Laboratory of Bacterial Genetics Centre for DNA Fingerprinting and Diagnostics Guide: Dr. J.

Gowrishankar

Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum

Summer Research Fellowship 2012

by

Aayudh Das
University of Calcutta

Indian Academy of Sciences, Bangalore Indian National Academy of Sciences, New Delhi The National Academy of Sciences India, Allahabad
1

ACKNOWLEDGEMENT
I desire to show my sense of gratitude to the Indian Academy of Sciences, Indian National Academy of Sciences and National Academy of Sciences for granting me the Summer Research Fellowship to work in the Laboratory of Bacterial Genetics, CDFD Hyderabad. My sincere thanks to Dr. J. Gowrishankar , Director, CDFD and Head, Laboratory of Bacterial Genetics as well as my guide for permitting me to work in his laboratory as a summer trainee and allowing to attend his lab meetings and seminars. I thank Dr. K. Anupama, Scientist III, CDFD and my supervisor, for her patient guidance and support. I acknowledge gratefully all LBGians, Amit, Nora, Aanisa, Amar, Raj, Shanthy, Mishraji, Suchitra, Shaffiqu, Dr. Krishna Leela, Dr. Bindu, Dr. Vimala, for helping me out in different occasions. Dr. Harinarayanan and Dr. Abhijit deserve special mention for useful discussions and criticism. I wish to thank Vamsee, Giri and Debashish for providing me with media and other chemicals during my work at LBG. I thank NGTF for providing me with the DNA sequences on time. To my friends and well-wishers of other laboratories and my co-summer trainees, my gratitude is boundless- they made my stay in CDFD immensely enjoyable. I have received complete support from my parents and sister all through and this has been a great source of strength.

Aayudh Das 27.07.2012

~CONTENT~
ABSTRACT INTRODUCTION OBJECTIVE Materials METHODS RESULTS DISCUSSION REFERENCE

ABSTRACT
The pairs ArgP-argO of Escherichia coli and LysG-lysE of Corynebacterium glutamicum are orthologous, with the first member of each pair being a LysR-type transcriptional regulator and the second its target encoding a basic amino acid exporter. Whereas LysE is an exporter of arginine (Arg) and lysine (Lys) whose expression is induced by Arg, Lys, or histidine (His), ArgO exports Arg alone and its expression is activated by Arg but not Lys or His. Of several ArgP-dominant (ArgPd) variants that confer elevated Argindependent argO expression, ArgP (S94L), ArgP (P108S) and ArgP (P274S) activates lysE expression in E. coli. We constructed several LysG mutants at the corresponding residues of LysG namely T94L, P108S and L274S to determine if they regulate argO. In the presence of arginine all those mutants activates the transcription of argO. So we can conclude that LysG mutants regulate argO in the presence of arginine.

INTRODUCTION
A common mechanism for activation of gene expression in all organisms is that involving recruitment by a transcription factor of RNA polymerase (RNAP) to a promoter so that the latter can then engage in productive transcription.

LTTRsThe family of LysR-type transcriptional regulators (LTTRs) is widely distributed across both Gram-positive and Gram-negative bacteria, with multiple paralogs being represented even within a single organism. These proteins are involved in modulating an extremely diverse set of metabolic functions which in most cases is achieved by their binding to co-effector ligands. Considerable specificity exists in the interactions between an individual protein, its co-effector(s) and cognate target(s); nevertheless, a limited extent of cross-talk has been identified between LysR-type paralogs in a single bacterium that control genes of related function such as those for catabolism of aromatic compounds but no cross regulation has been reported between LTTR orthologs. Structural studies have indicated that although the LysR-type transcriptional regulators share common protein folds, they differ in their oligomerization properties and the mechanisms by which they both bind to DNA regulatory regions and contact RNAP. They have an extensive structural homology especially at N-terminal DNA binding domain.

(A)

RBS

ABS

-35

-10

+1 Active transcription

(B)
RBS ABS -35 -10 +1

Fig 1: Schematic presentation (A) showing that LTTRs in absence of any co-effectors cannot induce transcription as RNAP is not recruited. (B) LTTRs in the presence any co-effectors is able induce transcription as RNAP gets recruited.

