This page intentionally left blank

A HISTORY OF THE UNIVERSITY IN EUROPE

general editor

EGG WALTER RU

This is the nal volume in a four-part series covering the development of the university in Europe (east and west) from its origins to the present day, focusing on a number of major themes viewed from a European perspective. The originality of the series lies in its comparative, interdisciplinary, collaborative and trans-national nature. It deals also with the content of what was taught at the universities, but its main purpose is an appreciation of the role and structures of the universities as seen against a backdrop of changing conditions, ideas and values. This volume deals with the reconstruction and epoch-making expansion of higher education after 1945, which led to the triumph of modern science. It traces the development of the relationship between universities and national states, teachers and students, their ambitions and political activities. Special attention is paid to fundamental changes in the content of teaching at the universities.

A H ISTORY OF TH E UNIVERSITY IN EUROPE

General Editor and Chairman of the Editorial Board: Walter Ruegg (Switzerland) Andris Barblan (Switzerland) Asa Briggs (United Kingdom) Alison Browning (United Kingdom) Aleksander Gieysztor (Poland) Notker Hammerstein (Germany) Olaf Pedersen (Denmark) Hilde de Ridder-Symoens (Belgium) John Roberts (United Kingdom) Edward Shils (United States of America) Jacques Verger (France)

This four-volume series, prepared under the guidance of an editorial board, has been directed by the Standing Conference of Rectors, Presidents and Vice-Chancellors of the European Universities (CRE), now European University Association (EUA). The EUA, which is a non-governmental organization based in Brussels and Geneva, has over 650 member universities in both eastern and western Europe. Its Brussels and Geneva secretariat oversees the administration of the project. The university is the only European institution to have preserved its fundamental patterns and basic social role and function over the course of the last millennium. This History shows how and why the university grew to encompass the whole of knowledge and most of the world, how it developed an intellectual tradition common to all Europeans, and how it trained academic and professional elites whose ethos transcends national boundaries. Volumes in the series I Universities in the Middle Ages Editor: Hilde de Ridder-Symoens II Universities in Early Modern Europe (15001800) Editor: Hilde de Ridder-Symoens III Universities in the Nineteenth and Early Twentieth Centuries (18001945) Editor: Walter Ruegg IV Universities since 1945 Editor: Walter Ruegg

A HISTORY OF THE UNIVERSITY IN EUROPE

general editor

walter ru egg

VOLUME IV UNIVERSITIES SINCE 1945

EDITOR EGG WALTER RU

cambridge university press Cambridge, New York, Melbourne, Madrid, Cape Town, Singapore, Sao Paulo, Delhi, Dubai, Tokyo, Mexico City Cambridge University Press The Edinburgh Building, Cambridge cb2 8ru, UK Published in the United States of America by Cambridge University Press, New York www.cambridge.org Information on this title: www.cambridge.org/9780521361088 c Cambridge University Press 2011 This publication is in copyright. Subject to statutory exception and to the provisions of relevant collective licensing agreements, no reproduction of any part may take place without the written permission of Cambridge University Press. First published 2011 Printed in the United Kingdom at the University Press, Cambridge A catalogue record for this publication is available from the British Library Library of Congress Cataloguing in Publication data A history of the university in the Europe / editor, Walter Ruegg. p. cm. (A history of the university in Europe; 4) Includes bibliographical references and index. isbn 978-0-521-36108-8 (hardback) 1. Universities and colleges Europe History 20th century. 2. Universities and colleges Europe History 21st century. 3. Education, Higher Europe History 20th century. 4. Education, Higher Europe History 21st century. I. Ruegg, Walter. la627.h57 2010 378.409 dc22 2010030058 isbn 978-0-521-36108-8 Hardback

Cambridge University Press has no responsibility for the persistence or accuracy of URLs for external or third-party internet websites referred to in this publication, and does not guarantee that any content on such websites is, or will remain, accurate or appropriate.

CONTENTS

Contributors and editors Readers guide Bibliographical abbreviations used in the notes Foreword
walter ru egg (general editor)

page xi xvi xvii xviii xxiii

Acknowledgements PART I: THEMES AND PATTERNS CHAPTER 1: THEMES

walter ru egg

3 3 4 8 11 13 15 22 26 29 31 31 32 v

Introduction Reformatio in melius Humanism and university reform through dialogue The liberal reform of the universities by Schleiermacher and Humboldt Expansion and democratic university reforms, 19561981 The introduction of entrepreneurial reforms and the destruction of the ivory tower The universities and globalization The Americanization of European universities Postscript CHAPTER 2: PATTERNS
guy neave

Introduction Post-war reconstruction

Contents The expansion of the Soviet university model The drive to mass higher education Foundation and creation Regionalization The place of the non-state sector The non-university sector Caveats on the sources for the period 19902005 New perspectives The astounding vitality of the non-university sector The closing of the circle The symmetry of patterns Select bibliography for Part I PART II: STRUCTURES CHAPTER 3: RELATIONS WITH AUTHORITY
walter ru egg and jan sadlak

35 41 48 52 54 56 59 60 61 63 64 65

73 73 74 95 102 113 118 122 124 124 125 128 130 132 137 140 144 150 155 159 160

Introduction Recovery in a divided Europe, 19451955 Emerging national and international university policies, 19561967 Expansion, democratization, bureaucratization, 19681982 Towards a common European model, 19831995 Concluding remarks: the universities Europe Select bibliography CHAPTER 4: MANAGEMENT AND RESOURCES
geoffrey lockwood

Introduction The university as an organization Images of change Academic structure Forces of change Effective autonomy The management quadrilateral Management and governance Resources Management techniques The arrival of management Select bibliography

vi

Contents CHAPTER 5: TEACHERS

thomas finkenstaedt

162 162 163 170 197 201 203

Introduction New quantities new qualities Staff structure The university teacher in the modern world Conclusion Select bibliography PART III: STUDENTS CHAPTER 6: ADMISSION
a. h. halsey

207 207 211 213 217 223 226 232 236

Introduction Persistent inequality Models of higher education Matriculation Social selection before 1970 Social selection after 1970 Shifts in the social distribution of opportunity Select bibliography CHAPTER 7: CURRICULUM, STUDENTS, EDUCATION
sheldon rothblatt

238 238 243 253 256 262 266 270 272 274

The whirligig of change Responsibility for curriculum and teaching Diplomas and degrees Undergraduates and postgraduates Research and curricula The student role in the curriculum Student mobility Conclusion Select bibliography CHAPTER 8: STUDENT MOVEMENTS AND POLITICAL ACTIVISM
louis vos

276 276 278 283

Introduction International student organizations Diverging missions (19451956)

vii

Contents A new student movement (19581969) The Leninist turn and decline (19691974) The nature of the new student movement Fighting for freedom (19561989) Beyond the student movement (19742000) Select bibliography CHAPTER 9: GRADUATION AND CAREERS
ulrich teichler

288 297 299 303 312 316 319 319 321 324 325

Introduction Overall development of enrolment, graduation and attainment Variations in Europe Distribution by eld of study Changing debates about the quantitative and structural relationships between university education and employment Degrees and graduation Graduate employment and work Womens employment and work Expectations, recruitment and work The responses of universities to changing graduate employment and work Four decades of trends and policies Postscript: trends and policies since the 1990s Select bibliography PART IV: LEARNING CHAPTER 10: SOCIAL SCIENCES, HISTORY AND LAW
notker hammerstein, with the collaboration of dirk heirbaut

327 335 341 353 354 356 362 364 368

371

Introduction Sociology Political science Economics Anthropology/ethnology Geography History Law Select bibliography viii

371 375 386 398 405 408 409 414 423

Contents CHAPTER 11: THE MATHEMATICAL, EXACT SCIENCES

john ziman

424 424 427 431 435 437 441 444 446 449 451 451 452 453 456 459 464 468 469 471 473 473 474 476 478 480 483 484 485 485 491 495 507 511 516

A traditional scene in a larger frame Policing the internal frontiers of knowledge Trans-disciplinary disciplines Collectivism Internationalization Linking the academy with industry Teaching and/or research Looking backward and forward Select bibliography CHAPTER 12: THE BIOLOGICAL SCIENCES
herbert c. macgregor

From bones to biotechnology Progress, development and discovery in biology 19452004 The unravelling of DNA The rise of ecology The role of the university The biology undergraduate The Internet Universities, graduates and employment Select bibliography CHAPTER 13: THE EARTH SCIENCES
gordon craig and stuart monro

Introduction Planetary geology Plate tectonics Palaeoclimates and global warming Impact on earth science education Conclusions Select bibliography CHAPTER 14: MEDICINE
john ellis

The changing context of university medicine 19451995 The adaptation of medical education to a changing context The reform of medical education The cost of medical education The outcome of reform Teachers and students ix

Contents Education and training Research Select bibliography CHAPTER 15: TECHNOLOGY
christopher watson

520 523 527 528 528 529 537 541 544 548

The post-war context Technology-related developments in the universities The marketplace for knowledge and research in technology Sources of funding and competition Successes and failures of the universities in meeting the competition Select bibliography EPILOGUE: FROM THE UNIVERSITY IN EUROPE TO THE UNIVERSITIES OF EUROPE
andris barblan

550 550 552 553 555 557 561 567 572 574

The origins of the project The lessons of history European images of the university The premises of Europeanization in higher education Lowering the iron curtain: 1989 and beyond The main issues of the 1990s: quality and mobility The return of European integration policies A European model of higher education Select bibliography Appendix: Universities founded in Europe between 1945 and 1995
walter ru egg

575 595 603

Name index Subject index

CONTRIBUTORS AND EDITORS

a n d r i s b a r b l a n (Switzerland) was born in Orbe, Vaud, in 1943. Denis de Rougemonts assistant at the Centre europ een de la culture (Geneva) from 1973, in 1976 he became the secretary general of the CRE, Standing Conference of Rectors and Vice-Chancellors of the European Universities (Geneva), and in 2001 of its successor, EUA, the European University Association. From 2002 to 2007 he was the secretary general of the Magna Charta Observatory on University Fundamental Values and Rights, Bologna, while also consulting for the Mario Boella Institute in Turin on knowledge-development strategies in European cities. a s a b r i g g s (United Kingdom), from 1976 Lord Briggs of Lewes, was born in Yorkshire in 1921. He is a former provost of Worcester College Oxford (197692), a former vice-chancellor of the University of Sussex (196792), a former chancellor of the Open University (197894) and a former chairman (197480) of the European Institute of Education and Social Policy in Paris. He is president of the British Social History Society. His writings span economic, social and cultural history and the history of broadcasting. He is a Fellow of the British Academy and of the American Academy of Arts and Sciences. a l i s o n b r o w n i n g (United Kingdom/USA) was born in Buckinghamshire in 1951. In her role as deputy secretary general of the CRE, the Association of European Universities (198694), she had responsibility for a number of the organizations international and interdisciplinary projects, including the preparation of this History of the University in Europe. She now divides her time between the USA and Europe. g o r d o n c r a i g (United Kingdom) was born in Milngavie (Scotland) in 1925. He held the James Hutton Chair of Geology in the University of xi

Contributors and editors Edinburgh. His published work includes Scottish geology, palaeoecology and history of geology. He is a Fellow of the Royal Society of Edinburgh. h i l d e d e r i d d e r - s y m o e n s (Belgium), born in Sint-JansMolenbeek (Brussels) in 1943, is professor of early modern history at the University of Ghent (Belgium), former president of the International Commission for the History of Universities and a member of the Royal Flemish Academy of Belgium. She has published on European university history and education in the Middle Ages and the Early Modern period. j o h n e l l i s (United Kingdom, 191698) was born in Birmingham to a medical family. Educated at Cambridge and at the London Hospital, where he qualied as a doctor in 1941, he became subdean of this institution in 1948, consultant physician in 1951, and dean in 1968. He is famous as the founder of the Association for the Study of Medical Education and as a pioneer in that eld, acting as a consultant to many overseas governments on setting up new medical schools and organizing graduate training; he was also the foundation editor of the British Journal of Medical Education. He was knighted in 1980. t h o m a s f i n k e n s t a e d t (Germany) was born in Planegg near Munich in 1930. He was professor of English in Saarbrucken (1960 72) and Augsburg (197292), president of the Association of University Professors in Germany in 1970/71 and served on the foundation committees of several new universities. He was also the rst head of the Bavarian Institute for Research into Higher Education in Munich. He has published books on the history of English vocabulary and has written a short history of English studies in Germany. Since his retirement (1992) he has published several volumes on the history of the pilgrimage to the Church in the Meadows (Wieskirche) in Upper Bavaria as well as several volumes on local history. a . h . h a l s e y (United Kingdom) is emeritus professor of sociology at the University of Oxford and Fellow of Nufeld College. He was born in London in 1923 and graduated after war service from the London School of Economics in 1950. He then specialized in the sociology of education, in the eld of higher education. His most famous book is The Decline of Donnish Dominion: The Academic Professions in Britain in the Twentieth Century (Oxford University Press, 2nd edn, 1996). n o t k e r h a m m e r s t e i n (Germany) was born in Offenbach am Main in 1930. Emeritus professor of early modern history at the University of Frankfurt am Main, he has published several works on the history of German universities and the history of learning. He is a member of the editorial board of History of Universities. xii

Contributors and editors d i r k h e i r b a u t (Belgium), born in Hamme (Eastern Flanders) in 1966, is professor of legal history and Roman law at the University of Ghent (Belgium) and secretary of the Legal History Committee of the Royal Flemish Academy of Belgium for Science and the Arts. He has published on medieval customary law, the history of private law in nineteenthcentury Belgium and the methodology of legal history. g e o f f l o c k w o o d (United Kingdom) was born in Yorkshire in 1936. He graduated in economics at the London School of Economics. In 1959, having previously served in the Royal Air Force in Germany, he joined the staff at the University of Manchester and in 1961 was a founder member of staff at the University of Sussex which he continued to serve until 1996, including twenty-four years as its head of administration. He earned his doctorate in strategic management in 1981. He was for thirty years a consultant in university management with the Organization for Economic Cooperation and Development (OECD), UNESCOInternational Institute of Educational Planning (UNESCO-IIEP) and the European Commission, and a founder member of the European Centre for Strategic Management in Universities. He has published widely, including the standard British text on university planning and management. h e r b e r t c . m a c g r e g o r (United Kingdom), born and educated in Scotland, is professor emeritus of zoology at the University of Leicester and a visiting professor at the School of Biosciences of the University of Exeter. His research and publications centre on animal cytogenetics and on the organization and expression of gene sequences in chromosomes, with a special emphasis on the genomes of amphibians and birds. He is editor of the journal Chromosome Research. s t u a r t m o n r o (United Kingdom), born in Aberdeen (Scotland) in 1947, is scientic director of Our Dynamic Earth, a centre in Edinburgh communicating Earth and environmental sciences to the public. He was a principal geologist in the British Geological Survey from 1970 to 2005 and now also serves as a trustee of the National Museums of Scotland, as a non-executive director of the Edinburgh International Science Festival, as a member of Edinburgh University Court and as independent co-chair of the Scottish Science Advisory Committee. He was appointed an Ofcer of the Order of the British Empire (OBE) in 2007. g u y n e a v e (United Kingdom) was born at Lyndhurst, Hampshire, in 1941. He is honorary professor at the Centre for Higher Education Policy Studies, Twente University (Netherlands), and senior principal researcher at the Centro de Investigac ao ticas do Ensino Superior (CIPES) de Pol at Matosinhos (Portugal). A historian by training, he has published as author/editor some thirty books on comparative higher-education xiii

Contributors and editors policy, as co-editor the Encyclopedia of Higher Education and the Complete Encyclopedia of Education. He was for eighteen years editor of the journal Higher Education Policy, and served as president of the European Association for Institutional Research, He is a foreign associate of the National Academy of Education of the United States of America. Since 1990 he has lived mainly in Saint-Germain-en-Laye near Paris. s h e l d o n r o t h b l a t t (USA) was born in Los Angeles, California, in 1934. He is professor of history emeritus at the University of California, Berkeley, and sometime director of the Center for Studies in Higher Education on that campus. He holds an honorary degree from Gothenburg University in Sweden. Besides American universities, he has taught in Australia, Austria, Sweden and Norway. He is a Fellow of the Royal Historical Society of Britain, a foreign member of the Royal Swedish Academy of Sciences and a member of the National Academy of Education (USA). His academic publications are on the comparative history of universities, with translations into Italian, Spanish, Swedish and Japanese. He serves on the editorial board of a number of journals. walter ru e g g (Switzerland) was born in Zurich in 1918. He was professor of sociology at the Universities of Berne (197386) and at the Johann Wolfgang Goethe University in Frankfurt am Main (1961 73), and served as rector of the latter (196570), as president of the Westdeutschen Rektorenkonferenz (19678) and founder president of the International Federation of Social Science Associations (19768). His numerous publications focus on humanism, historical sociology and the history of higher education. j a n s a d l a k (Poland/Canada), born in 1945, is professor and vicerector at the Warsaw School of Social Sciences and Humanities/SWPS, Poland. He is also a visiting professor of European studies at the BabesBolyai University in Cluj-Napoca, Romania. He is a former director of UNESCOs European Centre for Higher Education (UNESCO-CEPES). His many publications cover such topics as the processes of reform and transformation in higher education and science policy, the organization of doctoral studies and academic qualications, private higher education, academic excellence and rankings, as well as the ethical dimension of higher education and academic values. He has been awarded six honorary doctorates from leading universities in Romania, the Russian Federation, and Ukraine. u l r i c h t e i c h l e r (Germany), born in 1942, is a professor and former director of the International Centre for Higher Education Research (INCHER) at the University of Kassel. The major themes of his numerous academic publications include higher education and the world of work, xiv

Contributors and editors systems of higher education, and the internationalization of higher education. He is a member of the Academia Europaea and the International Academy of Education, a past chairman of the Consortium of Higher Education Researchers (CHER) and a former president of EAIR, an association of higher-education management professionals. j a c q u e s v e r g e r (France) was born in Talence near Bordeaux in 1943. He is professor of medieval history at the University of Paris IV-Sorbonne and Directeur d etudes at the Ecole pratique des hautes etudes, IVe section (Paris). He is a leading medievalist whose publications on the intellectual and cultural world, especially on the universities of the Middle Ages, have been translated into several languages. l o u i s v o s (Belgium), born in Mol in 1945, is professor of history in the Faculty of Arts at the Catholic University of Leuven. A former visiting professor at the Universities of Pennsylvania and Nijmegen, he teaches on contemporary European history and the history of Poland. He has published several books and articles on the history of student movements, youth associations and nationalism in Belgium. c h r i s t o p h e r w a t s o n (United Kingdom) was born in Edinburgh in 1937. He was a fellow of Merton College, Oxford from 1968 to 2002 and has since been an emeritus fellow. In parallel with this appointment, he has worked for the United Kingdom Atomic Energy Authority (subsequently AEA Technology), initially engaged in research in plasma physics and controlled fusion, and later in managing R&D on offshore technology and nuclear robotics. He was a member of the international team which built the Joint European Torus at Culham, and has more recently been involved in UK-funded programmes to help Russian nuclear weapon scientists to transfer to civilian work. His writings include publications on the history of science. j o h n z i m a n (United Kingdom, 19252005) was born in Cambridge but brought up in New Zealand. He studied at Oxford and lectured at Cambridge, before becoming professor of theoretical physics at Bristol in 1964. His researches on the theory of the electrical and magnetic properties of solid and liquid metals earned his election to the Royal Society in 1967. Voluntary early retirement from Bristol in 1982 was followed by a period as visiting professor at Imperial College, London, and from 1986 to 1991 as founding director of the Science Policy Support Group. He was chairman of the Council for Science and Society from 1976 to 1990, and wrote extensively on various aspects of the social relations of science and technology.

xv

READERS GUIDE

This series, although compiled by specialists, is destined for the general reader. The notes and bibliographies accompanying the different chapters have therefore been kept to a minimum. The notes are either bibliographical references to specify sources, generally the most important or recent works relating to the subject, or they have been introduced to justify quantitative data or explain any signicant differences between two interpretations of a particular point. Select bibliographies at the end of the chapters are designed to stimulate further reading and are not exhaustive. The reader will nd more complete bibliographical references in the works indicated. As a number of well-known works for the period are quoted in several chapters, abbreviations of the titles of these works have been used in the notes. A list of bibliographical abbreviations is provided on the next page. In addition, the reader will nd a more general bibliography at the end of chapter 2 (Patterns), as this chapter locates the presence and nature of universities during the period covered by this volume. In order to avoid unnecessary overlaps between the various chapters, the editors have made cross-references to other chapters in the text as well as in the notes, thereby informing the reader that more ample information on the subject can be found elsewhere in the volume (see also the subject index). The standard English version of proper names has been used throughout; when necessary, a form more commonly used in Continental Europe is indicated by means of a cross-reference in the name index.

xvi

BIBLIOGRAPHICAL ABBREVIATIONS USED IN THE NOTES

Clark and Neave, Encyclopedia I B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. I: National Systems of Higher Education (Oxford, 1992). Clark and Neave, Encyclopedia II B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. II: Analytical Perspectives (Oxford, 1992). Clark and Neave, Encyclopedia III B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. III: Analytical Perspectives (Oxford, 1992). Clark and Neave, Encyclopedia IV B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. IV: Academic Disciplines and Indexes (Oxford, 1992). J lek, Historical Compendium L. J lek (ed.), Historical Compendium of European Universities/R epertoire historique des universit es europ eennes (Geneva, 1984).

xvii

FOREWORD

EGG WALTER RU

With this fourth volume the History of the University in Europe reaches its conclusion. It owes its origins to the Standing Conference of Rectors and Vice-Chancellors of the European Universities (Conf erence permanente des Recteurs et Vice-chanceliers des Universit es Europ eennes, CRE). In the Epilogue the former general secretary, Andris Barblan, describes how the project came about, and, from the position of someone who has been continually involved with European university questions, adds conclusions he has drawn from the completed History. After thorough clarication of the aims in the autumn of 1983, the CRE handed the concrete realization of the project to an international editorial board. This body decided that a modern university history focusing on Europe could not simply be organized according to countries, types of university, leading universities, and intellectual movements. Instead it should seek to summarize the social conditions and tasks, the structures and functions, the protagonists and activities of the university from its origins to the period after the Second World War in a comparative European context and according to the very latest research. There then appeared between 1992 and 2004 three volumes with the same thematic structure for the Middle Ages, the Early Modern era, and the period covering 1800 to 1945 a fundamentally coherent time span in terms of university history. The Epilogue in each volume sketched the transition to the next and, in addition, in the second volume the chapter Tradition and Innovation showed the gradual transition from the Middle Ages to the Early Modern period. The comparative European approach of the individual chapters caused the least difculties in the rst volume, not only because the university landscape of the Middle Ages was largely restricted to those parts of Europe Christianized by Rome, but especially because medievalists have xviii

Foreword always carried out their research within a European perspective. This could only be sustained in the following volumes for Part IV, Learning, in which topics were not bound by national frontiers. For those aspects treated in the other chapters, historians in a variety of countries had produced excellent work, but in terms of content they were for the most part national, indeed local, in their focus. Already in the preparatory stages of the project, the CRE had set up a network of national correspondents, who were able to help improve the European comparative element of the undertaking. The network passed its rst major test in collecting material, for a Historical Compendium of European Universities was published by the CRE in 1984 and served as a reference book for the whole project.1 Later on, the national correspondents were at the disposal of the different authors for information on the particularities of their respective university systems, and they helped to furnish a more complete European perspective. As a result, the editorial board tried to nd authors for the various chapters of each volume from a wide range of European cultural traditions willing to pursue their theme comparatively over the whole of Europe. In order to introduce them to this comparative approach, they were invited to take part in two or three workshops for each volume, which were hosted by old and new universities famous for their European importance from Bologna and Oxford to Bochum, from Salamanca and Coimbra to Ghent. At the rst workshop the authors concepts of the individual chapters, which they had prepared on the basis of guidelines proposed by the editorial board, were thoroughly discussed by both authors and editors. At the second and third meetings a similar debate occurred relating to the authors drafts. This led to a learning process that increased not only the European perspective of the different chapters, but was also introduced by our collaborators into conferences and publications on modern European university history.2 The fteen chapters and the Epilogue of volume IV have been produced by an East European scholar, a French-speaking Swiss, two Flemish Belgian, four German-speaking and ten Anglophone authors. That the last group forms the majority is a reection of the leading role assumed by their universities since 1945. The American model of entrepreneurial universities was introduced in Europe in 1985 by the British ViceChancellors Committee. In chapter 4, Management and Resources,
1 2

J lek, Historical Compendium. A. Romano and J. Verger, I poteri politici e il mondo universitario (XIIIXX secolo), Atti del Convegno Internazionale di Madrid 2830 Agosto 1990 (Soveria Mannelli, 1994); M. Peset (ed.), Aulas y Saberes, VI Congreso Internacional de Historia de las Uni versidades Hispanicas (Valencia, 1999); R. C. Schwinges (ed.), Veroffentlichungen der Universitats und Wissenschaftsgeschichte (Basel, 1999ff.). Gesellschaft fur

xix

Foreword the example of the University of Sussex clearly shows this revolutionary change, which was later adopted by university bodies throughout Europe. The reason why the universities were cast adrift into this state of autonomy is explained in chapters 2 and 3. That they were forced to learn in a few decades of autonomous decit funding what the American universities had practised for hundreds of years is discussed in the conclusion of the rst chapter. This one example shows that the thematic treatment can sometimes only be explored in its European perspective over several chapters.3 Part IV, under the title Learning, was designed to show what was studied, discovered, and taught in the various subject areas, but it presented a special problem. Such an excursion into the history of scholarship and knowledge had proved relatively easy to carry out in the earlier volumes. Yet this was not the case in the fourth volume. The subject matter of modern science and its applications is too far ranging and technically demanding, and the universitys part in the development of science too extensive, for adequate review in a work of this kind. However, the fact that the European countries hardest hit by the war faced similar problems of reconstruction after it, including adjustment to the new American dominance in all the natural sciences and technologies, suggested a simplication in our approach. We thus emphasize science policy, as in John Zimans chapter on the exact sciences, rather than substantive scientic contributions. Sometimes, because of the many successes of the policy, a congratulatory tone creeps in, as in Herbert Macgregors piece on the biological sciences. But we have let the chapters stand as the considered opinions of experienced men who worked in science and advised about its future during much of the time covered by this volume. Their contributions have value as both primary and secondary accounts of their topics. The six authors of the chapters on science, medicine and technology are British. Although this was not a determined editorial policy, it has advantages that compensate for the resultant emphasis on the experience of the UK. Firstly, it has provided some unity in problems and their solutions and allowed extensive treatment of teaching in the sciences, technology and medicine. Secondly, because Britain occupied a position between the post-war driver of world science, the United States, and Continental Europe, it felt American pressures early and keenly; and because its infrastructures had not been destroyed in the war, it faced squarely and publicly the problem of renovating them to meet the new circumstances. Thirdly, the programme for academic expansion in general and for enlarging the relative representation of science and technology
3

