ii AUTHORIZATION TO SUBMIT DISSERTATION This dissertation of Slawomir A Dziedzic, submitted for the degree of Doctor of Philosophy with a major

in Microbiology, Molecular Biology and Biochemistry and titled A novel contribution of autophagic proteins to the process of cell death, has been reviewed in final form. Permission, as indicated by the signatures and dated given below, is granted to submit final copies to the College of Graduate Studies for approval.

Major Professor_____________________________________Date_______________ Allan Caplan Committee Members

_____________________________________Date_______________ Patricia Hartzell _____________________________________Date_______________ Deborah Stenkamp _____________________________________Date_______________ Gustavo Arrizabalaga _____________________________________Date_______________ Douglas Cole

Department Administrator _____________________________________Date_______________ Gustavo Arrizabalaga Disciplines College Dean

_____________________________________Date_______________ Scott Wood

Final Approval and Acceptance by the College of Graduate Studies _____________________________________Date_______________ Jie Chen

iii Abstract

Background Autophagocytosis, also known as a self eating process is a mechanism that is mainly used by eukaryotic cells to recycle nutrients rapidly at the onset of environmental stresses such as amino acid or nitrogen starvation. Despite the fact that this process has been known for a number of decades, its mechanism of action remains poorly described. One of the biggest challenges facing this field is the relationship between this pro-life phenomenon and the increasingly indisputable evidence linking autophagy and cell death. One of the reasons autophagic cell death (ACD) is questioned is that many of the examples supporting it were obtained using mutants with defects in normal cell death pathways, while many of the examples showing that ACD could be prevented used inhibitors that also affected other processes. One way to avoid this controversy is to develop a new model for studying ACD that could be manipulated genetically. One candidate organism for such studies is Saccharomyces cerevisiae. Since autophagy plays many roles in eukaryotic cell and human pathologies, the results from this analysis could identify novel pathways and gene targets leading to the development of new drugs and treatments. Methods In order to examine autophagy functions in response to different stresses I have performed phenotypic analyses on 112 specifically chosen yeast deletion mutants. To distinguish between apoptosis and necrosis I used Annexin V/ PI co-staining. Genetic screening for suppressors of cell death identified the yeast vacuolar protein sorting 70 (VPS70) and other

iv members of the transferrin receptor-like protein family (TfRL) including the plant altered meristem program 1 (AMP1) and human prostate specific membrane antigen (PSMA). By means of biochemical examination employing western blot analysis together with changes in the in vivo localization of fluorescent reporters, I monitored how different autophagy pathways are influenced by death-inducing treatments and how the presence of TfRLs are able to alter this response. Results As a result of these analysis I first determined that yeast treated with zinc underwent a form of necrosis as they died that was facilitated by a group of autophagy proteins. Second, this same treatment also induced other autophagy proteins to carry out a process in opposition to the pro-death set so as to prolong yeast survival. Third, I have shown that these two processes also operated when cells were exposed to other stresses such as nitrogen or leucine starvation. Finally, apoptosis and necrosis could be suppressed by any one of three TfRLs including the mammalian Psma. Conclusion Based on data I have gathered, I have concluded that Psma and other tested members of the TfRL family possess in common a novel biological activity which can prolong cell survival during exposure to several unrelated stresses. Significantly, none of the experiments found evidence of ACD operating independently of apoptosis and necrosis.

v Acknowledgements I would like to express my deep gratitude to my major professor Dr. Allan Caplan, for incomparable mentorship, providing quality education and the opportunity to participate in truly exceptional research project. I would also like to thank him for passing to me part of his vast scientific skills and knowledge as well as for his guidance and friendship outside academics. I also appreciate help of other members of my committee, Dr. Patricia Hartzell, Dr. Deborah Stenkamp, Dr. Gustavo Arrizabalaga and Dr. Douglas Cole for their valuable suggestions and support at various stages of my research. I am especially thankful to Dr. Patricia Hartzell for the opportunity of using her microscope thorough the course of my project. I am indebted to Dr. Andrzej Paszczynski who brought me to University of Idaho. I would also like to express my gratitude to Dr. Katarzyna Dziewanowska and Dr. Bob Behal for their help with biochemical analysis, as well as other members of MMBB department who assisted me on many occasions. I am very grateful to my parents who encouraged and support me at every step of my carrier. Finally, I would like to thank my bellowed wife Jowita for her companionship, countless hours of care and numerous suggestions and ideas which helped me to complete my research project.

vi

This work is dedicated to my wife Jowita

vii Table of Contents Abstract ..iii Acknowledgments ...v Dedication ...vi Table of Contents ......vii List of Tables ...x List of Figures .xi List of Abbreviations ...xiv Chapter 1, Introduction to cellular death pathways ...1 Modes of cell death ..2 Necrosis 2 Apoptosis ..3 Necroptosis ...7 Parp1-mediated necrotic death ..9 Autophagic cell death ...10 Macroautophagy ...12 Microautophagy 17

viii Chaperone-mediated autophagy .18 Autophagy functions .18 Does autophagy really have the license to kill? ..20 Chapter 2, Chapter 3, Chapter 4, Hypothesis and specific aims .......................................................................30 Materials and methods .33 Identification of autophagy genes participating in zinc-induced necrotic cell death in Saccharomyces cerevisiae 45 Introduction ...47 Results 50 Discussion ..75 Chapter 5, Autophagy proteins play cytoprotective and cytocidal roles in leucine starvation-induced cell death in Saccharomyces cerevisiae ...78 Introduction ...80 Results 84 Discussion 100 Chapter 6, A novel effect of Prostate specific membrane antigen, a member of TfRL protein family, on cell death in yeast .............103 Introduction .105

ix Results ..108 Discussion 134 Chapter 7, Chapter 8, Future directions .138 References 146

List of Tables Table 1.1. Diagnostic features of the different death pathways......25 Table 3.1. Yeast strains used in this study .42 Table 3.2. Plasmids used in this study ...43 Table 4.1. Classification of knockout mutant phenotypes .60 Table 5.1. Rapamycin reduces the symptoms of death during leucine starvation .90 Table 6.1. VPS70 requires many vacuolar proteins to protect cells from Zn2+....... 118

xi

List of Figures Figure 1.1. Classification of cell death pathways ..26 Figure 1.2. Characterization of autophagy pathways 27 Figure 1.3. Non-specific autophagy targets random cytoplasm content for degradation ..28 Figure 1.4. Cvt transport of the premature Ape1 protein to the vacuole ...29 Figure 4.1. Zn2+ disrupts cell metabolism and division .61 Figure 4.2. Vacuolar inclusions in Zn2+-treated cells bound DAPI ...62 Figure 4.3. Zn2+-induced cell death is dependent on ATG8 ...63 Figure 4.4. Zn2+ -treated cells failed to expose annexin-binding sites ...64 Figure 4.5. GFP-Atg8 accumulated in perivacuolar vesicles in Zn2+-treated cells 65 Figure 4.6. Dual fluorescent protein, ROSELLACyt, was restricted to the cytosol in Zn2+treated cells ..67 Figure 4.7. Zn2+ did not promote the harvesting of either nuclear- or mitochondriallytargeted ROSELLA ..68 Figure 4.8. Ape1-RFP accumulated in perivacuolar vesicles in Zn2+-treated cells ...69 Figure 4.9. Classification of phenotypic responses of mutants to excess zinc ..71 Figure 4.10. Autophagic mutants were differentially inhibited by Zn+2 ....73 Figure 4.11. Mutants of SEY6210 behaved qualitatively like those of BY4741 ...74 Figure 5.1. Autophagy mutants did not respond uniformly to nutrient deprivation ..91 Figure 5.2. Annexin V and PI staining in PS populations progresses at different rates depending on the starvation treatment .92

xii Figure 5.3. Expressing GFP-Atg8 in PS cells changed the percentages of cells dying during starvation ..93 Figure 5.4. GFP-Atg8 was not harvested or processed by atg8 cells during leucine starvation .94 Figure 5.5. GFP-Atg8 was not harvested in leucine-starved atg8 cells ...95 Figure 5.6. HttQ25-GFP didnt influence cell death 96 Figure 5.7. HttQ25-GFP didnt accumulate in vacuoles during leucine starvation .97 Figure 5.8. Leucine-starved cells harvested basal levels of Ape1-RFP .98 Figure 6.1. TfRL proteins protect yeast from excess zinc ...120 Figure 6.2. Psma and Amp1 did not need Vps70 to protect cells from zinc 122 Figure 6.3. TfRL proteins protect yeast from treatments that induce necrotic and apoptotic death ...123 Figure 6.4. VPS70 did not alleviate all causes of death ...125 Figure 6.5. VPS70 suppressed autophagy mutations but not a knockout of the rab-like gene, YPT7 .126 Figure 6.6. TfRL proteins alter vacuolar morphology and the cell size of yeast .127 Figure 6.7. Vps70 was not required for Ape1-RFP harvesting by CVT or autophagic pathways ...128 Figure 6.8. Vps70 did not suppress the inhibitory effect of Zn2+ Ape1-GFP import into vacuoles ..129 Figure 6.9. TfRL proteins suppressed the block on GFP-Atg8 import into vacuoles caused by Zn2+ ...130 Figure 6.10. PMSA and PSMA-GFP required Atg11 to protect cells from 13 mM Zn2+ .131

xiii Figure 6.11. Psma-GFP was harvested by an Atg11-dependent process in Zn2+-treated cells ..132 Figure 6.12. Psma-GFP was harvested during both leucine- and nitrogen-starvation 133 Figure 7.1. Model describing possible role of Psma in response to Zn2+ ....145

xiv List of Abbreviations ACD Autophagy cell death ATG Autophagy related gene CMA Chaperone-mediated autophagy Cvt Cytoplasm to vacuole transport DR Death receptor MOB Mitochondrial outer membrane permeabilization Parp1 - Poly(ADP-ribose) polymerase 1 PAS Phagophore assembly site PCD Programmable cell death PI Propidium iodide PMN Piecemeal microautophagy of the nucleus Psma Prostate specific membrane antigen Rap Rapamycin TNF Tumor necrosis factor Tor target of rapamycin

Chapter 1 Introduction to cellular death pathways

Modes of cell death

It is the ultimate fate of every living cell to die. It is sometimes hard to understand that every cell has the means to do this encoded in its genome. The major role of cell death during development is to orchestrate morphogenesis and tissue sculpting whereas in mature organisms it helps to maintain homeostasis and remove cells invaded by pathogens. Because of its crucial role, many defects in cell death functions are widely associated with many diseases such as neuron degenerative disorders or cancer. Historically, cellular death was called necrosis until 1971 when the form of nonpathologic shrinking necrosis was described in certain tissue types (Kerr, 1971). Later on, this was called apoptosis to distinguish between gene-independent and gene-controlled forms of death. Nevertheless, as more and more data was gathered it became obvious that this simple division was not sufficient since other forms of death have been discovered. Because of that, an effort has been made to create a new taxonomy which would include those new mechanisms. One such a classification was recently proposed by Degterev and Yuan (2008), where cellular death pathway were divided into Programmable cell death (PCD) and necrosis (Figure 1.1).

Necrosis
Necrosis (from Greek death, the stage of dying) is considered to be an uncontrolled, premature death of cells or living tissue. The mechanism was described in detail in 1988 (Walker et al, 1988). It is characterized by plasma membrane disruption, organelle swelling, random DNA degradation, and overall bioenergetic impairment (Zong & Thompson, 2006). It is a passive process which does not require protein synthesis, energetic input and does not

3 play any known role in homeostasis. In humans, necrosis can be triggered by exposure to toxins or reactive oxygen metabolites, temperature treatment or nutrient deprivation and generally by any severe change in physiological conditions (Nicotera et al, 1999; Nicotera & Lipton, 1999). Despite its relevance in many human diseases, such as Huntington, Parkinson or Alzheimer syndromes (Price et al, 1998), a detailed molecular outline of events occurring during necrosis remains to be elucidated. Due to many challenges and difficulties in working with higher eukaryotes, many studies related to this death pathway have been carried out in Drosophila melanogaster (Mutsuddi & Nambu, 1998) or Saccharomyces cerevisiae (Eisenberg et al, 2010b). In yeast, more than a dozen different agents capable of inducing necrosis have been characterized. Most of them, like H202, valproic or acetic acid, Mn2+, Cu2+ or amphotercin B may be also utilized in lower concentrations to study apoptosis (Liang & Zhou, 2007; Ludovico et al, 2001b; Madeo et al, 1999). Because one of the necrotic hallmarks is membrane permeabilization, the passive transfer of propidium iodide (a DNA binding dye) through the disruptions is used as a primary death indicator.

Apoptosis
The word apoptosis (from the Greek falling off as in leaves from tree) was introduced in 1972 to describe morphological changes leading to controlled cell demise (Kerr et al, 1972). The mechanism is characterized by an internucleosomal fragmentation of genomic DNA (Wyllie, 1980), and cell shrinkage and fragmentation into apoptotic bodies that are rapidly engulfed by phagocytes (Kerr et al, 1972).

4 Even though the existence of apoptosis was described in the early seventies of the previous century, its molecular basis was dissected as recently as twenty years ago (Horvitz et al, 1994). Those pioneer studies were mostly done in Caenorhabditis elegans, a transparent nematode in which 131 cells undergo PCD during development. Interestingly, any disruption of the cell death machinery results in organisms with additional cells (Hedgecock et al, 1983). The apoptosis in those selected cells is triggered by the transcriptional activation of egl-1, which in turn binds to a suppressor of Ced-4, Ced-9, leading to the activation of Ced3 which triggers a cascade of reactions resulting in death (Metzstein et al, 1998). In mammals, apoptosis can be triggered by different stimuli through intrinsic and extrinsic pathways. Intrinsic mechanisms, which resemble PCD in C. elegans, may be initiated by stress signals such as cytoskeleton disruption, protein synthesis inhibition or DNA damage (Youle & Strasser, 2008). Extensive studies have led to the identification of various homologues in mouse and different human cell lines for each of the Ced proteins revealing complexity of this mechanism in higher eukaryotes. Even though mammalian Egl-1-like BH3-only members of BCL2 family, like the related proteins in C. elegans, inhibit antiapoptotic Ced-9-like proteins via direct interactions (Youle & Strasser, 2008), the more important role of this protein group is to protect the integrity of mitochondria, thus inhibiting Bax/Bak pro-apoptotic activation (Cheng et al, 2001). Bax, Bak and Bok, which make up the Bax family of proteins, possess a BH domain which makes them structurally similar to Bcl2. Studies in the mouse model revealed that their presence is essential for the initiation of apoptosis and at the same time suppression of oncogenic transformation (Zong et al, 2001). Upstream signals, such as DNA damage, activate caspase-8 which in turn cleaves p15 Bid, creating tBid which by direct interaction with either Bax or Bad results in their

5 oligomerization which leads to mitochondrial outer membrane permeablization (MOMP) (Li et al, 1998). The presence of MOMP mediates release of cytochrome c or AIF, proteins which are normally found in between two mitochondrial membranes (Scorrano & Korsmeyer, 2003). In the cytoplasm, cytochrome c initiates formation of the APAF1 complex, which then activates caspase-9 by changing its conformation. This in turn activates the group of caspases which are involved in the biochemical chain of events leading to death (Degterev et al, 2003). This intrinsic pathway can be compared with the extrinsic pathway that is initiated after the engagement of pro-inflamatory and pro-apoptotic ligands which bind to surface death receptors (DR) (Schulze-Osthoff et al, 1998). The best studied death factors belong to the tumor-necrosis-factor (TNF) protein family which is composed of TNF (TNF), FasL and TRAIL (Gonzalvez & Ashkenazi, 2010). Interaction of those factors, which are predominantly produced by the immune system, with DR triggers the formation of intercellular death signaling complexes (DISCs), which activate caspase-8 (Micheau & Tschopp, 2003), thus initiating either the caspase signaling pathway (Amarante-Mendes & Green, 1999) or mitochondria damage leading to cell death (Barnhart et al, 2003). Apoptosis is believed to be a universal PCD mechanism present in almost all eukaryotic organisms. Nevertheless, recent discoveries in plant molecular biology seem to be questioning this dogma. In a review article, Van Doorn and others (2011) argue that dying plant cells never exhibit traits characteristic for apoptosis. Even though protoplasts exposed to stress treatments do shrink, they never form apoptotic bodies when their plasma membrane is disrupted (Heath, 2000). What is more, proteolytic activity and caspase activation has never been shown to be associated with apoptosis in plants (Hatsugai et al, 2004). These

6 findings taken together with the fact that chromatin condensation and DNA fragmentation in plants is associated with other forms of PCD (Lee & Baehrecke, 2001), led to the hypothesis that apoptosis is not present in those organisms. Instead, the authors proposed two alternative forms of programmable cell demise: necrosis and vacuolar plant death. Apoptosis was also discovered in Saccharomyces cerevisiae (Madeo et al, 1997b), Schizosaccharomyces pombe, as well as in a number of protozoan parasites (CarmonaGutierrez et al, 2010). Initially it did not make any sense for the organism composed only of a single cell to poses any form of programmable cell death. Nonetheless the presence of PCD in unicellular organisms is often explained as one more feature associated with quorum sensing, where the death by an individual cell can be beneficial for the whole population (Bttner et al, 2006). For example, in the wild, any individual cell which comes across rotting fruit will start a colony composed of organisms carrying virtually the same genotype. Within time, nutrients from the source will run out and the members of the colony will enter a dormant, but still metabolically active, state that continues to undergo chronological aging (Fabrizio & Longo, 2007). Nonetheless even in this phase cells utilizing the last portions of the available nutrients will sentence the whole colony to its doom. Because of that, it seems that older cells (particularly those which divided more than twice) preferentially undergo apoptosis donating their portion of amino acids and sugars to the younger ones (Allen et al, 2006) In yeast, as mentioned previously, apoptosis can be induced by a lower concentration of the same agents that induce necrosis. The molecular mechanisms for this process are still unknown. Nonetheless, similar to higher eukaryotes, reactive oxygen species (ROS) originating from the mitochondrial respiratory chain together with nitric oxide (NO) serve as

7 the two main signals capable of initiating apoptosis (Almeida et al, 2007; Laun et al, 2001). Only a handful of proteins have been identified to play a role in apoptosis, among which is a homologue of human caspases, Yca1. Because this doesnt have the ability to hydrolyze proteins after an acid residue (aspartate), it is biochemically considered a metacaspase. Nevertheless, Yca1 is believed to be responsible for the initiation of a process equivalent to apoptosis in yeast. One of the earliest hallmarks of apoptosis is a translocation of a phosphatidylethanolamine from the inner to the outer leaflet of the cellular membrane making it accessible to fluorescence-tagged annexin V. If cells stain positively both for annexin V and PI then it implies that they are undergoing late apoptosis, or as it is sometimes known, secondary necrosis (Carmona-Gutierrez et al, 2010). Other, sometimes less reliable, methods to detect apoptosis in yeast include DNA nicks staining using TUNEL and DAPI staining which is being used to measure the level of chromatin condensation (Madeo & Frhlich, 2008).

Necroptosis
As noted previously, stimulating the DR protein family with any of its ligands leads to the induction of an extrinsic form of apoptosis (Schulze-Osthoff et al, 1998). Nevertheless, some studies have shown that cells are still able to undergo some form of gene-regulated death even when their caspase-3 is inhibited (Degterev et al, 2005). Cells treated in this way failed to show nuclear fragmentation, plasma membrane disruption, and organelle swelling, and so seemed to be dying necrotically rather than apoptotically (Matsumura et al, 2000; Vercammen et al, 1998). This has come to be recognized as a new form of PCD called programmable necrosis or necroptosis (Degterev et al, 2005).

8 Receptor interacting protein 1 (Rip1) is an essential player that seems to be responsible for initiating necroptosis (Degterev et al, 2008). Rip1, first discovered in relation to NF-B activation, possesses a serine/threonine kinase activity that autophosphorylates at residue Ser 161 (Degterev et al, 2008). However, phosphorylation alone is insufficient to activate the protein: it also needs an upstream signal from TNF-related apoptosis-inducing ligand (TRAIL) to trigger additional conformational changes of Rip1 which lead to its dimerization (Degterev et al, 2005). At the moment, very little is known about Rip1 substrates and the signaling pathways downstream from it. What has been shown is that upon activation, Rip1 translocates to the mitochondria and then triggers their rapid degeneration, presumably by disrupting the association of ADP-ATP translocase with cyclophilin D (Temkin et al, 2006). How this is done remains to be elucidated. It has been postulated that ROS might be executioners of necroptosis. Nevertheless, their involvement in the process is likely very cell type specific since antioxidant treatment is unable to protect some cell lines against necroptosis (Degterev et al, 2005). Similarly, knockouts of the genes involved in autophagy such as BECLIN1 (homologue to the yeast AuTophaGy-related gene 6, ATG6) or ATG7, were shown to prevent this type of death in mammalian cells (Yu et al, 2004). Nonetheless, this is the only, to date, system in which a direct correlation between autophagy and necroptosis inhibition has been described (Christofferson & Yuan, 2010). Although researchers have begun to understand necroptosis, it appears that all of the cases attributed to it result from pathological conditions. Because this linkage has medical implications, a screen has been carried out recently that has identified a group of structurally different, small molecules which can preferentially inhibit necroptosis, but not TNF-

9 induced apoptosis (Degterev et al, 2005; Teng et al, 2005). The most potent of these chemicals, Nec-1, is the first described specific inhibitor of Rip1. Its addition protects neurons against excitotoxins, which are involved in the pathology of neurodegenerative diseases (for example Alzheimers Disease) and in acute neuronal loss resulting from strokes (Moskowitz et al, 2010). Excitotoxicity occurs mainly as a result of excessive stimulation by neurotransmitters such as glutamate, which by binding to the neurotransmitter receptors, allows excessive amounts of calcium ions to enter the cell and to death (Manev et al, 1989)

Parp1-mediated necrotic death

Poly(ADP-ribose) polymerase 1 (Parp1) is a very important nuclear protein needed for a genome stability. This enzyme, which is activated by DNA-strand breaks, possesses three functional domains. Two N-terminal zinc fingers are responsible for binding to the singleand double-strand DNA brakes. The central automodification domain allows for self poly(ADP-ribosyl)-ation, while the carboxy-terminal part of the protein can transfer ADPribose subunits from NAD+ to peptide acceptors (Rouleau et al, 2010). Loss of Parp1 results in cell hypersensitivity to DNA damage. At the same time, its excess can trigger a unique, non-apoptotic form of PCD (Oei et al, 2005). In glycolytic cells, Parp1 mediates necrotic cell death resulting from an energy collapse caused by a depletion of NAD+ in the cytosol. In this case, Parp1 acts as a metabolic sensor in the damaged cells which recognizes if ATP can be produced in glucose-dependent and independent processes. Cell that can run both processes, rather than just one of them, are resistant to Parp1-mediated DNA-damage induced death. This ATP sensing prevents accumulation of DNA damage in rapidly proliferating cells that would be predisposed to

10 becoming transformed (Zong et al, 2004). In a separate response to secondary DNA damage, Parp1 triggers the translocation of the apoptosis inducing factor (AIF) from the mitochondria to the nucleus where it causes nuclear condensation and cell death (Yu et al, 2006b). The exact nature of this mechanism is unknown, but it has been postulated that Parp1 can either change mitochondria membrane polarization or bind to a specific factor, in either case leading to the AIF release (Gagne et al, 2003). Parp1 inhibitors have proven to be extremely effective in mouse models of various diseases. They provide significant protection against colitis, neurodegeneration and diabetes mellitus (de la Lastra et al, 2007) as well as seem to be very promising agents in cancer treatment since their application selectively kills some tumor cells (Zaremba et al, 2010).

Autophagic cell death

The term autophagy (from Greek self-eating) was introduced in 1963 to describe the presence of intracellular single- or double-membrane vesicles containing degenerated cytoplasmic content (De Duve & Wattiaux, 1966). Early studies on autophagy which were carried out in rat livers demonstrated that the process could be induced by starvation (NOVIKOFF et al, 1964). Later on, it became apparent that this process was specifically triggered by the lack of amino acids and that the degradation mediated by autophagocytosis was the cells way of relieving this (Mortimore & Schworer, 1977). Even though the early studies were based on morphological changes observed predominantly in mammalian tissue, most of what we know today about autophagy comes from genetic analyses carried out in Saccharomyces cerevisiae. In the early nineties, a pioneering analysis performed by Ohsumi and co-workers showed high levels of similarity between the

11 mechanistic principles of autophagy in yeast and mammals (Takeshige et al, 1992b). This work was followed by the identification of the first AuTophagy-related Gene, ATG1, that encoded for a ser/thr protein kinase (Matsuura et al, 1997). Since the recent identification of ATG34 (Suzuki et al, 2010), more than thirty yeast proteins have been directly and exclusively assigned to this pathway. Initially, autophagocytosis was believed to be a process only responsible for the random degradation of the contents of the cytoplasm. This activity was seen to release free amino acids and lipids which could be utilized to prolong cell survival during stress (Tsukada & Ohsumi, 1993b). Within time it became obvious that this was only one of the mechanisms by which autophagy proceeded. Nowadays, autophagy is very often divided into macrophagy, microphagy and chaperone-mediated autophagy (CMA). Within the macrophagy category, researchers distinguish between mechanisms of random sequestration of the intracellular content (non-specific autophagocytosis) and very specific destruction mechanisms named according to the nature of the substrate being targeted (e.g. destruction of mitochondria mitophagy, ER ER-phagy, nucleus nucleophagy, and so on) (Mizushima et al, 2008). This simple classification is believed to apply to most eukaryotic organisms although yeast possesses an additional very selective process called cytoplasm to vacuole transport (Cvt) (Harding et al, 1995b). In most organisms and cell types all of these different forms of autophagocytosis co-exist in any given time. Nevertheless, the rate of each activity and their contribution to homeostasis may vary greatly depending on the cell type and environmental conditions (Cuervo, 2010).

12 Macroautophagy Different forms of autophagy operate using dissimilar machineries (Figure 1.2). During mammalian macroautophagy de novo created membranes surround and engulf cytoplasm within a double membrane vesicle called an autophagosome. This autophagosome is then delivered to the lysosome. Upon fusion, it forms a so-called autolysosome where lysosomal enzymes degrade the captured cytoplasmic material (Mizushima et al, 1998). In organisms which do not posses lysosomes (like yeast), autophagosomes fuse with vacuoles and release their contents for destruction (Tsukada & Ohsumi, 1993b). The whole mechanism, which includes vesicle formation, delivery, and lysosomal (vacuolar) fusion is carried out by ATG proteins and negatively controlled by a tyrosine protein kinase complex called TORC (Kamada et al, 2000). In normal physiological conditions, macroautophagy operates at a very low basal level. Nitrogen starvation or treatment with the chemical, rapamycin, leads to inhibition of the Target Of Rapamycin (Tor or mTor in mammals) inhibitor of autophagy. This in turn activates another serine/threonine protein kinase Atg1, which forms a ternary complex with Atg13 and Atg17 to create a scaffold for other ATG proteins thus recruiting them to the phagophore assembly site (PAS) (Figure 1.3) (Kawamata et al, 2008). Unlike yeast, mammalian cells possess two Atg1 homologues Unc-51-like kinase 1 (Ulk1) and -2 (Ulk2) and one Atg17 homologue, Fip200. Similar to the yeast system, those three proteins together with Atg13 create a complex which initiates assembly of the preautophagosome assembly structure (PAS) (Hara et al, 2008). Autophagosomes are built at the PAS from ER-originated membranes (Girardi et al, 2011). This extremely complex process requires formation of the class III phosphatidylinositol 3kinase (PtdIns3K) complex, which in yeast contains Atg6, Atg14, Vps15 and Vps34. The

13 main function of this complex is to recruit Atg18, Atg20, Atg21 and Atg24 to the PAS, where, together with the PtdIns3K, they further employ two ubiquitin-like conjugation systems, that condense Atg8-phosphatydyloethanoloamine and Atg12-Atg5-Atg16 , which are the key elements of autophagosome formation (Nice et al, 2002). In mammals, this mechanism operates in a similar fashion by utilizing homologues of the yeast proteins with the exception of Atg20 and Atg24 (He & Klionsky, 2009). When autophagosome formation is complete, all ATG proteins dissociate back to the cytosol with the exception of Atg8 which remains with the autophagosome and enters the lysosome or vacuole with the inner-most membrane of the autophagosome. The exact details of this process still need to be elucidated, but the crucial role of a cysteine protease Atg4 in vesicle fusion is beyond any doubt (Kirisako et al, 2000). The protein set which is responsible for autophagosome-lysosome fusion is virtually the same as the one guiding autophagosome fusion with the vacuole. In both cases, fusion of the two vesicles requires small GTPases, Ypt7 or Vps21 (mammalian Rab7 and Rab5, respectively), members of the class C Vps/HOPS complex, SNARE proteins Vam3, Vam7, Vti1 and Ykt6, together with Ccz1 and Mon1 which are proposed to be guanine exchange factors (GEF) for GTPases (Klionsky, 2005; Nordmann et al, 2010b). Upon fusion, the contents of the autophagosomes are degraded by acid hydrolases such as proteinases A and B together with lipase Atg15 (Epple et al, 2001). In yeast the end products of autophagic degradation, amino acids, are then recycled back to the cytosol by a set of vacuolar permeases including Atg22 and Avt4 (Yang & Klionsky, 2007). In selective macroautophagy, the cargo is generally recognized by its interaction with a specific recognition protein. The Cvt pathway shown on Figure 1.4 is probably the most

14 extensively studied type of specific autophagocytosis. Even though Cvt uses many of the ATG proteins used by other processes (Scott et al, 1996), there are few major differences in the way Cvt operates in comparison with non-specific macroautophagy. First of all, this pathway operates constitutively, thus conventional autophagy inducers have no effect on the rate of its activity. Furthermore, this mechanism is known to operate using vesicles called Cvt-somes that are smaller than conventional autophagosomes (Scott et al, 1996). Cvt transports four known hydrolases to the vacuole for their maturation rather than degradation (Kim et al, 1997b). Ape1 is one such aminopeptidase that hydrolases leucine substrates (Trumbly & Bradley, 1983). Ape1 is synthetized in the cytosol as an inactive proenzyme (mApe1), which is recognized by a receptor protein, Atg19. This complex is in turned recognized by an adaptor protein Atg11, which directs it to the PAS, where Atg19 interacts with Atg8 to initiate Cvt vesicle formation (Scott et al, 2001). The Cvt-some is transported and fused with the vacuole using (apart from a few exceptions such as a requirement for Ypt7 and Vps15) essentially the same components as non-specific macroautophagy (Noda et al, 2000). Extensive studies, mainly performed by Klionskys group, led to identification of additional Cvt proteins such as Atg21, Atg23 and Atg24 (Lynch-Day & Klionsky, 2010). Atg21 was shown to be responsible for vesicle formation in place of Atg18 that is not required for non-specific macrophagy (Barth et al, 2002) Similarly, Atg24 a member of the nexin family of sorting proteins, and Atg23, a PAS peripheral membrane protein, are only crucial for Cvt (Harding et al, 1996; Meiling-Wesse et al, 2004). In higher eukaryotes, selective macroautophagy is exclusively associated with the preferential destruction of cellular organelles. Nevertheless, recent studies have shown that autophagy is also involved in selective destruction of ubiquitinated preoteins and protein

15 aggregates (Fujita & Yoshimori, 2011; Jimenez-Sanchez et al, 2011). This mechanism is mediated by p62, which binds to mono- and poly-ubiquitinated substrates by means of its ubiquitin-associated (UBA) domain. In turn, this increases the affinity of these complexes for LC3, the mammalian homologue of yeast Atg8 (Pankiv et al, 2007). Because p62 and Atg19 share similar N-terminal domains, it is believed that the mammalian protein is in fact a receptor that operates for its substrates like Atg19 does for Ape1 in yeast (Noda et al, 2008). Damaged mitochondria tend to release reactive oxygen species (ROS) into the cytosol where they can damage cell structures and thus trigger death. A specialized type of macroautophagy called mitophagy is responsible for clearing these dysfunctional organelles from cells. In yeast, Atg32 is a protein which tags mitochondria for autophagic destruction by binding to their outer membrane (Okamoto et al, 2009). This protein, in turn, is recognized by Atg11, which under mitophagy-inducing conditions, acts as an adaptor for the autophagosome. Relatively little is known about the molecular basis of this process, but a recent genomic screen has identified another yet mitophagy-related protein of unknown function, Atg33 (Kanki et al, 2009). When the cells encounter stress conditions characterized by a prolonged lack of amino acids, it can terminate the energetically expensive process of ribosome biogenesis and protein translation by a mechanism called ribophagy. Within this process the large ribosomal subunit is degraded in a ubiquitin protease-dependent manner This mechanism is carried out by a deubiquitinase, Ubp3 (cysteine protease), interacting with its cofactor, Bre5 (Kraft et al, 2008). In addition, the chaperone-like protein, Cdc48, with its cofactor, Ufd3, have recently been shown to be involved in ubiquitin tagging of ribosomes (Ossareh-Nazari et al, 2010).

