JOURNAL OF INTERFERON AND CYTOKINE RESEARCH 22:371378 (2002) Mary Ann Liebert, Inc.

Expression of Biologically Active Human Tumor Necrosis Factor-a in Transgenic Potato Plant
KENJI OHYA, 1 NORIKO ITCHODA, 2 KAZUHIKO OHASHI, 1 MISAO ONUMA,1 CHIHIRO SUGIMOTO, 3 and TAKESHI MATSUMURA2,4

ABSTRACT We report the successful insertion of the cDNA of human tumor necrosis factor-a (HuTNF-a) into the genome of potato plant species, Solanum tuberosum, using Agrobacterium tumefacience-mediated transformation. HuTNF-a is a known and essential cytokine mediating host defense against tumors and infectious diseases and an immunomodulating agent. To enhance the accumulation of foreign gene product expression in plant cells, the molecular design of the constructed HuTNF-a is presented. Transcription and translation of TNF-a in transformants were confirmed by Northern blot, RT-PCR, ELISA, and Western blot, respectively. Expression of the bioactive HuTNF-a in plant cells was confirmed by way of the cytotoxic effect of the extract obtained from the transformants against murine L929 cells. We think that the expression level of HuTNFa (15 mg/g potato plant tissue) obtained in the present study may be sufficient to induce responses/effects similar to those generated by TNF-a in human milk administered orally. We believe that the TNF-a expressed in edible potato plants has tremendous potential for clinical use in the areas of medicine and veterinary science. Its usefulness and applicability, therefore, need to be fully explored.

INTRODUCTION

(TNF-a) is a proinflammatory cytokine primarily produced by monocytes and macrophages in response to many different kinds of stimuli, including endotoxin. TNF- a has the ability to modulate inflammatory immune responses, to lyse tumor cells in vitro, and to induce hemorrhagic necrosis of certain transplantable tumors in vivo.(1) Systemic injection of TNF-a induces severe side effects, thus limiting its clinical use. Although only the antagonists of TNF have been proven to be clinically useful against autoimmune diseases, such as rheumatoid arthritis,(2) recent findings have shown the effectiveness of regional or localized administration of TNF-a against melanoma metastases and soft-tissue sarcomas without side effects,(3) suggesting the clinical usefulness of recombinant TNF- a for cancer therapy. TNF-a also plays an important role in host defense against infectious agents, such as Listeria monocytogenes(4,5) and Candida albicans.(6) As

UMOR NECROSIS FACTOR -a

TNF-a is secreted in human and animal milk, it may contribute to the development of the immune component of the gastrointestinal tract epithelium.(7,8) Orally delivered TNF- a produced by a recombinant attenuated Salmonella typhimurium has been shown to enhance the systemic immune response against Leishmania major,(9) implying that administration of TNF-a specifically into the mucosal surface should be effective for therapy against infectious agents. The plant expression systems provide an inexpensive source of recombinant therapeutic proteins compared with other in vitro expression systems, such as Escherichia coli.(10) Recombinant products expressed in edible plant tissues can be orally administered to human and animals.(11) Antigens of pathogenic microorganisms, such as E. coli heat-labile enterotoxin(12,13) and Norwalk virus capsid protein,(14,15) have been expressed in plants and administered to animals and humans as edible vaccines. There are also indications that microencapsulation in plant cells can shield recombinant products from degradation

of Disease Control, Graduate School of Veterinary Medicine, Hokkaido University, Kita-ku, Sapporo 060-0818, Hokkaido, Japan. Green-Bio Institute, Naganuma, Yubari-gun 069-1311, Hokkaido, Japan. Research Center for Protozoan Diseases, Obihiro 080-8555, Hokkaido, Japan. 4Research Institute of Biological Resources, National Institute of Advanced Industrial and Science Technology, Toyohira-ku, Sapporo 0628517, Japan.
2Hokkaido 3National

1Department

371

372 in the gastrointestinal tract. Taking advantage of the plant expression systems, several therapeutic proteins have been expressed in plants.(16,17) In the present study, we attempted to introduce human TNF-a (HuTNF- a) cDNA into a potato plant species, Solanum tuberosum, using Agrobacterium tumefacience-mediated transformation, which resulted in a successful expression of the bioactive product. The molecular design of HuTNF-a, which was constructed to enhance accumulation of foreign genes in plant cells, is discussed.