LysG-LysE of C. glutamicum and ArgP- argO of E.coliThe proteins LysG and ArgP are orthologous members of the LysR family from, respectively, Grampositive Corynebacterium glutamicum and Gram-negative Escherichia coli. LysG is a transcriptional regulator of LysE expression and likewise ArgP regulates expression of ArgO which is a LysE ortholog. LysE and ArgO belongs to the family of amino acid exporters in bacteria.

Fig 2: Schematic representation showing LysG regulates LysE and ArgP regulates ArgO.

LysE exports both lysine (Lys) and arginine (Arg), ArgO is an exporter only of Arg. The LysG activates lysE transcription in presence of Arg, Lys or histidine (His), while ArgP activates argO in presence of Arg but not Lys or His;

(A)

(B)

(i)

(i)

(ii)

(ii)

(iii)
Fig 3: Schematic presentation (A) i- showing that ArgP without any co-effector cannot induce transcription of argO as RNAP is not recruited. ii- In the presence of arginine RNAP is recruited and argO expression takes place. iii- In the presence of lysine ArgP actively shuts off argO transcription. (B) i-

showing that LysG without any co-effector cannot induce transcription of LysE as RNAP is not recruited. ii- In the presence of arginine or lysine RNAP gets recruited and LysE transcription takes place.

Cross regulation between LTTRs1. It has been reported that LysG doesnt regulate argO 2. ArgP doesnt regulate lysE But is has been reported that some of the ArgPd mutants namely S94L and P274S, P108S activate lysE constitutively but V144M, Q65V, R295L, R217L are unable to activate lysE.
Fig 4: Schematic presentation showing neither LysE regulate argO nor ArgP regulate lysE.

Sequence Alignment studies of ArgP and LysG Sequence alignment ClustalW was used to obtain ArgP of E.coli and LysG of C. glutamicum. It was observed the corresponding residues for E.coli ArgP (T94L) , ArgP (L274S), ArgP (P108S) in C. glutamicum LysG were T94L, P108S, L274S.

Fig 5: Schematic representation showing the sequence alignment of ArgP of E.coli and LysG of C. glutamicum.

Table 1: LysG mutants-

LysG mutants
L274S T94L P108S V144M Q65V R295C R217L

Amino acid change

Theronine to Lysine (ACCTTA/AAT) Valine to Methionine (GTAATG/TAC) Arginine to Cysteine (CGGTCT/ACA) Arginine to Lysine (CGCTTA/AAT) Glutamine to Valine (CAAGTG/CAC) Proline to Serine (CCCTCT/AGA) Lysine to Serine (CTGTCT/AGA)

OBJECTIVE
The study aims at finding the effect of LysG mutants (T94L, L274S, P108S, V144M, Q65V, R295L, R217L) on argO expression in E. coli.

MATERIALS
Bacterial strains: All the bacterial strains that were used in this study were derivatives of Escherichia coli K-12 and their genotypes have been listed below. Table 2: List of Bacterial strains -

Strains
MC4100 DH5

Genotypes
F-araD139(argF-lac) U169rpsL150rela1 F16B5301 fruA25 deeoC1 ptsF25 e14 1 hsdR17 fhuA2 (argF-lacZ) U169 phoA glnV44 80 (lacZ)M15 gyrA96 recA1 relAl endA1 thi-

Table 3: List of primers-

Name
JGHlysGL274SF

Sequence (5-3)
TGTATTGGCAACGATGGCGCTCTGAATCTAGATC CTAGCTAGAGATCTAGATTCAGAGCGCCATCGTT CGCTATCCACATGGTTTCCTTCTGTGTTCAACGA GAAGCTACCTCGTTGAACACAGAAGGAAACCATG GCCTTGCTGAAATCCCGTTATTAATCGCCATCAA GAATCTGCGTTGATGGCGATTAATAACGGGATTT CGCTATCCACATGGTTTCCTTCTGTGTTCAACGA GAAGCTACCTCGTTGAACACAGAAGGAAACCATG GTGGAGATGTTTTAGGAGCGATGACCCGTGAAGC ACGGGATTAGCTTCACGGGTCATCGCTCCTAAAA ATGGTCCTGTGGGGCGCAGGTTAGTATCCATTGT GCCGACGGGACAATGGATACTAACCTGCGCCCCA ATGCAGCAATCGAGGGATTGTGTCCTTAGTTACT CTTTTCAGAAGTAACTAAGGACACAATCCCTCGA TTGCTGCAT
9