16 Remarkably, the adaptor protein for ribophagy seems to be Atg19, the adaptor also essential for Cvt (Baxter et al, 2005). During starvation, or during the unfolded protein response that occurs in response to inhibition of protein folding, ER structures are destroyed by a gene-regulated process called ERphagy (Hamasaki et al, 2005). Interestingly enough, under nutrient deprivation, ERphagy is independent of Atg5 and Atg12, which implies that ER may be delivered to the vacuole/lysosome using an autophagosome-independent pathway (Mijaljica et al, 2006). Similarly, preferential degradation of peroxisomes may or may not occur via the autophagosome machinery (Manjithaya et al, 2010). Peroxisomes are single membrane organelles with multiple functions including fatty acid biogenesis and detoxification of hydrogen peroxide. In yeast they are mostly destroyed in an Atg8-independent manner in response to shifts in carbon source as occurs when cells are transferred from methanol to glucose (Komatsu & Ichimura, 2010). For historical reasons, the molecular principles of pexophagy were revealed mostly by studies carried out in Pichia pastoris. Atg30, a receptor for this process, has been identified and shown to bind to the peroxisomal proteins, Pex3 and Pex14, causing Atg30 to be autophosphorylated. Activated Atg30 interacts with Atg11, which triggers the vacuole to engulf the tagged peroxisomes bringing them directly into the vacuole. Unlike autophagic receptors like Atg19 and p62, Atg30 does not have an Atg8 binding domain, adding support to the notion that pexophagy does not require autophagosome formation (Farr et al, 2008). Another specific type of macrophagy is involved in the degradation of certain parts of the nucleus. This so-called piecemeal microautophagy of the nucleus (PMN) is an Atg11 dependent mechanism within which a nuclear-vacuolar junction is formed mediated by the

17 vacuolar protein, Vac8, and by the nuclear protein, Nvj1 (Roberts et al, 2003). Nutrient starvation increases the affinity of Nvj1 for Osh1 and Tsc13, which in turn helps Nvj1 to create holes in the membranes that separate the nucleus from the vacuole (Kvam & Goldfarb, 2004). PMN is not believed to be responsible for nutrient re-cycling, but rather involved in the regulation of nuclear processes important during stress conditions. Microautophagy In mammals, microautophagy is a direct sequestration of cytoplasm content by the lysosome. Despite the fact that this mechanism has been known for almost half a decade, its exact mechanism and function in higher eukaryotes still remains unclear (Mijaljica et al, 2011). In yeast, non-selective microautophagy (NMS) where the vacuole forms a tubular invagination, has been seen by fluorescence and electron microscopy (Muller et al, 2000). Both in-vitro and in-vivo studies have revealed that NMS depends on an ATPase activity and on a proton gradient across the membrane. Furthermore, GTPase together with sources of lipids and membranes is crucial for the release of the mincoautophagic vesicles into the lumen. The whole process occurs independently of proteins involved in regular vacuolar fusion (Sattler & Mayer, 2000). NMS can be induced by starvation (Mayer, 2008) and is at least partially regulated by Tor and by the EGO (exit from rapamycin-induced growth arrest) complex composed of Ego1, Ego3, Gtr2 (Dubouloz et al, 2005b). Actin (Uttenweiler et al, 2005), not tubulin (Kunz et al, 2004), seems to be involved in the mechanism of membane invagination, but how it is used remains unknown.

18 Chaperone-mediated autophagy CMA is a direct translocation of a target protein to the lysosome lumen so that it can be degraded. This process was first discovered in human fibroblasts (Dice, 1982) and has continued to be studied in mammalian tissues. Its basic machinery requires chaperones which recognize the substrate and deliver it to the lysosome, a receptor which pulls the substrate into the lysosome lumen, and a substrate that poses the specific recognition motif, KFERQ (Orenstein & Cuervo, 2010). Hsc70 is a chaperone which can be found both bonded to the lysosome or in a free form. Hsc70 possesses a strong affinity for the KFERQ sequence and transports the recognized proteins to a lysosomal receptor, Lamp2a, where it is partially unfolded before it is transported across the lysosomal membrane for its degradation (Majeski & Dice, 2004). Similar to macroautophagy, CMA is most effectively induced by stresses such as nutrient depravation. It was shown that this mechanism can contribute both to the selective degradation of unimportant proteins as well as damaged ones which could otherwise trigger cell death (Cuervo, 2010). Because of that, and due to the fact that basal CMA was shown to be important for cell homeostasis (Massey et al, 2006), this pathway has attracted great interest because stimulating it may be beneficial for treating several human diseases such as Alzheimer or Parkinson diseases that are characterized by protein misfolding and aggregation (Li et al, 2011). Autophagy functions Autophagy, as one of the primary non-proteosomal degradation pathway plays multiple roles during both normal and pathological stages of the life of a cell. Because the primary role of autophagy is to clear the cell of damaged proteins or organelles, this mechanism is

19 indispensable during aging. Studies in Drosophila melanogaster revealed that mutants lacking Atg7 expression in their central nervous system lived shorter lives than their parents (Juhsz et al, 2007). In addition, over-expression of ATG8 resulted in increased lifespan in adult organisms (Simonsen et al, 2008). Autophagy is also stimulated in old cells by caloric restriction, which correlates with the prolonged longevity that this condition produces (Cavallini et al, 2008). In addition to being involved in aging, autophagy is considered to be a defense mechanism against many human diseases ranging from neurodegenerative syndromes to cancer. Rapamycin treatment, which inhibits Tor leading to autophagy induction, has been shown to remove otherwise toxic huntingtin aggregates in a mouse model (Ravikumar et al, 2004). Furthermore, recent studies showed that autophagy is stimulated by ROS and contributes to clearance of amyloid--peptide (the main cause of the condition) in Alzheimers disease (Lipinski et al, 2010). A link between autophagy and cancer was established by the discovery that Beclin 1 (an essential mammalian autophagy protein) is also a haplo-insufficient tumor suppressor. Beclin 1 binding to the anti-apoptotic protein Bcl-2, decreases its affinity for Vps34 and inhibits autophagy. Furthermore beclin 1 mice are more susceptible to different forms of metastasis (Qu et al, 2003) while its monoallelic loss coincides with more than 50% of human breast, ovary and prostate cancer cases (Aita et al, 1999). In general, defects in autophagy lead to the accumulation of damaged mitochondria, ROS and mis-folded proteins, which in turn may promote DNA damage which in turn results in metastatic transformation (Mathew & White, 2007). In this regard, autophagy is utilized by the cell to protect itself from carcinogenesis. Nevertheless, once cancer does begin, autophagy can prolong its survival by protecting the cells from stresses such as nutrient limitations or hypoxia. This

20 phenomenon is the focus of several new strategies for cancer treatment. Many drugs in clinical trials nowadays inhibit autophagy and by doing so, lead to tumor regression (Amaravadi et al, 2007). Beyond its well described involvement in cell defense mechanisms, autophagy also participates in various developmental processes in numerous organisms. In yeast, diploid mutants deficient in autophagocytosis cannot sporulate during starvation (Tsukada & Ohsumi, 1993b), while ATG1 and ATG3 strains of Drospohila melanogaster die prematurely before reaching the pupal stage (Juhsz et al, 2003). In addition, mice embryos lacking Beclin 1 are unable to undergo developmental divisions and die prematurely (Mathew et al, 2007). Does autophagy really have the license to kill? Autophagic cell death (ACD) is believed to be a form of PCD resulting from excess autophagy (Some of the diagnostic features of the different death pathways are listed in Table 1.1). It is identified by an increase in autophagosomes accumulation in dying cells (Clarke, 1990). The symptoms of this caspase-independent process are different from the morphological features seen in cells undergoing apoptosis. During ACD, cells first degrade their organelles leaving an intact cytoskeleton which is destroyed at a later step (Schweich.JU & Merker, 1973). Taking into consideration the fact that autophagy in most cases is induced by various stress conditions (such as starvation), it shouldnt be a surprise to find it operating in dying cells. Ironically, this association is being used now as the main argument supporting the notion that death by autophagy does not exist. It is being suggested that autophagy, which is primarily a pro-life pathway, is, in these circumstances, being used by the cell as the last

21 line of defense against death, rather than an accelerator or cause of death (Shen et al, 2011a). Furtermore, recent studies using mammalian tissue cultures have identified numerous autophagy inducers, none of which is able to induce ACD (Shen et al, 2011b). Nevertheless, since more and more evidence, mainly from studies carried out in lower eukaryotes, is pointing to a correlation between autophagy and death, it is way too soon to proclaim the end of autophagic cell death. Shen and Codogno (2011) have proposed that in order to call the studied mechanism ACD, \ three criteria must be met. First, cell death must occur without involvement of apoptotic machinery. What is more, death must be accompanied by an increase in autophagic flux and must be suppressed by chemical or mutations that specifically inhibit autophagy. Because the interplay between autophagy and apoptosis is well described in the literature (Giansanti et al, 2011), fulfilling these requirements, especially in higher eukaryotes, can be challenging. Nonetheless results obtained with model organisms missing components of the apoptosis machinery seem to provide evidence supporting the existence of ACD. A few of these cases are presented below, but whether these are only exceptions from the general rule or artifacts generated by improperly designed experiments (Shen et al, 2011a), remains to be determined. As mentioned above, plants lack the machinery of apoptosis. Instead, their cells can undergo so-called vacuolar cell death which resembles specific macroautophagy (van Doorn et al, 2011). This mechanism is especially important during the development of the plant vasculatory system including tracheary element formation and secondary cell wall deposition (Kwon et al, 2010). For example, mutants missing ATG5 in A. thaliana cannot form mature tracheids due to their inability to undergo vacuolar cell death (Kwon et al, 2010).

22 Like plants, the genome of the soil amoeba, Dicytostelium discoideum, does not contain genes encoding caspases or members of the Bcl-2 family and therefore it has been hypothesized that this organism cannot utilize apoptosis. Nonetheless, Dicytostelium uses some kind of PCD during its development. Subsequently, mutational analysis carried out in this organism revealed the crucial role of Atg1 in pro-life and pro-death mechanisms. During starvation, atg1 mutants died faster than their parental strain. On the other hand, the same knockouts could not die when treated with differentiating factor 1 (Dif-1), the slime molds natural inducer of PCD (Luciani et al, 2011). This suggests that the PCD response involves autophagocytosis. Drosophila melanogaster also appears to use ACD in parts of its development. During the transition from larvae to adult, several tissues such as midgut and salivary glands are removed (Lee et al, 2002). Salivary gland degradation is accompanied by an increase in caspase activity and autophagosome formation. This, taken together with the fact that separate apoptosis and autophagy inhibition only partially delays salivary gland removal, leads to the conclusion that it is due to involvement of both pathways acting in parallel (Berry & Baehrecke, 2007). Furthermore, overproducing ATG1 has proved to be sufficient to carry out organ degradation, even without the induction of apoptosis (Berry & Baehrecke, 2007). Nevertheless, the same ATG1 over-expression in larval fat bodies promotes caspasedependent cell death (Scott et al, 2007), and later, during embryogenesis, autophagy assists apoptotic removal of extra-embryonic amnioserosa (Mohseni et al, 2009). Few cases of ACD have been reported in mammalian tissues, even though it was first described there (Edinger & Thompson, 2004). In the central nervous system (CNS), autophagy is mainly responsible for the removal of otherwise toxic aggregates, thus

23 extending neuronal lifespan. By contrast, hippocampal neural (HCN) stem cells seem to undergo autophagy dependent cell death in response to insulin starvation. In those conditions, HCN cells accumulate LC3 and Beclin-1, while deletion of ATG7 inhibits death. Interestingly, insulin withdrawal does not induce the caspase machinery, effectively precluding any involvement of apoptosis (Yu et al, 2008). Depending on the type of the stimuli and development stage, autophagy can also lead to the growth or demise of cancer cells. Cancer cell lines missing the Bax/Bak system undergo autophagy dependent death when exposed to DNA damage agents. The rate of death in these cases can be reduced by either ATG5 or Beclin-1 deletion (Shimizu et al, 2004). Simultaneously deleting Beclin-1 and ATG7 in mouse L929 cells can suppress caspase-8 induced death (Yu et al, 2004). Several studies have shown that expression of activated Ras can also result in ACD. For example, in human ovarian surface epithelial cells, induced expression of H-RasV12 causes growth arrest and death. This process is caspase-independent and is accompanied by hallmarks characteristic for induced autophagy including LC3 lipidation and p62 degradation (Kuma et al, 2004). Taken together, those studies may imply that autophagic cell death is an ancient form of death that supports more conventional pathways in very specific conditions (e.g. starvation stress of development). It is possible that over the course of evolution autophagy primarily lost its dual nature and became, for the most part, an exclusively pro-life pathway. Nonetheless, it remains very important to study its pro-death properties since inhibiting them may become an additional way to treat many diseases.

24 In this study we aimed to describe a specific type of autophagy responsible for yeast cell death in response to external stresses. Chapters 4 and 5 will show that 13 mM zinc treatment and leucine deprivation induced two possibly parallel autophagy-dependent pathways that have distinct pro-life and pro-death outcomes. Even though most of the identified genes participating in these pathways operated during the two treatments, addition of Zn2+ induced necrotic cell death (ziNCD), while leucine deprivation induced apoptosis. The 6th chapter of this work will focus on 3 members of the transferin receptor-like protein family: the yeast vacuole protein sorting protein, Vps70, the human prostate specific membrane antigen (Psma) and the Arabidopsis thaliana altered meristem program protein (Amp1) and their relation to inhibition of cell death in yeast. Over the course of our research we were able to show that introducing any member of this family into yeast cells resulted in their desensitization to different death stimuli. One possible mechanism for this phenomenon was indicated by their ability to overcome the inhibition of vesicle fusion caused by zinc treatment.

Since throughout the whole study different genes and proteins from distinct kingdoms are discussed for the simplicity the convention used in yeast is utilized where protein is noted in small letters with first capital letter, gene in capital italicized letters and knock-out with italicized small with first capital letter.

25 Table 1.1. Diagnostic features of the different death pathways (following Shen & Codogno, 2011).

Non-apoptotic Apoptosis Chromatin condensed Cell shrunk Cell blebbing Intact cell membrane Cell death ligands DNA damage agents Caspases inhibitors (zVAD) Caspases Bcl-2 family members Mitochondria Caspase activation Autophagic cell death Autophagosomes Autolysosomes Increased autophagic flux Starvation mTOR inhibitors Wortmannin 3-methyladenine Chloroquine ATGs mTOR Class III Ptdlns3K Lysosomes Autophagosomes mTOR suppression Atg activation and reaction Necroptosis Parp-mediated cell death

Morphology

Organell swollen Early cytoplasmic membrane rapture Cell death ligands Nec-1 Rip1 Rip3 Jnk Cytoplasmic membrane TNFR1 activation DNA damage agents Parp inhibitors (3-aminobenzamide) Parp Ampk Nuclei Parp activation ATP depletion HMGB1 release

Main inducers Chemical inhibitors

Key regulators involved Key organelles involved Key biochemical features

26

Figure 1.1. Classification of cell death pathways (following (Degterev & Yuan, 2008)).

27

Figure 1.2. Characterization of autophagy pathways.

28

Figure 1.3 Non-specific autophagy targets random cytoplasm contents for degradation. An upstream signal (nitrogen starvation or rapamycin treatment) triggers formation of the double membrane vesicle in the cytoplasm which engulfs random cell contents. Each autophagosome is delivered to the vacuole (or fuses with a lysosome creating an autolysosome) releasing its contents for degradation.

29

Figure 1.4. Cvt transport of the premature Ape1 protein to the vacuole. Aggregated pApe1 is engulfed by a Cvt-some at the phagophore assembly site (PAS) during the constitutively operating process. Each vesicle is targeted to the vacuole, where the released pApe1 maturates into fully active mApe1.

30

Chapter 2 Hypothesis and specific aims

31 The following chapters are intended to address three different working hypotheses. The fourth chapter will investigate whether Zinc triggers an autophagy regulated form of cell death. Despite the numerous reports from different groups who are studying a variety of organisms, the existence of autophagy cell death still remains questionable by many researchers. In addition, despite the facts that zinc has been known for a more than a decade to be toxic to yeast, the exact mechanism causing death has not beenn determined. We addressed our hypothesis by: 1. Showing that 13 mM Zn2+ triggers non-apoptotic death. 2. Testing ATG deletion mutants for their response to zinc treatment. 3. Testing the targeting and/or processing of different autophagy reporters in response to zinc treatment. In the fifth chapter we hypothesized that The dual role of autophagy in keeping the balance between life and death is activated in response to many treatments, and not only limited to zinc. We wanted to test if the two parallel autophagy pathways detected by us during 13 mM Zn2+ could be operating during other stresses. This would strengthen the argument for two opposing forms of autophagy. To test our assumption we: 1. Compared the response of different autophagy mutants to leucine and nitrogen starvation.

32 2. Tested the influence of autophagy induction by rapamycin on the rate of death. 3. Tested autophagy reporters in strains starved for leucine to determine whether they localize here the way they localize during zinc treatment. In the sixth chapter we wanted to test the hypothesis that Psma possesses a novel enzymatic activity which prolongs yeast cell survival during stress. Psma is a protein of unknown function that is being over-expressed in prostate cancer cells. Despite correlation of expression levels with angiogenesis, nothing is known about the mechanism Psma controls. One approach addressing this challenge could be to investigate Psma and its homologues in a model organism such as yeast. To investigate our hypothesis, we have proposed the following specific aims: 1. To test yeast strains over-producing Psma and its homologues for their effect on the survival of cells exposed to distinctly different stresses. 2. To use a genetic approach to identify autophagy proteins which could interact functionally with Psma. 3. To test if Psma (and its homologues) is able to alter trafficking and/ or processing of autophagy reporters. 4. To localize Psma in yeast with and without exposure to death inducing agent(s). The results of these experiments will be summarized in a pictorial model shown in Chapter 7.

33

Chapter 3 Materials and methods

34 Bacteria, media, plasmids construction and DNA techniques Bacterial cultures were grown in standard Luria-Bertani (LB) medium at 37 C supplemented with ampicilin (200 mg/L), chloramphenicol (34 mg/L) or kanamycin (50 mg/L) when needed. E. coli competent cells were prepared using RbCl (Hanahan, 1983). Plasmids from bacterial cultures were extracted by means of alkaline lysis (Birnboim, 1983). When necessary, DNA manipulations were performed by following standard procedures (Maniatis et al, 1982) using enzymes purchased from either Invitrogen (Carlsbad, CA) or New England Biolabs (Beverly, MA). A Psma-GFP chimera was constructed by the following manipulations. A cDNA clone of PSMA (Israeli et al, 1993) was kindly provided by Dean Bacich (University of Pittsburg, PA). The cDNA was isolated from pSPORT1 (Gibco-BRL)) and ligated into pYES2 (Invitrogen, Carlsbad, CA) placing it under control of the GAL1 promoter. Divergent primers were used to amplify the entire plasmid as a linear molecule using polymerase from a Phusion Site-Directed Mutagenesis Kit (New England Biolabs, F-541S). One primer (5 gaaggctgcaacatagatctgtctcttcac 3) overlapping the 3 end of the cDNA made a synonymous change in codon 732 from AUU to AUC, creating a BglII site. The adjacent primer was 5 ttaccccgcggtggtggtt 3. The blunt end DNA was then self-ligated and transformed into E. coli and selected on LB agar (Luria et al, 1960) containing 200 mg mL-1 ampicillin (Sigma, A9393). After verifying the cDNA sequence, the plasmid was cut with BglII and NotI and ligated to the open-reading frame of GFP isolated as a BamH1/ NotI fragment from pEGFPN2 (BD Biosciences Clontech, 6081-1).

35 In order to identify suppressor genes, a yeast genomic library ((Ramer et al, 1992) ; kindly provided by Ron Davis and Grace Yen, Stanford University School of Medicine, Stanford, CA) was transformed into the yeast strain, BY4723, and transformants were selected for enhanced growth in the presence of 10 mM ZnSO4 without supplementary uracil. Plasmids were extracted from all clones that passed this screen were extracted and transformed again into BY4723 to verify that the growth advantage was due to the plasmid gene and not to a host mutation. The native VPS70 gene was part of a 4346 bp EcoRI fragment of yeast genome that included flanking intergenic sequences. To remove its native promoter, the open reading frame was amplified by means of PCR using a set of two primers: forward (tttcagtcctctgtgtgtaata) and reverse (gacagggaatggatccagtac), and cloned into PCR Blunt 2.0 TOPO vector (Invitrogen, Carlsbad, CA) following the manufactures procedures. The orientation was verified by a set of control digestions and then sub-cloned into pYES2 (Invitrogen, Carlsbad, CA) placing it under control of the GAL1 promoter. A cDNA of AMP1, a generous gift of Dr. Chris Helliwell, CSIRO, Canberra, was isolated from pSPORT2 and re-cloned as an Acc651 and BsiW1 into pYES2 (Invitrogen, Carlsbad, CA). Yeast strains, plasmids, and media Saccharomyces cerevisiae strains and plasmids used in this study are listed in Tables 3.1.and 3.2 respectively. Unless otherwise noted, yeast strains were all obtained from an Open BiosystemsTM collection of yeast deletion mutants derived from BY4741 (MATa his2 leu2 met15 ura3). A smaller set of BY4742 mutants was the kind gift of Carol Newlon (UMDNJ, Newark, NJ). Each mutant strain in these 2 sets has a kanMX cassette in place of the

36 indicated open reading frame. Five additional strains (Shintani et al, 2002), SEY6210, WPHYD7, AHY001, WHY3 and GSY244 (SEY6210 ape1::APE1-GFP kanMX) were kindly provided by Daniel Klionsky (U Michigan, Ann Arbor, MI) and Yoshinori Ohsumi (The Graduate University of Advanced Studies, Okazaki, Japan). All cells were grown in minimum medium (either SD or SG; 0.67% yeast nitrogen base without amino acids, 2% glucose (SD) or 2% galactose (SG) and strain-specific amino acids and nucleotides), or rich medium (YPD; 1% yeast extract, 2% peptone, 2% dextrose), or SD or SG medium without leucine (SD-L or SG-L), or in nitrogen depleted minimum media (SD-N or SG-N; 0.17% yeast nitrogen base without amino acids and ammonium sulfate, 2% glucose (SD-N) or 2% galactose (SG-N)) at 30 C. When necessary, medium was supplemented with 1.5% agar and/or 0.22 M rapamycin (Alexis Biochemicals, R-5000) and/or 1 mM PMSF. When needed, sterile stocks of CdSO4, ZnSO4, valproic acid, and H202 were added to autoclaved media at appropriate concentrations. The plasmid carrying the GFP-ATG8 chimera was a generous gift from Dr. Y. Ohsumi (Suzuki et al, 2001), APE1-RFP was generously provided by Dr. M. Thumm (Meiling-Wesse et al, 2005), HTTQ25-GFP was kindly provided by Dr. M. Sherman (Meriin et al, 2002), and ROSELLA constructs were graciously donated by Dr. R. Devenish (Rosado et al, 2008). Each was transformed into appropriate yeast strains using standard protocols (Gietz & Woods, 2006). Dilution analysis Cell cultures were grown to mid-log phase in SD medium and diluted to an OD600nm of 0.5 using TE buffer pH 8.0 (10 mM Tris-HCl, 1 mM EDTA). These cells were further diluted 4 times by factors of 10 in 96-well microtiter plates. The cells suspensions were then spotted onto appropriate solid media using an ethanol sterilized, flame dried 48-pin metal stamp.

37 Each droplet contained approximately 5 L of culture suspension. Inverted plates were incubated at 30 C for 4 d and photographed using a BioRad Gel Doc 1000 unit. A minimum of two replicates were done for each tested strain with cells grown on separate days. Flow cytometry analysis Appropriate strains were grown in SD medium to an OD600nm of 0.4, washed twice using TE buffer pH 8.0 (10 mM Tris-HCl, 1mM EDTA), and resuspended in 50 mM sodium citrate. For the analysis, cell suspensions were diluted tenfold in 1X FACS solution and analyzed by BD FACSAria Flow Cytometer equipmed with 488 nm, >20mW solid state laser and 633 nm, >18 MW gas laser. Each experiment examined 30,000 cells. The data obtained was further evaluated using FlowJoe software. Survival assay and propidium iodide staining The parental strain culture was grown to mid-log phase in SD medium supplemented with appropriate amino acids and nucleotides. At that time two samples were taken and diluted using fresh SD to an OD600 of 0.05 and grown for 2 h. Afterwards, one culture was treated with 13 mM ZnSO4 and the other with an equal volume of sterile distilled H2O. Every 2 h, 100 L of each culture were taken and diluted three and four fold in TE buffer and 100 L was spread onto YPD plates. The inverted plates were incubated at 30 C for two days before colonies were counted in order to calculate the number of viable cells mL-1. Colony forming ability (CFA) was measured as the number of colonies at tn relative to the number at t0 expressed as a percentage. Standard deviation bars were generated from 4 independent experiments. Unless otherwise stated, for the propidium iodide (PI; MP Biomedicals, 195458) staining, an additional 100 L was removed at each time point, pelleted for 5 min at

38 5000 rpm, resuspended in an equal volume of TE buffer, and brought to 10 M PI stain using a 1 mM aqueous stock. After 10 min incubation in the dark, 4 L of the suspension were spotted onto a glass slide and immediately covered with a cover glass. Necrotic cells were counted using a Nikon i80 Eclipse fluorescent microscope equipped with a Lambda LS unit. Fluorescent microscopy Appropriate strains were grown in SD (or SG) medium to an OD600nm = 0.2 and then treated with 13 mM zinc or 25 mM valproic acid and/ or 0.22 M of rapamycin as needed. For the starvation experiments, harvested cells were washed twice with TE and then resuspended in appropriate fresh medium. To visualize vacuoles, harvested cells were incubated for 30 min in 30 C with 20 g/ml FM4-64, washed twice with TE and resuspended in appropriate medium prior to chemical induction. In addition, cultures expressing either ROSELLA, Psma-GFP or GFP-Atg8 were treated during this time with 1 mM phenylmethylsulfonyl fluoride (PSMF; USB, 20203) to reduce intravacuolar proteolysis. Dilution tests on both YPD and SD media showed that 1 mM PMSF had no significant effect on the growth of PS, atg1, atg6, atg8, or atg11 (data not shown). All cultures were then grown for 6 h before 4 L of each culture were spotted onto microscope slides previously coated with poly L-lysine (Sigma-Aldrich, P-4707). Where possible, cells were distinguished as living or dead based on PI-staining. However, when other fluorescent molecules were being used, dead cells were distinguished from living ones by their gross abnormalities that included shrunken cytoplasm, enlarged vacuoles, and a diameter approximately 10-20% smaller than that of sister cells that did not accumulate PI. Preliminary analyses showed that only PI-staining cells showed all 3 of these traits. Images

39 were taken using a Nikon i80 Eclipse fluorescent microscope equipped with Lambda LS unit and Photometrix Cool SNAP ES digital camera. The excitation time for GFP-Atg8 (URA3) was 500 ms; for GFP-Atg8 (HIS3), 2s; for Ape1-RFP, 2s; for Ape1-GFP 2s; for Psma-GFP, 4s; for ROSELLA, 200 ms. Annexin staining was carried out on cells that were permeabilized by partially removing their cell wall as previously described by Madeo et al. (Madeo et al, 1997a) with minor changes. Cells grown to mid-log phase were washed in sorbitol buffer (1.2 M sorbitol, 0.5 mM MgCl2, 35 mM KH2PO4, pH 6.8), digested with 20 U/ml lyticase (L-8012, Sigma) in sorbitol buffer for 30 min at 28C, harvested, and washed in binding buffer (1.2 M sorbitol, 10 mM Hepes/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2). Permeabilized cells were then resuspended in 38 l binding buffer and incubated for 20 min in room temperature with 2 l annexin-FITC (640905, BioLegend) and 2 l (500 g/ml) PI (195458, MP Biomedicals, LLC). Cells were harvested, suspended in binding buffer, and examined using a fluorescent microscope at 520 nm (annexin-FITC) and 620 nm (PI). In order to confirm that our preparation of annexin-FITC was functional, an additional population of cells was treated for 300 min with 80 mM acetic acid, pH 3.0 (Ludovico et al, 2001a). In order to visualize H2O2 accumulation, permeabilized cells prepared in this way were stained with 10 M H2DCFDA (D399, Invitrogen) for 30 min at room temperature according to company protocols before cells were scored at 522 nm. DAPI staining of vacuolar inclusions was carried out using standard procedures. (Puchkov, 2010)

40 Protein purification and Immunoblot analysis Cultures of each yeast strain were grown to OD600nm = 0.2 and treated with 13 mM zinc or starved and/ or treated with 0.22 M rapamycin as needed. Strains were then grown for 6 additional hours (unless otherwise stated) before samples containing 5 OD units of cells were removed, pelleted for 5 min at 5000 rpm, resuspended in an equal volume of TE buffer, spun again, and finally re-suspended in CSB buffer (200 mM HEPES pH 7.4, 200 mM NaCl) with 1 M PMSF together with the manufacturers recommended amount of complete protease inhibitor cocktail (Roche Applied Science, 11873580001), and incubated at -20 C overnight. Cells were disrupted using a Branson Sonifier 450 (10% power, 50% duty cycle, for 4 bursts of 10 s separated by 3 min chilling on ice). This mixture was then spun for 20 min, 13,000 rpm at 4 C. The supernatant was mixed with sufficient 5-fold concentrated Laemmli buffer to bring the final solution to 1x. This mixture was then boiled for 10 min at 95 C and spun at 4 C for 10 min 13,000 rpm. These samples and a Color Plus Protein Ladder (BioLabs, P7711S) were separated using an 8.5% SDS-PAGE gel and transferred to a Protran nitrocellulose membrane (Whatman, 10402452). The membrane was blocked with commercial Odyssey Blocking Buffer (Li-COR, 927-40000) overnight at 4 C and developed with primary rabbit polyclonal anti-GFP antiserum (632377; Clonetech) for proteins extracted from strains caring either ATG8::GFP or PSMA::GFP, goat polyclonal anti-APE1 (Santa Cruz Biotechnology, SC-26740) antibody for Ape1 processing detection, and primary rabbit polyclonal anti-actin antibody (Sigma-Aldrich, A2066) as an internal loading control for teste. Secondary antibodies were IR700-labeled goat anti-rabbit (Rockland, 611-130-122) and alkaline phosphatase-conjugated donkey anti-goat (Santa Cruz Biotechnology, SC-2037) antibody, respectively. Membranes developed with IR700 were scanned using a Li-Cor

41 Odyssey Infrared Imaging System (Li-Cor Bioscience), while those treated with alkaline phosphatase conjugated antibody were developed according to standard methods (Liu et al, 2008) Each western was analyzed using ImageJ (http://rsb.info.nih.gov/ij/index.html). The intensity of the band representing the protein of interest was normalized to that of actin. Each western has been replicated at least twice with similar results.