That is the reason for the detailed subject index.

xx

Foreword in particular gave exemplary results in Britain. Our authors have made comparisons with the situation in other European countries as they have seen t. On the occasion of the Ninth Centenary Celebrations of the University of Bologna in 1988,4 work started on volume IV with the establishment of the plan and the guidelines. When the working groups and the authors who had been engaged up to that point came together in 1991 and 1992 in Bologna and Ghent, the European university landscape was no longer divided by the Iron Curtain. The comparison of the Soviet and western university models in the third chapter, Relations with Authority, which had been developed using the example of the occupying powers in Germany, had to be augmented by an author who was particularly familiar with the universities of Central and Eastern Europe. In other chapters writers were asked to broaden the European perspective wherever possible and appropriate. It was also necessary to extend the nishing point of the volume in stages, from 1990 to 1995. Delays held back the appearance of the third volume until 2004, and we had to ask the authors of volume IV to revise their drafts in light of the current state of research. Some of them felt it necessary to sketch in developments beyond 1995. Sir John Ellis, who wrote the chapter Medicine, died in 1998 and John Ziman passed away at the beginning of 2005, before being able to complete the revision of his chapter The Mathematical, Exact Sciences. The editorial board reviewed the revised drafts at its nineteenth meeting in June 2005 and delegated various editorial tasks for the English edition to individual members. We owe a particular debt of gratitude to John Heilbron, who agreed to help with the editing of the science chapters of the Learning part, paying special attention to those written by the now deceased authors. Both he and the board decided to leave this section as a testimony to the authors own experience. The earlier volumes contained a chronological catalogue of the universities in existence during the period in question. In the third volume this was augmented by a list of specialist colleges and applied science universities of equivalent standing. In the fourth volume the great number of colleges and universities has made such a detailed catalogue impractical. However, at its last meeting the editorial board thought it helpful to list for every country those universities founded between 1945 and 1995 in chronological order. The successor body to the CRE, the EUA, kindly asked the national rectors conferences to supply the appropriate information. Any missing data were added by the general editor, using the World Higher Education DATABASE 2005/6. As in the earlier volumes
4

For further information on the foundation date of 1088, see vol. I, pp. 246, 5860.

xxi

Foreword (and, indeed, as in most developed nations) the denition of a university was taken to be an institution that had been accorded the right to award doctorates by the state; this denition naturally presupposes teaching supported by research. Among the national correspondents, Walter Hoechner, Graz, and I. V. Komarov, St Petersburg, have contributed most helpfully to individual chapters with their commentaries. We are also very grateful to our authors for their patience and their willingness to revise their contributions. The two youngest members of the editorial board, Andris Barblan and Alison Browning, have been especially active in the preparation of the fourth volume. As secretary general and deputy secretary general of the CRE during the gestation and implementation phase of this project, they have played a crucial part in following it through to completion with never-failing energy. They must derive great satisfaction from the fact that not only the English and German editions initiated by the CRE have been very well received, but Portuguese and Spanish versions of the rst volumes have already appeared, and translations into Russian and Chinese are in progress. In the early volumes it was repeatedly necessary to point to gaps in the research base. The same is of course true for volume IV. As we have done throughout this series, in the Learning section we have emphasized the subjects that gave the university its character during the several periods covered by the volumes. Thus theology and the arts received special attention in the rst three volumes, with particular emphasis on the rise of humanism and the humanities. During the period covered by the present volume, natural science set the tone and direction, and the social sciences followed suit. Our coverage includes history as a social science and omits religion and the humanities. The latter as academic disciplines have undergone substantial changes since 1945 and their place in contemporary universities driven by science, engineering and business is constantly being redened. Perhaps our successors will be inspired to examine recent developments in both areas, and in the process persuade the publishers to bring out a fth volume.5 Yet despite its deciencies, we hope that A History of the University in Europe by presenting and explaining the conditions and developments that shaped this history will not only stimulate further research but also contribute to a better understanding of the purpose and task of the university in a globalized world.
5

For the teaching of the humanities, see chapter 8, Education.

xxii

ACKNOWLEDGEMENTS

The preparatory work for A History of the University in Europe has been generously supported by Dutch, German, Portuguese, Swedish, Spanish and Swiss foundations and sponsors, the European Cultural Foundation in Amsterdam, the Fritz Thyssen Stiftung in Cologne, the Konrad-Adenauer-Stiftung in Sankt Augustin, the Robert Bosch Stiftung in Stuttgart, the Stifterverband fur die deutsche Wissenschaft in Essen, the Stiftungsfonds Deutsche Bank in Essen, the VolkswagenStiftung in Hanover, the Portuguese Secretary of State for Higher Education, the National Institute for Scientic Research as well as the Calouste Gulbenkian Foundation in Lisbon, the Fondacion Ramon Areces in Madrid, the Antonio de Almeida Foundation in Oporto, the Bank of Sweden Tercentenary Fund in Stockholm, the Cr edit Suisse in Zurich, HoffmannLa Roche & Co. in Basel, the Jubilaumsstiftung der Versicherungs gesellschaften Zurich/Vita/Alpina in Zurich, the Max und Elsa Beer Brawand-Fonds of the University of Bern, the Nestl e Corporation in Vevey, and the Schweizerische Nationalfonds zur Forderung der wis senschaftlichen Forschung in Bern. Among the national correspondents listed in volume II, Walter Hoechner, Graz, and Griigori A. Tishkin, St Petersburg, helped espe cially in giving volume IV a European dimension. The assistance of other colleagues is recognized in the chapters concerned. Johan Hanselaer from Ghent (Belgium) has systematized the names, footnotes and format of this volume, as he did for the earlier volumes in our series. He also prepared the name indexes, and, with the help of Hilde de Ridder-Symoens, the subject indexes for volumes I, II and IV. We thank him for his meticulous and intelligent work over the course of the whole project. xxiii

Acknowledgements We are very grateful for all the nancial and scholarly support of the project. We thank the universities at which our conferences and discussions have taken place, notably the Universities of Bern, Salamanca, Coimbra, Eichstatt, Oxford, Bochum, Bologna and Ghent. Above all we thank the CRE and its successor, the EUA, for their invaluable help. Last but not least we wish to thank the authors, sponsors and publishers for their patience and understanding during the long delay of this publication.

xxiv

PART I

THEMES AND PATTERNS

CHAPTER 1

THEMES

EGG WALTER RU

introduction The Second World War left behind a devastated university landscape in many parts of Europe. The only areas to escape were Spain and Portugal in the Iberian peninsula, Sweden in Scandinavia, and Switzerland in the middle of Europe. The most severe damage was sustained by the universities of Eastern Europe, which were systematically destroyed by the conquerors. In Central and Western Europe as well, the German occupation and liberation by the Allies left many universities in ruins. Fifty years later, they had more than recovered. The 201 universities registered in Europe in 1945 had grown by another 600. They enrolled ve times as many young men and women as had attended universities just after the war. Among their subjects of study were many not taught at universities in 1945. This success story is the general theme of this volume, which is the last in our History of the University in Europe. Three main themes contribute to its particular character. The rst is the idea of reform, an essential element in universities since their earliest beginnings. The second theme, the destruction of the ivory tower, is concerned mainly with the consequences of the reforms that began in the 1980s relating to the university and its interaction with the public domain. The third major theme is the provincialization of European universities, the loss of their world dominance in research and instruction. Both the second and third volumes have a chapter devoted to the adoption of the European university model in other continents. In the present volume there can be no talk of this. Europe itself has become a province, though an important one, in a global university landscape, whose contours are drawn largely by the United States. There rst British and then German university models underwent an independent development, with the result 3

 Walter Ruegg that in the 1990s it was the American model that drove the fundamental changes in the universities of a reunited Europe. In this nal volume of our history, it will be useful to put these changes into perspective.

reformatio in melius1
The oldest-surviving university statutes of 1215 state as their goal lasting improvements in the circumstances of the Paris schools, ut statui Parisiensium scolarum in melius reformando impenderemus operam efcacem. Reformatio described not only the restoration of a dissolved university, but also the renewal of former statutes and the foundation or regulation by statute of a university. The ofcials in the Italian city states responsible for the universities were often referred to as reformatores studii. Since the tenth century Reformatio had been applied to monasteries in its original sense of the restoration of an original form, and when it came to be used in connection with the universities, it meant that, from the very beginning, they had as their task to realize their own particular form, their underlying Platonic idea, their Aristotelian entelechy. As far as the imagination of the new students and the public were concerned, this form was symbolized by a gure of authority. The very rst universities, therefore, invented founders from the distant past. In Paris it was Charlemagne, in Oxford, the English king Alfred the Great. In Bologna they concocted a foundation document according to which the emperor Theodosius II of the late classical period, who had played an important role in establishing Roman law, gave Bologna the right to teach jurisprudence.2 Later foundations authorized by popes, emperors or kings followed the model of one of the two oldest universities founded around 1200, that is, either Paris or Bologna. They only differed in the way they were administered through their scholars, or masters, and in the number of their faculties. Gradually the state university emerged, with its four faculties: the arts or philosophical faculty, offering a general education in the artes liberales and in philosophy, and the three higher faculties, which provided the academic basis for a career as a theologian, lawyer or doctor. The reformatio in melius explains the uniformity of the organization into faculties and the structure of study, with the grades of baccalaureus, magister or licentiatus and doctor, together with prescribed teaching programmes and methods.
1 2

Vol. I, 2834 (Ruegg, Themes). Around 1888 a foundation year of 1088 was invented in Bologna in order to be able to celebrate the jubilee of the oldest university in Europe; cf. vol. I, 24f.

Themes The reformatio was given concrete form in the university statutes. Minute regulations and proscriptions ruled the behaviour of the university members, with the aim of avoiding friction between them and with the general public and of ensuring that the university fullled its purpose as efciently as possible. The norms laid down in the regulations embodied the values then associated with the ideal of the scholar and expressed both explicitly and implicitly in sermons and disputations. In addition to amor sciendi, intellectual honesty, wide-ranging knowledge, and clarity of thought, there were virtues such as humility, a paternal interest in the well-being of the scholars, collegial solidarity and loyalty to the university, and obedience to the ofcers of the university and its ecclesiastical and secular supporters.3 The essential features of this newly emerging academic ethos rested on seven values, which gave a religious legitimacy to amor sciendi and its practice in the universities:4 1. Belief in a world order accessible to human reason underwrote the concept of academic research as an attempt to discern the rational order in Gods creation. 2. The ancient view of man as an imperfect being and the JudeoChristian vision of a creature who had lapsed into sin, together with the associated idea of a limited human intellect, acted as a motor for academic criticism and collegial cooperation, while forming the basis for the conversion of general ethical values such as humility, modesty, respect and self-criticism into the ideal of the academic scholar. 3. Respect for the individual as a reection of the macrocosm or as an image of God constituted the basis for the gradually emerging freedom of academic research and teaching. 4. The establishment of absolute truth as the goal of the academic pursuit of knowledge required the introduction of basic norms, such as sharing information, submitting statements to generally accepted rules of critical examination, and, not least, subscribing to the public nature of the procedures underlying academic research and its results. 5. A readiness to improve ones own knowledge by accepting convincing results from any source, such as the rediscovered Roman law or Arabic medicine and science. Thus from the very beginning there was
3

A. L. Gabriel, The ldeal Master of the Medieval University, The Catholic Historical Review, 9 (1974), 140; G. Lebras, Velut splendor rmamenti. Le docteur dans le droit ` Etienne Gilson (Toronto and Paris, 1959), de l eglise m edi evale, in M elanges offerts a 37388; J. Leclerq, Lid eal du th eologien au moyen-age, textes in edits, Revue des sciences religieuses, 21 (1947), 12148. W. Ruegg, The Academic Ethos, Minerva, 24 (1986), 393412; cf. A. B. Cobban, The Medieval Universities: Their Development and Organisation (London, 1975), 13ff.

 Walter Ruegg a particular value unique to the universities, which in the course of the centuries was to take on a socially revolutionary force: judging knowledge on the basis of its merit, not its source, and accepting the equality and solidarity of their members in carrying out this task. However much modern social history emphasizes the social inequalities in universities, they disappeared completely (at least in principle) when it came to the pursuit and transmission of academic knowledge. 6. Thanks to the appreciation of academic research as a public good, in religious terms as a gift of God, the university in contrast to the guilds and the regional corporations was an open institution. Any freeborn Christian able to study was admitted, and the pecuniary interest in exploiting knowledge was lower within the university than outside. 7. The reformatio put enormous emphasis on prescribed authors and systems of thought, but these were not accepted uncritically. They were scrutinized logically before being admitted as the basis of education. Academic research as the acquisition of knowledge in a cumulative process was based, in the Middle Ages, on the reformatio ad melius. The fact that the world is illuminated by academic research, which at the same time leads towards obedience to God and his servant the emperor (scientia mundus illuminatur ad obediendum deo et nobis, eius ministris, vita subiectorum informatur) was stressed by Frederick Barbarossa in 1155 in his ordinance protecting foreign masters and scholars.5 The student practised obedience when he matriculated at the minimum age of thirteen and had to nd a master who would supervise his studies and his way of life. He practised academic obedience by listening to the prescribed texts as they were dictated and explained by his teachers, and by learning them by heart and repeating them in class. After three or four years of basic study in grammar, logic and rhetoric, he could graduate as a bachelor and either take up an academically non-specialized career as a town scribe or notary, or, under the supervision of a master, learn to become a teacher and educate himself further in the mathematical artes liberales (arithmetic, geometry, music and astronomy) and the three philosophies (physics, ethics and metaphysics). After a total of four years he was allowed to present himself for the masters examination, which brought with it the licentia ubique docendi, the generally recognized teaching qualication. Only a few students who had qualied as masters in the arts faculty went on for a further four to eight years of study to
5

W. Stelzer, Zum Scholarenprivileg Friedrich Barbarossas (Authentica Habita), Erforschung des Mittelalters, 34 (1978), 12345. Deutsches Archiv fur

Themes gain the licentiate in one of the higher faculties of medicine, the two forms of law or theology. Both masters and licentiates could obtain the title of doctor without any extra examinations, simply on the payment of hefty fees. As early as the Middle Ages, therefore, university study already had the levels of bachelor and master or licentiate. Both were retained in the Anglo-Saxon higher-education system as well as in France, since the Baccalaur eat, which forms the school leaving examination, is considered the lowest form of university examination. What today would be deplored as high rates of non-completion was the norm in the medieval period. Most of those entering the university left without taking an expensive examination. In their self-determined period of study they gained the intellectual skills that would allow them to prosper without an academic qualication in areas increasingly dominated by the ability to deal with the exchange of money and letters. An Italian city administration, for example, accepted the possession of the Corpus iuris as a qualication for the post of judge. In the Middle Ages the social function of the university consisted in the dissemination of academic knowledge and methods vitally necessary to reduce rational uncertainty in the socially uncertain situation that prevailed in the realms of politics, the church, the law, medicine and education between 1200 and 1600. The university taught intellectual certainty by subjecting the contradictions between doctrines themselves and between these and the experiences of practical life to a dialectical process, and by nally resolving it in a logical synthesis. The disputations in which students practised this dialectic were an important part of the curriculum in all faculties. This scholastic method corresponded to the Aristotelian and monastic ideal of the vita contemplativa. From the fourteenth century onwards the universities had to contend with the criticism that, with their scholastic method, they were not concerned with individual human beings and their concrete problems, although their main task was the education of medical doctors, lawyers and careerists in public service. As a result, other institutions of higher education emerged. There were state schools for navigation in Portugal and Spain. Learned private circles and academies started up in Italy before spreading to Erfurt, Cracow and Buda.6 Printing also contributed to breaking the medieval universitys monopoly in the production and dissemination of academic knowledge.

T. Klaniczay, Das Contubernium des Johannes Vit ez. Die erste ungarische Akademie, in K. Benda et al. (eds.), Forschungen uber Siebenburgen und seine Nachbarn, Festschrift Attila T. Szabo und Zsigmond Jako (Munich, 1988), 22743. fur

 Walter Ruegg humanism and university reform through dialogue Just a few decades ago scholars focused on the decline, indeed the comatose state of universities in the Early Modern period. The second volume of our series, which appeared in 1996, destroyed this diagnosis.7 On the contrary, the universities contributed to a very considerable degree to the spread of the scientic revolution.8 But they no longer did this within the framework of a unied Europe governed hierarchically by universal powers, but in the role of bridgeheads linking intellectual elites across a confessionally and politically divided Europe. The foundations for these bridgeheads were the studia humanitatis, ` , that is, a humanist the humaniora, humanit es, humanidades, umanita education common to all European states with a shared cultural background. This was the second reform of the universities in Europe, the reformatio of the thirteenth century being the rst. Admittedly, in terms of the list of subjects studied, it only differed in the addition of history and Greek together with an emphasis on rhetoric and moral philosophy. But much more important than the difference in the material studied was the difference in the direction of study in all the faculties. Similarly, just as the vertically oriented Gothic cathedrals were replaced by renaissance and baroque churches with their emphasis on the horizontal perspective, so the aim of university study became not so much that of the scholar, who had scaled the tower of the sciences in order to view the world beyond, but rather the gentleman, the honn ete homme, the enlightened servant and citizen of the state, who educated himself in conversation with the most learned personalities of the past as they imparted to him the best of their thoughts. It was in these words9 that Descartes committed himself to the principle of the structured dialogue, which the Italian humanists had employed to open up a new access to the classical world.10 For the mathematician Descartes and other scientists, the dialogical structure, which also manifested itself in the style of academic publications, changed not only the educational basis of the European elites, but also the concept of academic research itself. Whereas in the vertical perspective of the Middle Ages the academics sat like dwarves on the shoulders of giants and only in this way were able to see further,11
7 9 10 8 Vol. II, 53162 (Porter, Scientic Revolution). Vol. II, xxi (Ruegg, Foreword). G. Lanson, Histoire de la litt erature franc aise, 12th edn (Paris 1912), viii. For this and what follows: W. Ruegg, Die Funktion des Humanismus fur die Bildung politischer Eliten, in W. Ludwig and G. Huber-Rebenich (eds.), Humanismus in Erfurt (Rudolstadt, 2002), 1332. John of Salisbury, Metalogicon III, 4, ed. C. C. I. Webb (Oxford, 1929), 136. Cf. R. K. Merton, On the Shoulders of Giants: A Shandean Postscript (New York, 1965).

11

Themes the humanist dialogue with the authors of the past enabled scholars to undertake voyages of discovery on the high seas, in order to discover new worlds, for which the title page of Francis Bacons Instauratio magna of 1620 provides both an illustration and a commentary.12 In their study of the surviving written sources, the social elites, depending increasingly on written forms of commerce and communication, maintained a dialogue with the authorities of traditional learning. In the process they judged opinions not so much by rules or doctrines, but by degree of persuasiveness. The exchange of letters as a dialogue with personal addressees, often written with publication in mind, linked European scholars with one another and with the political elites in a way that transcended confessional and political boundaries. It made possible the rapid spread and discussion of new ideas throughout the whole of Europe. In 1665 the Journal des sc avans, associated with the Acad emie Royale des Sciences in Paris, and the Philosophical Transactions of the Royal Society of London took on this function. The key function of this humanist dialogue, in which the stranger is recognized as a partner in conversation and then often as a friend, appears most vividly in a letter that Guillaume Bud e, the intellectual father of what was to be the Coll` ege de France, wrote to the Swiss humanist Vadianus in October 1518: their friendship, which had just been forged as a result of the dedication of a book, would not be jeopardized by a war between France and the Swiss Confederation, for what person imbued with humanist values [humanitate literaria imbutus] who had once found friends in foreign lands could renounce them, even if the governments became tired of peace and developed a taste for warlike enterprises?13 Such an attitude, for which Erasmus of Rotterdam is also a model, allows us to understand why, after the collapse of church unity, the Europe of the universities survived. They did not survive, however, as the sole all-embracing institution of higher education. General education was entirely or partly displaced from the arts faculties into residential colleges within the university, which in England continued to operate as an examining body for academic degrees, or outside the university in schools, gymnasiums, lyceums, which prepared students not only for university study, but also for the direct assumption of social roles. Humanist education was so successful in its socially integrating role that Rousseau declared in 1772 that there were
12 13

Vol. II, 6; 16 (Ruegg, Themes). Vadianische Briefsammlung, vol. VII: Erganzungsband (St Gallen, 1913), 9. Text based on the original corrected by W. Ruegg, Humanistische Elitenbildung in der Eidgenossen schaft zur Zeit der Renaissance, in G. Kauffmann (ed.), Die Renaissance im Blick der Nationen Europas, Wolfenbutteler Abhandlungen zur Renaissanceforschung, 9 (Wies baden, 1991), 133.

 Walter Ruegg no longer Frenchmen, Germans, Spaniards, and indeed Englishmen, there were only Europeans. They had all been formed in the same way.14 Academic research also burst the bounds of the university. Either on their own initiative or as a result of invitations on the part of princes, scientic societies, often called academies, brought together university scholars and scientists with members of the academic professions and educated lay persons for the joint discussion and advancement of academic discoveries. Apart from a few leading universities in Scotland, Italy, Germany and the Netherlands, which ushered in the enlightenment by modernizing their curricula, the humanist impulse towards a vita activa and a socially oriented education degenerated in the seventeenth and eighteenth centuries into the sterile pedantry and pretence of learning that Moli` ere and Mozart caricatured so arrestingly. It is not surprising that the French Revolution put an end to universities together with other medieval institutions and carried out that most radical of reforms, the replacement of outmoded forms by new ones. In France the Revolution closed all twenty-two universities and replaced them in the twelve largest cities by technical colleges, grandes coles and schools for medicine and law. Later the Facult e es des lettres and the Facult es des sciences were reintroduced, in order to administer the baccalaur eat examinations, to train secondary-school teachers, and to provide lectures for an educated public. In other countries, too, universities disappeared; in the whole of Europe some sixty had gone by 1815 out of the 143 that had existed around 1789.15 This policy corresponded to the mentality of the enlightenment and its desire to direct higher education towards the transmission of practical knowledge, which served the common good, and to establish professional schools. Thus the leaders of large and small states from Spain to Russia created institutes of higher education to provide an academic training for their military and civilian ofcials. In 1801 the Prussian king expressly demanded that the Academy of Architecture founded in Berlin two years previously should train architects and not professors.16 As in the Middle Ages, the production of their own teachers was still considered to be the main task of the universities. It is thus all the more remarkable that the Prussian universities not only
14

15 16

J.-J. Rousseau, Consid erations sur le gouvernement de Pologne et sur sa r eformation projet ee (ed. J. Fabre), Oeuvres compl` etes (ed. B. Gagnebin and M. Raymond), vol. III (Paris, 1964), 960. Originally the quotation was erroneously attributed to Voltaire (e.g. in O. Dann and J. Dinwiddy (eds.), Nationalism in the Age of the French Revolution (London and Ronceverte 1988), 14); this was corrected by Charles Wirz, curator at the Institut et Mus ee Voltaire in Geneva. With regard to the following section, see vol. III, 7ff. (Ruegg, Themes). Die Technische Hochschule zu Berlin 17991934. Festschrift (Berlin, 1935), 39.

10

Themes survived, but in the nineteenth and twentieth centuries developed into the worlds leading institutions in higher education. The reason is that a General Educational Institute was not established in Berlin, as had been planned, but instead a university was founded in 1810 on the basis of the modern idea of university reform.

the liberal reform of the universities by schleiermacher and humboldt In the French model, given its nal form by Napoleon, higher education dedicated to the training of higher civil servants and ofcers, and the academic professions under the control of the state, fell under a bureaucratically organized administration. The same bureaucracy regulated curricula and examinations in detail, supervised the political and religious conformity of teaching, and subjected the behaviour of the staff to a quasimilitary discipline.17 This model was very successful in the meritocratic selection and specialized training of highly qualied ofcials. Today, however, the unexpected rise of the universities in the nineteenth century is explained even among French historians of universities by that policy of a modernizing revival of the university, which is symbolized by the opening of the University of Berlin in 1810, and is now associated with the name of Wilhelm von Humboldt.18 In the course of his fourteen months in charge of the Prussian education system, the diplomat and scholar, Wilhelm von Humboldt convinced the king that he should reject the French model and found a modern university in Berlin based on the liberal proposals of the theologian and philosopher Friedrich Schleiermacher and charged the latter with carrying them out.19 For Schleiermacher and Humboldt, schools were responsible for disseminating generally accepted and directly applicable knowledge. The task of universities was to show how to discover knowledge by making apparent the principles at the basis of all knowledge in such a way that the ability to work ones way into any sphere of knowledge would emerge.
17 18

19

Vol. III, 33ff. (Charle, Patterns). A. Renaux, Le role eveloppement dune culture des institutions universitaires dans le d d emocratique europ eenne, in N. Sanz and S. Bergan (eds.), Le patrimoine des universit es europ eennes (Strasbourg, 2002), 12331, quotation 126; cf. W. Ruegg, LEurope des universit es: tradition, fonction de pont europ een, modernisation lib erale, ibid., 3948. W. Ruegg, Der Mythos der Humboldtschen Universitat, in M. Krieg and M. Rose (eds.), Hans Heinrich Schmid Universitas in theologia theologia in universitate: Festschrift fur (Zurich, 1997), 15574. Cf. R. C. Schwinges (ed.), Humboldt International: Der Export des deutschen Universitatsmodells im 19. und 20. Jahrhundert, Veroffentlichungen der Gesellschaft fur Universitats und Wissenschaftsgeschichte (GUW), 4 (Basel, 2001).

