Phytomedicine 19 (2012) 364368

Contents lists available at SciVerse ScienceDirect

Phytomedicine
journal homepage: www.elsevier.de/phymed

Short communication

Bioactive metabolites from Chaetomium globosum L18, an endophytic fungus in

the medicinal plant Curcuma wenyujin
Yanhong Wang a , Lei Xu b , Weiming Ren a , Dan Zhao a , Yanping Zhu a , Xiaomin Wu c,
a
b
c

Ginseng and Velvet Antler Products Quality Supervision & Test Center Certicated by Ministry of Agriculture, Jilin Agricultural University, 130118 Changchun, PR China
College of China Medicinal Material in Jilin Agriculture University, 130118 Changchun, PR China
The Afliated Hospital of Jilin Agricultural University, 130118 Changchun, PR China

a r t i c l e

i n f o

Keywords:
Curcuma wenyujin
Chaetomium globosum L18
Endophytic fungi
Metabolites
Antifungal activity
Cytotoxic activity

a b s t r a c t
An endophytic fungus, strain L18, isolated from the medicinal plant Curcuma wenyujin Y.H. Chen et C.
Ling was identied as Chaetomium globosum Kunze based on morphological characteristics and sequence
data for the internal transcribed spacer (ITS-5.8S-ITS2) of the nuclear ribosomal DNA. A new metabolite
named chaetoglobosin X (1), together with three known compounds erogosterol (2), ergosterol 5,8peroside (3) and 2-methyl-3-hydroxy indole (4), were isolated from C. globosum L18. Their structures
were elucidated by spectroscopic methods including NMR, UV, IR and MS data and comparison with
published data. Chaetoglobosin X (1) is hitherto unknown, whereas 2-methyl-3-hydroxy indole (4) is
reported for the rst time as a fungal metabolite, and erogosterol (2) and ergosterol 5,8-peroside (3)
are known fungal metabolites previously identied in other genera. Chaetoglobosin X (1) exhibited a
broader antifungal spectrum and showed the strongest cytotoxic activity against H22 and MFC cancer
cell lines.
2011 Elsevier GmbH. All rights reserved.

Introduction
Fungal endophytes are microorganisms that colonize living,
internal tissues of plants without causing any immediate, overtly
negative effects (Aly et al. 2008). Endophytic fungi are ubiquitous in plant species and are mutualistic to their host (Li et al.
2007). Some can produce similar or identical biologically active
constituents as the host, such as taxol (Stierle et al. 1993). In
addition, many fungal endophytes produce secondary metabolites
and some of these compounds exhibit antifungal and antibacterial
activity that strongly inhibits the growth of other microorganisms
(Gunatilaka 2006). Other secondary metabolites display antibiotic
activity against pathogens and tumor cells to different degrees (Li
et al. 2000). Recently, endophytic fungi have been recognized as
important sources of a variety of structurally novel active secondary
metabolites with anticancer, antimicrobial and other biological
activities (Yang et al. 2011).
Curcuma is a well-known genus used in traditional Chinese
medicines. Curcuma wenyujin Y.H. Chen et C. Ling, called Erzhu in
Chinese, contains volatile components that are pharmacologically
active and often used for their anticancer activity. The principal
components include -elemene, curzerene, curzerenone, germacrone, curcumol, isocurcumenol and curcumenol (Mau et al. 2003).

Corresponding author. Tel.: +86 0431 8451 7904; fax: +86 0431 8451 0955.
E-mail address: yanhong-w@163.com (X. Wu).
0944-7113/$ see front matter 2011 Elsevier GmbH. All rights reserved.
doi:10.1016/j.phymed.2011.10.011

