Cells Molecules and Mechanisms Axolotl Academic Publishing Co.

Cells: Molecules and Mechanisms by E. V. Wong, Ph.D. Copyright 2009, ISBN 978-0-9852261-1-4 Axolotl Academic Pub lishing Company, Louisville, KY. This work may be used under the terms of the Creative Commons BY-NC-SA version 3 .0 license as fully described on the following page. In short, you may create de rivative works from Cells: Molecules and Mechanisms as long as (1) you acknowled ge the original author/publisher, (2) you do not sell it and make it freely avai lable, and (3) your work is also to be distributed under this CC BY-NC-SA licens e.

THIS WORK (AS DEFINED BELOW) IS PROVIDED UNDER THE TERMS OF THIS CREATIVE COMMON S PUBLIC LICENSE (CCPL OR LICENSE). THE WORK IS PROTECTED BY COPYRIGHT AND/OR OTHER APPLICABLE LAW. ANY USE OF THE WORK OTHER THAN AS AUTHORIZED UNDER THIS LICENSE OR COPYRIGHT LAW IS PROHIBITED. BY EXERCISING ANY RIGHTS TO THE WORK PROVIDED HE RE, YOU ACCEPT AND AGREE TO BE BOUND BY THE TERMS OF THIS LICENSE. TO THE EXTENT THIS LICENSE MAY BE CONSIDERED TO BE A CONTRACT, THE LICENSOR GRANTS YOU THE RI GHTS CONTAINED HERE IN CONSIDERATION OF YOUR ACCEPTANCE OF SUCH TERMS AND CONDIT IONS. 1. Definitions 1. Collective Work means a work, such as a periodical issue, anthology or encyclopedia, in which the Work in its entirety in unmodified form, along with one or more other contributions, constituting separate and independe nt works in themselves, are assembled into a collective whole. A work that const itutes a Collective Work will not be considered a Derivative Work (as defined be low) for the purposes of this License. 2. Derivative Work means a work based upon the Work or upon the Work and other pre-existing works, such as a translation, m usical arrangement, dramatization, fictionalization, motion picture version, sou nd recording, art reproduction, abridgment, condensation, or any other form in w hich the Work may be recast, transformed, or adapted, except that a work that co nstitutes a Collective Work will not be considered a Derivative Work for the pur pose of this License. For the avoidance of doubt, where the Work is a musical co mposition or sound recording, the synchronization of the Work in timed-relation with a moving image (synching) will be considered a Derivative Work for the purpos e of this License. 3. Licensor means the individual, individuals, entity or entiti es that offer(s) the Work under the terms of this License. 4. Original Author mean s the individual, individuals, entity or entities who created the Work. 5. Work me ans the copyrightable work of authorship offered under the terms of this License . 6. You means an individual or entity exercising rights under this License who ha s not previously violated the terms of this License with respect to the Work, or who has received express permission from the Licensor to exercise rights under this License despite a previous violation. 7. License Elements means the following high-level license attributes as selected by Licensor and indicated in the titl e of this License: Attribution, Noncommercial, ShareAlike. 2. Fair Use Rights. N othing in this license is intended to reduce, limit, or restrict any rights aris ing from fair use, first sale or other limitations on the exclusive rights of th e copyright owner under copyright law or other applicable laws. 3. License Grant . Subject to the terms and conditions of this License, Licensor hereby grants Yo u a worldwide, royalty-free, non-exclusive, perpetual (for the duration of the a pplicable copyright) license to exercise the rights in the Work as stated below: 1. to reproduce the Work, to incorporate the Work into one or more Collective W orks, and to reproduce the Work as incorporated in the Collective Works; 2. to c reate and reproduce Derivative Works provided that any such Derivative Work, inc luding any translation in any medium, takes reasonable steps to clearly label, d emarcate or otherwise identify that changes were made to the original Work. For example, a translation could be marked The original work was translated from Engl ish to Spanish, or a modification could indicate The original work has been modifi ed.; 3. to distribute copies or phonorecords of, display publicly, perform public ly, and perform publicly by means of a digital audio transmission the Work inclu ding as incorporated in Collective Works; 4. to distribute copies or phonorecord s of, display publicly, perform publicly, and perform publicly by means of a dig ital audio transmission Derivative Works; The above rights may be exercised in a ll media and formats whether now known or hereafter devised. The above rights include the right to make such modifications as are technically nec essary to exercise the rights in other media and formats. All rights not express ly granted by Licensor are hereby reserved, including but not limited to the rig hts set forth in Sections 4(e) and 4(f). 4. Restrictions. The license granted in Section 3 above is expressly made subject to and limited by the following restr ictions: 1. You may distribute, publicly display, publicly perform, or publicly digitally perform the Work only under the terms of this License, and You must in clude a copy of, or the Uniform Resource Identifier for, this License with every copy or phonorecord of the Work You distribute, publicly display, publicly perf

orm, or publicly digitally perform. You may not offer or impose any terms on the Work that restrict the terms of this License or the ability of a recipient of t he Work to exercise the rights granted to that recipient under the terms of the License. You may not sublicense the Work. You must keep intact all notices that refer to this License and to the disclaimer of warranties. When You distribute, publicly display, publicly perform, or publicly digitally perform the Work, You may not impose any technological measures on the Work that restrict the ability of a recipient of the Work from You to exercise the rights granted to that recip ient under the terms of the License. This Section 4(a) applies to the Work as in corporated in a Collective Work, but this does not require the Collective Work a part from the Work itself to be made subject to the terms of this License. If Yo u create a Collective Work, upon notice from any Licensor You must, to the exten t practicable, remove from the Collective Work any credit as required by Section 4(d), as requested. If You create a Derivative Work, upon notice from any Licen sor You must, to the extent practicable, remove from the Derivative Work any cre dit as required by Section 4(d), as requested. 2. You may distribute, publicly d isplay, publicly perform, or publicly digitally perform a Derivative Work only u nder: (i) the terms of this License; (ii) a later version of this License with t he same License Elements as this License; or, (iii) either the unported Creative Commons license or a Creative Commons license for another jurisdiction (either this or a later license version) that contains the same License Elements as this License (e.g. Attribution-NonCommercial-ShareAlike 3.0 (Unported)) (the Applicab le License). You must include a copy of, or the Uniform Resource Identifier for, the Applicable License with every copy or phonorecord of each Derivative Work Yo u distribute, publicly display, publicly perform, or publicly digitally perform. You may not offer or impose any terms on the Derivative Works that restrict the terms of the Applicable License or the ability of a recipient of the Work to ex ercise the rights granted to that recipient under the terms of the Applicable Li cense. You must keep intact all notices that refer to the Applicable License and to the disclaimer of warranties. When You distribute, publicly display, publicl y perform, or publicly digitally perform the Derivative Work, You may not impose any technological measures on the Derivative Work that restrict the ability of a recipient of the Derivative Work from You to exercise the rights granted to th at recipient under the terms of the Applicable License. This Section 4(b) applie s to the Derivative Work as incorporated in a Collective Work, but this does not require the Collective Work apart from the Derivative Work itself to be made su bject to the terms of the Applicable License. 3. You may not exercise any of the rights granted to You in Section 3 above in any manner that is primarily intend ed for or directed toward commercial advan-

tage or private monetary compensation. The exchange of the Work for other copyri ghted works by means of digital file-sharing or otherwise shall not be considere d to be intended for or directed toward commercial advantage or private monetary compensation, provided there is no payment of any monetary compensation in conn ection with the exchange of copyrighted works. 4. If You distribute, publicly di splay, publicly perform, or publicly digitally perform the Work (as defined in S ection 1 above) or any Derivative Works (as defined in Section 1 above) or Colle ctive Works (as defined in Section 1 above), You must, unless a request has been made pursuant to Section 4(a), keep intact all copyright notices for the Work a nd provide, reasonable to the medium or means You are utilizing: (i) the name of the Original Author (or pseudonym, if applicable) if supplied, and/or (ii) if t he Original Author and/or Licensor designate another party or parties (e.g. a sp onsor institute, publishing entity, journal) for attribution (Attribution Parties) in Licensors copyright notice, terms of service or by other reasonable means, th e name of such party or parties; the title of the Work if supplied; to the exten t reasonably practicable, the Uniform Resource Identifier, if any, that Licensor specifies to be associated with the Work, unless such URI does not refer to the copyright notice or licensing information for the Work; and, consistent with Se ction 3(b) in the case of a Derivative Work, a credit identifying the use of the Work in the Derivative Work (e.g., French translation of the Work by Original Au thor, or Screenplay based on original Work by Original Author). The credit required by this Section 4(d) may be implemented in any reasonable manner; provided, how ever, that in the case of a Derivative Work or Collective Work, at a minimum suc h credit will appear, if a credit for all contributing authors of the Derivative Work or Collective Work appears, then as part of these credits and in a manner at least as prominent as the credits for the other contributing authors. For the avoidance of doubt, You may only use the credit required by this Section for th e purpose of attribution in the manner set out above and, by exercising Your rig hts under this License, You may not implicitly or explicitly assert or imply any connection with, sponsorship or endorsement by the Original Author, Licensor an d/or Attribution Parties, as appropriate, of You or Your use of the Work, withou t the separate, express prior written permission of the Original Author, Licenso r and/or Attribution Parties. 5.For the avoidance of doubt, where the Work is a musical composition: 1. Performance Royalties Under Blanket Licenses. Licensor r eserves the exclusive right to collect whether individually or, in the event tha t Licensor is a member of a performance rights society (e.g. ASCAP, BMI, SESAC), via that society, royalties for the public performance or public digital perfor mance (e.g. webcast) of the Work if that performance is primarily intended for o r directed toward commercial advantage or private monetary compensation. 2. Mech anical Rights and Statutory Royalties. Licensor reserves the exclusive right to collect, whether individually or via a music rights agency or designated agent ( e.g. Harry Fox Agency), royalties for any phonorecord You create from the Work (c over version) and distribute, subject to the compulsory license created by 17 USC Section 115 of the US Copyright Act (or the equivalent in other jurisdictions), if Your distribution of such cover version is primarily intended for or directe d toward commercial advantage or private monetary compensation. 6. Webcasting Ri ghts and Statutory Royalties. For the avoidance of doubt, where the Work is a so und recording, Licensor reserves the exclusive right to collect, whether individ ually or via a performance-rights society (e.g. SoundExchange), royalties for th e public digital performance (e.g. webcast) of the Work, subject to the compulso ry license created by 17 USC Section 114 of the US Copyright Act (or the equival ent in other jurisdictions), if Your public digital performance is primarily int ended for or directed toward commercial advantage or private monetary compensati on. 5. Representations, Warranties and Disclaimer UNLESS OTHERWISE MUTUALLY AGRE ED TO BY THE PARTIES IN WRITING, LICENSOR OFFERS THE WORK AS-IS AND ONLY TO THE EXTENT OF ANY RIGHTS HELD IN THE LICENSED WORK BY THE LICENSOR. THE LICENSOR MAK ES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE WORK, EXPRESS, IM PLIED, STATUTORY OR OTHERWISE, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF TITL E, MARKETABILITY, MERCHANTIBILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGE MENT, OR THE ABSENCE OF LA-

TENT OR OTHER DEFECTS, ACCURACY, OR THE PRESENCE OF ABSENCE OF ERRORS, WHETHER O R NOT DISCOVERABLE. SOME JURISDICTIONS DO NOT ALLOW THE EXCLUSION OF IMPLIED WAR RANTIES, SO SUCH EXCLUSION MAY NOT APPLY TO YOU. 6. Limitation on Liability. EXC EPT TO THE EXTENT REQUIRED BY APPLICABLE LAW, IN NO EVENT WILL LICENSOR BE LIABL E TO YOU ON ANY LEGAL THEORY FOR ANY SPECIAL, INCIDENTAL, CONSEQUENTIAL, PUNITIV E OR EXEMPLARY DAMAGES ARISING OUT OF THIS LICENSE OR THE USE OF THE WORK, EVEN IF LICENSOR HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. 7. Termination 1. This License and the rights granted hereunder will terminate automatically up on any breach by You of the terms of this License. Individuals or entities who h ave received Derivative Works (as defined in Section 1 above) or Collective Work s (as defined in Section 1 above) from You under this License, however, will not have their licenses terminated provided such individuals or entities remain in full compliance with those licenses. Sections 1, 2, 5, 6, 7, and 8 will survive any termination of this License. 2. Subject to the above terms and conditions, t he license granted here is perpetual (for the duration of the applicable copyrig ht in the Work). Notwithstanding the above, Licensor reserves the right to relea se the Work under different license terms or to stop distributing the Work at an y time; provided, however that any such election will not serve to withdraw this License (or any other license that has been, or is required to be, granted unde r the terms of this License), and this License will continue in full force and e ffect unless terminated as stated above. 8. Miscellaneous 1. Each time You distr ibute or publicly digitally perform the Work (as defined in Section 1 above) or a Collective Work (as defined in Section 1 above), the Licensor offers to the re cipient a license to the Work on the same terms and conditions as the license gr anted to You under this License. 2. Each time You distribute or publicly digital ly perform a Derivative Work, Licensor offers to the recipient a license to the original Work on the same terms and conditions as the license granted to You und er this License. 3. If any provision of this License is invalid or unenforceable under applicable law, it shall not affect the validity or enforceability of the remainder of the terms of this License, and without further action by the parti es to this agreement, such provision shall be reformed to the minimum extent nec essary to make such provision valid and enforceable. 4. No term or provision of this License shall be deemed waived and no breach consented to unless such waive r or consent shall be in writing and signed by the party to be charged with such waiver or consent. 5. This License constitutes the entire agreement between the parties with respect to the Work licensed here. There are no understandings, ag reements or representations with respect to the Work not specified here. Licenso r shall not be bound by any additional provisions that may appear in any communi cation from You. This License may not be modified without the mutual written agr eement of the Licensor and You.

Preface Yet another cell and molecular biology book? At the very least, you would think that if I was going to write a textbook, I should write one in an area that real ly needs one instead of a subject that already has multiple excellent and defini tive books. So, why write this book, then? First, its a course that I have enjoye d teaching for many years, so I am very familiar with what a student really need s to take away from this class within the time constraints of a semester. Second , because it is a course that many students take, there is a greater opportunity to make an impact on more students pocketbooks than if I were to start off writi ng a book for a highly specialized upperlevel course. And finally, it was fun to research and write, and can be revised easily for inclusion as part of our next textbook, High School Biology. As with every textbook, this one owes a huge deb t to the many excellent textbooks that came before it. And in fact, because I co nsider this more of a teaching text than a reference text, if a student is serio us about this subject area, and has the funds, I very strongly recommend picking up one of the classic tomes in this field of biology, either Molecular Biology of the Cell by Bruce Alberts and colleagues (Garland Science), or Molecular Cell Biology, by Harvey Lodish and colleagues (W.H. Freeman & Co.). But to come back to a reason for writing my own text, as wonderful as those two books are, they are actually overloaded with information for an average introductory (sophomorel evel) course in cell biology. One of the areas that was carved out of the primar y text is the historical perspective and experimental design that led to the dis covery of the molecules and mechanisms described. This was a difficult decision because I am a strong believer in understanding the scientific thought process a nd learning from history. In the end though, I decided to provide that kind of i nformation as ancillary material that can be included by course instructors at t heir discretion, because long experience and many conversations with students in dicate that even if they thought it was going to be on the test, they tended to gl oss over the names and dates stuff while studying, and on my end, I would rather u se exam space to test them on information more relevant to success Preface, version 1.01 and understanding of more complex concepts later in the course (or in more advan ced coursework). This book is free. It has been published with a Creative Common s BY-NC-SA license, which means that you can copy and distribute it to anyone yo u want as long as you do not charge for it, and you properly acknowledge its ori gin. You may create derivative works from it as long as you do not change the or iginal intent or meaning of the work, and all derivative works must carry the sa me kind of license. This license does not apply to any images marked as being co pyrighted and used with permission to do so in this context only (mostly figures from recent journal articles). Axolotl Academic Publishing Company is devoted t o the idea that only a scientifically literate general population can make sound decisions on a host of important governmental and non-governmental matters that involve the many advances in science and technology that have occurred in the p ast few decades. Paradoxically, the science literacy of the average citizen did not keep pace with development by our leading scientists and engineers, and the widening gap has led to many conflicts that, in our opinion, may not exist if ev eryone was fully versed in the science. Complex issues such as genetic engineeri ng or stem cell research have been boiled down to erroneously simplified sound b ite definitions. Providing free textbooks is just one step of many needed to low er some of the economic barriers to quality science education. Although I must c laim responsibility for much of the book (for better or worse), I can only take credit for a little of the art. My talented illustrator, Patrick J. Burton, did most of the original artwork, and served as a reviewer of the text as well. Sour ces for all other figures are acknowledged in the figure caption. Finally, this book would not have come about had it not been for the unflagging support from m y wife and children, who are ultimately the reason for everything I do. E.V.Wong

Table of Contents Anatomy of a Cell Basic Cell Chemistry Water 8 Acids and Bases Carbon Sugars Nucleotides Amino Acids Chirality Fatty Ac ids 1 8 11 12 13 15 16 18 20 23 27 30 31 36 40 44 49 53 53 58 66 70 71 71 72 72 75 77 77 Photosynthesis The Calvin Cycle Gluconeogenesis Glycogen synthesis Fatty acid sy nthesis Amino acid synthesis DNA Semi-Conservative DNA Replication Prokaryotic Replication Eukaryotic Replication DNA Lesions DNA Repair Telomeres Bioenergetics Enzymes Enzyme Kinetics Regulation of Enzyme Activity Transcription Prokaryotic Transcription Eukaryotic Transcription Post-Transcriptional Processi ng of RNA Membranes Membrane Permeability Membrane Transport Proteins The Action Potential in Neuron s Gene Regulation Prokaryotic Transcriptional Regulation Eukaryotic Transcriptional Regulation Metabolism 1 Glycolysis Fermentation Oxidative Phosphorylation Uncoupling Electron Transport from ATP Synthesis Structure of Electron Carriers Other Catabolic Reactions Star ch and Glycogen Depolymerization Fatty Acid Breakdown Amino Acid Degradation Translation Prokaryotic ribosomes Eukaryotic ribosomes The Genetic Code tRNAs are rather odd ducks Prokaryotic Translation Eukaryotic Translation Regulation of Translation ER, Golgi, and Vesicles Proteolytic Cleavage Protein Trafficking Protein Folding in the ER Metabolism 2 Anabolic Reactions Preface, version 1.01 77 81 86 89 90 91 93 98 98 105 106 110 113 116 119 121 123 129 129 133 139 140 1 40 141 143 146 149 151 155 155 157 162

N-linked Protein Glycosylation Begins in the ER O-linked Protein Glycosylation t akes place entirely in the Golgi Vesicular Transport Receptor-mediated Endocytos is Cytoskeleton Intermediate Filaments Actin Microfilaments Microtubules Microtubule Organizing Centers Transport on the Cytoskeleton Cytoskeletal Dynamics Cell Motility ECM and Adhesion Collagen Proteoglycans Fibronectins Laminins Integrins Hemidesmosomes Dystrophin Glycoprotein Complex Desmosomes Cadherins Tight Junctions Ig Superfamily CAMs S electins Gap Junctions Cell Communication Receptors and Ligands 7-TM receptors (G-protein-coupled) Receptor Tyrosine Kinas es Ca++ Signaling 163 166 167 172 175 176 178 179 181 182 189 192 198 199 201 202 203 204 206 207 208 209 211 212 213 215 217 218 219 224 227 Cell Cycle The Prokaryotic Cell Cycle Controlling the Cell Cycle Activation and inactivatio n of the cyclin G1/G0 phase S phase G2 phase Mitosis Cell Death Meiosis Advanced Topics Viruses Lytic life cycle of viruses The Lysogenic Pathway Cancer Oncogenes Tumor S uppressor Genes Human Cancers Metastasis The Immune System Antibodies DNA Rearra ngement 229 229 231 234 236 236 237 237 243 246 253 253 255 257 259 262 264 266 267 268 269 271 Preface, version 1.01

Anatomy of a Cell : A Very Brief Overview Since this entire course is devoted to understanding the workings of the cell, i t is almost superfluous to dedicate a chapter to identifying the parts of the ce ll and their functions. However, because it is easy to get lost in the intricaci es of the molecules and chemical reactions within the cell, consider this chapte r more of a framework or map for the course, giving context to the minutiae. The cell is the smallest unit of life, so all cells, whether they are unicellular o rganisms or just a tiny part of a multicellular organism, have certain character istics in common: they must contain genetic information and the mechanisms to re gulate and use that information to produce its own parts and to reproduce new ce lls, they must be able to use energy in chemical reactions and physical actions, they must be able to regulate those activities, and they must respond to stimul i. Cells use DNA (deoxyribonucleic acid) for their genetic material, and all cel ls contain the transcriptional and translational enzymes to read it and use the information to construct more cell components. However, simply having genetic ma terial does not define life: viruses have genetic material containing all the in formation necessary to make a complete virus, but it does not contain the enzyme s necessary to do so, nor the ability to obtain the raw molecular material neede d to do so. It is absolutely dependent on the machinery inside whatever cell it infects. Therefore, a virus is not a living organism. The genome is not only an instruction set for making a cell (or an organism, for that matter), it is also replicable itself. Roughly speaking, during part of its life cycle, the cell mak es an extra copy of its genome and increases the numbers of all the other stuff (p roteins, fats, etc.) of which it is made, and then it reproduces by division: th e mother cell splits into two daughter cells, each with the same complement of g enetic information, and with approximately the same cellular components. Thus we see that while the genome is often considered the blueprint for a cell/organism , in fact cells are not built up from scratch directly from DNA. Every cell come s from another cell. The Chapter 1, The Cell, version 1.0 Using this book: This book is designed to be used in both introductory and advan ced cell biology courses. The primary text is generally on the left side of the vertical divider, and printed in black. Details that are usually left to an adva nced course are printed in blue and found on the right side of the divider. Fina lly, additional biomedically relevant information can be found in red print on e ither side of the divider. This chapter, as a very simple introductory chapter, has no advanced material, and anything inthe right column should be considered b asic information. Page 1

DNA can then be used to customize that cell for specific purposes as determined by its environment. When a particular component of the cell is needed, the infor mation for making that component is read from the DNA and copied into RNA which is used as a program from which ribosomes can manufacture the proteins needed. A living cell needs all these things: the genetic information, the mechanisms and machinery to use the information to build cell parts, and the ability to harnes s energy to do so. As we will see in chapter 3, the physical laws of nature requ ire that everything tends towards its simplest, least organized, state unless th ere is an input of energy to work against that tendency. Since cells are a highl y ordered collection of very complex molecules, they must therefore require ener gy to remain as cells. Thus, life requires the ability to obtain energy, either from sunlight or food, and the ability to convert that energy into forms that ca n be readily used by the cell to maintain itself by building or rearranging nece ssary molecules and macromolecular structures. How do cells know when to carry o ut these activities? This leads us to the next characteristic of living cells, t he ability to respond to stimuli. In other words, they are self-regulating. If g lucose levels run low and the cell needs energy, glucose transport proteins are made, or if the cell needs to move to an area of higher food concentration, the cell cytoskeleton rearranges to move the cell. The cell has the ability to initi ate repair processes if it detects lesions in its genome, it can pause the cell cycle to allow such repair processes time, and it can even initiate its own deat h if repairs are repeatedly unsuccessful. In addition to responding to internal signals, living cells are also able to respond to external stimuli. Whether it i s contact with a neighboring cell, binding a hormone released from a cell far aw ay, or simply interacting with non-cellular environmental objects, a cell is abl e to respond to such stimuli. Responses may include making new proteins, destruc tion of existing proteins, moving away from the stimulus, moving towards the sti mulus, initiation of reproduction, and many other possibilities. There are two b asic types of cells: prokaryotes and eukaryotes. The difference is simple and re adily recognizable under light microscopy. Eukaryotic cells contain intracellula r membrane-bound compartments (called organelles). Prokaryotic cells do not cont ain any such compartments (fig. 1). There is only one membrane in prokaryotes, t he cell membrane, and only one compartment in prokaryotic cells, the cytoplasm. That does not preclude a certain level of organization in prokaryotes, but it is not as complex as eukaryotes. The genomic DNA is usually organized in a central nucleoid. There are not intracellular membranous organelles, but the cell is de fined by a cell membrane. Outside of the cell membrane, prokaryotes have a cell wall. This wall is relatively rigid Chapter 1, The Cell, version 1.0 Ribosomes DNA Cell Membrane Cytoplasm Cell Wall Capsule Figure 1. A Prokaryotic Cell. Page 2

and confers shape to the cell. Depending on the type of bacteria, the thickness of the wall varies (thick = gram positive, thin = gram negative). Some, but not all bacteria also secrete another layer outside of the cell wall. This is a relative ly tight matrix called a capsule that helps protect the cell from dessication in dry environments. A comparatively loose matrix of the same types of molecules m ay be secreted, and instead of the capsule, the result is called a slime layer. The slime layer is important in bacterial attachment and formation of biofilms ( see chapter 13, Extracellular Matrix). Eukaryotic cells are considerably more co mplex. Eukaryotic organisms are currently classified into four kingdoms: animal, plant, fungus, and protists. The animal cell in figure 2 depicts has many featu res in common with cells of the other three kingdoms. Golgi Body Cell Membrane Nuclear Membrane Lysosome Smooth Endoplasmic Reticulum Nucleus Rough Endoplasmic Reticulum Nucleolus Peroxisome Cytoplasm Free Ribosomes Mitochondrion Figure 2. A prototypical animal cell. Obviously, the biggest difference between the animal cell (or any eukaryotic cel l) and prokaryotic cells is the presence of internal membrane-bound compartments , or organelles. The most prominent of these is the nucleus, which houses the DN A. Traditionally, it has been assumed that most eukaryotic genomes can range fro m 10 to 100 Chapter 1, The Cell, version 1.0 Page 3

x 106 nucleotides (10-100 Mb) in total length, over two or more chromosomes (DNA molecules) of roughly similar size. In contrast, prokaryotic genomes have tradi tionally been viewed as a single circular chromosome, and mostly under a megabas e (106 nucleotides) in length. The nucleus is bounded by a double-layered membra ne (most other organelles are bounded by a single membrane) that is continuous w ith the the endoplasmic reticulum (ER). The endoplasmic reticulum is subdivided into the rough ER (RER) and the smooth ER (SER) based on appearance in electron micrographs. The studs on the RER are ribosomes, which are the molecular machinery for making proteins in the cell. There are also free-floating ribosomes - the d ifference is that the free ribosomes make proteins that stay in the cytoplasm, w hile ribosomes attached to the RER are synthesizing proteins that are destined t o insert into a membrane, localize inside an organelle, or be secreted out of th e cell entirely. The RER makes modifications to the proteins as well as compartm entalizing them. The SER counts lipid synthesis (e.g. to make membranes) and det oxification reactions among its duties. It should be noted that ribosomes on the RER are not permanently attached, and after they have produced a protein, they dissociate from the RER and rejoin the general pool of free ribosomes in the cyt oplasm. The Golgi complex, or Golgi bodies, while physically independent, are a functional extension to the protein processing and sorting that occurs in the ER . Proteins leave the Golgi in vesicles bound for the cell membrane or other orga nelles. Vesicles, while membrane-bound, are not generally counted as organelles: they are simply small transport packages. Mitochondria are complex organelles t hat are not only bounded by a membrane, but also contain a second membrane that is highly crenulated. Mitochondria make aerobic respiration possible, using oxyg en as an oxidizer to produce chemical energy (i.e. ATP) far more efficiently tha n the anaerobic processes used by most prokaryotes. This ability to produce more energy from the same amount of food allows eukaryotic cells to grow larger than prokaryotes. Lysosomes are acidic and contain digestive enzymes that break down large food molecules particularly proteins and fats to make them usable by the rest of the cell. These enzymes work optimally in acidic conditions, which acts as a sort of safety mechanism: if a lysosome breaks and releases its enzymes int o the cytoplasm, they will not break down cellular components willy-nilly becaus e the cytoplasmic pH is close to neutral and the enzymes do not work well. Once thought to be exclusive to animal cells, lysosomes have now been described in al l cells from all eukaryotic kingdoms. Recent and better methods for genome mapping and sequencing, and a broadening of the sample organisms has shown those numbers to be inaccurate. In fact, eukaryo tic genomes range from ~3 Mb to over 4000 Mb. Prokaryotic genomes vary from 0.5 Mb to a little over 10 Mb (0.5 to 6 Mb for Archaea, 0.6 to 10 Mb for Bacteria) a nd may be spread over multiple DNA molecules that may be either linear or circul ar. Chapter 1, The Cell, version 1.0 Page 4

Peroxisomes also break down or convert molecules, but they generally act on smal ler molecules by oxidation. For example, some peroxisomes in human liver cells a re used to break down alcohol (ethanol). Processes like this often produce H2O2, hydrogen peroxide, as a byproduct. Since H2O2 in high concentrations is harmful , peroxisomes often contain an enzyme, catalase, that converts it into water and molecular oxygen. Peroxisome Nucleolus Smooth Endoplasmic Reticulum Chloroplast Lysosome Rough Endoplasmic Reticulum Nucleus Nuclear Membrane Central Vacuole Cell Wall Golgi Body Cytoplasm Cell Membrane Free Ribosomes Mitochondrion Figure 3. A typical plant cell. Plant cells have all of the above named organelles, but additionally may also be ar two other types of organelles: chloroplasts and vacuoles. In addition to this , plant cells also have a rigid cell wall external to the cell membrane. Chlorop lasts are similar to mitochondria in shape and structure (membranes within the o uter membrane). However, its function is very different: chloroplasts absorb lig ht energy from the sun (or other light sources) and convert them into chemical e nergy in the form of simple sugars for the cell to store and use later, in essen ce turning the cell into a solar energy warehouse and distribution center. Since plants and some photosynthetic bacteria are the only Chapter 1, The Cell, version 1.0 Page 5

organisms capable of converting solar energy into a form useful to living cells, they are crucial to the survival of all other life. Vacuoles are essentially st orage units. They may store starches for use as energy sources when sunlight is unavailable or when immediate photosynthesis alone is not sufficient to provide for the energy needs of the cell. Other vacuoles, such as the one depicted above in fig. 3, store water, which helps the cell to maintain rigidity in combinatio n with the cell wall. Plant cell walls are composed of very different materials than the previously mentioned bacterial cell walls. Plant cell walls are primari ly composed of the glucose polymer, cellulose, but contain other polysaccharides as well. Depending on the type of plant cell, there may be multiple layers of c ellulose composing the cell wall. The wood and bark of trees, for example have b oth a primary (thin) cell wall and a secondary (thick) wall, while the leaves wo uld have only a primary wall. Fungi also have cell walls, and they too are diffe rent from bacterial cell walls. True fungi have cell walls that are composed pri marily of the polysaccharide chitin, and no cellulose. Finally, consider the cyt oplasm. Once considered merely the aqueous environment in which the important mole cules or organelles floated, it is now better understood to be filled with impor tant structural and transport elements (fig. 4). The cytoskeleton provides not o nly an internal physical structure but also a transport system to move molecules , vesicles, and even organelles to where they are needed. All of the cell parts introduced in this chapter will be explained in much greater detail in subsequen t chapters. More importantly, the intertwined relationships between many of the molecules and organelles will be discussed and elucidated. As you go through thi s course, you will notice that the same species come up over and over as example s. These are the model organisms upon which the great majority of molecular cell biology research is based. Most prokaryotic research has been based on Escheric hia coli (E. coli), which is a Gram-negative rod-shaped bacterium commonly found in the gut of many higher animals. The Gram-negative soil bacteria, Bacillus su btilis, is a sporeforming organism that has also been used in research because, like E. coli, its genome is easily manipulated for experimentation, and is also relatively easy to grow in the lab. On the eukaryotic side, yeast (Saccharomyces cerevisiae, or Schizosaccharomyces pombe) are very commonly used for simpler in tracellular processes due to simple genetics and very fast generation times. Cae norhabditis elegans (a nematode) and Drosophila melanogaster (fruit fly) are pop ular invertebrate model organisms, especially for developmental and genetic stud ies due to the small number of cells, mostly with traceable lineage, and fast ge neration time (for metazoans). Frogs, particularly the South African clawed Chapter 1, The Cell, version 1.0 Interestingly, two groups once classified as fungi: oomycetes and dictyostelids, have cell walls composed of cellulose (and some have both). These organisms hav e been reclassified in Protista. = Microtubules = Intermediate Filaments = Actin Filaments = Centrosome Figure 4. Animal cell cytoskeleton Page 6

frog, Xenopus laevis, and the Northern Leopard frog, Rana pipiens, are popular f or certain types of developmental and cell cycle studies because they have huge oocytes that are amenable to many kinds of genetic and physiological manipulatio n not possible in other cells. Arabidopsis thaliana is the most commonly used mo del organism for the study of plant genetics. Finally, because they are mammals like us (humans), but breed quickly and can be genetically manipulated with rela tive ease, mice (Mus musculus) are very commonly used in the study of more compl ex intra- or inter-cellular mechanisms. More recently, the near complete sequenc ing of the genome and development of techniques to manipulate it, have made the rat (Rattus norvegicus) another viable research organism for the study of mammal ian genes. The commonalities that make all of these organisms excellent models f or the study of the molecules of the cell and the interactions between them that constitute life, are a relatively short generation time, well-described (and in most cases fully sequenced) genome, and ease of experimental manipulation. Most of the molecules and mechanisms you will learn in the course were discovered in the simpler model mechanisms, and then found again, often with elaboration in t he more complex ones. Further information on model organisms can be found at the United States National Institutes of Health web site: http://www.nih.gov/science/models/ Figure 5. Model Organisms. The Northern Leopard frog, Rana pipiens (left), the m ustard-family plant, Arabidopsis thaliana (center), and the common rat, Rattus n orvegicus (right). All images released to the public domain by the United States Goverment (USGS, NPS, NIH). Chapter 1, The Cell, version 1.0 Page 7

Basic Cell Chemistry : A Review of Chemical Compounds and their Interactions Water There is no life without water. In this chapter, water will be used to review so me very basic ideas in chemistry, particularly as applies to cell and molecular biology. What is water? H2O. Two hydrogen atoms and one oxygen atom (Fig. 1). To gether they form a molecule of water. They are defined as a molecule by the pres ence of strong chemiUsing this book: This book is designed to be used in both introductory and advan ced cell biology courses. The primary text is generally on the left side of the vertical divider, and printed in black. Details that are usually left to an adva nced course are printed in blue and found on the right side of the divider. Fina lly, additional biomedically relevant information can be found in red print on e ither side of the divider. In this chapter, there are few advanced concepts, and t he right side text should be considered clarification and review. A eeB O If any of the first five pages is not a review, then your high school chemistry class faile to prepare you properly for college. Go take an intro chemistry cla ss before procee ing with this course. Then go complain to your high school a mi nistrators an tell them to stop umbing own courses an teaching to the lowest common enominator. ee8p 8n eeH + eeH + eeOxygen eeee8p 8n eee-

1p 1p e- eHy rogen 1p

cal bon s connecting each atom. In this case, each atom is connecte to another by a covalent bon . These are the strongest type of chemical bon s, an form whe n two atoms are sharing electrons in or er to fill their outermost (valence) ele ctron shell an increase stability. In the case shown here, hy rogen (H) has onl y one electron, an for maximal stability of that electron shell, it shoul have two. Oxygen, on the other han , has six electrons in its outer shell, an a fil le shell woul have eight. Thus, it woul like to pull in two more electrons for maximal stability. As shown in Fig. 1B, Chapter 2, Cell Chemistry, version 0.2 The volume of an atom is efine by electrons in a very fast an energetic obit aroun a nucleus. The electrons are very small negatively charge particles, an the nucleus is compose of neutrons (electrically neutral) an protons (positiv ely charge ), both relatively massive in comparison to electrons. The electrons o rbits aroun the nucleus can be approximate by shells or levels. These shells cha racteristically have limitations on the number of electrons that can fit within them: the first shell (closest to nucleus) hol s only 2 electrons, while the sec on shell hol s 8, an the thir shell hol s 18. The atom is most stable when it s outer shell (an by extension, all inner ones also) is fille . The energy of t he electrons also varies by level - innermost electrons have the least energy wh ile the outermost electrons have the most. Page 8

Figure 1. (A) Oxygen an

hy rogen (B) Water.

both of those requirements are fulfille when each of the hy rogen atoms shares an electron with the oxygen, which also shares an electron each with the hy roge n. The water molecule can also be written as HOH, in which the single soli line i n icates a pair of share electrons, i.e. a single covalent bon . The energy of an average single covalent bon is about 80 kcal/mol. However, as shown H H at l eft, ouble an even triple covalent bon s are posC C H C C H sible. The strengt h of those types of bon s is slightly less H H than ouble (~150 kcal/mol) or tr iple (~200 kcal/mol) the Ethylene Acetylene energy of the single bon s. Sharing electrons is not the only way to create bon s between atoms. Ionic bon s are cre ate when an atom onates or receives an electron, rather than sharing one. When an atom gives up an electron, the electrical balance between the numbers of pos itively charge protons in its nucleus an negatively charge electrons is upset , an the overall atom now has a positive electrical charge. Similarly when an a tom receives an extra electron, the balance in a neutral atom is upset, an the atom becomes negatively charge . An ionic bon is forme when one atom onates a n electron to an a jacent atom, creating an ionic pair, one positively an one n egatively charge . The electrical attraction between the oppositely charge atom s hol s them together. Ionic bon s are weaker than covalent bon s, with an avera ge bon energy of ~5.5 kcal/mol. Both covalent an ionic bon s are thermo ynamic ally stable in ry, room temperature con itions (25C, 298 K, 77F). The average ene rgy imparte when molecules colli e at this temperature is only ~0.6 kcal/mol, f ar less than the energy nee e to break a covalent or ionic bon . Figure 2. (A) In ivi ually, the Na atom an the Cl atom are electrically neutral . However, they are both very reactive chemically because both nee only get ri of (Na) or take in (Cl) one electron to have a full outer shell. (B) Because an electron is completely transferre , the Na becomes Na+ an Cl becomes Cl-, refl ecting the new charge imbalance. Although electrically no longer neutral, the th ermo ynamic enhancement from filling the outer shells makes both of these ions v ery stable. A e- ee- ee- eBon energy is a measure of the strength of the bon between two covalently join e atoms, an is proportional to the bon istance, which is etermine by the a tomic ra ii. It is not the same thing as bon issociation energy, which is the energy release in a homolytic reaction (bon is split with electrons equally i stribute ) taking place at absolute zero, but they are similar in being measures of bon strength. Although salts (such as NaCl) are ionic compoun s, not all ionic compoun s are s alts. The chemical efinition of a salt requires that the compoun be forme by the substitution of a hy rogen ion (H+) in the original compoun . This usually o ccurs in neutralization reactions, such as the neutralization of hy rochloric ac i , HCl (or H+Cl-) with so ium hy roxi e (Na+(OH)-), which yiel s the salt NaCl, an water (HOH = H2O). eee11 p 11 n eeeeeee-

eee17 p 17 n eeeeeeeee(11 electrons) Na (17 electrons) e- eCl B e- ee- eeee11 p 11 n eeeeeeeeee17 p 17 n eeeeeeeee(10 electrons) Na+ (18 electrons)

ClChapter 2, Cell Chemistry, version 0.2 Page 9

Covalent an ionic bon s between atoms are the only way to make molecules, which are stable collections of chemically bon e atoms. However, other attractive in teractions between atoms an molecules exist, but they are significantly weaker, an can be isrupte with relatively small changes in temperature or environmen tal con itions. These are van er Waals forces. They are very short-range interac tions, requiring close apposition of the two atoms. As mentione , an in ivi ual hy rogen bon (a specific type of van er Waals force escribe below) or other v an er Waals interaction can be easily isrupte , but these types of interactions generally occur en masse. In a sense, they are like molecular Velcro - each in i vi ual little plastic hook an in ivi ual loop of nylon coul barely hol two ha irs together, but a suit of velcro can hol a person on a vertical wall (a la La te Night with Davi Letterman, 1984). In the case of hy rogen bon s, these occur when there is permanent asymmetric electron sharing within a covalently bon e molecule so that the share electrons spen more time aroun one nucleus (thus i mparting a negative character), than the other (which is therefore somewhat posi tive in character) to create a permanent electrical ipole. These ipole moments can interact with oppositely charge moments on other molecules or the same mol ecule. Van er Waals forces also inclu e in uce (nonpermanent) ipole- ipole in teractions in which a temporary shift in electron ensity as they orbit the nucl eus forms a minute charge ifferential, that can in uce an opposite an attracti ve charge ifferential in a very close neighboring atom. In fact, some texts ef ine van er Waals forces exclusively as such, leaving hy rogen bon s as a separa te category altogether. One of the arguments for that i ea is that the bon leng th of the average H-bon is smaller than the sum of the van er Waals ra ii of th e two atoms. As note above, hy rogen bon s result from severely uneven sharing of electrons that generate permanent ipoles. In biological systems, this genera lly means that a hy rogen is covalently boun to either an oxygen or a nitrogen atom, which are both highly electronegative atoms, strongly attracting the share electrons away from the hy rogen. Common hy rogen-bon ing pairs are OH :O, OH :N, NH :N, an NH :O. Dotte lines are a common metho for epicting hy rogen bo n s in printe text an iagrams. Water is a molecule that has a permanent ipol e (i.e. it is a polar molecule), with the highly electronegative oxygen nucleus taking the lions share of the share electrons time, leaving the hy rogen nuclei s trippe bare own to their protons. The geometry of the water molecule (Fig. 1B) makes one si e of the molecule somewhat negative with two pairs of free electro ns, an the opposite si e positive, because the share electrons are only rarely near the hy rogen nuclei. This gives water the ability to hy rogen bon , an is the basis for several of waters most important qualities. The ability to form Chapter 2, Cell Chemistry, version 0.2 O H H O H + + + H + O +

H H Figure 3. The hy rogen bon ing of water molecules to one another is an important eterminant of the physical properties of water. + + H O H O H + H + + O O H + H O H + O H H + H H + O H H + H + + + + + O H O

O + H + + H H + + H H + Page 10

Aci s an Bases While it is easiest to think of water as H2O, it is in fact in an equilibrium be tween the ionize molecules H+ (which is simply a proton) an OH (the hy roxyl io n). The H+ itself can be subsequently boun to a water molecule to form a hy ron ium ion, H3O+. The release of H+ an OH are not limite to water molecules, an m any compoun s o so in aqueous solutions. These compoun s can be classifie as a ci s (raising the free H+ concentration) or bases (increasing the free hy roxyl concentration]. The exWater can issociate from H2O into the ions H+ an OH, in w hich the eparting hy rogen leaves its electron with the oxygen. However, H+ is extremely reactive an almost imme iately attaches to a nearby water molecule, f orming the hy ronium ion H3O+. Chapter 2, Cell Chemistry, version 0.2 Page 11

many hy rogen bon s lea s to a high specific heat of water, an enables it to ac t as a generous heat buffer. In or er to get enough molecules of water moving fa ster an increase the temperature of the water, the energy put into the water mu st first be use to break apart the hy rogen bon s without generating heat. This is unlike most other liqui s, which o not link internally with H-bon ing. So t he water is able to absorb more heat (energy) without a phase change than many o ther liqui s. Another important an unique characteristic of water is that the s oli phase (ice) is less ense than the liqui phase. With most other liqui s, a s the temperature rops, the molecules have less energy, so they move less, an they stay closer together, increasing the ensity. Only part of that hol s true with water. Again, the ability to form hy rogen bon s is irectly relate to thi s: as the temperature is lowere , the molecules move aroun less, affor ing them more opportunities to form hy rogen bon s. However, even though they are attrac tive, the H-bon s also act as spacers separating the water molecules more than i f they were allowe to tumble about together in a liqui without forming H-bon s . From a chemical stan point, the polar nature of water makes it an excellent so lvent for ionic an polar molecules. As you can see in the figure, the hy rogen si e of water interacts with the negatively charge chlori e ion, while the oxyg en si e of water interacts with the positively charge so ium ion, thus easily issolving the salt. However, the polarity of water also makes it repel nonpolar molecules or by non-polar regions of molecules. This property, known as hy ropho bicity, is crucial to life, since it is the basis for the formation of the biolo gical membranes that efine a cell. In general terms, the H-bon ing between wate r molecules is very stable. Non-polar molecules cannot participate in H-bon ing, an therefore create areas of instability wherever they are touching aqueous (w ater-base ) solutions. The resolution to this problem is for hy rophobic molecul es to aggregate, thus lowering the total surface area in contact with water. In living organisms, many protein an lipi molecules are amphipathic, with some po rtions hy rophobic, while other parts of the molecule are hy rophilic. This aspe ct of water chemistry is actually more important to life in a geologic sense tha n at the cellular level. At the cellular level, the consequence is that freezing cells causes the water in them to expan an burst, killing them at low tempera tures unless the cell has chemicals that act as antifreeze an lower the freezin g temperature of the cytoplasm. On the other han , at the geological level, when a pon or lake freezes in winter, the ice is less ense than water, thus stayin g on top of the pon , insulating eeper layers, an helping them stay liqui an able to support life (many organisms migrate eeper own in the winter). If wat er became more ense as it froze, as many other molecules, ice woul sink, an e ventually the entire pon woul be completely soli , killing off most life in it once a year!

tent to which aci s an bases onate or remove protons is measure on the pH sca le, which is a logarithmic scale of relative H+ concentration. Thus the Coca-Col a that I am rinking, an which counts phosphoric, carbonic, an various other ac i s among its ingre ients, has a pH aroun 3, which means that it liberates 104 times more H+ than water, which has a pH of 7. Insi e cells, the pH range is tig htly restricte to slightly above neutral (neutral = pH 7), although in eukaryot es, various intracellular organelles (e.g. lysosomes) may have significantly if ferent internal aci ity/alkalinity. This is important biologically because chang es in aci ity or alkalinity can alter hy rogen an ionic bon s, thus potentially changing the shape an activity of enzymes an other biomolecules. Sometimes, t his can be use to an organisms a vantage. For example, cells lining the stomach of an animal such as yourself secrete the enzyme pepsin into the stomach to help igest proteins. Pepsin has a pH optimum close to pH 2, which is great because stomach pH is also aroun 2. However, consi ering that cells themselves contain a lot of proteins, an we ont want pepsin-containing cells to igest themselves away, what is the solution? Because the pH insi e the cell is close to 7.2, far above the pH optimum for pepsin, it is inactive insi e the cell, an only works after it has been secrete into an aci ic environment. Carbon The major constituent molecules in all living organisms are base on carbon. Car bon has versatility stemming from its four outer shell electrons allowing the po ssibility of four covalent bon s with a variety of partners, incu ing very stabl e carbon-carbon covalent bon s. Because of this, long carbon chains can form the backbone of more complex molecules, an makes possible the great iversity of m acromolecules foun in the cell. The carbon chains themselves are not very react ive, but they often have reactive chemical groups attache to them. Common group s are the hy roxyl (OH), carbonyl (CO), carboxyl (COOH), an phosphate (PO4). Carbon chains may even have other carbon chains attache to them: the smaller ones beh ave an are name as groups also: methyl (CH3), ethyl, (C2H5), propyl (C3H7), an s o forth. Figure 4B (right) epicts several functional groups that can be foun i n the simple molecule, acetic aci (very ilute acetic aci is the primary compo nent of vinegar). Carbon is also the basis for the four major classes of biologi cal molecules: sugars, nucleoti es, amino aci s, an fatty aci s. The first thre e are classes of molecules that can A eB H3C O C OH O C OH O C Carbonyl group -CO ee6p 6n

Carboxyl group -COOH e-

Acetic Aci

eH H C H Methyl group -CH3 O H Hy roxyl group -OH eFigure 4. (A) The carbon atom has four electrons in its outer shell. (B) Functio nal groups that can be i entifie from a molecule of acetic aci . Chapter 2, Cell Chemistry, version 0.2 Page 12

be strung together by covalent bon s to make important large biomolecules: simpl e sugars can form large polysacchari es such as starch, cellulose, or glycogen, nucleoti es can form RNA (ribonucleic aci s) or DNA ( eoxyribonucleic aci s), an amino aci s can form proteins. Fatty aci s, on the other han , are aci eriva tives of long chains of carbons linke to one another, with hy rogens taking up most of the other bon ing positions. Sugars Sugars, an glucose in particular, are important molecules for cells because the y are the primary energy source. Sugars have the general chemical formula CH2O, an can be joine together almost infinitely for storage. However, because they are hy rophilic, they allow water molecules to intercalate between them, an can not pack as efficiently as fats, which are hy rophobic an thus exclu e water. O n the other han , the sugars can be mobilize for use more quickly. Therefore, p olysacchari es are usually short-term reservoirs of energy for an organism, whil e fats are use for longer-term storage. The general chemical formula cannot ful ly efine a particular sugar, because the same set of atoms, e.g. C6H12O6 can re fer to glucose, fructose, mannose, or galactose, an that oesnt even inclu e the stereoisomers. Isomers are rearrangements of the same atoms, such as with gluco se an fructose (fig. 5), while stereoisomers are much more similar: they are mi rror-images of one another. Thus glucose can exist as l-glucose or -glucose, e pen ing on whether it is a left-han e or right-han e isomer. This may seem like a n esoteric istinction, but it becomes important in intermolecular interactions, because many are base on recognition of specific shapes, so an l-conformation molecule may not be recognize by an enzyme that recognizes its - isomer. Anoth er important aspect of sugar chemistry is whether it is an al ose or a ketose, b ase on the type of carbonyl group it carries. This is easiest to un erstan loo king at the position of the carbonyl group in the linear structure: put simply, an al ehy e is a terminal carbonyl group, while a ketone is an internal carbonyl group. Sugars in aqueous solution exist in an equilibrium between the linear fo rm an the ring form, which is forme by intramolecular attack by a hy roxyl gro up on the carbonyl. Technically, the cyclic sugar is a pyranose (6-membere ring ) or a furanose (5-membere ring), so that -glucose cyclizes into -glucopyrano se. However, in most cell biology courses, the cyclic sugar will still be referr e to as its non-cyclic alter ego. Note that ue to the ifference between the C 6H12O6 al ose glucose, an the C6H12O6 ketose fructose, cyclization generates a pyranose in one case, an a furanose in the latter (fig. 5), although the H C O HO H HO CH2 H OH H O H OH CH2OH H OH H C O HO CH2 HO H HO O HO H HO C H H C OH H C OH CH2OH H CH2 OH H C OH HO C H H C OH H C OH CH2OH Glucose Fructose Figure 5. Glucose is an al ose (terminal carbonyl) that cyclizes into a pyranose , fructose is a ketose (internal carbonyl) that cyclizes into a furanose. Chapter 2, Cell Chemistry, version 0.2 Page 13

number of carbons (an other atoms) are the same. These two molecules are theref ore recognize ifferently by the enzymes of the cell, lea ing to ifferent meta bolic pathways. Simple sugars can be joine together by con ensation reactions t o form glycosi ic bon s. These reactions are calle con ensation reactions becau se they form water as a bypro uct. The glycosi ic bon is an O linkage between car bons of two sugars. The bon is usually name with the specific linkages: for ex ample in cellulose, glucoses are linke by b(1,4) linkages, which means in a sta n ar ring iagram, the upwar -facing b-hy roxyl on the 1-carbon interacts with the OH on the 4-carbon of a neighboring glucose (fig. 6B). [Technically, since on ly two glucoses are shown here, this is a molecule of cellobiose, not cellulose. ] In contrast, the maltose shown in the same figure (fig. 6A), while also showin g two glucoses linke together, is an a(1,4) linkage, with a ownwar -facing a-h y roxyl on the 1-carbon. Large polysacchari es generally have one of two functio ns: as a very strong structural component of a cell, an as a storage molecule f or rea ily accessible energy. The two major structural polysacchari es ma e by c ells are cellulose an chitin. Cellulose is primarily synthesize by plants, whi le chitin is mostly synthesize by invertebrates (think crab shells), though it is also ma e by many fungi an algae. As we just saw, cellulose is an array of p arallel lengths of glucose monomers joine together by b(1,4) glycosi ic bon s ( fig. 7). These long glucans are stacke closely on one another so that many Hbon s can form along their lengths, which are virtually limitless, etermine by th e nee s of the organism. Interestingly, chitin is also a homopolymer linke by b (1,4) glycosi ic bon s, but instea of glucose, the monosacchari e use is N-ace tylglucosamine (often abbreviate GlcNAc, see chapter 11). However, the macromol ecular structure is very similar to cellulose, an like cellulose, it is very st rong. As with structural polysacchari es, there are also two primary energy-stor age polysacchari es: starch, which is synthesize by plants, an glycogen, which is synthesize by animals. Starch is actually a mixture of two slightly iffere nt polysacchari es. One is a-amylose, which is a glucose homopolymer like cellul ose, but connecte by a(1,4) glycosi ic linkages, which makes it completely iff erent structurally. Unlike the linear an highly stackable cellulose polysacchar i es, a-amylose takes on a twisting a-helical shape. The other starch polysaccha ri e is amylopectin, which is like a-amylose with the a ition of branches forme from a(1,6) glycosi ic bon s every 24-30 resi ues (fig. 6C). The storage polys acchari e for animals, glycogen, is essentially amylopectin with a higher freque ncy of branching, approximately every 8-14 resi ues. Whereas the tight packing o f the structural polysacchari es ren ers them waterproof, this is certainly not the case for starch or glycogen, both of which can interact with many water mole cules Chapter 2, Cell Chemistry, version 0.2 A HO H HO CH2 H O H HO H O H CH2 H O H H OH H OH (1

H 4) link ge HO CH2 H OH OH B HO H HO CH2 H OH H O H O H H O H H OH OH (1 HO H HO H CH2 H H 4) link ge OH C O H OH H (1 O 6) link ge HO H OH CH2 H O H OH CH2 H O H H H O H H OH H OH

HO H CH2 H OH H HO O H OH O H H

Figure 6. (A) the (1,4) glycosidic ond of m ltose, (B) the (1,4) o iose, nd (C) the (1,6) ond in r nching glycogen.

ond of cell

CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H HO H CH2 H OH H HO O H OH O H H

CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H HO H CH2 H OH H HO O H OH O H H

CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H O HO H CH2 H OH H HO O H OH O H H CH2 H OH H O H OH H Figure 7. Cellulose is very strong m teri l due to the m ny hydrogen onds (in (1 4) link ge red) possi le when str nds of (1,4)-linked glucoses re ligned. P ge 14

Nucleotides Nucleotides, the uilding locks of RNA nd DNA, re themselves composed of pe ntose sug r tt ched to nitrogenous se on one side nd phosph te group on nother. The sug r is either the 5-c r on sug r ri ose or its close cousin, deox yri ose (the deoxy refers to missing hydroxyl group on the 2-c r on, which h s n H inste d). The tt ched nitrogenous se c n e purine, which is 6-mem er r ing fused to 5-mem er ring, or pyrimidine, which is single 6-mem ered ring . These ses re usu lly denine (purine), gu nine (purine), thymine (pyrimidin e), nd cytosine (pyrimidine) for DNA, with su stitution of ur cil for thymine in RNA ses. However, there re lso some unconvention l nd modified ses th t show up in speci l situ tions, such s in tRNAs. In ddition to eing the mon omer components of DNA nd RNA, nucleotides h ve other import nt functions s we ll. The est known, denosine triphosph te, or ATP, is the prim ry inst nt energy source for the cell y the energy rele sed through hydrolysis of its termin l ph osph te group. DNA or RNA re uilt from nucleotides through link ges of the sug rs, nd the polymeriz tion occurs y condens tion re ctions, ut these onds r e not glycosidic onds like with polys cch rides. Inste d, onds form etween th e 5 phosph te group of one nucleotide nd the 3 hydroxyl group of nother. These re phosphodiester onds, nd quick gl nce t the structure (fig. 8) expl ins t he n ming: n ester ond is c r onoxygen link ge, nd the phosphodiester ond is C-O-P-O-C, so there re two esters with phosphorus linking them. With the purine or pyrimidine se on the 1-c r on, this rr ngement pl ces the ses on the opposite side of the sug r from the polymerizing phosphodiester onds. This forms sug r-phosph te ck one to the DNA/RNA, which then h s the ses proje cting out from it. The ses will then likely inter ct with the ses of other n ucleotides, whether p rt of nother nucleic cid str nd or free-flo ting. Not on ly do they inter ct, ut they inter ct with gre t specificity nd consistency: denines se-p ir with thymines (or ur cils) through two hydrogen onds, while g u nines inter ct with cytosine through three H- onds. Note th t while one extr hydrogen ond does not ppe r to e p rticul rly signific nt, the ttr ction et ween G-C is 50% stronger th n etween A-T, nd over long stretches of DNA, re s high in G-C content re signific ntly more difficult to unzip (sep r te str nds ) th n re s high in A-T p irs. This specific se-p iring, known s Ch rg ffs ru les, is the sis for life: se-p iring is needed to m ke DNA dou leA 5 -O O OP O H 3C O O H O H H O O H O -O H2N N H H N N H T N A N N H OH H H 3 B

simult neously, nd swell up with the hydr tion, s ny cook who h s ever m de pudding (the thickening ingredient is st rch from corn) c n ttest.

5 -O OP O O O H O H NH2 N N N N H A H -O H N O H O P O H H O 3 OH H P OC H O -O NH2 N O OO O H H OH N N N H P O P O P O CH2 OH OH OH

Ch pter 2, Cell Chemistry, version 0.2 O H H O H H2C

Figure 8. (A) DNA nd (B) RNA differ y the presence of OH on the 2-c r on of ri ose ut not deoxyri ose nd the use of ur cil in RNA inste d of thymine. Both r e constructed from nucleotides like denosine triphosph te (C).

O H H N N H O H O N O H -O N P O A N T O O H NH2 H N CH3 P O H H H

H O O H H2C O N H H O N H C H 2N N O H N H N G O NH2 O N P O H H H O H

H2C H H N N NH2 H O G O N O H P N H C O N P O H2N O H2C H O H2C CH2 H O-O H N N H

OH O O H O O N N H P O G NH2 H2C CH2 H -O H NH2 N OOH O P O C O CH2 OH2C H -O O H O P O O H N H O OH N O N H H H U O CH2 OH2C H H OH 5 3 OH P ge 15

Ch pter 2, Cell Chemistry, version 0.2 P ge 16

Amino Acids Most of the m jor molecules of the cell - whether structur l, like cellul r equi v lents of uildings girders nd e ms, or mech nic l, like enzymes th t t ke p rt or put together other molecules, re proteins. Proteins inter ct with wid e v riety of other molecules, though ny given inter ction is usu lly quite spec ific. The specificity is determined in p rt y electric l ttr ction etween the molecules. So, wh t determines the ch rge of different regions of protein?

str nded which gives n org nism uilt-in ckup of genetic inform tion nd it is lso the sis for tr nsforming th t inform tion into proteins th t form the ulk of cell. Nucleic cids, the long polymers of nucleotides, exist in eithe r single or dou le str nded forms in vitro. However, in the cell, most RNA is si ngle-str nded, nd most DNA is dou le-str nded. This difference is import nt to their function: RNA is tempor ry inform tion tr nsfer molecule for p rticul r gene, DNA is the perm nent repository of ll genetic inform tion needed to m k e n org nism. Therefore, RNA needs to e e sily re d, me ning th t the ses ne ed to e ccessi le, nd not locked to complement ry str nd. Its long-term st ility is not p rticul rly import nt ec use when it is m de, usu lly m ny copie s re m de t the time, nd it is only needed while the cell needs to m ke the p rotein it encodes. Conversely, the s me str nd of DNA is re d over nd over to m ke the RNA, nd since there re only two copies of e ch chromosome ( chromosom e is single dou le-str nded DNA molecule) in cell, the ility to m int in t he integrity of the DNA is cruci l. Bec use of se p iring, e ch str nd of DNA cont ins ll the inform tion necess ry to m ke complete ex ct copy of its comp lement ry str nd. Of course, the point of the genetic inform tion in DNA is to e ncode the production of proteins th t c n then c rry out the functions th t defi ne cellul r life. Some of those functions, such s DNA replic tion, gene regul t ion, tr nscription, nd tr nsl tion, require the proteins to inter ct with nuc leic cid. Usu lly, p rt of the recognition process involves pposition of pos itively ch rged region of the protein to the DNA (or RNA), which is very neg t ively ch rged molecule, s expected from ll the phosph tes in the sug r-phosph te ck one. RNA, ut not DNA (with some exceptions), c n lso inter ct with its elf y complement ry se-p iring. If stretch of RNA sequence comes into cont ct with stretch of RNA with complement ry sequence on the s me molecule, the n se-p iring c n occur. Depending on the num er of nucleotides etween the com plement ry re s, second ry structures such s stem- nd-loops nd h irpins c n f orm.

Pol r Ch rged: OCH2 CH2 CH2 CH2 C O+H N 3 NH3+ C O NH3+ NH CH2 CH2 CH2 C O+H N 3 NH H HC C CH2 C O+H N 3 O C OC N+ N CH2 CH2 O+H N 3 CH H OH2C H2C H N + CH2 C C OHO H CH2 +H N 3 C C C C C C C H O Asp rtic cid (Asp, D) H O Glut mic cid (Glu, E) H O Lysine (Lys, K) H O Arginine (Arg, R) H O Histidine (His, H) OH Proline (Pro, P) Pol r Unch rged: O OH CH2 +H N 3 C NH2 O C NH2 CH2 C O+H N 3 CH3 H C OH C O+H N 3

CH2 CH2 O+H 3N CH2 C O+H N 3 C C C C C C C OH O Serine (Ser, S) H O Threonine (Thr, T) H O Glut mine (Gln, Q) H O Asp r gine (Asn, N) H O Tyrosine (Tyr, Y) Nonpol r: H3C CH2 +H N 3 H3C C O+H 3N CH3 CH C C O+H 3N CH3 CH CH2 C C OCH3 S CH2 CH2 +H N 3 C H O Al nine (Al , A) H O V line (V l, V) H O Leucine (Leu, L) CH3 CH2 H C CH3 +H 3N NH C CH2 C O+H N 3 C CH2 C O+H 3N H OC

C C C SH H +H N 3 CH2 C O+H 3N C C H C O OH O Methionine (Met, M) OH O Phenyl l nine (Phe, F) H O Tryptoph n (Trp, W) C C H O Glycine (Gly, G) Cysteine (Cys, C) H O Isoleucine (Ile, I) Nonessenti l . . (Hum n) Figure 9. The Amino Acids. The ck one is shown in l ck, while the side ch ins re colored red. Amino cids circled in lue c n e synthesized y hum ns, whil e the uncircled mino cids must e ingested. Amino cids with yellow ckgrou nd h ve unique structur l consider tions: the extremely sm ll side ch in of glyc ine llows it to fit into tight sp ces, the sulfhydryl group of cystein llows t he form tion of disulfide onds, nd the cyclic structure of proline introduces forced end in the polypeptide ch in. Ch pter 2, Cell Chemistry, version 0.2 P ge 17

Amino cids (figure 9), which re joined together to m ke proteins, m y e posit ively ch rged ( sic), neg tively ch rged ( cidic), pol r, or nonpol r, sed on the ch r cteristics of their side ch ins. The ch rge on the mino or c r oxyl e nd of e ch mino cid does not pl y role in the over ll ch r cter of ny p rti cul r region of the protein, ec use they re effectively neutr l, h ving een l inked, the mino group of one mino cid to the c r oxyl group of nother, y peptide ond. Note the figure of the mino cid: it is one c r on, c lled the c r on, linked to mino nd c r oxyl groups on opposite sides, nd to hydrogen, nd side ch in, denoted y R. These side ch ins, of which there re twenty com mon ones, c n e s simple s hydrogen tom (glycine), or could e quite compl ex, involving extended ring structures (histidine, phenyl l nine). The v riety i n their size, sh pe, nd ch rge ll dd up to n extremely vers tile set of uil ding locks for some of the most import nt working molecules of the cell. In the cell, peptide ond is formed etween two mino cids with enzym tic help from the ri osome. Like the previous two polymerizing re ctions, form tion of peptid e onds is condens tion re ction in which the c r on of the c r oxyl group nd the nitrogen from the mino group of their respective mino cids re onded to gether (fig. 10). This is very st le ond due to reson nce of the mide group . In the cell, peptide onds re mostly nonre ctive, except when tt cked y pro teolytic enzymes. Figure 10. Peptide Bond Form tion. A condens tion re ction etween CH2 the c r o xyl group of l nine nd nd the mino group of v line genH N C C Oer tes pept ide ond linking the 2 two mino cids, with molecule of H O w ter s yprod uct. Al nine H3C C O N CH3 CH C H C O O+ H2O Chir lity Almost ll mino cids (glycine is the exception) re optic lly ctive, which me ns th t they re symmetric in such w y th t it is impossi le to superimpose the origin l molecule upon its mirror im ge. There is h nded-ness out them, mu ch s your right h nd c nnot e superimposed on your left h nd if oth p lms mus t f ce the s me direction. In f ct, in the figure here, you c n lso underst nd why glycine is n exception, since its R-group is simple hydrogen tom. figure rele sed to pu lic dom in y NASA H3 C H2N CH3 CH C C OH O V line Chir l p irs, or en ntiomers, not only h ve the s me tomic components like ll isomers, they lso h ve the s me onds nd ond order. The term optic lly ctive c omes from the discovery th t pol rize light is rot ted in different directions y en ntiomers. Amino cids re often l eled s either d- (dextrorot tory) or l( levorot tory) depending on their tomic configur tion in rel tion to the en ntio mers of glycer ldehyde. This is common n ming system, ut not lw ys logic l, in th t lmost h lf of the l- mino cids re in f ct dextrorot tory (clockwise r ot tion of light), ut their molecul r configur tions resem le the levorot tory isomer of glycer ldehyde. Ri osome-cre ted proteins nd peptides re ll constru cted with l- mino cids. However, d- mino cids do exist in n ture, nd c n e i ncorpor ted into peptides through non-ri osom l me ns. An excellent ex mple is f ound in the cell w lls of some cteri . Bec use most proteolytic enzymes only ct on proteins with l mino cids, the incorpor tion of d- mino cids into the ce ll w ll c n protect the cteri from h rm. These D- mino cids re incorpor ted y tr nspeptid se. Tr nspeptid se is lso the t rget of the nti iotic, penicil lin, which is n irreversi le inhi itor of th t enzyme. CH2 H2 N C H

A peptide is n inex ct term used for rel tively few (usu lly <30) mino cids j oined together. E ch mino cid in polypeptide or protein m y lso e referred to s residue which c n sometimes e confusing ec use the s me term is lso p plied to monomers of nucleic cids nd of polys cch rides. L rger polymers re k nown s polypeptides or s proteins, lthough polypeptide h s more of structur l connot tion nd m y e used to indic te n unfinished or not-yet-function l s t te, where s protein gener lly implies some physiologic l function. On of the k ey ch r cteristics of proteins is the ility to form second ry, terti ry, nd f or proteins, qu tern ry structure y me ns of specific folding p tterns. If you think of long piece of thre d, y rn, or rope, you Ch pter 2, Cell Chemistry, version 0.2 P ge 18

c n pro ly im gine n infinite num er of different w ys to rr nge it, from sp ir ls to loops to r ndom t ngles. This is essenti lly wh t c n h ppen with pro tein with the constr ints put upon it y the size nd ch rge of the mino cids th t compose it. The prim ry structure of protein is simply the sequence of m ino cids th t compose the protein. These mino cids re joined y peptide ond s from the c r oxyl termin l of one mino cid to the mino termin l of the next . Second ry structure refers to the loc lized, simple, sh pes th t c n e formed , such s lph -helices, or et -sheets. These come out prim rily through hydr ogen onding to ne r y (rel tive to the prim ry structure) residues. Terti ry st ructure is 3-dimension l structure th t is uilt upon rr ngements of secondNot surprisingly, the proteins of thermophilic rch e cteri such s Thermophil us qu ticus (T q) or Pyrococcus furiosus (Pfu) h ve high proportion of cystei nes nd disulfide onds, since they live in deep se volc nic oce n vents under high pressure nd temper tures. A G T Y G S S F D S S B helix C sheet Figure 11. (A) Prim ry structure, (B) Second ry structure: n -helic l region, (C) Second ry structure: -ple ted sheet region, (D) Terti ry structure. ry structures, often through disulfide onds nd hydropho ic inter ctions in d dition to hydrogen onding. In the context of structur l st ility, cysteine pl ys speci l role. Beyond the prim ry structure, most protein folding is held in pl ce y hydrogen onds. Although strong enough in most situ tions, they c n e disrupted without extr ordin ry energy. Disulfide onds ( SS) re cov lent onds t h t form etween the sulfhydryl groups of two cysteines th t effectively locks t he loc l protein structure in pl ce, m king the protein extremely st le. Fin ll y, qu tern ry structure is the rr ngement of different individu l polypeptides (su units) into function l protein. O viously, only multi-su unit proteins h v e qu tern ry structure. Figure 12. Qu tern ry structure is illustr ted here y hemoglo in, which is comp osed of four independent polypeptide su units th t come together in specific c onform tion to m ke function l hemoglo in protein. Ch pter 2, Cell Chemistry, version 0.2

P ge 19

Ste ric cid H O C HO C H H C H H C H H C H H C H H C H H C H H C H C C H H H H C C H H H H C C H H H H C C H H H C H H Oleic cid Figure 13. F tty cids. (Top) Ste ric cid is fully s tur ted f tty cid with no c r on-c r on dou le onds. (Bottom) Oleic cid is n uns tur ted f tty cid. There re signific nt physic l differences etween the s tur ted nd uns tur ted f tty cids due simply to the geometry of the dou le- onded c r ons. A s tur te d f tty cid is very flexi le with free rot tion round ll of its C-C onds. Th e usu l line r di gr ms nd formul s depicting s tur ted f tty cids lso serve to expl in the ility of s tur ted f tty cids to p ck tightly together, with v ery little intervening sp ce. Uns tur ted f tty cids, on the other h nd re un le to p ck s tightly ec use of the rot tion l constr int impo rted y the dou le ond. The c r ons c nnot rot te round the dou le ond, so there is now kin k in the ch in. Gener lly, dou le- onded c r ons in f tty cids re in the cis- c onfigur tion, introducing 30-degree end in the structure. Ch pter 2, Cell Chemistry, version 0.2 H Figure 14. Triglycerides. These lipids re formed y conjug tion of glycerol t o three f tty cyl ch ins through ester onds from e ch glycerol oxygen. P ge 20

F tty Acids Unlike monos cch rides, nucleotides, nd mino cids, f tty cids re not monome rs th t re linked together to form much l rger molecules. Although f tty cids c n e linked together, for ex mple, into tri cylglycerols or phospholipids, the y re not linked directly to one nother, nd gener lly no more th n three in given molecule. The f tty cids themselves re long ch ins of c r on toms toppe d off with c r oxyl group. The length of the ch in c n v ry, lthough most re etween 14 nd 20 c r ons, nd in higher order pl nts nd nim ls, f tty cids with 16 nd 18 c r ons re the m jor species. Due to the mech nism of synthesis, most f tty cids h ve n even num er of c r ons, lthough odd-num ered c r on c h ins c n lso e gener ted. More v riety c n e gener ted y dou le- onds etwe en the c r ons. F tty cid ch ins with no dou le onds re s tur ted, ec use e ch c r on is s tur ted with s m ny onded hydrogen toms s possi le. F tty ci d ch ins with dou le onds re uns tur ted (fig. 13). Those with more th n one d ou le ond re c lled polyuns tur ted. The f tty cids in euk ryotic cells re n e rly evenly divided etween s tur ted nd uns tur ted types, nd m ny of the l tter m y e polyuns tur ted. In prok ryotes, polyuns tur tion is r re, ut other modific tions such s r nching nd cycliz tion re more common th n in euk ryo tes. A t le of common f tty cids is shown elow. Myristic Acid P lmitic Acid S te ric Acid Ar chidic Acid P lmitoleic Acid Oleic Acid Linoleic Acid Ar chidonic Acid 14:0 (14 c r ons, no dou le onds) 16:0 18:0 20:0 16:1 18:1 18:2 2:4 H H C H C H C O O O O C O C O C H O C HO C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H C H H

F tty cids inside cells re usu lly p rts of l rger molecules, r ther th n free cids. Some of the most common lipids derived from f tty cids re tri cylglyce rols, phosphoglycerides, nd sphingolipids. Tri cylglycerols, s the n me implie s, is three f tty cid ( cyl) ch ins connected to glycerol molecule y ester onds (fig. 14). Tri cylglycerols, lso known s triglycerides, m y h ve f tty c ids of the s me (simple tri cylglycerols) or v rying types (mixed tri cylglycero ls). Mixtures of these re the prim ry long-term energy stor ge molecules for mo st org nisms. Although they m y e referred to colloqui lly s f ts or oils, the only re l difference is the degree of s tur tion of their constituent f tty ci ds. Mixtures with higher percent ges of s tur ted f tty cids h ve higher melt ing point nd if they re solid t room temper ture, they re referred to s f t s. Tri cylglycerol mixtures rem ining liquid t room temper ture re oils. In hu m n medicine, common test for he rt dise se risk f ctors is me surement of tri glyceride levels in the lood. Although v rious cell types c n m ke nd use trig lycerides, most of the triglycerides in people re concentr ted in the dipose t issue, which is m de up of dipocytes, or f t cells, though liver is lso sign ific nt f t store. These cells h ve speci lized to c rry f t glo ules th t t ke up most of the volume of the cell. When triglyceride levels in the lood re hig h, it me ns th t f t is eing produced or ingested f ster th n it c n e t ken u p y the dipocytes. Phospholipids ( lso c lled phosphoglycerides or glycerophos pholipids), re lso sed on tt chment of f tty cids to glycerol. However, in ste d of three f tty cyl t ils, there re only two, nd in the third position i s phosph te group (fig. 15). The phosph te group lso tt ches to he d group . The identity of the he d group n mes the molecule, long with the f tty cyl t ils. In the ex mple figure, 1-ste royl refers to the ste ric cid on the 1-c r o n of the glycerol ck one; 2-p lmitoyl refers to the p lmitic cid on the 2-c r on of the glycerol, nd phosph tidyleth nol mine refers to the phosph te group nd its tt ched eth nol mine, th t re linked to the glycerol 3-c r on. Bec use of the neg tively-ch rge phosph te group, nd he d group th t is often pol r or ch rged, phospholipids re mphip thic - c rrying strong hydropho ic ch r c ter in the two f tty cyl t ils, nd strong hydrophilic ch r cter in the he d group. This mphip thicity is cruci l in the role of phospholipids s the prim r y component of cellul r mem r nes. Sphingolipids (fig. 16) re lso import nt co nstituents of mem r nes, nd re sed not upon glycerol ck one, ut on the mino lcohol, sphingosine (or dihydrosphingosine). There re four m jor types o f sphingolipids: cer mides, sphingomyelins, cere rosides, nd g ngliosides. Cer mides re sphingosine molecules with f tty cid t il tt ched to the mino gro up. Sphingomyelins re cer mides in which phosphocholine or phosphoeth nol min e re tt ched to the 1-c r on. Cere rosides nd g nglioCh pter 2, Cell Chemistr y, version 0.2 H3C H3C H H C O H H O P OH O C H C H C H H O O O H H H H H H H H H H H H H H H C C C C C C C C C C C C C C C C H H H H H H H H H H H H H H H H O H H H H H H H H H C C C C C C C C C H H C H H H H H H H C H C H H C H H C H C H C H H H H H3C N+ C Choline Phosph te F tty Acid Ch ins

Glycerol Hydrophilic He d Group Hydropho ic T il Figure 15. A phospholipid: the glycerol ck one (red) connects to two f tty ci ds nd to phosph te nd pol r he d group. A H HO C H C H C H NH3+ C H C H HO B H3C H3C H H C O H H O P OH O C H C H C H O C C H H3C N+ C NH C H HO C HO H HO CH2 H OH H O H OH H H O C H C H C H O C C H NH C H HO Figure 16. Sphingolipids re sed on the mino lcohol, sphingosine (A). Cer mi des h ve f tty cid t il tt ched, nd cer mide with phosphocholine he d g roup is sphingomyelin (B). If the he d group is sug r, then the molecule is cere roside. (C).

P ge 21

HO

Ch pter 2, Cell Chemistry, version 0.2 P ge 22

Figure 17. Cholesterol is n import nt lipid steroid precursor.

oth s

mem r ne component nd

sides re glycolipids - they h ve sug r or sug rs, respectively, tt ched to t he 1-c r on of cer mide. The oligos cch rides tt ched to g ngliosides ll con t in t le st one si lic cid residue. In ddition l to eing structur l compo nent of the cell mem r ne, g ngliosides re p rticul r import nt in cell to cell recognition. Lipids re v guely defined s iologic l compounds th t re insolu le in w ter ut re solu le in org nic solvents such s meth nol or chloroform. This includes the f tty cid deriv tives listed ove, nd it includes the fin l topic for this ch pter, cholesterol. Cholesterol (fig. 17) is the m jor iolog ic l deriv tive of cyclopent noperhydrophen nthrene, s tur ted hydroc r on con sisting of four fused ring form tions. It is n import nt component of pl sm me m r nes in nim l cells, nd is lso the met olic precursor to steroid hormones , such s cortisol or -estr diol. Pl nt cells h ve little if ny cholesterol, ut other sterols like stigm sterol re present. Simil rly, fungi h ve their p rt icul r sterols. However, prok ryotes do not, for the most p rt, cont in ny ster ol molecules. H3C CH3 CH3 CH3 CH3

Bioenergetics: Energy, Thermodyn mics, nd Enzymes Two fund ment l concepts govern energy s it rel tes to living org nisms: the Fi rst L w of Thermodyn mics st tes th t tot l energy in closed system is neither lost nor g ined it is only tr nsformed. The Second L w of Thermodyn mics st tes th t entropy const ntly incre ses in closed system. More specific lly, the Fi rst L w st tes th t energy c n neither e cre ted nor destroyed: it c n only ch nge form. Therefore, through ny nd ll processes, the tot l energy of the univ erse or ny other closed system is const nt. In simple thermodyn mic system, t his me ns th t the energy is tr nsformed either y the tr nsfer of he t energy ( i.e. he ting nd cooling of su st nce) or y the production of mech nic l work (i.e. movement). In iologic l nd chemic l terms, this ide c n e extended to other forms of energy such s the chemic l energy stored in the onds etween toms of molecule, or the light energy th t c n e sor ed y pl nt le ves. Th e Second L w dict tes th t entropy lw ys seeks to incre se over time. Entropy i s simply f ncy word for ch os or disorder. The theoretic l fin l or equili riu m st te is one in which entropy is m ximized, nd there is no order to nything in the universe or closed system. Spont neous processes, those th t occur withou t extern l influence, re lw ys processes th t convert order to disorder. Howev er, this does not preclude the imposition of order upon system. Ex mining the st nd rd m them tic l form of the Second L w: DSsystem + DSsurroundings = DSuniv erse, where DSuniverse > 0 shows th t entropy c n decre se within system s lo ng s there is n incre se of equ l or gre ter m gnitude in the entropy of the s urroundings of the system. The phr se in closed system is key component of the se l ws, nd it is with the ide enc psul ted in th t phr se th t life c n e po ssi le. Lets think out typic l cell: in its lifetime, it uilds countless com plex molecules - huge proteins nd nucleic cids formed from mixture of sm ll mino cids or nucleotides, respectively. On its surf ce, Ch pter 3, Bioenergetics, v. 1.01 Sep09

Work, in this c se, need not imply complic ted mech nism. In f ct, there is wo rk ccomplished y e ch molecule in the simple exp nsion of he ted m ss of g s eous molecules ( s visu lized y exp nsion of he ted lloon, for ex mple). Th is is expressed m them tic lly s the Fund ment l Thermodyn mic Rel tion: dE = T dS p dV in which E is intern l energy of the system, T is temper ture, S is ent ropy, p is pressure, nd V is volume. Unlike the First L w which pplies even to p rticles within system, the Second L w is st tistic l l w it pplies gener lly to m croscopic systems. However, it does not preclude sm llsc le v ri tions in the direction of entropy over time. In f ct, the Fluctu tion theorem (propos ed in 1993 y Ev ns et l, nd demonstr ted y W ng et l in 2002) st tes th t s the length of time or the system size incre ses, the pro ility of neg tive ch nge in entropy (i.e. going g inst the Second L w) decre ses exponenti lly. So on very sm ll time sc les, there is re l pro ility th t fluctu tions of e ntropy g inst the Second L w c n exist.

P ge 23

The universe is it.

closed system

y definition ec use there is nothing outside of

Using this ook: This ook is designed to e used in oth introductory nd ced cell iology courses. The prim ry text is gener lly on the left side of vertic l divider, nd printed in l ck. Det ils th t re usu lly left to n nced course re printed in lue nd found on the right side of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither side of the divider.

dv n the dv Fin on e

A B C A B C

Figure 1. In the top p nel, depicting n open system in which there re inputs f or m tter nd energy (in the form of food), the ox is open nd ir c n e exch nged, food dropped in, etc, thus llowing the mouse to grow. However, in the ot tom p nel, depicting closed system, the mouse does not h ve re dy ccess ny m ore oxygen th n is in the ox, nor does it h ve ccess to food. Without these in puts, the second l w t kes effect, nd the mouse dies nd decomposes into m ny s m ller molecules.

this ex mple might seem to e counterex mple to the second l w - cle rly going from mixture of v rious sm ll molecules to l rger molecule with onded nd ordered components would seem to e decre se in entropy (or n incre se in ord er). How is this possi le with respect to the second l w? It is, ec use the sec ond l w pplies only to closed systems. Th t is, system th t neither g ins nor loses m tter or energy. A living cell is not closed system: it h s inputs nd outputs. However, the second l w is still useful if we recognize th t the only w y th t it c n e yp ssed is through the input of energy. If cell c nnot t k e in food (input of m tter nd energy into the system) it dies, ec use the seco nd l w requires th t everything eventu lly re ks down into more r ndom/ch otic collections of sm ller components. The order required to sust in life (think o ut ll the different complex molecules th t were mentioned in the previous ch pt er) is phenomen l. The s me thing pplies on the org nism l level (fig. 1) - wit hout n input of energy (in the form of food molecules for nim ls or in the for m of light for pl nts), the org nism will die nd su sequently decompose. Cre ti ng molecules from toms costs energy ec use it t kes disordered collection of toms nd forces them, through chemic l onds, into ordered, non-r ndom positio ns. There is likewise n energy cost to form tion of m cromolecules from sm ller molecules. By imposing order in the system, there must e n ssoci ted input o f energy. This h ppens t every level of the system: toms to molecules, sm ll m olecules to m cromolecules, groups of molecules to org nelles, etc. Where does t h t energy go? It ends up in the onds th t re holding the molecules or m cromo lecules in their ordered st te. When such ond is roken, nd molecule is tu rned ck into collection of toms, energy is rele sed. The energy in chemic l ond is thus potenti l energy - it is stored energy th t, when rele sed, h s the ility to do work. This term, if you rec ll your high school physics, is us u lly le rned long with kinetic energy, which is energy th t is eing used in t he process of ctu lly doing work (i.e. moving n o ject from one pl ce to noth er). The cl ssic ex mple is the rock on the top of hill: it h s potenti l ener gy ec use it is elev ted nd could potenti lly come down. As it tum les down, i t h s kinetic energy s it moves. Simil rly in cell, the potenti l energy in chemic l ond c n e rele sed nd then used for processes such s putting sm ll er molecules together into l rger molecules, or c using molecul r motor to spi n or end - ctions th t could le d to pumping of protons or the contr ction of muscle cells, respectively. Coming ck to the second l w, it essenti lly m nd t es th t re king down molecules rele ses energy nd th t m king new molecules (g oing g inst the n tur l tendency tow rds disorder) requires energy. Every molec ule h s n intrinsic energy, nd therefore Ch pter 3, Bioenergetics, v. 1.01 Sep09

P ge 24

As the polymerizing re ction reduces entropy, it requires energy gener ted (usu lly) y the re kdown of ATP into AMP nd PPi, which is re ction th t incre se s entropy.

whenever molecule is involved in chemic l re ction, there will e ch nge i n the energy of the resulting molecule(s). Some of this ch nge in the energy of the system will e us le to do work, nd th t energy is referred to s the free energy of the re ction. The rem inder is given off s he t. The Gi s equ tion descri es this rel tionship s DG=DH-TDS. DG is the ch nge in free energy, DH is the ch nge in enth lpy (roughly equiv lent to he t), T is the temper ture t wh ich the re ction t kes pl ce, nd DS is the ch nge in entropy. As m tter of co nvention, rele se of free energy is neg tive num er, while requirement for i nput of energy is denoted with positive num er. Gener lly, chemic l re ction in which DG < 0 is spont neous re ction ( lso c lled n exergonic re ction), while chemic l re ction in which DG > 0 is not spont neous (or endergonic). Wh en DG = 0, the system is in equili rium. DG c n lso e expressed with respect t o the concentr tion of products nd re ct nts: DG = DG + RT ln ([P1] [P2] [P3] .. . / [R1] [R2] [R3] ...) Terms in squ re r ckets denote concentr tions, DG is the st nd rd free energy for the re ction ( s c rried out with 1M concentr tion of e ch re ct nt, t 298K nd t 1 tm pressure), R is the g s const nt (1.985 c l K-1 mol-1), nd T is the temper ture in Kelvin. In simpler system in which the re re just two re ct nts nd two products: A + B cC + dD

Ch nges in su str te or product concentr tion to drive non-spont neous re ctio n re n ex mple of the more gener l ide of coupling re ctions to drive n ener getic lly unf vor le re ctions forw rd. Endergonic re ctions c n e coupled to exergonic re ctions s series of re ctions th t ultim tely is le to proceed forw rd. The only requirement is th t the over ll free energy ch nge must e neg tive (DG < 0). So, ssuming st nd rd conditions (DG = DG), if we h ve re ction with free energy ch nge of +5 Ch pter 3, Bioenergetics, v. 1.01 Sep09 P ge 25

the equ tion for free energy ch nge ecomes [C ]c [D ]d DG = DG + RT ln [A] [B ] This is import nt to us s cell ec use lthough cells re not very well suited to regul ting chemic l re ction s y v rying the temper ture or the pressure of the re ction conditions, they c n rel tively e sily lter the concentr tions of su str tes nd products. In f ct , y doing so, it is even possi le to drive non-spont neous re ction (DG > 0) forw rd spont neously (DG < 0) either y incre sing su str te concentr tion (pos si ly y tr nsporting them into the cell) or y decre sing product concentr tion (either secreting them from the cell or y using them up s su str tes for di fferent chemic l re ction).

iolo

kc l/mol, it is non-spont neous. However, if we couple this re ction, to ATP hyd rolysis for ex mple, then oth re ctions will proceed ec use the st nd rd free energy ch nge of ATP hydrolysis to ADP nd phosph te is n exergonic -7.3 kc l/m ol. The sum of the two DG v lues is -2.3 kc l/mol, which me ns the coupled serie s of re ctions is spont neous. In f ct, ATP is the most common energy currency in cells precisely ec use the -7.3 kc l/mol free energy ch nge from its hydrolysis is enough to e useful to drive m ny otherwise endergonic re ctions y coupling , ut it is less costly (energetic lly) to m ke th n other compounds th t could potenti lly rele se even more energy (e.g. phosphoenolpyruv te, PEP). Also, much of the -14.8 kc l/mol (DG) from PEP hydrolysis would e w sted ec use rel tively few endergonic re ctions re so unf vor le s to need th t much free energy. E ven when re ction is energetic lly f vor le (DG < 0), it m y not occur withou t little push, chemic lly spe king. The push is something c lled ctiv tion energy , nd it overcomes thermodyn mic st ility. Consider glucose, for inst nce. This simple sug r is the prim ry source of energy for ll cells nd the energy inher ent within its onds is rele sed s it re ks down into c r on dioxide nd w ter . Since this is l rge molecule eing roken down into sm ller ones, entropy is i ncre sed, thus energy is rele sed from re ction, nd it is technic lly spont n eous re ction. However, if we consider some glucose in dish on the l ench , it cle rly is not going to spont neously re k down unless we dd he t. Once w e dd sufficient he t energy, we c n remove the energy source, ut the sug r wil l continue to re k down y oxid tion ( urn) to CO2 nd H2O. Tr nsition st te Non-enzymec t lyzed re ction Why is ATP different from other sm ll phosphoryl ted compounds? How is it th t t he g-phospho nhydride ond (the most dist l) of ATP c n yield so much energy whe n hydrolysis of glycerol-3-phosph te produces under third of the free energy? The most o vious is electrost tic repulsion. Though they re held together y th e cov lent onds, there re m ny neg tive ch rges in sm ll sp ce (e ch phosph te c rries pproxim tely 4 neg tive ch rges). Removing one of the phosph tes sig nific ntly reduces the electrost tic repulsion. Keeping in mind th t DG is c lcu l ted from the equili rium of oth re ct nts nd products, we lso see th t the products of ATP hydrolysis, ATP nd phosph te, re very st le due to reson nce ( oth ADP nd Pi h ve gre ter reson nce st iliz tion) nd st iliz tion y hydr tion. The gre ter st ility of the products me ns gre ter free energy ch nge. Activ tion energy (EA) of unc t lyzed re ction Free energy Enzyme-c t lyzed re ction Activ tion energy (EA) of c t lyzed re ction Initi l st te Re ct nts Free energy of re ction (G) with or without enzyme Final state Products Progress of reaction Figure 2. Catalysts lower the activation energy barrier to chemical reactions wi thout altering the free energy change for that reaction.