OHYA ET AL. TTCTCTTTACAAGC contained the SmaI site at the 59-end. The antisense oligonucletide TTCAGTGCTTTGTAAAGGGCCAGT ATGGCT GCTAAA CATGTG CTTGTA AAGA GAAGCAAGG overlapped the HuTNF- a start codon 9 bases downstream (AGCACTGAA) in frame at the 59-end. The following condition was used for legumin fragment synthesis: 95C for 5 min, 30 cycles of 95C for 1 min, 45C for 1 min, and 72C for 2 min. Fifteen picograms each of legumin and HuTNF-a fragments were ligated by PCR using the sense primer of legumin and an antisense primer (CCCGGGTCAGAGCTCGTCCTT CTCGCTCAGGG CAATGATCCCTT T) that contained a nucleotide sequence encoding a hexapeptide endoplasmic reticulum (ER) retention signal (SEKDEL) in frame with the HuTNF-a open reading frame (ORF) at the 59end. The condition was 95C for 5 min, 30 cycles of 95C for 1 min, 45C for 1 min, and 72C for 2 min. The PCR product was digested with SmaI and subcloned into SmaI-digested pBE2113 (pBE/L-TNF) (Fig. 1B).

MATERIALS AND METHODS Construction of plasmid for plant transformation

A HuTNF- a cDNA fragment, provided by the Hayashibara Biochemical Laboratories Inc. (Okayama, Japan), was amplified with oligonucletides containing the SmaI site (CCCGGG) at both 59 and 39-ends. The sense primer corresponding to the beginning of the signal sequence of HuTNF-a was CCCGGGATGAGCACTGAAAGCATG, and the antisense primer corresponding to the end of the HuTNF- a coding region was CCCGGGTCACAGGGCAATGATCCC. Polymerase chain reaction (PCR) was carried out in Gene Amp PCR System 9700 (Perkin Elmer-Applied Biosystems, Norwalk, CT) using 15 pg of the HuTNF-a cDNA fragment and 2.5 U of Taq DNA polymerase (Promega, Madison, WI). The following conditions were used for PCR: 94C for 5 min, 5 cycles of 94C for 1 min, 51C for 1 min, 72C for 1 min, and 25 cycles of 94C for 1 min, 63C for 1 min, and 72C for 1 min. The PCR product was digested with SmaI and subcloned into SmaI-digested pBE2113(18) (pBE/TNF) (Fig. 1A). A fragment coding for legumin signal sequence(19) was synthesized using two oligonucleotides by PCR. The sense oligonucletide CCCGGGATGTCCAAACCTTTTCTATCTTTGCTTTCACTTTCCTTGC-

Plant transformation
The plant transformation vectors pBE/TNF and pBE/L-TNF were introduced into A. tumefacience LBA4404 by direct transformation(20) and used for the transformation of S. tuberosum cv Waseshiro. The standard procedures as described previously(21) were used.

Genomic PCR analysis

Insertion of the HuTNF- a gene into the plant genome was confirmed by genomic PCR analysis. Genomic DNA of transformants were extracted according to the method of Murray and Thompson.(22) For PCR analysis of transformants, 0.1 mg of genomic DNA was used, and the primers and the condition were the same as described for the construction of plasmid for plant

FIG. 1. Expression cassettes for (A) pBE/TNF and (B) pBE/L-TNF. RB and LB, right and left T-DNA borders; Np and Nt, nopaline synthase promoter and terminator; NPT II, neomycin phosphotransferase II, which provides kanamycin resistance; CaMV 35S, cauliflower mosaic virus 35S promoter; E2, 59 upstream sequence of the CaMV 35S promoter, which functions as an enhancer sequence of CaMV 35S; TMV V, tobacco mosaic virus G-free sequence reported to improve the translation efficiency in plant. These genes are located in the T-DNA legion of pBE2113. HuTNF-a cDNA, including its own signal sequence, was inserted downstream of TMV V. (B) HuTNF-a cDNA was fused in frame with legumin (a seed storage protein) at the 59end and the endoplasmic reticulum (ER) retention signal (serine-glutamic acid- lysine- aspartic acid-glutamic acid-leucine [SEKDEL]) at the 39-end in pBE/L-TNF.

EXPRESSION OF HuTNF- a IN TRANSGENIC POTATO transformation. For the negative control, an untransformed regenerated potato plant without kanamycin selection was used.

373 pBE/L-TNF transformants, the sense primer used was CCCGGGATGTCCAAACCTTTTCTATCT, and the antisense primer was the same as that used to fuse SEKDEL to the 39end of HuTNF- a.