11

 Walter Ruegg The subject of study was thus for Schleiermacher learning how to learn. The university should teach so that the idea of pursuing knowledge, the highest consciousness of reason, is awakened as a guiding principle in the human being.20 For the founders of the University of Berlin the freedom that lay at the heart of the academic pursuit of knowledge meant not only freedom to study, to teach and to do research, but also freedom in the universitys relationship with the state and the church. It was Humboldts belief that the state had only two tasks with regard to the university: to ensure the richness (strength and variety) of intellectual resources through the selection of the staff, and to guarantee their freedom to carry out their work.21 This liberal model was not as easy to realize as the dirigiste version preferred by Napoleon. Academic freedom of speech and publication fell victim in 1819 to the censorship and control measures agreed in Carlsbad following student demonstrations, and it was only reinstated in 1848. Nor did the introduction of students to academic research through their participation in seminars and laboratories take place quickly.22 Nevertheless, the liberal reform of universities prevailed. Whereas at the beginning of the nineteenth century Paris had been the Mecca of scholars and scientists from around the world, from 1830 on French governments regularly sent observers to Germany to obtain up-to-date information about the advances in the universities there. Many French, British and, later, American scholars were educated at German universities, and by the end of the century they had institutionalized the ideal of the modern research university throughout Europe, the USA and Japan.23 The number of universities increased rapidly. In 1939 there were 201 in Europe, twice as many as had existed one hundred years earlier.24 In addition there were 300 specialized institutions of higher education preparing students for careers in the military, medicine and veterinary medicine, agriculture, education, music, engineering and commerce. These had not, however, replaced the universities, for they were attended by a relatively small
20

21

22

23

24

F. Schleiermacher, Gelegentliche Gedanken uber Universitaten im deutschen Sinn: Nebst einem Anhang uber die neu zu errichtende (Berlin, 1808), 33f. W. von Humboldt, Uber die innere und auere Organisation der hoheren wis Banden senschaftlichen Anstalten in Berlin, in Werke in funf , vol. IV: Schriften zur Politik und zum Bildungswesen (ed. A. Flitner and K. Giel) (Darmstadt, 1964), 25566, quotation 259. B. vom Brocke, Die Entstehung der deutschen Forschungsuniversitat, ihre Blute und Krise um 1900, in Schwinges, Humboldt International (note 19), 367401. W. Ruegg, Humboldt in Frankreich, in Schwinges, Humboldt International (note 19), 24861. Cf. universities and similar institutions in existence between 1899 and 1945, in vol. III, 679706.

12

Themes number of students and aspired, sometimes with success, to acquiring the status and freedoms of the universities. expansion and democratic university reforms, 19561981 After the Second World War the universities in Germany, devastated both from within and without during Hitlers reign of terror, presented a tabula rasa, which Plato considered to be necessary for a fundamental reform of the state and its education system. In the zone of occupation under its direct supervision, the Soviet Union embarked on a total reorganization of the university system based on the Soviet model. In the liberated states of Central and Eastern Europe, this reorganization took place indirectly with the help of the local communist regime. Until the collapse of the Soviet regime in 1989, there were few changes in the Soviet-style university and academy model, but its application varied in the satellite states. In the Western occupation zones of Germany plans for real university reform were discussed intensively, but the occupying forces soon refrained from imposing them and cultural and academic exchange programmes began. These exchanges in marked contrast to the boycott of German academics after 1918 helped to underpin the economic miracle of the 1950s with the politically more important democratic miracle, which in 1968 prevented the growth of extreme right- or left-wing parties. In the liberated states of Western Europe, the governments restricted themselves to rebuilding universities, sometimes adding new disciplines, such as nuclear physics or political science, and in some cases founding modern institutions, such as the Ecole Nationale dAdministration in Paris. Real university reform began after 1955. In France Prime Minister Mend` es-France invited high-ranking gures from business, politics and academia to a conference in Caen on concrete proposals for reform, the immediate effect of which was the expansion of engineering schools, the reform of medical studies, and the promotion of research, especially in the natural and social sciences. In 1957 the Federal Republic of Germany established a Science Council (Wissenschaftsrat), composed of representatives of the federal government, the federal states and the academic community. Its recommendations, beginning with the extension and reform of universities, allowed until 1965 the systematic establishment and equipping of new chairs in subjects already strongly represented at each university. In the United Kingdom a royal commission set up in 1961 examined academic research and teaching. Its results, published in 1963 in the socalled Robbins Report, led to a country-wide network of universities and 13

 Walter Ruegg polytechnics. Similar measures were taken in other countries of Western Europe. The purpose of the reforms was to increase competitiveness vis-a-vis ` the United States and the Soviet Union. They led to a massive increase in the numbers of students, to a considerable increase in the number of staff, though not in proportion to the increase in students, to an initially modest number of new universities (except in the United Kingdom, where they were widespread), and to increased resources for academic research. From the outset, Marxist students in France and in the Federal Republic of Germany criticized this expansive reform as capitalist or technocratic. The emergence of mass universities gave them the numbers to produce political movements using the methods of the American student revolts originated in Berkeley. The starting point was the summer term of 1967 in Berlin when, during a demonstration against the Shah of Iran, a police ofcer shot a student. This triggered solidarity movements in other universities. During the winter term the Emergency Laws (Notstandsgesetze) planned by the Federal Republic provoked sit-ins at lectures, initially in Frankfurt. At the same time, disputes with the administration in the over-crowded social studies faculty in Paris-Nanterre led to disturbances that in May 1968 spread to the Sorbonne and other French universities. The unexpected political successes that followed, and which precipitated a national political crisis, unleashed a hurricane of student protest actions, sweeping the continent as far as the Iron Curtain. In Continental Western Europe, they forced the governments to offer so-called democratic university reforms. In academic governance terms, the bodies consisting of all permanent professors were replaced by committees made up of representatives of the various categories of university members. At the same time administrators ceased to justify university expansion on economic grounds alone, and added the desirability of the democratization of education. In consequence the 1970s saw the foundation of many new universities25 and other higher-education institutions, thereby opening up tertiary education to a growing percentage of the population. The spread of the mass university and the power of committees strengthened the bureaucratization of academic and state university administrations. A striking example is the unprecedented number of successive university laws. At the same time, the ongoing cost of the reforms had such an impact on national budgets that in the 1980s it was no longer possible to nance them fully.
25

Cf. the appendix in this volume with chronological lists of the new foundations in different countries.

14

Themes the introduction of entrepreneurial reforms and the destruction of the ivory tower The crisis rst became evident in the United Kingdom, where the costs of the individual universities were not a part of the governmental budget. From 1919 onwards an autonomous university organ, the University Grants Committee, distributed the states contribution to the universities on the basis of submitted development plans and their implementation. The British universities thus had to compete with one another to nance their basic needs. In 1982 the government cut the new three-year contribution by 12%. Many universities were forced to introduce drastic economy measures, ranging from reductions in salaries and grants to the enforced early retirement of professors and the closing of whole subject areas.26 This dramatic situation induced the Committee of Vice-Chancellors and Principals to investigate the consequences of the shortfall. The Jarratt Report of 1985 recommended the introduction of business-like administrative control systems. As a result the British universities were paid like rms for the various services that they provided. In 19889 they received from the state, by way of the University Grants Committees successor, the Universities Funding Council, an average of 53% of their budgets for securing of high quality research and teaching. Student fees brought in another 15%, which local authorities provided for British citizens; 7% came from research projects supported by the subject-specic national research councils; and 25% came as external subsidies and reimbursements for different services.27 The British universities still gained their funding predominantly through competitive bids for public moneys, but the business methods introduced into their administration brought about greater transparency and planned fund-raising. University reform based on differentiation and competition had also stimulated public interest on the Continent through international comparative studies and conferences of experts.28 Their ideas on competition found concrete embodiment in the British model of university nancing. Consequently, more universities on the Continent began to test their
26

27

28

R. Dahrendorf, Die europaischen Universitaten in einem veranderten sozialokono der Universitat: Jahresvermischen Klima, in W. Kalischer (ed.), Die Internationalitat sammlung 1982: Ansprachen und Referate, Zusammenfassung der Plenardiskussionen. Konstanz, 3. und 4. Mai 1982, Dokumente zur Hochschulreform, 50 (Bonn and Bad Godesberg, 1982), 12139, quotation 136. J. Brennan and T. Shah, Higher Education Policy in Great Britain, in L. Goedegebuure et al., Higher Education Policy: An International Comparative Perspective (Oxford, 1993), 17693. W. Ruegg, Diversication and Competition in Higher Education, International Journal of Institutional Management, Higher Education, 2/11 (1987), 22132.

15

 Walter Ruegg autonomy through performance agreements over several years with their governments. Autonomy in most universities meant nothing more than the management of deciency, but it induced universities to prepare themselves for a new role as entrepreneurial teaching and research bodies. This forms the second main theme of this volume. Since the late nineteenth century the universities have been compared to ivory towers to symbolize their arrogant distancing from the world. This charge can hardly be laid at the door of the entrepreneurial university. Yet the ivory tower did not originally symbolize arrogant withdrawal from the world. In the twelfth century it stood for the casing in which the salvation of the world was segregated for a while in order to grow for its role in the world. The Virgin Mary was compared to an ivory tower because she had carried the Saviour in her pure womb until He entered the world.29 No doubt no one at that time would have linked the activities of scholars and masters with the purity of the ivory tower. But as a space protecting individual growth, the university was compared with a tower, up which the student climbed from the basement of grammar up through the oors of the artes liberales and philosophy. En route he looked down on the general public through narrow windows before nally rising as a theologian through the clouds to the attics of metaphysics.30 Scholars and masters, especially in universities based on the Paris model, were clerics who lived in monasteries or monastic-like buildings, and whose separation from the general citizenry can still be experienced by the visitor to a college in Oxford or Cambridge. This separation only increased the authority of the university over important sectors of public life. The law schools provided an appropriate civil and criminal law for a growing international trade and, in fullling their spiritual and intellectual tasks through the extension and binding interpretation of the canon law of the Roman Catholic Church, the development of the rst modern administrative structure in Europe. The theological faculties provided the church with arguments to preserve and enforce orthodoxy, while the medical faculties developed rationally based procedures and techniques to preserve and restore the health of prominent persons in public life. Translated into the horizontal dimension of the secularized world, the symbol of the ivory tower corresponded to Wilhelm von Humboldts idea of the university. His famous denition of the university of 1809 ends with a sentence that attracts too little attention:
29

30

R. Bergmann, Der elfenbeinerne Turm in der deutschen Literatur, Zeitschrift fur deutsches Altertum und deutsche Literatur, 92 (1963/64), 30320. G. Reisch, Margarita philosophica, Freiburg 1503, in G. Munzel, Der Kartauserprior Gregor Reisch und die Margarita philosophica (Freiburg/Breisgau, 1937), g. 1: Der Turm der Wissenschaften (The Tower of the Sciences).

16

Themes
Listening to lectures is only a minor matter, the essential thing is to live for a number of years in close community with like-minded colleagues of the same age in the consciousness that there is in the same place a number of those whose education is complete and who dedicate themselves fully to the enhancement and spread of scholarship and science.31

These peculiar conclusions, drawn from his famous principles of freedom and solitude (Freiheit und Einsamkeit) underlying university organization, are found in his report on the Lithuanian school plan, and were thus derived directly from Humboldts ofcial task, which was to reorganize the Prussian school system within the framework of Steins administrative reforms. The sentence quoted makes it clear that, according to Humboldt, the university best fulls its social function when it offers its students, the future senior civil servants and members of the publicly regulated free professions, a protective space where they can educate themselves for their professional roles. The professors, characterized by Humboldt rather too atteringly as completely educated, promote this self-education of the students less as teachers who could intimidate the students with their superior knowledge and ability than as examples of a disciplined search for knowledge, which mould personalities able to solve problems with rational methods. This method of preparation for public service allowed the universities to present themselves very rarely to the public. Certainly, university teachers and students were present in the public sphere in many social and political roles. Yet as an institution the university rarely emerged from its ivorytower isolation. The French facult es des lettres were an exception, since their lectures were primarily addressed to the general public. In other countries the public offerings of universities were limited to the annual commemoration of its founders or foundation, to other manifestations of remembrance, and to rare processions to celebrate a university jubilee. Each year on 6 August the rector of the Konigliche Friedrich-Wilhelms University in Berlin remembered its founder in a public oration that usually combined historical references with the discussion of an actual contemporary problem. Thus in 1893 the famous professor of medicine Rudolf Virchow praised the advances in the natural sciences since the foundation of the university and warned against pseudo-scientic movements, especially the anti-Semitism that was rife even among academic youth.32 Early in 1900, at the express wish of the king, the Prussian universities celebrated the beginning of the twentieth century, one year too early in fact, and praised their role in the rise of Germany as a
31 32

Humboldt, Innere und auere Organisation (note 21), 191. Cf. vol. III, 19 (Ruegg, Themes).

17

 Walter Ruegg world power. In Berlin, the speaker the classicist Ulrich von WilamowitzMoellendorf put into perspective the internationally accepted superiority of German scholarship and science: Germany was only giving back what it had received from other nations; in the worldwide relay race of nations towards the goal of a world society, it had taken over the baton in the nineteenth century for transmission to the USA in the twentieth.33 The topical question which Wilamowitz-Moellendorf discussed in his oration concerned the monopoly right of the humanist gymnasium to award the Abitur qualication for admission to the universities. Already in 1890 the king wanted to abolish this monopoly. The head of university affairs in the Prussian Ministry of Education, Althoff, hoped to overcome conservative resistance in parliament and in important pressure groups with the help of this leading classicist, and thus encouraged Wilamowitz-Moellendorfs move from Gottingen to Berlin. Wilamowitz obliged by launching a devastating critique of classical antiquity as a model for modern education and contributing to the opening of the universities in 1900 to successful Abitur candidates from other types of secondary school.34 Another reform in the same direction had occurred the year before, when the technical universities gained the right to award doctorates, thus obtaining a legal status equal to that of the universities. In 1905 the University of Berlin went a step further with a programme of professorial exchanges with the USA. In 1906 the speech at the universitys commemoration of its founder took up the question of whether visiting professors from abroad should use their mother tongue or that of the audience an issue still topical today but eased somewhat by the prominence of English in the academic world.35 Not only in Germany was the university viewed as an exclusive, socially prestigious institution, which, without having to take any special measures, enjoyed the esteem and support of the public. This status was expressed in the monumental buildings erected by many European states, not only for ministries and higher courts but also for their universities. A Danish scholar wrote in 1889 that in the new buildings of the Swedish university of Uppsala the nest rooms were used for concerts and balls as well as for housing state and academic authorities. The real purpose of the university, academic teaching, was restricted to the smaller rooms. Everything signals to the students, make a real effort, rise until you can
33

34

35

U. von Wilamowitz-Moellendorff, Neujahr 1900, in U. von Wilamowitz-Moellendorff, , 4th edn (Berlin, 1926), vol. II, 3555. Reden und Vortrage W. Ruegg, Die Antike als Leitbild der deutschen Gesellschaft, in W. Ruegg, Bedrohte Lebensordnung: Studien zur humanistischen Soziologie (Zurich and Munich, 1978), 93105. Rede zur Gedachtnisfeier U. H. Diels, Internationale Aufgaben der Universitat: des Konig Stifters der Berliner Universitat Friedrich Wilhelm III in der Aula am 3. August 1906 (Berlin 1906).

18

Themes become professors, then you will get comfortable chairs and splendid portraits by great masters on the walls.36 In this caricature the ivory tower appears to have been reduced to a tness centre for future professors. But the main point of the grand buildings was to indicate that cultural events and social festivities gained lustre when held in university settings. The two world wars, which revealed the murderous underside of scientic discoveries, did not tarnish the prestigious image of the university. Indeed, the unexpected shortage of university graduates after 1945 worried the governments of Western Europe, which embarked in the 1950s on the expansionist reforms already discussed. At the same time, public and private foundations generously supported academic research. There followed an expansion of student grants based on social and in part intellectual criteria, in order to make better use of the talent pool. Not only was entrance to the ivory tower widened, the universities also began to take a more active role in shaping their relationship with the public.37 They ran courses for students resident outside the universities: the radio college in Frankfurt38 was opened in 1966 followed in 1969 by the Open University in Milton Keynes39 and by similar developments in other countries. In 1964 the West German conference of university rectors recommended that universities set up their own press ofces to inform the public about their activities.40 The university administrations began to implement this suggestion in 1966, at rst with the help of private foundations.41 The transition to entrepreneurial management in the 1980s caused the universities to intensify their public relations work.42 They did not recoil from using marketing methods. Lectures that had been open to the public but without arousing much response were now offered as The University of the Third Age, and they lled auditoriums with members
36

37

38

39

40

41 42

G. Brandes, Tale i Upsala (1889), in G. Brandes, Samlede Skriften, vol. XV (Copenhagen, 1905). W. Ruegg, Hochschule und Offentlichkeit: Speech Held at the Installation of the Rector, Frankfurter Universitatsreden, 40 (Frankfurt/Main, 1965). J. Greven (ed.), Das Funkkolleg 19661998: Ein Modell wissenschaftlicher Weiter bildung im Medienverbund, Einfuhrungen Auswertungen Dokumentation (Weinheim, 1998). W. Perry, Open University: A Personal Account by the First Vice-Chancellor (Milton Keynes, 1976). und Presse: Empfehlung der Westdeutschen Rektorenkonferenz, Berlin, 5. Universitat 7. Februar 1964. Reprint in W. Becker (ed.), WRK, Stellungnahmen, Empfehlungen, Beschlusse, 19601989, vol. I (Bonn, 1989), 31f.; cf. Zur Offentlichkeitsarbeit der Hochschulen und zur Einrichtung von Presse- und Informationsstellen: Erklarung der 86. Westdeutschen Rektorenkonferenz. Bonn-Bad Godesberg, 26. Januar 1971. Reprint, ibid, 27985. In 1966 that was the case at the University of Frankfurt. Zur Offentlichkeitsarbeit der Hochschulen: Empfehlung des 176. Plenums der Hochschulrektorenkonferenz, Juli 1995, Dokumente zur Hochschulreform, 102 (Bonn, 1995).

19

 Walter Ruegg of the public that had taken the time to enrol in the new university institution. The success of this programme led to the introduction of the Childrens University, in which motivated youngsters could share in the adventure of academic research while their taxpaying parents convinced themselves of the value of the university. Today universities advertise themselves to the world through their web pages. Many regularly present their academic achievements in multicoloured format and inform the reader about their distinguished faculties, activities and plans. The development of a new logo and so on for a university is pursued with the energy and expense of a medium-sized research project. In short, packaging and marketing have become, if not more important than the fullling of their tasks of teaching and research, at least an essential factor for the management of the entrepreneurial universities. The demolition of the ivory tower by the market-oriented opening up of the university was in full swing by 1995. The market had always been important for universities. They came into being round 1200, when the demand for the academic education of clerical and secular elites brought so many students to Paris and Bologna that corporate bodies were created to augment the individual scholar teacher relationship. The market also determined over the years the longand short-term waves of expansion and decline in the universities and defeated every attempt to orient their capacity to absorb student numbers in the various subject areas according to guesses, usually erroneous, about the future development of the market. Yet in those times the alternation of supply and demand in academic education took place on such a modest scale that most adaptations were caused by scientic progress and restricted to new areas of study and to specialized universities. The big changes came with the mass university after 1960. The huge numbers of new universities founded from 1968 onwards only provided a temporary respite for the older ones (in the larger towns of France, the new derived from division of the old). Many of the new foundations turned into mass universities. The governments hoped to take some of the pressure off the universities by offering an academic preparation for a practical career in the shortest possible time. The English polytechnics, the French IUTs, the German Fachhochschulen and the corresponding institutions in other countries performed this task splendidly. Nonetheless, they did not improve the situation at the universities. On the one hand, they could take only a relatively small number of the new students, and those rejected turned to the universities. On the other hand, many intermediary institutions applied for and received the status of universities with the right to do fundamental research and grant doctorates. Many of the more than 600 new universities founded between

20

Themes 1945 and 1995 developed out of such intermediary institutions. The university status did not raise their capacity and was irrelevant for the problem of the mass universities. The multiplication of European universities from 200 to over 800 in 199543 reected less an increase of their public inuence than an inationary decline to provinciality. This is clearly shown in a comparison with the United States, where, in 2005/6, there were 4,276 post-secondary institutions offering a state-recognized nal qualication. Some 1,694 provided only two years of study. Of the 2,582 four-year institutions, 1,049 limited themselves to the study of a single subject such as medicine, business, theology, ne arts or engineering. In 637 colleges, study led only to a bachelors degree, whereas in 638 of them it was possible to continue to a masters degree. In the fty federal states and the District of Columbia there were only 258 universities (165 state-supported and 93 private) that also regularly awarded doctorates (yearly at least twenty doctorates in more than four disciplines). Together they made up hardly more than 6 per cent of the degree-granting institutions of American higher education and less than a quarter of the number of European universities.44 The small number of universities in a broadly differentiated range of tertiary education cannot be ascribed to market orientation. It is only possible in democracies, which recognize the academic degree or title as a sign of academic education, and yet do not regard it as necessary to procure general advantages in careers or social prestige. As long as the nature and length of a successful period of university study provides access to privileged career paths in the public service and in bureaucratically organized rms, then the inationary growth and consequent qualitative provinciality of European universities will continue, even in those countries whose politicians and businessmen do not bear the title of professor. Provinciality in the literal sense of the word indicates that Europe has lost its leadership in higher education. The Erasmian sancta quaedam communitas eruditorum developed into a worldwide scientic community. Europe has become just one of several provinces in a global education sphere. The national authorities responsible for higher education have been supplemented and are being increasingly replaced by supranational institutions. This forms the third main theme of this volume.

43

44

Numbers for 1939/49: vol. III, 3, IV, ch. 2, table 5. Numbers for 1995 according to the appendix in this volume. NCES National Center for Educational Statistics, Integrated Postsecondary Education Data System (IPEDS) (Fall 2005), table 249. Degree-granting institutions and branches by type and control of institution and state of jurisdiction.

21

 Walter Ruegg the universities and globalization A new chapter entitled Exporting models appeared in the second volume of our History of the University in Europe. It dealt almost exclusively with Latin America and the English colonies of North America between 1500 and 1800. The third volume, dealing with the period 18001945, had to include the other parts of the globe as well. Quantitatively and qualitatively the chapter dealt mainly with those states in Latin America and especially North America that had become constitutionally independent or, in the case of Canada, were in practice independent. Japan founded state and private universities on the German and the American model, while China established some also on the English model. The universities of other countries were offshoots of the colonial powers. Englishmen or Indians trained in England taught in India; Gandhi was representative of many other Indians in completing his studies in England. The University of Algiers was the jumping off point for the careers of important French academics, and at the Cit e universitaire in Paris a student hostel built for students from Indochina provided a place to prepare themselves for their future as revolutionary leaders. Today Indian professors, doctors and lawyers are found in universities throughout the world. A few years ago the German government attempted to ease the shortage of IT specialists by recruiting graduates from Indian universities. Colleges and universities in former European colonies in Africa and Asia no longer follow European models but American ones. A ranking list of world universities, issued by a Chinese university, was received very positively in Europe although only a few European universities gured among the rst fty. Despite the fact that Europe has not become just one of the many university provinces of the world, as far as the status of its universities is concerned, it has fallen a long way behind North America. The globalization of university relationships began after the end of the Second World War with the exchange of professors and researchers. Since 1948 the Fulbright Program has enabled some 250,000 graduate students, university teachers and administrators, 40% from the United States and 60% from 140 other states, to extend their education at foreign universities and, as Fulbrighters, to remain in touch through alumni associations. The American example was followed in Europe. The Alexander von Humboldt Foundation, set up in Bonn in 1953, has supported 25,000 highly qualied scholars who have formed permanent associations in their home countries.45 Governments have provided the considerable funding
45

http://exchanges.state.gov/education/fulbrigh44t/ (16 April 2005); C. Jansen and C. Nensa, Exzellenz weltweit: Die Alexander von Humboldt-Stiftung zwischen

22

Themes required for such initiatives, and probably not just for the publicly proclaimed goal of international understanding. But the exchanges had an impact far wider than was intended by those who nanced them. This wider effect in the university sphere may also be seen in some supranational institutions established after 1945, again on the initiative of the Americans. In 1948 the Organization for European Economic Cooperation (OEEC) was founded to carry out the Marshall Plan for the reconstruction of a devastated Europe. After reconstruction ended in 1960, the OEEC continued as the Organization for Economic Cooperation and Development (OECD). Article 2 of its statutes gave the OECD the task of developing aid in the scientic and technical sphere and furthering research and professional training in order to achieve its goals (economic growth, full employment and a rising standard of living). There followed not only a substantial research programme (between 1962 and 196846 ) but also a series of inuential regular evaluations of the university and research policies of its member states. More recently, the OECD gained a broader pedagogical inuence through PISA (Programme for International Student Assessment), which is an internationally standardized assessment that was jointly developed by participating countries and administered to fteen-year-olds in schools. Half a century ago the question was raised whether actions of such political consequence should not be controlled by politically legitimized bodies. A proposal to require political legitimization failed, owing to what was described as the excessive workload of parliamentarians who had to represent their various countries on many international bodies at the same time.47 Such an argument would hardly stand up today, but still the question Quis custodiet ipsos custodes? (who guards the guardians?) is rarely answered. The United Nations Educational, Scientic, and Cultural Organization (UNESCO) initially concerned itself with the educational problems of developing countries. Three initiatives in university policy had a lasting effect. In 1963 UNESCO founded an Institute for Educational Planning in Paris, in 1973, a European Centre for Higher Education (CEPES) in Bucharest, and in 1950, an International Association of Universities (IAU), which has grown into a world body of some 600 members.48 The IAU publishes regularly a global directory of World Higher Education
Wissenschaftsforderung und auswartiger Kulturpolitik (19532003) (Cologne, 2004), 8. See chapter 3, p. 99 note 97. K.-J. Maass, Europaische Hochschulpolitik: Die Arbeit des Europarats im Hochschulbereich 19491969, Schriftenreihe zur europaischen Integration, 7 (Hamburg, 1970), 77. G. Daillant, Universality, Diversity, Interdependence: IAU 19501990, A Commemorative Essay (Paris, 1990).