42 Table 3.1. Yeast strains used in this study. Strain name BY4741 BY4741 atg8/ yca1 BY4742 BY4742 BY4741/42 SEY6210 WPHYD7 AHY001 WHY3 GSY244 Genotype MAT a his3 leu2 met15 ura3 BY4741 *::KanMX BY4741 atg8::KanMX yca1::KanMX MAT his3 leu2 met15 ura3 BY4742 **::KanMX BY4741/BY4742 diploid strain MAT his3 leu2 lys2 suc2 trp1 ura3 SEY6210 atg8::KanMX SEY6210 atg11::KanMX SEY6210 atg8 atg11::KanMX SEY6210 ape1::APE1-GFP KanMX Reference Open BiosystemsTM Open BiosystemsTM This study UMD-NJ, Newark, NJ UMD-NJ, Newark, NJ This study (Kim et al, 2001a) (Kim et al, 2001a) (Kim et al, 2001b) (Shintani et al, 2002) (Suzuki et al, 2002) This study This study

BY4741/SEY6210 BY4741/SEY6210 diploid strain atg8/atg8* BY4741 atg8::KanMX/ SEY6210 atg8::KanMX MAT a his3 leu2 met15 ura3 ZRC1-GFP

YMR243C

Invitrogen Carlsband, CA

A complete list of all mutant strains in this background is presented in the Table 4.1 A complete list of all mutant strains in this background is presented on Figure 4.10

43 Table 3.2. Plasmids used in this study. Name Insert Plasmid origin pSPORT1 Yeast selection Reference marker Gibco-BRL Invitrogen, Carlsbad, CA (Gietz & Woods, 2006) This study This study This study This study (Suzuki et al, 2001) This study (Kraft et al, 2008) (MeilingpRS313-APE1-RFP APE1-RFP CEN URA3 Wesse et al, 2005) CIT2pAS1NBCSRG ROSELLA (ROSELLA )
Mit

pYES2

CEN

URA3

pYEp

URA3

pVPS70 pgal1::VPS70 pgal1::PSMA pgal1::AMP1 pRS316-GFP-ATG8 pBC415-GFP-ATG8 pRS316-RPL25-GFP

VPS70 VPS70 PSMA AMP1

2 CEN CEN CEN

URA3 URA3 URA3 URA3

GFP-ATG8

CEN

URA3

GFP-ATG8

CEN

HIS3

RPL25-GFP

CEN

LEU2

LEU2

(Rosado et al, 2008)

44 NAB2pAS1NBNAPB35RG ROSELLA (ROSELLA ROSELLA 2 (ROSELLACyt) pHttQ25-GFP HttQ25-GFP LEU2

Nuc

2 )

LEU2

(Rosado et al, 2008)

pAS1NBRG

(Rosado et al, 2008) (Meriin et al, 2002)

URA3

All listed plasmids were caring gene encoding -lactamase, except encoding NPT2 or CAMR.

45

Chapter 4 Identification of autophagy genes participating in zinc-induced necrotic cell death in Saccharomyces cerevisiae

The content of this chapter was previously published as: Dziedzic SA, Caplan AB (2011) Identification of autophagy genes participating in zinc-induced necrotic cell death in Saccharomyces cerevisiae. Autophagy 7: 490-500

46

Abstract

Eukaryotes use a common set of genes to perform two mechanistically similar autophagic processes. Bulk autophagy harvests proteins non-selectively and re-uses their constitutents when nutrients are scarce. In contrast, different forms of selective autophagy target protein aggregates or damaged organelles that threaten to interfere with growth. Yeast uses one form of selective autophagy, called cytoplasm-to-vacuole transport (Cvt), to engulf 2 vacuolar enzymes in vesicles (Cvt-somes) from where they are transported to vacuoles for maturation. While both are dispensable normally, bulk and selective autophagy help sustain life under stressful conditions. Consistent with this view, knocking out several genes participating in Cvt and specialized autophagic pathways heightened the sensitivity of Saccharomyces cerevisiae to inhibitory levels of Zn2+. The loss of other autophagic genes, and genes responsible for apoptotic cell death, had no such effect. Unexpectedly, the loss of members of a third set of autophagy genes heightened cellular resistance to zinc as if they encoded proteins that actively contributed to zinc-induced cell death. Further studies showed that both sensitive and resistant strains accumulated similar amounts of H2O2 during zinc treatments, but that more sensitive strains showed signs of necrosis sooner. Although zinc-lethality depended on autophagic proteins, studies with several reporter genes failed to reveal increased autophagic activity. In fact, microscopic analysis indicated that Zn2+ partially inhibited fusion of Cvt-somes with vacuoles. Further studies into how the loss of autophagic processes suppressed necrosis in yeast might reveal whether a similar process could occur in plants and animals.

47

Introduction

Cells facing starvation quickly halt their replicative cycles in order to conserve their remaining resources. As part of the triage that follows, autophagosomes systematically engulf and dismantle the constituents of the cytoplasm into amino acids and other building blocks in order to synthesize new macromolecules to sustain cells until exogenous raw materials became available again. Genetic studies, especially those carried out in yeast, have revealed that the formation of autophagosomes, the selection of their targets, and the process that delivers these vesicles to their final destination, involves a minimum of 33 designated ATG genes. Although none of these genes appear to be essential for growth under nutritionally-replete conditions, most have proven to be indispensible during starvation (Cao et al, 2008). During starvation, a form of bulk autophagy appears to harvest material indiscriminately. During other conditions, some of the same proteins, acting in conjunction with proteins recruited from other pathways, carry out selective scavenging operations against damaged or superfluous ribosomes, mitochondria, peroxisomes, or portions of the ER and the nucleus (van der Vaart et al, 2008). One such process in yeast has been termed the cytoplasm-to-vacuole (Cvt) pathway (van der Vaart et al, 2008; Xie & Klionsky, 2007). Cvt appears to harvest naturally aggregating enzymes very selectively in order to transport them to the vacuole for maturation (Hutchins & Klionsky, 2001; Kageyama et al, 2009; Kim et al, 1997a). Cvt-like pathways have not been described in multicellular organisms, but equally specialized forms of autophagy operate there to clear away protein aggregates symptomatic of Huntingtons Disease and Alzheimers Disease (Butler et al, 2006; Sarkar et al, 2009).

48 Although most of the attention on autophagy has focused on its ability to extend life, cases have been described where it appears to be responsible for a form of programmed cell death characterized by an absence of normal apoptotic landmarks and by an abundant accumulation of autophagosome-like vesicles. Dictyostelium amoebae die in this way as they differentiate into the cells comprising fruiting body stalks (Cornillon et al, 1994; Kosta et al, 2004), as do plant cells undergoing a hypersensitive response (Hofius et al, 2009) and heart tissues as they age (Nishida et al, 2009). Despite these examples, it has not been possible to determine whether autophagy is the sole agent of death, or instead is merely acting as an accomplice for another mechanism of cell death (Gonzalez-Polo et al, 2005; Kroemer & Levine, 2008). The present study explores a complex set of relationships that we have found between different autophagy pathways and yeasts tolerance for excessive amounts of zinc. It has been known for a number of years that high levels of Zn2+ ions inhibit growth of mammalian cells severely (He et al, 2005) and with increasing exposure, induce an atypical, caspaseindependent form of apoptosis (Hamatake et al, 2000). More recent studies have shown that this property can be used to kill cancer cells selectively (Magda et al, 2008). The studies in the current report describe our attempt to characterize possible mechanisms behind this cell death process using Saccharomyces cerevisiae. Paradoxically, it was possible to increase either the sensitivity or the resistance of yeast to zinc by knocking out alternative sets of autophagy genes. None of the sets identified in this screen correlated perfectly with any of the autophagic processes described previously in this organism. Although we have no detailed model explaining how zinc kills, we have found evidence that it blocks the fusion of Cvt-like autophagosomes with the cell vacuole. It seems likely that further studies along

49 these lines could possibly identify how operations carried out by autophagy proteins predispose cells to become necrotic and die in the presence of excess zinc.

50 Results

Zn2+-treatment temporarily arrested cell growth Zinc, like any ion, is cytotoxic when its levels are sufficiently raised. Curiously, in the case of yeast, the sensitivity of cells to this metal proved to be dependent on the composition of the medium used. BY4741 grew well on a rich medium, YPD, supplemented with 13 mM ZnSO4 (Figure 4.1A). However, on standard minimal medium with glucose (SD), colonyforming ability decreased sharply when Zn2+ levels rose from 10 to 13 mM. As Figure 4.1A shows, even adding uracil to SD medium slightly increased cell tolerance for zinc. Further studies revealed that in liquid SD medium, cell division ceased within the first 2 h of exposure to 13 mM Zn2+ arresting the population with a multi-budded phenotype (Figure 4.1B) looking like mutants missing CDC42 (Richman & Johnson, 2000). This period of stasis lasted for approximately 6 hours (Figure 4.1C). By this time, 54.0 1.5% of the Zn2+treated cells had accumulated large, refractile aggregates in their vacuoles (arrow, Figure 4.1B), while untreated cells had none. Although we have not performed definitive chemical analysis on these inclusions, we have determined that they stained with DAPI (Figure 4.2), like polyphosphate inclusions (Puchkov, 2010), and were less abundant (6.31.5%) in cells with a deletion of VTC4, a gene needed for polyphosphate accumulation in the vacuole (Huang et al, 2002). When BY4741 cultures were diluted into medium without supplemental zinc, the number of cells harboring these inclusions dropped to 32.6 1.9% within 2 h and continued falling thereafter. Unbudded cells began to appear some time later. On the other hand, cells that remained under zinc treatment gradually became permeable to propidium-

51 iodide (PI) and lost viability (Figure 4.1C), dropping to 50% of the starting population by 22 h (data not shown). Apoptotic processes played little role in the death of Zn2+-treated cells Nargand et al. (Nargund et al, 2008) found that Cd2+, an ion chemically related to Zn2+, induces metacaspase-dependent apoptotic death. Zn+2, however, did not. First, if zinc-treated cells died apoptotically, the loss of the metacaspase gene, YCA1 (Madeo et al, 2002) or of other apoptosis-associated genes such as AIF1 (Wissing et al, 2004), NUC1 (Buttner et al, 2007), and SVF1 (Brace et al, 2005), would have decreased zinc sensitivity. Instead, these mutants proved to be as sensitive as their parental strain (PS), BY4741, on Zn+2-containing media (Figure 4.3 and data not shown). Second, if zinc treatments induced apoptosis, we expected to see the frequency of annexin-binding cells to increase, as occurs when cells are treated with 80 mM acetic acid (Figure 4.4). Instead, the percentage of PI-permeable necrotic cells increased approximately 8-fold after 6 h of Zn+2 treatment, while the frequency of annexin-binding, apoptotic ones remained unchanged (Figure 4.4). Although apoptotic genes contributed little to this kind of death, a knockout of the core autophagic gene, ATG8, actually increased colony formation significantly (Figure 4.3). Introducing a yca1 mutation into a atg8 mutant did not change this level of resistance (data not shown). Zn2+ partially inhibited the flow of GFP-Atg8 to vacuoles The above results implied that zinc triggered a previously unexamined form of cell death mediated, at least in part, by Atg8. Atg8 is essential for the expansion of autophagosomes (Xie et al, 2008) and over the years, has proven to be a reliable monitor for tracking autophagic activity (Cheong & Klionsky, 2008). In order to determine whether death was

52 accompanied by a noticeable increase in the number of autophagosomes, a plasmid encoding an GFP-Atg8 fusion protein (Prick et al, 2006) was introduced into the atg8 mutant. This strain was as sensitive as BY4741 when grown on SD medium with 13 mM Zn+2 (data not shown), indicating that the chimeric gene retained its attendant functions. Under normal growing conditions, the fluorescent reporter was distributed throughout the cytoplasm and nearly absent from the vacuoles (Figure 4.5A). This distribution was reversed when bulk autophagy was induced with rapamycin. Most of these treated cells had comparatively dark cytoplasms and intensely fluorescent vacuoles, together with a characteristic increase in GFP-Atg8 processing (Figure 4.5C). In contrast, cells treated with zinc were indistinguishable from untreated cells (Figure 4.5A), apart from the polyphosphate-like inclusions and multi-budded appearance. Cells treated with both agents displayed a mixed phenotype in which diffuse, fluorescent vacuoles were surrounded by dark cytoplasm, 1-3 intensely glowing vesicles docked close to the vacuole (Figure 4.5A), and levels of GFPAtg8 processing similar to those seen with rapamycin alone (Figure 4.5C). The proportion of the population that fell into each of these phenotypic classes is shown in Figure 4.5B. These studies clearly showed that zinc did not induce autophagic processes like rapamycin. In fact, the most parsimonious interpretation of the results tabulated in Figure 4.5B appeared to be that Zn2+ partially inhibited a late stage in the autophagic process, so that the reporter was left in the cytoplasm or sequestered in autophagosome-like vesicles that rarely, if ever, delivered their contents to the vacuole for re-cycling.

53 Zn2+-treated cells did not harvest common fluorescent reporters of bulk autophagy activity It seemed counter-intuitive that Zn2+ killed cells in an ATG8-dependent manner without increasing the number of visible autophagosomes. We therefore continued our studies using several different reporter proteins, each one diagnostic for a different form of autophagy. One particularly useful series of reporters has been built recently by fusing an acid-sensitive GFP to an acid-stable RFP (Rosado et al, 2008). When autophagy was not induced, the vacuoles of cells expressing the cytoplasmic variant of this series, ROSELLACyt, remained dark, even when observations were continued past 24 h (Figure 4.6). On the other hand, when bulk autophagy was induced by rapamycin treatment, some of this protein was harvested so that the vacuoles fluoresced red while the cytoplasm glowed red or green, depending on the excitation filters used. Zinc did not have this effect. Instead, ROSELLACyt remained in the cytoplasm unless cells were treated simultaneously with rapamycin. Note that although GFPAtg8 revealed autophagosomes in transit during zinc and rapamycin treatment (Figure 4.5), no ROSELLACyt-filled vesicles were seen (Figure 4.6). It is possible that ROSELLACyt accumulation in autophagosomes was too low to highlight them. The ROSELLACyt reporter showed that zinc did not induce bulk autophagy like rapamycin. Further experiments with ROSELLA proteins targeted to the nucleus (ROSELLANuc) or to mitochondria (ROSELLAMit) demonstrated that zinc similarly failed to induce either piecemeal nuclear autophagy or mitophagy to any noticeable degree (Figure 4.7). Similarly, studies with Rpl25-GFP (Kraft et al, 2008), a fusion between a protein of the 60S ribosomal subunit and GFP, failed to detect signs of ribophagy (data not shown).

54 Zn2+ treatment inhibited entry of APE1 into vacuoles It is now recognized that cells use different combinations of autophagy proteins to target different parts of the cell. It has even been suggested that there is no such process as nonselective autophagy; rather, many of the treatments that have been used might in fact be causing the simultaneous execution of several (possibly independent) autophagic pathways (Kraft et al, 2009). In particular, at least half of the gene products responsible for inducible bulk autophagy in yeast also participate in the far more selective Cvt pathway that transports a handful of hydrolytic enzymes to the vacuole where they participate in the routine metabolism of the cell (Lynch-Day & Klionsky, 2010). One of the enzymes brought there in this way is aminopeptidase 1, product of the gene, APE1. We transformed yeast with plasmids encoding an Ape1-RFP fusion protein (Meiling-Wesse et al, 2005) and used it to monitor Cvt-like autophagy. Under normal growth conditions, this reporter accumulated in low amounts within the vacuole. Rapamycin treatment increased the amount of fluorescent material in the vacuole considerably (Figure 4.8A). However, while the subcellular distributions of the ROSELLA and Rpl25-GFP reporter proteins were unaffected by zinc, Ape1-RFP distributions were. Zn+2-treated cells showed a 7-fold reduction in Ape1-RFP processing (Figure 4.8C) and were 9 times more likely than untreated cells to have 1-2 highly fluorescent vesicles, presumably Cvt-somes, docked onto the surface of otherwise dark vacuoles (Figure 4.8B). Superficially, the localization and the intensity of fluorescence of Ape1-RFP in zinc-treated cells resembled those seen in mon1 mutants (Figure 4.8A) that are defective in both autophagosome- and Cvt-some-fusion with vacuoles (Wang et al, 2003). Significantly, this Zn+2-imposed block was overcome when bulk autophagy became active:

55 vacuolar filling (Figure 4.8B) and Ape1-RFP processing (Figure 4.8C) proceeded equally in cells treated with zinc and rapamycin and in cells treated with rapamycin alone. These results indicated that Zn2+ treatment inhibited one or more of the last steps in the delivery of Cvt-somes to the vacuole. Since rapamycin suppressed this block, it seems likely that bulk autophagy either did not depend on a zinc-sensitive fusion process, or compensated for the reduced efficiency of vesicle-to-vacuole fusion with increased vesicle production. Either of these models would equally accommodate our previous observation that ROSELLACyt, like Ape1-RFP, continued to enter vacuoles when rapamycin-treated cultures were co-challenged with zinc (Figure 4.6). Which autophagic pathway contributed to ziNCD? The studies with the previous sets of reporter proteins failed to find evidence that zinc treatment induced excessive autophagosome formation and indiscriminate protein harvesting, one possible mechanism leading to cell death (Kang & Avery, 2008; Yoshimoto, 2010). At the same time, it was counterintuitive to infer that inhibiting a late step in Cvt would lead to cell death when genetically inactivating the pathway did not (Harding et al, 1995a). This prompted us to investigate whether the atg8 phenotype was representative of all autophagy mutants growing on zinc-rich media. For these experiments, we included 20 mg L-1 uracil in the agar so that we could carry out these tests on plasmid-free strains, and so that we could detect increased sensitivity as well as increased resistance to zinc. The autophagy-defective strains that we tested fell into 4 phenotypic classes (Figure 4.9A), regardless of whether they had been made in BY4741 or BY4742 (Figure 4.10). The majority, including the atg1 and atg2 mutants, behaved like the parental line when each

56 was grown on ZnSO4-supplemented agar. A smaller number typified by atg12, were more tolerant, others like atg8 even more so, but a handful including atg11, were more sensitive to zinc than their parental strain. The make-up of the 4 phenotypic classes is summarized in Table 4.1. These differences in growth on solid media were also seen in liquid medium (Figure 4.9B). By 12 h, each example that we tested showed signs of necrosis, but strains showing the greatest resistance to zinc (atg8) showed less, while those with the least resistance (atg11) showed more (Figure 4.9C). Closer examination of these mutants revealed that the number of cells containing polyphosphate-like inclusions correlated with the number of PI-excluding, seemingly viable, cells in each culture (Figure 4.9E): atg11 cultures contained the fewest of these inclusions if one surveyed all cells, but similar numbers if one confined the counts to intact (PI-) cells. This correlation could imply that cells produced polyphosphates defensively, perhaps to immobilize vacuolar zinc. Significantly, although there was also variation in the number of cells accumulating H2O2 after 12 h of zinc treatment (Figure 4.9D), it seemed that each mutant strain had similar numbers of H2O2-accumulating cells (measured by fluorescence in the presence of H2DCFDA) regardless of their level of zinc resistance. It was as if zinc sensitivity was either unrelated to this source of damage, or instead determined by the subsequent response to that damage. While the correlation was not perfect, most of the strains in class I were mutated in genes closely associated with the control of nonspecific autophagic responses to starvation and rapamycin treatment. Many of the strains in classes II and III were mutated in genes that encoded proteins making-up the core machinery of autophagosomes whereas most of the

57 mutants in class IV encoded proteins that were only required for the Cvt pathway and a few specialized forms of autophagy. In an attempt to refine our classification scheme and pinpoint the specific pathways being detected in this assay, we tested mutants that affected a number of protease and ubiquitination processes (APE1, BSD2, DSK2, LAP3, PEP4, TUL1), as well as mutations specifically associated with pexophagy (PEX3, PEX14), microphagy (GTR1, GTR2), mitophagy (AUT1, UTH1), and early steps in the regulation of autophagy (RAS1, RAS2, SCH9, TOR1). All of these displayed the same level of sensitivity as their parental strain. On the other hand, strains missing ZRC1, the principle zinc transporter in the vacuolar membrane, CCZ1, MON1, TLG2, and VPS18 which help autophagosomes and CVT-somes dock with the vacuole (Furgason et al, 2009; Wang et al, 2002a), BRE5 and UBP3 that are needed for ribophagy (Kraft et al, 2008), PEX6, a peroxisomal protein transporter needed to suppress the build-up of reactive oxygen species that leads to necrotic cell death (Jungwirth et al, 2008), SLM4 (EGO3), which is part of the Cvt pathway and critical for recovery from rapamycin treatments (Dubouloz et al, 2005a), SNF1, which regulates the cellular response to nutrient availability (Smets et al, 2010), VPS15 (a regulator of protein sorting (Sambade et al, 2005)), and VTC4 (a subunit of the polyphosphate polymerase (Hothorn et al, 2009)), were all more sensitive to Zn2+ than normal (Table 4.1). Surprisingly few of these genes have been associated with zinc tolerance before, despite the fact that several intensive screens for the determinants of zinc homeostasis have previously been carried out. However, most of those screens for zinc sensitivity (Pagani et al, 2007) and for zinc induced genes (Jin et al, 2008) were conducted on YPD medium where the PS strain (Figure 4.1A), as well as 4 apoptosis-associated genes and 6 autophagy genes drawn from all 4 classes (data not shown), showed no growth inhibition in the presence of 13 mM zinc.

58 Although most of the autophagy genes in class IV encoded proteins involved specifically in Cvt, not all Cvt genes were in class IV. Mutants in ATG19, the only known receptor for bringing proteins into Cvt-somes, fell into class I while mutants in ATG24, a nexin involved in retrieving SNAREs from endosomes (Hettema et al, 2003), fell into class III. One possible explanation for these exceptions could be that cells use class IV proteins to build a basic vesicle that then interacts modularly either with Atg19 to produce a Cvt-some, or with as yet unidentified gene products to select different sets of substrates for a minimum of 2 alternate forms of selective autophagy. In this scheme, one of these 2 vesicle-receptor conformations protected cells from the effects of Zn2+ while the other configuration acting together with Atg24 contributed to ziNCD. One question that lingered throughout this study was why these sets of genes hadnt shown up in any of the more extensive searches for zinc tolerance pathways (Jin et al, 2008; Pagani et al, 2007). Some studies may have overlooked the kinds of phenotypes reported here because they were carried out on rich medium (Figure 4.1A). However, these phenotypes may also have been masked by genetic differences between strains. SEY6210 (Shintani et al, 2002), for example, proved to be more sensitive to zinc than BY4741 (compare Figure 4.11A where strains were grown for 5 d with Figure 4.10 where strains were grown for 3 d). We do not yet have an explanation for the strain-dependent differences in zinc sensitivity, but we did observe that this sensitivity was recessive in a BY4741/ SEY6210 diploid (Figure 4.11B). Despite this difference in responsiveness to zinc, SEY6210 responded qualitatively like BY4741 when its copies of ATG11 or ATG8 were knocked out (Figure 4.11A), but perhaps not dramatically enough to attract attention during a screen of the entire yeast genome. As a side-note, a atg8 atg11 double mutant reproducibly grew better than a knockout of ATG8

59 alone (Figure 4.11A). This synergistic response could indicate that while Atg11 acted primarily to protect cells, it also participated to a small extent in ziNCD.

60 Table 4.1. Classification of knockout mutant phenotypes.

Phenotypic class

Zn+2 Autophagy mutants tolerance ape1, bsd2, dsk2, gtr1, gtr2, lap3, nvj1, pep4, pex3, pex14, ras1 ,ras2, rim15, sch9, tor1, tul1, uth1, vid24, vps38, vps45 (aif1, ald6, coq3, gsy1, nuc1, svf1, yca1)* vac8 (coq3) bre5, ccz1, mon1, slm4, snf1, Autophagy-associated mutants

atg1, atg2, atg3, atg4, atg5, atg9, atg10, atg13, atg14, atg17, I atg18, atg19, atg22, atg26, atg27, atg28, atg29, atg31, atg32, atg33, atg34

II III

+ ++

atg6, atg7, atg12 atg8, atg15, atg16, atg24

IV

atg11, atg20, atg21, atg23

tlg2, vps15, vps18, vtc4, ubp3 (pex6, zrc1)

Autophagy mutants as well as a set of strains with mutations in proteolytic, regulatory, or vacuolar processes believed to be affiliated with autophagy were grown, diluted, and stamped as described in Figure 4.1A onto SD agar containing 0.002% uracil with or without 13 mM ZnSO4. Tolerance (, sensitive; +, tolerant; ++, very tolerant; -, very sensitive) was scored as illustrated in Figure 4.9. Each strain was tested a minimum of 3 times before being assigned to the indicated phenotypic class. For comparative purposes, strains with mutations in pathways believe to be unrelated to autophagy or allied processes are shown in parentheses.

61

Figure 4.1. Zn2+ disrupts cell metabolism and division. (A) The sensitivity of the parental strain, BY4741, transformed with the plasmid, YEp, was assessed using cultures grown in SD medium to mid-exponential phase. A sample was serially diluted by factors of 10, and stamped onto SD or YPD media supplemented with 0, 10, or 13 mM ZnSO4, or 13 mM ZnSO4 and 0.002% uracil as indicated. This collage was assembled from photographs taken after 4 d growth at 30C. (B) The morphological responses to zinc were assayed by growing the parental strain in SD medium to exponential phase and then treating it with or without 13 mM ZnSO4 for 6 h at 30C. Left panels show samples of the populations at that time, while right panels show cells exhibiting the most common phenotypes. The arrow points to a vacuolar inclusion that can be found in 54.0 1.5% of the zinc treated cells but in none of the untreated ones. (C) The effect of zinc on cell viability was assessed by growing the parental strain at 30C in SD medium to exponential phase, diluting it in fresh SD medium and after 2 h (indicated by arrow), adding ZnSO4 to bring the culture to 13 mM. Samples were removed every 2 h, spread onto YPD agar, and incubated for 2 d to count the number of colony forming units. The left scale shows the average percent change ( SD) for 4 independent replicates. Solid line, untreated cells; broken line, Zn2+-treated ones. The right scale shows the percent of cells ( SD) at each time point that accumulated PI. Black bars, untreated cells; white bars, treated cells.

62

Figure 4.2. Vacuolar inclusions in Zn2+-treated cells bound DAPI. BY4741 PS cells were grown to an OD600 = 0.2, treated with 13 mM ZnSO4 for 6 h, and stained with 3 M DAPI. The photograph shows an example of the results obtained in 3 independent experiments. Yellow arrows point to the stained nuclei, red arrows point to the stained mitochondria, and white arrows point to stained vacuolar inclusions, in representative cells. Both the location and the fluorescence of the material were characteristic of polyphosphates 19. Moreover, vtc4 strains, which are characteristically defective in polyphosphate accumulation in vacuoles, accumulated fewer inclusions.

63

Figure 4.3. Zn2+-induced cell death is dependent on ATG8. The parental strain (PS), and two derivatives with deletions of either ATG8 or YCA1, all transformed with the plasmid, YEp, were grown, diluted, and stamped as described in Figure 4.1A onto SD agar with or without 13 mM ZnSO4. Growth was scored after 4 d at 30C.