However, little is known about secondary metabolites produced

by endophytes harbored inside the healthy tissues of C. wenyujin (Xuan and Zhang 2007). We recently isolated the endophytic
fungus Chaetomium globosum from the leaves of C. wenyujin based
upon analysis of the nucleotide sequences of the 18S and internal transcribed spacer (ITS) region of the ribosomal RNA gene
and morphological characteristics. In previous studies, several
novel metabolites have been reported from strains of C. globosum,
which were isolated from Ginkgo biloba and the rhizosphere of
the Christmas cactus and the marine sh Mugil cephalus (Kithsiri
Wijeratne et al. 2006; Muroga et al. 2009; Qin et al. 2009; Yamada
et al. 2008). Our ongoing search for biologically active secondary
metabolites from C. globosum in C. wenyujin led to isolation of
one new compound, namely chaetoglobosin X (1), together with
three known compounds, namely erogosterol (2) (Li et al. 2003),
ergosterol 5,8-peroside (3) (Gao et al. 2000; Xie et al. 2007) and
2-methyl-3-hydroxy indole (4) (Ding and Yang 1999). The known
metabolites were identied by comparison of their spectroscopic
data with those reported in the literature. In addition, 2-methyl3-hydroxy indole (4) was found for the rst time as a natural
product in endophytic fungi. We report herein the isolation and
structural elucidation of the metabolites as well as antifungal activity against phytopathogenic fungi and cytotoxic activity. The results
indicate that compound 1 has reasonably strong fungistatic activities on plant pathogenic fungi and inhibits the growth of mouse
fore-stomach carcinoma cell(MFC) and morse hepatocellular carcinoma cell(H22). The endophytic fungus C. globosum could protect

Y. Wang et al. / Phytomedicine 19 (2012) 364368

the host by producing secondary metabolites and may have the

potential to be used in the medical eld.
Methods
General experimental procedures
Melting points were measured on a digital Electrothermal 9100
melting point apparatus. Optical rotations were measured in CHCl3
using a PerkinElmer polarimeter with a sodium lamp operating at 598 nm and 25 C. IR and UV spectra were recorded on
a Nicolet 5DX-FTIR spectrophotometer and Shimadzu UV-1700
spectrophotometer. 1 H and 13 C NMR spectra were recorded on
a Bruker AVANCE 600 NMR spectrometer (operating at 600 MHz
for 1 H and 150 MHz for 13 C). ESI-MS was conducted on a
Micromass ZQTM 4000 mass spectrometer. Analytical HPLC was
performed on a Varian Pro Star 230 using a Phenomenex C-18
column (250 mm 4.6 mm). Thin-layer chromatography (TLC) and
precoated TLC were performed on silica gel 60. Column chromatography (CC) was carried out on silica gel (100200 mesh; Qingdao
Haiyang Chemicals) with a gradient system of PE/EtOAc or on
Sephadex LH20 with CHCl3 /MeOH. All fungal culture media were
purchased from Difco and the materials used for the antimicrobial
assays were all obtained from Oxoid.
Fungal material and identication
Fresh healthy leaves of Curcuma wenyujin were collected in Zhejiang Province, Wenzhou, China, in 2008. The samples were washed
under running tap H2 O and air-dried. The cleaned leaves were
surface-sterilized as previously described (Chomcheon et al. 2006).
The surface-sterilized leaves were cut into small pieces using a
sterile blade and placed on sterile water agar plates for further incubation at 28 C. The hyphal tip of the endophytic fungus growing
out from the plant tissue was cut by a sterile Pasteur pipette and
transferred onto a sterile potato dextrose agar (PDA) plate. After
incubation at 28 C for 6 days, culture purity was determined from
colony morphology.
The isolated endophytic fungus L18 was identied based on
both microscopic morphology and analysis of the nucleotide
sequence of the ITS1-5.8S-ITS2 ribosomal RNA region. The
primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990) were used to amplify the
region from total cellular DNA as previously described (Prachya
et al. 2007). The amplied DNA was puried and directly sequenced
using the same primers. BLASTN 2.2.18+ (Zhang et al. 2000) was
used to search for similar sequences in GenBank. Highly similar
sequences were GU062299.1 (Max ident 99%, E value 0.0, Query
coverage 91%), HQ316556.1 (Max ident 98%, E value 0.0, Query
coverage 94%), FN598936.1 (Max ident 98%, E value 0.0, Query coverage 92%), AB511978.1 (Max ident 98%, E value 0.0, Query coverage
91%), EU918706.1 (Max ident 97%, E value 0.0, Query coverage 99%),
and GQ906953.1 (Max ident 97%, E value 0.0, Query coverage 96%).
These results indicated that strain L18 might be Chaetomium globosum.
Endophytic fungus isolate L18 grew on PDA as a gray-white velvety colony. Extrametrical ascocarps were olive or green-yellow
with ascomal hairs. The clustered asci were clavate with each containing 8 ascospores; the ascospores were 911 m 6.29.1 m,
pale brown and lemon-shaped. These characteristics corresponded
well with those of C. globosum (Wei 1979). Thus, based on microscopic morphological characteristics and ITS sequence data, this
endophytic fungus was identied as C. globosum. The 18S and ITS
rRNA sequence for L18 has been lodged in GenBank (accession
number GU564156). The culture of Chaetomium globosum L18 has

