasions without bleeding; and category III single or multiple transdermal bites or scratches, contamination of mucous membrane with saliva from licks, licks on broken skin, exposures to bats. For category I exposures, no prophylaxis is required; for category II, immediate vaccination is recommended; and for category III, immediate vaccination and administration of rabies immunoglobulin are recommended. For categories II and III, thorough washing and flushing (for about 15 minutes, if possible) with soap or detergent and copious

194

amounts of water of all bite wounds and scratches should be done immediately, or as early as possible. Where available, an iodine-containing, or similarly viricidal, topical preparation should be applied to the wound. Pre exposure vaccination : Pre-exposure vaccination should be suggested to people at high risk of exposure such as those working in rabies diagnostic or research laboratories, veterinarians, animal handlers (including bat handlers), animal rehabilitators and wildlife officers, as well as other people (especially children) living in or travelling to high-risk areas. Veterinarians who are actively engaged in handling of clinical cases and all people who work with live rabies virus in a diagnostic or research laboratory or in vaccine production may be required to have periodic antibody determinations possibly at 6 months intervals to avoid unnecessary boosters. Vaccines produced in cell culture or from embryonated eggs should be used for pre-exposure vaccination of humans. Pre-exposure vaccination is administered as one full dose of vaccine intramuscularly or 0.1 ml intradermally on days 0, 7 and either day 21 or 28. A few days variation is acceptable. Vaccine is administered into the upper arm (deltoid region) of adults and into the anterolateral thigh region of young children. Vaccine should never be administered into the gluteal region as absorption is unpredictable. Rabies vaccines having a potency of at least 2.5 IU per single intramuscular dose will induce longlasting memory cells causing an accelerated immune response when a booster dose of vaccine is administered. People currently receiving malaria prophylaxis or who are unable to complete the entire threedose pre-exposure series prior to initiation of malarial prophylaxis should receive pre-exposure vaccination by the intramuscular route. If the immune status of a patient is questionable at the time of vaccination, his or her immune response to the vaccine should be assessed after the three-dose preexposure series has been administered. Periodic booster injections are recommended for people who are at continual risk of rabies exposure. (5) Animal vaccine types Cell-culture vaccines Inactivated vaccines can be produced in cell culture, using either primary cells or continuous cell lines. The seed virus/cell systems vary considerably between different manufacturers. Improvements in vaccine production techniques during the last decade have led to an increased use of inactivated adjuvanted vaccines for animal immunization. The duration of immunity and safety are especially important when a vaccine is being selected for use in a mass vaccination campaign. Use of vaccines that will provide stable and long-lasting immunity is recommended, because this constitutes the most effective method of controlling and eliminating the disease in animals. Regardless of the vaccine used, it must be administered properly to provide the desired protection. Nerve-tissue vaccines Inactivated nerve-tissue vaccines can be produced from the brains of lambs or suckling mice. Such vaccines have been shown to be effective in mass canine immunization programmes in North Africa (lamb brain vaccines) as well as in Latin America and the Caribbean (suckling-mouse brain vaccines). In the future, because of the availability of safe and inexpensive locally produced cell-culture vaccines, replacement of all nerve-tissue rabies vaccines with cell-culture vaccines can be expected. Combined vaccines Use of combined vaccines will certainly lead to a wider range of immunoprophylactic strategies against different microbial pathogens, and has already simplified the vaccination schedule. No indication of competitive inhibition of the immune response has been reported for combined vaccines, but each new product should be investigated for its overall immunogenic potency. Attention should be paid to all vaccine components, including rabies antigen. Combined rabies

195

vaccines are already used for the immunization of dogs and cats. Several different antigens have been incorporated into canine rabies vaccines, such as canine distemper virus, canine adenovirus type 1, Leptospira and canine parvovirus. Combined vaccines currently available for cats include various antigens such as feline panleukopenia virus, feline calicivirus and feline parvoviruses. A combined rabies and footand-mouth disease vaccine is available for use in cattle, sheep and goats. Oral animal vaccines Modified live-virus vaccines Several types of modified live-virus vaccines with various levels of attenuation have been developed for oral immunization of wildlife. SAD B19 and SAD P5/88 vaccines are produced by several cellculture passages of the SAD Berne strain, which is a cell culture-adapted derivative of the ERA strain. The SAG (Street Alabama Gif) 2 vaccine was selected from the SAD Berne strain after two successive mutations of the arginine 333 codon using selected monoclonal antibodies. During a recent trial conducted in India on caged street dogs, no adverse effects were observed in any dog, even those immunosuppressed, that received freeze-dried SAG2 in administered baits. In efficacy studies, red foxes (adult and cubs), raccoon dogs and dogs were protected from virulent challenge after immunization with one single SAG2 bait. No salivary excretion of infective SAG2 virus strain was detected in dogs after vaccination. In bait, SAG2 is either contained in a capsule as a viral suspension or incorporated in the bait matrix as a freezedried suspension, for use in countries with canine rabies. (6) Live recombinant vaccines A recombinant vaccinia virus expressing the glycoprotein gene of rabies virus (VRG) was developed by inserting the cDNA of the glycoprotein of ERA strain into the thymidine kinase gene of vaccinia virus (Copenhagen strain). When administered orally (by direct instillation into the oral cavity or in a bait), a dose of 108 TCID50 (median tissue-culture infective dose) of VRG elicits titres of virus neutralizing antibodies and confers a protective immune response against rabies virus challenge in a number of carnivorous or omnivorous mammalian species (red fox, arctic fox, coyote, raccoon, raccoon dog, domestic dog and golden jackal). In the field, the VRG vaccine strain is stable above 56 C. The recombinant virus expressing VRG does not exhibit residual pathogenicity caused by rabies, however it shares basic properties with its parental virus, the human smallpox vaccine strain vaccinia Copenhagen. As shown in the severely compromised immune deficient mouse model, insertion of the rabies glycoprotein gene into the thymidine kinase locus attenuates the recombinant compared with the parental strain. More than 75 million doses of VRG have been used to successfully control or reduce wildlife or canine rabies in a variety of animal species such as red foxes (Belgium, France, Israel, Luxemburg and Ukraine), raccoon dogs (Republic of Korea), coyotes, raccoons and grey foxes (Canada and USA) and domestic dogs. Rabies can be prevented in domesticated animals by vaccination and by the avoidance of contact with rabid wild animals. Rabies vaccines are available for dogs, cats, ferrets, cattle, sheep and horses. Both inactivated and modified live vaccines are effective, but rare cases of post-vaccinal rabies have been reported with the modified live vaccines in dogs and cats. Vaccines have not been validated in rabbits or rodents, although they might be used extra label in petting zoos or other facilities where animals are in contact with many people. Wild animals can be immunized with oral vaccines distributed in bait. In countries with large stray dog populations, similar vaccines may be useful. Conventional rabies vaccines do not seem to protect animals against rabies-related viruses in phylogroup II (Mokola virus and Lagos bat virus); these viruses have caused fatal disease in vaccinated animals. Some cross-protection seems to exist with rabies-related viruses in phylogroup I. (7) Preventing animals from roaming will reduce the risk of exposure to rabid wild animals. To protect pet rabbits and rodents, they should be housed indoors, and watched closely if they are allowed outside to exercise. Rabbits kept outside should be kept in an elevated, double-walled hutch that does not have exposed wire mesh floors. As much as possible, domesticated animals should be kept from contact with

196

wildlife, especially those that behave unusually. Bats caught by cats should be submitted for rabies testing. To prevent the transmission of rabies to humans or other animals (as well as to prevent unnecessary prophylaxis in people who have been exposed), unvaccinated animals that have been exposed should be euthanized and tested. Alternatively, they may be placed in strict isolation for 6 months, with vaccination of dogs, cats and ferrets either upon entry into isolation or 1 month before release. Livestock, rabbits and other animals are isolated but not necessarily vaccinated. Vaccinated animals are revaccinated and confined under observation for at least 45 days. Animals with expired vaccinations are evaluated on a case-bycase basis. Asymptomatic dogs, cats or ferrets that have bitten humans (with no history of exposure to rabies) are currently observed for 10 days; if the animal develops signs of rabies during this time, it is euthanized and tested for rabies. Countries free of the rabies virus may require a prolonged quarantine period before animals can be imported. Rabies control programme: Rabies control programme essentially needs to incorporate surveillance of the disease, mass vaccination of canine population, control of stray canine population and growing awareness about responsible ownership of pets. Rabies can only be reliably diagnosed by laboratory tests and it is strongly recommended that where diagnostic facilities are inadequate or lacking, laboratory capacity be developed to permit effective rabies surveillance. At least 70% of the dog population in each community should be vaccinated in areas where canine rabies is endemic. High vaccination coverage (70% or higher) can be attained through strategies consisting of well-designed educational campaigns, intersectoral cooperation, community participation, local commitment in planning and execution, availability of recognized quality vaccine, media support and effective general coordination and supervision of the activities by the health services. References: Rabies vaccines:WHO position paper: http://www.who.int/wer David M. Knipe, Peter M. Howley (Editor), Fields Virology: 2008 Frederick A. Murphy, E. Paul J. Gibbs, Marian C. Horzinek, Michael J. Studdert : Veterinary Virology: 2009 Intradermal application of rabies vaccines. Report of a WHO consultation, Bangkok, Thailand 5-6 June 2000. Geneva, World Health Organization, 2000 (WHO/CDS/CSR/APH/200.5; World Organization for Animal Health [OIE]. Manual of diagnostic tests and vaccines for terrestrial animals. OIE; 2008. Rabies. Rabies Vaccine: what you need to know: www.cdc.gov/ncidod/dvrd/rabies Manickama R, Basheer MD, Jayakumar R. Post-exposure prophylaxis (PEP) of rabies-infected Indian street dogs. Vaccine. 2008;26(51):6564-8.

197

LP 4 : V

Advances in Diagnosis of Diseases in India with Special Emphasis to Companion Animals

Nitin Bhatia and Abhishek Garg Intas Animal Health, 4th Floor, Premier House, Sarkhej Gandhinagar Road, Bodakdev, Ahmedabad- 380054, Gujarat , India

India is amongst the few countries worldwide with the fast growing animal husbandry sector and it is taking steps to achieve self-sufficiency in animal products. India ranks first in the world in production of milk, seventh in production of egg and eighth in export of meat. It is projected that by 2020 meat, egg and milk production will increase by 50%, 35% and 25% respectively. The companion animal population is also growing at enormous rate in India. The growth in animal husbandry is supported by the network of 27,562 Polyclinics / Hospitals / Dispensaries and 25,195 Veterinary Aid Centers (including Stockmen Centres and Mobile Dispensaries), supported by about 250 disease diagnostic laboratories. Vaccines against important livestock and poultry diseases are produced in the country at 26 veterinary vaccine production units. Besides the number of private clinics and vets involved in companion animal has grown significantly in number. In India, facilities are available to diagnose and control existing animal diseases. Apart from laboratories at the state and district levels, there are referral diagnostic facilities including national and regional laboratories with advanced technologies. In 1998, a containment laboratory of Bio-safety Level-4 (BSL-4) High Security Animal Disease Laboratory (HSADL) has been established with state-of-the-art facilities at Bhopal. This is one of the ten such containment laboratories in the world. It is safe for handling high risk (risk group-IV) and exotic animal pathogens. And, it has been authorized by the Government to diagnose and suggest suitable control measures for exotic and emerging animal diseases, which might gain entry into the country through international borders. The lab is well equipped for research and diagnosis of diseases using conventional and latest molecular biological techniques. The scientific manpower is well trained and adequate. In India, technology has been developed for diagnosis of exotic diseases using OIE recommended tests and latest molecular techniques like PCR, gene cloning and sequencing. Facilities are also available for monoclonal antibody production against various exotic animal pathogens. Presently projects are being undertaken for research and diagnosis of avian influenza, rabbit haemorrhagic disease, Bovine viral diarrhoea, Bovine immuno-deficiency, Aujeszky's disease, porcine reproductive and respiratory syndrome, transmissible gastroenteritis, African swine fever, malignant Catarrhal fever, caprine arthritis and encephalitis. In addition, the laboratory has developed recombinant antigen and mono clonal antibody based competitive ELISA kits for diagnosis of bovine viral diarrhoea and bovine immuno-deficiency. The later is the first diagnostic kit of its kind in the world. IVRI and many other laboratories in the country have developed world-class diagnostics/diagnostic kits against some important animal diseases like PPR (Monoclonal antibody based competitive ELISA kit, Monoclonal antibody based sandwich ELISA kit), Rinderpest (Monoclonal antibody based competitive ELISA kit), FMD (LPB ELISA kit, DIVA Kit, diagnostic reagents and vaccine quality assurance reagents), Bluetongue (recombinant BTV VP7 protein antigen-based indirect ELISA, whole viral antigen based indirect ELISA), Brucellosis (for sero-prevalence studies) and some other viral, bacterial and parasitic diseases. However, inspite these significant developments, not many techniques are available for a practicing Vet to suffice to his needs primarily because versatility of application of monitoring technologies in the veterinary industry is to develop fast, quantitative and low cost devices that can be used with minimal expertise. Most of the diagnostic technologies in use today require laboratory facilities, expensive equipments and trained personnel. During the last decade, a few technologies have been proposed and developed that fulfill most requirements of versatility mentioned above. One of the most promising approaches is the lateral flow immunoassay technique. Immunoassays are analytical measurement systems that use antibodies as test reagents. These

198

antibodies are attached to some kind of label and then used as reagents to detect the substance of interest. The label can either be an enzyme or coloured particles like colloidal gold, latex beads or carbon/silica nano-particles, and it is used for direct visualization of the reaction. The most commonly used labels are 20-40nm gold particles. These lateral flow assays are especially designed for use at point of care and the results are usually available within 10-20 minutes. Lateral flow assay principles.

The principle of the assay can be illustrated with a canine Parvovirus antigen assay as an example. The canine Parvovirus assay is an immunochromatographic assay as shown in the diagram above. The membrane substrate has a test line which is formed by monoclonal anti-canine Parvovirus antibody, and a control line formed by anti-mouse IgG. The virus in the fecal sample dropped into sample well moves along the sample pad and react with polyclonal anti-canine Parvovirus antibody labeled with colloidal nanogold on the conjugate pad. The antibody-antigen complex then moves along the membrane substrate and binds to the monoclonal antibodies on the test line, forming a test line which is colored red by the nanogold. The excess complex moves further along the substrate and binds with the anti-mouse antibody on the control line, which causes red color to develop along the control line as well. If virus is absent in the sample, only gold-labeled antibody flows along the substrate, and it does not bind to the test line, which causes only the control line to appear. Lateral flow assays in companion animal diagnosis These patient side rapid tests are commonly used for diagnosis of canine infectious dieses like Canine distemper, Canine Parvovirus, Canine Adeno virus, Corona virus, Canine brucellosis, Ehrlichia canis, Giardia and Heartworm. In case of Canine Distemper, nasal or ocular discharge can be used for virus detection. Fecal swabs are the specimen of choice for canine Parvovirus detection. In antibody tests like Ehrlichia and Brucella canis, whole blood or serum can be used depending on the test format. Similar antibody tests are also available for distemper and parvovirus which is helpful for assessing the vaccination status of animals. These tests usually measure IgG response in the serum. Another important applica-

199

tion of these rapid tests is detection of rabies virus in suspected cases. The virus can be detected in saliva or brain samples without much exposure to rabid specimens. Rapid tests advantages. The advantages of lateral flow based rapid tests are1. Quick results, available in just a few minutes. 2. Requires no instrumentation. 3. Easy to use. 4. Allows decentralized implementation (serum transport not required) 5. Able to execute the test and read result in the field itself. 6. Does not require refrigerated storage. Assay methodology These rapid tests are designed so that even a technician with limited expertise can perform the test easily. The veterinarian or the technician draws blood (or other suitable specimen depending on the test) from the animal using a syringe optionally coated with a clot-activator for faster serum separation. The syringe is kept till the serum separates and then, 3 drops of serum/sample are added to the sample hole on the test card using a dropper. The results can be read as shown in the diagram above, in just 5-10 minutes. After the test is complete and result recorded, the used kits should be disposed of according to standard disposal procedure followed for clinical specimens in veterinary hospitals and labs.

200

Abst 1: V

Standardization of differential PCR for diagnosis of infectious canine hepatitis (ICH) and infectious canine tracheobronchitis virus (ICTB)
Vishal Chander, S. Nandi and Rishendra Verma Virology Laboratory, Centre for Animal Disease Research and Diagnosis (CADRAD), IVRI, Izatnagar, U.P. (243122)

Canine adenovirus 1 (CAV-1) and CAV-2 are important pathogens causing infectious canine hepatitis (ICH) and infectious canine tracheobronchitis (ICTB) in dogs respectively. The infectious canine hepatitis is characterized by fever, anorexia, increased thirst and abdominal pain with swollen liver whereas CAV-2 infections is mainly associated with respiratory symptoms. Further corneal opacity (blue eye) and interstitial nephritis may occur 1-3 weeks after the clinical recovery as a consequence of the deposition of circulating immune complexes in CAV-1 infections in dogs. CAV-1 is a ds DNA containing virus under the genus Mastadenovirus and family Adenoviridae and is genetically and antigenically distinct from canine adenovirus 2 (CAV-2) under the same genus. Both viruses are shed in faeces and urine of the infected or recovered dogs, thus urine and faeces are important sources of infection to healthy dogs. A galaxy of immunoprophylactic agents are available in the market to control both infectious canine hepatitis (ICH) and infectious canine tracheobronchitis (ICTB) in dogs. However, pet dogs are mainly immunized against ICH and ICTB whereas stray and community dogs are left unvaccinated and they act as carrier and transmit the infections to other susceptible dogs. In this study, differential PCR has been standardized to amplify the genomic DNA of not only CAV-1 but also CAV-2 in order to diagnose and differentiate pathogens causing ICH and ICTB in the clinical samples and vaccines. A total of 19 clinical samples and 7 commercially available vaccines have been tested and 3 and 9 samples were found positive for CAV-1 and CAV-2 whereas 4 vaccines have been found positive only for CAV-2 as revealed by the presence of 508 bp and 1030 bp DNA bands in CAV-1 and CAV-2 respectively in the agarose gel. Abst 2 : V

Antibody prevalence to canine distemper virus (cdv) in unvaccinated rural dogs of torkaman county in iran
Rostami A, Namroodi S., Bahonar1 A.R. and Barin A Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran.

In this study the frequency of antibody against canine distemper virus (CDV) in unvaccinated rural dogs was evaluated by means of serum neutralization test. Serum samples were randomly collected from 71 clinically healthy unvaccinated rural dogs of Torkaman County from 2008 to 2009. The frequency of positive antibody reaction in animals against CDV was found to be 53.5% (38/71) in 1/32 dilution indicating that this virus is present in the ecosystem. Also there is evidence of previous natural exposure to CDV. No significant difference in susceptibility was observed between males and females and most of these positive cases occurred during the winter months. This result suggested that rural areas can support dog populations dense enough to maintain canine distemper virus (CDV) and rural dogs can be a potential source of infection for urban dogs and wild carnivores in this region. 1 Department of Food Hygiene and Quality control, Faculty of Veterinary Medicine, University of Tehran, Tehran , Iran.

201

Abst 3 : V

Serological Evidence of Leishmania donovani Infection in Apparently Healthy Dogs using Direct Agglutination Test (DAT) and rk39 Dipstick Tests in Kafta Humera, north-west Ethiopia
S. Kalayou1,2, H. Tadelle1, A. Bsrat1, N. Abebe1, M. Haileselassie3, H. D. F. H. Schallig4 1Mekelle University College of Veterinary Medicine, P.O.Box: 231, Mekelle, Ethiopia 2Norwegian School of Veterinary Science, Department of Production Animal Clinical Sciences, Oslo, Norway 3Tigray Regional State, Science and Technology Agency, Mekelle, Ethiopia 4Department of Parasitology, Koninklijk Instituut voor de Tropen (KIT, Royal Tropical Institute), KIT Biomedical Research, Amsterdam, The Netherlands

Leishmania (Kinetoplastida: Trypanosomatidae) are protozoan parasites of significant medical and veterinary importance. Over the last decade, visceral leishmaniasis (VL) has emerged as a major opportunistic infection associated with HIV/AIDS in North Western Ethiopia. This paper reports on serological evidence of possible Leishmania donovani (L. donovani) infection in dogs using two serological tests: direct agglutination test (DAT) and Kalazar detect rapid test (KDRT). Two hundred and seventeen asymptomatic local breed dogs were examined for L. donovani antibodies. Performance of the DAT and KDRT was assessed in 162 matching samples of blood collected on filter paper and serum, respectively. Using DAT and KDRT testing in parallel, the overall seroprevalence of L. donovani infection was 27.7% and 14.8%, respectively. The degree of agreement was found to be fair (68.8%, k = 0.234). Univariable logistic regression analysis of some risk factors for L. donovani infection in dogs using DAT indicates that place of residence, sex, age, dog keeping purpose and dog housing condition were not significantly associated with seropositivity. The high proportion of positive dogs suggests the exposure of these animals to L. donovani infection and needs further investigation. Isolation and typing of the parasite aiming at confirming the role of these animals in maintenance and transmission of kala-azar is advocated. Abst 4 : V

Antimicrobial susceptibility patterns of microbes isolated from otitis externa of dogs

Kruthikaben D., Sharma S.K., Maherchandani S., Shringi B.N., Kashyap S.K. Department of veterinary microbiology and biotechnology College of veterinary and animal sciences, Bikaner(Raj.).

Otitis externa, the inflammation of the epithelial lining of the external auditory canal is a very common malady of cats and dogs which causes a lot of distress to owners and discomfort to the pet. Etiology of otitis externa may be bacterial, yeasts, parasites or foreign bodies. Sterile swab samples were obtained from ear canals of 6 dogs with otitis externa. Out of the six samples processed for bacterial isolation bacteria could be isolated from three samples. From two samples Staphylococcus sp. could be isolated and one sample had Enterobacter sp.. Antimicrobial susceptibility test were performed for these isolates using 24 antibiotics. Based on the results of this study, the Staphylococcus spp. were sensitive to 14 antibiotics which includes amikacin, enrofloxacin, rifampicin, ceftazidime, oxacillin, minocycline and nitrofurantoin, and showed resistance to cephotaxime, tetracycline and co-trimoxazole. Enterobacter spp. was sensitive to 9 antibiotics which includes gentamicin, tetracycline, trimethoprim, nitrofurantoin and cotrimoxazole, and showed resistance to rifampicin, oxacillin, clindamycin, erythromycin, ceftazidime and vancomycin. Both these isolates showed sensitivity for nitrofurantoin, colistin, gentamicin and amikacin.

202

Abst 5 : V

Resistotyping of E. coli isolated from rectal swab samples of enteritic dogs

Sharma S.K., Kruthikaben D., Maherchandani S., Shringi B.N., Kashyap S.K. Department of Veterinary Microbiology & Biotechnology College of Veterinary & Animal Science, RAJUVAS, Bikaner (Raj.).

In the present investigation antibiotic resistance pattern of E. coli isolates from fecal samples of enteritic dogs was studied for 24 antibiotics. Eleven different resistotypes were found. First group of E. coli resistotypes included isolates, all resistant to Ampicillin, Cephalothin, Erythromycin, Vancomycin, Doxycycline hydrochloride, Oxacillin, Amoxycillin and Clindamycin. Second resistotype comprised of bacteria showing 77.78% resistance to Ciprofloxacin, Norfloxacin and Ofloxacin, followed by third group of isolates with 55.56% resistance to Minocycline and Tetracycline. Fourth resistotype had bacteria showing 66.67% resistance to Carbenicillin. Fifth group included isolates showing 55.56% resistance to Trimethoprim, Ceftazidime and Co-trimoxazole. Sixth, seventh, eighth & ninth groups of resitotypes included E.coli showing 33.33%, 22.23%, 11.12% &11.11% resistance to Ampicillin/Sulbactum, Kanamycin, Nitrofurantoin and Amikacin respectively. Tenth group of E. coli resistotype were 77.78% sensitive to Colistin followed by isolates showing 100% sensitivity to Gentamicin and Imipenem. Abst 6 : V

Canine pyometra and its antibiogram pattern

Bassessar V., Verma Y., Swamy M., Tripathi S.M., Sankhala L.N., Trivedi M.S. Department of Veterinary Pathology, College of Veterinary Science and Animal Husbandry Madhya Pradesh Pashu Chikitsa Vigyan Vishwavidyalaya,Jabalpur-482001 (MP), India

A study was conducted to evaluate the sensitivity of different antibiotics on 20 female dogs diagnosed with pyometra. The discharge material was collected by sterilized swab and streaked smoothly over Mueller Hinton medium and sensitivity towards antibiotics was determined by measuring the zone of inhibition using a Hi-media scale. The antobiogram showed that gentamicin was the most sensitive (85%) antibiotic followed by enrofloxacin, Ciprofloxacin and amoxicillin (65%, 65% and 55%) respectively. The isolates were most resistant to oxytetracycline (85%) followed by tetracycline, ampicillin, chloramphenicol, cloxacillin and erythromycin (80%, 80%, 75%, 70% and 70%) respectively. Abst 7 : V

Sporotrichosis in cats
Ranjit Kaur Mendhir Jr veterinary centre 4 Tingkat Taman Ipoh Enam, Ipoh Garden South, Ipoh,31400, Perak, Malaysia

Sporotrichosis is aubiquitousmycosis causedby sporothrix schenkii a dimorphic saprophytic soil fungus, commonly found in rotting plant matter.the portal of entryis typically a skin wound,in particular a scratch or bite from infected cats. Will present some clinical cases from shelters and owner owned cats brought to my practice.simple diagnosis, symptoms and treatment.

203

Abst 8 : V

Random Amplified Polymorphic DNA typing of Aeromonas species isolates from foods of animal origin, water and clinical cases from Jammu Province, Jammu & Kashmir
Bakshi, S.B; Kotwal, S.K1 and Taku, A.K.2 SKUAST of Jammu, Chatha campus, Jammu J&K -180009.