Chapter 3, Bioenergetics, v. 1.01 Sep09 Page 26

Put another way, the reactant(s) must be brought to an unstable energy state, kn own as the transtion state (as shown at the peak of the graphs in fig. 2). This energy requirement barrier to the occurrence of a spontaneous thermodynamically favored reaction is called the activation energy. In cells, the activation energ y requirement means that most chemical reactions would occur too slowly/infreque ntly to allow for all the processes that keep cells alive because the required e nergy would probably come from the chance that two reactants slam into one anoth er with sufficient energy, usually meaning they must be heated up. Again, cells are not generally able to turn on some microscopic bunsen burner to generate the activation energy needed, there must be another way. In fact, cells overcome th e activation energy problem by using catalysts for their chemical reactions. Bro adly defined, a catalyst is a chemical substance that increases the rate of a re action, may transiently interact with the reactants, but is not permanently alte red by them. The catalyst can be re-used because it is the same before the react ion starts, and after the reaction completes. From a thermodynamic standpoint, i t lowers the activation energy of the reaction, but it does not change the G. T hus it cannot make a non-spontaneous reaction proceed; it can only make an alrea dy spontaneous reaction occur more quickly or more often. Enzymes Biological catalysts are called enzymes, and the overwhelming majority of enzyme s are proteins. The exceptions are a class of RNA molecules known as ribozymes, of which most act upon themselves (i.e. part of the RNA strand is a substrate fo r the ribozyme part of the strand). In this book (and most textbooks in this fie ld), unless otherwise specified, the term enzyme refers to one made of protein. Enzymes confer extraordinary specificity to a chemical reaction: a reaction that might occur between a variety of potential substrates in an uncatalyzed situati on may only be allowed between two specific substrates when catalyzed by an enzy me. Enzymes allow cells to run chemical reactions at rates from a million to eve n a trillion times faster than the same reactions would run under similar condit ions without enzymes. In some cases, the enzymes allow reactions to proceed that would normally (i.e. sans enzyme) require more extreme temperature, pressure, o r acidity/alkalinity. Finally, and perhaps most importantly for life, enzymes ca n be regulated. This is crucial for the cell, since it must be able to react to different situations, such as availability of energy, accumulation of toxic bypr oducts, the need to reproduce, etc. Not only can enzymes be modified either cova lently or noncovalently to increase or decrease their activity, the cell can als o regulate production of the enzymes, providing another level of control over pa rticular cellular biochemical reactions. Chapter 3, Bioenergetics, v. 1.01 Sep09 Page 27

Enzymes are the most diverse type of protein in a cell. They vary not only in si ze, but also in the number of independently manufactured subunits that must come together to form an active enzyme, or holoenzyme. Part of the reason for requir ing so many different enzymes is that they are usually very specific for their s ubstrate molecules, and that specificity is based upon a combination of shape an d charge. The interactions between substrate and enzyme are often likened to a l ock and key or pieces of a jigsaw puzzle. If the substrate fits the shape of the enzymes active site (the part of the enzyme that carries out the actual catalyti c reaction), and the charges interact (e.g. positively charged amino acids on th e enzyme lining up with negative charges on the substrate), then there may be fu rther stabilization of the interaction by Van der Waals and hydrogen bond intera ctions. In fact, formation of a stable Enzyme-Substrate (ES) intermediate is ene rgetically analogous to the transition state (fig. 2) of reactions. The specific ity of enzymes is such that stereoisomers may not be recognized by some enzymes: for example, a protease (enzymes that chop up proteins into smaller pieces by h ydrolyzing the peptide bonds between specific amino acids) such as trypsin can b e stymied by the presence of a -amino acid in place of the usual L-amino acid i n a protein, even though it is a mirror image of the very same amino acid. This specificity means that enzymes are highly selective with respect to the reaction s they catalyze, which means that specific reactions can be greatly enhanced wit hout causing a general increase in many related chemical reactions. Another impl ication of the high specificity is that enzymes can (and often do) have high aff inity for their substrates without the problem of binding non-substrate molecule s (other than specific inhibitors - see below). If most biochemical reactions wo uld proceed extremely slowly, if at all, without catalysis, enzymes are needed t o lower the activation energy needed for chemical reactions to support life. Exa ctly how does an enzyme lower the activation energy of a reaction? What exactly does activation energy mean in the context of a cell? To understand this, there ar e two principles to keep in mind: first, when we talk about chemical reactions, generally, we are concerned with populations of substrate, product, and enzyme m olecules, not individuals; and second, the reactions are generally taking place between molecules dissolved in the aqueous cytoplasm of the cell. Consider a rea ction in which substrates A and B interact to form product C (fig. 3). If this r eaction is not catalyzed, it depends on the happenstance that a molecule of A ru ns into a molecule of B in just the right orientation, and with the right amount of energy, to react and form the new molecule. We can conceptualize activation e nergy as the difficulty in getting A and B together perfectly so the reaction can proceed. How might an enzyme lower this activation energy? By making it easier for A and B to find each Chapter 3, Bioenergetics, v. 1.01 Sep09 Enzyme Classification Enzymes have been catalogued and classified since the 1950s , during which time there was an explosion of enzyme discoveries and a need for a unified nomenclature and catalog. An International Commission on Enzymes was e stablished (yes, of course Im serious, why do you ask?) and thus started the Enzy me List. This list is now kept up-to-date online at http://www.chem.qmul.ac.uk/ iubmb/enzyme. All enzymes now have both recommended names for common usage, ofte n reflecting historical naming, and a systematic name, which is highly specific. They also have a classification number based on their activity. The major class es of enzymes are (1) Oxidoreductases, which carry out oxidation-reduction react ions, (2) Transferases, which transfer functional groups, (3) Hydrolases, which carry out hydrolysis reactions, (4) Lyases, which eliminate groups to form doubl e bonds, (5) Isomerases, which rearrange the bonds in a molecule but do not add or remove atoms, and (6) Ligases, which form bonds in reactions coupled to ATP h ydrolysis. As an example, NA ligase (recommended name) catalyzes the formation of a phosphodiester bond between the 3 end of one NA fragment and the 5 end of an other. Its rather long and tedious systematic name is poly(deoxyribonucleotide):p oly(deoxyr ibonucleotide) ligase (AMP-forming) and its classification number is 6 .5.1.1. As a ligase, it is class 6; because it forms phosphoric ester bonds, it is subclass 5; the sub-subclass of 1 in this case is meaningless because it is t

he only sub-subclass of phosphoricester bond-forming ligases, but the final numb er designates the NA ligase separately from other 6.5.1 enzymes such as RNA lig ase, which is 6.5.1.3. Page 28

other with the right orientation and energy. So it could have binding sites for molecule A and molecule B, and once it has bound these two molecules, it changes its conformation, bringing A and B together under exactly the right conditions to react and form C. Once the reaction is complete, the product floats off becau se the enzyme has no affinity for it, and the enzyme returns to its initial shap e, ready to bind more substrates. A B C Enzymes may also facilitate a chemical reaction by acting as a temporary holding site for an active group being transferred from one substrate to another. Alter natively, temporary formation of hydrogen bonds or even covalent bonds between t he enzyme and substrate can alter chemical characteristics of the substrate to m ake it react more easily. An example of enzyme mechanisms on the molecular level is shown in Chapter 5: Figure 1. A wrong orientation B X X C A too little/too much energy B C A B Enzyme C Figure 3. Enzymes can lower activation energy by binding substrates individually and bringing them together under optimal conditions to react. Another example may be found with enzymes that break apart a molecule (figure 4) . In order for a molecule to break apart, it may need to collide with another mo lecule with sufficient energy to break one or more of its covalent bonds. An enz yme that catalyzes A Substrate B C Enzyme Enzyme C

Products Enzyme Enzyme Figure 4. The enzyme (A) binds a specific substrate, leading to a conformational change (B) that stresses the molecule (C) until it breaks down into two smaller component molecules ( ), which are released. the breakdown reaction might bind to the molecule, and in binding it, undergoes a conformational shift that bends or twists the molecule in such a way that the bonds in the substrate molecule are weakened or broken. These two examples overs implify the chemistry of enzyme activity into a mechanical idea, but the general relationship in how an enzyme lowers activation energy for a reaction is accura te. Chapter 3, Bioenergetics, v. 1.01 Sep09 Page 29

Vmax Initial reaction velocity (v) Enzyme-catalyzed Vmax 2 Non-enzyme-catalyzed Km Substrate concentration [S] Figure 5. Saturation curve for a single-substrate enzyme-catalyzed reaction. Enzyme Kinetics Unlike uncatalyzed (but readily occurring) reactions, in which the rate of the r eaction is dependent only on the concentration of the reactants, the rate of enz yme-catalyzed reactions is limited by the number of enzyme molecules available. This maximal rate of turnover from substrate to product is a function of the spe ed of the enzyme and the number of enzyme molecules. Vmax, this theoretical maxi mal rate or reaction, is approached when there is such a high concentration of s ubstrate molecules that not only is every available enzyme at a given time occup ied, but as soon as an enzyme finishes converting substrate to product, it immed iately binds a new substrate. Another term, Km, is related to Vmax in that Km (t he Michaelis constant) is the concentration of substrate at which half-maximal r eaction rate (Vmax/2)occurs. These two terms are related in the Michaelis-Menten equation, which describes the reaction rate v with respect to the substrate con centration [S]. v= Vmax [S] KM + [S] k The Michaelis-Menten equation was derived by Leonor Michaelis and his graduate s tudent Maud Menten in 1913, based on work by Victor Henri, and is applicable onl y to simple enzyme kinetics in which there is only one substrate that is changed immediately to a product during the reaction without forming any intermediate c ompound, the enzyme in question shows no allostericity, and the reaction is unid irectional. It should be noted that the reaction rate v is actually the initial reaction rate at a particular substrate concentration, and is sometimes denoted vo. Naturally, as the reaction continues, the substrate concentration decreases, along with the reaction rate. Figure 6. Michaelis-Menten Equation The Michaelis-Menten equation assumes a simple reaction of the form: k3 E + S k1 ES E + P 2 where E is an enzyme, S is the substrate, and P is the product. Note the formati on of the intermediate enzyme-substrate complex, ES, which is a transition state (recall fig. 2) in which the substrate is unstable and associated with the enzy me. In fact, ES could as Chapter 3, Bioenergetics, v. 1.01 Sep09 Page 30

easily be considered EP, since this state is essentially the tipping point betwe en the conversion from substrate to product. In this construction, the Michaelis constant, KM, of an enzyme-catalyzed reaction is (k2 + k3) / k1. That is the ra te of ES dissociation over the rate of ES association. KM, of course, varies not only depending on the enzyme, but also with respect to the identity of the subs trate. Some enzymes can work with multiple substrates, and the KM of that enzyme for the different substrates is usually different. Because the saturation curve in Fig. 5 can be difficult to work with, linearizations of the Michaelis-Menten equation were developed. The most common is the double reciprocal plot, better known as the Lineweaver-Burk plot. On this type of graphical representation of e nzyme kinetics, the reciprocal of the substrate concentration is plotted against the reciprocal of the reaction velocity. This generates a line in which the x-i ntercept is then -1/Km, the y-intercept is 1/Vmax, and the slope of the line is Km/Vmax. Obtaining Vmax and Km from a direct plot of v against [S] can be difficult becau se even at very high substrate concentrations, experimental data may still be si gnificantly under the Vmax. This leads to underestimation of the Vmax. The Linew eaver-Burk plot addresses this concern, but has some shortcomings of its own. Be cause it is easier to obtain data at high concentrations, most of the data point s are near 0, and fewer data points are available further out (to the right of t he graph). Because these are reciprocals, under these low [S] conditions, small errors in measured values of v turn into large errors in 1/v, and therefore larg e errors in KM and Vmax. This is evident on examination of the Lineweaver-Burk e quation: 1 1 + = v V max [ S ] V max 1 KM Figure 8. Lineweaver-Burk Equation Noncompetitive inhibition 1 V Competitive inhibition Uninhibited enzyme 1 Vmax -1 Km 1 [S] Figure 7. Lineweaver-Burk plot of enzyme kinetics and the effect of competitive and non-competitive inhibitors at constant concentrations. Regulation of Enzyme Activity Figure 7 (and 9) also illustrates the effects of two different types of inhibiti on on the different components of enzyme kinetics. Enzymes can be slowed down or even prevented from catalyzing reactions in many ways including preventing the substrate from entering the active site or preventing the enzyme from altering c onformation to catalyze the reaction. The inhibitors that do this can do so eith er reversibly or irreversibly. The irreversible inhibitors are also called inact ivators, and either bind to the enzyme with such high affinity as to be virtuall y irreversible, or they actually form covalent bonds with the enzyme. Reversible inhibitors are generally grouped into two basic types: competitive and non-comp etitive. Finasteride (trade names include Propecia and Proscar) is an irreversib le inhibitor that binds very tightly to the enzyme 5-a-reductase, used in conver ting testosterone to dihydrotestosterone. It is used in the treatment of male pa ttern baldness, benign prostatic hyperplasia, and prostate cancer. Aspirin is an example of an irreversible inhibitor that actually forms a covalent bond with t he enzyme. The aspirin (acetylsalicylic acid) transfers its acetyl group onto a serine residue on cyclooxygenase-2 (COX-2). This stops the production of inflamm ation-producing prostaglandins and thromboxanes by COX-2. Page 31 Chapter 3, Bioenergetics, v. 1.01 Sep09

Competitive inhibition is perhaps the simplest to understand. The inhibitor mole cule competes directly with the substrate for the active site of an unbound enzy me. If an inhibitor binds to the active site, the substrate is unable to do so u ntil the inhibitor has vacated the site. Thus, one could potentially overwhelm c ompetitive inhibition with sufficiently larger concentrations of substrate so th at the probablility that the enzyme bumps into a substrate to bind becomes excee ding large compared to the probablility of bumping into an inhibitor. Normal, un inhibited Vmax is then achieved despite the presence of the competitive inhibito r, which has only affected the Km, that is, the concentration of substrate neede d to reach Vmax/2. This is the kinetic signature of competitive inhibitors: with increasing inhibitor concentrations, KM is increased but Vmax is unaffected. Methotrexate is a competitive inhibitor of dihydrofolate reductase ( HFR), an en zyme that synthesizes tetrahydrofolate, which is a precursor for purine synthesi s, and therefore for NA and RNA. It has a very similar molecular structure for folic acid, the natural substrate of HFR. Methotrexate is used as an anti-cance r drug because it affects rapidly reproducing cells (which need to make NA soon er than other cells) more than non-cancerous cells. Vmax(E) , Vmax(C) Initial reaction velocity (v) Uninhibited enzyme Competitive inhibition Vmax(E) Vmax(C) 2 2 , Vmax(N) Vmax(N) 2 Noncompetitive inhibition Km(E) Km(C) Km(N) Substrate concentration [S] Figure 9. Saturation curves for enzyme-catalyzed reactions without inhibitor (re d) with competitive inhibitor (blue) at a constant concentration, and with nonco mpetitive inhibitor (green) at a constant concentration. Non-competitive inhibition involves inhibiting the enzyme by altering its abilit y to complete the catalyzed reaction through binding of the enzyme at a position that is not the active site. When the inhibitor binds to the enzyme, it causes a change, usually conformational, that may either prevent the enzyme from bindin g the substrate, or prevent the enzyme from acting upon a bound substrate. In ei ther case, increasing the availability of substrate will not ultimately overcome the effect of the inhibitor. Thus, Vmax is reduced because some proportion of t he enzymes are no longer usable, but because the enzymes that are available have the same access to substrate as it would without inhibitor (that is, it is not in competition with an inhibitor), the Km is not affected. Non-competitive regul ation is one example of allosteric regulation of enzymes. Allosteric interaction s occur when the binding of a ligand (not necessarily a substrate) to a protein influences the binding of another ligand to the protein at a separate binding Chapter 3, Bioenergetics, v. 1.01 Sep09 Many of the enzymes in metabolic pathways (chapters 5 and 6) are regulated by a naturally occurring non-competitive inhibitor. One example is phosphofructokinas

e (PFK), which is involved in glycolysis, which produces ATP for the cell. Howev er, if there are high enough levels of ATP in the cell that other cellular proce sses arent using, the it can bind to phosphofructokinase outside of its active si te (it binds fructose-6-phosphate), and turn it off. This blocks glycolysis and production of excess ATP when the cell does not need it. As ATP is used up, ther e is less available to inhibit PFK, and glycolysis starts back up. There are two models for allosteric interactions. The symmetry model, also known as the conce rted model, or MWC model (Monod, Wyman, and Changeux, 1965), proposes that the a llosteric enzyme is an oligomer of several subunits, each of which are symmetric ally related, and can be in either a tensed or relaxed state, but all of the subunit s are in the same state and at equilibrium. When a ligand binds, it changes the state of the subunit(s) to which it binds, and to maintain equilibrium, that in turn causes the state of the other subunits to match, thus altering binding prop erties for a subsequent ligand. The sequential model, or the KNF model (Koshland , Nemethy, and Filmer, 1966), proposes Page 32

site. These kinds of interactions can be either positive (activating) or negativ e (inhibitory), and either homotropic (both ligands are identical) or heterotrop ic (ligands are different). Interestingly, sometimes the regulator ligand may ac tually be a product of the catalyzed reaction. In this kind of feedback mechanis m, the progress of a reaction is self-regulating. 1 2 Product released 1 2 Product released Active site Enzyme Allosteric site Enzyme Active site Enzyme Allosteric site Enzyme 3 Increasing product concentration Increasing product concentration 3 = Reactants = Product Enzyme = Reactants = Product Change in conformation Enzyme something quite different: although it also supposes subunits in either tensed o r relaxed states, it does not require all subunits to be connected in such a way as to mandate that all subunits be in the same state, and therefore conformatio nal changes in one subunit need not be propagated to all. Instead, using an indu cedfit model of ligand binding rather than the more rigid basic lock and key mec hanism, it suggests that when a ligand binds to the enzyme, it induces a slight conformational change in the active site that increases its affinity for the lig and. The conformational change may slightly alter the conformation of other subu nits of the enzyme, but may not constitute a state change between relaxed and te nsed depending on how tightly the subunits are interacting. However, the change is enough to increase substrate affinity in adjacent subunits. Negative feedback by allosteric binding leading to decreased enzyme activity Figure 10. Feedback control loops. (Left) Negative feedback is a common biologic al mechanism for self-regulating processes. The product of the reaction, either

by itself or inconjunction with other molecules, acts as an allosteric inhibitor of the enzyme. (Right) Positive feedback is less common because it can lead to rapid expansion of the scope of a reaction, and requires an external (relative t o the enzymatic reaction) mechanism for slowing or stopping the reaction. While important, especially pharmaceutically, the use of enzyme inhibitors is no t the only way to regulate enzymes. There are numerous examples of one type of e nzyme activating or inhibiting another. The most common general example are the protein kinases. These enzymes phosphorylate (transfer phosphate group to) other enzymes and thereby activate them. Kinases are generally fast and very specific , and this is an efficient method for activating large numbers of particular enz ymes quickly. Conversely, protein phosphatases are enzymes (also quite fast, but much less specific than kinases) that remove the phosphate groups from phosphor ylated proteins, thereby turning off those enzymes. Keep in mind that this is a generalization, and that not all phosphorylations are activating. In addition to enzymatic inhibition of enzymes, there is also inhibition by binding and seques tration of the substrates. In fact, the antibiotic vancomycin works just this wa y, binding to the substrate peptide for transpeptidase and preventing the enzyme from recognizing it. Transpeptidase normally helps stabilize the cell wall of c ertain bacteria by altering some of the proteins, and without its activity, the protection of the cell wall is compromised and the bacteria may be more easily k illed. Chapter 3, Bioenergetics, v. 1.01 Sep09 X Positive feedback by allosteric binding leading to increased enzyme activity Most cell/molec courses stop the discussion of enzyme inhibitors at competitive vs non-competitive based on their kinetic profiles. However, it should be noted that if you take a biochemistry course, you may encounter the terms uncompetitiv e inhibitor and mixed inhibitor. These terms are defined not just by the enzyme kinetics, but the mechanism of interaction: Uncompetitive inhibitors bind only t o the enzyme-substrate (ES) complex, and not to the enzyme before it has encount ered substrate. This leads to decreased Vmax and decreased Km. Mixed inhibition means that the inhibitor can bind to either enzyme alone or the enzyme-substrate complex. Because the affinities of the inhibitor for the two forms of the enzym e are different, and because part of it depends on substrate concentration while the other kind of binding does not, generally, Vmax decreases and Km increases. Non-competitive inhibition is a special case of mixed inhibition in which the c atalytic activity of the enzyme is diminished or abolished, but the ability to b ind substrate is unaltered. Page 33

The activity of enzymes is greatly influenced by both pH and temperature, as exp ected from the discussion of protein structure in the previous chapter. Activity profiles of most enzymes shows a peak of activity that tails off on either side , whether it is pH or temperature. This is an innate characteristic of the enzym e. For example, pepsin, a digestive enzyme secreted into the stomach (pH 2) does not function when the pH > 5. On the other hand, another digestive enzyme, tryp sin, which is secreted into the duodenum (proximal small intestine) where the pH is ~8, does not work in acidic environments. Changes in pH can change ionizatio n of amino acid side chains that can thereby alter interaction with the substrat e, or lead to changes in tertiary structure. Well over half of the enzymes discovered so far do not act in the simplistic Mic haelis-Menten one-substrate-one-product mechanism, but rather operate with two s ubstrates and two products, usually with the transfer of an active group. These types of reactions are sometimes known as Bi Bi reactions. There are two major c lasses of these reactions: the sequential reactions, in which all substrates bin d with the enzyme before the reaction proceeds, and the ping pong reactions, in which one or more products are created and released before all of the substrates have been bound. In fact, unlike sequential reactions, the two substrates do no t interact with one another while bound to the enzyme. Figure 11. pH dependence of enzymatic activity. This graph depicts three hypothe tical enzymes with acidic, neutral, and basic pH optima. Similarly, at suboptimal temperatures, the likelihood of protein-substrate inter action is low but above the optimal temperature, the increased energy can lead t o breaking of hydrogen bonds within the structure of the enzyme, resulting in ch anges that inactivate the catalytic ability of enzyme or prevent it from binding substrate with sufficient affinity. The temperature optimum of most enzymes is very close to its typical environment. Thus, a human enzyme would operate optima lly around 37C, while an enzyme from bacteria that live in deep-sea volcanic vent s (e.g. Thermophilus aquaticus) might have temperature optima over 90C. This is o ne of the reasons that refrigeration can slow down growth of microorganisms (whi ch obviously have no ability to regulate their temperature), and why most microo rganisms are killed (enzymes permanently denatured) when put into sustained high temperature environments. Interestingly, the NA polymerase from the T. aquatic us bacteria, also commonly called Taq polymerase, is used in a rapid NA-amplify ing lab technique known as PCR (polymerase chain reaction, see Methods chapter) in which samples are repeatedly heated to high temperatures to separate NA stra nds in preparation for making copies of them. NA polymerases from most prokaryo tic or eukaryotic species would be denatured and inactivated by the high heat, b ut Taq has evolved (with respect to its tertiary structure) for extraordinary st ructural stability even in heat extremes. Chapter 3, Bioenergetics, v. 1.01 Sep09 Page 34

Finally, many enzymes require a molecular partner that has no catalytic activity of its own, but like a catalyst, is not permanently altered by the chemical rea ction. These molecules are cofactors. Some are simple: elemental, in fact, inclu ding metal ions such as Zn++ or Ca++. Others are slightly more complex: small or ganic cofactors are called coenzymes, and accomplish the same thing, acting as a required partner to the enzyme in catalyzing a reaction. The interaction with t he enzyme itself varies and may be only transient, as in NA +/NA H which are coe nzymes used in redox reactions, or permanently bound to the enzyme by covalent b ond like the heme group of hemoglobin. Often the function of the coenzyme is to provide an active group to facilitate the catalyzed reaction. Coenzyme A, in var ious metabolic pathways such as glycolysis or the tricarboxylic acid cycle, can be bound to a substrate to form a stable product that then acts as an intermedia te. The Co-A is released from the molecule as it undergoes the next step in a se ries of reactions in the metabolic pathway (see Chapter 5). From a human health standpoint, it is interesting to note that many coenzymes are vitamins, or deriv ed from vitamins. These are the B vitamins biotin (B7), cobalamin (B12), folic a cid (B3), niacin/nicotinamide (B9), pantothenic acid (B5), pyridoxine (B6), ribo flavin (B2), and thiamine (B1). Vitamins are small organic compounds that are no t synthesized by an organism and must therefore be ingested. They are generally needed only in small quanitities, but necessary nonetheless. Naturally, the vita mins we are familiar with are those required by humans. The specific roles of th ese vitamins and the consequences of not having enough of them are discussed lat er in this textbook, as the enzymes that they work with are introduced in detail . Chapter 3, Bioenergetics, v. 1.01 Sep09 Page 35

Membranes: Structure, Physical and Chemical Properties, and Function Biological membranes are the basis for many important properties of the cell, no t the least of which is to physically define the cell boundary, and in eukaryote s, the boundaries of each intracellular organelle. However, they are not complet ely impermeable boundaries, and through embedded proteins, the membrane serves a s the gatekeeper for the passage of specific molecules into (e.g. nutrients) and out of (e.g. waste) the cell. Other embedded proteins can identify the cell to other cells, and participate in numerous interactions with the environment or ot her cells. Finally, the membrane, or more precisely, the chemical gradients acro ss the membrane, is an important energy source for the cell. Using this book: This book is designed to be used in both introductory and advan ced cell biology courses. The primary text is generally on the left side of the vertical divider, and printed in black. etails that are usually left to an adva nced course are printed in blue and found on the right side of the divider. Fina lly, additional biomedically relevant information can be found in red print on e ither side of the divider. Membrane Structure and Composition Since most cells live in an aqueous environment and the contents of the cell are also mostly aqueous, it stands to reason that a membrane that separates one sid e from the other must be hydrophobic to form an effective barrier against accide ntal leakage of materials or water. In the earlier chapter on the basic biomolec ules, cellular membranes were partially defined as being composed primarily of p hospholipids: molecules consisting of a phosphorylated polar head group attached to a glycerol backbone that has two long hydrocarbon tails. The composition of the hydrocarbons can vary in length and degree of saturation, and there is also variation in the head groups. It is also important to remember that although we concentrate on the phospholipids as the primary components of the membrane, ther e are other significant parts: other lipids, including cholesterol, integral and peripheral membrane proteins, and glycosylated lipids and proteins. Because the phospholipids are amphipathic, meaning they have a hydrophilic head and hydroph obic tail, the simplest conformation for a small group of phospholipids in aqueo us solution might be expected to be a micelle (fig. 1A), but is this actually th e case? Mixtures of hydrophobic molecules and water are thermodynamically unstab le, so this structure would protect the hydrophobic fatty acyl tails from the aq ueous environment with which the head groups interact. Micelles can form with ot her amphipathic lipids, the most recognizable being detergents such as S S (sodi um dodecyl sulfate, also called Chapter 4, Membranes, v. 1.2 Page 36

sodium lauryl sulfate), used in common household products such as shampoos. The detergents act by surrounding hydrophobic dirt (1B) and holding it in solution w ithin the micelle to be rinsed away with the water. At smaller sizes, the micell e is fairly stable; however, when there are a large number of phospholipids, the space inside the micelle becomes larger and can trap water in direct contact wi th the hydrophobic tails (1C). This renders the micelle unstable, so a large sin gle layer of phospholipid is unlikely to serve stably as a biological membrane. Micelles form easily with S S and other singletailed lipids because their overal l shape (van der Waals envelope) is conical (1 ), which lends itself to fitting tight curvatures. However, phospholipids are more cylindrical, and it is harder to fit them into a tight spherical micelle. If they do form micelles, they tend to be larger, and likely to collapse. Figure 1. A B C Just as overly large micelles will be unstable, there is also a minimal concentr ation of lipid needed for a micelle to form. This is known as the critical micel le concentration (cmc) and is a property of each particular lipid. Below the cmc , there are not enough amphipathic lipids to mutually shield their hydrophobic t ails from the water, and the more likely position of the lipids is on the surfac e of the aqueous solution, hydrophilic heads in contact, with the hydrophobic ta ils in the air. Liposomes are artificial spherical bilayers (Fig.2) that are use d both in research for study of both membrane lipids and integral membrane prote ins. They are also used to deliver drugs and other macromolecules into cells for either research of therapeutic purposes. A common method for getting NA, a lar ge molecule that is not normally transported into cells, into a cell is called l ipofection. This technique involves creating liposomes within a solution contain ing the NA of interest. This traps the NA into the liposome, which can then be applied to cells. The liposomes then fuse with the plasma membrane and deliver the NA into the cell. Another technique for introducing foreign NA into a cell is electroporation, which illustrates the self-sealing property of the phosphol ipid bilayer (figure 3). The cell (usually thousands of cells, actually) is plac ed in a NA solution and subjected to an electric current. This transiently pull s on the cell membrane in all directions, causing many small holes to open up. NA then moves into the cell, and the holes spontaneously heal. Of course, the pr ocess is not perfect, and due to variations in the cells and in the electric fie ld, some cells will be unable to reseal the holes, or for other reasons may not survive the process. Figure 3. unstable ? On the other hand, a phospholipid bilayer (figure 2A) could form a fatty acyl sa ndwich in which the polar head groups face outward to interact with an aqueous e nvironment, and the fatty acids are sequestered in between. However, this does n ot resolve the problem on the edges of the sandwich. Sometimes, a collapsed mice lle can form a closed bilayer in which the edges appear to be sealed, but due to the shape of the phospholipids, there is poor contact between acyl chains. Such a tight bend is unstable and the edge phospholipids are likely to break apart f rom one another. So, the solution to the ideal phospholipid structure in an aque ous environment is a spherical phospholipid bilayer (2B and cutaway in 2C) : no edges mean no exposed hydrophobicity. Figure 2. A B C

Chapter 4, Membranes, v. 1.2 Page 37

The stability of the spherical phospholipid bilayer does not imply that it is st atic in its physical properties. In most physiologically relevant conditions, th e membrane is cohesive, but fluid. It can mold its surface to the contours of wh atever it is resting on, and the same thermodynamic and hydrophobic properties t hat make it so stable also allow it to seal up minor tears spontaneously. Mainta ining a working range of fluidity is important to the cell: if the membrane is t oo rigid, then it may be unable to move or undergo necessary processes such as e ndocytosis, in which a cell takes up large extracellular molecules by enveloping them with the cell membrane and pinching it off in a vesicle; while if it becom es too fluid, it may lose integrity and fall apart. There are three major factor s that govern the fluidity of the membrane: (1) degree of saturation of the fatt y acyl chains, (2) the temperature, and (3) the concentration of cholesterol. Fu lly saturated fatty acyl chains can rotate freely around any bond and therefore can pack together very tightly, thus decreasing membrane fluidity. As more unsat urated fatty acyl chains are introduced into the membrane, the more space there is between some of the fatty acyl tails, and there is an increase in fluidity. S imilarly at higher temperatures, even saturated fatty acyl chains, with their in creased energy, move more and create more space between the chains, also increas ing fluidity. Finally, cholesterol, as a small planar lipid molecule, can interc alate between the fatty acyl tails. Interestingly, in normal physiological tempe ratures, the effect of cholesterol is dependent on its concentration. At normal concentrations, the cholesterol restricts acyl tail movement and decreases fluid ity. However at very low concentrations, cholesterol has the opposite effect, se parating the hydrophobic tails and slightly increasing fluidity, especially in t he innermost regions of the membrane. [In case you were wondering, human medical problems with cholesterol are unrelated to the cholesterol in the cell membrane s, and refers to cholesterol (bound to lipoprotein carriers) in the bloodstream. That cholesterol can build up in the blood vessels, decreasing the internal dia meter and along with it, blood flow. When this happens to the heart, which uses a lot of oxygen, the oxygen deprivation can cause necrosis and a heart attack.] In addition to the three factors noted above, phospholipid composition can also alter membrane fluidity: shorter acyl chains lead to greater fluidity, while lon ger chains, with more surface area for interaction, generate membranes with high er viscosity. The phospholipid composition of biological membranes is dynamic an d can vary widely. The table below shows the differences in the ratios of major phospholipid species phosphatidylcholine (PC), phosphatidylethanolamine (PE), ph osphatidylserine (PS), and sphingomyelin (SM) in plasma membranes from two diffe rent cell types. As you might expect based on their differing functions, the rat ios of plasma membrane lipids of a myelinating Schwann cell are very different f rom the lipids in the plasma membrane of a red blood cell. Chapter 4, Membranes, v. 1.2 H3C CH3 CH3 CH3 CH3 HO Cholesterol Figure 4. Cholesterol is a small planar molecule that can fit in between the fat ty acyl tails of phospholipids in the membrane. The effect of cholesterol is actually a little more complicated than explained t o the left. Cholesterol is not only planar but rigid, and it intercalates close between acyl tails near the head region. Because cholesterol is somewhat shorter than many acyl tails, while the parts of the hydrocarbon chains nearer the head groups are stabilized and restricted in movement, the cholesterol actually acts as a spacer for the other (methyl) end of each chain, so in the center domain o f the hydrophobic core of the bilayer, there is actually increased fluidity arou

nd cholesterols. Cholesterol concentration varies greatly among organelles of th e same cell, and can even be dynamically regulated in response to temperature ch anges. Membrane samples taken from fish living in warmer temperatures contain mo re cholesterol than samples from the same species acclimatized to a lower temper ature. H3C H H C O H H O P OH O C H C H C H H H H C O H H O P OH O C H C H C H H H C H OO O P OH O C H C H C H H3C H H C O H H O P OH O C H C H C H O C C H H O O O C C O H H O O O C C O H O O O C C O PC: H3C N+ C H3C PE: H N+ C H H N+ H C O PS: C SM: H3C N+ C H3C NH C H HO Figure 5. The molecular structures of phosphatidylcholine (PC), phosphatidyletha nolamine (PE), phosphatidylserine (PS), and sphingomyelin (SM). The acyl chains of all four molecules are of variable length except the 13-C chain of SM. Page 38

Lipid Schwann Cell PM Phosphatidylcholine 44% Phosphatidylethanolamine 14% Phosp hatidylserine 3% Sphingomyelin 29% Erythrocyte PM 19% 18% 8% 17% Even within a single cell, the composition of the plasma membrane differs from t hat of intracellular organelles. There is even heterogeneity within a membrane i tself the lipids are not simply distributed randomly in the membrane. Research o ver the last two decades have identified lipid rafts that appear to be specific fo r embedding particular proteins. Since they are unanchored lipids, the rafts can move laterally within the membrane just like most individual lipid molecules. F inally, there are different ratios of the lipids between the two layers of the b ilayer. The cytoplasmic face of every membrane will have different associations and functions than the noncytoplasmic face, so why should we expect the lipid co mposition to be the same? Although some phospholipids are directly linked to pro teins and the cytoskeleton, most are not, and are therefore free to move within the plane of its layer of the bilayer. In the experiment shown in figure 6 below , the cell surface has been labeled with a covalently bound dye that fluoresces red when excited by green light. When the dye molecules are exposed to high inte nsity light for an extended period, they no longer fluoresce, a phenomenon known as photobleaching. Photobleaching is a permanent effect, and therefore it can b e inferred that if a photobleached spot fluoresces again, then other, non-bleach ed, phospholipids must have moved into the spot. This experiment clearly proves the lateral mobility of phospholipids in a membrane. Figure 6. (A) photobleaching experiments can demonstrate lateral mobility of lip ids in a bilayer. But, transverse mobility is severely limited and is usually fa cilitated by a flippase enzyme (B). A 1 Though lipid rafts were considered a possibility in the fluid-mosaic membrane mo del proposed by Singer and Nicholson in 1972, only in the last two decades has t he idea been researched seriously, but there have been technical difficulties wi th visualizing a small domain of lipids within a virtual ocean of lipids. In bro ad terms, the rafts are considered small areas of ordered lipids within a larger undirected membrane. Lipid rafts most often form in association with specific m embrane proteins while excluding others. Some of the proteins are peripheral mem brane proteins such as src or the GPI-linked adhesion molecule Thy-1, while othe rs are transmembrane proteins such as the T-cell receptor. Usually the included proteins have signaling-related functions, and one model proposes that these pro teins may direct the organization of selected lipids around them, rather than th e other way around. LASER 2 B Flippase 3 4 ATP A P + Pi However, this is not the case with transverse mobility from one face of the memb rane to the other. ue to the highly unfavorable energetics of pushing a polar h ead group through the lipid tail layers, phospholipids very rarely move from one layer to the other within a membrane (fig. 6B, far right yellow phospholipid). Such movement is greatly facilitated by a flippase enzyme, which hydrolyzes a mo lecule of ATP for the energy to push a phospholipid from one face of the bilayer to the other.

For over a century since Meyer (1899) and Overton (1901) first suggested it, the prevailing theory for the mechanism of gaseous general anesthesia (e.g. ethyl e ther, halothane, nitrous oxide, cyclopropane) has been that they partition into and interact with the lipids of the plasma membranes of neurons and by altering the physical membrane properties accomplish the anesthesia. However, in 1985, Fr anks and Lieb published a report in Nature that, for the first time, showed that an enzyme could be directly affected by a gaseous anesthetic. Since that report , the evidence has been building against the old model of altering membrane lipi d properties, and now the current model of direct gas-protein interaction is ass umed. Page 39 Chapter 4, Membranes, v. 1.2

In a pure phospholipid bilayer, membrane proteins as well as lipids have lateral mobility, but in living cells, the proteins are generally constrained either by preferential association with certain kinds of lipids, by direct attachment to cytoskeletal elements, by indirect attachment to the cytoskeleton, or by being fe nced in by cytoskeletal gridwork directly underlying the cell membrane. Since 197 2, the Singer-Nicholson fluid mosaic model of membrane structure has been accepted as a general model for biological membranes. It proposes that integral membrane proteins as well as membrane lipids have lateral freedom of movement. This has since been refined with the recognition of lipid rafts and clustered membrane pr otein patches, but is still viable as a basic model. Membrane Permeability A pure phospholipid bilayer, whatever the lipid composition, is a semi-permeable membrane that is generally repellent to large molecules and to ions. Small pola r molecules can sometimes pass easily (e.g. ethanol), but more often pass at low rates if at all (e.g. water). However, small nonpolar molecules are able to pas s through the membrane with relative ease. The reasons should be self-evident: l arger molecules simply cannot fit between the lipid molecules to make their way through. Small molecules Large Molecules Ions Na+ Sucrose Small Nonpolar Molecules N2 Small Polar Molecules H2O Ethanol Figure 7. A pure phospholipid bilayer is inherently semi-permeable. that can fit must be hydrophobic, otherwise the fatty acyl core of the membrane will repel them and block them from proceeding. Higher concentrations of cholest erol, by filling in gaps between phospholipid tails, decreases permeability even for small molecules that can normally pass through the membrane easily. Cells n eed far more than small nonpolar molecules for their material and energy require ments. Fortunately for life on earth, the membranes of living cells are not pure ly phospholipids, and as we will see, proteins embedded in the phospholipid bila yer can form conveyances for the transport of many different molecules in and ou t of the membrane. In fact, the observation of saturation kinetics in glucose transport in erythroc yte membranes was the first indication of proteinmediated transport (the GLUT1 g lucose transporter). Another telling observation was the finding that glucose pe rmeability through erythrocyte membranes is a million times greater than that th rough an artificial lipid bilayer. The concentration of glucose in the blood is relatively high compared to that inside of most cells, so this is mediated trans port, but passive transport since it is going down the concentration gradient. T o facilitate the process by preventing a buildup of glucose concentration in the cell, the first step of glucose metabolism is phosphorylation to convert it int o a different molecule, glucose-6-phosphate. Thus the concentration of glucose s tays very low, and it flows readily from the bloodstream into the cell. Page 40 Chapter 4, Membranes, v. 1.2

There are some obvious differences between transport of molecules directly throu gh the lipid bilayer (nonmediated transport) and transport using a protein facil itator embedded in the membrane (mediated transport). Nonmediated transport is g overned by diffusion: the solute moves from areas of high concentration to areas of low concentration, thereby eliminating the gradient. As long as a solute (A) can get through the membrane, its flux (J) is determined solely by concentratio n difference and the permeability (P) of the membrane: JA = PA ([A]out - [A]in) and the relationship between the flux across the membrane and the concentration differential is linear. This is not the case in mediated transport. As the name implies, a protein intermediary is required, and alarm bells should be going off in your head saying, theres a limit, to the number of available transport proteins at any given time. Therefore, just as we saw with enzyme kinetics in chapter 3, the flux of solutes going through a transporter is not linearly related to the concentration differential across the membrane, though there is still a concentr ation effect. Instead, the relationship is logarithmic, reaching a saturation pl ateau once all the available transport proteins are in use. At that point, incre asing the concentration of the solute will not increase its flux across the memb rane. Thus for simple unidirectional mediated transport of a solute (B), the flu x (J) can be expressed as a value of the affinity of the transporter for the sol ute (KM) and the concentration of the solute: JB = (Jmax[B])/(KM + [B]) Membrane permeability allows for the possibility of concentration gradients across membr anes, which in turn have potential energy associated with the concentration diff erential across the membrane. This turns out to be a phenomenally important sour ce of cellular energy, and is the basis for aerobic synthesis of ATP by oxidativ e phosphorylation (chapter 5). However, to have a meaningful discussion of how c oncentration differences across semipermeable membranes store energy, we should review some basic concepts first. If a point source (e.g. a glob) of a solute (e.g . honey) is placed into a solvent (e.g. tea), it starts to dissolve, and as it d oes so, the concentration of solute near the point source will start out much hi gher than the concentration towards the periphery of the container (e.g. teacup) . Over time, the solute then diffuses from the point source outward in all avail able directions, and eventually the concentration of solute is equal at any poin t in teacup-space. This behavior is governed by the Second Law of Thermodynamics . The solute is initially concentrated, which means that its constituent molecul es are relatively organized. By the second law, these molecules will tend toward chaos, moving away from the constraints of the initial point toward an area wit h lower concentrations of the solute. Chapter 4, Membranes, v. 1.2 In case you have already forgotten and are too lazy to flip back to chapter 3 to check, this is the law that states that the entropy of the universe (or any clo sed system) tends toward maximum. Page 41

Now, imagine a temporary wall around the point source. The natural tendency is f or the solutes to spread out, so by preventing that movement, you have bottled u p some potential energy. Of course, this is only potential energy if there is so me chance that the solutes can eventually go through the barrier (e.g. the wall has windows that can be opened). If the solutes have absolutely zero chance of p assing through, then there is no potential energy because there is no potential to get out and about. Recalling the Energy chapter in which the second law was i ntroduced, the chemical potential energy of a solute is G=RT ln[A]+G, so the chem ical potential difference across a membrane is then G= RT ln([Ai]/[Ao]). Now im agine this as something like a hydroelectric dam, where there is a great deal of pressure building up behind the dam, which can be utilized when some of the wat er is allowed through, powering turbines that generate electricity. In the biolo gical case, there is concentration pressure building up both inside and outside the cell because the natural thermodynamic tendency is to bring the inside and o utside concentrations of each solute to equilibrium. When this pressure is relea sed by allowing the ions or other molecules to flow across the membrane, energy is released, and may be captured and used. The most direct example of this the p roton-gradient-driven ATP synthase in the inner mitochondrial membrane (see Chap ter 5, Metabolism), which contains a direct molecular equivalent to the turning of a water wheel with the flow of water. For another example, if we look at [Na+ ] in an animal cell, the extracellular concentration is much higher than that in tracellularly. When a Na+ channel is opened, the Na+ ions rush inward to try to equalize the concentration of Na+ inside and outside of the cell. Equilibrium is not actually reached in a living cell because Na+ channels are tightly regulate d and only open for short periods of time. In cells, concentration gradients of ions are great energy sources because the lipid part of the membrane is strongly repellent to ions, preventing them from passing through, but the membrane is em bedded with channels and transporters that can allow the ions through if and whe n they are open. Because ions have both concentration differentials and charge d ifferentials across the membrane, the electrochemical potential difference acros s the membrane is represented by a modification of the chemical potential differ ence equation with a term that takes that electrical charge into account: G=RT ln([Ai]/[Ao]) + ZF Y Z is the charge of the ion (e.g. +1 for Na+, -1 for Cl-, +2 for Ca++), F is the Faraday constant (9.6485 x 105 C/mol), and Y is the membra ne potential. In an average animal cell, the membrane potential is approximately -70mV. The number is negative to show that the inside of the cell is negative w ith respect to the outside. Thus, again considering Na+, not only is there a che mical gradient of more Na+ ions outside the cell than inside, there Chapter 4, Membranes, v. 1.2 Potassium leak channels are structurally as well as functionally different from other potassium channels. Where most K+ channels have one pore domain, the leak channels have two. While leak channels, by definition are not voltage gated, nor appreciably activated or inactivated, this is not true of all members of the ta ndem pore domain family of potassium channels. Interestingly, some (e.g. TASK-1) are mechanoreceptors, opening in response to membrane stretch, and others act a s thermoreceoptors, with heat-sensitive activation (e.g. TREK-1). Page 42

is also a charge gradient of more positive charges outside the cell to inside, s o both forces contribute to the energy of Na+ flow into the cell. The equilibriu m potential of one ion (e.g. Na+) across a membrane is determined by the Nernst equation: Em= (RT/zF) ln ([Na+]out/[Na+]in) which is extended in the Goldman equ ation (also Goldman-Hodgkin-Katz equation) that calculates membrane potential ba sed on multiple ion gradients. For most animal cells, a good approximation of th e overall membrane potential can be calculated using the three major gradients: Na+, K+, and Cl-. There are, of course, other ion gradients, but their contribut ions are normally much smaller than these three. Vm= (RT/F) ln PNa+[Na+]out + PK +[K+]out + PCl-[Cl-]out PNa+[Na+]in + PK+[K+]in + PCl-[Cl-]in The membrane potential is relatively stable in non-excitable cells, but in neuro ns and muscle cells, the membrane potential is quite dynamic, so the membrane po tential in a non-excited state is referred to in these cells as the resting pote ntial. The membrane (resting) potential in most animal cells is around -70mV. Th is is due in large part to the presence of K+ leak channels. These channels leak K+ from the cell down the concentration gradient until the chemical potential d ifference of K+ is at equilibrium with the membrane potential. In other words, t he gradient pushing K+ out will eventually be stopped by an equal force from the gradient pushing positive ions (including K+) back in. There are also Na+ and C l- leak channels, but there are far fewer and they contribute far less to the re sting potential than K+. Although we most commonly think of water as the solvent in which interesting molecules (e.g. ions) diffuse, its concentration and movemen t across membranes has important biological consequences. Osmosis is a term that specifically refers to the diffusion of water across a membrane. In this case, water is considered a solute rather than a solvent, so that if a water-permeant liposome, embedded with aquaporin channels to allow the passage of water, is pla ced in a very salty saline solution, the cell will shrink because there is a low er ratio of water to dissolved salts outside of the cell than inside. This is a hypertonic solution relative to the cell. Therefore the water flows from the cel l (higher water concentration) out into the saline (with lower water concentrati on). Conversely, a cell placed in distilled and deionized water will swell and p otentially burst because the water rushes from the highest possible concentratio n (pure water) to a cytoplasm with lower water concentration (because dissolved in it are various ions and other molecules). This is an example of a hypotonic s olution. An isotonic solution will have the same concentration of water inside a nd outside of the cell. Chapter 4, Membranes, v. 1.2 Figure 8. Osmosis. An artificial cell that is permeable to water but not to Na+, K +, or Cl- is placed in a aqueous solutions of varying salinity. Hypotonic Isotonic Hypertonic H2O Na+ ClPage 43

Membrane Transport Proteins Membrane proteins come in two basic types: integral membrane proteins (sometimes called intrinsic), which are directly inserted within the phospholipid bilayer, and peripheral membrane proteins (sometimes called extrinsic), which are locate d very close or even in contact with one face of the membrane, but do not extend into the hydrophobic core of the bilayer. Integral membrane proteins may extend completely through the membrane contacting both the extracellular environment a nd the cytoplasm, or they may only insert partially into the membrane (on either side) and contact only the cytoplasm or extracellular environment. There are no known proteins that are completely buried within the membrane core. Integral me mbrane proteins (fig. 9) are held tightly in place by hydrophobic forces, and pu rification of them from the lipids requires membrane-disrupting agents such as o rganic solvents (e.g. methanol) or detergents (e.g. S S, Triton X-100). ue to t he nature of the bilayer, the portion of integral membrane proteins that lie wit hin the hydrophobic core of the membrane are usually very hydrophobic in charact er, or have outward-facing hydrophobic residues to interact with the membrane co re. These transmembrane domains usually take one of the two forms depicted in fi gures 8 and 14: alpha helices - either individually or in a set with other alpha helices, or barrel-shaped insertions in which the barrel walls are constructed of beta-pleated sheets. The hydrophobic insertions are bounded by a short series of polar or charged residues that interact with the aqueous environment and pol ar head groups to prevent the hydrophobic portion of the protein from sliding ou t of place. Furthermore, proteins can have multiple membranespanning domains. Integral membrane protein Phospholipid Peripheral membrane protein GPI anchor Cholesterol Peripheral membrane protein Figure 9. Integral (orange) and peripheral (blue) membrane proteins embedded in a phospholipid bilayer. Peripheral membrane proteins (also shown in figure 9) are less predictable in th eir structure, but may be attached to the membrane either by interaction with in tegral Chapter 4, Membranes, v. 1.2 Page 44

membrane proteins or by covalently attached lipids. The most common such modific ations to peripheral membrane proteins are fatty acylation, prenylation, and lin kage to glycosylphosphatidylinositol (GPI) anchors. Fatty acylation is most ofte n a myristoylation (a 14:0 acyl chain) and palmitoylation (a 16:0 chain) of the protein. A protein may be acylated with more than one chain, although one or two acyl groups is most common. These fatty acyl chains stably insert into the core of the phospholipid bilayer. While myristoylated proteins are found in a variet y of compartments, almost all palmitoylated proteins are located on the cytoplas mic face of the plasma membrane. Prenylated proteins, on the other hand, are pri marily found attached to intracellular membranes. Prenylation is the covalent at tachment of isoprenoids to the protein - most commonly isoprene (a C5 hydrocarbo n), farnesyl (C15), or geranylgeranyl (C20) groups (fig. 10). GPI anchors (fig. 11) are found exclusively on proteins on the outer surface of the cell, but ther e does not appear to be any other commonality in their structures or functions. Of course, not all membrane proteins, or even all transmembrane proteins, are tr ansporters, and the many other functions of membrane proteins - as receptors, ad hesion molecules, signaling molecules, and structural molecules - will be discus sed in subsequent chapers. The focus here is on the role of membrane proteins in facilitating transport of molecules across the cell membrane. Transport across the membrane may be either passive, requiring no external source of energy as so lute travels from high to low concentration, or active, requiring energy expendi ture as solute travels from low to high concentration (fig. 12). Passive transpo rt can also Figure 12. For Na+ ions and animal cells, passive transport is inward, sending N a+ from the high concentration outside the cell to the low concentration inside. Active transport requires energy such as ATP hydrolysis to push a Na+ ion from the low concentration inside the cell to the higher concentration outside. High Na+ Concentration Isoprene CH3 HC C H C CH2 HC CH3 Farnesyl group CH3 CH3 CH3 Geranylgeranyl group HC CH3 CH3 CH3 CH3 CH3 Figure 10. Prenylation Peripheral Membrane Protein O C N H C-terminal peptide HO H HO H H2N C H H C H O O P O CH2 H OH H O- H HO CH 2 H OH H O O HO H H H O H O H HO CH2 H OH H HO O HO H O O P O CH2 CH2 NH2 OO H CH2 H OH H O H H NAc O H HO H

OH H OH H H O H O P R3 OH O C H O H C C H C C H O H H O O R2 R1 N C-terminal peptide HO H HO O C N H H C H H C H O O P O CH2 H OH H O- H HO CH2 H OH H O O HO H H O H H O H HO CH2 H OH H HO O HO H O O P O CH2 CH2 NH2 OO H CH2 H OH H O H H Peripheral Membrane Protein NAc O H Active Transport Extracellular HO H OH H OH H H O H O P R3 OH O C H O H C C H C C H O O O R2 R1 Intracellular

Passive Transport ENERGY Low Na+ Concentration Figure 11. GPI-linked proteins are connected by the C-terminal carboxyl group to phosphoethanolamine, which is linked to a core tetrasaccharide of three mannose residues and one N-acetylglucoasmine, the latter of which is bound by glycosidi c linkage to a phosphatidylinositol. be divided into nonmediated transport, in which the movement of solutes is deter mined solely by diffusion, and the solute does not require a transport protein, and mediated passive transport (aka facilitated diffusion) in which a transport protein is required to help a solute go from high to low concentration. Even tho ugh this may sometimes involve a change in conformation, no external energy is r equired for this process. Nonmediated passive transport applies only to membrane -soluble small nonpolar molecules, and the kinetics of the movement is ruled by diffusion, thickness of the membrane, and the electrochemical membrane potential . Active transport is always a mediated transport process. Chapter 4, Membranes, v. 1.2 Page 45

All transporter proteins occupied Mediated transport Flux Non-mediated transport 0 0 [A]out - [A]in Figure 13. Non-mediated and Mediated transport: flux vs concentration. In addition to protein transporters, there are other ways to facilitate the move ment of ions through membranes. Ionophores are small organic molecules, often (b ut not exclusively) made by bacteria, that help ions move through membranes. Man y ionophores are antibiotics that act by causing the membranes to become leaky t o particular ions, altering the electrochemical potential of the membrane and th e chemical composition inside the cell. Ionophores are exclusively passive-trans port mechanism, and fall into two types. The first type of ionophore is a small mostly-hydrophobic carrier almost completely embedded in the membrane, that bind s to and envelopes a specific ion, shielding it from the lipid, and then moves i t through the cell membrane. The most studied carriertype ionophore is valinomyc in, which binds to K+. Valinomycin is a 12-residue cyclic depsipeptide (contains amide and ester bonds) with alternating d- and l- amino acids. The carbonyl gro ups all face inward to interact with the ion, while the hydrophobic side chains face outward to the lipid of the membrane. Carrier ionophores are not necessaril y peptides: the industrial chemical 2,4-dinitrophenol is an H+ carrier and impor tant environmental waste concern, and nystatin, an antifungal used to treat Cand ida albicans infections in humans, is a K+ carrier. The second type of carrier f orms channels in the target membrane, but again, is not a protein. Gramicidin is a prototypical example, an anti-gram-positive antibacterial (except for the sou rce of gramicidins, the gram-positive Bacillus brevis) and ionophore channel for monovalent cations such as Na+, K+, and H+. It is impermeable to anions, and ca n be blocked by the divalent cation Ca++. Like valinomycin, gramicidin A is also a made of alternating d- and l- amino acids, all of which are hydrophobic (l-Va l/ Ile-Gly-l-Ala-d-Leu-l-Ala-d-Val-l-Val-d-Val-l-Trp-d-Leu-l-Trp-d-Leul-Trp-d-Le u-l-Trp). Gramicidin A dimerizes in the membrane to form a compressed b-sheet st ructure known as a b-helix. The dimerization forms N-terminal to N-terminal, pla cing the Trp residues towards the outer edges of the membrane, with the polar NH groups towards the extracellular and cytoplasmic surfaces, anchoring the pore i n place. Comparing the solute flux vs initial concentration in figure 13, we see that the re is a linear relationship for nonmediated transport, while mediated passive tr ansport (and for that matter, active transport) shows a saturation effect due to the limiting factor of the number of available proteins to allow the solute thr ough. Once there is enough solute to constantly occupy all transporters or chann els, maximal flux will be reached, and increases in concentration cannot overcom e this limit. This holds true regardless of the type of transporter protein invo lved, even though some are more intimately involved in the transport than others . Channels are essentially hands-off transport systems that, as the name implies , provides a passage from one side of the cell to another. Though channels may b e gated - able to open and close in response to changes in membrane potential or ligand binding, for example - they allow solutes through at a high rate without tightly binding them and without changes in conformation. The solute can only m ove through channels from high to low concentration. The potassium channel depic ted below (fig. 14A) is an example: there is a selectivity filter (14B) of align ed carbonyl oxygens that transiently A K+

B Extracellular HO C H CH O O C HC H NH2 C NH2 C CH NH2 C H CH NH2 C HC O CH H2N C HC H C CH3 O O O O O C HC OH NH2 K+ K+ O C HC C HC CH O NH2 H NH2 H3C H3C K+ Intracellular H 3C H3C K+ H 3C H C HO C CH NH2 OH NH2 Figure 14. (A) Half of the tetrameric K+ channel showing two subunits. (B) etai l of the selectivity filter boxed in A. (C) Top-down image generated from data f rom the RCSB Protein ata Bank. positions the K+ ions for rapid passage through the channel, but it does not bin d the K+ for any significant period, nor does the channel undergo any conformati onal changes as a result of the interaction. Smaller Na+ ions could (and on rare occasion do) make it Chapter 4, Membranes, v. 1.2 Page 46

through the K+ channel, but because they are too small to be properly positioned by the K+ filter, they usually pop back out. It should be noted that this chann el is a tetramer (14C) and the cutaway diagram in (14A) only shows half of the c hannel for clarity. While most proteins called channels are formed by multiple alp ha-helices, the porins are formed by a cylindrical beta sheet. In both cases, so lutes can only move down the concentration gradient from high to low, and in bot h cases, the solutes do not make significant contact with the pore or channel. T he interior of the pore is usually hydrophilic due to alternating hydrophilic/hy drophobic residues along the beta ribbon, which places the hydrophobic side chai ns on the outside, interacting with the membrane core. Porin Aquaporin Figure 15. 2 ATP A P Na+ Na+ Na+ Porins are primarily found in gram-negative bacteria, some gram-positive bacteri a, and in the mitochondria and chloroplasts of eukaryotes. They are not generall y found in the plasma membrane of eukaryotes. Also, despite the similarity in na me, they are structurally unrelated to aquaporins, which are channels that facil itate the diffusion of water in and out of cells. Transport proteins work very d ifferently from channels or pores. Instead of allowing a relatively fast flow of solutes through the membrane, transport proteins move solutes across the membra ne in discrete quanta by binding to the solute on one side of the membrane, chan ging conformation so as to bring the solute to the other side of the membrane, a nd then releasing the solute. These transport proteins may work with individual solute molecules like the glucose transporters, or they may move multiple solute s. The glucose transporters are passive transport proteins, so they only move gl ucose from higher to lower concentrations, and do not require an external energy source. The four isoforms are very similar structurally but differ in their tis sue distribution within the animal: for example, GLUT2 is found primarily in pan creatic b cells, while GLUT4 is found mostly in muscle and fat cells. On the oth er hand, the classic example of an active transport protein, the Na+/K+ ATPase, also known as the Na+/K+ antiport, utilizes the energy from ATP hydrolysis to po wer the conformational changes needed to move both Na+ and K+ ions against the g radient. Referring to the figure 16, in its resting state, the Na+/K+ ATPase is open to the cytoplasm and can bind three Na+ ions (1). Once the three Na+ have b ound, the Chapter 4, Membranes, v. 1.2 3 P Na+ Na+ Na+ 1 Extracellular Intracellular Na+ Na+ Na+ K+ P 6

4 K+ K+ K+ 5 P K+ K+ P P Figure 16. Active Transport by Na+/K+ ATPase. This enzyme pushes three Na+ ions out of the cell and two K+ ions into the cell, going against the gradient in bot h directions and using energy from ATP hydrolysis. [Note: some texts diagram thi s enzyme activity with separate binding sites for Na+ and K+, but recent crystal lographic evidence shows that there is only one ion binding site that changes co nformation and specificity.] Page 47

transporter can catalyze the hydrolysis of an ATP molecule, removing a phosphate group and transferring it onto the ATPase itself (2). This triggers a conformat ional change that opens the protein to the extracellular space and also changes the ion binding site so that Na+ no longer binds with high affinity and drops of f (3). However, the ion binding site specificity is also altered in this conform ational change, and these new sites have a high affinity for K+ ions (4). Once t he two K+ bind, the attached phosphate group is released (5) and another conform ational shift puts the transporter protein back into its orginial conformation, altering the K+ binding sites to allow release of the K+ into the cytoplasm (6), and revealing Na+ affinity once again. The Na+/K+ ATPase is a member of the P-t ype family of ATPases. They are named because of the autophosphorylation that oc curs when ATP is hydrolyzed to drive the transport. Other prominent members of t his family of ATPases are the Ca++ -ATPase that pumps Ca++ out of the cytoplasm into organelles or out of the cell, and the H+/K+ ATPase, though there are also P-type H+ pumps in fungal and plant plasma membranes, and in bacteria. Unlike Na + or K+, the Ca++ gradient is not very important with respect to the electrochem ical membrane potential or the use of its energy. However, tight regulation of C a++ is important in a different way: it is used as an intracellular signal. To o ptimize the effectiveness of Ca++ as a signal, its cytoplasmic levels are kept e xtremely low, with Ca++ pumps pushing the ion into the ER (SR in muscles), Golgi , and out of the cell. These pumps are themselves regulated by Ca++ levels throu gh the protein calmodulin. At low Ca++ levels, the pump is inactive, and an inhi bitory domain of the pump itself prevents its activity. However, as Ca++ levels rise, the ions bind to calmodulin, and the Ca++calmodulin complex can bind to th e inhibitory region of the Ca++ pump, relieving the inhibition and allowing the excess Ca++ to be pumped out of the cytoplasm. There are three other families of ATPases: the F-type ATPases are proton pumps in bacteria and mitochondria and c hloroplasts that can also function to form ATP by running backwards with protons f lowing through them down the concentration gradient. They will be discussed in t he next chapter (Metabolism). Also, there are V-type ATPases that regulate pH in acidic vesicles and plant vacuoles, and finally, there are anion-transporting A TPases. Hydrolysis of ATP, while a common source of energy for many biological p rocesses, is not the only source of energy for transport. The active transport o f one solute against its gradient can be coupled with the energy from passive tr ansport of another solute down its gradient. Two examples are shown in figure 17 : even though one is a symport (both solutes crossing the membrane in the same p hysical direction) and one is an Chapter 4, Membranes, v. 1.2 Cardiac glycosides (also cardiac steroids) inhibit the Na+/K+ ATPase by binding to the extracellular side of the enzyme. These drugs, including digitalis (extra cted from the purple foxglove plant) and ouabain (extracted from ouabio tree) ar e commonly prescribed cardiac medications that increase the intensity of heart c ontractions. The inhibition of Na+/K+ ATPase causes a rise in [Na+]in which then activates cardiac Na+/Ca++ antiports, pumping excess sodium out and Ca++ in. Th e increased [Ca++]cytoplasm is taken up by the sarcoplasmic reticulum (see chap. XX), leading to extra Ca++ when it is released to trigger muscle contraction, c ausing stronger contractions. Extracellular Intracellular A) Symport Na+ Na+ Glc Na+ Na+ Glc Glc Glc Glc Na+ Na+

Na+ Na+ Na+ Na+ Glc Na+ Na+/Glucose Cotransporter Na+ Glc Glc Glc Na+ Glc Na+ B) Antiport Na+ Na+ Na+ H+ H+ Na+ H+ Na+ H+ Na+ Na+ H+ Na+ H+ Na+/H+ Exchanger Na+ H+ Na+ H+ H+ Na+ H+ Na+ H+ Na+ H+ Na+ Na+ Figure 17. Symport and Antiport. The terms refer only to direction of solutes in

or out of cell, not to energetics. In this symport, the energy release from pas sive transport of Na+ into the cell is used to actively transport glucose in als o. In the antiport example, Na+ transport is again used, this time to provide en ergy for active transport of H+ out of the cell. Acetylcholine receptors (AchR), which are found in some neurons and on the muscl e cells at neuromuscular junctions, are ligandgated ion channels. When the neuro transmitter (acetylcholine) or an agonist such as nicotine (for nicotinic type r eceptors) or muscarine (for muscarinic type receptors) binds to the receptor, it opens a channel that allows the flow of small cations, primarily Na+ and K+, in opposite directions, of course. The Na+ rush is much stronger and leads to the initial depolarization of the membrane that either initiates an action potential in a neuron, or in muscle, initiates contraction. Page 48

antiport (the two solutes cross the membrane in opposite physical directions), t hey both have one solute traveling down its gradient, and one solute traveling u p against its concentration gradient. As it happens, we have used Na+ movement a s the driving force behind both of these examples. In fact, the Na+ gradient acr oss the membrane is an extremely important source of energy for most animal cell s. However this is not universal for all cells, or even all eukaryotic cells. In most plant cells and unicellular organisms, the H+ (proton) gradient plays the role that Na+ does in animals. The Action Potential in Neurons The transport of solutes in and out of cells is critical to life. However, in ne urons, the movement of ions has another crucial function in metazoan animals: pr oduction of action potentials used for neurotransmission. This specialization al lows for extremely rapid transmission of information across long distances. An e xample my mentor would use when teaching basic neuroscience to schoolchildren wa s a bipolar neuron that extends from the toe to the brain. For information from the toe to be useful, it must reach the brain for processing very quickly. This signal may have to travel several meters in a giraffe, far more in whales. No ch emical signal can move that quickly, and despite the popular simplification and dramatic depictions on television, electricity does not flow through neurons as though they were copper wires. The reality does involve rapid changes to membran e potential. Since that is measured in volts and is a difference in electrical c harge across the membrane, it is sometimes thought of colloquially as electrical transmission, but the mechanism is completely different from electrons flowing through a wire. Instead, there is a moving change in membrane potential due to s equential opening of ion channels along the length of the axon (the long thin pa rt of the nerve cell). Generally, the signal starts with an A number of potent t oxins have been used in the study of the AchR, including histrionicatoxin, an ar row poison extracted from a South American tree frog, endrobates histrionicus, curare (dtubocurarine) isolated from certain plants, and a-bungarotoxin, which i s isolated from the Taiwanese snake, the banded krait. All three act by competit ive inhibition, blocking the opening of the AchR channel. Acetylcholine spontane ously dissociates from AchR in about a millisecond, closing the channel. It coul d then be reactivated by the acetylcholine, but this is tightly regulated by the enzyme acetylcholinesterase (AchE), which is a GPI-anchored protein on the memb rane of the target cell, and prevents overstimulation by rapid degradation of th e acetylcholine. The military nerve gas sarin, which gained notoriety in a 1995 attack on the Tokyo subway system, works by inactivating AchE, thus causing over stimulation of AchR. Figure 18. 1 Extracellular Neurotransmitter Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ + (closed) + (closed) + NT

+ (closed) + (closed) + Intracellular Ligand-gated Na+ Channel Na+ Na+ Voltage-gated Na+ Channel Chapter 4, Membranes, v. 1.2 Page 49

excitatory chemical signal, or neurotransmitter (fig. 18), that binds to a recep tor on the neuron. This receptor may be linked to an ion channel or it may itsel f be a ligand-gated ion channel. In either case, the channel opens and Na+ comes into the cell. 2 Extracellular Na+ Propagation Na+ Na+ (open) Na+ Na+ (open) Since neuronal transmission of information is critical to many systems, it is no t surprising that a variety of organisms have evolved toxins that can paralyze o r kill an attacker or prey. Interestingly, the primary target of the toxins is t he voltage-gated Na+ channel, and not the K+ channel. The toxin most widely used in research, is tetrodotoxin (TTX), which is derived from the skin and certain organs of the puffer fish (Fugu rubripes). This fish is considered a delicacy (p rimarily in Japan), and even when prepared by expert and specially-trained chefs , the small amount of residual TTX in the flesh causes a tingling numbing of the tongue as neural excitation is blocked. Interestingly (but unrelated to ion cha nnels) fugu has a highly compressed genome - where most other eukaryotes have la rge swaths of non-coding regions, fugu has little, and its genes are very close together. In fact, it has almost as many predicted genes as the human genome in only 1/8th the NA! Saxitoxin (STX) is another poison that acts on the voltage-g ated Na+ channel. It is produced by the plankton that cause red tide (dinoflagella tes of the genus Alexandrium, Gymnodium, and Pyrodinium) and is concentrated by filter-feeders such as mussels, oysters, and other shellfish. Interestingly, STX was once investigated by the US military as a nerve agent for chemical warfare, under the designation TZ. Both STX and TTX bind to the external surface of the closed voltage-gated Na+ channel near the mouth of the pore, preventing opening, and thereby blocking Na+ flow. Batrachotoxin, on the other hand, binds to volta ge-gated Na+ channels when they are open rather than closed, so there is a massi ve continuous influx of Na+. A product of another South American tree frog, Phyl lobates aurotaenia, this toxin is used as a hunting poison by aboriginal tribes in the area, and is the most potent venom currently known. With a lethal dose of less than 2 mg/kg, batrachotoxin is roughly ten times more deadly than TTX. How ever, to put this in perspective, botulinum toxin, used pharmacologically as Bot ox and the cause of botulism, is well over a hundred times more potent (though ac ting through a completely different mechanism - prevention of neurotransmitter r elease). Page 50 Na+ + (closed) + + + +

(closed) + (closed) + Intracellular + Na+ + Na+ Na+ + Na+ Na+ + Na+ + K+ Voltage-gated K+ Channel K+ Na+ K+ Na+ Na+ Na+ Na+ K+ Na+ Na+ Na+ Na+ Na+ Na+

Figure 19. The sudden influx of positive charges transiently and locally depolarizes the me mbrane (more + charges along the inside of the membrane than outside). The depol arization of the membrane near the channel causes all nearby voltage-gated Na+ c hannels to transiently open (fig. 19), thus allowing a new rush of Na+ ions into the cell that can then depolarize another small section of membrane. Although t echnically, channels open up on either side of the receptor, normally, the recep tor is located on the main cell body, or soma, while most of the ion channels ar e lined up along the axon. Therefore, there is a de facto directionality to the propagation of the depolarization. 3 K+ K+ K+ K+ K+ K+ (open) K+ Propagation Na+ (inactivated) (inactivated) (open) Na+ Na+ Na+ Na+ Na+ (open) Extracellular + (closed) + + + + + + (closed) + Intracellular K+ K+ K+ Na+

+ Na+ + Na+ Na+ + Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Figure 20. Chapter 4, Membranes, v. 1.2

More voltage gated Na+ channels are opened up quickly after their neighboring ch annels have opened and depolarized their section of the membrane, leading to a l ong chain reaction of voltage-gated depolarizations all the way down the axon (f ig. 20). Once the signal is propagating down the axon, there are two questions t hat should come into your head. First, neurons are not disposable cells, so how are all these opened channels reset and the membrane re-polarized for the next a ction potential? And second, why wouldnt the depolarization wave become bidirecti onal since each little depolarization area spreads out in both directions from t he opened Na+ gate? In fact, the answers to both questions are closely related, and has to do with the gating mechanism of voltage-gated ion channels (fig. 21). Voltage-gated ion channels have two gates: one that opens in response to an inc rease in membrane potential, and one that closes the channel after a short perio d of time. This means that there are three potential states for most voltage-gat ed ion channels: closed, open, and inactivated. Closed Open Inactivated Figure 21. Three states of a voltage-gated K+ channel. The inactivated state occurs when the second gate (more like a plug, really) clo ses, because this is voltage-insensitive. The plug eventually comes out of the p ore and the voltage-sensitive gate is set back in place to the closed state. Vol tage-sensitive K+ channels are tetramers, as shown here, and each subunit carrie s a potential inactivating domain. The choice of which domain appears to be rand om. Voltage-sensitive Na+ channels, on the other hand, also have four transmembr ane regions, but they are all part of a single protein, and the channel only has one inactivation gate/domain. However, the three-state gating mechanism is stil l the same. Back to the action potential: each new depolarization opens the next adjacent set of voltage gated Na+ channels, and so on. In a neuronal axon, whic h is where action potentials occur, the movement of the depolarizations happens very quickly and unidirectionally. It happens quickly because the axon is a very long thin projection of the cell, so the volume is small and therefore the infl ux of Na+ can quickly depolarize a long section of membrane. It happens unidirec tionally because the previously opened voltage-sensitive Na+ channels go into a refractory inactivated state that cannot be reopened immediately. Chapter 4, Membranes, v. 1.2 Page 51

Thus when the adjacent wave of depolarization hits, the previously opened channe ls do not open again, and the opening of more voltage-gated channels continues u nidirectionally away from the start. 4 K+ K+ K+ K+ K+ Extracellular K+ K+ K+ Propagation Na+ Na+ Na+ Na+ Na+ Na+ (open) (closed) (closed) (closed) (inactivated) (inactivated) (open) (open) + + + + + + + Intracellular Na+ + Na+ Na+ + Na+ Na+ Na+

Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ Figure 22. But wait, theres more! Just because the Na+ channels are locked closed doesnt mean that the membrane goes back to normal. What repolarizes the membrane behind the action potential? The voltage-gated potassium channels, which are interspersed among the Na+ channels (note purple ions and channels in figs. 20, 22). They ope n more slowly than the sodium channels (fig. 23) and thus reach peak flux shortl y after the peak flux of Na+. Thus, the recovery phase, or repolarization back t owards the resting potential, is helped by both cessation of the inward Na+ move ment and continued outward K+ movement. 30 +60 +40 Membrane potential (mV) Ionic ux (m.mho/cm2) Na+ ux +20 0 -20 -40 -60 -80 0 0 1 2 Time (ms) 3 4 0 1 Hyperpolarization 2 Time (ms) 3 4 Action potentia l 10 K+ ux epola rizatio

20 n Resting potential Figure 23. The contributions of Na+ flux (depolarizing) and K+ flux (repolarizin g) to the neuronal action potential. Remember that the Na+ movement is into the cell, while K+ is moving out. Since all action potentials behave the same way from the standpoint of changes i n membrane potential, the difference between stronger and weaker nerve signals i s in the frequency/rate of action potential firing, not in magnitude of the ion flux. Page 52 Chapter 4, Membranes, v. 1.2

Metabolism 1 : Catabolic Reactions of the Cell Life requires energy. As our discussion of biomolecules pointed out, the major f unctional components of the cell are mostly polymers - long chains of smaller in dividual molecular units. Each addition of a small link to the chain costs energ y. Chemical reactions that build up complex molecules from simple ones are known as anabolic reactions. Conversely, heterotrophic organisms such as animals inge st food made up of these large polymers, which, when broken down in the digestiv e process, release energy for maintaining and building that organism. Such chemi cal reactions, in which complex molecules are broken down to simpler components, are classified as catabolic reactions. Taken as a group of reactions within a c ell or even an organism, they can be referred to as the cells or organisms anaboli sm or catabolism. The sum total of both types of reactions is the cells metabolis m. Nearly all metabolic reactions are catalyzed by enzymes in order to keep up w ith the energy and material demands of the cell. In fact, the discussion of some of the metabolic processes in this chapter will almost seem to be laundry lists of enzymes. We will begin with one such list in describing the catabolism of th e simple sugar, glucose, through the process of glycolysis. Using this book: This book is designed to be used in both introductory and advan ced cell biology courses. The primary text is generally on the left side of the vertical divider, and printed in black. etails that are usually left to an adva nced course are printed in blue and found on the right side of the divider. Fina lly, additional biomedically relevant information can be found in red print on e ither side of the divider. Glycolysis Whether the cell is prokaryotic or eukaryotic, one of its basic methods for gene rating usable energy is glycolysis. This process uses glucose, which is the most common energy source for most cells. However, glucose cannot be directly broken down to provide energy for the cell: glycolysis is a process that breaks it dow n in a series of reactions to create adenosine triphosphate (ATP), which is the most common energy currency of the cell. That is, ATP can release usable energy in a single reaction. Glucose, being a 6-carbon sugar, has a large amount of poten tial energy stored in its bonds. However, since it is thermodynamically stable, it would take the investment of a lot of external energy to release the energy o f glucose in one step (e.g. lighting it on fire to break it down into CO2 and H2 O), and not only is it impossible for cells to Chapter 5, Metabolism 1, version 1.5 Page 53

generate that kind of energy at once, the cell has no mechanism to use all the e nergy released at one instant in time. Most of it would be wasted as excess heat . Instead, the cell uses enzymes to destabilize and break down the sugar through a series of conversions into intermediate compounds. The basic process and enzy mes involved are as follows. 1. Glucose is phosphorylated by hexokinase to make Glucose-6-Phosphate. The enzyme is so named because it is a kinase (puts a phosp hate group on) that acts on a hexose (six-carbon sugar). In this case, it places the phosphate on the 6-carbon of glucose. However, hexokinase can also phosphor ylate other hexoses such as fructose and mannose (all in the - conformation). T here are two major reasons this is good for the cell. Since glucose concentratio n is higher inside the cell than outside, there is pressure for it to move back out of the cell. By converting it to G6P, it is no longer part of the glucose co ncentration gradient, and it has a charged phosphate group making it nearly impo ssible to leak out of the membrane. The addition of the phosphate also increases the energy in the molecule, making it less thermodynamically stable, so that it can be broken down. This reaction requires the use of ATP as a phosphate donor and the energy needed to attach it. That is, energy is used in this step, not pr oduced. Consider it an investment of energy though, since by the end of glycolys is, more ATP is produced than used. HO H HO CH2 H OH H Glucose O H OH H OH ATP A P Hexokinase Mg++ -2O P 3 Hexokinase requires ATP in the form of a complex (to the 2nd and 3rd phosphate g roups) with a divalent cation, typically Mg++ in vivo. ATP alone is actually a c ompetitive inhibitor of hexokinase. The product, G6P, also functions as an inhib itor, thus providing some measure of feedback regulation. In fact, muscle cells using glycogen stores convert the glycogen directly to G6P, so hexokinase activi ty is very low in those cells. O H HO CH2 H OH H O H OH H OH Glucose-6-phosphate 2. Glucose-6-Phosphate is converted to Fructose-6-Phosphate by phosphoglucose is omerase. As the name implies, the isomerase simply rearranges the existing atoms within the G6P to make the F6P without removal or addition of any atoms. -2O P 3 O H HO CH2 H OH H O H OH H OH -2O P 3 O CH2 H H HO O HO H

CH2 OH OH Phosphoglucose isomerase Glucose-6-phosphate Fructose-6-Phosphate Chapter 5, Metabolism 1, version 1.5 Page 54

3. Fructose-6-Phosphate is phosphorylated by phosphofructokinase (PFK) to Fructo se1,6-bisphosphate. There is again an investment of an ATP to provide the phosph ate group and the energy to attach it. -2O P 3 O CH2 H H HO O HO H CH2 OH OH ATP A P -2O P 3 O CH2 H H HO O HO H CH2 OH O PO32Phosphofructokinase Mg++ Fructose-6-Phosphate Fructose-1,6-bisphosphate 4. The Fructose-1,6-bisphosphate is cut in half by aldolase, yielding a molecule of dihydroxyacetone phosphate and a molecule of glyceraldehyde-3-phosphate. -2O P 3 O CH2 H H HO O HO H CH2 OH O PO32Aldolase O HO CH2 C CH2 O PO3 2O + H

C H C H C O PO323. PFK is an important regulator of glycolysis. It is a tetrameric protein, and each subunit has two binding sites for ATP: one is the normal substrate site, th e other is an inhibitory site such that binding of ATP lowers the enzymes affinit y for F6P. ATP is not the only regulator of PFK activity: AMP is also a positive regulator of PFK, and can increase it up to 5-fold. 4. There are two classes of aldolases: class I are found in animals and plants, while class II are found in fungi and bacteria. Class I require no cofactors, but class II require a divale nt cation (physiologically usually Fe++ or Zn++). 5. Triose phosphate isomerase is a perfect enzyme that catalyzes the formation of product as fast as the enzyme and substrate can make contact in solution (i.e. rate is purely diffusion-limite d). yc er al e deh hy yd dr e 3 og -P en ho as sp e ha te Glyceraldehyde-3-phosphate HO H ihydroxyacetone phosphate 1. Fructose-1,6-bisphosphate

+ H C + HC O 1. Sulfhydryl of GAP H initiates nucleophilic attack on G3P aldehyde. 2. Forms t hiohemiacetal that is oxidized by NA + to thioester. Resulting NA H is displaced by NA +. 5. The G3P can participate in the next reaction, but the dihydroxyacetone phosph ate, despite its similarity, cannot. So, it needs to be rearranged by triose pho sphate isomerase, which converts it to another molecule of glyceraldehyde-3-phos phate. O HO CH2 C CH2 O PO32Triose phosphate isomerase Gl CH2OPO3 2O H C H C H yc er al e deh hy yd dr e 3 og -P en ho as sp e ha te Gl yc er al e deh hy yd dr e 3 og -P en ho as sp e h

NA S H

C O PO322. Glyceraldehyde-3-phosphate HO H ihydroxyacetone phosphate

+ at e NA NA H O S + Gl OC HC 2CH2OPO3 Gl yc er al e deh hy yd dr e 3 og -P en ho as sp e ha te 6. Each of the two molecules of G3P generated from the glucose molecule now unde rgo oxidation catalyzed by glyceraldehyde-3-phosphate dehydrogenase (GAP H) in t he presence of NA + and inorganic phosphate (Pi). Each of these reactions produc es 1,3-bisphosphoglycerate, which has a high-energy phosphate group, and NA H. N A H is a high energy electron carrier (electron comes from G3P). In eukaryotes w ith an aerobic environment, this NA H will likely be used to help generate ATP t hrough the tricarboxylic acid cycle (aka Krebs cycle or citric acid cycle). In a naerobic situations, the NA H will participate in fermentation for reasons discu ssed in the next section. O HO CH2 C CH2 O PO32+ Pi NA + NA H -2O P 3 C HC CH2OPO3 2+ - OPO3 23. NA H 2-

+ 3. Soluble inorganic phosphate attacks thioester to release 1,3-bisphosphoglycer ate. O C HC

NA SH

NA H S

OPO3 OH O CH2 C H C O PO32+ H+ O CH2OPO3 2Glyceraldehyde-3-phosphate Glyceraldehyde3-phosphate dehydrogenase 1,2-Bisphosphoglycerate Figure 1. NA + is reduced by glyceraldehyde-3-phosphate dehtdrogenase to form NA H. The NA H is released by substitution with another NA +. Chapter 5, Metabolism 1, version 1.5 Page 55

7. The phosphate group on the 1-carbon of 1,3-bisphosphoglycerate is transferred to A P by phosphoglycerate kinase to make 3-phosphoglycerate and ATP (finally!) . From the two molecules of G3P entering step 6, we get two molecules of ATP to provide energy for the cell in this step. Recalling the earlier investment of AT P (in steps 1 and 3), the reaction has only broken even at this point. 2 in, 2 out . OH -2O P 3 O PO32C O A P ATP -2O P 3 OH O CH2 C H 3-Phosphoglycerate C OO O CH2 C H Phosphoglycerate kinase 1,2-Bisphosphoglycerate The name of the enzyme suggests that a phosphate is added to phosphoglycerate. T his is not a mistake: remember that enzymes can catalyze reactions in either dir ection, depending on reaction conditions. Under conditions of high phosphoglycer ate and ATP, phosphorylation of phosphoglycerate would occur. However, the physi ological conditions are a relatively high concentration of the 1,3-bisphosphogly cerate in comparison to relatively low levels of phosphoglycerate thus driving t he reaction backwards with respect to the naming of the enzyme. 8. The 3-phosphogl ycerate is then rearranged by phosphoglycerate mutase to make 2-phosphoglycerate . This molecule has a higher free energy of hydrolysis than when the phosphate g roup is on the 3-carbon. OH -2O P 3 OC O Phosphoglycerate mutase -2O P 3 O C OO O CH2 C H HO CH2 C H The action of phosphoglycerate mutase is not just the intramolecular phosphate g roup transfer that it seems to be at first glance. The enzyme must first be acti

vated by phosphorylation, and it is the enzymes phosphate that is added to the 2carbon of 3PG. The doubly-phosphorylated intermediate then transfers its 3-phosp hate to the enzyme, and 2PG is released. 3-Phosphoglycerate 2-Phosphoglycerate 9. That energy is used to create ATP, as the 2-phosphoglycerate undergoes dehydr ation by enolase to make phosphoenolpyruvate (PEP). -2O P 3 O C OO Enolase -2O P 3 O C C OO + H2O PEP is made because hydrolysis of the phosphate from 2PG does not release enough energy to drive phosphorylation of A P to ATP. PEP hydrolysis, on the other han d, releases significantly more than needed. HO CH2 C CH2 H 2-Phosphoglycerate Phosphoenolpyruvate Chapter 5, Metabolism 1, version 1.5 Page 56

HO H HO CH2 H OH H O H OH H OH ATP A P Hexokinase -2O 3P O H HO CH2 H OH H O H OH H OH -2O 3P O CH2 H H HO O HO H CH2 OH OH ATP A P -2O 3P O CH2 H H HO O HO H CH2 OH O PO32Aldolase 1 Phosphoglucose isomerase Phosphofructokinase

Glucose 2 3 4 Glucose-6-phosphate Fructose-6-Phosphate Fructose-1,6-bisphosphate O HO CH2 C CH2 O Triose phosphate isomerase PO32Pi NA + NA H + H+ OH 3P Glyceraldehyde-3-phosphate + Aldolase 5 4 H O C H C H C O PO32Glyceraldehyde3-phosphate dehydrogenase *6 O PO32C O A P ATP -2O 3P OH O CH2 C C OO Phosphoglycerate mutase -2O O CH2 C H

Phosphoglycerate kinase 1,2-Bisphosphoglycerate 7 H 3-Phosphoglycerate 8 HO H ihydroxyacetone phosphate -2O 3P O C OO Enolase -2O 3P O C C OO A P ATP O CH3 C C OO HO Phosphoglycerate mutase CH2 C H CH2 Pyruvate kinase 8 2-Phosphoglycerate 9 Phosphoenolpyruvate 10 Pyruvate Figure 2. Overview of Glycolysis.

Bidirectional arrows indicate enzymes used for both glycolysis and gluconeogenes is. Unidirectional arrows indicate enzymes that only function in glycolysis. rin g in duplicate (two G3P from one glucose). *Note that reactions 6-10 are occurChapter 5, Metabolism 1, version 1.5 Page 57

10. Pyruvate kinase then transfers a high energy phosphate group from PEP to A P , producing an ATP for use by the cell, and pyruvate. -2O P 3 O C C OO A P ATP O CH3 C C OO Pyruvate kinase requires not only divalent Mg++ as with most other kinases, but also K+. The enzyme works in two steps: the A P attacks the PEP phosphorus to ma ke ATP and enolpyruvate. Enolpyruvate is then converted to its keto- tautomer. CH2 Pyruvate kinase Phosphoenolpyruvate Pyruvate Keeping in mind the doubling of reactions from steps 6-10 (splitting of fructose -1,6bisphosphate generates two G3P), the total usable energy production from gly colysis of a single molecule of glucose is 4 ATP and 2 NA H. However, the net AT P production is only 2 ATP if we remember the initial investment of two ATP in t he early steps. Not really anything to write home about. Furthermore, although t he NA H and pyruvate can participate in the tricarboxylic acid cycle in aerobic eukaryotic situations to generate a significant amount of ATP, in anaerobic situ ations, they do not produce usable energy. Thus anaerobic ATP production, i.e. g lycolysis, is far less efficient at extracting energy from a glucose molecule th an aerobic ATP production, which can generate approximately 38 ATP per glucose. On the other hand, when a lot of ATP must be generated quickly, glycolysis is th e mechanism of choice, in cells such as the fast-twitch fibers of skeletal muscl e. These cells actually have very few mitochondria because glycolysis can produc e ATP at a much higher (up to 100 times) rate than oxidative phosphorylation. Wh at happens to the pyruvate and NA H? In aerobically metabolizing cells, they go to the mitochondria for the TCA cycle and oxidative phosphorylation. In anaerobe s, they undergo fermentation. Note that the NA H produced by glycolysis in the cytoplasm does not directly par ticipate in oxidative phosphorylation in the mitochondria since the inner mitoch ondrial membrane is impermeable to it, but it sends a virtual equivalent into the mitochondria via one of two pathways: the aspartate-malate shuttle combines mala te-a-ketoglutarate antiports, aspartate-glutamate antiports, and metabolite inte rconversion by transaminase with malate dehydrogenase to oxidize NA H cytoplasmi cally and use the energy generated to reduce NA + in the mitochondrial matrix; t he other pathway is a HAP shuttle system, in which NA H is used to reduce dihyd roxyacetone phosphate to glycerol-3-P using a cytoplasmic glycerol-3-phosphate d ehydrogenase, and the cycling the HAP to glycerol-3-P via a flavoprotein dehydr ogenase embedded in the inner mitochondrial membrane. This flavoprotein dehydrog enase takes the electrons from glycerol-3-P to make FA H2, which can participate in the electron transport chain. The HAP or glycerophosphate shuttle is less e fficient than the malate-aspartate shuttle, generating approximately 2 ATP vs 2.

Fermentation When the average person hears the word fermentation he probably thinks about alcoh ol. As you no doubt recall, glycolysis gave us some usable energy in the form of ATP, and then there are the other products, NA H and pyruvate. As we shall see in the next section, if the cell is eukaryotic and oxygen is available, then tho se molecules can help make more ATP. If no oxygen is available or the cell is ju st a lowly prokaryote, it undergoes fermentation to produce either lactate or et hyl alcohol. Why does the cell need lactate or ethanol? It doesnt, although the l actate can contribute to overall metabolism. What the cells do need is NA +, so that glycolysis can continue beyond step 6. Without fermentation, continued glyc olysis would convert all of the NA + to NA H, and then be stuck, unable to conti nue. So the primary reason for fermentation, whichever path it takes, is to rege nerate NA + from the NA H. Chapter 5, Metabolism 1, version 1.5 Page 58

7 ATP per NA H. However, it can operate even when the concentration of cytoplasm ic NA H is low, as happens in tissues/ cells with a very high metabolic rate (in cluding skeletal muscle and brain), while the malate-aspartate shuttle (prevalen t in liver and heart) is sensitive to the relative concentration of NA H and NA +.

In lactate fermentation, the pyruvate is converted to lactate by lactate dehydro genase. This reaction requires the oxidation of NA H, which thus provides NA + t o the cell for continued glycolysis. O OC O C CH3 NA H NA + O OC OH H Lactate Lactate ehydrogenase C CH3 Pyruvate For many cells, the lactate is a waste product and excreted. In fact, this is th e case with most muscles: the lactate is carried by the blood from the muscle ce lls to the liver, where it can be converted to glucose. Thus, although lactate i s formed at high rates when muscles are overworked and become fatigued, it is no t directly the cause of muscle fatigue. As oxygen availability cannot keep up wi th aerobic ATP production, and larger and larger proportions of the ATP generate d come from glycolysis with fermentation. The current model of muscle fatigue po sits that it is due to acidification of the muscle cell as it undergoes rapid gl ycolysis. However, in some tissues and cell types, particularly in the heart and brain of higher animals, cell membranes are highly permeable to lactate, the ce lls can readily convert the lactate to pyruvate, and since these are highly oxyg enated tissues, the pyruvate is then used for the TCA cycle and oxidative phosph orylation to generate ATP. In fact, some non-neuronal support cells in the brain (astrocytes) generate and excrete copious lactate which is taken up by the neig hboring neurons to fuel ATP production. In alcohol fermentation, pyruvate is fir st acted upon by pyruvate decarboxylase, which liberates a CO2 molecule and prod uces acetaldehyde. Acetaldehyde is then acted upon by alcohol dehydrogenase, usi ng NA H, generating NA + and ethanol. Here, like with lactate fermentation, the desired product is the regenerated NA +. Ethanol is excreted, and in most animal s, is converted to acetaldehyde and then acetic acid, before finally ending up a s acetyl-CoA. O C C O CH3 Pyruvate Acetaldehyde NA + OPyruvate ecarboxylase O C CH3 H + CO2 O C CH3 H NA H OH H C CH3 Ethanol H Alcohol ehydrogenase Chapter 5, Metabolism 1, version 1.5 Page 59

As with glycolysis, fermentation can and does take place in cells that are able to make ATP by oxidative phosphorylation. The relative contribution of glycolysi s and oxidative phosphorylation to the cellular ATP pool is determined dynamical ly by physiological conditions. The TCA cycle So youre a hot young eukaryote sporting all kinds of fancy internal membranous organelles, with a need to prove yourself better than the old guard prokaryotes what do you do? Well, make scads of ATP, of course! And seemingly ef fortlessly at that, using only the dregs left over after glycolysis has taken it s pass at a glucose molecule: NA H and pyruvate. Glycolysis in eukaryotes, as be fits its prokaryotic origins, happens in the cytoplasm. The TCA cycle happens in side the matrix of the mitochondria, a doublemembraned organelle. The pyruvate n eeds to make its way from the cytoplasm, through both outer and inner mitochondr ial membranes, and into the mitochondrial matrix. How does this work? The outer membrane is porous, being riddled with large relatively nonspecific anion channe ls known as voltage-dependent anion channels (V ACs), and will readily admit pyr uvate. In contrast, the inner mitochondrial membrane is highly impermeable, and entry of pyruvate is specifically regulated by a pyruvate transporter protein. O S CH2 CH2 NH C CH2 CH2 NH C HO H3C C C CH2 O H CH3 O O P OO O O P OH -O Blue = Acetyl group Green = -Merc ptoethyl mine Red = P ntothenic cid (Vit mi n B5) Bl ck = Adenosine - 3 - phosph te C CH3 O NH2 N N O CH2 H O P O OO H N N H OH Figure 3. Acetyl-Coenzyme A is composed of four distinct molecul r p rts. Ch pter 5, Met olism 1, version 1.5 P ge 60

+ Coenzyme A Pyruv te Dehydrogen se O H3 C C S CoA + NADH + CO2 1. Pyruv te dehydrogen se complex (fig. 4) is ctu lly n m lg m tion of three enzymes. Th t is, there re three su units to the complex: pyruv te dehydrogen s e (E1), dihydrolipoyl tr ns cetyl se (E2), nd dihydrolipoyl dehydrogen se (E3). These three su units re ssoci ted y noncov lent onds. The pyruv te dehydrog en se su unit E1 cts first, using the cof ctor thi mine pyrophosph te (TPP) to help remove CO2 from the pyruv te to gener te hydroxyethyl-TPP. This is immedi tely used s su str te y E2, resulting in regener tion of TPP nd re ctiv ti on of pyruv te dehydrogen se, nd lso m king the intermedi te cetyl-dihydrolip o mide. Coenzyme A, which is lso su str te for E2, h s sulfhydryl group th t tt cks the cetyl group of cetyl-dihydrolipo mide. The cetyl group is immed i tely tr nsferred to Coenzyme A to form the Acetyl-CoA th t enters the TCA cycl e. The fin l step is for the dihydrolipo mide to e oxidized ck to lipo mide y E3. It is this oxid tion step th t gener tes the NADH from NAD+. O H3C C COO- + Thi mine-PP non-cov lently ound to E1 E1

Now consider the re kdown of glucose. Rec ll th t the complete re kdown of th t six-c r on sug r should yield six single-c r on molecules of c r on dioxide. I n glycolysis, the glucose is roken down into two molecules of three-c r on pyru v te. As the pyruv te is converted to cetyl-CoA, one CO2 is gener ted per molec ule of pyruv te. Th t le ves just four c r ons (in two 2-c r on molecules of ce tyl-CoA) out of the origin l glucose 6. The TCA cycle will li er te e ch of thos e c r ons s CO2 s well. Knowing the re ctions in which the rem ining c r ons re rele sed is good w y to study the first h lf of the TCA cycle. As n integr l p rt of coenzyme A, vit min B5, or p ntothenic cid, is needed for the TCA cy cle, nd therefore, for norm l efficient gener tion of ATP. However, unlike some other vit mins, B5 deficiency is r re, nd usu lly ssoci ted with deficiency i n other vit mins or gener l m lnourishment. On the other h nd, deficiency in no ther B vit min involved in pyruv te dehydrogen se ctivity (fig. 4), thi mine (B 1), c n le d to dise se symptoms known s eri eri. Arsenic, or more specific ll y rsenic-cont ining compounds such s rsenite nd rsen te, re poisonous to c ells y interfering with this re ction. The rsenic compound c n inter ct with d ihydrolipo mide, resulting in cycliz tion y onding of oth sulfhydryl sulfurs to the rsenic tom. This prevents E2 from working, nd cetyl-CoA c nnot e gen er ted for ATP production vi TCA cycle nd oxid tive phosphoryl tion. It should e noted th t these rsenic compounds lso ffect other sulfhydryl-cont ining c ompounds, nd within the context of the TCA cycle, it c n lso in ctiv te -keto glut r te dehydrogen se, which is simil r to the pyruv te dehydrogen se. Beri er i symptoms re cl ssified in two groups: wet eri eri ffects the c rdiov scul r system with symptoms such s enl rged he rt, lung congestion, shortness of re th, swelling of lower legs, congestive he rt f ilure; dry eri eri ( lso known s WernickeKors koff syndrome) ffects the nervous system. Symptoms include polyn euritis in oth centr l nd peripher l nervous system, le ding to p in, tingling , loss of sens tion in extremities, loss of muscle function or p r lysis of the lower legs, vomiting, nyst gmus, nd eventu lly ment l confusion, speech difficu lties, com nd de th. Ch pter 5, Met olism 1, version 1.5

1. Once the pyruv te complex (consisting tyl-CoA (fig. 3) for n gener tes NADH nd O H3C C COO- + NAD+

enters the mitochondri l m trix, the pyruv te dehydrogen se of three enzyme su units E1, E2, nd E3) converts it to ce entry into the tric r oxylic cid cycle (TCA). This re ctio li er tes CO2.

H3 C OH C- TPP E1 + CO2 O E1 TPP E1 OH C- TPP E1 + S S E2 E1 HO C S HS CH3 C TPP E1 + S HS CH3 H3C E2 O C S HS E2 HS HS E2 SH HS E3 E3 E2 CH3 + CoA E2 O H3C C S CoA + HS HS E2 + S E3 S FAD E3 S S E2 + SH HS E3 FAD FAD S E3

S FADH2 + NAD+ E3 S E3 S FAD + NADH + H+ Figure 4. Pyruv te dehydrogen se is complex of three enzym tic su units, E1, E 2, nd E3, which work in sequence s depicted here. P ge 61

Genetic deficiencies in the pyruv te dehydrogen se complex le d to simil r, ut more immedi tely severe pro lems. The most common mut tion is n X-linked domin nt mut tion in the su unit of E1. PDC loss-of-function mut tions s well s mu t tions in pyruv te c r oxyl se nd mut tions in cytochrome oxid se, re conside red c uses of Leighs dise se, which is often neon t lly f t l, though exceptions h ve survived little over dec de. Severe l ctic cidosis nd the in ility t o gener te sufficient energy, especi lly in neurons (which would norm lly e l e to met olize f t - see section of f tty cid c t olism - ut c nnot in these p tients) nd muscle cells, is the underlying c use of the symptoms. 2. AcetylCoA enters the tric r oxylic cid cycle s su str te of citr te synth se, whic h dds it to ox lo cet te to m ke citr te. This is the re son th t this cycle is lso c lled the citric cid cycle. Citr te, h ving three c r oxyl groups, is tric r oxylic cid, le ding to the n me th t this text will use. The other commo n n me for this is the Kre s cycle, s it w s first proposed y H ns Kre s in 19 37. O C H 3C S CoA COOCOOCitr te Synth se 2. Citr te synth se is dimeric enzyme th t in its n tive form h s inding cl eft for ox lo cet te. Binding of ox lo cet te c uses conform tion l shift clos ing the ox lo cet te inding site, locks it in nd simult neously reve ls the c etyl-CoA inding site. The current model for this re ction involves three steps: Acetyl-CoA is converted to n enol intermedi te, which tt cks the ox lo cet te to form citronyl-CoA (S-citryl-CoA), which is then hydrolyzed to citr te nd Co enzyme A. COOHO C CH2 COOO C CoA Citronyl-CoA CH2 + C CH2 O CH2 HO C CH2 COO+ CoA COOCOO3. In the next step, conit se re rr nges citr te to m ke isocitr te. COOCH2 HO H C C COOH Aconit se COOCH2 H HO C C COOH 3. Aconit se pushes citr te into cis- conit te intermedi te, which is then con verted to isocitr te. Interestingly, while conit se cont ins n Fe-S cluster, i t does not ppe r to p rticip te in redox re ctions s is usu lly the c se for s uch groups. Inste d, its purpose is to hold the cis- conit te in its pl ce withi n the enzyme s it [the cis- conit te] undergoes iz rre molecul r flip on its w y to isocitr te. COOCH2 HO H C C COOH Aconit se

COOCH2 H C C COOH Aconit se COOCH2 H HO C C COOH COOCOOCOOSodium fluoro cet te, lso known s compound 1080, is common pesticide th t is used prim rily g inst rodent nd other m mm li n pests, nd c n ct in hum ns if ingested. Once introduced to the org nism, it c n e converted to fluoro cety l-CoA nd then to fluorocitr te, which then cts s competitive inhi itor of conit se. As such, the poisoning most severely nd quickly ffects tissues with high energy needs. No effective ntidotes re recognized for leth l doses of flu oro cet te poisoning. COOcis- conit te intermedi te COOCh pter 5, Met olism 1, version 1.5 P ge 62

4. Isocitr te is su str te for isocitr te dehydrogen se, which tr nsfers hig h energy electron from the isocitr te onto NAD+ to m ke NADH nd -ketoglut r te . This re ction lso li er tes one CO2. For those keeping tr ck t home, th t le ves two more c r ons from the six in glucose. COOCH2 H HO C C COOH NAD+ NADH CO2 COOCH2 CH2 C O COO4. The NAD+-dependent isocitr te dehydrogen se is ctu lly found in two isoforms in m mm ls: n NAD+-utilizing isoform in the mitochondri l m trix, nd n isofo rm th t uses NADP+ th t is found in the cytosol s well s the mitochondri . The re ction st rts with NADH-gener ting oxid tion of isocitr te to oxo losuccin te , which is then dec r oxyl ted with the help of Mn++ or Mg++ cof ctor to rele se the c r on dioxide nd form -ketoglut r te. COOCH2 H HO C C COOH NAD+ NADH + H+ H COOCH2 C C COOO CO2 COOCH2 CH2 C O COOIsocitr te dehydrogen se

COOCOOCOOIsocitr te Ox losuccin te -ketoglut r te COO-ketoglut r te dehydrogen se CH2 CH2 C S O CoA + CoA + NAD+ + NADH + CO2 6. The CoA is regener ted y succinyl-CoA synthet se, which lso forms succin te nd GTP or ATP. This GTP is energetic lly n ATP equiv lent, nd m de in nim l cells. B cteri l nd pl nt homologues of this enzyme use ADP nd m ke ATP. Form tion of this ATP/GTP is possi le ec use the high-energy thioester ond of succ inyl-CoA is roken. COOCH2 CH2 C S O CoA Succinyl-CoA synthet se 5. -ketoglut r te dehydrogen se is very simil r to pyruv te dehydrogen se compl ex structur lly nd mech nistic lly. There re three enzymes: the -ketoglut r t e dehydrogen se, dihydrolipoyl tr nssuccinyl se, nd dihydrolipoyl dehydrogen se. Also simil r to pyruv te dehydrogen se complex, the end product is molecul e cont ining high energy thioester ond.