Northern blot analysis

Transcription of the HuTNF-a gene in transformants was determined by Northern blot hybridization using a32P-labeled HuTNF-a cDNA as a probe. Transformants were frozen in liquid nitrogen and ground into powder using a mortar and pestle. The untransformed potato plant served as negative control and was prepared similarly. Total RNA samples were extracted by Trizol reagent (GIBCO-BRL, Grand Island, NY). Electrophoresis and transfer to a nylon membrane (Hybond-N1 , Amersham Pharmacia Biotech, Buckinghamshire, U.K.) were carried out using 10 mg each of the total RNA sample following the standard method described previously.(21) The membrane was hybridized with a32P-labeled HuTNF- a cDNA and washed twice with 2 3 SSC (33.3 mM sodium chloride, 33.3 mM sodium citrate, pH 7.0) containing 0.1% sodium dodecyl sulfate (SDS) at room temperature for 15 min and once with 0.2 3 SSC containing 0.1% SDS at 65C for 20 min. The membrane was exposed to an x-ray film (X-OMAT AR, Eastman Kodak, Rochester, NY) for 2 days at 280C.

Enzyme-linked immunosorbent assay (ELISA)

Expression of HuTNF- a in transgenic potatoes was detected using a polyclonal antibody-based HuTNF- a ELISA kit (Hayashibara Biochemical Laboratories). Leaf tissues of the transformants and the untransformed potato plant were ground with 3 volumes (w/v) phosphate-buffered saline (PBS) supplemented with 0.05% Tween-20 (0.05% PBST) and centrifuged at 9000 g for 30 min at 4C. The supernatants were used in duplicate for ELISA, following the manufacturers instruction. The concentration of HuTNF- a in the supernatants was calculated using a purified HuTNF- a standard (Hayashibara Biochemical Laboratories, Inc.) at an absorbance of 492 nm.

Western blot analysis

Leaf tissues of the transformants and the untransformed potato plant were ground with 3 volumes (w/v) of 0.05% PBST and centrifuged at 9000g for 30 min at 4C. The supernatants and the HuTNF- a standard were electrophoresed on a 15% acrylamide gel and electroblotted onto a polyvinylidene difluoride (PVDF) transfer membrane (Immobilin, Millipore, Bedford, MA). The membrane was reacted with antihuman TNF-a monoclonal antibody (mAb) (G-T Monoclonal Anti-human TNF-a Antibody, Techne, Minneapolis, MN). As the secondary antibody, horseradish peroxidase (HRP)-conjugated goat antimouse IgG (Jackson ImmunoResearch, West Grove, PA) was used. Signals were detected using an ECL Plus Western blotting detection system (Amersham Pharmacia Biotech) and Fluor-S MAX MultiImager (Bio-Rad, Hercules, CA) according to the manufacturers instructions.

Reverse transcription (RT)-PCR analysis

One microgram each of total RNA samples of transformants and the untransformed potato plant serving as negative control were digested with 2 U DNase I (Invitrogen, Carlsbad, CA) to avoid genomic DNA contamination and used for reverse transcription with 5 U reverse transcriptase (Takara, Tokyo, Japan), 10 U RNase inhibitor (Promega), 1 mM oligo dT, and 0.2 mM dNTP at 42C for 1 h. To detect transcription of HuTNF-a cDNA in pBE/TNF transformants, the same primers used to amplify the HuTNF-a fragment were used. To detect transcription of the legumin-HuTNF-a-SEKDEL fusion gene in

FIG. 2. Genomic PCR analysis of HuTNF- a transformants. Genomic DNA (0.1 mg) isolated from each transgenic line (numbers) and a nontransformant were amplified by PCR using HuTNF-a primers. The pBE/TNF plasmid was used as a positive control. M, DNA size markers, the sizes of which are recorded at the left of each band in base pairs (bp).

374

OHYA ET AL. foreign gene product in plants.(18) The T-DNA region of the pBE2113 also contains the 5 9 upstream sequence of cauliflower mosaic virus 35S (CaMV 35S), which acts as an enhancer (E2),(24) and the tobacco mosaic virus V sequence (TMV V), which had been reported to improve the translation efficiency in plants and animals,(25) except for the CaMV 35S core promoter (Fig. 1). HuTNF- a cDNA, including its own signal sequence, was inserted into the Sma I site of the pBE2113 (pBE/TNF) (Fig. 1A). Additionally, to enhance accumulation of expressed foreign gene product in plant tissues, HuTNF- a cDNA was fused in frame with the legumin signal sequence, which encodes a seed storage protein(26) at the 59-end and the ER retention signal (SEKDEL) sequence, which has been reported to increase protein accumulation in transgenic plants, such as tobacco, potato leaves, and tubers(2729) (pBE/L-TNF) (Fig. 1B). After infection of A. tumefacience carrying the pBE/TNF or the pBE/L-TNF to potato tuber disks, calli were formed from the tuber disks on medium supplemented with kanamycin, and shoots were developed from the calli. Finally, we obtained 130 clones of pBE/TNF and 70 clones of pBE/L-TNF transformants.

