Min Jung Kim

BIOEN 498A: Molecular Diagnostics

FINAL CAPSTONE PROJECT
Rohrman BA, Leautaud V, Molyneux E, et al. A Lateral Flow Assay for Quantitative Detection of
Amplified HIV-1 RNA. PLoS One. 2012;7(9):e45611. Doi:10.1371/journal/pone/0045611. Epub
2012 Sep 21.
Section 1: Isothermal amplification mechanism

Figure 1: A diagram of the NASBA phases

and products [1].

Nucleic acid sequence-based amplification

(NASBA) is an isothermal single strand RNA
amplification assay developed by Dr. Jean
Compton in 1991 [1]. The assay allows for a
continuous,
homogenous,
isothermal
amplification of the target. There are three main
materials: primers, enzymes, and nucleosides.
There are two primers. Primer 1 and primer 2
are complementary to the 3 and 5 end
respectively of the target sequence. Primer 1s
5 end contains a promoter sequence that is
recognized by T7 RNA polymerase when the
promoter is double stranded. The assay also
requires T7 RNA polymerase, ribonuclease H
(RNase H), and Avian Myeloblastosis Virus
(AMV) reverse transcriptase (RT) as well as
nucleoside triphosphates. RNase H is a nonsequene specific endonuclease that utilizes a
hydrolytic mechanism to cleave RNA in a
RNA:DNA duplex. Typically, it is used in DNA
synthesis to degrade the RNA primer. AMV RT
can synthesize DNA from both RNA and DNA
templates. It can also function as an RNase H,
can unwind dsDNA, and function as an
endonuclease [2]. T7 RNA polymerase is a
DNA dependent RNA polymerase that is highly
specific to the T7 promoter [3].

There are two phase to NASBA. The first phase is the non-cyclic phase, and it begins when primer
1 anneals to the target. The 3 end of the primer is then extended by AMV RT which synthesizes
cDNA. This results in a RNA:cDNA hybrid, and RNase H degrades RNA from this complex. Primer
2 binds to the cDNA and gets extended by the RT. T7 RNA polymerase can now recognize and
bind to the double stranded promoter region and transcribe the target region. Each DNA template
can yield as many as 100 RNA copies. The RNA synthesized from the cDNA can start the cyclic
phase. This second phase starts when primer 2 binds to the RNA and its extended by RT. Then
the RNase H degrades the RNA strand, leaving just the cDNA once again. Primer 1 then binds to
cDNA and gets extended by RT, and the cycle continues.
In theory, this method is much more efficient than Polymerase Chain Reaction (PCR). Each RNA
template in a given lysed and purified sample will go through the non-cyclic phase and produce a