5. Alph -ketoglut r te is lso oxidized ( y -ketoglut r te dehydrogen se) gener ting NADH nd succinyl-CoA. Like cetyl-CoA, this CoA- ssoci ted compound cont ins high energy thioester ond. This re ction li er tes the fin l CO2 from the glucose. COOCH2 CH2 C O COO-

COOCH2 CH2 COO+ GDP + Pi + GTP + CoA 7. Next, the succin te is oxidized. The enzyme th t does this, succin te dehydro gen se, is little different from the other dehydrogen ses ec use this one h p pens to e em edded in the inner mitochondri l mem r ne, nd inste d of tr nsfer ring the electron to NAD+, the electron is tr nsferred to FAD, m king FADH2, nd fum r te. The energy in FADH2 c n lso e used to power ATP production simil r to the energy in NADH. COOCH2 CH2 COOSuccin te dehydrogen se 6. Succinyl-CoA synthet se first rings together the succinyl-CoA nd inorg nic phosph te (in solution within the mitochondri l m trix s well s the cytosol) t o produce succinyl phosph te nd li er te the CoA. Then the phosph te is tr nsfe rred from the succinyl phosph te, to the enzyme itself tempor rily, which then d rops the succin te. And fin lly, the phosph te is tr nsferred to GDP/ADP. 7. Eve n though the usu l intro-cl ss simplific tion is th t FADH2 is roughly n equiv lent to NADH, the situ tion is ctu lly more complic ted. Unlike NAD+, nd for t h t m tter, unlike most occurences of FAD, the FAD is cov lently ound to the su ccin te dehydrogen se. Therefore, it is not solu le met olite, nor is it v i l le to e reoxidized quite like NADH. It is, of course, reoxidized. But, this occurs within the context of the electron tr nsport ch in (where it is known s Complex II), with the help of Coenzyme Q. P ge 63 COOHC CH COOFAD FADH2 Ch pter 5, Met olism 1, version 1.5

COOHO C CH2 COOH H2O 8. The c r on dou le ond of fum r te is tt cked y hydroxyl (OH-) to form c r nion tr nsition, which then t kes on proton (H+) from the enzyme to form the m l te. The fum r se enzyme is proton ted t the s me time th t it inds fum r te, nd is deproton ted t the end to form the m l te. 9. M l te is oxidized y m l te dehydrogen se in the fin l re ction of the TCA c ycle to gener te more NADH, nd ox lo cet te, the l tter of which c n then e d ded to COOHO C CH2 COOH M l te Dehydrogen se NAD+ NADH COOC CH2 COOO 9. M l te dehydrogen se is simil r in structure to the l ct te dehydrogen se nd the lcohol dehydrogen se mentioned in the ferment tion section. Energetic lly, the st nd rd free energy ch nge of this re ction is very highly positive (29.7 kJ/mol) ut the ox lo cet te is quickly converted to citr te, so th t more form tion of ox lo ctet te is f vored over m l te form tion.

Ch pter 5, Met olism 1, version 1.5 P ge 64

cetyl-CoA to st rt the cycle ll over g in. Now th t the complete cycle h s e en descri ed, it should e noted th t the regul tion of this cycle is prim rily through cetyl-CoA nd ox lo cet te v il ility, s well s NADH concentr tion. As respir tion r te incre ses, NADH levels drop s they re oxidized to m ke AT P (see next section). This drop in [NADH] then c uses n incre se in ox lo ctet te, which is then used y citr te synth se. [Acetyl-CoA] is regul ted y its syn thesis y pyruv te dehydrogen se. On the reverse side of regul tion, oth NADH nd succinyl-CoA re strong inhi itors of -ketoglut r te dehydrogen se. Thus s NADH is used up, the enzyme is disinhi ited nd incre ses its production of more NADH. H ving t ken the 2 pyruv tes cre ted during glycolysis through the TCA cy cle to complete oxid tion into CO2, wh t is our intrepid euk ryotic hero left wi th? Two ATPequiv lents (GTPs) six NADH, nd two FADH2. This h rdly seems to e tre sure trove of us le energy worth o sting out. Fortun tely, the mitochon drion is not finished. Next, the high energy electrons will t ke ride on the e lectron tr nsport ch in, nd vi the m gic of oxid tive phosphoryl tion, produce ATP y the ucket.

8. Fum r se c t lyzes the COOHC CH COOFum r se

ddition of w ter to the fum r te to gener te m l te.

O H3 C C COOH HO Pyruv te (3C) NAD+ Coenzyme A Pyruv te dehydrogen se COOCH2 C C COOH NAD+ NADH CO2 COOCH2 CH2 C O Coenzyme A CO2 NAD+ NADH COOCH2 CH2 C S O CoA COO1 Aconit se COOIsocitr te dehydrogen se Isocitr te (6C) 4 -ketoglut r te (5C) NADH O H3 C C CO2 COOS CoA HO CH2 C CH2 COO3 -ketoglut r te dehydrogen se 5 COOAcetyl CoA (2C) CoA-SH Citr te (6C) Citr te synth se Succinyl-CoA (4C) 2 COOC CH2 COOTCA CYCLE Succinyl-CoA synthet se GDP + Pi GTP CoA-SH COOCH2 ADP ATP 6 O Ox lo cet te (4C)

CH2 COOSuccin te (4C) M l te dehydrogen se NADH NAD+ 9 COOHO C CH2 COOM l te (4C) H Fum r se Succin te dehydrogen se COOHC 7 FADH2 FAD (to Complex II) 8 CH COOFum r te (4C) Figure 5. The Tric r oxylic Acid Cycle HO Ch pter 5, Met olism 1, version 1.5 P ge 65

Oxid tive Phosphoryl tion Oxid tive phosphoryl tion denotes the phosphoryl tion of ADP into ATP, utilizing the energy from successive electron tr nsports (hence the oxid tive). The sic c oncept is th t oxid tion of NADH, eing highly exergonic, c n gener te the energ y needed to phosphoryl te ADP. Since oxid tion of NADH y oxygen c n potenti lly rele se 52 kC l/ mol (218 kJ/mol), nd the energy needed to phosphoryl te ATP i s pproxim tely 7.5 kC l/ mol (30.5 kJ/mol), we should e le to expect the for m tion of sever l ATP per oxidized NADH. Indeed, this is wh t h ppens, lthough not directly. As noted with the re kdown of glucose, one-step oxid tion would gener te too much energy for cellul r processes to h ndle, nd most would e w sted. So inste d of oxidizing NADH directly with O2, the electrons re tr nsferr ed to series of gr du lly lower-energy c rriers until fin lly re ching oxygen. This sequence is the electron tr nsport ch in. The electron tr nsport ch in is sed on the ctivity of four m jor enzyme complexes (conveniently c lled comple xes I-IV) em edded in the inner mitochondri l mem r ne, long with some sm ll e sily diffusi le electron c rriers to move the electrons from one complex to the next. These complexes re present in extremely high num ers s efits their nece ssity in gener ting energy, comprising ne rly 75% of the inner mem r ne m ss (in comp rison, the pl sm mem r ne of n ver ge euk ryotic cell h s protein con centr tion closer to 50%). An overview of the process is shown in figure 6: s p reviously noted, electrons re stripped from NADH, nd eventu lly end up on oxyg en. As the electrons re moved to lower-energy c rriers, energy is rele sed nd used to pump protons from the mitochondri l m trix into the intermem r ne sp ce. Complex I is n NADH dehydrogen se. Shown in yellow in figure 6, its purpose is to remove p ir of electrons from NADH nd tr nsfer them onto u iquinone (Coen zyme Q or CoQ), sm ll hydropho ic electron c rrier th t c n then c rry the ele ctrons to complex III. This is multistep process th t involves first tr nsferr ing the electrons onto n ssoci ted fl vin mononucleotide (FMN) molecule, which then tr nsfers the electrons to set of iron-sulfur moieties connected to the enzyme complex itself (structure in fig. 7). Fin lly, the electrons re moved on to u iquinone. As these tr nsfers occur, the energy th t is rele sed during thes e tr nsfers powers the pumping of 4 H+ ions cross the inner mitochondri l mem r ne. Complex I is inhi ited y rotenone, pesticide used prim rily g inst inse cts nd fishes. Well t ke ment l p ss on complex II for now, nd hit it t the end of this roll c ll. The re sons will e pp rent then. e4 H+ Complex I Fe-S 2e FMN 2e Fe-S e2 H+ Cyt c eCyt c 2 H+ 2 H +

CoQ CoQH2

Fe-S Cyt

Cyt c Cyt c1 Cu Cyt

Cu

- Cyt 3

Complex IV 2 H+ NAD+ + H+ Complex III 2 H+ NADH 2 H + / 02 + 2H+ HO 4 H+

Figure 7. Although the size of complex I v ries somewh t cross species, the rou gh L-sh ped three-dimension l conform tion is const nt. The FMN is loc ted in th e l rger portion of the complex, while the u iquinone docking site is loc ted in the short r nch. In the figure ove, which depicts two spects (rot ted 90) of NADH dehydrogen se complex, the FMN is shown in grey nd red, while Fe-S center s re shown in or nge nd yellow. The figure w s gener ted from d t in the RCSB Protein D t B nk. Ch pter 5, Met olism 1, version 1.5 P ge 66

Figure 6. The prim ry electron tr nsport p thw y in mitochondri . Complexes I, I II, nd IV re shown. Complex II is pictured in fig. 10. The complexes re ll uried in the inner mitochondri l mem r ne. Protons re eing pumped from the m t rix to the intermem r ne sp ce utilizing energy s pped from the high energy elec trons s they move from higher-energy c rrier to lower-energy c rrier.

In f ct, some well known poisons ct t ex ctly this point. Both cy nide nd c r on monoxide c n ind with higher ffinity th n oxygen t the heme in complex IV . Since neither c n ccept electrons, the effect is just s though no oxygen w s v il le. Although cytochrome c oxid se is sometimes revi ted COX, it is no t the t rget of the COX-2 inhi itors th t re used ph rm ceutic lly in p in m n gement, e.g. Bextr , Cele rex, or Vioxx. Th t refers to f mily of enzymes know n s the cyclooxygen ses.

Complex III is lso known s the cytochrome c1 complex (fig. 6, purple). The pu rpose of this complex is to p ss the electrons from u iquinone onto cytochrome c . The use of u iquinone is import nt here, ec use it is st le with either two, or just one, extr electron. Cytochrome c, on the other h nd, c n only c rry on e electron. So, this complex docks u iquinone, nd holds it until it h s p ssed its first electron onto cytochome c, which then moves onto complex IV, nd then its second electron onto nother cytochrome c. With e ch tr nsfer, two protons re pumped cross the mem r ne. Fin lly, cytochrome c drops the electron off to c omplex IV, cytochrome c oxid se (fig. 6, red). Cytochrome c oxid se ccomplishes the fin l step: tr nsferring electrons onto oxygen toms to m ke w ter. The re lly interesting thing out this process is th t the enzyme must hold onto the e lectrons s they re tr nsferred one t time from cytochrome c, until it holds four electrons. Then, it c n tr nsfer one p ir to e ch of the oxygen toms in m olecul r oxygen (O2). It is very import nt to do this ec use tr nsferring ny l ess th n ll four electrons would le d to the cre tion of re ctive oxygen specie s (ROS) th t could c use d m ge to the enzymes nd mem r nes of the mitochondri . Oxygen is solutely required. If oxygen is not v il le, there is no pl ce t o tr nsfer the electrons, nd very quickly, the electron tr nsport ch in is h lt ed nd c rriers such s cytochrome c nd CoQ c nnot rele se their electrons nd eventu lly there re no more v il le c rriers. Simil rly, when th t h ppens, N AD+ is not regener ted, so the TCA cycle is lso stuck. This le ves only the n ero ic non-oxygen-requiring glycolysisferment tion cycle for gener ting ATP. We now return to complex II (see fig. 10). We mentioned complex II s succin te deh ydrogen se when discussing the TCA cycle. It lso p rticip tes in the electron t r nsport ch in y p ssing electrons to u iquinone. However, r ther th n tr nsfer ring electrons th t origin ted from NADH like the other three complexes of the e lectron tr nsport ch in, the electrons origin te from the cov lently ound elect ron c rrier FADH2 (fl vin denine dinucleotide), which received the electrons fr om succin te, s descri ed in the TCA cycle section. Once the electrons h ve ee n p ssed to u iquinone, it then moves on to complex III to drop off those electr ons to cytochrome c, nd the rest of the electron tr nsport ch in continues. FAD , the oxidized form of FADH2, is then re dy to p rticip te in the next redox cyc le. The purpose of this electron tr nsport ch in, with respect to ATP gener tion , is the pumping of H+ from the mitochondri l m trix into the intermem r nous sp ce. Since the concentr tion of protons is higher in the intermem r ne sp ce, it will t ke energy to move them g inst the concentr tion gr dient, which is wher e our high-energy Ch pter 5, Met olism 1, version 1.5 P ge 67

CYTOSOL Pyruv te OUTER MEMBRANE eePyruv te H+ 4 H INTERMEMBRANE SPACE + 2 H+ 2 H+ Cyt c eCyt c H+ H+ H+ H+ H +

2 H+ H+ H+ Complex I Fe-S 2e FMN 2e Fe-S 2 H+ Cyt c Cyt c1

CoQ CoQH2

CoQ CoQH2 H+ c H+ c c c INNER MEMBRANE Compl x IV

Fe-S Cyt

Complex II Fe-S Cu Fe-S Fe-S 2eCyt

H+ H H+ +

Cu

- Cyt 3

2 H+ NAD+ + H+ Compl x III c 2 H+ H+ Pyruvat (3C) NAD+ CO2 NADH Co nzym A NAD+ NADH Ac tyl CoA (2C) Isocitrat ( 6C) Aconitas FAD FADH2 / 02 + 2H+ HO H+ 2 H+ NADH 2 H+ 4 H+ CO2 -ketoglut r te (5C) Isocitr te dehydrogen se

NAD+ NADH CO2 ADP + Pi Succinyl-CoA (4C) GDP + Pi GTP CoA-SH ATP CoA Citrat (6C) CoA-SH Citrat synthas -ketoglut r te dehydrogen se ATP TCA CYCLE Fum r se Succinyl-CoA synthet se ADP Ox lo cet te (4C) M l te dehydrogen se

Succin te dehydrogen se Succin te (4C) FAD NADH NAD+ M l te (4C) Fum r te (4C) FADH2 H2O (to Complex II) MATRIX Figure 10. C t olic re ctions of the mitochondri . Ch pter 5, Met olism 1, version 1.5 P ge 68

electrons come into the picture. As they move from one c rrier to the next, they re moving from higher to lower energy st te. This implies th t some energy is lost from the electron, nd some of th t energy is t pped y the enzymes of the electron tr nsport ch in to move protons from the m trix to the intermem r n e sp ce. There re two methods y which the protons re moved: the redox loop, nd the proton pump. The proton pump, which is the method y which complex IV mov es protons, is the e sier to underst nd: H+ is ound on the m trix side of the e nzyme in its reduced st te ( fter it h s received n electron), nd conform ti on l shift occurs upon reoxid tion to open the enzyme up to the intermem r ne si de, nd the H+ is rele sed. The redox loop, which occurs in complex I, nd in co mplex III in v ri tion c lled the Q cycle, essenti lly posits th t n initi l redox center requires the inding of oth the high energy electron nd proton from the m trix side of the mem r ne. When the electron is tr nsferred to the ne xt redox center in the ch in, proton is rele sed to the intermem r ne sp ce. W h tever the mech nism, wh t is the point of ll this proton pumping? As you migh t suspect, using up energy to pump n ion g inst its concentr tion gr dient isnt done for the fun of it. R ther, this gener tes signific nt potenti l energy cr oss the inner mitochondri l mem r ne. And, it so h ppens th t there is n enzyme th t c n convert th t energy into the physiologic lly useful chemic l form of A TP. This enzyme is, not surprisingly, n med ATP synth se (fig. 8). It is lso re ferred to in some texts s the F1F0-ATP se, sed on its reverse ctivity ( t th e expense of ATP, it c n pump protons), nd the f ct th t it c n e roken down into two m jor function l units: F1 which c n hydrolyze ut not synthesize ATP nd is solu le protein, nd F0 which is n insolu le tr nsmem r ne protein. The ATP synth se is n extr ordin ry ex mple of n enzyme th t tr nsforms the energ y inherent in concentr tion gr dient cross mem r ne into mech nic l energy, nd fin lly into chemic l ond energy. It is descriptively c lled rot ry engin e ec use the very gener lized sequence of events is s follows: protons flow dow n their gr dient through proton ch nnel su unit of the ATP synth se, in flowin g down the gr dient, energy is rele sed, this energy c uses rot tion of multis u unit wheel-like su unit tt ched to spindle/ xle (g su unit) which lso spins. The spinning of this symmetric lly sh ped spindle unit c uses conform tion l c h nges in the c t lytic su unit (m de of the nd su units) it is tt ched to , ch nging n ADP+Pi inding site to c t lytic site th t c n squeeze the molecul es together into n ATP, nd then fin lly open up to rele se the ATP (fig. 9). H+ H+

H+ H+ H+ H+ H+ c H+ c c c INNER MEMBRANE c H+ b

H+ H+ H+

H+

 ADP + Pi ATP Fi ur 8. ATP synthas . As protons pass throu h th ATP synthas , th y r l as n r y by oin from hi h conc ntration to low. This n r y riv s th rotational mov m nt of th shaft an th n ration of ATP. ADP + Pi ADP Pi L O T ATP L O T ATP ATP ADP Pi T L O L T O ATP ATP Fi ur 9. ATP synthas h a rotation. Th rotatin spin l caus s asymm tric cha n s to th shap of th thr pot ntial bin in sit s, cyclin th m throu h th loos (L) conformation that bin s ADP an Pi, th ti ht (T) conformation that l it rally squ z s th two sustrat s to th r into ATP, an th op n (O) conforma tion that allows ATP. Chapt r 5, M tabolism 1, v rsion 1.5

Pa

69

Uncouplin El ctron Transport from ATP Synth sis So, that is oxi ativ phosphorylation. It pro uctiv ly utiliz s th n r y of th proton ra i nt across th inn r mitochon rial m mbran (cr at by oxi ationpow r pumps) to riv ATP formation at an approximat rat of 3 protons to 1 A TP. Th syst m is normally hi hly s lf-r ulat u to imp rm ability of th in n r mitochon rial m mbran to H+. If th ATP is not us up quickly, th n its co nc ntration slows th action of ATP synthas s, which slow th mov m nt of proton s out of th int rm mbran spac . This buil up of protons will v ntually b no u h that th fr n r y n to transf r a proton into th int rm mbran spac (from th l ctron transport chain) will not b suffici nt to ov rcom th con c ntration ra i nt. El ctron transport is slow , an workin backwar s, th ch ain r action slows r spiration rat s in n ral. As th c ll/or anism r quir s m or n r y an us s up th ATP mor quickly, protons flow mor quickly an th l ctron transport chain is isinhibit . Thus th r is a ir ct association b tw n r spiration rat an physiolo ical n r y n . Int r stin ly, th r is an xc ption to this ti ht couplin of th l ctron transport chain an formation of ATP. Th purpos of brown fat (aka brown a ipos tissu ), which is most oft n f oun in n wborn an hib rnatin mammals, is to n rat nonshiv rin (non-mov m nt-bas ) h at to k p th animal warm. This is accomplish by uncouplin th l ctron transport chain from th ATP synth sis. This uncouplin is a hormonally controll proc ss bas on th pr s nc of a mitochon rial proton chann l call th rmo nin. Th hormon nor pin phrin incr as s pro uction of fr fatty aci s, which op n th th rmo nin chann l. This allows protons to flow from th int rm mbran spac back into th matrix without havin to o throu h ATP synthas . B caus of this, th l ctron transport chain can k p chu in away, ATP l v l s o not buil up, th r is no r uction in r spiration rat , an th xc ss n r y not b in us in ATP pro uction is r l as as h at.

Chapt r 5, M tabolism 1, v rsion 1.5

Pa

70

In fact, 2,4- initroph nol, which is us in a vari ty of r s arch an in ustria l applications to ay, was at on tim us as i tin ru (in th 1930s) b caus throu h a iff r nt m chanism, it too uncoupl l ctron transport from ATP syn th sis. Its m chanism of action riv from its ability to carry an r l as pr otons as it fr ly iffus throu h th mitochon rial m mbran (sinc it is a sm all hy rophobic mol cul ). As this continu s, c lls cataboliz mor an mor sto r s of carbohy rat s an fats, which is th r ason for th int r st by i t rs. Unfortunat ly for som of thos i t rs, this pharmacolo ical m ans of uncouplin th l ctron transport chain from th ATP synth sis ha no r ulation oth r th an th amount of DNP tak n. In cas s of ov r os , r spiration rat s coul ris ramatically whil pro ucin littl ATP an a r at al of h at. In fact, ov r o s illn ss an ath ar n rally u to th spik in bo y t mp ratur rath r t han low r ATP availability. Unfortunat ly, th r ar still som i t rs an bo ybuil rs who s lf-m icat with DNP spit th an rs.

Of cours , it isnt quit that simpl (fi . 8). Startin with th initial mov m nt of protons, as th y mov from th int rm mbran spac into th ATP synthas , th y nt r a small hy rophilic chann l (a) an th n bin onto on of th c-subunit s of th wat r wh l c-rin . Bin in of th H+ to th c-subunit caus s it to los affinity for th asubunit, allowin it to spin, an simultan ously caus s a conf ormational chan that ss ntially push s off a ainst th a-subunit, initiatin th mov m nt. Onc it has spun aroun almost a compl t turn, th H+ is position by anoth r chann l (b), which funn ls it from th c-subunit into th matrix. Th c-subunit structur is conn ct to an asymm tric spin l that is its lf con n ct to th catalytic subunits.

N N H N H

FMNH [ra ical (s miquinon ) form]

O H3C O H3C O O CH3 H (CH2 C CH3 C CH2)10 H H H3C O H 3C O O CH3 R OH H H3C O H 3C O OH CH3 R OH

Co nzym QH (ra ical form)

H2C H3C C H

Fi ur 11. Flavin mononucl oti

Co nzym QH2 (r uc

Co nzym Q (oxi iz

form)

form) an Ubiquinon ar l ctron carri rs.

FMNH2 [r uc

(hy roquinon ) form]

Flavin mononucl oti

(FMN) [oxi iz

(quinon ) form]

Structur of El ctron Carri rs Thou h th y hav b n m ntion fr qu ntly in th arli r parts of this chapt r, th structur s of th l ctron transport chain participants, an particularly o f th moi ti s that t mporarily hol xtra l ctrons, hav not b n a r ss . S o, now is th tim to o so. Th major play rs ar th flavin mononucl oti (FM N) that plays a rol in compl x I, ubiquinon (Co nzym Q), th lipi -solubl l ctron carri r, th h m roups of th cytochrom s, an iron-sulfur clust rs, fo un in compl x s I, II, an III. Flavin mononucl oti (FMN) or flavin a nin inucl oti (FAD), ar pictur in fi ur 11. Not th tripl -rin structur an th thr possibl oxi ation stat s. All thr stat s ar stabl - th s miquin on stat is not m r ly a transi nt form. This stability allows th conv rsion f rom carri rs that can only han l on l ctron to carri rs that can han l two l ctrons, an vic v rsa. Th sam hol s tru for ubiquinon - stabl as ubiquin on (fully oxi iz ), s miubiquinon (ra ical stat ), an ubiquinol (fully r uc ). Alt rnativ nom nclatur for th s mol cul s is Co nzym Q, CoQH+, an CoQH 2. Not th aromaticity ain by ubiquinon wh n it is r uc . This nhanc s i ts stability an its suitability as a r c iv r of l ctrons from NADH. H m rou ps (fi ur 12) ar consi rably lar r, ncompassin a porphyrin rin with an ir on ion h l in its c nt r. This iron ion alt rnat s b tw n f rric (F 3+) an f rrous (F 2+) stat s as th h m roup is oxi iz an r uc , r sp ctiv ly. In th cas of compl x IV, th iron ion can form a compl x with O2, which can th n r c iv th l ctrons b in h l by th rin structur . This lar structur is particularly important b caus it n s to b abl to transf r a total of 4 l c trons to r uc O2 to 2 H2O. Finally, F -S clust rs (fi ur 12) can also act as l ctron carryin moi ti s. Lik in th h m roup, th iron atom can r a ily sw itch b tw n th f rric an f rrous stat s. CH2 HO HO HO C C C CH2 H3C H3C N N N O O H H H3C H3C H H H R N N N O O H H H3C H 3C R N N N O O H O PO32-

CH3 H C N F 3+ N N CH3 N CH2 Cys S2Cys

Cys S2[2F -2S] Clust r Cys H3C CH2 CH2 COOCH2 CH2 COOFi ur 12. L ft: Th h m roup shows on of th possibl combinations of th r oups attach to th outsi of th porphyrin rin . Ri ht: Th F -S c nt rs also hav variations, such as 4 F an 4 S, or v n just 1 F surroun by th S at oms of th four cyst in s. Oth r Catabolic R actions Of cours , for many or anisms, th foo us by c lls is not in th form of simp l lucos solutions, but ma up of various polym ric biomol cul s. Th br ak o wn of thos mol cul s is scrib in th n xt s ctions. Chapt r 5, M tabolism 1, v rsion 1.5

Pa

71

Starch an Glyco n D polym rization Glyco n an starch ar lon branch polym rs of lucos that provi a rapi ly availabl sourc of lucos mol cul s for lycolysis. In omnivor s an h rbivor s, th primary sourc of carbohy rat s (an thus lucos ) is i tary starch. Th catabolism of th amylos an amylop ctin in humans b ins in th mouth with s alivary a-amylas . This nzym br aks a(1-4) bon s of both starch mol cul s xc pt at th n s an n ar branch points (in th cas of amylop ctin). Thou h th s alivary nzym is inactivat by th aci ity of th stomach, a pancr atic a-amyl as o s to work on starch that has r ach th small int stin . Th pro uct of th s i stions inclu s maltos , maltotrios , an xtrins. Th s ar act up on by oth r int stinal nzym s: a- lucosi as r mov s in ivi ual lucos s from o li osacchari s, an a- xtrinas , also known as branchin nzym , can br ak a (1-6) bon s as w ll as th a(1-4) bon s. Glyco n br ak own is iff r nt sinc m ost lyco n br ak own is occurin int rnal to th c lls of an or anism rath r t han in th i stiv tract. Th primary nzym is phosphorylas (also known as lyco n phosphorylas ), which br aks th bon of a t rminal lucos to its n i h bor by substitutin a phosphat roup. This n rat s lucos -1-phosphat , which can b conv rt to lucos -6-phosphat by phospho lucomutas . Th G6P, of cour s , can nt r th lycolytic pathway. A lyco n branchin nzym is also impo rtant, as th phosphorylas is unabl to work clos r than fiv lucos r si u s to a branch sit . Th us of lyco n pr s nts an int r stin qu stion: why us it as an n r y stora mol cul wh n fats ar mor abun ant in most animals, an mor ffici nt at packa in pot ntial n r y? As scrib in th n xt s ction , fatty aci s can only b m taboliz a robically, so th y cannot s rv as a bac kup fu l sourc in ana robic con itions. Furth rmor , v n in a robic con itions , fatty aci catabolism cannot n rat lucos , which is not only n for c llular fu l, but in th bloo str am for f back control m chanisms r ulatin o r anismic m tabolism. HO H HO H CH2 H O H OH HO H O H H CH2 H HO O H OH H O H H CH2 H O H OH (1 HO H O H H CH2 H O H OH 6) link ge Br nching enzyme H O HO H Glycogen synth se

CH2 H O H OH HO H O H CH2 H HO O H OH (1 H O H CH2 H O H OH CH2 H O H H H HO O H OH H O H CH2 H O H OH H OH

Glycogen phosphoryl se HO H H HO H HO CH2 H H 4) link ge H HO H O H CH2 H H O O H O P OOH O O P OHO OH H Glucose-1-phosph te OOH H Glucose-1-phosph te Figure 13. Glycogen is stor ge form of glucose th t is roken down y glycogen phosphoryl se (line r (1-4) onds) nd de r nching enzyme ( r nchpoint (1-6) onds). Phosphoryl se is homodimer th t is llosteric lly controlled y glucose, G6P, nd ATP neg tively, nd y AMP positively. In ddition to llosteric inding sit es for these molecules nd su str te inding site, phosphoryl se lso inds py ridox l-5-phosph te s n essenti l cof ctor. P5P is derived from pyridoxine, or vit min B6. Much like the phosphoglycer te mut se in step 8 of glycolysis, phos phoglucomut se is phosphoryl ted enzyme th t tempor rily tr nsfers is phosph t e group to the su str te to form glucose-1,6- isphosph te intermedi te. De r n ching enzyme ctu lly h s two functions: it tr nsfers tris cch ride from 4-s ug r r nch on the 1 side of n (1-6) r nching link ge to the end of r nch co nnected to the 6 side of the r nchpoint. It then hydrolyzes the (1-6) connecting the fin l glucose of the r nch, le ving n un r nched ch in of glucose for pho sphoryl se to tt ck. F tty Acid Bre kdown Hormone-sensitive lip se in dipose tissue hydrolyzes the stored f t in those ce lls into glycerol nd f tty cids. Glycerol c n enter the glycolytic cycle vi c onversion to dihydroxy cetone phosph te ( two-step conversion using glycerol ki n se nd glycerol3-phosph te dehydrogen se). The f tty cids re secreted from t he dipose cells into the loodstre m where they ind to c rrier protein, l u min. This complex c n then e rought inside of other cells y endocytosis, wher

Ch pter 5, Met olism 1, version 1.5 P ge 72

e they c n e roken down

s n energy source.

CH3 H 3C N+ C CH3 H C H C H C L-C rnitine C rnitine Acyl-C rnitine Acyl - CoA F tty Acid + Acetyl-CoA TCA CYCLE O H3C (CH2)n C SCoA F tty cyl-CoA FAD cyl-CoA dehydrogen se FADH2 O H3C C SCoA O 1 SCoA H3C (CH2)n-2 C C rnitine P lmitoyltr nsfer se I H O + H3C (CH2)n-2 C Acetyl-CoA F tty cyl-CoA C C SCoA H 2-Enoyl-CoA tr ns- -keto cyl-CoA thiol se enoyl-CoA hydr t se 4 2 HO CoA Tr nsloc se C rnitine P lmitoyltr nsfer se II O H3C (CH2)n-2 C CH2

O C SCoA 3-L-hydroxy cyl-CoA dehydrogen se 3 NADH + H+ NAD+ H H3C (CH2)n-2 C CH2 OH 3-L-Hydroxy cyl-CoA O C SCoA Acyl-C rnitine C rnitine -Keto cyl-CoA Acyl - CoA + C rnitine

C rnitine deficiency syndromes c n occur when there is either dysfunction l mu t tion of c rnitine p lmitoyltr nsfer se or severe deficiency of intr cellul r c rnitine. Since most of the c rnitine in the ody is found in c rdi c nd volu nt ry muscle, the usu l symptoms re muscle we kness nd c rdi c rrhythmi s, s well s hypoketosis. In neon tes, the rrythmi s c n le d to de th. C rnitine s upplement tion is successful tre tment in systemic c rnitine deficiency due to either low c rnitine int ke or defects in the c rnitine tr nsporter em edded in the cell mem r nes. However, if the defect is in the p lmitoyltr nsfer se, supp lement tion will e unsuccessful. C rnitine is widely sold s diet ry suppleme nt for incre sing weight loss y enh ncing f t c t olism. The sic ide is o v ious: c rnitine is needed for long-ch in f tty cid re kdown, so more c rnitine = more f t urned. However, th t only holds true if c rnitine levels re elow s tur tion levels for the p lmitoyltr nsfer ses. Bec use 75% of the c rnitine in the ody must e ingested (only 25% is synthesized), this is mild possi ility , depending on diet. Currently, the iomedic l community h s not re ched conse

performed y one of f mily of enzymes known s cyl-CoA synthet ses or thiokin ses, nd requires Coenzyme A nd ATP hydrolysis. These re ctions occur either o n the cytopl smic surf ce of the mitochondri l outer mem r ne or the endopl smic reticulum, where cyl-CoA synthet ses re em edded. In the second re ction, c r nitine p lmitoyltr nsfer se I on the outside of the inner mitochondri l mem r ne links the cyl ch in to c rnitine, rele sing CoA. The cyl-c rnitine is tr nspo rted into the mitochondri l m trix where c rnitine p lmitoyltr nsfer se II rele ses the f tty cyl ch in from the c rnitine nd re tt ches it to n molecule of CoA. In the mitochondri l m trix, oxid tion occurs in four steps to yield n cyl-CoA ch in th t is shortened y two c r ons, nd n cetyl-CoA th t c n then enter the TCA. . The refers to the second closest c r on to the one tt ched t o CoA. The ond th t will e roken is the ond etween the nd c r ons. All even-num ered, fully s tur ted, f tty cids c n thus e completely oxidized. Th e presence of dou le onds in uns tur ted f tty cids introduces complic tions t o this process th t must e ddressed using ddition l enzymes th t either move the dou le ond or remove it. Most nim ls nd pl nts gener te even-num ered f t ty cids; however, some m rine nim ls (e.g. smelt, mullet) nd some pl nts nd cteri synthesize odd-ch in f tty cids s well. The s me enzymes responsi le for oxid tion of even-num ered f tty cids c n h ndle odd-num ered f tty cids s well, except th t the fin l degr d tion yields propionyl-CoA inste d of cet yl-CoA. Ch pter 5, Met olism 1, version 1.5

Figure 15. F tty cid re kdown

y C rnitine P lmitoyl Tr nsfer ses.

Figure 14.

oxid tion of f tty cids h ppens in the mitochondri l m trix.

nsus on the effic cy of c rnitine supplement tion on f tty cid oxid tion in c r nitine-sufficient persons. P ge 73 O OAcyl-CoA Synthet se -oxid tion H HO H The re kdown of f tty cids occurs y oxid tion inside the mitochondri l m tr ix (fig. 14). Since the inner mitochondri l mem r ne is imperme le to long-ch i n free f tty cids, they must first e ctiv ted to f tty cyl-CoA nd linked to c rnitine, n mino cid deriv tive synthesized from methionine nd lysine (see Fig. 15). The first step is

Propionyl-CoA c r oxyl se O H3C H2C C S CoA ATP ADP + Pi H OOC C CH3 O C S CoA Propionyl CoA CO2 (S)-Methylm lonyl CoA Methym lonyl-CoA R cem se O OOC CH3 CH3 Succinyl-CoA C S CoA Methylm lonyl-CoA mut se H H3C C O C S CoA COO(R)-Methylm lonyl CoA Propionyl-CoA is converted to succinyl-CoA through series of three enzymes: pr opionyl-CoA c r oxyl se, methylm lonyl-CoA r cem se, nd methylm lonyl-CoA mut s e. The succinyl-CoA could theoretic lly enter the TCA cycle, ut rec ll th t the succinylCoA is simply recycled nd never ctu lly consumed y the TCA cycle. Th us, in order for the succinyl-CoA to contri ute to the energy needs of the cell, it must first e converted to m l te (steps 6-8 of TCA cycle), which is then co nverted to pyruv te y m lic enzyme, lso known s dec r oxyl ting m l te dehydr ogen se. Pyruv te c n then enter nd e consumed y the TCA cycle. In ddition t o oxid tion in the mitochondri , f tty cids lso undergo oxid tion in peroxis omes. However, gener lly, the oxid tion in peroxisomes is limited, nd the purpo se is to shorten long f tty cids in prep r tion for fin l degr d tion in the mi tochondri . In ddition to the more common single-ch in f tty cids, cells will lso encounter r nched f tty cids, which lock oxid tion is lkyl group is o n the c r on. In these c ses, phyt nic cid for ex mple, oxid tion is necess ry to gener te n intermedi te with the lkyl group on the c r on. This is th en followed y oxid tion to completion. Fin lly (with respect to f tty cid c t olism), it must e noted th t in liver especi lly, l rge p rt of the cetyl -CoA gener ted y oxid tion of f tty cids does not enter the TCA cycle. Inste d , it is converted into ceto cet te or D- -hydroxy utyr te, which long with ce tone, re known, somewh t iz rrely, s ketone odies. These molecules re w ter solu le, nd tr nsported through the loodstre m s energy sources for v riet

y of tissues, even including r in, which typic lly only uses glucose s fuel si nce f tty cids c nnot p ss through the lood- r in rrier. However, ketone od ies c n penetr te nd re used y r in cells under st rv tion conditions. Ch pter 5, Met olism 1, version 1.5 Vit min B12, or 5-deoxy denosylco l min, is coenzyme component of methylm lony l-CoA mut se, ut it is not m de y either pl nts or nim ls. It is only m de y cert in cteri , some of which live in the intestin l tr cts of her ivores. He r ivores thus sor the B12 for their use, nd c rnivores o t in their B12 from e ting her ivores. Defects in methylm lonyl-CoA mut se or severe deficiency in vit min B12 (most often in veget ri ns) c n le d to methym lonyl ciduri / cidem i , th t c n e f t l in untre ted inf nts due to cidosis. However, depending o n the c use, it c n e tre ted with high doses of B12 nd/or y voiding diet ry oddch in f ts nd proteins rich in isoleucine, leucine, or methionine, which l so c t olize to propionyl-CoA. Pernicious nemi , in which usu lly elderly p ti ents h ve very low levels of red lood cells nd hemoglo in, s well s neurodeg ener tion, is lso rel ted to B12. However, it is usu lly not due to vit min d eficiency, ut r ther to the insufficient secretion of intrinsic f ctor, which inds B12 in the stom ch nd then is t ken into intestin l cells y receptor-medi ted endocytosis. Keto cidosis is condition in which ketone odies re eing produced much f ste r th n they re used. This le ds to uildup of the molecules in the loodstre m, which lowers the pH, since the molecules re cidic. An e sy di gnostic of ke to cidosis is sweet somewh t fruity smell (of cetone) on the re th. This con dition c n e n indic tion of di etes, ut m y lso occur when person is con suming high-f t/low-c r diet. When the odys met olism is not using glucose/c r ohydr tes s the prim ry food source for either re son, f t is used inste d, incre sing production of ketone odies. Left untre ted, severe keto cidosis c n le d to cell d m ge s the lood cidifies, nd compens tion y incre sed exh l tion of c r on dioxide nd le d to respir tory f ilure in suscepti le individu l s. P ge 74

Amino Acid Degr d tion Proteins re roken down y v riety of prote ses th t hydrolyze the peptide o nds to gener te sm ller peptides nd mino cids. Those mino cids th t re not used for uilding new proteins m y e roken down further to enter the met oli c processes discussed in this ch pter. In their conversion to met olic intermed i tes, the mino cids first undergo de min tion. The prim ry go l of de min tio n is to excrete excess nitrogen ( s ure ) nd then use or convert (to glucose) t he rem ining c r on skeleton. This de min tion is two-p rt process: the first step to de min tion is usu lly tr ns min tion c t lyzed y n minotr nsfer se , in which the mino group of the mino cid is tr nsferred to -ketoglut r te w hich then yields new -keto cid of the COOCH2 CH2 C O R tr ns min se COOH CH2 CH2 HC NH2 R + H C NH2 + C O There is l rge v riety of prote ses, cl ssified into one of six groups ( s of 2008): serine prote ses, met lloprote ses, sp rtic cid prote ses, cysteine pro te ses, threonine prote ses, nd glut mic cid prote ses. All of them work y fo rming nucleophile t their ctive site to tt ck the peptide c r onyl group. T hey differ in the construction of their ctive sites, nd the specificity of the t rget sequences to e cle ved. The MEROPS d t se (http:// merops.s nger. c.u k/) lists hundreds of enzymes nd their specific recognition sites. As with othe r enzymes, recognition is sed on form tion of st ilizing hydrogen onds etwe en enzyme nd t rget. In the c se of prote ses, m ny of the import nt st ilizin g onds must e formed right round the cle v ge site, thus le ding to specific recognition sequences. Although cle v ge is often thought of s w y of destroy ing the ctivity of protein, in f ct, specific cle v ge of inhi itory p rts of protein c n ctiv te it. A prominent ex mple of this (the c sp se c sc de) is discussed in the poptosis section of the cell cycle ch pter. Some prote ses r e secreted nd do their work extr cellul rly. These include digestive enzymes su ch s pepsin, trypsin, nd chymotrypsin, s well s loodstre m prote ses like t hrom in nd pl smin th t help control clotting. The immune system lso uses prot e ses to destroy inv ding cells nd viruses.

COO-Keto cid COO-Ketoglut r te COOGlut m te mino cid nd glut m te. The mino group of glut m te could then tr nsferred to ox lo cet te to form -ketoglut r te nd sp rt te. Th t series of tr ns min ti ons tr nsforms the origin l mino cid, ut does not get rid of the mino group

COO-Amino

cid

COOCH2 CH2 C O + NH3+ NAD+ NADH H O COOGlut m te COO-Ketoglut r te ut r te nd mmoni , using either NAD+ or NADP s the oxidizing gent. The mino cids re k down into one of the following seven met olic intermedi tes: pyruv te, cetyl-CoA, ceto cet te, -ketoglut r te, succinyl-CoA, fum r te, nd ox l o cet te s follows: 1) Al , Cys, Gly, Ser, Thr, Trp re k down to pyruv te; 2) Ile, Leu, Lys, Thr to cetyl-CoA; 3) Leu, Lys, Phe, Trp, Tyr to ceto cet te; 4) Arg, Glu, Gln, His, Pro to -ketoglut r te; 5) Ile, Met, V l to succinyl-CoA; 6 ) Asp, Phe, Tyr to fum r te; 7) Asn, Asp to ox lo cet te. Ch pter 5, Met olism 1, version 1.5 P ge 75

nitrogen. The ltern tive p thw y is de min tion of the glut m te ehydrogen se, which gener tes -ketoglCOO CH2 CH2 HC NH3+ glut m te dehydrogen se

y glut m te d

Br in Glucose Ketone odies Liver Ketone odies Adipose Tissue Tri cylglycerols F tty cids + Glycerol Acety l CoA F tty cids Tri cylglycerols Glycogen Glycerol L ct te Pyruv te Glucose Gl ucose Ure Amino cids Proteins Kidney

Glucose

L ct te Pyruv te Glycogen Glucose Figure 16. Overview of hum n m jor met olites. Although most cells in the ody c rry out m ny of the met olic ctivities descri ed in this ch pter nd the nex t, the dv nt ge of multicellul r org nisms is th t cert in cell types, tissues, or org ns m y ecome speci lized to process p rticul r met olic re ctions more efficiently th n other cells, nd thus t ke on lot of th t urden for the org nism. Ch pter 5, Met olism 1, version 1.5 P ge 76

Al nine + Glut mine Muscle F tty cids Amino

Ketone odies Ure Glut mine Ammoni

-Ketoglut r te

cids Ketone odies Proteins

Met olism 2 : An olic Re ctions of the Cell An olic Re ctions As pointed out t the eginning of this ook, most of the energy for life on thi s pl net origin tes from the sun. In the l st ch pter, the discussion w s on the re kdown of complex molecules such s sug rs nd f ts th t hold gre t, ut dif ficult to ccess, potenti l energy to produce molecules like ATP th t c n ct s more re dily ccessi le sources of cellul r energy. This energy is then used to synthesize the more complex iomolecules necess ry to uild living cells. Th t synthesis, the form tion of sug rs, f tty cids, nd mino cids, is the focus o f this ch pter. Although technic lly the polymeriz tion of nucleic cids nd pro teins re n olic processes, they re not included in this ch pter nd re ex m ined in det il sep r tely.

Photosynthesis In one w y or nother, the energy of sug r nd f t fuel molecules is derived fro m photosynthesis - the conversion of sol r light energy into chemic l ond energ y, whether directly in photosynthetic pl nt cells nd cert in photosynthetic c teri , or indirectly y the ingestion of those pl nts nd cteri . Photosynthes is is simple ide : tmospheric c r on dioxide molecules re joined with w ter molecules to form sug rs nd oxygen: CO2 + H2O light CH2O + O2

The production of us le energy from sunlight nd the fix tion of tmospheric c r on dioxide re two sep r te sets of re ctions. In pl nts, photosynthesis t kes pl ce only in cells cont ining chloropl sts. Chloropl sts re org nelles with n evolution ry origin suspected to e simil r to th t of mitochondri , nd like mitochondri , chloropl sts gener te ATP nd use nicotin mide- sed high-energy electron c rrier. There re further simil rities: they oth h ve highly folded inner mem r nes, though in chloropl sts, there re three mem r nes in ll, while mitochondri only h ve two. Fin lly, Ch pter 6, Met olism 2, version 1.0 P ge 77

Using this ook: This ook is designed to e used in oth introductory nd ced cell iology courses. The prim ry text is gener lly on the left side of vertic l divider, nd printed in l ck. Det ils th t re usu lly left to n nced course re printed in lue nd found on the right side of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither side of the divider.

dv n the dv Fin on e

H2C H3C CH CH3 H C N Mg N N CH3 N H CH3 H3C H H CH2 CH2 H O C O CH3 CH3 O O H C H C O

n electron tr nsport ch in is em edded in the thyl koid mem r ne of chloropl st s, functioning very simil rly to electron tr nsport in the mitochondri . In ddi tion to the electron tr nsport components nd ATP synth se (structur lly nd fun ction lly lmost identic l to mitochondri l ATP synth se), the thyl koid mem r n e is lso rich in set of molecules th t re not found in the inner mitochondri l mem r ne: light- sor ing pigment molecules. In pl nts, these pigment molecul es f ll into two cl sses: the chlorophylls nd the c rotenoids (fig. 1) ut only the chlorophylls c n medi te photosynthesis. Photosynthetic cteri do not con t in chlorophyll, ut do h ve c rotenoid pigments th t c n c rry out photosynthe sis. Both re hydropho ic hydroc r ons th t re held in pl ce within the pl ne o f the mem r ne y tr nsmem r ne proteins. Chlorophylls re e sily recogniz le y the very l rge Mg++-cont ining porphyrin ring, while the c rotenoids re long hydroc r on ch ins th t m y or m y not h ve sm ll ring structures on the ends (e .g. -c rotene). While there is v ri tion in the chlorophyll f mily, they ll im p rt green color to the le f. C rotenoids, on the other h nd h ve much wider r nge of colors from yellows to reds. Both chlorophylls nd c rotenoids re l e to sor light energy of p rticul r w velength/energy r nge nd enter n un st le excited st te. When the molecule returns to its ground st te, the energy would e emitted s he t or light in n isol ted situ tion. However within the c ontext of the pigment rr ys ( ntenn complex) in living cell, most of the ene rgy is shuttled to nother pigment molecule of lower energy y reson nce tr nsfe r. As descri ed elow, only one p ir of chlorophyll molecules in n ntenn comp lex will ctu lly eject n electron s it drops from n excited st te ck to gr ound st te. It is the tr nsfer of th t high-energy electron th t powers photosyn thesis. Photosynthesis c n e divided into two mech nisms: the light re ctions, which use light energy to excite the electrons of cert in chlorophylls, nd p rt icip te in the electron tr nsport ch in to gener te ATP nd NADPH, nd the d rk re ctions, which use th t ATP nd NADPH to fix c r on from CO2 into org nic mole cules (c r ohydr tes). As the n me implies, the light re ctions require light en ergy to excite the chlorophyll nd egin electron tr nsport. D rk re ctions, how ever, do not require d rkness. They re technic lly light-independent, ut in so me pl nts, the d rk re ctions run etter in the light for re sons to e discusse d. The light re ctions re intim tely tied to the n tomy of the thyl koid mem r ne; specific lly, the rr ngement of light- sor ing pigment molecules in nten n complexes, lso c lled light-h rvesting complexes (sometimes revi ted LHC, not to e confused with the L rge H dron Collider). These pigments re held y proteins in ordered three-dimension l groups so th t the pigments th t sor th e highest energy Ch pter 6, Met olism 2, version 1.0

CH3 CH3 CH3 H3C CH3 CH3 CH3 CH3 CH3

Chlorophyll molecules re m de up of phytol hydroc r on t il th t nchors the molecule within mem r ne, nd n electronc rrying porphyrin ring cont ining m gnesium c tion. Note th t the phytol t il is not dr wn to sc le with the porph yrin ring in figure 1. Among different types of chlorophyll, the chemic l groups tt ched to the ring m y v ry, nd this v ri tion is responsi le for difference s in the sorption spectrum from one type of chlorophyll to the next. For ex mp le, chlorophyll h s sorption pe ks t pproxim tely 430 nd 662 nm, where s chlorophyll h s pe ks t 453 nd 642 nm. The difference etween the two is sm ll: t C7, there is CH3 group on chlorophyll , ut CHO group on chlorophyll . Presently, there re five known chlorophylls: chlorophyll is found in ll ph otosynthetic org nisms, chlorophyll is only found in pl nts, chlorophylls c1 nd c2 re found in photosynthetic lg e, nd chlorophyll d is found in cy no ct eri . C rotenoids h ve two functions. As noted in the prim ry text t left, they c n p rticip te in energy tr nsfer in tow rd the re ction center chlorophylls. They re lso protect nt molecule, preventing re ction center uto-oxid tion. C rotenoids c n e highly efficient free r dic l sc vengers due to the conjug ti on of ltern ting single-dou le c r on ond structures. P ge 78

Figure 1. Chlorophyll (top) nd

-c rotene ( ottom)

PHOTON 4 H+ PQB PQA Pheophytin P680 2e PQH2

2 HO O2 4 H+ Figure 3. Photosystem II (which feeds electrons into photosystem I). -1.5 Thyl koid Mem r ne REACTION CENTER P700 -1.0 A0 A1 Electron Tr nsport Ch in Fe-S 2ePl stoquinone Electron Tr nsport Ch i n 2eFe-S Ferredoxin eFerredoxin-NADP+ Reduct se Antenn Complex Chlorophyll Pigment Molecule P680 -0.5 Energy of Electrons (volts) Fe-S

When excited, the re ction center chlorophyll of photosystem II (figure 3) egin s the process of electron tr nsport. This chlorophyll is p rt of protein compl ex th t lso includes Mn- sed oxygen-evolving complex (OEC), pheophytin, nd docking site for pl stoquinone. Although the chlorophyll electron is the one e xcited y the sol r energy, the origin of the electrons to keep the chlorophyll replenished comes from the splitting (oxid tion) of w ter to O2 nd 4 H+. The qu estion of how cell could gener te the energy needed to split w ter w s long

Figure 2. Pigment molecules re mem r ne.

rr nged in n ntenn

complex in the thyl koid

Mn-C

light re tow rd the periphery, nd the lowest-energy- sor ing chlorophylls re in the center (fig. 2). Sunlight is composed of ro d r nge of w velengths, s ome of which re tr nsiently sor ed y the pigments. After pigment molecule sor s photon, the energy is rele sed nd p ssed on to pigment tuned to s lightly lower energy level (longer w velength), nd from there to n even lowerenergy pigment, nd so on until it re ches the re ction center chlorophylls. In this w y, energy from wide r nge of light w velengths/energies c n ll contri ute to the ATP nd NADPH production y the light re ctions. The ntenn complex is cruci l ec use it llows the use of gre ter portion of the sol r light spe ctrum. And, s tightly-p cked three-dimension l rr y, photons th t p ss y on e pigment molecule m y well hit nother one on its w y through the rr y. All of these ch r cteristics com ine to incre se the efficiency of light use for photo synthesis. The re ction center chlorophylls (P680 for photosystem II, P700 for p hotosystem I) re the only chlorophylls th t ctu lly send excited electrons int o the electron tr nsport ch in. The other chlorophylls nd pigments only ct to tr nsfer the energy to the re ction center. LIGHT

thorny issue ec use w ter is n exception lly st le molecule. The current mode l suggests th t the energy comes from n extremely strong oxidizer in the form o f P680+. After P680 is energized y light, n excited electron h s enough energy to re k w y from the chlorophyll nd jumps to pheophytin. Pheophytin ecomes Pheo- tempor riCh pter 6, Met olism 2, version 1.0 0 2e2eCytochrome 6f Complex 2ePl stocy nin 2ePhoton Antenn Arr y +0.5 Photon Antenn Arr y H+ + NADP+ NADPH +1.0 HO 1/2 O2 + 2H+ Photosystem I 2ePhotosystem II +1.5 Figure 4. Ch nge in electron energy moving through photosystems II nd I. Light energy is needed in oth photosystems to oost the electron energy high enough t o move to the next electron c rrier. P ge 79

The OEC, or oxygen-evolving complex ( lso WOC, w ter oxidizing complex) is met lloenzyme with Mn4OXC c t lytic cluster, where X is the num er of m-oxo- rid ges connecting the met l toms, with surrounding mino cids, especi lly cruci l tyrosines, lso pl ying role in the coordin tion sphere of the ctive site. T he over ll complex undergoes series of 4 oxid tion st te ch nges s the P680 c hlorophylls re excited y the light energy nd tr nsfer electrons, ut t prese nt it is not known wh t the ex ct oxid tion st te of ny given Mn tom is throug h this series of st te ch nges. The cruci l re ction is the form tion of the O-O ond to form O2. There re two proposed models for this mech nism. One is th t the O-O ond is formed when the OEC h s re ched its fully oxidized st te, nd n oxygen in m-oxo- ridge r dic l st te inter cts with w ter molecule. The oth er proposed mech nism is th t the O-O ond forms e rlier s complexed peroxide held y the OEC center. Line r P thw y Cyclic 1e- P thw y FD PHOTON 2 H+ 2 NADP+ 1e-

ly, nd the ch rge sep r tion in the complex etween P680+ nd Pheo- helps to en h nce the oxid tive power of P680+. Th t extr ordin rily strong ttr ction for e lectrons is wh t llows the P680 chlorophyll to te r them w y from H2O nd spli t the w ter. In f ct, P680+ is one of the strongest iologic l oxidizers known. Since four electrons must e t ken to fully oxidize two w ter molecules nd gene r te molecul r oxygen, four photoexcit tion events re needed. While the ex ct m ech nism is still to e elucid ted, it ppe rs th t the OEC helps to st ilize t he w ter molecule during this process s well s holding onto e ch electron s i t comes off. The excited electrons, moving from the OEC to P680+ to pheophytin, next move to the lipid-solu le c rrier, pl stoquinone. The simil rity of the n m e with the mitochondri l c rrier u iquinone is not coincidence. They function simil rly, nd s the pl stoquinone t kes on the electrons, it lso t kes on pro tons from the strom l side of the thyl koid mem r ne. The PQ moves within the me m r ne from pheophytin to cytochrome 6f. As the electrons re tr nsferred to cy tochrome 6f, the protons re then dropped off on the lumen l side of the mem r ne, incre sing their concentr tion in the chloropl st lumen, nd uilding prot on gr dient to power ATP synth se. Cytochrome 6f p sses the electrons on to pl stocy nin, n queous-ph se c rrier, which shuttles the electrons to the P700 re ction center chlorophyll of photosystem I. However, fter ll the tr nsfers, th e energy level of the electrons is now f irly low (fig. 4) nd un le to power t he upcoming re ctions. Since it is now on re ction center chlorophyll, the o v ious nswer is to re-energize it with it of sunlight. This r ises the electro n energy sufficiently to reduce ferredoxin. Now things get little complic ted. This p rt of photosynthesis c n t ke one of two directions, the line r p thw y, which gener tes oth NADPH nd ATP, nd the cyclic p thw y which mostly gener t es ATP. Most of the time, the line r p thw y is t ken, with the electrons on fer redoxin tr nsferred vi ferredoxin-NADPH reduct se (FNR) onto NADPH. However, so metimes the cell requires signific ntly more ATP th n NADPH, in which c se, the electrons from ferredoxin re tr nsferred ck to pl stoquinone vi ferredoxin-p l stoquinone reduct se. This cts just s descri ed ove, nd pumps more proton s cross the mem r ne to power the ATP synth se. ATP synthesis goes up nd NADPH synthesis goes down. The ATP nd NADPH gener ted y the chloropl st re lmost exclusively used y the chloropl st itself ( nd not distri uted to the rest of t he cell) to power the d rk re ctions, which re energetic lly expensive. In f ct , when the light re ctions re not running due to d rkness, some pl nt cells h v e mech nisms to prevent the d rk re ctions from using the limited resources of c ellul r, non-chloropl stic, respir tion. The simplest method of such limit tion is the pH sensitivity of ru isco (ri ulose is-phosph te c r oxyl se), t le st in C3 pl nts (see elow). Ru isco h s very sh rp pH optimum Ch pter 6, Met olism 2, version 1.0

2 NADPH FNR Fe-S Fe-S Fe-S PQH2 8 H+ Fe-S A1 A0 P700 PC THYLAKOID MEMBRANE 8 H+ 1ePhotosystem I Figure 5. Photosystem I initi tes electron movement through two p thw ys. P ge 80

t out pH 8.0, so while the light re ctions re running nd the protons re e ing pumped, the pH rises to out 8 nd ru isco works, ut in the d rk, the pH d rops ck to its s l level close to 7.0, inhi iting ru isco ctivity.

The C lvin Cycle CH2 HO H 6 CO2 C C C O OH O PO32OC CH2 C H H C C O OH OH O PO32Phosphoglycer te kin se O PO32COOCH2 6 C r oxyl se intermedi te O PO32Ri ulose isphosph te c r oxyl se O OH O PO32H C 1 CH2 12 3-Phosphoglycer te 12 ATP 12 ADP + 12 Pi CH2 6 Ri ulose-1,5- isphosph te 6 ADP + 6 Pi 6 ATP 2 Tr nsketol se Ri ose phosph te isomer se Phosphori ulokin se CALVIN CYCLE H O C C O OH O PO32PO32H C H C O OH Glycer ldehyde-3-phosph te dehydrogen se CH2 12 1,3-Bisphosphoglycer te O PO3210 Glycer ldehyde-3-phosph te CH2 H C O OH H 3 12 NADPH 12 NADP+ 12 Pi

To c yto p l s m C CH2 O PO3212 Glycer ldehyde-3-phosph te H C H C O OH Sug rs O PO322 Glycer ldehyde-3-phosph te CH2 Figure 6. The C lvin cycle fixes tmospheric c r on to ri ulose 1,5- isphosph te to form the org nic 3-c r on intermedi te 3-phosphoglycer te for the form tion of sug rs. The d rk (c r on fix tion) re ctions v ry depending on the type of pl nt. The mo st common set of c r on fix tion re ctions is found in C3-type pl nts, which re so n med ec use the m jor st le intermedi te is the 3-c r on molecule, glycer ldehyde-3-phosph te. These re ctions, est known s the C lvin cycle (fig. 6), fix CO2 onto the pentose, ri ulose 1,5- is-phosph te (RuBP). The production p rt of the cycle egins with form tion of RuBP from glycer ldehyde-3-phosph te. The n, the r te-limiting step occurs: Ch pter 6, Met olism 2, version 1.0 P ge 81

Ri ulose 1,5- isphosph te nd CO2 re joined together y ru isco. C r oxyl ses re rel tively slow enzymes s f mily, nd ru isco is one of the slowest. A 6-c r on intermedi te is formed ut it is unst le, nd quickly re ks down to yiel d two molecules of 3-phosphoglycer te. Some f mili r enzymes (from glycolysis, lthough this is h ppening in the strom , not the cytopl sm) now come into pl y. Phosphoglycer te kin se phosphoryl tes 3-PG to 1,3- isphosphoglycer te. 1,3-BPG is then reduced y glycer ldehyde-3-phosph te dehydrogen se to form glycer ldehy de3-P. This step requires the energy rele sed from oxid tion of NADPH. A sm ll p ortion (1/6th) of the GAP th t is m de is then exported from the chloropl st nd will e used to form more complex c r ohydr tes. However, the m jority is recyc led through the recovery ph se of the C lvin cycle to regener te NADP. As if h v ing centr l enzyme th t moves t sn ils p ce nd needing to recycle the m jor ity of its potenti l product w s not d enough, C3 pl nts lso h ve to contend with the hij cking of ru isco for competing, nd energy-w sting, set of re cti ons known s photorespir tion. Under conditions of low CO2 nd high O2 in the lo c l tmosphere, oxygen, inste d of c r on dioxide, inds to ru isco nd forms 3PG nd 2-phosphoglycol te from its re ction with RuBP. As det iled in figure 7, the 2-phosphoglycol te is dephosphoryl ted to glycol te nd tr nsported out of t he chloropl st. From there, it undergoes series of re ctions in the peroxisome s nd mitochondri to tr nsform it to 3-PG, which c n then go in the chloropl st nd p rticip te in the C lvin cycle. Unfortun tely for the cell, in the course of these re ctions, NADH nd ATP re used, thus lowering the energy v il ility inside the cell. This is p rticul r pro lem in hot clim tes, ec use the oxyg en se ctivity of ru isco incre ses more th n the c r oxyl se ctivity s the te mper ture incre ses. This le ds to n interesting side effect: in C3 pl nts, s the temper ture rises nd CO2 is outcompeted y O2 for ru isco inding, the stom t of the le ves need to rem in open for longer in order to llow for cquisiti on of enough CO2 from the tmosphere. This in turn llows more w ter v por from inside the cell to esc pe, le ding to dehydr tion. C3 pl nts re thus t compe titive dis dv nt ge in hot dry clim tes in comp rison to pl nts th t do not use ru isco for c r on fix tion. Wh t out pl nts d pted to such clim tes? C4 pl n ts, which include some gr sses, corn, sug rc ne, nd weeds, utilize PEP c r oxyl se (which does not h ve the nnoying photorespir tory c p ilities of ru isco nd higher ffinity for CO2) to fix c r on dioxide to PEP, m king ox lo cet te. In n interesting twist, the ox lo ctet te, fter conversion to m l te, is dec r oxyl ted to yield CO2 g in, which is fed to ru isco nd the c lvin cycle. The C4 mech nism, lso c lled the H tch-Sl ck p thw y, utilizes two Ch pter 6, Met olism 2, version 1.0 OC H CH2 C H H C C O OH OH O PO32H O PO32O2 C O H H2O PO32H OC C O H O PO322-Phosphoglycol te O H Glycol te Ru isco + OC C O OH O PO32CH2 Tr nsported to peroxisome O2 H2O2

CH2 Ri ulose-1,5- isphosph te OC H C O Glyoxyl te O C lvin Cycle 3-Phosphoglycer te ADP + Pi ATP Tr nsported to chloropl st OC H C O OH H OC C NH2 Glycine O H CH2OH Glycer te NAD+ NADH OC C O O

CH2OH Pyruv te Tr nsported to peroxisome NH2 Serine

PEP c r oxyl se ctu lly fixes HCO3- to PEP r ther th n CO2 directly. The tmosp heric CO2 is converted to the ic r on te y c r onic nhydr se. P ge 82

Figure 7. Photorespir tion. Ru isco c n c t ducing 3PG, which c n e used y the C lvin is converted to glycol te, tr nsported out cer te over sever l steps in the peroxisome o the chloropl st. This is n energetic lly used).

Tr nsported to mitochondri NADH NAD+ OC H C O CH2OH

lyze the ddition of O2 to RuBP, pro cycle, nd 2-phosphoglycol te, which of the chloropl st, converted to gly nd mitochondri , nd shipped ck t expensive process (note NADH nd ATP

sets of cells, n outer l yer (mesophyll) th t t kes in ir nd fixes the CO2 to PEP nd produces m l te, nd n inner l yer of cells ( undle she th) th t t kes the m l te, nd dec r oxyl tes it for its ru isco enzyme. The two cells re con nected vi pl smodesm t (see Cell-cell Inter ctions ch pter). Although energeti c lly more expensive th n c r on fix tion y C3 pl nts in cooler clim tes, the C 4 p thw y overt kes C3 in efficiency s temper tures rise nd photorespir tion i ncre ses. Desert pl nts go one step further th n C4 pl nts. Living in environmen ts th t re extremely hot nd dry during the d y, ut rel tively cool t night, m ny desert succulents (like c cti) re diurn l, nd only open their stom t t night (when temper tures re signific ntly lower nd w ter ev por tes f r more s lowly) for CO2 g thering, which is then fixed vi the CAM p thw y to m l te. The n in the d ylight hours, CO2 is rele sed from the m l te nd used in the C lvin cycle to gener te c r ohydr tes.

Pentose Phosph te P thw y NADPH is found not only in pl nts, ut in nim l cells s well. Although our fir st discussion of NADPH w s in the context of photosynthesis, it is lso gener l reducing gent in ny cell. It is lso cruci l to note th t though introductor y texts often consider NAD+/NADH nd NADP/NADPH simil rly s high energy electro n c rriers, nd lthough they re structur lly differenti ted only y phosph t e group (on the 2-OH of denosine), they re not interch nge le in the met olic p thw ys of cell. NADP/NADPH is used in reductive met olic p thw ys, where s NAD+/NADH is used in oxid tive p thw ys. With such n import nt role in iosynt hesis, it is no surprise th t its production is p rt of m jor met olic p thw y, the pentose phosph te p thw y (figure 7), lso c lled the phosphoglucon te p thw y, nd the hexose monophosph te shunt. In step 1 of this p thw y, glucose-6phosph te nd NADP+ re ound to glucose-6phosph te dehydrogen se, which tr nsfe rs hydride ion from glucose-6-phosph te to NADP+ to form 6-phosphoglucono-d-l ctone nd NADPH. -2O 3P

O H HO CH2 H OH H -2O O H OH H OH

The cr ssul ce n cid met olism (CAM) p thw y is n med for c r on fix tion p thw y discovered in the Cr ssul ce e f mily of succulent pl nts including pine p ples s well s v rious c ctus species. It utilizes simil r iochemic l mech n ism s the C4 p thw y, ut occurs within single photosynthetic cell. The m jor difference is th t the CO2 is only t ken in t night, nd it quickly turned int o m l te, which is stored in v cuoles until d ytime. The m l te is then rele sed nd dec r oxyl ted to provide the RuBP c r oxyl se (ru isco) with ste dy stre m of CO2 for fix tion. Bec use there is such rush of PEP c r oxyl se ctivity t night to fix the tmospheric CO2 to PEP, there is high r te of st rch re kdown to provide the glucose for glycolytic gener tion of PEP. Interestingly, s the m l te is dec r oxyl ted in the d y, its product, pyruv te, c n then e use d to re-synthesize glucose (see gluconeogenesis elow) nd then st rch.

V ri tions of this p thw y h ve een found in which sp rt te is the undle-she th cells inste d of m l te. After dec r oxyl tion y m lic enzyme (NAD-dependent in some species, NADP-dependent in se the CO2 for ru isco, the resulting pyruv te is shuttled ck l cell where it is phosphoryl ted y pyruv te-phosph te dikin se for re-entry into the C4 cycle.

tr nsported to of the m l te others) to rele to the mesophyl to gener te PEP

NADP+ NADPH + H+ 3P O H HO CH2 H OH H O H OH O Glucose-6-phosph te dehydrogen se Ch pter 6, Met olism 2, version 1.0 P ge 83

In step 2, the 6-phosphoglucono-d-l ctone is hydrolyzed to 6-phosphoglucon te us ing 6-phosphogluconol cton se. This re ction ctu lly proceeds f irly quickly ev en without the enzyme. O -2O P 3 OC C C C C OH H OH OH O PO32O H HO CH2 H OH H O H OH O HO H+ H HO H H 6-phosphogluconol cton se CH2 In step 3, the 6-phosphoglucon te is dec r oxyl ted y 6-phosphoglucon te dehydr ogen se, in the process producing more NADPH, s well s the five-c r on sug r, ri ulose5-phosph te. This met olite is used y the cell s the sis for nucleo tide syn thesis. This concludes the NADPH-producing portion of the pentose phosp h te p thw y. O C H HO H H C C C C OH H OH OH O PO32NADP+ NADPH + H+ H H CH2 C C C O OH OH O P O32OH O6-phosphoglucon te dehydrogen se A met olic disorder known s G6PD deficiency m nifests itself in erythrocytes, or red lood cells. NADPH in this c se, is needed not for iosynthetic p thw ys, ut to regener te reduced glut thione (GSH). GSH is needed to detoxify peroxide s through the ction of glut thione peroxid se. Since the NADPH is in short supp ly (due to defect in G6PD), peroxides uild up nd c use d m ge to the mem r ne lipids. Extensive d m ge c n le d to prem ture cell de th y utolysis. CH2 CH2 However, it is useful, in the context of this ch pter, to lso consider the f te the Ru5P, which is converted to ri ose-5-P y ri ulose-5-P isomer se or it is c onverted to xylulose5-phosph te using ri ulose-5-P epimer se. The ri ose-5-phosp h te is used in nucleotide synthesis, so pl ys n import nt role in not only nuc leic cid production, ut gener l met olism (e.g. for ATP). Ri ulose-5-phosph t e nd NADPH re the most signific nt products of this p thw y. As mentioned e rl ier, NADPH is import nt s gener l reducing gent. The mech nism for this invo lves glut thione nd glut thione reduct se. Glut thione is the prim ry sc venger of re ctive oxygen species such s oxides nd peroxides, nd the key regul tor of cellul r oxid tive stress. The reduced form of the glut thione tripeptide (Gl u-Cys-Gly) dimerizes with nother glut thione vi disulfide ond s they don te electrons to oxidizers, nd is regener ted y glut thione reduct se. NADPH is necess ry cof ctor for glut thione reduct se ctivity, providing the electrons t o reduce the G-S-S-G dimer.

Ch pter 6, Met olism 2, version 1.0 P ge 84

O C H -2O 3P OC C C C OH H OH OH O PO3 2CH2 NADP+ NADPH + H+ C H H C C O OH O H HO CH2 H OH -2O O H H OH NADP+ NADPH + H+ 3P O H HO CH2 H OH O H O HO H+ HO H H OH OH O PO32OH H Glucose-6-phosph te Glucose-6-phosph te dehydrogen se 1

2 CH2

6-Phospho luconat

6-phospho luconat

hy ro nas

6-phospho luconolactonas

OH H 6-Phosphoglucono--lacton

CH2

O C C C OH OH OH O PO3 2H H CH2 C OH H H OH Transk tolas

CH2 C O C H PO32C OH O PO32CH2 H C C C O H OH O C H C C OH OH O PO32CH2 C C C C

OH OH OH O + CH2 C OH Ribulos -5-phosphat H + OH OH O PO32+ H H H O H OH O PO32CH2 CH2 CH2 C C

Glyc ral hy -3-phosphat

S oh ptulos -7-phosphat

Ribos -5-phosphat

OH O H OH H Transal olas

pim ras

H C H Ribulos -5-phosphat isom ras

Ribulos -5-phosphat

H CH2

CH2 CH2 C OH H C C O H OH O PO3 2OH O H O C H PO3 2OH O C H C C OH OH O PO3 2-

C C C + H H OH OH O H + H C OH O PO32CH2 CH2 CH2 CH2

Fi ur 7. Th p ntos phosphat pathway. Th first thr r actions n rat th n r y carri r NADPH in th proc ss of conv rtin lucos -6-phosphat to ribulos -5-phosphat . Th Ru5P is important as a pr cursor to nucl oti synth sis, as w ll as for pro uction of oth r su ars an important m tabolic int rm iat s, su

Glyc ral hy -3-phosphat

Fructos -6-phosphat

Erythros -4-phosphat

Xylulos -5-phosphat

C OH H Transk tolas

Xylulos -5-phosphat

Erythros -4-phosphat

Fructos -6-phosphat

Chapt r 6, M tabolism 2, v rsion 1.0

Pa

85

ch as fructos -6-phosphat an lyc ansf rs th t rminal two carbons of tulos -7-phosphat an G3P. Transal unit from s oh ptulos -7-P to th os -6-phosphat .Transk tolas is us on unit from xylulos -5-phosphat G3P an fructos -6-P.

ral hy -3-phosphat . Transk tolas th n tr ribulos -5-P to xylulos -5-P, makin s oh p olas com s up n xt. It transf rs a 3-carbon G3P, formin rythros -4-phosphat an fruct a ain at this point, transf rrin a 2-carb to rythros -4-phosphat an n ratin mor

Glucon o n sis Havin consi r th initial anabolic r action of lif - carbon fixation by pho tosynth sis, w now turn our att ntion to utilizin th small r m tabolit s to n rat lucos an oth r su ars an carbohy rat s. Glucos is th most importan t fu l for most or anisms, an th only fu l for som c ll typ s, such as brain n urons. Pot ntial buil in blocks of lucos inclu many of th pro ucts an i nt rm iat s of lycolysis an th TCA cycl , as w ll as most amino aci s. Th k y r action is conv rsion of any of th s compoun s into oxaloact tat b for us in th m to mak lucos . In animals, th amino aci s l ucin an isol ucin , as w ll as any fatty aci s, cannot b us to buil lucos b caus th y conv rt f irst to ac tyl-CoA, an animals hav no pathway for ac tyl-CoA to oxaloac tat c onv rsion. Plants, on th oth r han , can push ac tyl-CoA to oxaloac tat throu h th lyoxylat cycl , which will b iscuss shortly. Th proc ss of lucon o n sis is in many ways th simpl opposit of lycolysis, so it is not surprisi n that som of th nzym s us in lycolysis ar th sam as thos us for l ucon o n sis. How v r, th r ar a f w xc ptions. Th s aros (an hav probab ly volv ) for two major r asons - (1) th th rmo ynamics of th r action ar p rohibitiv , an (2) th n for in p n nt control of th catabolic an anabol ic proc ss s. Sinc th r is this parall l, w will xplor lucon o n sis firs t by startin with on of th major pro ucts of lycolysis, pyruvat . Pyruvat c an b conv rt to oxaloac tat by pyruvat carboxylas , in a r action r quirin ATP hy rolysis. Th oaxaloac tat is th n conv rt to phospho nolpyruvat (PEP ) by PEP carboxykinas , which also us s nucl oti triphosphat hy rolysis for n r y, thou h this tim it is GTP. As shown in th summary/comparison (fi ur 8) , from th formation of PEP to th formation of fructos -1,6-bisphosphat th n zym s us in lucon o n sis ar xactly th sam nzym s us in lycolysis. T his works b caus th fr n r y chan in thos r actions is r lativ ly small. How v r, in th phosphorylation of fructos -1,6bisphosphat to to fructos -6phosphat , an subs qu ntly in th phosphorylation of lucos -6-phosphat to lucos , th r is a lar fr n r y chan that works a ainst th lucon o nic r actions. Thus, th nzym s that riv th s r actions ar iff r nt from th nzym s that riv th r v rs r actions in lycolysis (i. . h xokinas , phospho fructokinas ). Th s two hy rolytic r actions ar catalyz by fructos bisphosp hatas an lucos -6-phosphatas , r sp ctiv ly. Full r v rsal of lycolysis in a nimals is limit , how v r, to liv r an ki n y, sinc th y ar th only tissu s that xpr ss lucos -6-phosphatas . Oth r tissu s us iff r nt m chanisms for n ratin lucos ( . . lyco nolysis). Int r stin ly, PEP carboxykinas (PEPCK) is unr ulat at th prot in l v l. Th r ar no known activators or inhibitors of its activity. Th only r ulation o f PEPCK app ars to b at th l v l of transcription: luca on can stimulat it ( as can luocorticoi s an thyroi hormon ), whil insulin can inhibit it. Th ot h r lucon o nic nzym s, thou h, o hav ir ct activators an inhibitors. Th y ar allost ric mo ulators, bin in away from, but influ ncin th shap an f ficacy of th substrat bin in sit . In xaminin th r ulation of th s nzym s, on important r ulator stan s out b caus it is not a m tabolit of ith r lycolysis or lucon o n sis. Fructos -2,6-bisphosphat (F2,6P) is an activator of phosphofructokinas , an an inhibitor of fructos bis-phosphatas . F2,6P l v ls ar controll by fructos -bisphosphatas -2 an phosphofructokinas -2, which ar th ms lv s controll by l v ls of fructos -6-phosphat , as w ll as throu h a hormon - riv n si nalin casca shown in th fi ur on th n xt pa . Chapt r 6, M tabolism 2, v rsion 1.0

Pa

86

Pi HO Pi HO

10 HO H HO H Glucos CH2 H O H OH ATP ADP H xokinas -2O 3P

8 O H HO H CH2 H O H OH H OH -2O 3P H OH O CH2 H H HO O HO H CH2 OH OH ATP ADP -2O 3P O CH2 H H HO O HO H CH2 OH O

2 3

Phosphofructokinas

Phospho lucos isom ras

PO32Al olas

Fructos

bisphosphatas

Glucos -6-phosphatas

PO32Pi NAD+ NADH + H+ OH 3P

5 4 H O C

O PO32C O ADP ATP -2O 3P OH O CH2 C C

-2O O CH2 C H H C H C O PO32-

H 3-Phospho lyc rat

1,2-Bisphospho lyc rat

Phospho lyc rat

kinas

OO Phospho lyc rat

mutas

6 Glyc ral hy 3-phosphat

+ Al olas

Glyc ral hy -3-phosphat

O HO CH2 C CH2 O Trios phosphat isom ras

Fructos -1,6-bisphosphat

hy ro nas

Fructos -6-Phosphat

Glucos -6-phosphat

O CO2 + GDP GTP -2O PEPCK -OOC

1 ATP

ADP + Pi ATP + CO2 O OC O 3P O C

-2O 3P O C C OO ADP

CH2 C H CH2

CH3 C 8

10

Fi ur 8. Glucon o n sis (shown in r n arrows) shar s som , but not all nzym s with th r v rs proc ss, lycolysis (black arrows).

Pyruvat

Phospho nolpyruvat

2-Phospho lyc rat

Pyruvat

kinas

HO Phospho lyc rat

OO Enolas

mutas

Pyruvat

carboxylas

C CH2 COOOxaloac tat

HO H Dihy roxyac ton phosphat

Chapt r 6, M tabolism 2, v rsion 1.0

Pa

87

COOCH2 H HO C C COOH

Glyoxysom COOCH2 HO C CH2 COOH HO COOCH2 C C COOH

Ac tyl CoA COOC CH2 O

NADH NAD+ COOHO C CH2 COOMalat H Malat synthas

CoA HC

+ O HC COOGlyoxylat

S CoA

COOCH2 CH2 COOSuccinat Mitochon rion/ TCA Cycl

COOOxaloac tat Malat hy ro nas

Isocitrat lyas

COOIsocitrat

COOCitrat CoA Citrat synthas

COOIsocitrat Aconitas

Th lyoxylat cycl provi s a m chanism for plants to conv rt ac tyl-CoA into oxaloac tat , an th r for contribut to lucon o n sis. This allows th m to c onv rt fatty aci s an th hy rophobic amino aci s l ucin an isol ucin into lucos wh n n c ssary. Th ability to o this com s from a plant-sp cific or an ll call th lyoxysom , as w ll as som mitochon rial nzym s. Th lyoxysoma l part of th cycl consists of fiv st ps, of which th first thr contribut to th conv rsion, whil th last two st ps r n rat th lyoxysomal oxaloac t at (fi ur 9). Onc th macromol cul s hav b n brok n own to ac tyl-CoA, th y nt r th lyoxysom an combin with oxaloac tat to mak citrat . This is ca talyz by citrat synthas just as in th mitochon rial TCA cycl . Th n xt r a ction also us s a familiar nzym : aconitas catalyz s th conv rsion of citrat to isocitrat . How v r, th aconitas is a cytosolic nzym , so th citrat is transport out of th lyoxysom an th n th isocitrat transport back in. A t this point, th lyoxysomal-sp cific nzym , isocitrat lyas , hy rolyz s isoc itrat to yi l succinat an lyoxylat . Th succinat is transport to th mi tochon rion, wh r TCA cycl nzym s conv rt it to fumarat an th n malat , whi ch is transport out to th cytosol. In th cytosol, th malat is conv rt to oxaloact tat throu h malat hy ro nas , an lucon o n sis can proc . Th lyoxylat is act upon by anoth r lyoxysomal nzym , malat synthas , which a s it to ac tyl-CoA to form malat . Th final st p of th lyoxysomal portion of th lyoxylat cycl is oxi ation of th malat to oxaloac tat by lyoxysom al malat hy ro nas . So, to summariz , th pool of oxaloac tat within th lyoxysom is us an r n rat within th lyoxysom . Ac tyl-CoA is conv rt to succinat within th lyoxysom , but th n o s to th mitochon rion for conv rsion to malat , an finally th cytosol for conv rsion to a s parat pool of o xaloac tat that is th n us in lucon o n sis.

O C Ac tyl CoA

Chapt r 6, M tabolism 2, v rsion 1.0

Pa

88

Fi ur 9. Th

lyoxylat cycl .

Glyco n synth sis Althou h lucos is th primary fu l for c lls, it is not an ffici nt mol cul for lon t rm stora in compl x (i. . r at r than sin l -c ll ) or anisms. Th r for , in both plants an animals, th lucos mol cul s ar link to th r to form polysacchari s known as lucans. In animals, th lucan form is lyco n, which consists of lucos mol cul s link by a(1->4) lycosi ic bon s, an b ranchin a(1->6) bon s approximat ly b tw n 8 to 14 r si u s apart. Th av ra siz of a lyco n unit is a cytoplasmic ranul containin ov r 100000 lucos mol cul s. Th a ition of a lucos -1-phosphat to anoth r (or to a lyco n c hain) is n r tically unfavorabl , so it must b coupl with a suffici ntly x r onic r action to proc . Glyco n synth sis b ins with UDP- lucos phosphor ylas , which combin s th nucl oti uri in triphosphat (UTP) with lucos -1-p hosphat to r l as pyrophosphat (PPi) an form UDP- lucos . Th phosphoanhy ri xchan r action catalyz by UDP- lucos phosphorylas is minimally x r on ic. How v r, th pyrophosphat r l as is quickly hy rolyz by inor anic pyrop hosphatas , a ubiquitous cytosolic nzym , in a hi hly x r onic r action. This pyrophosphat hy rolysis is a m chanism utiliz in many biosynth tic pathways t o provi n r y for oth rwis n r onic r actions. In th n xt st p, lyco n synthas attach s th UDP- lucos to th pr - xistin lyco n chain with an a(1 ->4) linka . It cannot join two in ivi ual lucos s to th r, only a to a pr - xistin chain. This m ans that th r must b som workaroun for th frst two lucos s: lyco nin is an nzym that catalyz s th a ition of UDP- lucos to its lf, an can o so for up to s v n UDP- lucos mol cul s, thus formin a shor t prim r for lyco n synthas to work with. Furth rmor , lyco n synthas can only a lucos s with an a(1->4) link. For branchin to occur, a branchin nzy m (sp cifically, amylo-(1,4->1,6)-trans lycosylas is n . This nzym can t ransf r t rminal chain s m nts to th 6-carbon hy roxyl of any lucos in a ly co n chain. How v r, th branch s can only b a if th r ar at l ast 4 lu cos r si u s b tw n th m, an if th ori inatin chain was at l ast 11 r si u s in l n th. Oli osacchari synth sis Lik lyco n synth sis, oli osacchari synth sis also r quir s th initial st p of couplin th su ar with a nucl oti . In mammals, a major isacchari is lactos , which is th linka of a alacto s an a lucos , an th formation is catalyz by lactos HO H HO CH2 H O H OH HO H O H CH2 H HO O H OH H O H CH2 H O H OH HO H O H CH2 H O H OH H H

H H H (1 6) link ge Br nching enzyme O HO H Glycogen synth se CH2 H O H OH HO H O H CH2 H HO O H OH (1 H O H CH2 H O H OH CH2 H O H H H HO O H OH H O H CH2 H O H OH H OH Glycogen phosphoryl se HO H H HO H HO CH2 H H 4) link ge H HO H O H CH2 H H O O H O P OO

O P OO Uridine H O O P HO OOH H UDP-glucose O OH H Glucose-1-phosph te Figure 10. Glycogen synthesis Ch pter 6, Met olism 2, version 1.0 P ge 89

synth se. However, efore the l ctose synth se is le to ct, the g l ctose mus t first e in the form of UDP-g l ctose. Simil rly, in pl nts, the m jor dis c ch ride is sucrose, formed y the link ge of UDP-glucose nd fructose-6-phosph t e. This results in sucrose-6-phosph te, which is then re dily dephosphoryl ted t o sucrose. These kinds of mech nisms re lso used in the glycosyl tion of prote ins nd lipids, which will e discussed prim rily in the protein processing nd tr fficking ch pter. The m jor hexose species esides glucose re fructose, m nn ose, nd g l ctose. Interconversion etween these hexoses c n occur vi intermed i tes, s demonstr ted in glycolysis (glucose-6-P to fructose-6-P). M nnose-6-P c n e converted to fructose-6-P y phosphom nnose isomer se. G l ctose c n e c onverted simil rly, to g l ctose-1-P nd then to glucose-1-P. The g l ctose to g lucose conversion c n lso t ke pl ce y epimeriz tion of UDP-Glucose to UDP-g l ctose vi intermedi te redox using NAD+/ NADH. Mut tion of g l ctose-1-phosph te uridylyltr nsfer se or mut tions of other enzy mes in this p thw y (uridylyl tr nsfer se mut tions re most common nd usu lly most severe) c n le d to g l ctosemi , hum n genetic dise se whose symptoms e gin in inf ncy nd m y include ment l ret rd tion, liver d m ge, j undice, vomit ing, nd leth rgy. The c use of these symptoms is gener lly uildup of g l cto se-1-phosph te, especi lly in the liver nd nervous tissue. Fortun tely, with e rly di gnosis, the symptoms c n e prevented y voiding milk products (l ctose) .

CO2- O O H3C C S CoA Acetyl-CoA H C H M lonyl-CoA C S CoA CO2- O O H3C C S ACP Acetyl-ACP + H C H C S

F tty cid synthesis This n olic process is ccomplished using different set of enzymes th n the c t olism of f tty cids discussed e rlier. F tty cid synthesis (fig. 11) st r ts with the form tion of p lmitic cid (C16) from cetyl-CoA nd m lonyl-CoA (wh ich is itself 3-c r on molecule formed from cetyl-CoA). Another difference e tween the c t olic nd n olic re ctions for f tty cids is the loc tion: wher e s we s w th t c t olism occurs l rgely in the mitochondri , f tty cid synthe sis is run from single l rge cytopl smic enzyme complex. The f tty cid synth se system is comprised of seven enzymes linked together with n cyl c rrier pro tein (ACP). As mentioned, this complex is found in the cytopl sm, so its su str tes must e s well. The cetyl-CoA in the cytopl sm is prim rily derived from t he mitochondri l cetyl-CoA vi citr te-m l te shuttle th t couples de cetyl t ion in the mitochondrion with cetyl tion in the cytosol. The cetyl-CoA nd m l onyl-CoA re linked to the synth se nd ACP, then there is sequence of cetyl group tr nsfers th t runs tot l of seven times to form p lmitoylACP, from whic h the p lmitic cid is fin lly rele sed. P lmitic cid is the precursor for v ri ety of long-ch in f tty cids such s ste ric cid, p lmitoleic cid, nd oleic cid. Gener lly, there is either n elong tion or sometimes des tur tion step. However, des tur tion is tricky process for verte r tes. The des tur tion t C9 to form oleic cid from ste ric cid c n occur; however, other des tur tions such s des tur tion t C-12 to gener te linoleic cid re not possi le in verte r tes. Interestingly, they c n e c rried out in pl nt species. Furthermore, ev en though linoleic cid c nnot e synthesized y verte r tes, it is nevertheless needed y verte r tes, which uild r chidonic

ACP M lonyl-ACP CO2 NADPH + H+ Repe t 7x NADP+ HO NADPH + H+ NADP+ HO S ACP H S ACP H3C H H O H3C C C C S ACP H H Butyryl-ACP After 7 Cycles H H3C C H (CH2)13 O C H C H (CH2)13 P lmit te O C OP lmitoyl-ACP Figure 11. F tty Acid Synthesis Ch pter 6, Met olism 2, version 1.0 P ge 90

O C OH+ + NADPH + NH4+ C O ONADP+ O C OCH2 CH2 O C CH2 CH2 +H N 3 Glut m te dehydrogen se C H C O-ketoglut r te O Glut m te (Glu, E) O C OATP + NH4 C O+ O ADP + Pi + H+ +H N 3 C NH2 CH2 CH2 +H 3N CH2 CH2 C C OC

cid, prost gl ndins, nd other molecules from it. Linoleic cid is therefore co nsidered n essenti l f tty cid, since it must e ingested y the nim l. These f tty cids re then used to form the tri cylglycerols th t form the ulk of th e energy stor ge molecules in most nim ls. Tri cylglycerols re synthesized y the re ction of f tty cyl-CoA ch ins with glycerol-3-phosph te. Two rounds of t his re ction yields di cylglygerol-3-phosph te (phosph tidic cid). After the c tion of phosph tid te phosph t se, the phosph tidic cid is converted to 1,2-di cylglycerol. This re cts with f tty cyl-CoA to form the fin l tri cyglycerol. E ch of the f tty cyl ch in dditions gener tes n ester ond, which requires signific nt energy input: th t energy comes from linked ATP hydrolysis re ctio n for e ch ch in ddition.

Glut mine synth se H O Glut m te (Glu, E) H O Glut mine (Gln, Q) O Amino cid synthesis +H 3N C OATP + H+ + NADPH C OADP + NADP+ + P O C H HO CH2 CH2 C H O Glut m te (Glu, E) i CH2 CH2 C H C OH 2C Spont neous CH2 N + H+ + NADPH NADP+ H2C H2C H N + CH2 C C OHO H Glut m te kin se dehydrogen se +H N 3 H C In hum ns, only h lf of the st nd rd mino cids (Glu, Gln, Pro, Asp, Asn, Al , Gly, Ser, Tyr, Cys) c n e synthesized (fig. 12 nd 13), nd re thus cl ssified the nonessenti l mino cids. Within this group, the first three, glut m te, gl ut mine, nd proline, h ve sh red n olic p thw y. It egins with glut m te d ehydrogen se, which dds mmoni to -ketoglut r te in the presence of NADPH to form glut m te. This is key re ction for ll mino cid synthesis: glut m te i s nitrogen ( mino group) donor for the production of ll the other mino cids . Glut mine synthet se c t lyzes the form tion of glut mine from glut m te nd mmoni . This is n import nt iochemic l re ction for completely different re son: it is the prim ry route for mmoni detoxific tion. Proline is synthesized from glut m te in two-step process th t egins with the reduction of glut m te

O Semi ldehyde C C OHO Pyrroline c r oxyl te reduct se H -pyrroline-5-carboxylate Proline (Pro, P) O C OCOOCH2 CH2 CH2 +H 3N C H C O+ O H3C C COOPyruvate CH2 C O + CH2 +H 3N C H C OO Glutamate (Glu, E) COO-ketoglut r te O Al nine (Al , A) O C

to semi ldehyde form th t spont neously cyclizes to D-pyrroline-5c r oxyl te. This is reduced y pyrroline c r oxyl te reduct se to proline. Al nine nd Asp rt te re the products of glut m te- sed tr ns min tion of pyruv te nd ox lo c et te, respectively. Asp r gine is synthesized through one of two known p thw ys . In cteri , n sp r gine synthet se com ines sp rt te nd mmoni . However, in m mm ls, the sp rt te gets its mino group from glut mine.

OCOOCOOCH2 CH2 C O O C OCH2 CH2 +H 3N C H C O+ C CH2 O + CH2 +H 3N C H C OO Glut m te (Glu, E) COOOx lo cet te COO-ketoglut r te O Asp rt te (Asp, D) O C OATP + NH4+ C OADP + Pi + H+ O C NH2 CH2 +H 3N CH2 +H N 3 C H O Asp rt te (Asp, D)

Asp r gine synthet se C H C O OAsp r gine (Asn, N) O NH2 ATP + H O C OAMP + PPi +H 3N O C OC O C OO C NH2 CH2 C OCH2 +H 3N C + CH2 +H 3N CH2 CH2 C H C OC H O Asp rt te (Asp, D) Asp r gine synthet se + CH2 +H 3N C H C O OH O Glut mine (Gln, Q) O Glut m te (Glu, E)

Asp r gine (Asn, N) Figure 12. Synthetic re ction for mino cids: Glut m te, Glut mine, Proline, Al nine, Asp rt te, Asp r gine. Ch pter 6, Met olism 2, version 1.0 P ge 91

PO32O CH2 HO C C OH O 3-Phosphoglycer te NAD+ H+ + NADH PO32O CH2 O C C OGlut m te -Ketoglut r te +H N 3 PO32O CH2 C C OH O 3-Phosphoserine HO Pi +H 3N OH CH2 C C OH O Serine (Ser, S) Phosphoglycer te dehydrogen se O 3-Phosphohydroxypyruv te Phosphoserine tr ns min se Phosphoserine phosph t se OH CH2 +H N 3 THF C ON5,N10Methylene-THF Serine hydroxymethyltr nsfer se HO H +H 3N C C C O-

The synthesis of serine egins with the met olic intermedi te 3-phosphoglycer t e (glycolysis). Phosphoglycer te dehydrogen se oxidizes it to 3-phosphohydroxypy ruv te. An mino group is don ted y glut m te in re ction c t lyzed y phosph oserine tr ns min se, forming 3-phosphoserine, nd fin lly the phosph te is remo ved y phosphoserine phosph t se to produce serine. Serine is the immedi te prec ursor to glycine, which is formed y serine hydroxymethyltr nsfer se. This enzym e requires the coenzyme tetr hydrofol te (THF), which is deriv tive of vit min B9 (folic cid). Serine is lso precursor for cysteine, lthough the synthesi s of cysteine ctu lly egins with the essenti l mino cid methionine. Methioni ne is converted to S- denosylmethionine y methionine denosyltr nsfer se. This is then converted to S- denosylhomocysteine y mem er of the SAM-dependent met hyl se f mily. The sug r is removed y denosylhomocystein se, nd the result nt homocysteine is connected y cyst thionine synth se to the serine molecule to f orm cyst thionine. Fin lly, cyst thionine-g-ly se c t lyzes the production of cy steine. Tyrosine is nother mino cid th t depends on n essenti l mino cid s precursor. In this c se, phenyl l nine oxygen se reduces phenyl l nine to pr oduce the tyrosine. In gener l, the synthesis of essenti l mino cids, usu lly in microorg nisms, is much more complex th n for the nonessenti l mino cids n d is est left to full-fledged iochemistry course.