46 47

48

23

 Walter Ruegg containing not only universities entitled to award doctorates, but also other state and privately funded tertiary-sector institutions.49 The cultural committee of the Brussels Pact of 1948 received the charge of improving cooperation among West European universities. Its leaders met in 1955 at a conference in Cambridge and decided to found a Standing Conference of European Rectors (CRE), which came into existence in 1959 in Dijon.50 The organization was all the more important because the Council of Europe, founded in 1949, had turned down the idea of a European association of university heads. It made university matters the responsibility of its Council for Cultural Cooperation (CCC), composed of government representatives, and its Committee for Higher Education and Research (CHER), consisting of two delegates from each member state, one of which represented the government and the other the universities. After a number of interventions by the national conferences of university rectors and vice-chancellors, the university member was nominated by the universities and not by the government. The CHER submitted recommendations and reform projects to the CCC, but it could not inuence their later fate. Relatively few decisions of the Council of Europe in relation to the mutual recognition of university entrance requirements and qualications were ratied.51 Bilateral agreements between the national rectors conferences on equivalences of diplomas therefore remained until the 1990s the usual procedure for the mutual recognition of studies in foreign countries. The Rome treaties of 1957, directed to economic goals, contained only two proposals relating to the university sphere. Initially, therefore, the Council of Ministers had members responsible for agriculture and economics, but not for education or research. Today the European Union has a very considerable inuence on European university policy and will have an even bigger role in the future. How has this come about? The foundation of the European University (in Florence), provided for in the Euratom Treaty and pursued energetically by the Italian government, met with enduring resistance from university bodies, as did other similar ideas put forward beginning in 1947. Universities were not willing to accord the status and name of a European University to a single institution and thus indirectly to downgrade their own institutions to a national level.

49 50

51

IAU World Higher Education DATABASE 2005/6. H.-A. Steger (ed.), Das Europa der Universitaten/LEurope des Universit es/The Univer sities Europe: Entstehung der Standigen Konferenz der Rektoren und Vize-Kanzler der europaischen Universitaten 19481962, Dokumentation (Bad Godesberg, 1964); cf. 40 ans CRE, CRE-action, 115 (1999), Suppl ement. Maass, Europaische Hochschulpolitik (note 47), 259, 12734.

24

Themes In 1970 an innovative compromise found favour: a proposal to establish not a European University but a European Graduate College. In 1976, in the Badia Fiesolana of San Domenico above the city of Florence, the European University Institute for Doctoral Studies in the Social Sciences opened. Cooperation between the rectors conferences of the six EEC states and the European Commission played a major part in this outcome. Their cooperation arose from an obstinate struggle around the EECs second university-related task to establish guidelines for the mutual recognition of the diplomas, examination certicates and other proofs of competence that then restricted the free movement of people and services.52 The rst draft of these guidelines, put forward in 1969, made the free professional practice of medicine dependent on completion of a certain number of study hours in the medical subjects recognized at the time; if they had been accepted, the guidelines would have paralysed curricular reform and undermined the autonomy of universities in their most sacred areas. An obstinate resistance movement took root within the rectors conferences and the universities of the EEC member states organized in the European Rectors Conference. Finally, the Commission withdrew the proposal and invited a liaison committee in Brussels made up of representatives of the rectors conferences of the EEC states to participate at the elaboration of a more exible series of guidelines based on qualitative rather than quantitative criteria.53 The difculties experienced in achieving this goal prompted the EEC for the rst time to call a conference of the education or research ministers of the six member countries (on 16 November 1971). It charged a committee composed of academics of the old and would-be Member States to enquire into the possibilities of widening the educational and scientic policy within the framework of the Rome treaties.54 The report, published in 1973, noted that the application of the Rome treaties makes it necessary to deal with the whole problem of the education of young persons and adult education insofar as it is an inherent part of the obligation to achieve the best possible economic development. The report offered general conclusions and concrete recommendations that made it
52 53

54

W. Ruegg, La CRE, autonomie et cadre europ een, in 40 ans CRE (note 50), 313. W. Ruegg, La coop eration entre les universit es europ eennes. Kolloquium in Grenoble. Tagungsbericht, Integration. Vierteljahrshefte zur Europaforschung, 4 (1970), 323 6. W. Ruegg, Les relations entre les Communaut es europ eennes et les e tablissements denseignement sup erieur en Europe. Le point de vue des universit es, in Semaine de Bruges 1973: Universit e et soci et e. Pour une politique europ eenne de lenseignement sup erieur, Cahiers de Bruges, n.s. 32 (Bruges, 1974), 25360. eine gemeinschaftliche BilThe Commission of the European Communities, Fur dungspolitik, Bulletin der Europaischen Gemeinschaften, Beilage, 10/73 (Luxemburg, 1973), 9f.

25

 Walter Ruegg possible for the European Community (EC) and the EU to extend their activity to European cultural educational and research policy.55 The recommendations proposed at rst the creation of a common research centre and a European Scientic Foundation,56 but the European Commission accepted the argument that a European Scientic Foundation should at least include all the free countries of Europe. Thus, in cooperation with the EC and yet independent of it, the European Science Foundation (ESF) was founded in 1974, with its seat in Strasbourg.57 A decade later the EC started its own programmes to encourage student mobility and inter-university cooperation with study and research projects in areas known by imaginative acronyms such as ESPRIT (European Strategic Programme for Information Technology) 1984, EURECA (European Research Common Action) 1985, Comett (Community Programme for Education and Training for Technology) and Erasmus (European Action Scheme for the Mobility of University Students) 1987. The success of these projects prompted the European Free Trade Area (EFTA) states to take part in them, so that the research and university policy of the Union became the model for large parts of Europe. The Memorandum on University Education in the European Community of 1991 strengthened cooperation on university policy between the European Commission and the European universities.58 The EU gave the Confederation of European Union Rectors Conferences, which had succeeded the Liaison Committee of the rectors conferences, in Brussels more and more tasks to execute autonomously. In 2001 it merged with the Conference of European Rectors (CRE) in Geneva to become the European University Association (EUA), located in Brussels.

the americanization of european universities Part IV of this volume, Learning, testies to the leading role of the American universities in the natural, life and social sciences, and increasingly also in the humanities. The American hegemony derived from successful adoption and further development of the ideas of the European university, especially the combination of teaching and research that the German universities developed in the nineteenth century. From 1825 onwards, the adoption of the German professional faculties was discussed and rejected. When the state of Michigan entered the Union in 1837, it founded a university on the German model, with secondary schools based on the
55 57 58 56 Ibid., 53. Ibid., 11. European Science Foundation, Report 1975 (Strasbourg, 1975). F. van Vught and D. Westerheijden, Institutional Management for Quality. The CRE Programme: Background, Goals and Procedures, CRE-Action, 107 (1996), 9151.

26

Themes German Gymnasium the task of which was to prepare students for the university. This direct borrowing had few echoes.59 Lasting success occurred by combining a college that offered bachelors and masters degrees with research-based graduate and professional schools at the Johns Hopkins University in Baltimore, founded and endowed in 1876. The graduate school prepared students for a PhD as the testimony of a comprehensive academic education. The professional school, at rst intended for medicine only, had as its nal qualication a specialized qualication, the MD. Johns Hopkins had no difculty in nding employers for its excellently educated academic products, and the combination of the college with the attached schools not only formed the basis for new foundations such as the University of Chicago, but also gradually established itself in older universities such as Harvard and extended the university concept to professional schools such as MIT. In 1900 a group of nine private and three state universities founded the Association of American Universities (AAU) in order to strengthen and unify doctoral studies in the USA.60 Since then only institutions in the USA that possess the ofcially acknowledged right to award doctorates and do so on a regular basis can be considered universities. As mentioned earlier, there are approximately 260 such institutions, of which only 60 American and 2 Canadian universities have been accepted as members of the AAU. It is through these leading institutions that the university ideal of an academic education through research has become a worldwide model, with its attendant demanding bachelors and masters courses. The emergence of the American research university shows that the foreign model was applied successfully only when its basic idea was adapted to the conditions of the new environment. It was adopted across the United States not by governmental initiatives, but by successful competition with other institutional models; the universities themselves embraced and developed it, and then the federal states accepted it as the standard by which new universities are recognized. In the model process, certain idiosyncrasies of the alien system were ignored, such as the autocratic position of the individual professor, the unpaid teaching of the Privatdozenten, and curricula free from checks on performance right up to the nal examination. From the bachelor to the doctorate the students freedom to educate themselves rather than the contents of the curriculum formed the basis of teaching. The American universities introduced after 1900 the
59

60

J. Herbst, The Yale Report of 1828, International Journal of the Classical Tradition, 2/11 (2004), 21331, especially 223f. Cf. H. Rohrs, The Classical German Concept of the University and its Inuence on Higher Education in the United States (Frankfurt/Main, 1995). Quotation from AAU Internet Homepage 2006.

27

 Walter Ruegg pedagogical democratization which had been put forward by John Dewey, and which took seriously the position that students are responsible for their own learning. To prepare themselves to be partners in the teaching sessions and in their search for knowledge, the students are expected to master a demanding reading list in their own free time and usually on their own, in such a way that Humboldt saw freedom and isolation as the organizing principle of the modern university. For the administration and management of the universities the Americans kept the model of the entrepreneurial organization developed in the seventeenth century. When the American colonists began to found colleges to educate and train their priests and other public ofcials, they were happy to take over the humanist subjects of study from Oxford and Cambridge, but not their system of corporate self-governance. In order to provide a materially secure base for the liberal arts colleges in an environment in which Plato, Cicero and Euclid had been strangers, they appointed an entrepreneurial director responsible to a board of trustees made up of people from their own ranks. The Puritans were familiar with this form of leadership from the Nonconformist academies of England, which had had to survive in a hostile religious environment.61 This entrepreneurial form of management proved effective. Through private sponsorship it secured the autonomy of any college recognized by a state so effectively that a court case, introduced by Dartmouth College in 1816 against state interference, led to a wide-reaching judgment from the Supreme Court, which secured the independence of the universities.62 The state universities founded in the nineteenth century took over the entrepreneurial management and administrative structure of the college and thus also learned to solve their nancial problems. Today the private universities cover almost half of their expenses through private means, and the state universities have to add a considerable income from private and public sources to their state funding. The entrepreneurial management style necessary to achieve this is in no way detrimental to an academic education based on research. All this agreed with Wilhelm von Humboldts view that the role of the state was above all to guarantee the autonomy of the university faculty.63 Consequently, he had proposed in his plan for the University of Berlin that the state should make over property to the university,
61

62

63

Vol. III, 166f. Cf. S. E. Morison, The Founding of Harvard College (Cambridge, Mass., 1935). B. I. Wheeler [President, University of California], Unterricht und Demokratie in Amerika: Die Quellen der offentlichen Meinung, das College, Universitaten, Studentenleben, Schule und Kirche in den Vereinigen Staaten. Vorlesungen, gehalten an der (Strasburg, 1910), 707. J. Herbst, From Crisis to Crisis: American Berliner Universitat College Government (16361819) (Cambridge, Mass., and London 1982), 23243. See p. 12.

28

Themes which the university could administer itself, so that the income from this property, rather than direct contributions from the state budget, should provide for its expenses.64 If the idea had not been rejected by his successor, the modernized concept of the university in Berlin in 1810 could also have embodied the modern self-governance of an entrepreneurial university.65 The European Commission in its report of 1973, For a Common Education Policy, raised a question still of direct relevance to universities:
Taking into account the growing size of companies, the increasing specialization and the degree of international cooperation with all the associated scientic and technical developments, can one really contemplate European economic integration without considering a simultaneous Europeanization of the great universities ? By Europeanization we mean that these universities will train their academic teachers, their researchers, and their students and will obtain their resources in such a way that their politics and their initiatives will so develop as if the Europe of the Nine represented their natural environment, as is the case for the American universities in their vast state territories.66

postscript Today (2007) the notion of the Europeanization of the universities based on the model of American universities is not merely a futurist vision. The European University Association brings together 760 universities from forty countries throughout the whole of Europe and works through the national rectors conferences for the realization of a common educational area. Many European universities will be able to develop into top universities in the face of worldwide competition. What the American higher education institutions from the seventeenth century onwards had to take into account has also been brought home to European universities as a fact of life by the rapid growth in university-level institutions after the Second World War. The inuence of university teaching and research today now requires forms of organization that are not restricted to the relationship between the university and its state funding body. Universities must now full their manifold tasks in cooperation with a variety of social partners from the local to the global level. The current Europe of twenty-seven EU Member States cooperating with the EFTA states on university policy has laboured in vain with the Erasmus and Socrates programmes to increase mobility within Europe
64

65 66

Berlin, Schriften, vol. IV W. von Humboldt, Antrag auf Errichtung der Universitat (note 21), 33, 117f. Kommission der Europaischen Gemeinschaften (note 54), 12. These being by no means always the ones with the greatest number of students.

29

 Walter Ruegg to what was the norm until the eighteenth century, i.e., 10 per cent of students. This is now to be achieved by a formal harmonization of student degrees agreed at the conference of European education ministers in Bologna in 1999 and due to come into effect in 2010. Even though this goal cannot be attained, at least the Bologna process has brought about a long-overdue curricular reform. This reform must not be perverted by bureaucratic impositions that turn the majority of European universities into provincial teaching bodies like the American version so horrifyingly caricatured in Edward Albees Whos Afraid of Virginia Woolf? The university has undergone many reforms in its 800-year history. That it has not only survived these but gone on to spread throughout the world is owed mainly to its students. Because of their academic training they were able to remove fossilized structures and mistaken initiatives in the way the universities worked. Some of them, as employees of the universities, developed new perspectives and methods, while still others supported the universities as exponents of public debate both politically and through their professional careers. These graduates harmonized the basic idea and ethos of the university with its changing environment and, in the process, modied the very process of change. This is also true for more recent reforms; they will favour universities that apply the Bologna process and other elements of Europeanization as independently and thoughtfully to their own environment and the world outside them as the predecessors of the top American universities did when they adopted European models. Then, even after toppling the ivory tower, European universities will be better able to full the basic task they have shouldered since the Middle Ages: that of creating an inspirational space for the adventure of the academic search for knowledge and the development of educated individuals.

30

CHAPTER 2

PATTERNS

GUY NEAVE

introduction Few institutions escape entirely from the consequences of war, particularly so when the conict involves the ideological and physical mobilization of whole populations, young and old, civilians, soldiers and noncombatants alike.1 The inuence of war upon the development of the university in Europe has been an important, if not always closely studied, phenomenon. The so-called Humboldtian model of university was forged in the aftermath of the Battle of Jena;2 the shaping of the French education system in the reforms associated with the Napoleonic university took place against a similar martial background 3 and, somewhat farther aeld, the roots of modern American higher education were laid by the Morrill Act passed in 1862 in the midst of civil war.4 There are, however, cogent reasons for considering the Second World War as a marker point in the development of the university in Europe. This war was less a matter of territorial conquest than a confrontation between ideologies and values expressed in the political order that each side enshrined. Since the education system is the prime instrument for the diffusion and perpetuation of such values, schools and universities formed a crucial and central part in that other parallel conict which went on behind the front, namely the battle for hearts and minds. Whether as the repository of the nations historic memory, as quintessential of a countrys
1

The precise and long-term consequences of modern war upon educational change are beginning to attract increasing attention amongst historians of education. See, for instance, R. Lowe (ed.), Education and the Second World War: Studies in Schooling and Social Change (London and Washington, 1992). T. Nybom, The Humboldtian Legacy: Reections on the Past, Present and Future of the European University, Higher Education Policy, 16:2 (2003). 4 Ibid., 168. See vol. III, 34.

31

Guy Neave national values or, nally, as a concentration of the nations highest qualied manpower and research capacity, the university in Europe stood at the forefront of the battle. Academic work was as much a strategic resource in its own right as the more visible forms of production that sustained an industrial nation at war. In the territories occupied by Nazi administration, sustained attempts were made to bring schools and universities if not under direct control of those sympathetic to the occupier, then at least to ensure that his ideas had favourable reception.5 In Eastern Europe, and particularly in Poland, attempts to eradicate both national identity and the institutions by which this was perpetuated involved wholesale destruction of both schools and universities.6 The obverse is equally true. Defence of national identity and the rst glimmerings of what were later to emerge as resistance movements, whether organized or not, found their roots amongst students and staff in the universities of Belgium,7 France8 and the Netherlands,9 and attained its most heroic expression in Poland.10

post-war reconstruction Three strands of thinking may be identied within the university reform that emerged at wars end. The rst of these was internal to the individual nation. It was often the result of governments newly restored from exile assessing the performance less of whole systems than of the part played by individual institutions in sustaining wartime regimes. Not untypical of this was the foundation of the Ecole Nationale dAdministration as a Republican counterweight to what was seen as the ambiguous role of the Institut dEtudes Politiques11 in the training of high civil servants who had succoured Vichy. The second and third strands which emerged in the course of the wartime discussions between the Allied Powers and the exiled governments of occupied countries derived from the need for a moral
5

6 7

10 11

For a closer examination of this in Belgium, France and the Netherlands, see G. Neave, War and Educational Reconstruction in Belgium, France and the Netherlands 1940 1947, in Lowe, Education (note 1), 84127. J. Szczepanski, Systems of Higher Education: Poland (New York, 1978). ` lhistoire de la R G. K. Tanham, Contribution a esistance belge 19401944 (Brussels, 1971); J. Willems, Belgium under Occupation (New York, 1947), 135. H. Granet and H. Michel, Combat: Histoire dun mouvement de R esistance de juillet ` juillet 1943 (Paris, 1957); A. Calmette, LOCM Organisation Civile et Militaire: 1940 a ` 1946 (Paris, 1961). Histoire dun mouvement de R esistance de 1940 a L. de Jong, Het Koninkrijk der Nederlanden in de tweede oorlog (The Hague, 1980); also L. de Jong, Je maintiendrai: Een jaar Nazityrannie in Nederlanden (London, 1941). See vol. III, 6578, 676, 683, 68990. M. Blocq Mascart, Chroniques de la R esistance, suivies d etudes pour une nouvelle r evolution franc aise par les groupes de lOCM (Paris, 1945).

32

Patterns reconstruction to run in parallel with the physical rebuilding of Europes universities. Within this approach, initiated largely under American auspices,12 two perspectives coexisted. A minimalist approach was backed mainly by the governments in exile. It turned around the restoration of the status quo ante and involved the removal of those more ignominious academics who had made themselves the adepts of the occupiers cause. A maximalist programme, backed by American ofcials, was more radical in its strategic purpose. It did not stop at the removal of collaborators. It also called for a goodly degree of curricular reform and the remodelling of course content. The purpose of this latter element was to give solid root to the theory and practice of a democratic society, to serve as the foundations of a new world order and to ensure that societys key value-allocating body the university would act as a sure bastion against any possible return of totalitarianism in the future. If the context in which these issues were raised was highly specic, the principles and the long-term implications which arose from them were to have major inuence upon the patterns, practices and structures within which the universities in Europe evolved over the ensuing fty years. And they raise issues, which, though placed in a different setting and often conducted through a different vehicle of discourse, are relevant today. The minimalist programme for the reconstruction of Europes universities took the view that occupation and its accompanying ideologies had not signicantly altered the basic commitment of the university to seek after Truth and to exercise independence of judgment and reason. Totalitarianism, to be sure, had imposed a supercial overlay upon a community which had entered into a species of inner exile. Yet the inner values of higher educations private life had remained intact in the form of Underground Universities in Belgium,13 the Netherlands and Poland,14 to cite but three examples. Restoration of what was basically an institution in good health simply involved stripping away the ideological excrescence. This could be done by the return of democratic governments to power and/or by bringing academia back from its self-imposed inner exile. In short, these were matters that could be settled by the individual nation acting on its own accord.
12

13

14

See, e.g., the speech by then Congressman William J. Fulbright to the Liaison Committee for International Education 5 May 1944 in Newsletter of International Education, 2 (12 July 1944). Also Memorandum: Grayson Kefauver to Assistant Secretary of State William Benton, London, 6 October 1944, [Personal] in Kefauver Papers, Hanna Collection (Hoover Archives, Stanford University, Cal.). Personal communication from the late Mme Henriette Herlant-Meewis, Professor Emerita, Universit e Libre de Bruxelles, 25 July 1992. I owe this point to my colleague at London University Institute of Education, Mr Janusz Tomiak, who was one of the many students enrolled in Polands clandestine universities during the war.

33

Guy Neave A similar approach could not, it was thought, apply to those countries where totalitarianism was a native product with which academia had thrown in its lot.15 The restoration of the nations historic universities and values could always be interpreted as returning to a happier era prior to the submission to the party and to its apparatus. But this could not be achieved from within the nation. The programme of recovery had to be set down from without and applied by the occupying forces, a situation of no little paradox since it involved democracy in eradicating totalitarian loyalties and practices in a top-down manner which many felt was precisely the hallmark of that self-same political system democracy was dedicated to replace. A further presumption also existed beneath the maximalist programme. It did not hold that, once democracy was restored, the academic community would revert to being part of an international community. On the contrary, strenuous efforts, both at the level of courses and in the content of what students should study, were to be made to stress the role of universities as part of an international community of scholarship rather than exponents of an aberrant and nationalistic ideology. The post-war arrangement reached at Potsdam on 2 August 1945 between the USA, the USSR and the UK, which France also applied, combined elements of territorial redistribution with the recognition of spheres of inuence. At the same time, it gave nal expression to the fact that if a new world order stood in the ofng, it subscribed to two very different interpretations of democracy, of the relationship between the individual and the state and, by extension, the articulation between social and political key institutions to the economy. Whatever label one cares to put on the two blocs, liberal/social democratic for the West or Marxist-Leninist for the Central and Eastern portions of Europe, the consequences for the world of academe were fundamental. The most remarkable feature, which formed an explicit part in the maximalist programme of educational reconstruction, involved at rst the introduction of practices and curricula as part of re-education for democracy. Yet, in 1947, the Western Allies withdrew the forcible application of the re-education programme. The universities asked for and obtained the right to self-government, which they had lost during the Nazi regime. Essentially, their former structures and practices were re-established. But the various strands contained in policies of post-war reconstruction were also to have a major effect in Western Europe upon the patterns and longterm development of the universities. Prior to the drawing up of plans
15

For the situation of German academia, see F. Ringer, The Decline of the German Mandarins: The German Academic Community 18901933 (Cambridge, Mass., 1969).

34

Patterns for post-war reconstruction, a nations universities tended to be regarded as individual establishments, each contributing in its specic manner to the training of future political and administrative elites and as guardians of the nations culture. Their mission, quite apart from their place in society, had been interpreted largely within the canons of the humanistic and largely historical tradition. The experience of war and recovery gave particular legitimacy to the university system of what may pass for an administrative if not a planners paradigm. The individual university was seen as one element in an overall university system. Because today this perspective is taken for granted as a basic category of analysis and comparison by policy-makers and students of higher education, we should not be blind to the importance of this conceptual shift. The notion of higher education as a system, the increasing degree of operational complexity and detail, regulation and oversight in Western Europe were not the only pattern-shaping inuences at work from 1945 to 1995. This sheer operational complexity may be brought to mind by referring to two areas: changes in ministerial remits and the drive towards system-wide legislation. The rst involved the setting up of specic ministries to deal with the affairs of higher education. Although not technically a ministry, but a board of permanent civil servants, the now defunct Swedish National Board of Universities and Colleges created out of the Ofce of the Chancellor of Swedish Universities in 1964 is perhaps the rst in a line of development that spread across Western Europe over the ensuing quarter century. In 1970 the government of the Federal Republic of Germany was granted the right of framework legislation on higher education and established a Federal Ministry of Education and Science. In Austria higher education became the domain of a Federal Ministry of Science and Research, created in 1973. The French Ministry of Universities, set up in 1976, is another, though it did not survive beyond 1981. In Belgium, two Ministries of Higher Education, one for the Francophone, the other for the Dutch-speaking parts of the country, were put in place in 1988. Italy followed suit in establishing the Ministry of Higher Education and Research in 1990.

the expansion of the soviet university model In countries under Soviet occupation collectivization of the means of production, the setting up of a command economy, the establishment of centralized state planning, the creation of single-party states and the fusion of party and state brought with them radical consequences for the university. And though the way each country responded and

35

Guy Neave interpreted this programme was far from the same, the basic goals were very similar.16 These goals were rst the incorporation of universities into the apparatus of state as part of the nations intellectual productive process; second, subordination of the higher-education system in toto to the imperative demands of the economy, both in quantitative and in qualitative terms, the close control exercised by central administration over capacity planning and curricular content justied on grounds as much ideological as technical. If higher education, under such a scheme, had the basic ideological goal of creating socialist man whose individual and personal fullment lay in the service he or she rendered the collectivity, it also had the explicit purpose of eliminating the essential differences between physical and intellectual work and of ensuring the development of the social homogeneity of society.17 Clearly, the repercussions that followed from such a programme penetrated all areas from admissions policy and access to the institutional structure and stratication and to the content of studies. Just as Socialism can be viewed as a way of adapting traditional society, its institutions and its policies to the process of industrialization, so the reforms put in place in Central and Eastern Europe between 1945 and 1951 can be seen as a deliberate attempt to break away from that model of organic accretion which had hitherto largely characterized the development of the historical university. In short, if executed in the name of the collectivity and Marxism-Leninism, it was a programme which, to use the inimitable parlance of contemporary Western technocracy, aimed not merely to systematize the university by scientic planning and economic forecasting, it also sought to rationalize, though principally by administrative and political centralization, management structures, goal setting, priority formulation and academic authority issues which were to assume particular importance in the Western democracies only after the upheaval of 1968. The incorporation of the higher-education system as a subset of a command economy brought a number of consequences in its wake and more particularly those related to the role and status of the university sensu stricto. In the rst place, the university, either in terms of student enrolments or of numbers of establishments, constituted a minority form of higher education. Thus, in the Soviet Union of 1960, of the 739 institutions of higher education covering all sectors of the economy, 40 were universities. Similarly, total student enrolments across all sectors of higher education in that same year were 2,396,000 of which slightly over
16

17

L. Rybalko and E. Soloviev, Reection on the Future: Educational Development and Forecasting (Paris, 1980), 45. V. Affanasiev, The Soviet Union, in Clark and Neave, Encyclopedia I, 64363.