64

Figure 4.4. Zn2+-treated cells failed to expose annexin-binding sites. BY4741 PS cells were grown to an OD600 = 0.2, treated with 13 mM ZnSO4 for 6 h, and spheroplasted as described in Materials and Methods. The wall-less cells were subsequently stained with both annexin-FITC (green fluorescence) and PI (red fluorescence) following standard procedures 61 .The numbers inserted in upper right of each panel represent the average number SD of necrotic (PI-staining) or apoptotic (annexin-staining) cells based on 3 independent experiments, with 44-72 cells/ treatment.

65

Figure 4.5. GFP-Atg8 accumulated in perivacuolar vesicles in Zn2+-treated cells. atg8 transformed with a plasmid encoding ATG8::GFP was grown to an OD600 = 0.2 and then treated with 1.0 mM PMSF (which had did not significantly inhibit yeast growth when added to SD agar) together with 13 mM ZnSO4, 0.22 M rapamycin (Rap), or both agents as indicated. (A) Cells were photographed after 6 h using fluorescence microscopy. Note that zinc partially inhibited the entrance of fluorescent material into the vacuole during rapamycin treatment. Note also that the vacuolar inclusions in Zn2+-treated cells never fluoresced at this wavelength indicating they did not entrap GFP. (B) Frequencies of the diagrammed phenotypes ( SD) in 3 independent experiments, 50 cells/ experiment. (C) Western analysis carried out on approximately 5 OD units of cells from each indicated treatment using antibodies to GFP or actin. The table shows the signal intensity of GFP-Atg8 and free GFP normalized to that of actin.

66

67

Figure 4.6. Dual fluorescent protein, ROSELLACyt, was restricted to the cytosol in Zn2+treated cells. PS cells transformed with a plasmid encoding cytoplasmic ROSELLA (Rosado et al, 2008) were grown to mid-exponential phase and treated for 16 h with 1.0 mM PMSF together with 13 mM ZnSO4 or 0.22 M rapamycin (Rap) as indicated. Only rapamycin- and rapamycin with zinc-treatments brought ROSELLA into vacuoles causing them to fluoresce red.

68

Figure 4.7. Zn2+ did not promote the harvesting of either nuclear- or mitochondriallytargeted ROSELLA. BY4741 PS cells transformed with plasmids encoding either NAB35ROSELLA (ROSELLANuc; a reporter targeted to the nucleus) or CIT2-ROSELLA (ROSELLAMit; a reporter targeted to the mitochondrion) 19, were grown to an OD600 = 0.2 and then treated with1 mM PSMF and 13 mM ZnSO4 for 6 h. Vacuolar inclusions are prominent in both images at this time but neither the encoded proteins, nor a ribosometargeted reporter, Rpl25-GFP 20 (data not shown), accumulated in vacuoles, even after 24 h (data not shown).

69

Figure 4.8. Ape1-RFP accumulated in perivacuolar vesicles in Zn2+-treated cells. PS cells transformed with a plasmid encoding Ape1-RFP were grown to an OD600 = 0.2 and then treated with 1.0 mM PMSF together with 13 mM ZnSO4 or 0.22 M rapamycin (Rap), or both as indicated. (A) Left panels show representative views of the population after 6 h. Right panels show detailed view of dividing cells. Ape1-RFP accumulated in vesicles (CVTsomes) during zinc treatment, or when expressed in a mon1 background. Rapamycin stimulated the accumulation of this material in the vacuole of PS cells, overcoming the blockade induced by zinc. (B) Frequencies of the diagrammed phenotypes ( SD) in 3 independent experiments, 90-140 cells/ experiment. (C) Western analysis carried out on approximately 5 OD units of cells from each indicated treatment using antibodies to Ape1 or actin. The table shows the signal intensity of pre-Ape1 and Ape1 normalized to that of actin.

70

71

Figure 4.9. Classification of phenotypic responses of mutants to excess zinc. (A) Indicated strains were grown, diluted, and stamped as described in Figure 4.1A onto SD agar containing 0.002% uracil with or without 13 mM ZnSO4. The mutants shown were representative of the phenotypic class (I-IV). PS (parental strain) was BY4741. (B) Representatives of each class were cultured in SD + uracil medium with (right panel) and without (left panel) 13 mM ZnSO4 for the hours indicated. The vertical arrow indicates that zinc was added after 2 h. At each sampling time, aliquots were withdrawn, diluted in TE buffer, and plated onto YPD medium. The number of colony-forming cells in each population was determined after 2 d growth at 30C. atg1, dash-dot line; atg6, dotted line; atg8, solid line; atg11,dash-dot-dot line; PS, dashed line. (C) Percent PI-staining cells after 12 hr in SD+uracil with (right) and without (left) 13 mM ZnSO4. (D) Percent permeabilized cells prepared from indicated mutants treated 12 h with and without 13 mM ZnSO4 and stained with 10 M H2DCFDA for 30 min at room temperature. (E) Percent cells with indicated genotypes harboring inclusions after 12 h treatment with and without 13 mM ZnSO4. The bars indicate the number of inclusions in both PI-negative and total cells. PInegative (intact) cells tended to accumulate more polyphosphate-like inclusions than did total PI-positive cells.

72

73

Figure 4.10. Autophagic mutants were differentially inhibited by Zn+2. BY4741 PS cells together with 8 knockout mutants were grown in SD + 0.002 % uracil, diluted by factors of 10, and replica plated onto SD medium containing 0.002% uracil with or without 13 mM ZnSO4. For the sake of consistency, the same experiments were carried on mutations in a BY4742 background. Pictures were taken after 3 d. The white spaces were introduced to show that figures were constructed from tests carried out on different plates containing the same media.

74

Figure 4.11. Mutants of SEY6210 behaved qualitatively like those of BY4741. (A) SEY6210 and 3 autophagy mutants were cultured on SD medium supplemented with 0.002% histidine, 0.01% leucine, 0.003% lysine, 0.002% tryptophan, and 0.002% uracil for 5 d. The asterisk denotes strains derived from a SEY6210 parent. Note that SEY6210 was more inhibited by 13 mM Zn+2 than BY4741 grown for only 3 d (Figure 4.10). Note too, that strains missing both ATG8 and ATG11 grew better than strains missing either of the genes alone. (B) Diploid strains were grown for 3 d on the same medium as in Figure 4.11A. Note that the sensitivity of SEY6210 was recessive to the tolerance of BY4741.

75 Discussion

The Cvt pathway was first identified in screens searching for the machinery that transports APEI from the cytoplasm to vacuoles (Wang et al, 1996). As new details emerged, it became apparent that Cvt operates with smaller vesicles than bulk autophagy (140-160 nm vs. 300900 nm) but nevertheless uses many, but not all, of the proteins used by nonspecific autophagy, together with several proteins unique to itself. Currently, only 2 proteins, Ape1 and the -mannosidase, Ams1, are known to be harvested by this pathway during normal growth. However, the Cvt proteins Atg11 and Atg19 acting together with some of the components of bulk autophagy, are involved in harvesting leucine aminopeptidase III in response to nitrogen starvation (Kageyama et al, 2009). Additionally, Atg11 combines with proteins used in bulk autophagy to direct autophagosomes to engulf mitochondria and peroxisomes (Nazarko et al, 2009); (Kanki & Klionsky, 2008). Based on the phenotype of mutants falling into class IV, yeast employed another Cvt-like form of autophagy to protect itself from some of the effects of excess zinc. Unlike Cvt, this process did not depend on the Cvt receptor, Atg19, yet still acted selectively since neither ROSELLA-based reporters nor GFP-Atg8 were harvested to any significant extent in PS cells during zinc treatment. What proved more problematic than finding that autophagy could extend life during zinc stress was finding evidence for 2 classes of autophagy proteins (II and III) that somehow hastened necrotic cell death. Unlike apoptotic cell death, ziNCD did not depend on any of the apoptosis-associated genes tested, and was not accompanied by the characteristic apoptotic process that exposures annexin-binding sites on the plasma

76 membrane. Unlike the pathways for necrotic cell death, which have proven hard to define unambiguously (Golstein & Kroemer, 2007), ziNCD depended heavily on an easily delineated subset of genes associated with the most basic steps in autophagosome assembly. Yet unlike autophagic cell death, we failed to find unusual numbers of autophagosomes or evidence that cytoplasmic, mitochondrial, nuclear, or ribosomal reporter proteins were being harvested indiscriminately as a result of autophagic karoshi (death from overwork). We are left proposing that ziNCD might be operating by re-directing the baseline population of Cvtsome-like vesicles to selectively harvest proteins that were not substrates previously. In this model that we are tentatively proposing, the harvesting of these targets causes more harm than would occur if the proteins had been left untouched. Further investigations may provide other explanations. Further investigations will also be needed to explain how zinc actually induced necrotic cell death. We do not think ziNCD was initiated by the block that Zn+2 imposed on Cvt-some fusion with vacuoles since, as far as we can tell, these treatments merely phenocopied several viable yeast mutations including mon1 (Figure 4.8A). We do not believe ziNCD was triggered by the vacuolar accumulation of polyphosphate-like aggregates since more of these accumulated in intact, presumably viable, cells than in ones beginning to take in PI (Figure 4.9D). We also do not believe that cells died because zinc inhibited one or more vital processes in a non-autophagic part of the metabolome since these would still be inhibited after class II and III autophagy genes were knocked out. The only factor that we have identified so far that might be creating the condition responsible for inducing ziNCD is the rise in H2O2 in Zn+2-treated cells (Figure 4.9C).

77 Starting from this point, we speculate that the phenotypes studied here arose through the following scenario. It is possible that an operation carried out by a Cvt-like pathway employing Atg11, Atg20, Atg21, Atg23, and Tlg2 (Abeliovich et al, 1999; Lynch-Day & Klionsky, 2010) was activated to clear away protein aggregates formed through the action of reactive oxygen species (Kim et al, 2010) or the direct effect of zinc on protein solubility (Bush et al, 1994; Zaworski & Gill, 1988). Harvesting these aggregates afforded cells some degree of protection, however at the same time as this defense was activated, a parallel process involving class II and III proteins was turned on and targeted against a separate set of proteins or organelles that actively prevented cells from becoming necrotic. In this scenario, it does not matter that the vesicles harvesting these anti-necrosis proteins are unable to deliver their contents to the vacuole because their fusion pathways are inhibited: the catastrophe is inevitable once the life-sustaining substrates are compartmentalized in autophagosomes and thereby prevented from carrying out their function. We believe that further investigations into the multiple roles of autophagy-associated genes in yeasts response to zinc may ultimately have bearing on whether selective or nonselectiveautophagy is directly responsible for cell death in other organisms as some propose (Hofius et al, 2009) (Nishida et al, 2009; Samara et al, 2008), or whether autophagic processes inadvertently upset the balance holding other, pro-death processes in check (Kroemer & Levine, 2008; Levine & Kroemer, 2009). Our studies were not intended to address this debate, but nevertheless, may still prove useful as a tool to establish how ziNCD operates in one cell-type so that experiments can be designed to look for similar events elsewhere.

78

Chapter 5 Autophagy proteins play cytoprotective and cytocidal roles in leucine starvation-induced cell death in Saccharomyces cerevisiae

The content of this chapter was previously submitted for publication as: Dziedzic SA, Caplan AB (2011) Autophagy proteins play cytoprotective and cytocidal roles in leucine starvationinduced cell death in Saccharomyces cerevisiae. Autophagy

79 Abstract

Autophagy is essential for prolonging yeast survival during nutrient deprivation, however this report shows that some autophagy proteins may also be accelerating population death in those conditions. While leucine starvation caused YCA1-mediated apoptosis characterized by increased annexin V staining, nitrogen deprivation triggered necrotic death characterized by increased propidium iodide uptake. Although a atg8 strain died faster than its parental strain during nitrogen starvation, this mutant died slower than its parent during leucine starvation. Conversely, a atg11 strain died slower than its parent during nitrogen starvation, but faster during leucine starvation. Curiously, although GFP-Atg8 complemented the atg8 mutation, this protein made ATG8 cells more sensitive to nitrogen starvation, and less sensitive to leucine starvation. These results were difficult to explain if autophagy only extended life but could be an indication that a second form of autophagy could concurrently facilitate either apoptotic or necrotic cell death.

80 Introduction

Studies of yeast have distinguished two sequences of events leading to growth arrest and to death. One sequence, typified by the process induced when yeast have been deprived of polyamines, culminates with the breakup of the plasma membrane so that previously excluded dyes like propidium iodide (PI) are able to enter the cell (Eisenberg et al, 2009). Although some PI+ cells can repair this damage and survive if stress is removed (Davey & P., 2011), most cells that begin to take up PI continue to deteriorate until they succumb to necrosis. Other treatments including exposure to low levels of H2O2, produce a more complex series of changes involving chromatin condensation, DNA breakage (Madeo et al, 2002), and membrane rearrangements that expose phosphatidylserine to exogenously provided annexin V (Madeo et al, 1997a). These events herald apoptotic death, but in most cases, cellular degeneration continues as cells undergo late apoptosis/ secondary necrosis (Buttner et al, 2008). In the literature there is also a 3rd pathway called autophagic cell death (ACD). Autophagy was initially defined as the cells primary response to nutrient deprivation or to the pharmacological agent, rapamycin. When these treatments set autophagy in motion, vesicles called autophagosomes harvested cytoplasmic proteins and organelles and delivered them to vacuoles or lysosomes to be disassembled into amino acids and lipids useful for preserving life until external nutrients are restored. However, in a handful of cases (Bursch et al, 1996; Chera et al, 2009; Kroemer et al, 2009), these autophagosomes were the only visible responses to stress prior to the demise of the cell (Schweichel & Merker, 1973). Some have inferred that such cells, lacking any of the hallmarks of apoptosis or necrosis, died from

81 excessive, non-specific harvesting of organelles and proteins that compromised their ability to maintain essential homeostatic processes. However, persuasive arguments have been made that death might not have resulted from increased autophagic activity, but because autophagic activity failed to prevent it (Kroemer & Levine, 2008; Shen & Codogno, 2011). For many, the resolution of this debate hinges on whether or not cells with defective autophagy genes are able to survive conditions that kill normal cells (Thorburn, 2011). A study using yeast recently presented evidence for just such a case (Dziedzic & Caplan, 2011). Cells treated with 13 mM Zn2+ died necrotically unless any one of 7 autophagy genes was inactivated. At the same time, inactivation of other autophagy genes accelerated cell death, while the inactivation of the remaining genes had no effect on survival at all. Based on the mutants phenotypes, it was suggested that the autophagic proteins could be sorted into 4 classes representing 4 combinatorial modules. When acting on their own, two of these modules carried out necrotic cell death. When joined with a 3rd module, the machinery performed starvation-induced, non-selective autophagy. Finally, when all of the modules were functionally joined, autophagy harvested a few proteins selectively including the vacuolar protein aminopeptidase 1 and delivered them to the yeast vacuole. Yet, despite this evidence that autophagic proteins played an active part in cell death, the dying cells did not harvest typical reporters of autophagic activity like ROSELLA (Rosado et al, 2008) or Rpl25-GFP (Kraft et al, 2008) that would have been expected if indiscriminate autophagy caused ACD. It appeared instead that a selective autophagic process that could not be tracked with any of the tested autophagy reporters enabled cells to go necrotic. This was by no means the first evidence indicating that autophagy contributed to necrotic cell death. Samara et al. found that the loss of the C. elegans gene homologous to ATG1 reduced

82 the number of cells dying necrotically (Samara et al, 2008). More recently, Shin et al. found that inhibiting autophagy inhibited the necrotic death of macrophages infected with a Mycoplasm tuberculosis mutant (Shin et al, 2010). In at least one study, inhibiting the mouse equivalents of the yeast genes ATG7 and ATG8 blocked autophagic harvesting of catalase, and by doing so, prevented necrotic death resulting from a catastrophic increase in reactive oxygen-caused damage (Yu et al, 2006a). The contribution of autophagy to zinc-induced necrotic cell death (ziNCD) in yeast (Dziedzic & Caplan, 2011) might therefore not be as unusual as it at first seems, but merely an extreme example of the cells response to a number of lethal treatments. Most of what we now understand about autophagy began with studies of how the process manifested itself during nitrogen starvation (Schworer & Mortimore, 1979; Takeshige et al, 1992a). We therefore proceeded to test whether the phenotypic differences between mutants during ziNCD correlated with phenotypic differences during nitrogen starvation, and with the less understood response to leucine starvation. Although the two forms of starvation might be expected to cause similar forms of damage, they in fact have been previously shown to elicit very different responses. Thus, leucine-starved cells accumulate almost as many autophagosomes as cells starved for all nitrogen and amino acid sources (Takeshige et al, 1992a), yet based on the vacuole-dependent processing of GFP-Atg8 and prApe1, and on the up-regulation of Atg4 and Atg8, amino acid-starved cells autophagically process less protein than nitrogen-starved ones (Ecker et al, 2010). Defective autophagy may account for the observation that leucine-starved cells lose colony-forming ability faster (Boer et al, 2008) than nitrogen-starved ones (Klosinska et al, 2011). The present study found additional ways that the two forms of starvation differed from each

83 other. We show that, like zinc treatments, nitrogen starvation caused the vast majority of cells to become permeable to propidium iodine (PI), a trait associated with necrosis. Leucinestarved populations, on the other hand, consisted of a mixture of cells. Some only accumulated PI, some only stained with annexin V (a phenotype associated with early apoptosis), and some stained with both, like cells undergoing late apoptosis/ secondary necrosis. Leucine-starved populations failed to harvest autophagic reporter proteins efficiently yet at least some autophagic gene knockout mutations that extended the life of zinc treated cells, extended the life of leucine-starved ones. Despite these contributions by autophagy proteins, we found no evidence for a unique form of death attributable to ACD. Based on these studies, it was concluded that autophagic processes aided both apoptotic and necrotic death, but did not bias which death pathway was used during each stress.

84 Results

The loss of ATG8 and ATG11 had opposite effects on cell survival during leucine and nitrogen starvations Previous studies showed that autophagic mutants displayed 1 of 3 different phenotypes when grown on excess zinc (Dziedzic & Caplan, 2011). Some mutants like atg29 had no effect on zinc tolerance. Others like atg8 were more resistant to zinc than the parental strain, while a handful like atg11 were more sensitive. These studies and others led to the suggestion that autophagic proteins participated in competing processes, some responsible for extending life, and some able to shorten it. The current set of experiments indicated that the colony-forming ability (CFA) of atg8 cells harboring the URA3 plasmid, YEp (Ma et al, 1987) declined rapidly during nitrogen starvation while atg11 cells with the same vector survived longer than the other lines for the first 3 d (Figure 5.1A). During leucine starvation, these phenotypes were reversed (Figure 5.1D). In fact, the initial responses of atg8 and atg11 towards leucine starvation resembled the responses of these two mutants to zinc treatment, with the notable difference being that all genotypes eventually succumbed to amino acid deprivation whereas atg8 cells formed colonies in the presence of 13 mM Zn2+. One explanation for such phenotypes was that these autophagy proteins participated in two diametrically opposed pathways of which one reduced CFA. Autophagy mutations accelerated both necrotic and apoptotic modes of death Previous studies reported that zinc-treated cells predominantly died through necrosis, based on PI accumulation, on their failure to bind annexin V, and on the fact that survival was not

85 affected by the loss of any one of 4 genes involved in apoptosis (Dziedzic & Caplan, 2011). By comparison, leucine-starved populations of PS cells showed a complex spectrum of phenotypes even after only 3h (Figure 5.2). At that time, some cells took up PI, but twice as many bound annexin V. By 12 h, an even larger number stained with both treatments (Figure 5.1E) indicating that by then, many apoptotic cells had begun to undergo late apoptosis/ secondary necrosis (Eisenberg et al, 2010a) as happens to cells that had been treated with H2O2 (Dziedzic & Caplan, 2011). Interestingly, deletion of ATG8 had little effect on the number of cells initially undergoing necrosis, and instead reduced the number of cells dying apoptotically or showing late apoptosis/ secondary necrosis (Figure 5.1E). In contrast, deletion of ATG11 had its greatest effect on the number of cells dying necrotically and from late apoptosis/ secondary necrosis. This observation, that autophagic mutations affected necrotic death in one case, and apoptotic death in another, implied that these proteins were not wedded to either cell death process, nor part of a unique death pathway on their own. Instead, the operation of these proteins impartially accelerated whichever mechanism killed cells during each particular stress. We then extended this comparison of zinc-induced and leucine starvation-induced death to include other mutants. During leucine-starvation, each strain was monitored at the time when PS cells showed a 30% loss in CFA (Figure 5.1). However, rather than focusing on the change in CFA over time, we analyzed the pathway by which the mutants died based on PI uptake and annexin V binding at a single time point. For the most part, the additionally tested autophagic mutants responded as they did on zinc-supplemented media. Two knock-out mutations that reduced necrotic death during zinc treatment (atg7 and atg15), delayed the loss of CFA and reduced annexin V staining during leucine starvation. One that had no effect

86 on zinc tolerance (atg19), had no effect on survival during leucine starvation. Yet there were notable exceptions to this correlation. The loss of the yeast metacaspase gene, YCA1, had no effect on zinc-induced necrotic cell death, but increased CFA from the PSs 69% 4 to the yca1 CFA of 93% 3 during leucine-starvation induced apoptotic death (Figure 5.1F). In addition, tor1 and atg29 mutants behaved like the parental strain on zinc-rich medium, but like atg8 during leucine starvation suggesting, perhaps, that nutrient recycling was only relevant to surviving the latter stress. Different pro-life processes operated during leucine and nitrogen starvation The responses of mutants to nitrogen-starvation were generally mirror-images of their responses to the other stresses. Whereas leucine starved cells died quickly over the course of hours (Figure 5.1D), cells that were concurrently deprived of all other potential nitrogen donors including leucine, died slowly over the course of days (Figure 5.1A). While the atg11 mutation accelerated death during leucine starvation (Figure 5.1A), this mutation sustained population growth during the first few days of nitrogen starvation (Figure 5.1D). Further studies indicated atg7, atg19, and yca1 mutations neither benefited nor harmed nitrogen starved cells during the first 24 h (Figure 5.1C). Consideration of all these phenotypes suggested that the kind of autophagy that sustained life during zinc treatment and leucine starvation worked against the survival of PS cell during the onset of nitrogen starvation. After day 3, this pro-death activity was either suppressed or over-shadowed by the contribution of Atg11 (as well as Atg8, 15, and 29) to survival. Nitrogen-starved cells were also assayed for PI accumulation and annexin V staining. As was done to study leucine starvation, we wanted to produce a snapshot of the initial responses to

87 stress and so assayed phenotypes after 24 h, when most members of populations of particularly mutants like atg8 were still viable. At this time, most cell death was accompanied by necrosis (Figure 5.1B and 5.1C). This PI+ phenotype continued to predominate at 6 d (Figure 5.2), when the CFA of PS cells had dropped to 860.9% (Figure 5.1A). At 6 d, this PI+ phenotype also dominated populations of starving atg11 cells (PI+ cells made up 151.1%, PI+/ annexin V+ made up 2.50.7%, and annexin V+ ones made up 0.90.2% of the population; data not shown). The fact that PI+/ annexin V+ cells remained scarce throughout this time course suggested that the onset of apoptosis was being delayed because cells were mounting a more successful response to nitrogen-starvation than they were able to mount against leucine-starvation, possibly because of the way that autophagy was being performed during each stress. The autophagy reporter protein GFP-Atg8 perturbed cell death during starvation Unexpectedly, independent evidence for the existence of competing autophagic pathways came from studies employing a common reporter protein, GFP-Atg8, under the control of the native ATG8 promoter (Prick et al, 2006). This reporter is incorporated into autophagosomes, and processed in the vacuole to release free GFP and functional Atg8 (Prick et al, 2006). Before using this construct to monitor autophagy, we carried out a routine analysis to verify that the additional Atg8 would not affect the cell death processes of the transformants. Surprisingly, it did. During nitrogen starvation, a parental strain with the reporter developed 2.5-fold more PI+, and fewer surviving, cells than a strain with an unaugmented vector (Figure 5.3). Conversely, leucine-starved PS cells expressing GFP-Atg8 showed 25% less PI staining, and 25% more CPA, than cells carrying the vector alone. We then assayed atg8 cells with the same construct. Here, the reporter merely returned both cell necrosis and cell

88 survival to PS levels indicating that the chimeric protein compensated for the loss of native Atg8. If Atg8 was involved in a single process, it would be difficult to accommodate the similar effects that adding GFP-Atg8 and deleting the endogenous gene had on cell survival. An alternative interpretation for what was found was that excess Atg8 protein, coming from both the original and the introduced genes, reduced competition for a rate-limiting molecule needed by two or more opposing forms of autophagy. Leveling this playing field, in turn, benefited a life-promoting pathway in leucine-starved cells, and a death-promoting process in nitrogen starved ones. Despite genetic and biochemical analyses indicating that at least 2 forms of autophagy operated in GFP-Atg8 expressing cells, we could not detect changes in the localization of the reporter in the atg8 strain (Figure 5.4). While nitrogen-starved cells acquired greenfluorescing vacuoles (Figure 5.4A) and showed enhanced GFP-Atg8 processing (Figure 5.4B), the vacuoles of leucine-starved ones were nearly as dark as those in cells during normal growth (Figure 5.4A). The appearance of these vacuoles differed from those in a previous report (Ecker et al, 2010). However, those studies were carried out in an ATG8 strain. In PS cells with that genotype, we too found fluorescence accumulated in vacuoles during leucine-starvation (Figure 5.5). In fact, had we only analyzed the PS strain, we might have concluded that leucine-starvation had induced macrophagy. After considering the phenotypes of atg8 cells, a more nuanced explanation might be that the combined Atg8 and GFP-Atg8 level artificially augmented the pro-life pathway, allowing it either to eliminate mis-translated or mis-folded proteins, or to re-cycle the limiting amino acid more quickly.

89 Leucine-starved cells were less sensitive to rapamycin After failing to see evidence for GFP-Atg8 processing in atg8 cells, we attempted to visualize autophagic events with an alternative reporter, HttQ25-GFP, an approximately 34 kD reporter built from the first 17 amino acids of the human protein, huntingtin, with 25 glutamine residues fused to a FLAG-tagged GFP, that was expressed in yeast from a GAL1 promoter (Meriin et al, 2002). The polyglutamine sequence on this reporter enables it to form unstable aggregates in vitro (Walters & Murphy, 2009). Preliminary experiments in galactose medium showed this protein was not toxic to yeast (data not shown), nor did it alter the percentages of cells that stained with either annexin V or PI during nitrogen or leucine starvation (compare strains with this reporter shown in Figure 5.6 with the percentages of PI+ cells in Figures 5.1B and E). Although this reporter was harvested during nitrogen starvation (Figure 5.7A), it too failed to accumulate in vacuoles, or to show evidence of increased proteolytic degradation, during leucine starvation (Figure 5.7B). We then turned to Ape1-RFP (Meiling-Wesse et al, 2005), a substrate for non-specific autophagy, as well as for one very selective process called cytoplasm-to-vacuole transport (Kageyama et al, 2009). As shown in Figure 5.8A, this protein was harvested constitutively during nutrient-replete conditions, but vacuolar accumulation increased 20-30-fold more during either rapamycin treatment or nitrogen starvation (Figure 5.8B). The amount of processed Ape1 protein also increased during these conditions, although this increase was not dramatic (Figure 5.8C).

90 Table 5.1. Rapamycin reduces the symptoms of death during leucine starvation.

SD-N Rapamycin PS::YEp atg8::YEp atg11::YEp atg29::YEp 1.3 1.1 3.5 1.0 1.3 0.7 11.3 2 2.1 0.9 3.7 1.8 1.3 0.8 11.5 1 + 1.0 0.7 4.9 1.3 1.0 0.8 13.3 1 1.0 0.5 4.6 0.8 1.0 0.7 11.1 1 23.2 2 5.3 2.3 10.3 2 3.1 2.0 36.4 3 11.6 2 10.7 1 1.5 0.6

SD-L + 9.0 1.8 1.8 0.7 5.8 1.2 1.3 0.7 24.3 2 2.4 0.7 10.8 1 1.3 0.3

The table shows the percent of cells ( standard deviation) staining with annexin V or annexin V and PI (upper white rows) or with PI alone (lower colored rows) for PS and mutant cultures starved for nitrogen for 24 hrs, or leucine for 12 hrs with (+) and without (-) 0.22 mM rapamycin as indicated. Each experiment was repeated 3 times. Note that atg29::YEp did not respond to rapamycin during this treatment.

91

Figure 5.1. Autophagy mutants did not respond uniformly to nutrient deprivation. (A and D) BY4741 and its derivatives bearing deletions of the indicated genes were transformed with a vector, YEp 25, and grown in SD medium to an OD600nm of approximately 0.4, harvested, washed, and then diluted to 0.04 OD600nm using either SD-leucine (SD-L) or SD-nitrogen sources (SDN) as described in Materials and Methods. Samples were removed every 12 h (SD-L) or 72 h (SD-N), plated onto YPD medium and incubated 2 d at 30 C to assay for survivors. This recovery was normalized to the number of survivors at 0 h. Each point is the average and standard deviation of 3-4 experiments. (B-C and E-F) Cells were removed from each culture after 12 h (SD-L) and 24 h (SD-N) starvation, permeabilized, treated simultaneously with PI and annexin V, and viewed microscopically at 520 nm (annexinFITC) and 620 nm (PI) 13. Each value is the average percentage (and standard deviation) of stained cells within a population of 100200 cells based on 3-4 independent experiments. The %CFA (the percentage of cells surviving relative to the initial cell number) at the time of sampling is shown below each mutant.

92

Figure 5.2. Annexin V and PI staining in PS populations progresses at different rates depending on the starvation treatment. The bar graph shows the percentage of PS cells staining with annexin V, PI, or both after 3 and 12 h incubation in SD-L, or after 6, 24, and 144 h in SD-N.

93

Figure 5.3. Expressing GFP-Atg8 in PS cells changed the percentages of cells dying during starvation. PS and atg8 cells were transformed with YEp or a plasmid expressing GFP-Atg8, starved and stained with PI, and scored. Because of the presence of GFP, it was not possible to score for annexin V-staining cells in these experiments. Each average (and standard deviation) was derived from 3-4 independent experiments, each counting 100-200 cells. The table shows the %CFA of each strain at the time of sampling.

