Design of a YFP PiT1 fusion protein for

studying localization of PiT1 in mouse

vascular smooth muscle cells
Kadin Brooks
Graduate Mentor: Nick Chavkin
UW BioE Professor: Dr. Cecilia Giachelli
5.23.16

Patients with vascular calcification have increased

risk for cardiovascular disease
Calcification reduces compliance of
elastic arteries left ventricular
hypertrophy
Prevalent in patients with chronic
kidney disease
Elevated serum phosphate is a
major risk factor for developing
vascular calcification
London, et al. Nephrol. Dial. Transplant. (2003)

Phosphate transporters regulate phosphate-induced

calcification of VSMCs
The type III NaPi transporters PiT1
and PiT2 are the main phosphate
transporters expressed in VSMCs
Elevated extracellular phosphate
triggers a signaling cascade in
VSMCs through PiT1

Li X, et al. Circulation Research. 2006

Problem Statement and Current Solutions

Problem: There is a need to be able to measure changes in PiT1 activity and
localization over a time period on the order of minutes
Current assays for studying protein localization
Immunocytochemistry
Conjugating protein to a fluorophore
Current assays for studying protein-protein interactions
Forster Resonance Energy Transfer
Coimmunoprecipitation
Yeast two hybrid
Antibody based assays for detecting protein are limited to fixed (dead) cells

Design Specifications
In order for the construct to be considered successful, it must:
Allow for studying potential protein-protein interactions involving PiT1 and
protein localization of PiT1
Allow for studying changes in protein activity or localization in live VSMCs in
response to extracellular phosphate changes
Our design: fuse the PiT1 protein to EYFP for the ability to do both protein
localization and protein-protein interaction studies in live VSMCs

Design of YFP PiT1 fusion gene

EYFP gene fused to start of mouse
PiT1 cDNA N-terminal YFP
fusion protein
Mouse PiT1 cDNA is 2046 bp
EYFP gene is 720 bp
Plasmid contains Neo/Kan
resistance gene for selection in
bacteria and eukaryotes

EYFP NaPi-IIc plasmid from Levi lab has restriction

enzyme sites for removal of NaPi-IIc cDNA
XhoI cut site near NaPi-IIc start
site
BamHI cut site after NaPi-IIc stop
codon
Rat NaPi-IIc cDNA is ~1800 bp in
length

Digestion of NaPi-IIc cDNA from EYFP plasmid and

NaPi-IIa cDNA from ECFP plasmid
ECFP and EYFP plasmids are
~4.7 kbp in length after digestion
NaPi-IIa cDNA is ~2400 bp in
length
NaPi-IIc cDNA is ~1800 bp in
length

ECFP EYFP
plasmid plasmid

5000 bp
2500 bp
2000 bp

Primer design for amplification of mouse PiT1 cDNA

with XhoI and BamHI overhang sequences
Forward primer contains 5 overhang
sequence with XhoI cut site
Reverse primer contains 5 overhang
sequence with BamHI cut site
Annealing temperature of each primer
designed to be ~62 deg C for PCR

eYFP_mPiT-1_XhoI_F
GATCTCGAGCTATGGAATCTACTGTGGC
AACGATTACTAGTACCC
eYFP_mPiT-1_BamHI_R
CACTGGATCCTCACACTGGCAGGATGA
TGTACTTGAATACTG

Subcloning mouse PiT1 cDNA into TOPO TA

plasmid
Amplified mouse PiT1 gene
with TAQ polymerase to add
single 3 adenine overhang
residues
Ligated amplified PiT1 gene
with single overhang A
residues into linearized TOPO
plasmid with single 3 T
overhang residues

2000 bp

Digestion of mouse PiT1 cDNA from TOPO TA

plasmid and ligation into cut EYFP vector
Digested mPiT1
from TOPO plasmid
and observed band
near ~ 2000 bp
Purified fragment
and ligated into cut
EYFP vector to yield
plasmid with fusion
gene

mPiT1 w/ EYFP overhangs TOPO

4000 bp
2000 bp

4000 bp
2000 bp

EYFP mPiT1 plasmid

Transfection of mouse VSMCs with EYFP mPiT1 plasmid

Stained cells transfected with EYFP PiT1 fusion gene with fluorescent deep
red plasma membrane stain (649 nm ex / 666 nm em)
Used confocal microscope to take images of 2D cross sections of cells and
superimposed fluorescent images to see colocalization
Preliminary data suggests high Pi media (3.0 mM [Pi]) causes internalization
of mPiT1
t = 0 mins

t = 1 mins

t = 2 mins

t = 3 mins

Conclusions
We were able to fuse mouse PiT1 with the fluorescent protein EYFP and
observe fluorescence in transfected cells under confocal microscopy
Achieved initial goal of designing a PiT1 construct to measure changes of
protein localization in live VSMCs in response to extracellular [Pi] changes
Working towards fusing ECFP (a FRET donor fluorophore) to PiT1 or PiT2 to
detect phosphate induced changes in protein-protein interactions (goal 2)

Thank you
Nick Chavkin
Mandy Lund
Mei Speer
Ceci Giachelli
Jia Jun Chia
Worakanya (Ice) Buranaphattana
Ted Chen
Cameron Rementer
Liz Soberg
Mary Wallingford

VSMCs transdifferentiate to osteoblast-like cells in

response to elevated phosphate
VSMCs in dialysis patients
activate Runx2 to mediate
transcriptional changes and
epigenetic modifications
VSMCs from dialysis patients
transcribe and translate genes
normally expressed in osteoblasts

Shroff, et al. JASN 2010

PiT1 has signaling functions in addition to its role as

a phosphate transporter
PiT1 is required for phosphate
induced phosphorylation of ERK1/2
Erk1/2 is significantly activated by 15
mins after high Pi treatment
PiT1 transport deficient mutant E74K
can still induce transdifferentiation of
VSMCs

Chavkin, et al. Experimental Cell Research. 2015