The aim of the present study was to determine the genetic relatedness of Aeromonas species isolates from foods of animal origin, water and clinical cases from different geographical areas in Jammu Province, Jammu & Kashmir. In total, 31 Aeromonas isolates from foods of animal origin, water and stool specimens collected from immuno-compromised human patients and pet dogs suffering from gastroenteritis were analyzed by random amplified polymorphic DNA PCR (RAPD). The RAPD fingerprints obtained proved reproducible when repeated on three different occasions using whole-cell DNA isolated from the Aeromonas strains. In total, 4 unique RAPD fingerprints were found. The results revealed a tendency of the isolates to cluster according to their origin of isolation. However, a certain degree of similarity was also observed between isolates of food origin sources which indicated genetic relatedness. This study has demonstrated the genetic relatedness of Aeromonas hydrophila isolates from drinking-water and clinical sources which may be due to cross-contamination from water to patients or vice-versa. This observation is of public health significance, particularly in the era of HIV/AIDS. This study points to the importance of monitoring and evaluating infection-control measures for improved hygiene and to prevent cross- contaminations. 1 Division of Vety. Public Health & Hygiene, KUAST of Jammu, R. S. Pura, Jammu J&K -181102 2 Division of Vety. Microbiology, SKUAST of Jammu, R. S. Pura, Jammu J&K-181102 Abst 9 : V

Antimicrobial sensitivity testing of bacteria isolated from skin of dogs suffering from pyoderma
Anju Bbala, Anshu Sharma, V. K. Jain, Rakesh Kumar, Sridhar, N. K. Rakha, Rajesh Khurana, Divya Agnihotry, Neelesh Sindhu and Sushma Yadav Department of Veterinary Medicine, LLRUVAS, Hisar 125 004 (Haryana)

Among dermatological diseases, canine pyoderma represents the second most frequently reported skin disease internationally after flea allergy dermatitis. Pyoderma is a common skin disorder in dogs which is caused due to pus formation by bacterial infection. The present investigation was carried out on 45 clinical cases of pyoderma in dogs examined during the study period; Staphylococci were isolated from 91.11% and other bacteria from 35.56% clinical cases of pyoderma in dogs. Staphylococci with predominance of Staphylococcus intermedius was the most common bacteria isolated from pyoderma followed by Streptococcus spp., Corynebacterium spp., Pseudomonas spp., Bacillus spp., and E. coli. Out of 41 staphylococcal isolates cultured, there were 53.33% isolates of Staphylococcus intermedius, 35.56% were Staphylococcus aureus and 2.22% were Staphylococcus hyicus. Majority of staphylococcal isolates i.e. 100.00 % were cultured from superficial pyoderma followed by surface pyoderma (95.00%) and least in deep pyoderma (70.00%). Multiple bacterial infections occurred less frequently than single infection in pyoderma in dogs. Bacterial isolates from pyoderma in dogs revealed the highest sensitivity against cephalexin (82.22%) followed by cloxacillin (80.00%), norfloxacin (77.78%) and lesser to enrofloxacin and azithromycin (46.67% each), penicillin (37.78%), erythromycin (33.33%) and lincomycin ( 28.89%). Multidrug resistance of Staphylococcus spp. isolates from pyoderma in dog revealed that 39.02% Staphylococcus spp. were resistant to more than 10 antimicrobials, 31.70% were found resistant to 3-6 antimicrobials, whereas few 4.88% were found resistant to less than 3 antimicrobials.

204

Abst 10: V

A retrospective study on status of canine diseases in Rajasthan State

A.K.Kataria, N. Kataria1, Ruchi Pachaury2, Rajneesh and A.K.Gahlot3 Apex Centre for Animal Disease Investigation, Monitoring and Surveillance, College of Veterinary and Animal Science, RAJUVAS, Bikaner

A retrospective cohort study was carried out involving veterinary officers and paravets from Department of Animal Husbandry, Government of Rajasthan in order to determine the status of different diseases in canines in Rajasthan state. In the study the feedback was received through a questionnaire from 777 veterinary officers and 769 paravets working in various veterinary hospitals across the state who attended a training on Animal Disease Diagnosis and Control in Apex Centre during year 2004 through 2010. Among viral diseases parvo, rabies, distemper and infectious canine hepatitis were the most reported infections in descending order of occurrence. Among bacterial diseases leptospirosis was reported highest followed by tetanus and tuberculosis. Among parasitic diseases mange was the most common disease followed by gastrointestinal worm infestation. Ehrlichiosis, a rickettsial disease had also been reported. The other common problems reported by vets and paravets were dermatitis, gastroenterisits, enteritis, respiratory tract infections and simple indigestion. The analysis revealed that overall the most common reported problems (in descending order) in canines were mange, parvo, rabies, canine distemper, gastroenteritis, dermatitis and infectious canine hepatitis. 1 Department of Vet. Physiology 2 Department of animal Husbandry, Govt. of Rajasthan, Jaipur 3 Vice-chancellor, RAJUVAS, Bikaner Abst 11: V

Assessment of canine plasma for its suitability in coagulase test with Staphylococcus aureus
V. Khichar and A.K.Kataria Department of Veterinary Microbiology and Biotechnology College of Veterinary and Animal Science, RAJUVAS, Bikaner-334 001

Production of staphylocoagulase, an extracellular protein, by Staphylococcus aureus forms an important criterion for identification of this organism. The staphylocoagulase forms a complex with plasma prothrombin leading to exposure of active site on the prothrombin molecule. This complex is capable of splitting fibrinogen into fibrin which then forms a clot. Different workers have used plasmas from various animal species and humans and have recorded variable results. In the present study the production of coagulase by 28 S. aureus isolates obtained from clinical mastitis in cattle was evaluated against plasmas from ten species of animals and against human plasma as well. The observations were made at one, three and five h of incubation. In the present study all the isolates were found to be positive for production of coagulase and the overall strongest coagulation reaction in regards to early onset and firmness of clot was recorded in plasma from rabbit followed by buffalo, cattle, camel, human, goat, sheep, dog, horse, chicken and pig. Hence the suitability of dog plasma for the use in coagulase test for detection of Staphylococcus aureus was only better than three other test species namely horse, chicken and pig.

205

Abst 12 : V

A survey study on status of brucellosis and haematoprotozoan infections in stray dogs

A.K.Kataria, N.Kataria1, Rajneesh, P.Nathawat, Ishrat-Ullah Ansari2 and Diane Blanger3 Apex Centre for Animal Disease Investigation, Monitoring and Surveillance, College of Veterinary and Animal Science, RAJUVAS, Bikaner

A study was conducted including the stray dogs brought to Marwar Animal Protection Trust, Jodhpur for the purpose of sterilization. The study was planned to detect the presence of brucella antibodies in the sera and haematoprotozoan parasites in the blood smears prepared from 351 stray dogs of both the sexes. Only three of the animals were found positive for brucella antibodies (0.85%) by Rose Bengal Plate test and antibody titres were more than 80IU in tube agglutination test. The brucella infected animals showed higher lymphocyte counts as compared to other animals in differential leucocyte count. None of the blood smears revealed presence of any haematoprotozoan parasite. The study revealed low incidence of brucella infected dogs, however it is of value to know that these stray animals may act as potential carrier in the transmission of infection to other animals or human population. 1 Department of Vet. Physiology, CVAS, Bikaner 2 Pet Hospital and Boarding shelter, Vasant Kunj, New Delhi 3 .Humane Society International (HSI), Haiti

206

Session-VI
Canine Nutrition, Hygiene and Management, Canine Behaviour and welfare

207

L P1 : VI

Role Of Dogs In Security

G S Nag, Deputy Commandant BSF, Bikaner

It is a well known fact that dogs are the best friend of the men since ages. Dogs have been domesticated some thirty to forty thousand years ago. Men have exploited various traits of dogs for its help and survival. The most important one is use of dogs in security. Men since the times of dependence on hunting for food have kept dogs with them for security and attack. Later men started using them successfully as an offensive against enemy forces. Traditionally, the most common breed for the military operations has been the German Shepherd; in recent years there has been a shift to smaller dogs with keener senses of smell for detection work, and more resilient breeds such as the Belgian Malinois and Dutch Shepherd for patrolling and law enforcement. Dogs in warfare have a long history starting in ancient times. Dogs were trained as dogs of combat for use as scouts, attackers, sentries and trackers. Their uses have been varied and same continue to exist even in modern military usage. The use of dogs in warfare has been common even in many early civilizations. As warfare has progressed, their purposes have changed greatly. Dogs have many peculiar qualities including that of sniffing and Hearing. Dogs have two giant olfactory bulbs in the brain, which weigh around 60 grams, almost four times as much as human olfactory bulbs. Fact remains that the canine brain is about one tenth of the size of the human one, that indicates the canine brain has forty times as much of its brain devoted to sniffing as humans do. The sniffing and scent discrimination power of a dog is reckoned to be 150000 times better than a man. A dog can hear a sound 4 times better the distance wise. However, it is the sense of sniffing which men has exploited the most. Dogs can be trained in many fields such as Explosive detection, Narcotic detection, Infantry Patrol, Guarding, Tracking, Search & Rescue Operations, Casualty detection, Messenger duty etc. However, Explosive detection remains the field of highest demand. The world has seen many bomb blasts in recent past including those in our own country. Explosive detection dogs are trained to detect explosives hidden any where including ground, building, vehicle, luggage, human body etc. They have an uncanny trait of finding out all kinds of explosives. Dogs are trained to indicate only silently the presence of an explosive article. This is most difficult field of dog training. In this a dog does not have the freedom to fiddle, play, scratch or mouth an explosive article, which otherwise is a basic instinct of a dog, as it may lead to blast. At times even barking can lead to blast if the device is having sound sensors. Militants and Anti National elements these days use crude kind of explosives or mixtures of explosives which they attach with a timer device and plant it at pre defined place. Such devices are called Improvised Explosive Devices (IEDs) which is a very familiar name to everyone around the globe. Since explosive detection dogs are related directly to the life and property, they remain in highest demand. Almost all State police forces, Para Military forces and armed forces have dogs skilled in Explosive detection. Equally important for the society is Narcotic detection dog. These days narcotics are related with Narco-terrorism. If you cannot conquer a country with military power, conquer it with Narco-terrorism. If the youth of a country plunges in narcotics, country is almost dead in few years without a war. Narcotics are mainly smuggled from China, Myanmar, Thailand, Indonesia and African countries. History is evident of some huge cache of narcotics by trained dogs at International Airports, Dockyards and at check-posts on international borders. Training a dog in narcotic detection is one of the easiest trainings. The dog has full freedom to mouth, play, fiddle or scratch the article as there is no risk to human life and property. Moreover narcotics are high odorous substances. Its a very playful training which both dog and handler enjoy. The only difficulty with this training is legal possession of narcotics for training purpose, for which permission and licensing is required from Narcotics Control Bureau. Most frequently demanded dog by state police forces is a Tracker dog. In simpler words we can call it as a Crime detection dog. Tracker dogs help in solving cases of dacoity, theft, rape, murder etc. where

208

identification of a culprit is required. Tracker dogs basically work on human scent. Their unbelievable power to discriminate different scents makes a dog wonderful tool to solve complicated cases. Dogs can find out both ways from Man to Article ( identifying an article of a particular man whose scent has been given to the dog) and from Article to Man(identifying a man after taking the scent of his article). This is of very high importance in Shinakhti Parade( Parade of Suspects to find out actual culprit). The result of a Shinakhti parade by a Tracker dog is acceptable in a court of Law as an evidence. Training a dog in Tracking is very difficult and its duration is longest. Infantry Patrol dog training is mostly used in thick jungle/relatively silent areas to indicate presence of ambush of militants. This is a training in which both the qualities of a dog ie, Extra ordinary hearing and sniffing, work hand in hand. German shepherd is the breed of choice for this training owing to erect ears which help in gathering sound waves. In addition they have good ear mobility which allows them to rapidly pinpoint the exact location of sound. Dog gives a signal of caution silently to patrol contingent on getting either scent of human through up wind or on hearing very low decibel of noises which are otherwise not audible to humans. These dogs are refrained from barking and making unwarranted noises which can lead to disclosure of position of patrol contingent. Remember the massive earthquake in Bhuj area of Gujrat on 26 January 2001. The need of search and rescue dogs was immediately felt to trace and save the life of persons buried alive under the rubble of collapsed buildings. On the directions of Govt of India, National Training Centre for Dogs (NTCD), a Centre of Excellence, BSF Academy, Tekanpur (Gwalior) started working on the project of designing the the training of dogs in S&R. Since then several batches of S&R dogs have successfully passed out from NTCD to serve the mankind at times of natural calamity. The Battalions of National Disaster Response Force (NDRF) have dogs trained by NTCD in S&R, not only in earthquake affected area but also for flood relief, Nuclear Biological and Chemical Warfare (NBC), manmade disasters, accidental explosions at chemical reactors etc,. Guarding is a natural instinct of all the dogs. Man has exploited this trait for guarding vital installations like Ops room, radar station, high security campus, hangers, ammunition dump etc. Guard dog is basically an attack dog, which on letting loose can even kill the intruder, hence its proper controlling and gearing is very essential. Mostly Rottweiler, Belgian Shepherd, German shepherd or Dobermann are suitable for this task. It is relatively easy to train a dog in Guarding as it basically aims at only refinement of attack instinct of dog. One of the most recent uses of dogs in security forces has been for intimidation. Though it is quite controversial but Military Working Dogs of United States have been effectively used in recent wars in Afghanistan and Iraq. Un-muzzled working dogs were used to threaten and attack the jail inmates and prisoners of wars. Dogs are just an inseparable commodity from security forces as they render relentless service to safeguard valuable life and property. They are true companion of a bordermen who remain away from their homes and families to safeguard the sanctity of our motherland. A rich tribute to those dogs who laid down their lives in the service of nation and a warm salute to those who are helping security forces from militants and anti national elements.

209

L P 2 : VI

Impact of Vitamins and Minerals on Canine Health

Chandan Lodh Department of Veterinary Medicine Ethics & Jurisprudence West Bengal University of Animal & Fishery Sciences, Kolkata, West Bengal

Vitamins are organic substances that your dogs body needs in certain quantities to be able to function properly. Vitamins are classified as either fat soluble or water soluble. Fat soluble vitamins are stored in your dogs fat cells called lipocytes. Water soluble vitamins are not stored in the body in large amounts. Thus, in general, vitamin over-supplementation is much more dangerous in fat soluble vitamins than in water soluble vitamins. Vitamin A Vitamin A, a fat soluble vitamin, is important for your dogs bone and teeth formation, vision, coat, skin, eyesight and mucous membranes. Sources of vitamin A include dairy, liver and vegetables with yellow coloring. Vitamin A deficiencies have been known to cause eye problems, lack of coat and skin quality, poor growth and a reduced ability to ward off infections. Too much vitamin A can cause your dog to have muscle weakness and bone problems. Signs of vitamin A toxicity also include decreased appetite, weight loss, limping, stiffness and constipation. The B Vitamins There are several types of B vitamins including vitamin B-1 (thiamine), vitamin B-2 (riboflavin), vitamin B-3 (niacin), vitamin B-5 (pantothenic acid), Vitamin B-6 (pyridoxine), vitamin B-9 (folic acid), vitamin B-12 (cobalamin) and biotin. These B vitamins are water soluble and, often, to be most effective, several B vitamins must work together. Stressful situations and very cold temperatures can deplete your dogs supply of B vitamins. Too much B vitamin can also create problems for your dog. For example, too much vitamin B-6 (pyridoxine) can cause nervous system damage and increased light sensitivity. Too much vitamin B-3 (niacin) can cause skin irritations, liver damage and stomach ulcers. In addition, too high quantities of one B vitamin can also cause other B vitamins to be depleted. Vitamin B-1, also known as thiamine, is an essential vitamin for your dogs overall health. Thiamine has also been found to be a natural flea repellent. Thiamine is found in fruits, vegetables, milk and meat. Though more common in cats than in dogs, thiamine deficiency can cause your dog to be unsteady on his legs, have spastic hind legs, seizures, vomit and lose his appetite. In some cases, thiamine deficiency can be fatal. Thiamine deficiency can result if your dog eats a lot of raw fish or, like many vitamin deficiencies, it can be caused by feeding your dog a low-quality or nutritionally incomplete diet. If your dog is found to have a thiamine deficiency, this condition can most often be completely cured by an injection of thiamine administered by your vet. Vitamin B-2 (Riboflavin)Riboflavin is essential to your dogs ability to grow and develop properly, and it is necessary for a healthy coat, eyes and heart. Riboflavin is found in organ meats and dairy products. A riboflavin deficiency will cause your dog to have poor growth, dandruff, eye conditions, limb weakness, fainting episodes and possible heart failure. Riboflavin deficiency in pregnant dogs has also been associated with birth defects in offspring. Vitamin B-3 (Niacin)Vitamin B-3, also called niacin, primarily helps your dogs enzymes work properly. Enzymes are proteins produced by your dogs cells to help trigger and regulate important chemical activities in your dogs system. Niacin can be found in meat. A lack of niacin can cause your dog to have a condition referred to as black tongue in which he will have inflamed lips and gums, a lack of appetite and bloody diarrhea. If the condition is not treated, death can result. Niacin has appeared to be helpful in controlling seizures, reducing cholesterol and regulating central nervous system functions. Too much niacin can cause skin irritations, liver damage and stomach ulcers.

210

Vitamin B-5 (Pantothenic Acid)Vitamin B-5, also called pantothenic acid, is essential for supporting your dogs immune system and adrenal functions. Pantothenic acid also helps your dogs system convert proteins, carbohydrates and fats into usable energy. Adequate amounts of pantothenic acid are necessary to help your dog fight infections, inflammations, asthma and allergies. Panothenic acid is found in many raw foods, both meat and vegetables. However, processing food tends to reduce the amount of pantothentic acid available for your dog to use. Dogs with a lack of pantothenic acid can suffer from abnormal hair loss and stomach upset. Allergies, skin irritations and skin infections are also considered pantothenic acid deficiency symptoms. Vitamin B-6 (Pyridoxine)Vitamin B-6, also known as pyridoxine, is vital for protein metabolism. It is also essential in helping your dog use some minerals. Pyridoxine is found in many foods, but can be damaged by processing. Symptons of pyridoxine deficiency in your dog include growth problems, epilepsy, water retention and kidney damage. Pyridoxine deficiency has also been implicated as a contributing cause of allergies, artery disease, arthritis, asthma and even some types of cancer. Too much pyridoxine can cause nervous system damage and increased light sensitivity Vitamin B-8 (Biotin)Vitamin B-8, also known as biotin, is important for thyroid, skin, bone marrow, adrenal and nervous system health. Biotin also is helpful to your dogs reproductive process and for aiding your dog in processing fats, carbohydrates and proteins. Good sources of biotin are corn and beef liver. Interestingly, raw eggs have an enzyme that depletes biotin so, if you feed your dog eggs, you should make sure the eggs are properly cooked. Long-term antibiotic use has also been associated with biotin deficiency in dogs. Symptoms of biotin deficiencies include hair and skin conditions, eye discharge, small litter size and sometimes diarrhea. If not treated, a biotin deficiency can also cause limb paralysis. Vitamin B-9 (Folic Acid)Vitamin B-9, also known as folic acid, is necessary for DNA and RNA synthesis, reproductive processes, proper protein metabolism and red blood cell formation. Folic acid is found in organ meats. Folic acid deficiencies can result in reproductive problems, birth defects if the mother is folic acid deficient, weight loss, anemia, weakness, seizures, eye discharge, and immune system suppression. Vitamin B-12 (Cobalamin)Vitamin B-12, also known as cobalamin, is essential for DNA synthesis, proper food digestion and nutrient absorption. Cobalamin is also helpful for promoting proper growth, preventing nerve damage and strengthening reproduction. The best source of cobalamin is raw liver. Cobalamin deficiency can lead to anemia in your dog. Vitamin C Vitamin C, a water soluble vitamin, aids your dogs immune system and development. Vitamin C is found in citrus fruits and vegetables. Vitamin C is often used to supplement large-breed puppies and nursing mothers. It has also been used with some success in reducing the effects of some conditions such as hip dysplasia and bladder stones. Too high doses of vitamin C can cause diarrhea (vitamin C is a natural laxative) and a bloated abdomen. In addition, a link has been suspected between too high doses of vitamin C and the occurrence of kidney stones. Vitamin D Vitamin D, a fat soluble vitamin, is essential for regulating the bloodstreams calcium and phosphorous levels, bone formation and proper muscle and nerve function. Vitamin D sources include fish liver oil and sunlight. Vitamin D deficiency can cause rickets, a bone disorder with symptoms such as bowed legs, swollen joints and weakness. Too much vitamin D can create inappropriate amounts of calcium to be stored within your dogs heart and other muscles. High doses of Vitamin D can also cause vomiting, diarrhea, hemorrhaging, excessive thirst, increased urination, lethargy, limping and bone pain. Vitamin E Vitamin E is a fat soluble vitamin important for proper cell functioning and fat metabolism. Vitamin E is also an anti-oxidant. Vitamin E sources include meat such as liver, leafy green vegetables, vegetable

211

oil and wheat germ. Vitamin E deficiencies can cause eye, heart, liver, muscle, nerve and reproductive disorders. Vitamin E deficiency can also impact your dogs bowels causing damage, hemorrhaging and destruction. Too high does of vitamin E can interfere with your dogs ability to absorb vitamin A and vitamin K. Significantly, the inability to absorb vitamin K can lead to blood clotting problems. Vitamin K Vitamin K, a fat soluble vitamin, is vital for normal blood functions such as clotting. Vitamin K sources include eggs and leafy green vegetables. A lack of vitamin K can cause clotting problems and lead to hemorrhaging. Vitamin K is often used to treat dogs who have accidentally ingested rodent poison. Minerals Minerals are natural substances that play essential roles in helping your dogs system function properly. Your dogs body does not make minerals on its own. Instead, your dog must obtain minerals from food and water which contain dissolved minerals. Some important minerals include calcium, phosphorus, iron, magnesium, manganese and selenium. Calcium and Phosphorus Your dog needs a proper amount and balance of calcium and phosphorous in his body. Calcium and phosphorous are necessary for sound bones and teeth. Phosphorous is also needed for the body to produce its own energy, and calcium is required for blood clotting and for heart, nerve and muscle functions. Generally dogs do not suffer from phosphorous deficiencies, but calcium deficiency is seen in some dogs. Calcium deficiencies can cause lameness, spasms, anxiety, heart palpitations, eczema, decreased bone density, osteoporosis, gum erosion, seizures, hemorrhages, high blood pressure, arthritis, bone fractures and respiratory problems. In pregnant and nursing dogs, calcium deficiencies have been implicated in the development of eclampsia. Calcium deficiencies can be brought about by high-meat diets because meats contain an unbalanced amount of phosphorous. For calcium to be activated, vitamin D is required. Excess levels of calcium and phosphorous can lead to growth problems in your dog. In addition, inappropriately high levels of phosphorous and calcium can inhibit your dogs ability to absorb manganese. Iron Iron plays an essential role in helping your dogs system function properly. Iron is necessary for red blood creation, enzyme functioning and energy and immune system functioning. Iron deficiency symptoms include anemia, lack of energy, diarrhea, pale gums and hair loss. Excess levels of iron can damage your dogs heart, liver, stomach and intestinal lining. Magnesium Magnesium is an essential component used for proper enzyme function and heart rate and healthy bones, muscles and nervous system. Magnesium also helps rid the body of lead and other heavy metals. Magnesium deficiency symptoms irregular heart rates, high blood pressure, seizures, bone pain, nervousness, irritability, depression and muscle spasms. Inappropriately high levels of magnesium can interfere with your dogs ability to absorb calcium. Manganese Manganese is necessary for enzyme utilization, normal reproduction, milk production in nursing dogs, fat and protein assimilation, blood sugar regulation, healthy nerves and immune systems, and normal functioning of the pituitary gland (the gland that regulates all of the other glands). It is also needed for proper bone and cartilage growth. Manganese is also needed for utilization of thiamine and vitamin E. Manganese deficiency can cause retarded growth and development as well as reproduction problems. Manganese deficiencies have also been reported to impact normal fat metabolism. Potassium and Sodium Potassium and sodium must be kept in balance for your dog to function properly. Potassium is needed for regulating body fluid and for metabolic, muscle and nerve functions. It also thought that potas-

212

sium can help prevent strokes. Sodium is important for regulating body fluids. Symptoms of potassium deficiency include muscle weakness, paralysis, heart problems including irregular heart rate, kidney lesions, retarded growth and dehydration. Some diuretics and heart medications can diminish your dogs potassium levels. Excess potassium levels in your dog tend not to be a problem as long as your dog has healthy functioning kidneys. However, for dogs with Addisons disease, dangerous levels of potassium can build up in your dog. Symptoms of sodium deficiency include fatigue, dry skin, hair loss and slowed growth. Heat exhaustion can cause a sodium deficiency. Too much sodium will cause your dog to be excessively thirsty. Selenium Small amounts of selenium are considered an antioxidant for dogs that helps slow aging and regulates your dogs blood sugar. Selenium deficiency appears linked to heart disease, the development of tumors, immune deficiencies, weakness, skin problems, slow growth and reduced fertility. Excess amounts of selenium can cause cardiovascular collapse, anemia, hair loss, limping and liver disease.

213

Abst 1 : VI

Food Animal lvermectin Overdose in a Local Dog

Shaba, P. College of Agriculture, P. M. B. 109, Mokwa, Niger State, Nigeria (Africa) A local dog, Pingo, weighing 35 kg body weight was presented to the college Veterinary Clinic with complains of anorexia, depression, dehydration, seizures and emaciation. The history obtained from the owner indicated that the dog was injected with two doses of large animal ivermectin1% (0.9 ml) in two weeks interval against mites, ticks, and endoparasites by a veterinary assistant. After a thorough clinical examination, slightly anaemic, respiratory distress and incoordination were observed. The condition was diagnosed as over dose of ivermectin that resulted in its poisoning. The dog was hospitalized and treated as per the symptoms observed. Fluid therapy, (Ringers lactate), analgesic (acetylsalicylic acid 1o mg/kg body weight tid), Bi-complex injection (2 ml bid for 5 days), adrenaline (0.1 mg/ml) Dextran 79 (15 ml/kg body weight) were given to the dog as per the condition with thorough critical re-evaluations at regular intervals. By day 5 of the hospitalization, the dog condition started deteriorating, and all the vital parameters were abnormal. The dog became weaker, recumbent and heartbeat slowed down. On day 7 of Pingos hospitalization, it died. The owner did not permit post mortem to be carried out. It was given a decent burial by all standards. That was an exceptional case by the owner. The resulted poisoning of Pingo highlighted the danger of injection of formulated food animal ivermectin in canine specie and coupled with wrong interval of its administration. Abst 2 : VI

Flourishing dog meat cuisines in Kaduna metropolis, Nigeria.