Tm (C)
60 60 61 61 61 61 61 61 63 63 69 69 58 58

Description
23bp, used for 23bp, used for 23bp, used for 23bp, used for 23bp, used for 23bp, used for 23bp, used for 23bp, used for V144M mutant V144M mutant R217L mutant R217L mutant R295C mutant R295C mutant 23bp, used for 23bp, used for 23bp, used for 23bp, used for 23bp, used for 23bp, used for P108S mutant P108S mutant T94L mutant T94L mutant P108S mutant P108S mutant L274S mutant L274S mutant

JGHlysGL274SR

TCTAGCTAG

JGHlysGP108SF

GCCAATACA GGTAGCTTC

JGHlysGP108SR

JGHlysGT94LF

TGGATAGCG CGCAGATTC

JGHlysGT94LR

JGHlysGP108SF

CAGCAAGGC GGTAGCTTC

JGHlysGP108SR

JGHlysGV144MF

TGGATAGCG TAATCCCGT CATCTCCAC

JGHlysGV144MR

JGHlysGR217LF

JGHlysGR217LR

CCCGTCGGC

JGHlysGR295CF

CAGGACCAT

JGHlysGR295CR

TCTGAAAAG

Table 4: Plasmids-

Plasmid
pHYD2676 pHYD1723 pHYD2677 pHYD2606 pHYD929 pCL1920 Vector mapspBAD18

Description
It is a pBAD18 construct of LysG cloned at EcoRI and HindIII It is a pMU575 derivative carryin, a 334-bp PstI-BamHI fragment of lysE regulatory It is a pCL1920 derivative of argP (p274S) pMB9 replicon for Ara-induced expression of target genes, ampicillin pSC101 replicon, streptomycin and spectinomycin pCL1920 derivative of argP (P217L) region. It is a pMU575 construct of argO regulatory region

10

Media and Buffers : All the media and buffers were sterilized by autoclaving for 15 minutes at 121C under 15 psi pressure. Media and buffers used in this study are as described below.

LB medium: Tryptone : 10 g 5g 10 g 1000 ml

Yeast extract : NaCl Water to : :

pH adjusted to 7.0-7.2 with 1N NaOH.

LB Agar: LB medium Bacto-agar : : 1000 ml 15 g

LB MES Agar (pH 5.8): MES : 3.904g 2g 2g 1g 30g

Bacto tryptone: NaCl :

Yeast extract : Bacto-agar :

Made up the volume to 200 ml using autoclaved water

Minimal Agar (0.1 M; pH 5.8): KHPO : 0.017M

11

KHPO (NH)SO

: :

0.183 M 0.2 % 0.1 %

Sodium Citrate:

Made up to 100ml using autoclaved water

TAE buffer: 40 mM Tris-acetate, 2 mM EDTA (pH 8.0) It was used as standard electrophoresis buffer. It was prepared as 50X concentrated stock solutions and used at 1X concentration.