Detection of biologic activity of HuTNF-a derived from transgenic potatoes

Leaf tissues of the transformants and a transgenic potato plant transformed with rotavirus VP4 gene (T. Matsumura and H. Tsunemitsu, unpublished observations) as a transformed control were ground using mortar and pestle in 3 volumes (w/v) of PBS and centrifuged at 9000g for 30 min at 4C. The supernatants were transferred into a cellulose dialysis tube, dialyzed against PBS, sterilized by filtration through a membrane filter with pore size of 0.2 mm, and stored at 280C until use. Detection of biologic activity of HuTNF-a derived from transformants was confirmed by cell cytotoxicity against murine L929 cells (murine fibroblasts) according to the standard method.(23) L929 cells were maintained in Dulbeccos modified Eagles minimal essential medium (DMEM, GIBCO-BRL) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Filtron, Brooklym, Australia), 2000 IU/ml penicillin, and 200 mg/ml streptomycin at 37C in 5% CO2. A confluent monolayer of L929 cells in a 96-well tissue culture plate (Corning Inc., Corning, NY) was exposed to serial 2-fold dilutions of HuTNF-a standard or the potato leaf extracts diluted with DMEM containing 1% FBS and 1 mg/ml actinomycin D. After 24 h, the cells were fixed and stained with amide black.

Genomic PCR analysis of pBE/TNF transformants RESULTS Regeneration of HuTNF-a cDNA transgenic potato plants
The plant transformation vector, pBE2113, used in this study was constructed in order to increase the expression of As HuTNF-a-specific bands were detected in all the tested transformants and no band was detected in an untransformed control, it was confirmed that the HuTNF-a cDNA was inserted into the plant genome (Fig. 2). For the pBE/L-TNF transformants, genomic PCR analysis was not performed because of the limited amount of product transformed.

FIG. 3. Transcription of the transferred HuTNF-a gene in the transformants. (A) Northern blot analysis of the pBE/TNF transformants. Total RNA samples (10 mg) were electrophoresed and hybridized with a32P-labeled HuTNF-a cDNA. The numbers in the lane indicate transformant clone numbers. C, untransformed potato plant. (Top) Specific hybridization signals against the HuTNFa probe. (Bottom) Ribosomal RNA on the gel stained with ethidium bromide. Arrowheads show the positions of 18S and 28S ribosomal RNA. (B) Transcription of HuTNF-a and legumin-fused HuTNF- a in the transformants. RT-PCR was carried out after total RNA samples were treated with DNase I. Arrows indicate PCR products of the TNF-a (701 bp) and legumin-fused TNF-a (L-TNF) genes (758-bp) in the transformants. M, 100-bp DNA size marker. 1 and 2 , with or without reverse transcription.

EXPRESSION OF HuTNF- a IN TRANSGENIC POTATO

375 and the chimeric HuTNF-a gene construct were transcribed to mRNA in the transformants.

Transcription of inserted HuTNF-a gene in transformants

Transcription of the HuTNF-a gene was confirmed by Northern blot analysis of total RNA samples of the pBE/TNF transformants, with HuTNF- a cDNA as a probe (Fig. 3A). As HuTNF-a-specific hybridization signals were detected in all the tested samples at the expected size (about 800 bp) and no signal was detected in the untransformed control, it was confirmed that the inserted HuTNF-a gene was transcribed to mRNA in the pBE/TNF transformants. In addition, HuTNF- a cDNA that was fused in frame with the legumin and the ER retention signal (SEKDEL) was also transformed in the potato plant (the pBE/L-TNF transformants). Transcription of the chimeric (legumin-HuTNF-a cDNA-SEKDEL) gene construct into plant cells was confirmed by RT-PCR analysis (Fig. 3B). In the pBE/TNF transformants, 701-bp products were detected, and no band was detected in the untransformed control and in total RNA samples without reverse transcription (Fig. 3B). In the pBE/L-TNF transformants, 758-bp products, the same size as the chimeric HuTNF-a gene construct, were detected, and no band was detected in samples without reverse transcription (Fig. 3B). These results confirmed that the inserted HuTNF-a cDNA