Shaba, P.

College of Agriculture, P. M. B. 109, Mokwa, Niger State, Nigeria (Africa) The trends of delicacy of dog meat cuisines in Nigeria has changed from being popular among the locals in the rural areas either due to traditional beliefs and ways of life or as per designed by group of people or individually. In recent times, the local beer parlours and organized drinking joints had become popular with selling of dog meat in forms of barbecue, boiled and hot pepper soup. In this current study, eight centres where dog meat is being sold within Kaduna metropolis were chosen for the survey. Two hundred questionnaires of twenty five questions each were distributed among the people that relished the dog meat, and often visit such designated centres. From the result obtained, 85% of the respondents were men, while 15% were women. 80% of the respondents have been eating the dog flesh for over 20 ears, 113% over ten years and 7% less than 10 years. The dogs to be slaughtered are sourced locally from within the state and neighbouring states as the situation warranted. There was excitement and degree of resentment at the first time the dog meat was being eaten by the respondents, 75% of the respondents loved to have a piece of the dog meat in a day, 18% twice a week and 7% once a week. 95% of respondents preferred to have the dog meat at the designated eating centres with friends. While 5% love to have a take away and shared it with family members. All the parts of the dog were being relished, and the price varies. 92% of the respondents preferred the meat of freshly slaughtered dog to be served, while 8% could managed the left over from the previous day. The reasons advanced by the respondents in relishing the dog meat at will were boosting immunity against diseases like malaria, traditional ways of life, the dog meat is just like any other animal meat or products (e.g. beef) as per individual preference. But on medical benefits of relishing the dog meat, there was not any scientific proof to the claim. The trend of dog meat eaters is increasing in the city centres, and getting unusual popularity than twenty years ago.

214

Abst 3 : VI

Animal Welfare organization working at border area

Rajiv Sharma Secretary, Animal Mercy Unit Society, SriGanganagar (Rajasthan)

Animal Mercy unit society in an animal welfare organization that working at Indo-Pakistan border areas since-2001. After the time of Cargill war, post effects of war as due to demining procedure at border area villages caused to lead severe injury, loss of limbs and death in animals. it inspires our team member to start an animal welfare organization who work to save animals in emergency & disaster conditions. During that time We have organized many free surgery camps under the banner of NGO Animal Mercy Unit Society at various places of border area, in those camps we treated many animals, surgical operations, gynecological complications, along with Deworming of small & large animals, vaccinations of cow & buffaloes against Hemorrhagic Septicemia & Black Quarter diseases, Infertility cure, Artificial Insemination, Dosing & Dusting of sheep & goat against ecto and endo parasites, Castration of scrub animals & fortified minerals mixtures supplementation to debilited and emaciated animals. We have also organized awareness camps for rural peoples regarding various animal diseases their prevention, vaccination, feeding & management practice. Every year at the occasion of animal welfare fortnight in the second half of January month, we are organizing free anti rabies vaccination camp for dog and awareness camp related with prevention of cruelty to animal. For street dogs affected with manze and other skin affections, we have started a campaign to treat them with the help of local areas people by giving drug Ivermecten (orally in milk/ injectalbe) along with tropically gention violet paint, with other antifungal tablets and this treatment continue up to 2 to 3 months until animal recovered, we have got 70% successful rate. In association with various animal welfare organizations as Sonadhi animal welfare charitable trust New Delhi, Bhomic Pashu Seva Samiti Almoda, We have organized animal birth control programme in canine at various places as in Delhi, Rajasthan, Uttaranchal. Our team members also taking care of Accidental injured street animals, after giving them proper treatment, we send them to various animal shelter homes, in cases of severely injured dog & cats after proper treatment they are adopted by our team members & other dog lover peoples. Many of these pets are now family members of our team workers. We are also creating awareness in the field of prevention of cruelty to animals through various publications of articles in Magazines, Newspapers & e-blogs. Abst 4 : VI

Geriatrics the problem of ageing and diseases of elderly dogs

Basant Bais and Garima Choudhary Department of Livestock Production and Management College of Veterinary and Animal Science, RAJUVAS, Bikaner (Rajasthan) 334001

The average dog now lives about 13 years, and it is not uncommon to see dogs who are more than 20 years old. The maximum life span of dogs has been estimated to be 27 years. Large dogs have shorter life spans than smaller dogs. St. Bernards, German Shepherd Dogs, Great Danes, and other giant breeds are considered senior at 6 to 9 years of age and old at 10 to 12. Medium dogs are seniors at 9 to 10 years of age and old at 12 to 14. Toy breeds are considered senior at 9 to 13 years of age and old at 14 to 16 years. Being a purebred or mixed-breed dog does not influence the aging process. A dogs biological age depends on his genetic inheritance, nutrition, state of health, and sum of lifetime stresses. Of greatest importance is the care the dog has received throughout his life. Dogs with a poor genetic inheritance may have shorter lives due to medical problems. Well-cared pets suffer fewer infirmities as they grow older

215

Abst 5 : VI

A Case study of Cypermethrin shampoo licking poisoning using indigenous novelty based probiotic drink for dog
Gopal Krishna German Pet Clinic, 5R/1,B.P., B.K.Chowk Near HDFC Bank, Faridabad(121001)

Four adult dog of German Shepherd breed visited German Pet clinic, Faridabad (Haryana) showing symptoms of restlessness and frothing from mouth. As informed by dog owners that he used cypermethrin shampoo for removal of ticks and lice, all of a sudden dog licked the shampoo, since then dog was frothing from mouth. Dogs were treated using I/M injection of phenaramine maleate, Dexamethasone and PAM (Pyridine Aldoxime Methiodde) . The components of probiotic drink are 1. Cud Liquor enzyme complex 2. Malt extract3. Mixed fruit juice 4. Pure honey 5.Ferric Ammonium citrate IP 6.Calcium Gluconate 7.Citric acid 8.Sodium benzoate 9. Potassium metabisulpate. From first day onward , probiotic drink (Two spoonful) was administered orally in two equal divided doses to adult dog for three days regularly. Dog started eating on 4th day and response of probiotic drink was outstanding. The cost of probiotic drink per day per dog was Rs5/- (Five only). It has been confirmed that presence of detoxifying microbes in the Cud liquor enzyme complex (Author innovation cleared by ISA authority, patent office Vienna, Austria and Registered with WIPO, Geneva). The technology for preparing CUD liquor enzyme complex is being commercialized by NRDC, GOI, Delhi office, interested veterinary drug manufactures may contact NRDC office for procuring license. Abst 6 : VI

Management of obsessive compulsive tail chasing and biting in a dog a report

Madhavan Unny N, John Martin K D, Manju K Mathew and Ajithkumar S Department of Clinical Veterinary Medicine, College of Veterinary and Anima Sciences,Mannuthy-680651, Thrissur, Kerala

An adult German shepherd dog was presented to the University Veterinary Hospital,Thrissur, with the complaint of lesions of tail and chasing of tail. Examination of skin scrapings revealed the presence of mite of Demodex spp. The dog was treated for demodicosis with Inj.ivermectin, benzoyl peroxide shampoo and amitraz wash at weekly intervals. The treatment was continued for a period of six weeks. Two skin scrapings during the last two weeks of treatment did not reveal any mites in the sample tested. After a week of discontinuing the treatment, the owner brought the animal back with the complaint that the tail chasing and biting was continuing. Skin scraping examination did not reveal any mites. Detailed history from the owner revealed that the condition had become a compulsive disorder with the animal chasing and biting the tail as a matter of routine. The owner was advised accordingly. The pet was treated with antihistamines for one week and then a treatment was initiated with clomipramine at the rate of 1.0 mg/kg p.o. q 12 h. The dose was increased at specific intervals along with behavior modification. Appreciable improvement in the condition was reported by 9 weeks of treatment. The etiology, therapeutic options available and the modifications that need to be made in managing pets with such behavioural disorders will be discussed.

216

Abst 7 : VI

Can Dogs Help Keep You Healthy? Exploring the Human-Animal Bond
Om Prakash Choudhary, Aditya Godara, Sorabh Kr. Amarwal Arawali Veterinary College, Sikar, Rajasthan

You take good care of your pet. But whats your pet done for you lately? Scared intruders from your door? Fetched your slippers? Given you a loving nuzzle? People have lots of reasons for owning pets. Now a small but growing body of research suggests that owning or interacting with animals may have the added benefit of improving your health. The bond between animals and humans is part of our evolution, and its very powerful. Today animal companions are more popular than ever. According to us When you see how long weve had pets in our lives, and how important they are to us today, we think its amazing that the study of human-animal interactions is still so new. Researchers have only recently begun to explore this wonderful relationship and what its health benefits might be. Its true that scientific study of the human-animal bond is still in its infancy. Several small or anecdotal studies have uncovered intriguing connections between human health and animal interactions. However, more rigorous follow-up studies have often shown mixed results. The general belief is that there are health benefits to owning pets, both in terms of psychological growth and development, as well as physical health benefits. Mans best friend may help you make more human friends, too. Several studies have shown that walking with a dog leads to more conversations and helps you stay socially connected. And studies have clearly shown that people who have more social relationships tend to live longer and are less likely to show mental and physical declines as they grow older. Its hard to walk a dog and not have someone talk to you or interact with you, compared to walking alone. Abst 8 : VI

Grooming an enjoyable interaction between dog and owner

Basant Bais and Devendra singh Department of Livestock Production and Management College of Veterinary and Animal Science, RAJUVAS, Bikaner (Rajasthan) 334001

Grooming is the most important part of dog management which perform two functions i.e. (i) to keep him looking and smelling , acceptable to you and to other people (ii) it is just as important. Grooming of a very different sort, between dogs establishes and maintains the relative status of each dog. By daily grooming you are telling the dog , in the most gentle term that you are in charge. The whole ritual of insisting that your dog stands while you brush and comb him emphasizes that when push comes to shove, what you say goes. There is no more important lesson in dog training than grooming. Abst 9 : VI

Noahs ark animal rescue, Ipoh Malaysia

Ranjit Kaur Mendhir Jr Veterinary Centre 4 ,Tingkat Taman Ipoh Enam, Ipoh Garden South, Ipoh,31400, Perak, Malaysia

Noahs ark is a registered ngo (nai).it is run by a small group of dedicated animal lovers and mainly does tnr, rescue and treatment, rehoming,fostering,education programmes in school and communities, liasing with governmental bodies regarding animal welfare issues.will present my work.

217

Abst 10 : VI

Environmental enrichment of dogs

Sankhala L.N., Tripathi S.M and Joshi A. Department of pharmacology and toxicology College of veterinary and animal science, RAJUVAS, Bikaner

Majority of dogs are kept as family pets and spend most of their lives in close attention of their owners while many other dogs spend variable period of time in confinement as they are kept in kennels for boarding, security, military and research purposes. Welfare of domestic dogs can seriously compromised by inappropriate confinement. Now days, environmental enrichment has become important part of animal husbandry regimes of captive animals. .Some most important goals of environmental enrichment include increasing activity, stimulating a more diverse range of behaviours, increasing exploration and reducing abnormal behaviors in captive animals. Two types of enrichment practice are specifically addressed for dogs namely social enrichment and nonsocial enrichment. Social enrichment includes enrichment of dogs through provision of social contacts with other dogs and humans and non social enrichment means enrichment of dogs through provision of various toys, plastic tunnels, items for chewing, music and olfactory stimulation. Abst 11 : VI

They died and you paid for it : Cosmetics and Unneccessary Painful Testing
Gupta,S Department of Veterinary Biochemistry, College of Veterinary and Animal Science Bikaner (Rajasthan)-334001

Animals are suffering as the result of painful testing associated with cosmetics, beauty products and even dog food. Today, animal testing statistics is on the rise because pharmaceuticals and cosmetic companies along with domestic product manufacturers are spending billions of dollars on making their products safe for the humans. They are using these animals to test their chemical preparations or drugs on, in order to detect and study the effectiveness or the adverse effects of such drugs, before they are marketed. Regardless of opinion on animal testing for medical research, we can all probably agree that animals should not be suffering for the sake of cheap mascara and shampoo, especially when there are crueltyfree options available. More effective are sophisticated alternatives like Episkin, artificial human skin that can replace some animal tests in a fraction of the time and cost. PETAs Caring Consumer Project was founded to help consumers choose products that dont contribute to animal suffering. Abst 12 : VI

Behavioral problems of pups and training

Choudhary G. Department of Livestock Production Management CVAS, Rajasthan University of Veterinary & Animal Science, Bikaner-334003

There are many common issues that owners find problematic with their puppy, such as eliminating in inappropriate locations, chewing, mouthing, growling, early aggression and biting. Many of behaviors that are problems for owners are in actuality normal puppy behaviors. Many of these issues can be prevented or managed by helping owners understand normal canine behavior and by teaching the puppy appropriate social behaviour. The focus always should be on rewarding socially appropriate behaviors rather than punishing inappropriate ones. Early puppy training involves teaching manners at early age and how to live in accordance with owner. New puppy owners need to teach patiently the behaviors that they want their puppy to perform. This is a more productive method than disciplining which pups do not like.

218

International Congress of Canine Practice On Modern Concepts in Canine Health and Diseases of Human Concern and IX Annual Convention of ISACP 9th - 11th February 2012, Bikaner, Rajasthan, India SUPPLIMENTRY LEAD PAPER
LP VI : III Animal Welfare: Concepts and Principles Parveen Goel*

As per Saunders Comprehensive Veterinary Dictionary: Animal Welfare is defined as: "The avoidance of abuse and exploitation of animals by humans by maintaining appropriate standards of accommodation, feeding and general care, the prevention and treatment of disease and the assurance of freedom from harassment and unnecessary discomfort and pain." The definition highlights the fact that Animal welfare is a system of management physical needs of an animal. Moreover, at the same time accepting that some degree of pain and discomfort may/will be inflicted on animals. Their very purpose is to serve humans as food, fur, entertainment, and work and research tool. Today this definition is challenged. The above definition has completely ignored its psychological and emotional needs. Welfare Principles: The government of UK commissioned an investigation into the welfare of intensively farmed animals. Professor Roger Brambell in 1965 conducted the investigations in response to concerns raised in Ruth Harrison's 1964 book, Animal Machines. On the basis of Professor Brambell's report, the UK government set up the Farm Animal Welfare Advisory Committee in 1967, which became the Farm Animal Welfare Council in 1979. The committee's first guidelines recommended that animals require the freedoms to 'turn around, to groom themselves, to get up, to lie down and to stretch their limbs'. These have since been elaborated to become known as the Five Freedoms of animal welfare: The five freedoms are: 1. Freedom from thirst, hunger and malnutrition 2. Freedom from discomfort due to environment 3. Freedom from pain, injury and disease 4. Freedom to express normal behavior for the species 5. Freedom from fear and distress In its True Sense Animal Welfare Is the State of Its Body and Feeling: " Animal welfare includes not only the state of the animal's body but also its feelings. " Most would agree that animals have feelings (fear, frustration), and it has been proposed that animals welfare consists entirely in feelings and that these have evolved to protect the animal's primary needs. " Thus, if an animal feels well, it is faring well. A feelings based approach to welfare research typically measures behavioral outcomes, such as willingness to "work"(pushing open a weighted door), and behavioral signs of fear or frustration. " Such research has led to the conclusion that animals have fundamental behavioral needs that they must be allowed to satisfy for humane reasons.

*Director, National Institute of Animal Welfare, Ministry of Environment & Forests, Government of India.

219

The first three Freedoms relate to disciplines long studied by veterinarians, animal and fishery scientists and also where the needs of animals are understood and it is accepted that their fulfillment is necessary for both good welfare and good biological performance. At practical level measurements of health, productivity, stress, physiology, immunology, normal vs. abnormal behaviors have all been studied and utilized in welfare assessment by veterinarians and scientists. Traditionally any attempt to discuss an emotional or psychological dimension to animal behavior or welfare was once regarded as mere subjective analysis. A great deal remains to be researched and studied to find ways to objectively assess the parameters in any given situation and assess simultaneously physical changes characteristics in the pathology and physiology of the body's regulatory systems and the mental/ psychological changes. A most important view of welfare is linked to the feelings based approach in other words animal fare best if they can live according to their nature and perform their full range of behaviors e.g. Gene Expression. In this case, physical suffering, such as feeling cold, and mental suffering such as the fear induced by being preyed upon, may not be acceptable. Natural Living Approach: Sectors of the general public favour the "natural living" approach; however, as with physical and mental aspects of welfare, animal welfare scientists have largely discounted this as the sole basis for ensuring optimal welfare. Instead, they propose that the physical, mental, and "naturalliving" aspects of welfare are interrelated and are all of ethical concern. Undoubtedly, the fourth and fifth freedoms of the animals as outlined above come into conflict with human requirements and economics. Hence, these two have largely been ignored. A great deal remains to be done to ensure the compliance with all five freedoms in all areas of animal use.

220

Session-VII
Applied subjects (Anatomy, Biochemistry, Parasitology, Pharmacology and Physiology)

221

L P 1: VII

Vector Identification and their Role in Epidemiology of Canine Babesiosis

Zafar Iqbal Chaudhry, Muhammad Ali and Isma Bashir Nazli* Bahauddin Zakriya University, Multan, Pakistan

Canine babesiosis is increasing in incidence and prevalence and is now a major problem for dogs. During this study, a total of 6204 dogs were examined for babesiosis over a 12 month period round the year in Lahore and 2.62 % were found positive. The dogs were grouped on the basis of age, sex, season and breeds. The male dogs were more prone to disease than female dogs (3.39 vs. 1.32%) whereas, the incidence of disease was higher in younger dogs (6.9%) than older age groups. Crossbreds were more prone to the infection (10.9%) than purebreds. However, none of them were completely resistant. Warm and humid season played a key role in the spread of disease. Predominant vector of the disease was Rhipicephalus spp. Canine babersiosis is caused two distinct species of genus Babesia, the large Babesia canis and the small Babesia gibsoni. The former, is subdivided into three subspecies, that is, Babesia canis canis, transmitted by Dermacentor reticulates in Europe, Babesia vogeli transmitted by Rhipicephalus sanguineus in tropical and subtropical regions and Babesia canis rossi transmitted by Haemaphysalis leachi in South Africa (Uilberg et al., 1989). Babesia gibsoni has been reported from Asia, North America, Northern and Eastern Africa, Australia and Europe (Birkenheuer et al., 1999; Muhnickel et al., 2002; Criado-Fonnelio et al., 2003). The present study was undertaken to identify the vector species and the species of genus Babesia harbored by the ticks removed from the bodies of dog, by PCR-RFLP in and around Lahore. The most frequent tick genera found was Rhipicephalus from 491 (97.2%) dogs out of 507. Genus Dermacentor was found on 14 dogs (0.08%), and Hemaphsalis was found on 2 dogs (0.004 %). Out of the total ticks (507) studied 401 (82%) Rhipicephalis sanguineus ticks harbored Babesia gibsoni, 10 (71%) Demacentor reticulates contained Babesia canis vogeli, while Haemaphysalis leachi contained no babesia in their bodies. This indicates that the babesial species harbored by the ticks seems to be species specific. Introduction The incidence of canine babesiosis is on increase causing severe disease throughout the World due to global warming (Muller et al., 2010). It has got zoonotic potential as well (Spolidorio et al., 2010). Until now there is no evidence in Pakistan about the zoonosis causes by any of species of geninus Babesia. However, Babesia divergens in Europe and Babesia microti have been reported from many countries to be zoonotic (Gray, 2004). The disease is characterized by haemolytic anaemia, icterus, and haemoglobinuria. Canine babersiosis is caused two distinct species of genus Babesia, the large Babesia canis and the small Babesia gibsoni. The former, is subdivided into three subspecies, that is, Babesia canis canis, transmitted by Dermacentor reticulates in Europe, Babesia vogeli transmitted by Rhipicephalus sanguineus in tropical and subtropical regions and Babesia canis rossi transmitted by Haemaphysalis leachi in South Africa (Uilberg et al., 1989). Babesia gibsoni has been reported from Asia, North America, Northern and Eastern Africa, Australia and Europe (Birkenheuer et al., 1999; Muhnickel et al., 2002; Criado-Fonnelio et al., 2003). The present study was undertaken to identify the vector species and the species of babesia harbored by the ticks removed from the bodies of dog, by PCR-RFLP in and around Lahore. Materials and Methods: A total of 100 dogs infested by ticks were included in this study and 507 ticks were removed from various parts of the body of dogs, and collected in the specimen bottles. The ticks were identified using the method described by Soulsby (1982). For identification of various species of genus Babesia, the ticks were chopped finely, separately and about 1 ul material was applied on Flinders Technology Associates (FTA) Classic Cards (Whatman International Ltd, UK), which were cut into one cm wide strips (vertically).

222

Each time a sterile blade was used to avoid DNA contamination of card. The impregnated cards were stored at room temperature in sealed plastic bag containing silica desiccant, until analyzed for the presence babesia species. Nested set of primers (Table 1) was used to amplify a partial region of the 18S rRNA gene of Babesia species (Thompson et al., 1994) alignment was performed using complete 18S rRNA gene sequences of c, available from the Gene Bank database. An external and internal set of primers (Table-1) were designed on the basis of conserved regions of DNA between the aligned sequences using Amplify 2.1 (Eagles, W., University of Wisconsin, Madison). The external primer set amplified an approximately 90bp product, while the internal set amplified an approximately 800bp product (Jefferies, et al., 2003). One l of 50 g/l Proteinase K (Master Pure, Madison, Wisconsin) was diluted into 150 l of 2X T and C lyses solution (Master Pure, Madison, Wisconsin) for each sample. The sample was transferred to a micro-centrifuge tube and 151 l of 2X T and C lyses solution containing the Proteinase K was added and mixed thoroughly. Then 150l of 1xPBS was added to the sample and mixed on vortex. The mixture was incubated at 55oC for overnight; and then vortexed 5 times. Next day the sample was incubated on ice for 5 minutes. One hundred and seventy five microlitre of MPC Protien Precipitation Reagent (Master Pure, Madison, Wisconsin) was added to 300 l of lysed sample and mixture was mixed vigorously on the vortex for 10 seconds. The debris was pelleted by centrifugation for 10 minutes at 10,000 rpm in a micro-centrifuge. If the resultant pellet was clear, or small, or loose, an additional 25 l of MPC Protien Precipitation Reagent, was added and mixed, the debris was pelleted again. The supernatant was transferred to a clean labeled 1.5 ml micro-centrifuge tube and pellet was discarded. Five hundred microlitre of isopropanol was added to the recovered supernatant. All tubes were inverted 40 times. The DNA pelleted by centrifugation for 10 minutes at 10,000 rpm. Isopropanol was carefully pipetted off without dislodging the DNA pellet. Pellet was rinsed twice with 75% ethanol, carefully without dislodging the pellet. All of the residual enathol was removed with a pipette tip or tissue. The DNA was re-suspended in a 20 l of TE Buffer. The sample was mixed on vortex and left at room temperature approximately for an hour to rehydrate the DNA pellet. The protocol recommended by the Whatman is available at http://www.whatman.com/ FTANecleicAcidCollectionStorageandPurification.aspx. The DNA was amplified and subjected to RFLP as mentioned latter. The sensitivity of the extraction method and the limit of detection were assessed by cutting the sample applied to the card according to their weight, which were 0.5g, 1g, 1.5g, 2g, 2.5g. The tick samples were subjected to PCR-RFLP to detect Babesia gibsoni and Babesia canis vogeli, as single infection or co-infections of both the Babesia species. The primer sequences were BLAST, to find out whether they do or do not amplify any other DNA.One l of extracted DNA was added to a 24 l reaction mixture comprising 0.6875 units of the taq Plus DNA polymerase (Fisher Biotech, Australia), 200 M of each dNTP, 12.5 pico moles of the forward and reverse primers (Invitrogen, Australia), 2.5l 10x PCR buffer (Fisher Biotech, Australia), and 1.5l MgCl2 (Fisher Biotech, Australia), Positive (1 l of B.gibsoni or B. canis DNA) and negative (1 l of dH2 O) control samples were included with each set of PCR reactions. Amplification was performed on a GeneAmp PCR system 2700 thermal cycler (Applied Biosystems, USA). For the primary round of amplification, an initial activation step at 94C for 3 minutes, 58C for 1 minute, 72C for 2 minutes, was followed by 45 cycles of amplification (94C for 30 seconds, 58C for 20 seconds, 72C for 30 seconds) and a final extension step of 72C for 7 minutes for 25l reaction. The same conditions were followed for secondary round of amplification, except that the annealing temperature was increased to 62C, using 1l of DNA template from the primary reaction (Jefferies et al., 2003). Gel electrophoresis of PCR products was performed using 1% agarose (Promega, Madison, USA) gels in TAE buffer (40mM Tris-HCL, 20mM acetate, 2mM EDTA). Gels were prestained with ethidium bromide (Amresco, USA). A 1kb bp molecular weight marker (Promega, Madison, USA) was run for all gels to determine the size of PCR product. Electrophoresis was performed using a Minisub electrophoresis cell (Biorad) at 90 V for 40 minutes and DNA was visualized by UV transillumination. Purification was carried out using the freeze squeeze method. Amplified DNA was electrophoresed on a