94

Figure 5.4. GFP-Atg8 was not harvested or processed by atg8 cells during leucine starvation. (A) The photos show representative cells that were pre-grown in SD and then stained for 30 min with FM4-64. Stained cells were then washed and starved for 12 h (SD-L) or 24 h (SD-N) and examined. (B) Proteins were extracted from cultures harvested at the same times as in A, separated by PAGE, transferred to duplicate membranes, and treated with antibodies to visualize GFP or actin. The amounts of GFP-Atg8 and GFP relative to actin are shown in the lower table.

95

Figure 5.5. GFP-Atg8 was not harvested in leucine-starved atg8 cells. The photos show representative ATG8 and atg8 cells that were stained with FM4-64 for 30 min, washed, and resuspended in SD-L medium. After 3 h starvation, cells were removed and viewed as described in the Materials and Methods. Fluorescence was only seen in vacuoles of ATG8 cells.

96

Figure 5.6. HttQ25-GFP didnt influence cell death. PS and mutant cells were transformed with YEp or a plasmid expressing HttQ25-GFP, pre-grown in SD, and then starved in SG medium, and stained with PI as in Figure 5.2, and scored. Because of the presence of GFP, it was not possible to score for annexin V-staining cells in these experiments. Each average (and standard deviation) was derived from 3-4 independent experiments, each counting 100200 cells. Additional experiments (data not shown) demonstrated that substituting galactose for glucose had no effect on the percentage of PS cells dying during either starvation. The frequencies of cell death shown here by each mutant were statistically similar to those shown in Figure 5.1.

97

Figure 5.7. HttQ25-GFP didnt accumulate in vacuoles during leucine starvation. (A) The photos show representative PS cells expressing HttQ25-GFP after 12 h starvation in SG-L medium, or 24 h in SG-N. Starvation media also contained 1.0 mM PSMF to inhibit vacuolar proteolysis. Cells were pre-grown in SD, stained with FM4-64 for 30 min, washed, and resuspended in the appropriate SG medium before starving them for the indicated times. Fluorescence was only seen in vacuoles of nitrogen-starved cells. (B) Proteins were extracted from cultures harvested at the times indicated above (but starved in the absence of PSMF), separated by PAGE, transferred to duplicate membranes, and treated with antibodies to visualize GFP or actin. The amounts of HttQ25-GFP relative to actin are shown in the lower table. While nitrogen starvation reduced HttQ25-GFP, leucine starvation had no significant effect.

98 Figure 5.8. Leucine-starved cells harvested basal levels of Ape1-RFP. (A) Representative cells in cultures expressing Ape1-RFP after 12 h (SD-L) and 24 h (SD-N) starvation in the presence or absence of 0.22 M rapamycin. (B) Average percentage of the population ( standard deviations) showing the indicated phenotypes. Each value was derived from looking at 100-200 cells in 3 independent experiments. (C) Proteins were extracted from cultures harvested at the times indicated above, separated by PAGE, transferred to duplicate membranes, and treated with antibodies to visualize Ape1 or actin. The amounts of Ape1RFP and Ape1 relative to actin are shown in the lower table.

99

100 Discusion

Nitrogen starvation-induced autophagy (also known as macroautophagy) has been the model for uncovering most of what we know about the contribution that this process makes to cell survival (Abeliovich & Klionsky, 2001). This pathway is negatively regulated by the TOR complex (Noda & Ohsumi, 1998). Neither the deletion of TOR1 (Figure 5.1C), nor simultaneous treatment with rapamycin (Table 5.1), a chemical inhibitor of Tor1 (Noda & Ohsumi, 1998), affected cell death during nitrogen starvation indicating that the kinase was already fully inhibited by nitrogen starvation. On the other hand, both the deletion of TOR1 and treatments with rapamycin halved the rate of death during leucine starvation (Figure 5.1F and Table 5.1). This confirmed what others have noted (Ecker et al, 2010): leucine starved cells survive longer if non-selective autophagy is induced, but are unable to induce this form of autophagy effectively without pharmacological help. Rapamycin treatments provided further evidence that autophagy proteins operated differently during the two deprivation conditions. As shown in Table 5.1, the life-extending process induced during nitrogen starvation and rapamycin treatment depended upon Atg8 and Atg29, and not on Atg11. This verified that the pro-life process operating throughout this treatment was almost certainly synonymous with canonical macroautophagy (Abeliovich & Klionsky, 2001). In contrast, the life-extending process activated during leucine starvation depended on Atg11 suggesting that this type of autophagy operated selectively (Lynch-Day & Klionsky, 2010), like the one that protected cells from excess zinc (Dziedzic & Caplan, 2011). Also like zinc-stressed cells, leucine starved ones appeared to simultaneously carry out a death-

101 promoting process, although in this case, one dependent not only on Atg8, but also on Atg29. Both proteins are considered vital for macroautophagy (Lynch-Day & Klionsky, 2010). Despite this sensitivity to increases in autophagic activity, the Ape1-RFP reporter failed to reveal increased protein harvesting during leucine starvation (Figure 5.8A-C). In fact, leucine starvation partially de-sensitized cells to rapamycin treatment so that there were nearly 3-fold fewer-than-expected cells with intensely fluorescent vacuoles, and nearly half as much processed Ape1 protein produced. Interestingly, leucine starved melanoma cells behave much like leucine-starved yeast: both fail to induce autophagy significantly, both die from caspase-dependent apoptosis, and neither is induced to full autophagy capacity by rapamycin (Sheen et al, 2011). Overall, these experiments demonstrated that mutational studies were able to reveal what our current set of reporter proteins could not. Without the autophagy mutants, we would have no reason to suppose autophagy operated during either zinc treatment or leucine starvation since none of the standard reporters showed extensive accumulation in the vacuoles of the treated cells. The genetic studies, by contrast, revealed that cells carried out 2 different processes in each of these conditions. One process protected cells from damage, and one process acted to accelerate cell death. The balance between these pathways could be shifted towards extending life by treating cells with rapamycin, or in either direction by expressing GFPATG8. However, at this time, we still cannot say which proteins operate in each pathway. Based on the small survey reported here, Atg29 played a much more important role protecting cells from the effects of leucine starvation than it did protecting cells from the effects of zinc (Dziedzic & Caplan, 2011). Moreover, while Atg11 operated in processes that protected cells during zinc treatment and leucine starvation, it appeared to interfere or

102 compete with life-extending processes during nitrogen starvation. More subtly, the loss of Atg15, a vacuolar lipase that extends the lifespan of cells during caloric restriction (Tang et al, 2008), switched the primary pathway of death during nitrogen starvation from necrosis to apoptosis. It is possible that cells that are unable to breakdown their autophagosomes in the vacuole, and thus unable to recycle the autophagosome contents, are dying like cells starved for leucine. The second outcome of these studies is to add to the growing evidence that autophagy operates differently, if at all, during leucine starvation (Ecker et al, 2010; Sheen et al, 2011). This deviation from the pathway operating during nitrogen starvation might have hastened the process that caused so many cells to show signs of late apoptosis/ secondary necrosis. A complete understanding of the basis for this defect, and of how pro-life and pro-death autophagic pathways differ, must await the identification of new reporters, ones capable of tracking what appear to be highly selective operations. Until such time, our current interpretation of the results presented here is that cells are able to use different combinations of autophagy proteins to harvest different cell constituents, and by so doing, affect the factors that specifically trigger either necrotic or apoptotic death.

103

Chapter 6 A novel effect of Prostate specific membrane antigen, a member of the TfRL family, on cell death in yeast

104 Abstract

Prostate specific membrane antigen (Psma) is a trans-membrane member of the Transferrin receptor-like protein family (TfRL) that is heavily over-expressed in some of the more aggressive forms of prostate cancer. Even though its enzymatic activities have been characterized in other parts of the body, its role in malignancy remains to be elucidated. Recently we have identified a yeast member of the TfRL family, vacuole protein sorting 70 (Vps70), which when present in extra copies, increases the resistance of yeast cells to zincinduced necrotic cell death (ziNCD). Remarkably, Psma together with a plant TfRL member, altered meristem program 1 (Amp1), showed similar responses when introduced to yeast exposed to zinc. What is more, all three proteins prolonged cell survival in such distinct stresses as nitrogen starvation or valproic acid treatment. Their presence did not alter the highly selective Cytoplasm to vacuole (Cvt) form of autophagy, but instead triggered transport of the general autophagy reporter GFP-Atg8 to the vacuole during zinc treatments that otherwise inhibit such transport. Psmas protective ability depended on the specific autophagy adaptor protein, Atg11. Based on these findings, we have hypothesized that the Psma pro-life property in yeast depends on its specific targeting to the vacuole, where Psma controls autophagy-like vesicle fusion leading to the degradation of a pro-death molecule, or the activation of a pro-life one, thus prolonging cell survival exposed to stress.

105 Introduction

Transferrin receptors span the plasma membrane of nearly every vertebrate cell. Their large extracellular domain binds transferrin while a much shorter intracellular domain mediates the endocytotic process that imports the complex into the cell where the iron is ultimately released allowing the receptors to cycle back to the cell surface (Collawn et al, 1993). While transferrin receptors are unique to vertebrates (Lambert, 2011), they are viewed as a relatively recent branch of a more ancient family of transferrin receptor-like proteins (TfRLs) that are present in animals, as well as in organisms predating the evolutionary appearance of transferrin itself. (Tinoco et al, 2008) TfRLs cannot bind transferrin (Davis et al, 2005) and no other polypeptide ligand for them has been found. One of the 3 yeast TfRLs is VPS70, first found during a screen for knockout mutations that abolished the import of common metabolic enzymes like carboxypeptidase Y into vacuoles. (Bonangelino et al, 2002) Knockouts of plant genes most like a TfRL affect a variety of processes that increase the size of the shoot apical meristem in Arabidopsis, accelerate the maturation of rice leaves, and reduce embryonic dormancy in maize. (Helliwell et al, 2001; Kawakatsu et al, 2009; Suzuki et al, 2008) Very little is known about how any of these TfRL proteins operate at the molecular level. By comparison, one particular member of the vertebrate gene family, most commonly referred to today as glutamate carboxypeptidase or prostate-specific membrane antigen (Psma), has been extensively studied because its expression level correlates with the aggressiveness of the prostate cancer. (Israeli et al, 1994; Sweat et al, 1998) The sequences of most TfRLs only show short runs of similar or identical amino acids. In this case, Psma is 21 and 26% identical respectively to Vps70 of yeast and Amp1 of Arabidopsis. (Lambert &

106 Mitchell, 2007) Like transferrin receptors, Psma has a large, extracellular domain, a single membrane-spanning peptide, and a short intracellular domain. Unlike transferrin receptors, Psma has a functional protease domain that hydrolyzes folate polyglutamate (the form of most intracellular folate) to folate monoglutamate (Pinto et al, 1996) and N-acetyl aspartylglutamate (the third most prevalent neurotransmitter in vertebrate nervous systems (Neale et al, 2011)) to glutamate and N-acetyl aspartate. (Carter et al, 1996) Neither of these activities are unique to Psma so it is still unclear what its role is in cells and mutational analyses have added little to clarify this. There are reports that mice harboring knock-outs of this gene are viable, (Bacich et al, 2002) but also other reports have shown that homozygotes die quite early, before most neuronal development begins. (Han et al, 2009; Tsai et al, 2003) Because Psma is linked to cancerous growth and to neuronal functions, its functional domains have been mapped out in great detail. Mutational studies have been performed to identify critical amino acid residues in its active site, in the binding of its Zn2+ co-factor, (Davis et al, 2005) and in post-translational modifications needed for full enzyme stability and activity. (Ghosh & Heston, 2003) While most of the histidine residues responsible for zinc binding to Psma are conserved in the homologues, (Helliwell et al, 2001) few of the asparagines where glycosylation occurs are. (Kawakatsu et al, 2009) Moreover, many of the essential arginine residues in the active site of Psma (Davis et al, 2005) are missing from Vps70 and the plant proteins, and neither of the latter two sets of proteins have been shown to have any kind of enzymatic activity.(Lambert & Mitchell, 2007) In the absence of proven biochemical activities, interpretations of the diverse phenotypes of the plant mutants have relied on the assumption that the homologous proteins functioned like Psma as peptidases acting on folate polyglutamate or as yet unidentified N-acetyl aspartylglutamate-like

107 peptides. This assumption does little to explain the known phenotypes of vps70 strains of yeast. As noted previously, this mutation was recovered in a screen for strains unable to import a peptidase, carboxypeptidase Y, into vacuoles. (Bonangelino et al, 2002) While most mutants recovered from this screen displayed visible changes in vacuole formation or vacuole-associated phenotypes, vps70 cells behaved very much like their wild-type parent, regardless of how they were grown. A subsequent screen, however, showed that these yeast were sensitive to the expression of a variant of the first exon of huntingtin containing 53 glutamine residues. (Willingham et al, 2003) Proteins like this form aggregates and inclusions that can be toxic unless dissolved by chaperones (Carmichael et al, 2000) or removed by autophagy (Iwata et al, 2005). Thus, it would seem that in order to protect cells from this protein, Vps70 or products that it produces, has to be able to carry out chaperonelike or autophagy-like activities that Psma has not been seen to do. In this paper, we report on phenotypic alterations occurring in yeast cells expressing extra copies of VPS70, or the homologous genes, PSMA and AMP1. Our studies showed that the encoded proteins could, to different degrees, suppress both necrotic or apoptotic death resulting from exposure to excess zinc, valproic acid, or to nitrogen and leucine starvation, four very different physiological stresses for cells. Further analyses showed that these TfRLs depended on the autophagy adaptor protein, Atg11 (Yorimitsu & Klionsky, 2005) and on additional gene products that mediate vesicular fusion with vacuoles. Since this protection was not dependent on many other autophagy proteins, we are forced to suggest that these TfRLs may have delayed cell death by enhancing the harvesting and/or turnover of selective proteins by a novel vacuolar import mechanism.

108 Results

Extrachromosomal copies of VPS70 suppressed zinc-induced cell death We recently reported that high levels of Zn2+ arrested yeast growth within 2 h, and initiated necrotic death within 8 h, of treatment. (Dziedzic & Caplan, 2011) Quite unexpectedly, zincinduced necrotic cell death (ziNCD) could be suppressed by deleting any one of 7 autophagy genes, or accelerated by knocking out any of 4 others. These results appeared to indicate that cells were dying from autophagic cell death (ACD), but we failed to find evidence that zinc treatments stimulated harvesting of any of the fluorescent reporters that ACD is expected to induce. (Thorburn, 2011) In order to explore the genetic pathways underlying ziNCD, a search was carried out for genes able to suppress it. Plasmids were prepared from a yeast genomic library (Ramer et al, 1992) and transformed into a common yeast strain, BY4723. (Brachmann et al, 1998) Out of approximately 3,000 transformed lines recovered using this library, 1 was found that grew reproducibly on SD medium containing 10 mM ZnSO4. The plasmid it contained not only protected BY4723 from high levels of exogenous Zn2+, but every other yeast strain tested. For example, BY4741 carrying this plasmid grew on medium supplemented with 13 mM Zn2+ while a strain harboring a vector alone did not (compare Figure 6.1A and B). Sequence analysis revealed that the cloned genomic fragment contained a single intact open reading frame encoding the vacuolar sorting protein, Vps70. The putative open reading frame for this gene was isolated and inserted into pYES2 (Invitrogen, Carlsbad, CA) placing it under the control of the GAL1 promoter. We observed that cells

109 transformed with this 2-based plasmid grew as well on SD medium with 13 mM Zn2+ as cells carrying the original genomic clone (Figure 6.1B). Transferrin receptor-like proteins suppressed several forms of cell death Vps70 is a member of a family of Transferrin Receptor-like (TfRL) proteins represented in all eukaryotic kingdoms, including fungi and plants that lack transferrin itself.(Lambert & Mitchell, 2007) Arabidopsis plants missing its equivalent gene, AMP1, which is 21.2% identical to Vps70, have abnormally enlarged shoot meristems (Helliwell et al, 2001; Kawakatsu et al, 2009; Suzuki et al, 2008) accompanied by changes in leaf morphology and in the levels of several of the major growth and stress-response regulatory molecules. (Griffiths et al, 2011; Saibo et al, 2007; Suzuki et al, 2008) While some deletions of a mammalian member of this gene family, PMSA, which is 19.4% identical to yeast protein, are homozygous lethal, (Han et al, 2009) others are viable, behaviorally normal, but less susceptible to stroke (Bacich et al, 2005) and additionally, defective in integrin-mediated endothelial cell invasiveness and angiogenesis. (Conway et al, 2006) In order to determine whether these proteins also protected yeast from zinc-induced necrosis, cDNAs encoding AMP1 (Helliwell et al, 2001) and PSMA (Israeli et al, 1993) were cloned into pYES2 and transformed into yeast. None of these plasmids altered the growth rate or final density of cultures growing in SD medium (Figure 6.1A and 6.1D), yet each reduced the inhibitory effect of excess zinc (Figure 6.1B and 6.1E). However, assaying for Zn2+-induced uptake of propidium iodide (PI; a characteristic of cells undergoing early necrosis) indicated that the 3 genes did not reduce the onset of death equally: whereas VPS70 reduced the percentage of cells permeable to PI after 6 h treatment from 203.4% to less than 3.81.6%, AMP1 and PSMA only halved the percentage of cells taking up the dye (Figure 6.1C). Since Psma must

110 dimerize in order to function as a carboxypeptidase, (Schulke et al, 2003) we also investigated whether either of the two foreign genes required the hosts endogenous copy of Vps70 in order protect cells. Figure 6.2 shows, to the contrary, that the CFA and PI uptake of vps70 cells expressing TfRL proteins were statistically indistinguishable from those in the corresponding parental strains (Figure 6.1C). Quite unexpectedly, these TfRL proteins not only delayed the onset of zinc-induced cell death, but delayed death caused by several other treatments as well. For example, nitrogendeprived cells, like Zn2+-treated ones, die necrotically, but only after several days in starvation medium (Dziedzic and Caplan, submitted). Nevertheless, whereas 9 d of this kind of treatment reduced the colony forming ability (CFA) of parental cells to 526%, strains carrying extrachromosomal copies of TfRLs died to 764 9914%, depending on the TfRL gene provided (Figure 6.3A). Revealingly, the protection that Vps70 offered did not negate the need for Atg8 (Figure 6.4A), a protein required for efficient recycling of amino acids during starvation (Kirisako et al, 1999; Lang et al, 1998) suggesting that even though Vps70 prolonged life in an autophagic-like fashion, it could not substitute for autophagy. Most of the cells dying from Zn2+ treatments and nitrogen starvation stained with PI or PI + annexin V rather than with annexin V alone indicating that they had died necrotically ((Dziedzic & Caplan, 2011); Dziedzic and Caplan, submitted). Surprising, the TfRL genes also reduced cell death from exposure to 25 mM valproic acid (Mitsui et al, 2005) (Figure 6.3C), a histone deacetylase inhibitor, (Gottlicher et al, 2001) and to leucine starvation (Figure 6.3E) where a significant percentage of the population stained only with annexin V (Figure 6.3 D and F), characteristic of early apoptosis. (Carmona-Gutierrez et al, 2010)

111 Significantly, we did find 2 lethal conditions that were not reversed by VPS70. One of the first steps in the execution of apoptosis in mammals involves translocation of the protein Bax from the cytoplasm to the outer mitochondrial membrane to create channels that release cytochrome c into the cytosol.(Wolter et al, 1997) Yeast lacks a homologue to Bax, but does encode proteins that function in a similar way in the cell death pathway. (Buttner et al, 2011) With their help, yeast carrying a galactose-regulated BAX transgene die apoptotically when cultured under inducing conditions. (Polcic & Forte, 2003) An episomal copy of the native VPS70 gene was introduced into a strain harboring BAX, but failed to suppress this galactoseinduced death (Figure 6.4B). This demonstrated that Vps70 did not prolong life by blocking responses to apoptotic signal molecules emanating from permeabilized mitochondria. The second failure that we found involved resistance to Cd2+ ions. Vps70 shares 15.3 and 16.9% identity with two more abundant transferrin receptor-like proteins, Tre1 and Tre2, that are estimated respectively to have 396 and 300 molecules/ cell compared to Vps70 with 112 molecules/ cell. (Ghaemmaghami et al, 2003) Strains missing TRE1 and TRE2 are hypersensitive to cadmium while double-mutants expressing either gene from a low-copy plasmid re-acquire wild-type levels of cadmium resistance.(Stimpson et al, 2006) By comparison, strains missing VPS70 (data not shown), or strains carrying the gene on a high copy plasmid, only grew like the PS on medium containing 40 mM Cd2+ (Figure 6.4C). Taking into account these observations and the fact that TfRLs protected cells from several physiologically unrelated treatments suggested that the TfRLs didnt prolong life by eliminating a specific toxic condition that initiated death, or suppressing enzymes in the pathway that executed it, but rather by alleviating particular kinds of damage caused by some treatments that ultimately triggered cell death.

112 TfRLs protected autophagy-deficient cells, but still depended upon genes involved in vacuolar fusion Yeast strains without a functional VPS70 gene are viable under routine growth conditions and most stresses tested. In particular, the vps70 mutant behaved like the PS during leucinestarvation (Figure 6.3C), valproic acid treatment (Figure 6.3E), and when cultured with 13 mM Zn2+ (Figure 6.2). However, vps70 cells died quickly during nitrogen starvation (Figure 6.3A), and began to show significant permeability to PI after only 24 h (Figure 6.3B). The sensitivity to nitrogen starvation that vps70 cells showed resembled the phenotype of cells with defects in starvation-induced autophagy (Tsukada & Ohsumi, 1993a) raising the possibility that TfRLs exerted their effects by modulating that pathway. In order to test this, the plasmid encoding VPS70 was transformed into representative autophagy mutants (Figure 6.5) and tested for growth on 13 mM Zn2+. Contrary to expectations, the effect of Vps70 was additive to the sensitivity or resistance of the tested mutations. For example, atg8 was more resistant than the PS to Zn2+ and still more resistant when additional copies of VPS70 were added. Similarly, atg11 was more sensitive than the PS, but addition of the pGAL1::VPS70 made it as resistant as the PS with that plasmid. Table 6.1 expands on this list. atg21 cells were more sensitive to Zn2+ than the PS(Tsukada & Ohsumi, 1993a), atg1, atg17, atg22, and tor1 were as sensitive as PS cells, and atg5, atg6, and atg7 were more resistant to zinc. (Dziedzic & Caplan, 2011) Each acquired the same level of tolerance as the PS when each was augmented with the additional VPS70 gene. These 10 genes are essential participants in either selective or nonselective autophagy, or involved in both, (Lynch-Day & Klionsky, 2010) yet VPS70 needed none of these to prolong cell life. The simplest

113 conclusion is that although Vps70 participated in an autophagy-like pathway, it worked independently of any of the known autophagic processes. Similar studies were done with several other genes in order to identify potential partners in this protective process (Table 6.1). VPS70 enhanced zinc tolerance in strains missing genes involved in apoptosis (AIF1, NUC1, SVF1, and YCA1), ubiquitination (BRE5, BSD2, TRE1, and TUL1), transcriptional responses to oxidative or ionic stress (ASK10 and SSN8), and some genes involved in vacuolar protein sorting (VPS11). On the other hand, other vacuolar sorting proteins (VPS4 and VPS21) were required, directly or indirectly, for the cells response to extrachromosomal copies of VPS70, as were a number of proteins involved in endosome-endosome or autophagosome-vacuole fusion processes (CCZ1, MON1, VPS16, VPS18, and YPT7). Cells missing ZRC1, the major transporter responsible for sequestering Zn2+ in vacuoles, (Kamizono et al, 1989) also couldnt respond to VPS70, possibly because the accumulating ion caused more damage than any defense system could handle. Expression of tTfRLs altered cell morphology Two additional points came to light as we continued to study cells expressing TfRLs. First, staining with FM4-64, a dye that visualizes vacuolar membranes (Vida & Emr, 1995) showed that PS or vps70 cells with the vector YEp, had 1-3 vacuoles with enlarged lumens (Figure 6.6A-E), but cells expressing any of the TfRL proteins had 3-6 small vacuoles. Often, vacuolar fragmentation of this kind is accompanied by increased sensitivity to Mn2+, Zn2+, and other growth inhibitory molecules that have to be sequestered or detoxified in the vacuole for the cells to tolerate them, (Banuelos et al, 2010) but this is the very opposite of the phenotypes we have seen.

114 Second, we noticed that cells expressing TfRLs tended to be smaller than those with the vector (Figure 6.6). Based on measurements of 30,000 cells per strain (Figure 6.6F), 58.9% of PS and 64.3% of vps70 cells, each with YEp, fell to the left of an arbitrarily chosen reference line. By comparison, 87.4%, 92.1%, and 86.0% of cells with pGAL1::VPS70, pGAL1::AMP1, and pGAL1::PSMA fell to the left of that position. Similar shifts towards smaller cells have been seen when cells are given extra copies of CLN3, (Cross, 1988) or contain reduced numbers of functional ribosomes.(Jorgensen et al, 2002) TfRLs increased the efficiency of protein import into the vacuole One of the conclusions of the genetic analysis recorded in Table 6.1 was that Vps70 performed an autophgy-like process independently of all autophagy genes tested. In order to visualize similarities and differences between the Vps70-mediated process and canonical autophagic abilities, we investigated whether TfRL proteins altered harvesting of either of 2 widely used reporter proteins, Ape1-GFP (Suzuki et al, 2002) or GFP-Atg8. (Suzuki et al, 2001) Ape1 assembles into small aggregates that are continuously engulfed by small vesicles at a unique cellular domain called the pre-autophagosomal structure (PAS). (Baba et al, 1997; Suzuki et al, 2002) These Cvt-somes are then delivered to the vacuole through a selective form of autophagy called the cytoplasm-to-vacuole (Cvt) pathway. (Klionsky et al, 1992) When cells are starved for nitrogen or treated with rapamycin, Atg8 is recruited to the PAS to create larger autophagosomes that are capable of performing nonselective, bulk harvesting of cytoplasmic proteins. (Huang et al, 2000) The chromosomal copy of VPS70 could be deleted without affecting the delivery of GFP-Atg8 to the vacuole, either during normal growth, or

115 when autophagy has been stimulated with rapamycin (Figure 6.7) demonstrating that VPS70 was not required for Cvt-some or autophagosome formation or operation. Previous studies indicated that high levels of zinc blocked the fusion of Ape1-loaded Cvtsomes with vacuoles. (Dziedzic & Caplan, 2011) As a result, PS cells accumulated fluorescently tagged versions of Ape1 (Suzuki et al, 2002) in 1-2 small subcellular structures, often close to the vacuole, while the vacuoles themselves remained dark (Figure 6.8). The introduction of VPS70 into this strain did little to change this: it did not noticeably increase Ape1-GFP uptake into the vacuole during normal growth, unlike treatment with rapamycin, nor did it overcome the block that prevented Cvt-somes from fusing with vacuoles (Figure 6.8). Vps70 also did not alter vacuolar accumulation of Zrc1-GFP, a reporter built from the principal vacuolar zinc transporter (Miyabe et al, 2001), nor did it change the cytosolic location of another reporter, ROSELLA (Rosado et al, 2008) (data not shown). Thus, not only was Vps70 not required for Cvt or nonspecific autophagy, additional copies of the gene were not sufficient to induce either process. Yet a different result was obtained when cells expressing GFP-Atg8 were examined. Cells expressing this reporter generally had fluorescent cytosols and vacuoles. Zn2+-treated cells appeared quite similar save that they had intensely fluorescent PASs. When extrachromosomal copies of any one of the 3 TfRL genes were introduced, much of the cytoplasmic reporter was moved to vacuoles so that the cytoplasm was dark and the PAS less distinct (Figure 6.9). However, the 3 TfRL proteins did not perform equally well either because their activities, turnover, or localizations differed. In SD medium, and SD medium with zinc, cells producing Vps70 and Psma together with GFP-Atg8 had dark cytoplasms and glowing vacuoles (Figure 6.9). By comparison, cells with AMP1 had some fluorescent

116 material in their vacuoles, but most was in their cytosol like PS cells. Since Vps70 exerted effects in atg8 cells (Table 6.1), it seems likely that GFP-Atg8 was being carried into vacuoles as cargo rather than as a participant in a conventional autophagy process. Psma-GFP entered the vacuole when other reporters could not. Although each of the TfRLs has similar structure, each is believed to be targeted to different parts of their host cells. Vps70 has not been localized yet, but the process it affects, targeting of carboxypeptidase Y to vacuoles, indicates it could be associated with the late golgi, the vacuole, or with the endosome-like vesicles that shuttle in-between. (Vida et al, 1993) On the other hand, Amp1 accumulates in the ER (Vidaurre et al, 2007) and Psma accumulates predominantly in the plasma membrane in mammalian cells.(Christiansen et al, 2005) In order to determine where Psma localized in yeast, a reporter was built that fused GFP to the C-terminal domain of Psma. Based on the accumulation of PI in dying cells, his chimera protected cells from Zn2+ as well as Psma (Figure 6.10) but it did not show membrane targeting during normal growth (Figure 6.11). On the other hand, when cells were treated with 13 mM Zn2+, or starved for leucine or nitrogen (Figure 6.12), much of the reporter translocated to the lumen of the vacuole. Since 7 other cytoplasmic or organelle-associated reporters including GFP-Atg8 failed to relocate in this way during Zn2+ treatment or leucine starvation (Dziedzic & Caplan, 2011) (Dziedzic and Caplan, submitted), this reporter had to have been using a novel mechanism, one possibly related to the specialized autophagic processes that contribute to the competing pathways of protection and death at work during those treatments (Dziedzic & Caplan, 2011) (Dziedzic and Caplan, submitted).

117 Despite its similarities to Vps70, this reporter did differ strikingly in its dependency on other proteins. Vps70 protected all of the autophagic mutants tested (Table 6.1). In contrast, Psma, and Psma-GFP, required Atg11 (but not Atg8) to protect cells from 13 mM Zn2+ (Figure 6.10) and to overcome the blockade that Zn2+ imposed on autophagic vesicle fusion with vacuoles (Figure 6.11). It may that this heterologous protein needed assistance to get into the vacuole, but once there, was able to perform like its yeast homologue.