36

Patterns 10 per cent 249,000 were university students.18 Clearly, as the leading sector within the Soviet model, the university discharged a very specic mission alongside the other highly differentiated sectors of higher education. This was to train researchers, to supply highly qualied academic staff to the university world and to provide teachers for secondary education. This model not only placed major emphasis on the signicance of the non-university sector as a means of meeting medium-term needs of the economy an issue that was to emerge in the course of the mid-sixties and beyond in the West. But, because institutional tasks and functions were formally assigned in keeping with the instrumentality of a planned economy, it tended also to be a system far more differentiated than any equivalent pattern of higher education in the West, with the possible exception of Belgium.19 The incorporation of the university into the command economy not only tended to strengthen the specialized nature of the non-university sector(s), it also involved a policy of splitting off some of the more practice-oriented disciplines from the university and the building up of separate, highly specialized universities, virtually of a mono-disciplinary nature. Not untypical of such a policy of diversication by fragmentation was the case of Riga University at the wars end. The faculty of agriculture was split off to form a Latvian Academy of Agriculture whilst the technological faculties were transferred to the Riga Polytechnic Institute. A similar development was visible slightly later at the University of Poznan. Between 1948 and 1951, as part of the general transition towards a Soviet-based model, the faculties of medicine and pharmacy were broken out of the university to form medical academies, whilst the department of physical education was hived off to become a college of the same activity.20 Agriculture and forestry migrated to become a higher school of agriculture.21 In Hungary similar moves applied to the faculties of theology and medicine, the latter receiving the name of a medical university.22 The degree to which disciplinary elds held to be key to the commanding heights of the economy were broken into specic elds varied from country to country. The disciplinary elds retained within the historic university in contrast to the specialist universities or polytechnic
18 19

20

21 22

Affanassiev, Soviet Union (note 17), table 14, 657. Higher education in Belgium divided formally and legally into seven different sectors including the university. The details of this are set out in the law of 7 July 1970, See, e.g., Ministerie van de Vlaamse Gemeenschap, Department Onderwijs, Education in Belgium: The Diverging Paths (Brussels, 1991), 6778, 211. Ministry of Higher Education, Institutions of Higher Education in Poland: Information and Statistics Bulletin (Warsaw, 1963), 8. J lek, Historical Compendium, 267, 260. J lek, Historical Compendium, 115, 129, 255, 290.

37

Guy Neave establishments were also subject to considerable variation. The stripping out of university-based subject areas reached its apogee in Bulgaria and Hungary, where universities were conned to teaching the humanities, natural sciences and law a development that closely mirrored the re-establishment of universities in the Soviet Union.23 At the other end of the spectrum stood Czechoslovakia where the subject range covered by the historic university remained largely untouched and included the humanities, social sciences, natural sciences, law, medicine and physical education.24 Thus, in the face of the growth of the parallel university system, based on key specialist sectors of the economy, or the expansion of a non-university sector during the early fties by the application of the Soviet policy of diversication founded upon dividing up the university, the university continued to be identied as providing a species of general education.25 Two other features underlined the functional stratication which developed as a result of introducing a command economy model of higher education into Central and Eastern Europe. The rst of these, which was to have a galvanizing effect on higher education in Western Europe in the sixties,26 was the particular emphasis placed upon the development of technological and technical higher education. The drive towards the establishment of technological universities in the period of reconstruction up to the early fties corresponded both to an ideological commitment as well as to a pragmatic need. The ideological commitment derived from one of the fundamental tenets of Marxism-Leninism, namely, the removal of the intellectual distinction between theory and praxis, and consequently of the social stratication between those who were brain workers and those who worked with their hands. The second and more pragmatic consideration emerged in the need not merely to reconstruct the industrial base, but in so doing also to lay down the social order which derived from a political system founded upon the primacy of the industrial proletariat. The role of the university as an instrument of industrial and economic reconstruction on the one hand and its mission of social engineering on the
23 24

25 26

See vol. III, Annex. UNESCO, Case Studies on the Development of Higher Education in Some Eastern European Countries, Document ED-74/WS/52, 26 October 1974 (Paris, 1974), 17 [roneo]. Szczepanski, Systems (note 6). Symbolically, this took the form of the Sputnik scare which, if its most direct effect was to be seen in the United States in the form of the National Defense (education) Act of 1960, had secondary order consequences for Western Europe; see also G. Neave, Higher Education Policy as Orthodoxy: Being One Tale of Doxological Drift, Political Intention and Changing Circumstances, in P. Teixeira, B. Jongbloed, D. Dill and A. Amaral (eds.), Markets in Higher Education: Rhetoric or Reality? (Dordrecht, 2004), 1324.

38

Patterns other brought with it equally signicant changes in the place of research. In the area of research policy, though universities did not cease their basic commitment to this essential undertaking, they were neither the centre nor, in general, did they command the best conditions, either of work or of equipment. These remained rmly in the various academies of science, engineering, medicine, agriculture, social sciences and pedagogy which not only moulded national guidelines for research in response to the various sectional ministries to which both they and the corresponding type of university were linked via the branch and inter branch system of control and planning, but also carried out fundamental research and awarded higher doctorates.27 The academies stood within their disciplinary elds, at the apex not only of the research system, but also of an extremely powerful series of centrally constituted coordinating layers. They conferred upon the Soviet model of higher education their fundamental feature of being coordinated by the state, as opposed to being coordinated either by academic oligarchy, which is sometimes held to have been the historic Western European model of coordination, or by the marketplace, which some writers have equated with the United States systems of higher education.28 Just as the establishment of a command economy placed especial weight on developing technical and technological institutes to reinforce knowledge transfer between higher education and a renascent industry, and in so doing sought to allocate social prestige away from the historic model of university towards these domains, so the creation of a socialist society was reected in policies of access to higher education. If higher education was open to all qualied, this general principle was attenuated in various ways: by competitive entrance examinations, by rigorous capacity planning to ensure that qualied student output remained in keeping with the manpower requirements of the economy usually set by the State Planning Commission or its equivalent.29 The Eastern bloc countries practised what may be presented as a form of positive discrimination in favour of young people from working-class and peasant backgrounds.30 In addition, special facilities for members of both the agricultural and industrial
27

28

29

30

Y. M. Rabkin, Academies: Soviet Union, in Clark and Neave, Encyclopedia II, 1049 55. B. R. Clark, The Higher Education System: Academic Organization in Cross National Perspective (Berkeley, Los Angeles and London, 1983), 265. For Bulgaria: B. Penkov in Clark and Neave, Encyclopedia I, 959; Afanassiev, The Soviet Union, in Clark, Encyclopedia I, 64363; H. Mohle, German Democratic Repub lic, in Clark and Neave, Encyclopedia I, 23140. For Poland: Szczepanski, Systems (note 6). In Poland, this measure had mixed results. By the mid to late seventies, the numbers of entrants with these backgrounds had begun to fall substantially. See W. Adamski and I. Bialecki, Selection at School and Access to Higher Education in Poland, European Journal of Education, 16:2 (1981), 20933.

39

Guy Neave working classes to pursue higher education were set up from the rst, in the form of evening classes and correspondence classes. In Eastern Germany, the democratization of higher education was the object of particular attention. The University of Greifswald, reopened in 1946, made provision for lectures for secondary-school students who had left school without formal qualication. Three years later, this facility was formalized as a Faculty of Workers and Peasants. It lasted throughout the transition period and was closed in 1962.31 This species of second route to higher education for workers and professionals in employment, incorporated into the mainstream of higher education, remained a characteristic feature of higher education in East and Central Europe. If founded upon the need to bring forward to higher levels of knowledge social strata other than the traditional upper middle classes which predominated in non-Socialist regimes, access to higher education remained, for all that, driven primarily by manpower considerations to which social demand remained rmly subordinated. However one interprets the Soviet model of higher education or the variants upon it which were implanted into Eastern and Central Europe, whether as an attempt to harness the university to the scientic principles of socialism, or as an adaptation to the progressive forces of dialectical materialism, it remained self-contained. Until the events of 1989 and 1990, academic mobility between the two world order systems of higher education remained highly restricted and under close ofcial control. This is not to say that within the Eastern bloc academic exchange at all levels students, researchers and staff was absent. On the contrary, academic trafc was heavy, above all between systems of higher education in East and Central Europe and the Soviet Union.32 Yet, across the decades, despite the fact that universities in Europe grew unprecedentedly in number, and their staff and students expanded their ranks, academic interchange between the two blocs remained invisible to all but the anxious eyes of governments and security services. Expressed as a proportion of those involved in the respective systems of higher education, whether as students, researchers or as staff, such interchange was in fact minimal.33 There is no testimony more eloquent to the depth of the ideological cul-de-sac into which Europes universities had been backed than this.
31 32

33

J lek, Historical Compendium, 162. D. Kallen and G. Neave, The Open Door: Pan European Academic Cooperation (Bucharest, 1991), 984. Kallens enquiry, conducted by eld visits during 1989 and 1990 to government agencies in charge of academic mobility both in West and East, suggests that over the period from 1988 to 1989, some 11,164 individuals from the Eastern bloc countries visited Western universities and approximately 3,080 were involved in moves in the opposite direction (Kallen and Neave, Open Door (note 32), 489).

40

Patterns the drive to mass higher education The drive of the university in Europe towards mass higher education stands as one of the watersheds in its history. From the 1950s through to the 1990s, higher-education systems and within them the university have been under the severe and continued pressure of spiralling student numbers. By 1990, a higher proportion of the age group found places in higher education than was often the case four decades previously in the academic upper secondary school on its own. In 1990, Spain enrolled fteen times more students than in 1960; Finland and the Netherlands more than ten times more university students than in 1950. In the Federal Republic of Germany and the United Kingdom, student enrolments rose by a factor of nine, in France eight, in Greece, Italy and Austria six, in Belgium ve, and in Yugoslavia four. This was not the case for the universities in East and Central Europe. Annual growth rates in most East European systems of higher education were low if not negative.34 The reasons for this will be dealt with later, in the context of the institutional development of the university in different parts of Europe. The contrast between the two blocs is striking in the uniformity of trends within each, quite apart from the enormous differences between them. If this policy extended over two decades from the early sixties onwards left few aspects unchanged, it remains no easy matter to plot the course of even the crudest of these dimensions. The development of mass higher education was not conned to the university alone, although in certain countries, Italy and Spain being the most noteworthy, the university sensu stricto was the main institutional vehicle through which the transition was accomplished. In other countries, for example France, the ex-Federal Republic of Germany, Britain and Norway, expansion of student numbers went hand in hand with an expansion in the types of institution brought into the ambit of the nations highereducation provision. Expansion was then matched by institutional diversication and by the development of a non-university sector, the principal features of which tended to be its emphasis on the applied and social sciences, a duration of studies shorter than the classical university rstdegree curriculum, a claim that imparted skills and knowledge held to be directly applicable in the world of work,35 and nally a commitment to
34 35

Kallen and Neave, Open Door (note 32), esp. table 3, 19. D. Furth, Short Cycle Higher Education: Crisis of Identity (Paris, 1974); for France: J. Lamour, Les instituts universitaires de technologie (Paris, 1981); for the Federal Republic of Germany: U. Teichler, Das Hochschulwesen in der Bundesrepublik Deutschland ein Uberblick, in U. Teichler (ed.), Das Hochschulwesen in der Bundesrepublik Deutschland (Weinheim, 1990), 1142; for Norway: S. Kyvik, The Norwegian Regional College: A Study in the Establishment and Implementation of a Reform in Higher Education (Oslo, 1981); for Britain: J. Pratt and T. Burgess, The Polytechnics (London, 1974).

41

Guy Neave Table 2.1 University enrolments in thousands from 1950 to 1990
Country Austria Belgium Bulgaria Czechoslovakia Denmark Finland France Germany FRG Germany GDR Greece Hungary Iceland Ireland Italy The Netherlands Norway Poland Portugal Romania Spain Sweden Switzerland UK USSR Yugoslavia 1950 24.6 18.2 38.8 7.3 10.4 129.0 1960 27.2 28.1 1970 43.1 42.0 85.3 58.8 694.8 412.0 44.0 72.3 2.0 682.0 103.4 30.2 43.6 232.1 258.0 503.5 172.6 1980 100.1 63.3 1990 213.4 108.5 127.0 112.9 113.8 120.5 1,251.4 (1,504.1) 117.3 108.4 5.2 42.8 1,324.9 173.9 47.9 823.0 1,158.8 93.9 80.2 799.4 593.7 267.1

23.0 240.7 247.2 30.1 0.9

83.0 883.6 791.5 32.0 85.7 3.6 1048.0 151.2 40.6 65.0 629.6 340.0 609.4 302.8

180.1 18.1 7.4 11.5 9.7 13.2 81.0 60.6

268.0 40.7 9.6 19.5 76.4 129.0 248.9 106.3

Source: specied country entries in Clark, Encyclopedia I and UNESCO, Organization and Statistics (Paris, 1951); OECD, Education in OECD Countries: A Compendium of Statistical Information (Paris, 1993), 64ff.; File and Goedegebuure, Real-Time Systems (note 39), table 5, 49.

practice-based teaching that was not matched by its institutional commitment to research. If such institutional markers in theory set the non-university sector off from the university, in reality the boundary lines were less clear-cut. British polytechnics, created between 1966 and 1972 as an alternative to the university though the origins of individual establishments can be traced back to the end of the last century provide an excellent example of the blurring of institutional frontiers. Their duration of study was exactly the same as the university rst degree; their subject prole and patterns of student subject choice imbued with remarkable similarity to universities. Over the years, they accumulated a not inconsiderable research capacity as well as scattered doctoral degree programmes. In France, the university institutes of technology, also created in 1966, whilst differentiated by their emphasis on subjects directly aligned with economic sectors, secondary 42

Patterns and tertiary, awarded rst degrees corresponding to the two-year rst cycle at university. The promotion of establishments outside higher education to highereducation status a pattern found in the Federal Republic of Germany in the case of the Fachhochschulen upgraded from secondary school status nevertheless poses severe methodological difculties. What denes a university? Is it, as an American student of higher education has proposed, an establishment with the full range of faculties?36 Some of the more prominent French universities would not qualify.37 Some of the more specialized institutions in Eastern and Central Europe, such as economics universities or veterinary universities, would suffer the same fate. Are there operational criteria that permit us to draw a hard and fast line between different institutional types in face of the evident blurring at the edges which has been a feature in the higher-education systems of Western Europe from the early seventies onward? These discriminations became even more central from 1990 onwards owing to major shifts in the denition of higher education itself. In addition to universities sensu stricto there emerged university-type establishments, often identied by the presence of masters or equivalent degree programmes and, here and there, a smattering of research. Definition became even more complex with the need to assert identity and status and to generate revenue, all of which accompanied the injection of a market-driven ideology and the principle of competition. In the case of the ex-Eastern bloc, denitional sleight of hand became commonplace, as governments imploded and private universities proliferated,38 largely as an attempt by academia to ensure its daily bread, if not its survival.39 Faced with these pitfalls, to which can be added the sheer number of universities created or founded, we have chosen the legalistic approach which the CRE/EUA applies to member institutions and which has its roots in the history of the European universities: universities are institutions of higher education founded or recognized as universities by the public authorities of their territory and authorized by these authorities
36 37

38

39

C. Kerr, The Great Transformation of Higher Education 19601980 (Albany, 1991). For this point, see G. Neave, France, in B. R. Clark (ed.), The Research Foundations of Graduate Education: Germany, Britain, France, United States, Japan (Berkeley, Los Angeles and London, 1993), 159220. For the situation in Romania in the 1990s, see A.-M. Dima, Quality Assurance Mechanisms and Accreditation Processes in Private Higher Education in Roumania, in UNESCO, Globalisation and the Market in Higher Education: Quality, Accreditation and Qualications (Paris, 2002), 14558. G. Neave, On the Return from Babylon: A Long Voyage around History, Ideology and Systems Change, in J. File and L. Goedegebuure (eds.), Real-Time Systems: Reections on Higher Education in the Czech Republic, Hungary, Poland and Slovenia (Brno, 2003), 1537; Teixeira et al., Markets (note 26).

43

Guy Neave to confer the academic degrees of master and doctor.40 The data used to compare universities so dened have been compiled by the CRE, now the European University Association (EUA).41 A selection of establishments that were already universities by 1950 or that subsequently achieved this status by 1985 was made. It yielded 524 establishments across twentyve countries, eight in the ex-Eastern bloc and the remainder in Western Europe.42 The thickening of what has been termed the institutional fabric43 of the university sector is evident. The 200-odd universities in 1950 had more than doubled thirty-ve years later and numbered around 500. There were more students in each institution. In the Federal Republic of Germany, Spain and Italy, certain establishments reached towering proportions Munich and the Freie Universitat Berlin with more than 60,000 students each, the University of Madrid Complutense with a similar number,44 and the University of Rome La Sapienza carrying the quite extraordinary load of 120,000 students on its books. Few rms indeed can claim to concentrate so many workers in one city! Expansion was not a slow accretion over time. As gure 2.1 shows, there was a very clear concentration on the ve years between 1970 and 1975. Against the long-term history of the university in Europe, this expansion is a remarkable feat. From the perspective of creating universities, it was an almost purely Western European phenomenon. There are a number of explanations that might account for this fact and that also explain the stagnation in the growth of student enrolments in the Eastern bloc at the same time. The infrastructure of higher education has always developed less intensely in Eastern and Central than in Western Europe. Second, the ravages of war were immeasurably less in the West and in the universities located there. The efforts needed in Eastern and
40

41

42

43

44

The same criterion is also applied by most governments for recognizing the status of a university, because the award of these degrees asks for fundamental research facilities and regular research activities. J lek, Historical Compendium, published by the CRE as the rst result of and as a working instrument for the History of the University in Europe project, dates from 1984 and therefore omits any establishment attaining university status after 1983. Nevertheless, it has two immense advantages: it is about the only document that contains the succinct institutional history of individual establishments; it also obviates, but not entirely, what would otherwise be the work for a team of research assistants. All institutions in this work were scrutinized for their date of foundation as a university, for their institutional origins if they came from a non-university establishment. Luxembourg was not included. Since Soviet universities are very much under-represented in J leks Compendium (some 22), the total of 65 was taken from Afanassiev, The Soviet Union (note 29). For the treatment of this concept as a major analytical category in the study of higher education systems, see Clark and Neave, Encyclopedia II. For the administrative and managerial consequences of this, see ICED, La Reforma e informe (Madrid, 1987). Universitaria espanola: evaluacion

44

Patterns
190 171 152 Absolute numbers 133 114 95 76 57 38 19 0 Prior to 1950 1956-60 1966-70 1976-80 Universites founded by half-decade

Half-decades

Overall

West

East

Figure 2.1 New universities in Eastern and Western Europe 19501990

Central Europe to recover from such destruction are evident in gure 2.1, particularly during the period from 1950 to 1955. Also the university constitutes only one segment within a highly segmented system. By plotting the institutional development of the university we have left aside what may well be more substantial growth in the non-university sector. Given the importance of technological and technical institutions, formally of non-university status, the poor showing of Eastern and Central Europe in creating universities may be partially a denitional artefact. The expansion of higher education in the West was largely the product of individual demand, amplied in many countries by the constitutional right of duly qualied individuals to a place in higher education.45 There existed few ways that were politically acceptable of channelling such demand, other than by the progressive establishment of a restricted entry policy to specic disciplines the numerus clausus or by selection during the rst year of study, either in the form of a propaedeutic year46 or by immense failure rates.
45

46

Such a right is attached to the French baccalaur eat, the Austrian, Belgian, Italian, Swiss , Maturit ` and the German Abitur. It does not follow from this that Maturitat e, Maturita individuals are guaranteed a place in the faculty or department of their rst choice. Indeed, one of the major trends over the past thirty years in Western Europe has been the introduction of a numerus clausus for certain over-subscribed faculties or disciplines. Prime amongst these are engineering and medicine. This has been tried at various times both in France and in the Netherlands and has its functional equivalent in the Spanish Curso de Orientacion Universitaria. In Spain, few of those sitting this examination fail, however.

45

Guy Neave By contrast, the essential feature of a command economy lay precisely in matching student numbers to institutional capacity and from there to aligning it on formal manpower requirements. Individual demand existed insofar as it accorded with the individuals attainment and his assignment to a particular segment of the higher-education system. Demand could be and was channelled between segments in accordance with manpower planning projections.47 Command economy systems had then the ability and, moreover, the legitimacy, to divert demand away from the university sector if required. And though such considerations were not absent in the West, the diversion could only be a matter of voluntary, individual choice. This in itself is a signicant difference. National university stock accumulation Table 2.2 sets out the total number of establishments identied as being of university status between 1981 and 1984, the proportion of those establishments in existence prior to 1950, and the number of universities created per half-decade expressed as a proportion of the national stock.48 One of the more interesting aspects of this table is the fact that some university systems were virtually in their present form by 1950. Switzerland, Ireland and Austria were then largely settled systems. Growth and expansion in student numbers were accommodated within the existing institutional framework. At the other end of the spectrum are countries whose university system, though often resting on a solid core of more than centennial foundations, is, in its present form, the creation of the second half of the twentieth century. Into this group fall Bulgaria, Finland, France, the ex-German Federal Republic, Greece, Portugal, Romania, Spain and Yugoslavia. These countries undertook massive programmes of institution creation, which raised their institutional stock to four times the level of 1950. Table 2.2 reveals with particular clarity the national dimension to the overall trend noted in gure 2.1 namely, that for many Eastern bloc countries the period of post-war reconstruction was also the period which saw the completion of the nations present-day university network. In the case of Czechoslovakia, this process was to all intents and purposes complete by 1955. Poland and Hungary present a similar picture. The German Democratic Republic extended the policy of institution development up to the period 19615, by which time Bulgaria had also put its
47 48

K. Hufner, Economics, in Clark and Neave, Encyclopedia III, 17971809. Table 2.2 locates the datum point at the end of the period under enquiry, i.e. 1984, in order to show when the provision of the national university stock was completed and over which length of time policies of institutional expansion and renewal were pursued.

46

Patterns Table 2.2 The development of the university infrastructure 19491984. Universities present or created per quinquennium as a percentage of all universities existing in 1984 by country
1949 % Austria Belgium Bulgaria Czechoslovakia Denmark France Finland Germany FRG GDR Greece Hungary Iceland Italy Ireland Netherlands Norway Portugal Poland Romania Spain Sweden Switzerland UK USSR Yugoslavia Unknown Total created in quinquennium Per cent existing in quinquennium 58 25 17 58 67 20 8 26 50 31 56 100 51 100 50 50 31 38 25 27 46 100 56 49 22 201 38 1954 % 8 17 17 17 8 1959 % 1964 % 8 6 8 17 3 23 16 1969 % 8 31 1974 % 17 38 50 8 17 67 38 33 23 1979 % 1984 % Total in 1984 12 16 6 12 6 81 13 57 10 13 9 1 49 2 14 4 13 13 8 34 11 10 48 65 18 4 524 100

9 20 8 44

8 2 10

7 20 23

11 8 2 8

16 5 8

2 7 14

8 14 8 8 13 12 9 25 14 6 56 64

16 14 50 16 25 30

14

31

15

46 25 9 2 6

8 12 9 18 2 11 6 3 11 32 53

21 18 2 5 39 39 95 19 99

6 14 22 127 88

32 44

18 47

Source: J lek, Historical Compendium

university system in place. Two exceptions are Romania and Yugoslavia. The former divided its reforming energies across two periods, the rst coinciding with the pattern of post-war reconstruction common to other socialist regimes, the second taking place at the same time as the institutional boom in the West. Yugoslavia, by contrast, developed like Western Mediterranean countries. In the West, the large increase in universities occurred in the sixties and seventies, though there was a lagged response in Greece, Portugal and Spain, countries where the bulk of the effort was concentrated across the years 1971 to 1980. The interesting feature that emerges from the process 47

Guy Neave of stock accumulation in Western Europe is not so much its location in time as its duration and intensity. Analysed along these two dimensions, countries can be grouped into one of two categories: those where stock accumulation was relatively protracted and those where the major effort was concentrated and contained within a relatively short period. The outstanding example of efforts which, for their very concentration, can be classied as nothing less than Herculean at least on paper, if not in brick, concrete and glass is France. Between 1970 and 1974 two-thirds of Frances present-day universities saw the light of day, largely thanks to institutional ssion which split existing universities into two or three separate entities, usually based around cognate disciplinary elds.49 Ex uno plures rather than e pluribus unum. Few other countries imitated the French, though Norway, in doubling its stock between 1966 and 1970, might be seen as a possible contender. The scale of the operation, however, was very different. Turning to the rst criterion, that of protracted development, four systems are noteworthy. In the Federal Republic of Germany and the United Kingdom the accumulation of university stock began after 1950 and continued for two decades, culminating in the United Kingdom between 1960 and 1969, in the Federal Republic between 1965 and 1974. In Finland and Italy expansion began slowly after 1950, but it increased from 1965 on and continued until the eighties.

foundation and creation It is one thing to observe the timing and intensity of the general process of adding to the nations stock of universities.50 But the way in which the process itself evolved demands the distinction between creation and foundation. A university may be created out of the structure of an establishment of a very different type. The process has been in existence for almost as long as the university itself, and it began, very often, by conferring the rights of a studium generale with its structural implications upon an already existing establishment. This has not changed today, and the variety of prior institutional bases from which a university may spring fully-edged, recognized and accredited with all the remaining privileges by authority, has in no way diminished. The process of assimilation is
49

50

L. L evy-Garboua, Diff erentiation des enseignements sup erieurs notamment en premier ` demain luniversit cycle, in Documents annexes a e: Rapport au ministre d el egu e de la recherche et de lenseignement sup erieur (Paris, 1987) [mimeo]; A. Bienaym e, Deux millions d etudiants en lan 2000: Que demande la France de lenseignement sup erieur?, Cahiers de lUniversit e Paris IX Dauphine (1987), 152. For the policy of national governments promoting this spawning process, see chapter 3.