223

1.5% agarose gel (90 V, 40 minutes). The gel was viewed under ultra-violet light and the appropriate sized band was cut out using a scalpel blade. Each band was cut out using a separate scalpel blade to avoid contamination of DNA. The bands were each placed in separate 1.5ml eppendorf tubes and allowed to freeze overnight. The gel was squeezed between 2 folded halves of parafilm to extract liquid. This liquid was placed in fresh eppendorf tube. To a tenth of the extract volume, 3M sodium acetate was added and to double the extract volume, 70% ethanol was added. The mixture was vortexed and then centrifuged at a 14000 rpm for 5 minutes. The supernatant was discarded and the pellet was vacuum dried. Finally, 10l of water was added to the dried pellet. DNA was sequenced using an ABI PrismTM Dye Terminator Cycle Sequencing Kit (Applied Biosystems, (ABI). Foster city, California) according to the manufacturers instructions, with the following modifications: Amplification was carried out in 10l reaction mixture containing the following: 1l of the forward or reverse primer diluted to 3.25pmol/l, 1l of dye terminator solution, 1.5l of sequencing buffer (Genpak Inc., Stony Brook, New York), 5.5l of H20 and 1l of purified template. 38 cycles of amplification (96 oC for 2minutes, 96 oC for 10 seconds, 60 oC for 5 seconds and 60 oC for 4 minutes) was preceded by an initial denaturation of 60 oC for 1 minute and followed by a holding temperature of 15 oC. Transferred the amplified DNA to 0.6ml tube. To 10 l amplified DNA, Twenty-five microlitres of 100% ethanol, 1 l of 125mM EDTA and 1 l of 3M sodium acetate were added. This solution was mixed gently using a pipette, then incubated at room temperature for 20 minutes and then centrifuged for 30 minutes at 14000 rpm. The supernatant was carefully removed with a pipette and 125l of 70% ethanol was added to the remaining precipitate. The tube was spun for 5 minutes at maximum speed. The supernatant was carefully removed and the insides of the tubes were dried with kimwipes (Kimberly-Clark, Australia Pty. Limited). The sample was vacuumed dried in a vacuum desiccator for 1 hour. The sequenced products were analyzed using the program seqEd v.1.0.3 (ABI) and were compared to sequence data available from GenBankTM, using the BLAST 2.1 program (http:// www.ncbi.nlm.nih.gov/BLAST/). RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP). A restriction fragment length polymorphism (RFLP) technique was designed to permit discrimination between each of the canine piroplasm species and, in particular, Babesia canis and Babesia gibsoni in ticks picked from the dogs in Lahore. Complete sequences of the 18S rRNA gene each of the canine species and subspecies available on GenBank database were imported into the program Amplify 2.1 (Engels, W., University of Wisconsin, Madison) and the target region of DNA was determined using the internal primer set (BTF2 and BTR2). The sequence of the amplified internal PCR product was then used in DNA Strider1.0 (Marck, 1988) to determine the most suitable restriction enzymes for discriminating between the canine Babesia species. Six l of amplified DNA from the secondary PCR reaction was subjected to restriction enzyme digestion in a reaction mixture of 16.3l of dH2O, 2.0 l of Buffer B (Promega, Madison, USA), 0.2 l of Bovine serum albumin acetylated (Promega, USA). The reaction mixture was gently mixed 0.5l of the appropriate restriction enzyme, (Hinf I, Hinc II or Ava II) (Promega, USA) was added and then incubated at 370 C for 2 hours. Restriction Products were then subjected to electrophoresis at 80 volts for 1 hour on a 3% agarose gel (Promega, USA) stained with Ethidium bromide and visualized using UV illumination. Table 1: External and Internal primer sets for the amplification of a partial region of the 18S rRNA gene of most Piroplasmida species. Primer name Sequence BTF1 (external) 5 GGCTCATTACAACAGTTATAG 3 BTR1(external) 5 CCCAAAGACTTTGATTTCTCTC 3 BTF2 (internal) 5 CCGTGCTAATTGTAGGGCTAATAC 3 BTR2 (internal) 5 GGACTACGACGGTATCTGATCG 3

224

RESULTS AND DISCUSSION The data regarding the ticks removed from the dogs in and around Lahore. The most frequent tick genera found was Rhipicephalus from 491 (97.2%) dogs out of 507. Genus Dermacentor was found on 14 dogs (0.08%), and Hemaphsalis was found on 2 dogs (0.004 %). Out of total 507 ticks 274 were males and 234 were females. Table 2: Showing Various Genera of Ticks on Dogs Tick Genus Number of Ticks Amblyomma Boophilus Hyalomma Rhipicephalus 491 Dermacentor 14 Ixodes Haemaphysalis 2 Total 507 Table 3: Various species of Genus Babesia recovered from Ticks Tick Genus B. canis canis B. canis vogeli Rhipicephalus sanguineus 10(8 females Dermacentor reticulatus and 2 males) Haemaphysalis leachi

B. canis rossi

B. gibsoni 401 (395 females and 6 males)

The diagnostic tests for babesiosis can be divided into three categories; the conventional tests including microscopy and culture, serological techniques, and molecular based tests. A combination of detection techniques is desirable. In the present study morphological and molecular techniques were used to identify the Babesia species. Out of the total ticks (507) studied 401 (82%) Rhipicephalis sanguineus ticks harbored Babesia gibsoni, 10 (71%) Demacentor reticulates contained Babesia canis vogeli, while Haemaphysalis leachi contained no babesia in their bodies. This indicates that the babesial species harbored by the ticks seems to be species specific. The results obtained by nested PCR-RFLP were confirmed by sequencing of amplified DNA sequences. Canine babersiosis is caused two distinct species of genus Babesia, the large Babesia canis and the small Babesia gibsoni. The former, is subdivided into three subspecies, that is, Babesia canis canis, transmitted by Dermacentor reticulates in Europe, Babesia vogeli transmitted by Rhipicephalus sanguineus in tropical and subtropical regions and Babesia canis rossi transmitted by Haemaphysalis leachi in South Africa (Uilberg et al., 1989). Babesia gibsoni has been reported from Asia, North America, Northern and Eastern Africa, Australia and Europe and Eastern Africa, Australia and Europe (Birkenheuer et al., 1999, Muhlnickel et al., 2002 and Criado-Fornelio et al., 2003). Gray et al. (2004) has reported that babesiosis is most prevalent arthropod disease of humans in the temperate northern hemisphere. The main parasites involved are Babesia divergens in Europe and Babesia microti in USA diagnosed by new molecular tools. Growing incidence of canine babesiosis was recorded in Slovakia during the last decade. The highest prevalence of B. canis canis was observed in D. reticulates, from eastern Slovakia, (14.7%; n=1250). Notably, all the 874 D. reticulates collected from low lands were negative for any Babesia canis species (Kubelona et al., 2011). The findings of present study are not in agreement with the findings of latter workers. This might be due to geographical factor. REFERENCES Abdalla, H.S., H. S. Hussein and J. P. Kreier, 1978. Babesia rodhaini: passive protection of mice with immune serum. Tropenmed. Parasitol., 29: 295306.

225

Abdussalam, M., 1959. Ticks in relation to disease in Indo-Pak, Proc. 11th Pak. Sci. conf. G1 G17. Afzal, M., M. M. Saeed, A. Rabbani and K. Saeed, 1991. Babesiosis in domestic animals in Lahore.J. Anim. Health and Prod., 11: 1- 4. Birkenheuer, A. J., M. G. Levy, K. C. Savary, R. B. Gager and E. B. Breitschwerdt, 1999. Babesia gibsoni infections in dogs from North Carolina. J Am Anim Hosp Assoc., 35: 125-8. Criado-Fornelio, A., M. A. Gonzalez-del-Rio, A. Buling-Sarana and J. C. Barba-Carretero, 2003. Molecular characterization of a Babesia gibsoni isolate from a Spanish dog. Vet Parasitol., 117: 123-129. Daynes, P and J. Gutierrez, 1980. Seasonal variations in the parasitic activity of Boophilus microplus in New Caledonia. Rev Elev Med Vet Pays Trop., 33:305310. Drummond, R. O., 1967. Seasonal activity of ticks on cattle in south western Texas. Ann Ent Soc Amer., 60: 439447. Euzeby, J., 1987. On the taxonomy of Babesiidae (piroplasma) parasitic in mammals. Veterinarski Arhiv., 57: 167-175. Francis, S., 1966. Resistance of zebu and other cattle to tick infestation and babesiosis with special reference to Australia: an historical review. Br. Vet. J., 122: 301-307. Fukumoto, S., H. Suzuki, I. Igarashi and X. Xuan, 2005. Fatal experimental transplacental Babesia gibsoni infections in dogs. Int J Parasitol., 35: 1031-1035. Gern, L., A. Kindler and M., Brossard, 1983. Etude dun foyer de piroplasmose bovine en Suiss . Proc. 2nd Int. Conf. Malaria and Babesiosis. Annecy, Sept. 1983, p.195. Ghosh, S., G. C. Bansal, S. C. Gupta, D. Ray, M. A. Khan, H. Irshad, M. D. Shahiduzzaman, U. Seitzer and J. S. Ahmad, 2007. Status of tick distribution in Bangladesh, India and Pakistan. Parasitol., Res 101 (Suppl 2): S207S216 Hall, W. T. K (1963). The immunity of calves to Babesia argentina infection. Aust. Vet. J., 39: 386-389. Hillyard, P.D., 1996. Diseases carried by ticks in NW Europe: their medical and veterinary importance. In ticks of North West Europe. Synopsis of the British Fauna (New series) (R. S. K. Barnes and J. H. Coles., eds.): 22-23. Iqbal, M., 1971. Studies on the ectoparasites of the livestock with special emphasis on the incidence, economic losses and chemotherapy. M.S. Thesis, Dept Vet Parasitol., Univ Agri, Faisalabad, Pakistan. Jacobson, L. S., 2006. The South African form of severe and complicated canine babesiosis: Clinical advances 19942004. Vet. Parasitol., 138: 126-139. Johnston, L.A.Y., G. Leatch and P.N. Jones, 1978. The dfuration of latent infection and functional immunity in Droughmaster and Hereford cattle following natural infection with Babesia argentina and B.bigemina . Aust. Vet. J., 56: 14-18. Kaiser, M. N and H. Hoogstraal, 1964. The Hyalomma ticks of Pakistan, India and Ceylon with key to subgeneral and species. Acarologia., 6: 257-286. Krause, P. J., T. Lepore, V. K. Sikand, J. Gadbaw Jr., G. Burke, S. R. Telford, P. Brassard, D. Pearl, J. Azlanzadeh, D. Christianson, D. McGrath and A. Spielman, 2000. Atovaquone and azithromycin for the treatment of babesiosis. N Engl J Med., 343: 1454-8. Kuttler, K. L., 1988. Chemotherapy of Babesiosis. In Babesiosis of domestic animals and man, edited by Ristic M, CRC Press, Florida, USA. Levine, N. D, 1988. The protozoan phylum Apicomplexa. Volume I. Volume II. CRC Press Inc., Boca Raton, FL 33431; USA, 203 + 154 p. Levy, M. G., G. Clabaugh and M. Ristic, 1982. Age resistance in bovine babesiosis: role of blood factors in resistance to Babesia boris. Infect. Immun., 37: 1127-1131. Mahoney, D. F., 1967. Bovine babesiosis: The passive immunization of calves against Babesia argentina with special reference to the role of complement fixing antibodies. Exp. Parasitol., 20: 119-126. Martinod, S., M. Brossard and Y. Moreau, 1985. Immunity of dogs against Babesia canis, its vector tick Dermacentor reticulatus, and Ixodes ricinus in endemic area. J Parasitol., 71: 269-73. Martinod, S., N. Laurent and Y. Moreau, 1986. Resistance and immunity of dogs against Babesia canis in an endemic area. J. Vet. Parasitol., 19: 245-254.

226

Mathe, A., 2006. Clinicopathological alterations in canine babesiosis. Ph.D thesis. Szent Istvan Uni. Badapest. Muhlnickel, C. J., R. Jefferies, U. M. Ryan and P. J. Irwin, 2002. Babesia gibsoni infection in three dogs in Victoria. Aust Vet J., 80: 606-10. Nakabayashi, T., Omata, Y., and Suzuki, N., 1978. Transmission and serum antibodies from mother to litters in rats infected with Plasmodium berghei. Protozoan disease, JGAPD., 1 : 161-168. Palmer, T. T., 1978. Plasmodium berghei infection pregnant rats: Effects on antibody response and course of infection in offspring. J. Parasitol., 64: 493-496. Patton, W. S., 1910. Preliminary report on a new piroplasm (Piroplasma gibsoni sp. Nov.) found in the blood of the hounds of Madras Hunt and subsequently discovered in the blood of the jackel Canis aureus. Bulletin de la Societe de Pathologie Exotique., 3: 274-280. Piana, G. P and B. Galli-Valerio, 1895. Su di un infezione del cane con parassiti endoglobulari nel sangue. Mod. Zooiatr., 6:163. Porchet, M. J., H. Sager, L. Muggli, A. Oppliger, N. Muller, C. Frey and B. Gottstein, 2007. A descriptive epidemiological study on canine babesiosis in the Lake Geneva region. Schweiz Arch Tierheilkd., 149(10): 457-65. Riek, R. F., 1963. Piroplasms. In: P.C. Garnham, A.E. Pierce and I. Roitt (Editors), Immunity to Protozoa. Blackwelt Scientific Publications, Oxford, pp., 160-170. Ristic, M., ed., 1988. Babesiosis of Domestic Animals and Man. CRC Press, Boca Raton, FL. Ristic, M., G. R. Healy and P. Arambulo, 1982. Babesiosis., In CRC handbook. Roberts, J. A and P. D. Tracey-Patte, 1975. Babesia rodhaini: a study of the effects of immune serum. Int. J. Parasitol., 5: 577-581. Sandor, H., R. Edelhofer and R. Farkas, 2006. Seroprevalence of canine babesiosis in Hungary suggesting breed predisposition. J. Parasitol. Res., 99: 638-642. Shen, Y., J. Gao, K. Xu, D. Li, Y. Zhang, X. Wei and S. Hugcuhi, 1997. Babesiosis in Nanjing area, China.Trop. Anima. Hlth Prod., 29: 19-22. Susan, E. S., J. D. Michael, R. J. Birtles and E. B. Breitschwerdt, 2001. Tick borne infectious diseases of dogs. Trends.in Parasitol., 17: 74-80. Uilenberg, G., F. F. Franssen, N. M. Perie and A. A. Spanjer, 1989. Three groups of Babesia canis distinguished and a proposal for nomenclature. Vet Q., 11: 33-40. Whitbread, T.J., R. M. Batt and G. Garthwaite, 1984. Relative deficiency of serum IgA in the German shepherd dog: a breed abnormality. Res. Vet. Sci., 37: 350352. Wright, I. G., M. White, P. D. Tracey-Patte, R. A. Donaldson, B. V. Goodger, D. J. Waltisbuhl and D. F. Mahoney, 1983. Babesis boris: isolation of a protective antigen by using monoclonal antibodies. Infect. Immun., 41: 244-250.

227

L P 2 : VII

Drug delivery system in canines

A. Manimaran and A. K. Srivastava National Dairy Research Institute, Karnal-132 001

Introduction The development of new drug is expensive and time consuming process. On other hand, improvement of the safety and efficacy of existing drugs would be the attractive alternative way in veterinary therapeutics in order to reduce toxicity and cost. The most important reason for limited potency or efficacy of many drugs is due to biochemical degradation, differential capabilities of drug metabolizing enzymes or drug transporters, which make insufficient concentration at the target site. The sufficient concentration at the target site is depends on size of the drug molecules. So, decrease the size or increase the persistence in systemic circulation without degradation would be possible way to increase the bioavailability of the drugs. The recent development in the biomedical technology paves the way for this existing problem. However, the economic feasibility of the costly technology hampers the common usage in companion animals therapeutics. Compare to food animal practice where much stringent regulatory process; development of drugs for small-animal needs less regulation with respect to food safety issues. Biological similarities in patho-physiology of both human and small animals disease further helps to identify the drug candidates molecules for companion animals. The growing preclinical research of novel technologies by using companion animals like dogs, as an animal model further authenticate the future possibilities of canine drug development. The technologies developed during recent years have improved the either drug discovery process (ex. High-throughput screening) or drug development process (ex. nanotechnology, drug delivery system and sophisticated computational pharmacology using computer to predict ADME). Further understanding about drug metabolizing enzymes, drug transporter, and its influence on the pharmacokinetics (Absorption, Distribution, Metabolism and Excretion; ADME) and pharmacodynamic of the drugs increased the basic knowledge of therapy. Among the various recent technologies, nano-biotechnology has important role in drug therapy in humans and animals. Global scenario of the drug delivery system The global market for animal health products was 7.3 billion during 2002-03 with 5% growth. Expenditures on animal health are increasing 7% per year at the global level. The global market for advanced drug delivery systems amounted to $134.3 billion in 2008 and projected to increase to $196.4 billion in 2014, with compound annual growth rate of 7.2%. The largest segment of the market is targeted drug delivery, followed by sustained-release products. The following picture depict the global revenue ($ millions) of advanced drug delivery systems by region during 2009-2016.

Role of nanotechnology in drug delivery process: Although the nanotechnology has wide range of application in animal sciences, drug delivery system is the most valuable nanotechnology mediated drug therapy (Table 1). In biological system, most of

228

the cellular structures exist at nanoscale level and thus the molecules which need to control this system should be at same scale. Drug delivering includes at controlled release, slow delivery, and targeted delivery The other important applied areas in veterinary discipline are diagnosis (ex. Instant analysis of the microbes or chemical contaminants in biological samples using biochips, nanosensors), breeding and reproduction (implantation of the nanotubes in order to track the estrus animals based on the estrogen level) and food safety issues through identity preservation. Drug delivery system in canine: Although the recent technologies are concerned about human pharmaceuticals, veterinary counterparts have also explored the possibilities as they have benefits and opportunities to the clients. It has been estimated that 70% of total sales of controlled drug delivery was for food-producing animals and 30% of the total market share for companion animals. Controlled delivery of antimicrobial- and antiparasiticagents and fertility control are important areas of applications in companion animals. Unlike the domestic animals practice where owners always compare cost of treatment with benefit results, companion-animal products may provide the higher profit as the high emotional value and financial resources with pet animal owners. Some preliminary clinical trials on the tolerability and efficacy of radioactive gold nanoparticle (198AuNP) brachytherapy for canine prostate cancer were shown to be effective. Target-mediated delivery of anticancer drugs to dogs in advanced stage of cancer has been shown to reduce the cancer burden in dogs. Although not every animal achieves complete reduction, the lack of side effects of chemotherapy despite repeat dosing, improvements of quality of life are clear evidence for future development. Biodegradable ocular inserts impregnated with gentamicin were designed for the treatment of dogs (Vetoquinol, Lure, France). Bioadhesive oral topical devices against gingivitis and periodontis in dogs has been developed using chlorhexidine diacetate and niacinamide (Stomadhex; Vetoquinol) for its antimicrobial, antiinflammatory, healing and antifungal properties. Biodegradable cross linked high amylose starch matrixciprofloxacin implants mediated drug delivery system has been shown to very effective in the treatment of osteomyelitis in experimental dogs. Increased penetrations of the ciprofloxacin in the remote area further substantiate the future possibilities. Apart from human being, the dog is the only animal develops spontaneous cancer. So, dog is the recognized animal model for testing and validation of targeted drug delivery nanoparticle and thus clinical application would be possible in future in canine therapy. Conclusion To increase the safety and potency of drugs, new drug delivery systems have made revolutionary changes in pharmaceuticals. Unlike uncontrolled drug release into entire body, time- and spatial-dependent release of the drugs not only increases the efficacy, it would be the promising way to reduce the possible side-effects of the drugs. Nanostructured mediated drug delivery system are promising tool to efficient and targeted delivery of novel drug compounds. Sustained drug release preparations and intracellular penetration through nanoscale drug delivery system are promising ways to minimize toxicity and direct treatment of the cause, rather than the symptoms of the disease. Improvement in vaccine delivery with antigen engineered nanocarriers are anticipated to be immunologically more effective than traditional dosage forms as, they are specifically act on target and can be retained at the desired site of action. Although human pharmaceutical dominate drug delivery products in cardiovascular, anti-inflammatory, antipsychotic or anti-tumour drugs, therapeutic application in pet animal practice is still infancy and may expect in future. The growth of pet animals health sector during last decades in UK and USA (more than half of the total market) shows the future development. The major barriers to growth on the animal healthcare are small contribution and less profit compare to human pharmaceutical sector. Adaptation of existing human pharmaceutical products in companion animal market and avoidance of time consuming costly drug development programmes would be the better strategy for short term benefits. The recent developments of the crossover products (developed originally for human purpose and adopted in pet animal health suggest its importance. However, strengthening of the R & D not only helps in long-term future, it will

229

reduce the cost of daily administering drugs, visiting time of veterinarian and improve the animal health and thus welfare. Establishment of veterinary pharmaceutical is important to design the dosage for development of veterinary drug delivery system. Table 1: Application of the nanotechnology mediated drug delivery system (DDS), its importance and advantages

230

231

LP 3: VII

Pathology and pathogenesis of canine flu

A.K. Srivastava Department of Pathology, College of Veterinary Science, DUVASU, Mathura

Canine Flu is a highly contagious respiratory infection of dogs that is caused by influenza virus. The canine influenza virus (CIV) is closely related to the virus that causes equine influenza. The H3N8 influenza virus spread to dogs and has adapted to cause disease in dogs and easily transmitted between dogs. It is now believed to be a dog-specific H3N8 virus (Meyer, 2006). The Canine Influenza Virus subtype H3N8 was first identified in January, 2004 during an outbreak of respiratory infection amongst Florida racing greyhounds. This virus is an Influenza A virus and on typing was found to be closely related to the equine influenza virus. In fact, canine influenza is now considered to have originated when the equine influenza virus jumped species during the year 1990s. The exposure and transfer apparently occurred at horse racing tracks, where dog racing also occurs. This was the first evidence of influenza A virus causing disease in dogs. However, serum collected from racing Greyhounds between 1984 and 2004 and tested for canine influenza virus (CIV) in 2007 had positive tests going as far back as 1999. It is possible that CIV caused some of the respiratory disease outbreaks at tracks between 1999 and 2003 which went un noticed (Marie, 2007). More recently there have been reports of additional influenza subtypes infecting dogs which include avianorigin influenza H3N2 in South Korea in 2007 and mortality in a dog due to feeding of infected duck flesh with avian strain of H5N1 virus in Thailand in 2006 and the new North American H1N1 in New York State in 2009 (Songserm et al, 2006). There is no evidence that the virus can be transferred to humans, horses, cats, or other species (Crawford et al, 2006). The virus Influenza viruse represent a specific type of virus. Unless a mutation occurs, influenza virus strains are specific to host species. Human influenza only infects humans. Equine influenza only infects horses. Canine influenza only infects dogs. The virus has on its surface an assortment of proteins that determine its strain or subtype, and it is against these surface proteins that the hosts mount an immune response. If a viral strain mutates and sufficiently changes its surface proteins, a new strain is created. A new strain is one where the susceptible population has no immunity and infection can spread rapidly. There are actually three types (genera) of influenza viruses- type A (including the canine influenza virus), type B, and the less closely related Type C. They usually produce fever, joint pain, and respiratory signs. Death is unusual but causes respiratory complications which are most common in very old and very young one. Canine influenza virus (CIV) is caused by novel influenza A subtype H3N8 virus based on the amino acid composition of the hemagglutinin (H) and neuraminidase (N) glycoproteins in the lipid outer layer of the capsid. These glycoproteins facilitate entry and release from host cells and are important targets for antibodies against the virus (generated as a result of infection or response to vaccination). The virus is 80-120 nanometers (nm) in diameter, and consist of a core of eight separate pieces of single-strand ribonucleic acid (RNA) surrounded by a spiked arrangement of glycoproteins. Influenza A virus is enveloped negative sense single-stranded RNA virus. Genome analysis has shown that H3N8 was transferred from horses to dogs and then adapted to dogs through point mutations in the genes (Buonavoglia, 2007). The incubation period is two to five days and viral shedding may occur for seven to ten days following the onset of symptoms. It does not induce a persistent carrier state. Molecular studies also indicate that canine influenza represents a mutation from the equine influenza virus. CIV infection can cause respiratory disease by itself or in conjunction with other respiratory pathogens such as Distemper virus, respiratory corona virus, para influenza virus Bordetella bronchiseptica etc. It is important to note that influenza virus is not related to parainfluenza virus and infection or vaccination for one does not induce cross-protective immunity against the other.