Detection of HuTNF-a in transformants by ELISA

Translation of HuTNF-a in the transformants was confirmed by sandwich ELISA using two kinds of anti-HuTNF-a polyclonal antibodies (Fig. 4). Most of the transformants showed positive reactions, and no reaction was detected in the untransformed control, indicating that the HuTNF-a gene was translated into polypeptides in the plant cells. Several clones of the pBE/TNF transformants (2, 80, 85) produced more than 3500 U/ml (equal to 10,500 U/g leaf) of HuTNF-a. However, expression levels of HuTNF-a in the pBE/L-TNF transformants were lower than those in the pBE/TNF transformants, although HuTNF-a was fused to legumin and the ER retention signal to increase the accumulation of HuTNF- a in plant cells in the pBE/L-TNF transformants. Additionally, the HuTNF- a expressed in the transformant was visualized by Western blot (Fig. 5). As the positive signal against HuTNF- a in clone 2 of the pBE/TNF transformants was detected at the same size as in the HuTNF-a standard and no signal was detected at the same position in the

FIG. 4. Detection of HuTNF-a in transgenic potatoes by sandwich ELISA. Transformants were ground with 3 volumes of DPBST, and the supernatants were collected and used as test samples (duplicated per sample). The numbers indicate the transgenic lines. Each concentration of the HuTNF-a standard (1753500 U/ml) was used as a positive control (striped bars). An untransformed potato plant was used as a negative control. OD492, optical density at 492 nm.

376

OHYA ET AL.

DISCUSSION
In this study, we introduced the HuTNF-a cDNA and the chimeric HuTNF- a into potato plants using A. tumefaciencemediated transformation. The pBE2113 used in this study for plant transformation contains the enhancer and the sequence derived from TMV to enhance translation efficiency of foreign genes in plant cells.(18) In addition, HuTNF- a was fused with a signal sequence of seed storage protein (legumin) and ER retention signal (SEKDEL) to increase the accumulation of expressed gene product in plant cells. Transcription and translation of the HuTNF-a gene in the transformants were confirmed by Northern blot analysis, RT-PCR, ELISA, and Western blot analysis. As the extract of the transformants showed cytotoxicity against murine L929 cells, expression of bioactive HuTNFa in the potato plant was confirmed. The expression level of HuTNF- a in the transformants reached . 10,500 U/g tissue, which is equivalent to 15 mg/g tissue in several clones of the pBE/TNF transformants, and the expressed HuTNF-a could be visualized by Western blot analysis at the accurate size. This was higher than our previous study on the expression of human interferon-a (IFN-a) in potato plants, in which the recombinant products could not be detected by Western blot analysis (600 IU/g tissue, equal to 6 ng/g tissue),(21) presumably because of the use of the pBE2113 vector. The expression level achieved in the present study approximated that in previous studies expressing other cytokines using tobacco suspension culture.(30,31) The potato expression system, however, has advantages over the tobacco system because it

FIG. 5. Visualization of HuTNF- a in the transformant by Western blotting. Potato leaf extracts and the HuTNF-a standard were electrophoresed on a 15% acrylamide gel and electroblotted to a PVDF membrane. The membrane was reacted with anti-HuTNF-a mAb and then with HRP-conjugated goat antimouse IgG. Signals were detected with the ECL plus Western blotting detection system. M.W., protein size marker recorded in kilodalton (kDa); Standard, 1 mg/ml HuTNF- a standard; Cont, extract of the untransformed potato plant; TNF 2, extract of the HuTNF-a transformant (clone 2); VP4, rotavirus VP4-transformed potato (T. Matsumura et al., unpublished observations) leaf extract as a transgenic control. An arrowhead indicates the positive signal for HuTNF- a.

untransformed control (Fig. 5), it was confirmed that the HuTNF-a polypeptide in plant cells was correctly translated as HuTNF-a .

Biologic activity of HuTNF-a derived from transformants

Although transcription and translation of the inserted gene were confirmed by northern blot (Fig. 3A), RT-PCR (Fig. 3B), ELISA (Fig. 4), and Western blot (Fig. 5), it was essential to determine if the recombinant HuTNF- a expressed in plants was biologically active. Bioactivity of HuTNF- a expressed in the transformants was assayed by cytotoxicity against murine L929 cells. L929 cells died after exposure to 31 ng/ml of the HuTNFa standard (Fig. 6B). After the leaf extract prepared from the HuTNF-a-transformed potato plant (clone 2 of the pBE/TNF transformants) was added to the L929 cells (1:32 dilution), a cytotoxic effect was observed (Fig. 6D). A leaf extract of a transgenic potato plant transformed with rotavirus VP4 gene as a transformed control (T. Matsumura and H. Tsunemitsu, unpublished observations) did not induce cell death of the L929 cells at the same dilution (1:32) (Fig. 6C). These results indicated that the HuTNF- a gene introduced into the potato plant was bioactive.