118 Table 6.1. VPS70 requires many vacuolar proteins to protect cells from Zn2+. Strains of BY4741 with knockout mutations in the indicated genes and transformed with YEp or VPS70 were assayed for growth as shown in Figure 6.5. The growth of the PS was set at - and other phenotypes were judged relative to that based on 2-3 independent experiments. -, very little or no growth detected after 4 d; +/-, weak growth when 104 cells were applied in the first position; ++, growth in the 2 left-most dilutions; +++, growth in the 3 left-most dilutions; ++++, growth in the 4 left-most dilutions.

119 Table 6.1. VPS70 requires many vacuolar proteins to protect cells from Zn2+

Distinguishing Deletion in Strain (PS) TOR1 ATG1 ATG5 ATG6 ATG7 ATG8 ATG11 ATG17 ATG21 ATG22 AIF1 NUC1 SVF1 YCA1 ASK10 SNF1 SSN8 VPS4 VPS11 VPS16 VPS18 VPS21 VPS33 VPS70 TRE1 MON1 CCZ1 YPT7 BRE5 BSD2 TUL1 ZRC1

Functional Role Of Gene (-) Negative regulator of autophagy (Klionsky et al, 2010) Negative regulator of autophagy (Klionsky et al, 2010) Part of an E3 ligase for Atg8 (Klionsky et al, 2010) Part of a PtdIns kinase (Klionsky et al, 2010) E1 enzyme for Atg8 and 12 (Klionsky et al, 2010) Required for autophagosome expansion (Klionsky et al, 2010) Scaffold protein for selective autophagy (Klionsky et al, 2010) Modulator of size of autophagosome (Klionsky et al, 2010) PtdIns(3)P binding protein (Klionsky et al, 2010) Amino acid effluxer for vacuole (Klionsky et al, 2010) Positive regulator of apoptosis (Wissing et al, 2004) Positive regulator of apoptosis (Vincent et al, 1988) Negative regulator of apoptosis (Vander Heiden et al, 2002) Apoptotic metacaspase (Madeo et al, 2002) Subunit of RNA polymerase II (Page et al, 1996) Positive regulator of autophagy, metabolism, and proteolysis (Petranovic et al, 2010) RNA polymerase II-associated kinase (Carlson et al, 1984) ATPase required for vacuolar protein sorting (Robinson et al, 1988) Vacuolar membrane protein involved in protein Sorting (Robinson et al, 1988) Endosome-to-vacuole docking and fusion (Robinson et al, 1988) Vesicle-to-vacuole docking and fusion (Robinson et al, 1988) Rab-like GTPase involved in protein sorting (Robinson et al, 1988) ATP-binding protein required for vesicle docking and fusion (Robinson et al, 1988) Vacuolar protein sorting (Bonangelino et al, 2002) Regulator of transporter turnover (Stimpson et al, 2006) GEF-subunit for ypt7 (Nordmann et al, 2010a) GEF-subunit for ypt7 (Nordmann et al, 2010a) Rab-like GTPase involved in endosome-endosome Fusion (Wichmann et al, 1992) De-ubiquitinase involved in ER-to-Golgi transport (Cohen et al, 2003) Facilitates degradation of metal transporter (Liu et al, 1997) E3 ligase involved in protein sorting (Reggiori & Pelham, 2002) Primary vacuolar transporter of Zn2+ (Kamizono et al, 1989)

VPS70 (-) ++ ++ ++ +++ ++ +/++ -

+ VPS70 (+++) +++ +++ +++ +++ +++ ++++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ +/+++ +/+/+++ +++ +++ ++++ +++ +++ +++ -

120

Figure 6.1. TfRL proteins protect yeast from excess zinc. (A) PS::VPS70 is a clone of the native gene in YEp while the others plasmids consist of open reading frames transcribed from the GAL1 promoter in pYES2. The growth of the parental strain (PS) or vps70 transformed with the indicated plasmids was assessed using cultures first grown in SD medium to mid-exponential phase, then serially diluted by factors of 10, and stamped onto SD agar. As shown above each photograph, the first dilution had approximately 104 cells and the last approximately 100 cells. (B) The same dilutions used in panel (A) were replica stamped onto SD medium supplemented with 13 mM ZnSO4. The collages in panels (A) and (B) were assembled from photographs taken after 4 d growth at 30C. C. Propidium iodide staining was carried out on cultures grown in SD medium to an OD600nm of approximately 0.4 and then diluted into fresh medium supplemented with 13 mM ZnSO4. Each culture was

121 sampled after 6 h, treated with PI, and viewed microscopically at 620 nm (PI). 13 Each value is the average and standard deviation of 3-4 independent experiments, each counting 100-200 cells. The probability that the results were similar to PS: *, p<0.001; **, p<0.004; ***, p<0.016. (D) Cultures were prepared as in (C), but diluted into SD medium without a Zn2+ supplement. Samples were removed every 2 or 12 h as indicated, spread onto YPD agar, and incubated for 2 d to determine colony forming ability (CFA) at tn as a percentage of colony forming ability at t0. The left scale shows the average percent change ( SD) from the initial population size for 4 independent replicates. (E) Cultures were prepared as in (C) diluted into SD medium with 13 mM Zn2+. Cultures were sampled and recorded as in (D).

122

Figure 6.2. PSMA and AMP1 did not need VPS70 to protect cells from zinc. PS and vps70 cells transformed with YEp or with plasmids encoding VPS70, PSMA, and AMP1 were grown with 13 mM Zn2+ and assayed for CFA and for PI accumulation as described in the legend for Figure 6.1C. Each value is the average and standard deviation of 3 independent experiments, each counting 100-200 cells The probability that the results were similar to PS: *, p<0.001; **, p<0.025; ***, p<0.01.

123 Figure 6.3. TfRL proteins protect yeast from treatments that induce necrotic and apoptotic death. (A), (C), and (E) Cultures of the PS or vps70 transformed with YEp or with pYES2 expressing each of the indicated genes were grown in SD medium to an OD600nm of approximately 0.4 and then diluted into nitrogen- and amino acid-free SD (A), or SD medium without leucine (C), or SD medium containing 25 mM valproic acid (E). Samples were removed at the indicated times, spread onto YPD agar, and incubated for 2 d to determine colony forming ability (CFA) at tn as a percentage of colony forming ability at t0. The left scale shows the average percent change ( SD) from the initial population size for 3 independent replicates. (B), (D) and (F) Cultures were sampled after 24 h (B), 12 h (D), and 42 h (F), permeabilized, treated with both PI and annexin V, and excited at 520 nm (annexinFITC) and 620 nm (PI).(Dziedzic & Caplan, 2011) Each value is the average and standard deviation of 3-4 independent experiments, each counting 100-200 cells. The percent CFA ( SD) for each sample is shown below each set of bars.

124

125

Figure 6.4. VPS70 did not alleviate all causes of death. (A) Cultures of PS or atg8 with YEp or pgal1::VPS70 were grown as in Figure 6.3A and sampled every 12 h on YPD agar. CFA was determined after 2 d. The left scale shows the average percent change ( SD) from the initial population size for 3 independent replicates. (B) Cultures of the yeast strain, CLM 282, carrying a pgal1::BAX transgene(Polcic & Forte, 2003) and either YEp or YEp with the native VPS70 transgene were grown in S medium with 2% raffinose (SR) to mid-exponential phase, then serially diluted by factors of 10, and stamped onto SR agar or SR agar with 0.5% galactose. As shown above each photograph, the first dilution had approximately 104 cells and the last approximately 100 cells. Photographs were taken after 4 d. (C) Cultures of PS with YEp or YEp with the native VPS70 gene were grown in SD, diluted, and applied as described in Figure 6.2A to SD or SD with 40 M CdSO4. Pictures were taken after 3 d growth at 30C.

126

Figure 6.5. VPS70 suppressed autophagy mutations but not a knockout of the rab-like gene, YPT7. Each strain was grown, diluted, and replicated onto SD or SD with 13 mM ZnSO4 as detailed in Figure 6.1. As shown above each photograph, the first dilution had approximately 104 cells and the last approximately 100 cells.The collages were assembled from photographs taken after 4 d growth at 30C.

127

Figure 6.6. TfRL proteins alter vacuolar morphology and the cell size of yeast. (A-E) Vacuolar morphology of the PS containing YEP (A), pgal1::VPS70 (B), pgal1::AMP1 (C), pgal1::PSMA (D), or vps70 with YEp (E) was assessed by growing cells in YPD at 30 C to an OD600nm of approximately 0.4, concentrated by centrifugation, and resuspended in YPD supplemented with 20 g/ml FM 4-64 for vacuole membrane visualization. After incubating cells for 30 min, cells were collected by centrifugation, resuspended in TE buffer, washed a second time in the same way, then diluted in SD to an OD600nm= 0.2, and grown for 4 h. Stained cells were viewed microscopically using an excitation wavelength of 520 nm. (F) Cells were grown in SD to an OD600nm of 0.4, washed twice and resuspended into 50 mM citrate buffer. A 10-fold dilution was analyzed by flow cytometry. Based on counts of 30,000 cells/ strain, 58.9% of cells with YEp fell to the left of the arbitrary reference line. Under the same conditions, 87.4% pgal1::VPS70; 92.1% pgal1::AMP1; 86.0% pgal1::PSMA; and 64.3% vps70 with YEp fell to the left of that position.

128

Figure 6.7. VPS70 was not required for Ape1-RFP harvesting by Cvt or autophagic pathways. Strains were transformed with pAPE1::APE-RFP and grown in SD to mid-log phase, then concentrated by centrifugation and resuspended in SD with or without 0.22 M rapamycin as indicted. Photographs were taken after 6 h culture at 30C. Without rapamycin, Cvt harvested the reporter equally well in PS cells and ones missing VPS70. With rapamycin, harvesting was performed by non-selective, bulk autophagy.

129

Figure 6.8. Vps70 did not suppress the inhibitory effect of Zn2+ Ape1-GFP import into vacuoles. Strains were transformed with pAPE1::APE-GFP and pgal1::VPS70 and grown in SD to mid-log phase, then concentrated by centrifugation and resuspended in YPD containing 20 mg/ mL FM4-64 for 30 min at 30C. Cells were next concentrated by centrifugation, washed twice in TE buffer, and suspended in SD without additional supplements, or with 0.22 M rapamycin, or with 13 mM Zn2+ as indicted. Photographs were taken after 6 h culture at 30C. In SD medium, most of the green fluorescent material in either PS::YEp or PS::pgal1-VPS70 cells accumulated in vacuoles and the PAS, or only in the vacuole when cells were treated with rapamycin, or only in the PAS in the presence of Zn2+.

130

Figure 6.9. TfRL proteins suppressed the block on GFP-Atg8 import into vacuoles caused by Zn2+. Strains were transformed with pATG8::GFP-ATG8 and one of the TfRL gene constructs and grown in SD to mid-log phase, then concentrated by centrifugation and resuspended in YPD containing 20 mg/ mL FM4-64 for 30 min at 30C. Cells were next concentrated by centrifugation, washed twice in TE buffer, and suspended in SD with 1.0 mM PMSF with and without 13 mM Zn2+. Photographs were taken after 6 h culture at 30C. PS::YEp cells had fluorescent cytoplasms and dark vacuoles. In comparison to PS::YEp, all 3 constructs promoted harvesting of GFP-Atg8 into vacuoles in SD with and without zinc, but pgal1::VPS70 and pgal1::PSMA were noticeably more effective than pgal1::AMP1 where much of the fluorescent protein was concentrated in vesicles adjacent to the vacuole.

131

Figure 6.10. PSMA and PSMA-GFP required Atg11 to protect cells from 13 mM Zn2+. PS, atg8, and atg11 cells transformed with PSMA or PSMA-GFP were pregrown in SG to mid log phase, cells were harvested, washed twice in TE buffer and inoculated into SD medium with 13 mM Zn2+, and assayed after 6 h for PI accumulation as described in the legend for Figure 6.1C. Each value is the average and standard deviation of 3 independent experiments, each counting 100-200 cells.

132

Figure 6.11. Psma-GFP was harvested by an ATG11-dependent process in Zn2+-treated cells. Strains transformed with pgal1::PSMA-GFP were grown in galactose medium to midlog phase, then concentrated by centrifugation and resuspended in YPD containing 20 mg/ mL FM4-64 for 30 min at 30C. Cells were next concentrated by centrifugation, washed twice in TE buffer, and suspended in SD with 1.0 mM PMSF with and without 13 mM Zn2+. Photographs were taken after 6 h culture at 30C. The reporter entered vacuoles in zinctreated PS or atg8 cells, but accumulated in 1-3 vesicles docked to the vacuole in atg11 ones.

133

Figure 6.12. Psma-GFP was harvested during both leucine- and nitrogen-starvation. Strains transformed with pgal1::PSMA-GFP were grown in galactose medium to mid-log phase, then concentrated by centrifugation and resuspended in YPD containing 20 g/ mL FM4-64 for 30 min at 30C. Cells were next concentrated by centrifugation, washed twice in TE buffer, and suspended in SD with 1.0 mM PMSF but without additional nitrogen and amino acid sources (SD-N), or without leucine (SD-L). Photographs were taken after 24 h or 12 h culture at 30C, respectively. Unlike previous studies (Dziedzic and Caplan, submitted), the reporter entered vacuoles in both cases.

134 Discussion

It is possible that more nuanced explanations for each of the effects will yet be found, but at this time, the most parsimonious assumption is that all of the phenotypes shown by these TfRL proteins in yeast stem from their effect on a single pathway that brings molecules into the vacuole that if left outside, would delay cell division during normal growth, and during certain stresses, contribute to necrotic or apopotic death. While enhanced protein recycling would account for extended cell survival during starvation, it could not explain how Vps70 saved zinc-treated cells since survival in those conditions did not require Atg22, the major transporter responsible for exporting free amino acids to the cytosol (Yang et al, 2006) for reuse (Table 6.1). This leaves open the possibility that a novel form of selective autophagy or autophagy-like process was at work, able to harvest GFP-Atg8 and possibly Psma-GFP as cargo. Since the effect of Vps70 depended on proteins like Ccz1, Mon1, Vps16, Vps18, Vps33, and Ypt7 that are involved in vesicle fusion, TfRLs presumably operated through a vesicle intermediate. It is not clear what kinds of molecules could be harvested to produce the effects that were observed, but they must have been chosen highly selectively since Vps70 did not cause the established reporters to enter vacuoles during Zn2+ treatment or leucine starvation. This selectivity argued against TfRLs activating bulk autophagy, while the failure to affect Ape1-GFP uptake argued against a similar effect on Cvt.

135 Does the uniform distribution of Psma-GFP in yeast which was so different from what has been seen in mammalian cells (Christiansen et al, 2005) invalidate extrapolating these effects to mammalian cells? It seems unlikely, although this can only be proven experimentally. The effects of this protein were qualitatively similar to the effects produced by Vps70. It seems improbable that these shared abilities were merely fortuitous. However, whereas Vps70 did not require assistance from tested autophagy genes in yeast, Psma needed assistance from Atg11 both for cell protection and for vacuolar localization (Figure 6.12). There is no known Atg11 in non-fungal species, but there are autophagy adapter proteins that might substitute. (Johansen & Lamark, 2011) Moreover, Psma may need assistance in entering vacuoles, but may be able to enter mammalian lysosomes (the equivalent organelle) without this particular kind of help. Finally, Psma is normally glycosylated in mammalian cells. (Barinka et al, 2004) The mis-localization and Atg11 requirement may both result from the lack of appropriate modifications in yeast. Understanding the underlying mechanism by which TfRL proteins work is not needed to appreciate how our observations alone could clarify how TfRL proteins might be participating in plant development. For example, the loss of AMP1 or its homologues in rice and maize have been shown to cause precocious leaf maturation and seed germination, enlarged meristems, and a bewildering array of secondary effects. (Griffiths et al, 2011; Kawakatsu et al, 2009; Suzuki et al, 2008) Most researchers have explained these as epistatic changes resulting from changes in production or catabolism of the regulatory hormone, abscisic acid (ABA). If the Amp1-like proteins affect protein harvesting in plants as they seem to do in yeast, then an alternative explanation for some, if not all of the phenotypes, displayed by these mutants would be that the developmental changes resulted from an

136 inability to remove some proteins meant to function for short periods of time such as signal molecules controlling germination or the number of programmed cell divisions, or cyclins controlling the length of the cell cycle. (Ho et al, 2008) A corollary of this hypothesis is that over-producing TfRL proteins would accelerate the destruction of some cell cycle proteins causing one or more phases of the cell cycle to begin prematurely, resulting in smaller cell sizes as seen in Figure 6.6. The present studies could also change the way we have been viewing Psma expression in cancer cells. At various times, increased expression of Psma has been correlated with invasiveness (Ghosh et al, 2005), tumor angiogenesis (Anilkumar et al, 2006; Silver et al, 1997), and with an increased propensity for cells to become aneuploid (Rajasekaran et al, 2008), but it has proven conceptually difficult to explain how these phenotypes could be linked to the only known activity of the protein: its role in liberating glutamic acid from folylpoly-g-glutamates (Pinto et al, 1996) and from the C-terminus of the neural peptide, Nacetylaspartylglutamate. (Carter et al, 1996) However, the phenotypes caused by Psma expression in yeast could provide a model to account for most if not all of the phenotypes seen in mammalian cells. Premature cell division, or failure to delay division until chromosome segregation has been completed could contribute to increased aneuploidy. Errors in signaling, especially relating to the turnover of angiostatins (Nussenbaum & Herman, 2010), could stimulate angiogenesis, and all of these changes plus invasiveness could be exasperated by any factor that prevented cells from dying apoptotically when detached from their original substratum and the surface of their neighbors. (Reddig & Juliano, 2005)

137 Finally, the results in this paper also add substance to a previous proposal that PSMA could be a multifunctional protein.(Rajasekaran et al, 2005) This proposal was based primarily on its unique glutamate carboxypeptidase activity, on its structural similarity to receptor proteins, and on its functional links with the actin cytoskeleton and integrin signaling via its interaction with filamin. (Conway et al, 2006) Since yeast and plants lack integrins, one would have to assume either that each homologue exerts pleiotropic effects through its own, particular set of domains, or that, contrary to expectations for proteins differing at approximately 80% of their residues, the primary abilities of this family lie with a few preserved domains that operate an yet unidentified, cell pathway. The results in the present paper support the latter argument.

138

Chapter 7 Future directions

139 Autophagocytosis is a pro-life mechanism which, by recycling non-essential proteins, prolongs cell survival during amino acid starvation. Nevertheless, a growing body of evidence obtained by studying different organisms has suggested that this protective mechanism in some cases may be leading to death when excessively induced. This form of response, which has been called autophagic cell death (ACD), is doubted by many researchers who believe that autophagy per se cannot trigger death, but rather modulates other pathways such as apoptosis or necrosis. Because of that there is a need for extensive studies into the potential interplay between the pro-life and hypothesized pro-death natures of autophagocytosis. The work of this thesis was aimed at characterizing such a dual role in Saccharomyces cerevisiae undergoing two distinct stress treatments, one resulting from exposure to 13 mM zinc sulfate and one from leucine deprivation. Within the course of this study we identified two possibly parallel pathways utilizing different sets of autophagy proteins shortening or prolonging survival of the yeast strains treated with zinc. This metal treatment triggered ROS formation which in turn led to the non-apoptotic form of death. The biochemical analysis utilizing commonly used fluorescent reporters did not reveal an increase in autophagic flux, which suggested that death was not caused by ACD as it is traditionally understood. Nonetheless, data obtained genetically showed that death could be the result of a specific autophagy pathway for which a reporter has yet to be found. Similar to zinc, leucine starvation also caused autophagy-controlled death yet did not change the location of any of the common autophagy reporters that were tested (Chapter 5). Even though the outcome of both treatments could be suppressed by addition of the autophagyinduced, rapamycin, leucine starvation triggered apoptosis rather than necrosis. This

140 suggested the possibility that depending on the environment conditions, cell can utilize various sets of autophagy proteins which by their actions trigger necrotic or apoptotic responses. In chapter 6 the relation of a yeast protein of unknown function (Vps70), together with other members of the transferrin receptor-like protein family, one from humans (Psma) and one from plants (Amp1), to different modes of death was described. Through the course of this project we discovered that increasing the VPS70 copy number leads to decreased sensitivity to various dissimilar treatments that would otherwise shorten the life span of the parental strain (PS). Remarkably, a similar effect was observed when mammalian or plant proteins sharing approximately 20% amino acid identity were introduced into yeast. One of the significant conclusions that has come from this work is that a GFP tagged version of Psma has proven to be the only fluorescence reporter out of nine that have been tested which was actively targeted to the vacuole in response to zinc treatment (Figure 6.11). This transport, and the protection that vacuolar localization required, depended on the specific autophagy adapter, Atg11 (Figure 5.10). A model has built that summarizes theses observations. As shown in Figure 7.1, 13 mM Zn2+ (or leucine starvation) triggers cell damage and a response to that. Firstly, Psma it is targeted into the vacuolar membrane in an Atg11 dependent manner. This in turn does one of two things. Either it leads to the harvesting of a pro-life factor which is activated or able to act in the vacuole to turn on a pro-life response or Psma helps vacuoles harvest a cytoplasmic pro-death factor so that it can be subsequently degraded in the vacuole.

141 Even though we tried to answer as many questions as possible related to this phenomena we found, it has not yet been possible to fill in all of the details or to distinguish how Psma works. It is crucial to identify additional proteins that interact with Vps70 in yeast and with Psma in humans in order to prolong cell longevity. Deletion mutation analysis revealed that Vps70 functions (and by analogy, Psma and Amp1) depended on a handful of other, better characterized proteins, since without their presence its protective phenotype against zinc was absent (Table 6.1). It is possible that Vps70 physically interacts with them, and therefore this should be tested using yeast two-hybrid analysis. Due to the fact that results obtained using fluorescent markers hint that Vps70 may be involved in facilitating vacuolar traffic, it would be particularly interesting to test if it binds to Ccz1, Mon1, or Ypt7, proteins which are believed to be involved in all vesicle-vacuole fusions (Wang et al, 2002b). In addition since these 3 proteins were previously shown to be important for pexophagy (Polupanov et al, 2011), it might be important to test whether Vps70 is not altering this specific autophagy pathway while facilitating survival of the cells exposed to stress. This could be tested both by genetic means, for example, by testing for interactions between Vps70 and Vps34 (Grunau et al, 2011) or Sar1 (Schroder et al, 2008), and cytological ones using RFP-SKL as a pathway marker (Bugnicourt et al, 2008). Chapters 3 and 4 showed that both zinc treatment and leucine starvation triggered a response that included inhibition of Cvt-some (or Cvt-some-like) fusion with vacuoles. In chapter 6 we showed that the presence of Vps70 (as well as Psma and Amp) can at least partially (Figure 6.5) remove this blockage and at the same time extend cell survival (Figures 6.1 and 6.2). It is then possible that in order to live longer during both treatments, cells must harvest and

142 transport to the vacuole (lysosome) a pro-death factor, for its destruction or harvest a pro-life factor so that it can become active. One possible method to identify this component would be to harvest cells with and without extra copies of genes of interest after both have been exposed to the zinc treatments or to leucine starvation, extract their vacuoles, and analyze their protein contents using electrospray ionization tandem mass spectrometry (Sarry et al, 2007), looking for differences in protein profiles between the two strains . The proteins discovered through this type of analysis could then be tested by yeast two-hybrid techniques for potential Vps70 interactions, and be knocked out and/or over-expressed in a parental strain cells to prove their importance. Totally unexpected, but potentially medically relevant, was the relation between the presence of extra copies of all three genes and the smaller cell size. This phenotype can suggest that over-expression of the PSMA in prostate cancer cells might similarly alter their cell cycle. The obvious question here would be if this smaller size gives the cells an advantage during starvation or zinc treatment or if this is simply an interesting, but irrelevant by-product of over-producing Psma protein . One way to test for that in yeast would be to examine other mutant strains showing similar size reduction for their response to stressors. A yeast twohybrid analysis against peptides important for cycle progression such as CDC28 (Reed & Wittenberg, 1990) or WIH1 (Russell et al, 1989) could reveal whether any of them interact with Psma, Vps70 or Amp1. Using flow-cytometry to measure DNA content (Sazer & Sherwood, 1990), it might also be possible to characterize the exact phase which is affected by the presence of the protein of interest relative to the parental strain. Since we already know many of the proteins controlling the completion of one phase and initiating the beginning of the next, knowing which phase is most affected could provide us with genes we

143 should begin to study with the methods above. Finding them could in turn open new avenues leading to the design of new strategies which to alter this mechanism towards malignant cell death. In addition to size, as shown in Figure 6.3, extra copies of VPS70, PSMA and AMP1 affect the distribution of the yeast vacuolar dye FM4-64 indicating differences in morphology of this organelle compared to the PS. It appeared that the vacuole was fragmented. It would be interesting to determine whether this increased the overall fusion area able to harvest prodeath components more efficiently. This hypothesis could be further supported by an electron microscopic analysis to directly measure vacuolar surface area. It would also be worthwhile to produce multiple vacuoles in the PS using different concentrations of natamycin (te Welscher et al, 2010) to see if this duplicates the effect that protects cells from zinc, or if Vps70 could still prevent death triggered by zinc or starvation if the vacuole was already split into several parts. The main challenge encountered while running projects described in all chapters was the lack of a suitable florescent reporter that could be used to monitor specifically pro-death or prolife pathway. In chapter 6 it was proposed that PSMA-GFP could be such a marker associated with mechanism leading to cell survival since it was being transported to the vacuole each time cells were living longer in response to the stressor (Figures 6.6 and 6.7). Nonetheless, one could easily argue that because Psma influenced the cell response to the stimuli this is not a proper reporter. Recently, a Japanese group showed that their dKeima GFP chimera can be transported to the lysosome with an autophagy-dependent but autophagosomeindependent manner (Katayama et al, 2011). This could be a potential route of at least one of

144 the pathways I found and thus should be tested both with and without Vps70 (and Psma and Amp1) present in the cell exposed to stress.