232

Transmission Similar to other respiratory pathogens, the most efficient transmission occurs by direct contact with infected dogs and by aerosols route as a result of coughing and sneezing. Dogs have the highest level of virus in their secretions, 2-4 days after they are exposed to virus. Often they are not yet showing clinical signs when they are most at risk of transmitting the virus. Dogs may be able to spread the virus for up to 10 days. The virus can contaminate kennel surfaces, food and water bowls, collars and leashes, and the hands and clothing of people who handle the infected dogs. Influenza virus can remain viable on surfaces for up to 48 hours, on clothing for 24 hours and on hands for 12 hours. Fortunately, the virus is easily inactivated by washing hands with simple disinfectant. Signs and Symptoms When a dog is infected, the symptoms range from subclinical to death. About 80% of infected dogs with H3N8 show usually mild symptoms and rest may have subclinical infection (Carter, et al, 2006). The fatality rate in general in pet and shelter dogs is less than 1 % (de Morais and Autran, 2006). The primary indicators of dog flu are cough, fever and running nose. In severe cases, the dog may suffer from acute pneumonia. Fortunately, most of the sufferers have the mild form of this illness. Those animals that are more susceptible to serious illness are young puppies, old dogs and dogs with weakened immune systems. Infected animals may show symptoms within two to five days post exposure. There are additional symptoms that can accompany the cough, running nose and fever. These include listlessness, depression, breathing difficulties, serous rhinitis and dehydration. Two clinical syndromes have been seen in dogs infected with the canine influenza virus-a mild form and a more severe form of the disease. ?Mild form-Dogs suffering with the mild form of canine influenza develop a soft, moist cough that persists for 10 to 30 days. Some dogs have a dry cough similar to the kennel cough caused by Bordetella bronchiseptica / parainfluenza virus complex. For this reason, canine influenza virus infections are frequently mistaken for kennel cough. Dogs with the mild form of influenza may also have a thick nasal discharge, which is usually caused by a secondary bacterial infection. ?Severe form-Dogs with the severe form of canine influenza develop high fevers (104F to 106F) and have clinical signs of pneumonia, such as increased respiratory rates and effort. Pneumonia in these dogs is not caused by the influenza virus, but by secondary bacterial infections. The fatality rate of dogs that develop pneumonia secondary to canine influenza can reach 50 percent if not given proper treatment (Sophia, 2007). Necropsies in dogs that die from the disease reveal severe hemorrhagic pneumonia and evidence of vasculitis (Yoon et al, 2005). Pathogenesis Influenza virus replicates in epithelial cells lining the airways from the nose to the terminal airways in the lungs. Peak viral shedding from the upper respiratory tract starts during the incubation period of 2-4 days ,therefore, dogs are most contagious prior to showing obvious clinical signs. Dogs with subclinical infection also shed virus. Virus shedding decreases substantially during the first 4 days of illness, but continues up to 7 days in most dogs, and to 10 days in some dogs. Once virus shedding ceases, the dog is no longer contagious. Therefore, it is unlikely that dogs pose a significant infectious risk 10 to 14 days after onset of clinical signs. Following viral replication in epithelial cells causes necrosis and exposure of the basement membrane. This exposure predisposes to secondary infections by a variety of gram positive and gram negative commensal bacteria, including Streptococcus sp. Staphyloccocus sp. E. coli, Klebsiella, Pasteurella multocida, and Mycoplasma spp. These bacteria contribute to development of purulent nasal discharge and productive cough. The viral and secondary bacterial infections initiate an intense inflammatory response resulting in rhinitis, tracheitis, bronchitis, and bronchiolitis. Fortunately, most of the infected dogs recover within 2-3 weeks without any further health complications. However, some dogs progress to pneumonia, which is usually due to secondary bacterial infections. The overall mortality rate for canine influ-

233

enza is very low. The secondary pneumonia develops due to contamination by invaders can be life threatening. Diagnosis Canine influenza cannot be diagnosed solely by clinical signs because the clinical signs (coughing, sneezing and nasal discharge) are similar to those associated with all of the other respiratory pathogens and cannot be differentiated from them. Antibodies to canine influenza virus may be detected in the blood as early as seven days after onset of clinical signs and the virus may be identified in nasal or pharyngeal swabs during the first 4 days of illness. The most reliable and sensitive method for confirmation of infection is serological testing. Paired acute serum samples (taken within the first 7 days of illness) and convalescent serum samples (taken 10-14 days later) are necessary for diagnosis of recent infection. If an acute sample is not available, a convalescent sample will indicate whether a dog has been exposed to the virus at some point in the past. A diagnosis of is made based on a four-fold increase in antibody titer from the acute to the convalescent sample. If a dog has been ill for less than 4 days, nasal and pharyngeal swab submission for Polymerase Chain Reaction (PCR) testing can be performed. If the PCR indicates a positive result, the dog is most likely infected. Negative PCR results may be falsely negative if the swabs are not collected during the time of peak virus shedding. After 4 days of illness, PCR results are less likely to be reliable. Serology should be performed to confirm infection, especially if the PCR results are negative and the case is highly suspicious for CIV infection. Other diagnostic options applicable to dogs that have died from pneumonia are viral culture and PCR analysis using fresh (not formalin-preserved or frozen) lungs and tracheal tissue. Virus detection in respiratory secretion specimens from acutely ill animals by use of viral culture / PCR analysis, / rapid chromatographic immunoassay is possible, but usually unrewarding. Treatment Since canine influenza is a viral infection, treatment consists mainly of supportive care based on clinical signs and laboratory tests. Although there is no specific antiviral treatment for canine influenza. A variety of secondary bacterial infections may play a significant role ,therefore, the antibiotics are indicated for dogs having fever, productive cough, and purulent nasal discharge. Nasal secretion usually responds within days to treatment with a broad spectrum bactericidal antibiotic, but cough may persist for 10 to 30 days. Antitussives are not very effective in reducing frequency and duration of coughing, and should not be used on dogs with productive cough. Dogs that develop pneumonia usually require hospitalization for intravenous fluids and parenteral antibiotics. Ideally, a transtracheal or endotracheal wash for bacterial culture and antibiotic sensitivity testing should be performed to target the choice of antibiotic. For dogs in which cultures are not performed, empirical treatment with a broad spectrum combination of bactericidal antibiotics may be recommended to cover gram positive, gram negative, aerobic, anaerobic infection. For more severe cases of pneumonia, oxygen supplementation and nebulization has been very beneficial. Prevention There is no vaccine for canine influenza at this time. The best prevention is to limit the amount of possible exposure at places such as grooming facilities, dog parks or other confined situations. If you bring a dog from any place where it has been kept in conditions favorable to canine influenza, keep them separate from your other dogs until the normal incubation period has passed (a week to 10 days). If your dog comes down with symptoms appearing to be canine influenza, immediately isolate it from other dogs in the house and seek veterinary attention immediately. References Buonavoglia, C and Martella, V (2007). Canine respiratory viruses. Vet. Res. 38 (2): 35573.

234

Carter, G.R.; Flores, E.F.; Wise, D.J. (2006). Orthomyxoviridae. A Concise Review of Veterinary Virology. http://www.ivis.org/advances/carter/Part2Chap20/chapter.asp?LA=1#Canine. Crawford, C.; Dubovi, EJ. ;Donis, RO.; Castleman, WL. ;Gibbs, EPJ. ;Hill, RC. ;Katz, JM. ;Ferro, P. and Anderson TC (2006). Canine Influenza Virus Infection. Proceedings of the North American Veterinary Conference. http://www.ivis.org/proceedings/navc/2006/SAE/218.asp?LA=1. de Morais and Helio, Autran (2006). Canine influenza: Risks, management, and prevention. Veterinary Medicine (Advanstar Communications) 101 (11): 714. Marie, R (2007). CIV may have started circulating earlier than originally thought. Veterinary Forum (Veterinary Learning Systems) 24 (7): 12. Meyer M. (2006) UF Veterinary researchers discover a new disease in dogs. Explore: Research at the University of Florida; 2006:11. Songserm, T. ; Amonsin, A. ;Jam-on, R. ;Sae-Heng, N.P; Ariyothorn, N. ;Payungporn, S. ;Theamboonlers, A. ; Chutinimitkul, S. ;Thanawongnuwech, R. and Poovorawan, Y (2006). Fatal avian influenza A H5N1 in a dog. Emerging Infect. Dis. 12 (11): 17447. Sophia Yin (2007). Managing canine influenza virus. Veterinary Forum (Veterinary Learning Systems) 24 (9): 4041. Yoon, K. ;Cooper, V. ;Schwartz, K. ;Harmon, K. ;Kim, W. ;Janke, B. ;Strohbehn,J. ;Butts, D. and Troutman, J (2005). Influenza virus infection in racing greyhounds. Emerging Infect. Dis. 11 (12): 19746.

235

Abst 1: VII

Angiographgy of arterial vascular pattern of some pelvic limb muscles as a guide for experimental muscle transplantation in dogs
Abuzeid, S.M.S.; Awad, M.A.1; Ahmed, I.H.1 and El-Daharwy, M.H.1 Department of Anatomy, Suez Canal University

The vascular patterns in gracilis, sartorius, semimembranosus, adductor, semitendinosus, biceps femoris, rectus femoris, superficial gluteal and tensor fascia latae muscles of five adult dogs were identified angiographically and by gross dissection in order to obtain a clear picture to the site of entrance and intramuscular arterial distribution. Angiography was performed in vitro on the selected muscles after injection of the animals with colored radio-opaque material (red lead oxide suspended in vegetable turpentine oil 1:1 weight: volume) via the common carotid artery. The present study aimed to provide knowledge of the vascular pattern of the muscles which might allow the reconstructive surgeon a mean of recognizing the muscle with greatest margin of safety for use in the management of difficult wound. The vascular pattern in the selected muscles showed three types.Type II -showing dominant vascular pedicle(s) and minor vascular pedicle(s) (superficial gluteal, tensor fascia latae, Gracilis, cranial part of sartorius, semitendinosus, biceps femoris and rectus femoris muscles), Type III- showing two dominant pedicles from different sources (semimembranosus and adductor muscles) and Type IV- showing segmental vascular pedicles with segmental distribution (caudal part of sartorius muscle). Neither type I nor type V was found in any of the selected muscles. An example of type II vascular pattern, gracilis musclewas experimentally transplanted. At 60 days post operation, the implanted muscle showed normal appearance and architecture with minimal fibers atrophy with little adipose tissue replacement at the middle section of the flap as confirmed histologically. Post operation angiography showed patency and normal direction of the proximal caudal femoral pedicle and vascular pattern. 1 Surgery, Faculty of Veterinary Medicine, Abst 2 : VII

Inhibition of oxidative stress and apoptosis in peripheral blood of dogs with canine monocytic ehrlichiosis
S.K. Behera, U. Dimri, R. Jhambh and A.M. Kumara Division of Veterinary Medicine, Indian Veterinary Research Institute, Izatnagar-243 122, Uttar Pradesh, India

Ehrlichia canis is an obligatory intracellular bacterium that resides in a vacuole in the cytoplasm of monocytes. Several authors have reported the inhibitory effect of other ehrlichial organisms such as E. ewingii, Anaplasma phagocytophilum, E. chaffeensis on apoptosis. The present study was aimed to investigate the effect of E. canis infection on apoptosis of mononcytes and erythrocytic oxidant/antioxidant status in vivo in infected animals. A total of twenty clinically infected dogs were chosen to analyze apoptosis of peripheral blood mononuclear cells (PBMC). While, oxidant/antioxidant status encompassing lipid peroxides (LPO), reduced glutathione (GSH), superoxide dismutase (SOD), glutathione-S-transferase (GST) and glutathione reductase (GR) were determined in erythrocytes. Ten healthy animals served as control. The percentage of apoptotic PBMCs was found to be non-significant (P>0.05) in E. canis infected dogs as compared to the healthy controls. With respect to oxidant/antioxidant equilibrium, there was non-significant (P>0.05) alteration in the levels of LPO, GSH and SOD where as activities of GST and GR showed significant (P<0.05) deviation from that of healthy control. These data demonstrated that in vivo infection with E. canis results in changes in rates of apoptosis of infected immune cells i.e., inhibition/delaying of apoptosis and also illucidated the minor role played by free radicals in the disease pathogenesis.

236

Abst 3: VII

Parasites diagnosed in local dogs from 2009 to 2011 in the Veterinary Research Institute, Ipoh, Malaysia
Chandrawathani P., Nurulaini R., ErwanasAsmar, I., Adnan M., Premaalatha B., Muhammad Hazmi Y., Zaini C. M.,Fazly Ann Z., Jamnah O., Masrin A.&Ramlan, M. Veterinary Research Institute, 59 Jalan Sultan Azlan Shah 31400 Ipoh, Malaysia

In Malaysia, dogs are are commonly kept ashousehold pets. A total of 246samples were received from government and private veterinary clinics from 2009-2011 for routine parasitology diagnosis. Samples of blood(187), faeces(6), organ (19), skin (8), intestine (22),whole parasites(1),serum (1) and others(2), were diagnosed positively for various parasitic infections, namely Babesia gibsoni , Babesia canis, Dirofilaria canis, Ancylostoma sp., Toxocara sp.,Erhlichiacanis and Demodex sp. In 2008, 135 local pet dogs around Ipoh were screened for Toxoplasma gondii using Indirect Fluorescent Antibody test and results showed 9.6% to have positive antibodies. In 2009, a survey of 80 blood samples from local pet dogs showed 15% were positive for Erhlichia canis antibody ies by Indirect Fluorescent Antibody test with 10% of the dogs harbouring ticks Rhipicephalus sanguineus. Due to the hot, wet tropical climate, these infections are prevalent and needregular attention from pet owners. Abst 4:VII

A Study of correlation between hematological values and chronic skin infections in dogs
Raheela Akhtar, Faheem Afzal1, Muhammad Younus2, Qamarun Nisa and Fariha Akhtar3 Department of Pathology, University of Veterinary and Animal Sciences, Lahore, Pakistan.54000

A retrospective study was performed to investigate the relationship between chronic skin infections and changes in hematological values of dogs. One hundred and sixty dogs were brought to Pet Centre, University of Veterinary and Animal Sciences, Lahore, Pakistan with complaint of skin infections during 2011. The animals were confirmed for skin infections by history, gross examination, skin scrapping and further microscopic examination. One hundred and fourteen(71.25%) cases were of chronic nature and their complete blood count revealed severe thrombocytosis along with leukocytosis in all the chronically infected dogs. While the animals with recent or acute dermatological infections had their thrombocytes and leuckocytevalues within the normal range or slightly higher. This indicated a positive relationship between thrombocytosis and chronic skin infection. Moreover, a drastic elevation was observed in eosinophils count in both the chronic and acute infections. 1 Department of Pediatric, Kind Edward Medical University, Lahore, Pakistan.54000. 2 Department of Pathophysiology, College of Veterinary Sciences, Jhang, Pakistan.54000. 3 University Diagnostic Lab, University of Veterinary and Animal Sciences, Lahore, Pakistan.54000.

237

Abst 5 : VII

Effect of Treadmill Exercise on Creatine kinase and Lactate dehydrogenase enzyme level in German Shepherd Dogs
N. S. Rathore1, A. Moolchandani, M. Sareen and D. S. Rajput1 College of Veterinary & Animal Science, RAJUVAS, Bikaner

The present paper highlighted the influence of treadmill exercise on plasma Creatine kinase and Lactate dehydrogenase enzymes level with different stages of exercise in both male and female of German shepherd dog. Twelve dogs of either sex were included in the present study and subjected to treadmill exercise at the speed of 9 Km/hour. The blood samples were collected at control or per-exercise condition and at 20 minutes, 40 minutes and 60 minutes during the course of exercise. The mean SE values of plasma CK and LDH concentrations (U/litre) during the course of study in present investigation were measured as : CK: 45.917 0.821, 87.417 1.288, 118.833 0.815 and 147.833 2.396 and LDH: 53.333 0.482, 69.583 0.583, 87.583 0.484 and 108.583 0.583 U/litre for control of pre-exercise condition (T1), at 20 minutes of exercise (T2), at 40 minutes of exercise (T3) and at 60 minutes of exercise (T4), respectively. The highest plasma CK and LDH concentration were observed at last episode (i.e. 60 minutes of exercise), whereas, lowest plasma CK and LDH concentrations were observed in control or pre-exercise condition (T1). In present investigation the effect of exercise revealed significantly (P ? 0.01) higher plasma CK and LDH activity. Males had significantly (P ? 0.01) higher values of plasma CK while non-significant (P > 0.05) but slightly higher values of plasma LDH than that of females. 1 College of Veterinary & Animal Science (RAJUVAS), Navania, Udaipur (Rajasthan) 313601 Abst 6 : VII

Pathology of Diffuse Interstitial Nephritis in Kidney Lesions of Dog

Goyal Sanjay, Rani Sunita, Vyas Indu, Rawat Ashwani Kumar and Asopa Shesh Department of Veterinary Pathology, College of Veterinary and Animal Science, RAJUVAS, Bikaner.

Pathology of kidney lesions in dog was studied in 780 dogs of different age groups, sex and breeds. Out of which, 234 (30 per cent) representative samples of kidney showing gross lesions were further processed for histopathological examination. These samples were preserved in 10 % formal saline and processed (acetone and benzene technique) and then stained with haematoxylene and eosin stain. Diffuse interstitial nephritis was found in 10.68 per cent cases. Grossly, kidney becomes enlarged, pale-gray coloured with distinct red and gray mottling on the capsular surface and cortex. Microscopically, in acute cases edema and infiltration mainly of lymphocytes, macrophages and plasma cells along with few neutrophils in the interlobular spaces, blood vessels and glomeruli seen. In chronic cases, capsule was thickened and large portion of normal renal parenchyma both in cortex and medulla being replaced by fibrous tissue. Abst 7: VII

Pathology of hemorrhagic enteritis in dog

Vyas Indu, Rani Sunita, Rawat Ashwani Kumar and Asopa Shesh Department of Veterinary Pathology, College of Veterinary and Animal Science, RAJUVAS, Bikaner.

The present study was conducted on samples of dog intestines brought to Department of Veterinary Pathology, Bikaner. The samples was preserved in 10 % formal saline and processed (acetone and benzene technique) and then stained with haematoxylene and eosin stain. Hemorrhagic Enteritis was present in it. Grossly, the intestine showed petechial haemorrhages. There was blood mixed ingesta in the intestinal lumen. Microscopically, different layers of intestinal wall showed focal extravasation of blood. There were erosions of epithelium with cellular infiltration mainly of red blood cells and mononuclear leukocytes. Most of the villi were congested and extremely denuded.

238

Abst 8: VII

Pathological observations of fatty changes in liver of dog

Agarwal Manish, Rani Sunita, Vyas Indu, Rawat Ashwani Kumar and Asopa Shesh Department of Veterinary Pathology, College of Veterinary and Animal Science, RAJUVAS, Bikaner.

Pathology of liver lesions in dog was studied in 761 dogs of different age groups, sex and breeds. Out of which, 294 (38.63 per cent) representative samples of liver showing gross lesions were further processed for histopathological examination. These samples were preserved in 10 % formal saline and processed (acetone and benzene technique) and then stained with haematoxylene and eosin stain. The incidence of fatty changes was found in 15.99 per cent cases. Grossly, liver showed enlarged, soft and light yellow coloured areas with greasy cut surfaces showing rounded borders. Microscopically, small few droplets to larger fused fat globules in the cytoplasm of the affected hepatocytes as well as displaced nucleus towards periphery and compressed hepatic sinusoids were recorded. Abst 9: VII

Pathology of Chronic Renal Failure in Dog

Rani Sunita, Vyas Indu, Rawat Ashwani Kumar, Asopa Shesh and Gupta Anuradha Department of Veterinary Pathology, College of Veterinary and Animal Science, RAJUVAS, Bikaner.

Post- Mortem examination of a dog was conducted. It was a female Labrador named Bela. The owner reported that it was completely off feed with persistent vomiting. External examination showed that general condition of carcass was good with no external injuries. Rigor mortis and putrefaction was present. Internal examination showed sub-pleural and sub-serosal haemorrhages. All mucous membranes were pale. Kidneys were pale, shrunken, very small quantity about 20ml urine was present in urinary bladder. The intestine was partially emptied with dark coloured faeces in the rectum. It was concluded that approximate time of death was 12 hrs and the dog died due to azotemia resulting due to chronic renal failure. Abst 10: VII

Hemato-biochemical alterations in canine pyometra

Bassessar V., Verma Y., Swamy M., Sharma B.L., Tripathi S. M., Sankhala L. N., Trivedi M.S. Department of Veterinary Pathology, College of Veterinary Science and Animal Husbandry Madhya Pradesh PashuChikitsaVigyanVishwavidyalaya,Jabalpur-482001 (MP), India

A study was conducted to investigate the hemato-biochemical alterations in 20 pyometric dogs. Pyometra was found in animals between age group of 3-10 years; however, the maximum cases of pyometra were noticed at 4 years of age. The results of haematological studies comprising haemoglobin estimation (HG, g/dl), total erythrocyte count (TEC, millions/l), Packed cell volume (PCV, %), Mean corpuscular haemoglobin (MCH, picogram), Mean corpuscular haemoglobin concentration (MCHC, g/dl), Total leukocyte count (TLC, thousands/l) and differential leukocyte count (DLC) revealed marked anaemia, leukocytosis, neutrophilia and elevated number of band cells. However, there were significant elevation of serum ALT, AST, ALP, bilirubin and BUN but decrease in protein and albumin concentration was observed.

239

Abst 11: VII

Clinical studies in naturally occurring cases of canine trypanosomiasis in surat (Gujarat)

Deshmukh, V.V.; Varshney, J.P., Chaudhary, P.S. and Prajwalita T. Sutaria Shree Surat Panjarapole, Nandini Veterinary Hospital, Ghod Dod Road Surat 395 001 (G.S.)

Clinical trypanosomiasis in dogs, caused by Trypanosoma evansi, is well established clinical entity in India but has not been reported from Gujarat. During a period of 4 years (Oct. 2007 Oct. 2011) twenty cases of Trypanosomiasis were diagnosed in dogs (Great Dane 03, German Shepherd 5, Rott Weiller 3, Doberman 4, St. Bernard 1, Crossbred 4). It was note worthy that most of cases were from Dumus area the delta formed by Tapi river merging into the Arabian Sea. The cases were clinically characterized by inappetance, emaciation, epiphora, bilateral corneal opacity, fever (> 1030F), nausea, vomiting, constipation/diarrhoea. In one case (Doberman) cardiomyopathy was also detected. Few dogs revealed hepatic changes on ultrasonography. In all cases flagellates were detected in peripheral blood smears confirming Trypanosomiasis. The dogs were treated with a single injection of diminazene aceturate @ 3.5 mg/kg b.wt. im with a supportive therapy of Pheniramine maleate @ 0.4 mg/kg im 30 minutes prior to diminazene aceturate, Normal Saline @ 60 ml/kg iv on first day followed by DNS 5 % @ 60 ml/kg iv from 2nd day to 4th day, Silymarine 140 mg PO BID for 10 days. Out of 20 dogs, 19 dogs recovered uneventfully. Abst 12: VII

Assessment of stress due to hot ambience in dogs from arid tracts in India
N. Kataria and A.K.Kataria1 Department of Veterinary Physiology, College of Veterinary and Animal science, Rajasthan University of veterinary and Animal sciences, Bikaner

Prolactin is considered as most versatile pituitary hormone in functions which acts directly on the tissues. The physiological actions of prolactin are mediated through specific surface receptors on the cells of mammary gland, liver, ovary, testis and prostate. Apart from lactation prolactin has multiple metabolic and behavioural effects that may contribute to the general adaptation syndrome. It induces increased glucocorticoid secretion. Cortisol is a glucocorticoid secreted by adrenal cortex playing an important role in many physiological functions including metabolism, mammogenesis, lactogenesis and galactopoiesis.Glucocorticoids are also involved with glycogen deposition in liver and lipolysis, and are associated with the immune system, stress, and thermal regulation.In many animal species prolactin and cortisol are considered as good biomarkers of environmental stress. To assess the stress due to hot ambience in dogs from arid tracts in Rajasthan state, India, serum prolactin and cortisol levels were determined by radioimmunoassay. The blood samples to harvest the serum were collected from the same animals during moderate and hot ambiences. During hot ambience the animals showed significantly (p=0.05) higher levels of serum prolactin and cortisol when compared to the moderate ambience. The mean rise in prolactin was four times whereas cortisol levels were five times higher. Further a multiple fold rise in serum prolactin clearly suggested that it can be used as an indicator of stress in dogs along with the cortisol. 1 Apex Centre

240

Abst 13: VII

Physico-chemical properties and microbial load in refinery effluent- a source of drinking water to street dogs
Pratima Singh, Pragati Swarnkar, Shivam Chaturvedi, Rajendra Singh and A.K. Srivastava Department of Pathology, College of Veterinary Science, Mathura

Due to rapid industrialization and commissioning of petroleum refinery in Mathura, which led to voluminous discharge of refinery effluents contributes pollution load of about 5000 Kg/day of BOD to the river. This condition has made not only the water non potable but also unsafe for domestic and wild animals and to the aquatic life. In recent years several times it was evident and shocking to find out that large numbers of dead fishes floating on the surface of Yamuna River. In view of these considerations, the study was aimed to evaluate the physico-chemical properties of refinery effluent causing potential toxicity to water consumers. The various physico-chemical parameters viz. total hardness, calcium hardness, total alkalinity, pH, free chlorine, phosphorous alkalinity levels sulphite and nitrite were tested by diagnostic kits (Himedia). The mean values of total hardness, calcium hardness, total alkalinity and nitrite levels were 755 ppm, 225 ppm, 205 ppm and 30 ppm, respectively along with acidic pH 6.0; however, phosphorous alkalinity, free chlorine and sulphite were not present. The level of pollutants in the refinery effluent appeared to be several folds higher than the recommended levels. The microbial load of the refinery effluent was tested on nutrient agar and EMB plates. On nutrient agar, the grown colonies were small, round, pin point. transparent and creamy colour. After staining, the morphology of the organism were gram negative bacilli / coco bacilli which was confirmed to be salmonella and pseudomonas by biochemical characteristics. No growth was seen on EMB plate as it ruled out the presence of E. coli. The street dogs located to the area were weak and emaciated with roughened coat with or without local to diffuse lesions of dermatitis. The effects to effluent toxicity bearing large number of heavy metals and petroleum components and continuous intake of microorganism in contaminated water have been discussed. Abst 14: VII

Canine Dirofilariasis - A clinical case report

Mohanty, I., Gupta, A.R., Sardar,K.K., Palai, S., Rout, S. and Nahak, A.K. College of Veterinary Science and Animal Husbandry, OUAT, Bhubaneswar-751003, Odisha

Canine heartworm disease is a commonly encountered mosquito vectored zoonotic disease resulting from parasitization by the filarid worm Dirofilaria immitis. This zooanthrophilic vector-borne parasite can not only cause serious infections in dogs and cats but also ferrets and other wild animals and occasionally humans. A two and half year old male Spitz dog, weighing 15 kg, was presented to the Teaching Veterinary Clinical Complex with history of anorexia, exercise intolerance, syncope and evening unproductive cough. The dog has not been treated for endoparasites since four months. On physical examination, the dog was dull and depressed and revealed respiratory distress on auscultation with enlarged retropharyngeal lymphnode on palpation. Haematological examination revealed mild eosinophilia and positive for microfilariae in wet blood smear as well as in Modified Knott technique. The animal was treated with ivermectin once monthly along with prednisolone to reduce the potential for adverse reaction. Ceftriaxone with tazobactam was administered to counteract secondary bacterial infections. In addition, diuretic (spironolactone) along with ACE-inhibitor (enalpril) was administered. The dog responded to treatment and the coughing was controlled. After 15 days of treatment wet blood smear as well as Modified Knott technique revealed absence of any microfilariae in blood. Thus treatment was successful and the animal recovered.