365

been deposited at the Microbiology Laboratory in Jilin Agriculture

University, China.
Fermentation, extraction and isolation
The endophytic fungus C. globosum L18, grown on PDA at 28 C
for 5 days, was inoculated into 500 ml Erlenmeyer asks containing
300 ml potato dextrose broth and autoclaved at 125 C for 15 min.
The fermentation was shaken at 150 rpm at 28 C for 8 days. The
cultures (80 l) were separated into mycelium and ltrate by ltration. The ltrate was extracted three times with an equal volume of
EtOAc and the EtOAc layer was collected. The frozen mycelia was
smashed and extracted three times repeatedly by ultrasonic treatment with an equal volume of EtOAc. Both of the EtOAc extracts
were combined and evaporated to dryness under reduced pressure to obtain a crude broth extract (25.16 g). This extract was
subjected to silica gel CC using gradient elution with petroleum
ether EtOAc (95:555:45, v/v), to give ten fractions. These fractions were analyzed on silica TLC using petroleum ether EtOAc
(85:15, v/v) as the developing solvent. Combining similar fractions
resulted in six fractions (A1A6). Fraction A2 was puried by silica
gel CC with a gradient of petroleum ether EtOAc (80:2065:35)
to give four subfractions (B1B4). Subfraction B2 was further puried by silica gel CC with petroleum ether EtOA (75:25) as the
mobile phase to give compound 2 (87.6 mg). Fraction B4 was puried by silica gel CC with petroleum etheracetone (85:15) to give
compound 1 (34.7 mg). Subfraction A3 was further puried by precoated TLC (silica gel F254) using petroleum ether EtOA (70:20) as
the mobile phase to give compound 3 (39.9 mg). Subfraction A5 was
further puried by Sephadex LH-20 CC, eluted with CH3 ClMeOH
(40:30), and ve fractions (C1C5) were obtained. Fractions C2 and
C3 were combined and further puried on preparative TLC eluted
with CH3Cl:MeOH (5:4) to yield compound 4 (42.3 mg).
Chaetoglobosin L (1)
Orange powder, m.p. 195198 C; []D 25 123 (c 1.2, CHCl3 );
UV (MeOH) max (log ) 254 (2.39), 340 (3.79), 369 (4.10) nm; IR
max (KBR) 3450, 3108, 2967, 2930, 2875, 1774, 1678.2, 1619.5,
1515.4, 1401, 1248, 1120, 1037, 959, 894, 873, 850 cm1 ; ESI-MS:
m/z 415.1951 [M]+ , 437.1948 [M+Na]+ , 459.1945 [M+Cl] ; (calcd.
for C23 H26 O7 , 414.1948). For 1 H and 13 C NMR spectroscopic data,
see Table 1.
Ergosterol (2)
White needle-shaped crystals, m.p. 165169 C; []D 25 135
(c 1.2, CHCl3 ); UV (MeOH) max (log ) 267 (4.61), 251 (4.66) nm;
1 H NMR (CDCl , 600 MHz) 0.63 (3H, s, 18-CH ), 0.82 (3H, d, J = 6.4,
3
3
26-CH3 ), 0.84 (3H, d, J = 6. 4, 27-CH3), 0.92 (3H, d, J = 6.8, 28-CH3 ),
0.95 (3H, s, 19-CH3 ), 1.03 (3H, d, J = 6.8, 21-CH3 ), 3.63 (1H, m, H30), 5.18 (1H, dd, J = 15.2, 8.0, H-23), 5.22 (1H, dd, J = 15.2, 8.0, H-22),
5.39 (1H, dd, J = 2.4, 6.0, H-6), 5.57 (1H, dd, J = 2.4, 5.4, H-7). 13 C NMR
(CDCl3 , 150 MHz) 141.4 (C-8), 139.8 (C-5), 135.6 (C-23), 132.0 (C22), 119.6 (C-6), 116.3 (C-7), 70.5 (C-3), 55.8 (C-17), 54.6 (C-14),
46.3 (C-9), 42.8 (C-13), 42.8 (C-24), 40.4 (C-20), 39.1 (C-12), 38.4
(C-1), 37.1 (C-10), 33.1 (C-4), 33.1 (C-25), 28.3 (C-16), 28.3 (C-2),
23.0 (C-15), 21.1 (C-11), 21.1 (C-27), 20.0 (C-26), 19.7 (C-21), 17.6
(C-28), 16.3 (C-19), 12.1 (C-18); ESI-MS: m/z 419.3237 [M+Na]+ ,
395.3249 [MH] ; (calcd. for C28 H46 O, 396.3243).
Ergosterol 5,8-peroside (3)
Colorless needle-shaped crystals, m.p. 173175 C; UV (MeOH)
max (log ) 265 (3.88), 298 (4.92), 321 (1.30) nm; IR max (KBR)
3525, 3309, 3105, 1653, 1546, 1465, 1218, 1190, 1054, 1038 cm1 ;
1 H NMR (CDCl , 600 MHz) 6.48 (1H, d, J = 8.4), 6.22 (1 H, d, J = 8.4),
3
5.19 (1H, dd, J = 7.8, 15.0), 5.12 (1H, dd, J = 8.4, 15.0), 0.98 (3H, d,
J = 6.6), 0.88 (3H, d, J = 6.8), 0.86 (3H, s), 0.82 (3H, d, J = 6.6), 0.79 (3H,