H O Serine (Ser, S) H O Glycine (Gly, G) OH NADPH + H+ + O2 CH2 +H 3N NADP+ + H O CH2 C C O+H N 3 C C OH O Phenyl l nine (Phe, F) H O Tyrosine (Tyr, Y) NH2 N CH3 S CH2 CH2 +H N 3 NH2 N C H N S H H Phosph tidyleth nol mine Phosph tidylcholine +H 3N N N CH2 H C OH OH O H N C H N CH3 +S N CH2 H C OH OH O H O + ATP PPi + Pi +H 3N CH2 CH2 C CH2 CH2 C H HO Adenosine C

C OOH SAM-dependent methyl se OH Adenosylhomocystein se H O Methionine (Met, M) Methionine denosyltr nsfer se H O S- denosylmethionine H O S- denosylhomocysteine H +H N 3 O C OC CH2 S CH2 CH2 HO Adenosine SH CH2 CH2 +H 3N Serine HO -keto utyr te + NH4+ Cyst thionine-lyas SH CH2 +H N 3

C C O-

+H N 3 C C O-

Cystathionin synthas

A nosylhomocyst inas

C H C O O-

Cyst in (Cys, C) Fi ur 13. Cyst in .

Chapt r 6, M tabolism 2, v rsion 1.0

Pa

92

Synth tic r actions for amino aci s: S rin , Glycin , Tyrosin , an

H O Cystathionin

H O Homocyst in

DNA: Structur an R plication DNA: th stuff of lif . W ll, not r ally, spit th hyp . DNA o s contain th instructions to mak a lot of th stuff of lif (prot ins), althou h a ain, not all th stuff of lif . At l ast not ir ctly. D oxyribonucl ic aci (an its v ry clos cousin ribonucl ic aci , or RNA) is a v ry lon chain polym r. You may r call that a polym r is just a r ally bi mol cul ma by conn ctin many smal l similar mol cul s to th r). In this polym r, th small (monom r) mol cul s ar known as nucl oti s, an ar compos of a p ntos (5-carbon su ar ith r o xyribos or ribos ), a nitro nous bas , an a phosphat roup. As you can s i n th fi ur , th nucl oti s only vary sli htly, an only in th nitro nous ba s . In th cas of DNA, thos bas s ar a nin , uanin , cytosin , an thymin . Not th similarity of th shap s of a nin an uanin , an also th similari ty b tw n cytosin an thymin . A an G ar classifi as purin s, whil C an T ar classifi as pyrimi in s. As lon as w r namin thin s, notic oxyribos an ribos . As th nam impli s, oxyribos is just a ribos without an oxy n. M or sp cifically, wh r th r is a hy roxyl roup attach to th 2-carbon of ri bos , th r is only a hy ro n attach to th 2-carbon of oxyribos . That is th only iff r nc b tw n th two su ars. In ran omly constructin a sin l st ran of nucl ic aci in vitro, th r ar no particular rul s r ar in th or r in of th nucl oti s with r sp ct to th ir bas s. Th i ntiti s of th ir nitr o nous bas s ar irr l vant b caus th nucl oti s ar attach by phospho i s t r bon s throu h th phosphat roup an th p ntos . It is th r for oft n r f rr to as th su ar-phosphat backbon . If w br ak own th wor phospho i st r, w s that it quit han ily scrib s th conn ction: th su ars ar conn ct by two st r bon s ( O) with a phosphorous in b tw n. On of th i as that oft n confus s stu nts, is th ir ctionality of this bon , an th r for , of nucl ic aci s in n ral. For xampl , wh n w talk about DNA polym ras , th nzym that catalyz s th a ition of nucl oti s in livin c lls, w say that it work s in a 5-prim (5) to 3-prim (3) ir ction. This may s m lik arcan mol cular-b iolo ist-sp ak, but it is actually v ry simpl . Tak anoth r look at two of th nucl oti s join to th r by th phospho i st r bon (fi . 1, bottom l ft). An a nin nucl oti is join to a Chapt r 7, DNA, v. 1.0 Usin this book: This book is si n to b us in both intro uctory an a van c c ll biolo y cours s. Th primary t xt is n rally on th l ft si of th v rtical ivi r, an print in black. D tails that ar usually l ft to an a va nc cours ar print in blu an foun on th ri ht si of th ivi r. Fina lly, a itional biom ically r l vant information can b foun in r print on ith r si of th ivi r.

5 -O O OP O H 3C O O H O H H O O H O -O H2N N H H N N H H2N O N N H NH2 O N H O H H N N H H O N H H N O T N A N N H OH H CH2 O P O H H H O O H 3

H2C H -O H N P O G N H H O N C H2C H P O H2C H -O O H O P O O H H N H N NH2 H2C 4 5 O H H 2 1 H 3 Fi ur 1. DNA. D oxyribonucl ic aci is a polym r chain of nucl oti s conn ct by 5 to 3 phospho i st r bon s. DNA normally xists as a two antiparall l compl m ntary stran s h l to th r by hy ro n bon s b tw n a nin s (A) an thymin s (T), an b tw n uanin s (G) an cytosin s (C).

O 3 H OH H P OO H

O H N N H N O H A T O CH3 P O H O N H C H 2N O N H N G O O NH2 O P O

H H H O OCH2 OCH2 OCH2 O5

Pa

93

cytosin nucl oti . Th phospho i st r bon will always link th 5-carbon of on oxyribos (or ribos in RNA) to th 3-carbon of th n xt su ar. This also m ans that on on n of a chain of link nucl oti s, th r will b a fr 5 phos phat (-PO4) roup, an on th oth r n , a fr 3 hy roxyl (-OH). Th s fin t h ir ctionality of a stran of DNA or RNA. DNA is normally foun as a oubl -s tran mol cul in th c ll wh r as RNA is mostly sin l -stran . It is import ant to un rstan thou h, that un r th appropriat con itions, DNA coul b ma sin l -stran , an RNA can b oubl -stran . In fact, th mol cul s ar s o similar that it is v n possibl to cr at oubl -stran hybri mol cul s wi th on stran of DNA an on of RNA. Int r stin ly, RNA-RNA oubl h lic s an R NA-DNA oubl h lic s ar actually sli htly mor stabl than th mor conv ntion al DNA-DNA oubl h lix. Th basis of th oubl -stran natur of DNA, an in fact th basis of nucl ic aci s as th m ium for stora an transf r of n ti c information, is bas -pairin . Bas pairin r f rs to th formation of hy ro n bon s b tw n a nin s an thymin s, an b tw n uanin s an cytosin s. Th s p airs ar si nificantly mor stabl than any association form with th oth r po ssibl bas s. Furth rmor , wh n th s bas -pair associations form in th cont xt of two stran s of nucl ic aci s, th ir spacin is also uniform an hi hly stabl . You may r call that hy ro n bon s ar r lativ ly w ak bon s. How v r, in th cont xt of DNA, th hy ro n bon in is what mak s DNA xtr m ly stabl an th r for w ll suit as a lon -t rm stora m ium for n tic information. Sinc v n in simpl prokaryot s, DNA oubl h lic s ar at l ast thousan s of nucl ot i s lon , this m ans that th r ar s v ral thousan hy ro n bon s hol in th two stran s to th r. Althou h any in ivi ual nucl oti -to-nucl oti hy ro n bon in int raction coul asily b t mporarily isrupt by a sli ht incr as in t mp ratur , or a miniscul chan in th ionic str n th of th solution, a f ull oubl -h lix of DNA r quir s v ry hi h t mp ratur s ( n rally ov r 90 C) to compl t ly natur th oubl h lix into in ivi ual stran s. B caus th r is a n xact on -to-on pairin of nucl oti s, it turns out that th two stran s ar ss ntially backup copi s of ach oth r - a saf ty n t in th v nt that nucl o ti s ar lost from on stran . In fact, v n if parts of both stran s ar ama , as lon as th oth r stran is intact in th ar a of ama , th n th ss nt ial information is still th r in th compl m ntary s qu nc of th opposit str an an can b writt n into plac . K p in min thou h, that whil on stran of DNA can thus act as a backup of th oth r, th two stran s ar not i ntical - th y ar compl m ntary. An int r r stin cons qu nc of this syst m of compl m nta ry an antiparall l stran s is that th two stran s can ach carry uniqu inform ation. Chapt r 7, DNA, v. 1.0 Bi- ir ctional n pairs ar two n s on opposit stran s of DNA, but sharin a promot r, which li s in b tw n th m. Sinc DNA can only b ma in on ir ct ion, 5 to 3, this bi- ir ctional promot r, oft n a CpG islan (s n xt chapt r), thus s n s th RNA polym ras for ach n in opposit physical ir ctions. Thi s has b n shown for a numb r of n s involv in canc rs (br ast, ovarian), an is a m chanism for coor inatin th xpr ssion of n tworks of n pro ucts. Pa 94

B-DNA form: R On h lical turn (11.6 bp, 25 A ) A-DNA form: R On h lical turn (12 bp, 47 A ) Z-DNA form: L th la r of DNA. Th s ar p rp n icular to th lon itu inal axis of th DNA. Mo st of th fr -floatin DNA in a c ll, an most DNA in any aqu ous solution of n ar-physiolo ical osmolarity an pH, is foun in this B conformation. How v r, o th r conformations hav b n foun , usually un r v ry sp cific nvironm ntal ci rcumstanc s. A compr ss conformation, A-DNA, was obs rv as an artifact of in vitro crystallization, with sli htly mor bas s p r turn, short r turn l n th, an bas -pairs that ar not p rp n icular to th lon itu inal axis. Anoth r, Z-D NA, app ars to form transi ntly in GCrich str tch s of DNA in which, int r stin ly, th DNA twists th opposit ir ction. In prokaryot s, th DNA is foun in t h cytoplasm (rath r obvious sinc th r is no oth r choic in thos simpl or a nisms), whil in ukaryot s, th DNA is foun insi th nucl us. D spit th i ff r nc s in th ir locations, th l v l of prot ction from xt rnal forc s, an most of all, th ir siz s, both prokaryotic an ukaryotic DNA is packa with p rot ins that h lp to or aniz an stabiliz th ov rall chromosom structur . R lativ ly littl is un rstoo with r ar to prokaryotic chromosomal packChapt r 7, DNA, v. 1.0 It has b n su st that both th A an Z forms of DNA ar , in fact, physiolo ically r l vant. Th r is vi nc to su st that th A form may occur in RNA-D NA hybri oubl h lic s as w ll as wh n DNA is compl x to som nzym s. Th Z conformation may occur in r spons to m thylation of th DNA. Furth rmor , th n ormal B-DNA conformation is som thin of a i aliz structur bas on b in ful ly hy rat , as is c rtainly v ry lik ly insi a c ll. How v r, that hy ration stat is constantly chan in , alb it minut ly, so th DNA conformation will oft n vary sli htly from th B-conformation param t rs in fi ur 2.

Pa

95

Th stran s of a DNA oubl -h lix ar antiparall l. This m ans that if w look at a oubl -h lix of DNA from l ft to ri ht, on stran woul b construct in th 5 to 3 ir ction, whil th compl m ntary stran is construct in th 3 to 5 ir ction. This is important to th function of nzym s that cr at an r pair DN A, as w will b iscussin soon. In fi . 1, th l ft stran is 5 to 3 from top to bottom, an th oth r is 5 to 3 from bottom to top. From a physical stan point, D NA mol cul s ar n ativ ly char (all thos phosphat s), an normally a oubl -h lix with a ri ht-han twist. In this normal (also call th B conformation) stat , on full twist of th mol cul ncompass s 11 bas pairs, with 0.34 nm b tw n ach nucl oti bas . Each of th nitro nous bas s ar planar, an wh n pair with th compl m ntary bas , forms a flat planar run on Fi ur 2. Thr conformations of DNA. B-DNA is most common, A-DNA is lik ly an a rtifact of crystallization in vitro, an Z-DNA may form transi ntly in parts of th chromosom . On h lical turn (10 bp, 34 A )

a in althou h th r ar structural similariti s b tw n som of th prot ins fo un in prokaryotic an ukaryotic chromosom s. Th r for , most intro uctory c ll biolo y cours s stick to ukaryotic chromosomal packa in . Nak DNA, wh th r p rokaryotic or ukaryotic, is an xtr m ly thin stran of mat rial, rou hly 11 nm in iam t r. How v r, iv n th siz of ukaryotic nom s, if th DNA was stor that way insi th nucl us, it woul b com unmana ably tan l . Pictur a buck t into which you hav toss a hun r m t rs of yarn without any att mpt w hatso v r to or aniz it by coilin it or bunchin it. Now consi r wh th r you woul b abl to r ach into that buck t pull on on stran , an xp ct to pull u p only on stran , or if inst a you ar lik ly to pull up at l ast a small tan l of yarn. Th c ll o s ss ntially what you woul o with th yarn to k p it or aniz : it is packa n atly into small r, mana abl sk ins. In th cas o f DNA, ach chromosom is loop aroun a histon compl x to form th first or r of chromosomal or anization: th nucl osom . Fi ur 4. Th nucl osom is compos of sli htly ov r two turns of DNA aroun a histon cor containin two copi s ach of H2A, H2B, H3, an H4 histon s. Th H1 histon is not part of th cor unit an functions in coor inatin int raction b tw n nucl osom s. H1 A 2 nm B 11 nm C 30 nm D 700 nm H4 H2B H2A H3 E H2B H3 1400 nm H2A DNA Histon s ar a family of basic (positiv ly-char ) prot ins. Th y all function primarily in or anizin DNA, an th nucl osom is form wh n DNA wraps (a litt l ov r 2 tim s) aroun a cor of i ht histon s - two ach of H2A, H2B, H3, an H4. Th numb r an position of th positiv char s (mostly from lysin s an ar inin s) ar crucial to th ir ability to ti htly bin DNA, which as pr viously p oint out, is v ry n ativ ly char . That opposit s attract i a is not just a atin tip from th a vic columns. Fi ur 5. Nucl osom s. (l ft) Cor histon compl x - th nitro ns in icativ of positiv ly-char si chains ar in blu . (ri ht) DNA wraps aroun th histon . Th r oxy ns surroun in th y llow phosphorus atoms ar th n ativ ly-ch ar phosphat roups. Fi ur from RCSB Prot in Data Bank (http://www.rcsb.or ) . Fi ur 3. DNA packa in . (A) A nak stran of DNA is approximat ly 2nm in iam t r. (B) Histon s, which ar octam ric prot ins pict h r as a rou hly cylin rical prot in, hav positiv char s istribut on th out r surfac to int ra

ct with th n ativ ly-char DNA backbon . (C) Ev n th or anization affor by histon bin in can l av an unmana abl tan l of DNA, sp cially with lon r ukaryotic nom s, an th r for th histon -boun DNA is packa into th 3 0-nm stran . This is h l to th r, in part, by histon int ractions. (D) Th 30nm fib rs ar loop into 700-nm fib rs, which ar th ms lv s form into th ty pical ukaryotic chromosom (E). Th 30-nm fib r is h l to th r by two s ts of int ractions. First, th link r histon , H1, brin s th nucl osom s to th r into an approximat 30-nm structur . This structur is th n stabiliz by isulfi bon s that form b tw n th H2A histon of on nucl osom an th H4 histon of its n i hbor. Chapt r 7, DNA, v. 1.0

Pa

96

Upon xamination of th 3D structur of th histon cor compl x, w s that wh il r lativ ly unchar prot in int raction omains hol th histon s to th r in th c nt r, th positiv ly char r si u s ar foun aroun th outsi of t h compl x, availabl to int ract with th n ativ ly char phosphat s of DNA. In a lat r chapt r, w will iscuss how nzym s r a th DNA to transcrib its information onto small r, mor mana abl pi c s of RNA. For now, w only n t o b awar that at any iv n tim , much of th DNA is packa ti htly away, whi l som parts of th DNA ar not. B caus th parts that ar availabl for us c an vary p n in on what is happ nin to/in th c ll at any iv n tim , th pac ka in of DNA must b ynamic. Th r must b a m chanism to quickly loos n th b in in of DNA to histon s wh n that DNA is n for n xpr ssion, an to ti ht n th bin in wh n it is not. As it turns out, this proc ss involv s ac tyla tion an ac tylation of th histon s. A B O C O C CH3 CH3 O CH2 CH2 CH2 CH2 NH3+ CH2 CH2 CH2 CH2 NH2 C CH3 ( OC CH3 )

Histon Ac tyltransf ras s (HATs) ar nzym s that plac an ac tyl roup on a ly sin of a histon prot in. Th ac tyl roups ar n ativ ly char , an th ac tylation not only a s a n ativ ly char roup, it also r mov s th positiv char from th lysin . This has th ff ct of not only n utralizin a point of attraction b tw n th prot in an th DNA, but v n sli htly r p llin it (with lik char s). On th oth r si of th m chanism, Histon D actylas s (HDACs) ar nzym s that r mov th ac tylation, an th r by r stor th int raction b t w n histon prot in an DNA. Sinc th s ar such important nzym s, it stan s to r ason that th y ar not allow to op rat willy-nilly on any availabl hist on , an in fact, th y ar oft n foun in a compl x with oth r prot ins that con trol an coor inat th ir activation with oth r proc ss s such as activation of transcription. Chapt r 7, DNA, v. 1.0 Pa 97

Fi ur 6. (A) D ac tylat histon allows int r phosphat s of th DNA an th positiv ly ) Wh n th histon is ac tylat , not only is lost, th ac tyl roup also imparts a n ativ t s.

Lysin + Ac tat

Lysin

raction b tw n th n ativ ly cha char lysin s of th histon . (B th positiv char on th lysin char , r p llin th DNA phospha

S mi-Cons rvativ DNA R plication DNA r plication is similar to transcription in its most n ral i a: a polym ra s nzym r a s a stran of DNA on nucl oti at a tim , it tak s a ran om nucl oti from th nucl oplasm, an if it is compl m ntary to th nucl oti in th DNA, th polym ras a s it to th n w stran it is cr atin . Of cours , th r ar si nificant iff r nc s b tw n r plication an transcription too, not th l ast of which is that both stran s of DNA ar b in r a simultan ously in or r to cr at two n w compl m ntary stran s that will v ntually r sult in a compl t an n arly p rf ct copy of an ntir or anismal nom . On of th most impor tant conc pts of DNA r plication is that it is a s mi-cons rvativ proc ss (fi . 7). This m ans that v ry oubl h lix in th n w n ration of an or anism con sists of on compl t ol stran an on compl t n w stran wrapp aroun ach oth r. This is in contrast to th two oth r possibl mo ls of DNA r plication, th cons rvativ mo l, an th isp rsiv mo l. A cons rvativ m chanism of r pli cation propos s that th ol DNA is us as a t mplat only an is not incorpora t into th n w oubl -h lix. Thus th n w c ll has on compl t ly n w oubl -h lix an on compl t ly ol oubl -h lix. Th isp rsiv mo l of r plication po sits a final pro uct in which ach oubl h lix of DNA is a mixtur of fra m nts of ol an n w DNA. In li ht of curr nt knowl , it is ifficult to ima in a isp rsiv m chanism, but at th tim , th r w r no m chanistic mo ls at all. Th M s lson-Stahl xp rim nts (1958) cl arly monstrat that th m chanism m ust b s mi-cons rvativ , an this was confirm onc th k y nzym s w r isco v r an th ir m chanisms luci at . In th M s lson-Stahl xp rim nts, E. coli w r first incubat with 15N, a h av y isotop of nitro n. Althou h it is only a iff r nc in mass of on n utron p r atom, th r is a r at nou h iff r nc in mass b tw n h avy nitro n-conta inin DNA (in th purin an pyrimi in bas s) an li ht/normal nitro n-contain in DNA that th y can b s parat from on anoth r by ultrac ntrifu ation throu h a CsCl conc ntration ra i nt (fi . 7). Ov r 14 n rations, this l to a po pulation of E. coli that ha h avy nitro n incorporat into all of th DNA (sh own in blu b low). Th n, th bact ria ar rown for on or two ivisions in li h t nitro n, 14N. Wh n th DNA from th bact rial populations was xamin by c nt rifu ation, it was foun that inst a of li ht DNA an h avy DNA, as woul b x p ct if DNA r plications was cons rvativ , th r was a sin l ban in an int rm iat position on th ra i nt. This supports a s mi-cons rvativ mo l in wh ich ach stran of ori inal DNA not only acts as a t mplat for makin n w DNA, it is its lf incorporat into th n w oubl -h lix.

Prokaryotic R plication DNA r plication b ins at an ori in of r plication. Th r is only on ori in in prokaryot s (in E. coli, oriC) an it is charact riz by arrays of r p at s q u nc s. Th s s qu nc s wrap aroun a DNA-bin in prot in, an in oin so, x r t pr ssur on th H-bon s b tw n th stran s of DNA, an th chromosom b ins to unzip in an ATrich ar a wrapp aroun this prot in. R m mb r that A-T pairs ar 33% w ak r than G-C pairs u to f w r hy ro n bon s. Th us of AT-rich st r tch s of DNA as points of stran s paration is a r currin th m throu h a var i ty of DNA op rations. Th s paration of th two stran s is bi ir ctional, an DNA polym ras s will act in both ir ctions in or r to finish th proc ss as qu ickly as possibl . Sp is important h r b caus whil r plication is happ nin , th DNA is vuln rabl to br aka , an most m tabolic proc ss s ar shut own

3 Disp rsiv

2 S mi-cons rvativ

1 Cons rvativ

CsCl ultrac ntrifu ation Fi ur 7. DNA r plication. Prior to th iscov ry of th nzym s involv in r p lication, thr n ral m chanisms w r propos . In cons rvativ r plication, t h ori inal DNA stran s stay associat with ach oth r, whil th n wly ma DN A forms its own oubl -h lix. S mi-cons rvativ r plication posits th cr ation of hybri ol -n w oubl h lic s. Disp rsiv r plication propos mol cul s comp os of ran omiz fra m nts of oubl -ol an oubl -n w DNA.

Pa

98

to vot th n r y to th r plication. Ev n in prokaryot s, wh r s ar or rs of ma nitu small r than in ukaryot s, Chapt r 7, DNA, v. 1.0

DNA mol cul

th siz of th DNA mol cul wh n it is unrav l from prot ctiv packa in prot ins mak s it hi hly susc ptibl to physical ama just from mov m nts of th c ll. Th first OriC bin in prot in, DnaA, bin s to DnaA box s, which ar 9 bas pair s m nts with a cons nsus s qu nc of TTATCCACA. OriC has fiv of th s r p ats, an on DnaA prot in bin s to ach of th m. HU an IHF ar histon -lik p rot ins that associat with DnaA an to th r b n that part of th DNA into a c ircular loop, situatin it just ov r th oth r major f atur of oriC, th 13-bp AT-rich r p ats (GATCTNTTNTTTT). DnaA hy rolyz s ATP an br aks th H-bon s b tw n stran s in th 13m r r p ats, also known as m ltin th DNA. This allows com pl x s of DnaB [an DnaC, which is a loa in prot in that h lps attach DnaB(6) t o th stran with accompanyin hy rolysis of ATP. Also, fiv mor DnaA ar r cru it to stabiliz th loop.] to bin to ach sin l stran r ion of th DNA on opposit si s of th n wly op n r plication bubbl . DnaB is a h licas ; its nzymatic activity is to unzip/unwin th DNA ah a of th DNA polym ras , to i v it sin l -stran DNA to r a an copy. It o s so in association with sin l -stran -DNA bin in prot ins (SSBs), an DNA yras . Th function of SSB is n arly s lf- xplanatory: sin l -stran DNA is lik RNA in its ability to form c ompl x s con ary structur s by int rnal bas -pairin , so SSB pr v nts that. DNA yras is a typ II topoisom ras , an is task with intro ucin n ativ sup r coilin to th DNA. This is n c ssary b caus th unzippin of th DNA by h lica s also unwin s it (sinc it is a oubl h lix) an caus s th intro uction of p ositiv sup rcoilin . This m ans that th ntir circular mol cul twists on its lf: ima in hol in a rubb r ban in two han s an twistin it. As th sup rcoi lin accumulat s, th DNA b com s mor ti htly coil , to th point that it woul b impossibl for h licas to unzip it. DnaB/ yras can r li v this str ss by t mporarily cuttin th oubl -stran DNA, passin a loop of th mol cul thr ou h th ap, an r s alin it. This (hop fully) mak s a lot mor s ns A B C Fi ur 9. D tail of DNA topoiA som ras typ II action. (A) First, th nzym bi n s to th DNA an initiat s an n onucl as activity, cuttin both stran s of t h DNA at that point. (B) This compl t trans ction of th DNA (as oppos to th sin l -stran cut by typ I topoisom ras s) allows anoth r part of th sam DN A mol cul to slip throu h th ap. (C) Finally, th two t mporarily brok n n s of th DNA, which ha b n h l clos ly in plac by B th nzym . oubl stran br ak Topo II

Topo II C Topo II Chapt r 7, DNA, v. 1.0

Pa

99

Fi ur 8. Typ II DNA topoisom ras s lik DNA in t mporary oubl -stran cut.

yras r li v

sup rcoilin by mak

lookin at th ia ram. Or, oin back to our rubb r ban , iv th rubb r ban a twist or two, th n tap own th two n s. If you snip th rubb r ban , an pa ss an a jac nt portion of th rubb r ban throu h that snip, th n r conn ct th cut n s, you will fin that th r is on l ss twist. Nifty, h? At this point, som of you ar oin to say, but if you twist a fr -floatin rubb r ban , as o n mi ht ima in a fr -floatin circular DNA chromosom in E. coli, you woul xp ct it to naturally untwist. T chnically, y s, but u to th lar mass of th chromosom , its association with various prot ins an th c ll m mbran , an t h viscosity of its nvironm nt, it o s not b hav as thou h it w r compl t ly fr . Onc oriC has b n op n an th h licas s hav attach to th two si s of th r plication fork, th r plication machin , aka th r plisom can b in to form. How v r, b for th DNA polym ras s tak positions, th y n to b pri m . DNA polym ras s ar unabl to join two in ivi ual fr nucl oti s to th r to b in formin a nucl ic aci ; th y can only a onto a pr - xistin stran o f at l ast two nucl oti s. Th r for , a sp cializ RNA polym ras (RNAPs o not hav this limitation) known as primas is a part of th r plisom , an r a s cr at s a short RNA stran t rm th prim r for th DNA polym ras to a onto. A lthou h only a f w nucl oti s ar n , th prokaryotic prim rs may b as lon as 60 nt p n in on th sp ci s. At l ast fiv prokaryotic DNA polym ras s h av b n iscov r to at . Th primary DNA polym ras for r plication in E. co li is DNA Polym ras III (Pol III). Pol I is also involv in th basic m chanis m of DNA r plication, primarily to fill in aps cr at urin la in stran sy nth sis ( fin 3 pa s ah a ) or throu h rror-corr ctin m chanisms. DNA poly m ras II an th r c ntly iscov r Pol IV an Pol V o not participat in chr omosomal r plication, but rath r ar us to synth siz DNA wh n c rtain typ s o f r pair is n at oth r tim s in th c llular lif cycl . DNA polym ras III is a multi-subunit holo nzym , with a, , an q subunits comprisin th cor po lym ras , an t, , , , c, y, an b comin to th r to form th compl t holo n zym . Th cor polym ras has two activiti s: th a subunit is th polym ras fu nction, r a in a stran of DNA an synth sizin a compl m ntary stran with r at sp , aroun 150 nt/s c; th subunit is a 3-5 proofr a in xonucl as an s as an imm iat proofr a r, r movin th last nucl oti if it is incorr ct. This proofr a in o s not r ach any furth r back: it only acts on th most r c ntly a nucl oti to corr ct misincorporation. Oth r m chanisms an nzym s ar us to corr ct DNA l sions that aris at oth r tim s. [As a matt r of nom n clatur , xonucl as s only cut off nucl oti s from DNA or RNA from ith r n , but not in th mi l . En onucl as s cl av phospho i st r bon s locat p r within a nucl ic aci stran .] Th q subunit has no nzymatic activity an r ul at s th xonucl as function. Althou h Chapt r 7, DNA, v. 1.0 Pa 100

act

it has polym ras activity, th Pol III cor polym ras has poor proc ssivity that is, it can only a up to 15 nucl oti s b for issociatin from th t mpl at DNA. Sinc nom s of E. coli strains av ra n ar 5 million bas pairs, r p lication in littl 15 nt s m nts woul b xtraor inarily in ffici nt. L a in Stran 3 5 DNA polymer se III The cl mp lo der complex is n ATP se ssem ly th t inds to the -cl mp unit up on inding of ATP ( ut the ATP se ctivity is not turned on). When the complex t hen inds to DNA, it ctiv tes the ATP se, nd the resulting hydrolysis of ATP l e ds to conform tion l ch nges th t open up the cl mp tempor rily (to encircle o r to move off of the DNA str nd), nd then dissoci tion of the cl mp lo der from the cl mp ssem ly. 5 3 3 Figure 10. The dimeric cl mp holds DNA Polymer se III on the templ te, llowin g it polymerize more nucleotides efore dissoci ting. This is where the su unit is needed. Also known s the cl mp, it is dimer of semicircul r su units th t h s centr l hole through which the DNA is thre d ed. The core polymer se, vi n - inter ction, is tt ched to this cl mp so th t it st ys on the DNA longer, incre sing the processivity of Pol III to over 5000nt. The cl mp is lo ded onto ( nd unlo ded off of) the DNA y cl mp lo d er complex ( lso c lled g complex) consisting of g (x3), d, d, c, nd y su units. The replic tion u le h s two replic tion forks - once the DNA is opened up (u nzipped) t the origin, replic tion m chine c n form on e ch end, with the hel ic ses he ding in opposite directions. For simplific tion, we will consider just one fork opening left to right in this discussion with the underst nding th t t he s me thing is h ppening with the other fork, ut in the opposite direction. T he first thing to notice when looking t di gr m of replic tion fork (fig. 1 1) is th t the two single-str nded portions of templ te DNA re nti-p r llel. T his should come s no surprise t this point in the course, ut it does introduc e n interesting mech nic l pro lem. Helic se opens up the dou le str nded DNA nd le ds the rest of the replic tion m chine long. So, in the single-str nded r egion tr iling the helic se, if we look left to right, one templ te str nd is 3 t o 5 (in lue), while the other is 5 to 3 (in red). Since we know th t nucleic cids re polymerized y dding the 5 phosph te of new nucleotide to the 3 hydroxyl o f the previous nucleotide (5 to 3, in green), this me ns th t one of the str nds, c lled the le ding str nd, is eing synthesized in the s me direction th t the r eplic tion m chine moves. No pro lem there. The other str nd is pro lem tic: loo ked t line rly, the newly synthesized str nd would e going 3 to 5 from left to r ight ut DNA polymer ses c nnot dd nucleotides th t w y. How do cells resolve t his pro lem? A num er of possi ilities h ve een proposed, Ch pter 7, DNA, v. 1.0 P ge 101 Underst nding the mech nics of DNA replic tion is highly visu l process, nd i t is recommended th t students frequently flip ck nd forth etween Figure 11 nd the text description of replic tion. In f ct, with the extr sp ce round Fi gure 11, we recommend writing you own description of the process to help underst nd the mech nism step y step.

Direction of Replic tion M chine Movement 3 5 Le ding Str nd DNA polymer se III Templ te Str nd 3 5 3 Prim se 2 DNA helicase 3 B RNA primer 5 SSBs 3 5 5

A Lagging S rand 3 5 Figure 11. DNA Replica ion in prokaryo es. Chap er 7, DNA, v. 1.0 Page 102

C Okazaki Fragmen

bu he curren model is depic ed here. The replica ion machine consis s of he helicase, primases, and wo DNA polymerase III holoenzymes moving in he same ph ysical direc ion (following he helicase). In fac , he pol III complexes are ph ysically linked hrough subuni s. In order for he empla e s rand ha is 5 o 3 from lef o righ o be replica ed, he s rand mus be fed in o he polymeras e backwards. This can be accomplished ei her by urning he polymerase around or by looping he DNA around. As he figure shows, he curren model is ha he p rimase is also moving along lef o righ , so i has jus a shor ime o quickl y syn hesize a shor primer before having o move forward wi h he replisome and s ar ing up again, leaving in ermi en primers in i s wake. Because of his, P ol III is forced o syn hesize only shor fragmen s of he chromosome a a ime, called Okazaki fragmen s af er heir discoverer. Pol III begins syn hesizing by adding nucleo ides on o he 3 end of a primer and con inues un il i hi s he 5 e nd of he nex primer. I does no (and can no ) connec he s rand i is syn he sizing wi h he 5 primer end. DNA replica ion is called a semi-discon inuous proc ess because while he leading s rand is being syn hesized con inuously, he lagg ing s rand is syn hesized in fragmen s. This leads o wo major problems: firs , here are li le bi s of RNA lef behind in he newly made s rands (jus a he 5 end for he leading s rand, in many places for he lagging); and second, Pol I II can only add free nucleo ides o a fragmen of single s randed DNA; i canno connec ano her fragmen . Therefore, he new s rand is no whole, bu riddled wi h missing phosphodies er bonds. The firs problem is resolved by DNA polymerase I. Unlike Pol III, Pol I is a monomeric pro ein and ac s alone, wi hou addi ion al pro eins. There are also 10-20 imes as many Pol I molecules as here are Pol III molecules, since hey are needed for so many Okazaki fragmen s. DNA Polymer ase I has hree ac ivi ies: (1) like Pol III, i can syn hesize a DNA s rand bas ed on a DNA empla e, (2) also like Pol III, i is a 3-5 proofreading exonuclease, bu unlike Pol III, (3) i is also a 5-3 exonuclease. The 5-3 exonuclease ac ivi y is crucial in removing he RNA primer (fig. 12). The 5-3 exonuclease binds o doub les randed DNA ha has a single-s randed break in he phosphodies er backbone s uch as wha happens af er Okazaki fragmen s have been syn hesized from one prime r o he nex , bu canno be connec ed. This 5-3 exonuclease hen removes he RNA primer. The polymerase ac ivi y hen adds new DNA nucleo ides o he ups ream Ok azaki fragmen , filling in he gap crea ed by he removal of he RNA primer. The proofreading exonuclease ac s jus like i does for Pol III, immedia ely removi ng a newly incorpora ed incorrec nucleo ide. Af er proofreading, he overall er ror ra e of nucleo ide incorpora ion is approxima ely 1 in 107. Chap er 7, DNA, v. 1.0 Technically, he 5-3 exonuclease cleaves he DNA a a doubles randed region downs ream of he nick, and may hen remove anywhere from 1-10n a a ime. Experimen ally, he 5-3 exonuclease ac ivi y can be cleaved from he res of Pol I by he pr o ease rypsin. This genera es he Klenow fragmen con aining he polymerase and 35 proofreading exonuclease. Page 103

A 5 3 3 5 B DNA polymerase I 5 3 3 5 C DNA ligase 5 3 3 5 D DNA ligase 5 3 3 5 = DNA = RNA primer Figure 12. Lagging S rand Syn hesis. Af er DNA polymerase III has ex ended he p rimers (yellow), DNA polymerase I removes he primer and replaces i by adding o n o he previous fragmen . When i finishes removing RNA, and replacing i wi h DNA, i leaves he DNA wi h a missing phosphodies er bond be ween he pol III-sy n hesized DNA downs ream and he pol I-syn hesized DNA ups ream. This break in he sugar-phospha e backbone is repaired by DNA ligase. Even hough he RNA has been replaced wi h DNA, his s ill leaves a fragmen ed s rand. The las major player in he DNA replica ion s ory finally appears: DNA l igase. This enzyme has one simple bu crucial ask: i ca alyzes he a ack of he 3-OH from one fragmen on he 5 phospha e of he nex fragmen , genera ing a ph osphodies er bond. This reac ion requires energy in he form of hydrolysis of ei her ATP or NAD+ depending on he species ( E. coli uses NAD+) genera ing AMP an d ei her PPi or NMN+. Chap er 7, DNA, v. 1.0

Page 104

Eukaryo ic Replica ion Given he crucial na ure of chromosomal replica ion for life o exis , i is no surprising o find ha eukaryo ic DNA replica ion is very similar o he proka ryo ic process. This sec ion will highligh some of he differences, which are g enerally elabora ions on he prokaryo ic version. Unlike prokaryo es, eukaryo ic chromosomes of en have mul iple origins of replica ion. Considering he size of eukaryo ic chromosomes, his is necessary o finish comple e replica ion in a imely manner. Each of hese origins defines a replicon, or he s re ch of he DN A ha is replica ed from a par icular origin. The replicons do no replica e a exac ly he same ime (al hough all wi hin he same phase of he cell cycle, se e chap er 15), so i is impor an o make sure ha replicons are used only once during a cell cycle. A B Conserved origin sequence Origin Recogni ion Complex (ORC) C Cdc6/Cdc18 Cd 1 D Licensing fac ors (Mcm2 - Mcm7) E Open replica ion fork Figure 13. Eukaryo ic Origin of Replica ion This requires a licensing mechanism. During he cell cycle phase before DNA replic a ion is ini ia ed, a pre-replica ive complex is assembled a each origin (Fig. 13). The origins are highly variable in composi ion and leng h, ranging from ~10 0 o well over 10000 base pairs. The pre-RC pro eins, on he o her hand, are ver y highly conserved. The pre-RC begins by making he ORC (origin recogni ion comp lex, no a crea ure ba ling Frodo and Aragorn), which is comprised of six subun i s (Orc1-Orc6). Al hough here is no significan sequence homology, he ORC ap proxima es he func ion of he DnaA pro ein in E. coli. To comple e he pre-RC, he ORC recrui s a pair of pro eins, Cdc6 and Cd 1 o each side, and hey bind he MCM complex (a hexamer of Mcm2Mcm6 ha has an inac ive helicase ac ivi y), l eading o he fully licensed pre-RC. The origin is now ready for ac iva ion. Ac iva ion of he pre-RC a an origin of replica ion requires firs Mcm10, which fa cili a es pro ein kinases ha phosphoryla e he MCM complex, ac iva ing he hel icase ac ivi y, and making he replica ion fork ready o accep he replica ion machine. Chap er 7, DNA, v. 1.0 Page 105

The componen s of he eukaryo ic replica ion machine may have differen names fr om he prokaryo ic, bu he func ions should be very familiar (Fig. 14). There i s a primase o make RNA primers, and igh ly associa ed wi h he primase is DNA polymerase a. Pol a has nei her a 5-3 exonuclease nor a 3-5 proofreading exonuclease , bu i can syn hesize DNA. However, his is no he primary DNA polymerase. Th e primase/pol a complex is essen ially a fancy primase ha begins wi h a shor <10n RNA primer and hen adds ano her shor ~15n DNA fragmen , making a hybrid primer. Replica ion fac or C (RFC), ac ing like he prokaryo ic clamp loader co mplex, hen replaces pol a wi h PCNA, he eukaryo ic version of he b clamp. Thi s hen recrui s DNA polymerase d, which is he primary replica ive DNA polymeras e, equivalen o prokaryo ic Pol III in func ion, and necessary for bo h leading and lagging s rand syn hesis. Finally, ins ead of SSB, eukaryo ic cells use rep lica ion pro ein A (RPA) o organize and con rol single-s randed DNA as i is ge nera ed during he replica ive process. You may have no iced ha none of he eu karyo ic DNA polymerases discussed so far have a 5 o 3 exonuclease ac ivi y as us ed by prokaryo ic DNA polymerase I o remove primers. In place of ha , RNaseH1 and and FEN-1 remove he RNA primers (all bu one ribonucleo ide, and he las r ibonucleo ide, respec ively). In eres ingly, FEN-1 also excises chunks of laggin g s rand DNA wi hin abou 15 base pairs of he RNA if hey con ain mis akes. Thi s seems o help allevia e he problem of lower fideli y of replica ion by pol a, which has no proofreading capabili y. Af er RNaseH1 and FEN-1 have removed prim ers and near-primer mis akes, pol d fills in he missing nucleo ides, and a liga se enzyme joins he fragmen s. Pol e does have a 3-5 exonuclease ac ivi y ha cho ps single-s randed DNA in o small oligonucleo ide fragmen s and is also associa ed wi h he replica ion machine. The func ion of Pol e is no clearly unders ood . 3 5 Leading S rand PCNA DNA polymerase

3 5 3 3 RNA+DNA prim r 5 DNA polym ras DNA helic se ctivity ( ctiv ted Mcm2-6) Replic tion Protein A Figure 14. The euk ryotic replic tion m chine is very simil r to the prok ryotic m chine. DNA Lesions The ro ust n ture of DNA due to its complement ry dou le str nds h s een noted

T mplat Stran

sever l times lre dy. We now consider in more det il the rep ir processes th t rescue d m ged DNA. DNA is not ne rly s ro ust s popul r medi m kes it out to e. In f ct, to t ke the lock uster ook nd film, Jur ssic P rk, s n ex mpl e, Although there is unquestion ly some DNA to e found either em edded in m e r- ound p r sites, or peh ps in preserved soft tissue (found deep in fossilize d femur, Schweitzer et l, 2007.). It is likely to e he vily degr ded, nd ccu r te reproduction is impossi le without m ny s mples to work from. Ch pter 7, DNA, v. 1.0 P ge 106

The most common insult to the DNA of living org nisms is depurin tion, in which the -N-glycosidic ond etween n denine or gu nine nd the deoxyri ose is hyd rolyzed. In m mm li n cells, it is estim ted t ne rly 10000 purines per cell ge ner tion, nd gener lly, the ver ge r te of loss t physiologic l pH nd ionic strength, nd t 37 C, is pproxim tely 3 x 10-11 /sec. Depyrimidin tion of cytos ine nd thymine residues c n lso occur, ut do so t much slower r te th n de purin tion. Despite the high r te of loss of these ses, they re gener lly rem edi ted e sily y se excision rep ir (BER), which is discussed l ter in this s ection. Therefore it is r re for depurin tion or depyrimidin tion to le d to mut tion. O 5 O -O Gu nine O P O O N H O H H H N N N H H2O NH2 H N N H N N H NH2 5 O -O P O O O H H H OH H H2C H H2C H Thymine good, Ur cil d. Why is thymine found in DNA r ther th n ur cil? It tur ns out th t the frequency of cytosine de min tion m y yield clue s to why cel ls h ve gone the extr step (liter lly, since ur cil is precursor in thymine iosynthesis) to m ke new st nd rd nucleotide for DNA when ur cil worked just fin e for RNA, presum ly the older genetic molecule. Consider this: if ur cil w s s t nd rd for DNA, then the very frequent de min tion conversions of C to U would not e c ught y errorchecking for non-DNA ses, nd the mut tion r te would sk yrocket. Fortun tely, since T h s evolved to e the st nd rd sep iring p rtner of denine in DNA, ur cil is quickly recognized nd removed y multiple ur cil DNA glycosyl ses (more on th t l ter in this ch pter), nd the integrity of our DNA sequences is much s fer. H 3 3

Three of the four DNA s th t c n e lost in onvert

ses, denine, gu nine, nd cytosine, cont in mine group v riety of pH nd temper ture-dependent re ctions th t c

Figure 15. Depurin tion of gu nines (or denines) is

common DNA lesion.

5 O -O Adenine P O O N H O H H H N N NH2 N H H2O NH3 5 O -O Hypox nthine O P O O N H O H H H N N N H H H2C H H2C H H H 3 5 O -O 3 Gu nine O P O O N H O H H H N N N H NH2 H2O NH3 5 O -O X nthine O P O O N H O H H H N N N H H2C H H2C H O H H 3 3 5 O -O Cytosine NH2 O H N N H H O H2O NH3 P O

5 O -O Ur cil O O H N N H H H O P O 5 O -O 5-methyl cytosine H3C O H O H H H H N NH2 N O P O 5 O -O Thymine O H3C O H O H H H H N P O N H O H2C H H H O H2C H H H O H2O NH3 H2C H H2C H H H 3 3 3 3

Ch pter 7, DNA, v. 1.0 P ge 107

Figure 16. De min tion of denine, gu nine, cytosine, d to mut tions upon replic tion if unrep ired.

nd methylcytosine c n le

the ses to hypox nthine, x nthine, nd ur cil, respectively. This c n sometime s le d to perm nent mut tions since during replic tion, they serve s templ te for the synthesis of complement ry str nd, nd where gu nine should go, for ex mple (complement ry to cytosine), n denine m y e inserted ( ec use it com plements ur cil, the de min tion product of cytosine). Another de min tion, of t he modified se methylcytosine, c n lso le d to mut tion upon replic tion. S ome cytosines m y e methyl ted s p rt of regul tory process to in ctiv te ce rt in genes in euk ryotes, or in prok ryotes s protection g inst restriction e ndonucle ses. When the methyl ted cytosine is de min ted, it produces thymine, which ch nges the complement ry nucleotide (upon replic tion) from gu nine to n denine. De min tion of cytosines occurs t ne rly the s me r te s depurin tion, ut de min tion of other ses re not s perv sive: de min tion of denin es, for ex mple, is 50 times less likely th n de min tion of cytosine. All DNA ses c n spont neously shift to t utomeric isomer ( mino to imino, keto to eno l, etc), lthough equili rium le ns he vily tow rd one th n the other. When r re t utomer occurs, it se-p irs differently th n its more common structur l fo rm: gu nines with thymines nd denines with cytosines. Here g in, mut tion c n e prop g ted during replic tion of the DNA. DNA inside cell must lso cont end with re ctive oxid tive species (ROS) gener ted y the cells met olic proces ses. These include singlet oxygen, peroxide nd peroxide r dic ls, s well s hy droxyl r dic ls. lthough it is thought th t the hydrogen peroxide nd peroxide r dic ls do not directly tt ck the DNA ut r ther gener te hydroxyl r dic ls th t do. Most of these ROS re gener ted in the mitochondri during oxid tive phos phoryl tion nd le k out, lthough some m y e gener ted in peroxisomes, or in s ome cytosolic re ctions. Depending on wh t p rt of the DNA is t rgeted, ROS c n c use r nge of lesions including str nd re ks nd remov l of ses. Ionizing r di tion (e.g. X-r ys) nd ultr violet r di tion c n e ch c use DNA lesions. Io nizing r di tion is often c use for dou le-str nded re ks of the DNA. As desc ri ed l ter in the ch pter, the rep ir process for dou le-str nded re ks necess rily le ds to some loss of inform tion, nd could potenti lly knock out gene. Ultr violet r di tion th t hits dj cent thymines c n c use them to re ct nd f orm cyclo utyl (four c r ons onded in closed loop) thymine dimer. The dimer p ulls e ch thymine tow rds the other, out of the norm l lignment. Depending on t he structur l form of the dimer, this is sufficient to stymie the replic tion m chine nd h lt replic tion. However, some d t suggests th t norm l sep iring to denine m y e possi le under some conditions, lthough, it is likely only on e se-p ir would result, nd the missing se could le d to either r ndom su st itution or deletion in the newly synthesized str nd. Ch pter 7, DNA, v. 1.0 5 -O O OP O H3C O O H O H H O O H3C H H3C N N H C C N O H3C N O N H H2C H H O N H -O P O O O H O H H N N UV r di tion C C

O O H2C H H 3 Figure 17. Ultr violet r di tion c n e sor ed y some DNA nd commonly c uses pyrimidine cyclo utyl dimers connecting dj cent nucleotide ses. P ge 108

Fin lly, we consider the form tion of chemic l dducts (cov lently tt ched grou ps) on DNA. They m y come from v riety of sources, including lipid oxid tion, cig rette smoke, nd fung l toxins. These dducts tt ch to the DNA in different w ys, so there re v riety of different effects from the dducts s well. Som e m y e very sm ll dducts - m ny environment l c rcinogens re lkyl ting gen ts, tr nsferring methyl groups or other sm ll lkyl groups to the DNA. Other dd ucts re l rger, ut lso tt ch cov lently to nitrogenous se of DNA. Common ex mples re enzo( )pyrene, m jor mut genic component of cig rette smoke, n d fl toxin B1, produced y v riety of Aspergillus-f mily fungi. Benzo( )pyren e is converted to enzo( )pyrene diol epoxide, which c n then tt ck the DNA. Wh en this h ppens, the fl t pyrene ring interc l tes etween ses, c using steric ch nges th t le d to loc l deform tion of the DNA nd disruption of norm l DNA replic tion. O Some lkyl ting gents, p rticul rly N-nitroso compounds, re formed in the cid ic conditions of the stom ch from nitros tion of n tur lly occurring nitrites pr oduced from food (reduction of nitr tes), or environment l nitrites in drinking w ter. Ironic lly, while some lkyl ting gents c n c use c ncers, others re us ed ther peutic lly s ntic ncer tre tments, e.g. mitomycin, melph l n. The ide , s with m ny c ncer tre tments, is th t lthough such drugs c use DNA d m ge t o non-c ncerous cells s well s c ncer cells, the high r te of c ncer cell prol ifer tion gives them fewer ch nces for rep ir of d m ged DNA, nd thus gre ter l ikelihood th t the d m ge might h lt replic tion nd le d to cell de th. In si mil r vein, crosslinking chemother peutic gents such s cispl tin ( pl tinum tom onded to two chloride groups nd two mino groups) lso ind to DNA. The ch loride groups re displ ced first y w ter nd then y other groups including si tes on DNA. Although sometimes cl ssified s n lkyl ting gent, it o viously i s not, ut it cts simil rly. Cispl tin goes step further th n simple lkyl ting gent though, ec use it h s nother re ctive site nd c n thus crosslink ( cov lently ond) nother nucleotide, possi ly on nother str nd of DNA, m king strong o struction to DNA replic tion. Cispl tin c n lso crosslink proteins to DNA. Benzo( )pyrene nd fl toxin B1 re not themselves mut gens. Once they re in the cell, the norm l met olism of these compounds le ds to diol epoxide for m tion, which c n then tt ck the DNA. Although the 7-nitrogen (N7) of gu nine i s more nucleophilic, nd is t rget for fl toxin, most enzo( )pyrene diol epo xide dducts tt ch to the 2-nitrogen of gu nine residues. There re feder l st nd rds (20-300 p rts per illion depending on us ge) for fl toxin in v rious fo rms of gr in- sed nim l feed, especi lly corn- sed feeds, ec use the toxin c n p ss through the nim l into milk, s well s linger in the me t. In ddition to feed, there re feder l m ximums for pe nuts nd pe nut products, r zil nut s, pist chios, nd other foodstuffs ( ction le t 20 pp ). P ge 109 OH HO OH 5 O -O HO Benzo( )pyrene Benzo( )pyrene-7,8-epoxide O O O H O H H N N N N

OH P O H NH2 H2C H H

3 Figure 18. Benzo( )pyrene is converted to n epoxide form y the cell. The epoxi de nd form n dduct on DNA. Afl toxin B1 is the prim ry fl toxin produced y some species (esp. fl vus, p r siticus) of Aspergillus, very common mold th t grows on stored gr in ( s well s detritus nd other de d or dying pl nt m tter). In ddition to infecting gr in, it is common pro lem with stored pe nuts. At high levels, fl toxin is cu tely toxic, ut t lower levels, it h s the insidious property of eing unnotice ly toxic ut mut genic. Like enzo( ) pyrene, it is met olized into n epoxid e nd will then re ct with DNA to form n dduct th t c n disrupt replic tion. O O O O O OH O O O O O O O OCH3 O O OCH3 5 O -O O O OCH3 A toxin A toxin-2,3-epoxide O O O H O H H N N N N H NH2 P O H2C H H

Adduct

ound to gu nine

se in DNA

Ch pter 7, DNA, v. 1.0

Figure 19. The epoxide form of

Adduct

ound to gu nine

se in DNA

fl toxin lso forms dducts on DNA.

Well then, wh ts poor cell to do when its DNA is eing const ntly r v ged? As i t turns out, there re some very good rep ir processes th t re const ntly t wo rk on the DNA, sc nning it for defects, nd where possi le, m king rep irs. Ofte n the rep irs re perfect, if the complement ry str nd is int ct, sometimes mut tions must e introduced, nd fin lly there re occ sions when rep ir is impossi le, nd poptosis is triggered to kill the cell nd prevent prop g tion of d m ged DNA. DNA Rep ir Strictly defined, the simplest rep ir mech nism does not use n enzyme. De lkyl tion, or remov l of lkyl groups (like CH3 or C2H5) involves only the tr nsfer of n lkyl group from n O6-methylgu nine or O6-ethylgu nine onto O6- lkylgu nyl-D NA lkyltr nsfer se. Despite the n me, the lkyltr nsfer se is not re lly n enz yme, since it is perm nently ltered nd in ctiv ted y the re ction nd therefo re does not fit the definition of c t lyst. Note th t this does not remedi te lkyl tion t N7 or other sites, just the O6-linked ones. The next simplest rep ir mech nism is the uncoupling of pyrimidine cyclo utyl dimers. This c n e cco mplished through the ctivity of DNA photoly ses, lso known s photore ctiv tin g enzymes. These re n med not just ec use the form tion of the pyrimidine cycl o utyl dimers is usu lly due to UV light exposure, ut ec use the rep ir enzyme s themselves require exposure to light (300-500nm, ne r UV to visi le lue) to c t lyze the dimer- re king re ction. While de lkyl tion nd dimer lysis re rel tively simple processes th t m ke only su tle ch nge to the DNA, excision rep ir mech nisms re more complic ted nd require multiple enzym tic steps to compl ete. When sm ll (not steric lly ulky) lesion is limited to single se, whe ther missing from depurin tion or incorrectly formed due to de min tion or misin corpor tion, the process known s se excision rep ir (BER) is eng ged. As illu str ted in figure 20, if non-convention l se is recognized, it is then remov ed y n ppropri te DNA glycosyl se. At present (Gen nk se rch, July 2009), th ere re t le st 8 specific genes encoding hum n DNA glycosyl ses, lthough thre e encode glycosyl ses th t recognize ur cil in v rious situ tions. Once the se h s een removed y the glycosyl se, n endonucle se is enlisted to re k the p hosphodiester onds th n hold the now-empty phosphodeoxyri ose. The resulting g p in the DNA is filled in y DNA polymer se nd fin lly the str nd is reconnec ted y DNA lig se. More specific lly, DNA photoly ses ( ~60kD protein), re non -cov lently ssoci ted with chromophore (N5,N10-methylenyltetr hydrofol te or 5-de z fl vin) nd n FADH. The photoly se inds to the pyrimidine cyclo utyl dim er of either single-str nded or dou le-str nded DNA in light-independent nd s equence-independent m nner. However it does not c t lyze ny ch nge in the ond until light is sor ed y the chromophore, which then tr nsfers the energy to F ADH, c using it to eject nd electron to the dimer, thus re king it p rt. Ch pter 7, DNA, v. 1.0 P ge 110

Figure 20. B se Excision Rep ir requires five sep r te steps. 1 Altered nucelotide recognized A B XPC F RNA XPB RNA pol II XPD TFIIH XPC XPA RPA

C XPF XPD XPB ERCC1 XPG XPC P G BRCA1 RNA XAB2 MSH CSA CSB RNA pol II XPG BRCA1 BRCA2 BRCA2 RNA XPD pol II XPB TFIIH TFIIH RPA XPA HO

XPA RPA HO TFIIH = Adenine = Thymine = Cytosine D PCNA

4 DNA polymer se removes phosph te

3 Endonucle se cle ves DNA HO P

2 DNA glycosyl se removes XPA RPA TFIIH

se ck one

nd inserts correct compliment ry

se

XPD XPB pol P

In th cas of bulky l sions that si nificantly alt r th physical pr s ntation of th DNA to th polym ras s an oth r nzym s that proc ss DNA, a iff r nt ty p of r pair proc ss is involv . Nucl oti xcision r pair (NER), p rhaps b tt r nam polynucl oti xcision r pair, involv s th r moval of th l sion as w ll as som of th nucl oti s in th imm iat vicinity. Th r ar two major in itiators of NER: ith r a non-transcriptionally activ portion of th DNA is sca nn by XPC (fi . 21A), which r co niz s a bulky l sion an r cruits th r pair compl x, or as a n is b in transcrib , RNA polym ras runs into a l sion, a n th n r cruits th r pair compl x via CSA an CSB (fi . 21F an G). If th t ction is throu h XPC, on of th arly r pair factors r cruit to th sit is Transcription Factor IIH/XPB/XPD, which is a DNA h licas (fi . 21B). This typ of lobal nom t ction is in ffici nt an r lativ ly slow, but provi s a ba sal l v l of rror-ch ckin for all DNA. In th cas of DNA b in transcrib , t h RNA polym ras compl x alr a y inclu s TFIIH, of which XPB an XPD ar a par t. This transcriptionally- ir ct t ction is mor ffici nt an tar ts thos parts of th DNA in r at st us in a iv n c ll. In th n xt st p (fi . 21C), XPG, associat with BRCA1/2, an XPF, associat with ERCC1, xcis a portion o f th aff ct stran , inclu in but not limit to th l sion its lf. DNA polym ras or can th n a onto th fr 3OH to fill in th ap bas on th compl m ntary stran s qu nc (fi . 21D). Finally, th r pair is conn ct on its 3 n to th r st of th stran by DNA li as (fi . 21E).

Th XP in XPC, XPB, XPD, an th oth rs in fi . 18 r f rs to x ro rma pi m ntosa, anoth r autosomal r c ssiv is as , of which th primary charact ristic is th formation of skin carcinomas at a youn a . B caus NER is a major form of pyr imi in im r r pair (in a ition to photolyas s), its isruption by mutations t o on or mor of th XP n s l a s to xtr m s nsitivity to UVin uc l sions. Aff ct in ivi uals must minimiz xposur to th sun. Th nam of th is as com s from th charact ristic pi m nt l sions (k ratos s) that oft n form on th skin wh n xpos to sun. CSA an CSB ar nam for Cockayn syn rom , an au tosomal r c ssiv a in isor r. Mutations in ith r n can caus th isor r, which is charact riz by pr matur a in , stunt rowth, photos nsitivity, an v lopm ntal f cts of th n rvous syst m. Pr sumably, knockin out th DN A r pair capability of CSA or CSB l a s to fast accumulation of ama , inabilit y to transcrib n n s, an v ntually c ll ath. Pa 111 Chapt r 7, DNA, v. 1.0

Fi ur 21. Nucl oti

Excision R pair in Eukaryotic Syst ms

DNA li as

5 DNA li as s als ap = Guanin

= Uracil

MutS 3 3

5 3 5 MutL C ADP + Pi D 3 Anoth r prokaryotic DNA r pair syst m is th SOS r spons . As pict in fi . 2 3 b low, if th r is no ama , R cA is inactiv , so L xA prot in can r pr ss th pro uction of mor SOS r pair prot ins. How v r, if th r is ama , R cA prot ins bin to th sin l stran DNA an ar activat . Th y in turn cl av th L xA r pr ssor allowin pro uction from a numb r of DNA r pair n s. A Op rators 5 l xA Transcription & Translation CH3 5

N w stran

B T mplat stran CH3 3 5

R call that in E. coli, Dam m thyltransf ras s v ntually m thylat m tho of prot ctin its nom , but n wly synth siz DNA is not hus, th assumption is that th m thylat stran contains th ori ct bas , whil th mismatch is u to misincorporation in th n w

th DNA as a m thylat . T inal an corr r stran .

A sort of variation on NER is th mismatch r pair (MMR) syst m. This is b st un rstoo in prokaryot s: in E. coli, MutS is a small prot in that forms homo im r s at mismatch sit s. Th MutS im rs r cruit two MutL prot ins, ach of which in t racts with on of th MutS units. Each MutS/MutL compl x push s DNA throu h in war ly, formin a loop with th mismatch in th c nt r of th loop. This continu s until on of th MutS/MutL compl x s ncount rs a h mim thylat GATC s qu nc . This caus s r cruitm nt of MutH, a hi hly sp cializ n onucl as that mak s a sin l -stran nick in th backbon of th non-m thylat stran . This provi s an op nin for th 3-5 xonucl as I or th 5-3 xonucl as VII (or R cJ) to ra th stran from th nick to th point of mismatch. This is th n, as you may hav u ss , fill in by DNA polym ras an th backbon conn ct by li as . In ukaryot s, multipl homolo u s to th MutS an MutL prot ins hav b n isc ov r an th proc ss is similar, but not cl arly un rstoo y t, as no homolo u to MutH has y t b n iscov r . A CH3 5

MutH

ATP r cA uvrA uvrB 3 3 5 3 5 5

DNApol L xA R pr ssion Fi ur 22. Mismatch R pair Syst m. Mismatch nucl oti s o not for normal H-bo n s, an caus a minor isturbanc (A) in th DNA structur . (B) MutS im riz s at mismatch sit s an ach r cruits a MutL prot in. (C) Th MutS/L compl x push s DNA throu h to form a loop with th mismatch in th c nt r. Wh n a m thylat GATC is ncount r , th MutS/L stop movin DNA an r cruit th th MutH n onucl as . An xonucl as th n i sts th DNA stran to th mismatch. (D) Finally, a DNA polym ras fills in th missin s m nt an th backbon is s al by li as .

Activ R cA So far, th r pairs hav b n bas on th assumption that a l sion aff cts only on stran , an th oth r stran can provi a r liabl t mplat for ff ctin r pairs without th loss of information. Unfortunat ly, that is not always th c as , an som l sions an r pair proc ss s n c ssarily l a to s qu nc loss. Wh n a oubl -stran br ak occurs, p rhaps as th pro uct of ionizin ra iation, t h most common r pair m chanism is known as non-homolo ous n joinin (NHEJ). T h oubl -stran n s ar first r co niz by Ku, a h t ro im ric circular pro t in that bin s th DNA n s. Ku th n r cruits th kinas DNA-PKCS. Th DNA-PKCS acts as a bri to brin th Chapt r 7, DNA, v. 1.0

B Dama

DNA

Stran nick

Exonucl as CH3 3 5 3

Activ L xA

Transcription & Translation L xA R cA UvrA UvrB 5 No R pr ssion l xA r cA uvrA uvrB 3 Fi ur 23. Th prokaryotic SOS op ron. (A) r pr ss stat wh n th r is no DNA ama , an (B) th activat stat in which DNA ama has b n t ct . 112

Pa

Cl av

(inactiv ) L xA

two n s to th r, an a DNA li as can th n join th n s to th r. If th stra n s w r brok n in iff r nt plac s, r sultin in compl m ntary sin l -stran ov rhan s at ach n (lik thos n rat by som r striction n onucl as s) t h n th r pair is oft n p rf ct, sinc th compl m ntary s qu nc s ali n th two n s corr ctly in th ir ori inal positions. How v r, if th stran n s hav al r a y b n act upon by nucl as s an ar no lon r compl m ntary, th n th r j oinin of th n s will lik ly l a to loss of information. In som parts of th DNA, this woul hav littl ff ct, but if it happ n within a n , th mutat n pro uct coul hav abnormal or compromis function.

Chapt r 7, DNA, v. 1.0

Pa

113

T lom r s If th r is a m chanism for r co nizin loos n s of DNA, what about th n s o f v ry ukaryotic chromosom ? Th y ar lin ar chromosom s, so th y hav n s, r i ht? What pr v nts th oubl -stran -br ak r pair syst ms from mis-r co nizin th m all as brok n DNA an concat natin all of th chromosom s to th r? Int r stin ly, th answ r to this qu stion is intimat ly ti up with th answ r to th probl m of n r plication, which was v ry bri fly allu to in our scriptio n of r plication. Th n -r plication probl m is on that aff cts all lin ar chr omosom s. It boils own to on simpl fact: an RNA prim r is n to start any DNA r plication. So on th 5 n of ach stran is an RNA prim r (fi . 24 in y l low) that ts r mov by th rrorcorr ction proc ss. Thus with v ry roun of r plication, information is lost from th 5 n of ach stran of ach chromosom . DNA 3 Ev ntually, crucial n s ar lost an th 5 3 5 c ll will i ; most lik ly many c llular R plication functions will b compromis lon b for that happ ns . Th solution to th DNA 3 n -r plication probl m mi ht b consi - 5 5 3 RNA prim r + r mor a tr atm nt of symptoms than RNA prim r 5 3 a cur , to us an analo y to m icin . In 3 5 short, urin th v ry arly sta s of an R moval of 5 RNA pr im rs or anisms lif , a lot of non-co in DNA is a onto th n s of th DNA s o that DNA 3 as th c ll an its pro ny continu to 5 3 5 r pro uc , th nucl oti s o not aff ct + 5 3 any functional n s. This proc ss is cat- 3 5 alyz by th nzym , t lom ras . Fi ur 24. En -r plication probl m.

T lom ras is a lar holo nzym that acts as a r v rs transcriptas , r a in a s lfcontain RNA t mplat to a on t lom r s qu nc to th 3 n s of lin ar c hromosom s. Not that this o s not a onto th 5 n s - as m ntion abov , th r is nothin to b on about th 5 n s ir ctly. How v r, whil t lom ras s ar activ , th 3 n s can b xt n , an thus wh n th 5 n prim r is r mov , t h s qu nc lost (for v r) from that stran of DNA is only a t lom ric r p at an not som thin mor us ful. Th r p ats ar w ll cons rv across ukaryot s, a n almost compl t ly cons rv across mammalian sp ci s (shown in Fi . 25). 5 3 DNA T lom r r p ats U C C C A A UC C C A A U C C A G G G T T A G G G T T A G G G T T A G G G T T A G G G 3 A A AA U C C C AA U U U A C 5 UA C U 3 RNA Elon ation

5 5 3 DNA UCCCAAUCCCAAUCC A G G G T T A G G G T T A G G G T T A G G G T T A G G G T T G 3 A A AA U C C C AA U U U A C 5 UA C U 3 RNA T lom ras Translocation 5 3 5 DNA C C C C A A U C C C A A UC C A G G G T T A G G G T T A G G G T T A G G G T T G G G G T T A 3 A A AA U C C C AA U U U A C 5 UA C U 3 RNA Elon ation

T lom ras

T lom ras

5 3 DNA CCCCAAUCCCAAUCC A G G G T T A G G G T TA G G G T TA G G G T T A G G G T T A G G G T T A 3 AA U C C C AA U U U A C AA A 5 U C U 3 RNA

In m tazoans, t lom ras activity is hi h in th mbryonic sta s of lif , but i s virtually non- xist nt in a ults xc pt in c ll typ s that must constantly pro lif rat ( . . bloo an pith lial c lls). Th activity of t lom ras is primar ily r ulat by xpr ssion of th TERT n (t lom ras r v rs transcriptas ) althou h construction of th full t lom ras also r quir s th xpr ssion of th TERC n (th t lom ras RNA, also abChapt r 7, DNA, v. 1.0 Pa 114

Fi ur 25. T lom ras s ar r v rs transcriptas s that a built-in RNA t mplat .

n rat DNA r p ats from

T lom ras

br viat TR), an ysk rin. Rou hly sp akin , th numb r of t lom ric r p ats t hat ar plac on a chromosom in arly v lopm nt t rmin s th numb r of DNA r plications an c ll ivisions that th c ll can un r o b for succumbin to apoptosis (pro ramm c ll ath). Exp rim nts on c lls in cultur monstrat a stron corr lation b tw n t lom r l n th an lon vity, an it is known that c lls tak n from p opl with th pr matur a in is as , pro ria, hav r lativ ly short t lom r s. Conv rs ly, canc r c lls almost univ rsally hav upr ulat xpr ssion of t lom ras . Giv n that a finin charact ristic of canc r c lls is th ability to prolif rat rapi ly an in finit ly, turnin t lom ras back on is, not surprisin ly, an important asp ct of carcino n sis. It is th r for a tar t for anti-canc r tr atm nts; how v r, to at no t lom ras -tar tin t h rapi s hav prov n ff ctiv . Now that w know about t lom r s, th qu stion t hat start this s ction b com s v n mor probl matic: with th s r p at s qu nc ov rhan s, how ar chromosom s pr v nt from conn ctin n -to- n throu h a oubl -stran r pair-lik proc ss? In part u to th ir r p at s qu nc s, t lom r s ar abl to form n -caps an prot ct chromosomal n s. Th t lom r s p rot ct th n s of ach chromosom by bin in to prot ctiv prot ins an by form in compl x structur s. T lom r n bin in prot ins (TEBP) bin to th 3 ov rha n in n of th t lom r . Oth r cappin prot ins, such as th mammalian TRF1 an TRF2 (t lom r r p at bin in factors) not only bin th t lom r , but h lp to or aniz it into lar loop structur s known as T-loops (Fi . 26). G T T T lom ric DNA T T GGGG T T GGGG T T GGGG Non-t lom ric DNA

Finally, th T-loop n s ar furth r stabiliz by th formation of G-quart ts ( fi . 27). G-quart ts ar a cyclic t tram rs that can form in s qu nc s with four cons cutiv uanin r si u s, which hy ro n-bon to ach oth r to mak a link squar shap stabiliz by a m tal ion in th c nt r. Furth rmor in cas s lik th t lom r , in which such s qu nc s ar r p at , th G-quart ts can stack a n associat thr - im nsionally, incr asin th ir stability.

G G G T T GGGG AA C C C C AA C C C C AA C C C C T T GGGG T T GGGG T T GGGG 5 3 AA C C C C AA C C C C AA C C C C AA C C C C AA C C C C T T GGGG 3 G GG C 5 G C T T CC A A T T GGGG AA C C C C T T GGGG T T GGGG AA C C C C AA C C C C

Fi ur 27. G-quart ts form by hy ro n bon in of fours cons cutiv uanin r si u s stabiliz by a m tal ion ( r n), an can form thr - im nsional stacks u to t lom ric r p ats. Pro uc from Prot in DataBank ata by T. Spl ttsto ss r . Chapt r 7, DNA, v. 1.0

Pa

115

Fi ur 21. T lom r s form prot ctiv T-loop structur s on th omosom s.

n s of lin ar chr

Transcription : R a in th Instructions in th G nom Althou h DNA is an xc ll nt m ium for th stora of information, th v ry cha ract ristic that mak s it so stabl an inh r ntly s lf-corr ctin - b in oubl -stran - also mak s it unwi l y for usin that n tic information to mak c ll compon nts. Sinc th informational parts of th mol cul (th nitro nous b as s) ar lock insi th la r, r a in it r quir s th n r tically xp ns iv task of br akin all th hy ro n bon s hol in th two stran s to th r. To o so for v ry sin l copy of ach prot in n by th c ll woul not only t ak a lot of n r y, but a lot of tim . Inst a , th r must b a m chanism to ta k th information from DNA onc (or a f w tim s), an th n mak many copi s of a prot in from that sin l pi c of information. That m chanism is transcription . Usin this book: This book is si n to b us in both intro uctory an a van c c ll biolo y cours s. Th primary t xt is n rally on th l ft si of th v rtical ivi r, an print in black. D tails that ar usually l ft to an a va nc cours ar print in blu an foun on th ri ht si of th ivi r. Fina lly, a itional biom ically r l vant information can b foun in r print on ith r si of th ivi r. 5 In or r to obtain th n tic information in a form that is asily r a an th n us to synth siz functionin prot ins, th DNA must first b transcrib int o RNA (ribonucl ic aci ). As w saw in chapt r 1, RNA is xtr m ly similar to DN A, usin som of th sam nitro nous bas s (a nin , uanin , cytosin ) as w ll as on uniqu to RNA, uracil. Notic that uracil is v ry similar to thymin (ch apt r 7, fi .1), particularly in th plac m nt an spacin of th hy ro n-bon i n atoms. Sinc it is th hy ro n-bon in int raction of th s bas s (i. . bas -pairin of uanin to cytosin , a nin to thymin /uracil) that forms th basis of information transf r from ori inal DNA to au ht r c ll DNA, it is lo ical t o xp ct that th sam kin of bas -pairin m chanism is us to mov th inform ation from a stora stat in th oubl -stran nucl ic aci (DNA) to a mor u s ful/usabl stat in th form of a sin l -stran nucl ic aci (RNA). Th proc ss of copyin DNA into RNA is call transcription. In both prokaryot s an uk aryot s, transcription r quir s c rtain control l m nts (s qu nc s of nucl oti s within th DNA) to proc prop rly. Th s l m nts ar a promot r, a start s it , an a stop sit . Th n for a r co nizabl point to b in an a point to n th proc ss is fairly obvious. Th promot r is som what iff r nt. Th promo t r controls th fr qu ncy of transcription. If you ima in th n s of a c ll at any iv n tim , cl arly not all n pro ucts ar n in th sam quantity at th sam tim . Th r must b a way to control wh n or if transcription occur s, an at what sp . Chapt r 8, Transcription, v rsion 1.0 OP O O O H O H NH2 N N N N H -O A H2C H -O H N N H OH O O H O

O N N H P O G NH2 H2C H -O H NH2 N OH O P O C O H2C H -O O H O P O O H N H O OH N O N H H H U O H2C H H OH 3 OH Fi ur 1. Ribonucl ic Aci (RNA) is a polym r of th nucl oti s a nin , uanin , cytosin , an uracil, conn ct by 3-5 phospho i st r bon s.

Pa

116

Th bar -bon s v rsion of th proc ss o s som thin lik this: (1) sp cial ock in prot ins r co niz th promot r s qu nc an bin to it, unzippin a small s ction aroun th start sit ; (2) RNA polym ras bin s to thos sp cial prot ins a n to th littl bit of sin l -stran DNA that has just op n up; (3) a h lic as nzym (part of, or attach to th polym ras ) unzips th DNA; (4) th RNA polym ras follows b hin th h licas , r a in th DNA s qu nc , takin ribonucl oti s from th nvironm nt, matchin th m a ainst th DNA t mplat , an if th y match, a in th m to th pr vious ribonucl oti or RNA chain. This continu s until th polym ras r ach s th stop sit , at which point, it tach s from th t mplat DNA, also r l asin th n wly ma RNA copy of that DNA. Of cours , if that was all th r was to it, th r woul nt b ntir journals icat to stu yin RNA, its transcription, an th control of that transcription. Th s qu nc of th promot r is ir ctly r lat to its function. Th r may b promot rs for hous k pin n s (n constantly, but at low copy numb r), normal n s (n as th c lls situation ictat s, rat of transcription also vari s), str ss r spons n s (n rar ly), an a vari ty of oth r cat ori s. Ev n within a cat ory, th s qu nc of th promot r t rmin s its str n th. This is bas up on what is known as th cons nsus s qu nc . Th cons nsus s qu nc is a th or tica l b st promot r bas on a surv y of all n s in a particular cat ory. Th fi ur b low shows an ali nm nt of th promot r s qu nc s of a vari ty of iff r nt n s, all of which ar r ulat by th sam typ of promot r an promot r-bin i n -prot in. Th hi hli ht box s show ar as c nt r aroun -35 (35 nucl oti s upstr am of th start sit ) an -10. G n ac B ac E a a ampC ansB Start AATTAAAATGGAAATTGTTTTTGATTTTGCATTTTAAATGAGTAG TCTTAGTTGTGCTGA GCAACTAAACGTAGAACCTGTCTTATTGAGCTTTCCGGCGAGAGTTCAATGGGACAGGTT AAA GCGCAAGATTGTTGGTTTTTGCGTGATGGTGACCGGGCAGCCTAAAGGCTATCCTTA TGGCTGCTATCCTGACAGTTGT CACGCTGATTGGTGTCGTTACAATCTAACGCATCGCCA TGCCTCTAACTTTGTAGATCTCCAAAATATATTCACGTTGT AAATTGTTTAACGTCAAAT -35 In contrast to its c llular rol as a transi nt an isposabl carri r of n ti c information, RNA is thou ht to hav b n th primary mol cul r sponsibl for makin lif possibl on arth. It has lon b n postulat that it s rv ual r ol s as both a r pository of n tic information an as a ru im ntary nzym to act upon that information. Unfortunat ly, pr biotic ch mists hav b n stymi f or ca s in comin up with a r asonabl synth tic pathway by which RNA coul a ris from th simpl mol cul s of th arths primor ial soup. Th k y probl m was t hat ribos coul b synth siz , thou h not particularly ffici ntly, an bas s coul b synth siz , but th r was no way to conn ct th m to th r. Th ch mist ry woul not allow a con nsation r action b tw n th bas s an su ars. In 2009 , by l avin b hin th conv ntional i a that ribonucl oti s must hav b n sy nth siz from ribos an purin s/pyrimi in s, Pown r, G rlan , an Suth rlan ( Natur 459:239-242, 2009) show that in fact, ribonucl oti s coul b synth si z from th ch mical con itions of a n wly form arth. Rath r than att mpt to mak ach part an put th m to th r, Pown r t al synth siz a mol cul that co ntain parts of what woul v ntually b both th ribos an a pyrimi in , 2-am inooxazol . Throu h a s ri s of r actions that utiliz phosphat as a catalyst an scav n r, all of which w r cl arly plausibl in th curr nt mo l of primo r ial arth, both ribocyti in an ribouri in w r cr at . Of cours , this is only th b innin , sinc this o s not xt n ir ctly to th formation of puri n nucl oti s, but it is a v ry si nificant st p in pr biotic ch mistry, an an xc ll nt xampl of th virtu s of st ppin outsi of th box som tim s. Bipartit 70 promoter -10 TATAAT ATATTA Pribnow box Start ite

A T 5 3 TTGACA AACTGT 3 5 Figure 2. Up tream control equence of variou E. coli gene . Below it i the c on en u equence for for 70 promoter . Chapter 8, Tran cription, ver ion 1.0 Page 117

The con en u equence in fig. 2 how the mo t common nucleotide found at each po ition within tho e area of imilarity. In thi example, the mo t common prok aryotic promoter i hown: the 70 promoter, o called becau e it i recognized and bound by the 70 tran cription factor. [Here, and by univer ally accepted co nvention, recognition equence of DNA are written a the nucleotide would occu r from 5 to 3 on the en e, or non-template, trand. ] It i a two-part promoter, with a region centered around -35 (con en u TTGACA), and a region ( ometime ca lled Pribnow box, con en u TATAAT) centered around -10. The (-) ign indicate that the nucleotide i up tream of the tart ite. Up tream mean to the left when t he nucleotide are written a a tring of letter , and it mean on the 5 ide of wi th re pect to the 5-3 directionality of a DNA trand. Notice the relation hip betw een the variou individual promoter and the con en u equence. In general, tho e promoter with more matche to the con en u equence are tronger promoter . A few paragraph ago, the ta k of the promoter wa defined a controlling the f requency of tran cription. How doe it do that? What doe it mean to be a trong er (or weaker) promoter? Fir t, keep in mind that the expre ion of any given ge ne i not automatic, or 100%. At any point in time, many of a cell gene will be near 0%, or hut off. However, even gene that are turned on are tran cribed at different rate . One of the governing factor i the recognition of the promote r ite by the RNA Polymera e. For tronger promoter , the RNA polymera e i more likely to recognize the ite, dock properly, open up the double helix, and begi n tran cribing. On the other hand, the RNA polymera e can potentially recognize weaker promoter , but it i le likely to do o, in tead pa ing it by a ju t another unimportant tretch of DNA. While thi i partially a matter of recognit ion by the polymera e, keep in mind that it i actually governed by recognition of the promoter equence by the general tran cription factor (to be di cu ed hortly) uch a igma factor in prokaryote that are recognized by the polymera e. Notice that there i a high proportion of (A)denine and (T)hymine in the 70 promoter equence . Thi i true for many promoter in both prokaryotic and e ukaryotic gene . A you probably u pected, thi i advantageou becau e there a re only two H-bond between A-T pair (a oppo ed to 3 H-bond between G-C pair ), which mean that it i 33% ea ier to unzip. Chapter 8, Tran cription, ver ion 1.0 Page 118

Prokaryotic Tran cription In E. coli, a with other prokaryote , there i only one true RNA polymera e (no t including the pecialty RNA polymera e, prima e, which make hort RNA primer for DNA replication). The polymera e i a multi- ubunit holoenzyme compri ed pr imarily of two a ubunit , a b ubunit, a b ubunit, an w ubunit, and a ubuni t. The a ubunit are primarily tructural, a embling the holoenzyme and a oci ated regulatory factor . The b ubunit contain the polymera e activity that cat alyze the ynthe i of RNA, while the b ubunit i u ed to non pecifically bind to DNA. The w ubunit i involved in a embly of the holoenzyme and may al o pla y a role in maintaining the tructural integrity of the RNA polymera e. Finally, there i the ubunit, which doe not tay clo ely a ociated with the core en zyme (abbw) except when helping to initiate tran cription, and i u ed to recogni ze the promoter by imultaneou ly decrea ing the affinity of RNAP to DNA in gene ral, but increa ing the affinity of RNAP for pecific DNA promoter equence . Wh y decrea e the affinity for non- pecific DNA? When the RNAP i not in u e, it do e not ju t float about in the nucleopla m: it i bound quite tightly along the DNA. When the igma i bound, the decrea ed affinity allow the RNAP holoenzyme to move along the DNA and can for promoter equence . There are multiple i ofor m of the ubunit ( uch a the igma-70 mentioned above), each of which recogn ize different promoter equence . All i oform perform the ame ba ic function of properly locating the RNAP to the tart of a gene, and all i oform only tay attached to the holoenzyme for that one tran ient purpo e, after which they are relea ed (u ually after tran cribing about ten nucleotide ). RNA tran cript Although RNA polymera e wa di covered in 1960, the E. coli RNAP ha not yet bee n ucce fully mapped by x-ray cry tallography. However, it i very imilar to t he RNAP of the archaean pecie , Thermophilu aquaticu , which i highly table (= ea ier to cry tallize) and for which an x-ray cry tallographic tructure ha been elucidated. The data from the Taq RNAP tructure and electron micro copic a naly e of E. coli RNAP produce a lob terclaw- haped holoenzyme. The inner urfa ce of the claw i lined with po itively charged amino acid that can interact wi th the negatively charged DNA, and when the holoenzyme bind a igma ubunit, th e two halve of the claw (formed mo tly by the beta and beta ubunit ) move clo e r together to interact with the DNA. Rifamycin are a cla of antibiotic that include rifamycin B, made by the bacteria Streptomyce mediterranei (incidentall y ju t one of many antibiotic derived from the Streptomyce genu ), and rifampi cin, it ynthetic cou in. They work by binding within the DNA-RNA channel near the active ite of RNA polymera e, which terically prevent the addition of nuc leotide to the RNA trand. If the organi m cannot tran cribe RNA, it cannot u e the RNA to make the enzyme and other protein nece ary for life either, and d ie . The rifamycin binding ite i highly con erved in mo t prokaryote but not in eukaryote , o the antibiotic kill bacteria pecifically with little chance of harm to eukaryote . DNA Coding Str nd

Compliment ry Str nd Ch pter 8, Tr n cription, ver ion 1.0 P ge 119

Figure 3. Prok ryotic RNA Polymer e u unit .

con i t of t o

u unit ,

, ,

, nd

3 RNA polymer e DNA

The elong tion ph e of tr n cription proceed in 5 to 3 direction, hich i to y th t ne nucleotide re dded to the 3-OH of the gro ing tr nd. Elong tion i toch tic proce in hich one of the plentiful free-flo ting ri onucleoti de drop into the ctive ite of RNAP oppo ite the DNA templ te. If it i the c orrect nucleotide (complement ry to the templ te), then H- ond ill tempor rily form, t ilizing the ne nucleotide in pl ce long enough for the RNAP to c t l yze the form tion of pho phodie ter ond et een the 3-OH of the RNA-in-progre nd the 5-pho ph te of the nucleotide. Ho ever, if it i the incorrect nucleoti de, the proper H- ond do not form, nd the nucleotide u u lly di oci te from the ctive ite efore the RNAP h ch nce to ind it to the gro ing RNA tr n d. O viou ly, thi i not perfect y tem, nd in f ct, the error r te for tr n cription i quite high t pproxim tely 1 in 10000 nucleotide . Fortun tely, th e cell gener lly churn out m ny copie of RNA from ny given gene very quickly ( pproxim tely 80 nucleotide per econd), mo t of hich re either error-free o r h ve error th t do not ffect the function of the end-product protein. Furthe rmore, unlike DNA, in hich error of replic tion get c rried long from one gen er tion of cell to the next, RNA i not tor ge medium, nd it tr n ient n t ure me n th t even mut tion th t everely imp ct the protein function only ff ect the fe protein tr n l ted from th t one RNA, not the protein gener ted fr om other RNA m de from the me templ te gene, much le u equent gener tion . In other ord , to mi ppropri te phr e from the movie Me t ll , It ju t do e nt m tter. Ch pter 8, Tr n cription, ver ion 1.0 P ge 120

Figure 4. A ne RNA polymer e c n egin tr n cri ing one h fini hed.

 

 

Promoter

equence

RNA tr n cript

gene efore the previou

Str nd ep r tion i n energetic lly difficult proce due to the trength he com ined H- ond et een the tr nd , nd often n RNAP m y m ke ever l t-lived ortive ttempt efore fin lly prying open the dou le helix long r enough to llo the RNAP to t ilize nd tr n cri e continuou ly to the ite.

of t hor nd f top

Once the holoenzyme h recognized nd ound tightly to the DNA t the promoter ite, the next tep i to melt the DNA ( re king the H- ond nd ep r ting the r nd of the dou le helix) in th t re o th t the RNAP c n proceed do n tre m, re d the templ te DNA tr nd, nd produce the ne RNA. Often m ny RNA tr n crip t of gene re needed to produce l rge num er of ctive protein in hort p n of time. Highly tr n cription lly ctive gene therefore often h ve multipl e RNA polymer e re ding them, one right fter nother. Gener lly, n RNA polym er e only need to proce out 15 nucleotide efore there i room for nothe r RNAP c n ind the promoter nd t rt nother tr n cript.

Ch pter 8, Tr n cription, ver ion 1.0 P ge 121

  

Euk ryotic Tr n cription Tr n cription in euk ryote i more complic ted, ut follo the me gener l id e . The promoter equence re much more v ried oth in pl cement ( ith re pect to the t rt ite) nd ize. A e ill ee in the next ch pter, euk ryotic gen e h ve m ny more control element regul ting their expre ion th n do prok ryot ic gene . Not only re there more control element , there re l o more RNA poly mer e , hich erve different pecific cellul r function . O viou ly, the ro d function nd loc tion of ll the RNA polymer e i the me: re d DNA templ te nd tr n cri e n RNA copy of it; nd ince the DNA i found only in the nucl eu , o re the polymer e . Ho ever, the polymer e differ in ex ctly h t kin d of RNA they produce. RNA Polymer e I i peci lized for producing pre-rRNA ( rRNA = ri o om l RNA). The pre-rRNA i cle ved po t-tr n cription lly nd incorp or ted into the ri o ome . Since ri o ome re em led in the the nucleolu , t h t i the p rt of the nucleu in hich mo t RNA Polymer e I i concentr ted. R NA Polymer e III l o m ke n RNA (5S) th t i incorpor ted into the ri o ome. It l o m ke other untr n l ted RNA uch tRNA nd v riety of m ll nucl e r RNA . The only RNA polymer e th t m ke the tr n l t le RNA (mRNA, or me enger RNA) th t mo t people think of hen RNA i referred to generic lly, i RNA polymer e II. Thi i the RNA polymer e th t produce pre-mRNA, hich fter ome proce ing, ecome mRNA, i tr n ported out of the nucleu , nd fin lly tr n l ted into protein . All of the euk ryotic RNA polymer e re compo ed of t o l rge u unit , roughly n logou to the nd u unit of prok ryotic RNAP, ut in te d of ju t three or four other u unit , there re over dozen m ller u unit to the euk ryotic RNA polymer e holoenzyme .

Eventu lly, the RNA polymer e re che the end of the gene nd top tr n cri in g. The termin tion ite i u u lly m rked y equence of 4-10 denine (A) re i due on the templ te tr nd, nd ome h ve p lindromic G-C-rich region th t fo rm h irpin loop ju t up tre m of the erie of denine . In the fir t c e, i t i thought th t the re ulting tring of A-U e p ir i un t le nd m y le d to the RNAP nd the ne RNA tr nd f lling off the templ te DNA hile t the me time, the h irpin tructure m y c u e the RNAP to top or p u e, nd thi c n l o le d to it di oci ting from the DNA. Only out h lf of ll tr n criptio n termin tion ite re m rked in thi y though, nd the other h ve no ignif ic nt h irpin loop or e ily recogniz le equence other th n erie of G-Crich region . In thi type of termin tion ite, the enzym tic co-f ctor, rho, i required for termin tion, nd o thi i kno n rho-dependent termin tion. Rh o i n RNA- inding protein ith helic e ctivity, o it i po tul ted th t it effect termin tion y forcing the RNA tr nd off of the DNA templ te.

        

TAP TFIIB TBP TFIIF TFIIA RNAPII TFIIE TFIIH Coding Str nd Compliment ry Str nd DNA Figure 5. Euk ryotic Tr n cription. An initi tion complex of ever l tr n cripti on f ctor i needed to dock the RNA Polymer e II in po ition to egin tr n cri ption. nd ever l TBP- oci ted f ctor (TAF ). Thi inding of the promoter y TFIID occur independently of RNA Polymer e II, nd in f ct, RNAP II ill not tt ch to TFIID t thi time. After TFIID h ound the TATA ox, t o more tr n cripti on f ctor , TFIIA nd TFIIB, tt ch to the TFIID ell the ne r y DNA, t ilizing the complex. TFIIF tt che to TFIID nd TFIIB to llo docking of the R NA Polymer e II. The complex i till not re dy to egin tr n cription: t o mor e f ctor re required. TFIIE ind TFIIF nd RNAP II, nd fin lly, TFIIH tt ch e to RNAP II, providing helic e ctivity needed to pry p rt the t o tr nd of DNA nd llo the polymer e to re d one of them. TFIIH l o h nother imp ort nt enzym tic ctivity: it i l o erine kin e th t pho phoryl te the c r oxyl-termin l dom in (CTD) of RNA polymer e II. There re ever l erine in the CTD, nd they re equenti lly pho phoryl ted, the CTD extend like (ne g tively ch rged) t il nd help to promote ep r tion et een the RNAP II nd t he TFIID/promoter. Ch pter 8, Tr n cription, ver ion 1.0 P ge 122

The euk ryotic RNA polymer e ere n med I, II, nd III ed on their elution order from ion-exch nge chrom togr phy purific tion. They re l o p rti lly di tingui h le y their en itivity to - m nitin nd rel ted m toxin-f mily mu h room poi on . RNAP I ( nd prok ryotic RNAP) i in en itive to the e toxin , RNAP III i ome h t en itive (Kd ~10-6 M), nd RNAP II i highly en itive (Kd ~10 -8 M). The e toxin ct y inding to ite in the RNA-DNA cleft nd interferin g ith tr n loc tion of the RNA. Th t i , there i no pro lem ith importing n ucleotide or ith tt ching it to the ne RNA, ut the RNA tr nd c nnot move th rough the ctive ite nd llo the next nucleotide to e dded.