145

Figure 7.1. Model describing possible role of Psma in response to Zn2+. Zinc treatment results in cellular damage which induces sequestration of the Psma cytoplasmic protein into specific autophagy vesicles in an Atg11-dependent manner. These vesicles are brought to and fused with the cell vacuole in a process controlled by the Rab protein, Ypt7, activated by Mon1/Ccz1 (Ypt7 GEFs). The presence of Psma in the vacuole membrane in one case triggers the harvesting of the pro-life factor which matures to increase cell life span. Alternatively, Zn2+ treatment induce the formation of a pro-death factor in the cytoplasm which leads to death. Psma in the vacuole membrane activates pathway(s) which sequester this and degrade it in the vacuolar lumen

146

Chapter 8 References

147
Abeliovich H, Darsow T, Emr SD (1999) Cytoplasm to vacuole trafficking of aminopeptidase I requires a t-SNARE-Sec1p complex composed of Tlg2p and Vps45p. Embo J 18: 6005-6016 Abeliovich H, Klionsky DJ (2001) Autophagy in yeast: mechanistic insights and physiological function. Microbiol Mol Biol Rev 65: 463-479. Aita VM, Liang XH, Murty VV, Pincus DL, Yu W, Cayanis E, Kalachikov S, Gilliam TC, Levine B (1999) Cloning and genomic organization of beclin 1, a candidate tumor suppressor gene on chromosome 17q21. Genomics 59: 59-65 Allen C, Bttner S, Aragon AD, Thomas JA, Meirelles O, Jaetao JE, Benn D, Ruby SW, Veenhuis M, Madeo F, Werner-Washburne M (2006) Isolation of quiescent and nonquiescent cells from yeast stationary-phase cultures. J Cell Biol 174: 89-100 Almeida B, Buttner S, Ohlmeier S, Silva A, Mesquita A, Sampaio-Marques B, Osrio NS, Kollau A, Mayer B, Leo C, Laranjinha J, Rodrigues F, Madeo F, Ludovico P (2007) NO-mediated apoptosis in yeast. J Cell Sci 120: 3279-3288 Amarante-Mendes GP, Green DR (1999) The regulation of apoptotic cell death. Braz J Med Biol Res 32: 1053-1061 Amaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, Thomas-Tikhonenko A, Thompson CB (2007) Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced model of lymphoma. J Clin Invest 117: 326-336 Anilkumar G, Barwe SP, Christiansen JJ, Rajasekaran SA, Kohn DB, Rajasekaran AK (2006) Association of prostate-specific membrane antigen with caveolin-1 and its caveolae-dependent internalization in microvascular endothelial cells: implications for targeting to tumor vasculature. Microvasc Res 72: 54-61 Baba M, Osumi M, Scott SV, Klionsky DJ, Ohsumi Y (1997) Two distinct pathways for targeting proteins from the cytoplasm to the vacuole/lysosome. J Cell Biol 139: 1687-1695 Bacich DJ, Ramadan E, O'Keefe DS, Bukhari N, Wegorzewska I, Ojeifo O, Olszewski R, Wrenn CC, Bzdega T, Wroblewska B, Heston WD, Neale JH (2002) Deletion of the glutamate carboxypeptidase II gene in mice reveals a second enzyme activity that hydrolyzes N-acetylaspartylglutamate. J Neurochem 83: 20-29 Bacich DJ, Wozniak KM, Lu XC, O'Keefe DS, Callizot N, Heston WD, Slusher BS (2005) Mice lacking glutamate carboxypeptidase II are protected from peripheral neuropathy and ischemic brain injury. J Neurochem 95: 314-323

148
Banuelos MG, Moreno DE, Olson DK, Nguyen Q, Ricarte F, Aguilera-Sandoval CR, Gharakhanian E (2010) Genomic analysis of severe hypersensitivity to hygromycin B reveals linkage to vacuolar defects and new vacuolar gene functions in Saccharomyces cerevisiae. Curr Genet 56: 121-137 Barinka C, Sacha P, Sklenar J, Man P, Bezouska K, Slusher BS, Konvalinka J (2004) Identification of the N-glycosylation sites on glutamate carboxypeptidase II necessary for proteolytic activity. Protein Sci 13: 1627-1635 Barnhart BC, Alappat EC, Peter ME (2003) The CD95 type I/type II model. Semin Immunol 15: 185193 Barth H, Meiling-Wesse K, Epple UD, Thumm M (2002) Mai1p is essential for maturation of proaminopeptidase I but not for autophagy. FEBS Lett 512: 173-179 Baxter BK, Abeliovich H, Zhang X, Stirling AG, Burlingame AL, Goldfarb DS (2005) Atg19p ubiquitination and the cytoplasm to vacuole trafficking pathway in yeast. J Biol Chem 280: 3906739076 Berry D, Baehrecke E (2007) Growth arrest and autophagy are required for salivary gland cell degradation in Drosophila. Cell 131: 1137-1148 Birnboim HC (1983) A rapid alkaline extraction method for the isolation of plasmid DNA. Methods Enzymol 100: 243-255 Boer VM, Amini S, Botstein D (2008) Influence of genotype and nutrition on survival and metabolism of starving yeast. Proc Natl Acad Sci U S A 105: 6930-6935 Bonangelino CJ, Chavez EM, Bonifacino JS (2002) Genomic screen for vacuolar protein sorting genes in Saccharomyces cerevisiae. Mol Biol Cell 13: 2486-2501 Brace JL, Vanderweele DJ, Rudin CM (2005) Svf1 inhibits reactive oxygen species generation and promotes survival under conditions of oxidative stress in Saccharomyces cerevisiae. Yeast 22: 641652 Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCRmediated gene disruption and other applications. Yeast 14: 115-132 Bugnicourt A, Mari M, Reggiori F, Haguenauer-Tsapis R, Galan JM (2008) Irs4p and Tax4p: two redundant EH domain proteins involved in autophagy. Traffic 9: 755-769

149
Bursch W, Ellinger A, Kienzl H, Torok L, Pandey S, Sikorska M, Walker R, Hermann RS (1996) Active cell death induced by the anti-estrogens tamoxifen and ICI 164 384 in human mammary carcinoma cells (MCF-7) in culture: the role of autophagy. Carcinogenesis 17: 1595-1607 Bush AI, Pettingell WH, Multhaup G, d Paradis M, Vonsattel JP, Gusella JF, Beyreuther K, Masters CL, Tanzi RE (1994) Rapid induction of Alzheimer A beta amyloid formation by zinc. Science 265: 1464-1467 Butler D, Nixon RA, Bahr BA (2006) Potential compensatory responses through autophagic/lysosomal pathways in neurodegenerative diseases. Autophagy 2: 234-237 Buttner S, Bitto A, Ring J, Augsten M, Zabrocki P, Eisenberg T, Jungwirth H, Hutter S, CarmonaGutierrez D, Kroemer G, Winderickx J, Madeo F (2008) Functional mitochondria are required for alpha-synuclein toxicity in aging yeast. J Biol Chem 283: 7554-7560 Buttner S, Eisenberg T, Carmona-Gutierrez D, Ruli D, Knauer H, Ruckenstuhl C, Sigrist C, Wissing S, Kollroser M, Frohlich KU, Sigrist S, Madeo F (2007) Endonuclease G regulates budding yeast life and death. Molecular cell 25: 233-246 Buttner S, Ruli D, Vogtle FN, Galluzzi L, Moitzi B, Eisenberg T, Kepp O, Habernig L, CarmonaGutierrez D, Rockenfeller P, Laun P, Breitenbach M, Khoury C, Frohlich KU, Rechberger G, Meisinger C, Kroemer G, Madeo F (2011) A yeast BH3-only protein mediates the mitochondrial pathway of apoptosis. Embo J 30: 2779-2792 Bttner S, Eisenberg T, Herker E, Carmona-Gutierrez D, Kroemer G, Madeo F (2006) Why yeast cells can undergo apoptosis: death in times of peace, love, and war. J Cell Biol 175: 521-525 Cao Y, Cheong H, Song H, Klionsky DJ (2008) In vivo reconstitution of autophagy in Saccharomyces cerevisiae. J Cell Biol 182: 703-713 Carlson M, Osmond BC, Neigeborn L, Botstein D (1984) A suppressor of SNF1 mutations causes constitutive high-level invertase synthesis in yeast. Genetics 107: 19-32 Carmichael J, Chatellier J, Woolfson A, Milstein C, Fersht AR, Rubinsztein DC (2000) Bacterial and yeast chaperones reduce both aggregate formation and cell death in mammalian cell models of Huntington's disease. Proc Natl Acad Sci U S A 97: 9701-9705 Carmona-Gutierrez D, Eisenberg T, Buttner S, Meisinger C, Kroemer G, Madeo F (2010) Apoptosis in yeast: triggers, pathways, subroutines. Cell death and differentiation 17: 763-773

150
Carter RE, Feldman AR, Coyle JT (1996) Prostate-specific membrane antigen is a hydrolase with substrate and pharmacologic characteristics of a neuropeptidase. Proc Natl Acad Sci U S A 93: 749753 Cavallini G, Donati A, Gori Z, Bergamini E (2008) Towards an understanding of the anti-aging mechanism of caloric restriction. Curr Aging Sci 1: 4-9 Cheng EH, Wei MC, Weiler S, Flavell RA, Mak TW, Lindsten T, Korsmeyer SJ (2001) BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Mol Cell 8: 705-711 Cheong H, Klionsky DJ (2008) Biochemical methods to monitor autophagy-related processes in yeast. Methods Enzymol 451: 1-26 Chera S, Buzgariu W, Ghila L, Galliot B (2009) Autophagy in Hydra: a response to starvation and stress in early animal evolution. Biochim Biophys Acta 1793: 1432-1443 Christiansen JJ, Rajasekaran SA, Inge L, Cheng L, Anilkumar G, Bander NH, Rajasekaran AK (2005) N-glycosylation and microtubule integrity are involved in apical targeting of prostate-specific membrane antigen: implications for immunotherapy. Molecular cancer therapeutics 4: 704-714 Christofferson D, Yuan J (2010) Necroptosis as an alternative form of programmed cell death. Current Opinion in Cell Biology 22: 263-268 Clarke PG (1990) Developmental cell death: morphological diversity and multiple mechanisms. Anat Embryol (Berl) 181: 195-213 Cohen M, Stutz F, Dargemont C (2003) Deubiquitination, a new player in Golgi to endoplasmic reticulum retrograde transport. J Biol Chem 278: 51989-51992 Collawn JF, Lai A, Domingo D, Fitch M, Hatton S, Trowbridge IS (1993) YTRF is the conserved internalization signal of the transferrin receptor, and a second YTRF signal at position 31-34 enhances endocytosis. J Biol Chem 268: 21686-21692 Conway RE, Petrovic N, Li Z, Heston W, Wu D, Shapiro LH (2006) Prostate-specific membrane antigen regulates angiogenesis by modulating integrin signal transduction. Mol Cell Biol 26: 53105324 Cornillon S, Foa C, Davoust J, Buonavista N, Gross JD, Golstein P (1994) Programmed cell death in Dictyostelium. Journal of cell science 107 ( Pt 10): 2691-2704

151
Cross FR (1988) DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mol Cell Biol 8: 4675-4684 Cuervo AM (2010) Chaperone-mediated autophagy: selectivity pays off. Trends Endocrinol Metab 21: 142-150 Davey HM, P. H (2011) Red but not dead? Membranes of stressed Saccharomyces cerevisiae are permeable to propidium iodide. Environ Microbiology 13: 163-171 Davis MI, Bennett MJ, Thomas LM, Bjorkman PJ (2005) Crystal structure of prostate-specific membrane antigen, a tumor marker and peptidase. Proc Natl Acad Sci U S A 102: 5981-5986 De Duve C, Wattiaux R (1966) Functions of lysosomes. Annu Rev Physiol 28: 435-492 de la Lastra C, Villegas I, Sanchez-Fidalgo S (2007) Poly(ADP-ribose) polymerase inhibitors: New pharmacological functions and potential clinical implications. Current Pharmaceutical Design 13: 933-962 Degterev A, Boyce M, Yuan J (2003) A decade of caspases. Oncogene 22: 8543-8567 Degterev A, Hitomi J, Germscheid M, Ch'en I, Korkina O, Teng X, Abbott D, Cuny G, Yuan C, Wagner G, Hedrick S, Gerber S, Lugovskoy A, Yuan J (2008) Identification of RIP1 kinase as a specific cellular target of necrostatins. Nature Chemical Biology 4: 313-321 Degterev A, Huang Z, Boyce M, Li Y, Jagtap P, Mizushima N, Cuny G, Mitchison T, Moskowitz M, Yuan J (2005) Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nature Chemical Biology 1: 112-119 Degterev A, Yuan J (2008) Expansion and evolution of cell death programmes. Nat Rev Mol Cell Biol 9: 378-390 Dice JF (1982) Altered degradation of proteins microinjected into senescent human fibroblasts. J Biol Chem 257: 14624-14627 Dubouloz F, Deloche O, Wanke V, Cameroni E, De Virgilio C (2005a) The TOR and EGO protein complexes orchestrate microautophagy in yeast. Molecular cell 19: 15-26 Dubouloz F, Deloche O, Wanke V, Cameroni E, De Virgilio C (2005b) The TOR and EGO protein complexes orchestrate microautophagy in yeast. Mol Cell 19: 15-26

152
Dziedzic SA, Caplan AB (2011) Identification of autophagy genes participating in zinc-induced necrotic cell death in Saccharomyces cerevisiae. Autophagy 7: 490-500 Ecker N, Mor A, Journo D, Abeliovich H (2010) Induction of autophagic flux by amino acid deprivation is distinct from nitrogen starvation-induced macroautophagy. Autophagy 6: 879-890 Edinger AL, Thompson CB (2004) Death by design: apoptosis, necrosis and autophagy. Curr Opin Cell Biol 16: 663-669 Eisenberg T, Carmona-Gutierrez D, Buttner S, Tavernarakis N, Madeo F (2010a) Necrosis in yeast. Apoptosis 15: 257-268 Eisenberg T, Carmona-Gutierrez D, Bttner S, Tavernarakis N, Madeo F (2010b) Necrosis in yeast. Apoptosis Eisenberg T, Knauer H, Schauer A, Buttner S, Ruckenstuhl C, Carmona-Gutierrez D, Ring J, Schroeder S, Magnes C, Antonacci L, Fussi H, Deszcz L, Hartl R, Schraml E, Criollo A, Megalou E, Weiskopf D, Laun P, Heeren G, Breitenbach M, Grubeck-Loebenstein B, Herker E, Fahrenkrog B, Frohlich KU, Sinner F, Tavernarakis N, Minois N, Kroemer G, Madeo F (2009) Induction of autophagy by spermidine promotes longevity. Nature cell biology 11: 1305-1314 Epple UD, Suriapranata I, Eskelinen EL, Thumm M (2001) Aut5/Cvt17p, a putative lipase essential for disintegration of autophagic bodies inside the vacuole. J Bacteriol 183: 5942-5955 Fabrizio P, Longo VD (2007) The chronological life span of Saccharomyces cerevisiae. Methods Mol Biol 371: 89-95 Farr JC, Manjithaya R, Mathewson RD, Subramani S (2008) PpAtg30 tags peroxisomes for turnover by selective autophagy. Dev Cell 14: 365-376 Fujita N, Yoshimori T (2011) Ubiquitination-mediated autophagy against invading bacteria. Curr Opin Cell Biol 23: 492-497 Furgason ML, MacDonald C, Shanks SG, Ryder SP, Bryant NJ, Munson M (2009) The N-terminal peptide of the syntaxin Tlg2p modulates binding of its closed conformation to Vps45p. Proc Natl Acad Sci U S A 106: 14303-14308 Gagne J, Hunter J, Labrecquet B, Chabot B, Poirier G (2003) A proteomic approach to the identification of heterogeneous nuclear ribonucleoproteins as a new family of poly(ADP-ribose)binding proteins. Biochemical Journal 371: 331-340

153
Ghaemmaghami S, Huh WK, Bower K, Howson RW, Belle A, Dephoure N, O'Shea EK, Weissman JS (2003) Global analysis of protein expression in yeast. Nature 425: 737-741 Ghosh A, Heston WD (2003) Effect of carbohydrate moieties on the folate hydrolysis activity of the prostate specific membrane antigen. Prostate 57: 140-151 Ghosh A, Wang X, Klein E, Heston WD (2005) Novel role of prostate-specific membrane antigen in suppressing prostate cancer invasiveness. Cancer Res 65: 727-731 Giansanti V, Torriglia A, Scovassi AI (2011) Conversation between apoptosis and autophagy: "Is it your turn or mine?". Apoptosis 16: 321-333 Gietz RD, Woods RA (2006) Yeast transformation by the LiAc/SS Carrier DNA/PEG method. Methods Mol Biol 313: 107-120 Girardi JP, Pereira L, Bakovic M (2011) De novo synthesis of phospholipids is coupled with autophagosome formation. Med Hypotheses 77: 1083-1087 Golstein P, Kroemer G (2007) Cell death by necrosis: towards a molecular definition. Trends in biochemical sciences 32: 37-43 Gonzalez-Polo RA, Boya P, Pauleau AL, Jalil A, Larochette N, Souquere S, Eskelinen EL, Pierron G, Saftig P, Kroemer G (2005) The apoptosis/autophagy paradox: autophagic vacuolization before apoptotic death. Journal of cell science 118: 3091-3102 Gonzalvez F, Ashkenazi A (2010) New insights into apoptosis signaling by Apo2L/TRAIL. Oncogene 29: 4752-4765 Gottlicher M, Minucci S, Zhu P, Kramer OH, Schimpf A, Giavara S, Sleeman JP, Lo Coco F, Nervi C, Pelicci PG, Heinzel T (2001) Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. Embo J 20: 6969-6978 Griffiths J, Barrero JM, Taylor J, Helliwell CA, Gubler F (2011) ALTERED MERISTEM PROGRAM 1 is involved in development of seed dormancy in Arabidopsis. PLoS One 6: e20408 Grunau S, Lay D, Mindthoff S, Platta HW, Girzalsky W, Just WW, Erdmann R (2011) The phosphoinositide 3-kinase Vps34p is required for pexophagy in Saccharomyces cerevisiae. Biochem J 434: 161-170 Hamasaki M, Noda T, Baba M, Ohsumi Y (2005) Starvation triggers the delivery of the endoplasmic reticulum to the vacuole via autophagy in yeast. Traffic 6: 56-65

154

Hamatake M, Iguchi K, Hirano K, Ishida R (2000) Zinc induces mixed types of cell death, necrosis, and apoptosis, in molt-4 cells. Journal of biochemistry 128: 933-939 Han L, Picker JD, Schaevitz LR, Tsai G, Feng J, Jiang Z, Chu HC, Basu AC, Berger-Sweeney J, Coyle JT (2009) Phenotypic characterization of mice heterozygous for a null mutation of glutamate carboxypeptidase II. Synapse 63: 625-635 Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557580 Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N (2008) FIP200, a ULKinteracting protein, is required for autophagosome formation in mammalian cells. J Cell Biol 181: 497-510 Harding TM, Hefner-Gravink A, Thumm M, Klionsky DJ (1996) Genetic and phenotypic overlap between autophagy and the cytoplasm to vacuole protein targeting pathway. J Biol Chem 271: 1762117624 Harding TM, Morano KA, Scott SV, Klionsky DJ (1995a) Isolation and characterization of yeast mutants in the cytoplasm to vacuole protein targeting pathway. J Cell Biol 131: 591-602 Harding TM, Morano KA, Scott SV, Klionsky DJ (1995b) Isolation and characterization of yeast mutants in the cytoplasm to vacuole protein targeting pathway. J Cell Biol 131: 591-602 Hatsugai N, Kuroyanagi M, Yamada K, Meshi T, Tsuda S, Kondo M, Nishimura M, Hara-Nishimura I (2004) A plant vacuolar protease, VPE, mediates virus-induced hypersensitive cell death. Science 305: 855-858 He C, Klionsky DJ (2009) Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet 43: 67-93 He ZL, Yang XE, Stoffella PJ (2005) Trace elements in agroecosystems and impacts on the environment. J Trace Elem Med Biol 19: 125-140 Heath MC (2000) Hypersensitive response-related death. Plant Mol Biol 44: 321-334 Hedgecock EM, Sulston JE, Thomson JN (1983) Mutations affecting programmed cell deaths in the nematode Caenorhabditis elegans. Science 220: 1277-1279

155
Helliwell CA, Chin-Atkins AN, Wilson IW, Chapple R, Dennis ES, Chaudhury A (2001) The Arabidopsis AMP1 gene encodes a putative glutamate carboxypeptidase. Plant Cell 13: 2115-2125 Hettema EH, Lewis MJ, Black MW, Pelham HR (2003) Retromer and the sorting nexins Snx4/41/42 mediate distinct retrieval pathways from yeast endosomes. Embo J 22: 548-557 Ho MS, Ou C, Chan YR, Chien CT, Pi H (2008) The utility F-box for protein destruction. Cell Mol Life Sci 65: 1977-2000 Hofius D, Schultz-Larsen T, Joensen J, Tsitsigiannis DI, Petersen NH, Mattsson O, Jorgensen LB, Jones JD, Mundy J, Petersen M (2009) Autophagic components contribute to hypersensitive cell death in Arabidopsis. Cell 137: 773-783 Horvitz HR, Shaham S, Hengartner MO (1994) The genetics of programmed cell death in the nematode Caenorhabditis elegans. Cold Spring Harb Symp Quant Biol 59: 377-385 Hothorn M, Neumann H, Lenherr ED, Wehner M, Rybin V, Hassa PO, Uttenweiler A, Reinhardt M, Schmidt A, Seiler J, Ladurner AG, Herrmann C, Scheffzek K, Mayer A (2009) Catalytic core of a membrane-associated eukaryotic polyphosphate polymerase. Science 324: 513-516 Huang D, Moffat J, Andrews B (2002) Dissection of a complex phenotype by functional genomics reveals roles for the yeast cyclin-dependent protein kinase Pho85 in stress adaptation and cell integrity. Mol Cell Biol 22: 5076-5088 Huang WP, Scott SV, Kim J, Klionsky DJ (2000) The itinerary of a vesicle component, Aut7p/Cvt5p, terminates in the yeast vacuole via the autophagy/Cvt pathways. J Biol Chem 275: 5845-5851 Hutchins MU, Klionsky DJ (2001) Vacuolar localization of oligomeric alpha-mannosidase requires the cytoplasm to vacuole targeting and autophagy pathway components in Saccharomyces cerevisiae. J Biol Chem 276: 20491-20498 Israeli RS, Powell CT, Corr JG, Fair WR, Heston WD (1994) Expression of the prostate-specific membrane antigen. Cancer Res 54: 1807-1811 Israeli RS, Powell CT, Fair WR, Heston WD (1993) Molecular cloning of a complementary DNA encoding a prostate-specific membrane antigen. Cancer Res 53: 227-230 Iwata A, Christianson JC, Bucci M, Ellerby LM, Nukina N, Forno LS, Kopito RR (2005) Increased susceptibility of cytoplasmic over nuclear polyglutamine aggregates to autophagic degradation. Proc Natl Acad Sci U S A 102: 13135-13140

156
Jimenez-Sanchez M, Thompson F, Zavodsky E, Rubinsztein DC (2011) Autophagy and polyglutamine diseases. Prog Neurobiol Jin YH, Dunlap PE, McBride SJ, Al-Refai H, Bushel PR, Freedman JH (2008) Global transcriptome and deletome profiles of yeast exposed to transition metals. PLoS genetics 4: e1000053 Johansen T, Lamark T (2011) Selective autophagy mediated by autophagic adapter proteins. Autophagy 7: 279-296 Jorgensen P, Nishikawa JL, Breitkreutz BJ, Tyers M (2002) Systematic identification of pathways that couple cell growth and division in yeast. Science 297: 395-400 Juhsz G, Csiks G, Sinka R, Erdlyi M, Sass M (2003) The Drosophila homolog of Aut1 is essential for autophagy and development. FEBS Lett 543: 154-158 Juhsz G, Erdi B, Sass M, Neufeld TP (2007) Atg7-dependent autophagy promotes neuronal health, stress tolerance, and longevity but is dispensable for metamorphosis in Drosophila. Genes Dev 21: 3061-3066 Jungwirth H, Ring J, Mayer T, Schauer A, Buttner S, Eisenberg T, Carmona-Gutierrez D, Kuchler K, Madeo F (2008) Loss of peroxisome function triggers necrosis. FEBS Lett 582: 2882-2886 Kageyama T, Suzuki K, Ohsumi Y (2009) Lap3 is a selective target of autophagy in yeast, Saccharomyces cerevisiae. Biochem Biophys Res Commun 378: 551-557 Kamada Y, Funakoshi T, Shintani T, Nagano K, Ohsumi M, Ohsumi Y (2000) Tor-mediated induction of autophagy via an Apg1 protein kinase complex. J Cell Biol 150: 1507-1513 Kamizono A, Nishizawa M, Teranishi Y, Murata K, Kimura A (1989) Identification of a gene conferring resistance to zinc and cadmium ions in the yeast Saccharomyces cerevisiae. Mol Gen Genet 219: 161-167 Kang C, Avery L (2008) To be or not to be, the level of autophagy is the question: dual roles of autophagy in the survival response to starvation. Autophagy 4: 82-84 Kanki T, Klionsky DJ (2008) Mitophagy in yeast occurs through a selective mechanism. J Biol Chem 283: 32386-32393 Kanki T, Wang K, Baba M, Bartholomew CR, Lynch-Day MA, Du Z, Geng J, Mao K, Yang Z, Yen WL, Klionsky DJ (2009) A genomic screen for yeast mutants defective in selective mitochondria autophagy. Mol Biol Cell 20: 4730-4738

157

Katayama H, Kogure T, Mizushima N, Yoshimori T, Miyawaki A (2011) A sensitive and quantitative technique for detecting autophagic events based on lysosomal delivery. Chem Biol 18: 1042-1052 Kawakatsu T, Taramino G, Itoh J, Allen J, Sato Y, Hong SK, Yule R, Nagasawa N, Kojima M, Kusaba M, Sakakibara H, Sakai H, Nagato Y (2009) PLASTOCHRON3/GOLIATH encodes a glutamate carboxypeptidase required for proper development in rice. Plant J 58: 1028-1040 Kawamata T, Kamada Y, Kabeya Y, Sekito T, Ohsumi Y (2008) Organization of the preautophagosomal structure responsible for autophagosome formation. Mol Biol Cell 19: 2039-2050 Kerr JF (1971) Shrinkage necrosis: a distinct mode of cellular death. J Pathol 105: 13-20 Kerr JF, Wyllie AH, Currie AR (1972) Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26: 239-257 Kim CH, Jeon HM, Lee SY, Jeong EK, Ju MK, Park BJ, Park HG, Lim SC, Han SI, Kang HS (2010) Role of reactive oxygen species-dependent protein aggregation in metabolic stress-induced necrosis. Int J Oncol 37: 97-102 Kim J, Huang WP, Klionsky DJ (2001a) Membrane recruitment of Aut7p in the autophagy and cytoplasm to vacuole targeting pathways requires Aut1p, Aut2p, and the autophagy conjugation complex. J Cell Biol 152: 51-64 Kim J, Kamada Y, Stromhaug PE, Guan J, Hefner-Gravink A, Baba M, Scott SV, Ohsumi Y, Dunn WA, Klionsky DJ (2001b) Cvt9/Gsa9 functions in sequestering selective cytosolic cargo destined for the vacuole. J Cell Biol 153: 381-396 Kim J, Scott SV, Oda MN, Klionsky DJ (1997a) Transport of a large oligomeric protein by the cytoplasm to vacuole protein targeting pathway. J Cell Biol 137: 609-618 Kim J, Scott SV, Oda MN, Klionsky DJ (1997b) Transport of a large oligomeric protein by the cytoplasm to vacuole protein targeting pathway. J Cell Biol 137: 609-618 Kirisako T, Baba M, Ishihara N, Miyazawa K, Ohsumi M, Yoshimori T, Noda T, Ohsumi Y (1999) Formation process of autophagosome is traced with Apg8/Aut7p in yeast. J Cell Biol 147: 435-446 Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, Ohsumi M, Takao T, Noda T, Ohsumi Y (2000) The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol 151: 263-276

158

Klionsky DJ (2005) The molecular machinery of autophagy: unanswered questions. J Cell Sci 118: 718 Klionsky DJ, Codogno P, Cuervo AM, Deretic V, Elazar Z, Fueyo-Margareto J, Gewirtz DA, Kroemer G, Levine B, Mizushima N, Rubinsztein DC, Thumm M, Tooze SA (2010) A comprehensive glossary of autophagy-related molecules and processes. Autophagy 6 Klionsky DJ, Cueva R, Yaver DS (1992) Aminopeptidase I of Saccharomyces cerevisiae is localized to the vacuole independent of the secretory pathway. J Cell Biol 119: 287-299 Klosinska MM, Crutchfield CA, Bradley PH, Rabinowitz JD, Broach JR (2011) Yeast cells can access distinct quiescent states. Genes Dev 25: 336-349 Komatsu M, Ichimura Y (2010) Selective autophagy regulates various cellular functions. Genes Cells 15: 923-933 Kosta A, Roisin-Bouffay C, Luciani MF, Otto GP, Kessin RH, Golstein P (2004) Autophagy gene disruption reveals a non-vacuolar cell death pathway in Dictyostelium. J Biol Chem 279: 4840448409 Kraft C, Deplazes A, Sohrmann M, Peter M (2008) Mature ribosomes are selectively degraded upon starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease. Nature cell biology 10: 602-610 Kraft C, Reggiori F, Peter M (2009) Selective types of autophagy in yeast. Biochim Biophys Acta 1793: 1404-1412 Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES, Baehrecke EH, Blagosklonny MV, El-Deiry WS, Golstein P, Green DR, Hengartner M, Knight RA, Kumar S, Lipton SA, Malorni W, Nunez G, Peter ME, Tschopp J, Yuan J, Piacentini M, Zhivotovsky B, Melino G (2009) Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009. Cell death and differentiation 16: 3-11 Kroemer G, Levine B (2008) Autophagic cell death: the story of a misnomer. Nat Rev Mol Cell Biol 9: 1004-1010 Kuma A, Hatano M, Matsui M, Yamamoto A, Nakaya H, Yoshimori T, Ohsumi Y, Tokuhisa T, Mizushima N (2004) The role of autophagy during the early neonatal starvation period. Nature 432: 1032-1036

159
Kunz JB, Schwarz H, Mayer A (2004) Determination of four sequential stages during microautophagy in vitro. J Biol Chem 279: 9987-9996 Kvam E, Goldfarb DS (2004) Nvj1p is the outer-nuclear-membrane receptor for oxysterol-binding protein homolog Osh1p in Saccharomyces cerevisiae. J Cell Sci 117: 4959-4968 Kwon S, Cho H, Jung J, Yoshimoto K, Shirasu K, Park O (2010) The Rab GTPase RabG3b functions in autophagy and contributes to tracheary element differentiation in Arabidopsis. Plant Journal 64: 151-164 Lambert LA (2011) Molecular evolution of the transferrin family and associated receptors. Biochim Biophys Acta Lambert LA, Mitchell SL (2007) Molecular evolution of the transferrin receptor/glutamate carboxypeptidase II family. Journal of molecular evolution 64: 113-128 Lang T, Schaeffeler E, Bernreuther D, Bredschneider M, Wolf DH, Thumm M (1998) Aut2p and Aut7p, two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to the vacuole. Embo J 17: 3597-3607 Laun P, Pichova A, Madeo F, Fuchs J, Ellinger A, Kohlwein S, Dawes I, Frhlich KU, Breitenbach M (2001) Aged mother cells of Saccharomyces cerevisiae show markers of oxidative stress and apoptosis. Mol Microbiol 39: 1166-1173 Lee C, Cooksey B, Baehrecke E (2002) Steroid regulation of midgut cell death during Drosophila development. Developmental Biology 250: 101-111 Lee CY, Baehrecke EH (2001) Steroid regulation of autophagic programmed cell death during development. Development 128: 1443-1455 Levine B, Kroemer G (2009) Autophagy in aging, disease and death: the true identity of a cell death impostor. Cell death and differentiation 16: 1-2 Li H, Zhu H, Xu CJ, Yuan J (1998) Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94: 491-501 Li W, Yang Q, Mao Z (2011) Chaperone-mediated autophagy: machinery, regulation and biological consequences. Cell Mol Life Sci 68: 749-763 Liang Q, Zhou B (2007) Copper and manganese induce yeast apoptosis via different pathways. Mol Biol Cell 18: 4741-4749

160

Lipinski M, Zheng B, Lu T, Yan Z, Py B, Ng A, Xavier R, Li C, Yankner B, Scherzer C, Yuan J (2010) Genome-wide analysis reveals mechanisms modulating autophagy in normal brain aging and in Alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America 107: 14164-14169 Liu XF, Supek F, Nelson N, Culotta VC (1997) Negative control of heavy metal uptake by the Saccharomyces cerevisiae BSD2 gene. J Biol Chem 272: 11763-11769 Liu XH, Liu TB, Lin FC (2008) Monitoring autophagy in Magnaporthe oryzae. Methods Enzymol 451: 271-294 Luciani M, Giusti C, Harms B, Oshima Y, Kikuchi H, Kubohara Y, Golstein P (2011) Atg1 allows second-signaled autophagic cell death in Dictyostelium. Autophagy 7: 501-508 Ludovico P, Sousa MJ, Silva MT, Leao C, Corte-Real M (2001a) Saccharomyces cerevisiae commits to a programmed cell death process in response to acetic acid. Microbiology 147: 2409-2415 Ludovico P, Sousa MJ, Silva MT, Leo C, Crte-Real M (2001b) Saccharomyces cerevisiae commits to a programmed cell death process in response to acetic acid. Microbiology 147: 2409-2415 Luria SE, Adams JN, Ting RC (1960) Transduction of lactose-utilizing ability among strains of E. coli and S. dysenteriae and the properties of the transducing phage particles. Virology 12: 348-390 Lynch-Day MA, Klionsky DJ (2010) The Cvt pathway as a model for selective autophagy. FEBS Lett 584: 1359-1366 Ma H, Kunes S, Schatz PJ, Botstein D (1987) Plasmid construction by homologous recombination in yeast. Gene 58: 201-216 Madeo F, Frohlich E, Frohlich KU (1997a) A yeast mutant showing diagnostic markers of early and late apoptosis. J Cell Biol 139: 729-734 Madeo F, Frhlich E, Frhlich KU (1997b) A yeast mutant showing diagnostic markers of early and late apoptosis. J Cell Biol 139: 729-734 Madeo F, Frhlich E, Ligr M, Grey M, Sigrist SJ, Wolf DH, Frhlich KU (1999) Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol 145: 757-767 Madeo F, Frhlich KU (2008) Apoptosis in yeast. Preface. Biochim Biophys Acta 1783: 1271