dsDNA that can be transcribed up to 100 times. Once these transcribed products move onto the
cyclic phase produce more dsDNA that can be transcribed up to 100 times and continue the cycle.
In a hypothetical situation, 20 PCR cycles are needed to reach one million amplicons. On the
other hand, NASBA would require only four or five cycles to reach the same level of amplicons.
There is only one set of primers for this assay. Of the two primers, primer 1 is more important for
the efficiency of the assay because it is the primer that the target binds to initiate the non-cyclic
phase and thus the entire assay. As a result, non-specific binding to RNA in the sample will result
in non-specific products. Not only that, primer 1 has the promoter region for the T7 RNA
polymerase, which means that theres more primer design constraints for primer 1 than primer 2.
Section 2: Analysis of Primer Design
Rohrman et al used the NucliSens EasyQ Basic Kit (BioMerieux) to generate the NASBA products
for their experiments. They specified that the KCl concentration in their reactions were 36 mM.
They incubated the reaction mixture with the purified HIV RNA at 65C for four minutes,
decreased the temperature of the heat block to 41C, and incubated it for another four minutes.
At this step, the enzymes were added in and the reaction was allowed to proceed for 90 minutes
at 41C. The authors state that they simply followed the kits protocol, but the manufacturers
protocol never states basic concentration levels of Mg2+, dNTP, Na+, or oligo concentration in the
stock solutions provided. Fortunately, Kievits et al published a paper in 1991 where they optimize
NASBA for diagnosis of HIV-1 infection, and they wrote out their reaction conditions in great detail
[4]. They state in their paper that their final reaction mixture contained 20 mM MgCl2, 4 mM dNTP,
40 mM Tris, 0.2 uM of primer 1, and 0.2 uM of primer 2 [4]. In total, there was 76 mM of monovalent
cations. These are the conditions that will be used to analyze primer properties.
A region of HIV group specific antigen (gag) gene was flanked by the two primers. The forward
primer has the T7 promoter region at the 5 end that does not bind to the HIV gag gene. The
reverse primer binds to the complementary strand that primer 1 binds on (Appendix A). The melt
temperatures for primer 1 when the target sequence is DNA and RNA are 72.6C and 70.8C
respectively. The melt temperature for primer 2 binding to DNA and RNA target are 64.2C and
60.7C respectively. Since the reaction is carried out at 41C, which is 20 - 30C less than the
melt temperatures, it is likely for primers to bind to non-specific RNA and DNA targets and give
yield to unspecific amplicons. These non-specific amplicons may not be problematic for a point of
care diagnostics (PoC) test result if the detection method is specific to the target sequence but
the efficiency of the assay will be greatly compromised due to the relatively high melt temperatures.
Each of these primers can make one hairpin, and the resultant Gibbs free energy is between -2
and -1 kcal/mol (Appendix B). The melt temperatures of both of these hairpin structures are
around 58C, which is 17C higher than the reaction temperature. This suggests that a large
proportion of the primers may have significant secondary structures that prevent proper annealing.
Although our previous readings suggest that these hairpin structures would not be
thermodynamically favorable enough to be an inhibitor for a typically Polymerase Chain Reaction,
this may not be the case for isothermal amplification reactions like NASBA.
Homodimer complexes are favorable with the primers and conditions used in this assay. Primer
1 is able to form 30 homodimers (Appendix C). The most favorable homodimer complex has
Gibbs free energy of -7.74 kcal/mol and it has two extendable 3 ends. Although very few of the
30 homodimers have extendable 3 ends, it is concerning that the most thermodynamically
favorable homodimer has two extendable ends. Since theres an excess of primers compared to
target in the reaction mixture by design, it is highly likely that most of the primer 1s in the reaction

will get extended at the beginning of the reaction. Once a primer is extended, its extended region
is no longer complementary to the target HIV RNA or DNA, which means that it cannot bind
properly to the target and cannot be extended. Primer 2, on the other hand, only has 10 possible
homodimers (Appendix C). The most thermodynamically favorable conformation has Gibbs free
energy of -7.05 kcal/mol, but there are no extendable ends. As a result, this primer is not much of
a concern for the assay. Heterodimers are not a concern with the primers and conditions used in
the assay. Although there are 25 possible heterodimer configurations, very few of them have 3
extendable ends and the most thermodynamically favorable configurations do not have
extendable 3 ends. As a result, it is safe to conclude that primer 2 will not be a significant inhibitor
in this context.
Cross-reactivity with bacteria is a slight concern for primer 1 in this assay. There are 103 bacterial
BLAST hits that share 96 100% identical sequences with the 5 end of primer 1 (Appendix D).
Although primer 1s 3 end cannot be extended when it is bound to bacterial genomes, this crossreactivity is a concern because low isothermal temperature would further promote unspecific
binding of the primer to the bacterial nucleic acid and possibly lead to amplification. This could
significantly compromise the assays efficiency and specificity. One of the bacteria that would
cross-react is Xenorhabdus nematophilus. It is a gram negative bacteria that lives symbiotically
with nematodes that live in the soil [5]. The bacteria or the nematode it resides in do not cause
disease in humans so they are not a likely contaminant to be concerned about in a PoC device.
There are three other bacteria that share primer 1s sequence that cause common human
diseases. Although Rohrman et al did not explicitly state which type of human samples they would
use in their final PoC device, they would use blood since HIV infects CD4+ cells that circulate in
the blood. It is important to note that bacteria that share primer 1s sequence are not only common
but they also cause bacteremia, which means that are likely to be found in patient blood samples.
Three other bacteria that may compromise NASBA efficiency are Klebsiella pneumonia,
Salmonella enterica, and Wolbachia. K. pneumonia is part of the normal flora in the mouth, skin,
and intestines [6]. It is the most common nosocomially acquired gram negative bacteria, and since
it can cause bacteremia in infected individuals [7, 8], it is likely to be found in patient blood samples.
Another bacterium that may be problematic is S. enterica. It is a gram negative bacteria that can
cause gastroenteritis (food poisoning), bacteremia, enteric fever, and asymptomatic carrier state
[9]. There are 1.3 billion cases of non-typhoid salmonellosis worldwide each year, and 17 million
cases of typhoid fever [10, 11]. Bacteremia occurs in 3 10% of infected individuals [10], which
means that there are 39.51 131.7 million people living with bacteremia from S. enterica
infections. Wolbachia is a genus of bacteria that infects arthropods and roundworms, and some
of them have symbiotic relationship with Onchocera, which is a genus of parasitic roundworm.
When a Wolbachia bacteria resides inside an Onchocera, it can cause river blindness, which
impacts about 17 million people in Africa, Arabia, and South America [12]. There have been
reported low levels of bacteremia in infected patients [13]. Cross-reactivity with this bacterium is
especially concerning, because the target patient population for the PoC device is most likely
African patients, who could have dormant infections from Wolbachia-Onchocera without any
symptoms.
Cross-reactivity of primer 1 with non-target human genome and viral genomes is slightly
concerning. There are 199 BLAST hits with the human genome (Appendix D) and about half of
them are found as transcripts and the other half are found in the genome. Some of the transcripts
have identical sequence on the 3 end of the primer and can be amplified. There are 408 BLAST
hits with viral genomes but most of them were from HIV and T7, which are intentional target
sequences. Banana bunchy top virus and East Asian Passiflora virus are ssDNA and ssRNA
viruses respectively that may cross-react. Since they are plant viruses, their genomes are unlikely