Initi tion of tr n cription i l o much more complic ted. Not only i there gre t v riety in promoter recognized y RNAP II, oth RNAP I nd RNAP III recogniz e promoter ith p rticul r tructur l ch r cteri tic . One of the mo t common e uk ryotic RNAP II promoter i the TATA ox, n med for the highly con erved moti f th t define it. Although it ppe r imil r to the Pri no ox in prok ryote , it i gener lly loc ted further up tre m from the t rt ite, nd it po ition i f r more v ri le. Where the Pri no ox i loc ted t -10, the TATA ox m y e loc ted clo er to -30 +/- 4. Al o, r ther th n ju t igm f ctor to reco gnize the promoter in conjunction ith the polymer e core enzyme, the euk ryoti c promoter i recognized y multi- u unit complex c lled tr n cription f ctor IID (TFIID). TFIID i compri ed of TATA- inding protein (TBP) RNA tr n cript

     

 

Elong tion of the RNA tr nd in euk ryote i very imil r to th t in prok ryote ith the o viou difference th t tr n cription occur in the nucleu r ther th n in the cytopl m. Thu , in prok ryote , the RNA c n e u ed for tr n l tion o f protein even it i till eing tr n cri ed from the DNA! In euk ryote , th e itu tion i ignific ntly more complex: there re num er of po t-tr n cript ion l event (5 end-c pping, 3 poly denyl tion, nd often RNA plicing) th t mu t occur efore the RNA i re dy to e tr n ported out of the nucleu nd m de v i l le for tr n l tion in the cytopl m. Termin tion of euk ryotic tr n cription i not ell-de cri ed t thi riting. RNAP I ppe r to require DNA- inding t ermin tion f ctor, hich i not n logou to the prok ryotic Rho f ctor, hich i n RNA inding protein. RNAP III termin te tr n cription ithout ny extern l f ctor, nd thi termin tion u u lly occur fter dding erie of uridine re idue . Ho ever, it doe not ppe r to u e the h irpin loop tructure found in r ho-independent cteri l tr n cription. The termin tion of protein-coding RNAP I I tr n cript i linked to n enzyme complex th t l o cle ve p rt of the 3 end of the RNA off, nd dd poly-A t il. Ho ever, it i not cle r ho the poly de nyl tion complex i involved in determining the point of tr n cription termin ti on, hich c n e over 1000 nucleotide eyond the poly-A ite (e.g. the -glo in gene in Mu mu culu ). Upon termin tion nd rele e from the RNAP II nd templ te DNA, the RNA i kno n the prim ry tr n cript, ut mu t undergo po t-tr n c ription l proce ing efore it i m ture me enger RNA (mRNA) re dy to e expo rted to the cytopl m nd u ed to direct tr n l tion. Po t-Tr n cription l Proce ing of RNA The fir t of the po t-tr n cription l event i 5 end c pping. Once the 5 end of n cent RNA extend free of the RNAP II pproxim tely 20-30 nt, it i re dy to e c pped y 7-methylgu no ine tructure. Thi 5 c p erve recognition ite for tr n port of the completed mRNA out of the nucleu nd into the cytopl m. O CH3 N N H NH2 O -O O N N H NH2 5 -O OP O -O N O N N H 5 O-O O O O O H O H H O O H O H H N N -O P O P O P O O P O P O O O O H O H H O O H O H H N N NH2 N N H -O

         

CH2 H H HO O H N P O O CH2 H H HO O NH2 N N H OP O -O -O 5 O O O O H H N N -O P O O H NH2 5 -O OH N N N N H -O P O O H NH2 OH N N N N H H2C H P O P O H2C H -O O N N H NH2 -O

P O O O H O H H O O H O -O H N N PPi Gu nylyl tr n fer e H N N O N N H NH2 O N N H NH2 P O RNA tripho ph t e -O P O + -O CH3 Gu nine-7-methyltr n fer e P O O O H O H H O O H O H 2C H -O H2C H -O H2C H H N N H H O N N H NH2 H N N H H O N N H NH2 The proce ctu lly involve three tep . Fir t, RNA tripho ph t e remove the 5-termin l tripho ph te group. Gu nyl tion y GTP i c t lyzed y c pping enzyme , forming n unu u l 5-5 ck rd ond et een the ne gu nine nd the fir t nucleot ide of the RNA tr n cript. Fin lly, gu nine-7-methyltr n fer e methyl te the n e ly tt ched gu nine. H2C H

 

H P O P O H2C H H HO OH H H2C H 3 H2C H 3 H H 3 RNA tr n cript RNA dipho ph te Gu no ine tripho ph te (GTP) 3 RNA ith 5-5 gu no ine link ge RNA ith 5 7-methylgu no ine c p Figure 6. C pping the 5 end of euk ryotic tr n cript . Ch pter 8, Tr n cription, ver ion 1.0 P ge 123

 

On the oppo ite end of the RNA, on the free 3-OH, poly denyl tion occur . A note d previou ly, n enzyme complex th t dock to ite on the CTD t il of RNAP II cle ve portion of the 3 end ne r n AAUAAA recognition equence nd then eri lly dd l rge num er of denine re idue . The poly(A) t il i not required fo r tr n l tion, ut it h n effect on the t ility of tr n cript in the cytop l m. A mRNA molecule t y in the cytopl m longer, the poly(A) t il i gr du lly removed. Once the poly(A) t il i gone, the mRNA ill oon e de troyed. mRN A molecule ith longer poly(A) t il re gener lly longer-lived in the cytopl m th n tho e ith horter t il , ut there i currently no evidence for direct ly proportion l effect. 5 -O O P O O O H O H H O O H O -O NH2 N N N N H 5 -O O P O O O H O -O NH2 N N H H O O H O -O N N H -O H2C H OP O N H NH2 -O -O 5 -O O P O H2C H -O NH2 O O H O P O O O H OH H H H H N N N N H -O -O H N N H H OP O P O -O O N N H NH2 H2C O H O O O H H N N NH2 N N H O O O O H HO H N N P O H N N H H PPi Poly(A) polymer e O

 

H N N P O P O P O O N N H NH2 + P O + NH2 N N H PPi Poly(A) polymer e H2C H H2C H N -O H N N H NH2 N N H RNA + (A)n P O O O H O H2C H H N N H H2C H NH2 N N H H2C H H H HO OH P O O O H HO H

H2C H -O OH H N N H 3 H2C H OH O O H HO NH2 N N H Although the enzyme th t cle ve the prim ry tr n cript in prep r tion for poly denyl tion h not een identified, t o nonenzym tic f ctor , the excitingly-n m ed cle v ge f ctor I (CFI) nd cle v ge f ctor II (CFII) h ve een implic ted. T he eri l denyl tion come from the ctivity of poly(A) polymer e (PAP) in con junction ith CPSF (cle v ge nd poly denyl tion pecificity f ctor), hich ind to the RNA. PAP it elf h rel tively poor ffinity for RNA. A ith other nuc leic cid polymer e , it dd ne nucleotide onto the free 3-OH of the pre-exi ting ch in. To encour ge proce ivity (continuou polymeriz tion) poly(A) indin g protein II (PABII) join the poly denyl tion complex, nd i involved in contr olling the fin l length of the poly(A) t il. It hould e noted th t PABII i nucle r protein nd hould not e confu ed ith PABP (poly(A) inding protein) hich ind to mRNA molecule in the cytopl m nd pl y role in protecting the m from nucle e tt ck. P O H 3 OH RNA tr n cript Adeno ine tripho ph te (ATP) RNA + (A)1 H2C Adeno ine tripho ph te (ATP) 3 H H OH RNA + (A)2 Figure 7. Poly denyl tion of the prim ry tr n cript. The third nd mo t complic ted modific tion to ne ly-tr n cri ed euk ryotic RNA

plicing. Unlike prok ryotic RNA, hich i continuou ly tr n l t le coding region immedi tely it come out of the RNA polymer e, mo t euk ryotic RNA h ve interrupted coding region . Splicing i the proce y hich the non-coding region , kno n intron , re removed, nd the coding region , kno n exon , re connected together. In ome RNA , thi c n h ppen utonomou ly, ith p rt o f the RNA cting n enzym tic c t ly t for the proce . Thi require th t th e RNA h ve pecific econd ry nd terti ry tructure, ringing the t o exon c lo e together hile looping out the intron. It the tudy of thi phenomenon th t led to the di covery of ri ozyme , hich re enzyme m de of RNA. In mo t c e , ho ever, plicing i c rried out y multi- u unit protein complex kno n the pliceo ome. Whether it i elf- pliced or y pliceo ome, there re thre e m in equence component needed to define n intron th t i going to e plice d out (fig. 8). There i 5 plice ite ith the con en u equence AG|GUAAGU. T here i 3 plice ite th t t rt ith n 11-nucleotide polypyrimidine tr ct fo llo ed y NCAG|G. And ome here in et een the t o, there i r nchpoint deni ne, typic lly ithin YNCURAY equence (Y i pyrimidine, N i ny nucleotide, R i purine). Splicing i ctu lly et of t o equenti l tr n e terific tio n re ction , nd require phy ic l proxCh pter 8, Tr n cription, ver ion 1.0 Until the di covery of ri ozyme , it h d een umed th t only the enzyme coul d only e gener ted ith the diver ity of tructure po i le ith the mino ci d in protein . 5 plice ite Br nch point 3 plice ite N C A G G Exon 2 5 A G G U R A G U Exon 1 ... Y N C U R AY Intron Polypyrimidine tr ct 3

P ge 124

Figure 8. Con en u

equence

for plicing.

   

          

imity of the re ctive ite y ending nd looping of the RNA, either utonomou ly or round protein f ctor kno nRNP (pronounced nurp ). SnRNP i n cro nym for m ll nucle r ri onucleoprotein . They cont in oth protein nd m l l nucle r RNA ( nRNA) component; the l tter help ith equence recognition. Ex min tion of the tructure of the nRNA p rt of the e pliceo ome nRNP ho th t they re very imil r to the h pe t ken y the RNA tr n cript it elf in c e of elf- plicing. Keeping th t in mind, much of the follo ing de cription of pliceo ome-medi ted plicing h ppen in elf- plicing ell. 5 plice ite 5 5 Exon Intron Br nch point A 3 plice ite 3 Exon 3

U1 U2 A 5 3 A U6 U1 U4 U5 U2 5 3 Tr n e teri c tion 1 A U2 U5 U6 3

Although the nRNP re the prim ry component of the pliceo ome, v riety of other plicing f ctor l o pl y role. The mo t prominent re U2AF (U2- oci ted f ctor, hich ind to the polypyrimidine tr ct, nd SF1 ( plicing f ctor 1, k r nchpoint protein BPP) hich ind to con en u equence ne r the r nchp oint. Together they help to properly po ition the U2 nRNP. There re l o v r iety of other le - tudied plicing f ctor from the SR protein f mily (C-termin l Serine-Arginine inding motif) nd the hnRNP (heterogenou nucle r ri onucleo protein) f milie th t ct to recruit the prim ry mem er of the pliceo ome to their proper loc tion .

  

5 Tr n e teri c tion 2 Intron 5 5 Exon 3 Exon 3

In the fir t tep, the U1 nRNP ind to the intronic portion of the 5 plice it e. Next, the U2 nRNP ind to the con en u ite round the r nchpoint, ut im port ntly, there i no e-p iring to the r nchpoint A it elf. In te d, due to ep iring of U2 ith the urrounding equence, the r nchpoint A i forced to ulge out from the re t of the RNA in th t region. U4, U5, nd U6 join the pli ceo ome together, ut hile U5 ind to the 5 exon, nd U6 di pl ce U1 t the 5 plice ite, U4 i only tr n iently tt ched nd l o f ll off the pliceo ome efore the fir t tr n e terific tion re ction. A the figure ho , in thi re ct ion, the 2-OH of the r nchpoint A nucleophilic lly tCh pter 8, Tr n cription, v er ion 1.0 P ge 125

Figure 9. RNA plicing y pliceo ome. De cription in text

elo .

t ck the 5-pho ph te of the fir t intron nucleotide to form l ri t tructure i n hich the 5 end of the intron i connected to the r nchpoint vi 2,5-pho phodi e ter ond. Thi rele e the 5 exon ( nd the hole 5 h lf of the RNA for th t m t ter), ut it i kept in clo e proximity to the 3 exon ( nd the re t of the RNA) y U5, hich tt che to oth exon . Thi llo the econd tr n e terific tion t o t ke pl ce, in hich the 3OH of the fir t exon tt ck the 5 pho ph te t the e ginning of the econd exon, thu imult neou ly re king the ond et een the in tron nd the econd exon, nd l o connecting the t o exon vi convention l 3, 5-pho phodie ter ond. The intron, in the h pe of l ri t, i thu rele ed nd ill e quickly degr ded. A Intron B Intron NH2 N H N O O O H H O O P OO P O CH2 H Br nch Point OH N NH2 N O O O H H O O P OO P O CH2 H Br nch Point OA N N A N 5 O H O P ON H 2 OH Tr n e teri c tion 1 O 2 O O 5 O O P OO 3 Exon Tr n e teri c tion 2 O O P OO 3 Exon P OO 5 5 Exon 3 5 5 Exon O H

 

   

3 Figure 10. (A) Tr n e terific tion re ction 1 connect the 2-OH of the r nchpoin t ri o e to the 5-pho ph te of the 3 end of exon 1. (B) Tr n e terific tion 2 i n tt ck y the rem ining -OH on the 3 end of exon 1 on the 5 pho ph te of exon 2. (C) Thi imult neou ly rele e the l ri t nd connect the exon . Intron L ri t C NH2 N H O N O O O H H O O P OO P O CH2 H OA N N 5 5 5 Exon O P O O 3 Exon 3 O H O P OO 2 OH 3 Splicing i n efficient ( ith re pect to genome ize) y to gener te protein d iver ity. In ltern tive plicing, ome potenti l intron m y e pliced out und er cert in circum t nce ut rem in coding equence under other circum t nce . Rec ll th t the plice ite re recognized y e-p iring nd therefore, the re c n e tronger nd e ker plice ite depending on ho clo e they re to th e con en u nd the complement ry equence on the nRNP . Therefore, gene ith ever l potenti l intron m y h ve ll intron pliced out 80% of the time, ut the other 20% of the time, perh p only one or t o intron re pliced out. Add ing v ri ility, there re plicing f ctor th t m y ind ne r plice ite nd c n either m ke them more e ily recogniz le, or ne rly hidden. Ch pter 8, Tr n cription, ver ion 1.0 P ge 126

 

The cl ic ex mple of ltern tive plicing i the gene encoding -tropomyo in ( fig. 11). By plicing in/out different com in tion of exon , ingle gene c n gener te even different protein , depending on the ti ue type. In the e c e , p rticul r type of cell or ti ue cont in pecific com in tion of plicing f ctor , nd therefore control the recognition of pecific plice ite , le ding to the different plicing p ttern . -Tropomyo in (R t) Gene Structure

Smooth Mu cle Fi ro l t Liver Br in Figure 11. Altern tive plicing of the -tropomyo in gene le d to different for m of the mRNA nd protein in different cell type . Although thi conclude the di cu ion of ic mech ni m of tr n cription, the next ch pter i re lly continu tion of thi one: control of gene expre ion i n it imple t form i regul ting the recognition of promoter equence y n R NA polymer e. Ch pter 8, Tr n cription, ver ion 1.0 P ge 127

-Tropomyo in (R t) Splice V ri nt

Stri ted Mu cle

A 5 plice ite B 5 Exon Intron Br nch point A 3 plice ite 3 Exon Intron 5 3 NH2 N H N O O O H H O O P OO P O CH2 H Br nch Point OA N N U1 U2 A 5 3 Tr n e teri c tion 1 H 2 OH O O 5 O O P OO 3 Exon P OO 5 5 Exon 3 A U6 U1 U4 U5 U2 Intron C NH2 5 3 H N

N O O O H H O O P OO P O CH2 H Br nch Point OA N 5 O H O P ON O 2 Tr n e teri c tion 1 Tr n e teri c tion 2 O O P OO A U2 U5 5 5 Exon O H 3 Exon 3 U6 3 5 D Intron L ri t NH2 Tr n e teri c tion 2 Intron N H N O O O H H O O P OO P O CH2 H OA N N 5 O H O P OO 2 5 5 Exon

3 Exon 3 O 5 Figure 12. Splicing of RNA. Splicing remove ome portion of prim ry tr n cri pt (intron ) hile com ining the rem ining RNA (exon ) to form the fin l mRNA e quence. The chemic l mech ni m i erie of t o tr n e terific tion . The fir t ccompli he the looping of the intron, hile the econd rele e th t intron l ri t hile imult neou ly joining the t o exon together. Splicing pecific ity relie on three l ndm rk on the RNA, mo t import nt of hich i the r nchp oint, n denine re idue th t i the connection point for the intron loop form t ion. The other t o l ndm rk re the 3 nd the 5 plice ite , e ch of hich re equence th t ind to nRNP to ring together the pliceo ome. Ch pter 8, Tr n cription, ver ion 1.0 O 5 Exon O P O 3 Exon 3 3 OH P ge 128

Prok ryotic Tr n cription l Regul tion Unlike multicellul r org ni m , in hich mo t cell re in tightly regul ted i ntern l environment, mo t prok ryotic cell re con t ntly re ponding to ch ngin g condition in their immedi te environment, uch ch nge in lt concentr ti on, temper ture, cidity, or nutrient v il ility. Bec u e the e org ni m mu t re pond quickly, the lifetime of n RNA i kept hort, on the order of ever l minute - o gene product th t re not u eful in the ne condition do not t e re ource . For the me re on, initi tion of ne tr n cription mu t l o occu r very quickly - o th t gene product th t re needed to t ilize the cell in the ne condition re r pidly v il le. A f t nd efficient control y tem i needed, nd in prok ryote , thi me n th t the control on tr n cription re imple ctiv tor nd repre or . For ome gene , oth m y e u ed for regul tion , hile for other , only one i needed to ch nge from def ult t te of expre ion or non-expre ion. A cl ic ex mple of repre or control of gene expre ion , the l c operon, l o illu tr te nother method y hich cteri m y control the expre ion of gene . An operon i group of gene ho e product p rticip t e in the me met olic p th y, nd re tr n cri ed under the control of ing le promoter. The l c operon con i t of three gene (l cZ, l cY, l cA) th t p rt icip te in the c t oli m of the di cch ride, l cto e. L cZ i -g l cto id e, n enzyme th t cle ve l cto e into g l cto e nd gluco e. L cY i -g l cto id e perme e, hich tr n port l cto e from the extr cellul r environment into the cell. Both re required for l cto e c t oli m. Oddly, l cA i not olutely Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 129

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

dv n the dv Fin on e

Gene Regul tion : Control Mech ni m To define gene, tretch of DNA mu t h ve promoter, t rt ite, nd nd top ite. In prok ryote, the e re nece ry nd often ufficient, ut in euk ryote, they re till nece ry, ut eldom ufficient. Thi ch pter di cu e the other element , oth po itive nd neg tive, th t re u ed to regul te the expre ion (i.e. tr n cription) of gene. It i prim rily tory of tr n crip tion f ctor nd the recognition element to hich they ind.

       

 

required for l cto e met oli m, ut it function i rel ted to the other t o: i t i g l cto ide tr n cetyl e th t tr n fer cetyl group from cetyl-CoA to l cto e. All three re tr n l ted (they ret in their individu l t rt nd to p codon for tr n l tion, not to e confu ed ith the t rt nd top of tr n cri ption) from ingle tr n cript. Of p rticul r intere t ith re pect to the regu l tion of thi tr n cription i the tructure of the promoter region. Note th t in ddition to the exected 70 promoter up tre m of the t rt ite, there i no ther control equence on e ch ide of the t rt ite (fig. 1A). A) l c operon CAP- inding RNAP- inding (promoter) Repre or- inding 5 nt CAP- inding region -35 -10 +1 OPERATOR l cZ l cY l cA 3 B) L cto e high, Gluco e high (cAMP lo ) Repre or L cto e RNAP CAP

5 nt CAP- inding region -35 -10 +1 OPERATOR l cZ l cY l cA 3 C) L cto e lo , Gluco e high (cAMP lo ) CAP Repre or No Tr n cription 5 nt CAP- inding region -35 -10 +1 OPERATOR

Very Lo

Tr n cription

l cZ l cY l cA 3

+cAMP OPERATOR -35 -10 +1 No Tr n cription CAP- inding region l cZ l cY l cA 3 E) L cto e high, Gluco e lo (cAMP high) RNAP CAP 5 nt Repre or L cto e +cAMP OPERATOR -35 -10 +1 High Tr n cription CAP- inding region l cZ l cY l cA 3 Figure 1. The l c operon. The oper tor i equence of DNA th t lie et een the promoter nd the t rt ite. It i recognized y the l c repre or, DNA inding protein ith helix-t urn-helix motif. In the ence of l cto e (fig. 1C), the l c repre or h hi gh ffinity for the oper tor equence nd ind tightly, o tructing the t rt ite nd forming phy ic l ro d lock to tr n cription y preventing the RNA polyme r e from moving for rd Ch pter 9, Gene Regul tion, ver ion 1.0

Note th t the helix-turn-helix (HTH) motif, hich i common in cteri l DNA- in ding protein , i not the me thing the helixloop-helix DNA- inding protein

D) L cto e lo , Gluco e lo

(cAMP high) CAP 5 nt Repre or

th t re u ed in m ny euk ryotic y tem . An el or tion of the ic HTH motif , kno n the inged helix motif, i l o found in v riety of prok ryotic DNA inding protein . P ge 130

from the promoter. Thi m ke en e phy iologic lly ec u e the cell i more eff icient met olizing gluco e, nd if there i no l cto e round, then it i te of re ource to m ke enzyme th t met olize it. Ho ever, h t if there i u ddenly n und nce of l cto e in the environment? A the l cto e i t ken into the cell, intr cellul r level ri e, nd no enzyme re needed to utilize thi ne food ource. The l cto e ctu lly turn on the expre ion of enzyme th t i ll met olize it! Specific lly, the l cto e ind to the l c repre or protein ( 4 l cto e inding ite ), hich c u e conform tion l ch nge th t rele e it from the oper tor equence (fig. 1B). No n RNA polymer e th t tt che t the l c operon promoter c n proceed to tr n cri e the me ge unhindered, producing RNA nd u equently protein th t re u ed to re k do n the l cto e. Thi con tinue long there i und nt l cto e in the cell. A the l cto e level d rop, repre or protein re no longer ound y l cto e, nd c n once g in ind the oper tor nd inhi it expre ion of the operon once g in. For no , ignore th e CAP protein in figure 1, nd p rt D nd E. Well come ck to th t. The l c ope ron i n ex mple of n induci le operon, in hich the n tive t te i off nd the introduction of nd inducer (in thi c e l cto e) ill ind the repre or nd turn the operon on. In contr t, there re l o operon ith the rever e mech ni m . An ex mple of one uch repre i le operon i the trp operon (fig. 2). Thi ope ron cont in five gene th t re involved in the ynthe i of the mino cid try ptoph n: trpE nd trpD, hich A) trp operon RNAP- inding (promoter) 5 nt -35 OPERATOR -10 +1 trpE trpD trpC trpB trpA 3 Repre or- inding

Repre or (in ctive) RNAP High Tr n cription 5 nt -35 OPERATOR -10 +1 trpE trpD

B) Tryptoph n lo

 

        

trpC trpB trpA 3 C) Tryptoph n high Tryptoph n Repre or ( ctive) No Tr n cription 5 nt -35 OPERATOR -10 +1 trpE trpD trpC trpB trpA 3 Figure 2. The trp operon. Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 131

In E. coli, cAMP level re not directly tied to intr cellul r gluco e level or gluco e met oli m. R ther, cAMP level re ltered y gluco e tr n port throug h pho phoenolpyruv te-dependent pho photr n fer e y tem (PTS), p rt of hich i de-pho phoryl ted (the crr gene product, l o kno n EIIA) hen gluco e i moved in rd. The pho phoryl ted EIIA~P i n ctiv tor of denyl te cycl e. S o, gluco e move into the cell, cAMP level drop due to in ctive denyl te cy cl e. P ge 132

together encode the u unit of nthr nil te ynthet e, trpC, hich encode N-( 5pho phori o yl)- nthr nil te i omer e, nd trpB nd trpA, hich e ch encode u unit of tryptoph n ynthet e. The trp repre or i l rger nd more complex th n the l c repre or, ut it l o utilize helix-turn-helix DNA- inding motif. Ho ever, it differ in cruci l pect. In it n tive form, it doe not ind to the oper tor equence. It only ind to the oper tor fter it h fir t ound t ryptoph n (t o molecule of trp ind to one repre or). Thi i the oppo ite of the l c repre or, ut hen con idering the phy iologic l function of the e gene , thi hould m ke perfect en e. A long there i no tryptoph n, the oper t or i un ound, llo ing the RNA polymer e to tr n cri e the gene needed to m k e tryptoph n (fig. 2B). When enough tryptoph n h ccumul ted in the cell, ome of the extr tryptoph n ind to the trp repre or, hich ctiv te it nd llo it to ind to the oper tor (fig. 2C). When thi h ppen , the RNAP c nnot re ch the t rt ite, nd re ource re not ted tr n cri ing gene for enzyme th t m ke omething the cell lre dy h lot of. Let u no return to the l c oper on in figure 1. It turn out th t even hen the operon i induced y the pre enc e of l cto e, the r te of tr n cription i lo . The limit tion i not from the r epre or - th t h een removed de cri ed ove (fig. 1B). In te d, the lo expre ion i due to lo - ffinity promoter. Thi i true not ju t of the l c o peron, ut l o other non-gluco e-p th y ug r-c t oli m gene . There i im ple expl n tion: even if there re und nt ltern te ug r v il le (e.g. l c to e), if there i gluco e v il le, it i the cell mo t efficient nd preferre d p th y for energy production, nd the production of enzyme for other p th y ould e n inefficient u e of re ource . So, hen nd ho i the l c operon r e lly turned on? The n er lie in CAP, c t olite gene ctiv tor protein, l o kno n CRP, or cAMP receptor protein. It i m ll homodimeric DNA inding protein th t ind to equence th t overl p the 5 ide of the promoter. In th e pre ence of cAMP, hich ind to the protein, CAP h high ffinity for the DNA recognition equence, nd ind to it (Fig. 1E). The protein then help to r ecruit the RNAP to the promoter ite, inding directly to the C-termin l dom in of the RNAP u unit to incre e the ffinity of the polymer e for the promote r equence to overcome e k promoter. Wh t doe cAMP h ve to do ith thi ? Whe n there i und nt extr cellul r gluco e, there i little cAMP. The enzyme th t ynthe ize cAMP, denyl te cycl e, i neg tively regul ted y gluco e tr n po rt. Ho ever, hen there i little environment l gluco e, denyl te cycl e i mo re ctive, m ke cAMP, hich ind CAP, nd le d to ro u t production of l cto e c t oli m enzyme . CAP i n ex mple of n ctiv tor th t c n control gene ex pre ion in po itive direction. Ch pter 9, Gene Regul tion, ver ion 1.0

 

                      

The l t, nd mo t complic ted ex mple of prok ryotic met olic gene control i the r BAD operon. Thi operon produce enzyme u ed for the c t oli m of the 5 -c r on ug r, L- r ino e. The intere ting thing out thi operon i the pre e nce of oth po itive nd neg tive control element th t re u ed y the me con trol protein, r C. When there i little or no r ino e, the r C ind to the oper tor equence r O2 nd r I1. The t o r C protein then inter ct, hich c u e the DNA to loop round preventing RNAP from inding to the promoter nd tr n cri ing r BAD. Furthermore, thi operon i l o under the control of CAP, n d the dou le r C loop tructure l o A) r BAD operon Control ite Structur l r gene 5 r O2 r O1

CAP r I r B r A r D

5 Ar C repre or ( ctive) No Tr n cription Not ll operon re concerned ith coordin ting met olic ctivitie . An import nt non-met olic operon in E. coli i the LexA/ RecA SOS re pon e operon, hich cont in gene th t re involved in DNA rep ir. The SOS rep ir y tem i invoked to llo DNA replic tion to continue through re of d m ged DNA, ut ith the pen lty of lo fidelity. One of the gene product of thi operon, RecA, i impo rt nt in recognizing nd rep iring d m ge c u ed y UV light. It l o function regul tor of the LexA repre or protein. LexA i ctu lly repre or for m ultiple SOS operon , inding to common oper tor equence up tre m of e ch gene /operon. It i ctiv ted hen RecA, upon detecting DNA d m ge, undergoe confo rm tion l hift nd ctiv te prote e ctivity, hich then cle ve LexA, llo i ng tr n cription from the SOS gene /operon . SOS rep ir i error-prone ec u e hen the repli ome encounter ulky d m ge, it undergoe replic tion fork coll p e in hich the DNA polymer e III unit re rele ed. The repl cement, or yp , polymer e , Pol IV (dinB), nd Pol V (umuDC), do not h ve 35 proofre ding exonucle e ctivity. Mi incorpor tion of G oppo ite thymine dimer occur t out h lf the r te of proper A incorpor tion, nd gener lly, the yp polymer e re out 1000 time more error-prone th n Pol II or Pol I. A 5 lexA Tr n cription & Tr n l tion r O1L r O1R

CAP

 

B) L- r ino e lo , cAMP lo r O2

  

r I1 r I2 r B r A r D

3 C) L- r ino e high, cAMP high L- r ino e

RNAP High Tr n cription 5 r O2 r B r A

3 r D 3 Ar C repre or (in ctive) + L- r ino e Figure 3. The r BAD operon. Oper tor recA uvrA uvrB 3

LexA Repre ion B D m ged DNA Euk ryotic Tr n cription l Regul tion A ith lmo t every comp ri on ith prok ryotic y tem , regul tion of euk ryot ic tr n cription i much more complex th n prok ryotic gene control, lthough t ill ed on imil r mech ni m of ctiv tor nd repre or . There i no clo e euk ryotic equiv lent to operon , though: euk ryotic gene re l y tr n cri e d one per mRNA. The previou ch pter de cri ed the form tion of preiniti tion complex of tr n cription Active LexA

prevent CAP from inding. Ho ever, hen there i plentiful r ino e, r C repr e or ind the r ino e nd then inter ct differently, till forming dimer , ut no in different conform tion th t le d to inding of r O1L nd r O1R to gether ell r I1 nd r I2. The r ino e- ound r C t the r I ite in ter ct ith RNAP nd together ith CAP promote trong ctiv tion of r BAD expre ion.

CAP + cAMP

  

r O1L r O1R CAP r I1 r I2

Active RecA Cle ved (in ctive) LexA Tr n cription & Tr n l tion LexA RecA UvrA UvrB 5 No Repre ion lexA recA uvrA uvrB 3 Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 133

TBP 5 TATA I +1 3 B RNAP TBP 5 TATA I +1 3 Figure 5. Euk ryotic tr n cription f ctor c n ork in complex com in tion . In thi figure, the tr n cription f ctor h nging do n rd re repre ent tive of in hi itory TF , hile tho e riding upright on the DNA re con idered enh ncer . Th u , the RNA polymer e in (A) h lo er pro ility of tr n cri ing thi gene, hile the RNAP in (B) i more likely to, perh p ec u e the TF ne re t the pro moter inter ct ith the RNAP to t ilize it inter ction ith TFIID. In thi y, the me gene m y e expre ed in very different mouunt nd t different time depending on the tr n cription f ctor expre ed in p rticul r cell type .

Very often, com in tion of m ny tr n cription f ctor , oth enh ncer nd ile ncer , i re pon i le for the ultim te expre ion r te of given euk ryotic gen e. Thi c n e done in gr ded f hion, in hich expre ion ecome tronger or e ker more Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 134

f ctor for RNA polymer e II. The e tr n cription f ctor (e.g. TFIID, TFIIH, e tc.) re kno n gener l tr n cription f ctor , nd re required for tr n cript ion of ny gene t ny level. Ho ever, there re l o pecific tr n cription f c tor , u u lly referred to imply tr n cription f ctor (TF), th t modul te th e frequency of tr n cription of p rticul r gene . Some up tre m element nd the ir oci ted TF re f irly common, hile other re gene or gene-f mily pecif ic. An ex mple of the former i the up tre m element AACCAAT nd it oci ted tr n cription f ctor, CP1. Another tr n cription f ctor, Sp1, i imil rly commo n, nd ind to con en u equence of ACGCCC. Both re u ed in the control of the et -glo in gene, long ith more pecific tr n cription f ctor , uch GA TA-1, hich ind con en u AAGTATCACT nd i prim rily produced in lood cell . Thi illu tr te nother option found in euk ryotic control th t i not found in prok ryote : ti ue- pecific gene expre ion. Gene , eing in the DNA, re t echnic lly v il le to ny nd every cell, ut o viou ly the need of lood c ell differ gre t de l from the need of liver cell, or neuron. Therefore, e ch cell m y produce tr n cription f ctor th t re pecific to it cell or ti ue type. The e tr n cription f ctor c n then llo or repre expre ion of mu ltiple gene th t help define thi p rticul r cell type, uming they ll h ve the recognition equence for the TF . The e recognition equence re l o kno n re pon e element (RE). A RNAP

 

 

(tr n cription f ctor) Activ tor 5 Co ctiv tor DNA Bending Protein 3

Figure 6. An enh ncer c n t ilize or recruit component of the tr n cription m chine through co ctiv tor protein. Euk ryotic tr n cription f ctor , hile v ried, u u lly cont in t le t one of the follo ing tr n cription f ctor motif : zinc finger , leucine zipper , ic helix-loop-helix dom in , Rel homology region dom in , or v ri tion thereof. T he zinc finger motif the fir t DNA- inding dom in to e di covered, nd found in gener l tr n cription f ctor oci ted ith RNA polymer e III. The initi l tructure found repe ting ~30- mino cid motif ith t o inv ri nt Cy nd t o inv ri nt Hi re idue th t together ind Zn++ ion nd thu ring tight loop or finger of ic potenti lly DNA- inding re idue together. The ic finger ind to the m jor groove of the DNA, ith the ex ct equence-m tching ch r cteri tic determined y the topology of the p rticul r re idue th t m ke up the finger. Although mo t DNA inding motif in ert po itively-ch rged -h elic l dom in into the m jor groove of Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 135

      

Gener l Tr n cription F ctor

nd RNA polymer e II

enh ncer or ilencer re ound, re pectively, or it c n e in ry mode of co ntrol, in hich ell-defined group of TF re required to turn on tr n criptio n, nd mi ing ju t one c n effectively hut do n tr n cription entirely. In the fir t c e, ctiv ting TF gener lly ind to the GTF or RNA Polymer e II dire ctly to help them recognize the promoter more efficiently or t ly, hile repre ing TF m y ind to the ctiv ting TF , or to the GTF or RNAP II, in preventi ng recognition of the promoter, or de t ilizing the RNAP II preiniti tion compl ex. In the econd c e, ctiv tion hinge on the uilding of n enh nceo ome, in hich tr n cription f ctor nd protein c ffolding element nd co ctiv tor c ome together to po ition nd t ilize the preiniti tion complex nd RNAP II on the promoter. The mo t prominent nd ne rly u iquitou co ctiv tor i n med Medi tor, nd ind to the CTD of the u unit of RNA polymer e II nd l o to v riety of tr n cription f ctor . Enh ncer

  

In ddition to the fir t type of Zn++- inding ite de cri ed ith t o Cy nd t o Hi (Cy 2-Hi 2), there re t o m jor v ri tion to note. The fir t i the Cy 2 -Cy 2 type, hich i ch r cteri tic of teroid receptor tr n cription f ctor u ch the glucocorticoid receptor or e trogen receptor. We ill con ider them in more det il l ter ith the di cu ion of intr cellul r ign l tr n duction, ut for no , the gener l ide i th t un ctiv ted teroid hormone receptor re fou nd in the cytopl m, here they come in cont ct ith nd ind their cogn te horm one molecule. They then tr n loc te to the nucleu , here they dimerize nd re le to ct tr n cription f ctor . The econd m jor v ri tion of the zinc fin ger i the inucle r Cy 6, hich c rrie ix Cy re idue to cre te lightly l rger ket in hich t o Zn++ ion re held, r ther th n ju t one. The e t- tudi ed ex mple of thi type of zinc-finger protein i GAL4, ye t met olic tr n c ription f ctor. The next motif i the leucine zipper. Although thi i common motif for tr n c ription f ctor , it i import nt to note th t unlike the zinc-finger, the leucin e zipper it elf i not DNA- inding motif. R ther, it i protein dimeriz tion motif, nd determine the y in hich t o protein u unit inter ct. Ho ever, the leucine zipper i common tructur l motif in tr n cription f ctor . It or k through oppo ing dom in of regul rly p ced hydropho ic mino cid , p rticu l rly leucine , hich re very effective t holding the t o u unit together in the queou environL L ment of the cell. The leucine re L L found in every 7t h re idue po iL L tion of n -helic l dom in, le dL L ing to coiled-coil upe r tructure L L L hen t o u unit inter ct. The L (+) ch rged DNA- inding dom i n of the e protein re u u lly Ntermin l to the leucine zipper , in the c e of the ZIP c tegory of leucine zipper protein (the n me t nd for ic reg ion Figure 8. Leucine zipper. leucine zipper). Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 136

Cy

Hi

Hi Zn2+ Cy

DNA, the zinc-finger protein re the only one th t com ine ever l uch motif to inter ct ith the DNA in ever l equenti l ite . Figure 7. Zinc-finger f mily tr n cription f ctor (left) nd clo e-up of Zn++ i nding ite (right). E ch cylinder repre ent n -helic l dom in.

The HLH, or ic helix-loop-helix dom in ppe r to e el or tion on the leu cine zipper theme. In thi c e, the N-termin l region i highly ic, m king i t ide l for inter cting ith DNA, nd thi ic dom in, hich i l o helic l, le d into the fir t helix (H1) of the motif, hich i then connected y non-h elic l loop of mino cid , le ding into econd helic l region (H2). Beyond th e HLH, the e tr n cription f ctor m y merge into leucine zipper motif or oth er protein inter ction dom in for dimeriz tion. Though the prim ry inding dom i n i N-termin l to H1, the H1 dom in l o ppe r to pl y role in inding the m jor groove of the DNA. [Ex mple myc]

NF-kB (nucle r f ctor kB) i u iquitou tr n cription f ctor di covered ( nd m o t notice le) in the immune y tem. When ctive, it i heterodimer, ith ot h u unit cont ining Rel homology region (RHR). Rel i n oncogene, nd the R HR re n med for their imil rity to the previou ly- equenced rel. The RHR dom i n ind to DNA ith extr ordin ry ffinity, due in p rt to h ving five loop for DNA cont ct per u unit. Ju t ith the other type of tr n cription f ctor , ome RHR-cont ining protein re repre or , hile other re ctiv tor . The regul tion of NF-kB i r ther intere ting: once it i in the nucleu , it i gener lly ctive. Ho ever, it i , lmo t ll cellul r protein , m de in the c ytopl m. Inhi itor of NF-kB (IkB) l o re ide in the cytopl m, nd they ct y inding the NF-kB nd covering the nucle r loc liz tion ign l th t llo it import into the nucleu . Thu eque tered, the NF-kB mu t rem in in the cytopl m in ctive until ome timulu ctiv te IkB kin e, hich pho phoryl te the I kB nd le d to u iquitin tion nd degr d tion, fin lly rele ing the NF-kB from it ond . Bec u e it c n e mo ilized quickly (comp red to ynthe izing ne pr otein), NF-kB i con ider r pid-re pon e tr n cription f ctor th t i often u ed to egin expre ion of gene needed oon fter it h een ordered y ign l , either extr cellul r or intr cellul r. Not urpri ingly for f ctor di covere d in the immune y tem, it i ctiv ted in re pon e to cteri l nd vir l ntig en , ell other type of cellul r tre or in ult. P ge 137

Ch pter 9, Gene Regul tion, ver ion 1.0

Figure 10. RHR dom in n cription f ctor .

re

DNA- inding dom in found in the NF-kB f mily of tr

Figure 9. Binding of

ic helix-loop-helix ( HLH) cl

tr n cription f ctor.

A O C CH3 O C O CH 3 DNA repre or ite DNA O C CH3 C CH 3 Acetyl ted hi tone (loo e DNA) B Corepre or Tr n cription l repre or O HDAC C O CH3 O C CH3 C CH3 O C CH3 DNA De cetyl ted hi tone (tight DNA) C DNA methyltr n fer e Corepre or Tr n cription l repre or CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 CH3 DNA Methyl ted DNA

Figure 11. Long-term gene repre ion. (A) Acetyl tion of hi tone


llo DNA to

In ddition to the rel tively hort-term regul tion of gene expre ion controlle d y inding tr n cription f ctor to regul tory element , there re l o trong er method of locking y gene to prevent it expre ion. In ch pter 7, cety l tion nd de cetyl tion of hi tone di cu ed method for decre ing n d incre ing their ffinity for DNA. Thi c n e controlled (Fig. 11B) y the re cruitment of hi tone de cetyl e (HDAC) to p rticul r gene i repre or/co-rep re or complexe . The de cetyl e force tight inding of the t rgeted DNA to th e hi tone , precluding cce y RNA polymer e or gener l tr n cription f ctor . Another recruiter of HDAC re MBD protein , hich ind to methyl ted DNA. DNA methyl tion in m mm l u u lly occur on CpG dinucleotide equence . Thi methy l tion ppe r to h ve the effect of locking cce of tr n cription f ctor n d enzyme to the DNA. It c n do o directly, or y recruiting MBD (methyl-CpG- i nding dom in) protein . In either c e, methyl tion i long-term method of loc king up gene , nd i the mech ni m for turning off gene th t ould never e u ed in p rticul r cell type (e.g. hemoglo in in neuron ).

  

move off, potenti lly freeing the gene in th t region for expre ion. (B) Speci fic region c n e r pped more tifhtly round hi tone through the ction of HD AC, removing the cetyl group . (C) Methyl tion of the DNA c n l o prevent expr e ion, either y phy ic lly locking cce , or y recruiting HDAC. Ch pter 9, Gene Regul tion, ver ion 1.0 P ge 138

Tr n l tion : From RNA to Protein The RNA polymer e h done it jo (or in the c e of prok ryote , m y till e in the proce of doing it jo ), o no h t h ppen to the RNA? For RNA th t i de tined to provide in truction for m king protein, then it need to e tr n l ted, hich i jo for Superm n! Oop , ctu lly it jo for ri o ome . Ri o ome re complex of RNA nd protein th t ind to nd proce ively move do n (from 5 to 3 end) tr nd of mRNA, picking up mino cyl-tRNA , checking to ee if they re complement ry to the RNA tri-nucleotide eing re d t the moment, nd d ding them to the ne polypeptide ch in if they re. The RNA p rt of the ri o ome re gener ted y the org ni m gener l purpo e RNA polymer e in prok ryote , nd gener ted y the RNA polymer e I nd III in euk ryote . Rec ll th t RNA Pol II i u ed y euk ryote to gener te protein-coding mRNA . Although the num er of RNA tr nd nd protein u unit differ et een the prok ryote nd euk ryote, the mech ni m for tr n l tion i rem rk ly ell con erved.

Figure 1. T o vie of prok ryotic ri o ome. The l rge ri o om l u unit (50S) i ho n in red, hile the m ll ri o om l u unit (30S) i ho n in lue. 3D i m ge gener ted from d t in the RCSB Protein D t B nk. Ch pter 10, Tr n l tion, ver ion 1.0 P ge 139

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

dv n the dv Fin on e

        

Prok ryotic ri o ome The prok ryotic ri o ome cont in 3 RNA tr nd nd 52 protein u unit hich c n e divided into 1 RNA nd 21 protein in the m ll ri o om l u unit ( k the 30S u unit) nd 2 RNA nd 31 protein in the l rge ri o om l u unit (50S u un it). The m ll u unit loc te the t rt ite nd move long the RNA. The l rge ri o om l u unit cont in the mino cyl tr n fer e enzyme ctivity th t conne ct mino cid to m ke protein. Neither u unit i ufficient to c rry out tr n l tion y it elf. They mu t come together to form the full 70S ri o ome for t r n l tion to occur. If you rent lre dy f mili r ith the nomencl ture, youre pr o ly thinking th t it o viou hy I ent into iology r ther th n m th. My com petence t ic comput tion ide, there i method to the m dne . The S in 30S or 50S indic te Sved erg unit , or me urement of the ediment tion r te he n the molecule in que tion re centrifuged under t nd rd condition . Bec u e t he r te of ediment tion depend on oth the m nd the h pe of molecule, n um er do not l y dd up. The gene for the prok ryotic rRNA molecule re r r nged in n operon nd thu come from ingle tr n cript. Depending on the org ni m, there m y e ever l uch operon in the genome to en ure te dy producti on of thi cruci l enzym tic complex. Ho ever, the e RNA re not tr n l ted, o in te d of h ving multiple tr n l tion t rt codon to ign l the eginning of e ch gene, the ingle tr n cript i cle ved po t-tr n cription lly y Ri onucle e III (RN e III) into 25S, 18S, nd 5S egment , nd the e re then further tr immed y RN e III nd RN e M into the fin l 23S, 16S, nd 5S rRNA found in th e ri o ome . Although the 5S doe not ppreci ly differ in ediment tion r te, it i in f ct lightly h ved in po t-tr n cription l editing.

Bec u e of the den ity of m teri l in the nucleolu needed for con t nt ri o ome production, it i often re dily vi i le under v riou type of micro copy de pi te not eing ounded y mem r ne. P ge 140

Euk ryotic ri o ome Like the RNA molecule in prok ryotic ri o ome , the euk ryotic rRNA molecule re l o po t-tr n cription lly cle ved from l rger tr n cript . Thi proce ing, nd the u equent em ly of the l rge nd m ll ri o om l u unit re c rri ed out in the nucleolu , region of the nucleu peci lized for ri o ome produc tion, nd cont ining not only high concentr tion of rRNA nd ri om l protein , ut l o RNA polymer e I nd RNA polymer e III. In contr t, RNA polymer e I I, efit it ro der purpo e, i found throughout the nucleu . The 40S m ll ri o om l u unit in euk ryote l o h ju t 1 rRNA, nd h 33 protein . The 60S, or l rge ri o om l u unit in euk ryote h three rRNA molecule , t o of hich re roughly n logou to the prok ryote (28S nd 5S euk ryotic, 23S nd 5S prok ryotic), nd one, the 5.8S, th t ind ith complemenCh pter 10, Tr n l tio n, ver ion 1.0

         

t ry equence on p rt of the 28S rRNA. It l o cont in 50 protein . The e ri o om l u unit h ve roughly the me function the prok ryotic ver ion : the m ll u unit in conjunction ith v riou initi tion f ctor i re pon i le for fi nding the t rt ite nd po itioning the ri o ome on the mRNA, hile the l rge u unit hou e the docking ite for incoming nd pent mino cyl-tRNA nd cont in the c t lytic component to tt ch mino cid vi peptide ond . The ri o om l RNA precur or (pre-rRNA) re rem rk ly con erved in euk ryote , ith the 28 S, 5.8S, nd 18S rRNA encoded ithin ingle tr n cript. Thi tr n cript, ynt he ized y RNA polymer e I, l y h the me 5 to 3 order: 18S, 5.8S, 28S. Aft er the 45S pre-rRNA i tr n cri ed, it i immedi tely ound y nucleol r protein in prep r tion for cle v ge nd e modific tion. Ho ever, it i prim rily th e m ll nuclelol r RNA ( noRNA ), not the protein , th t determine the po ition of the modific tion . The prim ry modific tion re 2-hydroxylmethyl tion nd tr n form tion of ome uridine into p eudouridine . The e noRNA re ometime t r n cri ed independently y RNA polymer e III or II, ut often re formed from the intron of pre-mRNA tr n cript . Oddly, ome of the e intron come from premRNA th t form unu ed mRNA ! For the nucleolu to e the ite of ri o ome em ly, the ri o om l protein mu t e v il le to inter ct ith the rRNA . By mec h ni m di cu ed in the next ch pter, the mRNA for the ri o om l protein re tr n l ted ( re ll protein ) in the cytopl m, ut the re ulting protein r e then imported into the nucleu for em ly into either the l rge or m ll ri o om l u unit. The u unit re then exported ck out to the cytopl m, here they c n c rry out their function. The Genetic Code We h ve lithely de cri ed the purpo e of the DNA chromo ome c rrying the in form tion for uilding the protein of the cell, nd the RNA the intermedi ry for doing o. Ex ctly ho i it, though, th t molecule m de up of ju t four d ifferent nucleotide joined together ( l eit thou nd nd even thou nd of tho u nd of them), c n tell the cell hich of t enty-odd mino cid to tring tog ether to form function l protein? The o viou olution th t ince there r e not enough individu l unique nucleotide to code for e ch mino cid, there mu t e com in tion of nucleotide th t de ign te p rticul r mino cid . A dou l et code, ould llo for only 16 different com in tion (4 po i le nucleotide in the fir t po ition x 4 po i le nucleotide in the 2nd po ition = 16 com in t ion ) nd ould not e enough to encode the 20 mino cid . Ho ever, triplet c ode ould yield 64 com in tion , e ily enough to encode Ch pter 10, Tr n l tion, ver ion 1.0 P ge 141

     

     

  

20 mino cid . So ould qu druplet or quintuplet code, for th t m tter, ut t ho e ould e teful of re ource , nd thu le likely. Further inve tig tion proved the exi tence of triplet code de cri ed in the t le elo . With o m ny com in tion nd only 20 mino cid , h t doe the cell do ith th e other po i ilitie ? The genetic code i degener te code, hich me n th t t here i redund ncy o th t mo t mino cid re encoded y more th n one triplet com in tion (codon). Although it i redund nt code, it i not n m iguou co de: under norm l circum t nce , given codon encode one nd only one mino ci d. In ddition to the 20 mino cid , there re l o three top codon dedic ted t o ending tr n l tion. The three top codon l o h ve colloqui l n me : UAA (och re), UAG ( m er), UGA (op l), ith UAA eing the mo t common in prok ryotic gene . Note th t there re no dedic ted t rt codon : in te d, AUG code for oth me thionine nd the t rt of tr n l tion, depending on the circum t nce, expl in ed forth ith. The initi l Met i methionine, ut in prok ryote , it i peci lly modified formyl-methionine (f-Met). The tRNA i l o peci lized nd i dif ferent from the tRNA th t c rrie methionine to the ri o ome for ddition to g ro ing polypeptide. Therefore, in referring to the lo ded initi tor tRNA, the u u l nomencl ture i fMet-tRNAi or fMet-tRNAf. There l o eem to e little more lee y in defining the t rt ite in prok ryote th n in euk ryote , om e cteri u e GUG or UUG. Though the e codon norm lly encode v line nd leucin e, re pectively, hen they re u ed t rt codon , the initi tor tRNA ring i n f-Met. Ch pter 10, Tr n l tion, ver ion 1.0 The colloqui l n me ere t rted hen the di coverer of UAG decided to n me th e codon fter friend ho e l t n me tr n l ted into m er. Op l nd ochre ere n med to continue the ide of giving top codon color n me . The top codon r e ometime l o u ed to encode h t re no con idered the 21 t nd 22nd mino cid , elenocy teine (UGA) nd pyrroly ine (UAG). The e mino cid h ve een d i covered to e con i tently encoded in ome pecie of prok ry nd rch e . P ge 142

Ch pter 10, Tr n l tion, ver ion 1.0 P ge 143

tRNA re r ther odd duck In prok ryote , tRNA c n e found either ingle gene or p rt of operon th t c n l o cont in com in tion of mRNA or rRNA . In ny c e, hether from ingle gene, or fter the initi l cle v ge to ep r te the tRNA tr n cript fro m the re t of the tr n cript, the re ulting pre-tRNA h n N-termin l le der (4 1 nt in E. coli) th t i exci ed y RN e P. Th t cle v ge i univer l for ny prok ryotic tRNA. After th t, there re v ri tion in the minor exci ion c rrie d out y v riety of nucle e th t produce the tRNA in it fin l length though not it m ture equence, e ill ee in fe p r gr ph . Euk ryotic pre-tRN A (tr n cri ed y RNA polymer e III) imil rly h n N-termin l le der removed y RN e P. Unlike the prok ryote though, the length c n v ry et een different tRNA of the me pecie . Some euk ryotic pre-tRNA tr n cript l o cont in in tron , e peci lly in the nticodon loop, th t mu t e pliced out for the tRNA t o function norm lly. The e intron re different from the elf- plicing or plic eo ome pliced tr n cript di cu ed in the tr n cription ch pter. Here, the pli cing function i c rried out not y ri ozyme , ut y convention l (protein) enz yme . Intere tingly, RN eP l o remove 3 equence from the pre-tRNA, ut then nother 3 equence i dded ck on. Thi ne 3 end i l y CCA, nd i dded y three ucce ive round ith tRNA nucleotidyl tr n fer e. E rlier in thi tex t ook, hen RNA introduced, it noted th t lthough extremely imil r to DNA on m ny count , it i norm lly ingle tr nded, nd th t property, com ined ith the opportunity for complement ry e p iring ithin tr nd, llo it t o do omething f r different th n dou le- tr nded DNA: it c n form highly comple x econd ry tructure . One of the imple t nd cle re t ex mple of thi i tRN A, hich depend on it conform tion to ccompli h it cellul r function. The pr ototypic l cloverle f-form tRNA di gr m i ho n in fig. 2 on the left, ith 3 D model derived from x-r y cry t llogr phic d t on the right. A you c n ee, t he fully- pl yed-out h pe

Other minor lter tion to the genetic code exi t ell, ut the univer lity of the code in gener l rem in . Some mitochondri l DNA c n u e different t rt codon : hum n mitochondri l ri o ome c n u e AUA nd AUU. In ome ye t pecie , the CGA nd CGC codon for rginine re unu ed. M ny of the e ch nge h ve ee n c t loged y the N tion l Center for Biotechnology Inform tion (NCBI) ed on ork y Juke nd O t the Univer ity of C liforni t Berkeley (USA) nd t he Univer ity of N goy (J p n), re pectively.

Although the genetic code de cri ed i ne rly univer l, there re ome itu tion in hich it h een modified, nd the modific tion ret ined in evolution rily t le environment . The mitochondri in ro d r nge of org ni m demon tr te t le ch nge to the genetic code including converting the AGA from encod ing rginine into top codon nd ch nging AAA from encoding ly ine to encoding p r gine. R rely, ch nge i found in tr n l tion of n org ni mic (nucle r) genome, ut mo t of tho e r re lter tion re conver ion to or from top codo n .

 

  

 

  

 

  

Amino Acid Phe A 3 C 5 G C G G A U U U A C U C G G A G C G C C A G A C U G G U C C C G C U U A A U A G A C A C C G T loop C U G U G C T C U G A G 3 5 D loop T loop D G A D loop D G G G A A Y G A A Anticodon loop Anticodon loop Figure 2. tRNA structure. At left, the classic clover-leaf, spla ed out for simp licit . At right, a more accurate representation of the tRNA in pseudo-3D. has four stem-loop arms with the amino acid attached to the acceptor arm, which is on the opposite side of the tRNA from the anticodon arm, which is where the tRN A must match with the mRNA codon during translation. Roughl perpendicular to th e acceptor-anticodon axis are the D arm and the T C arm. In some tRNAs, there ar e actuall five total arms with a ver short loop between the T C and anticodon arms. The arm-like stem and loop structures are formed b two areas of strong co mplementarit (the stems, base-paired together) interrupted b a short non-compl ementar sequence (the loop). In general terms, the arms are used to properl po sition the tRNA within the ribosome as well as recognizing the mRNA codon and br inging in the correct amino acid. When it comes time for the tRNA to match its a nticodon with the codon on the mRNA, the code is not followed to the letter if ou will pardon the pun. There is a phenomenon called wobble in which a codon-anticod on match is allowed and stabilized for translation even if the nucleotide in the third position is not complementar . Wobble can occur because the conformation of the tRNA allows a little flexibilit to that position of the anticodon, permi tting H-bonds to form where the normall would not. This is not a universal phe nomenon though: it onl applies to situations where a U or a G is in the first p osition of the anticodon (matching the third position of codon). Following the c onvention of nucleic acid sequences, the sequence is alwa s written 5 to 3, even t hough in the case of codon-anticodon matching, the strands of mRNA and tRNA are antiparallel: tRNA mRNA Chapter 10, Translation, version 1.0 3 U A A 5 5 A U U 3 Page 144

In addition to being allowed a bit of wobble in complementar base-pairing, tRNA molecules have another peculiarit . After being initiall incorporated into a t RNA through conventional transcription, there is extensive modification of some of the bases of the tRNA. This affects both purines and p rimidines, and can ran ge from simple additions such as meth lation or extensive restructing of the sug ar skeleton itself, as in the conversion of guanosine to w osine (W). Over 50 di fferent modifications have been catalogued to date. These modifications can be n earl universal, such as the dih drouridine (D) found in the tRNA D loop, or mor e specific, such as the G to W conversion found primaril in tRNAPhe of certain species (examples have been identified in both prokar otic and eukar otic specie s). As man as 10% of the bases in a tRNA ma be modified. Naturall , alteration s to the sugar base of the nucleotides can also alter the base-pairing character istics. For example, one common modified base, inosine, can complement U, C, or A. This aberrant complementar base pairing can be equal among the suitor bases, or it ma be biased, as in the case of 5-methox uridine, which can recognize A, G, or U, but the recognition of U is poor. The knowledge of the genetic code be gs the question: how is the correct amino acid attached to an given tRNA? A cla ss of enz mes called the aminoac l tRNA s nthetases are responsible for recogniz ing both a specific tRNA and a specific amino acid, binding an ATP for energ an d then joining them together (sometimes called charging the tRNA) with h drol si s of the ATP. Specificit is a difficult task for the s nthetase since amino aci ds are built from the same backbone and are so similar in mass. Distinguishing b etween tRNA molecules is easier, since the are larger and their secondar struc tures also allow for greater variation and therefore greater ease of discriminat ion. There is also a built-in pre-attachment proofreading mechanism in that tRNA molecules that fit the s nthetase well (i.e. the correct ones) maintain contact longer and allow the reaction to proceed whereas ill-fitting and incorrect tRNA molecules are likel to disassociate from the s nthetase before it tries to att ach the amino acid. Charging an aminoac l tRNA s nthetase with its amino acid re quires energ . The s nthetase first binds a molecule of ATP and the appropriate amino acid, which react resulting in the formation of aminoac l-aden late and p rophosphate. The PPi is released and the s nthetase now binds to the proper tRNA . Finall , the amino acid is transferred to the tRNA. Depending on the class of s nthetase, the amino acid ma attach to the 2-OH of the terminal A (class I) or to the 3-OH of the terminal A (class II) of the tRNA. Phe-tRNA s nthetase is the exception: it is structurall a class II enz me but transfers the Phe onto the 2OH. Note that amino acids transferred onto the 2-OH are soon moved to the 3OH an w a due to a transesterification reaction. Chapter 10, Translation, version 1.0 Page 145

 

 

 

 

 

 

5 AUG 3 B fMet-tRNAi fMet IF-2 5 GTP IF-1 AUG 3 C 50S subunit fMet E P A GTP 3 5 AUG CH3 S CH2 CH2 H2N C H C O H N H C H 5

Prokar otic Translation As soon as the RNA has emerged from the RNAP and there is sufficient space to ac comodate a ribosome, translation can begin in prokar otes. In fact, for highl e xpressed genes, it would not be unusual to see multiple RNA pol merases transcri bing the DNA and multiple ribosomes on each of the transcripts translating the m RNA to protein! The process begins with the small ribosomal subunit (and onl th e small subunit - if it is attached to the large subunit, it is unable to bind t he mRNA), which binds to the mRNA loosel and starts to scan it for a recognitio n sequence called the Shine-Dalgarno sequence, after its discoverers. Once this is recognized b the small ribosomal subunit rRNA, the small subunit is position ed around the start codon (AUG). This process is facilitated b initiation facto rs as follows. The 30S ribosomal subunit dissociates from the 50S ribosomal subu nit if it was associated with one, and binds to intiation factors IF-1 and IF-3. IF-1 binds to the A site, where it prevents new aminoac l-tRNA molecules from e ntering before the full ribosome is assembled. It also facilitates the assembl and stabilization of the initiation complex. IF-3 is required to allow the 30S s ubunit to bind to mRNA. Once this has occurred, IF-2-GTP arrives on scene, carr ing with it the initiator aminoac l-tRNA. This settles into the P site, which is positioned so that the anticodon of the tRNA settles over the AUG start codon o f the mRNA. H drol sis of the GTP attached to IF-2 and release of all the initia tion factors is needed to allow the 50S subunit to bind to the 30S subunit to fo rm the full and full functional ribosome. Because GTP h drol sis was required, the joining of the subunits is irreversible spontaneousl , and requires expendit ure of energ upon termination of translation. Once the 50S subunit joins with t he 30S subunit, the A site is read to accept the next aminoac l-tRNA. A IF-3 30S subunit mRNA transcript Shine-Dalgarno Sequence

 

CH3 S H3C O C O 3 O O H2 N 3 H2N C H C C H C O OH 3 N C H 5 Peptid l transferase 5 peptid l-tRNA (Met-Gl ) aminoac l-tRNA (Val) free tRNA Figure 4. Peptide bond formation at the addition of the third amino acid. The pr evious two amino acids are peptide bonded together as well as attached to the tR NA from the second amino acid. The aminoac ltRNA bond is broken and transferred/ transformed to the peptide bond connecting the initial dipeptide to the third am ino acid. Chapter 10, Translation, version 1.0 O C CH3 CH CH2 CH2 H H H3C N CH3 CH C C D O O fMet 3 H H 5

 

IF-1 GDP + Pi IF-2 IF-3 3 E P AUG A + 5 peptid l-tRNA (Met-Gl -Val) Figure 3. Initiation of Translation in Prokar otes. (A) 30S subunit binds to Shi neDalgarno sequence. (B) fMet-tRNAi is loaded into the middle slot of the small ribosomal subunit. Initiation factors occup h the other two slots. (C) The large ribosomal subunit docks with the small subunit. (D) The initiation factors are released and the ribosome is read to start translation. Page 146

A common and understandable misconception is that the new amino acid brought to the ribosome is added onto the growing pol peptide chain. In fact, the mechanism is exactl the opposite: the pol peptide is added onto the new amino acid (fig. 4). This begins from the second amino acid to be added to a new protein (fig. 5 ). The first amino acid, a methionine, ou should recall, came in along with IF2 and the initiator tRNA. The new aminoac l-tRNA is escorted b EF-Tu, an elonga tion factor that carries a GTP. Once the aa-tRNA is in place, EF-Tu h drol zes t he GTP and dissociates from the aminoac l-tRNA and ribosome. A Pro His EF1 GTP EF1 GTP Met

EF1 E 7-mG 5 P AUG A GTP 3 EF1 GTP B EF1 + Pi Met V l GDP E 7-mG 5 P A AUG G U G 3

For long time, there it of my tery urrounding the imult neou docking of t o tRNA molecule on immedi tely dj cent codon of mRNA. Under norm l cond ition , there hould not e enough room, ince the tRNA re f irly ulky nd on e hould o truct the other from re ching the mRNA to m ke codon nticodon m tc h. The m tter fin lly cle red up in 2001 ith x-r y cry t llogr phic ex min tion ho ing end in the mRNA et een the codon in the P lot nd the codon i n the A lot. The end put the t o oci ted tRNA t lightly different ngle nd thu cre te ju t enough room for oth to m int in ep iring hydrogen o nd ith the mRNA. See Yu upov et l, Science 292 (5518): 883-896, 2001.

 

 

V l Ly

 

C Met V l Ri o ome Tr n loc tion E 7-mG 5 P A AUG G U G EF2 GTP 3 D

EF1 Pro

Met V l EF1 E 7-mG 5 P A EF1 GTP GTP AUG G U G 3 EF2 GDP + Pi

Figure 5. Elong tion of the polypeptide ch in. (A) ne mino cyl-tRNA drop in to the A lot of the ri o ome. (B) the fMet i moved off it tRNAi nd peptideonded to the ne mino cid, hich i till tt ched to it tRNA. (C) Ri o ome hift over to the right. (D) empty tRNAi i ejected.

GTP Ly

Hi

Ch pter 10, Tr n l tion, ver ion 1.0 P ge 147

When ne mino cyl-tRNA drop into the A lot of the ri o ome, the nticodon i lined up ith the codon of the mRNA. If there i no complement rity, the mino cyltRNA oon flo t ck out of the lot to e repl ced y nother c ndid te. H o ever, if there i complement rity (or omething clo e enough, rec lling the id e of o le) then H- ond form et een the codon nd nti-codon, the tRNA ch ng e conform tion, hich hift the conform tion of EF-Tu, c u ing hydroly i of G TP to GDP + Pi, nd rele e from the -tRNA. The codon- nticodon inter ction i t le long enough for the c t lytic ctivity of the ri o ome to hydrolyze the ond et een fMet nd the tRNAf in the P lot, nd tt ch the fMet to the ne m ino cid ith peptide ond in the A lot. The ne mino cid i till tt ched to it tRNA, nd thi proce occur , the ri o ome hift po ition ith re p ect to the mRNA nd tRNA . Thi put the no empty (no mino cid tt ched) tRNAf in the E lot, the tRNA in the P lot, tt ched to th t hich i onded to Met, nd the A lot i g in open for ne tRNA to come in. The elong tion f c tor EF-G ind ne r the A lot oon EF-Tu le ve , nd i required for ri o om l tr n loc tion, providing energy for the proce y hydrolyzing GTP th t it c rrie ith it to the ri o ome. From my tudent experience , the e t y to le rn thi eem to e to tudy the di gr m nd ee the movement of the molec ule , filling in the mech ni tic det il in your mind. Thi proce continue un til the ri o ome ring the A lot in line ith top codon. There i no tRNA ith n nticodon for the top codon. In te d, there i et of rele e f ctor th t fit into the A ite of the ri o ome, ind to the top codon, nd ctv te th e ri o ome to cut the ond et een the polypeptide ch in nd the l t tRNA (fig. 6). Depending on hich top codon i pre ent either RF1 (recognize UAA or UAG) or RF2 (for UAA or UGA) fir t enter the A lot. The RF1 or RF2 i complexed i th RF3, hich i involved in u equent rele ing of the RF complex from the A lot. Thi i nece ry ec u e once the polypeptide h een rele ed from the r i o ome, the mRNA mu t e rele ed. Ri o ome rele ing f ctor (RRF) l o ind i n the A lot, hich c u e conform tion l ch nge in the ri o ome rele ing the previou nd no empty tRNA. Fin lly, EF-G ind to RRF, nd ith n ccomp nyi ng hydroly i of GTP, c u e di oci tion of the ri o ome into ep r te l rge n d m ll u unit . Note th t it i the com in tion of EF-G/RRF th t c u e di oc i tion; EF-G lone pl y different role in ri o ome movement hen it i not t the top codon.

                       
A RF3 RF1 Phe Gly GTP Pro Phe Pro Met V l E 7-mG 5 P

Ly

Hi

 

A 3 B Phe Gly Pro

Phe

Pro Met V l RF3 E 7-mG 5 P RF1 A UA A GTP 3 C Phe Gly Pro

Phe

Pro Met V l RF3 RF1 E 7-mG 5 GDP + Pi

Ly

Hi

Ly

Hi

P A 3 Figure 6. Termin tion of tr n l tion. Ch pter 10, Tr n l tion, ver ion 1.0 P ge 148

GTP 2 1A 3 40S u unit 4A 4B 7-mG 4G 5 mRNA tr n cript AUG 3 4E B Met GTP 2 4E 4A 4B 7-mG 4G 5 1A 3 ATP ADP + Pi AUG 3 C 60S u unit 4A 4E 1A GDP + Pi 4B 3 7-mG 5 AUG 4G 3 E P A 5B Met GTP 2 D GDP + Pi 5B Met E 7-mG 5 P AUG A 3 Figure 7. Initi tion of Tr n l tion in Euk ryote . Ch pter 10, Tr n l tion, ver ion 1.0

Euk ryotic Tr n l tion Euk ryotic tr n l tion, ith tr n cription, i ti fyingly imil r (from tudent tudying point of vie , or from n evolution ry con erv tion one) to the prok ryotic c e. The initi tion proce i lightly more complic ted, ut the e long tion nd termin tion proce e re the me, ut ith euk ryotic homologue of the ppropri te elong tion nd rele e f ctor . A Met-tRNAi Met

 

P ge 149

For euk ryote , e ch mRNA encode one nd only one gene ( oppo ed to multi-gen e tr n cript uch operon ), o there i nt much que tion of hich AUG i t rt codon, nd hich re ju t regul r methionine . Therefore, there i no require ment for Shine-D lg rno equence in euk ryote . The m ll ri o om l u unit, ccomp nied y euk ryotic initi tion f ctor eIF-3, eIF-2, nd Met-tRNAi, togethe r kno n the terne ry complex, ind to eIF-1A. Me n hile, eIF-4A, -4B, -4E, nd -4G ind to the 5 (7-methygu no ine) c p of the mRNA (fig. 7A). The m ll u u nit complex nd the eIF4/ mRNA c p- inding complex inter ct to form the 43S comp lex, hich then egin c nning the mRNA from 5 to 3 looking for the fir t AUG. On ce the 43S c nning complex h found the t rt codon, the initi tion f ctor dr op off, nd the l rge ri o om l u unit rrive . The l rge ri o om l u unit h ound eIF-6, hich prevent it from re oci ting ith m ll u unit , nd it remov l i required fir t. Another f ctor, eIF-5 enter the cene during the cou pling proce et een the l rge nd m ll ri o om l u unit , nd hydroly i of n eIF-5- tt ched GTP i required to complete the docking of the u unit nd th e form tion of complete function l ri o ome on the mRNA. Elong tion i functio n lly the me in prok ryote except th t the function of EF-Tu i t ken c r e of y EF-1 , l o ith hydroly i of GTP. EF-2 i the euk ryotic n log of EFG, nd utilize GTP hydroly i for tr n loc tion of the ri o ome. Termin tion u e euk ryotic homologue of the rele e f ctor , though eRF-1 t ke the pl ce of oth prok ryotic RF-1 nd RF-2. Although polyri o ome ( k poly ome ) c n form on oth prok ryotic nd euk ryotic mRNA , euk ryotic poly ome h ve n ddition l t i t. Technic lly, poly ome i imply n mRNA ith multiple ri o ome tr n l ting it imult neou ly, ut in euk ryote , the poly ome l o h unique mor phology ec u e it utilize PABPI, or poly-A inding protein. Thi protein not o nly ind to the 3 poly-A t il of n mRNA, it l o inter ct ith the eIF-4 initi tion f ctor , hich thu loop the mRNA into circul r h pe. Th t y, once t he ri o ome re che the end of the gene nd rele e from the mRNA, it i phy ic lly ne r the eginning of the mRNA to t rt tr n l ting g in.

Ch pter 10, Tr n l tion, ver ion 1.0 P ge 150

U u lly, ut not l Ho ever, the context equently recognized t -3 nd G t +4.

y , the fir t AUG i the t rt codon for euk ryotic gene . of the AUG m tter , nd it i much tronger (i.e. more fr nd u ed) t rt codon if there i purine re idue (A or G) See Koz k, M., Biochimie 76: 815-821, 1994.

 

  

       

Active IRP IRE 5 mRNA Ferritin-coding region 3 B. High Iron Concentr tion In ctive IRP Iron IRE Ri o ome 5 Tr n l tion 3 mRNA Ferritin Figure 8. Pre-tr n l tion l control of gene expre ion y iron-re pon e protein (IRP), hich ind to either the iron-re pon e element (IRE), unle it h oun d iron.

Ch pter 10, Tr n l tion, ver ion 1.0 P ge 151

Tr n very do n tr n

ferrin l o u e iron re pon e element nd IRE- inding protein , ut in different mech ni m. The IRE equence of the tr n ferrin gene re loc ted tre m of the top codon, nd pl y no direct role in llo ing or preventing l tion.

Regul tion of Tr n l tion Gene expre ion i prim rily regul ted t the pre-tr n cription l level, ut the re re num er of mech ni m for regul tion of tr n l tion ell. One ell- t udied nim l y tem i the iron- en itive RNA- inding protein, hich regul te t he expre ion of gene involved in regul ting intr cellul r level of iron ion . T o of the e gene , ferritin, hich fely eque ter iron ion in ide cell , nd tr n ferrin, hich tr n port iron from the lood into the cell, oth utilize thi tr n l tion l regul tion y tem in feed ck loop to re pond to intr cell ul r iron concentr tion, ut they re ct in oppo ite y . The key inter ction i et een the iron re pon e element (IRE), hich re equence of mRNA th t form hort tem-loop tructure , nd IRE-BP, the protein th t recognize nd ind t o the IRE . In the c e of the ferritin gene, the IRE equence re itu ted up tre m of the t rt codon. When there i high iron, the IRE-BP i in ctive, nd t he tem-loop tructure re melted nd overrun y the ri o ome, llo ing tr n l tion of ferritin, hich i n iron- inding protein. A the iron concentr tion dr op , the IRE-BP i ctiv ted nd ind round the IRE tem-loop tructure , t ilizing them nd preventing the ri o ome from proceeding. Thi prevent the prod uction of ferritin hen there i little iron to ind. A. Lo Iron Concentr tion

 

      

Ho ever, hen there i lo intr cellul r iron nd there i need for more tr n ferrin to ring iron into the cell, the IRE-BP i ctiv ted in the previou c e, nd it ind to the IRE to t ilize the tem-loop tructure . In thi c e; ho ever, it prevent the 3 poly-A t il degr d tion th t ould norm lly occur o ver time. Once the poly-A t il i degr ded, the re t of the mRNA i de troyed o on there fter. A mentioned in the tr n cription ch pter, the longer poly-A t il re oci ted ith gre ter per i tence in the cytopl m, llo ing more tr n l tion efore they re de troyed. The IRE-BP y tem in thi c e extern lly prolo ng the lifetime of the mRNA hen th t gene product i needed in higher mount . Since mRNA i ingle- tr nded nucleic cid nd thu le to ind complement r y equence, it i not too urpri ing to find th t one of the y th t cell c n regul te tr n l tion i u ing nother piece of RNA. Micro RNA (miRNA ) ere d i covered very hort (~20 nucleotide ) non-protein-coding gene in the nem to de, C. eleg n . Since their initi l di covery (Lee et l, Cell 75: 843-54, 1993) , hundred h ve een found in v riou euk ryote , including hum n . The expre i on p ttern of the miRNA gene i highly pecific to ti ue nd development l t ge. M ny re predicted to form temloop tructure , nd ppe r to hy ridize to 3untr n l ted equence of mRNA thu locking initi tion of tr n l tion on tho e mRNA molecule . They m y l o ork through mech ni m imil r to the iRNA di c u ed elo , ut there i cle r evidence th t mRNA level re not nece rily l tered y miRNA-directed tr n l tion l control. Another mech ni m for tr n l tion l control th t u e m ll RNA molecule i RNA interference (RNAi). Thi fi r t di covered n experiment lly induced repre ion of tr n l tion hen hort dou le- tr nded RNA molecule , fe hundred nucleotide in length nd cont ini ng the me equence t rget mRNA, ere introduced into cell . The effect dr m tic: mo t of the mRNA ith the t rget equence quickly de troyed. The current mech ni tic model of RNAi repre ion i th t fir t, the dou le tr nded molecule re cle ved y n endonucle e c lled Dicer, hich cle ve ith over-h nging ingle- tr nded 3 end . Thi llo the hort fr gment ( iRNA, ~20nt long ) to form complex ith ever l protein (RISC, RNA-induced ilencing complex). The RISC plit the dou le- tr nded fr gment into ingle tr nd , one of hich i n ex ct complement to the mRNA. Bec u e of the complement rity, thi i t le inter ction, nd the dou le- tr nded region ppe r to ign l n endonucle e to de troy the mRNA/ iRNA hy rid. The fin l method of controlling level of gene expre ion i control fter the f ct, i.e., y t rgeted de truction of the gene product protein. While ome protein keep orking until they f ll p rt, ot her re only me nt for hort-term u e (e.g. to ign l hort ph e in the cell cycle) nd need to e removed for the cell to function propCh pter 10, Tr n l t ion, ver ion 1.0 P ge 152 MicroRNA re currently under inve tig tion for their role either oncogene or tumor uppre or (revie ed in G rzon et l, Ann. Rev. Med. 60: 167-79, 2009) . Approxim tely h lf of kno n hum n miRNA re loc ted t fr gile ite , re kpo int , nd other region oci ted ith c ncer (C lin et l, Proc. N t. Ac d. S ci. (USA) 101: 2999-3004, 2004). For ex mple, miR-21 i not only upregul ted in num er of tumor , it overexpre ion lock popto i nece ry tep to l lo norm l cell to contine to live nd divide r ther th n die out. Conver ely , miR-15 i ignific ntly depre ed in ome tumor cell , nd overexpre ion c n lo or top the cell cycle, even inducing popto i .

          

   

 

 

Figure 9. U iquitin. Thi 3D repre ent tion gener ted from the file 1u i ( y nthetic hum n u iquitin) in the RCSB Protein D t B nk U U + ATP C S O

O O NH2 E2 E1 C S E3 E2

Mut tion in E3 gene c n c u e v riety of hum n medic l di order uch the neurodevelopment l di order Angelm n yndrome, Hippel-Lind u yndrome, or the gener l gro th di order kno n 3-M yndrome. Mech ni m linking m lfunction in u iquitin tion p th y nd ymptom of the e di order re not currently kno n . E1 AMP + PPi E1 E2 +

Prote ome Prote ome U U U Figure 10. Polyu iquitin tion of t rgeted protein ( lue) require three u iqui tin ting enzyme , E1, E2, nd E3. Once t gged, the protein i po itioned in the prote ome y inding of the polyu iquitin t il to the outer urf ce of the prot e ome. The prote ome then cle ve the protein into m ll polypeptide .

Repe t multiple time ... ATP U U U AMP U U U

 

C U

erly. Remov l, in thi en e, ould e euphemi m for chopped up nd recycled. The u iquitin-prote ome y tem i t g- nd-de troy mech ni m in hich protein th t h ve outlived their u efulne re polyu iquitin ted. U iquitin i m ll (76 mino cid , ~5.6 kD ), highly con erved (96% et een hum n nd ye t eque nce ) euk ryotic protein (fig. 9) th t c n e tt ched to other protein through the ction of three equenti l enzym tic tep , e ch c t lyzed y different e nzyme. E1 ctiv te the u iquitin y com ining it ith ATP to m ke u iquitin- de nyl te, nd then tr n fer the u iquitin to it elf vi cy teine thioe ter ond . Through tr n (thio) e terific tion re ction, the u iquitin i then tr n ferr ed to cy teine in the E2 enzyme, l o kno n u iquitin-conjug ting enzyme. F in lly, E3, or u iquitin lig e, inter ct ith oth E2-u iquitin nd the protei n de ign ted for de truction, tr n ferring the u iquitin to the t rget protein. After ever l round , the polyu iquitin ted protein i end to the prote ome fo r de truction.

  

Ch pter 10, Tr n l tion, ver ion 1.0 P ge 153

Ch pter 10, Tr n l tion, ver ion 1.0 P ge 154

Prote ome re very l rge protein complexe rr nged four-l yered rrel ( the 20S u unit) c pped y regul tory u unit (19S) on e ch end. The t o outer ring re e ch compo ed of 7 u unit th t function entry g te to the cen tr l ring , e ch of hich i compo ed of 7 u unit , nd hich cont in long t he interior urf ce, 6 proteolytic ite . The 19S regul tory unit control the o pening nd clo ing of the g te into the 20S c t lytic rrel. The entire prote ome i ometime referred to 26S p rticle. A polyu iquitin ted protein i fir t ound to the 19S regul tory unit in n ATP-dependent re ction (the 19S con t in ATP e ctivity). 19S unit open the g te of the 20S unit, po i ly invol ving ATP hydroly i , nd guide the protein into the centr l proteolytic ch m er . The prote e ctivity of prote ome i unique in th t it i threonine prote e, nd it cut mo t protein into regul r 8-9 re idue polypeptide , lthough t hi c n v ry. A e ill ee in the cell cycle ch pter, prote ome re cruci l component to preci e regul tion of protein function .

  

ER, Golgi nd Ve icle : Po t-tr n l tion l Proce ing nd Ve icul r Tr n port Once polypeptide h een tr n l ted nd rele ed from the ri o ome, it m y e re dy for u e, ut often it mu t undergo po t-tr n l tion l proce ing in order to ecome fully function l. While m ny of the e proce e re c rried out in o th prok ryote nd euk ryote , the pre ence of org nelle provide the need ell ome of the mech ni m for euk ryote- pecific modific tion uch glyco yl tion nd t rgeting.

HS V -L-H G-S B ch in HS CG-E Q-V-E-L-G-G-G-P-G-A-G-S -R-G-Q-V-G-L-QF-F-Y-T-P-K-T-R-R-E-A-E-D-L P-L-A -LE A-EL- Q K-R-G-I-V-E-Q-C-C-T-S-I-C-S-L-Y-Q-L-E-N-Y-C-N D F-V-N-Q-H-L-C-G-S-H-L-V-E-A-L-Y-L-V-C-G-E-R-G-F-F-Y-T-P-K-T R -R -ES S S S C

Proteolytic Cle v ge The mo t common modific tion i proteolytic cle v ge. Some of the pre-cle v ge p olypeptide re immedi tely cle ved, hile other re tored in ctive precur or to form pool of enzyme (or other kind of protein ) th t c n e ctiv ted very quickly, on time c le of econd to minute , comp red to h ving to go through tr n cription nd tr n l tion, or even ju t tr n l tion. Intere tingly, though methionine (Met) i univer lly the fir t mino cid of ne ly ynthe i zed polypeptide, m ny protein h ve th t methionine cle ved off ( l o true for ome prok ryotic f-Met). Sign l equence M-A-L-

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

dv n the dv Fin on e

S S S S S S K-R-G-I-V-E-Q-C-C-T-S-I-C-S-L-Y-Q-L-E-N-Y-C-N F-V-N-Q-H-L-C-G-S-H-L-V-E-A-L-Y-L-V-C-G-E-R-G-F-F-Y-T-P-K-T Ch pter 11, Po t-Tr n l tion, ver ion 1.0 S - I- C S-L-Y-Q-L-EN-Y-C-N -Q -L S S SH - CC-TA ch in SH SH VE- Q -V -G -Q -V-E - L- G - G - G - P- G - A - G - S - LQ-P B - L- A -L-C -Q-H W V-N -M -A-F-R-L -P-A-A -L-P-L-LA-L-L-A-L-W-G-P-D

- LEGFigure 1. Proteolytic proce ing i nece ry to m ke iologic lly ctive in uli n. (A) The line r protein cont in ign l equence, hich i cle ved fter the protein enter the ER, n A ch in, B ch in, nd C-peptide. (B) In ide the E R, the proin ulin (in ulin precur or) fold nd di ulfide ond form et een cy teine . (C) Fin lly, t o cle v ge rele e the C peptide, hich le ve the A nd B ch in tt ched y the di ulfide ond . Thi i no ctive in ulin. A -E -AL-Y-L-VC-peptide GSQ L- K - R - G -ISH SP ge 155

   

Procoll gen H2N OH COOH OH Propeptide Propeptide Triple helix form tion H2 N H2N H2N OH OH OH OH COOH COOH COOH

OH OH OH Completed coll gen molecule OH OH

Figure 2. Proce ing nd

em ly of procoll gen into coll gen.

Secretion from cell Propeptide

clipped

Activ tion of protein y cle v ge of precur or i common theme: the precur o r protein i termed proprotein, nd the peptide th t i cle ved off of it to ctiv te the protein i c lled the propeptide. Among the etter kno n ex mple of protein th t re derived from proprotein re the hormone in ulin, the cell de th protein f mily of c p e , nd the Alzheimer- oci ted neur l protein - m yloid. In ulin i n intere ting ex mple (fig. 1) in m mm l : preproin ulin (in ctive hormone) i fir t tr n l ted from the in ulin mRNA. After cle v ge th t remove n N-termin l equence, proin ulin ( till in ctive) i gener ted. T he proin ulin form ome intern l di ulfide ond , nd hen the fin l proteolyti c ction occur , u t nti l chunk (c lled the C-peptide) i t ken out of the middle of the proin ulin. Since the protein intern lly di ulfide onded thou gh, the t o end piece rem in connected to ecome the ctive in ulin hormone. An other intere ting protein proce ing ex mple i th t of coll gen em ly (fig. 2). A you ill re d in ch pter 13, coll gen i very l rge ecreted protein th t provide tructure nd hock or nce for the extr cellul r m trix in nim l . You c n find it in kin, hoove , c rtil ge, nd v riou connective ti ue . An individu l coll gen protein i ctu lly t i ted triple-helix of three u un it . The coll gen u unit re m de procoll gen, nd propeptide re lopped o ff of oth N- nd C- termini to gener te the fin l protein. Ho ever, they re no t cle ved off until fter the three u unit em le round one nother. In f c t, coll gen u unit th t h ve lre dy een proce ed do not em le into tripl e-helic l protein . The propeptide equence re cle rly nece ry for efficient em ly of the fin l protein complex. OH

Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 156

                
Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 157

Protein Tr fficking The ide th t propeptide equence h ve import nt function in protein m tur tio n eyond ju t keeping them from eing ctive i not exclu ive to em ly. A m j or cl of cle ved peptide equence i ign l peptide . Sign l peptide direct the protein from the cytopl m into p rticul r cellul r comp rtment. In the c e of prok ryote , thi e enti lly me n the cell mem r ne, ut for euk ryote , there re pecific ign l peptide th t c n direct the protein to the nucleu , to the mitochondri , to the endopl mic reticulum, nd other intr cellul r org nelle . The peptide re pecific lly recognized y receptor on the mem r ne o f p rticul r comp rtment , hich then help to guide the in ertion of the protein into or through the mem r ne. Almo t ll protein ynthe i in euk ryote i c r ried out in the cytopl m ( ith the exception of fe protein in the chloropl t nd mitochondri ), o protein found in ny other comp rtment or em edded in ny mem r ne mu t h ve een t rgeted nd tr n ported into th t comp rtment y i t ign l equence. The nucleu i one uch comp rtment, nd ex mple of the pro tein found ithin include DNA nd RNA polymer e , tr n cription f ctor , nd h i tone . The e nd other nucle r protein h ve n N-termin l ign l equence kno n the NLS, or nucle r loc liz tion ign l. Thi i ell- tudied p th y th t involve et of importin d pter protein nd the nucle r pore complex (fig . 3). Tr n port into the nucleu i p rticul rly ch llenging ec u e it h do u le mem r ne (remem er th t it i contiguou ith the endopl mic reticulum mem r ne. Although there re other mech ni m for m king protein th t re em edded in the nucle r mem r ne, the prim ry mech ni m for import nd export of l rge m olecule into nd out of the nucleu it elf i the nucle r pore complex. The com plex i very l rge nd c n e m de of over 50 different protein (nucleoporin , ometime c lled nup ). The nucleoporin re em led into l rge open oct gon l pore through the nucle r mem r ne . A figure 3 indic te , there re ntenn like fi ril on the cytopl mic f ce, nd the e help to guide protein from thei r origin in the cytopl m to the nucle r pore, nd on the nucle r ide there i ket tructure. Of cour e, not ll protein re llo ed into the nucleu , n d the mech ni m for di tingui hing ppropri te t rget i tr ightfor rd. The p rotein mu t e r nucle r loc liz tion ign l (NLS). While in the cytopl m, n importin- protein ind to the NLS of nucle r protein, nd l o ind to n importin- . The importin i recognized nd ound y the nucle r pore complex. T he det il of the tr n port mech ni m re murky, ut phenyl l nine-glycine repe t in the nucleoporin u unit (FG-nup ) re thought to e involved. Although th i i prim rily con idered euk ryotic proce given th t there re o m ny pot enti l t rget , prok ryote do h ve mem r ne protein (in f ct, ome 800 differe nt one in E. coli compri ing ~20% of tot l protein), nd they re po itioned th ere ith the id of in ert e enzyme uch YidC nd complexe uch Sec tr n loc e. The Sec tr n loc e u e ign l recognition p rticle (SRP) much like th t in euk ryote , nd ill e di cu ed l ter in thi ch pter hen the SRP i introduced. YidC, hich h euk ryotic homologue (e.g. Ox 1 in mitochondri ), i 61 kD tr n mem r ne protein th t i pl ced in the mem r ne through n SRPSec tr n loc e mech ni m. Once there, YidC inter ct ith n cent polypeptide (once they re ch ~70 mino cid long) th t h ve egun to inter ct ith the lipi d of the cell mem r ne, nd pu he the protein into/through the mem r ne.

Figure 3. Tr n port through nucle r pore. A Protein ith NLS Importin Importin B Cytopl mic l ment Cytopl m Nucleopl m

Centr l tr n porter C D R n-GDP R n-GTP Exportin Once the nucleoprotein-importin ggreg te i moved into the nucleu , R n-GTP, m ll GTP e, c u e the ggreg te to di oci te (fig. 3c). The imported protein i rele ed in the nucleu . The importin re l o rele ed in the nucleu , ut they re exported ck out g in to e reu ed ith nother protein t rgeted for the nucleu . Export from the nucleu to the cytopl m l o occur through the n ucle r pore. The R n-GTP i l o p rt of the export complex (fig. 3d), nd in conjunction ith n exportin protein nd h tever i to e exported, i moved ou t of the nucleu vi the nucle r pore. Once in the cytopl m, the hydroly i of GTP to GDP y R n ( ctiv ted y R n-GAP, cytopl mic protein) provide the ene rgy to di oci te the c rgo (e.g. mRNA) from the exporting tr n port molecule . The R n-GDP then ind to importin , re-enter the nucleu , nd the GDP i exch nged for GTP. The nucle r pore i the only tr n port complex th t p n du l mem r ne l yer , lthough there re coordin ted p ir of tr n port complexe in dou le-mem r ned org nelle uch mitochondri . The tr n port protein in the out er mitochondri l mem r ne link ith tr n port protein in the inner mitochondri l mem r ne to move m trix- ound protein (e.g. tho e involved in the TCA cycle) in from the cytopl m. The complexe th t move protein cro the outer mem r n e re m de up of Tom (tr n loc tor outer mem r ne) f mily of protein . Some of t he protein ill t y em-

Ch pter 11, Po t-Tr n l tion, ver ion 1.0

The mech ni m of m ll GTP e ctiv tion of other proce e ill e di cu ed g in in more det il in l ter ch pter (cyto keleton, ign ling). The key to unde r t nding the mech ni m i to remem er th t the GTP e hydrolyze GTP to GDP, u t till hold onto the GDP. Although the GTP e ill hydrolyze GTP pont neou ly , the GTP e- ctiv ting protein, GAP (or R n-GAP in thi c e) gre tly peed th e r te of hydroly i . In order to cycle the y tem ck to GTP, the GDP i not r e-pho phoryl ted: it i exch nged for ne GTP. The exch nge i gre tly f cilit ted y the ction of n cce ory protein, the gu nine nucleotide exch nge f ct or (GEF), in thi p rticul r c e, R n-GEF.

Nucle r

ket

P ge 158

edded in the outer mem r ne: they re proce ed y SAM ( orting nd em ly m chinery) complex l o em edded in the outer mem r ne). Me n hile, other conti nue to the Tim (tr n loc tor inner mem r ne) protein th t move them cro the inner mem r ne. A ith the nucle r protein , there i con en u ign l equen ce on mitochondri l protein th t i ound y cyto olic ch perone th t ring th em to the Tom tr n porter . A ho n in the t le elo , there re ign l equen ce /propeptide th t t rget protein to ever l other comp rtment . Nucleu ER e ntry ER retention Mito. M trix Peroxi ome Peroxi ome PPKKKRKV MMSFVSLLLVGILFWATEAE QLTKCEVFQ KDEL MLSLRQSIRFFKPATRTLCSSRYLL SKL RLXXXXXHL Of p rticul r import nce for the re t of thi ch pter, i the equence t rgeting protein to the endopl mic reticulum, nd y exten ion, ny protein de tined for the ER, the Golgi pp r tu , the cell mem r ne, ve icle nd ve icul rly-der ived comp rtment , nd ecretion out of the cell. Here, in ddition to n N-term in l ign l equence, the po ition of econd ry intern l ign l equence ( omet ime c lled ign l p tche ) help to determine the di po ition of the protein it enter the ER. The initi l in ertion require recognition of the ign l equ ence y SRP, the ign l recognition protein. The SRP i G-protein nd exch nge it ound GDP for GTP upon inding to protein ign l equence. The SRP it h it tt ched protein then dock to receptor (c lled the SRP receptor, toun dingly enough) em edded in the ER mem r ne nd extending into the cytopl m. The SRP u u lly ind oon the ign l equence i v il le, nd hen it doe o, it rre t tr n l tion until it i docked to the ER mem r ne. Incident lly, thi i the origin of the rough endopl mic reticulum: the ri o ome tudding the ER re tt ched to the ER cytopl mic urf ce y the n cent polypeptide it i producing nd n SRP. The SRP receptor c n exi t on it o n or in oci tion i th tr n locon, hich i ip rtite tr n loc tion ch nnel. The SRP receptor (S R) i l o GTP e, nd i u u lly c rrying GDP molecule hen un oci ted. H o ever, upon oci tion ith the tr n locon it exch nge it GDP for GTP. The e GTP re import nt ec u e hen the SRP ind to the SR, oth GTP e ctiviti e re ctiv ted nd the re ulting rele e of energy di oci te oth from the t r n locon nd the n cent polypeptide. Thi relieve the lock on tr n l tion im po ed y the SRP, nd the ne protein i pu hed on through the tr n locon it i eing ynthe ized. Once the ign l equence h completely entered the lumen of the ER, it reve l recognition ite for ign l peptid e, hydrolytic enzy me th t re ide in the ER lumen nd ho e purpo e i to nip off the ign l pept ide. Ch pter 11, Po t-Tr n l tion, ver ion 1.0 Prok ryote l o u e n SRP homolog. In E. coli, the SRP i imple, m de up of o ne protein u unit (Ffh) nd m ll 4.5S RNA. By comp ri on, ome higher euk ry ote h ve n SRP compri ed of ix different protein u unit nd 7S RNA. Simi l rly, there i imple prok ryotic homologue to the SRP receptor, Ft Y. An int ere ting difference i th t Ft Y gener lly doe not inter ct ith exported prote in , nd ppe r to e nece ry only for mem r ne-em edded protein . Other i e, there re m ny imil ritie in mech ni m for SRP- ed in ertion of mem r ne pr otein in euk ryotic nd prok ryotic pecie , including GTP dependence, nd comp letion of the mech ni m y tr n loc e (SecYEG in E. coli). P ge 159

       

     

1 mRNA Ri o ome Sign l equence 2 SRP Cyto ol Plug 3 4 5 Tr n locon SRP receptor Sign l peptid e ER Figure 4. SRP nd it receptor SR medi te movement of protein through the ER me m r ne. The SRP recognize the ign l equence nd ind to it nd the ri o ome, tempor rily rre ting tr n l tion. The SRP-polypeptide-ri o ome complex i oun d y it receptor, SR, hich po ition the complex on tr n locon. Once the ri o ome nd polypeptide re docked on the tr n locon, the SRP di oci te , nd tr n l tion re ume , ith the polypeptide moving through the tr n locon it i e ing ynthe ized.

If th t the only ign l equence in the protein, the rem inder of the protei n i ynthe ized nd pu hed through the tr n locon nd olu le protein i depo ited in the ER lumen, ho n in figure 4. Wh t out protein th t re em edd ed in mem r ne? Tr n mem r ne protein h ve intern l ign l equence ( ometim e c lled ign l p tche ). Depending on their rel tive loc tion , they m y e co n idered either t rt-tr n fer or top-tr n fer equence, here tr n fer refer to tr n loc tion of the peptide through the tr n locon. Thi i e ie t to under t nd y referring to fig. 5. If Figure 5. Single-p tr n mem r ne protein in ertion. (1) the ign l equence h llo ed the ri o ome to dock on tr n locon nd ne ly m de polypeptide i th re ded through until the toptr n fer equence. (2) The hydropho ic top tr n fe r equence get tuck in the mem r ne, forcing the re t of the polypeptide to t y in the cytopl m it i tr n l ted. 1 mRNA 2 Ri o ome Stop tr n fer equence Cyto ol

ER

C-terminu

Tr n locon

Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 160

Sign l equence Sign l peptid

N-terminu

2 3 Cyto ol St rt tr n fer equence ER Tr n locon Sign l equence

ign l p tch fter the top-tr n fer equence, it ould ct t rt-tr n fer equence, tt ching to tr n locon nd llo ing the rem inder of the protein to e moved into the ER. Thi re ult in protein ith oth N- nd C- termini in the ER lumen, p ing through the ER mem r ne t ice, nd ith cytopl mic loop ticking out. Of cour e, the N-terminu could e on the mRNA other ide. For cytopl mic N-ter- 1 minu , the protein c nnot h ve n Ri o ome N-termin l ign l equence (fig. 7). N-terminu It h n intern l ign l p tch in2 St rt tr n f er te d. It pl y e enti lly the me 3 equence role, ut the orient tion of the N-terminu N-terminu Cyto ol p tch me n th t the N-termin l t y cytopl mic. The polypeptide tr n l ted fter the p tch i fed Tr n locon ER into the ER . And ju t in the l t C-terminu ex mple, multiple top- nd t rt equence c n rein ert the protein in the mem r ne nd ch nge the Figure 7. In ertion of ingle-p protein ith N-terminu in f cing of the next portion. cytopl m u e ign l p tch ut no N-termin l ign l. Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 161

 

Figure 6. In ertion of 2-p

tr n mem r ne protein.