366

Y. Wang et al. / Phytomedicine 19 (2012) 364368

Table 1
1
H (600 MHz) and 13 C (150 MHz) NMR spectroscopic data for compound 1 in CDCl3 and DMSO-d6 (J values in Hz).
Position
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23

H (, CDCl3 )

3.41(m,1H)
2.28(m,1H)
1.41(m,2H)

8.59 (s,1H)
6.46(d,15.6,1H)
6.81 (s,1H)
6.63 (dd,7.8,15.6, 1 H)

3.55(m,1H)
0.85(t,7.2,3H)
1.04(d,6.6, 3H)
1.62(s,3H)
0.97(s,3H)
0.98(d,1.8,3H)

13

C (, DMSO-d6 )

183.6
51.0
201.3
38.6
28.9
140.6
126.3
151.2
120.7
168.4
105.7
107.8
147.4
87.8
110.5
157.5
160.9
70.0
21.9
25.7
19.5
13.2
12.0

d, J = 6.6), 0.78 (3H, s); 13 C NMR (CDCl3 , 150 MHz) 135.4 (C-6),
135.2 (C-22), 132.3 (C-23), 130.7 (C-7), 82.1 (C-5), 79.4 (C-8), 66.4
(C-3), 56.2 (C-17), 51.7 (C-14), 51.1 (C-9), 44.6 (C-13), 42.8 (C-24),
39.7 (C-20), 39.3 (C-12), 36.9 (C-4), 36.9 (C-10), 34.6 (C-1), 33.0 (C25), 30.1 (C-2), 28.6 (C-16), 23.4 (C-13), 20.9 (C-21), 20.6 (C-15),
19.9 (C-26), 19.6 (C-27), 18.2 (C-19), 17.5 (C-28), 12.9 (C-18); ESIMS: m/z 429.3236 [M] + , 451.3242 [M+Na] + , 427.3275 [MH] ;
(calcd. for C28 H44 O3 , 428.3251).
2-Methyl-3-hydroxyl indole (4)
Light yellow powder, m.p. 133135 C; UV (MeOH) max (log )
257 (4.02), 276 (1.34), 301 (4.04) nm; 1 H NMR (CDCl3 , 600 MHz)
6.34 (1H, d, J = 1.8), 6.26 (1H, d, J = 1.8), 5.99 (1H, s), 5.90 (1H, s), 2.08
(3H, s); 13 C NMR (CDCl3 , 150 MHz) 145.8 (C-2), 138.5 (C-9), 134.3
(C-3), 128.1 (C-6), 116.1 (C-4), 116.0 (C-5), 111.1 (C-7), 104.4 (C3), 9.5 (C-10); ESI-MS: m/z 146.1370 [MH] ; (calcd. for C9 H9 ON,
147.1376).
Antifungal assay
The plant pathogens E. turcicum, F. oxysporium f. sp. cucumeris,
C. lunata, F. graminearum, and F. moniliforme were used in the
antifungal assay. Cultures were obtained from the Plant Pathology
Laboratory of Jilin Agricultural University. The minimum inhibitory
concentrations (MICs) were performed using a modied version
of the 2-fold serial dilution method (Pongcharoen et al. 2008).