FIG. 6. Detection of biologic activity of TNF-a derived from the transformant. Leaf tissues were ground with 3 volumes of PBS, centrifuged, and dialyzed against PBS. These samples were added to murine L929 cells in culture medium supplemented with 1 mg/ml actinomycin D, and after a 24-h incubation, the cells were stained with amide black. (A) Control L929 cells. (B) L929 cells exposed to the HuTNF-a standard. (C) L929 cells exposed to rotavirus VP4-transformed leaf extract as a transgenic control. (D) L929 cells exposed to the pBE/TNFtransformed leaf extract (clone 2).

EXPRESSION OF HuTNF- a IN TRANSGENIC POTATO usually does not contain substances highly toxic to animals.(17) Furthermore, TNF- a should be in a homotrimeric form to exert its functions.(32) In this study, successful expression of biologically active TNF- a in the potato plant cells showed that recombinant products, which should be multimeric to exert their functions, can be expressed in this expression system. The chimeric HuTNF- a construct (legumin-HuTNF-a-SEKDEL) was also successfully introduced into potato plants, although the level of expression was insignificant despite the confirmation of the correct transcription of the chimeric HuTNF- a gene construct by RT-PCR. Several studies have demonstrated that fusion of the inserted gene into plants with the legumin(26,33) and ER retention signal (SEKDEL) (2729) enhanced expression of recombinant products, but we did not observe this in the present study. Orally administered cytokines,(34) at doses as low as 40 ng IFN-a,(3537) 120 ng interleukin-2 (IL-2), IL-5, and IL-6,(38) or 800 mg macrophage colony-stimulating factor (M-CSF) (39) per kg body weight, induce various immunologic effects, including enhancement of secretory IgA production and reduction of pathogens in several organs. A concentration of 600 pg/ml of TNF-a in human milk(40) has a chemokinetic effect on monocytes.(41) We think that the expression level of HuTNF- a (15 mg/g potato plant) obtained in the present study may be sufficient to induce responses/effects similar to those generated by TNF-a in human milk administered to mucosal sites. We believe that the TNF- a expressed in edible potato plants has tremendous potential for clinical use in the fields of medicine and veterinary science. Its usefulness and applicability, therefore, must be fully explored.

377
SHI, P.S., KRONKE, M., and MARK, T.W. (1993). Mice deficient for the 55kd tumor necrosis factor receptor are resistant to endotoxin shock, yet succumb to L. monocytogenes infection. Cell 73, 457467. MARINO, M.W., DUNN, A., GRAIL, D., INGLESE, M., NOGUCHI, Y., RICHARDS, E., JUNGBLUTH, A., WADA, H., MOORE, M., WILLIAMSON, B., BASU, S., and OLD, L.J. (1997). Characterization of tumor necrosis factor-deficient mice. Proc. Natl. Acad. Sci. USA 94, 80938098. LEUTENEGGER, C.M., ALLUWAIMI, A.M., SMITH, W.L., PERANI, L., and CULLOR, J.S. (2000). Quantitation of bovine cytokine mRNA in milk cells of healthy cattle by real-time TaqMan polymerase chain reaction. Vet. Immunol. Immunopathol. 77, 275287. GOLDMAN, A.S. (2000). Modulation of the gastrointestinal tract of infants by human milk. Interfaces and interactions. An evolutionary perspective. J. Nutr. 130, 426S431S. XU, D., McSORLEY, S.J., TETLEY, L., CHATFIELD, S., DOUGAN, G., CHAN, W.L., SATOSKAR, A., DAVID, J.R., and LIEW, F.Y. (1998). Protective effect on Leishmania major infection of migration inhibitory factor, TNF-a, and IFN-g administered orally via attenuated Salmonella typhimurium. J. Immunol. 160, 12851289. KUSNADI, A., NIKOLOV, Z.L., and HOWARD, J.A. (1997). Production of recombinant proteins in transgenic plants: practical considerations. Biotechnol. Bioeng. 56, 473484. MASON, H.S., and ARNTZEN, C.J. (1995). Transgenic plants as vaccine production systems. Trends Biotechnol. 13, 388392. HAQ, T.A., MASON, H.S., CLEMENTS, J.D., and ARNTZEN, C.J. (1995). Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268, 714716. TACKET, C.O., MASON, H.S., LOSONSKY, G., CLEMENTS, J.D., LEVINE, M.M., and ARNTZEN, C.J. (1998). Immunogenicity in humans of a recombinant bacterial antigen delivered in a transgenic potato. Nat. Med. 4, 607609. MASON, H.S., BALL, J.M., SHI, J.J., JIANG, X., ESTES, M.K., and ARNTZEN, C.J. (1996). Expression of Norwalk virus capsid protein in transgenic tobacco and potato and its oral immunogenicity in mice. Proc. Natl. Acad. Sci. USA 93, 53355340. TACKET, C.O., MASON, H.S., LOSONSKY, G., ESTES, M.K., LEVINE, M.M., and ARNTZEN, C.J. (2000). Human immune responses to a novel Norwalk virus vaccine delivered in transgenic potatoes. J. Infect. Dis. 182, 302305. TACKET, C.O., and MASON, H.S. (1999). A review of oral vaccination with transgenic vegetables. Microb. Infect. 1, 777783. GIDDINGS, G., ALLISON, G., BROOKS, D., and CARTER, A. (2000). Transgenic plants as factories for biopharmaceuticals. Nat. Biotechnol. 18, 11511155. MITSUHARA, I., UGAKI, M., HIROCHIKA, H., OHSHIMA, M., MURAKAMI, T., GOTOH, Y., KATAYOSE, Y., NAKAMURA, S., HONKURA, R., NISHIMIYA, S., UENO, K., MOCHIZUKI, A., TANIMOTO, H., TSUGAWA, H., OTSUKI, Y., and OHASHI, Y. (1996). Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants. Plant Cell Physiol. 37, 4959. BAEUMLEIN, H., WOBUS, U., PUSTELL, J., and KAFATOS, F.C. (1986). The legumin gene family: structure of a B type gene of Vicia faba and a possible legumin gene specific regulatory element. Nucleic Acids Res. 14, 27072720. AN, G., EBERT, P.R., MITRA, A., and HA, S.B. (1988). Binary vectors. In: Plant Molecular Biology Manual. S.B. Gelvin and R.A. Schilperoort (eds.) Dordrecht, The Netherlands: Kluwer Academic Publishers, pp. 119. OHYA, K., MATSUMURA, T., OHASHI, K., ONUMA, M., and SUGIMOTO, C. (2001). Expression of two subtypes of human in-