Chemicals-

No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Chemical Glucose CaCl2

Final Concentration 0.2 % 0.2 % 0.8% 0.1M

Arabinose Glycerol MgSO

Thiamine ( B ) Lysine X-gal IPTG SDS

0.0001 % 0.001M 10mM 10mM

Arginine

80g/ml 4mg/ml 0.1% 100M

ONPG

12

Antibiotics-

Antibiotics

Working Concentration (in g/ml) LB 50 100 40 60 MA 50 100 40 30

Abbreviated in text as

Spectinomycin Trimethoprim Streptomycin Ampicilin

Spec Strep Amp TP

13

METHODS
MOLECULAR TECHNIQUES:
Isolation of plasmid DNAFor high purity plasmid RBC HiYield Plasmid Mini Kit were used where ever required. Restriction Digestion0.5-1g of DNA was used for restriction enzyme digestion. 5-20 units of the restriction enzyme with the appropriate 10X buffers supplied by the manufacturers at final concentration of 1X were used in a total reaction volume of 25l. The digestion was allowed to proceed for a minimum of 6h at 37C. The DNA fragments were visualized by ethidium bromide staining following electrophoresis on 0.8-1% agarose gels. Commercially available DNA size markers (GeneRuler) of 1kb and HindIII lamba DNA were run along with the digestion samples to compare with and estimate the sizes of the restriction fragments. Reaction mixture1) PCR product-20.5 l, EcoRI-1 l, HindIII-1 l, Digestion buffer-2.5 l. Total = 25 l 2) pBAD18 plasmid-20.5 l, EcoRI-1 l, HindIII-1 l, Digestion buffer-2.5 l. Total = 25 l
Fig 6: Schematic representation showing digested PCR product and digested pBAD18 plasmid.

Ligation100-200ng of DNA was used in each ligation reaction. The vector to insert ratio was maintained at 1:3. The reaction was done in 10l volumes containing ligation buffer (provided by the manufacturers) and 0.5-1 units of T4 DNA ligase. The reaction was carried at 21C for 16h (overnight). Reaction mixture-

14

pBAD18 digested purified-2 l, PCR product digested purified-6.5 l, T4 DNA ligase enzyme-1 l, 10mM ATP-0.5ul, Total reaction volume = 10 l

Polymerease Chain Reaction (PCR)The PCRs were performed using either Taq DNA polymerase or Deep Vent proofreading polymerase. Deep vent was mostly used as because it has got High-Fidelity: 5X greater than Taq, Extremely High Thermostability: half-life of 23 hours at 95C. Approximately, 10-20 ng of plasmid DNA was used as a template in a 50 l reaction volume containing 0.2 mM dNTPs and 1 picomole/l of each primer.

Overlapping PCRThe overlap extension polymerase chain reaction is a variant of PCR. It is used to insert specific mutations at specific points in a sequence or to splice smaller DNA fragments into a larger polynucleotide. It involves 2 PCRs with 2 template specific primers and 2 vectors specific primers using LysG (pHYD2676) as a template. PCR1-Using LysG reverse & pBAD18 forward primers, PCR 2-Using LysG forward & pBAD18 reverse primers primer. Now using PCR 1 product as a template and amplify using vector specific pBAD18R and pBAD18F.

Fig 7: Diagrammatic representation showing the general principle of overlapping PCR

15

PCR amplification for LysG mutant constructionPCR 1

COMPONENTS VOLUME (l)

PCR2
COMPONENTS VOLUME (l)

PCR 1+2
COMPONENTS VOLUME (l)

10X Thrmo pol dNTPs buffer

5 1 0.5 1 10 1

10X Thrmo pol dNTPs buffer

5 1 0.5 1 10 1

10X Thrmo pol dNTPs buffer

5 1 0.5 1 21 1

Deep Vent enzyme LysGR

Deep Vent enzyme LysGF

Deep Vent pBAD18R PCR 1 product PCR 2 product Total reaction volume pBAD18F enzyme

MB grade water Total reaction volume

Template DNA

pBAD18F

31.5 50 l

MB grade water Total reaction volume

Template DNA

pBAD18R

31.5 50 l

20.5 50 l

16

Reaction conditionsPCR 1 and PCR 2 Condition Initial Denaturation Denaturation Annealing Extension Final extension Hoarding Number of cycles Temperatures ( C ) 95 95 50 72 72 4 Time 5min 1min 1min 5min 29 5min 1min PCR 1+2 Temperatures ( C ) 95 95 50 72 72 4 29 Time 5min 1min 1min 30sec 5min 5min 1min

Colony PCRWe can use this type of PCR to identify which are the colonies those have the insert of interest. First add reverse and forward primers to MB grade water. Now pick up a little bit of colony with micropipettes and resuspend in the water-primer mixture. Now lysis of the resuspended mixture has been done by heating in 99C in PCR machine. After that add 10ul of Dream taq that is a mixture of DreamTaq DNA Polymerase, optimized Dream Taq buffer, MgCl2 and dNTPs. After that set up for PCR in a reaction condition mentioned below then check insert release with the help of gel electrophoresis.

