4/14/13

Primer design report

Report of BatchPrimer3 Primer Design

Help | View primers in HTML table format | View primers in tab-delimited table format Save as a tab-delimited text file | Save as an Excel file | Primer Report Statistics | Download entire results (a zip file) Primer type: Generic primers Sequence Index: 1 Sequence ID: Generic primers: Orientation Start Len Tm 1 FORWARD REVERSE 1416 20 2113 20 GC% Any 3' Primer Seq compl compl 0.00 2.00 Product Seq Size Size Included Pair_any Pair_3' Size 5.00 1.00

60.00 45.00 2.00 59.58 40.00 6.00

CTTCTTTTTGCTTGCCGTTC 698 TTGGAAGCTTGTTCAAAGCA

2372 2372

Primer Report Statistics

Total sequences input: 1 Number of sequences with sucessful primer pairs: 1 Number of sequences without primer pair picked: 0 Total primer pairs picked: 1 Used time: 0 seconds.

B a t c h P r i m e r 3v 2 . 0

probes.pw.usda.gov/batchprimer3/batch_primers/117.227.204.93_1365878248/117.227.204.93_1365878248_primer_report.html

1/1