DEPT

HMBC

C
CH
C
CH
CH2
C
C
CH
CH
C
CH
C
CH
C
C
C
C
CH
CH3
CH3
CH3
CH3
CH3

C-2
C-1, C-4
C-2, C-4, C-5
C-2, C-5, C-6
C-4, C-19, C-20
C-4, C-5, C-8, C-20, C-21
C-5, C-8, C-9, C-20, C-21
C-9, C-21
C-8, C-11
C-8, C-9, C-11, C-12
C-9, C-12,
C-11, C-22,
C-11, C-12, C-22
C-22

C-2, C-23
C-2, C-23
C-4, C-5
C-5
C-8
C-12
C-2

Compounds 14 were dissolved in DMSO. Serial 2-fold dilutions

of the test extract were mixed with melted sabourauds dextrose
agar medium in the ratio of 1:50 in microtiter plates with atbottomed wells. Final concentrations in agar ranged between 100
and 1.56 g/ml for the compounds. Inoculum suspensions were
spotted on the compound amended agar surface (106 CFU per spot).
The inoculated plates were incubated at 28 C for 48 h. The MICs
were recorded by reading the lowest concentrations that inhibited
visible growth. Growth controls were performed on agar containing
DMSO.

Cytotoxicity bioassays
MFC (gastric cancer cells in mice) and H22 (hepatic cancer
cells in mice) cell lines were obtained from the Basic Medical
Experimental Animals Laboratory of Jilin University. Cytotoxicity of
compounds 14 were tested against each cell line using the microculture tetrazolium assay as described previously (Ashour et al.
2006). All experiments were carried out in triplicate and repeated
three times, and the target compounds were diluted into different
concentrations and calculate their respective inhibition ratio. Their
inhibition ratio was used as the Y-axis and the concentration as
the X-axis by drawing standard curve for determination of IC50.
As controls, media with 0.1% EGMME/DMSO were included in the
experiments.

Fig. 1. Micromorphology of Chaetomium globosum isolate L18. ascocarp, asci, ascospores.