17

COMPONENTS pBAD18F

VOLUME in l 0.5 0.5 9 10

Template DNA (colonies resuspended in MB grade water) Dream Taq

pBAD18R

Total reaction volume Reaction conditionsSteps Initial Denaturation Denaturation Annealing Extension Final extension Hoarding Number of cycles PCR purificationThe PCR purification protocol of QIAGENTM kit was employed. Temperatures ( C ) 94 94 50 72 72 4 25

20 l

Time 4 min 45sec 5 min 1min

1min 30sec 5 min

18

Agarose gel electrophoresisThe DNA samples were mixed with the appropriate volumes of the 6X loading buffer (0.25% bromopheno lblue, 0.25% xylene cyanol and 30% glycerol in water) and subjected to electrophoresis through 0.8% agarose gel in 1X TAE buffer at 5V/cm for 2-4 hours. The gel was stained in 1 g/ml of ethidium bromide for 30 min at room temperature and bands were visualized under UV light. Commercially available DNA size markers (GeneRuler) of 1kb and HindIII lamba DNA were run for visualization of DNA.

Ladders-

HindIII-DNA

Fig 8: Images of 1kb ladder and HindIII lambda DNA.

Gel elutionThe gel elution protocol of QIAGENTM gel extraction kit was employed.

19

GENETIC TECHNIQUESTransformation (Calcium chloride method) For routine plasmid transformation where very high efficiencies were not essential, the following method which is a modification of the procedure described by Cohen et al was used. An overnight culture of the recipient strain was sub-cultured in fresh LB broth and grown at 37C till middle logarithmic phase. Cells were washed with cold 0.1 M CaCl2 and resuspended in the same. The cells were incubated on ice for 3045 min. 0.1 ml of this cell suspension was mixed with 0.1-0.5 g of the DNA, incubated further for 30 min and given a heat shock for 90 seconds at 42C. The cultures were rapidly chilled on ice for 1-2 min, mixed with 1 ml of LB and incubated at 37C for 45-60 min. The cells were pelleted by centrifugation and resuspended in 300 l of LB. 0.1 ml of this mixture was plated on selective media.

Transformation with Ultra competent cell-

20

21

Stored DH5-Ultracom cells are made by following protocol and 100 l of freezing competent are taken. Then thaw in ice for sometimes followed by the addition of 10 l ligated plasmid, mix it properly and incubate on ice for 45min. After that heat shock is given at 42C for 90sec. The cultures were rapidly chilled on ice for 1-2 min, mixed with 1 ml of LB and incubated at 37C for 45min. Now after 45min samples are spin it down at 6000 for 5min. The cells were pelleted by centrifugation and resuspended in 200 l of LB. 0.1 ml of this mixture was plated on selective media and incubate overnight at 37C.

-gal assayFrom the purified plate we have to make primary culture in minimal media with water, B1, MgSO 4, 20% glucose, Ampicilin, Trimethoprim. After that overnight grown cultures are spin down at 7000 rpm for 3min. Then the supernatant is discarded and washed with minimal media. Now the strains were sub-cultured in minimal media with water, B1, MgSO 4, 20% arabinose, 80% glycerol, Ampicilin, Trimethoprim. Then 3 sets are prepared one with arginine, one with lysine and one without any amino acid. Now they are allowed to grow. Whenever the O.D of the subculture is 0.3-0.7 we must take out the cultures and measure the O.D at 600nm. Then a reaction mixture is prepared with 700l of Z buffer and 300l of cultures. Now to that mixture add few drops of 0.1% SDS and chloroform followed by mixing with vortex. Now keep the samples in 28C for 10-15min. Then add 200l ONPG (orthoNitrophenyl--galactoside) to mixture, mixed well and the time is noted. When pale yellow colour is developed then check the O.D (must be ranging from 0.3-0.9). Now add 500l of Na2CO3 to stop the reaction. Now measure the O.D at 429nm and calculate with the help of the given formula-gal unit=

22

X-gal assayX-gal (5-bromo-4-chloro-indolyl--D-galactopyranoside) is an organic compound consisting

of galactose linked to a substituted indole. X-gal is an analog of lactose, and therefore may be

hydrolyzed by the -galactosidase enzyme which cleaves the -glycosidic bond in D-lactose. Xgal, when cleaved by -galactosidase, yields galactose and 5-bromo-4-chloro-3-hydroxyindole. The latter then spontaneously dimerizes and is oxidized into 5,5'-dibromo-4,4'-dichloro-indigo, colored product therefore may be used as a test for the presence of an active -galactosidase. to be used as a reporter gene in various applications. This easy identification of an active enzyme allows the gene for -galactosidase (the lacZ gene) an intensely blue product which is insoluble. X-gal itself is colorless, the presence of blue-