241

Abst 15: VII

Effect of age on serum chemistry profile and thyroid hormones in German Shephered dogs
Sareen, M. and Moolchandani, A. Department of Veterinary Biochemistry, College of Veterinary and Animal Science RAJUVAS, Bikaner (Rajasthan)- India

Biochemistry tests were conducted on serum from young German Shephered dogs in order to determine the effect of age on these parameters. Blood was collected at regular intervals from 20 normal German Shephered dogs (10 males and 10 females) at ages ranging from 2 weeks to 12 months. Serum chemistry profiles and radioimmunoassays for thyroxine(T4) and triiodothyronine(T3) were included . Rapidly changing age related differences were observed in several parameters. Urea nitrogen, cholesterol, lactate dehydrogenase, thyroxine, glucose, and total bilirubin values were elevated early in life, and decreased during the first 6 to 8 weeks, while alanine aminotransferase activity was low initially and increased during this period. Lactate dehydrogenase, thyroxine, total bilirubin and alanine aminotransferase attained stability by 3 months, but the remaining parameters showed slight changes subsequently, gradually approaching adult values. More gradual age related changes were observed in other parameters. These included alkaline phosphatase, inorganic phosphorus and calcium values, which were higher in younger dogs, and creatinine, aspartate aminotransferase and total protein values, which were lower in younger dogs. Creatinine and aspartate aminotransferase values were stable by approximately 6 months; alkaline phosphatase, inorganic phosphorus, calcium and total protein values continued to change gradually up to 1 year. Abst 16 : VII

Gross and histopathological observations of hepatic abscesses in dogs (Canis familaris)

M. Mathur, M. Agrawal; H. Dadhich;, S. K. Goyal and A. P. Singh College of Veterinary and Animal Science, Bikaner- 334001 (Rajasthan)

Hepatic abscesses are one of the major pathological condition found in dogs as the infections that may attack the liver include a few which are peculiar to the liver and several which localize elsewhere with equal or greater facility. A total of 761 carcasses of dogs examined and from these, 294 liver specimens showing frank macroscopic lesions were collected in 10 per cent formal saline and processed for histopathological examination. The hepatic abscesses were recorded in 4.08 per cent cases. Grossly, multiple abscesses were irregularly distributed throughout the surface and were also found deep into the parenchyma. The thick wall of abscess was made by the fibrous tissue and cavity contained yellowish and semi- solid contents. Small abscesses were soft and contained small amount of pus. Microscopically, abscesses were made up of various layers. The inner most caseo- necrotic zone was stained with eosin. The fragments of pycnotic nuclei were also present as scattered granular debris with in this zone, which stained black. A layer of polymorphonuclear leucocytes surrounded this innermost zone. A few macrophages were also present in this layer. Around this layer a well developed pycnotic membrane was found. A well- developed connective tissue capsule was also present around the larger abscesses. Abst 17: VII

Heartworm in dogs
Ranjit Kaur Mendhir JR VETERINARY CENTRE, 4 ,TINGKAT TAMAN IPOH ENAM, IPOH GARDEN SOUTH, IPOH,31400, PERAK, MALAYSIA

Heartworm is caused by dirofilaria immitis in dogs.will discuss cases and prevalence in dogs in ipoh .will discuss symptoms,diagnosis,treatment used in my practice and its prevalence in cats.

242

Abst 18: VII

T3 and T4

Estimation as marker of hypothyroidism induced dermatological disorders

P. T. Ramesh Veterinary college, Hebbal, Bangalore- 560 024

Hypothyroidism is one of the most common endocrinopathies in dogs caused due to deficiency of thyroid hormones. A total of 40 dogs with dermatological disorders suggestive of hypothyroidism were selected for the present study, the serum obtained were subjected for T3 and T4 estimation by using RIA kit. Results revealed value of T4 ranged between 8-14.1 ng/ml with a mean 10.10.56 ng/ml.Similarly mean value of T3 in hypothyroid dogs was significantly ( P < 0.0001)lower ( 0.63 0.05 ng/ml ) as compared to normal dogs. Abst 19 : VII

Gross and biometrical studies on os penis ofindian wolf (Canis lupus pallipes)
Om Prakash Choudhary, Arun Sanadhya Arawali Veterinary College, Sikar

The Indian wolf (Canis lupus pallipes) is a grey wolf subspecies inhabiting the Middle East and southwestern Asia. In the present study the Os penis of the three adult Indian wolves were used.They possessed a bone interior to the penis the os penis, or baculum. This bone occurs sporadically in the animal kingdom and also appears in the domestic dog. In both canids it was hollow or dished down its length, possibly to contain the corpus spongiosum, with a distinct bend of approximately 20 degrees a little more than halfway down its length. The baculum diminished distally, with a thick base of roughened bone and a distal end which was little more than a point. The Indian wolf baculum was 12.50.05 cm long and 1.050.01 cm wide; the coyotes was 7.3002 cm long and 0.650.02 cm wide. Abst 20: VII

Gross and histopathological observations of hydronephrosis in dogs

S. K. Goyal, H. Dadhich, M. Mathur, R. Khanna and A. P. Singh Department of Veterinary Pathology College of Veterinary and Animal Science, Bikaner- 334001 (Rajasthan)

Kidney diseases constitute a major segment of the total burden of diseases and hence the pathology of this organ is of major importance. Among the various common disorders affecting dogs, urinary disorders are more frequent and renal diseases has been considered to be the most important cause of illness. Hydronephrosis is one of the common renal pathological disorder occurs in the dogs. For present study, a total of 234 kidney specimens of dogs showing frank macroscopic lesions were collected for histopathological examination. Hydronephrosis was recorded in 5.55 per cent cases. Grossly, the kidneys were enlarged and there was progressive dilation of pelvis and calyces. Atrophy of the pyramids and finally of the cortex were also observed. In some cases, the kidneys showed hollow sacs distended to larger outside dimension. Microscopically, kidneys showed dilation of convoluted tubules being lined by flattened epithelial cells. These changes were significant and extensive in medulla. Oedema of associated interstitium was also observed.

243

Abst 21: VII

Influence of age, breed, and exercise on thyroid hormonal status in dogs

A. Moolchandani and M.Sareen Department of Veterinary Biochemistry, College of Veterinary and Animal Science RAJUVAS, Bikaner (Rajasthan)- India

Biochemistry studies on German Shephered and Pomeranian have established that thyroid hormone concentrations are higher in healthy young and adolescent animals, and lower in geriatric animals. Similarly, healthy toy and small breed dogs have higher metabolic rates and higher basal thyroid concentrations than large or giant breed dogs. Endurance exercise is another variable that affects thyroid hormone concentrations in healthy dogs. Significant decreases in serum T3 and T4 concentrations and significant increases in serum TSH concentrations were consistently found for dogs in the peak exercise state for as compared with concentrations in the control state. Thus, endurance exercise has a profound impact on thyroid hormone concentrations in German Shephered dogs. Abst 22: VII

Pathological observations on Toxic Hepatitis in Dogs (Canis Familaris)

M. Agrawal, H. Dadhich, M. Mathur, S. K. Goyal and A. P. Singh College of Veterinary and Animal Science, RAJUVAS, Bikaner- 334001 (Rajasthan)

Hepatitis is one of the major pathological condition found in dogs as the infections that may attack the liver include a few which are peculiar to the liver and several which localize elsewhere with equal or greater facility. A total of 761 carcasses of dogs examined and from these, 294 liver specimens showing frank macroscopic lesions were collected in 10 per cent formal saline and processed for histopathological examination. Toxic hepatitis was recorded in 5.78 per cent cases. Grossly, the liver was enlarged and centers of lobule were opaque, grayish or yellowish white. Microscopically, there were fatty changes with the lysis of hepatocytes. The lattice fibers and endothelium were affected. In some cases, the liver cells were damaged. Focal cellular infiltration in parenchyma and triad area was also seen. Intralobular and centrilobular necrosis were observed. Hyperchromatosis of nuclear walls and karyolysis were revealed in some cases. There were areas of liver cell degeneration and dissociation of the hepatocytes from periphery extending towards the center of the lobule. Complete lobule had also been washed away at some places. Abst 23 : VII

Nodular dermatitis in dog- a case report

A. P. Singh, M. Mathur, H. Dadhich and A. Maheshwari College of Veterinary and Animal Science, RAJUVAS, Bikaner- 334001 (Rajasthan)

The term dermatitis is used for inflammation of the skin moreover apply to inflammation of the dermis and adjacent subcuits, but if the dermis is regarded as the stroma of the organ of which the epithelial structures are the parenchyma, then dermatitis can logically be applied to all inflammations of the skin. Nodular dermatitis is one of the types of dermatitis classified on the basis of histopathological characteristics where the formation of nodules due to the heavy inflammatory infiltration. This is usually acute in nature but sometimes chronic cases are also reported. A German Shepherd dog was submitted with a complaint of multiple, firm, brown nodules with ill- defined borders seen on neck region. Microscopically, a circumscribed nodule with necrosis was seen accompanied with abundance of epithelioid histiocytes. More mature lesion tended to show numerous giant cells and spindle shaped fibroblastic cells.

244

Abst 24 : VII

Pathological and haemato-biochemical observations on basal cell tumor in dogs

H. Dadhich; R. Khanna; M. Mathur and A. P. Singh Department of Veterinary Pathology College of Veterinary and Animal Science, RAJUVAS, Bikaner- 334001 (Rajasthan)

The dermatological complaints are recurrent and complicated amongst the various clinical problems in dogs. It has been estimated that small animals have up to 75 per cent skin problems out of various clinical manifestations but till date the diagnosis of dermatological disorders in pets is foremost constraint affecting treatment. Consequently neoplasia has become of greater importance to the practicing veterinarian and more of his time is now employed in the diagnosis, prognosis and treatment of tumors. In the present study, a total of one hundred seventy two skin biopsies showing frank macroscopic lesions were collected from dogs of either sex, different age groups and breeds from various districts of Rajasthan state and preserved in 10 per cent formal saline. These samples were processed mechanically for paraffin embedding by acetone and benzene technique for histopathological examination. The Basal cell tumor was observed in 3 cases. Grossly, solitary, firm, rounded, elevated, well circumscribed lesions usually seen on the trunk and extremities as a flat erythematous and sometimes translucent macule or patch with scaling. Microscopically, tumor cells were intimately associated with the connective tissue stroma. The stroma was course collagenous, acellular, hyalinized and sometimes oedematous. Tumor cells were small and uniform in size and nuclei were round or oval and hyperchromatic. Tumor cells arranged in elongated cords which form festoons in connective tissue stroma. The cells in these cords were columnar and usually arranged with their long axis at right angles to the long axis of the cell column. Abst 25: VII

Assessment of oxidative stress in brucella affected stray dogs

A.K.Kataria, N.Kataria1, T. Bhati, Ishrat-Ullah Ansari2 and Diane Blanger3 Apex Centre for Animal Disease Investigation, Monitoring and Surveillance College of Veterinary and Animal Science, RAJUVAS, Bikaner

Oxidative stress can influence the metabolism of cells in vital organs of the body and is extremely dangerous as it does not exhibit any symptom and can only be monitored with several biomarkers like antioxidants and pro-oxidants which can be assessed in serum. There is paucity of work in dogs to detect oxidative stress, which is essential to take timely corrective measures. Therefore an investigation was carried out to evaluate oxidative stress in the stray dogs suffering from brucellosis. For this serum biomarkers of oxidative stress viz. vitamin C, vitamin E, catalase, monoamine oxidase, glutathione reductase, superoxide dismutase, glutathione, xanthine oxidase, oxidase and peroxidase were determined. Results indicated that vitamin C, vitamin E and glutathione activity decreased significantly in brucella affected dogs as compared to healthy ones. Serum catalase, superoxide dismutase, monoamine oxidase, glutathione reductase, xanthine oxidase, oxidase and peroxidase activities increased significantly in affected dogs as compared to healthy dogs. Decreased activity of vitamin C, vitamin E and glutathione indicated towards their depletion which generally occurs in the oxidative stress to scavenge the free radicals. It was concluded that oxidative stress was there in the brucella affected dogs. This study recommends the use of antioxidants in affected animals. 1 Department of Physiology, CVAS, Bikaner 2 Pet Hospital and Boarding shelter, Vasant Kunj, New Delhi 3 Humane Society International (HSI), Haiti

245

Abst 26: VII

Laboratory evaluation of health status of stray dogs

N.Kataria, A.K.Kataria1, Ishrat-Ullah Ansari2 and Diane Blanger3 Department of Veterinary Physiology College of Veterinary and Animal Science, RAJUVAS, Bikaner

Welfare of stray dogs is gaining importance day by day due to their close association with human population. To interpret the results of laboratory findings of clinical cases it is very important to develop physiological reference values of the dogs residing in a particular area. In view of this an investigation was carried out to determine serum parameters of clinical significance. For this purpose sera were collected from 351 stray dogs of both the sexes brought to the Marwar Animal Protection Trust, Jodhpur for the purpose of sterilistion. The serum parameters of clinical significance included metabolites like total proteins, cholesterol, glucose, urea and creatinine; electrolytes like calcium, phosphorus and magnesium; and enzymes like alkaline phsophatase and gamma glutamyl transferase. The mean values of total proteins, cholesterol, glucose, urea, creatinine, calcium, phosphorus, magnesium, alkaline phsophatase and gamma glutamyl transferase were 61.00 0.71 gL-1 ; 3.560.02 m mol L-1 ; 4.50 0.10 m mol L-1; 4.05 0.08 m mol L-1 ; 87.88 8.34 umol L-1 ; 2.20 0.10 m mol L-1 ; 1.49 0.18 m mol L-1 ; 0.81 0.017 m mol L-1 ; 74.114.00 UL-1 and 82.832.00 UL-1, respectively. Simultaneously blood smear of each dog was prepared for differential leucocytic count (DLC) to monitor health status. The mean values (%) of neutrophil, lymphocyte, monocyte, eosinophil and basophil were 67.91 0.96; 28.92 0.98; 4.17 0.24; 2.05 0.17 and 0.50 0.001, respectively. 1 Apex Centre for animal Disease Investigation, Monitoring and Surveillance, CVAS, Bikaner 2 Pet Hospital and Boarding shelter, Vasant Kunj, New Delhi 3 Humane Society International (HSI), Haiti Abst 27: VII

Fuelling of TCA cycle in hepatic cells of dogs during cold ambience

N. Kataria, A. Joshi, N. Pandey , S. Soren, Abhimanu and L.N. Sankhala1 Department of Veterinary Physiology, College of Veterinary and Animal Science RAJUVAS, Bikaner- 334 001

Ambience associated changes occur within physiological limits in healthy dogs as maintaining body temperature is an energy consuming task. However, higher energy consumption may result in obesity. Therefore assessment of modulations in metabolism of the dog is gaining importance day by day due to its significance in monitoring obesity. During cold ambience the calorie requirements of dogs may increase depending upon exposure of the animal. Tricarboxylic acid cycle is the gateway to the aerobic metabolism being the central metabolic hub of the cell. Glutamate dehydrogenase enzyme is located in the mitochondria and plays an important role in assessing energy metabolism. Due to paucity of work on this aspect in dogs, the present study was conducted to assess the effect of cold ambience on fuelling of TCA cycle. To carry out the study, serum samples were collected from dogs during moderate and cold ambient conditions to determine glutamate dehydrogenase activity and glucose concentration. Serum GD activity increased significantly during cold ambience as compared to moderate ambience. Simultaneously serum glucose concentration decreased. This showed the association of serum GD with glucose homeostasis. It was observed that serum GD activity increased to provide more fuel for TCA cycle by making alpha ketoglutarate available during cold ambience. It was concluded that fuelling of TCA cycle increased during cold ambience than moderate ambience. 1 Dept. of Vety. Pharmacology and Toxicology

246

Abst 28: VII

Biomarkers of physiological defense against reactive oxygen species during ambient stress in dogs
N. Kataria, S. Arora1, S. Soren, N. Pandey, A. Joshi and L.N. Sankhala2 Department of Veterinary Physiology, College of Veterinary and Animal Science RAJUVAS, Bikaner- 334 001

Reactive oxygen species are formed as a part of metabolism. They are highly reactive due to the presence of unpaired valence shell electrons.During ambient stress their levels can increase dramatically producing oxidative stress, which is a large rise in the cellular reduction potential. To find out the physiological defense against reactive oxygen species during ambient stress, an investigation was carried out in dogs of various breeds. Ambient stress included hot ambient temperature period. Serum levels of antioxidants like vitamin A, vitamin C, vitamin E and glutathione and antioxidant enzymes catalase, superoxide dismutase, monoamine oxidase and glutathione reductase were determined. These findings were compared with those obtained during moderate ambient temperature period serving as control. Vitamin A, vitamin C, vitamin E and glutathione activity decreased significantly during hot ambient temperature period as compared to moderate. Serum catalase, superoxide dismutase, monoamine oxidase and glutathione reductase activities increased significantly during hot ambient temperature period. It was concluded that ambient stress induced marked changes in the levels of reactive oxygen species scavengers in the serum of dogs. 1 Veterinary Officer, Kashir, Ajmer 2 Dept. of Vety. Pharmacology and Toxicology Abst 29: VII

study of erythron function test of stray

dogs

N.Kataria, N. Pandey, A. Joshi, Abhimanu and L.N. Sankhala1 Department of Veterinary Physiology, College of Veterinary and Animal Science RAJUVAS, Bikaner- 334 001

The diagnostic approach for anaemia involves a number of tests and erythron function test is one of them. The erythron constitutes circulating erythrocytes in the blood, their precursors, and all the body elements concerned in their production. Determinations of packed cell volume(PCV), total RBC counting and haemoglobin (Hb) are considered as important parameters of erythron function tests and are routine tests of a clinical laboratory. Many a times defined source of clinically healthy dogs from which the required volume of blood can be withdrawn and processed in a standard manner is not always readily available. For clinical interpretation physiological reference values are always required. Therefore the present investigation was aimed to determine the reference values of these parameters in apparently healthy stray dogs for the purpose of health status assessment. The study included 36 clinically healthy dogs, 18 female and 18 males. Collection of blood specimens and laboratory analysis were done in a standard described manner including a continuing quality control program. It was observed that the mean values of PCV, RBC count and Hb were significantly higher in males than the female dogs. The mean values were 36.80 1.22 %; 5.7 0.98 1012 L-1 and 130.22 gL-1, respectively in male dogs. 1 Dept. of Vety. Pharmacology and Toxicology

247

Abst 30: VII

Surveyof mortality in pet dogs

Singh,Pratima, Singh,Rajendra, Shivam,Chaturvedi and Srivastava,A.K. Department of Veterinary Pathology, DUVASU, Mathura

Survey of the mortality record available in the department of Pathology for the year 2007-11 (five years) was carried out. The animals belonged to training Centre Tekanpurand private breeders who reported to the Kothari Hospital of the University for theirmaladyand that caseswho succumbedwere necropsied in the department. A total of 30 dogs(16 maleand 14 female)of various breeds viz. Labrador(21), Germansheferd(4),Dobberman(7) and indigenous (4) were investigated for the age sex, bred and cause of death. The mortality was observed highest in the dog up to one year age (11) followed by 1-3 years (8), above 5 years (7) and 3-5 years (4). The cause of death in the dogs were due to nervous disorders (7), renal disorders(8), digestive disorders(4), and miscellaneous(6). The highest mortality due to nervous disorderswas observed in the dogs below one year of age and renal failure was seen in dogs above 5 year of age. The cause of nervous disorder in young dogs and renal disorders in old dogs were discussed in relation to Canine Distemper and Leptospirosis, respectively. Abst 31: VII

Nodular lymphoid hyperplasia of the spleen in dog- a case report

ShaguftaAzmi, ShafiqurRahman, Tanveer Ahmad,Ajaz Ahmad,NavdeepKourandN.A.Sudhan Division of veterinary pathology Sher-eKashmir University of Agricultural Sciences and Technology of Jammu Faculty of Veterinary Sciences & Animal Husbandry, R.S. Pura, Jammu-181102

A BSF male dog, aged four and half years was suffering from renal dysfunction and prostate hyperplasia in the Veterinary Clinic, FVSc&AH, SKUAST-J, Jammu. After a long period of treatment, the said dog succumbed to death and Postmortem was conducted in Division of Veterinary Pathology, FVSc&AH, SKUASTJ, Jammu. On PM examination, dog showed hepatomegaly with moderate congestion, pulmonary congestion and thickened hemorrhagic urinary bladder mucosa. Characteristic findings included diffuse multiple nodules scattered throughout the spleen and buldged from spleenic surface. These nodules were round, firmer and dark red in color with a diameter ranging from 1-3cm. On microscopic examination, spleenic nodules consisted of lymphocytic and reticular cells proliferation. Some of these hyperplastic cells were spherical and resembled spleenic corpuscle except that central artery was absent. The lesions were vascularised and hemorrhages were common. On AgNOR staining, 4-5 AgNOR dots per nuclei per cell were observed. On the basis of these findings, the present case was diagnosed as nodular lymphoid hyperplasia of the spleen. Abst 32 : VII

Gross and Histopathological Observation on Hepatitis in Dogs

Goverdhan Singh, N. Sharma, Pushpa, H. Dadhich, M. Mathur, T. Sharma and A. P. Singh Department of Veterinary Pathology College of Veterinary and Animal Science, RAJUVAS, Bikaner- 334001 (Rajasthan)

Hepatitis is one of the major pathological conditions as the infections that may attack the liver include a few which are very peculiar to liver and several which localizes elsewhere with equal or greater facility. If the causative agent is not removed it leads to death of dog. In the present study liver specimen from 3 dead stray dog showing frank macroscopic lesions were collected in 10% fomal saline and processed for histopathological examination. Grossly, liver were enlarged and showed presence of grayish white necrotic foci with hemorrhages on the surface. Microscopically, inflammatory infiltration scattered in hepatic parenchyma, congestion of portal vein and hepatic artery, dilatation of sinusoids alongwith numerous focal necrotic areas were seen.

248

Abst 33: VII

Gross and histopathological observations on enteritis in dogs

Goverdhan singh, H. Choudhary, J. Yadav, H. Dadhich, M. Mathur, T. Sharma and A. P. Singh Department of Veterinary Pathology College of Veterinary and Animal Science, RAJUVAS, Bikaner- 334001 (Rajasthan)

Dog plays an important role in life of human being. They serve as variety of purpose which includes their role as sniffer dogs, guard dogs and companion animal. They get emotionally attach to their owners. Enteritis is the term denoting inflammation of small intestine, which is most common pathological condition found in dogs. If not treated in proper time, causes mortality in dogs. Enteritis can be occur due to various etiological agents includes bacteria, virus, fungi, parasitic, chemical and toxin. In the present study, intestinal specimens from 6 dead stray dog showing frank macroscopic lesions were collected in 10% formal saline and processed for histopathological examination. Grossly, mucosa of all sample were congested, thickened ,corrugated with pin point haemorrhages . Some patchy necrotic areas were also seen. Microscopically, there were inflammatory infiltration predominantly of mononuclear cells in submucosa and mucosa. There were hyperplasia of goblet cells ,desquamation of mucosal epithelial cell and presence of RBC were recorded. Abst 34 : VII

Prevalence of gastro-intestinal helminthes in stray dogs in Jodhpur

Anju Chahar, R.K. Tanwar, Fakhruddin, J.K. Mathuria, Deepika Dhuria, Ashwani Rawat and A.A. Gauri Department of Epidemiology & Preventive Veterinary Medicine College of Veterinary and Animal Science, RAJUVAS, Bikaner- 334001 (Rajasthan)

Faecal samples of 100 adult stray dogs were examined. Among these, 50 were males and 50 were females. The faeces of each dog was collected from rectum and examined by floatation method. Out of these, 82 faecal samples were found positive for gastrointestinal helminthosis. Grossly, adult worms were not found in the faeces of stray dog. The faeces were firm in consistency. The colour of the faeces was yellowish brown. The overall prevalence of gastrointestinal helminthosis was 82 per cent. Prevalence of Ancylostoma spp. was 92.68 per cent (72/82), Toxocara spp. 4.88 per cent (4/82) & Toxascaris leonena 2.44 per cent (2/82). Male stray dogs shared prevalence of 90 per cent & female of 74.00 per cent. The mean value of eggs per gram of feaces in stray dogs affected with gastrointestinal helminthosis in the present study was 1136.5824.25 with range of 700-1800 EPG. Clinical signs observed in worms infested stray dogs included pale mucous membrane, rough hair coat and weakness.