48

Patterns Table 2.3 Foundation and creation of new universities in Europe 19501984
Overall % Universities existing in 1949 Foundations Establishments created: (1) from university status (2) from non-university status Total of universities founded and established 19501984 Unknown Universities existing in 1984 N = New universities as % of all existing in 1984 37 31 43 26 100 N= 204 96 139 83 318 2 524 60 50 % 50 29 44 27 100 East N= 71 20 31 19 70 % 33 31 44 25 100 West N= 133 76 108 63 245 5 383 64

141

not always easy, as many students of implementation theory in higher education have found.51 Creation may involve several steps before reaching the Promised Land of full university rank. Many of the establishments designated universities in the UK in the inter-war and immediate post-war period possessed a previous institutional form as university colleges, afliated to an established university in many cases, to the University of London. Between their foundation as an establishment of higher education and their creation as fully recognized universities, they went through the step of university college. Variation on this process involved a two-step process. Many of the so-called technological universities established in the course of the sixties had been regional colleges of technology in the early fties. Certain of them were promoted to colleges of advanced technology later in that same decade.52 The British polytechnics established from 1966 onwards, however, formed the basis of a reinforced non-university sector and as such are taken into account here only when they became fully-edged universities in 1992.53 Table 2.3 distinguishes between universities under a command economy and those in the Western countries. In the West almost two-thirds of
51

52

53

L. Cerych and P. Sabatier, Great Expectations and Mixed Performance: The Implementation of Higher Education Reforms in Europe (Stoke-on-Trent, 1986); J.-E. Lane, Creating the University of Norrland: Goals, Structures and Outcomes (Umea, 1983). T. Burgess and J. Pratt, Policy and Practice: The Colleges of Advanced Technology (London, 1970); P. Venables, Higher Education Developments: The Technological Universities 19561976 (London, 1978). See below, 63.

49

Guy Neave the universities existing in 1984 were created during the previous thirtyve years. The command economies never surpassed the effort of their Western rivals. True, the number of additional universities doubled the regional stock from 71 to 141. Over the same period, Western Europe added 255 establishments. Yet, when we turn our attention to the particular way in which universities were created by building new foundations, by upgrading those already endowed with a certain university status, or by promoting others to this condition there is a considerable similarity. Upgrading establishments already endowed with a form of university status was with 44% in the Eastern bloc and in the West the most used of the three strategies. The proportion of new constructions was only slightly higher in Western than in Eastern systems 31% against 29%. Direct institutional elevation from non-university to university status was slightly higher in the Eastern bloc (27%) than in the West (25%). The method employed to meet growth in demand and how it was reected in the university stock of individual countries is set out in table 2.4. In Western Europe, Belgium, Finland, France and the then Federal Republic of Germany show particularly strong growth; in the Eastern bloc, Bulgaria, Romania and Yugoslavia. Amongst the systems where the policy of institutional promotion from a previous existence in the non-university sector appeared to be the main instrument are Belgium, Bulgaria, the German Democratic Republic, the Netherlands and Romania. By contrast, upgrading that is, conferring full university status on institutions which already enjoyed a partial condition was especially evident in Portugal, Poland, France and Spain. Creating new universities by splitting old ones apart can be seen as a variation on institutional upgrading a pattern much employed for instance in France after 1968. At the time of their creation, new universities naturally attracted considerable attention, particularly when they sought to develop alternative ways of organizing disciplines, introducing new curricular patterns, redrawing the map of knowledge and, in the case of the German comprehensive universities set up experimentally in the mid-1970s, of reuniting theory and practice in the undergraduate curriculum in response to changing skills requirements from the labour market.54 Not all new foundations were dedicated to innovation. Yet a considerable number assumed this additional catalysing role. It is no less evident that only in a minority of countries did the founding of new universities constitute the main and undisputed basis for the expansion of the nations university network. Amongst the notable exceptions to this general rule were Denmark, Finland and Portugal.
54

For example, H. J. Perkin, New Universities in the United Kingdom (Paris, 1969).

50

Patterns Table 2.4 Foundation and creation of new universities 19501984

Created from institutions with Universities existing in 1949 N= Austria Belgium Bulgaria Czechoslovakia Denmark Finland France Germany DDR Germany BRD Greece Hungary Iceland Ireland Italy Netherlands Norway Poland Portugal Romania Soviet Union Spain Sweden Switzerland United Kingdom Yugoslavia Unknown Europe 7 4 1 7 4 1 16 5 15 4 5 1 2 24 7 2 5 4 2 32 9 5 10 27 5 204 1984 N= 12 16 6 12 6 13 81 10 57 13 9 1 2 49 14 4 13 13 8 65 33 11 10 48 18 524 New foundations N= 1 2 1 2 5 7 10 7 % 8 12 16 33 39 9 18 54 University status N= 3 8 3 3 3 34 1 18 1 3 % 25 50 50 25 23 42 10 32 8 33 Nonuniversity status N= 1 2 2 2 4 24 4 14 1 1 % 8 13 33 17 31 30 40 25 8 11 Total created N= 5 12 5 5 2 12 65 5 42 9 4 % 42 75 83 42 33 92 80 50 74 69 44 100 49 50 50 69 69 75 46 72 55 44 72

9 2 1 4 4 1 15 8 2 9 6 96

18 14 25 31 31 12 23 24 18 19 33

13 2 4 4 2 10 10 2 10 5 10 139

27 14 31 31 25 15 30 18 21 28

2 3 1 1 1 3 5 6 2 2 2 83

4 21 25 8 8 38 8 18 18 4 11

24 7 2 9 9 6 33 24 6 21 13 320

Table 2.5 distinguishes the new universities from those that were upgraded or promoted from a non-university institution. Of the 224 establishments created by upgrading, more than half derived from another institution of university status. Very few of these underwent two changes prior to attaining university rank, though this mode of development occurred more often in Eastern Europe. The question remains whether, in expanding their provision of universities, the same channels of institutional promotion were used by East and West. In the West, more than 60 per cent of all universities extant in 1984 were new establishments as compared to 53 per cent in the Eastern bloc, and a signicantly higher proportion of established universities in the East were the result of upgrading one-third as against one fth. The 51

Guy Neave Table 2.5 Patterns of institutional development (new universities created between 1950 and 1984)
Overall N= Total universities 1984 New universities total Universities established by: upgrading promotion 2-step promotion Total established universities 524 319 129 83 12 224 % West N= 383 241 107 62 1 170 % East N= 141 78 22 19 11 52 % Unknown N=

61 58 37 5 100

62 63 36 <1 99

55 42 37 21 100 10

latter pattern largely reects the process of splitting off faculties to form specialized universities during the 1950s. regionalization The rising number of Europes universities was not simply a response to student demand. It was also a response to the demand for accessibility.55 The creation of a university, as Max Weber long ago noted, is not just a cause for rejoicing for students or their parents. It is also the source of no less satisfaction amongst shopkeepers, landladies and local politicians,56 for if students are the wealth of tomorrows nation, they are very much todays consumers of goods and services. Equalization of geographical access to university was a powerful argument, especially when allied to the notion that the university itself could serve not merely to raise the educational level of regions often distant from the capital or on the periphery of a nations university infrastructure, but could also act as a catalyst in a regions agging industrial infrastructure. The physical location of universities, the upgrading of non-university establishments and the strengthening of others became in the course of the sixties and the following decade an aspect of considerable importance in the planning of higher education. The foundations in the Federal Republic of Germany of the Universities of Trier and Kaiserslautern,57 of the University of Umea in Sweden58 and of the University of Cosenza in Southern Italy are examples, though the last responded more to the urgent demands of party than to the theories of human capital applied to the
55 56

57 58

See chapter 3. M. Weber, Wissenschaft als Beruf, in C. Wright Mills and H. Gerth (eds.), From Max Weber: Essays in Sociology (Oxford 1964) [translation]. G. Kueppers et al., Die Universitat Trier, Paedagogica Europaea, 12:2 (1976), 86112. Lane, Creating (note 51).

52

Patterns region.59 The clearest example of the marriage between the university and regional development policies was Finland where, from the early sixties onwards, university location was determined in the light of the need to build up the regional economy.60 Equity in the distribution of universities across regions rarely, if ever, brought about immediate change in governance, control or accountability. Three factors have subsequently altered this situation. The rst one was administrative, exemplied by the Swedish reforms of 1977 that brought all higher-education establishments under one administrative umbrella within each of seven regions, and made provision both for regional representatives on university boards and for regional highereducation boards to have nancial control over an element of non-degree courses.61 The second factor that enhanced regional control over higher education was cultural. It was a reection inside the university of demands made externally for a regions claims to a specic cultural and historic identity.62 The creation of the autonomous regions in Spain and the establishment of social councils representing regional interests inside the university,63 and the administrative division of Belgium into Dutchand French-speaking parts, each exercising control over the nancing of higher education, are cases in point. The third factor, while no less political, has nancial considerations as its prime motive and has to do with hiving off certain functions of central administration down to the regional level and increasing the direct contributions of regional authorities to nancing higher education. France since 198964 and Norway since 199065 are perhaps the best examples of this process. The regional dimension as a force currently shaping the development of universities is important, though still a minor trend. It implies strengthening what has often been seen as a weak middle layer in highereducation administration, one sandwiched between a powerful central

59

60

61

62

63 64

65

For a perceptive and hilarious account, see D. Ryan, The University of Calabria in its Regional Context, Paedagogica Europaea, 13:1 (1977), 6392. J. Vakkuri, Institutional Change of Universities as a Problem of Evolving Boundaries, Higher Education Policy, 17:3 (2004), 287310. R. T. Premfors, The Regionalization of Swedish Higher Education, Comparative Education Review, 28:1 (1984), 85104. R. Diez-Hochleitner, La educacion postsecundaria ante la sociedad del conocimento y postsecondaria de la comunicaciones documento del trabajo basico, in La educacion ante la sociedad del conocimiento y de las comunicaciones: documentos de un debate (Madrid, 1989), 917. ICED, Reforma universitaria (note 44). J. Guin, The Re-awakening of French Higher Education, European Journal of Education, 25:2 (1990), 12346. P. O. Aamodt, A New Deal for Norwegian Higher Education?, European Journal of Education, 25:2 (1990), 17185.

53

Guy Neave administration and equally powerful institutions.66 It implies also that university priorities will be inuenced increasingly by the budgetary clout of regional authorities. From there it follows that, since regional economies and the labour market will develop in very different ways, the university system, though held in many countries to be homogeneous in task and disciplinary coverage, may well see new forms of institutional diversication and specialization required by the regional economy. Since the history of the university has long involved a swing between periods of institutional convergence and divergence,67 the increasing weight of the regional in the life of the university may well be a counterweight to the convergence explicit in the creation of a European higher-education area. It is certainly one of the many inuences driving the de-nationalization of higher education.68

the place of the non-state sector The conversion of the universities in Europe towards mass higher education, by contrast with the United States and Latin America,69 was almost exclusively a public undertaking. That it was planned, nanced and implemented by the government, and in Western Europe involved a massive numerical reinforcement of state-sector higher education, should not cause us to lose sight of the non-state sector. Recent developments and the ideological shift towards privatization in Western Europe and its astonishingly rapid if not incautious assimilation as the guiding principle for higher-education development in both Central and Eastern Europe after 198970 give an additional retrospective importance to this dimension. The importance of the non-state sector is symbolic of a
66

67

68

69

70

T. Becher and M. Kogan, Structure and Process in Higher Education, 2nd edn (London, 1990). U. Teichler, Convergence or Growing Variety: The Changing Organization of Studies (Strasbourg, 1988). For an exploration of some of the implications of this, see G. Neave, La dimensio educacional en la integracio es enlla dels Europea: Una ulluda m ` dels programes, Bullet Mestres [Departament dEnsaynament, Generalitat de Catalunya], 228 (June 1991), 511. V. Stadtman, The United States, in Clark and Neave, Encyclopedia I, 77788; L. A. Cunha, Public Policies for Higher Education in Brasil, Higher Education Policy, 3:2 (1990), 215; D. C. Levy, University and Government in Mexico: Autonomy in an Authoritarian System (New York, 1980); see also D. C. Levy, Higher Education and the State in Latin America: Private Challenges to Public Dominance (Chicago, 1986); S. Slancheva and D. Levy (eds.), Private Higher Education in Post-Communist Europe: In Search of Legitimacy (New York, 2007). See below, 60 and also the OECD Review of Higher Education in the Czech and Slovak Federal Republic: Examiners Report and Questions (Paris, 1992); for the degree of commitment to market forces and some of their likely consequences, see Higher Education in Europe, 16:3 (Autumn 1991).

54

Patterns change in views as to the legitimate role of central administration in the affairs of academe.71 It also had a real and structural signicance as a new species of private higher education began to grow up on the margins of the public sector, either as afliates to established universities in the form of schools of business administration (the Universities of London, Manchester and Warwick in the UK) or, as one sees in France, Spain, Belgium and the Netherlands, in the shape of schools of commerce, some superior, others of a creatively ambiguous status and condition. This new non-state sector is characterized by its highly specialized and restricted range of disciplines, which are focused almost exclusively on economics, management and business studies, by its often considerable fees even in countries where enrolment charges are minimal, and by its proprietorial nature; that is, it is owned and legally incorporated as a business. It also tends to have much smaller student intakes and to award its own diplomas. Precisely how many establishments of this sort exist is one of the grey areas of higher-education enquiry. The expansion of this new institutional layer within the vaster universe of non-state higher education may well constitute one of the more signicant amongst the emerging patterns in the structure of higher education. Paradoxically, since it has grown up as a structural response to market forces, it may be seen as paralleling the segmentation between specialized establishments which forty years ago were created to feed the different sectors of a command economy in the Eastern bloc. Be that as it may, the earlier forms of non-state higher education, usually dened by their particular religious or ethical identity, were important instruments in the drive to mass higher education. In some instances, and notably in Belgium, the main change involved a nationalization of their nancing.72 Another variant in the process of institutional development of the non-state sector may be seen in the Free University of Brussels and the Catholic University of Leuven, though the decision owed more to linguistic dissent than simply the demands for student places on their own. Both universities were split along linguistic lines, with a Dutchspeaking Vrije Universiteit te Brussel emerging from the former and the French-speaking Universit e Catholique de Louvain from the latter. In 1984, forty-four universities distributed across fourteen countries were in the non-state sector. Of these, only three were located in Eastern and Central Europe, all of them religious foundations, two in Czechoslovakia and one in Poland. Six non-state universities out of ten were concentrated in Italy, Belgium, Spain and the Netherlands. Around one in
71

72

G. Neave and F. A. van Vught (eds.), Prometheus Bound: The Changing Relationship between Government and Higher Education in Western Europe (Oxford, 1991). R. L. Geiger, Private Sectors in Higher Education: Structure, Function, and Change in Eight Countries (Ann Arbor, 1986).

55

Guy Neave Table 2.6 Universities in the non-state sector

Overall N= Established universities upgraded promoted by 2-step mobility Unknown Total 242 129 89 13 8 481 % 50 27 18 3 2 100 Non-state sector N= 12 6 21 3 2 44 % 27 14 48 7 4 100

Source: J lek, Historical Compendium

four had been established before 1950. As the individual cases mentioned above indicate, expansion was largely a matter of recognizing establishments already in place but not ofcially designated as full universities by the State. This process of accreditation was determined by the overall rhythm and periodicity of reform in individual countries. It tended to be earlier in Northern Europe, beginning in Belgium in the early sixties and taking place somewhat later in Italy and Spain. As a result, around onethird of the forty-four non-state establishments gained university status between 1970 and 1983. This was not the only difference. Table 2.6 shows the patterns of institutional advancement for the nonstate sector compared to all universities in the survey. Though perhaps an obvious point, creating universities in the non-state sector was based to a far higher degree on promotion from a non-university status than on the institutional upgrading that had propelled their state counterparts.73

the non-university sector There is another pattern-moulding development, which has already had great effect. This is the rise of the non-university sector and, more especially, short-cycle higher education.74 Enrolments in short-cycle higher
73

74

The point could be made that the rise of national university systems often took over establishments which, like all universities, had at one time been religious in origin. The growth in mass demand for higher education thus continued a practice steeped in time. Yet it would appear that pressure for growth was more powerful in raising establishments which were in the non-university sector to full university status than it was in moving those already on the periphery of the university system to fully accredited status. We have already had cause to remark on the operational difculties of identifying these two categories. The non-university sector in Belgium and Britain, for example, may contain degree courses the duration of which is as long as university programmes. If all short-cycle higher education is located in non-university establishments, not all nonuniversity establishments are exclusively given over to short-cycle higher education. At

56

Patterns education are far from uniform in Western Europe.75 As a proportion of all students in higher education, these ranged from 2% in Italy to 58% in the Netherlands. Countries where short-cycle programmes enrolled a substantial minority of all student enrolments were Belgium (48%) the United Kingdom (41%) Norway (36%) Ireland (30%) Switzerland (29%) and Sweden (25%).76 In the Soviet model of higher education, by contrast, the non-university sector, with certain exceptions such as Czechoslovakia, catered for the overwhelming majority of students in higher education. The growth of short-cycle higher education as the non-university sector of national provision passed through two interpretative phases. During the rst phase, the sixties and early seventies, it was seen as complementary and, to some extent, as an alternative to the university, as institutions were concerned with the development of skills immediately applicable on the market, often at the middle management and technician level.77 To this extent, the non-university sector dealt with relatively short-term shifts in the labour market. The task of meeting long-term change remained with the university. Many short-cycle institutions whether university institutes of technology in France, Fachhochschulen in the Federal Republic of Germany, hoger beroepsonderwijs in the Netherlands or the polytechnics in Portugal awarded what in the magnicently sinister terminology of international agencies were deemed terminal degrees. They did not open the path to research or to postgraduate training. Exceptions to this binary model occurred in the Norwegian regional colleges, which prepared the rst part of a normal university degree programme. Possibilities for transfer to university were also open to graduates of the Yugoslavian visa skola.78 Short-cycle establishments during this phase of their evolution reinforced within their respective systems the dual phenomenon of institutional segmentation and sectoral differentiation. In the second phase, which emerged in the mid-1970s, short-cycle higher education was reassessed as a prime vehicle for meeting labour market requirements. It became a sector in competition with the university, not merely for students, but also for the favourable eye of governments and employers. This they obtained, partly on grounds of cost short-cycle students were held to cost less, since a higher proportion of students graduated within the time ofcially set for completion and
the risk of confusion, we will, however, assume that short-cycle higher education and the non-university sector are the same thing. D. Furth, Short Cycle Higher Education: Europe, in Clark, Encyclopedia I, 1219. OECD, Education in OECD countries (Paris, 1990), cited by Furth, Short Cycle (note 74), 1219. M. Y. Bernard, Les instituts universitaires de technologie (Paris, 1970). G. Neave, Patterns of Equality: The Inuence of New Structures in Higher Education upon Equality of Opportunity (Windsor, 1976).

75 76

77 78

57

Guy Neave partly because they were held to be more market responsive and less discipline driven than long-established institutes of academe.79 Whether their manifest success or their mediocre performance in meeting public expectations about the relevance of their training or the employability of their graduates accounts for the undoubted inuence short-cycle higher education had upon the university is by no means clear. There are examples of both. In France, to take one instance, the failure of the two-year university institutes of technology to attract students in the numbers for which planners had hoped was certainly one of the reasons for extending the two-year rst-cycle pattern to the university sector in 1972. In Britain, the reinforcement of vocationalism in universities was the product of the relative success polytechnics had in developing new cross-disciplinary combinations for degree programmes. Their initiatives were rapidly emulated by the noble sector. Whether history repeats itself or, for that matter, whether higher education has its counterpart of the long-term Kondratieff cycle in economics is a matter that historians and their brethren, whose concern focuses more exclusively on higher education, may well debate. Yet evidence for a second cycle of reform, of radical shifts in both pattern and structure that began to gather momentum from the mid-1980s, is undeniable. Indeed, there is every indication, in terms of student enrolments, institutional creation and upgrading, to suggest that the second wave of reform was, if anything, more far reaching than its predecessor. I shall not repeat the analysis for the period post-1984 I gave for the years from 1950 onwards. Rather, we will conne ourselves to what is seen increasingly by specialists as higher educations driving onward and beyond the mass stage in its development, and in some instances reaching what the American policy analyst Martin Trow termed the universal stage,80 when more than 40 per cent of the appropriate age group enters higher learning. Already more than half the age range moves on to post-school learning in France. In Britain, the attainment of a similar rate of attendance has been xed as a national goal for 2007,81 whilst the same ambition is being oated for higher education in the Netherlands by the year 2010.82
79

80

81 82

Wissenschaftsrat, Fachstudiendauer an Fachhochschulen im Prufungsjahr 1986 9/7 (Cologne, 1986); E. Frackmann, Resistance to Change or no Need to Change? The Survival of German Higher Education in the 1990s, European Journal of Education, 25:2 (1990), 187202; M. Doumenc and J. C. Gilly, Les IUTs: Ouverture et id eologie (Paris, 1977). M. Trow, Problems in the Transition from Elite to Mass Higher Education: Policies for Higher Education, General Report to the Conference on the Future Structure of Post-secondary Education (Paris, 1974). White Paper, Education and Skills: The Future of Higher Education (London, 2003). Ministerie van Onderwijs, Cultuur en Wetenschap and HBO-Raad, Prestatieagenda 2005 (The Hague, 2005), esp. ch. 4 Participatie.

58

Patterns caveats on the sources for the period 19902005 The CRE/EUA compilation stopped at 1984. We have therefore to draw on other sources for the later period, which are not always based on the same denitions of institutional type and status, and are not always directly comparable. The data bank of the International Association of Universities, though worldwide, relies on ofcial ministerial denitions as to what constitutes a university-type establishment. Furthermore, the very events that mark the late eighties as a watershed in the history of the universities of Europe the fall of the Berlin Wall and the collapse of those systems of higher education that drew upon the Soviet Union as referential model also saw the re-emergence of independent nations and with them their higher education systems from behind the former Iron Curtain. The world we have lost is very different from the world that we have gained. The main difference between the two datasets is that the rst relied on a historical denition of the university, whereas the second is grounded in what is best described as a nominal or administrative denition. If an establishment is dened by its authorities as a university and carries the title university, it is accepted as such. This rule of thumb meets with considerable difculty in the case of France, where alongside the univer coles, engineering schools, sity run two other sectors, the elite grandes e coles dapplication and higher commercial schools (e coles sup e erieures de commerce) on the one hand and, on the other, the short-cycle sector. Whilst identifying universities de nomine is not arduous, classifying the remainder, which constitute by far the greater part of the institutional fabric of French higher education, is a redoubtable task. One of the salient features of the decade and a half since restoration of the universities of Central and Eastern Europe as full members to the Republic of Learning has been the drive towards marketization on the one hand and privatization on the other.83 What is understood by these terms is very different in Western Europe from the overtones it carries in Central and Eastern Europe.84 They are matters of major consequence in shaping the prole of particular systems of higher education and especially so when it comes to the sources of support. Here again, the denition of whether a particular establishment relies for the major part of its nancing on the public purse or the private pocket corresponds to information given by ofcial sources, which obviously follow their own particular criteria. Nor is information always forthcoming. Indeed,
83 84

Slancheva and Levy, Private Higher Education (note 69), Appendix, 1418. J. de Groof, G. Neave and J. Svec, Governance and Democracy in Higher Education (Dordrecht, 1998), esp. ch. 1.

59

Guy Neave Table 2.7 Institutional growth rates 19902005 in the European Union, Western Europe and East and Central Europe (universities only)
Public institutions Overall West N= N= Private institutions East and Central Unknown N= N= 3 13

East and Central Unknown Overall West N= N= N= N= 2 38

1990 614 508 104 2005 817 635 144 % growth 33.06 25.00 38.46

100 89 8 201 125 63 101.00 40.45 687.50

Source: Derived from IAU data archives of universities existing in 1990 and 2005

in certain states Belgium, Ireland and the Netherlands, for instance the question of nancing combined with ownership (pouvoirs organisateurs in Belgian legal terminology) is a matter of such delicacy that often no information was provided. Discretion is then the better part of inaccuracy! Be that as it may, our concern here lies less with exactitude down to the last establishment than with the gross patterns and general tendencies that have emerged from the university world in Europe since 1984. new perspectives The systems of higher education that today are part of the Member States of the European Union have experienced an immense further development in their institutional fabric. Leaving aside Russia, Albania, Bulgaria, Romania, Belarus and the Ukraine, the number of universities rose by more than a third between 1984 and 1990. By 2005, their number had almost doubled, from 524 in 1984 to 1,018 two decades later. Once we control for differences in ownership and funding patterns and break out universities that governments see as publicly funded, it is clear that the most rapid growth has occurred in the private sector. The most intense activity occurred in the Western economies, where some 200 establishments obtained university status over the decade and a half that followed the fall of the Berlin Wall. In terms of percentage rates, growth is most marked in East and Central Europe, where the number of universities created doubled. In both East and West, what one scholar has termed the rise and rise of the private sector85 outstrips by far the growth of its public counterpart, increasing by almost 40 per cent over the
85

V. Tomusk, The War of Institutions, Episode 1 the Rise and Rise of Higher Education in Eastern Europe, Higher Education Policy, 16:2 (2003), 314.