N-terminu C-terminu Sign l peptid

1 Ri o ome mRNA Stop tr n fer

equence

there i ignific nt tretch of mo tly-uninterrupted hydropho ic re idue , it ould e con idered top-tr n fer ign l, th t p rt of the protein c n get tuck in the tr n locon ( nd u equently the ER mem r ne) forcing the rem inder of the protein to rem in out ide the ER. Thi ould gener te protein th t in ert into the mem r ne once, ith it N-terminu in the ER lumen nd the C-termi nu in the cytopl m. In multi-p tr n mem r ne protein, there could e eve r l t rt- nd top- tr n fer hydropho ic ign l p tche . Building on the ingle -p ex mple, if there nother

Protein Folding in the ER The ER lumen pl y four m jor protein proce ing role : folding/refolding of the polypeptide, glyco yl tion of the protein, em ly of multi- u unit protein , nd p ck ging of protein into ve icle . Refolding of protein i n import nt p roce ec u e the initi l folding p ttern the polypeptide i till eing tr n l ted nd unfini hed m y not e the optim l folding p ttern once the entire p rotein i v il le. Thi i true not ju t of H- ond , ut of the more perm nent (i.e. cov lent) di ulfide ond ell. Looking t the hypothetic l ex mple po lypeptide, the econd ry tructure of the N-termin l h lf m y le d to the form t ion of t le di ulfide ond et een the fir t cy teine nd the econd cy tein e, ut in the context of the hole protein, more t le di ulfide ond might e formed et een cy teine 1 nd cy teine 4. The exch nge of di ulfide onding t rget i c t lyzed y protein di ulfide i omer e (PDI). The intern l redox envi ronment of the endopl mic reticulum, i ignific ntly more oxid tive th n th t in the cytopl m. Thi i l rgely determined y glut thione, hich i found in 30:1 GSH:GSSG r tio or higher in the cytopl m ut t ne rly 1:1 r tio in the E R lumen. Thi oxid tive environment i l o conducive to the di ulfide remodelin g. It hould e noted th t PDI doe not choo e the Ri o ome correct onding p rtne r . It imply move the exi ting di Cyto ol ulfide ond to more energetic lly t le rr ngement. A the re t of the polypeptide 4 Tr n locon ER 4 HS Incorre ct org niz tion continue to refold, re king 3 SH 2 nd m king H- ond quickly, 2 3 1 HS S S ne potenti l di ulfide ond 2 1 p rtner m y move ne r one 1 PDI SH Re rr ngement nother nd PDI c n g in 4 3 Polypeptide ttempt to re rr nge the di S S ulfide onding p ttern if the S S re ulting p ttern i more ther1 2 m odyn mic lly t le. S S Figure 8. Protein Di ulfide I omer e re rr nge di ulfide ond . The em ly of multi u unit protein nd the refolding of polypeptide re imi l r in their u e of ch perone protein th t help prevent prem ture folding, equ e tering p rt of the protein from H- onding inter ction until the full protein i in the ER lumen. Thi mech ni m imply m ke finding the thermodyn mic lly op tim l conform tion e ier y preventing the form tion of ome potenti l u optim l conform tion . The e ch perone protein ind to the ne protein they ente r the lumen through S S A 1 SH SH B HS S S S 1 S HS .. C 1 2 HS S S HS .. D 4 1 S S 2 PDI

4 PDI 2 2 3 S S S S PDI .. 3 2 S S 3 4 3 S S 4

Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 162

 

Figure 9. Protein Di ulfide I omer e. Thi enzyme u e cy teine re idue tempor ry onding p rtner in order to on the t rget protein nd llo for ne one to form. Note ne ond i not directed y PDI, ut i in te d toch tronger inding p rtner di pl ce the PDI SH.

ulfhydryl group of re k di ulfide ond th t the form tion of tic proce in hich

Ri o ome C lnexin Cyto ol Tr n locon ER Polypeptide the tr n locon nd in ddition to imply preventing incorrect ond th t ould h ve to e roken, they l o prevent prem ture inter ction of multiple polypeptid e ith one nother. Thi c n e pro lem ec u e prior to the proper folding t h t ould norm lly hide uch dom in ithin the protein, the imm ture polypeptid e m y h ve inter ction dom in expo ed, le ding to indi crimin te inding, nd potenti lly precipit tion of in olu le protein ggreg te .

N-linked Protein Glyco yl tion Begin in the ER Glyco yl tion i n import nt modific tion to euk ryotic protein ec u e the d ded ug r re idue re often u ed molecul r fl g or recognition ign l to o ther cell th n come in cont ct ith them. There re t o type of protein glyco yl tion, oth of hich require import of the t rget polypeptide into the ER. N-l inked glyco yl tion ctu lly egin in the endopl mic reticulum, ut O-linked g lyco yl tion doe not occur until the polypeptide h een tr n ported into the Golgi pp r tu . Therefore, it i l o the c e th t N-linked glyco yl tion c n ( nd i ) u u lly eginning co-tr n l tion l mech ni m, here O-linked gly co yl tion mu t e occurring po t-tr n l tion lly. Other m jor difference in th e t o type of glyco yl tion re (1) N-linked glyco yl tion occur on p r gine (N) re idue ithin n N-X-S or N-X-T equence (X i ny mino cid other th n P or D) hile O-linked glyco yl tion occur on the ide ch in hydroxyl oxygen of either erine or threonine re idue determined not y urrounding equence, ut y econd ry nd terti ry tructure; (2) N-linked glyco yl tion egin ith tr ee of 14 pecific ug r re idue th t i then pruned nd remodeled, ut rem in f irly l rge, hile O-linked glyco yl tion i ed on equenti l ddition of ind ividu l ug r , nd doe not u u lly extend eyond fe re idue . Technic lly, N-glyco yl tion egin efore protein i even eing tr n l ted, the dolicho l pyropho ph te oligo cch ride (i.e. the ug r tree - not n offici l term, y th e y) i ynthe ized in the ER (fig. 12) ithout eing triggered y tr n l tion or

   

Ch perone protein c n l o e found in prok ryote , rch e , nd in the cytopl m of euk ryote . The e re ome h t imil r to e ch other, nd function ome h t differently th n the type of folding protein found in the ER lumen. They re referred to gener lly ch peronin , nd the e t ch r cterized i the GroEL/ GroES complex in E. coli. A the tructure in figure 11 indic te , it i imil r in h pe to the prote ome, lthough ith completely different function. GroE L i m de up of t o t cked ring , e ch compo ed of 7 u unit , ith l rge cen tr l c vity nd l rge re of hydropho ic re idue t it opening. GroES i l o compo ed of 7 u unit , nd ct c p on one end of the GroEL. Ho ever, G roES only c p GroEL in the pre ence of ATP. Upon hydroly i of the ATP, the ch peronin undergo m jor concerted conform tion l ch nge th t impinge on the prot ein in ide, c u ing refolding, nd then the GroES di oci te nd the protein i rele ed ck into the cyto ol.

 

Figure 10. Protein folding i tempor rily ind to n cent y tructure from incomplete the entire polypeptide h

optimized in the ER. Protein uch c lnexin c n polypeptide , preventing them from forming econd r inform tion, rele ing the protein for folding once een tr n l ted.

    

 

Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 163 Figure 11. GroEL/GroES complex. The t o hept meric ring of GroEL re ho n in g reen nd lue/purple. The GroES hept mer (red/yello ) c p the GroEL complex in the pre ence of ATP. Illu tr tion y D.S. Good ell, 2002.

= N-Acetylgluco mine = M nno e = Gluco e PP P = Dolichol dipho ph te = Dolichol pho ph te Cyto ol PP UDP UDP UMP PP GTP GDP PP FLIP! ER lumen 1 2x 2 5x 3 PP GDP P Cyto ol 4 GDP UDP P 6 UDP + ER lumen + PP 4x 5

P PP 3x 7 P PP A n-X-Ser/Thr 8 Figure 12. Form tion of N-glyco yl tion ug r tree nd tt chment to protein. E ch tep i c t lyzed y glyco yltr n fer e. Note th t the ug r u tr te re ug r nucleotide , not i ol ted ug r molecule .

Not ll nucleo ide re u ed for thi proce d to UDP, GDP, nd CMP. UDP i the mo t ver (G lNAc), N- cetylgluco mine (GlcNAc), Ne, glucuronic cid, nd xylo e. GDP i u ed only u ed for i lic cid. P ge 164

   

protein entry. Dolichol i long-ch in hydroc r on [ et een 14-24 i oprene unit of 4+1 c r on ] found prim rily in the ER mem r ne, nd erve tempor ry nchor for the N-glyco yl tion oligo cch ride it i eing ynthe ized nd it it for n ppropri te protein to glyco yl te. The oligo cch ride ynthe i egin ith the ddition of t o N- cetylgluco mine re idue to the pyropho p h te linker, follo ed y m nno e. From thi m nno e, the oligo cch ride r nc he , ith one r nch receiving three more m nno e re idue nd the other receivi ng one. So f r, ll of the e ddition to the oligo cch ride h ve een t king p l ce in the cytopl m. No the glycolipid i flipped in rd to the ER lumen! On ce in the lumen, four more m nno e re dded, nd fin lly three gluco e re idue top off the tructure. The enzyme th t ccompli h the glyco yl tion re glyco yltr n fer e pecific for oth the dded ug r re idue nd the t rget oligo cch ride. The ug r u ed y the enzyme re not imply the ug r, ut nucleotid e ug r - u u lly ug r linked to nucleo ide dipho ph te, for ex mple, ur c il dipho ph te gluco e (UDP-gluco e) or GDPm nno e. Ch pter 11, Po t-Tr n l tion, ver ion 1.0 : ug r h ve only een found linke tile, inding N- cetylg l cto mine cetylmur mic cid, g l cto e, gluco for m nno e nd fuco e, hile CMP i

  

ER C lnexin Incompletely folded polypeptide 1 4 (return to cycle) Gluco id e II Incompletely folded

(to ve icle for tr n port) Folded correctly Gluco yltr n fer e 3 UDP UDPFigure 13. N-glyco yl tion c n e u ed in error-checking. Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 165

The protein di ulfie i omer e-like ctivity come from ERp57, hich i technic lly thiol oxidoreduct e, ut i function lly imil r to PDI.

 

The N-linked oligo cch ride h t o phy iologic l role : it ct the e fo r further glyco yl tion, nd it i u ed m rker for error-checking of protei n folding y the c lnexin-c lreticulin y tem (fig. 13). Once the oligo cch rid e i tt ched to the ne polypeptide, the proce of further glyco yl tion egin ith the ction of gluco id e nd th t remove t o of the gluco e . The l t gluco e i nece ry to help the glycoprotein dock ith either c lnexin or c l reticulin (fig.13, tep 1 or 4), hich re very imil r protein th t h ve lo gluco id e ctivity nd oci te ith protein di ulfide i omer e-like ct ivity. The m jor difference i th t c lreticulin i olu le in the ER lumen hil e c lnexin i ound to the ER mem r ne. Both tempor rily hold onto the glycoprot ein giving it time to (re)fold nd po i ly re rr nge di ulfide ond , then it r emove the gluco e, llo ing the glycoprotein to continue on it y. Import ntl y, if the glycoprotein h not een completely folded ( tep 2 ), the enzyme UDPg luco e:glycoprotein gluco yltr n fer e (GT) recognize it nd dd ck the glu co e re idue ( tep 3), forcing it to go through the c lreticulin/c lnexin cycle g in in hope of folding correctly thi time. If it h een folded correctly ( tep 2 ), it c n e recognized y ER- -1,2-m nno id e, hich remove m nno e, completing the glyco yl tion modific tion in the ER. Cyto ol

 

 

Mo t glycoprotein continue ith oligo cch ride remodeling once they h ve een moved from the ER to the Golgi pp r tu y ve icul r tr n port. There, v riet y of glyco id e nd glyco yltr n fer e prune nd dd to the oligo cch ride. Although the glyco yl tion i con i tent nd tereotyped for given protein, i t i till uncle r ex ctly ho the glyco yl tion p ttern re determined. ER lumen A n-X-Ser/Thr A n-X-Ser/Thr = N-Acetylgluco mine = M nno e 1 = Gluco e = G l cto e = Si lic cid Tr n port to Golgi ody Cyto ol

Golgi lumen A n-X-Ser/Thr A n-X-Ser/Thr A n-X-Ser/Thr A n-X-Ser/Thr 2 3 4 UDP UDP 5 UDP CMP UDP CMP nd/or

Figure 14. N-linked glyco yl tion c n continue in the Golgi. Sug r m y e dded nd removed in different p ttern y glyco yltr n fer e re ident in the Golgi . O-linked Protein Glyco yl tion t ke pl ce entirely in the Golgi O-linked glycoprotein egin their glyco yl tion ith the ction of the Golgi- p ecific enzyme, G lNAc tr n fer e, hich tt che n N- cetylg l cto mine to th e hydroxyl group of erine or threonine. The determin tion of hich re idue to glyco yl te ppe r to e directed y econd ry nd terti ry tructure previ

T o common nti iotic , tunic mycin nd citr cin, c n t rget N-linked glyco yl tion, lthough their nti iotic propertie come from di rupting form tion of cteri l cell ll . Tunic mycin i n n logue of UDP-GlcNAc, nd in ide euk ryo tic cell c n di rupt the initi l oligo cch ride form tion y locking the init i l GlcNAc ddition to the dolichol-pho ph te. Since it c n e tr n ported into euk ryotic cell , tunic mycin i not clinic lly u eful due to it toxicity. B ci tr cin, on the other h nd, i m ll cyclic polypeptide th t ind to dolicholPP preventing it depho phoryl tion to dolichol-P, hich i needed to uild the oligo cch ride. B citr cin i not cell-perme le, o even though it h imil r ctivity to tunic mycin on cteri y di rupting extr cellul r glycolipid ynt he i needed for cell ll form tion, it i h rmle to euk ryote nd thu i u eful ther peutic nti iotic.

   

  

Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 166

ou ly mentioned, nd often occur in den e clu ter of glyco yl tion. De pite e ing f irly m ll ddition (u u. <5 re idue ), the com ined oligo cch ride ch i n tt ched to n O-linked glycoprotein c n contri ute over 50% of the m of glycoprotein. T o of the etter kno n Olinked glycoprotein re mucin, compon ent of liv , nd ZP3, component of the zon pellucid ( hich protect egg ce ll ). The e t o ex mple l o illu tr te key property of glycoprotein nd gly colipid in gener l: the ug r re highly hydrophilic nd hold ter molecule to them, gre tly exp nding the volume of the protein.

UDP Ser UDP Ser UDP UDP 1 2 Ser CMP Ser CMP Ser GDP GDP Ser 3 4 = N-Acetylg l cto mine = G l cto e = Si lic cid = Fuco e

Intere tingly, thi protective terlogged hell c n m k p rt of the protein c ore. In the c e of the cell dhe ion molecule, NCAM, hich i highly poly i l yl ted glycoprotein t cert in development l t ge nd loc tion , nd unglyco y l ted in other , the n ked protein c n e recognized n dhe ive u tr te h ile the glyco yl ted protein c n e recognized repul ive u tr te to other cell . Even in highly glyco yl ted protein though, the ug r re idue often c t recognition ite for other cell . For in t nce, the zon pellucid i ver y import nt phy ic l rrier th t protect the egg, ut glyco yl ted ZP3 l o ct perm receptor. ...to endo ome, ly o ome, or v cuole cl thrin tr n Golgi

Ve icul r Tr n port In ddition to protein proce ing, the ER nd Golgi l o t ke c re of ome type of protein tr n port. Ve icle (mem r ne- ound u le , e enti lly) pinch off from the ER, Golgi, nd other mem r nou org nelle , c rrying ith them h tever olu le molecule ere in ide the fluid th t enclo ed ell ny molecu le em edded in th t ection of mem r ne. The e ve icle then c tch ride on molecul r motor uch kine in or myo in, nd tr vel long the cyto keleton unt

 

Figure 15. O-linked glyco yl tion in the Golgi involve ug r to erine or threonine.

 

tt chment of only

fe

ci Golgi KDEL receptor ERGIC COP I COP II

rough ER ri o ome Figure 16. Ve icle ud from the endopl mic reticulum nd merge to form ERGIC, hich m ture into the ci Golgi, then the medi l Golgi, nd fin lly the tr n G olgi. Ve icle m y l o ud from ny of the e other comp rtment to other org ne lle or to the pl m mem r ne. P ge 167

= tr n port c rgo = glyco yl tion enzyme

il they dock t the ppropri te de tin tion nd fu e ith the t rget mem r ne or org nelle. In gener l, ve icle move from the ER to the ci -Golgi, from the ci - to the medi l Golgi, from the medi l to the tr n - Golgi, nd from the tr n -G olgi to the pl m mem r ne or other comp rtment . Although mo t movement i in thi direction, there re l o ve icle th t move ck from the Golgi to the ER, c rrying protein th t ere uppo ed to t y in the ER (e.g. PDI) nd ere cci dent lly cooped up ithin ve icle. The form tion of ve icle i dependent on co t protein th t ill, under proper condition , elf- em le into pheric l c ge . When oci ted ith tr n mem r ne protein , they c n pull the tt ched me m r ne long into pheric l h pe l o. The m jor type of co t protein u ed in ve icle form tion re COPII, COPI, nd cl thrin. Ch pter 11, Po t-Tr n l tion, ver ion 1.0 medi l Golgi

  

COPII co t protein form the ve icle th t move from ER to Golgi. COPI co t prot ein re u ed et een p rt of the Golgi pp r tu ell to form ve icle g oing from the Golgi ck to the ER. Fin lly, cl thrin i u ed to form ve icle l e ving the Golgi for the pl m mem r ne ell for ve icle formed from the pl m mem r ne for endocyto i . A Cl thrin Light ch in He vy ch in B C Light ch in AP2 complex He vy ch in Golgi lumen

Figure 17. Cl thrin. (A) cl thrin ind to d pter protein hich re ound to t r n mem r ne c rgo receptor , linking the mem r ne ith the cl thrin. (B) A ing le cl thrin tri kelion i compo ed of three he vy ch in nd three light ch in . (c) The tri kelion elf- em le into roughly pheric l con truct ithout th e need for ny ddition l energy or enzyme . From the l te 1990 , there h een de te out the origin nd t ility of the Golgi pp r tu . The t o prim ry competing model , oth of hich re de cri ed in m ny text ook prior to 2006, ere the t le comp rtment model nd the ci te rn l m tur tion l model. According to the older t le comp rtment model, the ci , medi l, nd tr n Golgi re e ch perm nent tructure ith p rticul r ch r ct eri tic (lumen l enzyme , pH, etc). Protein re huttled from ci to medi l to tr n comp rtment in equence. The ci tern l m tur tion model, on the other h nd, po it th t ci Golgi comp rtment ctu lly m ture into medi l Golgi, hich then m ture into tr n Golgi - m tur tion eing ccompli hed y import nd export of pecific protein ch r cteri tic of p rticul r comp rtment. Although there ome evidence on either ide of the rgument, vi u l demon tr tion (fluore c ent l eling of e rly- nd l te- Golgi pecific protein ) of ci tern l m tur tio n in 2006 (Lo ev, et l, N ture 441: 939-40) confirmed th t model.

Cl thrin (fig. 17) i the e t de cri ed of the three, nd the ve icul r co t re m de from rr ngement of cl thrin tri kelion (from Gk. me ning three-legged ). E ch tri kelion i compo ed of three he vy ch in joined together t the C-te rminu , nd three light ch in , one oci ted ith e ch he vy ch in. The he vy ch in of different tri kelion inter ct long the length of their he vy ch in le g to cre te very turdy con truct. The light ch in re unnece ry for ve icl e form tion, nd re thought to help prevent ccident l inter ction of cl thrin molecule in the cytopl m. There i ignific nt imil rity et een the ve icle form tion mech ni m u ing the e different co t protein , eginning ith the re cruitment of ARF1 (ARF t nd for ADP ri o yl tion f ctor, hich h nothing to do ith it function here) to the mem r ne. Thi require the ARNO-f cilit ted e xch nge of GTP for GDP (ARNO i ARF nucleotide inding ite opener). Once ARF1 h ound GTP, the conform tion l ch nge reve l n N-termin l myri toyl group hich in ert into the mem r ne. Both COPI nd cl thrinco ted ve icle u e ARF1

 

 

C rgo receptor protein

 

nd ARNO, ut COPII u e imil r protein c lled S r1p nd Sec12p. The ARF1 (or S r1p) i u ed to recruit d pter protein th t ind to the t il end of mem r neound receptor protein . The u ine end of the e receptor ind to c rgo molec ule th t need to e p ck ged into the ve icle. The d pter protein ct the link et een the mem r ne (through the receptor ) nd the co t protein . For cl thrin, the d pter protein re AP1 for tr n -Golgi-derived ve icle nd AP2 for endocytic Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 168

A. COP I B- u complex F- u complex Arf

tr n Golgi medi l Golgi Fin lly, the d pter link to the ctu l co t protein : cl thrin, - or e- COP, Sec13p nd Sec31p. B. COP II Sec13/31 Wh t the e protein ll h ve in common i th t pont neou ly (i.e. ithout ny requireGTP ment for energy expenditure), P Sec23/24 GT GTP S r1-GTP they elf- em le into c ge-like pheric l tructure . Under the electron micro cope, the cl thC rgo receptor protein ER lumen rin-co ted ve icle re more Figure 18. COP co ted ve icle . h rply defined nd the he x gon l nd pent gon l h pe ounded y the cl thrin u unit give the ve icle occer ll look. COP co t mer-co ted ve icle re much fuzzier in ppe r nce un der EM. Golgi lumen C rgo receptor protein ci Golgi ER

Figure 20. Glyceropho pholipid re m de prim rily in the ER. Although the ER l o m ke the cer mide precur or for phingolipid , the phingolipid re m de o nly in the Golgi. All three type of ve icle co t protein h ve the iliy to pont neou ly oci te into pheric l con truct, ut only the COPI nd COPII co ted ve icle l o pont neou ly pinch off the mem r ne to rele e the ve icle from it origin ting m em r ne. Cl thrin-co ted ve icle require n extern l mech ni m to rele e the v e icle (fig. 19). Once the ve icle h lmo t completed, there i till m ll t lk or neck of mem- A B r ne th t connect the ve icle to the mem r ne. Aroun d thi t lk, dyn minCl thrin-co ted ve icle GTP molecule ggreg te in ring/ pir l con truction. Dyn min molecule re glo ul r GTP e th t contr ct upon Dy n min hydroly i of GTP. When they oci te Cyto ol = GTP = GDP round the ve i cle t lk, e ch dyn min protein contr ct , ith the com ined Figure 19. Dyn min monomer , e ch of hich i GTeffect of con tricting the t lk enough P e, pol ymerize round the neck of the ve icle. When th t the mem r ne pinche together , the GTP i hydrolyzed, the dyn min noo e tighten e ling off nd rele ing the ve icle from nd pinche off the ve icle. the origin ting mem r ne. Although lipid nd mem r ne ere di cu ed in ch pter 4, e neglected to di cu the loc tion of their ynthe e in euk ryote . A fig. 20 indic te , the ynt he i of cert in type of lipid i egreg ted nd exclu ive. Glyceropho pholipi d re prim rily formed in the endopl mic reticulum, lthough they re l o m d e in mitochondri nd peroxi ome . In contr t, phingolipid re not m de in th e ER (though their cer mide precur or re) in m mm l , the nece ry enzyme r e found in the lumen of the ci nd medi l Golgi. There i evidence of nterogr

 

= Other mem r ne lipid

= Sphingolipid

= Glyceropho pholipid

ve icle . For COPI ve icle , the pproxim te homologue z- COP hile the COPII y tem u e Sec23p nd Sec24p.

re the

-, g-, d-,

nd

de nd retrogr de ve icul r tr ffic et een the v riou Golgi nd ER comp rtment , hich ould theoretic lly indic te redi tri ution of lipid type . Ho ever, the phingolipid tend to ggreg te into lipid r ft nd eem to e more concent r ted in nterogr de-moving ve icle . Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 169

The co t protein come off hortly fter ve icul r rele e. For cl thrin, the pr oce involve H c70, n ATP e. Ho ever, for COPI or COPII co ted ve icle , hyd roly i of the GTP on ARF/S r1p ppe r to e ken the co t protein ffinity for the d pter nd initi te unco ting. The GTP e ctiv tor i ARF GAP (or Sec23p ) nd i n integr l p rt of the COP I (or II) co t. The ve icle c rry t o c te gorie of c rgo: olu le protein nd tr n mem r ne protein . Of the olu le pro tein , ome re t ken up in the ve icle y virtue of eing ound to receptor. Other protein ju t h ppen to e in the vicinity nd re cooped up the ve ic le form . Occ ion lly, protein i t ken up th t not uppo ed to e; for e x mple, PDI m y e enclo ed in ve icle forming from the ER. It h little func tion in the Golgi, nd i needed in the ER, o h t h ppen to it? Fortun tely, PDI nd m ny other ER protein h ve C-termin l ign l equence, KDEL (Ly ine-A p rtic AcidGlut mic Acid-Leucine), th t cre m I elong in the ER. Thi equence i recognized y KDEL receptor in ide the Golgi, nd inding of the KDEL prote in to the receptor trigger ve icle form tion to end them ck to the ER. Sec retory ve icle h ve peci l pro lem ith olu le c rgo. If the ve icle to rely imply on enclo ing protein ithin it during the form tion proce , it o uld e difficult to get high concentr tion of tho e protein . M ny ecreted pro tein re needed y the org ni m quickly nd in ignific nt mount , o there i mech ni m in the tr n Golgi for ggreg ting ecretory protein . The mech ni m u e ggreg ting protein uch ecretogr nin II nd chromogr nin B th t ri ng together the t rget protein in l rge concentr ted gr nule . The e gr nin o rk e t in the tr n Golgi milieu of lo pH nd high C ++, o hen the ve icle r ele e it content out ide of the cell, the higher pH nd lo er C ++ re k p rt the ggreg te to rele e the individu l protein . Fin lly, there i the que tion of t rgeting the ve icle . The ve icle re much le u eful if they re t o ed on molecul r freight tr in nd dropped off t r ndom. Therefore, there i docking mech ni m th t require m tching of the v-SNARE protein on the ve icle cytopl mic urf ce nd the t-SNARE on the cytopl mic urf ce of the t rge t mem r ne. Fu ion of the ve icle to the mem r ne only proceed if there i m tch. Other i e, the ve icle c nnot fu e, nd ill tt ch to nother molecul r mo tor to he d to nother, hopefully correct, de tin tion. Thi proce i ided y tethering protein hich initi lly m ke cont ct ith n incoming ve icle nd dr it clo e enough to the t rget to te t for SNARE protein inter ction. Other pr otein on the ve icle nd t rget mem r ne then inter ct nd if the SNARE m tch , c n help to inch the ve icle into the t rget mem r ne, hereupon the mem r ne fu e. An import nt rule of thum to under t nding ve icul r fu ion nd l o the direction lity of mem r ne protein nd Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 170

There i con i tent pH ch nge during the m tur tion of the Golgi, o th t e go from ER to Golgi, e ch comp rtment h progre ively lo er (more cidic) lumen l pH.

                

A v-SNARE Ve icle Tethering protein t-SNARE R -GTP B Ve icle T i ting SNARE complex T rget mem r ne T rget mem r ne C Mem r ne joined - ingle comp rtment Figure 21. Ve icle fir t inter ct ith tethering protein (A), hich help ring the ve icle nd t rget mem r ne clo e. SNARE c n then inter ct, nd if they m tch, then they ill egin to t i t round e ch other, r tcheting the t o mem r ne clo er they t i t.

lipid , i th t the cytopl mic-f cing ide of mem r ne i l y going to e f cing the cytopl m. Therefore protein th t i eventu lly found on the outer urf ce of the cell mem r ne ill h ve een in erted into the lumen l urf ce of the ER mem r ne to egin ith. More pecific lly, ve icle ppro che the t rget mem r ne, the tethering protein R -GTP, hich i linked to the t rget mem r ne vi dou le ger nylger nyl lipid t il, loo ely oci te ith the ve icl e nd hold it in the vicinity of the t rget mem r ne to give the SNARES ch nc e to ork. The v-SNARE nd t-SNARE no h ve the opportunity to inter ct nd te t for m tch. Recently, the SNARE h ve een ren med R-SNARE nd Q-SNARE , re pectively, ed on con erved rginine nd glut mine re idue . In ddition to t he e t o prim ry SNARE , t le t one other SNARE i involved, together forming undle of four -helice (four, not three, ec u e t le t in the e t tudie d ex mple, one of the SNARE i ent round o th t t o of it lph -helic l dom in p rticip te in the inter ction. The four helice r p round e ch other nd it i thought th t they do o, they pull the ve icle nd the t rget mem r ne together. The tet nu toxin, tet no p min, hich i rele ed y Clo tridium tet ni cter i , c u e p m y cting on nerve cell , nd preventing neurotr n mitter rele e. The mech ni m for thi i th t it cle ve yn pto revin, SNARE protein, o th t the yn ptic ve icle c nnot fu e ith the cell mem r ne. Botulinum toxin , from Clo tridium otulinum, l o ct on SNARE to prevent ve icle fu ion nd neurotr n mitter rele e, lthough it t rget different neuron nd o h the o ppo ite effect: tet nu i c u ed y preventing the rele e of inhi itory neurot r n mitter , hile otuli m i c u ed y preventing rele e of excit tory neurot r n mitter . Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 171

        

 

The endo om l proton pump re ATP-driven, Mg++-dependent V-type pump ( oppo e d to the F-type pump in the mitochondri l inner mem r ne). Structur lly, the t o re imil r though, nd ATP hydroly i drive the rot ry unit, hich then po er the movement of proton cro the mem r ne from cytopl m into endo ome. Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 172

          

Receptor-medi ted Endocyto i Ju t there i ve icul r tr ffic to rd the pl m mem r ne, either for ecre tion or for incorpor tion of mem r ne lipid or protein , there c n l o e ve i cul r tr ffic from the pl m mem r ne. Endocyto i i the proce y hich co t protein (u u lly cl thrin) on the cytopl mic ide of the pl m mem r ne, e gin to polymerize co t th t dr the mem r ne ith it into ve icle. Ho eve r, in te d of c pturing it of ER or Golgi lumen ith it, the ve icle cont in little m teri l from out ide of the cell. Sometime endocyto i i initi ted intern lly, perh p to remove p rticul r protein from the cell urf ce (for n ex mple, ee tr iling edge dyn mic in cell motility in the next ch pter), ut often, the endocyto i i the re ult of lig nd inding to n extr cellul r rec eptor molecule, le ding to it ctiv tion nd u equent nucle tion of cl thri n em ly nd ve icle form tion. There re m ny type of lig nd : nutrient mo lecule (u u lly on c rrier protein, in the ex mple elo ) or even n tt c king viru hich h co-opted the endocytic mech ni m to f cilit te entry into t he cell. The ex mple depicted here i cl ic ex mple: endocyto i of chole te rol (vi lo -den ity lipoprotein). Thi illu tr te one potenti l p th y th t t he receptor nd their c rgo m y t ke. In the c e of chole terol, the c rrier p rotein i roken do n fully, lthough in the c e of tr n ferrin, erum protei n th t c rrie iron in the lood, the c rrier protein i ju t recycled fter rel e ing it tr n ferrin c rgo. It i p ck ged into n exocytic ve icle he ded c k to the cell urf ce. Serum chole terol i u u lly e terified nd ound y LDL (lo den ity lipoprotein), hich then flo t out in the lood tre m until it m eet up ith n LDL receptor on the urf ce of cell. When the LDL ind to it receptor, the receptor i ctiv ted, nd cl thrin-co ted ve icle form round the LDL/receptor complex. LDL receptor tend to ggreg te in h t re kno n cl thrin-co ted pit cr ter-like p rti l ve icle th t lre dy h ve m ll num er of polymerized cl thrin molecule . The ve icle form ex ctly de cri ed pre viou ly for Golgi-derived cl thrin ve icle : the cl thrin elf em le into pheric l ve icle, nd dyn min pinche the ve icle off the cell mem r ne. Thi ve icle then fu e ith n e rly endo ome, hich c rrie proton pump in it mem r ne, c u ing the environment in ide the ve icle to cidify (~pH 6). Thi cidifi c tion c n c u e conform tion l hift in protein th t could, for ex mple, le d to receptor rele ing it lig nd, i the c e here ith LDL nd LDL recept or. The e rly endo ome l o function orting t tion: the receptor i re-v e icul rized nd tr n ported ck to the pl m mem r ne. Me n hile, the LDL i p ck ged into different ve icle nd he d off for further proce ing.

 

 

AP2 Cl thrin Chole terol H3C CH3 CH3 CH3 CH3 Ly o ome AA HO AA H3C CH3 CH3 CH3 CH3 Amino cid F tty cid Co ted ve icle HO H3C CH3 CH3 CH3 CH3 AA HO Unco ting L te endo ome Recycled LDL receptor Tr n port ve icle Fu ion E rly endo ome

Ly o om l enzyme re pecific lly t gged y m nno e-6-pho ph te th t i dded in the ci Golgi. Thi i t o- tep proce in hich N- cetylgluco mine pho p hotr n fer e dd pho pho-GlcNAc to m nno e re idue, connecting vi the pho ph te group, then pho phodie ter e remove the GlcNAc, le ving the m nno e-6 -P. Thi pecific lly t rget ly o om l enzyme ec u e they ll h ve pecific p rotein recognition equence th t the pho photr n fer e ind to efore tr n fe rring the P-GlcNAc. Although the ly o om l enzyme re t gged in the ci Golgi, they do not ort until the tr n Golgi, hen m nno e-6-P receptor ind to the l y o om l enzyme nd form ly o om l ve icle th t ill ud off nd tr vel to l t e endo ome nd ly o ome to deliver their cid hydrol e p ylo d. Ag in, the pH ch nge i import nt: in the ome h t cidic (pH 6.5) environment of the tr n G olgi, the receptor ind the m nno e-6-P-t gged enzyme , ut in the more cidic ly o ome, the cid hydrol e re rele ed to do their ork. When one or more c id hydrol e do not function properly or do not m ke it into the ly o ome ue t o improper orting, the re ult i incomplete dige tion of the ly o om l content . Thi in turn le d to the form tion of l rge inclu ion of p rti lly dige ted m teri l in ide the ly o ome . Thi ccumul tion of m teri l c n e cytotoxic, nd genetic di order th t ffect the expre ion or orting of ly o om l hydrol e re collectively referred to ly o om l tor ge di e e . The e f ll into ever l c tegorie depending on the type of molecule ccumul ted. A common nd

     

Figure 22. Receptor-medi ted endocyto i of chole terol vi ein.

lo -den ity lipoprot

LDL ApoB LDL receptor Endocyto i

e ily tre t le di e e of glyco minoglyc n ccumul tion i Hurler di e e, h ich c n e effectively tre ted nd non-neurologic l effect even rever ed y enz yme repl cement ther py. Hurler other in it cl ffect ide v riety of ti ue ec u e glyco minoglyc n re u iquitou . On the other h nd, ec u e the r in i enriched in g nglio ide , ly o om l tor ge di e e like G ucher di e e ho defect prim rily in the CNS. M ny ly o om l tor ge di e e h ve imil r pre ent tion: development l norm litie , e p. tunted one gro th, l ck of f ine f ci l fe ture , nd neuromu cul r e kne .

The endo om l ve icle ith the LDL in it next fu e ith nother cidic, mem r n e ound comp rtment. The ly o ome, t pH ~5.0, i even more cidic th n the endo ome, nd it l o cont in l rge complement of cid hydrol e - hydrolytic enz yme r nging cro u tr te (incl. prote e , lip e , glyco id e , nucle e ) th t oper te optim lly in cidic condition , nd minim lly in the neutr l or lightly ic condition in the cytopl m. In p rt, thi i fety mech ni m le k ge of dige tive enzyme from the ly o ome ill not re ult in hole le dige tion of the cell ec u e the enzyme h ve little or no ctivity in the cytopl m. The ly o om l mem r ne, in ddition to h ving proton pump to cidify the int ern l environment, l o incorpor te m ny tr n porter protein to id in moving the dige tion product of the cid hydrol e out of the ly o ome o th t the ce ll c n m ke u e of the mino cid , ug r , nucleotide , nd lipid th t re ult. B ck to our ex mple, th t me n th t the chole terol e ter re roken p rt in to individu l chole terol molecule , nd the lipoprotein i roken do n into lip id nd mino cid . Intere tingly, the e tr n porter protein re not dige ted y the ly o om l prote e ec u e they re very he vily glyco yl ted, hich hi eld potenti l proteolytic ite from the prote e . Since it depend gre tly on the content of the endo ome( ) th t fu ed ith it, the ize nd content of ly o ome c n v ry gre tly. In f ct, the ly o ome m y l o degr de intern l cellul r component through the proce of utoph gy. U u lly, thi i initiCh pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 173

  

      

Ch pter 11, Po t-Tr n l tion, ver ion 1.0 P ge 174

The mo t evere, I-cell di e e (mucolipido i type II) occur hen ne rly ll l y o om l enzyme re mi ing in the fi ro l t of the ffected individu l. Ther e i evere development l del y nd e rly gro th f ilure, neuromu cul r pro lem , nd m lform tion in e rly kelet l development. The everity of thi di order i due to the lmo t complete l ck of ly o om l enzyme , hich i c u ed y d eficiency of GlcNAc pho photr n fer e. Without it, no enzyme re t gged for o rting to the ly o ome. Other rel tively common di order include T y-S ch nd N iem nn-Pick di e e . T y-S ch i c u ed y n ccumul tion of g nglio ide in the r in nd i u u lly f t l y 5 ye r of ge. Niem nn-Pick, on the other h n d, m y m nife t Type A ith n even horter life expect ncy, or Type B, in hich ymptom re rel tively minor. The m jor difference i th t Type A p tien t h ve very little (<5%) of their phingomyelin e ctivity, hile Type B p tie nt h ve only lightly le th n norm l (~90%) ctivity.

                        

ted under t rv tion condition hich le d to inhi ition of mTor, nd u equen t expre ion of utoph gic gene . The e then inter ct ith mitochondri nd othe r cellul r component , nd promote the form tion of dou le-mem r ned utoph go ome round them. The origin of the mem r ne i uncle r, lthough the ER i u pected. Fin lly, the utoph go ome fu e ith ly o ome, nd the cid hydrol e re k do n the cell p rt for energy. A v ri tion on thi c lled micro utoph g y c n l o occur, in hich the ly o ome it elf inv gin te it of cytopl mic m teri l nd intern lize n intr ly o om l ve icle th t i then roken do n. Fi n lly, it hould e noted th t the l rge v cuole of pl nt cell re in f ct pe ci lized ly o ome . Rec ll th t v cuole help to m int in the turgor, or out rd ter pre ure on the cell ll th t le d to rigid pl nt p rt r ther th n limp, ilted one. One of the y in hich thi occur i th t the cid hydrol e in ide the v cuole lter the o motic pre ure in ide the v cuole to regul te the movement of ter either in or out. Another ex mple of receptor-medi ted end ocyto i i the import of iron into m mm li n cell. A ith erum chole terol, iron i not gener lly imported into the cell y it elf. In te d, it i ound to potr n ferrin, erum protein th t ind t o Fe3+ ion . Once it h ound the iron ion , the potr n ferrin i no referred to tr n ferrin, nd it c n e recognized nd ound y tr n ferrin receptor (TfR) loc ted on the extr cellul r urf ce of cell mem r ne . Thi initi te receptor-medi ted endocyto i ju t de cri ed ove. Ho ever, in thi c e, the ly o ome i not involved. A the tr n ferrin nd tr n ferrin receptor re ch the e rly endo ome, they do not di oci te, ut r ther the Fe2+ rele e from the tr n ferrin, nd then exit the endo ome vi DMT1, div lent met l tr n port protein to e u ed in heme group or ot her complexe . Thi le ve the potr n ferrin-TfR complex, hich i recycled c k to the cell mem r ne vi ve icle. Once the ve icle fu e ith the extr cellul r p ce, the cidity of the endo ome i di ip ted nd the potr n ferrin no lon ger ind to TfR. Apotr n ferrin c n thu go ck to it duty of finding iron io n nd ringing them ck to the cell.

P ge 175

Although the gene re not p rticul rly ell con erved, com in tion of genetic imil rity nd protein tructure h ve confirmed the pre ence of prok ryotic pro tein th t re rel ted to euk ryotic cyto kelet l protein in oth form nd func tion. Comp red to the euk ryotic cyto keleton, tudy of prok ryotic protein i very recent, nd for long time, there n umption th t prok ryote did n ot h ve or need cyto kelet l rchitecture. Ft Z, the cteri l equiv lent of tu ulin, di covered in 1980 ut mo t of the ork on it h occurred in the l t dec de. MreB i n ctin-like protein, fir t comp red to ctin in 1992, nd cre centin, n intermedi te fil ment cl protein, only de cri ed in 2003. For comprehen ive revie of prok ryotic cyto keleton protein , ee Gr um nn, P.L., Ann. Rev. Micro iology 61:589-618, 2007.

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

dv n the dv Fin on e

Cyto keleton : Structure nd Movement When euk ryotic cell i t ken out of it phy iologic l context nd pl ced in pl tic or gl Petri di h, it i gener lly een to fl tten out to ome extent . On precipice, it ould eh ve like S lv dor D li tch, oozing over the ed ge. The immedi te umption, p rticul rly in light of the f ct th t the cell i kno n to e mo tly ter y m nd volume, i th t the cell i imply g o f fluid. Ho ever, the cell ctu lly h n intric te micro tructure ithin it, f r med intern lly y the component of the cyto keleton. A the n me implie , the cyto keleton ct much like our o n keleton in upporting the gener l h pe o f cell. Unlike our keleton though, the cyto keleton i highly dyn mic nd in tern lly motile, hifting nd re rr nging in re pon e to the need of the cell. It l o h v riety of purpo e eyond imply providing the h pe of the cell. Gener lly, the e c n e c tegorized tructur l nd tr n port. While ll thre e m jor component of the cyto keleton perform e ch of the e function , they do not do o equ lly, their iophy ic l ch r cteri tic re quite different. Wit h re pect to tructure, t ome point in the life of every cell, it mu t ch nge h pe, hether imply incre ing or decre ing in ize, or more dr tic lter tion like the uper-elong ted form of neuron ith xon , the cyto keleton mu t e le to re pond y dyn mic lly incre ing nd decre ing the ize of the inte rn l tructure needed. Structure l o pplie to the rel tive po ition of in tern l cellul r element , uch org nelle or protein , to one nother. In m n y highly peci lized cell , the egreg tion of p rticul r tructure ithin cert in p rt of the cell i cruci l for it to function. Tr n port refer to the mov ement of molecule nd org nelle ithin the cell ell movement of the cel l hole. We ju t di cu ed intr cellul r movement of protein nd lipid y y of ve icle in the l t ch pter. Tho e ve icle , e ill ee in thi ch pter, re not ju t flo ting from one pl ce to nother; they re moved purpo eful ly nd direction lly long the cyto keleton like c rgo on high y or r ilro d t r ck . With re pect to hole cell movement, thi c n r nge from p ddling or im ming y ingle-celled org ni m to the tereotyped nd highly coordin ted cr li ng of m ny cell from their point of origin to their eventu l de tin tion during the development of met zo n org ni m or the movement of fi ro l t to he l cut in your kin. Ch pter 12, Cyto keleton, ver ion 1.0

 

 

   

  

 

  

The three m jor component of the cyto keleton re microtu ule , microfil ment , nd intermedi te fil ment . E ch of the e re polymer compo ed of repe ting u unit in pecific rr ngement . With ju t quick gl nce (fig. 1), it i very c le r th t the intermedi te fil ment ill likely pl y ignific ntly different role from either microtu ule or microfil ment . Bec u e the IF re m de of long fi rou u unit th t coil round one nother to form the fil ment, there i cl e rly gre t de l of cont ct ( hich f cilit te form tion of hydrogen ond , k molecul r velcro) et een u unit providing gre t ten ile trength. It i very difficult to re k the e u unit p rt, nd thu the IF re prim rily u ed for long-term or perm nent lo d- e ring purpo e . Looking t the other t o componen t of the cyto keleton, one c n ee th t ith the glo ul r in te d of fi rou h pe of the u unit , the m ximum re of cont ct et een u unit i gre tly lim ited (think of the cont ct re hen you pu h t o ket ll together), m king it e ier to ep r te the u unit or re k the microfil ment or microtu ule. Th e cell c n u e thi ch r cteri tic to it dv nt ge, y utilizing the e kind of cyto kelet l fi er in dyn mic itu tion here form tion or de truction of int ermedi te fil ment ould t ke f r too long. We no ddre the e three group o f cyto kelet l element in more det il. Intermedi te Fil ment Intermedi te fil ment i ctu lly generic n me for f mily of protein (groupe d into 6 cl e ed on equence nd iochemic l tructure) th t erve imil r function in protecting nd h ping the cell or it component . Intere tingly, they c n even e found in ide the nucleu . The nucle r l min , hich con titute cl V intermedi te fil ment , form trong protective me h tt ched to the in ide f ce of the nucle r Ch pter 12, Cyto keleton, ver ion 1.0

Mo t D ), d mo P ge

intermedi te fil ment f ll et een 50-100 kD , including ker tin (40-67 k l min (60-70 kD ), nd neurofil ment (62110 kD ). Ne tin (cl VI), foun tly in neuron , i n exception, t pproxim tely 240 kD . 176

    

Figure 1. Cyto kelet l element di tri ution in he purple ll i the nucleu .

prototypic l euk ryotic cell. T

= Microtu ule = Intermedi te Fil ment

= Actin Fil ment

   

mem r ne. Neuron h ve neurofil ment (cl IV), hich help to provide tructur e for xon long, thin, nd delic te exten ion of the cell th t c n potenti lly run meter long in l rge nim l . Skin cell h ve high concentr tion of ker t in (cl I), hich not only run through the cell, ut connect lmo t directly to the ker tin fi er of neigh oring cell through type of cellul r dhe ion tructure c lled de mo ome (de cri ed in the next ch pter). Thi llo pre u re th t might e le to ur t ingle cell to e pre d out over m ny cell , h ring the urden, nd thu protecting e ch mem er. In f ct, m lform tion of ei ther ker tin or of the protein forming the de mo ome c n le d to condition c ollectively termed epidermoly i ullo , in hich the kin i extr ordin rily f r gile, li tering nd re king do n ith only light cont ct, compromi ing the p tient fir t line of defen e g in t infection. NH2 Monomer COOH Figure 2. Intermedi te fil ment re compo ed of line r u unit th t r p roun d e ch other nd inter ct very tightly. Coiled-Coil Dimer Tetr mer Epidermoly i ullo implex i collection of congenit l di e e c u ed y m ut tion to the ker tin gene KRT5 or KRT14, or to the plectin gene PLEC1. The e mut tion either e ken the polymeriz tion of ker tin into fil ment , or the in ter ction et een ker tin fil ment . Thi le d to the in ility of e ch individ u l cell to m int in tructur l integrity under pre ure. Another type of EB, ju nction l epidermoly i ullo (JEB), i c u ed y mut tion to integrin recepto r ( 4, 6) or l minin . Thi include JEB gr vi or Herlitz di e e, hich i t he mo t evere, often le ding to e rly po tn t l de th. JEB i l o rel ted to d y trophic epidermoly i ullo (DEB) di e e uch Cock yne-Tour ine, e ch o f hich due to mut tion in coll gen type VII. The gene product involved in JEB nd DEB re di cu ed in more det il in the next ch pter. They pl y role i n dhering the cell to the ememnt mem r ne, nd ithout them, the di org niz tion of the cell le d to incomplete connection et een the epiderm l cell , nd therefore imp ired pre ure- h ring. Some form of Ch rcot-M rie-Tooth di e e, the mo t common inherited peripher l nerve di e e, re l o linked to mut t ion of intermedi te fil ment gene . Thi di e e, l o kno n perone l mu cul r trophy or heredit ry motor en ory neurop thy, i non-leth l degener tive di e e prim rily ffecting the nerve of the di t l rm nd leg . There i ro d v riety of CMT type nd c u e , the mo t common eing m lform tion of Sch nn cell nd the myelin he th they form. CMT type 2 i ch r cterized y m lfo rm tion of the peripher l nerve xon , nd i linked to mut tion of l min A pr otein nd of light neurofil ment . The c u l mech ni m h not yet een e t l i hed; ho ever, the neurofil ment re ignific nt element in m int ining the i ntegrity of long xon . Structur lly, mentioned previou ly, ll intermedi te fil ment t rt from f i rou u unit (fig. 2). Thi then coil round nother fil mentou u unit to f orm coiled-coil dimer, or protofil ment. The e protofil ment then inter ct to form tetr mer , hich re con idered the ic unit of intermedi te fil ment co n truction. U ing protein c lled plectin , the intermedi te fil ment c n e co nnected to one nother to form heet nd me he . Plectin c n l o connect the intermedi te fil ment to other p rt of the cyto keleton, hile other protein c n help to tt ch the IF cyto keleton to the cell mem r ne (e.g. de mopl kin). The mo t triking ch r cteri tic of intermedi te fil ment i their rel tive lon gevity. Once m de, they ch nge nd move very lo ly. They re very t le nd do not re k do n e ily. They re not u u lly completely inert, ut comp red to m icrotu ule nd microfil ment , they ometime eem to e. Ch pter 12, Cyto keleton, ver ion 1.0

             

    

P ge 177

_ + Figure 3. Actin microfil ment h ve (+) nd (-) end. When the free (glo ul r) ctin concentr tion i lo , ctin i prim rily dded to the (+) end, nd lo t fr om the (-) end. Ho ever t high level of g- ctin, ne monomer c n potenti lly dd onto the fil ment from either end. High G- ctin Concentr tion _ +

Ch pter 12, Cyto keleton, ver ion 1.0 P ge 178

When the ctin u unit come together to form microfil ment , they inter ct dire ction lly. Th t i , u unit h ve top nd ottom, nd the top of one u unit l y inter ct ith the ottom of nother. If e go to the ottom-mo t u unit of fil ment, the open end i c lled the minu (-) end, hile the oppo ite end, hi ch incident lly ee more dditive ction, i c lled the plu (+) end. Microfil ment re l o id to h ve pol rity, ut g in thi i only in the en e of h v ing direction lity, nd h nothing to do ith electric l ch rge. Individu l mic rofil ment c n exi t, ut mo t microfil ment in vivo re t i ted p ir . Unlike DNA; ho ever, microfil ment p ir re not ntip r llel: oth tr nd h ve the me direction lity.

      

Actin Microfil ment Microfil ment re l o kno n ctin fil ment , fil mentou ctin, nd f- ctin , nd they re the cyto kelet l oppo ite of the intermedi te fil ment . The e tr nd re m de up of m ll glo ul r ctin (g- ctin) u unit th t t ck on one nother ith rel tively m ll point of cont ct. You might envi ion t o tenni ll , one fuzzy nd the other covered in velcro hook . Even if you pu h h rd to mu h them together, the re of cont ct et een the ll (i.e. the re v il le for H- onding et een u unit ) i f irly m ll comp red to the over ll urf ce re , or to the re of cont ct et een IF u unit . They ill hold together, ut they c n l o f ll p rt ith rel tively little force. Contr t thi ith i ntermedi te fil ment , hich might e repre ented t o ri on of velcro hook or loop . Con ider ly more ork i required to t ke them p rt. Bec u e there re fe er H- ond to re k, the microfil ment c n e decon tructed very quickly , m king it uit le for highly dyn mic pplic tion . Lo G- ctin Concentr tion

 

         

   

Ch pter 12, Cyto keleton, ver ion 1.0 P ge 179

 

Microtu ule Microtu ule re m de up of t o equ lly di tri uted, tructur lly imil r, glo u l r u unit : nd tu ulin. Like microfil ment , microtu ule re l o depend ent on nucleotide tripho ph te for polymeriz tion, ut in thi c e, it i GTP . Another imil rity i th t microtu ule h ve pol rity in hich the (-) end i f r le ctive th n the (+) end. Ho ever, unlike the t i ted-p ir microfil me nt , the microtu ule re mo tly Microtu ule t ility i temper ture-dependent: if cooled to 4C, microtu ule f ll p rt into -tu ulin heterodimer . W rmed ck up to 37C, the tu ulin repolymerize if there i GTP v il le.

              

The form tion of fil ment from g- ctin i n ATP-dependent proce , lthough no t in the convention l en e of utilizing the energy rele ed in hydroly i . In t e d, the glo ul r ctin u unit ill only ind ith nother g- ctin u unit if it h fir t ound n ATP. If the g- ctin h ound ADP, then it mu t fir t exch nge the ADP for ATP efore it c n e dded onto fil ment. Thi lter the con form tion of the u unit to llo for higher- ffinity inter ction. A hort tim e l ter, hydroly i of the ATP to ADP ( ith rele e of Pi) e ken the ffinity ut doe not directly c u e di olution of the u unit inding. The hydroly i i rought out y the ctin it elf, hich h thi ATP e enzym tic ctivity u ilt in. Although f- ctin prim rily exi t p ir of fil ment t i ted round e ch other, ddition of ne ctin occur y the ddition of individu l g- ctin m onomer to e ch fil ment (fig. 3). Acce ory protein c n e u ed to help or hin der either the uilding or re kdo n of the fil ment , ut the prim ry mech ni m i e enti lly elf-regul ting. When free g- ctin level re high, elong tion o f ctin fil ment i f vored, nd hen the g- ctin concentr tion f ll , depolyme riz tion of f- ctin predomin te . Under ver ge phy iologic l condition , though , h t i often een in ctin microfil ment i n effect c lled tre dmilling. S ince ctin i mo tly dded onto one end ut removed from the other, the net effe ct i th t ny given ctin monomer in fil ment i effectively moving from (+) end to (-) end even if the pp rent length of the fil ment doe not ch nge. In m o t cell type , the gre te t concentr tion of ctin- ed cyto kelet l tructure i found in the periphery of the cell r ther th n to rd the center. Thi fit ell ith the tendency of the edge of the cell to e more dyn mic, con t ntly dju ting to en e nd re ct to it environment. Cle rly, the polymeriz tion n d depolymeriz tion of ctin fil ment i much f ter th n for intermedi te fil m ent . The ig exception to the ctin-in-periphery rule i found in mu cle cell . Actin fil ment , nd the myo in motor protein th t ork on them, re the i for mu cle cell contr ction, nd fill up mo t of the mu cle cell , not ju t the periphery. We ill di cu the role of ctin in oth type of cell movement l t er in the ch pter.

 

GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP P GT GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP GTP G G DP TP TP GTP G GDP GDP GDP GDPGDP GDP GDP GDP GDP GDP GDP GDPGDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDPGDP GDP GDP GDP GDP GDP GDP GDPGDP G DP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP DP GDP G GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP

found l rge 13- tr nded (e ch tr nd i c lled protofil ment) hollo tu e tructure . Al o, the nd tu ulin u ed for uilding the microtu ule not only ltern te, ut they re ctu lly dded in p ir . Both the -tu ulin nd -tu ul in mu t ind to GTP to oci te, ut once ound, the GTP ound to -tu ulin doe not move. On the other h nd, GTP ound in the -tu ulin m y e hydrolyzed to G DP. GDP- ound -dimer ill not e dded to microtu ule, o imil r to the i tu tion ith ATP nd g- ctin, if the tu ulin h GDP ound to it, it mu t fir t exch nge it for GTP efore it c n e polymerized. Although the ffinity of tu ulin for GTP i higher th n the ffinity for GDP, thi proce i u u lly f cili t ted y GEF, or gu nine nucleotide exch nge f ctor. A the ign l tr n ductio n ch pter ill ho in more det il, thi type of nucleotide exch nge i common mech ni m for ctiv tion of v riou iochemic l p th y . Figure 4. Microtu ule exhi it dyn mic in t ility. GTP- ound -tu ulin dimer re dded onto the microtu ule. Once the GTP i hydrolyzed, the conform tion l hift tr in the microtu ule, hich ill tend to re k p rt unle ne tu ulin dimer re dded to t ilize the tructure. GTP GTP

GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GD P GDP GD P GDP GDP GDP GDP GDP GDP GDP GDP GDP GD P GDP GD P GDP GDP GDP GDP GDP GDP GD P GDP GDP GDP

GDP P GD GDP GDP GDPGDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GD P GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP Ag in like ctin, the tu ulin it elf h enzym tic ctivity, nd over time, the GTP e ctivity hydrolyze the GTP to GDP nd pho ph te. Thi ch nge the tt ch ment et een -tu ulin of one dimer nd the -tu ulin of the dimer it i t cked on ec u e the h pe of the u unit ch nge . Even though it i nt directly loo en ing it hold on the neigh oring tu ulin, the h pe ch nge c u e incre ed tre th t p rt of the microtu ule trie to pu h out rd. Thi i the i of property of microtu ule kno n dyn mic in t ility. If there i nothing to t ilize the microtu ule, l rge portion of it ill f ll p rt. Ho ever, long ne tu ulin ( hich ill h ve GTP ound) i eing dded t high enough r te to keep ection of lo - tre t le-conform tion microtu ule (c lled the GTP c p) on top of the older GDP-cont ining p rt, then it t ilize the over ll micro tu ule. When ne tu ulin ddition lo do n, nd there i only very m ll or nonexi tent c p, then the microtu ule undergoe c t trophe Ch pter 12, Cyto keleton, ver ion 1.0 P ge 180

     

     

Inhi ition of g-tu ulin function y nti ody locking, RNA interference of expre ion, nd gene knockout confirm th t ithout g-tu ulin function, the microtu ul e tructure did not form. In ddition, it ppe r to e pl y role in coordin t ion of l te mito i ( n ph e on rd ). P ge 181

           

Microtu ule Org nizing Center Microtu ule , like microfil ment , re dyn mic tructure , ch nging in length n d inter ction to re ct to intr - nd extr -cellul r ch nge . Ho ever, the gener l pl cement of microtu ule ithin the cell i ignific ntly different from mic rofil ment , lthough there i ome overl p ell inter ction. Microfil men t do not h ve ny kind of glo l org niz tion ith re pect to their pol rity. T hey t rt nd end in m ny re of the cell. On the other h nd, lmo t ll micro tu ule h ve their (-) end in perinucle r re kno n the MTOC, or microtu u le org nizing center nd they r di te out rd from th t center. Since the microt u ule ll r di te out rd from the MTOC, it i not urpri ing th t they re con centr ted more centr lly in the cell th n the microfil ment hich, mentioned ove, re more und nt round the periphery of the cell. In ome cell type ( prim rily nim l), the MTOC cont in tructure kno n the centro ome. Thi c on i t of centriole (t o hort rrel- h ped microtu ule ed tructure po i tioned perpendicul r to e ch other) nd poorly defined concentr tion of perice ntriol r m teri l (PCM). The centriole i compo ed of nine fi ril , ll connecte d to form cylinder, nd e ch l o connected y Figure 5. An electron microgr p h r di l poke to centr l xi . The electron microgr ph depicting the cro ection of in figure 5 ho cro - ection of centriole. In it, e ch centri ole in n em ryonic fi ril i ho n to ctu lly e fu ed triplet of microtu ul e . mou e r in cell. L. Ho rd nd M. M rin-P dill , 1985 Ch pter 12, Cyto keleton, ver ion 1.0

in hich l rge portion r pidly re k p rt. Note th t thi i very different proce th n re kdo n y depolymeriz tion, hich i the gr du l lo of only fe u unit t time from n end of the microtu ule. Depolymeriz tion l o occ ur , nd like ith ctin, i determined p rti lly y the rel tive concentr tion of free tu ulin nd microtu ule . From phy ic l t ndpoint, the microtu ule i f irly trong, ut not very flexi le. A microfil ment ill flex nd end hen deforming force i pplied (im gine the fil ment nchored t the ottom end t nding tr ight up, nd omething pu hing the tip to one ide). The microtu ule in the me itu tion ill end only lightly, ut re k p rt if the deforming force i ufficient. There i , of cour e, limit to the flexi ility of the micr ofil ment nd eventu lly, it ill l o re k. Intermedi te fil ment re lightl y le flexi le th n the microfil ment , ut c n re i t f r more force th t eith er microfil ment or microtu ule .

     

Ho ever, in e ch triplet, only one i complete microtu ule (de ign ted the A t u ule), hile the B nd C tu ule GTP GTP GTP GTP GTP GTP do not form complete t u e (they h re ll ith the A GTP GTP GTP GTP nd B tu ule , re pectively). Intere tingly, the centriole GTP GTP GTP GTP GTP do not ppe r to e connected to the cellul r microtu ule GTP GTP GTP GTP GTP net ork. Ho ever, hether there i defined centro ome GTP GTP GTP GTP GTP or not, the MTOC region i the poin t of origin for ll micro GTP tubul arrays. This is b caus th MTOC contains a hi h conc ntration of -tubulin. Why is this important? With all of th cytosk l tal l m nts, thou h it is most pronounc Fi ur 6. -tubulin rin com- with m icrotubul s, th rat of nucl ation, or startin a mipl x facilitat s microtubul crotubul is si nificantly slow r than th rat of lon atin nucl ation. an xistin structur . Sinc it is th sam bioch mical int raction, th assumption is that th ifficulty li s in ttin th initial rin of im rs into position. Th -tubulin facilitat s this proc ss by formin a -tubulin rin compl x that s rv s as a t mplat for th nucl ation of microtubul s (fi . 6). This is tru both in animal an fun al c lls with a sin l fin MTOC, as w ll as in plant c lls, which hav multipl , isp rs sit s of microtubul nucl ation. GTP GTP GTP GTP GTP GTP GTP GTP

Transport on th Cytosk l ton Whil it can b us ful to think of th s cytosk l tal structur s as analo ous to an animal sk l ton, p rhaps a b tt r way to r m mb r th r lativ plac m nt of th microtubul s an microfilam nts is by th ir function in transportin intrac llular car o from on part of th c ll to anoth r. By that analo y, w mi ht con si r th microtubul s to b a railroa track syst m, whil th microfilam nts a r mor lik th str ts. By th sam analo y, w can su st that th microtubu l n twork an microfilam nt n twork ar conn ct at c rtain points so that wh n car o r ach s its n ral stination by microtubul (rail), th n it can b ta k n to its sp cific a r ss by microfilam nt. L ts xt n this analo y a bit furt h r. If th microtubul s an microfilam nts ar th tracks an str ts, th n wha t ar th trains an trucks? Ah, an astut qu stion, Grasshopp r. On th microtu bul s, th trains ar on of two famili s of mol cular motors: th kin sins an th yn ins. W can n raliz som what an say that th kin sins riv towar s th (+) n (towar p riph ry of c ll) whil th yn ins o towar th (-) n (to war th MTOC). On actin microfilam nts, th mol cular motors ar prot ins of th myosin family. At this point, th analo i s n , as th functionin of th s m ol cular motors is v ry iff r nt Chapt r 12, Cytosk l ton, v rsion 1.0 Pa 182

from locomotion by train or truck. Finally, on mi ht qu stion th biolo ical n for such a transport syst m. A ain, if w analo iz to human transport, th n w coul say that transport via simpl iffusion is akin to p opl carryin pack a s ran omly about th c ll. That is to say, th liv ri s will v ntually b ma , but you woul nt want to count on this m tho for tim -critical mat rials. T hus a ir ct , hi h-sp syst m is n to k p c lls (particularly lar r, ukaryotic c lls) aliv .

= Microtubul s = Actin Filam nts = Myosin V

Althou h this typ of transport occurs in all ukaryotic c lls, a particularly w ll-stu i cas is axonal transport (also call axoplasmic transport) in n uro ns. H r , th transport of mat rials from th c ll bo y (soma) to th tips of th axons can som tim s trav rs v ry lon istanc s up to s v ral m t rs in lar r animals, an must o so in a tim ly mann r. Axonal transport is n rally clas sifi as ant ro ra (from soma to axon t rminal) or r tro ra (from t rminals back). Th typ s of mat rial transport in th s two ir ctions is v ry iff r nt: much of th ant ro ra transport is prot in buil in blocks for xt n in th axon or synaptic v sicl s containin n urotransmitt rs; r tro ra transport is mostly n ocytic v sicl s an si nalin mol cul s. Axonal transport is also cat oriz as fast an slow. Slow transport is primarily th mov m nt of prot i ns ir ctly boun to th motors, an th y can mov from from 100 mm p r ay (SCa , slow compon nt a) up to 3mm/ ay (SCb). In comparison, fast transport is n ra lly mov m nt of v sicl s, an can vary from 50 to 400 mm/ ay. Th m chanism of s low transport ha b n bat for ov r a ca until 2000, wh n ir ct visuali zation of fluor sc ntly lab l n urofilam nts in transport show that th actu al mov m nt of th prot ins was v ry similar to th mov m nt in fast axonal tran sport, but th r w r many paus s in th transport, a stop an o m chanism rath r movin from sourc to stination continuously. Fi ur 7. Transport on microtubul s an microfilam nts. All of th kin sins an yn ins hav a f w k y commonaliti s. Th r is a catalyt ic n r y-r l asin h a conn ct to a hin or n ck r ion allowin th mol cul to fl x or st p, an th r is a car o-carryin tail b yon that (fi . 8). Th h a of a kin sin or yn in catalyz s th hy rolysis of ATP, r l asin n r y to ch an its conformation r lativ to th n ck an tail of th mol cul , allowin it to t mporarily r l as its rip on th microtubul , swiv l its hips aroun to pla nt its lf a st p away, an r bin to th microtubul (fi . 9). On th actin microf ilam nts, th myosins, of which th r ar also many typ s (som pict in fi . 10) ar th mol cular motors. Th ir mov m nt is iff r nt from yn ins an kin sins, as will b scrib in th n xt s ction, but also us s th n r y of ATP hy rolysis to provi n r y for th conformational chan s n for mov m nt. W hav intro uc th motors, but consi rin th normous iv rsity in th mo l cul s that n to b transport aroun a c ll, it woul b imposChapt r 12, Cytosk l ton, v rsion 1.0 Pa 183

= Dyn in = Kin sin = V sicl

sibl for th motors to ir ctly bin to all of th m. In fact, th motors bin t o th ir car o via a apt r mol cul s that bin th motor on on si , an a car o mol cul or v sicl on th oth r. Furth r xamination of th car o an th rout in of th car o by a r ss mark rs (SNAREs) was iscuss in th v sicular tran sport chapt r. Fi ur 8. Kin sin (A) an Dyn in (B) ar motor prot ins that mov alon microtub ul s. G n rally, kin sins mov to th (+) n whil yn ins mov to th (-) n . Th ir motor function r quir s ATP hy rolysis. ATP bin in sit s ar mark in w hit . A ATP H avy Chain Li ht Chain ATP ATP H avy Chain B ATP Int rm iat Chain Li ht Chain Fi ur 9. A car o v sicl (y llow) can b simultan ously boun by yn in ( r n) an kin sin (blu ) via a apt r prot ins. This top si also picts th mov m n t of th kin sin, in which bin in of ATP caus s on foot to r l as , an hy rolys is of ATP caus s th mol cul to swiv l th oth r foot in front. + _ Fi ur 10. S l ct Myosins. (A) Typ I myosin, primarily for bin in m mbran s to f-actin, inclu in n ocytic v sicl s. (B) Typ II myosin, bin s f-actin on b oth n s to sli filam nts a ainst ach oth r. (C) Typ V myosin, us in v sic ular transport. (D) Typ VI myosin, us in n ocytosis. (E) Typ XI myosin, a f ast myosin us in cytoplasmic str amin in plant c lls. A B C D E Chapt r 12, Cytosk l ton, v rsion 1.0

Pa

184

Actin - Myosin Structur s in Muscl Th motor prot ins that transport mat rials alon th actin microfilam nts ar similar in som ways, such as th lobular h a roup that bin s an hy rolyz s ATP, y t iff r nt in oth r ways, such as th motion catalyz by th ATP hy rol ysis. Much of th f-actin an myosin in striat an car iac muscl c lls is fou n in a p culiar arran m nt si n to provi a robust contractil r spons o v r th ntir l n th of th c ll. Th sarcom r is an arran m nt of alt rnatin fib rs of f-actin (also known as thin fib rs bas on th ir app aranc in l ctr on micro raphs) an myosin II (or thick fib rs). Althou h w o not normally think of th motor prot in as a fib r, in this cas th tails of th myosin II mol cu l s int rtwin to form a continuous fib r of myosin mol cul s. As th contractil cycl proc s, th myosin mol cul s rip th a jac nt actin fib rs, an mov th m. In fi . 11, you can s that a sarcom r is construct so that th statio nary myosin fib rs ar locat c ntrally, with two parall l s ts of actin fib rs int rsp rs b tw n th myosin fib rs, to th l ft an th ri ht of th c nt r . Not that th actin fib rs o not cross th c nt r lin , an that at th

Fi ur 11. Sarcom r . Myosin II is pict as in fi . 9, but h r ntwin with oth r myosins to form th thick filam nt. Th y ar support an anchor by ti tin (shown as lon tan l oran ribbons). Th myosin h a s act on th actin fi lam nts (blu ), pullin th m towar s ach oth r in a contractil mov m nt. Fi ur 12. Human sk l tal muscl is or aniz into sarcom r s. Th ark Z lin s ar a cl ar r f r nc point in comparin this to ia ram in fi .11. This l ctro n micro raph plac in th public omain by L. Howar . Chapt r 12, Cytosk l ton, v rsion 1.0

Pa

185

M lin Z lin H zon I ban A ban I ban Z lin

Ca2+ Ca2+ Ca2+ ATP Ca2+ Ca2+ Ca2+ Ca2+ ATP ADP Ca2+ Ca2+ ADP ADP Pi Ca2+ Ca2+ Pi Fi ur 12. Th myosin pow r strok . Myosin can only attach to f-actin if th r C a++ availabl to bin troponin ( r n) an mov tropomyosin (y llow) out of th bin in roov . Wh n ATP bin s to th myosin h a , it r l as s th f-actin. Hy r olysis of th ATP l a s to cockin of th myosin h a (movin it r lativ to th f-actin). As Pi l av s th myosin h a , it r attach s to th f-actin, but sli h tly isplac from its ori inal bin in sit . ADPis th n r l as an th myosin un r o s a pow r strok in which it sprin s back to its ori inal position, mov in th f-actin alon with it. Chapt r 12, Cytosk l ton, v rsion 1.0

Pa

186

OK, mayb youv watch CSI or Bon s, n at non th l ss, ri ht?

tc nou h to alr a y know this, but pr tty

c nt r, th myosin mol cul s switch ori ntation. Th physiolo ical ff ct of thi s is that th actin filam nts ar all pull inwar s towar th c nt r of th sa rcom r . Th sarcom r in turn, is m r ly on of many conn ct to th r to form a myofibril. Th myofibrils xt n th l n th of th muscl c ll. Wh n th myos in h a is in its r stin stat , it is ti htly attach to th actin filam nt. I n fact, ri or mortis occurs in a animals b caus th r is no mor ATP b in m a , an thus th sarcom r s ar lock into plac . Ri or b ins approximat ly 2 -3 hours aft r ath in humans, aft r r s rv s of ATP ar pl t . Wh n th bo y r lax s a ain in about 3 ays, it is u to th composition an br ak own of th actin an myosin

Low Ca++ in cytoplasm

Fi . 13. In low Ca++ con itions, tropomyosin (y llow lin ) is h l in th myosin -bin in roov of f-actin (blu ) by a tripartit troponin compl x (li ht r n) . Onc Ca++ l v ls incr as , it can bin to troponin-C, causin a conformational shift that mov s th tropomyosin out of th way so that myosin (oran ) can bin th actin microfilam nts. Chapt r 12, Cytosk l ton, v rsion 1.0

Pa

187

Ca++ r l as

from SR bin s to troponin-C

prot ins. How v r, whil th y ar still livin animals, ATP is n rally availab l , an it can bin to th myosin h a , causin it to los affinity for th f-ac tin, an l t o (fi . 12). At this point, no si nificant mov m nt has occurr . Onc th ATP is hy rolyz thou h, th myosin h a can r attach to th f-actin a littl furth r own th filam nt than it ha ori inally. Th n r y r l as is stor in th n ck r ion. Th ADP an Pi ar still attach to th myosin h a as w ll. Th n xt st p is for th Pi to rop off th myosin, l a in to th pow r strok . Th n ck of th myosin swiv ls aroun , l a in to a translocation of th h a by approximat ly 10 nm for myosin II. Th istanc of translocation var i s p n in on th typ of myosin, but it is not y t cl ar wh th r th l n th of th n ck is proportional to th isplac m nt of th h a . Finally, th ADP r ops off th myosin h a , incr asin th affinity of th h a for th f-actin. Th sarcom r structur scrib in th first para raph was incompl t in or r t o plac th major play rs cl arly in th ir rol s. Th r ar oth r prot ins in th sarcom r with important structural an r ulatory functions. On of th k y r ulatory compon nts is tropomyosin. This is a fibrous prot in that li s in th roov of an actin microfilam nt an blocks acc ss to th myosin bin in sit . T ropomyosin attach s to th microfilam nt in conjunction with a multi-subunit tro ponin compl x. Wh n Ca++ is availabl , it can bin to troponin-C, l a in to a c onformational chan that shifts th position of tropomyosin to r v al th myosi n bin in sit . This is th primary point of control for muscl contraction: r c all that intrac llular Ca++ l v ls ar k pt xtr m ly low b caus its primary fu nction is in intrac llular si nalin . On way that th Ca++ l v ls ar k pt that low is to pump it into a r s rvoir, such as th n oplasmic r ticulum.

Th SR is a sp cialization of part of th n oplasmic r ticulum, an contains a hi h conc ntration of Ca++ ions b caus th SR m mbran is mb with Ca++ pu mps (ATPas s) to k p th cytoplasmic conc ntration low an s qu st r th Ca++ i ons insi th SR. This is r ulat by phosphorylation an [Ca++] via a r ulat ory prot in such as phospholamban (in car iac muscl ). Phospholamban is an int ral m mbran prot in of th SR that normally associat s with an inhibits th Ca ++ pump. How v r wh n it is phosphorylat , or as cytoplasmic Ca++ l v ls ris , th phospholamban r l as s from th Ca++ pump an allows it to function. Disturbanc s to th prop r formation of th titin-bas support structur can b a caus of ilat car iomyopathy, an from that, con stiv h art failur . Som 20-30% of cas s of ilat car iomyopathy ar familial, an mutations hav b n mapp to th N-t rminal r ion of titin, wh r th prot in int racts with t l thonin. D f cts in titin ar also b in inv sti at with r sp ct to chronic ob structiv pulmonary is as , an som typ s of muscular ystrophy.

Chapt r 12, Cytosk l ton, v rsion 1.0

Pa

188

In muscl c lls, th r is a sp cialization of th ER call th sarcoplasmic r t iculum (SR) that is rich in Ca++ pumps an Ca++. Wh n a si nal is s nt from a co ntrollin n rv c ll to th muscl c ll, it caus s a polarization of th muscl c ll m mbran . This cons qu ntly polariz s a s t of m mbran s call th tra nsv rs tubul s (T-tubul s) that li ir ctly on parts of th sarcoplasmic r tic ulum. Th r ar prot ins on th t-tubul surfac that ir ctly int ract with a s t of Ca++ chann l prot ins, hol in th chann l clos normally. Wh n th t-tub ul is polariz , th prot ins chan shap , which chan s th int raction wit h th Ca++ chann ls on th SR, an allows th m to op n. Ca++ rush s out of th S R wh r it is availabl to troponin-c. Troponin-C boun to Ca++ shifts th tropo myosin away from th actin filam nt, an th myosin h a can bin to it. ATP can bin th myosin h a to start th pow r strok cycl , an voila, w hav contro ll muscl c ll contraction. In a ition to th movin parts, th r ar also mor static, structural, prot ins in th sarcom r (fi . 11). Titin is a i antic pr ot in (th lar st known, at n arly 3 MDa), an can b thou ht of as som thin o f a bun cor t th r to th myosin fib r. Its ss ntial purpos is to pr v nt th forc s n rat by th myosin from pullin th fib r apart. Titin wraps aro un th myosin fib r an attach s at multipl points, with th most m ial just n ar th of th H zon . At th Z-lin , titin attach s to a t l thonin compl x, which attach to th Z- isk prot ins (antiparall l a-actinin). Titin also int racts with obscurin in th I-ban r ion, wh r it may link myofibrils to th S R, an in th M-ban r ion it can int ract with th Ca++-bin in prot in calmo ulin-1 an TRIM63, thou ht to acts as a link b tw n titin an th microtubul c ytosk l ton. Th r ar multipl isoforms of titin from alt rnativ splicin , wit h most of th variation comin in th I-ban r ion. Of cours in an actual musc l (fi . 14), what happ ns is that n rv s row into th muscl an mak synaptic conn ctions with th m. At th s synaptic conn ctions, th n rv c ll r l as s n urotransmitt rs such as ac tylcholin (ACh), which bin to r c ptors (AChR) on th muscl c ll. This th n op ns ion chann ls in th muscl c ll m mbran , tri rin a volta chan across that m mbran , which also happ ns to aff ct th n arby m mbran of th transv rs tubul s subs qu ntly op nin Ca++ chann ls in th SR. Th contraction of sarcom r s can th n proc as alr a y scrib abov .

Muscl N uron Muscl Fib r

Sarcoplasmic r ticulum Myo bril

Cytosk l tal Dynamics In th arly v lopm nt of animals, th r is a hu amount of c llular r arran m nt an mi ration as th rou hly sph rical blob of c lls call th blastula s tarts to iff r ntiat an form c lls an tissu s with sp cializ functions. Th s c lls n to mov from th ir point of birth to th ir v ntual positions in th fully v lop animal. Som c lls, lik n urons, hav an a itional typ of c ll motility - th y xt n lon proc ss s (axons) out from th c ll bo y to th ir tar t of inn rvation. In both n urit xt nsion an whol c ll motility, th c ll n s to mov first its attachm nt points an th n th bulk of th c ll f rom on point to anoth r. This is on ra ually, an us s th cytosk l ton to m ak th proc ss mor ffici nt. Th major l m nts in c ll motility ar chan in th point of forwar a h sion, cl arin of int rnal spac by Chapt r 12, Cytosk l ton, v rsion 1.0

Pa

189

Fi ur 14. Th sarcom r in iny contractil unit within of many within a muscl c ializ xt nsion of th ER s its r l as .

Sarcom r

T-tubul

cont xt. Th sarcom r of fi ur s 11 an array that forms a myofibril. Th ll, surroun by th sarcoplasmic r that s qu st rs Ca++ until T-tubul

an 12 is on t myofibril is on ticulum, a sp c xcitation caus

myosin-pow r r arran m nt of actin microfilam nts an th subs qu nt fillin of that spac with microtubul s. For forc to b transmitt , th m mbran Ankyr in must b attach to th cytosk l ton. In Ban 3 fact, si nalin (chap. 14) fr om r c ptors in Sp ctrin th m mbran can som tim s ir ctly in- Actin uc r ar ran m nts or mov m nts of th cytosk l ton via a apt r prot ins that con- Filam in n ct actin (or oth r cytosk l tal l m nts) Glycophorin to transm mbran prot ins such as int - Ban 3 rin r c ptors. On of th arli st xp rim ntal syst ms for stu i s of cytosk l ton- Ban 4.1 A ucin m mbran int raction was th r ythrocyt Sp ctrin (r bloo c ll). Th illustrations at ri ht Actin (fi . 15) show som of th int ractions of Fi ur 15. M mbran to microfilam nt -integrin l ink ge -integrin n exten ive ctin microfil ment net ork complexe in erythrocyt e involve pectrin. T lin ith tr n mem r ne protein . Ankyrin nd Vinculin pe ctrin re import nt link ge protein et een the tr n mem r ne protein nd the Actin microfil ment . Thi ide of uilding protein complex round the cytopl mic ide of tr n mem r ne protein i u iquitou , nd c ffolding (linking) pr otein re u ed - ctinin not only in connecting the extr cellul r u tr te (vi tr n mem r ne protein) to the cyto keleton, ut l o to phy ic lly connect ign ling molecule nd thu incre e the peed nd efficiency of ign l tr n duction . Acce ory protein to ctin fil ment nd microtu ule ere riefly mentioned e rlier. Among other function , they c n control polymeriz tion nd depolymeriz tion, form undle , rr nge net ork , nd ridge et een the different cyto kele t l net ork . For ctin, the prim ry polymeriz tion control protein re profili n, hich promote polymeriz tion nd thymo in 4, hich eque ter g- ctin. The minu end c pping protein Arp 2/3 complex nd tropomodulin, nd the plu end c pping protein C pZ, everin, nd gel olin c n t ilize the end of f- ctin. Fi n lly, cofilin c n incre e depolymeriz tion from the (-) end. Profilin h t o ctivitie th t promote polymeriz tion. Fir t, it i nucleotide exch nge f cto r th t remove ATP ound to g- ctin, nd repl ce it ith ADP. Thi ound count erintuitive, ut keep re ding through to the next p r gr ph. Second, hen ound to g- ctin, it incre e the r te of ddition to ctin microfil ment . It doe o y inding to the end oppo ite the ATP- inding ite, le ving th t ite nd t h t ide open to inding oth ATP nd the (+) end of microfil ment. Profilin c n e found Ch pter 12, Cyto keleton, ver ion 1.0 P ge 190

           

Gel olin i inhi ited y the pho pholipid PIP2. Pho pholip e C, hich re k do n PIP2 c n l o incre e cyto olic C ++, hich i n ctiv tor of gel olin. Thu it i po i le to r pidly upregul te gel olin ctivity y PLC ign ling. Mut tion in p tin re linked to 40% of tho e p tic p r plegi di tingui he d y degener tion of very long xon . The evering ility of p tin ppe r to e required for remodeling of the cyto keleton in re pon e to neuron l d m ge.

T u h complic ted iomedic l hi tory. It norm l ing, t ilizing, nd linking microtu ule . Ho ever, o phoryl ted neurofi rill ry t ngle th t re oci A c u e for Alzheimer i not yet kno n, o it i protein t ngle re pl y m jor role in ny of the

function i cle r em l it i l o found in hyperph ted ith Alzheimer di e e. till uncle r hether the t u ymptom .

oth in the cytopl m t l rge, nd oci ted ith pho pholipid (PIP2) nd mem r ne protein , to control uch proce e le ding edge remodeling of f- ctin cyto kelet l tructure . Thymo in 4 regul te microfil ment em ly y control ling the v il le pool of g ctin. We lre dy t ted th t gre ter concentr tion of g- ctin c n incre e polymeriz tion r te . Ho ever, ec u e of the highly dy n mic n ture of the ctin cyto keleton, the time con tr int of degr ding nd pr oducing ne ctin ould prevent the f tre pon e control nece ry. Therefore, t he optim l mech ni m i to m int in l rge pool of g- ctin monomer , ut regul te it v il ility y tying it up ith eque tering protein - thymo in 4. Th ymo in 4 h 50x higher ffinity for g- ctin-ATP th n for g- ctin-ADP, o her e i here profilin come ck into the picture. Profilin exch nge the ATP of T 4-g- ctin-ATP complex for n ADP. The re ult i th t the T 4 rele e the gctin-ADP, llo ing it to enter the gener l pool for uilding up fil ment . Incre ed depolymeriz tion nd lo ing or ce tion of polymeriz tion c n gr du lly re k do n f- ctin tructure , ut h t if there i need for r pid re kdo n? T o of the c pping protein previou ly mentioned, gel olin nd everin, h ve n ltern te mode of ction th t c n ever ctin microfil ment t ny point y ind ing long ide n ctin fil ment nd ltering the conform tion of the u unit to hich it i ound. The conform tion l ch nge force the ctin- ctin inter ction to re k, nd the gel olin or everin then rem in in pl ce (+) end c pping protein. On the microtu ule ide of thing , due to dyn mic in t ility, one mig ht think th t evering enzyme i not needed, ut in f ct, p tin nd k t nin re microtu ule evering protein found in v riety of cell type , p rticul rly neuron . There i l o T 4-like protein for tu ulin: Op18, or t thmin, hich ind to tu ulin dimer (not monomer ), cting to eque ter them nd lo er the orking concentr tion. It i regul ted y pho phoryl tion ( hich turn off it tu ulin inding). Microtu ule- oci ted protein MAP1, MAP2, nd t u (t) e ch or k to promote em ly of microtu ule , ell other function . MAP1 i the m o t gener lly di tri uted of the three, ith t u eing found mo tly in neuron , nd MAP2 even more re tricted to neuron l dendrite . The e nd ome other MAP l o ct to t ilize microtu ule g in t c t trophe y inding long ide the m icrotu ule nd reinforcing the tu ulin-tu ulin inter ction . Fin lly, ith re pe ct to microfil ment nd microtu ule cce ory protein , there re the linker . S ome of the forementioned MAP c n cro link microtu ule either into p r llel o r me h rr y , c n ome kine in nd dynein , lthough they re convention ll y con idered to e motor protein . On the microfil ment ide, there re m ny kno n protein th t cro link f- ctin, m ny of hich re in the c lponin homology Ch pter 12, Cyto keleton, ver ion 1.0 P ge 191

                          

dom in uperf mily, including fim rin, - ctinin, - pectrin, dy trophin, nd fi l min. Although they ll c n ind to ctin, the h pe of the protein dict te di fferent type of inter ction: for ex mple, fim rin prim rily undle f- ctin in p r llel to form undle , hile fil min ring ctin fil ment together perpendi cul rly to form me h net ork . FG Syndrome i genetic lly linked di e e ch r cterized y ment l ret rd tion, enl rged he d, congenit l hypotoni , imperfor te nu , nd p rti l gene i of the corpu c llo um. It h een linked to mut tion in ever l X chromo ome gen e , including fil min A (FLNA, FLN1, loc ted Xq28). Mut tion in dy trophin, hi ch i m jor mu cle protein of the CD-dom in uperf mily, c n re ult in Duchenn e Mu cul r Dy trophy or the rel ted ut le evere Becker Mu cul r Dy trophy. T he mo t di tinctive fe ture i progre ive proxim l mu cul r degener tion nd p eudohypertrophy of the c lf mu cle . On et of DMD i u u lly recognized efore ge 3 nd i leth l y ge 20. Ho ever, ymptom of BMD m y not pre ent until t he 20 , ith good pro ility of long-term urviv l. Although it i prim rily mu cle- ting di e e, dy trophin i pre ent in other cell type , including neu ron , hich m y expl in link to mild ment l ret rd tion in ome DMD p tient . Like FLNA, the dy trophin gene i l o loc ted on the X chromo ome (Xp21.2). Cell Motility There re num er of y in hich cell c n move from one point in p ce to nother. In liquid medium, th t method m y e ome ort of imming, utilizing cili ry or fl gell r movement to propel the cell. On olid urf ce , tho e mech ni m cle rly ill not ork efficiently, nd the cell undergoe cr ling proce . In thi ection, e egin ith di cu ion of cili ry/fl gell r movement, nd then con ider the more complic ted requirement of cellul r cr ling. Cili nd fl gell , hich differ prim rily in length r ther th n con truction, re micr otu ule- ed org nelle th t move ith ck- nd-forth motion. Thi tr n l te to ro ing y the rel tively hort cili , ut in the longer fl gell , the flexi il ity of the tructure c u e the ck- nd-forth motion to e prop g ted ve , o the fl gell r movement i more undul ting or hiplike (con ider h t h ppen you ggle g rden ho e quickly from ide to ide comp red to hort piec e of the me ho e). The core of either tructure i c lled the xoneme, hich i compo ed of 9 microtu ule dou let connected to e ch other y cili ry dynein m otor protein , nd urrounding centr l core of t o ep r te microtu ule . Cent r l Microtu ule Nexin Bridge (13 proto l ment ) Thi i kno n the 9+2 form tion , lthough the nine dou let re not the Microtu ule Dou let me the t o cen tr l microtu ule . (13 + 10 proto l ment ) The A tu ule i full 13-protofil me nt , ut the B tu ule fu ed to it cont in only 10 protofil ment . E ch of the D ynein Arm centr l microtu ule i full 13 protofil ment . The 9+2 xoneme exte nd the length of the cilium or fl gellum from the tip until it re che the e , nd connect to the cell ody through l ody, hich i compo ed of 9 mic rotu ule triplet rr nge in hort rrel, much like the centriole from Centr l She th R di l Spoke Figure 16. P rti l (cut y) di gr m of n xoneme, the hich they re derived. PDG PDG PDG PDG GDP GDP PDG PDG GDP GDP PDG PDG GDP GDP GDP GDP GDP GDP GDP GDP PDG PDG GDP GDP PDG PDG GDP GDP GDP GDP GDP GDP GDP GDP PDG PDG GDP GDP PDG GDP GDP PDG GDP GDP GDP GDP GDP GDP PDG PDG GDP GDP GDP GDP PDG GDP GDP GDP GDP PDG GDP GDP PDG PDG GDP GDP PDG PDG GDP GDP GDP GDP GDP GDP GDP GDP PDG PDG GDP GDP PDG GDP GDP PDG GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP GDP

Ch pter 12, Cyto keleton, ver ion 1.0 P ge 192

centr l undle of cili

nd fl gell .

               

 

  

  

The cili ry dynein provide the motor c p ility, ut there re t o other link g e protein in the xoneme ell. There re nexin th t join the A-tu ule of on e dou let to the B-tu ule of it dj cent dou let, thu connecting the outer rin g. And, there re r di l poke th t extend from the A tu ule of e ch dou let to the centr l p ir of microtu ule t the core of the xoneme. Neither of the e h ny motor ctivity. Ho ever, they re cruci l to the movement of cili nd fl gell ec u e they help to tr n form liding motion into ending motion. Wh en cili ry dynein (very imil r to cytopl mic dynein ut h three he d in te d of t o) i eng ged, it ind n A microtu ule on one ide, B microtu ule fr om the dj cent dou let, nd move one rel tive to the other. A line of the e dy nein moving in concert ould thu lide one dou let rel tive to the other, if ( nd it ig if) the t o dou let h d complete freedom of movement. Ho ever, ince the dou let re interconnected y the nexin protein , h t h ppen one dou let ttempt to lide i th t it end the connected tructure in te d (fig. 17) . Thi end ccount for the ro ing motion of the cili , hich re rel tively h ort, ell the hipping motion of the long fl gell , hich prop g te the e nding motion do n the xoneme. PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG Thi ection refer only to euk ryote . Some prok ryote l o h ve motile ppend ge c lled fl gell , ut they re completely different in oth tructure nd me ch ni m. The fl gell them elve re long helic l polymer of the protein fl gel lin, nd the e of the fl gellin fi er i connected to rot tion l motor pro tein, not tr n l tion l motor. Thi motor (fig. 18) utilize ion (H+ or N + de pending on pecie ) do n n electrochemic l gr dient to provide the energy to ro t te m ny 100000 revolution per minute. It i thought th t the rot tion i driven y conform tion l ch nge in the t tor ring, ne tled in the cell mem r ne. PDG PDG PDG PDG PDG PDG Un tt ched PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG Force Gener tion PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG PDG

  

       

PDG PDG PDG PDG PDG PDG PDG PDG Att ched vi nexin Force Gener tion Figure 18. The cteri fl gellum i completely different from euk ryotic fl gel l . It i moved y rot ry motor driven y proton or N + ion flo do n the elec trochemic l gr dient. Illu tr tion rele ed to pu lic dom in y M.R. Vill re l. Figure 17. The nexin ridge connecting dj cent microtu ule dou let tr n form the liding motion gener ted y the cili ry dynein into ending motion.

Although e think of cili ry nd fl gell r movement method for the propul io n of cell, uch the fl gell r imming of perm to rd n egg, there re l o num er of import nt pl ce in hich the cell i t tion ry, nd the cili re u ed to move fluid p t the cell. In f ct, there re cell ith cili in mo t m jor org n of the ody. Sever l cili ry dy kine i h ve een reported, of hich the mo t prominent, prim ry cili ry dy kine i (PCD), hich include K rt g ener yndrome (KS), i due to mut tion Ch pter 12, Cyto keleton, ver ion 1.0 P ge 193

     

Ch pter 12, Cyto keleton, ver ion 1.0 P ge 194

of the DNAI1 gene, hich encode u unit (intermedi te ch in 1) of xonem l (c ili ry) dynein. PCD i ch r cterized y re pir tory di tre due to recurrent in fection, nd the di gno i of KS i m de if there i l o itu inver u , cond ition in hich the norm l left-right ymmetry of the ody (e.g. tom ch on left , liver on right) i rever ed. The fir t ymptom i due to in ctivity of the num erou cili of epitheli l cell in the lung . Their norm l function i to keep m ucu in the re pir tory tr ck con t ntly in motion. Norm lly the mucu help to keep the lung moi t to f cilit te function, ut if the mucu ecome t tion ry , it ecome reeding ground for cteri , ell ecoming n irrit nt nd o t cle to proper g exch nge. Situ inver u i n intere ting m lform tion ec u e it ri e in em ryonic development, nd ffect only 50% of PCD p tient ec u e the imp ired cili ry function c u e r ndomiz tion of left-right ymme try, not rever l. In very imple term , during e rly em ryonic development, lef t-right ymmetry i due in p rt to the movement of molecul r ign l in left rd flo through the em ryonic node. Thi flo i c u ed y the coordin ted e t ing of cili , o hen they do not ork, the flo i di rupted nd r ndomiz tion occur . Other ymptom of PCD p tient l o point out the ork of cili nd fl g ell in the ody. M le infertility i common due to immotile perm. Fem le infer tility, though le common, c n l o occur, due to dy function of the cili of t he oviduct nd f llopi n tu e th t norm lly move the egg long from ov ry to ute ru . Intere tingly there i l o lo oci tion of hydroceph lu internu (ov erfilling of the ventricle of the r in ith cere ro pin l fluid, c u ing their enl rgement hich compre e the r in ti ue round them) ith PCD. Thi i li kely due to dy function of cili in the ependym l cell lining the ventricle , nd hich help circul te the CSF, ut re pp rently not completely nece ry. Si nce CSF ulk flo i thought to e driven prim rily y the y tole/ di tole ch nge in lood pre ure in the r in, ome hypothe ize th t the cili m y e invol ved prim rily in flo through ome of the tighter ch nnel in the r in.