249

Abst 35 : VII

Effect of Treadmill Exercise on plasma concentrations of triglycerides and cholesterol in German shepherd Dogs
Narendra Singh Rathore1, Anil Moolchandani, Meenaxi Sareen and Devi Singh Rajput1 College of Veterinary & Animal Science, RAJUVAS, Bikaner

The present paper highlighted the influence of treadmill exercise on plasma concentrations of triglycerides and cholesterol with different stages of exercise in both male and female of German shepherd dog. Twelve dogs of either sex were included in present study and subjected to treadmill exercise at the speed of 9 Km/ hour. The blood samples were collected at control or per-exercise condition and at 20 minutes, 40 minutes and 60 minutes during the course of exercise. The mean SE concentration of triglycerides and cholesterol during the course of study [T1 (control), T2, T3 and T4] were measured as : triglycerides : 1.081 0.003, 0.999 0.006, 0.924 0.004 and 0.866 0.004 and cholesterol : 5.707 0.018, 5.38 0.01, 4.988 0.019 and 4.651 0.013 mmol/litre for control or pre-exercise condition (T1), at 20 minutes of exercise (T2), at 40 minutes of exercise (T3) and at 60 minutes of exercise (T4), respectively. The highest concentrations of plasma triglycerides and cholesterol were observed at control or pre-exercise condition and lowest concentrations were observed at last episode of exercise (i.e. 60 minutes of exercise). A highly significant (P ? 0.01) effect of treadmill exercise with gradually decreasing trend (T1 > T2 > T3 > T4) in plasma triglycerides and cholesterol values were recorded. 1 College of Veterinary & Animal Science (RAJUVAS), Navania, Udaipur (Rajasthan) 313601

250

Session-VIII
Human, Canine Interaction and Zoonosis

251

LP 1: VIII

Dog-Associated Zoonoses in India

P.K. Kapoor, Ashok Kumar and Renu Gupta Department of Veterinary Public Health and Epidemiology, College of Veterinary sciences, LLRUV&AS, Hisar- 125 004, INDIA

Dogs were domesticated by man many centuries ago and with the passage of time they became closely associated with number of human activities including hunting, guarding and herding etc .Later on this association became more strengthen thereby entering of the dogs into human dwelling and sharing their space and time. Presently there are large numbers of breeds of dogs which are used for various purposes. Dogs serve as companion animals to large number of people and companion animal medicine is increasing being recognized as an important area of public health. Dogs may contribute to the human health by allowing the people to live healthier and happier life particularly to the children, elderly people and those who have been isolated by diseases like AIDS. The dog population in the world today is estimated around 500million and dogs are the most widespread and abundant of all carnivores. The size of dogs population in an area is closely related to human population and increases as human population increase as they are highly dependant on human activities. Indias dog population is estimated at 25 million and can be divided in to four categories which can be defined as follows: pets (restricted and supervised); family dogs (partially restricted, wholly dependent); community dogs (unrestricted, partially dependent); and feral dogs (unrestricted, independent). Approximately 80% of the population fall into the latter three categories leaving over 5 million dogs within the pet category. In a recent survey, 17% of households in India were reported to own a pet/domesticated dog. Dogs are the most common household pets, which may be a direct or indirect source of human infections. They are carrier, reservoir and transmitter of various zoonotic infections which includes viruses, bacteria, fungi and protozoan and helminthic parasites. The important dog transmitted zoonoses in India are Leptospirosis, Campylobacteriosis, Brucellosis, Tuberculosis, Salmonellosis, E. coli infections,Yersiniosis, Ehrlichiosis, Boutonneuse fever, Rabies, Ancylostomiasis, Leishmaniasis, Dipylidiasis, Giardiasis, Echinococosis, Toxocariasis, Dirofilariosis, Cryptosporidiosis, Schistosomiasis, Blastomycosis, Nocardiosis, Scabies, Ringworm, etc These pathogens are transmitted to human beings either directly through close contact or indirectly through environmental contamination or through arthropod vectors. Parasitic infections, such as Creeping Eruptions, Visceral Larva Migrans, Cryptosporidiosis and Toxoplasmosis, are diseases associated with contact with dogs and cats. Dog associated zoonoses are present in developed and developing regions of the world. Some of these diseases such as Rabies, Brucellosis, Leptospirosis Tuberculosis, Leishmaniasis and Echinococcosis continue to occur in many countries especially in the developing world where they mostly affect the poorest segment of the human population. They cause a serious amount of deaths in large number of affected people every year. All major zoonotic diseases of dogs cause indirect losses of efficient production and quality of food of animal origin, particularly of much-needed proteins and create obstacles to international trade in animals and animal products. They are thus, an impediment to overall socioeconomic development. An increase in awareness that some of these diseases may be associated with animals could provide a better plan for the prevention and treatment of common and un-common zoonotic infections. Common measures for prevention and control of dog associated zoonoses involves simple preventive measures, such as adequate hand washing before eating, using gloves when gardening, changing the litter daily, thoroughly cooking all meat, adequate food safety, proper disposal of dog faeces and other secretions, prevention of contamination of water, soil or vegetation, effective control of stray dogs population and routine veterinary care, including appropriate vaccinations, deworming, and care for sick animals, should reduce the risk of disease transmission. Dogs should not be thought of as vectors for disease transmission, but as sources of joy and companionship for their owners. This paper summarizes some of the most important common zoonotic diseases of dogs.

252

L P 2: VIII

Vector-borne disease interaction between human and canines

B.K. Tyagi Centre for Research in Medical Entomology (ICMR) 4-Sarojini Street, ChinnaChokkikulam, Madurai - 625002, TN, India Email: bk_tyagi@sify.com , abk.tyagi@yahoo.co.in

Globally the vector-borne diseases have posed a serious threat to successful survival of human being, especially in the tropical and subtropical countries. Canine vector-borne infectious diseases (CVBDs) such as leishmaniosis, babesiosis, ehrlichiosis, hepatozoonosis, anaplasmosis, bartonellosis and borreliosis, particularly dog-relared like Cutaneous leishmaniasis, are an emerging problem worldwide not in veterinary medicine but also the public health considering their zoonotic potential. The successful diagnosis, treatment and prevention of these infections is dependent upon firm understanding of the underlying immunopathology of the diseases in which there are unique tripartite interactions between the microorganism, the vector and the host immune system. Although significant advances have been made in the areas of molecular speciation and the epidemiology compared vto that of pathology and immunology of these infections and their vectors in many countries across the world, nevertheless, little is known on zoonotic diseases involving various canines In India, albeit appreciable advancement made in the field of leishmaniasis of which a major focus exists in the Thar Desert in north-western Rajasthan. The cutaneous leishmaniasis is a serious, highly debilitating infection caused by Leishmaniatropicato the human being, and dogs are also affected with sores. The desert gerbil, Merioneshurrianae, is an additional zoonosis. Three sandflies, namely, Phlebotomuspapatasi, Ph. Salehiand Ph. Sergentii are the vectors in the Thar Desert. There is a highly complex matrix of various factorsunder which the disease proliferates in the Thar Desert in human being and the dogswith a specific transmission cycle by each of the vector sandfly species and zoonotic host, which are all discussed in detail in the light of fast changing desert topography and physiography under the impact of extensive canalization of India Gandhi Near Pariyojana.

253

LP 3 : VIII

Hook worm infection- a challenge to canine health and a disease of human concern
N.R. Pradhan Faculty of Veterinary & Animal Science West Bengal University of Animal and Fishery Sciences, 37, K.B. Sarani, Kolkata-700 037

Hook worm infection is a very important parasitic disease of dogs as well as of human beings in the warm and moist climates of the World like Asia, Africa, Central and South Americas & in some European Countries. In Asiatic countries, it is highly prevalent in India, in Assam, West Bengal, Bihar, Orisa, Andhra, Tamil Nadu, Kerala and Maharashtra in canine population and also in 60 to 80 % of human population. It causes severe anaemia, hypoproteinaemia, cutaneous lesions, allergic reactions and abdominal pain. The common hook worms which infect the dogs are Ancylostomum caninum, A. tubaeforme, A. braziliense, A. ceylanicum, A. duodenale, Necator americanus, and Uncinaria stenocephala. Out of these, A. duodenale, A. ceylanicum and N. americanus target the human beings also. Infection routes An adult hook worm produces an average of 16000 eggs (10,000 to 30,000) per day and develops mostly in the moist surroundings like sandy or clay warm moist soil with optimum temperature of 23 to 30 C to the stage of larvae within a week and infects the hosts. a) Infection through food:The infection mostly occur through ingestion of infected food contaminated with the larvae. b) Cutaneous larval migrans :Infection also occur through skin. Cutaneous larval migrans produces progressive lineral erruptive lesions is also known as dermatitis lineral migrans and ground itch. This creeping erruption mostly occur in warm & damp climates and mostly in the children & pups who play in places polluted with the dog excreta. Besides the persons working in plumbing works, fields, tea gardens and other places, where the dogs move around suffer more. This infection occur due to exposure to the contaminated soil for 5 to 10 minutes. The larvae elaborate an enzyme, protease that helps to bore through the skin. On reaching the subcutaneous tissues, they enter into the lymphatics or small venules. The larvae which cannot reach the vascular spaces usually die or are phagocytosed, but others reaches to the lungs through the blood circulation on 3rd day via the heart. There they are arrested & reach to the alveolar spaces. Thereafter, they migrate through the bronchi, trachea, larynx & then pharynx where they are coughed up and are swallowed. From 7th to 10th day, they reaches the stomach & duodenum where they develop and become adult. In the intestine, the adults using their teeth and powerful esophageal muscles and with the help of hydrolytic enzymes, digests the wall tissues and attaches themselves with the intestinal wall. At the same time, the worm releases a potent anticoagulant causing profound bleeding from the eroded capillaries and starts sucking blood. c) Prenatal infection sometimes occur in foetus as a result of intrauterine infection and it is considered as 2% of the infections. d) Another route of infection is the colostral or lactogenic infection by the passage of larvae through the milk to the suckling puppy. It is presumed that, in this route of infection the larvae comes through the muscles, since they can survive in the musculature upto 240 days. e) In human beings, the infection mostly occur through the oral route and cutaneous infections. The epidemiological studies have implicated the presence of dogs, particularly the pups in the houses and childrens having attraction to the pets put them at the risk of hook worm infections. The Electricians, plumbers and others who recline on wet sand contaminated with hook larvae become infected.

254

It mostly infect the man & women with barefoot on fields like the tea gardens and other household gardens where the pets have access to move. The children also suffer more. The babies who take breast feeds from infected mother gets infection too. Pathogenesis Whatever may the routes of infection, ultimately the larval worms develops to adult stages in the intestine and starts sucking of blood. The adults sucks 0.01 to 0.09 ml of blood per day after 7th to 8th day of reaching to the intestine. The female sucks more blood than the males. The worms are primarily acrobic, for which for acquairing more oxygen from the outside source, they suck blood and therefore sucking of blood is considered as a respiratory function of worms. They remain in the intestine for few months to years and ultimately leads in severe haemorrhogic anaemia. Morphologically, the anaemia is normocytic and normochromic but gradually become microcytic and hypochromic. The new born puppies suffer more and the puppies of smaller breeds suffer more than the larger breeds. Death in puppies occur after 10 to 24 days of infection, but in some cases, there is less blood loss and mild anaemia. There is percutaneous eczematous to ulcerative lesions particularly in the feet which are generally aggravated by licking & biting of the areas. Sometimes pneumonia also develops due to larval migration in the lung which may lead to consolidation. There is hypoproteinaemia, due to blood loss, protein loosing enteropathy and malabsorption. The adult worms like A. caninum & others secrete potential allergens in the intestinal mucosa and leads in eosinophilic enteritis. Adult hook worms secrete a potent inhibitor of digestive enzymes, which contribute to malabsorption and aggravates the malnutrition. Symptoms The hook worm infections mostly occur in the summer months. It generally develops in acute & rapidly fatal form in susceptible dogs. The dogs shows moderate to severe anaemia with pale mucous membranes, dehydration, haemorrhagic diarrhoea, oedema, general weakness and emaciation. There is poor growth and poor body condition and poor appetite. The coat become dry & rough. The skin shows areas of dermatitis with erythema and small papules or vesicles especially in the feet which shows severe itching of the areas, which provokes intense scratching. The pneumonic signs are observed sometimes in them with coughing and other signs. There is moderate to severe recurrent abdominal pain due to potent allergens. In human beings, the symptoms are almost same like anaemia, diarrhoea, poor growth, skin lesions and itching. Besides, there is congestive cardiac failure in adults and poor mental development in children. Immunity Recently, considering the pathognomic effect of the disease, other than the regular treatments, extensive studies have been started with vaccination programme against the disease by double subcutaneous inoculation of infective larvae exposed to 40 kr irradiation. Vaccination may be started as early as 72 hours after birth and in other puppies and adults. Vaccination to be done after proper deworming. The duration of immunity is around 7 months and not up to the economic expectations.

255

Treatment Considering the pathognomic importance, the treatment for hook worms should be extended at regular intervals, with good effective drugs. 1. The effective anthelmintics available for treatments are a) Bephenium compounds, b) Disophenol, c) Pyrantel pamoate, d) Tetramisole, e) Mebendazole f) Fenbendazole g) Albendazole These anthelmintics may be given in proper doses. 2. Blood transfusion to be done in severe anaemia. 3. 4. 5. Proper nutritional therapy especially with protein rich diet. Haematinics are indicated. Other treatments for secondary complications like pneumonia or abdominal pain etc.

Prevention Veterinarians can help in prevention of Public Health hazards by recommending well-timed anthelmintic treatments and counseling of the clients for practicing good personal hygiene, eliminating intestinal parasites from the pets and by limiting the contacts of children to pets.

256

LP 4 : VIII

Interaction between human, dogs and farm animals in relation to diseases

R.K. Tanwar Director of Clinics, RAJUVAS, Bikaner 334001

Animals have been closely associated with man since ancient times. Due to close proximity with animals, the man can get many infectious diseases of animals. Diseases which are naturally transmitted between animals and man are known as zoonotic diseases. These diseases are more prevalent in developing countries especially in the rural areas. The word Health organization have recognizes 87 such diseases. The 21st century holds the threat of even more emerging diseases, nurtured by an ever-increasing human population. Control of zoonotic diseases and protection of the public health will become even more challenging as world population increases. When over population and crowding occur, water shortages occur, hygiene often cannot be maintained, and malnutrition develops leading to disease and epidemics. Surveillance and reporting of disease is the first line of the defense. Knowledge of the epidemiology of the disease organism is the first steps in initiating a control program. The ultimate objective is to protect and preserve both human and animal health. The important zoonotic diseases are as follows. A. Viral diseases 1. Rabies 2. Influenza 3. Contagious ecthyma 4. Cowpox 5. Eastern equine encephalomyelitis 6. Hendra virus infection 7. Hepatitis E 8. Louping ill 9. Pseudo cowpox 10. Nipah virus infection 11. Severe acute respiratory syndrome (SARS) 12. Venezuelan equine encephalomyelitis 13. Vesicular stomatitis 14. Rift Valley fever 15. West Nile fever B. Prion diseases 1. Variant Creutzfeldt Jakob disease C. Bacterial diseases 1. Anthrax 2. Brucellosis 3. Borreliosis 4. Campylobacter enteritis 5. Enterohemorrhagic Escherichia coli infections 6. Glanders 7. Leptospirosis 8. Listeriosis

257

D.

E.

F.

G.

9. Meliodosis 10. Mycobacteriosis 11. Pasteurellosis 12. Plague 13. Psittacosis and ornithosis 14. Salmonellosis 15. Streptococcal infections 16. Tetanus 17. Tuberculosis 18. Tularemia 19. Yersiniosis Rickettsial diseases 1. Ehrliochiosis 2. Eperythrozoonosis 3. Q fever 4. Typhus Fungal diseases 1. Aspergillosis 2. Blastomycosis 3. Candidiasis 4. Coccidioidomycosis 5. Cryptococcsis 6. Dermatophilosis 7. Histoplasmosis 8. Nocardiosis 9. Rhinosporidiosis 10. Ring worn Protozoan parasitic diseases 1. Babesiosis 2. Balantidiasis 3. Cryptosporidiosis 4. Giardiasis 5. Leishmaniasis 6. Sarcocytosis 7. Toxoplasmosis 8. Trypanosomiasis Tremadoses (Flukes) diseases 1. Clonorehiasis 2. Dicroceliasis 3. Echinostomiasis 4. Fascioliasis 5. Fasciolupsiasis 6. Gastrodiscoldiasis 7. Paragonimiasis

258

8. Schistosomiasis 9. Coenuriasis 10. Diphyllobothriasis 11. Diphlidiasis 12. Echinococcosis 13. Sparganosis 14. Taeniasis 15. Cysticercosis & Neurocysticercosis H. Nematodes parasitic diseases 1. Dictophymosis 2. Dracunculiasis 3. Filariasis 4. Gnathostomiasis 5. Carvamigrans 6. Oesophagosomiasis 7. Trichuriasis I. Arthropod diseases 1. Acariasis (Mange) 2. Myiasis

259

Abst 1: VIII

Rabies control: mass vaccination and aniimal welfare

Sankey, C., Eckman, H., Mitchell, R. World Society for the Protection of Animals, Programmes department, 5th floor, 222 Grays Inn road, WC1 8HB, London, UK. <CaroleSankey@wspa-international.org>

The welfare of animals in countries in which rabies is endemic is frequently ignored. This is largely because of the gravity of the human health problem and this, combined with an ignorance of the best methods to control the disease and hence protect human health, can, and often does, result in extreme animal suffering.The disease itself causes great suffering in domestic animals, farm animals and wildlife, as it does in humans. The WHO stated in 2005: There is no evidence that removal of dogs alone has ever had a significant impact on dog population densities or the spread of rabies and mass canine vaccination campaigns have been the most effective measure for controlling canine rabies. Indeed, mass dog vaccination programmes have been carried out throughout the world with great success. Nevertheless, some are still reluctant to engage in such mass vaccination programmes, often citing economic reasons, and rabies remains endemic in most of Asia and Africa. Vaccinating animals, particularly dogs, is a vitally important control measure and whilst it may appear expensive, it has proved to be hugely beneficial in terms of human and animal health, as well as economically beneficial after a few years only. The tragedy of rabies is that it is entirely preventable. The development of integrated control measures involving public health and veterinary services, as well as animal welfare agencies is needed to ensure that control of canine diseases becomes a reality. The tools are available and all we need is the political will to free the world from the ongoing tragedy of rabies. Abst 2: VIII

Canine echinococcosis and risk perception of zoonotic infection to community

Gupta V.K.1,Bist B., Agrawal R.D., Gupta P., Maharana B.R. College Of Veterinary Science & Animal Husbandry, DUVASU, Mathura,India

Echinococcosis or hydatidosis is the one of the most important cestode infection of man and domestic animals caused by the canid tapeworm of genus Echinococcus. The tapeworms eggs are discharged with the faeces of definitive hosts (dogs and other carnivores) which are swallowed by intermediate hosts like sheep and other domestic animals while grazing in field and also by man (particularly children) due to intimate handling and playing with infected dogs. The infection is worldwide in distribution and having immense public health importance being a dreadful zoonotic disease. Keeping in view the above facts, a study was conducted to estimate the level of infection and potential impact of this infection among the community in Agra city. The level of infection was detected by coproscopical examination which reveals 34 dogs positive out of 104 suspected cases examined with echinococcal infection. A questionnaire survey was simultaneously conducted to gather information regarding dog ownership, feeding pattern of dog, general management, dog parasitism, mode of transmission, associated health related risk factors and preventive measure adopted. The surveillance showed that the majority of care takers had fed their dogs uncooked meat and unsound offals. The most of respondent were not aware regarding dog parasite, their transmission to human being, associated health related risk factor and very few were treated their dogs with anthelmintics. The predominance of this echinococcal infection in dogs in the studied region along with ignorance of the community about dog parasite and their transmission indicate the high risk of the zoonotic infection therefore prompt immediate actions need to be taken into consideration by health planners for welfare of the community. 1 Department of Veterinary Public Health, College of Veterinary Science & A.H., Junagadh Agricultural University, Junagadh, (Gujarat)

260

Abst 3 : VIII

Echinococcus granulosus metacestodiasis in sheep of kashmir Valleywith relation to canine human zoonosis
Shahnawaz M., ShahardarR.A., WaniZ.A. and Bhat1S.A. Division of Veterinary Parasitology, 1Division of Veterinary Public Health, Faculty of Veterinary Sciences and Animal Husbandry, SKUAST-K, Shuhama, Srinagar-190006.

A necropsy study of 55 sheep was carried out in Ganderbal district of Kashmir valley over a period of one year from September 2008 to August 2009 that revealed hydatid cysts in 9.09% animals. Prevalence was highest in summer (13.33%) followed by 8.30, 7.69 and 6.66% during autumn, winter and spring season respectively, the variation being statistically non significant (P>0.05). The infection rate was higher in adult sheep (>1year) (10.25%) compared to 6.25% in younger ones (<1year) (P>0.05) and liver and lungs was the site of predilection with mean count of 1.800.49. The present investigation confirmed the presence of Echinococcusgranulosus infection in the canines (definitive hosts) whose metacestode stage (hydatid cyst) poses a potential threat to humans. Key words: metacestodiasis, sheep, Echinococcus Abst 4 : VIII

Studies on cutaneous leishmaniasis in dogs and human beings in and around Bikaner city, Rajasthan
Rajani Joshi, Rakesh Rao, Jagbir Singh and Shruti Shree Joshi Department of Veterinary Public Health Collage of Veterinary and Animal Science, RAJUVAS, Bikaner

Cutaneous leishmaniasis is an important protozoan metazoonosis, caused by the protozoa leishmania tropica. Its occurrence is world wide including India and disease has got great importance especially for this part of Rajasthan. Distribution of the disease in India is not uniform, in some areas it is sporadic where as in other areas it is endemic and is known by local names viz Bombay sore, Delhi boil, Ambala sore and Gujarat sore etc. since the infection of cutaneous leishmaniasis has been reported from time to time from this area, an attempt was made to record epidemiological distribution of disease in dogs & human being in and around Bikaner city. A survey of 27 pet dogs having cutaneous lesion on face, eye and nostrils were screened for presence of LT bodies out of them only 5(18.51%) dogs revealed the presence of LT bodies. In all 36 suspected cases of human beings having skin lesions were screened for oriental sore, out of these 18(50%) cases revealed the presence of L.T bodies. The high population of pet and street dogs might be responsible for such high incidences. Abst 5 : VIII

Canines in diagnosis of cancer

Choudhary G. Department of Livestock Production Management CVAS, Rajasthan University of Veterinary & Animal Science, Bikaner-334003

Dogs being reliable and efficient scent-detectors have been used from long time to sniff out explosives and drugs, track criminals and find missing children. Now, researchers are attempting to harness the olfactory powers of canines for use in the field of medicine. Numerous studies have shown efficiency of dogs in locating an extremely wide range of scents. Trained dogs are used in epileptic seizure alert, low blood sugar level in diabetic patients and heart attacks. Several authors have published research suggesting that dogs may be able to detect lung, breast, prostate, ovarian, and melanoma cancers by smelling urine, exhaled breath, skin lesions, and surgically extracted tumors. It is less invasive than painful biopsies and cheap also. Early successes with canine scent detection suggest chemical analysis of samples may be a valid method for cancer detection. Future research should target tumor types, and seek to identify that which specific compound may signal a cancer diagnosis. We expect to see dogs involved more widely in early detection of cancer both in human and veterinary medicine.

261

Session-IX
Poster Session

262

Poster 1: IX

Celebration of World Rabies Day at Mekelle University College of Veterinary Medicine for the control and prevention of Rabies since 2009 to 2011
Habtamu Taddele, Yohannes Tekle, Abreha Tesfaye, Yisehak Tsegaye, Guesh Negash, Netsanet Berhe, Biruk Mekonnen, Birhan Mengiste, Birhanu Hadush, Gebrehiwot Tadesse, Wubishet Mengiste, Tihtina Alemayehu, Etsay Kebede, Gebregiorgis Ashebir, Berihun Afera, Berihu Gebrekidan Mekelle University College of Veterinary Medicine, P.O.Box: 231, Mekelle, Ethiopia

Rabies virus claims an estimated 70,000 lives each year, with the majority of fatalities in Asia and Africa. Many of the victims are young often young boys who are more likely to try to play with or approach strange dogs or other animals. One person dies every ten minutes worldwide due to rabies, even though it is 100% preventable. Rabies is an endemic disease in Ethiopia claiming thousands of lives each year. In Tigray region alone more than 1617 cases of human rabies were reported in the year 2009, out of which 12 deaths were recorded. In response to this, Mekelle University College of Veterinary Medicine has started organizing events during the celebration of the World Rabies Day to create awareness to the community particularly to school children, organize panel discussion forums and conduct vaccination campaigns. In 2010 and 2011, an awareness creation has been conducted to more than 3000 school children and a total of 2400 dogs have been vaccinated. Three panel discussion forums were conducted at regional and national level with concerned stakeholders to initiate a collaborative and integrated control measures against the disease. After the college started these activities, the awareness of the community has changed significantly. Intensifying the awareness creation programs and vaccination campaigns, and dissemination of best practices are believed to be alternative areas of intervention for rabies control.
Poster 2 : IX

Ultrasonographic evaluation of uterine involution following induction of abortion in bitch

S Soroori, H Ghasemzadeh-Nava,M Molazem,N Sayyah, M Asghari Dept. of Clinical Sciences, Faculty of Veterinary Medicine, University of Tehran, Iran

This study was performed on 6 pregnant bitches in their third trimester of pregnancy. Pregnancy was terminated in all the bitches by medical interventions, using ultrasound-guided induced cardiac arrest in the fetuses. Ultrasonographic examination of the reproductive tract were carried out after the day of complete abortion up to complete uterine involution, in which uterine dimensions were unchanged within two consecutive evaluations. Uterine shape, size, and echogenicity as well as its wall layering were evaluated in ultrasonographic evaluations, and mean values were measured both in placental and interplacental region. Our findings revealed that, uterine wall is detected on ultrasound images having 6 different layers, on the basis of its echogenicity. Wall layering was very explicit and distinct within the first week after abortion and it lost its distinction in the course of uterine involution. Immediate to the day of abortion, placental regions measured approximately twice the size of the uterus in interplacental areas. In the first week, the mean values of the placental and interplacental thickness were 2.11cm and 1.12cm respectively, measured in uterine horns. After the third week, the placental and interplacental regions were lost their distinction and their thickness. In the last two weeks, uterine horns were almost equal in dimension in every part. The time of complete involution varied amongst these 6 different bitches, being in 6th, 8th, 9th, 10th, and 13th week after the induction of abortion. 263

Poster 3 : IX

Three Dimensional Power Doppler Ultrasonography of Flunixin Induced Inflamed Kidney in Dog
L. Mohammadyar1, M. Molazem2, P. Sadeghian1 Islamic Azad University, Garmsar Branch, Garmsar, Iran 2 Department of Veterinary Radiology, University of Tehran, Tehran, Iran
1

Inflamed kidney in dogs develops when the spaces of the kidney tubules become inflamed, which in turn will eventually cause the kidneys to lose their function. It can get worse over time, and can be life threatening if not be diagnosed and treated fast and properly. Blood chemistry, arterial blood gases, blood count, kidney biopsy, conventional ultrasonography and urine analysis are routine diagnostic procedures. The present study will evaluate using Three-dimensional power Doppler ultrasonography in detection of the disorder. A total of 12 healthy dogs were selected. Inflamed kidneys induced in them by using flunixin. All cases underwent three-dimensional power Doppler ultrasonography. Mean Gray Index, Flew Index, Velocity Index, Velocity and flew Index were all obtained before, after induction and after treatment. Results showed that Flew, Velocity, Velocity and flew Indexes were all increased significantly after inflammation induction and decreased again after treatment. The vascularity pattern of the kidneys was not different, though.The results revealed that using three-dimensional power Doppler ultrasonography can be a reliable, accurate and fast technique for diagnosis of inflamed kidney in dogs and can be used in following up the treatment procedure too.
Poster 4: IX

Study of Skeleton of Leopard

Pankaj Thanvi and Hemant Joshi Department of Veterinary Anatomy College of Veterinary & animal Science, Navania, Vallabhnagar, Udaipur Rajasthan University of Veterinary & Animal Sciences, Bikaner (Rajasthan)

A damaged and incomplete carcass was presented to the Department of Anatomy by the Forest Department, Udaipur for identification of the species. The bones were maccerated properly for the osteological studies. The ossification centers of large bones were unossified which revealed that the presented carcass was of young animal. The scapula was roughly triangular. Anterior border of scapula was srongly curved while the posterior border was straight. Parietal surface was divided into two equal halves like that of dog. The scapular spine presentsmetacromin process at its distal end. The humerus was less curved and head of humerus was hemispherical. Olecrononfosswas less deep. Just above the lateral condyle and on the lateral margin of posterior surface of shaft of humerus there was a foramina. Ulna was straight and anconeus process does not overhang the semilunar notch. The oscoxaewas composed of thre bones and both the innominateswere arranged parallely. Acetabular cavity was deep and acetabular notch was wide. Obturatur foramina was large and eleptical. Ilium was thick, flat plate of bone in the shape of an elongated rectangle. The lateral surface of the wing of ilium was mostly concave except for the thick dorsal border like the tiger. The skull was widest anterioly and strongly narrowing posterioly. Presphenoid bone was long and narrow with no median widening but it was short and wide and widened medially. Orbital part of frontal bone was longer than nasal part, while it smaller than the nasal part in the tiger and wolf which is comparable to Hemantjoshi (2004). On the above osteological study it was concluded that the presented carcass was of leopard 264

Poster 5 : IX

Therapeutic management of canine ehrlichiosis

Gupta, S. R., Yadav, R., Sharma, C.S. and Sharma, Y.K. Department of Veterinary Medicine Apollo College of Veterinary Medicine, Jaipur (Rajasthan)

Canine ehrlichiosis is an emerging tick born disease caused by obligatory intracellular pathogen Ehrlichia canis. It was first described at the Pasteur Institute in Algeria by Donatien and Lestoquard in the year 1935. The present study was carried out on ten dogs of either sex of different breeds and age groups (ranging between eight months to two years) which were presented at TVCC of Apollo College of Veterinary Medicine, Jaipur (Rajasthan) during March to November, 2011 with the history of intermittent fever, anorexia, lethargy, depression, mild weight loss, serous nasal and ocular discharges. Epistaxis, anemia and odema of limbs and scrotum are also reported in some dogs. Diagnosis of disease is carried out on the basis of anamnesis, clinical findings, buffy coat smear and haematobiochemical examination. In present investigation buffy coat smear with wright stain reveals mulberry like ehrlichial morulae in segmented neutrophills. Haematological investigation revealed leucopaenia, thrombocytopenia and mild normocytic normochromic anaemia whereas, biochemical investigation revealed significant hypoproteinemia, hypoalbumenia and mild transient increase in globulin, alanine amino transferase and alkaline phosphatase. In present study infected dogs were treated with doxycycline @ 10mg/kg body weight once a day orally for fifteen days and intravenous fluid for stabilized the condition. Blood transfusion was also carried out in three severely anaemic dogs. Most of dogs showed clinical improvement within 24-72 hr.
Poster 6: IX

Bactriolgy and antibiogram profile of canine pyometra

Singathia Rajesh,Yadav Rajendra1, Dutta Pankaj, Gangil Rakhi, Gupta Sita Ram and Lakhotia R. L. Department of Veterinary Microbiology Apollo College of Veterinary Medicine, Agra Road, Jaipur-302031.