60

Patterns 1990 base line by 2005 in Western systems and rising almost sevenfold over the same period in Central and Eastern Europe. The preponderance does not hold for student numbers. Most private universities are relatively small and tend not to have the full range of faculties, choosing rather to specialize where equipment costs are low and private sector interest high banking, business, management, languages and so on.86 On the other hand, the private sector in Eastern Europe is not as separate from the public sector universities as many analysts think. Much of it draws on public sector university staff to provide teaching and other services.87 In which of the EU Member States has institutional growth been the most outstanding? In the public sector, the United Kingdom stands out more than doubling the number of universities from 53 in 1990 to 118 in 2005,88 followed by Poland (22 additions), Italy (17), Spain (11), France (9), Slovakia (7), the Czech Republic (6), Estonia and Austria (4 each). The league table in respect of private sector universities shows a different prole: Poland is the most prolic (37 additions), followed by Portugal (16),89 Spain (14), Italy and Austria (6 each) and Estonia (4).

the astounding vitality of the non-university sector In todays system of higher education, the university sensu stricto is increasingly looked upon by both governments and citizens as primus inter pares. It is rst amongst perhaps not equals but certainly amongst other forms of institution, whether these are called short-cycle, higher vocational training, higher education outside the university and so on. If account is taken of the non-university sector, which was not possible for the period 194984, a tipping point appears to have been reached in the course of the last fteen years. In terms of numbers, Europes universities despite their tremendous expansion now appear to form a minority within the higher-education systems of the EU. In some systems, the sheer
86

87

88

89

V. Tomusk, Higher Education Reform in Estonia: A Legal Perspective, Higher Education Policy, 14:2 (2001), 20112. For this in the Romania context, see Dima, Quality (note 38), and also Tomusk, War (note 84), 314. For details, see British Council, Recognized UK Degrees (London, 2007). www.dfes.gov. uk/recognisedukdegrees/index.cfm?fuseaction=institutes.list&InstituteCategoryID=1& OrderBy=Category. A. Amaral and P. Teixeira, The Rise and Fall of the Private Sector in Portuguese Higher Education, Higher Education Policy, 13:3 (2000), 24566.

61

Guy Neave Table 2.8 The changing place of the university in the institutional prole of higher education in the EU 19902005
Universities total N= 1990 2005 714 1,018 Non-university sector total N= 656 1,375 University as percentage of total higher education % 52 44

Source: IAU data bank

quantitative rise can only be the result of changes in legislation, nomenclature and denition rather than physical construction. That appears to be the case of the public non-university sector in Denmark, where the number of establishments associated with the non-university sector rose from 10 to 115 between 1990 and 2005. And a similar explanation holds for Finland, where national policy laid particular weight on developing the non-university public sector in the early nineties.90 Similar considerations operated in Austria, where institutional diversication in the shape of setting up a Fachhochschule sector took place at the same time,91 though ofcial sources classify these establishments, nancially at least, as being in the private sector. In Germany, where the non-university sector showed similar buoyancy adding some 68 establishments to the 159 that fell into this category in 1990 the assimilation of the higher-education establishments of the ex-Democratic Republic largely accounts for the increase. In Poland, however, institutional growth in all sectors university and non-university, public and private showed a general mobilization which far surpassed other systems of higher education, whether East or West, especially in the non-university sector. This fact may be explained not simply by entrepreneurial energy in meeting a social demand for higher education that a command economy had long held in abeyance, but also by the return of the Catholic Church as an organizing power in a system of higher education set free from the shackles of state and party. In short, whilst the multiplication of institutions of higher education stands as a phenomenon that transcends the frontiers of individual lands, the circumstances that surround and accompany it are more often than not
90 91

OECD, Lenseignement polytechnique en Finlande (Paris, 2003). E. Leitner, Academic Oligarchy and Higher Education Research: Implications for the Reform of Institutions of Higher Education in Austria, Higher Education Policy, 12:2 (1999), 2740.

62

Patterns specic to the particular society. Similar outcomes do not always denote similar causes. Though there are certainly exceptions (the British reform of 1992 that incorporated the polytechnics into an expanded university sector is one), the expansion of the non-university sector, whether it is designated as public or private in its ownership and nancing, is a clear pointer to the continuation of institutional diversication and institutional segmentation. Since 1990, this pattern has marked such diverse higher-education systems as Austria, the Czech Republic, Denmark, Finland, Germany, Poland and Portugal. When set against the sheer numbers of establishments that came into being after 1990 and especially those in the nonuniversity sector, the pattern is further evidence of a subtle and longdrawn-out process that accelerated over the past decade. This process does not point to a decline of the university from the place it occupied over the past two centuries on the normative heights of post-school education. That the university became a minority in terms of all institutions in the higher-education systems of the European Union does not strengthen it as a species, though triage through conditional nancing, repeated quality assessment and performance evaluation may serve to boost the lot of a fortunate few amongst them. As the university and non-university sectors unfold, the exact relationship between them becomes crucial. Is cross-sectoral coordination between them to be based on the extension of the university ethos to the non-university sector? Or is it to be based on the swallowing up of the university by the non-university sector? That such questions can be posed is a sure pointer to the pattern-moulding power, irrespective of the reasons or motives behind it, that the non-university sector now exercises upon the university, though often indirectly through the declarations of central policy-makers. the closing of the circle In examining the institutional dynamic that lay beneath the drive of the university towards mass status, as well as exploring what we have termed the pattern-moulding forces which bore down upon the university once it had become a mass institution, we have concentrated perhaps overmuch on Western Europe. There is one excellent reason for this. The basic issues that the university in East, Central and Western Europe faced were by no means dissimilar over the past forty years reconstruction, the ways of linking with the economy, the offsetting of social inequality, to mention but three. The differences lay rather in the institutional structures and their accompanying systems of control. They reected the model of human progress that each ideological bloc upheld 63

Guy Neave and thus the priorities and goals that shaped the university systems within them. Following the fall of the Berlin Wall in 1989, the Soviet model of higher education ceased to be the reference point for the countries that assimilated it at the beginning of the period with which this volume is concerned. Todays reference point, regardless of the reasons and irrespective of whether it is fully apprehended,92 is now the patterns, practices and proles contained in the higher-education systems of Western Europe.93

the symmetry of patterns A certain symmetry between East and West may be perceived across the sixty years that have elapsed since the end of the Second World War. This symmetry is present in two outstanding manifestations: rst, reconstruction of higher-education systems; second, and as a consequence of the rst, the quest for an optimal model on which to ground reconstruction. These were the predominant themes at the opening of this period. They are at the head of the agenda as it draws to a close. It would not be correct to believe that reconstruction is a priority conned to East and Central Europe alone. There, the problems are certainly more visible, more massive and often involve basic issues such as the balance between university and non-university higher education,94 admission and selection. They also embrace such fundamental matters as student participation in governance, the internal distribution of power and authority as much at institutional level as at the level of central administration.95 Many of these items on the agenda for reform were raised, and in some cases dealt with, in Western university systems over the course of the past half-century. The universities of Central and Eastern Europe, by contrast, have been faced with such matters simultaneously and under strong pressure of time.96 Western universities are engaged in a species of reconstruction as well. It is presented in terms of the creation of a European Higher Education Area, of integrating national labour markets, of recognizing each others
92

93

94

95

96

J. Rupnik, Higher Education and the Reform Process in Central and Eastern Europe, European Journal of Education, 27:12 (1992), 14551. V. Tomusk, The Open World and Closed Societies: Essays on Higher Education Policies in Transition (New York, 2005). The interest of the Czech authorities in the West German Fachhochschulen as an alternative sector and developed in much the same way, that is, out of upper secondary vocational schools elevated to higher education status, is a case in point. G. Neave, A Changing Europe: Challenges for Higher Education Research, Higher Education in Europe, 16:3 (1991), 327. See also chapters 3 (Relations with Authority), 4 (Management and Resources) and 6 (Admission) in this volume. Neave, Return (note 39).

64

Patterns diplomas, of internationalizing student ows and opportunities to study. This reconstruction drives towards the international at the very time when what was formally also a species of international higher-education space, grouped within Comecon, has gone the way of Nineveh and Tyre. Just when Europes universities of the Centre and East are reasserting their cultural and historic independence and identity, the question is being raised in certain quarters in the West as to whether the nation state is any longer an adequate framework for the university and a fortiori, university research to develop further.97

select bibliography for part i

General works Becher, T. and Kogan, M. Structure and Process in Higher Education, London, 1990, 2nd edn. Burn, B. B. et al. Higher Education in Nine Countries: A Comparative Study of Colleges and Universities Abroad. A General Report Prepared for the Carnegie Commission on Higher Education, New York, 1971. Cerych, L. and Sabatier, P. Great Expectations and Mixed Performance: The Implementation of Higher Education Reforms in Europe, Stoke-on-Trent, 1986. Clark, B. R. The Higher Education System: Academic Organization in Cross National Perspective, Berkeley, Los Angeles and London, 1983. Clark, B. R. and Neave, G. (eds.) Encyclopedia of Higher Education, Oxford, New York, Seoul and Tokyo, 1992, 4 vols. Furth, D. Short Cycle Higher Education: Crisis of Identity, Paris, 1974. Daalder, H. and Shils, E. (eds.) Universities, Politicians and Bureaucrats: Europe and the United States, Cambridge, 1982. Geiger, R. L. Private Sectors in Higher Education: Structure, Function, and Change in Eight Countries, Ann Arbor, 1986. Hopkins, M. Manpower Planning Revisited, PhD thesis, Geneva, 2000. IRDAC (Industrial Research and Development Advisory Committee of the Commission of the European Communities), Skills Shortages in Europe: Industrial Research and Development Advisory Committee Opinion, Brussels, 1990. J lek, L. (ed.) Historical Compendium of European Universities/R epertoire historique des universit es europ eennes, Geneva, 1984. Kallen, D. and Neave, G. The Open Door: Pan European Academic Cooperation, Bucharest, 1991. Kerr, C. The Great Transformation in Higher Education, 19601980, Albany, N.Y., 1991.
97

A. Ruberti, The Role and Position of Research and Doctoral Training in the European Union, in J. Huisman, P. Maassen and G. Neave (eds.), Higher Education and the Nation State (Oxford, 2001), 10720.

65

Guy Neave
Kogan, M. and Tuijnman, A. Educational Research and Development Trends: Issues and Challenges, Paris, 1995. Kwiek, M. Social and Cultural Dimensions of the Transformation of Higher Education in Central and Eastern Europe, Higher Education in Europe, 26 (2001), 399410. Laderri` ere, P. Les examens de politiques nationales d education a ` lOCDE, in Education compar ee Les sciences de l education pour l` ere nouvelle ducation et soci e et es, Paris, 1998. Lester, R. A. Manpower Policy in a Free Society, Princeton, 1966. Levy, Daniel C. Higher Education and the State in Latin America: Private Challenges to Public Dominance, Chicago, 1986. Lowe, R. (ed.) Education and the Second World War: Studies in Schooling and Social Change, London and Washington, 1992. Neave, G. A Changing Europe: Challenges for Higher Education Research, Higher Education in Europe, 16:3 (1991), 327. Neave, G. La dimensio es educacional en la Integracio Europea: Una ulluda m enlla dels Mestres (Departament dEnsaynament, ` dels programes, Bullet Generalitat de Catalunya), 228 (June 1991), 511. Neave, G. The European Dimension in Higher Education: An Excursion into the Modern Use of Historical Analogues, in J. Huisman, P. Maassen and G. Neave (eds.), Higher Education and the Nation State, Oxford, 2001, 1367. Neave, G. and van Vught, F. A. (eds.) Prometheus Bound: The Changing Relationship between Government and Higher Education in Western Europe, Oxford, 1991. Nybom, T., Neave, G. and Bluckert, K. (eds.) The European Research University: A Historical Parenthesis? Basingstoke, 2006. OECD, Education in OECD Countries, Paris, 1990. Rothblatt, S. and Wittrock, B. (eds.) The European and American University since 1600: Historical and Sociological Essays, Cambridge, 1993. Rupnik, J. Higher Education and the Reform Process in Central and Eastern Europe, European Journal of Education, 27:1/2 (1992), 14551. Rybalko, L. and Soloviev, E. Reection on the Future: Educational Development and Forecasting, Paris, 1980. Seabury, P. (ed.) Universities in the Western World, New York and London, 1975. Teichler, U. Convergence or Growing Variety: The Changing Organization of Studies, Strasbourg, 1988. UNESCO, Case Studies on the Development of Higher Education in Some Eastern European Countries, Document ED-74/WS/52. 26 October 1974, Paris, 1974 [roneo]. Weber, M. Wissenschaft als Beruf, in C. Wright Mills and H. Gerth (eds.), From Max Weber: Essays in Sociology, Oxford, 1964 [translation]. Woodhall, M. Changing Sources and Patterns of Finance for Higher Education: A Review of International Trends, Higher Education in Europe, 17:1 (1992), 1419.

66

Patterns
Individual countries Belgium Ministerie van de Vlaamse Gemeenschap, Departement Onderwijs. Education in Belgium: The Diverging Paths, Brussels, 1991. ` lhistoire de la R Tanham, G. K. Contribution a esistance belge 19401944, Brussels, 1971. Willems, J. Belgium under Occupation, New York, 1947.

Bulgaria Penkov, T. Bulgaria, in B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. I, Oxford, New York, Seoul and Tokyo, 1992, 959.

Czechoslovakia OECD. Review of Higher Education in the Czech and Slovak Federal Republic: Examiners Report and Questions, Paris, 1992.

Finland Holtt a, S. From Ivory Tower to Regional Networks, European Journal of Education, 35:4 (December 2000), 46574.

France Bernard, M. Y. Les instituts universitaires de technologie, Paris, 1970. Blocq Mascart, M. Chroniques de la R esistance, suivies d etudes pour une nouvelle r evolution franc aise par les groupes de lOCM, Paris, 1945. Calmette, A. LOCM Organisation civile et militaire: Histoire dun mouvement ` 1946, Paris, 1961. de R esistance de 1940 a Doumenc, M. and Gilly, J. C. Les IUTs: Ouverture et id eologie, Paris, 1977. Granet, H. and Michel, H. Combat: Histoire dun mouvement de R esistance de ` juillet 1943, Paris, 1957. juillet 1940 a Guin, J. The Re-awakening of French Higher Education, European Journal of Education, 25:2 (1990), 12345. Lamour, J. Les instituts universitaires de technologie, Paris, 1981. Minot, J. Quinze ans dhistoire des institutions universitaires (mai 1968 mai 1983), Paris, 1983. Neave, G. France, in B. R. Clark (ed.), The Research Foundations of Graduate Education: Germany, Britain, France, United States, Japan, Berkeley, Los Angeles and London, 1993, 159220.

67

Guy Neave
Germany, Democratic Republic Mohle, H. German Democratic Republic, in B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. I, Oxford, New York, Seoul and Tokyo, 1992, 23140. Germany, Federal Republic Fuhr, C. and Furck, C. L. (eds.) Handbuch der Bildungsgeschichte, vol. VI: 1945 bis zur Gegenwart, Munich, 1998. Peisert, H. and Framhein, G. Higher Education in Germany, Bonn, 1995. Ringer, F. The Decline of the German Mandarins: The German Academic Community 18901933, Cambridge, Mass., 1969. Teichler, U. (ed.) Das Hochschulwesen in der Bundesrepublik Deutschland, Weinheim, 1990. Italy Ryan, D. The University of Calabria in its Regional Context, Paedagogica Europaea, 13 (1977), 6392. The Netherlands Daalder, H. The Netherlands: Universities between the New Democracy and the New Management, in H. Daalder and E. Shils (eds.), Universities, Politicians and Bureaucrats: Europe and the United States, Cambridge, 1982, 173231. Goedegebuure, L. Grapes, Grain and Grey Cats: Binary Dynamics in Dutch Higher Education, European Journal of Education, 27:1/2 (1992), 5768. Groen, M. Het wetenschappelijk onderwijs in Nederland van 1815 tot 1980: Een onderwijskundig overzicht, 3 vols. Eindhoven T.U., 1989. Jong, L. de. Je maintiendrai: Een jaar Nazityrannie in Nederlanden, London, 1941. Jong, L. de. Het Koninkrijk der Nederlanden in de Tweede Wereldoorlog, The Hague, 196788. Ministerie van Onderwijs en Wetenschappen. Beleids voornemens taakverdeling en concentratie wetenschappelijk onderwijs, The Hague, 1983. Rupp, J. C. C. Van oude en nieuwe universiteiten: Een historisch-sociologisch onderzoek naar de veronderstelde verdringing van Duitse door Amerikaanse modellen van wetenschapsbeoefening en hoger onderwijs en de dynamiek van de Nederlandse universitaire wereld, 19451995, The Hague, 1997. Norway Aamodt, P. O. A New Deal for Norwegian Higher Education?, European Journal of Education, 25:2 (1990), 17185. Kyvik, S. The Norwegian Regional College: A Study in the Establishment and Implementation of a Reform in Higher Education, Oslo, 1981.

68

Patterns
Poland Adamski, W. and Bialecki, I. Selection at School and Access to Higher Education in Poland, European Journal of Education, 16:2 (1981), 20933. Ministry of Higher Education. Institutions of Higher Education in Poland: Information and Statistics Bulletin, Warsaw, 1963. Szczepanski, J. Systems of Higher Education: Poland, New York, 1978. Soviet Union Afanassiev, V. The Soviet Union, in B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. I, Oxford, New York, Seoul and Tokyo, 1992, 68798. Rabkin, Y. M. Academies: Soviet Union, in B. R. Clark and G. Neave (eds.), The Encyclopedia of Higher Education, vol. II, Oxford, New York, Seoul and Tokyo, 1992, 104954. Spain Consejo de Universidades. La reforma de la ensenanza universitaria, Madrid, 1987. de hoy, Madrid, 1987, 2nd edn. Garcia Garrido, J.-L. Sistemas de educacion e informe, Madrid, 1987. ICED. La reforma universitaria espanola: Evaluacion Sweden Lane, J.-E. Creating the University of Norrland: Goals, Structures and Outcomes, Umea, 1983. Premfors, R. T. Analysis in Politics: The Regionalization of Swedish Higher Education, Comparative Education Review, 28:1 (February 1984), 85104. Switzerland Ruegg, W. Switzerland: The Re-afrmation of Autonomy, in H. Daalder and E. Shils (eds.), Universities, Politicians and Bureaucrats: Europe and the United States, Cambridge, 1982, 394433. United Kingdom Burgess, T. and Pratt, J. Policy and Practice: The Colleges of Advanced Technology, London, 1970. Perkin, H. J. New Universities in the United Kingdom, Paris, 1969. Pratt, J. and Burgess, T. The Polytechnics, London, 1974. Venables, P. Technical and Higher Education, The Changing Pattern. Part 2, BACIE, 24:1 (March 1970), 3440.

69

PART II

STRUCTURES

CHAPTER 3

RELATIONS WITH AUTHORITY

EGG AND JAN SADLAK WALTER RU

introduction Never before in history had the expectations placed on the universities been greater than in the fty years following the Second World War. Never had Europe seen so many universities and other institutions of higher learning being founded in such a short time. Never before had they hosted such crowds of teachers, students and administrative personnel. Never, to such an extent, had they been at the centre of public discussion, expectation and criticism. Never had governments had such an inuence on the universities development; at the same time universities were cooperating on an unprecedented scale at the national and international levels. Hardly anyone could have predicted this development in 1945 quite the opposite: there were fears that structural unemployment in the academic professions would continue as before the war,1 and that the state would have to take measures accordingly.2 Thus, in 1942, the government of neutral Switzerland created the ofce of a Delegate for Job Creation, assisted from 1944 on by a Commission for the Promotion of Scientic Research.3 In those countries that had been stricken by the war, government interventions in university education were even more drastic. Comprehensive publications on the situation of universities in belligerent and occupied
1

See, e.g., W. Kotschnig, Unemployment in the Learned Professions (Oxford, 1937); tudiants (Paris, 1937). K. Dubois, Que deviendront les e H. Erb, Die Uberf ullung in den akademischen Berufen und Vorschlage fur Gegenmassnahmen, Schweizerische Hochschulzeitung, 17 (1943), 61128. W. Ruegg, Switzerland: The Re-afrmation of Autonomy, in H. Daalder and E. Shils (eds.), Universities, Politicians and Bureaucrats: Europe and the United States (Cambridge, 1982), 398.

73

 Walter Ruegg and Jan Sadlak countries are still lacking. In Poland, following the Aktion gegen Uni versitatsprofessoren Sonderaktion Krakau of 6 November 1939, most universities were left bereft of their professors and closed down; they were replaced by a clandestine network of college-level classes.4 In 1941, in open only to Germans was founded. Posen (Poznan), a Reichsuniversitat Hitler considered France to be an archenemy and destined it to become an agrarian state with low living standards. Therefore, until the end of 1941, the occupied part of the country was treated as a reservoir for systematic pillage. Then, with the transition from blitzkrieg to total war, the doctrine of Albert Speer prevailed: French production facilities were not to be destroyed but rather put to good use for the German war economy. As a result, the practice of deporting students to German labour camps was abandoned.5 With the exception of the institutions in the Alsace-Lorraine region, the universities remained under French control. In Lille, entering the buildings both of the state and of the free (Catholic) university was forbidden to members of the German armed forces.6 In the Netherlands, after 1942, the universities practically stopped their teaching activities, since only a few of the students agreed to sign the declaration of loyalty that the occupying power requested of them.7 Here, too, underground university classes operated. The war brought to light the economic and social importance of the universities and, correspondingly, the states interest in the increasing role of higher education in the interplay of social forces. Over the ensuing fty years, this process gained further impetus. In this context, four phases can be distinguished: 1. 2. 3. 4. Recovery in a divided Europe, 19451955 Emerging national and international university policies, 19561967 Expansion, democratization, bureaucratization, 19681982 Towards a harmonised European model, 19831995 recovery in a divided europe, 19451955 The war had left the universities heavily damaged, both materially and at the very core of their intellectual foundations, because of Nazi occupation
4

6 7

Some 10,000 students, mostly in Warsaw and Cracow, participated in underground higher education based on pre-war institutions. Jerzy Slaski, Polska Walczaca (1939 1945) Noc, Solidarni (Warsaw, 1986), 56. M. Zareba and A. Zareba (eds.), Ne Cedat Academia: Kartki w tajnego mauczania w universytecie Jagellionskim 19391945 (Cracow, 1975), 1429. J.-B. Duroselle, R eexions sur la France face a ` la guerre totale dAdolf Hitler (1972), in B. Duroselle, Itin eraire (Paris, 1991), 327. C. Schmid, Erinnerungen (Bern, Munich and Vienna, 1980), 194. W. Kronig and K.-D. Muller, Nachkriegssemester: Studium in Kriegs- und Nachkriegszeit (Stuttgart, 1990), 79.

74

Relations with authority and collaboration. The speed of their reconstruction is one of the most astonishing post-war achievements of both governments and universities. Yet this phenomenon has only been partially studied to date. In 1949, across many countries of Western Europe, about twice as many women and men were studying as in 1938; in other regions, it was 25 to 30 per cent more.8 This growth cannot be simply explained by the fact that, in 1945, the surviving members of several age cohorts returned from the war or from war-camps to continue or begin their studies. The fact that they were able to do so, in such numbers and to such an extent, shows that the authorities viewed the reconstruction of Europe not only as an economic and technical problem, but also as an educational and intellectual challenge. However, nowhere did they address this challenge by way of any special university policy. In the UNITED KINGDOM, the Education Act of 1944, ofcially called An Act to reform, i.e. to reshape, the law relating to education in England and Wales, left the universities untouched. The University Grants Committee, founded in 1919 and composed of university representatives, continued to distribute state subsidies without any direct prescriptions; nevertheless, in 1946, the universities agreed to follow the recommendations of the Barlow Committee and to double the ratio of students they trained, in order to provide the professionals required by society. The state subsidized research in the elds of Slavic and oriental languages, economics and the social sciences.9 In the other Western European countries, too, the authorities conned themselves to placing the universities in a position whereby they could once again engage in their traditional tasks. In FRANCE, de Gaulles government in exile had plans to reform the coles. However, after higher-education system, particularly the grandes e victory, the need to reform higher education was neither felt nor given a high place on the political agenda until after 1956.10 In ITALY, the universities resorted to the traditions of autonomy and freedom to teach they had enjoyed before Fascism.11 The same is true for the countries that had suffered under German occupation. Countries that had been spared by the war, such as SWEDEN and SWITZERLAND, continued with their liberal university policy, whereas the governments
8

10

11

Wissenschaftsrat, Empfehlungen zum Ausbau der wissenschaftlichen Einrichtungen, vol. I: Wissenschaftliche Universitaten (Tubingen, 1960), 510. E. Shils, Great Britain and the United States: Legislators, Bureaucrats and the Universities, in Daalder and Shils, Universities (note 3), 440f. F. Bourricaud, France: The Prelude to the loi dorientation of 1968, in Daalder and Shils, Universities (note 3), 36f. A. Malintoppi, Italy: Universities Adrift, in Daalder and Shils, Universities (note 3), 109.

75

 Walter Ruegg and Jan Sadlak in SPAIN and PORTUGAL upheld their authoritarian hold on the universities.