23

RESULTS
Cloning of lysG geneSpecific mutation inserted in lysG gene by overlapping PCR and pBAD18 used as a vector. Now the gel extracted PCR products as well as the vector plasmids are digested as in the LysG clone and vector pBAD18 have restriction enzyme sites for HindIII and EcoRI. Now after digestion ligation was performed and ligated plasmids are transformed in DH5 ultra competent cell and were selected on LB-amp-glu plates. Plasmid was isolated from eight transformants to check for insert release of size 960 bp by digesting with HindIII and EcoRI. All the clones selected showed insert release as shown in Fig.9., however the digestion was partial, as evident from the presence of linearised plasmid (5.6Kb), vector (4.6Kb) and insert (960bp). Plasmid from two of the clones was transformed into MC4100 ArgP/argO-lac strain.

PCR 1and PCR 2 results of overlapping PCR(A) (B)

Fig 9: Gel electrophoresis images of PCR products (A) Showing L274S mutant. (B) Showing T94L mutant.

24

PCR 1+2 results of overlapping PCR(A) (B)

L274S mutants

T94L, V144M mutants

(C)
Fig 10: Gel electrophoresis images of PCR products (A) Showing L274S mutant. (B) Showing T94L mutant. (C) P108S mutant.

25

Gel showing digested PCR products and vector plasmids-

Fig 11: Gel electrophoresis image of pBAD18 digested and digested PCR products.

Gel showing insert release after digestion of transformed cloned mutants Fig 12: Gel electrophoresis image showing that out of 6 transformed colonies colony 1 and 3 got the insert release.

26

Fig 13: Gel electrophoresis image showing that out of 8 transformed colonies colony 2 and 4 got the insert release.

Gel showing insert release after colony PCR of transformed cloned mutants1 2 3 4 5 6 1 2 3 4 5 6 7 8 9 10

(A)Colony PCR of L274S mutants 1 2 3 4 5 6 7 8

(B)Colony PCR of T94L mutants

Fig 14: Gel electrophoresis image (A) Showing that in L274S mutant colony 1, 3, 5 have insert release out of 8 transformed colonies. (B) Showing that in T94L mutant colony 1, 3, 4, 6, 9, 10 have insert release out of 10 transformed colonies. (C) Showing that in P108S mutant colony 2, 3, 4, 5, 6, 7, 8 have insert release out of 10 transformed colonies.

(C)Colony PCR of P108S mutants

27

Sequencing results of ClonesL274S CLONE-

that to

Fig 14: Sequencing results shown that lysine (CTG) has been changed serine (CTC).

T94L CLONEFig 15: Sequencing results shown that Threonine (ACC) has been changed to Leucine (TTA).

28

P108S CLONE-

Fig 16: Sequencing results shown that Proline (CCC) has been changed to Serine (TCT).

X-gal assay results of ClonesAll positive regulators (L274S, P108S, T94L) are giving Blue coloration in the X-gal plate but not in same intensity while negative regulators (V144M) giving white colouration and we used LysG as our control which is giving white coloration in X-gal plate.