The present study was carried out on 18 bitches presented at Teaching Veterinary Clinical Complex of Apollo College of Veterinary Medicine, Jaipur, with variety of clinical manifestation evident by elevated temperature,vomition, occasionally vaginal discharge of light chocolate brown color with foetidodour and abdominal distension. Swab samples were collected aseptically from the vagina in open cases and after hysterectomy in closed cases of pyometra. Samples were processed for bacterial isolation by streaking on Nutrient Agar plates, MacConkeys Lactose Agar and Blood agar and were incubated at 370C for 24-48 hrs both in aerobic as well as in anaerobic conditions. Primary and secondary biochemical tests were performed for the identification of the bacteria. Biochemical characterization of these isolates revealed that Staphylococcus spp was predominant one(72.22%)followed by E.coli(16.67%) and Pseuomonasspp (11.11%). In in vitro study, majority of the above isolates were highly sensitve to Ciprofloxacin, Enrofloxacin, Genatmicin and Ampicillin. Lowered sensivity was noticed towards Oxytetracycline, Erythromycin, Chloremphenicol,Nalidixic acid and resistant to Penicinllin, Cefixime, Ceftriaxone, Cephalexin. 1 Department of Veterinary Medicine

265

Poster 7 : IX

Canine Mastitis
Virendra Kumar, N.K. Jeph, M. Ashfaque, A. Gahlot, R.K. Tanwar, Anju Chahar, Fakhruddin Department of Epidemiology & Preventive Veterinary Medicine College of Veterinary and Animal Science, RAJUVAS, Bikaner

Mastitis is inflammation of the mammary gland associated with infection. Mastitis can occur anytime during lactation or in false pregnancy. The most common bacteria isolated are coliforms, staphylococcus sp. and streptococcus sp. These bacteria are normal inhabitants of the intestines and skin of dogs.Bitches housed in dirty environments or unhygienic conditions, in poor body condition, and bitches that are heavily parasitized or systemically ill are all predisposed. Puppies with long nails can predispose the bitch to infection due to trauma from the nails. In addition, galactostasis can predispose a bitch to mastitis. Affected glands are reddened, firm and painful. Mastitis may involve only a portion of a gland, one whole gland or several glands. Milk from the affected glands can be normal in color, greenish-yellow, brown or red and can have flakes or clots. Abscessation and gangrene of the glands can be present in severe cases. In these cases the glands may also appear dark or black in color. This type of disease can rapidly lead to a systemic infection. The signs can include depression, neglect of pups, anorexia, lethargy, fever and shock. Treatment is focused on management of the infection of the gland. Use of anti-inflammatories and broad spectrum antibiotics until culture and sensitivity results are available. The gland should be hot packed or soaked in warm water, and milked out twice a day if the puppies are avoiding the mastitic glands.
Poster 8 : IX

Agalactia in bitches
Virendra Kumar, N.K. Jeph, M. Ashfaque, R.K. Tanwar, Anju Chahar, Fakhruddin Department of Epidemiology & Preventive Veterinary Medicine College of Veterinary and Animal Science, RAJUVAS, Bikaner

Agalactia occurs when no milk is produced by the mammary glands or the breasts do not develop in late pregnancy. This condition may have a genetic basis. . The most common cause of insufficient milk production is failure to feed the mother an adequate number of calories, especially during the second or third weeks after whelping, when nursing demands are the greatest. Lactation failure is very serious and if measures arent taken the litter will die. These puppies must be hand fed using artificial milk, until the litter can be weaned onto solid foods. it is important to encourage suckling to continue breast stimulation. Once the milk comes down, the dam will usually accept her puppies. Feeding a pregnant dam high quality food during pregnancy may reduce the instance of failure to produce enough milk. Drug Domperidone (a dopamine antagonist) can be used to promote mammary development. Metoclopramide, also indirectly increases prolactin levels. It may be used if domperidone is unavailable, but has the potential to cause some neurologic side effects (excitation, anxiety) especially when administered at higher dosages .These medications may also be used in combination with oxytocin to stimulate milk letdown, especially in nervous bitches. Hydration of bitch must for milk let down,especially in nervous bitches.

266

Poster 9 : IX

Anaphylactic shock in dog - a case report

Surender Kumar, Richa Gaur, Shadab A. Khan, R. Kumar, D.K.Saini Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, RAJUVAS, Bikaner

A two year old Pomeranian male dog was brought to the clinic of Veterinary College, Bikaner. It had difficulty in breathing, swelling on face, eye lids and hind limbs. There was generalised erythema with wheals on abdomen. It was unconscious. On clinical examination it had subnormal body temperature with cold extremities and tachycardia with irregular heart beat. It was immediately treated by giving injection Dexamethasone (4mg/ml) 8mg I/V, Injection Pheniramine Maleate (22.75mg/ml) 1ml I/M with oxygen therapy. The dog being non-responsive to the treatment was treated with injection adrenaline (1:1000) 0.5ml I/M and rapid massage was given at the site of injection. It started regaining consciousness after 20 minute when a second injection of adrenaline was given in the same dose rate and by same route. It regained consciousess after 2 hours of treatment. Injection Dexamethasone and injection Pheniramine Maleate were repeated on 2nd and 3rd day. Symptoms fully subsided after 3 days of treatment.
Poster 10 : IX

Ascites in dog- A case Report

A.P. Singh, A. Maheshwari, Deepika Gokhlani, S. K. Vyas, D.S. Meena, J.P.Kachhawa and N.K. Mudgal Department of Clinical Veterinary Medicine, College of Veterinary and Animal Science RAJUVAS, Bikaner 334001

A six year old male Labrador dog weighing 31 kg body weight was brought to Medicine Clinic of College of Veterinary and Animal Science, Bikaner. Physical examination revealed distention of abdomen, tactile percussion quaver was evident. Mucus membrane was pallor, ribs were prominently visible and there was tachycardia and polypnea was evident. Temperature of the dog was 101.8F. Haemato-biochemical examination revealed Hb 8 g%, Neutrophil 78, Lymphocyte 19, Monocyte 3, Total leukocyte counts 5550/ cumm, Blood urea nitrogen 168.97 mg/dl serum creatinine 4.06 mg/dl, ALT 55.37 U/L and AST 22.7 U/L. Faecal examination revealed presence of Trichuris and Toxocara infestation. The dog was administered with Inj. Amoxycillin and Dicloxacillin (M/s Alembic Pharmaceuticals Ltd. Vet. Division, Moxel-D) 500 mg i/ v b.i.d, Inj. Frusemide (Aventis Pharmaceuticals, Lasix) 10 mg i/m, Inj Tribivet (Intas Pharmaceuticals Pvt. Ltd.) 2 ml i/m, Inj 5% Dextrose 300 ml i/v, Syp. Sharkoferol pet 2 TSF b.i.d. orally and Tab. Plozicheck 3 orally (M/s Vetnex Pfizer each tablet contain Praziquental 50 mg, Pyrantel embonate 144 mg and Fabantel 150 mg). Fluid was removed by abdominal Paracentesis. The animal did not took anything orally but after 4th day of treatment there was decrease in abdominal distention and feed intake was started.

267

Poster 11 : IX

Epiphora in dogs
Maini Ankush , Chandrapuria V. P., Jawre Shobha , Rai Somil M.P.P.C.V.V., JABALPUR (M.P.)

Affections / diseases of canine lacrimal and nasolacrimal system mostly cause epiphora (dacryocystitis). It can be simply defined as overflow of tears characterized by chronic tearing results to brown rust colored staining of hairs around the eye and face of animals. The condition can be diagnosed by clinical examination with the help of direct ophthalmoscope and can be differentiated by schirmer tear test, dacryocystorhinography and probing. Medicinal treatment includes antibiotic eye drops with NSAIDs and steroids. Doxycyclin is used for controlling facial staining however the response remains poor. Surgical therapy includes cannulization by probing the nasolacrymal gland through punctum with lachrymal probe. The flushing can be done by infusing normal saline solution. In recurrent or non responding cases conjuctivorhilostomy can be performed for permanent relief. A subcutaneous tunnel is constructed from the middle of lower eyelid for draining of excessive tears.
Poster 12 : IX

Prevalence of different infectious and systemic diseases in Dogs in Bikaner

Nirmal Kumar Jeph, M. Ashfaque, V. Kumar, R.K. Tanwar, Anju Chahar, Fakhruddin Department of Epidemiology & Preventive Veterinary Medicine College of Veterinary and Animal Science, RAJUVAS, Bikaner

In total 1544 Dogs, clinicopathies were examined during one year (April 2009-March 2010). All type of clinicopathies were diagnosed by routine techniques. Overall occurrence of diseases in dogs were determined and expressed as percentage. The prevalence of different diseases in dogs were Infectious Canine Hepetitis- 0.19 %, Leptospirosis- 0.45 %, Dermatitis-11.72 %, Canine Distemper- 1.17 %, Babesiosis- 0.06 %, Gastritis- 7.51 %, Enteritis- 2.85 %, Gastro-Enteritis- 18.26 %, Dyspepsia- 2.66 %, Rickets- 1.49 %, Ascitis- 0.06 %, Otitis- 1.75 %, Pneumonia- 0.71 %, Kennel Cough- 1.10 %, Debility- 1.55 %, Pica- 0.13 %, R. L. Syndrom- 7.12 %, Gingivitis- 0.13 %.
Poster 13 : IX

A case report of haemorrhagic gastroenteritis in Canines

Rajendra Kumar,N.K.Jeph, Mahesh Nehra, surendra Kumar, R.K. Tanwar, Anju Chahar & fakhruddin Department of Epidemiology & Preventive Veterinary Medicine, College of Veterinary and Animal Science, RAJUVAS, Bikaner

The present study reports a case of male labrador dog (weight = 20 kg) with symptoms of haematemesis, dull, depressed and enteritis presented to the clinic and on clinical examination temperature was noted 100.50F, pulse rate 84, Heart rate 84. On the basis of history and clinical symptoms haemorrhagic gastroenteritis was diagnosed. The treatment given was Inj. Ascorbic acid 5 ML I/V Inj. Dextrose normal saline 200 ML I/V BD Inj. Ringer's lactate 200 ML I/V BD Inj. Perinorm 1 ML I/M Inj. Rentac .8 ML I/V Inj. Botra pause 1 ML I/V After 3 Days of continuous treatment animal becomes normal.

268

Poster 14 : IX

A Case Report of Coprophagia in Pomeranian Dog and Response to Pancreatic Extract.

R.K.Dedar Equine Production Campus, National Research Center on Equines Bikaner.

Coprophagia in dogs occurs due to various reasons. Deficiency of pancreatic enzymes due to chronic pancreatitis in adult is one important cause of coprophagia . It is thought that disease states result in a large amount of undigested food being passed in the stool. The drive to eat stool is enhanced by both the increased nutritional value of the stool and by the increased appetite resulting from poor absorption . In some cases, the addition of small amounts of pancreatic enzymes to the diet eliminates the behavior .A two year male Pomeranian dog was presented with a History of Coprophagia and moist foul smelling feces. Animal was earlier treated for coprophagia by deworming with albendazole and mineral supplements. The dog did not respond to treatment. Based on clinical signs and history of response to previous treatments animal was suspected for deficiency of pancreatic enzymes. The dog was treated with Tab. Panzynorm (Containing Pancreatin 100mg; and bile extract 40 mg per tablet) tablet once a day for first 7 days and 1/8 of tablet for next 15 day. Animal responded well to the treatment and further treatment did not require. It is concluded that Coprophagia due to pancreatic enzyme deficiency may occur in pomerian dogs, This type of coprophagia may be treated with pancreatic enzyme supplementation. Poster 15 : IX

Eye Cancer and its management in a dog - A case report

Sanjeev Nehru Dr. Nehru's Multispeciality Dog Hospital, Agra

A Pointer mix 10 yrs old dog suffering from eye cancer since last 10 months presented to the clinic. The growth was like a small ball and there was no vision in that eye. The dog was operated surgerycally and removed the eye cancer. After surgery the dog was treated with Moxiflox eye oint and drops, Gatiflox eye drops, Olpatadine eye drops 5 to 6 times a day. After 10 days of operation the dog was seeing normally. Poster 16 : IX

An approch to blood transfusion in dogs - A clinical study

AK Palei, MC Parashar, K. Kachhawa, M. Nagar, M. Agarwal, TK Gahlot Department of Veterinary Surgery & radiology College of Veterinary & Animal Sciences, RAJUVAS, Bikaner, Rajasthan, 334001

Blood transfusion was undertaken in 15 dogs during last 2 years, out of which 9 were female & 6 were males. These cases were presented for either surgery or had severe dehydration and anemia following parvo virus infection. The hemoglobin of these cases ranged from 4 to 8 gm%. A standard human blood bag (350 ml) was used containing anticoagulant citrate phosphate dextrose adenine solution USP 49 ml. An apparently healthy donor dog of large breed was chosen to collect the blood. Approximately 300 ml blood was aspirated out by jugular vena puncture of donor dog. A cross matching of the blood was not carried out in any of the case of present study since all recipients were receiving first transfusion. The blood transfusion was carried out in recipient dogs through cephalic veins. All dogs showed remarkable improvement in general condition & those which underwent surgery tolerated general anesthesia satisfactorily. The parvo infection cases showed either absence or meager melena after blood transfusion. It was opined that critical cases showing anemia or low hemoglobin should be selected for blood transfusion

269

Poster 17 : IX

Benefits of Pregnancy determination in the bitch by ultrasonography

Sanjeev Nehru Dr. Nehru's Multispeciality Dog Hospital, Agra

Ultrasonographic evaluation of the reproductive tract is an important component in the evaluation of the bitch. Information is obtained concerning normal events involving the reproductive system (eg, ovulation, pregnancy) as well as pathologic conditions (eg, ovarian cysts, metritis).Ultrasonic examination commonly will be performed 24 to 50 days after ovulation when fetal masses and heart beats (120 - 150 beats per minute) can be visualized within the vesicles with the help of ultrasound. Heart beat are often used to evaluate fetal life when complication arises during a delivery. Serial ultrasonographic evaluation of the diseased reproductive tract can be very helpful in evaluating response to therapy. Poster 18 : IX

Mitral valve insufficiency and its therapeutic management in a dog - A case report
Khinchi R.K., Singh Naveen Kumar, Bihani D.K., Ahuja Anil Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Sciences, RAJUVAS, Bikaner (Rajasthan) - 334001

A male Labrador dog of 9 yrs age with history of respiratory distress, mild abdominal distension was presented to the clinic. Physical examination finding revealed grade four systolic murmur and tachycardia on cardiac auscultation and moist crackles on lung auscultation. ECG showed left ventricular enlargement and sinus tachycardia. Radiography revealed cardiomegaly and pulmonary edema. The case was diagnosed as mitral valvular insufficiency with systolic failure. It was treated with digoxin, enalapril maleate and frusemide. In subsequent visit animal showed marked improvement in physical examination findings and reduced pulmonary edema in radiography. Still animal is under treatment and doing well. Owner advised to bring the animal every month for a review. Poster 19 : IX

Hookworm infestation in pup - A case report

Lenin Bhatt1, Sandeep Meel and Vikas Sharma Post Graduate Education & Research Centre For Livestock Health and Production, Jaipur

A two months old Labrador pup came to the clinic with history of lethargic, frequent vomiting with small blood traces and black coloured pasty faeces. On examination, the mucous membranes were severely pale suggesting severe anemia. There was no history of deworming or treatment. Blood and faecal samples were collected and treatment was started symptomatically with antibiotics, I/V fluids, Antiemetics and Haemostatics. With Hb being 3.2 gm %, blood transfusion was done same day evening and fenbendazole was started as the faeces were positive for hook worms. Pup vomited pure blood later that night and collapsed. Post mortem examination confirmed presence of number of live hookworms in the intestine. 1 Veterinary Officer, SDDC, Jaipur

270

Poster 20 : IX

Importance of dental hygiene for dogs health

N. K. Mudgal, A. P. Singh, D. K. Choudhary, S. K. Sharma and N.K.Jeph Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Science, Bikaner

Dental hygiene plays an important role in dogs overall health, parallel with nutrition, proper exercise and grooming. Quality dental hygiene can be potential reason to enhance dogs healthy life, perfect for companionship and make them friendly in our home environment by avoiding doggy breath. In addition to these, proper dental care is known to add as much as five years to dogs life. Avoiding of dental care not only cause chronic dental diseases such as plaque, tartar, calculus, halitosis (bad breath), gingivitis, periodontitis, oral pain and tooth loss but also support the accumulation of bacteria and other infective agents in oral cavity. Puppies have 28 deciduous teeth that typically fall out by about six months of age so dental care should start in routine as early as possible in dogs life. The simplest way to keep track of dogs teeth is to look at them on a regular basis and be aware of signs that may indicate a problem. To inspect dogs teeth, lift the lips all around the mouth, looking at the front and back teeth as closely as possible. Be gentle and cautious so you do not accidentally get nipped. Use a finger brush or long toothbrush especially designed for dogs. Never brush dogs teeth with human toothpaste otherwise it can make dog sick. Use recommended enzymatic toothpaste made especially for dogs and the same goes for oral rinses. Daily brushing and proper dental care is recommended for healthy routine of dogs. Poster 21 : IX

Scooting problem in dog

Urmila Pannu, Anju Chahar and V.S. Netra Department of Animal Breeding and Genetics College of Veterinary and Animal Science

Scooting means rubbing or dragging the anal area on the ground. Hind legs are extended in front of the animal as the pet drags herself forward. Anything that causes an irritation or itching to the area under the tail may cause an animal to scoot. The most common cause of scooting is anal gland disease. It includes impacted, infected and abscessed anal glands. Other causes of scooting include allergic dermatitis, tapeworms infestation, skin parasites (fleas or ticks). Diagnosis made by taking history, physical examination of rectum and faecal examination. Proper treatment depends on the cause of scooting. Manual expression of impacted anal glands, and antibiotics should be given orally. If itching is severe antihistamines or corticosteroids should be given orally. Internal and external parasites should be checked by giving broad spectrum anthelmintic twice a year. Poster 22 : IX

Detection of canine distemper in a dog - A case report

Dhuria Deepika1, Singh Naveen Kumar2, Ahuja Anil 3, Khinchi R.K.4 Department of Clinical Veterinary Medicine, Ethics and Jurisprudence College of Veterinary and Animal Sciences, Bikaner (Rajasthan) 334001

A Labrador male dog aged 2 months weighing 2.2 Kg. with no clinical illness of was presented to the clinic for immunization. On clinical examination slightly conjunctival discharge noticed. By this conjunctival swab Canine Distemper was diagnosed by canine distemper Ag test kit. The therapy has given which included multivitamins (Actipet drops), ascorbic acid and zymopet drops. After 11 days the dog started to show the clinical symptoms like retching, respiratory involvement and neurological complications. The dog collapsed on the 2nd day after clinical symptoms appeared.

271

Poster 23 : IX

Surgical correction of rectal diverticulum with and without perineal hernia in dogs - A report of two cases
A.K.Maji, Sabyasachi Konar and H.Palui Department of Veterinary Surgery and radiology, WBUAFS,37,K.B.sarani, Kolkata-700 037

One 5 years old male German Shepherd Dog with 2 months long standing perineal swelling,dyschezia and tenesmus diagnosed clinically as bilateral rectal diverticulum without perineal hernia was operated by pull-thorough technique in anal approach. The pathological portion of rectum with disrupted muscularis and protruded mucosa was pulled to limit and resected out.The healthy rectal wall was apposed with anal skin. Laxative diet, regular dressing and antibiotic were followed at post-operation with uneventful rehabilitation upto 6 months observation period. Another 6 years old,11 kgs of body weight having right unilateral rectal diverticulum perineal hernia complex was operated by right elliptical incision, blunt dissection and obliteration of blind pouch of rectum by application of transverse interrupted lembert suture followed by routine perineal hernia repair . Castration in both the cases was done. Standard post-operative measures were followed. In both the dogs formed faeces defecation along with body weight gain were achieved at successful rehabilitation. Poster 24 : IX

Surgical Management of Pyometra in Bitches

Mahendra Tanwar, K. Kachawaha, M.C. Parashar, S.M. Qureshi , T.K. Gahlot

Present report is based on 10 cases of close pyometra in Bitches. Out of these Six were between 8 to 11 years age group & remaining were between 3 to 5 years age group. All the bitches showed abdominal distention, dehydration & anaemia due to frequent vomitions. The haemoglobin of these animals ranged from 7 to 10.5 g%. These animals were in a state of septicemia. Three bitches of present study were transfused blood & 200-300 ml of 5% DNS was administered preoperatively. Dexamethasone 20-30 mg was given intravenous preoperatively. Animal & surgeons were prepared before administration of anaesthesia in order to reduce duration of anaesthesia. All animals were given atropine, xylazine and ketamine cambination. A minilaparotomy was done from the right flank to carryout the ovariohyterectomy. Postoperatively antibiotics for 7 days, NSAID for 3 days & fluid therapy for 2 days were administered. All animals were made uneventful recovery. Poster 25 : IX

Hematology of indigenous stray puppies at Bikaner

Yash Pal1, R A Legha, R K Dedar Equine Production Campus, National Research Centre on Equines, Post Bag. No. 60, Bikaner 334 001 Rajasthan

The present study was undertaken to evaluate the hematological indices in indigenous mother-reared puppies. These puppies were of 1.5-2 months old and their mothers were of wild type sustaining themselves on dead carcass and hides at Bikaner. Blood was collected from eight apparently healthy puppies of either sex from cephalic vein on the front of the foreleg in EDTA coated tubes. Hematological indices (hemoglobin, packed cell volume, total erythrocyte count, total leukocyte count, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, and differential leukocyte count) were manually analyzed following standard methods. Hb, PCV, TEC and TLC ranged between 7.4 and 10.0g/dl, 20 and 28%, 4.8 and 6.0x106 cmm and 12.9 and 23.0x103 cmm, respectively irrespective of sex. During the study MCV (fl), MCH (pg), MCHC (%) ranged between 39.2-42.27, 14.66-17.24 and 35.2 39.0, respectively. Neutrophils ranged between 66 to 90% in puppies. Higher values of TLC and neutrophils indicate presence of bacterial infection in stray puppies. 1 yashpal@scientist.com

272

Poster 25 : IX

Milk composition of stray bitches

R. A. Legha1, Yash Pal and R K Dedar Equine Production Campus, National Research Centre on Equines, Post Bag. No. 80, Bikaner 334 001 Rajasthan

The present study was conducted on three newly parturated stray bitches to analyze the milk composition. The lactation stage of bitches was 14 to 21 days. These bitches were mainly dependent for food on carcass of dead animals. The average live litter size was three. The milk samples of three bitches were collected two times at alternate day. The bitches were separated from their puppies for two hours before milking. Initially, milking was tried in the presence of their puppies but milk let down could not take place in any of the bitch. Therefore, the bitches were separated from their puppies for 2 hours and then injected oxytocin 5IU intramuscularly to each bitch and milked all the teats. Total milk obtained during each milking ranged between 25- 40 ml from each bitch. The milk samples were analyzed for its composition by automatic milk analyzer. The average values (SD) observed for fat %, SNF%, density, protein %, lactose%, ash%, pH and conductivity were 10.27 0.11, 10.24 0.51, 14.27 1.39, 3.99 0.14, 5.150.29, 1.040.07, 6.57 0.05 and 3.180.02, respectively. 1 legha@scientist.com

273