to be found in patient blood samples. Hepatitis B, hepatitis C, Enterobacteria phage, and

Escherichia phage can also cross-react with 5 end of primer 1, They are slightly concerning
because the low isothermal condition may promote more unspecific binding. Enterobacteria and
Escherichia genus can both cause bacteremia [14, 15]. As a result, if a patient has bacterial
infections from these genera they could potentially have the cross-reactive bacteriophage in their
blood. Hepatitis B and C cause acute and chronic liver infections and they can be found in
patients blood [16, 17].
Cross-reactivity of primer 2 with non-target human and bacterial genomes is concerning. Primer
2 has 100 BLAST hits with viral genomes but they are all from HIV-1, which is our target. Therefore,
cross-reactivity with viral genomes is not a concern for primer 2. On the other hand, primer 2 has
200 BLAST hits with the human genome (Appendix E), and about half of them are transcripts.
Primer 2 can also bind to pericentrin (PCNT) mRNA and Rap guanine nucleotide exchange factor
2 (RAPGEF2) mRNA and have an extendable 3 end bound to these mRNAs. RAPGEF2 plays a
crucial role in forming the immunological synapse between T lymphocytes and antigen presenting
cells [18], and PCNT is a structural protein that is essential for cell cycle regulation [19]. Both of
these proteins are commonly found in cells that circulate the blood [18, 19] and therefore their
mRNAs must also be found in the blood. Primer 2 also has 236 BLAST hits with bacterial
genomes (Appendix E). This is highly concerning because it has nearly 100% match with
glucarate dehydratase and esterase found in Shigella flexneri and Escherichia coli. S. flexneri is
a gram negative bacteria that causes dysentery. It is not associated with bacteremia [20] so it not
likely to cause false positive signal from blood samples. On the other hand, as stated previously,
E. coli can cause bacteremia and since primer 2 can bind to mRNA of common enzymes, primer
2 can bind to the mRNA, get extended, and yield in non-target amplification.
Section 3: Detection

Figure 2: Lateral flow assay design by Rohrman et al.