       

Cell cr ling (fig. 19) require A Le ding edge dv ncing the coordin ted re rr ngement of the le ding edge microfil Actin polymeriz tion ment net ork, extendin g ( y oth polymeriz tion nd lidColl gen u tr te Integrin ing fil ment ) n d then forming B dhe ion t the ne for rdAdhe ion of Rele e of mo t point. Thi c n t ke the le ding edge tr iling edge form of filopodi or l mellipodi , nd often oth imult neou ly. Filopodi re long nd very thin C Cell ody moti on projection ith core undle of p r llel microfil ment nd high Intern liz tion of receptor concentr tion of cell urf ce receptor . Their purpo e i prim rily to en e the environment. L mellipodi often extend e- Figure 19. Cell c r l y ( ) extending the le ding edge prim rily through remodeling of the ctin cyto keleton, ( ) forming ne t een t o filopodi nd i more dhe ive cont ct t th t le ding edge hile rele ing dhe ion of ro d ruffle th n finger. to the re r, nd (c) ulk intern l movement for rd to c tch up ith the le ding edge. Intern lly the ctin form more into me he th n undle , nd the ro der edge llo for more dhe ion to e m de to the u tr te. The microfil ment ne t ork then re rr nge g in, thi time opening p ce in the cytopl m th t ct ch nnel for the movement of the microtu ule to rd the front of the cel l. Thi put the tr n port net ork in pl ce to help move intr cellul r ulk m te ri l for rd. A thi occur , the old dhe ion on the t il end of the cell re rele ed. Thi rele e c n h ppen through t o prim ry mech ni m : endocyto i of the receptor or de ctiv tion of the receptor y ign ling/conform tion l ch nge . Of cour e, thi over implific tion elie the complexitie in coordin ting nd controlling ll of the e ction to ccompli h directed movement of cell. Onc e cell receive ign l to move, the initi l cyto kelet l re pon e i to poly merize ctin, uilding more microfil ment to incorpor te into the le ding edge. Depending on the ign l ( ttr ctive or repul ive), the polymeriz tion m y occur on the me or oppo ite ide of the cell from the point of ign l-receptor cti v tion. Signific ntly, the polymeriz tion of ne f- ctin lone c n gener te uff icient force to move the mem r ne for rd, even ithout involvement of myo in mo tor ! Model of force gener tion re eing de ted, ut gener lly t rt ith the incorpor tion of ne g- ctin into fil ment t it tip; th t i , t the fil me nt-mem r ne interf ce. Even if th t might technic lly e enough, in live cell, myo in re involved, nd help to pu h nd rr nge fil ment direction lly in o rder to et up the ne le ding edge. In ddition, ome Ch pter 12, Cyto keleton, ver ion 1.0 One model of microfil ment force gener tion, the El tic Bro ni n R tchet Model (Mogilner nd O ter, 1996), propo e th t due to Bro ni n motion of the cell mem r ne re ulting from continuou minute therm l fluctu tion, the ctin fil ment th t pu h out to rd the edge of the mem r ne re flexed to v rying degree . I f the flex i l rge enough, ne ctin monomer c n fit in et een the mem r ne nd the tip of the fil ment, nd hen the no longer fil ment flexe ck, it c n exert gre ter pu h on the mem r ne. O viou ly ingle fil ment doe not gen e te much force, ut the coordin ted exten ion of m ny fil ment c n pu h the me m r ne for rd. P ge 195

   

     

  

 

  

 

- ctinin

The third tep to cell locomotion i the ulk movement of the cellul r content for rd. The mech ni m for thi ph e re uncle r, ut there i ome evidence t h t u ing link ge et een the ctin cyto keleton t the le ding edge nd for r d p rt of the microtu ule cyto keleton, the microtu ule re re rr nged to form n efficient Ch pter 12, Cyto keleton, ver ion 1.0 P ge 196

Figure 20. Foc l dhe ion form in cell culture di he .

hen integrin

ind to

n rtifici l ECM urf ce

  

fil ment nd net ork mu t e quickly evered, nd ne connection m de, oth et een fil ment nd et een fil ment nd other protein uch dhe ion molec ule or microtu ule . Ho i the polymeriz tion nd ctin re rr ngement controll ed? The receptor th t ign l cell locomotion m y initi te ome h t different p th y , ut m ny h re ome common litie in ctiv ting one or more mem er of t he R -f mily of m ll GTP e . The e ign ling molecule , uch R c, Rho, nd cdc42 c n e ctiv ted y receptor tyro ine kin e ( ee RTK-R ctiv tion p t h y , Ch p. 14). E ch of the e h lightly different role in cell motility: cdc42 ctiv tion le d to filopodi form tion, R c ctiv te p th y th t incl ude Arp2/3 nd cofilin to l mellipodi form tion, nd Rho ctiv te myo in II t o control foc l dhe ion nd tre fi er form tion. A different type of recepto r c c de, the G-protein ign ling c c de ( l o Ch pter 14), c n le d to ctiv tion of PLC nd u equent cle v ge of PIP2 nd incre e in cyto olic C ++. The e ch nge , noted e rlier, c n l o ctiv te myo in II, ell the remodel ing enzyme gel olin, cofilin, nd profilin. Thi re k do n exi ting ctin tr ucture to m ke the cell more fluid, hile l o contri uting more g- ctin to for m the ne le ding edge cyto keleton. In vitro experiment ho th t the mem r ne pu he for rd, ne dhe ive cont ct re m de through dhe ion molecule or receptor th t ind the u tr te (often cell culture lide or di he re co t ed ith coll gen, l minin, or other extr cellul r m trix protein ). The cont ct then recruit cyto kelet l element for gre ter t ility to form foc l dhe i on (fig. 20). Ho ever, the form tion of foc l dhe ion ppe r to e n rtif c t of cell culture, nd it i uncle r if the type of dhe ion th t form in vivo recruit the me type of cyto kelet l component . -integrin -integrin T lin Actin Vinculin

  

        

tr n port p th for ulk movement. Another pect to thi m y e corr lling effec t y the ctin net ork , hich direction lly open up p ce to rd the le ding e dge. The microtu ule then enter th t p ce more e ily th n orking through t ight ctin me h, forcing flo in the proper direction. Fin lly, the cell mu t un do it old dhe ion on the tr iling edge. Thi c n h ppen in num er of differ ent y . In vitro, cr ling cell h ve een o erved to rip them elve off of t he u tr te, le ving ehind tiny it of mem r ne nd oci ted dhe ion prote in in the proce . The force gener ted i pre umed to come from ctin-myo in t re fi er le ding from the more for rd foc l dhe ion . Ho ever, there re le de tructive mech ni m v il le to the cell . In ome c e , the dhe ivity of the cellul r receptor for the extr cellul r u tr te c n e regul ted intern lly, perh p y pho phoryl tion or depho phoryl tion of receptor. Another po i ility i endocyto i of the receptor, t king it off the cell urf ce. It coul d imply recycle up to the le ding edge here it i needed (i.e. tr n cyto i ), or if it i no longer needed or d m ged, it m y e roken do n in ly o ome.

Ch pter 12, Cyto keleton, ver ion 1.0 P ge 197

 

Much of the ork on microtu ulee through re e rch on the neuron cell on le h, ec u e it e rching for the proper p th y er yn ptic connection (A.W. Sch

ctin inter ction in cell motility h een don l gro th cone, hich i ometime referred to ct lmo t independently like cr ling cell, to le d it xon from the cell ody to it prop efer et l, Dev. Cell 15: 146-62, 2008).

   

  

Coll gen L minin Fi ronectin Integrin Extr cellul r Intr cellul r Figure 1. Extr cellul r m trix (ECM). Typic l component include coll gen, prote oglyc n ( ith hydr tion hell depicted round ug r ), fi ronectin, nd l minin . The cellul r receptor for num er of the e ECM component re integrin , lt hough the ex ct integrin p ir m y differ. Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 198

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

dv n the dv Fin on e

ECM nd Adhe ion : Cell-M trix nd Cell-Cell Adhe ion Inter ction et een cell nd it environment or ith other cell re governed y cell- urf ce protein . Thi ch pter ex mine u et of tho e inter ction : direct cell cont ct ith either other cell or extr cellul r m trix (ECM). Extr cellul r m trix i gener l term for the extremely l rge protein nd poly cc h ride th t re ecreted y ome cell in multicellul r org ni m, nd hich ct connective m teri l to hold cell in defined p ce. Cell den ity c n v ry gre tly et een different ti ue of n nim l, from tightly-p cked mu cle ce ll ith m ny direct cell-to-cell cont ct to liver ti ue, in hich ome of the cell re only loo ely org nized, u pended in e of extr cellul r m trix. Proteoglyc n

 

 

 

The l l min nd ement mem r ne re frequently confu ed y tudent nd profe ion l like. The ement mem r ne di covered fir t very thin l yer of connective protein ju t ene th n epitheli l cell l yer. The l l min not di covered until l ter ec u e it i not vi i le y light micro copy (nor m lly only ~50 nm thick). Technic lly, the l l min , hich con i t of multi ple l yer it elf, i l yer of ECM protein ecreted y the epitheli l l yer. The l l min nd thick reticul r l min (ECM ecreted y other cell type ) together form h t i con idered the ement mem r ne. The l l min round glomerul r lood ve el in the kidney i t ice thick (up to 100 nm) u u l, ccompli hing p rt of the kidney phy iologic l role in lood filtr tion. Coll gen The l rge t nd mo t prominent of the extr cellul r m trix protein , con titutin g qu rter of the dry m of the hum n ody, re the mem er of the coll gen f mily. Coll gen re polymer th t c n e c tegorized into fi rill r (e.g. coll gen I, II, III) nd nonfi rill r (e.g. coll gen IV) type . The fi rill r coll g en re m de up of triple helic l monomer of either identic l (homotrimer) or d ifferent (heterotrimer) u unit . The e monomer re then oci ted in n off e t p r llel inter ction ith other coll gen monomer , le ding to the form tion of long fi er . Electron micro copic ex min tion of the e long fi er ho nd ing p ttern, hich i indic tive of the light g p et een monomer long the me p r llel. OH Procoll gen H2N OH COOH OH Propeptide Propeptide Triple helix form tion

H2 N H2N OH OH OH OH H2N

Figure 2. Coll gen i triple-helic l protein con i ting of three fi rill r u unit . Some of the mino cid re hydroxyl ted ( ee fig. 3), nd the protein i l o glyco yl ted (repre ented y purple hex gon ).

ECM i generic term encomp ing mixture of poly cch ride nd protein , inc luding coll gen , fi ronectin , l minin , nd proteoglyc n , ll ecreted y the cell. The proportion of the e component c n v ry gre tly depending on ti ue type. T o, quite different, ex mple of ECM re the ement mem r ne underlying the epidermi of the kin, thin, lmo t t o-dimen ion l l yer th t help to o rg nize the kin cell into ne rly-impenetr le rrier to mo t imple iologi c l in ult , nd the m ive threedimen ion l m trix urrounding e ch chondrocyt e in c rtil ginou ti ue. The ility of the c rtil ge in your knee to ith t n d the repe ted hock of your foot tep i due to the ECM protein in hich the c ell re em edded, not to the cell th t re ctu lly r ther fe in num er nd p r ely di tri uted. Although oth type of ECM h re ome component in common, they re cle rly di tingui h le not ju t in function or ppe r nce, ut in the proportion nd identitiy of the con tituent molecule .

  

       

COOH COOH COOH Secretion from cell Propeptide clipped OH OH OH Completed coll gen molecule OH OH Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 199

NH3+ CH2 OH H C H2C CH2 H2C H2C C C ON HO + H H OH C H O+H N 3 CH CH2 CH2 C H OH C C N HO + H H C O O4-Hydroxyproline 3-Hydroxyproline 5-Hydroxyly ine

Figure 3. Coll gen

h ve

high proportion of hydroxyl ted proline

nd ly ine .

             

Like ll ecreted protein , coll gen I i proce ed in the ER (fig. 2), ut not completely em led there: the three pro- -ch in re em led into procoll gen triple helix, hich i ecreted. Extr cellul rly, they mu t then e cle ved t oth termini to form the ctive coll gen protein, hich i completely fi rill r. Other coll gen type do not h ve the me cle v ge, nd m y h ve glo ul r do m in t the end of the fi ril . Coll gen re l o intere ting for their unu u l mino cid m keup. They cont in high proportion of hydroxyl ted mino cid , mo tly proline nd ly ine (fig. 3). Thi hydroxyl tion i nece ry for the exten ive hydrogen onding th t occur et een u unit nd et een monomer . Th e fi ril re oci ted ith high ten ile trength. An ex mple of thi ould e the long coll gen fi er th t run p r llel to the long xi of tendon nd lig ment . The e high- tre - e ring tructure (connecting one to mu cle, nd one to one, re pectively) require the re ilience th t coll gen fi er c n provide. Conver ely, condition th t dver ely ffect coll gen form tion c n le d to er iou di e e condition . In f ct, form of epidermoly i ullo (the herit le kin li tering di e e introduced in the previou ch pter) i c u ed y mut ti on in coll gen VII hich i prim rily produced y epiderm l ker tinocyte nd e creted into the derm lepiderm l ement mem r ne l yer. A v riety of chondrody pl i ell one m lform tion uch o teogene i imperfect ( hich c n e perin t lly leth l) h ve een linked to mut tion in v riou coll gen gene . Fin lly, ever l ymptom of curvy re due to m lform tion of coll gen in the ECM: e k lood ve el ll , leeding gum nd loo e teeth, nd fr gile one . Scurvy i di e e of cor ic cid (vit min C) deficiency, nd the effect on E CM i due to the need for cor ic cid cof ctor for enzyme th t hydroxyl te the proline nd ly ine of coll gen. Coll gen i m jor component of the ement mem r ne nd l l min . The l l min i trong nd flexi le, le to erve tructur l upport for the epitheli l heet tt ched to it, ell providing emi-perme le m trix/filter th t llo the p ge of ter n d m ller molecule , ut exclude l rger m cromolecule . The t o m jor protein c omponent to the l l min re coll gen IV nd l minin. Coll gen IV h oth long fi rill r, lph -helic l dom in ell glo ul r dom in th t c n inter ct in different orient tion to form the me h ork th t et up the ement mem r ne. The l minin net ork i connected to the coll gen net ork through ent ctin (nidogen) linker protein . An intere ting pplic tion of coll gen fi ril i in the corne , the protective cle r covering of the eye. The corne i the prim ry protection g in t eye injury, nd mu t e tough. The centr l l yer ( trom , or u t nti propri ) i compo ed of pproxim tely 200 l yer of tightly p cked, regul rly p ced p r llel coll gen fi ril , ith dj cent l yCh pter 13, ECM & A dhe ion, ver ion 1.0

 

P ge 200

er rr nged o th t the coll gen fi ril lie perpendicul rly from one l yer to the next. Thi kind of l min r tructure i u ed in v riety of m n-m de con tr uction m teri l (including the u iquitou uilding m teri l, ply ood) nd provi de gre t trength in rel tively m ll m . Some h t m zingly, nd quite unl ike ply ood, the corne i tr n p rent. Th t property i thought to come from th e regul rity of the coll gen l ttice, hich llo for c ncell tion of c ttered light from one fi ril y de tructive interference from the c ttered light of nother fi ril. Some h t counterintuitively, it ctu lly get cloudy (due to refr ction) hen it or fluid from the queou humor, nd h ctive mech ni m to pump ny uch fluid ck out of the corne . Thi i hy the corne thicken nd ecome tr n lucent fter de th the pump mech ni m no longer h energy to ru n, nd the queou humor diffu e into the corne . Proteoglyc n The protein component of proteoglyc n re not l rge fi rill r coll gen i n gener l, ut they often fill m ive volume ec u e of he vy glyco yl tion. The ug r , m ny of hich re ulf ted or c r oxyl ted, re hygro copic to egin ith, ut eing neg tively ch rged, ttr ct po itive ion , hich in turn ring in more ter. Sug r tt ched to the core protein re u u lly repe ting di c ch ride unit uch chondroitin (d-Glucuronic cid nd G lNAc), chondroitin u lf te, hep rin (d-Glucuronic cid nd GlcNAc y / 1-4 ond), hep r n ulf te, k er t n ulf te (G l cto e nd GlcNAc), or hy luron n ( l o c lled hy luronic ci d, compo ed of d-Glucuronic cid linked y 1-3 ond to GlcNAc). A ith ll gly coprotein , em ly of the GAG occur in the Golgi, Figure 4. Proteoglyc n re compo ed of multiple glyco minoglyc n tt ched to core protein. The e core protein re ometime tt ched to hy luronic cid molecule. Neg tively ch rged ug r , like chondroitin ulf te or hep r n ulf te , re depicted in yello . They ttr ct po itive ion nd ter, forming hydr t ion hell round the proteoglyc n. Thi figure depict ggrec n, c rtil ginou ggreg te of proteoglyc n em led on hy luronic cid core. Hydr tion hell Core protein Glyco minoglyc n The re oning ehind the u e of gluco mine nd chondroitin ulf te upplement y people ith joint pro lem i th t they re t o of the ug r found in proteo glyc n of c rtil ginou ti ue uch the meni cu of the knee, nd in other j oint . Chondroitin ulf te in p rticul r i the m jor ug r in rticul r c rtil ge proteoglyc n . Both re thought to timul te GAG ynthe i , nd limite docume nt tion of prote e inhi itory nd coll gen ynthe i effect h ve een noted. D t from r it model ( ut potenti l conflict of intere t, Lippiello et l, 200 0) ugge t ther peutic enefit from uch upplement . Ho ever, hum n tudie h ve o f r ho n no ignific nt improvement in p tient lre dy uffering from moder te to evere rthriti nd other joint-rel ted ilment (Clegg et l, 2006 ). A econd ry urvey n ly i ugge ted th t there ome promi e ith reg rd to effect on mild to moder te c e , ut the d t not ignific nt.

Hy luronic cid

Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 201

ut eyond th t, mech ni m for control of the extent nd length of the di cch ride polymer ddition i unkno n. Unlike coll gen nd mo t other ECM component , proteoglyc n c n either e ecreted or mem r ne ound. In f ct, of the mem r ne

Hep rin, hyper ulf ted form of hep r n ulf te, i l o u ed medic lly n nticlotting drug. It doe o not y preventing clot directly, ut y ctiv ting ntithrom in III, hich inhi it clotting.

    

 

  

 

    

 

On the other h nd, there i l o evidence (Roll et l, PLoS Med. 5: e171, 2008) th t the CSPG m y e needed to ctiv te microgli nd m croph ge to promote he ling.

RGD Sequence S-S S-S Figure 5. Fi ronectin. The C-terminu of e ch u unit i t the ottom of the fi gure. The RGD equence i inding ite for integrin receptor . Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 202

Fi ronectin Fi ronectin nd l minin re ignific ntly m ller th n either coll gen or prote oglyc n , nd pl y different role in the extr cellul r m trix. Fi ronectin i f ormed y the joining of t o imil r polypeptide u unit vi p ir of di ulfide ond ne r the C-termin l of e ch (fig. 5). E ch u unit i rr nged line r equence of 30 function l dom in (v rie lightly y pecie ). Within e ch u unit, e ch dom in ct emi-independent unit ith re pect to econd ry nd even terti ry tructure. Structur lly, there re three m jor type of dom in ( Fig. 6) th t c n e di tingui hed not only y equence, ut y the inding ite they form. The figure ove ho inding ite for other fi ronectin , fi rin, coll gen, hep rin, nd yndec n. Fi ronectin i therefore n excellent link ge protein et een the e different molecule to t ilize nd trengthen the ECM.

ound proteoglyc n , ome re ctu lly tr n mem r ne protein (the e re de ign ted yndec n ), hile other re ound to the cell urf ce vi glyco ylpho ph tid ylino itol (GPI) nchor (glypic n ). In ddition to the e three ic v rietie of core protein , proteoglyc n exhi it extr ordin ry diver ity in glyco yl tion , r nging from the ddition of only fe ug r , to ell over hundred. Intere tingly, the core protein for chondroitin ulf te proteoglyc n in l l min of mu cle c n e coll gen (Type XV)! One of the p r doxe of proteoglyc n i th t they c n function either u tr te for cell to tt ch to, or due to t he hydr tion hell, they c n e very effective rrier to other cell ell. Thi i u eful during development hen there i gre t de l of cell migr tion, nd there need to e y to egreg te cell oth y ttr cting them nd repell ing them. Unfortun tely, thi c n h ve deleteriou con equence in ome itu tio n . For ex mple, hen the r in or pin l cord i injured, gli l c r i forme d, nd th t c r cont in chondroitin ulf te proteoglyc n. Unfortun tely, thi proteoglyc n i n inhi itor of neur l gro th, hich contri ute to the preven tion of neur l regener tion, nd for the unlucky p tient, likely p r ly i or o r e depending on loc tion nd everity of the le ion.

      

Hep r n Sulf te Fi rin Fi ronectin Coll gen Fi ronectin Integrin Hep r n Sulf te Fi ronectin Fi rin Syndec n N C One of the intere ting pect of fi ronectin fi ril form tion i th t the elfoci tion ite i gener lly hidden, ut i reve led hen cell ind to the i ntegrin- inding ite. Thu cell- inding eem to nucle te the form tion of fi ri l , perh p helping to form trong nchor in cert in itu tion in hich the ce ll i not migr ting, ut e t li hing it elf perm nently. Type I Type II Type III v ri le

L minin Although there re m ny other le , l minin i the fin l ECM molecule e f mily of ecreted glycoprotein like fi ronectin, ind to cell vi ompo ed of three u unit ( , , g) tiple i oform of e ch u unit

und nt protein in the to e di cu ed in thi th t re found in m ny integrin receptor . The rr nged in cruciform

extr cellul r m trix ch pter. L minin r ECM form tion , nd l minin protein i c h pe. There re mul

 

Import ntly, in ddition to linking v riety of extr cellul r m trix protein t ogether, fi ronectin l o h ite th t ind to integrin receptor on cell . Where coll gen for the mo t p rt ct p ive u tr te th t cell re i lling to tt ch to or cr l on, fi ronectin c n ctively induce cell migr tion y ctiv tion of the integrin . Fi ronectin expre ion long very pecific p th y re cruci l for the migr tion of neur l cre t nd other cell type in develop ment. In vitro experiment ith fi ro l t nd other cell type ho m rked p reference for re co ted ith fi ronectin over re co ted ith coll gen. Thi i l o true in vivo: n upregul tion of fi ronectin in re pon e to injury pro mote migr tion of fi ro l t nd cell oci ted ith ound he ling into the le ioned re . The integrin inding ite i ch r ctized y the pre ence of n r ginine-glycine- p rtic cid (RGD) equence. If thi ite i oli hed or mut te d, the mut nt fi ronectin doe not ind to cell . Simil rly, if cell re tre te d ith high concentr tion of hort peptide th t cont in the RGD equence, tho e peptide ind to the integrin , nd the cell ignore fi ronectin. Fin lly, in ddition to erving linker et een other ECM protein , or even to cell , fi ronectin c n form fi ril through inter ction ith other fi ronectin .

Figure 6. E ch fi ronectin u unit i compo ed of out 30 modul r dom in , of hich there re three m jor tructur l type . Binding ite for other molecule re l eled. The t o Type III dom in th t re m rked ith t r re ltern tive ly pliced dom in not found in fi ronectin th t circul te in the lood tre m, here it help to promote clotting.

       

Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 203

RGD Sequence yielding the v riety (15) of l minin protein c t logued to d te. Although l min in cont in n RGD equence like fi ronectin, it role in cell dhe ion i not u niver l. Although ome cell type h ve een demon tr ted to ind to the RGD it e, other cle rly ind to other dom in of l minin, prim rily loc ted on the opp o ite end of the protein. At pre ent, there re 5 -ch in gene , 4 -ch in , nd 3 g-ch in kno n. The 2/ 1/g1 com in tion i kno n l minin-2 or mero in, nd i found prim rily in th e l l min of tri ted mu cle. Mut tion th t ffect the function of thi l minin c u e form of congenit l mu cul r dy trophy.

Lig nd Di tri ution mo tly coll gen , l o l minin ide pre d mo tly coll gen , l o l minin ide pr e d fi ronectin, VCAM-1 fi ronectin l minin l minin ICAM-1, ICAM-2 fi ronectin, fi rinogen hem topoietic cell fi ro l t ide pre d epitheli l cell T-lymphoc yte pl telet T le 1. Integrin receptor , their lig nd , nd di tri ution. Ch pter 13, ECM & Adhe ion, ver ion 1.0

 

Su unit

1 1

2 1 4 1 5 1 6 1 6 4 L 2 II 3

Integrin The integrin h ve thu f r een introduced receptor for fi ronectin nd l m inin, ut it i l rge f mily ith ide v riety of u tr te . For ex mple, t he foc l dhe ion (fig. 8) ho n n integrin receptor ound to coll gen. A lre dy di cu ed in the previou ch pter, foc l dhe ion re u u lly tr n ient, nd een point of cont ct fi ro l t or other migr tory cell cr l on culture di h or lide co ted ith ECM protein . In ddition to coll gen, fi ro nectin nd l minin re l o potenti l inding p rtner for integrin . A t le 1 ho , the diver ity of u unit nd com in tion me n th t integrin re in volved in ide rr y of cellul r proce e , nd c n ind cell urf ce protein ell ECM. With thi v riety, it i not urpri ing th t not ll integrin ind RGD equence , lthough mo t do. For ex mple, 2 1 integrin prefer

      

L minin pl y cruci l role in neur l development, here it ct guiding p th long hich cert in xon extend to find their eventu l yn ptic t rget . On e prominent ex mple i the retinotect l p th y th t le d retin l g nglion cell xFigure 7. The cruciform on from the eye to the r in. Another ex mple of the role tructure of l minin i com- of l minin in development i the guid nce of primordi l germ po ed of three u unit . The rm ind coll gen nd cell (PGC) . The e re cell th t eventu lly ecome the g m ulfolipid , hile the foot ete , ut need to migr te from the yolk c, hich i out ide cont in LG dom in th t the em ryo proper, to the ite of gon d form tion. L minin i ind integrin nd c r ohyfound long thi p th y. Intere tingly, the PGC re ched dr te . tretch of l minin very clo e to the fin l de tin tion, the dhe ion to l mini n incre ed, nd thi dhe ion found to involve not integrin receptor , ut n inter ction ith cell urf ce hep r n- ulf te proteoglyc n. Thi nd other evidence ugge t th t migr tion on l minin m y e medi ted y integrin receptor , ho e dhe ivity c n e regul ted intr cellul rly, hile more t tic inter ct ion ith l minin m y e medi ted y other type of inding protein . Fin lly, lre dy di cu ed, l minin i n impot nt component of l l min , le to f orm fi ril nd net ork it elf, ell ith coll gen IV.

      

    

P ge 204

-Actinin Actin Vinculin T lin Intr cellul r Coll gen-co ted di h Integrin Extr cellul r YYGDLR or FYFDLR equence , nd II 3 ind oth the RGD nd KQAGDV equence trongly. Integrin ctiv tion h een ho n to initi te ign ling p th y , eg inning foc l dhe ion kin e (FAK) or fe other centr l kin e , hich control ctivitie from cyto kelet l re rr ngement to cell urviv l. Both nd u un it re tr n mem r ne protein th t p through the mem r ne ju t once. Evoluti on rily, they re found only in met zo n pecie , ut they re l o found in ll met zo n pecie . All integrin ut one, 6 4, connect to the ctin microfil me nt cyto keleton through the u unit cyLig nd inding topl mic dom in. The 6 4 integrin link to the intermedi te fil ment cyto keleton, in p rt ec u e the 4 cytopl mic dom in i very l rge nd extend Mg2+ inding ite further into t he cytopl m. On the extr cellul r ide, there i met l ion coordin tion ite u u lly occupied y Mg++, th t i nece ry for lig nd inding. There re l o ever l other div lent ion inding ite , The receptor c n e found in either n in ctive ( ome h t ent over to rd the mem r ne) or n ctive t te ( tr ighte ned up). In the in ctive t te, u unit u unit the u unit ind the u uni t clo ely preventing inter ction ith the cyto keleton. Ho ever, once Figure 9 . Integrin receptor re comcyto kelet l element uch t lin tt che to the po ed of t o polypeptide th t e ch p through the mem r ne once. Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 205

       

Figure 8. A foc l dhe ion i g on coll gen-co ted di h.

dyn mic point of cont ct formed y

cell gro in

u unit cytopl mic dom in, it di pl ce the u unit, c u ing light ep r t ion of the t o u unit nd le ding to ctiv tion of the receptor. In f ct, inte grin demon tr te h t i kno n in ide-out ign ling, in hich cellul r ign l (for ex mple, from the ign ling c c de of gro th f ctor) le d to lter ti on to the cytopl mic dom in nd hich hift the conform tion of the extr cell ul r dom in to n ctive tr ightened-up t te in hich it c n more re dily ind to lig nd . Thi i hy integrin re o ell uited to foc l dhe ion nd oth er in motion dhe ion th t mu t dhere nd rele e quickly. Though recycling of r eceptor l o h ppen , turning them on or off y in ide-out ign ling i n effe ctive mech ni m for f t movement. A one might expect from n ctin-linked tru cture, foc l dhe ion nd their in vivo equiv lent re tr n ient, dyn mic poin t of cont ct et een the cell nd the u tr te it i cr ling over. Ho ever, t here re m ny itu tion in hich cell i not only t tion ry, it need to e firmly tt ched to it u tr te in order to gird it elf for h tever tre or might come to te t it re olve. In the e c e , the ctin cyto keleton i too ep hemer l for the t k.

Protein pl que Cytopl m L minin-5 BP180 Integrin Extr cellul r M trix Figure 10. Hemide mo ome . (Left) Di gr m depicting involvement of intermedi te fil ment nd den e protein pl que reinforcing the mem r ne t the point of co nt ct. (Right) Thi ho up the electron den e re pointed out y the rro in thi electron microgr ph of epitheli l cell in mou e tr che . Microgr ph rele ed ith cre tive common ttri ution licen e y Nguyen et l, Re pir tory Re e rch 7:28 (2006). Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 206

Intermedi te l ment

Hemide mo ome

        

Hemide mo ome , p rticul rly tho e tt ching epitheli l cell to their ement mem r ne, re the tighte t dhe ive inter ction in n nim l ody. Thi clo e c ont ct, nd the reinforced tructure of the e cont ct , i cruci l for the prote ctive re ilience of epitheli l l yer . Remem er the 6 4 integrin? Th t ould e the one th t link ith intermedi te fil ment in te d of f- ctin. Intermedi te fil ment , eve lre dy noted, re not dyn mic, ut out t le cell ul r component c n e. They re l o very trong nd re u ed to uttre cellul r integrity. So, it i no urpri e to ee intermedi te fil ment nd the 6 4 i ntegrin pl ying role in hemide mo ome . The di tingui hing ch r cteri tic of he mide mo ome though, i the electron-den e pl que. It c n e thought of reinf orcement o th t hen the epithelium i tretched, the cell doe not ju t pop lo o e le ving ehind p rt of it mem r ne. The pl que cont in ever l protein , ut the prim ry component re plectin , the linker protein th t help to undle i ntermedi te fil ment , nd connect them to e ch other ell other cyto kele t l element . Another m jor element of the pl que i BP230, hich connect the pl que to ker tin. On the extr cellul r ide, in ddition to the integrin lre d y mentioned, there i l o tr n mem r ne glycoprotein c lled BP180, hich l o ind to l minin element of the ement mem r ne. BP230 nd BP180 re n med for ullou pemphigoid, the u epiderm l ullou di or der ch r cterized y chronic li tering of the kin. It i n utoimmune di orde r nd in hich the err nt nti ody re pon e i to the e t o hemide mo om l pro tein . Dy trophin Glycoprotein Complex Another type of cell-ECM connection i the dy trophin glycoprotein complex (DGC) of kelet l mu cle cell . Simil r complexe re found in mooth mu cle nd in ome nonmu cle ti ue . Mu cle cell , of cour e re u ject to frequent mech nic l tre , nd connectivity to the ECM i import nt in upporting the cell integr ity. The DGC u e the l rge tr n mem r ne glycoprotein, dy troglyc n, it pri m ry inding p rtner to l l min l minin. A rcoglyc n complex nd rco p n re other m jor -Dy tro revin NOS tr n mem r ne component of the DGC, Syntroph in Dy trophin Actin ut their role do not ppe r to include Gr 2 Cyto ol direc t inter ction ith l l min . The rcoglyc n complex (con i ting of 4 sarco lycans) is postulat to act as Sarcospan structural r inforc m nt for th m m,-Dy troglyc n S rcoglyc n complex r ne t the e cont ct point . The role of L mini n rco p n, 4-p tr n mem r ne pro- B l l min tein, h not een demon t r ted ithin Coll gen the DGC, ut homologou protein in other cell re found in dhe ive comFigure 11. Dy trophin Glycoprotein Complex.

Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 207

Mut tion le ding to lo of rco rophie . Ho ever, rco p n i not mut tion in the rcoglyc n . It complex i required for norm l mem

p n h ve not een found in mu cul r thu ppe r th t r ne loc liz tion

linked to ny mu cul r dy t dy trophy p tient ho h ve the tetr meric rcoglyc n of rco p n.

 

 

plexe ith integrin receptor , ugge ting the me function here. Although the DGC re long-lived dhe ive cont ct th t h ve more in common ith hemide mo ome th n foc l cont ct , the cyto kelet l component tt ched to the DGC i ctin ( vi dy trophin), not intermedi te fil ment . Ho ever, it i import nt to note th t the ctin cyto keleton of mu cle cell h very different function from it counterp rt in fi ro l t. Mut tion to the rcoglyc n , dy troglyc n, nd dy trophin h ve ll een ho n to c u e mu cul r dy trophie . De mo ome Cell ill form dhe ive inter ction ith other cell ell ith ECM. Mo t of the e inter ction utilize different et of protein , lthough integrin h ve een found to inter ct ith ome cell dhe ion protein . An ex mple of cel l-cell inter ction ith m ny imil ritie to cell-ECM inter ction, ut u ing d ifferent dhe ion molecule , i the de mo ome. Like it l-l min - tt ched co uterp rt, the hemide mo ome, the de mo ome i found in epitheli l heet , nd it purpo e i to link cell together o th t Intermedi te l ment Intercellul r p ce De moglein De mopl kin De mocollin Pl koglo in

Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 208

Figure 12. De mo ome connect the intermedi te fil ment of dj cent cell cro dhe ion molecule trengthened y protein pl que. De moglein nd de mocolli n, the dhe ion molecule re mem er of the c dherin f mily, nd the reinforcin g pl que cont in pl koglo in, hich connect the dhe ion molecule to the IF l inker, de mopl kin.

  

 

 

Mut tion in de mopl kin (on chromo ome 6p24) re linked to C rv j l yndrome ( l o kno n dil ted c rdiomyop thy ith oolly h ir nd ker toderm ). P tient re orn ith oolly h ir, nd p lmopl nt r ker toderm ppe r ithin the fir t ye r. Dil tion of the left ventricle nd ttending e kne in contr ctility m y le d to de th from he rt f ilure in teen ge ye r . Pemphigu vulg ri i noth er r re di e e involving dy function of de mo ome . It i n utoimmune di e e t rgeted to the p tient o n de moglein protein . The reduced epitheli l dhe io n le d to li tering of kin nd mucou mem r ne . C dherin The c dherin uperf mily i compri ed of the de moglein (of hich 4 h ve een i dentified in hum n ) nd de mocollin (3 in hum n ), the c dherin (>20), nd th e protoc dherin (~20) ell other rel ted protein . They h re tructur l imil rity nd dependence on C ++ for dhe ive ctivity, nd they c n e found in mo t ti ue , nd for th t m tter, mo t met zo n pecie . C dherin re ing le-tr n mem r ne modul r protein . On the out ide of the cell, the c dherin h five dom in of imil r ut not identic l tructure. It origin lly thought t h t C ++ u ed et een c dherin to medi te dhe ion, ut it i no cle r th t C ++ i ound in et een e ch extr cellul r dom in, pp rently coordin ting th em into more rigid tructure. C dherin c n l o ct in ci , i.e. c dherin fr om the me cell c n form dimer . Thi property llo p tch of c dherin dhe ion uch de mo ome to zipper together into very trong clu ter . The cytopl mic dom in of c dherin ch r cteri tic lly ind to f mily of protein c lled the c tenin , nd thi inding c n e regul ted y pho phoryl tion of the c dhe rin. The mo t common c tenin re nd , u u lly ith the -c tenin cting intermedi ry et een c dherin nd -c tenin, nd the -c tenin linking them to t he ctin microfil ment . Thi kind of rr ngement i found in oth cell th t r e motile, cr ling over other cell th t re expre ing c dherin, ell t tion ry cell . Although thi i not the rr ngement in de mo ome , the de mo om l pl que protein pl koglo in i mem er of the c tenin f mily. Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 209

          

pre ure i pre d cro m ny cell r ther th n concentr ted on one or fe . D e mo ome re nece ry for the tructur l integrity of epitheli l l yer , nd re the mo t common cell-cell junction in uch ti ue . The prim ry tructur l ch r cteri tic of the hemide mo ome, the den e pl que reinforcing the intr cellul r ide of the dhe ion, i l o found in de mo ome , lthough it i compo ed of different protein . In de mo ome , the pl que i compo ed prim rily of pl koglo in nd de mopl kin . The pl koglo in connect the dhe ion molecule to the de mopl kin , nd the de mopl kin link to intermedi te fil ment uch ker tin. Another imil rity to hemide mo ome , nd one predicted y the involvement of ke r tin, i the perm nence of de mo ome . On the other h nd, key difference et een the t o type of dhe ion i the dhe ion protein involved. The m jor prot ein of the de mo ome re de moglein nd de mocollin, oth of hich re mem er of the c dherin uperf mily of C ++-dependent dhe ion molecule .

          

-c tenin - ctinin C dherin -c tenin Actin

With the p tch of c dherin inter ction , the dheren junction (fig. 13) look v ery imil r to the de mo ome (fig. 12). Adheren junction erve ome of the m e purpo e de mo ome : providing connectivity to neigh oring cell , nd reinf orcing nd h ping the cell . Ho ever, dheren junction re mo tly loc lized n e r the pic l urf ce of epitheli l cell , nd in te d of intermedi te fil ment , they re connected to ctin microfil ment th t form circumferenti l elt t h t produce ten ion nd h ping force in conjunction ith myo in th t oci t e ith it. Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 210

Figure 13. Adheren Junction. Thi type of cell-cell dhe ion i ed on inter ction of c dherin , hich re connected intr cellul rly to the ctin cyto keleto n through the linker protein - nd - c tenin. Al o depicted here i the ctin undling protein - ctinin.

    

The prim ry inding ite for c dherin ppe r to e the N-termin l dom in (mo t di t l extr cellul r), lthough there i evidence th t m ny three dom in c n e involved. C dherin mo tly ind homophilic lly (E-c dherin ind E-c dhe rin on nother cell, ut not P-c dherin), lthough ome c dherin c n ind heter ophilic lly (e.g. N-c dherin c n ind to either N-c dherin or E-c dherin). Incid ent lly, the e three, Ec dherin (epitheli l), N-c dherin (neur l), nd P-c dheri n (pl cent l) re the e t- tudied c dherin . Both E- nd P-c dherin re import nt in e rly em ryonic development, hile N-c dherin h een tudied in the con text of xon guid nce in the developing nervou y tem. E-c dherin i l o t r get of crutiny ec u e it i l o import nt in the met t i of c ncer. In ord er for c ncer cell to re k from the initi l tumor, it mu t do nregul te it dhe ion to neigh oring cell efore migr ting el e here. Thi i kno n the ep itheli l-me enchym l tr n ition nd i ccomp nied y decre ed E-c dherin expre ion. Intercellul r p ce

Tight Junction Sometime , holding cell together, even ith gre t trength, i not enough. In e pitheli e peci lly, l yer of cell m y need to not only hold together ut for m complete e l to ep r te h tever i in cont ct ith the pic l ide from h tever i in cont ct ith the l ide. Th t ould e jo for The Tight Jun ction! Well, more ccur tely, for m ny tight junction in n rr y ne r the pic l urf ce. Perh p the e t ex mple of the utility of tight junction i in the dige tive tr ct. The tight junction th t form et een cell of the epitheli l lining of the gut ep r te the food nd it dige tion product from the ody t l rge, forcing m cromolecule nutrient to e tr n ported through the epitheli l cell y endocyto i /tr n cyto i to the lood tre m here they c n e mo t effic iently di tri uted. The tight junction l o form in lood ve el to prevent le k ge of lood, nd in v riety of org n here liquid mu t e cont ined. A. B. Extr cellul r Intr cellul r 1 Figure 14. Tight Junction . (A) Tight junction re u u lly pre ent in rr y th t e l off one ide of n epitheli l l yer from the other multiple time . (B) E ch tight junction i formed y very m ll tr n mem r ne protein , cl udin nd occludin , o th t the mem r ne of oppo ing cell c n come into extremely clo e cont ct . Intr cellul r 2 An individu l tight junction i formed y the inter ction of cl udin nd occlud in . They re e ch 4-p tr n mem r ne protein ith oth N- nd C-termini on t he cytopl mic ide; the extr cellul r ide h very lo profile, con i ting o f one (cl udin) or t o (occludin) m ll loop . Bec u e of their m ll ize, hen they inter ct, the mem r ne re rought together very clo ely. In order to ct u lly form e l et een cell though, tight junction mu t e lined up in clo e order ll the y round the cell, nd in f ct, u u lly there re multiple lin e , hich one could think of ckup in c e one line develop le k. Cl udin m olecule h ve rel tively m ll cytopl mic dom in nd it i not cle r hether t here re ignific nt inter ction ith other protein . Ho ever, occludin h l rge C-termin l cytopl mic dom in th t cont in PDZ- inding dom in. PDZ i protein inter ction motif of pproxim tely 80-90 mino cid found in num er o f ign ling protein , mo t often in u e to hold ign ling complexe ne r the mem r ne y inter cting ith tr n mem r ne protein, ould e the c e here it h occludin. The e PDZ-cont ining protein oth h ve ign ling function nd c n Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 211

                 

ct d pter to the cyto keleton, prim rily the ctin fil ment . Fin lly, lt hough n ex ct mech ni m i uncle r, elev ted level of C ++, either extr cellul rly or perimem r nou ly, i oci ted ith tight junction em ly.

NCAM P0 L1 Figure 15. Ig uperf mily cell dhe ion molecule NCAM, P0, nd L1 (top to otto m) re uilt ith fi ronectin Type II dom in nd Ig C2-like dom in .. IgSF molecule re involved in num er of cellul r proce e requiring dhe ion . The mo t o viou , of cour e, i the immune re pon e in hich n immunoglo ulin , either ecreted or on cell, ind to molecule foreign to the ody. Ho ever , there re m ny other inter ction out ide of the immune y tem th t involve Ig SF molecule . One ell- tudied re i in neur l development, here IgSF mem er L1 (L1CAM), NCAM nd numerou other re expre ed in pecific p ttern to cont rol the routing of xon Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 212

Ig Superf mily CAM In ddition to occludin nd cl udin , junction dhe ion molecule (JAM ) h ve re cently een found in tight junction . The e molecule re mem er of gig ntic uperf mily of cell dhe ion molecule kno n the Ig (immunoglo ulin dom in) uperf mily ec u e ll of the e protein cont in n immunoglo ulin loop dom in t h t pl y n import nt p rt in the dhe ion mech ni m. The purpo e of immunoglo ulin ( nti odie ) i to recognize nd dhere to other molecule , o it m ke e n e th t uch tructur l motif ould l o e u ed for other kind of dhe ion. Ig loop f ll into t o prim ry c tegorie , g in ed on the loop of n immun oglo ulin molecule. The e re the v ri le (V) loop nd the con t nt (C1) loop. Some IgSF molecule cont in C2 loop, hich h mino cid homologhy to the V l oop, ut tructur l/ ize imil rity to the C1 loop. The ize of IgSF molecule r nge gre tly, nd the num er of Ig loop dom in nd other dom in (e.g. fi rone ctin Type III dom in ) c n l o v ry ignific ntly. FN type III IgC2

 

they m ke their y from the neuron l cell ody to their eventu l connection . T hi p th c n often e very long, cro ing m ny different cell type , nd t king ever l turn , o ro u t guid nce y tem i cruci l to m ke norm l functioni ng nervou y tem. Specific com in tion of cell dhe ion molecule ( l o c lled xon guid nce molecule in thi c e) direct the e proce e even through the e xtr ordin ry den ity of potenti l ( ut incorrect) nerve cell t rget in the r i n. IgSF molecule h ve een found to ind oth homophilic lly nd heterophilic l ly, nd for th t m tter, not ju t to other IgSF molecule , ut to dhe ion molec ule of other tructur l f milie uch integrin . Selectin The l t m jor cell dhe ion molecule f mily to di cu i the electin . Select in ind heterophilic lly to oligo cch ride moietie on glycoprotein . In f ct the n me of the f mily i ed on lectin, generic term for protein th t ind ug r . The electin , like c dherin nd IgSF molecule re modul r glycoprote in th t p through the mem r ne once. From C-terminu to N-terminu , the ele ctin re compo ed of rel tively hort cytopl mic dom in, ingle tr n mem r ne dom in, erie of CR (con en u repe t) or tructur l dom in (from 2 in L - electin to 9 in P- electin), n EGF (epiderm l gro th f ctor) -like dom in, n d lectin-like dom in. The lectin-like dom in ind f irly pecific oligo cc h ride compo ed of i lic cid, g l cto e, GlcNAc, nd fuco e, of hich the i l ic cid nd fuco e re mo t import nt for recognition. Selectin-medi ted dhe io n i C ++ dependent proce .

L- electin, hich i found on leukocyte , the fir t di covered, y virtue of n intere ting phenomenon c lled lymphocyte homing, in hich lymphocyte ere r emoved from v riou peripher l lymph node , l eled, nd then injected ck into the nim l. Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 213

L- electin E- electin P- electin Figure 16. Selectin (L-, E-, nd P-) re compo ed of et een 2 nd 9 hort con en u repe t dom in (purple), n EGF-like dom in (or nge), nd the lectin-like inding dom in (te l).

 

The e lymphocyte ould migr te ck to the ti ue from hich they ere derived ithout reg rd for the ite of re-injection. The other t o kno n electin re E- electin, hich i expre ed prim rily on endotheli l cell , nd P- electin, hich i expre ed on pl telet nd endotheli l cell . The e t-ch r cterized lig nd for electin i PSGL-1, cre tively n med P- electin glycoprotein lig nd -1. Both E- nd P- electin re n import nt p rt of the infl mm tory re pon e, medi ting the inv ion of neutrophil from the lood tre m into the re of injury ( fig. 17). 1 2 3 Sign l from d m ged ti ue Selectin upregul tion Pl telet ctiv ting f ctor rele ed 4 5 Inv ion = ICAM = Integrin = E/P- electin = Pl telet ctiv ting f ctor

Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 214

      

Figure 17. Neutrophil ctiv tion nd inv ion in the infl mm tory re pon e. Fir t, endotheli l cell in the lood ve el ll re ctiv ted y ne r y d m ged c ell . The e endotheli l cell then egin to expre E- nd P- electin , hich ind onto neutrophil th t re tum ling y in the lood tre m. Thi inter ction lo the neutrophil do n o th t they re ju t rolling more lo ly in p rti l c ont ct ith the endotheli l cell . The endotheli l rele e pl telet ctiv ting f ctor, hich ctiv te 1 2 nd m 2 integrin on neutrophil . Tho e integrin c n ind onto the ICAM ( nd IgSF molecule) on the endotheli l cell urf ce, top ping their movement. Fin lly the neutrophil ind to ICAM on t o dj cent cell , then remodel it cyto keleton it queeze et een the t o to exit the loo d tre m nd move to the le ion ite.

  

 

Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 215

Although they h ve no een found in mo t met zo n ti ue type , they re p rtic ul rly import nt in he rt mu cle. Here, the g p junction in ure efficient prop g tion of contr ctile ign l o th t the c rdi c mu cle c n contr ct in ynchro ny. It i l o import nt in c rdi c development: gene knockout of connexin43, th e prim ry he rt connexin, le d to del yed looping of the cending lim of the em ryonic he rt tu e, hich me n m lform tion e peci lly in the right ventricl e, tricu pid v lve, nd u pulmon ry outflo tr ct.

   

When mo t people, including mo t iologi t , think out neuron l connection n d yn p e , they think of chemic l yn p e in hich one cell ign l to nother y rele e of neurotr n mitter . Ho ever, it i no ell e t li hed th t in th e CNS, electric l yn p e through g p junction re ignific nt p rt of the r epertoire of neur l communic tion. The retin i n excellent ex mple ith numer ou g p junction et een neuron . In f ct, light- ctiv ted neurotr n mitter c n ctiv te protein kin e p th y th t pho phoryl te connexin , thu ltering c onduct nce through the g p junction . A triking ex mple i the g p junctioned electric l coupling of cone photoreceptor neuron . They re coupled ne r the e of the cell , o th t excit tion of one drive excit tion of ever l other . Thi i import nt in gener ting cle r vi u l ign l ec u e the prim ry re c tion, phototr n duction, i dirty proce . Due to the imple pre ence of r ndo m photon ouncing out, the ign l to noi e r tio of light-induced excit tion i very lo . Ho ever, ec u e electric l coupling um up the ign l of ne r nei gh or ut not the ckground noi e, the ign l output from the e neuron h n improvement in ign l to noi e r tio of ~77%! Thi topic i revie ed in Bloomfi eld nd Volgyi, N ture Revie (Neuro cience), 10:495-506, 2009.

G p Junction Unlike the other type of cell-cell dhe ion, the g p junction ( ometime c lled nexu ) connect not only the out ide of t o cell , it connect their cytopl m ell. E ch cell h connexon ( k hemich nnel) m de of ix connexin prote in . The connexin m y e ll of the me type, or com in tion of different one , of hich there re 20 kno n in hum n nd A. B. Extr cellul r mice. The conne xon inter ct ith connexon on n dj cent cell to connect the cytopl m of o th cell in g p junction. Intr cellul r Intr cellul r The g p junction pore ize 2 v rie depending on the type of conne xin , ut gener lly, the molecule under 1 kD re le to p through hile l rger one Figure 18. G p Junction . c n not. Therefore, cell connected y g p j unction re electric lly connected (ion c n freely p ), they c n h re cellu l r energy (ATP), nd econd me enger ign ling molecule like C ++ or IP3, ut not mo t protein or nucleic cid . The pore re not l y open, ut re cont rolled y pho phoryl tion of ever l erine in the intr cellul r dom in of e c h connexin. 1

               

Figure 19. An overvie of cellul r dhe ion . From top to ottom, there re tigh t junction (purple), dheren junction ith f- ctin ( lue), de mo ome (or nge ) connected to intermedi te fil ment , nd g p junction ( lue). There re l o hemide mo ome (or nge) on the l urf ce tt ched to the ement mem r ne. Ch pter 13, ECM & Adhe ion, ver ion 1.0 P ge 216

Cell Communic tion : Sign l Tr n duction Met zo n org ni m re not ju t conglomer tion of cell th t h ppen to tick to gether. The cell e ch h ve pecific function th t mu t e coordin ted ith one nother in order to ure the urviv l of the org ni m nd thu the h red ur viv l of the component cell . If coordin tion i required, then method of comm unic tion et een cell i l o required. In f ct, it i even more complic ted t h n th t ec u e the communic tion et een the cell only cr tche the urf ce (ye , d pun intended) nd the intr cellul r communic tion th t goe on to coo rdin te multiple cellul r ctivitie in re pon e to n extern l ign l i u u ll y f r more complex th n the initi l tr n mi ion of th t ign l. There re three prim ry mode of intercellul r communic tion. The e re (1) direct cont ct et een ign ling molecule ound to the mem r ne of t o dj cent cell , (2) hortr nge olu le ign l th t diffu e over hort di t nce , nd (3) long-r nge olu le ign l th t re ecreted into the circul tion to e c rried ny here in the ody. An ex mple of juxt crine ign ling i exemplified y the ctivity of ome cell dhe ion or ECM protein , uch l minin, th t do not ju t llo cell t o move over them, ut ct ign l to promote incre ed motility. Thi likely h ppen y ctiv tion of integrin receptor on the moving cell, hich then initi te nd coordin te ch nge through the re t of the cell to ccompli h the ch nge in ctivity. Another ex mple i the Delt -Notch p th y u ed in em ryonic p tte rning. Delt , Ch pter 14, Sign ling, ver ion 0.1

A Sign ling cell B

p300 CSL Tr n cription Inhi ited epitheli l cell expre ing Notch receptor

P ge 217

Figure 1. Delt -Notch

ign ling.

Prote e Nucleu

Delt Notch Receiving cell Prote e Developing nerve cell expre ing inhi itory Delt

Undi erenti ted epitheli l cell

ign l

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

dv n the dv Fin on e

   

   

The Delt -Notch p th y i ell ch r cterized nd ome h t more complic ted th n portr yed in the p r gr ph to the left. The cle v ge of Notch involve t o prot e e nd t o ite . Once the Notch cytopl mic dom in ind to CSL, it di pl ce num er of co-repre or ound to the CSL, nd l o recruit MAM (M termind1) co ctiv tor. MAM recruit hi tone cetyl e to llo further incre e t r n cription of t rgeted gene , ut l o recruit kin e th t initi te the proc e of t rgeting the Notch cytopl mic dom in for u iquitin-medi ted de truction . The expre ion of Notch-controlled gene i thu elf-regul ted nd hut off oon fter Delt i no longer v il le. Revie ed in R.A. Kov ll, Curr. Opin. St ruct. Biol. 17: 117-27, 2007. Receptor nd Lig nd A protein th t h ppen to ind omething i not nece rily receptor. A recept or i defined protein th t ind to n extr cellul r lig nd, nd then under goe conform tion l or iochemic l hift in uch y th t it initi te ch in of intr cellul r event y hich the cell re ct to the extr cellul r ign l. Wh t re the e lig nd nd their receptor ? Ch pter 14, Sign ling, ver ion 0.1 P ge 218

              

tr n mem r ne protein on the ign ling cell, ind to Notch, receptor on the r eceiving cell. Notch lter it conform tion, llo ing it cytopl mic dom in to e cut off y g- ecret e. The cytopl mic dom in then tr n loc te into the nu cleu , here it ct n ctiv ting tr n cription f ctor y inding ith CSL. In the ex mple ketched in fig. 1B, toch tic upregul tion of delt in one cell ctiv te notch in the urrounding cell , hich then ctiv te pecific diffe renti tion p th y for them. Thu the centr l cell m y e en ory neuron, like h ir cell, hile tho e immedi tely urrounding it re upport cell like gli . Thi type of ign ling impo e p cing p ttern on the expre ion of neuron (or other cell). Diffu ion limited ign l from ne r neigh or i c lled p r cri ne ign ling, nd ometime the ign l c n ct on receptor right on the cell t h t ecreted the ign l, hich ould e utocrine ign ling. P r crine ign l re only ctive if they c n ind to cell ove critic l concentr tion to cti v te ign ling p th y. Therefore, the ign l diffu e y from the ource , there i cutoff, eyond hich the concentr tion of ign l i in ufficient to ctiv te receiving cell. Gro th f ctor re often p r crine ign l . Although they do often encour ge gro th, they re l o often urviv l f ctor . In th t c ontext, Nerve Gro th F ctor (NGF) i ecreted y t rget cell th t then re rd t he neuron th t m ke the right connection y providing NGF for their urviv l. Tho e neuron th t he d off in the rong direction, re un le to o t in NGF, n d they do not urvive, promoting efficiency nd etter ign l:noi e r tio ith in the nervou y tem. Endocrine ign ling i e enti lly hole- ody ign ling. A ign l produced y hormone-producing gl nd i ecreted into the lood tre m, here it ecome cce i le to ne rly ny cell in the ody. Of cour e, not ever y cell ill re pond to the hormone: like every other c e of intercellul r ign ling, re pon e i holly dependent on receptor , o only the cell th t h ve rec eptor to recognize the ign l ill re ct. For ex mple, e trogen i rele ed int o the circul tion, ut in fem le , only ome org n ho ignific nt imp ct hen e trogen level re ignific ntly ltered. Mo t ti ue re un ffected. Endocri ne ign l m y circul te in other extr cellul r fluid uch lymph.

    

    

7-TM receptor (G-protein-coupled) The 7-tr n mem r ne receptor , or G-protein-coupled receptor re, un urpri ingl y, f mily of protein th t p through the cell mem r ne 7 time . The mino t ermin l i extr cellul r nd the c r oxyl termin l i intr cellul r. Figure 2 h o the tr n mem r ne region pre d out for cl rity, ut the tr n mem r ne dom in ctu lly Ch pter 14, Sign ling, ver ion 0.1 P ge 219

 

Intercellul r ign l p n very ide r nge of molecule type . Some re imple g e , like NO, hile other re mino cid or deriv tive , including glut m te , dop mine, or epinephrine. Lipid uch teroid (e.g. e trogen, corti ol) or eico noid (e.g. pro t gl ndin , leukotriene ) c n e intercellul r me enger . Fin lly m ny ign l re peptide or even complex protein (rec ll our juxt cr ine ign ling ex mple). Although mo t re recognized y cell urf ce receptor , thi i not l y the c e ince, for ex mple, teroid re lipid- olu le nd c n diffu e through the pl m mem r ne. Receptor re f r le v ried group of molecule , ince they re ll protein , though it mu t e id th t they repre ent m ny different protein tructure nd function . In gener l, receptor re v ery pecific for their lig nd , ut the pecificity i not mutu l: lig nd c n e r ther promi cuou nd ind ith multiple receptor . Thi i p rt of the coord in tion pect of ign ling, though ingle lig nd c n initi te different ef fect in different cell depending on h t receptor i expre ed. The rem inder of thi ch pter ill delve into ome of the intr cellul r ign ling c c de th t re ch r cteri tic of p rticul r receptor type . Bec u e receptor , even t hi gh den ity, repre ent only minute fr ction of the urf ce re of the cell, n d therefore n even tinier fr ction of the volume of the cell, the ctiv tion of receptor mu t e mplified in order for it to initi te cellul r ctivitie (e .g. locomotion, gro th, cell cycle progre ion). Thu one of the fir t thing receptor doe upon ctiv tion i to initi te ign ling c c de. Thi ptly n m ed equence of event egin ith the receptor ctiv ting n enzyme. The enzyme m y e the cytopl mic dom in of the receptor it elf, or it m y e n independen t protein ut clo ely linked to the receptor. The enzyme doe h t enzyme do: i t r pidly convert u tr te molecule into product molecule . In thi c e, om etime the product i n ctiv tor for nother enzyme, nd ometime , the u tr te i n in ctive enzyme nd the product i n ctiv ted enzyme. Either y, e c u e of the high ctivity r te , the ingle ctiv tion of the receptor h incr e ed fir t to ten or hundred of enzyme ctiv tion , nd e ch of tho e ctiv t e hundred , nd o on, o th t the effect of the receptor c n e r pidly di tri uted throughout the cell.

        

form together in more of cylindric l h pe. 7-TM protein re u ed receptor for neurotr n mitter uch epinephrine ( - drenergic receptor), cetylcholi ne (mu c rinic receptor), nd erotonin, ell hormone like gluc gon or th yroid- timul ting hormone, nd even non-molecul r lig nd uch light! Rhodop in re cl of 7-TM receptor th t re ctiv ted hen they or photon ( fig. 5). Activ ting thi f mily of receptor , hether y photon or y more conve ntion l lig nd inding, induce conform tion l ch nge in the cytopl mic dom i n th t lter the inter ction et een the receptor nd protein complex kno n heterotrimeric G protein. The heterotrimeric G protein con i t of n , , nd g u unit, of hich the u unit c n ind either GTP or GDP, nd c n hydrol yze GTP to GDP. When the 7-TM receptor i in ctive, the G protein complex i u u lly ne r y oci ted ith the mem r ne y myri toyl tion or p lmitoyl tion of the u unit nd f rne yl tion or ger nylger nyl tion of the g u unit. Once th e 7-TM receptor i ctiv ted, it oci te ith the heterotrimeric G-protein, hich c u e the G to let go of the GDP nd ind to GTP. Thi then di oci te the G from the other t o u unit . It c n then oci te ith nd ctiv te n enzyme to exp nd the ign ling c c de. One of the t o cl ic l p th y t rt ith G ctiv tion of denyl te ( denylyl) cycl e. Adenyl te cycl e (AC) conv ert ATP to cAMP. Since ATP i plentiful nd AC i rel tively f t enzyme, the fir t mplific tion of the ign l come ith gener tion of the econd me enger m olecule NH3+ Extr cellul r Intr cellul r COOFigure 2. 7-TM receptor. A Lig nd B Adenyl te cycl e Lig nd 7-tr n mem r ne G-coupled receptor 7-tr n mem r ne G-coupled receptor G G G GDP G G Adenyl te cycl e G Trimeric G protein Trimeric G protein GTP GDP

     

  

 

C Lig nd 7-tr n mem r ne G-coupled receptor G G G Trimeric G protein Adenyl te cycl e GTP PKA cAMP ATP Enzyme pho phoryl tion

Ch pter 14, Sign ling, ver ion 0.1 P ge 220

Figure 3. The heterotrimeric G-protein c n ct cycl e.

timed ctiv tor of

denyl te

An intere ting v ri tion from the cl ic 7-TM p th y t rt ith the rhodop i n receptor in rod cell . The e receptor ind photon for ctiv tion, nd eng g e heterotrimeric G protein. The G -GTP then ind to the g u unit of pho phod ie ter e (PDE), ctiv ting it nd c t lyzing conver ion of cGMP to GMP. A cGMP decre e , ion ch nnel clo e, pol rizing the mem r ne nd ch nging the ign l from the rod cell to the r in (vi connecting neuron ). LIGHT . . Rod cell . . . .. . . . . . .. . . . . To optic nerve B PLC G G G GDP Trimeric G protein Lig nd 7-tr n mem r ne G-coupled receptor

7-tr n mem r ne G-coupled receptor PLC G G G Trimeric G protein Op in (in ctive) Op in ( ctive) G G Di k mem r ne G G G G Trimeric G protein GTP Trimeric G protein

Rhodop in di k

    

cAMP. E ch cAMP molecule c n then ctiv te other enzyme , the prim ry one eing protein kin e A. PKA c n then pho phoryl te v riety of u tr te to lter ce llul r ctivity y gene expre ion, molecul r motor , or met olic ch nge . The other cl ic l p th y for 7-TM receptor i the ctiv tion of pho phlip e C , l o y G . PLC ctu lly produce t o econd me enger molecule : it hydrolyze pho ph tidylino itol into di cylgylcerol (DAG) nd ino itol tripho ph te (IP3) . IP3 prim rily induce the rele e of C ++ from the endopl mic reticulum. The DAG c n ctiv te protein kin e C. PKC i l o ctiv ted y C ++ nd oth C ++ nd DAG c n ctiv te PKC ynergi tic lly. Protein kin e C i n import nt centr l kin e th t h een ho n to pho phoryl te nd control the ctivity of numero u other enzyme from cyto kelet l element to tr n cription f ctor . A Lig nd

 G Trimeric G protein G Trimeric G protein GDP GTP GTP GDP GTP GTP PDE ( ctive) C Lig nd PDE (in ctive) High cGMP, ion ch nnel open 7-tr n mem r ne G-coupled receptor PLC G G G Trimeric G protein Lo cGMP, ion ch nnel clo ed

PI DAG IP3 C ++ PKC X Extr cellul r Rod cell mem r ne Enzyme pho phoryl tion N + C ++ N + C ++

GMP cGMP (Cyto olic cGMP level Intr cellul r

reduced)

GTP Figure 5. Activ tion of the 7-TM receptor rhodop in y light.

Endopl mic reticulum (high C ++) C ++ rele e Figure 4. G-protein ctiv ted Pho pholip e C. (A) The G-protein i in ctive it h GDP ound. (B) Upon lig nd inding, G-protein ind receptor, exch nge GDP fo r GTP, nd G di oci te . (C) G GTP ctiv te PLCg, hic produce DAG nd IP3. The l tter induce C ++ rele e into the cytopl m nd together ith DAG, ctiv te PKC. Second me enger mu t h ve t o propertie . They mu t e m ll enough to diffu e effectively, nd the cell mu t e le to gener te them quickly. C ++ nd cAMP f ll into thi c tegory. Furthermore they c n oth e removed from circul tion f irly quickly: the former y C ++ pump in the ER nd Golgi, nd the l tter y p ho phodie ter e ctivity. When the G-protein-p th y di covered, the u e of lipid econd me enger Ch pter 14, Sign ling, ver ion 0.1 P ge 221

 

Cytopl m (lo

C ++)

O H2C -O C C C O CH2 O H2C -O C C C O CH2 O H2C -O C C C O CH2 OO P OO H HO H -O O H2C C C C O CH2 O O O H P O O H OH OH H OH H HO H H OH O O O H P O O H OH OH H OH H HO H O O O H P O O H OH OH H O O HO H ATP ADP ATP ADP di cylglycerol (DAG) OP O O H OH OH H OO P OO H HO H H

urpri ing. Mem r ne pho pholipid ere l rgely ignored t the time impl e t tic component of mem r ne . It i no cle r th t ome of the pho pholipid re iochemic lly ctive, ith ever l enzyme th t modify them, including pho pholip e , pho pholipid kin e , nd pho pholipid pho ph t e . Some of the e e nzyme h ve v riety of function ec u e their u tr te of product m y e n import nt me enger molecule. For ex mple, PI3K (pho ph tidylino itol-3-kin e) i centr l ign ling kin e ec u e it product, PIP3 (pho ph tidylino itol (3 ,4,5)-tripho ph te) i n ctiv tor for Akt/PKB nd other enzyme th t c n ctiv te ever l ign ling p th y . Pl m mem r ne

   

PI kin e H PIP kin e OH H O O P OH O O P OOPho pholip e C H H O O P OOpho ph tidylino itol [PI] PI 4-pho ph te [PI(4)P] Cytopl m PI 4,5- i pho ph te [PI(4,5)P2] ino itol 1,4,5-tripho ph te [IP3]

The ctiv tion mu t eventu lly end, nd it doe o hen G hydrolyze the GTP o und to it. In thi y, the G ct kind of timer for the ign ling c c de . Thi i import nt ec u e for ign ling to e effective, it mu t e tightly co ntrolled. Very e rly in thi cour e, it pointed out th t C ++ i kept t v ery lo concentr tion in the cytopl m of the cell ec u e e nt C ++- en itiv e mech ni m to e le to re ct quickly to n influx of c lcium, ut e equ lly nt to e le to quickly turn off the ign l needed, nd th t i o viou ly much e ier to do y eque tering m ll mount of C ++ th n lot of it. Simi l rly, if u t ined ctivity of recipient cell i c lled for, it i ccompli h ed y continuou ctiv tion of the receptor nd not y long-l ting effect Ch pter 14, Sign ling, ver ion 0.1 P ge 222

       

Figure 6. Modific tion of Pho ph tidylino itol gener te v riou tive pecie .

iologic lly c

       
A Lig nd 7-tr n mem r ne G-coupled receptor AP2 -Arre tin Cl thrin GDP Trimeric G protein B 7-tr n mem r ne G-coupled receptor P -Arre tin P GTP C AP2 Trimeric G protein Cl thrin GTP Trimeric G protein Endocytic ve icle Figure 7. (A) After GRK pho phoryl te 7-TM receptor, rre tin c n ind. In o me c e , rre ting c n l o ind AP1 nd cl thrin, (B) nucle ting the form tion of cl thrin-co ted ve icle nd endocyto i of the receptor (C).

from ingle ctiv tion. Thi en ure th t if cellul r effect mu t e ruptl y nd quickly cut off, it c n e ccompli hed ithout ignific nt l g period et een ce tion of hormone ecretion nd ce tion of intr cellul r ign ling. The receptor i p rt of nother hutoff mech ni m ell: to prevent over tim ul tion, the receptor re de en itized for hort time fter they h ve ctiv t ed. G-proteincoupled receptor kin e (GRK) pho phoryl te the 7-TM receptor. The pho phoryl tion cre te recognition ite for rre tin . The rre tin h ve v riety of function , the imple t of hich i to ct competitive inhi itor of G-protein inding y the receptor. Thi i rel tively hortlived de en itiz tion. For longer de en itiz tion, rre tin ind to AP2 nd cl thrin, nucle tin g form tion of cl thrin-co ted endocytic ve icle. Thi remove the receptor fr om the cell urf ce, de en itizing the cell for much longer period of time th n imple competition et een rre tin nd G-protein. The rre tin h ve nother potenti l function. They c n ct c ffolding protein th t ring completely different ign ling complex to the 7-TM receptor. Figure 8 ho n ex mple in hich the 7-TM receptor i u ed to ctiv te Jun tr n cription f ctor. Ch pter 14, Sign ling, ver ion 0.1

A Lig nd 7-tr n mem r ne G-coupled receptor AJK-1 JNK-1 -Arre tin MKKY GDP Trimeric G protein B 7-tr n mem r ne G-coupled receptor P -Arre tin P GTP AJK-1 MKKY JNK-1 Trimeric G protein Jun Jun P Jun P Jun 5 Jun P P 3 Tr n cription

Figure 8. Intere tingly, rre tin c n l o ct to initi te completely differe nt type of ign ling c c de from 7-TM receptor. Here, the Jun tr n cription f ctor i ctiv ted. P ge 223

Nucleu

RAS GDP P Y Y Y Y P Y RAS GTP So Solu le R f RTK P P P Mem r ne- ound R f P Gr 2 MAPKKK Nucleu TF P MAPKK MEK P MEK ERK

Receptor Tyro ine Kin e In contr t to the 7-TM receptor , the receptor tyro ine kin e (RTK) p thro ugh the mem r ne only once, nd h ve uilt-in enzyme dom in - protein tyro i ne kin e. RTK mu t dimerize to e function l receptor , lthough individu l RT K c n ind to their lig nd . The lig nd l o dimerize, nd hen dimerized re ceptor i ctiv ted, the kin e dom in cro -pho phoryl te the cytopl mic dom in on the other receptor Lig nd

The - rre tin ring AJK-1, MKKY, nd JNK-1 to ctiv te JNK-1, hich c n then p ho phoryl te Jun. Thi llo tr n loc tion of pho pho-Jun into the nucleu nd u equent dimeriz tion, converting it into n ctive tr n cription f ctor. Wh t re ome of the cellul r ction th t c n e evoked y 7-TM receptor ctiv tion ? C ++ dyn mic ill e ddre ed in ep r te ection. IP3 h een ho n to e voke contr ction of mooth nd kelet l mu cle, ctin polymeriz tion nd cell h pe ch nge , c lcium rele e from intr cellul r tore , opening of pot ium ch nnel , nd mem r ne depol riz tion. cAMP h een implic ted in control of glyco gen re kdo n nd gluconeogene i , tri cyglycerol met oli m, ecretion of e tro gen y ov ri n cell , ecretion of glucocorticoid , nd incre ed perme ility of kidney cell to ter.

 

P P MAPK ERK 3 TF 5 P ERK P = In ctive enzyme = Active enzyme

Ch pter 14, Sign ling, ver ion 0.1 P ge 224

Tr n cription Figure 9. Receptor Tyro ine Kin e c n ctiv te the MAP p th

y.

Gluco e In ulin receptor (receptor tyro ine kin e) P Y Y P Y P Y P Y P RAS Gr 2 P P GLUT4

In ertion in mem r ne IRS-1

P P PI3K PDK1

GLUT4

Figure 10. In ulin receptor ign ling p th

Cytopl mic ve icle

PKB Other ign lling p th

Other

ign lling p th

ith gluco e tr n porter

GTP So Other ign lling p th y

y .

unit. Thi pho phoryl tion i nece ry to form recognition ite for c ffoldin g or effector protein . Figure 9 ho n ex mple of n d pter protein, Gr 2, hich ind to pho phoryl ted SH2/SH3 type dom in on the receptor ell to So ( gu nine nucelotide exch nge f ctor), hich ind to nd ctiv te the GT P e R y exch nging GDP for GTP. Thi i the t rt of very common RTK i ntr cellul r ign ling p th y, the MAP kin e p th y. Follo ing ctiv tion of R , it c n ctiv te R f y pho phoryl tion nd tr n loc ting it from the cytopl m to the inner urf ce of the pl m mem r ne. R f i Ser/Thr kin e ( l o k no n y the un ieldy ut fun to y, MAP kin e kin e kin e) th t pho phoryl t e MEK ( k MAP kin e kin e). MEK i intere ting ec u e it i du l- pecific ity kin e, pho phoryl ting oth Ser/Thr ite ell Tyr ite . The t rget e re p rticul rly intere ted here though, re MAP kin e (mitogen ctiv ted protein kin e), l o kno n ERK (extr cellul r ign l regul ted kin e ). E ch kin e long the c nonic l MAP kin e p th y h other potenti l u tr te e ide the next one in the MAPK equence, o the v riety of cellul r re pon e th t c n e initi ted y thi p th y i very ro d. There re t le t 20 cl e of RTK y tructur l imil rity, including the fi ro l t gro th f ctor recep tor (FGFR) cl , epiderm l gro th f ctor receptor (EGFR) cl , neurotrophin re ceptor (Trk) cl , nd in ulin receptor cl . Some gro th f ctor not only ind uce gro th, ut urviv l, nd ometime prolifer tion. In f ct, mut tion to gro th f ctor c n e oncogenic (c ncer-c u ing). In ulin

          

    

Ch pter 14, Sign ling, ver ion 0.1 P ge 225

JAK JAK JAK JAK JAK JAK JAK JAK P STAT STAT STAT P STAT P P P P P STAT STAT P 4 Dim rization P STAT P STAT 5 P P 3 Transcription Nucl us Fi ur 11. Th JAK-STAT pathway. Activation of cytokin r c ptors can initiat th JAK-STAT pathway. Cytokin s ar n rally immunomo ulatory si nals, som of which act as hormon s an oth rs i n a paracrin fashion. Int rf ron- is an xampl (fi . 11) of a cytokin , an t

One of the pect of cell ign lling th t m ke tudying it oth fun nd fru tr ting i the immen ity of po i ilitie . The in ulin receptor ex mple ove (fig. 10) demon tr te thi . When the receptor i ctiv ted, the IRS-1 c ffolding pr otein ind to it, nd ring ith it inding ite to recruit num er of diffe rent ign ling molecule uch Gr 2-So -R to he d do n the MAPK p th y, ut l o PI3K, hich c n le d to ctiv tion of PDK1 nd Protein Kin e B, import nt in regul tion of gluco e tr n port. PKB ( l o kno n Akt), i l o n import nt medi tor of cell urviv l ( y inhi iting BAD), cell prolifer tion, nd ngiog ene i . IFN 1 2 3

 

 

h inactiv RTK r c ptor bin s to JAK (Janus kinas ) in th inactiv stat . Upon li an bin in to th im riz r c ptor, th JAK units ar activat an th p hosphorylat th r c ptor. This r c ptor phosphorylation l a s to bin in of STA Ts (th cr ativ ly nam si nal trans uc rs an activators of transcription), whic h ar th n phosphorylat by th still-activ JAK. Upon phosphorylation, th STA T-P prot ins issociat from th r c ptor an im riz in th cytoplasm, wh r t h y ar boun by importins an translocat into th nucl us wh r th y act as t ranscription factors. Chapt r 14, Si nalin , v rsion 0.1

Pa

226

Ca++ Si nalin Si nalin by incr asin cytosolic calcium is an important an ubiquitous intrac llular coor ination m chanism. W alr a y saw that r l as of Ca++ in muscl c l ls is r quir to allow contraction of ach sarcom r , an th positionin of th sarcoplasmic r ticulum mak s possibl rapi chan s in conc ntration n arly si multan ous across th ntir c ll. Anoth r xtr m ly important physiolo ical m c hanism that r li s on calcium is f rtilization. Imm iat ly upon p n tration of th by th sp rm, a wav of intrac llular Ca++ incr as spr a s across th startin from th point of f rtilization. This activat s CaMKII (a kinas ) an calcin urin (a phosphatas ). Both ar n to ov rcom m iotic arr st an ma y also b n c ssary in initial mbryonic v lopm nt by control of chromatin c on nsation, nucl ar- nv lop formation, an th mov m nt an fusion of th two nucl i. Th afor m ntion CaMKII is Ca++/calmo ulin- p n nt kinas II, an il lustrat s a fairly common th m , which is th us of Ca++-bin in prot ins as in t rm iat Ca++ s nsin activators. Calmo ulin is a ubiquitous calcium-bin in p rot in in ukaryot s an its importanc is hi hli ht by th xtraor inarily hi h homolo y across sp ci s. In normal cytosolic Ca++ l v ls, th r lativ ly low affinity of th 4 Ca++ bin in sit s on calmo ulin ar unfill . But wh n Ca++ c onc ntrations ris , th y occupy th sit s, causin a conformational chan in ca lmo ulin an allowin it to int ract with oth r prot ins. In a ition to calmo u lin, troponin-C, an PKC, a f w oth r important calcium-s nsitiv prot ins ar c als qu strin, a Ca++ buff r prot in, lsolin, th f-actin s v rin nzym , th prot as calpain, an calr tinin, an activator of uanylyl cyclas (which mak s th s con m ss n r cGMP). Guanylat ( uanylyl) cyclas is also an important pl ay r in si nal trans uction by nitric oxi (NO). Nitric oxi is a as pro uc by th action of nitric oxi synthas (NOS) on th substrat amino aci ar ini n . It is us as a sup r-solubl si nal that pass s throu h c lls asily. How v r, it r quir s r lativ ly hi h conc ntrations for physiolo ical ff ct, so it i s strictly a paracrin factor workin on n ar n i hbors. P rhaps th b st stu i xampl of NO si nalin is vaso ilation, in which th NOS- xpr ssin n oth li al c lls of a bloo v ss l r l as NO to th smooth muscl c lls surroun in th m. Th NO bin s to an stimulat s uanylat cyclas . Th r sultin incr as in c GMP conc ntration l a s to r laxation throu h multipl tar ts of prot in kinas G. Finally, no iscussion of si nal trans uction woul b compl t without at l ast a fl tin m ntion of th xtraor inary crosstalk (fi . 12) that can occur b tw n th iff r nt pathways m ntion . Sil nafil (Via ra) an its ch mical siblin s tak a vanta of this pathway by inhibitin cGMP-sp cific phospho i st ras s (PDE5) which normally br ak own cGM P to limit th r spons to NO. How v r, it shoul b not that thou h PDE5 xpr ssion is limit , it is xpr ss not only in th nitalia but in th r tina a s w ll. Chapt r 14, Si nalin , v rsion 0.1

Pa

227

This fi ur com s from C ll Si nalin T chnolo y, Inc. Th fi ur r pr s nts only on small part of th si nalin that happ ns insi a movin c ll. Not only ar som parts of th c ll formin filopo ia to h lp t rmin wh r to o, oth r parts or rufflin up th lam llipo ia, an still oth rs in ucin motor prot ins to r arran th cytosk l ton in th prop r way to faci litat bulk transport int rnally v n as th l a in of th c ll is thrusti n forwar to mak contacts xt rnally. All of this must b coor inat by cross talk b tw n si nalin syst ms as pict , not to m ntion si nalin r lat to m tabolism, or n xpr ssion, or v n c ll cycl , all of which ar happ nin s imultan ously insi th c ll. Chapt r 14, Si nalin , v rsion 0.1

Pa

228

Fi ur 12. Si nal trans uction in actin

ynamics.

C ll Cycl : Lif cycl of th c ll an Gam to n sis Th Prokaryotic C ll Cycl C lls, wh th r prokaryotic or ukaryotic, v ntually r pro uc or i . For proka ryot s, th m chanism of r pro uction is r lativ ly simpl , sinc th r ar no i nt rnal or an ll s. Th proc ss consists of thr istinct but short phas s: fir st, a rowth phas in which th mass of th c ll is incr as , th n th chromoso mal r plication phas , an finally th chromosom s ar s parat an th c lls a r physically split into two in p n nt n w c lls. In bact ria, th s ar r f r r to as th B, C, an D p rio s, r sp ctiv ly. Initiation of th r pro uctiv proc ss app ars to b primarily a function of c ll siz . Th l n th of th ov ra ll c ll cycl is t rmin by th B p rio , as th C an D p rio s hav r lativ ly fix tim constraints. Th l n th of B is t rmin , in part, by nvironm ntal con itions an th ain in c ll mass. G n ration tim s for bact ria can var y from un r half an hour to s v ral ays, althou h most bact rial cultur s in l aboratory s ttin s an nutri nt-rich m ia hav n ration tim s un r a ay. DN A r plication has alr a y b n cov r in tail in chapt r 7. In bact ria, th proc ss is initiat at th ori in of r plication by DnaA. How v r, in archa a, synchronous initiation of r plication at multipl sit s on th chromosom as w l l as r co nition prot ins homolo ous to ukaryotic ORC prot ins su sts that th r ar similariti s b tw n archa bact rial an ukaryotic DNA r plication to b xplor . Onc th DNA is r plicat an mov to opposit si s of th c ll, th mi c ll s ptum forms to split th c ll. At l ast 9 n pro ucts ar involv in this proc ss inclu in FtsZ, th prokaryotic tubulin homolo u that forms a circumf r ntial rin , FtsI, a p pti o lycan synth tas involv in s ptum forma tion, FtsL, whos function is uncl ar but is involv in in rowth of th c ll wa ll at th s ptum, an ZipA, which anchors th FtsZ rin . Th rin contracts, pul lin th m mbran in with it. Ev ntually th m mbran is pinch in nou h to fu s an n rat two compl t ly s parat cytoplasmic compartm nts. Oth r s ptatio n nzym s mak c ll wall compon nts that fill in as th s ptum forms simultan ou sly with m mbran /FtsZ contraction, an th c lls s parat . Chapt r 15, C ll Cycl , v rsion 1.0 Usin this book: This book is si n to b us in both intro uctory an a van c c ll biolo y cours s. Th primary t xt is n rally on th l ft si of th v rtical ivi r, an print in black. D tails that ar usually l ft to an a va nc cours ar print in blu an foun on th ri ht si of th ivi r. Fina lly, a itional biom ically r l vant information can b foun in r print on ith r si of th ivi r.

Pa 229

Th Eukaryotic C ll Cycl Most ukaryotic c lls un r o a r pro uctiv cycl to n rat ith r anoth r co py of th ms lv s or to n rat am t s (s x c lls), an in oin so r quir a c ompl x m chanism to ov rn th saf an accurat r plication of th ir much lar r (than prokaryot ) nom s. Imm iat ly followin mitosis, th n wly cr at c lls ar in th G1 phas . This is lar ly a rowth phas , urin which th r is a lot of biosynth sis of prot ins, lipi s, an carbohy rat s. How v r, th r is n o synth sis of n w DNA at this tim . G1 is th lon st of th c ll cycl phas s in many c ll typ s, an most of th physiolo ical activity of a c ll happ ns ur in G1. Followin G1, th n xt phas of th c ll cycl is th S phas , urin wh ich synth sis of n w DNA occurs. In oth r wor s, th nom is b in r plicat urin this phas ; thus at th n of S phas , th c ll has twic th normal amo unt of DNA. Aft r S phas , th c ll proc s into G2, which provi s an opportun ity for th c ll to p rform a s lf-ass ssm nt an mak final pr parations (such as mor c ll rowth, r pairs of DNA) as n c ssary b for it finally h a s into m itosis. Mitosis, or M phas , is primarily (1) th br ak own of th nucl us, (2) r - istribution of th DNA to opposit si s of th c ll, an (3) formation of t wo n w nucl i aroun that DNA, an cytokin sis, th final splittin of th c ll its lf. G2 - M Ch ckpoint -DNA fully r plicat ? -Environm nt?

M taphas Ch ckpoint

DNA R plication

G1 - S Ch ckpoint Fi ur 1. Th Eukaryotic C ll Cycl .

Chapt r 15, C ll Cycl , v rsion 1.0

Pa

230

-Environm nt? -C ll lar

nou h to

S Phas

G1 Phas

G2 Phas

C ll Growth an D v lopm nt

-Chromosom s attach

M Phas

to spin l ?

ivi ? -DNA quality?

Mitosis an Cytokin sis Furth r C ll Growth an

D v lopm nt

As th c ll pro r ss s throu h th various phas s of mitosis, an for that matt r, th phas s of th c ll cycl ov rall, it o s so in a sp cific an controll mann r, with ch ckpoints that ask if th c ll is r a y for th n xt st p: is it b i nou h, is th DNA h althy, tc. so that th c ll has th b st chanc of n ratin h althy au ht r c lls. For xampl , if th c ll cycl runs too rapi ly t hrou h ach phas , th n th r is not nou h tim for th c ll to buil up its ma ss in pr paration for r pro uction, an that l a s to abnormally small au ht r c lls, an pot ntially v n au ht r c lls that ar too small to surviv . If a c ll un r o s mitosis with ama or mutat DNA, th n that may incr as th li k lihoo of a patholo ical mutation survivin an harmin th or anism by turnin into a canc rous tumor. Controllin th C ll Cycl Th r ar thr major ch ckpoints for c ll cycl control (fi . 1). Th first r ulat s th transition from G1 to S phas . R call that G1 can b a v ry lon phas , v n (in th cas of G0) as lon as th lif span of th c ll. How v r, onc t h c ll r ach s S phas , it is committ to oin throu h S, G2, an M phas s to r pro uc . This is b caus onc S phas has b un, th r is mor than th norma l iploi compl m nt of DNA insi th c ll. Ov r tim this woul confus th c ll ( . ., by ov r xpr ssion of uplicat n s) as it tri to us th DNA to ir ct RNA an prot in synth sis, an it coul b com sick an i . Th s con ma jor ch ckpoint r ulat s ntry into mitosis. Onc mitosis b ins, most of th m tabolic activity of th c ll is shut own, an th c ll conc ntrat s its r sourc s on ivi in th nucl ar an c llular mat rial qually to support th lif of both r sultin au ht r c lls. If th c ll n s mor tim to mak final r pairs on th DNA or v n to bulk up a littl , this ch ckpoint can hol th c ll in G2 a littl lon r for thos thin s to happ n. Finally, th thir major ch ckpoint occurs urin mitosis, an r ulat s th transition from m taphas into anaphas . Sinc th sist r chromati s ar b in split apart an mov to opposit pol s to form th n w nucl i, it is important that all of th m ar p rf ctly lin up at m taphas an th prot ins hol in th m to th r hav ropp off. If th y o not split v nly, th au ht r c lls will hav abnormal numb rs of chromosom s (an uploi y) usually l a in to l t rious cons qu nc s. What is th mol cular m chanism that r ulat s th pro r ss of th c ll cycl ? Whil many of th ch c kpoint s nsin m chanisms ar still uncl ar, th y s m to conv r on two s ts o f prot ins that act to th r to tri r c ll cycl a vanc m nt. Th s prot ins a r known as th cyclins an th cyclin- p n nt kinas s (c k). As th nam s su st, th cyclins ar prot ins that r ulat pro r ssion throu h th c ll cycl , an Chapt r 15, C ll Cycl , v rsion 1.0

Pa

231

must b pr s nt in suffici nt conc ntration to h lp activat th appropriat c k . Th cyclin- p n nt kinas is th activ , nzymatic, half of th partn rship, an activat s oth r nzym s by phosphorylation. Althou h th cyclins app ar to b n c ssary for c k activation, th y ar not suffici nt, as th r ar int rm i at phosphorylation an phosphorylation st ps r quir to activat th c k aft r cyclin bin in . Both th cyclins an th c ks ar famili s of r lat prot ins , an th y can combin in iff r nt ways to ov rn particular points in th c ll cycl (fi . 2). Int r stin ly, th intrac llular l v l of c ks is fairly consta nt. Th l v l of cyclins, on th oth r han , fluctuat s ramatically p n in o n th stat of th c ll with r sp ct to th c ll cycl . G2 - M Ch ckpoint -DNA fully r plicat ? -Environm nt?

M taphas Ch ckpoint

Cyclin B C k1 Cyclin D Cyclin A C k2 Cyclin E C k2 C k4,6

DNA R plication

G1 - S Ch ckpoint

Th m tho olo y of som of th arly xp rim nts is p rf ctly suit to xplaini n how this works. Th s minal pap r in this fi l was a 1971 pap r in J. Exp. Z ool. by Masui an Mark rt. In it, th y xamin fro (X nopus la vis) s that w r arr st at G2. Th oocyt s arr st for about 8 months naturally in or r to buil up th mass n to start a n w or anism onc it has b n f rtiliz . T h basic qu stion b in ask is what is causin th s to com out of G2 an into M phas ? It was alr a y known Chapt r 15, C ll Cycl , v rsion 1.0 Pa 232

Fi ur 2. Cyclins ar involv

in control of th

-Environm nt? -C ll lar

S Phas

nou h to

G1 Phas

C ll Growth an D v lopm nt

ivi ? -DNA quality? c ll cycl .

G2 Phas

-Chromosom s attach

M Phas

to spin l ?

Mitosis an Cytokin sis Furth r C ll Growth an

D v lopm nt

that th hormon pro st ron can tri r this transition, but what ar th intr ac llular play rs in th chan in c ll stat ? Masui an Mark rt ci to t st wh th r th r was a cytoplasmic mol cul that was r sponsibl . Th y took a smal l amount of cytoplasm from an M-phas an inj ct it into a G2-arr st . This tri r th maturation of th G2-arr st an push it into M phas , v n without pro st ron . Th activity was call maturation promotin facto r (MPF), an was hypoth siz to b a solubl , cytosolic prot in. In lat r xp r im nts, oth r inv sti ators att mpt to fin th sp cific prot in tri r, an from th r , pr sumably, th r st of th m chanism. Fractionatin th M-phas ooc yt cytoplasm by column chromato raphy, a prot in, nam cyclin B, was foun to ris an fall in conc ntration in ir ct synchronization with MPF activity. Furt h rmor , a ition of cyclin B alon was suffici nt to r scu MPF activity from M -phas cytoplasmic xtract that ha b n pl t by RNas tr atm nt (pr v ntin synth sis of any n w prot ins, inclu in cyclin B, an abolishin MPF activity) . This cl arly plac s cyclin B in th for front of th maturation m chanism, but th r was on major issu : cyclin B ha no nzymatic activity. How was it ff c tin th chan s n for pro r ss from G2 to M phas ? This probl m was answ r by xp rim nts on a v ry iff r nt or anism, th fission y ast, Schizosacchar omyc s pomb . B caus th y hav a v ry short cycl tim , a r lativ ly small no m , an th y can b iv n ran om mutations n mass by irra iation or ch mical t r atm nt, y ast ar xc ll nt mo l or anisms for many typ s of biolo ical stu y . Aft r ran om mutation of a population of y ast, th y can b scr n for mutat ions of particular typ s, such as c ll ivision cycl (c c). Wh n th mutations ar s qu nc an i ntifi , th y ar oft n nam by th typ of mutation an o r r of iscov ry. C c2, it turns out, show two int r stin ph notyp s wh n mu tat in opposit ir ctions. Mutations that knock out function of c c2 caus th formation of xtr m ly lar y ast that o not un r o c ll ivision, whil mutations that ma c c2 ov ractiv caus th formation of rapi ly ivi in v ry small c lls. Th int rpr tation was that wh n c c2 is missin or inactiv , th c lls cannot pro r ss to mitosis, so th y stay in G2 accumulatin bulk mat ria l in pr paration for a c ll split that n v r com s. Conv rs ly, wh n c c2 is ov ractiv , it riv s th c ll quickly into mitosis, v n if it has not b n in G2 lon nou h to synth siz nou h mass to form two normal-siz c lls. This ti s c c2 nic ly to c ll cycl r ulation, an it v n has an nzymatic activity: it is a kinas . This ma it a p rf ct can i at as a first-or r coor inator of c llular v nts b caus phosphorylation is fast, phosphorylation usually activat s som oth r nzym , an kinas s usually act on an array of tar ts, not just on . So w now hav a cyclin (i ntifi as c c13 in S. pomb ) an a cyclin- p n nt kinas that work to th r to promot c ll cycl pro r ssion into M phas . Chapt r 15, C ll Cycl , v rsion 1.0 Pa 233

Activation an inactivation of th cyclin-c k compl x As mor mutant y ast w r b in scr n for chan s to th ir c ll cycl , two ot h r Mitotic cyclin Cyclin- p n ant kinas (CDK) n s w r foun in which mutat ions av ris to similar ph notyp s. Nonfunctional c c25 or ov ractiv w 1 mut ants n rat th ov rly lar c lls with a sin l INACTIVE MPF nucl us, an co nv rs ly, ov ractiv c c25 Tyr Thr or inactiv w 1 n rat many s v r ly P W 1 kinas un rsiz c lls. Both c c25 an w 1 n pro ucts int ract with c k, an in fact, th y ar positiv an n ativ r ulaINACTIVE tors of c k, r sp ct iv ly. Actin to th r MPF Thr P with on mor nzym , CAK (c k-activatin kinas ), th y activat th c k (fi . P CDK-activatin kinas 3). Usin th mitotic cy clin/c k compl x as an xampl , th cyclin (c c13) an c k (c c2) com to th r to form an inactiv INACTIVE MPF compl x. Th c k is th n phosphorylat P P by w 1, a kinas . Th phosphat it puts on tyrosin -15 is n for th r st of t h C c25 phosphatas P activation s qu nc , but it is inhibitory: it actually pr v nts final activation. But onc Tyr-15 is phosphorylat , CAK can ACTIVE MPF p hosphorylat a n i hborin thr onin Tyr P (Thr-161), which is r quir for acti vation. Fi ur 3. Activation of mitotic cyclin/c k compl x. Finally, c c25, a pr ot in phosphatas , r mov s th phosphat on Tyr-15, allowin activation of th c k by th phosphorylat Thr-161, an th MPF is finally on its way. Th r is s lf-amplification of th activation as w ll, b caus on of th tar ts of MPF is c c25, so th r is a positiv f back loop in which th activity of c c25 is u pr ulat by phosphorylation. Tyr Tyr Thr Thr As you will s in a lat r s ction of this chapt r, MPF p rforms many functions, som of which pr v nt pro r ss of mitosis past anaphas . Th r for , th r must b a way to turn off MPF (an for that matt r, any cyclin/c k compl x) quickly a n compl t ly wh n th c ll r ach s th appropriat sta of th c ll cycl . Thi s is born out by tim cours stu i s of MPF activity, which show a pr cipitous rop in activity in anaphas . This coinci s with a pl tion of th cyclin B (c c13 in S. pomb ) u to a combinaChapt r 15, C ll Cycl , v rsion 1.0

Pa

234

Conc ntration Fi ur 4. MPF activity an cyclin B prot in xpr ssion ris as th c ll nt rs m itosis but rop just b for anaphas . How v r, c k l v ls r main st a y throu ho ut th c ll cycl . cyclin MPF ph as Pr op ha s M t ap h An as ap ha s T lo ph as In t rp ha s Pr op ha s M t ap ha An s ap ha s T lo ph as In t rp ha s Pr op ha s M t a p h An as ap ha s T lo ph as In t r Mitosis 1 Mitosis 2 Mitosis 3 Ess ntially, MPF nsur s its own struction: on of its phosphorylation tar ts is c c20. Upon phosphorylation, c c20 is activat an th n activat s anaphas promotin compl x (APC). APC is a ubiquitin li as (typ E3) that polyubiquitina t s th cyclin of th MPF compl x, makin it a tar t for prot olytic ra atio n by a prot osom . Not that only th cyclin is stroy , whil th kinas is l ft alon . Without th cyclin, th kinas is inactiv an must wait for cyclin l v ls to ris a ain b for it can b r activat by a fr sh roun of phosphoryla tion an phosphorylation. Activ MPF Mitotic Cyclin Activation CDK Thr P P Ub Ub Ub + P Polyubiquitination Ub C c20 Inactiv APC Activ APC Mitotic Cyclin Ub Ub Ub

tion of turnin off transcription of th n , an sp cific prot olytic ion. Th ra ation pathway is now w ll un rstoo , an is an int r stin l of a sort of f back r ulation. c k

ra at xamp

Ub CDK P

CDK Chapt r 15, C ll Cycl , v rsion 1.0

Pa

235

Fi ur 5. MPF an oth r cyclin/c k compl x s ar inactivat yclin.

by stroyin th c

D ra ation by prot asom

G1/G0 phas Th G1 phas is th stat a c ll is in imm iat ly followin cytokin sis. At tha t point, th c lls will b som what un rsiz , an n to tak up mat rials an n r y sourc s, an conv rt th m to c llular compon nts in or r to support th v ntual c ll ivision. Durin this tim , th c ll o s about oin its normal b usin ss - an n ocrin c ll mak s an s cr t s hormon s, an int stinal pith lia l c ll absorbs nutri nts from th ut an pass s th m on to th bloo str am, a n uron con ucts si nals, tc. Most typ s of c lls sp n th majority of th ir cyc l in G1, althou h th r ar xc ptions, such as th fro oocyt s m ntion arl i r. Th l n th of G1 is n rally constant for a iv n c ll typ un r normal c on itions, but can vary r atly b tw n iff r nt c ll typ s. Post-mitotic c lls , which hav l ft th c ll cycl an will no lon r ivi , ar in G1 until th y i , barrin r activation of th c ll cycl by str ss con itions. This continuo us G1-lik stat is r f rr to as G0. For thos c lls pr parin to mov from G1 into S, cyclins D an E, an c k 2, 4, an 6 pr ominat , with activation of cy clin D compl x s pr c in activation of cyclin E compl x s. Two major qu stions ar ask by th c ll: is th DNA un ama an compl t , an is th xtrac llu lar nvironm nt favorabl for c ll ivision? Th c llular s nsors for th s con itions th n link to cyclin compl x s ff ct r striction points on c ll cycl pro r ssion. Th xtrac llular nvironm nt qu stions can b a tricky on , b caus t his can inclu mor than just ass ssm nt of nutri nt availability or pr atory thr ats; it can also b a r quir m nt for an xt rnal tri r such as a mito ni c hormon or paracrin si nal. In fact, n arly all normal animal c lls r quir a n xtrac llular si nal to pro r ss throu h th G1/S ch ckpoint. Th cyclin E/ c k2 combination is th principal r ulator of ntry into S phas an DNA r plicat ion.