Fig 17: X-gal assay results of clones

29

-galactosidase assay result Table 5: -gal assay of different strainsStrain 1. Control 1 (Z buffer) 2. Control 2 ( Z buffer) 3. ArgP (Glu-Arg) 4. ArgP (Glu-Arg) 5. ArgP (Glu-Lys) 6. ArgP (Glu-Lys) 7. ArgP (Ara-Arg) 8. ArgP(Ara-Arg) 9. ArgP (Ara-Lys) 10. ArgP (Ara-Lys) 11. ArgP +(Glu-Arg) 12. ArgP +(Glu-Arg) 13. ArgP +(Glu-Lys) 14. ArgP +(Glu-Lys) 15. ArgP +(Ara-Arg) 16. ArgP+(Ara-Arg) 17. ArgP +(Ara-Lys) 18. ArgP+ (Ara-Lys) 19. pBAD18 (GluArg) 20. pBAD18 (GluArg) 21. pBAD18 (Glu-Lys) 22. pBAD18 (Glu-Lys) 23. pBAD18 (AraArg) 24. pBAD18 (AraArg) 25. pBAD18 (Ara-Lys) 26. pBAD18 (Ara-Lys) 27. +pBAD18 (Glu-Arg) 28. +pBAD18 (Glu-Arg) 29. +pBAD18 (Glu-Lys) 30. +pBAD18 (Glu-Lys) 31. +pBAD18 (Ara-Arg) 32. +pBAD18 (Ara-Arg) 33. +pBAD18 (Ara-Lys) 34. +pBAD18 (Ara-Lys) OD600 0.00 0.00 0.720 0.810 0.303 0.473 0.293 0.274 0.298 0.252 Time (t) 60min 60min 60min 60min 60min 60min 60min 60min 60min 60min 90min 90min 90min 90min 90min 90min 90min 90min 60min 60min 0.632 0.391 60min 60min 60min 60min 0.356 0.483 0.489 0.457 0.409 60min 60min 90min 90min 90min 90min 90min 90min 90min 90min OD420 0.001 0.001 0.012 0.014 0.026 0.030 0.018 0.023 0.011 0.021 0.109 0.122 0.012 0.018 0.122 0.134 0.013 0.019 0.022 0.020 0.019 0.022 0.017 0.014 0.021 0.027 0.308 0.275 0.041 0.033 0.308 0.333 0.033 0.027 0.024 0.291 0.037 0.320 0.03 4.12 22.31 3.08 26.66 2.77 0.205 1.81 0.013 0.028 0.020 0.016 0.115 0.15 0.128 0.016 1.00 1.92 3.73 1.88 14.55 2.05 16.00 2.35 OD420 avg. 0.001 -gal unit 00

0.452

0.021

2.59

0.015

2.14

30

35. LysG (Glu-Arg) 36. LysG (Glu-Arg) 37. LysG (Glu-Lys) 38. LysG (Glu-Lys) 39. LysG (Ara-Arg) 40. LysG (Ara-Arg) 41. LysG (Ara-Lys) 42. LysG (Ara-Lys) 43. L274S (Glu-Arg) 44. L274S (Glu-Arg) 45. L274S (Glu-Lys) 46. L274S (Glu-Lys) 47. L274S (Ara-Arg) 48. L274S (Ara-Arg) 49. L274S (Ara-Lys) 50. L274S (Ara-Lys)

0.273 0.296 0.247 0.209 0.491 0.450 0.462 0.419

90min 90min 90min 90min 90min 90min 90min 90min 60min 60min 60min 60min 60min 60min 60min 60min

0.012 0.018 0.023 0.026 0.030 0.028 0.022 0.024 0.407 0.453 0.24 0.28 0.587 0.614 0.020 0.068

0.03 0.024 0.029 0.023 0.43 0.26 0.600 0.44

4.28 3.03 4.14 3.15 51.8 3.20 72.28 5.86

51. P108S (Glu-Arg) 52. P108S (Glu-Arg) 53. P108S (Glu-Lys) 54. P108S (Glu-Lys) 55. P108S (Ara-Arg) 56. P108S (Ara-Arg) 57. P108S (Ara-Lys) 58. P108S (Ara-Lys) 59. T94L (Glu-Arg) 60. T94L (Glu-Arg) 61. T94L (Glu-Lys) 62. T94L (Glu-Lys) 63. T94L (Ara-Arg) 64. T94L (Ara-Arg) 65. T94L (Ara-Lys) 66. T94L (Ara-Lys)

0.714 0.511 0.240 0.896 0.568 0.664 0.652 0.591

100min 100min 100min 100min 100min 100min 100min 100min 80min 80min 80min 80min 80min 80min 80min 80min

0.447 0.443 0.029 0.025 0.432 0.486 0.044 0.032 0.505 0.532 0.031 0.039 0.529 0.487 0.027 0.033

0.45 0.027 0.459 0.038 0.518 0.04 0.508 0.03

21.42 1.761 65.57 1.413 39.84 2.66 32.56 2.12

[Strains used in the -galactosidase assay-

1) ArgP = ArgP strain, 2) ArgP+= ArgP+ strain, 3) pBAD18= pBAD18 transformed in ArgP/ argO-lac, 4) +pBAD18 = pBAD18 transformed in ArgP+/argO-lac, 5) LysG = LysG transformed in ArgP/argO-lac, 6) L274S = L274S mutant transformed in ArgP/ argO-lac, 7) P108S = P108S mutant transformed in ArgP/argO-lac 8) T94L = T94L mutant transformed in ArgP/ argO-lac.]