Rohrman et al designed a paper lateral flow assay (LFA) that utilizes gold nanoparticle (GNP)
probes and gold enhancement solution for detecting HIV RNA that has been amplified by NASBA.
NASBA product is loaded on a conjugate pad with GNPs and it down the paper assay via
capillarity (Figure 2). GNPs with RNA sequence attached to it gets bound target capture sequence
in the detection zone. Unbound GNP can be removed to reduce background with a wash buffer,
and a gold enhancement solution can be added for increasing optical absorbance of captured
GNPs. The authors scanned the LFA strips and imaged it using a stereo microscope to
quantitatively assess their results but users can easily compare the detection zone with the
positive control with the naked eye (Figure 3). I think that this is simple and cost-effective enough

as a PoC method. Loading solutions onto a

paper strip is a task that can be performed
by untrained individuals as long as they are
careful in loading all of the solutions onto the
device. The authors state that their device
costs about a dollar each and the storage
conditions or length of time did not greatly
impact the performance of the assay.
Additionally, the positive control is handy for
users and easy to interpret. Although this
assay is very promising, the authors may
want to conduct user tests to get a
quantitative estimate of what percentage of
untrained users correctly interpret the
results.
There are other methods for detecting viral
RNA in a PoC device like the cobas Liat PCR
Figure 3: A scanned image of LFA strips by
system or BioFires FilmArray. Both of these
Rohrman et al. The color intensity proportionally
systems use dyes that are not detectable by
the naked eye. As a result, machines have increases with the target RNA copy number.
to be used to read the results. The

advantage of a system that uses a machine
to read the result is that there is no leeway for the user to misinterpret the results. The downside
is that the machines require maintenance that may be hard or impossible to get in rural areas in
developing and developed countries. The disadvantages outweigh the positives since the
disadvantages have led other PoC methods to fail in the past and cannot be overlooked.
Section 4: Sample preparation
As stated previously, the authors would use human blood samples since HIV infects CD4+ T cells
and macrophages that circulate in the blood. The authors never address how the samples would
be prepared for this assay because they were focused on the detection portion of the device.
Although NASBA is mainly used for detecting ssRNA, DNA would also be an appropriate target
since HIV is a retrovirus that integrates its genome into the hosts genome. The benefit of using
DNA as a target is that it is far more stable compared to RNA. As a result, it may less sensitive
and withstand harsh lysis and purification methods. The authors mentioned using QIAmp DNA
Blood Mini Kit (Qiagen) for purifying nucleic acid from culture lymphoblast for the control assay.
This kit would not be appropriate for a PoC setting because the procedure requires expensive
resources including a sterilized workspace and repetitive pipetting and centrifuge steps that only
trained technicians would be able to carry out.