S phas Th m chanisms of DNA r plication w r iscuss in chapt r 7. It is important t o not that onc a c ll has nt r S phas , it has ss ntially committ to oi n throu h c ll ivision. C lls o not cop w ll with xtra copi s of chromosom s, an a c ll that w nt throu h S phas without oin throu h mitosis woul lik ly hav major malfunctions in n r ulation. For similar r asons, th c ll mus t only un r o DNA r plication onc p r c ll ivision. Th cyclinA/ c k2 compl x plays a k y rol in initiation of r plication by activatin th pr -r plicativ compl x. It also phosphorylat s c c6, causin it to issociat from th ORC, an cons qu ntly th r st of th pr -RC. This pr v nts imm iat r -us of this or i in of r plication, an sinc th phosphorylation of c c6 allows it to b r co niz by a ubiquitin li as compl x, it is ta for prot olysis. Chapt r 15, C ll Cycl , v rsion 1.0 Th activ cyclin E/c k2 compl x phosphorylat s th tumor suppr ssor prot in Rb (r tinoblastoma), which caus s E2F to translocat to th nucl us an turn on n s n for ntry into S phas .

Pa

236

In a ition to DNA r plication, S phas is also th c ll cycl sta in which c ntrosom s ar uplicat in animal c lls. Th cyclin E/c k2 combination lic ns s th uplication of c ntrosom , phosphorylatin nucl ophosmin, which th n issoc iat s from th c ntrosom . This h lps to tri r th c ntrosom uplication. Nuc l ophosmin o s not r associat with c ntrosom s until t lophas , wh n it is no lon r phosphorylat . Plk4 (Polo-family kinas 4) activity is n c ssary for c n triol uplication, an app ars to initiat th c ntriol ass mbly m chanism. G2 phas Th G2 phas b ins wh n DNA r plication has compl t . Havin sai that, b for th c ll is allow out of G2 an on to M phas , it must pass a DNA fi lity ch ckpoint, nsurin that not only has r plication b n fully compl t , but that th r ar no major rrors. G2 is a r lativ ly short phas (compar to G1) in mo st c ll typ s, an it is sp nt buil in up n r y an mat rial stor s for c ll ivision an ch ckin th DNA. If v rythin is ok, an th cyclin B/ c k1 compl x has b n activat , th c ll proc s to M phas .

Th ubiquitin li as compl x, SCF, is ma up of thr major prot ins an s v ra l minor sp ci s. Skp1 (S-phas kinas -associat prot in 1) can b an RNA polym ras lon ation factor, but in this compl x links th oth r two prot ins to th r. Cul1 (Cullin 1) is an E3 typ ubiquitin li as . Finally, an F-box family prot in lik Rbx1 (Rin -box 1), that h t ro im riz s with cullin-1 an may also r cr uit E2 ubiquitinatin nzym .. In a ition to c c6, it also r co niz s an ubiqu itinat s CKIs (cyclin compl x kinas inhibitors) such as p27, which is involv in proc ss s such as DNA r pair an rror-ch ckin .

Mitosis Mitosis consists of prophas , m taphas , anaphas , an t lophas , with istinct c llular activiti s charact rizin ach phas . This compl t s th uplication of th nucl us, an is follow by cytokin sis, in which th c ll ivi s to pro u c two au ht r c lls. Int rphas (G2) 1. Prophas ( arly) 2. Prophas (lat )

Int rphas (G1)

Chapt r 15, C ll Cycl , v rsion 1.0

Pa

237

Fi ur 6. spin l th nucl c ll into

Mitosis. Durin mitosis, th nucl ar nv lop br aks apart to allow th acc ss to th chromosom s. Onc th y hav b n mov to opposit n s, ar m mbran r forms aroun ach s t. Finally, cytokin sis ivi s th two n w au ht r c lls.

5. T lophas

4. Anaphas

3. M taphas

Prophas is th pr paration of ach compon nt for this compl x c llular anc . T h DNA con ns s (it is wrapp aroun its lf ti htly to mak it a small r an s tron r packa ) so that it is l ss susc ptibl to br aka urin mov m nt acro ss th c ll. In oin so, most of th DNA b com s transcriptionally inactiv . Th Gol i bo i s an th n oplasmic r ticulum b in to br ak apart into m mbranou s v sicl s that can b mor asily an v nly istribut across th c ll so tha t both au ht r c lls r c iv about th sam . Th c ntrosom s (in animal c lls) mov from th ir ori inal position n ar th nucl us towar opposit si s of th c ll, to stablish th pol s of th mitotic spin l . Fi ur 7. Th mitotic spin l . Th spin l is ma of microtubul s that ori inat from th c ntrosom s, which hav mi rat to opposit si s of th c ll. Th r ar thr typ s of spin l microtubul s: th kin tochor microtubul s (K), pola r microtubul s (P), an astral microtubul s (A). A A K P K P

Chapt r 15, C ll Cycl , v rsion 1.0

Pa

238

MPF phosphorylat s microtubul motor prot ins an microtubul associat prot in s (MAPs) to alt r th normal microtubul ynamics an allow th massiv r or ani zation into a mitotic spin l to occur. For xampl , on tar t of MPF is PRC1, a bun lin prot in that is inactivat by phosphorylation, thus allowin in ivi ual microtubul s to mov to n w locations mor asily than a lar bun l coul . Oth r ff cts ar inactivation of stabilizin MAPs, which l a s to r at r labi lity of microtubul s u to incr as inci nc s of catastroph . Th motor prot in tar ts of MPF ar in th kin sin family an th phosphorylation is n c ssary for som of th m to bin to th mitotic spin l . Prom taphas is som tim s cons i r a s parat phas but is also r f rr to as lat prophas , an is primari ly fin by th br akup of th nucl ar nv lop . This proc ss is in uc by MP F phosphorylation of th nucl ar lamins. A orn with n ativ char s from th phosphat s, th lamins r fus to associat with on anoth r any lon r, l a in to th br ak own of th nucl ar lamina. As th lamins issociat , th nucl ar n v lop r mains boun to th m, an fra m nts. This nucl ar fra m ntation must hap p n so that th mitotic spin l can r ach insi an attach to th chromosom s.

Som of th microtubul s of th mitotic spin l attach to th chromosom s via th kin tochor prot ins, which link th spin l microtubul s to th c ntrom r r ion of ach chromosom . Th s ar known as kin tochor microtubul s (fi . 8). T h r ar two oth r typ s of microtubul s in th mitotic spin l (fi . 7): th po lar microtubul s that r ach across th c ll an int ract with on anoth r to h l p maintain th s paration of th c ntrosom s an finin th ov rall l n th of th spin l , an th ast r microtubul s that ar n rally short, ra iatin out from, an stabilizin th c ntrosom . R m mb r that th DNA r plicat arli r i n S phas , an thus sist r chromati s ar still partially attach . Visually, th c ntrom r r ion app ars narrow r or mor compr ss than th r st of th chr omosom , an n rally li s n ar th mi l . Th c ntrom r contains r p at s qu nc s that ar involv in kin tochor bin in an ass mbly. In primat s, th r p atin motif is known as alpha sat llit DNA, which is ma of multipl instanc s of tan m r p ats of a cor ~170bp s qu nc ov r a c ntrom ric DNA span ov r a m abas in l n th. Similar r p ats ar foun in various ot h r v rt brat s as w ll. In oth r ukaryot s, th siz an s qu nc may vary; fo r xampl , much short r r p ats of ~5bp ar foun in c ntrom ric DNA m asurin 2 00-600kb in Drosophila chromosom s, an S. pomb has c ntrom ric DNA w ll un r 10kb. Inn r Kin tochor Lay r CENP-E MCAK Out r Kin tochor Lay r GDP GDP GDP GDP GDP GDP

GDP GDP Dyn in Fibrous Corona Chromosomal DNA Fi ur 8. Th kin tochor ass mbl s on th c ntrom r of th chromosom . Spin l microtubul s attach to th fibrous corona of th kin tochor throu h kin sins a n yn ins. Th kin tochor s attachin to th c ntrom r DNA ar trilaminar prot in structur s consistin of an inn r lay r, an out r lay r, an a fibrous corona. Th kin t ochor microtubul s of th mitotic spin l ar primarily attach to th fibrous corona. As pict in th fi ur , it is attach throu h CENP-E, a kin sin, an yn in motor prot ins that bin alon th barr l of th microtubul . In fact, som tim s th first contact b tw n a chromosom (via th kin tochor ) an a spi n l microtubul is som wh r

Kin tochor Microtubul

GDP

Chapt r 15, C ll Cycl , v rsion 1.0 Pa

239

in th mi l of th microtubul , an a combination of microtubul ynamics an motor prot in activity mov th chromosom to th istal n of th microtubul . This is facilitat by MCAK (mitotic c ntrom r -associat kin sin), which is a ssociat with th kin tochor cor prot ins an plays a rol in polym rizin microtubul s n ar th (+) n . As th nucl ar nv lop is br akin apart, th mi totic spin l microtubul s ar un r oin incr as ynamic instability, cyclin b tw n p rio s of rowth spurts (polym rization) an rapi short nin (catastr ophic isass mbly), s archin for chromosom s to conn ct to. Onc th kin tochor microtubul s conn ct to th chromosom s, th microtubul ynamics shift. Th m icrotubul will primarily un r o short nin if it is b yon th c nt r of th s pin l an primarily l n th nin if it is short of c nt r. Sinc v ntually ach s t of sist r chromati s is conn ct to microtubul s on both kin tochor s, ac h chromati is conn ct to on short nin an on l n th nin microtubul . As t h chromosom s approach th c nt r of th mitotic spin l , th rat of microtubu l short nin /l n th nin slows. Th sist r chromati s ar push an pull by th spin l microtubul s Fi ur 10. A c ll at m taphas . Mi r n, f-actin until th y ar all lin up alon th mi lin of th mi- crotubul s ar stain chromo som s, is stain r , an totic spin l , which in most (but not all) cas s is a lso with c ntrom r s lin up alon th th mi lin of th c ll. Onc th y ar a ll lin up, th mi lin , ar stain blu . Not th surroun in c lls, which ar not in c ll is consi r to hav r ach m taphas . Unlik mitosis, with th i r MT an MF cyth oth r phas s, m taphas is a r lativ ly static phas tosk l to ns mor ov rlapp . This photo r l as to public omain by th US ov rm nt. it is a ch ckpoint for linin up th chromosom s. Th chromosom s must b prop r ly ali n to nsur that both au ht r c lls r c iv th prop r compl m nt of c hromosom s. How o s th c ll know wh n th chromosom s hav r ach th c nt r of th spin l ? An l antly simpl xp rim nt monstrat that th n ral m c hanism is a t nsion ch ck - if th two microtubul s conn ctin to th pair of si st r chromati s from ach si ar of th sam l n th, th y shoul b x rtin qual t nsion on th chromosom s. If th microtubul -kin tochor conn ction is s v r at m taphas , th c ll will b pr v nt from pro r ssin (Nicklas, R.B., t al, J. C ll Biol. 130: 929-39, 1995). How v r, if an quival nt t nsion is ap pli by tu in on th chromosom with a lass micron l , pro r ssion of mito sis is r stor !

A (+) (-) (+) (-) B (+) (-) (+) (-) C (+) (-) (-) (+) (+) (+) (-) (-)

Fi ur 9. Mol cular motors s t up th

mitotic spin l .

Th transition from th int rphas microtubul cytosk l ton to a mitotic spin l r quir a numb r of mol cular motors to mov th c ntrosom s, ali n th microtu bul s, an xpan th spin l . Th s ar pict in fi . 9. Initially, as th uplicat c ntrosom s mov away from ach oth r alon with som of th cytosk l tal microtubul s, th microtubul s will int ract at various an l s. B caus th polar microtubul s that h lp to xpan or maintain th spin l wi th must in rac t in parall l, cytoplasmic yn ins bin to th v ntual polar microtubul s an b y movin on alon th oth r, brin th m into parall l (9a). Onc in that positi on, BimC an oth r kin sins tak ov r as th primary motors alon polar microtub ul s. Th y cr at an outwar pushin forc by hol in onto a microtubul facin on ir ction, an rivin alon a parall l MT facin th opposit ir ction tow ar s th (+) n (9b). Finally, cytosolic yn ins attach to cortical cytosk l ton pull on th astral microtubul s, which pulls th spin l n s furth r from c nt r (9c).

Chapt r 15, C ll Cycl , v rsion 1.0

In in b h Pa

fact, th r app ar th t nsion s nsin important in susp spin l microtubul 240

to b two m chanisms at work: th bub1/ bub2 syst m works pathway, whil anoth r m taphas prot in, ma 2 app ars to n in mitosis upon isconn ction of th kin tochor with t .

In a ition to th t nsion ch ck, th r is anoth r con ition that must b m t fo r continuation of mitosis: th MPF must b inactivat . As outlin arli r, MPF in part l a s to its own inactivation by activatin th anaphas -promotin comp l x (APC), which polyubiquitinat s th cyclin, l a in to its struction an th us MPF-c k inactivation. APC also ta s s curin for struction. S curin is a pro t in that bin s an inhibits th prot olytic nzym , s paras , th activation of which is n to allow th sist r chromati s to s parat , which in turn, is n c ssary for anaphas to proc . Barrin patholo ical situations, if an only i f th chromosom s all lin up at th m taphas plat will th c ll proc to th n xt sta of mitosis: anaphas . Th sist r chromati s s parat an ar pull towar opposit pol s of th mitotic spin l . Som what p rv rs ly, v n as th chromosom s mov towar s th spin l pol s, th pol s th ms lv s mov outwar sl i htly. S paration of th sist r chromati s r quir s th issociation of th mol cular lu hol in th m to th r: th coh sin prot ins. Th coh sins bin to both mol cul s of DNA an hol th m to th r shortly aft r r plication back in S pha s . As anaphas approach s, th nzym s paras is activat , which th n cuts th coh sin mol cul s. Onc all of th coh sin mol cul s ar cut, th sist r chrom ati s can finally b s parat . Th r moval of th coh sins proc s rou hly inw ar s from th istal points of th chromosom s to th c ntrom r , which is n r ally th last r ion of attachm nt. Anaphas can actually b ivi into two st a s, som tim s r f rr to as arly an lat or A an B. At first, th kin toch or microtubul s ar short nin from both n s, an kin sin-family motors pull t h microtubul s back towar th spin l pol s. As lat anaphas starts, polar mi crotubul s lon at , an an a itional chromati -s paratin forc is appli by kin sin-family motor prot ins [kin sin-5] that push th polar microtubul s a ain st on anoth r to incr as th s paration b tw n th pol s. Dyn infamily motors h lp to ir ct mov m nt of th pol s as w ll, throu h th ir attachm nt to th a st r microtubul s an th cortical (p riph ral) cytosk l ton. Wh n both s ts of chromosom s arriv at th ir r sp ctiv pol s, t lophas b ins. T chnically, it was slowly buil in up sinc anaphas : wh n MPF was inactivat by APC, its abil ity to phosphorylat nucl ar lamins was n . Prot in phosphatas s in th c ll r mov th phosphat roups, allowin th lamins to onc a ain int ract with on anoth r, an by t lophas th y ar r constitutin th nucl ar lamina an th nu cl ar nv lop . Sinc th lamins an oth r nucl ar m mbran prot ins also int ra ct with DNA, th nucl ar m mbran fra m nts isp rs back in lat prophas now coal sc aroun ach s t of DNA to form th n w nucl ar nv lop s. Th oth r fra m nt m mbranous or an ll s (ER, ol i) also start to r -form. By th n of t lophas , th pro uct is a sin l lar c ll with two compl t nucl i on opposit si s. Th n xt an Chapt r 15, C ll Cycl , v rsion 1.0 Pa 241 A coh sin is a multim r of four subunits, Scc1, Scc3, Smc1, an Smc3 in y ast. A n a itional prot in has also b n obs rv in X nopus. Th SCC1 prot in is cl a v by s parin in y ast, but in m tazoans, SCC1 may b r mov from chromosom s by anoth r m tho as w ll. It is phosphorylat , which cr as s its affinity fo r DNA, an may xpos a sit for s paras -catalyz hy rolysis. S paras also pr omot s anaphas by activatin C c14, a phosphatas n to phosphorylat th c k substrat s that ha b n phosphorylat by th cyclin-c k compl x s of arl y mitosis. In a ition, C c14 is also r quir for cytokin sis in th y ast S. c r visia an n mato C. l ans.

Th cont nts of th v sicl s trav lin alon th phra moplast ar not w ll scr ib . Callos , a lucos polysacchari with b1-3 linka s is known to b pr s n t in th v lopin c ll plat , but has not b n foun in th Gol i or v sicl s. Int r stin ly, onc th c ll plat has fus compl t ly with th xistin c ll walls, callos ra ually isapp ars. It is thou ht that th sam nzym syst m t hat synth siz callos may switch to synth sizin c llulos as th c ll plat m atur s.

Pa

242

last st p, cytokin sis, splits th c ll into two s parat an in p n nt au ht r c lls. In animal c lls, cytokin sis is similar to th ti ht nin of a rawstr in in th mi l of th c ll, pullin th waist in until all s m t, an two s parat c lls r sult. This contractil rin is compos of actin (structural) a n myosin (motiv ) subunits. Th s prot ins, usin ATP for n r y, ratch t th ms lv s clos r an clos r to th r similar to th actin-myosin pow r strok scrib for muscl c ll sarcom r s, also primarily ma from actin an myosin. This m chanism is univ rsal for animal c lls, but th plac m nt of th rin is not alwa ys in th c nt r of th c ll. Th rin oft n coinci s with th c nt r of th c ll, but is in fact position by th m taphas plat (i. . th c nt r of mitotic spin l ). Th most obvious xampl of a m taphas plat that o s not coinci with th c nt r of th c ll is foun in th formation of c lls. B caus th purpos of an c ll is to provi all of th mat rial n c ssary to mak a via bl n w or anism upon f rtilization (th sp rm contribut s n li ibl biomass b yon th n tic mat rial), it ivi s asymm trically, with th mitotic spin l locat far to on si Fi ur 11. T lophas / Cytokin sis. Th contracstain of th c ll (fi . 19). Wh n cytokin sis occurs, til rin an oth r actin structur s ar an th r n, th microtubul s ar oran , on au ht r c ll, th pr sum oocyt , is v ry chromosom s ar blu . Photo r l as to public olar , whil th oth r c ll, call a polar bo y, main by US ov rnm nt. has minimal cytoplas mic mat rial surroun in th nucl us. Th contractil rin works in animal c lls b caus th c ll m mbran is fl xibl . In plant c lls, th c ll m mbran is fir mly at- A B tach to a ri i c ll wall, an thus cannot b pull in. So, th p lant c ll in niously buil s a wall own th mi l of th c ll usin sp cializ v sicl s that ori inat from part of th Gol i, an which contain th mat rial s n c ssary to form a c ll wall. Th v sicl s trav l alon th C phra moplast, a structur built from th mitotic spin l microtubul s, an as th v sicl s lin up alon th mi l of th c ll, th y b in to fus to form bi r v sicl s an th n a lar isk-lik v sicl , th c ll plat . Ev ntually th y r ach th c ll m mbran its lf, an fusin with Fi ur 12. Cytokin sis in plant c lls. Gol ifil l with c ll wall mat rial that l a s to formation of a n w c ll wall, an ri v v sicl s phra moplast an fus in th trav l alon th two compl t an in p n nt c lls. c nt r to form a n w c ll wall. Chapt r 15, C ll Cycl , v rsion 1.0

C ll D ath A c ll may i ith r int ntionally (usually r f rr to as apoptosis or pro ram m c ll ath, thou h also onc known also as c llular suici ), or unint ntional ly (n crosis). Th microscopic obs rvation of th s two proc ss s shows strikin ly iff r nt m chanisms at work. In apoptosis, th c ll b ins to shrink an los shap as th cytosk l ton is ra , th n th or an ll s app ar to pack to th r, xc pt for th nucl us. Insi th nucl us, th chromatin con ns s an at tach s to th nucl ar nv lop , which th n los s its int rity an starts to br ak apart. Th c ll m mbran b ins to show irr ulariti s, scriptiv ly known a s bl bs, an v ntually, th c ll br aks apart into v sicl s that ar n atly cl an up by pha ocyt s rawn to th sit by apoptotic si nals mitt by th yin c ll. N crosis, on th oth r han , is quit lit rally a m ss. Th c ll app ars to sw ll an th plasma m mbran b ins to los its int rity. It is soon catas trophically l akin cytoplasm, an l av s b hin c ll bris that can accumulat an tri r n crotic ath of a jac nt c lls. A B Fi ur 13. (A) A c ll un r yin by n crosis is isor aniz , n rally bursts a n l aks its cont nts. (B) A c ll un r oin apoptosis first sub ivi s its lf, i stin its lf in an or rly fashion an compartm ntalizin v rythin for sca v n in by pha ocyt s.

Chapt r 15, C ll Cycl , v rsion 1.0

Pa

243

Apoptosis is ultimat ly put into action by a casca of caspas s, a family of pr ot olytic nzym s. This family of nzym s is n rally pro uc as pro nzym s th at ar activat by oth r m mb rs of th caspas family. Thus a casca ff ct o ccurs, aft r th initial tri r activatin on s t of caspas s, th y can th n c l av a vari ty of prot ins inclu in procaspas s that ar th r by activat an can hy rolyz v n mor prot ins, inclu in y t anoth r typ of procaspas , an so on. Of cours , oth r nzym s ar also activat an participat by wi nin th r spons , activatin oth r roups of prot as s an apoptotic nzym s. Tri rin th apoptotic casca is usually on of two n ral pathways: an int rnal t ri r, arisin from ama to th mitochon ria, an an xt rnal tri r, start by bin in an xtrac llular si nal mol cul to activat

a ath r c ptor. Althou h th r ar many variations on both tri rs, th y follow similar paths to th xampl s w will us h r . If you r call th s ction on l ctron Mitochon rion transport in oxi ativ phosphorylation, Apaf-1 th n you may also r call th solubl l ctron carri r, cytochrom c. This prot in is xclusi v ly foun in th mitochon rial matrix un r normal circumstanc s, so cytochrom c its pr s nc in th cytoplasm can b takGroupin of Apaf-1 n to in icat mit ochon ria in istr ss. an cytochrom c Giv n th importanc of mitochon ria in provi in th n r y for most a robic c lls to carry out th ir normal lif , Casc a l a in to apoptosis such istr ss is an arly in icator that Procaspas 9 C aspas 9 th c ll will i soon. Th ia ram at ri ht shows a sampl pathway tha t can caus cytochrom c l aka from th Procaspas 3 Caspas 3 mitochon ria, b ut mitochon ria can also just t ol , an if th c ll is proProcaspas 6 Caspas 6 ramm (by transcription factors) not to r plac failin compon nts, th n as th mitochon rial m mbran s los in- Fi ur 14. Apoptotic si nalin casca s may b initiat by l aka of cytochrom c into cytoplasm. t rity an allow cytochr om c out, it is a cl ar si nal to initiat t rmination protocols, to us th pa rlanc of sci nc fiction nov ls. Th cytochrom c is boun by APAF-1 (apoptotic prot as activatin factor 1) which oli om riz s to form an apoptosom ma of 7 APAF-1 mo cul s an 7 cytochrom c mol cul s. Th apoptosom bin s an activat s procaspas -9 to initiat a caspas casca that continu s with activation of procaspas -3. Wh n th mitochon ria l aks cytochrom c, it also l aks anoth r ap optotic prot in, SMAC/Diablo. This prot in, amon oth r functions, inhibits IAP (inhibitor of apoptosis) -family prot ins. Th IAP prot ins normally inhibit cas pas activation both ir ctly an in ir ctly to pr v nt c ll ath, an SMAC/Dia blo blocks that inhibition. Wh n ath r c ptors ar activat , th subs qu nt c aspas casca o s not involv th mitochon ria or APAF-1. Th b st stu i cas , FasR (Fas r c ptor) activat s caspas s 2, 8, an 10 by clippin procaspas s a n by r l asin caspas s from inhibitin compl x s. Th s activat caspas s 3, 6 , an 7, which l a s to th final sta s of apoptosis. In both int rnally an x t rnally tri r apoptosis, th final st ps ar th sam : som of th final ta r ts of th caspas s ar th nucl ar lamins an ICAD (inhibitor of casChapt r 1 5, C ll Cycl , v rsion 1.0 Pa 244

TNF- TNFR p e- ctiv ted DN e). De troying the nucle r l min le d to fr gment tion of t he nucle r envelope, hile removing ICAD ctiv ted the c p e- ctiv ted DN e ( CAD) hich then egin to dige t the DNA. Why doe the popto i mech ni m exi t? There re t o m jor ( nd m ny other) re on TRADD for popto i . The fir t i development l. In FADD the development of n org ni m, the mo t effective tr tegy i often to h ve overgro th of C c de le ding Proc p e 8 C p e 8 to popto i cell th t re then pruned ck to the proper form tion . Ex mple of thi re the poptotic de th of ti ue et ee n initi lly connected finProc p e 3 C p e 3 ger nd toe ( e hum n t rt ith e ed finger nd toe em ryonic lly), nd de th of unconnected or improper ly connected neuron . Proc p e 6 C p e 6 The l tter c e l o illu tr te fund ment l Figure 15. Apoptotic ign ling c c de m y e principle in m mm li n cell iology, nd mo t t rted y extern l ctiv tion of de th recepother ver te r te ell: cell require ign l tor uch F R. (trophic f ctor ) to t y live. In thi ex mple, the neuron th t do not m ke proper connection to t rget cell do not receive the nece ry trophic f ctor ( ecreted y the t rget) . Thi le d to poptotic de th of the unconnected neuron. In f ct, if popto i i locked due to mut tion to gene in the p th y, there i evere overgro th of the r in nd pin l cord, c u ing eriou m lfunction nd cr niof ci l defo rmitie . Thu in development, popto i i nece ry to control the gro th of di fferent p rt of met zo n org ni m. DD

Ch pter 15, Cell Cycle, ver ion 1.0 P ge 245

The other m jor function for popto i i to kill d ngerou cell . In ome c e , the e m y e cell infected y p thogen. In other , the cell h ve ccumul t ed mut tion th t do h ve ffected the DNA error-correction y tem or cell-cycle checkpoint . When the former occur , e ch gener tion h n incre ed likelihoo d of even more mut tion . It i import nt to ctiv te popto i in uch cell e fore they h ve ch nce to cquire error th t remove ll cell cycle checkpoint , llo ing unchecked cell prolifer tion. Thi could le d to tumor form tion nd potenti lly c ncer ( ee next ch pter). When uch cell need to e killed for th e enefit of the org ni m, it m y h ppen y the triggering of n intern l en or uch mitochondri l d m ge, or y extern l me n , uch n immune y tem ce ll recognizing n infected cell.

  

Meio i In met zo , there re t o itu tion in hich cell give ri e to d ughter cell . The fir t, nd y f r mo t common, i mito i . The econd i meio i . Meio i i the proce y hich g mete ( ex cell ) re gener ted. Anim l nd pl nt re gener ted y exu l reproduction (if thi i ne to you, ple e con ider m j oring in omething other th n iology). The e org ni m t rt life through the f u ion of t o cell : perm nd n egg. Both contri ute genetic m teri l to the ne org ni m. In order to m int in the proper num er of chromo ome in e ch gene r tion, the g mete e ch contri ute one et of chromo ome , o th t the fertiliz ed egg nd ll other cell in the org ni m h ve t o et of chromo ome one from e ch p rent. The purpo e of meio i , nd it prim ry difference ith mito i , i not gener ting d ughter cell th t re ex ct replic te , ut gener ting d ught er cell th t only h ve h lf the mount of genetic m teri l the origin l cell . Let u t ke look t thi itu tion elfi hly: meio i in hum n eing . Almo t every cell in your ody h nucleu cont ining 46 chromo ome , et of 23 f rom your f ther, nd et of 23 from your mother. The only exception re the g mete : the perm tocyte in men nd the oocyte in omen. The om tic cell re id to e 2n or diploid, th t i h ving 2 et of chromo ome , nd the g mete re 1n or h ploid, h ving only one et of chromo ome . Sometime , meio i c n e little confu ing to tudent ec u e it occur in the me p rt of the cell cycle mito i , hich i to y fter G2. Bec u e of thi , the cell entering m eio i ctu lly h 4 et of chromo ome , ince the DNA h lre dy undergone r eplic tion in S ph e. Meio i con i t of t o con ecutive meiotic divi ion e c h of hich h ph e imil r to mito i : proph e, met ph e, n ph e, teloph e, nd e ch of hich fini he ith complete cytokine i . Note th t immedi tely follo ing meiotic teloph e I, the cell divide , nd oth d ughter cell re imm edi tely in proph e II. There i no intervening G1, S, or G2 ph e. Proph e I of meio i egin very imil rly to proph e of mito i : MPF (mitotic-cdk) ctiv tion, chromo ome conden tion, pindle form tion nd nucle r envelope re kdo n . Ho ever, comp red to mito i , meiotic proph e I l t for very long time n d c n e u divided into five t ge : leptotene, zygotene, p chytene, diplotene, nd di kine i . During leptotene, the t o et (m tern l nd p tern l) of i te r chrom tid for e ch chromo ome conden e, lign nd form tructure kno n iv lent. To cl rify, thi iv lent con i t of four copie of given chromo o me: t o copie e ch of the m tern l chromo ome nd of the p tern l chromo ome. B ec u e the m tern l nd M ture red lood cell cont in no nucleu , nd ome mu c le cell , hile multinucle ted ec u e they form from the fu ion of ever l myo l t , neverthele h ve 46 chromo ome in e ch of the nuclei. Polyploidy, hile uncommon in hum n , i norm l t te for m ny org ni m . The frog, Xenopu l e vi , common re e rch nim l, i tetr ploid. Ch pter 15, Cell Cycle, ver ion 1.0 P ge 246

  

  

              

p tern l ver ion of given chromo ome re kept in extremely clo e proximity fo r n extended period of time, there i gre ter ch nce of recom in tion, or c ro ing over nd exch nge of homologou piece of e ch chromo ome. 1 Leptotene 2 Zygotene 3 P chytene 4 Diplotene

Figure 16. The five t ge of Meiotic Proph e I. Recom in tion occur hen piece of the p tern l chromo ome i pped for the homologou piece of DNA on the m tching m tern l chromo ome (or vice ver ). Not e th t i ter chrom tid (i.e. ex ct copie ) do not recom ine - only homologou non- i ter chrom tid c n recom ine. O viou ly, thi kind of DNA p mu t e done c refully nd ith equiv lence, o th t the re ult nt DNA on e ch ide cont in ll the genetic inform tion it i uppo ed to, nd no more inform tion th n it i uppo ed to. In order to en ure thi preci ion in recom in tion, the noni ter homologou chrom tid re held together in yn ptonem l complex (SC). T hi l dder-like complex egin to form in the zygotene t ge of proph e I nd c omplete in p chytene. The complete SC con i t of protein ceou l ter l element ( k xi l element ) th t run long the length of the chrom tid nd hort c entr l element compo ed of fi rou protein forming the rung of the l dder perp endicul r to the t o l ter l element . The centr l element i formed of tr n ver e fil ment dimer th t inter ct ith one nother in off et f hion, ell ith the l ter l element . The e fil ment protein (e.g. SCP1 (mou e), Zip1p (ye t)) h ve centr l coiled-coil region th t function protein inter ction dom in . Although SCP3 nd therefore complete l ter l element form tion re unnece ry for function l yn ptonem l complex, conden in nd cohe in do ppe r to e nece ry for proper tr n ver e fil ment tt chment of the l ter l element . Ch pter 15, Cell Cycle, ver ion 1.0 L ter l element re compo ed ever l protein , including conden in nd cohe in . The cohe in re meio i - pecific v ri nt , ith u titution for the Scc1 nd Scc3. Like i e, conden in u unit l o h ve meio i - pecific llele . In dd ition to the conden in nd cohe in , hich other th n their meiotic- pecific v ri nt , re common chromo om l protein , there re SC- pecific protein , includi ng SCP2 nd SCP3. Both re loc lized to conden ed chromo ome in e rly meio i , nd SCP3 h een ho y knockout n ly i to e nece ry for l ter l element form tion. Ho ever, it i not nece ry for recom in tion. P ge 247

 

  

  

5 Di kine i

5 3 3 5 3 5 5 3

5 3 3 5 3 5 5 3

5 3 3 5 5 3 3 5 3 5 5 3

5 3 3 5 3 5 5 3 5 5 3 One ingle- tr nded 3 t il inv de the other DNA duplex 5 3 3 5 3 5 5 3 5 3 3 5 3 5 5 3

5 3 3 5 3 5 5 3 5 3 3 5 3 5 5 3

DNA rep ir enzyme ll in g p

2nd end c pture form DNA heteroduplex, r nch migr tion, t o Hollid y junction re olve 5 3 3 5 3 5 5 3 5 3 3 5

Single Hollid y junction re olve

DNA rep ir enzyme ll in g p

y rever ing inv ion

G p i

idened, le ving t o 3 overl pping t il

Dou le tr nd

re k in one duplex

Homologou

DNA duplexe

lign

3 5 5 3 Cro over No Cro over

Recom in tion m y occur ith or ithout the form tion of dou le- tr nd re k , nd in f ct, c n occur ithout the form tion of the yn ptonem l complex, lthoug h the SC pro ly enh nce the efficiency of recom in tion. In S. pom e, meio i occur ithout the form tion of yn ptonem l complex, ut there re m ll di continuou tructure ome h t imil r to p rt of the SC. In the fruit fly, Dro ophil mel nog ter, fem le undergo meio i u ing yn ptonem l complex, ut m le do not undergo meiotic recom in tion, nd their chromo ome do not form y n ptonem l complexe . In mo t c e , recom in tion i preceded y the form tion of recom in tion nodule , hich re protein complexe th t form t potenti l poi nt for recom in tion. The e t tudied mech ni m for meiotic recom in tion invo lve dou le- tr nded re k of one of the chromo ome initi ted y the meio i pecific endonucle e, Spo11. The 5 end (one in e ch direction) of thi cut re degr ded lightly to form 3 ingle- tr nded overh ng . Thi le d to the form tio n of Hollid y junction ith tr nd from one chromo ome cting templ te f or mi ing portion of the homologou cut chromo ome. Thi m y e re olved one of t o y , ith or ithout cro over, illu tr ted (fig. 17). Ch pter 15, Cell Cycle, ver ion 1.0 P ge 248

Figure 17. Recom in tion of homologou

  

chromo ome .

Proph e I (e rly) Proph e II Proph e I (l te) Met ph e II Met ph e I An ph e II An ph e I Teloph e II Teloph e I

Figure 18. Meio i gener te 4 h ploid d ughter cell from one diploid precur or . To do o, it undergoe t o round of meiotic nucle r nd cell divi ion, After convention l n ph e nd teloph e, the cell plit , nd immedi tely th e d ughter cell egin the econd meiotic divi ion (fig. 18, right ide). In om e cell type , chromo ome do not deconden e in meiotic teloph e I, ut if they h ve, they re-conden e Ch pter 15, Cell Cycle, ver ion 1.0 P ge 249

H ploid D ughter Cell

The recom in tion i initi ted in p chytene nd complete in diplotene, t hich time the yn ptonem l complex re k do n. A the chrom tid egin to ep r te, chi m t ecome pp rent t ome of the recom in tion ite . A proph e compl ete , the chi m t re olve from the center of the chromo ome to the end . A t he cell goe from meiotic proph e I to meiotic met ph e I, nother difference et een mito i nd meio i i reve led: the chromo ome line up t the met ph e pl te tetr d r ther th n p ir . Bec u e of thi , hen they pull p rt i n n ph e, et of i ter chrom tid egreg te to oppo ite pole . Of cour e, du e to recom in tion, the i ter chrom tid re unlikely to till e identic l.

 

Prim ry oocyte Peripher l po itioning of meiotic pindle Meiotic divi ion I

Pol r ody + Second ry oocyte Meiotic divi ion II Pol r odie + M ture ovum Figure 19. Oogene i . Ch pter 15, Cell Cycle, ver ion 1.0 P ge 250

Arre ted in met ph e II of meio i

Arre ted in proph e I of meio i

in meiotic proph e II. Proph e II proceed imil rly to mitotic proph e, in t h t there i no form tion of yn ptonem l complexe or recom in tion. At met ph e II, the i ter chrom tid line up long the met ph e pl te ju t in mito i , lthough no there re only 2n chromo ome in the cell, hile in mito i ther e ould h ve een 4n ( ec u e the DNA h replic ted). Ag in, fini hing the re t of the divi ion lmo t ex ctly like mito i , the i ter chrom tid pull p rt i n n ph e II, the nucleu reform in teloph e II, nd the fin l cytokine i ge ner te tot l of four cell from the origin l one th t entered into meio i , e ch cont ining 1n chromo ome . Egg cell , genetic nd ulk m teri l donor , n eed to e l rge ut perm cell , genetic donor only, do not. The di gr m el o depict the gener tion of the egg cell . Only one oocyte i gener ted from meiotic event; the other three d ughter cell re termed pol r odie , nd cont in o little cytopl mic m teri l th t they re only vi le for hort time. Th e ymmetric di tri ution of cytopl m in the fir t meiotic divi ion for oocyte i due to the po ition of the meiotic pindle in the periphery of the cell r th er th n centered. Since the center of the pindle determine the po ition of the contr ctile ring for cytokine i , thi le d to unevenly ized d ughter cell . Oogonium Mitotic divi ion Prim ry oocyte

   

The gener tion of the very m ll perm i different mech ni m ltogether. In t he meiotic tep of perm togene i , the cell divi ion re equ l, ith the meio tic pindle ligned ith the center of the cell, nd the cell h ve equ l mount of cytopl m, much like n ver ge cell th t h undergone mito i . The tre m lined, minim l-cytopl m m ture perm i product of po t-meiotic differenti ti on, in hich it g in the fl gell r t il, nd eject mo t of it cytopl mic m t eri l, keeping only ome mitochondri to po er the fl gell , nd n cro om l ve icle, th t cont in the enzyme nd other molecule needed to re ch nd fu e i th (i.e. fertilize) n egg. Type A1 perm togoni Type A2 perm togoni Type A3 perm togoni Mitotic divi ion

Di erenti tion

Not ll org ni m reproduce ith the hum n-like egg nd perm mech ni m, i.e. g metic meio i . A ju t de cri ed, in g metic meio i life cycle, meio i gener te h ploid g mete , hich then fu e/fertilize to ecome diploid zygote. The zygote ecome multicellul r diploid org ni m, nd once it re che exu l m tu rity c n m ke more h ploid g mete vi meio i . The only multicellul r t te i diploid, nd the g mete re h ploid. Ch pter 15, Cell Cycle, ver ion 1.0 P ge 251

Figure 20. Sperm togene i

Re idu l odie

Sperm tid

Sperm tid

nd M ture perm

Second ry perm tocyte Meiotic divi ion II

Type A4 perm togoni Intermedi te erm tocyte Meiotic divi ion I

perm togoni Type B perm togoni

 
Prim ry

A common v ri tion i poric meio i , u ed in ll pl nt nd m ny type of lg e . In thi u ge, pore refer to euk ryotic pore , nd not to cteri l endo pore , hich re imply dorm nt cteri . Sporic meio i doe not directly produce g mete . In te d, meio i produce h ploid pore , hich c n develop y mito i i n h ploid multicellul r org ni m . The e org ni m (termed g metophyte ) c n pro duce ( till h ploid) g mete y mito i , th t hen fu ed/fertilized form diplo id zygote. Thi zygote c n then develop into diploid multicellul r form c lled the porophyte. Fin lly, the porophyte i le to gener te more pore y meio i . H ploid (n) G metophyte H ploid (n) G mete

( perm) fertiliz tion

fertiliz tion Zygote Zygote Sporophyte Diploid (2n) Adult individu l Diploid (2n)

Ch pter 15, Cell Cycle, ver ion 1.0 P ge 252

An ex mple of thi type of life-cycle nd the role of meio i i found in mo . Wh t e think of the ody of the mo i ctu lly g metophyte, m de up of h ploid cell gener ted y mitotic divi ion of h ploid pore. The e g metophyte gener te either perm or egg in peci lized tructure in their di t l tip , nd under the right condition (e.g. r in) the perm i c rried to the egg nd fertiliz tion occur . The fertilized (diploid) egg no develop y mitotic divi ion nd differenti tion into porophyte. In thi c e, the porophyte i pe ci lized reproductive tructure on the tip of the mo , nd i l o diploid. On the tip of the porophyte i the por ngium, hich i here meio i t ke pl ce to gener te h ploid pore . The pore m y then e di per ed ( y ind or r in) nd egin the cycle g in y dividing nd forming ne g metophyte.

    

Figure 21. G metic meio i

meio i

meio i

mito i G mete (egg) Spore

(left) nd Sporic meio i

(right).

Adv nced Topic : Viru e , C ncer, nd the Immune Sy tem At thi point, you hould e f irly comfort le ith the ic concept of cell iology. The purpo e of thi ch pter i to uild on th t ic kno ledge nd put it together into more complex y tem . In ddition, e ill introduce ome more dv nced v ri tion on ome of the mech ni m nd tructure th t ere di cu e d in e rlier ch pter . The three topic , viru e , c ncer, nd immunity, re not only relev nt current ne topic , ut rel te to one nother through multiple p th y , hich i hy they re lumped together.

Viroid re l o infectiou non-living p rticle , ut they re only genetic m te ri l, RNA, nd h ve no protein c p id. To d te, they re only kno n to infect pl nt ho t , nd pp rently pre d y direct or extremely clo e cont ct ith n in fected pl nt. The e infectiou p thogenic RNA molecule re ingle- tr nded nd circul r, nd rel tively m ll, roughly 200-400 nucleotide .

      

Viru e Though viru h oth genetic m teri l nd protein component , it i not liv ing org ni m. It doe not cont in the c p ility of elf-replic tion, nd i com pletely reli nt on the cellul r iochemi try of h tever ho t cell it h infect ed. The minim l definition of viru i nucleic cid genome in ide of prote in hell, or c p id. There re v ri tion of thi , uch virion (infectiou v ir l unit) th t h ve mem r ne co t out ide of the c p id, or ome th t h ve en zyme in ide of the c p id long ide the genome. Ag in, none of the e vir l v ri tion re le to fully replic te ithout cellul r m chinery. The cell th t vi ru e c n infect r nge cro mo t living org ni m . There re viru e pecific for hum n , ome th t only infect p rticul r nim l , ome th t infect pl nt , nd even viru e th t u e cteri ho t . In current medi report of vir l ou t re k in recent ye r , HIV, vi n flu, ine flu, much i m de of the origin o f the viru ith re pect to it ho t/t rget org ni m . Ho ever, mo t viru e re very pecific out the cell th t they infect. The n rro ho t r nge m y e no t only to p rticul r pecie , ut p rticul r cell type ithin p rticul r pec ie . Viru e ith ro d ho t r nge re rel tively r re. Ho ever, thi doe not preclude the po i ility of ne tr in of viru evolving ith different ho t r nge from their nce tr l virii. Viru e m y h ve either RNA or DNA genome , th t m y e line r or circul r, nd ingle or dou le - tr nded. There re fe er v ri tion of c p id tructure. In gener l, c p id f ll into t o c tegorie : heli c l nd ico hedr l. Helic l c p id re ctu lly m de up of glo ul r u unit t h t oci te into helic l cylinder, ith the genome lying in ide Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 253

U ing thi ook: Thi ook i de igned to e u ed in oth introductory nd ced cell iology cour e . The prim ry text i gener lly on the left ide of vertic l divider, nd printed in l ck. Det il th t re u u lly left to n nced cour e re printed in lue nd found on the right ide of the divider. lly, ddition l iomedic lly relev nt inform tion c n e found in red print ither ide of the divider.

 

     

  

dv n the dv Fin on e

n interior groove of the helix (fig. 1c). The ico hedr l c p id re l o m de up of m ny u unit th t together form n pproxim tely 20- ided polygon m de f rom ide th t re equil ter l (or ne rly o) tri ngle . If you pl y Dungeon n d Dr gon tm or kno omeone ho doe , then you h ve pro ly een dice ( d20) of thi h pe. Of cour e ith c p id , ut not dice, there c n e ome v ri tion in the num er of ide , the h pe of the tri ngle , nd the num er of u unit th t m ke up e ch f ce. A B C Viru e in ll c tegorie (ICTV cl or B ltimore type) th t c n c u e hum n di e e. Some of the m jor one re li ted here. Viru Adenoviru Ep tein-B rr Hep titi A Hep titi B Cl Adeno Herpe Picorn Hep dn Di e e Fe rile re pir t ory di e e Ph ryngoconjunctiv l fever Infectiou mononucleo i Acute hep titi Acute/chronic hep titi Hep tic cirrho i Hep tocellul r c rcinom imil r to He p titi B Cold ore , ph ryngiti Gingivo tom titi A eptic meningiti Genit l h erpe AIDS Influenz Me le Mump Cervic l c ncer Genit l rt Poliomyeliti R ie Germ n me le

D E

Figure 1. Viru e . (A) T-4 cterioph ge, (B) denoviru , (C) to cco mo ic v iru , (D) hum n immunodeficiency viru , (E) influenz viru .

Extern l to the c p id, ome viru e l o h ve mem r ne co t (vir l envelope). A ill e more cle rly expl ined oon, thi pho pholipid il yer come from vi ru e th t exit ho t cell y exocyto i . Bec u e it c me from ho t cell, the mem r ne c n e u ed ru e y the viru to fool other potenti l ho t cell into mi recognizing the viru norm l cell or cell de ri , ed on the rece ptor th t recognize cellul r protein on the mem r ne. It m y then e t ken int o the cell y receptor-medi ted endocyto i in mi t ken ttempt to recycle old cell de ri , here it c n proceed to infect the overgenerou ho t. There re t o cl ific tion y tem for viru e , the Intern tion l Committee on T xonomy of Viru e (ICTV) h Linn e n-like t xonomic y tem ed on h red tructur l or iochemic l propertie ( ut not ho t pecificity). Another y tem, l o in u e, i the B ltimore cl ific tion, in hich viru e re cl ified into even c tegorie y the mech ni m of mRNA production. Th t i , type I re the d DNA vir u e th t m ke mRNA the norm l y y direct tr n cription of the genome, type II re DNA viru e th t Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 254

   

Polioviru R ie Ru ell

Fl vi Herpe Herpe Retro Orthomyxo P r myxo P r myxo P pillom Picorn og

Rh do T

Hep titi C Herpe Simplex Type 1 Herpe Simplex Type 2 HIV Influenz mp HPV 0.1 m

Me le Mu

 

mu t fir t m ke complement ry tr nd to ecome d DNA efore tr n cription, typ e VI re RNA viru e th t u e rever e tr n cript e (det iled l ter in thi e ction) to fir t convert the RNA to DNA intermedi te efore tr n cription, nd o on.

1 2 Figure 2. The Lytic P th y 3 4 5 Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 255

          

Lytic life cycle of viru e Viru e c n inter ct ith their ho t in t o di tinct y : the lytic p th y n d the ly ogenic p th y. Some viru e re le to itch et een the t o p th y hile other only u e one. The di tingui hing ch r cteri tic of the lytic life cycle i c t trophic de th of the ho t cell y ly i nd imult neou rele e of vir l p rticle . In figure 2, the t ge of the lytic p th y re depicted. I n thi c e, T4 cterioph ge (the term ph ge i u ed for cteri l viru e ) i u ed n ex mple. In tep 1, the viru tt che to the cell ll. In tep 2, t he viru inject it genetic m teri l (d DNA) into the cytopl m of the cteri . In tep 3, the vir l DNA i eing replic ted nd the gene on the vir l DNA r e eing tr n cri ed nd tr n l ted into vir l protein . Expre ion from the ho t genomic DNA i rre ted. In tep 4, viru e re em led from the protein nd DNA. And fin lly, once the vir l f ctory h u ed up the cell energy nd m teri l re ource in m king more viru e , it perform fin l coup de gr ce, cell i de troyed to free the viru e to exit nd find more ho t cell . The T4 ph ge u ed in thi ex mple only undergoe thi p th y nd not the ly ogenic p th y.

  

In euk ryote , the mech ni m i lightly more complic ted y the nucleu . The DN A i tr n ported into the nucleu , here the tr n cription nd replic tion t ke pl ce. Although the vir l mRNA i tr n ported out to the cytopl m for tr n l ti on expected, the re ulting c p id protein re then imported ck into the nu cleu , here the virion p rticle re em led. Lytic pl nt nd nim l viru e ith RNA genome c n yp the nucleu ltogether, nd the genome replic tion, protein ynthe i , nd p rticle em ly ll occur in the cytopl m. In uenz viru Poxviru = Ho t DNA = Vir l DNA = Vir l RNA

Figure 3. Lytic viru e in euk ryote : n RNA viru (influenz ) replic te compl etely in the cytopl m, hile the DNA viru (poxviru ) u e oth cytopl m nd n ucleu .

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 256

      

The lytic p th y c n produce huge num er of vir l p rticle et een infection nd ly i , m ny ever l ten of thou nd , for ex mple from r ie -infe cted cell. Therefore, thi p th y i ell uited for condition in hich potent i l ho t cell re plentiful. On the other h nd, thi i te of re ource if there re rel tively fe potenti l ho t . Im gine fe cteri th t h ve flo ted off from the colony: if ph ge infected cteri in the m in colony, comm ndeering the cteri to cre te thou nd of vir l p rticle , mo t of tho e p r ticle ould infect ne ho t nd m ke m ny thou nd more oldier in thi vir l rmy. But if the viru infected one of the re k y cteri , then once it ki lled it ho t y ly i , the vir l p rticle ould h ve fe , if ny, other potent i l ho t , nd eventu lly ll the vir l p rticle ju t re k do n from v riou e nvironment l condition . Wh t ould etter urviv l tr tegy for the viru in uch itu tion?

     

= Vir l protein

1 2 3 4 5 6 Figure 4. The ly ogenic p th y. temper te cterioph ge. The initi l t ge of infection nd genome injection r e the me the lytic cycle, ut under condition th t encour ge ly ogeny, the vir l genome i integr ted into the ho t genome in tep 3. In l integr tion int o E. coli, thi occur y reciproc l recom in tion t 15- e p ir equence kn o n the tt l ite nd i f cilit ted y the Int gene product. A long the environment l condition re not conducive to cteri l reproduction ( nd thu limited num er of po i le ho t cell ), the vir l genome rem in mo tly hidden nd in ctive. The only ignific nt exception i gene encoding l repre or th t prevent the next tep nd keep the viru dorm nt. Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 257

 

The Ly ogenic P th y A etter option for ome cteri l viru e i cterioph ge th t h ve thi option, ell mper te ph ge. In thi p th y, the viru goe the ho t genome, nd rem ining tr n cription condition ch nge nd reflect likelihood of . L m d (l) i n ex mple of

   

c lled the ly ogenic p th y. The lytic p th y, re kno n te into dorm ncy y integr ting into lly quie cent until environment l more ho t cell to infect (fig. 4)

Figure 6. The HIV genome. 1 Or, in the c e of curtoviru e , DNA pl nt viru e (e.g. eet curly top viru ) , the genome not only h overl pping gene , it i even i-direction l (fig. 7) encoding gene product in oth tr nd of DNA fter the DNA h een converted to d DNA. 2 6 C4 Rep V2 Curtoviru genome CP C2 REn MP Figure 7. A curtoviru genome. 3 5 7 4 9 8 10 Given the need for economy, h t gene re found in viru e ? One of the mo t tu died vir l genome , cterioph ge l, cont in gene encoding five tr n cription l control protein ( hich one re expre ed depend on hether the ph ge i in ly ogenic or lytic mode), inding protein th t control degr d tion of tr n cription l ctiv tor, 17 c p id protein , n exci ion e th t control exci io n nd in ertion of the ph ge genome in the ho t genome, n integr tion protein t h t in ert the ph ge genome into the ho t , nd 3 gene p rticip ting in ly i o f the ho t cell. The HIV genome depicted ove i much m ller th n l, t round 9 kilo e comp red to 48 k , ut g in, the theme i to u e cellul r protein hen po i le, nd encode vir l gene if nece ry. So, g g encode c p id prot ein , pol encode rever e tr n cript e, integr e, nd HIV prote e ( hich cle ve the g g nd pol gene product into their function l protein ), vif ct g i n t common ho t cell ntivir l enzyme, vpr regul te nucle r import, t t tron gly incre e tr n cription of HIV gene , rev export vir l RNA from the nucleu , vpu i needed for udding of p rticle from the ho t, env encode vir l envelo pe glycoprotein , nd nef promote urviv l of infected cell . The LTR region re very trong promoter to drive high expre ion of the e gene . P ge 258

In order for p ck ging into the tight p ce con tr int fforded y c p id , vir l genome mu t e highly economic l. For ex mple, the HIV genome (fig. 6) h ever l gene th t overl p. 5 LTR g g pol vif vpr vpu rev t t env 3 LTR nef

    

Th t next tep i the exci ion of the l ph ge DNA from the ho t chromo ome, nd u equent replic tion nd tr n cription of the vir l DNA (fig. 4, Step 4). Then , like efore, the fin l tep re em ly nd ccumul tion of virion , nd eve ntu l re kdo n of cellul r tructure nd rele e of the vir l p rticle . Althou gh it i not referred to ly ogeny, ome nim l viru e c n eh ve imil rly. The mo t prominent ex mple i the B ltimore Cl VI viru e - commonly kno n retroviru e , one of hich i HIV. The p th of retroviru through euk ryoti c ho t cell i depicted elo (fig. 5). HIV h n envelope, hich i tudded i th tr n mem-

 

r ne protein th t re recognized y the ho t cell, inding the viru to the ce ll urf ce nd initi ting receptor-medi ted endocyto i (1). After the endocyto i , the mem r ne envelope of the virion nd the ve icul r mem r ne fu e to rele e the c p id nd it content (2). After the c p id di oci te in the cytopl m, the t o tr nd of vir l RNA re rele ed long ith peci l polymer e: re ver e tr n cript e, hich re d n RNA templ te nd ynthe ize DNA. Rever e tr n cript e l o u e th t ne DNA to ynthe ize complement ry DNA tr nd o t h t it eventu lly produce dou le tr nded DNA ver ion of the vir l genome (3). Thi vir l d DNA i tr n ported into the nucleu here it integr te into the h o t genome u ing nother vir l protein, integr e Ch pter 16, Adv nced Topic , ver ion 1.0

 

Figure 5. Infection nd reproduction p th y of retroviru in cell.

euk ryotic ho t

  

(4). The integr ted vir l DNA i c lled proviru . The proviru c n l y dorm nt , ut if it i ctiv ted, then it i tr n cri ed nd the re ulting vir l RNA i tr n ported out of the nucleu (5). Some of the vir l RNA encode enzyme like r ever e tr n cript e nd integr e, or c p id protein , ll of hich re m de in the cytopl m (6), ut ome encode mem r ne ound glycoprotein , hich re tr n loc ted into the ER (7) nd eventu lly proce ed through the Golgi nd incorpor ted into the pl m mem r ne (9). Once the virion h een em led (8), it i nd to the vir l tr n mem r ne protein , nucle ting n exocytic ve icle (10) hich i the virion complete ith vir l envelope. In con idering viru e ith re pect to the re t of thi integr tive ch pter, there re t o overriding ide to keep in mind. Fir t, vir l urviv l i ed on num er : it need to m ke huge num e r of it component to c t ide net for ne ho t cell po i le. To do thi , vir l promoter re u u lly much tronger th n ho t cell promoter , imul t neou ly driving more vir l gene expre ion hile preventing ho t gene expre i on ( y dedic ting cellul r re ource to viru production). Second, ec u e of f t gener tion time , the r te of vir l mut tion nd evolution i f r f ter th n norm l euk ryotic genome . In ddition, if the viru u e it o n polymer e ( uch rever e tr n cript e or RNA replic e), the mut tion r te ri e even mor e ec u e there i no error-checking y vir l polymer e . Recent tructur l ex min tion of the HIV genome ugge t th t the tructure of H IV RNA it elf m y pl y ignific nt role in it prop g tion in ide of ho t cell . Figure 8, from W tt et l, N ture 460:711-716, 2009, ho predicted econ d ry tructure of the genome. The uthor ugge t th t the RNA tructure ctu ll y m y inter ct ith ri o om l elong tion to control the folding of the vir l pro tein . They l o po tul te the exten ion of thi rgument to include import nt g enetic inform tion encoded not ju t in the nucleotide equence, ut the econd r y tructure nd terti ry tructure of ny RNA viru . C ncer C ncer encomp e et of genetic di e e th t le d to uncontrolled cell prol ifer tion in multicellul r org ni m . The di cu ion of c ncer l o h ppen to e u eful in cell iology cour e, ec u e it tie together m ny of the concept th t you ju t pent mo t of the eme ter le rning. Although it c n e c u ed in p rt y n out ide gent, the development of c ncer i e enti lly erie of uncorrected mi t ke y cell regul r proce e . It c n trike pl nt ell nim l , nd ec u e of inten e reFigure 8. Second ry tructure of HIV-1. Ltd: N ture 460:697, 2009)

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 259

Cypre

Figure 9. (left) A tumor on cypre r nch. (right) A tumor of the m ll inte tine. tumor photo y W. C lder, cc licen ed 2009. Sm ll o el tumor y E. Uthm n, pu l ic dom in 1999.

(reprinted

y permi ion from M cmill n Pu li her

 

 

  

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 260

Figure 10. Norm l hum n re t cell in culture t left. At right, imil red cell th t h ve een tr n formed (i.e. they re no c ncerou ). Note egul rity of oth cell nd nucle r morphology. Mem r ne re r itr rily in different color ; chromo ome re t ined lue in oth p nel . Photo nce et l, C ncer Cell 12:160-170, 2007.

r cultu the irr t ined from I

e rch nd u equent deeper under t nding of the cellul r event th t le d to c ncer, it c n no e tre ted in hum n ith ome degree of ucce , depending on the type, loc tion, nd progre ion of the tumor. A norm l replic tion of cel l gener lly le d to the form tion of tumor, hich i imply olid m of norm lly gro ing cell , u u lly clon l colonie of one or fe origin l tumori genic cell . Ho ever, tumor i not nece rily c ncerou . A enign tumor i on e th t i en conced ithin n extr cellul r m trix he th, doe not pre d eyon d th t he th, nd ho e gro th i lo or limited. In contr t, c ncerou or m lign nt tumor gro quickly due to uncontrolled prolifer tion, exp nd ignifi c ntly eyond it origin l ound rie , inv ding ne ti ue, nd c n met t ize, pre ding through the circul tory y tem. Once thi h ppen , not only i it no longer po i le to remove ll of the c ncerou cell y urgic l exci ion of the prim ry tumor, it i l o ne rly impo i le to kno ho m ny econd ry tumor h ve formed or here they formed, ince the met t tic c ncer cell in the lood tre m m y theoretic lly exit lmo t ny here. Ho ever, in re lity, cert in tumor met t ize preferenti lly to p rticul r t rget ti ue /org n , pre um ly ed on molecul r m rker on the urf ce of the cell or in the extr cellul r m tr ix. Met t i i con idered the gre te t medic l pro lem ith re pect to c ncer tre tment. If c ncer i detected fter met t i h occurred, the ch nce of urviv l drop dr m tic lly. At the cellul r level, c ncerou cell differ from n orm l cell in num er of import nt y . Norm l cell re regul ted y the cel l round them, nd y dulthood, mo t cell re inhi ited from prolifer tion y cont ct ith their neigh oring cell . In vitro, thi c n e demon tr ted y the o erv tion th t non-c ncerou prolifer tive cell uch epitheli l cell c n prolifer te until the culture di h ottom i completely covered

                  

Figure 11. Development of colon c ncer t ke time nd multiple mut tion . Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 261

PRL3 oncogene ctiv ted, Further mut tion

p53 gene tumor

uppre ion lo t

DCC gene tumor

6. Met t i

uppre ion lo t

5. M lign nt c rcinom

4. Cl

III denom

RAS oncogene

ctiv ted ( enign)

Lo

of DNA methyl tion APC gene tumor uppre ion lo t

1. Polyp gro

on colon

ll 2. Benign tumor 3. Cl

II denom ( enign)

Differenti tion i key p rt of norm l met zo n development. All cell come fro m the fertilized egg, nd even fter ever l divi ion , the cell re very imil r. Eventu lly, though, they egin to peci lize for their p rticul r phy iologi c l function , hether lung cell , r in cell , or one cell , nd th t proce of peci liz tion i differenti tion. In c ncer cell , thi proce i p rti lly rever ed, the cell revert to le peci lized, more primitive t te.

(confluence), ut once th t h ppen , prolifer tion top . Thi phenomenon i kno n cont ct inhi ition. If c ncerou cell re llo ed to prolifer te in cultu re, they do not top fter the urf ce i covered, nd in te d c n mound up on o ne nother. The cell urf ce nd intern l cellul r org niz tion of c ncer cell i often di org nized in comp ri on to norm l cell . Fin lly, c ncer cell u u l ly ppe r de-differenti ted in comp ri on to their origin l cell type. If the or igin l cell type fl t cell, the c ncerou cell ould e more rounded nd t hree-dimen ion l. Thi i n expected con equence of ecoming c ncerou cell. Not only i prolifer tion deregul ted, cell urf ce protein expre ion i ltere d to promote met t i . C ncer i con idered genetic di e e ec u e it i c u ed y lter tion to the DNA. Ho ever, it i r rely n inherited di e e. An i nherited di e e ould me n di e e th t c n e p ed from one gener tion to the next, implying th t the di e e-c u ing DNA mut tion i found in the g mete ( perm or egg) of the tricken dult. Mo t c ncer re due to pont neou ly ri ing mut tion in the DNA of one or fe om tic cell , nd not y temic err tion. Spont neou mut tion in the germ cell re po i le, ut mo t potenti lly c ncer-c u ing one le d to non-vi le off pring. So, lthough it i exceedingl y r re for c ncer to e inherited, ho ever, it i much more common to inherit predi po ition or incre ed ch nce of developing c ncer.

    

Oncogene Regul tory Protoregion oncogene Norm l protein 1 2 Mut tion or deletion Gene duplic tion

Protein ith incre ed function Fu ion protein not under norm l control More copie of norm l protein More copie of norm l protein Figure 12. Conver ion of protooncogene to oncogene . (1) Due to mut tion of the coding region, the protein h higher phy iologic l ctivity. (2) Gene duplic t ion le d to multiple copie of the gene e ch expre ed norm lly, m king m ny mo re copie of the protein th n norm l. (3) Mut tion of the regul tory region or t r n loc tion of tronger enh ncer or promoter to the protooncogene c n le d to enh nce tr n cription, nd therefore more protein. (4) Tr n loc tion of nother gene inline ith p rt of the coding region, c n put the ctivity of the protoon cogene under the control of modifier of the tr n loc ted gene, nd thu le d to over ctivity. Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 262

4 3 Tr n loc ted enh ncer/promoter incre e tr n cription Tr n loc ted gene form u ion gene

An individu l c ncer-c u ing mut tion gener lly cre te pro lem th t c n e co rrected y ome other cellul r mech ni m. Therefore, development of c ncer come out through the ccumul tion of multiple mut tion nd not the cqui ition of ju t one. The e t tudied ex mple of thi gr du l development of c ncer i col on c ncer (fig.11). There i f irly ch r cteri tic progre ion of mut tion in the gene APC, RAS, DCC, TP53, nd PRL3. Note th t the progre ion depicted her e i not inevit le: the pre ence of polyp doe not le d inv ri ly to colon c ncer. Furthermore, intervention c n e highly ucce ful if it occur e rly in t he progre ion, o oncologi t need to con ider r nge of ri k f ctor in eigh ing the co t nd enefit of medic l intervention. RAS nd PRL3 re oncogene , hile APC, TP53, nd DCC re tumor uppre or gene .

Some kind of retrovir l infection c n ccompli h the conver ion of protooncog ene to n oncogene y in erting vir l DNA ne r the promoter region of the protoo ncogene. Bec u e the vir l promoter tend to e very trong, they c n induce ove rexpre ion of the protooncogene product. In vi n pecie , vi n leuko i viru i kno n to c u e tumor y in ertion ne r the c-myc oncogene, hile in hum n , nother retroviru , HTLV (hum n T-lymphotropic viru ), c n c u e cute di e e (tropic l p tic p r p re i ), ut m y l o c u e T-cell leukemi nd lymphom . Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 263

Oncogene re gener lly domin nt g in-of-function mut tion of norm l cellul r g ene c lled protooncogene . The e protooncogene re them elve po itive regul t or of the cell cycle, ut they re regul ted y other f ctor , either extr cell ul r ign l or intr cellul r mech ni m . Mut tion th t turn them into oncogene pecific lly remove ll or ome of thi regul tion. They thu ecome over ctiv e, nd try to pu h the cell cycle for rd le ding to incre ed prolifer tion. Th e e mut tion c n l o e cl ified into fe gener l mech ni tic c tegorie . The e (fig. 12) re mut tion to the coding region th t incre e phy iologic l ctivity, gene duplic tion re ulting in more copie of the gene t the DNA level Proto-oncogene gro th f ctor receptor nd thu more t the protein level, mut tion to the regul tory region of the gene or th t lter regul tion of gene expr e ion, thu incre ing copy num er of the protein, nd fin lly, tr n loc tion th t repl ce Amino cid ch nge Deletion of extr cellul r in tr n mem r ne region lig nd- inding dom in p rt of the coding region, re ulting in chimeric protei n ho e ctivity m y e under different control cheme th n norm l. Con titutively ctive Ex mple of t o type of mut tion P P P P oncoprotein gro th f ctor receptor P P P P re illu tr ted to the right (fig. 13) P P (lig ndindepend nt) ith mitogen receptor the protooncogene. In the fir t c e, th e Figure 13. Conver ion of mitogen receptor protooncogene into n oncogene y point mut tion le ding to mino cid tr n mem r ne portion of the re- ch nge in the tr n mem r ne region (left) or y trunc tion ceptor h een mut ted, c u in g of lig nd- inding dom in. n mino cid ch nge th t lter the conform tion no t ju t of the tr n mem r ne region, ut of the cytopl mic kin e dom in, hich ecome con titutively ctive, reg rdle of hether lig nd h ound out ide or not. In the econd c e, the entire extr cellul r dom in h een removed due to mut tion of n mino cid codon into top codon or tr n loc tion, nd th e re ulting receptor i l y ctive, l o independent of lig nd inding.

    

 

Tumor Suppre or Gene Tumor uppre or gene norm lly do Regul tory Tumor uppre or region gene Norm l protein h t ould e expected from their n me. Where the oncogene mo tly d rive the cell cycle for rd, the tumor uppre or 1 2 gene prim ry function re to tempor rily Mut tion or deletion t ll the cell cycle o th t DNA rep ir mec h- Mut tion or deletion in regul tory region in coding region ni m c n h ve ti me to ork. Ho ever, if rep ir i un ucce ful fter fe ttempt , the tumor uppre or gene product m y then trigger popto i r ther th n llo d m ged ce ll to replic te nd potenti lly cre te nother genetic lly d m ged cell. Thu , t he pre ence of n oncogene in cell ill not nece rily le d to development of Protein ith c ncer ec u e functioning tumor upimp ired function pre or ge ne might prevent the cell from Figure 14. Tumor uppre or gene mut tion c n le d to c ncer. replic ting. Equ lly, if tumor uppre or gene i knocked out u t there i no oncogene pre ent, then the cell i unlikely to e immedi tely c nc erou ec u e lthough cellul r emergency r ke i nonfunction l, if there i no thing to drive the cell through it cycle ny f ter or more frequently th n u u l, then the r ke i never needed ny y. Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 264

   

Wh t function re ch r cteri tic of protooncogene ? Mitogen receptor , lre dy de cri ed ove, nd exemplified y the receptor tyro ine kin e EGFR (epide rm l gro th f ctor receptor), VEGFR (v cul r endotheli l gro th f ctor receptor ), RON (recepteur dorigine n nt i , m croph ge timul ting protein receptor), nd Er B2 ( l o HER2/neu, nother hum n EGF receptor). Gro th f ctor them elve m y l o e protooncogene , uch FGF-5, one of ever l oncogene in the fi ro l t gro th f ctor f mily, or c- i , n oncogenic form of PDGF (pl telet-derive d gro th f ctor). Sign l c c de protein , often either tyro ine or erine/threo nine kin e or other regul tory enzyme , re l rge group of protooncogene (e .g. Src f mily tyro ine kin e , BTK f mily tyro ine kin e , cyclin-dependent S er/Thr kin e , R -f mily m ll GTP e ). Fin lly, v riou tr n cription f ctor (e.g. Et , Myc, E2F f milie ), c n effectively e mut ted into oncogene .

 

 

Like oncogene , tumor uppre or gene c n ork (or not ork, ould e the c e in c ncer) in ever l y . Here i n ex mple ith the re t c ncer- oci ted gene , BRCA1 nd BRCA2. The e gene product re involved in DNA rep ir (ch p ter 7). When BRCA1 or BRCA2 i knocked out, the cell lo e it ility to u e th t DNA rep ir p th y. There re other rep ir p th y , nd even if there erent there m y not e ny eriou le ion to the DNA, o the cell could eh ve norm l ly for the time eing. Wh t i import nt from c ncer t ndpoint, i th t e ch fety/rep ir mech ni m th t i lo t incre e the likelihood th t n ddition l mut tion m y c u e the cell to ecome c ncerou . Cytopl m Nucleu Ionizing R di tion DNA tr nd re k ATM Chk2 Chk2 P BRCA1 BRCA2 F ilure

ATM Active RAD51 BARD1 UV R di tion DNA tr nd re k ATR Chk2 Chk2 P In ctive p53 Tr n ient St le p53 P ATM Rep ired DNA Active Chk1 Chk1 P P p53 P In ctive Cdc25 Incre ed Tr n cription

Succe

p53 Active Cdc25 P p21 mRNA p21 B x mRNA B x

Seque tered (In ctiv ted) Cdc25 P In ctive Cyclin Cyclin Cdk P P Cdk P Cdk p21 Cell Cycle Arre t Norm l Cell Cycle In ctive Active In ctive

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 265

     

Figure 15. Cell cycle rre t due to DNA d m ge. ATM detect the dou le tr nd r e k, nd ctiv te Chk2 nd BRCA1. Chk2 l o ctiv te BRCA1, hich ith BRCA2 f orm rep ir complex. Ho ever, if BRCA1 i not immedi tely v il le, the cell need to go into holding p ttern until one ecome v il le. Therefore, Chk2 ctiv te p53, hich induce tr n cription of p21, hich ind to cdk, preventin g oci tion ith cyclin, nd thu preventing cell cycle progre . If thi cont inue for long, ome of the p53 ctiv te tr n cription of B x, hich ill induc e popto i to kill off cell ith d m ged DNA. When p53 i hit ith lo of function mut tion, the cell doe not die, nd it ttempt to replic te even ith d m ged DNA, hich m y le d to more mut tion in the u equent gener tion, if it i ucce ful in reproduction. Without p53, the ccumul tion of error in uc ce ive gener tion incre e . The mech ni m of uying time for the cell to m ke rep ir i not limited to the ATM-BRCA itu tion. The left ide of the figure ho nother re pon e to DNA d m ge th t le d to cell cycle rre t.

Apopto i

It hould e cle r no ho rece ive lo -of-function mut tion in tumor uppr e or gene c n le d to n inherited predi po ition to c ncer. A diploid org ni m , e h ve t o copie of e ch gene in our cell , o lo ing one to mut tion doe not ipe out the protective function. Thu , if nothing h ppen to the other one , then the cell i fine. It i ju t que tion of pro ility. Lo ing the functi on of one i very lo pro ility event, ut the pro ility of lo ing oth co pie i extremely m ll. Thu , even though it i only 1 tep on the y to lo ing the protection of thi p rticul r tumor uppre ing function, it i very l rge difference in pro ilitie . Of cour e, keep in mind th t even complete lo of ingle tumor uppre or gene i u u lly not enough to le d immedi tely to c n cer, nd till other mut tion mu t occur to t ke dv nt ge of the e kened cell defen e nd pu h it to rd c ncerou t te. Hum n C ncer Although ome oncogene nd tumor uppre or gene h ve re tricted di tri utio n th t hint t likely tumor loc tion , m ny of the gene re ide pre d nd eve n u iquitou . It i pre ently uncle r, therefore, hy cert in type of c ncer r e linked to p rticul r mut ted gene , ut there re num er of trongly correl ted c e . Retino l tom i c ncer of the eye th t u u lly trike t rel t ively young ge. It h een linked to the RB gene, hich encode repre or of E2F, tr n cription f ctor th t ould norm lly turn on gene needed for S ph e progre ion. Only 10% of individu l ho inherit the RB lo -of-function mut t ion e c pe the development of the c ncer. It l o turn out th t people ith the RB mut tion h ve higher incidence of developing other tumor ell, lthoug h gener lly l ter in life. Perh p the higher r te of d m ge to retin l cell (d ue to light expo ure) le d to gre ter u cepti ility. Bre t c ncer i nother di e e th t h trong link to mut tion in cert in gene . Lo of function mu t tion to the BRCA1 gene encoding DNA rep ir protein le d to five-fold high er ri k of developing re t c ncer in om n lifetime. Although mut tion to o ther tumor uppre or (including p53, PTEN, CHEK2, ATM) mo t heredit ry re t c ncer h ve link to BRCA1 or BRCA2 mut tion. On the oncogene ide, re t c n cer tumor con i tently ho expre ion of CYCD1 ( cyclin) mut tion , nd depen ding on the type of tumor, HER2/Neu m y e linked ell. Lung c ncer re mon g the mo t common - the econd highe t in men (pro t te i higher) nd omen ( r e t i higher) like, nd m ke up pproxim tely 1 in 3 c ncer de th nnu lly. Sever l oncogene of the myc f mily: N-myc, L-myc, nd c-myc, ell H-r h ve een linked to v riou lung c ncer . Lo of p53 nd RB re l o ociC nce r re cl ified y the ti ue type in hich the tumor fir t ri e. Thu , c rc inom , hich re the mo t common type (~85% of hum n c ncer ), come from epithe li l cell ri ing from either the em ryonic ectoderm ( kin nd nerve cell ) or endoderm (gut lining). Leukemi (~4%) ri e from hite lood cell . Lymphom ( ~5%) reflect err nt gro th of lymphocyte in pleen or lymph node . S rcom ( ~2%) ri e from connective ti ue of me oderm l origin, uch one c ncer . Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 266

     

 

      

Met t i The on et of met t i ign l dr tic ch nge in the progno i of c ncer p tient. While pre-met t tic tumor c n cert inly e d ngerou or p inful, tre tm ent c n e f irly loc lized, e.g. 1 urgic l exci ion nd directed r di tion the r py. Once the tumor met t ize it mu t e tre ted y temic lly due to 3 2 the potenti l for econd ry tumor liter lly ny here in the ody. Thi pre ent pro lem ec u e the tumor cell re derived from the ody cell nd re mo tly i ndi tingui h le y the ody immune y tem. The prim ry 4 mech ni m for nti-c n cer drug i to t rget f t prolifer tion, ince mo t 5 c ncer cell prolifer te much f ter th n mo t norm l cell , ut thi till Figure 16. Met t i . kill off ome of the ody n tur lly f t-prolifer ting cell , uch the epitheli l cell lining the gut. More recently, other ppro che to nti-c ncer drug tre t ment h ve een developed; mo t not ly, nti ngiogene i drug to t rve tumor y preventing them from developing or recruiting ne lood ve el . A tumor g ro , the ility to or nutrient from the environment decre e for the inne rmo t cell of olid tumor. Met t i (fig. 16) t rt ith do nregul tion of cell-cell dhe ion (1). Thi m y include in ide-out ign ling to integrin rece ptor , or do nregul tion of c dherin expre ion, nd other method for llo ing the cell to ep r te from the re t of the tumor. Non-met t tic tumor re urro unded y c p ule of extr cellul r m trix th t cont in the tumor in it loc ti on. To e c pe thi c p ule, the met t izing cell mu t ecrete prote e (u u l ly met lloprote e ) th t c n re k do n the ECM protein (2). Once out into the loo er connective me enchym l ti ue, the met t tic cell incre e Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 267

       

ted ith the development of lung c ncer , nd perh p not coincident lly, to c co moking i oci ted ith p53 mut tion . Intere tingly, de pite eing o com mon, o f r, there h ve een no p rticul r oncogene oci ted ith pro t te c ncer, nor ny hint of pro t te- pecific tumor uppre or u cepti ilitie .

Figure 17. Common ite (open yello circle ) for the met t i of colon c ncer (filled yello circle).

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 268

The Immune Sy tem Immunology i full eme ter cour e t mo t univer itie , o thi ection ill only touch on fe ic concept th t hould e e ily cce i le to the tude nt ho h ne rly completed the cell iology cour e. At it core, immunology i out d pt tion. Th t i , ince n nim l h no preconception of the v riou p otenti l infection it m y e u ject to, it mu t h ve y tem in pl ce th t i flexi le enough to de l ith lmo t nything th t come long. O viou ly, the y tem re not perfect, ut con idering the ide r nge of p thogen , immune y t em re rem rk ly efficient. In hum n , there re t o type of immune re pon e to infection: the inn te re pon e, hich i rel tively non pecific, nd the d p tive, or cquired, re pon e, hich h more pecificity. The inn te immune re po n e re common to ll nim l , nd ct on l rge cl e of p thogen . For ex mp le, Toll-like receptor on ph gocyte recognize v riety of cteri l urf ce m olecule uch the fl gellin pecific to cteri l fl gell , or the peptidogly c n component of cteri l cell ll . When the e receptor re ctiv ted, the ph gocyte goe into ction, enveloping the offending cteri or viru , nd re king

it locomotive ctivity nd he d for lood ve el. Intr v tion (3) into m ll, lo -flo lood ve el llo the cell to e c rried to ne rly ny de tin t ion in the ody y the circul tory y tem (4). At ome point, the met t tic cel l ill tt ch to the interior ll of lood ve el, nd exit the circul tion ( 5). The molecule nd itu tion th t determine the point of exit re not cle r yet, lthough there re cle rly preferred ite of met t i for ome type of tumor . Pre um ly, there i pecific recognition nd dhe ion occurring ed o n cell dhe ion molecule expre ion on tumor cell nd t rget ti ue urf ce .

   

      

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 269

Anti odie Front nd center in the d ptive immune re pon e re nti odie . The e protein m y e either ecreted y or tt ched to the urf ce of B cell , the lymphocyte th t differenti te either in one m rro ( dult) or liver (fetu ), oppo ed t o tho e c lled T cell , hich differenti te in the thymu gl nd. Incident lly, i f you ee eet re d on menu, th t ould e thymu . Yum. You c n t ke th t e riou ly or rc tic lly depending on ho you think my t te run.

it do n. Thi depend on recognizing the extern l urf ce, o cteri or viru e th t do not h ve recogniz le molecule on their urf ce re le to e c pe t hi p rticul r line of defen e. Defen in , hich re found on v riety of urf ce ( kin, corne , gut) ell in circul tion, re m ll (18-45 mino cid ) cy teine-rich c tionic protein th t ind to v riety of p thogenic viru e , cteri , nd fungi. It i uncle r ho they m y ork g in t viru e , other th n perh p tt cking infected ho t cell , ut g in t cteri nd fungi the mode o f oper tion i gener lly to ind to the cell mem r ne nd form pore th t llo ion nd other m ll molecule to flo out killing the p thogen. Complement, group of protein (~20) circul ting in the lood, c n ct imil rly g in t p t hogenic cell . Fin lly, n tur l killer (NK) cell , lymphocyte th t t rget ny c ell th t doe not c rry cell urf ce protein th t re norm lly found on cell f rom the nim l, c n kill not only tt cking cell , ut vir lly infected cell th t h ve topped producing their norm l protein (including the recognition prote in) ec u e they re u y producing vir l protein . NK cell c n even e effecti ve g in t ome c ncer cell if they h ve do nregul ted cell urf ce protein exp re ion p rt of their de-differenti tion nd de dhe ion. The d ptive immune y tem, hich i only found in verte r te , i h t mo t people think of hen th e hum n immune y tem i mentioned. We nd other verte r te l o h ve n inn te immune y tem, ut ll the molecule nd cell th t norm lly come to mind nti odie , T-cell , B-cell re p rt of the d ptive immune re pon e. There re t o component to the d ptive re pon e, humor l re pon e, in hich protein ( nti odie ) flo ting in the lood ind to the infectiou gent nd prevent if from inding to cell or t rgeting it for the cellul r re pon e, hich i medi ted y T cell th t c n pecific lly recognize nd kill the t rgeted p thogen.

    

             

A Antigen- inding dom in B IgG VH SS SS VH SS SS (IgD, IgE very imil r) ecretory component CH1 CH1 SS SS SS SS J ch in SS VL CL Hinge region VL SS SS CL Light ch in IgA SS SS CH3 SS SS CH2

        

B ck to the nti odie . The different type of nti odie , IgA, IgD, IgE, IgG, nd IgM, re ll ed on the IgG tructure (fig. 18), hich i roughly Y- h ped, nd compo ed of t o he vy ch in nd t o light ch in . The e ch in h ve di ulf ide ond- t ilized loop (rec ll the Ig-like loop in the cell dhe ion molecul e fe ch pter ck?), nd the com in tion of the di t l light ch in loop nd di t l he vy ch in loop m ke the ntigen inding ite. The ntigen i defined the molecule, or more pecific lly the p rt of molecule th t i recognized y the p rticul r nti ody. Since the nti ody i me nt to medi te highly pecifi c recognition of ide v riety of inv ding p thogen , there mu t e y to cr e te t le t m ny different nti odie . Thi i m de po i le y the proce of DNA re rr ngement. Thi mech ni m i l o u ed to gener te diver ity in T-ce ll receptor , hich re quite different tructur lly, ut l o need to e v il le ith n extremely ide v riety of pecific inding ite .

CH2 CH3 J ch in He vy ch in IgM Figure 18. Anti odie . (A) n nti ody i compo ed of t o he vy ch in (red) nd t o light ch in ( lue). E ch h v ri le region, nd con t nt region( ). (B ) IgA nd IgM re uilt upon multiple IgG-like tructure . Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 270

DNA Re rr ngement One of the centr l umption throughout our tudy of the cell h een th t l though the RNA nd protein in ny cell m y differ, ny cell of given org ni m other th n the g mete hould h ve the me DNA. Thi i not the c e ith B ce ll or T cell . In the e cell , p rt of the m tur tion proce i to cre te un ique rr ngement of different dom in to form pecific nti ody (or T-cell rec eptor). The germline DNA, or the DNA th t i found in ll other om tic cell of the org ni m, cont in m ny different uch egment , ut only fe re put tog ether to m ke the nti ody/TCR. Thi i toch tic proce , nd ith thi kind of re rr ngement h ppening on oth he vy ch in gene nd t o different light ch in gene (de ign ted k nd l), there re ell over 10 trillion (1013) different com in tion for gener ting immunoglo ulin in hum n , nd even more com in tio n for T-cell receptor ! Ho i thi ccompli hed? A 5 Germline DNA V1 V2 V3 V4 V5 ... Vn J1 J2 J3 J4 J5 ... C 3 B DNA re rr ngement V5 V1 V2 V3 ... Vn A V4 J2 J1 J3 J4 J5 5 ... C 5 Germline DNA V2 Vn C V1 ... ... J1-5

   

C 3 Antigen- inding dom in H2N NH2 3 R ndom recom in tion S S C B-cell DNA V5 ... Vn Degr d tion Tr n cription nd Splicing mRNA 5 S S J1 V4 5 3 J2 V3 J3 J4 J5 V1 V2 ... C B 3 5 ch in Germline DNA V1 Vn S S V1 J1 C C S S

Re rr nged DNA V1 5 J1-5 C 3 V V C ch in S S Tr n cription ... ... D1 ... J1-3 C1 D2 ... J4-6 C2 3 Extr cellul r D Prim ry tr n cript 5 R ndom recom in tion V3 J3 J4 J5 ... C Re rr nged DNA 3 5 V1 D1 J3 C1

3 Intr cellul r E Tr n cription nd Splicing mRNA 5 V3 J3 C mRNA 3 5 HOOC 3 COOH V1 D1 J3 C1

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 271

Figure 20. T-cell receptor gene l o under DNA re rr ngement to gener te diver ity like nti odie . In f ct, there i ctu lly gre ter diver ity in TCR th n in immunoglo ulin . (A) re rr ngement of ch in nd (B) ch in. (C) protein tru cture of TCR.

Figure 19. DNA re rr ngement of k light ch in gene. (A) The germline DNA h pproxim tely 40 V region gene , 5 J egment , nd one C region gene. (B) By cti on of the V(D)J recom in e, r ndom V region i rought clo e to r ndom J re gion, nd the intervening equence i cut out (C). (D) The gene m y till cont i n multiple J egment , ut RNA plicing remove ll ut one, le ving the fin l m RNA (E) ith one V, one J, nd one C region.

Figure 19 ho the DNA re rr ngement th t t ke pl ce in gener ting k ch in div er ity. The l ch in locu h lightly different rr ngement, nd h only 30 V gene , ith 4 J egment nd 4 C gene . The he vy ch in h n extr dom in: t here re 40 V gene , hich re linked to one of 25 D egment , then 6 potenti l J egment , nd one C gene. The e re rr ngement , lthough they look omething l ike the RNA plicing th t e e rlier in thi cour e, re h ppening t the DN A level. Once it h h ppened, th t cell nd it progeny c n no longer m ke the other com in tion ec u e tho e p rt of the genome h ve een cut out nd de tr oyed. Thi i di tinctly different from ltern tive plicing of RNA, in hich th e genetic inform tion i till there, nd under different condition could till gener te other v ri tion of the gene product. The enzyme th t produce thi di ver ity i complex c lled the V(D)J recom in e. The recom in tion occur in t o p rt : fir t dou le- tr nded re k re m de t recom in tion ign l equence (RSS) ite , then the re k re rep ired y the gener l dou le- tr nded re k rep ir mech ni m. Depending on hich J egment i cho en, there m y e more th n one left in the gene fter the re rr ngement. Ho ever, only the one clo e t to the V egment i u ed, nd the other re pliced out of the prim ry tr n cript ( y norm l RNA plicing) in the proce of connecting the C egment to the V nd J for the fin l mRNA. Although thi proce gener te gre t diver ity, there i nother mech ni m th t c n gener te further diver ity under cert in circum t nc e . Som tic hypermut tion c u e re rr nged V egment to mut te t 105 time th e r te of other DNA! Thi mech ni m i c rried out y Activ tion-Induced Cytidin e De min e (AID), hich convert cytidine to ur cil , gener ting G:U mi m tc h th t i corrected y rep ir polymer e ithout trong error-correction. Thi hy permut tion i initi ted y the ctiv tion of B cell y recognizing nd indin g to lig nd. A e ill ee in the next p r gr ph , hen th t h ppen , the B c ell initi te r pid prolifer tion nd thi i hen the om tic hypermut tion t k e effect, o th t m ny of the B cell ill c rry highly imil r ut u tly diff erent nti odie th n the initi l B cell th t recognized nd ctiv ted y th e ntigen. The ide i ome of the e u tle mut tion m y le d to nti odie ith higher ffinity for the ntigen nd therefore f ter re pon e the next time thi p rticul r p thogen trie to infect the org ni m. The re on th t thi kind of DNA re rr ngement i nece ry i th t nti ody de ign i not re ctive y tem, ut pro ctive y tem. A common mi conception i th t the immune y tem encount er p thogen nd cre te nti odie th t fit it. Unfortun tely, there i no kn o n mech ni m y hich cell c n feel the h pe of omething nd cre te protein th t m tche it. In te d, the immune y tem pre-emptively m ke m ny differe nt nti odie ( nd TCR ) po i le, o th t initi lly, mo t of the B nd T cel l in the ody re ctu lly genetic lly different. If n infection occur , mo t of Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 272 RAG1 nd RAG2, lymphocyte- pecific recom in tion ctiv ting gene , recognize the RSS ite nd m ke the dou le- tr nded cut . Once the cut re m de, the exci e d portion join it end together to form circul r ign l joint (SJ) hich i then degr ded. The coding portion h ve ymmetric cut end th t fold into h irp in form tion nd prevent their fu ion. The e h irpin re roken y Artemi , nucle e recruited y DNA-dependent protein kin e (DNA-PK), hich l o ring t ogether XRCC4, XLF, DNA lig e IV, nd DNA polymer e. The XRCC nd XLF light the DNA end , recruit termin l tr n fer e th t r ndomly dd nucleotide to the end , then DNA polymer e l or m fill in the overh ng , nd the lig e com plete the join. Intere tingly, thi proce dd even more v ri ility to the i mmunoglo ulin, ince Artemi cut the h irpin t r ndom, nd the termin l tr n f er e l o dd nucleotide t r ndom.

                     

the B nd T cell ill ump into the p thogen nd ounce right off, not recogniz ing it, ut ome of them ill h ve the right nti ody com in tion to ind to p rt of the p thogenic inv der. Although B cell c n recognize urf ce ntigen o n their o n, in mo t c e , helper T cell i needed to ctiv te the B cell (fi g. 21). Thi proce i initi1 B cterium 2 Antigen TCR MHC II M croph ge M croph ge Helper T cell

B4 cell B4 cell B3 cell ted y m croph ge non- pecific lly inge ting p thogen (1), re king it p r t, nd pre enting it of it on it cell urf ce in p rtner hip ith MHC (m jor hi tocomp ti ility complex). A helper T-cell ith TCR th t c n recognize the ntigen pre ented y the m croph ge ind to it (2) nd th t le d to ctiv tion of the T cell. The ctiv ted helper T-cell ind to nd ctiv te B cell (3) t h t h l o ound to the ntigen of intere t, le ding to m ive B-cell prolife r tion (4), thu providing the ody ith m ny more copie of cell th t h ve the right nti ody to loc te nd fight the infection. Thi doe t o thing : it prov ide lymphocyte reinforcement to pecific lly de l ith p rticul r p thogen ( ut not other B cell , fig. 22), nd once the p thogen h een elimin ted, ther e i l rger circul ting pool of the e cell to re pond more quickly to ny u equent infection y thi p rticul r type of p thogen. Fin lly, ome of the B ce ll ill differenti te into pl m cell (fig. 21-5), th t ecrete nti odie in to the lood tre m to provide humor l re pon e. Other ecome memory cell , h ich re like B cell in th t the nti ody i on it cell urf ce nd not ecrete d, ut they c n e thought of pre- ctiv ted nd c n re pond more quickly th n n ive B cell to re-infection. B2 cell B2 cell B3 cell Activ ted helper T cell B1 cell Antigen B1 cell B1 cell B1 cell

   

Figure 21. Activ tion of B cell

y helper T-cell .

Speci c ntigen receptor ( urf ce

Prolifer tion Activ ted helper T cell B cell Pl m

Cytokine

5 Secreted

nti odie to ntigen

Clon l B cell

3 Antigen

cell

nti ody)

 

Prolifer tion B1 cell B1 cell B1 cell B1 cell B6 cell B5 cell B7 cell B1 cell B1 cell B1 cell B5 cell B7 cell B6 cell Figure 22. Amplific tion of only tho e B cell po e ing nti odie th t c n re cognize the infectiou p rticle( ). Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 273

The ig que tion th t hould h ve een lurking in the ck of your mind through ll thi i , ho do the nti odie nd T-cell receptor tell h t foreign nd h t p rt of one o n ody? Well get to th t hortly. Fir t, rec ll the ctiv tion o f the helper T-cell. It occur hen the T-cell receptor recognize n ntigen fr om n inge ted p thoFigure 23. Antigen pre ent tion y MHC cl II (top) nd cl I ( ottom) to T cell .

Antigen-pre enting cell Helper T cell Endocyto i Endocytic ve icle

Ly o ome . . . . . . .. . . . . . . . . . . . . . . . .. . .. . .. . . . . .. . . . . . . . Fu ion of ly o ome nd tr n port ve icle

Tr n port ve icle

ER Golgi +

Antigen-pre enting cell Cytotoxic T cell Endocyto i Golgi Vir l RNA

ER TAP

2-microglo ulin

Ch pter 16, Adv nced Topic , ver ion 1.0 P ge 274

He vy ch in Prote ome Peptide

MHC cl

I molecule

C p id nd other vir l protein

Viru

Ii molecule MHC cl

Ii fr gment

II molecule

( ntigen) C lnexin

Peptide

( ntigen)

Antigen protein

gen eing pre ented y the MHC cl II molecule on n ntigen pre enting cell ( e.g. m croph ge). Figure 23 ho the p th y from inge tion of the p thogen t o the pre ent tion of it molecul r p rt on n MHC molecule. A imil r p th y l o pplie to pre ent tion of ntigen on MHC cl I molecule in conjunction ith cytotoxic (killer) T cell . The cytotoxic T cell ork g in t compromi ed cell , hether they re infected y viru or nother p thogen (fig. 24). Ther e re t o m jor p th y to A Activ ted cytotoxic T cell F lig nd F

Infected t rget cell C p e C c de Infected t rget cell Apoptotic t rget cell killing the infected cell. One i the ctiv tion of de th receptor, F , hich i nduce ign l tr n duction c c de to ctiv te c p e nd popto i . The oth er p th y i the rele e of gr nzyme nd perforin . The perforin drill into t he mem r ne of the t rget cell nd ecome pore th t llo , mong other thing , gr nzyme to enter the cell, here they ctiv te c p e y proteoly i , nd g in induce popto i . An import nt p rt of thi i th t the T cell receptor reco gnize the ntigen in com in tion ith the MHC molecule th t i pre enting it. F urthermore, there re m ny v ri tion of MHC molecule due there eing 6 loci e ch ith m ny kno n llele . So, h t doe ny of thi h ve to do ith elf v no n- elf recognition? E rly in the development of the immune y tem, the MHC doe not pre ent it of dige ted p thogen , it pre ent it of the org ni m o n cel l th t h ve gone through prote ome or ly o ome. At thi e rly time, T cell eh ve ome h t differently, nd if the T cell receptor ind trongly, the T ce ll commit popto i . Thi get rid of TCR gene th t trongly re ct to the org ni m o n cell . If the T cell do not re ct t ll, popto i i l o invoked, ec u e the TCR gene th t c nnot recognize the MHC ill not e u eful in n immu ne re pon e. Only tho e T cell th t very e kly ind to the elf-pre enting MHC urvive (fig. 25). Ch pter 16, Adv nced Topic , ver ion 1.0 A Antigen-pre enting cell B Antigen-pre enting cell MHC MHC TCR TCR

Figure 24. Cytotoxic T cell fir t recognize n infected cell y the T cell rece ptor, thich then le d to (A) inding of T-cell F lig nd to F on the t rget cell, or ltern tively, (B) ecretion of gr nzyme nd perforin . Both le d to ctiv tion of c p e c c de nd u equent popto i of the infected cell.

 

B Activ ted cytotoxic T cell Gr nzyme

Perforin

    

 

    

T cell T cell

Figure 25. Self-recognition y T-cell receptor inding of MHC protein pre entin g ntigen derived from the org ni m o n cell . If there i trong recognition ( A), the T cell die to prevent cytotoxic tt ck on it o n cell . If it i e k nd the TCR recognize the MHC ut not the ntigen, the T cell urvive (B). P ge 275

T cell

urvive

T cell undergoe

We k receptor

nity popto i

Strong receptor

nity

Cell : Molecule nd Mech ni m i pu li hed y Axolotl Ac demic Pu li hing Comp ny under Cre tive Common licen e th t permit redi tri ution of thi ork in hole or in p rt, provided th t no fee i ch rged nd the ork i ttri uted peci ed in the licen e det il . Axolotl Ac demic Pu li hing Co.