6.

7.

8.

9.

10.

11. 12.

13.

ACKNOWLEDGMENTS
We thank Hayashibara Biochemical Laboratories, Inc. for providing the HuTNF-a cDNA, HuTNF-a standard, and the HuTNF-a ELISA kits. We thank Professor Florencia Claveria (College of Science, De La Salle University, Philippines) and Dr. Orr Kinberly for valuable comments on the manuscript. This study was supported by grants from New Energy and Industrial Technology Development Organization, Japan, the Ministry of Education, Culture, Sports, Science and Technology, Japan, and research fellowships of the Japan Society for the Promotion of Science for Young Scientists.

14.

15.

16. 17.

18.

REFERENCES
1. VASSALLI, P. (1992). The pathophysiology of tumor necrosis factors. Annu. Rev. Immunol. 10, 411452. 2. KEYSTONE, E.C. (1999). The role of tumor necrosis factor antagonism in clinical practice. J. Rheumatol. 26, 22S28S. 3. LEJEUNE, F.J., RUEGG, C., and LIENARD, D. (1998). Clinical application of TNF-a in cancer. Curr. Opin. Immunol. 10, 573580. 4. NAKANE, A., MINAGAWA, T., KOHANAZAWA, M., CHEN, Y., SATO, H., MORIYAMA, M., and TSURUOKA, N. (1998). Interactions between endogenous gamma interferon and tumor necrosis factor in host resistance against primary and secondary Listeria monocytogenes infections. Infect. Immun. 57, 33313337. 5. PFEFFER, K., MATSUYAMA, T., KUNDIG, T.M., WAKEHAM, A., KISHIHARA, K., SHAHINIAN, A., WIEGMANN, K., OHA-

19.

20.

21.