31

Graphical representation of the -gal assay result-

Fig 18: Graphical representation of LysG regulation level of argO from -gal assay. It has been observed that LysG mutants regulates the argO in high level in the presence of arginine co-factor. 80 70 60 50

-gal unit

40 30 20 10 0

b-gal unit

Strains
Fig 19: Graphical representation showing the LysG regulation levels of LysG mutants using LysG wild type as a control.
32

DISCUSSION
Specific mutations were inserted in lysG (pHYD2676) gene by overlapping PCR and pBAD18 used as a vector. Now the gel extracted PCR products as well as the vector plasmids are digested as in the LysG clone and vector pBAD18 have restriction enzyme sites for HindIII and EcoRI. Now after digestion ligation was performed and ligated plasmids are transformed in DH5 ultra competent cell and were selected on LB-amp-glu plates. As several ArgP-dominant (ArgPd) variants that confer elevated Arg-independent argO expression, ArgP (S94L), ArgP (P108S) and ArgP (P274S) activates lysE expression in E. coli. So we constructed several LysG mutants at the corresponding residues of LysG namely T94L, P108S and L274S to determine if they regulate argO or not. After inserting the specific mutation the plasmids carrying the mutations are transformed into ArgP-argO-lac and ArgP+-argO-lac strain and -galactosidase assay was performed. From the assay result it has been concluded that in the presence of arginine all those mutants activates the transcription of argO. So we can infer that LysG mutants regulate argO in the presence of arginine with both arabinose and glucose.

33

REFERENCE
1. Rakesh S. Laishram and Jayaraman Gowrishankar. 2007 Environmental regulation operating at the promoter clearance step of bacterial transcription. GENES & DEVELOPMENT, 21: 1258 1272. 2. Madhusudan R. Nandineni and J. Gowrishankar . 2004 Evidence for an Arginine Exporter Encoded by yggA (argO) That Is Regulated by the LysR-Type Transcriptional Regulator ArgP in Escherichia coli. JOURNAL OF BACTERIOLOGY 186.11.35393546. 3. Nandineni, M. R., R. S. Laishram, and J. Gowrishankar. 2004. Osmosensitivity associated with insertions in argP (iciA) or glnE in glutamate synthase-deficient mutants of Escherichia coli. J. Bacteriol. 186:6391-6399.

4. Carmelita N. Marbaniang and J. Gowrishankar. 2011. Role of ArgP (IciA) in Lysine-Mediated Repression in Escherichia coli. JOURNAL OF BACTERIOLOGY. 191: 59855996. 5. Bellmann, A., M. Vrljic, M. Patek, H. Sahm, R. Kramer, and L. Eggeling. 2001. Expression control and specificity of the basic amino acid exporter LysE of Corynebacterium glutamicum. Microbiology 147:1765-1774.

6. Bouvier, J., P. Stragier, V. Morales, E. Remy, and C. Gutierrez. 2008. Lysine represses transcription of the Escherichia coli dapB gene by preventing its activation by the ArgP activator. J. Bacteriol. 190:5224-5229. 7. Celis, R. T. 1999. Repression and activation of arginine transport genes in Escherichia coli K 12 by the ArgP protein. J. Mol. Biol. 294:1087-1095.

8. Goss, T. J. 2008. The ArgP protein stimulates the Klebsiella pneumoniae gdhA promoter in a lysine-sensitive manner. J. Bacteriol. 190:4351-4359. 9. Momany, C., and E. L. Neidle. 2012. Defying stereotypes: the elusive search for a universal model of LysR-type regulation. Mol. Microbiol. 83:453-456.

10. Maddocks, S. E., and P. C. Oyston. 2008. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology 154:3609-3623.
34