Y. Wang et al. / Phytomedicine 19 (2012) 364368

367

Results and discussion

The endophytic fungus Chaetomium globosum strain L18 was
isolated from the leaves of the medicinal plant Curcuma wenyujin. The fungus was identied based on analyses of the nucleotide
sequence of the nuclear ribosomal ITS region and morphological
characteristics. The nucleotide sequence obtained in this study
has been lodged in GenBank (accession number GU564156). An
analysis of DNA sequence similarity among sequences lodged in
GenBank revealed that the ITS1-5.8S-ITS2 region of L18 showed
9799% homology to that of C globosum reference strains (GenBank
accession numbers GQ906953, EU918706, AB511978, FN598936,
HQ316556, GU062299). Morphological features (colony shape and
color, and characteristics of the ascocarp, ascomal hairs, ascus
and ascospores) also indicated the isolated strain L18 was closely
related to Chaetomium globosum. An ascocarp, ascus and ascospores
of strain L18 are illustrated in Fig. 1.
A crude broth extract of C. globosum L18 was separated with
a silica gel column, Sephadex LH-20 and preparative TLC to
yield a novel compound 1 (named chaetoglobosin X) as well as
three known compounds 2, 3 and 4 (erogosterol, ergosterol 5,8peroside and 2-methyl-3-hydroxy indole). Compounds 2 and 3 are
known metabolites previously isolated from endophytic fungi from
the mangrove trees and Spartina aherniora (Wei et al. 2008; Shao
et al. 2007), whereas compound 4 was isolated for the rst time
from a fungal source.
Compound 1 was isolated as an orange powder whose ESI-MS
exhibited a strong peak at m/z 415.1951 [M]+ , 437.1948 [M+Na]+ ,
and 459.1945 [M+Cl] , indicating a molecular formula of C23 H26 O7
(414.1948) and the LiebermanBurchard reaction was positive. It
melted at 195198 C with []D 25 123 (c 1.2, CHCl3 ) and exhibited an UV absorption band at 254, 340, and 369 nm. A hydroxyl
absorption band was found at 3450.6, 2967.5 cm1 while a double
bond absorption band was observed at 1774.0, 1678.2, 1619.5, and
1515.4 cm1 in the IR spectrum. The 1 H NMR spectroscopic data
(Table 1) displayed six sets of methyne protons [ 3.41 (1H, m),
2.28 (1H, m), 8.59 (1H, s), 6.46 (1H, d, J = 15.6 Hz), 6.81 (1H, s), 6.63
(1H, dd, J = 7.8, 15.6 Hz), 3.55 (1H, m)], ve sets of methyl protons [
0.85 (3H, t, J = 7.2 Hz), 1.04 (3H, d, J = 6.6 Hz), 1.62 (3H, s), 0.97 (3H,
s), 0.98 (3H, d, J = 1.8 Hz)] and a methylene proton [ 1.41 (2H, m)].
The 13 CNMR and DEPT spectra (Table 1) showed 13 signals with
unsaturated carbons in a low magnetic eld, two carbonyl groups,
four tertiary carbons, seven quaternary carbons and ve primary
carbons, a secondary carbon, three tertiary carbons, and a quaternary carbon in a higher magnetic eld.
Based on HMQC, carbonhydrogen correlation was found, and
the HMBC spectrum (Table 1) showed correlations from 0.85 and
1.04 (H-3) and 2.28 (H-1) to 28.9 (C-4, C-19, C-20); 0.85 (H-3)
and 3.41 (H-1) to 201.3 (C-2, C-4, C-5); 3.41 (H-1) to 38.6 (C-2,
C-5, C-6); 3.41 (H-1) to 70.0 (C-2, C-23); 1.41 (H-2) and 1.04,
1.62 (H-3) to 140.6 (C-4, C-5, C-8, C-20, C-21) and 126.3 (C-5, C-8,
C-9, C-20, C-21). However, these HMBC data could not place the
position of four methynes in the structure of compound 1, and four
olenic carbons may exist in its structure.
According to its degree of unsaturation of 11, it was deduced to
contain an oxygen ring. Based on these and other data, the planar
structure of compound 1 was elucidated as shown in Fig. 2. It is
not reported as yet and its structure has not been searched in CA
Scinder, but compound 1 showed some similarities to chaetoglobosin A based on comparison with published spectroscopic data
(Ni et al. 2008) and was also obtained from Chaetomium globosum.
Therefore compound 1 was named chaetoglobosin X.
In addition, three known compounds 2, 3 and 4 isolated from
extracts of liquid cultures of Chaetomium globosum L18 were
identied as erogosterol, ergosterol 5,8-peroside and 2-methyl3-hydroxy indole respectively, based on their UV, 1 H, 13 C NMR, and

Fig. 2. Structure of the isolated compound 1 (chaetoglobosin L) and its HMBC correlations and HMQC correlations.