378
terferon alpha in transgenic potato plants. J. Interferon Cytokine Res. 21, 596602. MURRAY, M.G., and THOMPSON, W.F. (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, 43214325. HOGAN, M.W., and VOGEL, S.N. (1991). Measurement of tumor necrosis factor a and b. In: Current Protocols in Immunology. J.E. Coligan, A.M. Kruiusbeek, D.H. Margulies, E.M. Shevach, and W. Strober (eds.) New York: Green Publishing Associates and WileyInterscience, unit 6.10.16.10.5. ODELL, J.T., KNOWLTON, S., LIN, W., and MAUVAIS, C.J. (1988). Properties of an isolated transcription stimulating sequence derived from the cauliflower mosaic virus 35S promoter. Plant Mol. Biol. 10, 263272. GALLIE, D.R., FEDER, J.N., SCHIMKE, R.T., and WALBOT, V. (1991). Post-transcriptional regulation in higher eukaryotes. Mol. Gen. Genet. 228, 258264. FIEDLER, U., and CONRAD, U. (1995). High-level production and long-term storage of engineered antibodies in transgenic tobacco seeds. Biotechnology 13, 10901093. WANDELT, C.I., KHAN, M.R.I., CRAIG, S., SCHROEDER, H.E., SPENCER, D., and HIGGINS, T.J.V. (1992). Vicilin with carboxy-terminal KDEL is retained in the endoplasmic reticulum and accumulates to high levels in the leaves of transgenic plants. Plant J. 2, 181192. HAQ, T.A., MASON, H.S., CLEMENTS, J.D., and ARNTZEN, C.J. (1995). Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268, 714716. ARAKAWA, T., CHONG, D.K.X., MERRITT, J.L., and LANGRIDGE, W.H.R. (1997). Expression of cholera toxin B subunit oligomers in transgenic potato plants. Transgenic Res. 6, 403413. LEE, J.S., CHOI, S.J., KANG, H.S., OH, W.G., CHO, K.H., KWON, T.H., KIM, D.H., JANG, Y.S., and YANG, M.S. (1997). Establishment of a transgenic tobacco cell suspension culture system for producing murine granulocyte-macrophage colony stimulating factor. Mol. Cells 7, 783787. MAGNUSON, N.S., LINZMAIER, P.M., REEVES, R., AN, G., HAYGLASS, K., and LEE, J.M. (1998). Secretion of biologically active human interleukin-2 and interleukin-4 from genetically modified tobacco cells in suspension culture. Protein Exp. Purif. 13, 4552. BEUTLER, B., and HUFFEL, C. (1994). Unraveling function in the TNF ligand and receptor families. Science 264, 667668. CONRAD, U., FIEDLER, U., ARTSAENKO, O., and PHILIPS, J. (1998). High-level and stable accumulation of single-chain Fv antibodies in plant storage organs. J. Plant Physiol. 152, 708711.

OHYA ET AL.
34. ROLLWAGEN, F.M., and BAQAR, S. (1996). Oral cytokine administration. Immunol. Today 17, 548550. 35. BEILHARZ, M.W., McDONALD, W., WATOSON, M.W., HENG, J., McGEACHIE, J., and LAWSON, C.M. (1997). Lowdose oral type I interferons reduce early virus replication of murine cytomegalovirus in vivo. J. Interferon Cytokine Res. 17, 625630. 36. BOSIO, E., BEILHARZ, M.W., WATOSON, M.W., and LAWSON, C.M. (1999). Efficiency of low-dose oral use of type I interferon in cytomegalovirus infections in vivo . J. Interferon Cytokine Res. 19, 869876. 37. CUMMINS, J.M., HUTCHESON, D.P., GEORGIADES, J.A., and RICHARDS, A.B. (1993). Oral therapy with human interferon alpha in calves experimentally injected with infectious bovine rhinotracheites virus. Arch. Immunol. Ther. Exp. 41, 193198. 38. BAQAR, S., PACHECO, N.D., and ROLLWAGEN, F.M. (1993). Modulation of mucosal immunity against Campylobacter jejuni by orally administered cytokines. Antimicrob. Agents Chemother. 37, 26882692. 39. MATSUZAWA, K., YOO, Y.C., FUKUSHIMA, A., YOSHIMATSU, K., ARIKAWA, J., and AZUMA, I. (1997). Protective effect of mucosal administration of recombinant human macrophage colony-stimulating factor (rhM-CSF) on mucosal infection of Sendai virus in mice. Vaccine 15, 8589. 40. RUDLOFF, H.E., SCHMALSTEIG, F.C., MUSHTAHA, A.A., PALKOWETZ, K.H., LIU, S.K., and GOLDMAN, A.S. (1992). Tumor necrosis factor-a in human milk. Pediatr. Res. 31, 2933. 41. MUSHTAHA, A.A., SCHMALSTEIG, F.C., HUGHES, T.K., RAJARAMAN, S., RUDLOFF, H.E., and GOLDMAN, A.S. (1989). Chemokinetic agents for monocytes in human milk: possible role of tumor necrosis factor-a. Pediatr. Res. 25, 629633.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

Address reprint requests to: Dr. Takeshi Matsumura Research Institute of Biological Resources National Institute of Advanced Industrial and Science Technology Tsukisamu Higashi 2-17, Toyohira-ku, Sapporo 062-8517 Japan Tel: 81-11-857-8492 Fax: 81-11-857-8927 E-mail: matsumura-t@aist.go.jp Received 3 October 2001/Accepted 26 November 2001

32. 33.