You are on page 1of 1

>pcrproduct_EMIA_8306-1_5235,Trimmed Sequence(602 bp) TCTTTTTCACTTAGTACAAAACCATTGGTGGTCTCTGTCATGATTTTCATCCGTTCCACG CCTAGTTCATTTTTGGGATTAGCAACTAAGATACAGTAGGAAGCATCACTTCCGCGTCCA ACACGTCCACGAAGCTGATGCAGCTGTGCCAAACCAAATCGATCCGCATCCATAATCAGC ATGACGGTTGCGTTTGGCACGTTTACCCCTACTTCTATTACCGTAGTAGAAACTAATATC TGCATCTGGTTATCTTTGAAAGCTTCCATGATCACTTCTTTTTCCTGATTCTTCATTTTA CCATGTAACAAGCCAACTTCATATTTTGGCGCAAATAGTTCACGAAGTTTTTCATAGATT TCCACTGCGTTTTTTACGTCTAATGCTTCTGATTCTTCGATCAGTGGACAGATGACATAC ATTTGATGTCCTCTTGCCAGTTCTTTCCTTGTCCAATCCAGTACACTGTCTAATTGAGGT GTTCTTACCCAGCGTGTTTCAATAGGGATACGCCCAGCTGGAAGTTCATCAATGATCGAT ACATCCATTTCACCGTACGCTGTGATAGCTAGCGTTCTAGGAATCGGAGTCGCCTGTCAT AA

>gb|EF694230.1|:1-557 Enterococcus faecium isolate KH 24 RecG gene, partial cds TACGGTGAAATGGATGTATCGATCATTGATGAACTTCCAGCTGGGCGTATCCCTATTGAAACACGCTGGG TAAGAACACCTCAATTAGACAGTGTACTGGATTGGACAAGGAAAGAACTGGCAAGAGGACATCAAATGTA TGTCATCTGTCCACTGATCGAAGAATCAGAAGCATTAGACGTAAAAAACGCAGTGGAAGTCTATGAAAAA CTTCGTGAACTATTTGCGCCAAAATATGAAGTTGGCTTGTTACATGGTAAAATGAAGAATCAGGAAAAAG AAGTGATCATGGAAGCTTTCAAAGATAACCAGATGCAGATATTAGTTTCTACTACGGTAATAGAAGTAGG GGTAAACGTGCCAAACGCAACCGTCATGCTGATTATGGATGCGGATCGATTTGGTTTGGCACAGCTGCAT CAGCTTCGTGGACGTGTTGGACGCGGAAGTGATGCTTCCTACTGTATCTTAGTTGCTAATCCCAAAAATG AACTAGGCGTGGAACGGATGAAAATCATGACAGAGACCACCAATGGTTTTGTACTAAGTGAAAAAGA >gb|EF694229.1|:1-557 Enterococcus faecium isolate FH 99 RecG gene, partial cds TACGGTGAAATGGATGTATCGATCATTGATGAACTTCCAGCTGGGCGTATCCCTATTGAAACACGCTGGG TAAGAACACCTCAATTAGACAGTGTACTGGATTGGACAAGGAAAGAACTGGCAAGAGGACATCAAATGTA TGTCATCTGTCCACTGATCGAAGAATCAGAAGCATTAGACGTAAAAAACGCAGTGGAAGTCTATGAAAAA CTTCGTGAACTATTTGCGCCAAAATATGAAGTTGGCTTGTTACATGGTAAAATGAAGAATCAGGAAAAAG AAGTGATCATGGAAGCTTTCAAAGATAACCAGATGCAGATATTAGTTTCTACTACGGTAATAGAAGTAGG GGTAAACGTGCCAAACGCAACCGTCATGCTGATTATGGATGCGGATCGATTTGGTTTGGCACAGCTGCAT CAGCTTCGTGGACGTGTTGGACGCGGAAGTGATGCTTCCTACTGTATCTTAGTTGCTAATCCCAAAAATG AACTAGGCGTGGAACGGATGAAAATCATGACAGAGACCACCAATGGTTTTGTACTAAGTGAAAAAGA >gb|CP006620.1|:86981-87581 Enterococcus faecium Aus0085, complete genome TTATGACAGCGACTCCGATTCCTAGAACATTAGCTATTACAGCATATGGTGAGATGGATGTATCTATCAT TGATGAACTTCCAGCTGGACGTATCCCGATCGAAACACGCTGGGTAAGAACACCTCAATTGGACAGTGTA CTGGATTGGACGAAAAAAGAACTGGCAAGAGGACATCAAATGTATGTCATCTGTCCGCTGATTGAAGAAT CAGAAGCATTAGATGTAAAAAATGCAGTGGAAATCTATGAAAAACTTCGTGAACTATTTGCACCAAAATA TGAAGTTGGCTTGTTACATGGTAAAATGAAGAATCAGGAAAAAGAAGTAATCATGGAAGCCTTCAAAGAC AACCAGATGCAGATATTAGTTTCGACTACTGTAATTGAAGTAGGGGTAAACGTGCCGAACGCGACCGTCA TGCTGATCATGGATGCGGATCGATTTGGATTGGCACAGCTGCACCAACTTCGTGGACGTGTTGGACGCGG AAGTGATGCTTCCTACTGTATCTTAGTTGCTAATCCTAAAAATGAACTAGGTGTGGAACGGATGAAAATC ATGACAGAGACCACCAATGGTTTTGTACTAAGCGAAAAAGA