MS data and comparison with published data (Li et al. 2003; Gao
et al. 2000; Xie et al. 2007; Ding and Yang 1999).
Compounds 14 were evaluated against the plant pathogens
Exserohilum turcicum, Fusarium oxysporum f. sp. Cucumerinum,
Curvularia lunata, Fusarium graminearum, and Fusarium moniliforme using the 2-fold serial dilution method. Compounds 2, 3,
and 4 showed no signicant antibiotic activity against the ve fungal strains. Compound 1 exhibited the highest antifungal activity
against E. turcicum, F. oxysporium f. sp. cucumeris and C. lunata with
a MIC value of 3.125 g/ml and showed moderate antifungal activity against F. graminearum and F. moniliforme with a MIC value of
6.25 g/ml.
Biological evaluation of compounds 14 was also carried out
using MFC (Gastric cancer cells in mice) and H22 (hepatic cancer cells in mice) cell lines. The four compounds exhibited clear
differences in cytotoxic activity toward MFC and H22 cells. Compound 1 displayed the strongest cytotoxicity against H22 cells
(IC50 3.125 g/ml) and exhibited moderate cytotoxicity against
MFC cells (IC50 6.25 g/ml), whereas the other compounds were
inactive against H22 and MFC cells.
Conclusions
The isolated endophytic fungus strain L18 was identied as
Chaetomium globosum from its morphological characteristics and
rDNA ITS sequence analysis. A novel compound 1 (chaetoglobosin
X) was isolated from C. globosum L18 together with three known
compounds 2, 3 and 4 (erogosterol, ergosterol 5,8-peroside and
2-methyl-3-hydroxy indole). Compound 4 was isolated from a fungal source for the rst time. Additionally, antimicrobial activity and
cytotoxic activity tests shows compound 1 presents a broader antifungal spectrum and a more effective antifungal activity and shows
an obvious inhibitory effect on MFC and H22 cell lines. Thus C.

368

Y. Wang et al. / Phytomedicine 19 (2012) 364368

globosum L18 is a potential fungal candidate for use in biological

control and exploitation for anticancer drug development. This is
an intriguing subject for further studies.
Acknowledgements
Y.H. Wang thanks the Scientic Research Starting Foundation
of Jilin Agricultural University (grant no. 201110) and Scientic
and Technological Planning of Zhejiang province, China (grant
no. 2005C13019) for nancial support. We gratefully acknowledge support from teachers of the Department of Pharmacology,
Wenzhou Medical College and College of Agronomy in Jilin Agriculture University. We also thank colleagues from the Laboratories
of Immunology, Pharmacology, and Biochemistry from the TCM
Academy of Jilin Province, and the Integrated Research Unit for
cytotoxicity tests.
References
Aly, A.H., Edrada-Ebel, R., Wray, V., Mller, W.E.G., Kozytska, S., Kozytska, U., Proksch,
P., Ebel, R., 2008. Bioactive metabolites from the endophytic fungus Ampelomyces
sp. isolated from the medicinal plant Urospermum picroides. Phytochemistry 69,
17161725.
Ashour, M., Edrada, R.A., Ebel, R., Wray, V., Wtjen, W., Padmakumar, K., Mller,
W.E.G., Lin, W.H., Proksch, P., 2006. Kahalalide derivatives from the indian
sacoglossan mollusk Elysia grandifolia. J. Nat. Prod. 69, 15471553.
Chomcheon, P., Sriubolmas, N., Wiyakrutta, S., Ngamrojanavanich, N., Chaichit,
N., Mahidol, C., Ruchirawat, S., Kittakoop, P., 2006. Cyclopentenones, scaffolds
for organic synthesis produced by the endophytic fungus, mitosporic Dothideomycete sp LRUB20. J. Nat. Prod. 69, 13511353.
Ding, D.Q., Yang, J.S., 1999. Analytical Chemistry Handbook (Book Seven), second ed.
Chemical Industry Press, 5.
Gunatilaka, A.A.L., 2006. Natural products from plant-associated microorganisms:distribution, structural diversity, bioactivity, and implications of their
occurrence. J. Nat. Prod. 69, 509526.
Gao, J.M., Dong, Z.J., Liu, J.K., 2000. The constituents of the Basidiomycetes Russula
cyanoxantha. Acta Botanica Yunnanica 22, 8589.
Kithsiri Wijeratne, E.M., Turbyville, T.J., Fritz, A., Whitesell, L., Leslie Gunatilakaa, A.A.,
2006. A new dihydroxanthenone from a plant-associated strain of the fungus
Chaetomium globosum demonstrates anticancer activity. Bioorg. Med. Chem. 14,
79177923.
Li, W.C., Zhou, J., Guo, S.Y., Guo, L.D., 2007. Endophytic fungi associated with lichens
in Baihua mountain of Beijing. Chin. Fungal Divers. 25, 95106.