References:
[1] Compton J. Nucleic acid sequence-based amplification. Nature. 1991 Mar 7;350(6313):91-2.
[2] Lin TH, Quinn T, Walsh M, et al. Avian myeloblastosis virus reverse transcriptase. Effect of
glycerol on its hydrodynamic properties. The Journal of Biological Chemistry. 1991 Jan
25;266(3):1635-40.
[3] Studier FW, Moffatt BA. Use of bacteriophage T7 RNA polymerase to direct selective highlevel expression of cloned genes. Journal of molecular biology. 1986 May 5;189(1):113-30.
[4] Kievits T, van Gemen B, van Strijp D, et al. NASBA isothermal enzymatic in vitro nucleic acid
amplification optimized for the diagnosis of HIV-1 infection. Journal of Virological Methods.1991
Dec;35(3):273-86.
[5] Vivas El, Goodrich-Blair H. Xenorhabdus nematophilus as a model for host-bacterium
interactions: rpoS is necessary for mutualism with nematodes. Journal of bacteriology. 2001
Aug;183(16):4687-93.
[6] Ryan, KJ; Ray, CG, eds. (2004). Sherris Medical Microbiology(4th ed.). McGraw Hill. ISBN 08385-8529-9.
[7] Ko WC, Paterson DL, Sagnimeni AJ, et al. Community-acquired Klebsiella pneumoniae
bacteremia: global differences in clinical patterns. Emerging Infectious Diseases. 2002
Feb;8(2):160-166.
[8] Paterson DL, Ko WC, Von Gottberg A, et al. International prospective study of Klebsiella
pneumonia bacteremia: implications of extended-spectrum beta-lactamase production in
nosocomial infections. Annals of Internal Medicine. 2004 Jan 6;140(1):26-32.
[9] Ryan, K. J., & Ray, C. G. (Eds.). (2004.). Sherris Medical Microbiology: An Introduction to
Infectious Disease. (Fourth Edition. ed.). New York.: McGraw-Hill.
[10] Bronze, M.S., and Greenfield, R.A (Ed.). (2005). Biodefence Principles and
Pathogenshorizon bioscience.
[11] Chimalizeni, Y., Kawaza, K., & Molyneux, E. (2010). The epidemiology and management of
non typhoidal salmonella infections. Advances in Experimental Medicine and Biology, 659, 3346. doi:10.1007/978-1-4419-0981-7_3
[12] Saint Andre AV, Blackwell NM, Hall, LR. The role of endosymbiotic Wolbachia bacteria in
the pathogenesis of river blindness. Science. 2002 Mar 8l295(5561):1892-5.
[13] Keiser PB, Reynolds SM, Awadzi K, et al. Bacterial endosymbionts of Onchocerca volvulus
in the pathogenesis of posttreatment reactions. Journal of Infectious Diseaes. 2002 Mar 15;
185(6):805-11. Epub 2002 Feb 19.
[14] Chow JW, Fine MJ, Shlaes DM, et al. Enterobacter bacteremia: clinical features and
emergence of antibiotic resistance during therapy. Annals of Internal Medicine. 1991 Oct
15;1159(8):585-90.
[15] Rodriguez-Bano J, Navarro MD, Romero L, et al. Bacteremia due to extended-spectrum
beta-lactamase-producing Escherichia coli in the CTX-M era: a new clinical challenge. Clinical
infectious diseases. 2006 Dec 1;43(11):1407-14.
[16] Gretch DR, dela Rosa C, Carithers RL Jr, et al. Assessment of hepatitis C viremia using
molecular amplification technologies: correlations and clinical implications. Annals of Internal
Medicine. 1995 Sep 1;123(5):321-9.

[17] Cacciola I, Pollicino T, Squadrito G, et al. Quantification of intrahepatic hepatitis B virus DNA
in patients with chronic HBV infection. Hepatology. 2000 Feb 3;31(2):507-12.
[18] Letschka T, Kollmann V, Pfeifhofer-Obermair C, et al. PKC-theta selectively controls the
adhesion-stimulating molecule Rap1. Blodo. 2008 Dec 1;112(12):4617-27.
[19] Delaval B, Doxsey SJ. Pericentrin in cellular function and disease. Journal of Cellular Biology.
2010 Jan 25; 188(2):181-190.
[20] Jennison AV, Verma NK. Shigella flexneri infection: pathogenesis and vaccine development.
FMES Microbiology Reviews.2004 Feb;28(1):43-58.

APPENDIX A: PRIMER DESIGN

5-aattctaatacgactcactatagggCTATGTCACTTCCCTT-3
3-GATACAGTGAAGGGAAACGATACAGTGAAGGGGAACCAAGAGAGTAGACCGGACCACGTTATCCGGGACGTACGTGAC
5-CTATGTCACTTCCCTTTGCTATGTCACTTCCCCTTGGTTCTCTCATCTGGCCTGGTGCAATAGGCCCTGCATGCACTG
--CTACGTTAGATAGGGTAAGACGTCGAAGGAGTAACTACCAGAGAAAATTGTAAACGTACCGACGAACTACAGGGGGGTGAAACGTACCGACGAACTAC -5
--GATGCAATCTATCCCATTCTGCAGCTTCCTCATTGATGGTCTCTTTTAACATTTGCATGGCTGCTTGATGTCCCCCCACTTTGCATGGCTGCTTGATG -3
3-AACGTACCGACGAACTAC-5

HIV GAG GENE

FORWARD PRIMER
REVERSE PRIMER

APPENDIX B: HAIRPINS
Hairpin for Primer 1

Hairpin for Primer 2

Appendix C: HOMODIMER
Primer 1

Primer 2

10

Appendix D: Heterodimer

11

APPENDIX E: BLAST results

Primer 1 against bacterial genomes

12

13

Primer 1 against human genome

14

15

Primer 1 against Viral genomes

16

APPENDIX E
Primer 2 against bacterial genomes

17

Primer 2 against viral genomes

18

Primer 2 against human genomes

19