161

Madeo F, Herker E, Maldener C, Wissing S, Lachelt S, Herlan M, Fehr M, Lauber K, Sigrist SJ, Wesselborg S, Frohlich KU (2002) A caspase-related protease regulates apoptosis in yeast. Molecular cell 9: 911-917 Magda D, Lecane P, Wang Z, Hu W, Thiemann P, Ma X, Dranchak PK, Wang X, Lynch V, Wei W, Csokai V, Hacia JG, Sessler JL (2008) Synthesis and anticancer properties of water-soluble zinc ionophores. Cancer Res 68: 5318-5325 Majeski AE, Dice JF (2004) Mechanisms of chaperone-mediated autophagy. Int J Biochem Cell Biol 36: 2435-2444 Manev H, Favaron M, Guidotti A, Costa E (1989) Delayed increase of Ca2+ influx elicited by glutamate: role in neuronal death. Mol Pharmacol 36: 106-112 Maniatis T, Fritsch E, Sambrook D (1982) Molecular cloning: a laboratory manual, New York: Cold Spring Harbor. Manjithaya R, Nazarko TY, Farr JC, Subramani S (2010) Molecular mechanism and physiological role of pexophagy. FEBS Lett 584: 1367-1373 Massey AC, Kaushik S, Sovak G, Kiffin R, Cuervo AM (2006) Consequences of the selective blockage of chaperone-mediated autophagy. Proc Natl Acad Sci U S A 103: 5805-5810 Mathew R, Kongara S, Beaudoin B, Karp C, Bray K, Degenhardt K, Chen G, Jin S, White E (2007) Autophagy suppresses tumor progression by limiting chromosomal instability (vol 21, pg 1367, 2007). Genes & Development 21: 1701-1701 Mathew R, White E (2007) Why sick cells produce tumors: the protective role of autophagy. Autophagy 3: 502-505 Matsumura H, Shimizu Y, Ohsawa Y, Kawahara A, Uchiyama Y, Nagata S (2000) Necrotic death pathway in Fas receptor signaling. Journal of Cell Biology 151: 1247-1255 Matsuura A, Tsukada M, Wada Y, Ohsumi Y (1997) Apg1p, a novel protein kinase required for the autophagic process in Saccharomyces cerevisiae. Gene 192: 245-250 Mayer A (2008) CELL-FREE RECONSTITUTION OF MICROAUTOPHAGY IN YEAST. Autophagy: Lower Eukaryotes and Non-Mammalian Systems, Pt a 451: 151-162

162
Meiling-Wesse K, Bratsika F, Thumm M (2004) ATG23, a novel gene required for maturation of proaminopeptidase I, but not for autophagy. FEMS Yeast Res 4: 459-465 Meiling-Wesse K, Epple UD, Krick R, Barth H, Appelles A, Voss C, Eskelinen EL, Thumm M (2005) Trs85 (Gsg1), a component of the TRAPP complexes, is required for the organization of the preautophagosomal structure during selective autophagy via the Cvt pathway. J Biol Chem 280: 33669-33678 Meriin AB, Zhang X, He X, Newnam GP, Chernoff YO, Sherman MY (2002) Huntington toxicity in yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1. J Cell Biol 157: 997-1004 Metzstein MM, Stanfield GM, Horvitz HR (1998) Genetics of programmed cell death in C. elegans: past, present and future. Trends Genet 14: 410-416 Micheau O, Tschopp J (2003) Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114: 181-190 Mijaljica D, Prescott M, Devenish RJ (2006) Endoplasmic reticulum and Golgi complex: Contributions to, and turnover by, autophagy. Traffic 7: 1590-1595 Mijaljica D, Prescott M, Devenish RJ (2011) Microautophagy in mammalian cells: revisiting a 40year-old conundrum. Autophagy 7: 673-682 Mitsui K, Nakagawa D, Nakamura M, Okamoto T, Tsurugi K (2005) Valproic acid induces apoptosis dependent of Yca1p at concentrations that mildly affect the proliferation of yeast. FEBS Lett 579: 723-727 Miyabe S, Izawa S, Inoue Y (2001) The Zrc1 is involved in zinc transport system between vacuole and cytosol in Saccharomyces cerevisiae. Biochem Biophys Res Commun 282: 79-83 Mizushima N, Levine B, Cuervo AM, Klionsky DJ (2008) Autophagy fights disease through cellular self-digestion. Nature 451: 1069-1075 Mizushima N, Noda T, Yoshimori T, Tanaka Y, Ishii T, George MD, Klionsky DJ, Ohsumi M, Ohsumi Y (1998) A protein conjugation system essential for autophagy. Nature 395: 395-398 Mohseni N, McMillan S, Chaudhary R, Mok J, Reed B (2009) Autophagy promotes caspasedependent cell death during Drosophila development. Autophagy 5: 329-338

163
Mortimore GE, Schworer CM (1977) Induction of autophagy by amino-acid deprivation in perfused rat liver. Nature 270: 174-176 Moskowitz M, Lo E, Iadecola C (2010) The Science of Stroke: Mechanisms in Search of Treatments. Neuron 67: 181-198 Muller O, Sattler T, Flotenmeyer M, Schwarz H, Plattner H, Mayer A (2000) Autophagic tubes: Vacuolar invaginations involved in lateral membrane sorting and inverse vesicle budding. Journal of Cell Biology 151: 519-528 Mutsuddi M, Nambu JR (1998) Neural disease: Drosophila degenerates for a good cause. Curr Biol 8: R809-811 Nargund AM, Avery SV, Houghton JE (2008) Cadmium induces a heterogeneous and caspasedependent apoptotic response in Saccharomyces cerevisiae. Apoptosis 13: 811-821 Nazarko TY, Farre JC, Subramani S (2009) Peroxisome size provides insights into the function of autophagy-related proteins. Mol Biol Cell 20: 3828-3839 Neale JH, Olszewski RT, Zuo D, Janczura KJ, Profaci CP, Lavin KM, Madore JC, Bzdega T (2011) Advances in understanding the peptide neurotransmitter NAAG and appearance of a new member of the NAAG neuropeptide family. J Neurochem 118: 490-498 Nice DC, Sato TK, Stromhaug PE, Emr SD, Klionsky DJ (2002) Cooperative binding of the cytoplasm to vacuole targeting pathway proteins, Cvt13 and Cvt20, to phosphatidylinositol 3phosphate at the pre-autophagosomal structure is required for selective autophagy. J Biol Chem 277: 30198-30207 Nicotera P, Leist M, Manzo L (1999) Neuronal cell death: a demise with different shapes. Trends Pharmacol Sci 20: 46-51 Nicotera P, Lipton SA (1999) Excitotoxins in neuronal apoptosis and necrosis. J Cereb Blood Flow Metab 19: 583-591 Nishida K, Kyoi S, Yamaguchi O, Sadoshima J, Otsu K (2009) The role of autophagy in the heart. Cell death and differentiation 16: 31-38 Noda NN, Kumeta H, Nakatogawa H, Satoo K, Adachi W, Ishii J, Fujioka Y, Ohsumi Y, Inagaki F (2008) Structural basis of target recognition by Atg8/LC3 during selective autophagy. Genes Cells 13: 1211-1218

164
Noda T, Kim J, Huang WP, Baba M, Tokunaga C, Ohsumi Y, Klionsky DJ (2000) Apg9p/Cvt7p is an integral membrane protein required for transport vesicle formation in the Cvt and autophagy pathways. J Cell Biol 148: 465-480 Noda T, Ohsumi Y (1998) Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J Biol Chem 273: 3963-3966 Nordmann M, Cabrera M, Perz A, Brocker C, Ostrowicz C, Engelbrecht-Vandre S, Ungermann C (2010a) The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Curr Biol 20: 1654-1659 Nordmann M, Cabrera M, Perz A, Brcker C, Ostrowicz C, Engelbrecht-Vandr S, Ungermann C (2010b) The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Curr Biol 20: 1654-1659 NOVIKOFF AB, ESSNER E, QUINTANA N (1964) GOLGI APPARATUS AND LYSOSOMES. Fed Proc 23: 1010-1022 Nussenbaum F, Herman IM (2010) Tumor angiogenesis: insights and innovations. J Oncol 2010: 132641 Oei S, Keil C, Ziegler M (2005) Poly(ADP-ribosylation) and genomic stability. Biochemistry and Cell Biology-Biochimie Et Biologie Cellulaire 83: 263-269 Okamoto K, Kondo-Okamoto N, Ohsumi Y (2009) Mitochondria-anchored receptor Atg32 mediates degradation of mitochondria via selective autophagy. Dev Cell 17: 87-97 Orenstein SJ, Cuervo AM (2010) Chaperone-mediated autophagy: molecular mechanisms and physiological relevance. Semin Cell Dev Biol 21: 719-726 Ossareh-Nazari B, Bonizec M, Cohen M, Dokudovskaya S, Delalande F, Schaeffer C, Van Dorsselaer A, Dargemont C (2010) Cdc48 and Ufd3, new partners of the ubiquitin protease Ubp3, are required for ribophagy. EMBO Rep 11: 548-554 Pagani MA, Casamayor A, Serrano R, Atrian S, Arino J (2007) Disruption of iron homeostasis in Saccharomyces cerevisiae by high zinc levels: a genome-wide study. Mol Microbiol 65: 521-537 Page N, Sheraton J, Brown JL, Stewart RC, Bussey H (1996) Identification of ASK10 as a multicopy activator of Skn7p-dependent transcription of a HIS3 reporter gene. Yeast 12: 267-272

165
Pankiv S, Clausen TH, Lamark T, Brech A, Bruun JA, Outzen H, vervatn A, Bjrky G, Johansen T (2007) p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282: 24131-24145 Petranovic D, Tyo K, Vemuri GN, Nielsen J (2010) Prospects of yeast systems biology for human health: integrating lipid, protein and energy metabolism. FEMS Yeast Res 10: 1046-1059 Pinto JT, Suffoletto BP, Berzin TM, Qiao CH, Lin S, Tong WP, May F, Mukherjee B, Heston WD (1996) Prostate-specific membrane antigen: a novel folate hydrolase in human prostatic carcinoma cells. Clin Cancer Res 2: 1445-1451 Polcic P, Forte M (2003) Response of yeast to the regulated expression of proteins in the Bcl-2 family. Biochem J 374: 393-402 Polupanov AS, Nazarko VY, Sibirny AA (2011) CCZ1, MON1 and YPT7 genes are involved in pexophagy, the Cvt pathway and non-specific macroautophagy in the methylotrophic yeast Pichia pastoris. Cell Biol Int 35: 311-319 Price DL, Sisodia SS, Borchelt DR (1998) Genetic neurodegenerative diseases: the human illness and transgenic models. Science 282: 1079-1083 Prick T, Thumm M, Kohrer K, Haussinger D, Vom Dahl S (2006) In yeast, loss of Hog1 leads to osmosensitivity of autophagy. Biochem J 394: 153-161 Puchkov EO (2010) Brownian motion of polyphosphate complexes in yeast vacuoles: characterization by fluorescence microscopy with image analysis. Yeast 27: 309-315 Qu X, Yu J, Bhagat G, Furuya N, Hibshoosh H, Troxel A, Rosen J, Eskelinen E, Mizushima N, Ohsumi Y, Cattoretti G, Levine B (2003) Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. Journal of Clinical Investigation 112: 1809-1820 Rajasekaran AK, Anilkumar G, Christiansen JJ (2005) Is prostate-specific membrane antigen a multifunctional protein? Am J Physiol Cell Physiol 288: C975-981 Rajasekaran SA, Christiansen JJ, Schmid I, Oshima E, Ryazantsev S, Sakamoto K, Weinstein J, Rao NP, Rajasekaran AK (2008) Prostate-specific membrane antigen associates with anaphase-promoting complex and induces chromosomal instability. Molecular cancer therapeutics 7: 2142-2151 Ramer SW, Elledge SJ, Davis RW (1992) Dominant genetics using a yeast genomic library under the control of a strong inducible promoter. Proc Natl Acad Sci U S A 89: 11589-11593

166
Ravikumar B, Vacher C, Berger Z, Davies J, Luo S, Oroz L, Scaravilli F, Easton D, Duden R, O'Kane C, Rubinsztein D (2004) Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nature Genetics 36: 585595 Reddig PJ, Juliano RL (2005) Clinging to life: cell to matrix adhesion and cell survival. Cancer Metastasis Rev 24: 425-439 Reed SI, Wittenberg C (1990) Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 87: 5697-5701 Reggiori F, Pelham HR (2002) A transmembrane ubiquitin ligase required to sort membrane proteins into multivesicular bodies. Nature cell biology 4: 117-123 Richman TJ, Johnson DI (2000) Saccharomyces cerevisiae cdc42p GTPase is involved in preventing the recurrence of bud emergence during the cell cycle. Mol Cell Biol 20: 8548-8559 Roberts P, Moshitch-Moshkovitz S, Kvam E, O'Toole E, Winey M, Goldfarb DS (2003) Piecemeal microautophagy of nucleus in Saccharomyces cerevisiae. Mol Biol Cell 14: 129-141 Robinson JS, Klionsky DJ, Banta LM, Emr SD (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8: 4936-4948 Rosado CJ, Mijaljica D, Hatzinisiriou I, Prescott M, Devenish RJ (2008) Rosella: a fluorescent pHbiosensor for reporting vacuolar turnover of cytosol and organelles in yeast. Autophagy 4: 205-213 Rouleau M, Patel A, Hendzel MJ, Kaufmann SH, Poirier GG (2010) PARP inhibition: PARP1 and beyond. Nat Rev Cancer 10: 293-301 Russell P, Moreno S, Reed SI (1989) Conservation of mitotic controls in fission and budding yeasts. Cell 57: 295-303 Saibo NJ, Vriezen WH, De Grauwe L, Azmi A, Prinsen E, Van der Straeten D (2007) A comparative analysis of the Arabidopsis mutant amp1-1 and a novel weak amp1 allele reveals new functions of the AMP1 protein. Planta 225: 831-842 Samara C, Syntichaki P, Tavernarakis N (2008) Autophagy is required for necrotic cell death in Caenorhabditis elegans. Cell death and differentiation 15: 105-112

167
Sambade M, Alba M, Smardon AM, West RW, Kane PM (2005) A genomic screen for yeast vacuolar membrane ATPase mutants. Genetics 170: 1539-1551 Sarkar S, Ravikumar B, Floto RA, Rubinsztein DC (2009) Rapamycin and mTOR-independent autophagy inducers ameliorate toxicity of polyglutamine-expanded huntingtin and related proteinopathies. Cell death and differentiation 16: 46-56 Sarry JE, Chen S, Collum RP, Liang S, Peng M, Lang A, Naumann B, Dzierszinski F, Yuan CX, Hippler M, Rea PA (2007) Analysis of the vacuolar luminal proteome of Saccharomyces cerevisiae. FEBS J 274: 4287-4305 Sattler T, Mayer A (2000) Cell-free reconstitution of microautophagic vacuole invagination and vesicle formation. Journal of Cell Biology 151: 529-538 Sazer S, Sherwood SW (1990) Mitochondrial growth and DNA synthesis occur in the absence of nuclear DNA replication in fission yeast. J Cell Sci 97 ( Pt 3): 509-516 Schroder LA, Ortiz MV, Dunn WA (2008) The membrane dynamics of pexophagy are influenced by Sar1p in Pichia pastoris. Mol Biol Cell 19: 4888-4899 Schulke N, Varlamova OA, Donovan GP, Ma D, Gardner JP, Morrissey DM, Arrigale RR, Zhan C, Chodera AJ, Surowitz KG, Maddon PJ, Heston WD, Olson WC (2003) The homodimer of prostatespecific membrane antigen is a functional target for cancer therapy. Proc Natl Acad Sci U S A 100: 12590-12595 Schulze-Osthoff K, Ferrari D, Los M, Wesselborg S, Peter ME (1998) Apoptosis signaling by death receptors. Eur J Biochem 254: 439-459 SCHWEICH.JU, MERKER H (1973) MORPHOLOGY OF VARIOUS TYPES OF CELL DEATH IN PRENATAL TISSUES. Teratology 7: 253-266 Schweichel JU, Merker HJ (1973) The morphology of various types of cell death in prenatal tissues. Teratology 7: 253-266 Schworer CM, Mortimore GE (1979) Glucagon-induced autophagy and proteolysis in rat liver: mediation by selective deprivation of intracellular amino acids. Proc Natl Acad Sci U S A 76: 31693173 Scorrano L, Korsmeyer SJ (2003) Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem Biophys Res Commun 304: 437-444

168
Scott RC, Juhsz G, Neufeld TP (2007) Direct induction of autophagy by Atg1 inhibits cell growth and induces apoptotic cell death. Curr Biol 17: 1-11 Scott SV, Guan J, Hutchins MU, Kim J, Klionsky DJ (2001) Cvt19 is a receptor for the cytoplasm-tovacuole targeting pathway. Mol Cell 7: 1131-1141 Scott SV, Hefner-Gravink A, Morano KA, Noda T, Ohsumi Y, Klionsky DJ (1996) Cytoplasm-tovacuole targeting and autophagy employ the same machinery to deliver proteins to the yeast vacuole. Proc Natl Acad Sci U S A 93: 12304-12308 Sheen JH, Zoncu R, Kim D, Sabatini DM (2011) Defective regulation of autophagy upon leucine deprivation reveals a targetable liability of human melanoma cells in vitro and in vivo. Cancer Cell 19: 613-628 Shen H, Codogno P (2011) Autophagic cell death Loch Ness monster or endangered species? Autophagy 7: 457-465 Shen S, Kepp O, Kroemer G. (2011a) The end of autophagic cell death? Autophagy, Vol. 7. Shen S, Kepp O, Michaud M, Martins I, Minoux H, Mtivier D, Maiuri MC, Kroemer RT, Kroemer G (2011b) Association and dissociation of autophagy, apoptosis and necrosis by systematic chemical study. Oncogene 30: 4544-4556 Shimizu S, Kanaseki T, Mizushima N, Mizuta T, Arakawa-Kobayashi S, Thompson C, Tsujimoto Y (2004) Role of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on autophagy genes. Nature Cell Biology 6: 1221-1228 Shin DM, Jeon BY, Lee HM, Jin HS, Yuk JM, Song CH, Lee SH, Lee ZW, Cho SN, Kim JM, Friedman RL, Jo EK (2010) Mycobacterium tuberculosis eis regulates autophagy, inflammation, and cell death through redox-dependent signaling. PLoS Pathog 6: e1001230 Shintani T, Huang WP, Stromhaug PE, Klionsky DJ (2002) Mechanism of cargo selection in the cytoplasm to vacuole targeting pathway. Developmental cell 3: 825-837 Silver DA, Pellicer I, Fair WR, Heston WD, Cordon-Cardo C (1997) Prostate-specific membrane antigen expression in normal and malignant human tissues. Clin Cancer Res 3: 81-85 Simonsen A, Cumming RC, Brech A, Isakson P, Schubert DR, Finley KD (2008) Promoting basal levels of autophagy in the nervous system enhances longevity and oxidant resistance in adult Drosophila. Autophagy 4: 176-184

169
Smets B, Ghillebert R, De Snijder P, Binda M, Swinnen E, De Virgilio C, Winderickx J (2010) Life in the midst of scarcity: adaptations to nutrient availability in Saccharomyces cerevisiae. Curr Genet 56: 1-32 Stimpson HE, Lewis MJ, Pelham HR (2006) Transferrin receptor-like proteins control the degradation of a yeast metal transporter. Embo J 25: 662-672 Suzuki K, Kamada Y, Ohsumi Y (2002) Studies of cargo delivery to the vacuole mediated by autophagosomes in Saccharomyces cerevisiae. Developmental cell 3: 815-824 Suzuki K, Kirisako T, Kamada Y, Mizushima N, Noda T, Ohsumi Y (2001) The pre-autophagosomal structure organized by concerted functions of APG genes is essential for autophagosome formation. Embo J 20: 5971-5981 Suzuki K, Kondo C, Morimoto M, Ohsumi Y (2010) Selective transport of alpha-mannosidase by autophagic pathways: identification of a novel receptor, Atg34p. J Biol Chem 285: 30019-30025 Suzuki M, Latshaw S, Sato Y, Settles AM, Koch KE, Hannah LC, Kojima M, Sakakibara H, McCarty DR (2008) The Maize Viviparous8 locus, encoding a putative ALTERED MERISTEM PROGRAM1-like peptidase, regulates abscisic acid accumulation and coordinates embryo and endosperm development. Plant Physiol 146: 1193-1206 Sweat SD, Pacelli A, Murphy GP, Bostwick DG (1998) Prostate-specific membrane antigen expression is greatest in prostate adenocarcinoma and lymph node metastases. Urology 52: 637-640 Takeshige K, Baba M, Tsuboi S, Noda T, Ohsumi Y (1992a) Autophagy in yeast demonstrated with proteinase-deficient mutants and conditions for its induction. J Cell Biol 119: 301-311 Takeshige K, Baba M, Tsuboi S, Noda T, Ohsumi Y (1992b) Autophagy in yeast demonstrated with proteinase-deficient mutants and conditions for its induction. J Cell Biol 119: 301-311 Tang F, Watkins JW, Bermudez M, Gray R, Gaban A, Portie K, Grace S, Kleve M, Craciun G (2008) A life-span extending form of autophagy employs the vacuole-vacuole fusion machinery. Autophagy 4: 874-886 te Welscher YM, Jones L, van Leeuwen MR, Dijksterhuis J, de Kruijff B, Eitzen G, Breukink E (2010) Natamycin inhibits vacuole fusion at the priming phase via a specific interaction with ergosterol. Antimicrob Agents Chemother 54: 2618-2625 Temkin V, Huang Q, Liu H, Osada H, Pope R (2006) Inhibition of ADP/ATP exchange in receptorinteracting protein-mediated necrosis. Molecular and Cellular Biology 26: 2215-2225

170

Teng X, Degterev A, Jagtap P, Xing X, Choi S, Denu R, Yuan J, Cuny G (2005) Structure-activity relationship study of novel necroptosis inhibitors. Bioorganic & Medicinal Chemistry Letters 15: 5039-5044 Thorburn A (2011) I think autophagy controls the death of my cells: what do I do to get my paper published? Autophagy 7: 455-456 Tinoco AD, Peterson CW, Lucchese B, Doyle RP, Valentine AM (2008) On the evolutionary significance and metal-binding characteristics of a monolobal transferrin from Ciona intestinalis. Proc Natl Acad Sci U S A 105: 3268-3273 Trumbly RJ, Bradley G (1983) Isolation and characterization of aminopeptidase mutants of Saccharomyces cerevisiae. J Bacteriol 156: 36-48 Tsai G, Dunham KS, Drager U, Grier A, Anderson C, Collura J, Coyle JT (2003) Early embryonic death of glutamate carboxypeptidase II (NAALADase) homozygous mutants. Synapse 50: 285-292 Tsukada M, Ohsumi Y (1993a) Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett 333: 169-174 Tsukada M, Ohsumi Y (1993b) Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett 333: 169-174 Uttenweiler A, Schwarz H, Mayer A (2005) Microautophagic vacuole invagination requires calmodulin in a Ca2+-independent function. J Biol Chem 280: 33289-33297 van der Vaart A, Mari M, Reggiori F (2008) A picky eater: exploring the mechanisms of selective autophagy in human pathologies. Traffic (Copenhagen, Denmark) 9: 281-289 van Doorn WG, Beers EP, Dangl JL, Franklin-Tong VE, Gallois P, Hara-Nishimura I, Jones AM, Kawai-Yamada M, Lam E, Mundy J, Mur LA, Petersen M, Smertenko A, Taliansky M, Van Breusegem F, Wolpert T, Woltering E, Zhivotovsky B, Bozhkov PV (2011) Morphological classification of plant cell deaths. Cell Death Differ 18: 1241-1246 Vander Heiden MG, Choy JS, VanderWeele DJ, Brace JL, Harris MH, Bauer DE, Prange B, Kron SJ, Thompson CB, Rudin CM (2002) Bcl-x(L) complements Saccharomyces cerevisiae genes that facilitate the switch from glycolytic to oxidative metabolism. J Biol Chem 277: 44870-44876 Vercammen D, Brouckaert G, Denecker G, Van de Craen M, Declercq W, Fiers W, Vandenabeele P (1998) Dual signaling of the Fas receptor: Initiation of both apoptotic and necrotic cell death pathways. Journal of Experimental Medicine 188: 919-930

171

Vida TA, Emr SD (1995) A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J Cell Biol 128: 779-792 Vida TA, Huyer G, Emr SD (1993) Yeast vacuolar proenzymes are sorted in the late Golgi complex and transported to the vacuole via a prevacuolar endosome-like compartment. J Cell Biol 121: 12451256 Vidaurre DP, Ploense S, Krogan NT, Berleth T (2007) AMP1 and MP antagonistically regulate embryo and meristem development in Arabidopsis. Development (Cambridge, England) 134: 25612567 Vincent RD, Hofmann TJ, Zassenhaus HP (1988) Sequence and expression of NUC1, the gene encoding the mitochondrial nuclease in Saccharomyces cerevisiae. Nucleic acids research 16: 32973312 Walker NI, Harmon BV, Gob GC, Kerr JF (1988) Patterns of cell death. Methods Achiev Exp Pathol 13: 18-54 Walters RH, Murphy RM (2009) Examining polyglutamine peptide length: a connection between collapsed conformations and increased aggregation. J Mol Biol 393: 978-992 Wang CW, Stromhaug PE, Kauffman EJ, Weisman LS, Klionsky DJ (2003) Yeast homotypic vacuole fusion requires the Ccz1-Mon1 complex during the tethering/docking stage. J Cell Biol 163: 973-985 Wang CW, Stromhaug PE, Shima J, Klionsky DJ (2002a) The Ccz1-Mon1 protein complex is required for the late step of multiple vacuole delivery pathways. J Biol Chem 277: 47917-47927 Wang CW, Stromhaug PE, Shima J, Klionsky DJ (2002b) The Ccz1-Mon1 protein complex is required for the late step of multiple vacuole delivery pathways. J Biol Chem 277: 47917-47927 Wang YX, Zhao H, Harding TM, Gomes de Mesquita DS, Woldringh CL, Klionsky DJ, Munn AL, Weisman LS (1996) Multiple classes of yeast mutants are defective in vacuole partitioning yet target vacuole proteins correctly. Mol Biol Cell 7: 1375-1389 Wichmann H, Hengst L, Gallwitz D (1992) Endocytosis in yeast: evidence for the involvement of a small GTP-binding protein (Ypt7p). Cell 71: 1131-1142 Willingham S, Outeiro TF, DeVit MJ, Lindquist SL, Muchowski PJ (2003) Yeast genes that enhance the toxicity of a mutant huntingtin fragment or alpha-synuclein. Science 302: 1769-1772

172

Wissing S, Ludovico P, Herker E, Buttner S, Engelhardt SM, Decker T, Link A, Proksch A, Rodrigues F, Corte-Real M, Frohlich KU, Manns J, Cande C, Sigrist SJ, Kroemer G, Madeo F (2004) An AIF orthologue regulates apoptosis in yeast. J Cell Biol 166: 969-974 Wolter KG, Hsu YT, Smith CL, Nechushtan A, Xi XG, Youle RJ (1997) Movement of Bax from the cytosol to mitochondria during apoptosis. J Cell Biol 139: 1281-1292 Wyllie AH (1980) Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature 284: 555-556 Xie Z, Klionsky DJ (2007) Autophagosome formation: core machinery and adaptations. Nature cell biology 9: 1102-1109 Xie Z, Nair U, Klionsky DJ (2008) Dissecting autophagosome formation: the missing pieces. Autophagy 4: 920-922 Yang Z, Huang J, Geng J, Nair U, Klionsky DJ (2006) Atg22 recycles amino acids to link the degradative and recycling functions of autophagy. Mol Biol Cell 17: 5094-5104 Yang Z, Klionsky DJ (2007) Permeases recycle amino acids resulting from autophagy. Autophagy 3: 149-150 Yorimitsu T, Klionsky DJ (2005) Atg11 links cargo to the vesicle-forming machinery in the cytoplasm to vacuole targeting pathway. Mol Biol Cell 16: 1593-1605 Yoshimoto K (2010) Physiological roles of autophagy in plants: Does plant autophagy have a prodeath function? Plant Signal Behav 5 Youle RJ, Strasser A (2008) The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 9: 47-59 Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, Baehrecke E, Lenardo M (2004) Regulation of an ATG7-beclin 1 program of autophagic cell death by caspase-8. Science 304: 1500-1502 Yu L, Wan F, Dutta S, Welsh S, Liu Z, Freundt E, Baehrecke EH, Lenardo M (2006a) Autophagic programmed cell death by selective catalase degradation. Proc Natl Acad Sci U S A 103: 4952-4957 Yu S, Andrabi S, Wang H, Kim N, Poirier G, Dawson T, Dawson V (2006b) Apoptosis-inducing factor mediates poly(ADP-ribose) (PAR) polymer-induced cell death. Proceedings of the National Academy of Sciences of the United States of America 103: 18314-18319

173

Yu S, Baek S, Brennan R, Bradley C, Park S, Lee Y, Jun E, Lookingland K, Kim E, Lee H, Goudreau J, Kim S (2008) Autophagic Death of Adult Hippocampal Neural Stem Cells Following Insulin Withdrawal. Stem Cells 26: 2602-2610 Zaremba T, Thomas H, Cole M, Plummer E, Curtin N (2010) Doxorubicin-induced suppression of poly(ADP-ribose) polymerase-1 (PARP-1) activity and expression and its implication for PARP inhibitors in clinical trials. Cancer Chemotherapy and Pharmacology 66: 807-812 Zaworski PG, Gill GS (1988) Precipitation and recovery of proteins from culture supernatants using zinc. Anal Biochem 173: 440-444 Zong W, Ditsworth D, Bauer D, Wang Z, Thompson C (2004) Alkylating DNA damage stimulates a regulated form of necrotic cell death. Genes & Development 18: 1272-1282 Zong WX, Lindsten T, Ross AJ, MacGregor GR, Thompson CB (2001) BH3-only proteins that bind pro-survival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Bak. Genes Dev 15: 1481-1486 Zong WX, Thompson CB (2006) Necrotic death as a cell fate. Genes Dev 20: 1-15