Li, J.Y., Strobel, G.A., Harper, J.K., Lobkovsky, E., Clardy, J., 2000. Cryptocin, a potent
tetramic acid antimycotic from the endophytic fungus Cryptosporiopsis ef.
quercina. Org. Lett. 2, 767770.
Li, J.X., Li, J., Xu, L.Z., Yang, S.L., Zou, Z.M., 2003. Studies on chemical constituents of
Cordyceps sinensis(Berk) Sacc. Chin. Pharm. J. 38, 499501.
Muroga, Y., Yamada, T., Numata, A., Tanaka, R., 2009. Chaetomugilins IO, new
potent cytotoxic metabolites from a marine-sh-derived Chaetomium species
stereochemistry and biological activities. Tetrahedron 65, 75807586.
Mau, J.L., Lai, E.Y.C., Wang, N.P., Chen, C.C., Chang, C.H., Chyau, C.C., 2003. Composition and antioxidant activity of the essential oil from Curcuma zedoaria. Food
Chem. 82, 583591.
Ni, Z.W., Li, G.H., Zhao, P.J., Shen, Y.M., 2008. Antimicrobial components of the endophytic fungal Strain Chaetomium globosum Ly50 from Maytenus hookeri. Nat.
Prod. Res. Dev. 20, 3336.
Prachya, S., Wiyakrutta, S., Sriubolmas, N., Ngamrojanavanich, N., Mahidol, C., Ruchirawat, S., Kittakoop, P., 2007. Cytotoxic mycoepoxydiene derivatives from an
endophytic fungus Phomopsis sp isolated from Hydnocarpus anthelminthicus.
Planta Med. 73, 14181420.
Pongcharoen, W., Rukachaisirikul, V., Phongpaichit, S., Khn, T., Pelzing, M., Sakayaroj, J., Taylor, W.C., 2008. Metabolites from the endophytic fungus Xylaria sp.
PSU-D14. Phytochemistry 69, 19001902.
Qin, J.C., Zhang, Y.M., Gao, J.M., Bai, M.S., Yang, S.X., Laatsch, H., Zhang, A.L., 2009.
Bioactive metabolites produced by Chaetomium globosum, an endophytic fungus
isolated from Ginkgo biloba. Bioorg. Med. Chem. Lett. 19, 15721574.
Stierle, A., Strobel, G., Stierle, D., 1993. Taxol and taxane production by Taxomyces
andreanae, an endophytic fungus of Pacic yew. Science 5105, 214216.
Shao, Z.Y., Feng, Y.H., Deng, Y.X., Xu, D.Q., Hong, F., 2007. Metabolites of endophytic
fungus Fusarium sp.F4 from Spartina aherniora. Chin. J. Nat. Med. 5, 108110.
Wei, M.Y., Li, S.D., Shao, C.L., Yu, Z.G., Lin, Y.C., 2008. Secondary metabolites from
mangrove endophytic fungus 350#. J. Guangdong Med. College 26, 503504.
Wei, J.C., 1979. Manual of Identication in Fungus [M]. Shanghai Science and Technology Press, Shanghai.
White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplication and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H.,
Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 315322.
Xuan, Q., Zhang, L.Q., 2007. Separation and identication of endophytic fungi from
rhizoma curcuma. Chin. J. Ethnomed. Ethnopharm. 84, 4546.
Xie, C.H., Ruan, L.J., Xia, H.Z., Chen, D.J., Ge, M., 2007. Fermentation products of
endophyte HCCB00167. J. Shenyang Pharm. Univ. 24, 245248.
Yang, S.X., Gao, J.M., Zhang, Q., Laatsch, H., 2011. Toxic polyketides produced by
Fusarium sp, an endophytic fungus isolated from Melia azedarach. Bioorg. Med.
Chem. Lett. 21, 18871889.
Yamada, T., Doi, M., Shigeta, H., Muroga, Y., Hosoe, S., Numata, A., Tanaka, R., 2008.
Absolute stereostructures of cytotoxic metabolites, chaetomugilins AC, produced by a Chaetomium species separated from a marine sh. Tetrahedron Lett.
49, 41924195.
Zhang, Z., Schwartz, S., Wagner, L., Miller, W., 2000. A greedy algorithm for aligning
DNA sequences. J. Comput. Biol. 7, 203214.