The university policy of the allied military forces in Germany The great difculties of formulating a university policy that went beyond mere material reconstruction were particularly evident in the case of Germany. After its unconditional surrender, Hitlers Reich was, in its material, political, economic and cultural fabric, a tabula rasa of the sort Plato had pictured as a starting point for the construction of an ideal state and its educational institutions. The university policy of the four occupying forces in Germany presents a fascinating case study of promising and failed initiatives, and deserves special consideration in the post-war history of the university in Europe. As an interesting showcase, it conrms Poppers warning, dating from 1945, about the dangers intrinsic to the Platonic idea of erecting an ideal state and its universities on the basis of a tabula rasa.12 But it also shows that the university policies of the Western occupation powers, whose goal was to establish democratic and European political convictions in Germany, had only indirect and long-term effects. The Allied Powers had agreed on a common aim: to prevent Germany from ever gaining the wherewithal to start another world war. Opinions as to how this was to be achieved, however, were widely divergent. In the United Kingdom, the prevailing wish was to avoid the harshness of the Treaty of Versailles. Thus, starting in 1940 and culminating in 1944,13 the British propagated re-education as a permanent change of heart and conversion to tolerable European behaviour.14 The Soviets, by contrast, held that the winners of the First World War had not gone far enough in Versailles. Stalin demanded a complete destruction of the industrial potential for war and a democratic reconstruction of German society. In the United States, initially, the tendency was to follow the British. Starting in 1942, both the State Department and the War Department had experts working on proposals for long-term policy and for the war occupation of Germany. In 1943, social psychologists propagated re-education to democratic values and behaviour for the mentally sick German people
12 13

14

K. Popper, The Open Society and its Enemies, 2 vols. (London, 1945). D. Phillips, War-Time Planning for the Re-education of Germany: Professor E. R. Dodds and the German Universities, Oxford Review of Education, 12:2 (1986), 195 208, esp. 196. K. Jurgensen, Was there a British Policy towards Higher Education? Some Retrospec tive Thoughts on the Oxford Symposium, in M. Heinemann and D. Phillips (eds.), Hochschulofziere und Wiederaufbau des Hochschulwesens in Westdeutschland 1945 1952, vol. I: Die britische Zone (Hildesheim, 1990), 79.

76

Relations with authority by means of a group-dynamic process of self-healing. A handbook was prepared, giving the universities a modest role in the reconstruction programme for cultural and educational policy.15 In 1944, indignation about the holocaust led to the Morgenthau Plan. Churchill adopted it at the AmericanBritish summit in Quebec: on 15 September 1944, he dictated a memorandum entailing a programme for eliminating the war-making industries in the Ruhr and the Saar and for converting Germany into a country primarily agricultural and pastoral in character.16 However, both in the UK and in the USA, public opinion reacted with such an uproar of criticism that Roosevelt and Churchill backed off and failed to endorse any denite occupation policy. Roosevelt banned any further use of the handbook. American troops marched into Germany without having any clear concept for the occupation of the country. Since 1942, the University of Virginia in Charlottesville had trained experts for administrative tasks in the occupied regions, including 200 education specialists. In spite of these efforts, in May 1945, the American military government had only ten education ofcers to hand in Germany to monitor the denazication and re-education of almost 20 million people.17 In January 1945, when Allied troops had already reached the Rhine, Churchill was still not inclined to concern himself with post-war politics.18 But since the very beginning of the hostilities he had emphasized that their scope was not destruction and revenge, but rather peace and security for the future community of nations, in which Germany would also take its place again. In the summer of 1944, in Kensington, two dozen education ofcers were trained in one of the various pedagogical sections of the British Control Commission in Germany.19 The Potsdam Agreement, signed by Attlee, Truman and Stalin on 2 August 1945, combined Stalins call for de-industrialization endorsed by Churchill and Roosevelt in Quebec with the concept of re-education. For the universities, the rst step toward de-industrialization resulted in taking away scientists and facilities, and in research bans on the strategic elds of war economy, such as nuclear physics, chemistry, aviation and shipbuilding. The formulation of the education programme stipulated that, out of the four Ds of denazication, demilitarization, democratization and decartelization, the rst three were to be assigned as education goals for the Germans themselves. The victorious powers were to allow
15

16 17 18

19

J. F. Tent, Mission on the Rhine: Reeducation and Denazication in American Occupied Germany (Chicago, 1982), 22. Henry Morgenthau, III, Mostly Morgenthaus: A Family History (New York, 1991), 386. Tent, Mission (note 15), 29. G. Murray, The British Contribution, in A. Hearnden (ed.), The British in Germany: Educational Reconstruction after 1945 (London, 1978), 68. Ibid., 77.

77

 Walter Ruegg and Jan Sadlak and control a successful transition from Nazi and militaristic doctrines to the development of democratic ideas, but they were not to bring it about themselves. At the same time, the Potsdam Agreement was couched in such general terms that it was compatible with the different university policies of the four occupying powers. In 1947 the Allied military government issued Directive No. 54, entitled Basic principles for the democratization of Education in Germany, which was theoretically binding for all occupying powers. But, against all expectations, the reopening of the universities had already been permitted in the late summer and autumn of the year 1945 partly to improve medical care for an underfed population with the help of the medical faculties,20 partly to keep potentially trouble-making youth off the streets.21 According to the Potsdam Agreement, university ofcers were to supervise, and, if need be, to enforce the denazication of both the faculty and the students, as well as the demilitarization that was to be carried out by German commissions. Additionally, they were to support education in democratic values. For these tasks they were unevenly prepared and equipped. Americans suffered both from the lack of a clear-cut concept for their university policy and from a lack of qualied controlling ofcers for their large occupation zone, with its fourteen institutions of university rank; furthermore, these ofcers had to endure the strong, sometimes contradictory, interference of the military command and its bureaucratic ordinances.22 The British were better prepared for the academic challenges of the occupation. For example, they had prepared lists of German professors to be red, checked upon, or restored to ofce immediately and given a leadership role, depending on their activities under Nazi rule.23 They had sufcient control ofcers for the eight universities and similar institutions in their zone, although the ofcers were hardly prepared for their specic tasks.24 They proceeded pragmatically; from the very beginning, they adopted both informal and institutional ways of cooperating with the heads of the universities. France was granted its own occupation zone as late as October 1944. It was not present at the Potsdam Conference, but it had adopted the guidelines of its Anglo-Saxon allies. Although most of the French university
20 21

22 23 24

Tent, Mission (note 15), 59. M. Heinemann and J. Fischer (eds.), Hochschulofziere und Wiederaufbau des Hoch schulwesens in Westdeutschland 19451952, vol. III: Die franzosische Zone (Hildesheim, 1991), 66f.; cf. Tent, Mission (note 15), 28. Tent, Mission (note 15), 316ff. Phillips, War-Time Planning (note 13), 2013. Heinemann, Hochschulofziere, I (note 14), 166ff.

78

Relations with authority ofcers had studied German language and literature, they were equally unprepared for their task.25 In the elds of culture and higher education, the French occupation forces pursued a more active policy than their Western Allies. In addition to the two ancient, barely damaged universities in their zone, Tubingen and Freiburg, they founded four new institutions of higher education on the western bank of the Rhine. These were the Universities of Mainz (1946) and Saarbrucken (1948), the Academy for Administrative Sci coles, and the Higher ences in Speyer (1947) modelled on the grandes e School for Translators in Germersheim (1947), which was afliated to the University of Mainz in 1949. The latter had been founded in 1476 as a studium generale and closed down by the French revolutionary troops in 1798. The signicance of its being reopened by the French occupation force of 1946 was underlined by the foundation of an Academy of Sciences and Literature at Mainz and an Institute for European History at the university. By adopting this broad-scale mission civilisatrice, the French were pursuing the goal of establishing intellectual bridgeheads in the former enemys country by cultural means in order to improve their security.26 In their control tasks, the university ofcers were generally supported by the rectors and the admissions committees of the various universities. When, beginning in 1947, the responsibility for university admin istration was increasingly handed over to the German States or Lander , re-education was supplanted by re-orientation. The university ofcers contributed to the successful development of democratic ideas to a far greater extent by taking care of the well-being of their universities and their members than by means of their ofcial duties. They supported the repair of buildings, defended students and teachers when pestered by the military, and helped them to survive during the Hunger Years and the exceptionally cold winter of 1946/47. Their promotion of international contacts and exchange programmes was of particular importance. From 1946 to 1948, several hundred foreign scientists, scholars, writers and artists presented the state of international science, scholarship and culture to German students and professors. Unlike in the years following the First World War, when even world-famous German professors were excluded from international conferences, from 1947 on professors and students alike were invited to the home countries of the Western occupying powers and to international meetings. The success of
25 26

Heinemann, Hochschulofziere, III (note 21), 12ff. M. Heinemann, Bildung und Wissenschaft im Rahmen der Kultur- und Sicherheitspolitik der Westalliierten. Erfahrungen der Nachkriegszeit, in F. Knipping and J. Le Ridder (eds.), Frankreichs Kulturpolitik in Deutschland, 19451950: Ein Tubinger Symposium, 19. u. 20. September 1985 1950 (Tubingen, 1987), 38.

79

 Walter Ruegg and Jan Sadlak this informal and indirect introduction to the values and customs of the Western democracies is evidenced by the records of women and men who studied in the early post-war years and who, later on, would belong to the elite of the Federal Republic.27 An undisputed major value of the Western democracies was the autonomy of the universities in organizing their curricula, conferring academic degrees and making a qualitative choice of the teaching staff. The occupy ing powers, together with the newly formed governments of the Lander , acknowledged and supported the universities efforts to re-establish the autonomy they had lost under Nazi rule. This renewed, edgling autonomy had to stand the test as the various tasks of reconstruction and recruitment were solved by commissions for planning and admission, by faculty committees, and through discussions with the mostly inexperienced Allied and German university administrations. How sensibly the universities reacted to any infringement of their newly acquired autonomy can be illustrated by a particular incident: when, in 1948, the government of Hesse appointed Secretary of State Hermann Brill to an honorary professorship against the will of the Frankfurt law faculty, the university, under the leadership of its rector Walther Hallstein, protested with such vehemence that this case of relatively minor importance was widely discussed.28 In these years of reconstruction, the universities were even temporarily granted the fourth pillar of their autonomy that had been lost in the nineteenth century to the secondary schools (Gymnasia): the right to choose their own students. In 1948, the Kaiser Wilhelm Society, founded in 1911, began operating again under the name of the Max Planck Society for the Advancement of Science.29 In 1949, it was followed by the Deutsche Forschungsgemeinschaft that succeeded the Notgemeinschaft fur die Deutsche Forschung,30 founded in 1920 to promote university-based research. The year 1949 also saw the ratication of the State Treaty of the German Lander in the
27

28

29

30

Kronig and Muller, Nachkriegssemester (note 7), with detailed bibliography; J. von Stackelberg, Die Uberwindung der Fremdheit: Memoiren eines engagierten Romanisten (Bonn, 2005), 3353; M. Becke-Goehring and D. Mussgnug, Erinnerungen: Fast vom Wind verweht (Bochum, 1950), 79115; cf. Heinemann and Phillips, Hochschulofziere (notes 14, 21) and M. Heinemann and U. Schneider (eds.), Hochschulofziere und Wiederaufbau des Hochschulwesens in Westdeutschland 19451952, vol. II: Die USZone (Hildesheim, 1990). Frankfurt am Main, vol. I: N. Hammerstein, Die Johann Wolfgang Goethe-Universitat 1914 bis 1950 (Frankfurt/Main, 1989), 24960. R. Vierhaus and B. vom Brocke (eds.), Forschung im Spannungsfeld von Politik und Gesellschaft: Geschichte der Kaiser-Wilhelm-Max-Planck-Gesellschaft (Stuttgart, 1990). T. Nipperdey and L. Schmugge, 50 Jahre Forschungsforderung in Deutschland: Ein Abriss der Geschichte der Deutschen Forschungsgemeinschaft 19201970 (Berlin, 1970).

80

Relations with authority German Federal Republic Concerning the Funding of Scientic Research Facilities, contracted at Konigstein im Taunus. The Konigstein Agree ment promoted university research that went beyond the scope and nancial power of a single Land. The costs were shared according to the relative population numbers and tax revenues of the Lander .31 Efforts to bring about a fundamental reform of the university system were less successful. From 1946 to 1952, the occupying powers initiated or promoted numerous reform conferences.32 Only the proposal to introduce general education programmes according to the American model, with the goal of improving political education, was adopted in the universities. It was called studium generale without reference to the historical meaning of the term and remained a foreign body in the German university system, not only semantically.33 For decades, post-war historiography focusing on university developments in Eastern Germany has encountered charges of partisan distortion. As they understood their role, historians in the DDR had to face the task of explaining and proving, in a far-reaching and thoroughgoing analysis, that Socialisms victory over Imperialism was a historical necessity.34 Studies by Western scholars were considered to be cold-war monstrosities but not only in the DDR. In 1992, a scientic colloquium on policies relating to universities and science was organized with the support of the Volkswagen Foundation at Gosen, near Berlin, with former Soviet university ofcers, thus continuing the tradition of the colloquia with university ofcers from the Western occupying powers.35 The contributions of the former Russian university ofcers revealed that Western studies on the Sovietization of East German higher education had been largely accurate.
31

32

33

34

35

E. Freund, Forschung der dritte Faktor: Eine Analyse mit Zahlen und Vergleichen (Stuttgart, 1966) (with international summaries). R. Neuhaus (ed.), Dokumente zur Hochschulreform 19451959, Veroffentlichungen der Westdeutschen Rektorenkonferenz (Wiesbaden, 1961), 260433; W. Ruegg, Epilogue: Higher Education at its Greatest Challenge. The Developments since 1960, in M. Heinemann and U. Schneider (eds.), Hochschulofziere und Wiederaufbau des Hochschulwesens in Westdeutschland 19451952, vol. II: Die US-Zone (Hildesheim, 1990), 228f.; D. Phillipps, Pragmatismus und Idealismus: Das Blaue Gutachten und die britische Hochschulpolitik in Deutschland 1948, Studien und Dokumentationen zur deutschen Bildungsgeschichte, 58 (Cologne, Weimar and Vienna, 1995). F. F. Tenbruck and W. Treue (eds.), Studium generale: Bericht uber zwei Weilburger Arbeitstagungen 30. August bis 1. September und 3. bis 15. September 1951 (with select bibliography); W. Ruegg, Humanism, and Studium Generale in German Higher Education, The Journal of General Education, 8:3 (1955), 13765. W. Flaschendrager and M. Straube, Die Entwicklung der Universitaten und Akademien im Spiegel der hochschulgeschichtlichen Forschungen (19601969): Literaturubersicht , Informationen und Studien zur Universitatsentwicklung, 12 (Berlin (Ost), 1970), 7. M. Heinemann (ed.), Hochschulofziere und Wiederaufbau des Hochschulwesen 1945 1949: Die sowjetische Besatzungszone (Berlin, 2000).

81

 Walter Ruegg and Jan Sadlak

We are facing a fortress. Its name is Science, Science with its innumerable branches of knowledge. We must take this fortress at any cost. If it wishes to be the builder of a new life, if it really wishes to supplant the old guard, Youth must take this fortress.

This quote from Stalin introduced the Western standard reference work on university policy promoted by the Soviet occupying power and the DDR administration, published in 1953.36 In 1992, one of the Russian participants at the Gosen conference used a quote by Lenin, which is very similar in its meaning, to describe the core of Soviet education policy:
It is only by deeply transforming the training, organization and education of Youth that we will be able to reach our goal: that Youth, by its efforts, may realize a society unlike the old one the communist society. [For university policy] this means that the focus must be shifted towards political education and the utilitarian and practical function of university education at the cost of its role in promoting humanistic and general education.

Concretely, the Soviet Military Government in Germany (SMGG), according to the Soviet experience, applied the following blueprint for restructuring all institutions of higher education: the introduction of standardized institutions of higher education approved by the Ministry of Higher Education, standardized teaching schedules for each department, and standardized curricula for each discipline. This meant centralizing the universities, giving them only limited independence; the compulsory study of Marxist-Leninist philosophy and political economy in all faculties; the total ideological and political orientation of higher education; securing the leadership role of Communist Party structures at the universities; creating strong ties between the needs of the socialist planned economy and the training of experts in different disciplines; and the single-minded transformation of the social origin of students, that is, the proletarization of the universities.37 In the Soviet zone as well, the universities were reopened in the winter of 1945/46. The fact that it took roughly six years to adapt them to the Soviet university system can be attributed to the maxims of Lenin and Stalin quoted above, according to which the taking of the Fortress of Science was the task of youth that had to be re-educated to the revolutionary ideology. To achieve this, the occupying power needed the support of German teachers, institutions and parties, especially that of
36

37

M. Muller and E. E. Muller, . . . sturmt die Festung Wissenschaft. Die Sowjetisierung der mitteldeutschen Universitaten seit 1945 (Berlin, 1953), 1. A. P. Nikitin, Die sowjetische Militaradministration und die Sowjetisierung des Volksbildungssystems in Ostdeutschland 19451949, in Heinemann, Sowjetische Besatzungszone (note 35), 110, quotation p. 2.

82

Relations with authority the Communist Party. There were very few communist university teachers, and they certainly did not belong to the inuential circle of Moscow exiles surrounding Walter Ulbricht and Wilhelm Pieck. University policy in East Germany between 1945 and 1955 was mostly inuenced by Paul Wandel and Fred Oelssner, who, at best, were autodidacts.38 Owing to emigration from the areas that had previously been occupied by the Americans, and because of denazication, the universities in the Soviet zone had lost up to 90 per cent of their teachers. Contrary to belief on the Western side, the ofcers of the SMGG in charge of universities were as badly prepared as their Western colleagues in carrying out their tasks.39 But they had retained a deep-rooted respect for the German university tradition and defended it often successfully against hasty adaptations to the Soviet system. They defended the election, rather than the appointment, of rectors, and keeping the law faculties within the universities, rather than farming them out.40 Of course, since the very beginning, the SMGG had introduced an ideological cleansing of the universities, removing not only Nazis and militarists, but also individuals with reactionary political opinions and upholders of false knowledge. In 1945, the SMGG forced Professors Eduard Spranger and Bernhard Schweitzer, the rst rectors of the Universities of Berlin and Leipzig, to resign.41 Both men emigrated to Tubingen. When, in the winter semester of 1946/47, the teaching of philosophy was permitted again, the professors had to submit the programme of every lecture and seminar for scrutiny, explaining how they intended to use them for political re-education. In 1948 they were asked to prove their allegiance to dialectical materialism by lling out a questionnaire issued by the Soviet philosophy ofcer. As a result, leading philosophers such as Walter Brocker, Hans-Georg Gadamer, Hans Leisegang and Theodor Litt emigrated to the West.42 The general political context was another reason for the self-restraint that the SMGG initially adopted in its dealings with universities. This restraint, however, did not apply to disciplines like philosophy and history, nor did it prevent the party from exerting pressure on the elections of rectors and deans. The inaugural manifesto of the German Communist
38

39

40 41 42

Die Hochschulpolitik der SED (Berlin, 1967), E. Richert, Sozialistische Universitat: 1317. R. F. Lawson, Die Politik der Umstande: Eine Kritik der Analysen des Bildungswandels im Nachkriegsdeutschland, in M. Heinemann (ed.), Umerziehung und Wiederaufbau: Die Bildungspolitik der Besatzungsmachte in Deutschland und Osterreich (Stuttgart, 1981), 29; Nikitin, Sowjetische Militaradministration (note 37), 1; I. Bejdin, Die Russen in Deutschland, Auszuge aus meinen Erinnerungen, in Heinemann, Sowjetische Besatzungszone (note 35), 11. Nikitin, Sowjetische Militaradministration (note 37), 5. Nikitin, Sowjetische Militaradministration (note 37), 6. Muller and Muller, Festung Wissenschaft (note 36), 6772.

83

 Walter Ruegg and Jan Sadlak Party, issued on 11 June 1945, declared it would be wrong to impose the Soviet system upon Germany: for this would not correspond to the present conditions for development in Germany. Rather, these conditions called for another procedure: to establish the antifascist democratic regime of a parliamentary democratic republic with all democratic rights and freedoms for the people.43 Just how far these democratic rights and freedoms went was experienced, among others, by three students from Berlin, relegated in 1948 for having written articles critical of university policy; they subsequently took the initiative to found the Free University of Berlin.44 By 1953, more than 500 students and professors had been arrested and mostly condemned to prison, forced labour or penal camps.45 Apparently, they did not belong to the people. From 1948 to 1953, the Volksbildungsministerium (Ministry of the Peoples Education) and, in particular, its Secretary of State for Higher Education (founded in 1951) began implementing the Soviet model described by a former high-ranking ofcial of the SMGG.46 The Sovietization of Central and Eastern Europe The aftermath of the Second World War brought about profound changes in the countries of Central and Eastern Europe which, for many years, were depicted by their geopolitical status: socialist, Soviet bloc, etc.47 The totality of such changes political, economic and social together with signicant modications of the state borders and ethnic compositions had an impact on higher education and its relations with the new dominant authority: the Communist Party and its representatives within the higher-education establishment. The consequences of the war on Polish higher education were particularly disastrous. One third of the Polish intelligentsia perished.48 Material losses were equally substantial. Two important pre-war academic centres Lwow and Wilno were outside the countrys new boundaries. The human losses were only slightly compensated for by those who beneted from the secret underground teaching and studying in Nazi-occupied territory provided by the so-called ying university. The extent to which
43 44 45 46 47

48

Muller and Muller, Festung Wissenschaft (note 36), 11. Heinemann and Schneider, Hochschulofziere (note 32), 14372. Muller and Muller, Festung Wissenschaft (note 36), 36371. (note 38), 4296. Cf. Richert, Sozialistische Universitat Yugoslavia, which was established as a federal state in 1943, should be considered as part of this bloc despite its specic brand of one-party rule and independent international policy. It has been estimated that only about 600 university professors, approximately 40 per cent of the total number, survived.

84

Relations with authority independent Polish education was able to function in Nazi-occupied territory as well as in Western Europe, notably in the United Kingdom and Switzerland, together with the role played by the non-communist government-in-exile, were the reasons behind the eagerness of the Sovietbacked Polish administration to support the launching and reopening of higher-education establishments and to promote the idea of tuition-free higher education. The potential political gain from this action was not obvious, but became evident when the rst new post-war Polish university Maria Curie-Skodowska University was established in Lublin in October 1944 as the symbol of the rebirth and democratization of Polish higher education. At the same time, but only after a hard struggle with the new regime, another university in this same town the Catholic University of Lublin was assured of its continuing existence in its pre-war form as autonomous from the state, but as a state-accredited academic institution. ROMANIAN higher education was also badly affected by the war, but not to the same degree of physical annihilation and material destruction as Poland.49 Both students and academics had to cope with the consequences of the war in which Romania had been implicated, namely the territorial transformation of its national boundaries, particularly those in Transylvania.50 From the point of view of challenges, the situation was also not very different in the three YUGOSLAV universities when this country started its existence as a federal, multi-ethnic state.51 In HUNGARY higher education had to cope with the consequences of war damage, particularly in Budapest, as well as with the consequences for both students and academic staff of the loss of Transylvania, which was briey under its control from 1940 to 1944.52 But even if the new post-war regimes of Central and Eastern Europe assumed an active role in higher education after the war, in many aspects universities were allowed to adhere to their traditional internal structure, organization of admissions and studies, academic and student representation, and so on. This situation, which lasted only until the end of 1947, was dictated primarily by the needs of reconstruction and
49

50

51

52

J. Sadlak, Higher Education in Romania 18601990: Between Academic Mission, Economic Demands and Political Control (Buffalo, 1990). In 1940, the Romanian King Ferdinand I University of Cluj had to be evacuated to Sibiu, and in its place functioned, until mid-1944, the Hungarian Royal Ferenc Jozsef Scientic University. V. Puscas (ed.), A History of Cluj Higher Education in the 20th Century (Cluj, 1999), 285302. N. N. Soljan, Yugoslavia, in P. G. Altbach (ed.), International Higher Education An Encyclopedia (New York and London, 1991), 83750. J. Kardos, E. Kelemen and L. Szogi, Centuries of Hungarian Higher Education (Budapest, 2001), 1326.

85

 Walter Ruegg and Jan Sadlak concealed the political pragmatism of the new but not yet fully empowered peoples national regimes. The situation altered drastically around 1948, when the communist-controlled countries of Central and Eastern Europe radically altered the design and purpose of the university and other higher-education institutions and academic organizations. Their mission and operations were subjected to the imperatives of a single ideological doctrine Marxism-Leninism. The universities were transformed into vast bureaucratic structures of the communist/peoples socialist state irrespective of their traditions and history.53 Like all the graduates of all other institutions of higher education, the graduates of the universities were destined to form a peoples intelligentsia. Higher-education institutions gradually lost most of their institutional autonomy, even if basic internal structures and bodies such as faculties, chairs and the senate were preserved. This was done by changes in the composition and prerogatives of the governing bodies, and by the creation of new executive organs. The veneer of democratic governance was kept by various forms of collective representation, including periodic congresses of science or meetings organized within a particular academic discipline. In reality, direct political and administrative intrusion into the functioning of universities covered practically all essential matters of governance, from the appointment of the rector, deans and academic personnel, to the composition of the student body, the organization of curricula, and the content of teaching particularly in ideologically relevant subjects such as philosophy, history, law, economics and other social sciences.54 The other common characteristic of these reforms was the imposition of a variety of features borrowed from the Soviet academic system and its organization of science. The institutional framework of the historical university, labelled liberal-bourgeois and thus synonymous with the obsolete, was radically altered. The new university was to concentrate on pure theoretical research and the teaching of the so-called basic disciplines, including philosophy, social studies, mathematics and all the natural sciences. Separated from the universities were disciplines such as medicine and pharmacy, agriculture and physical education. As a result of these changes, the importance of the specialized institutions grew, while the role of the traditional universities, particularly in relation to
53

54

The Humboldtian model of free access to knowledge at the centre of the universitys mission was prevalent in the region. However, some countries, such as Romania, also developed institutions that derived from Napoleonic inuences, such as the grandes coles. e Ideological standard-setting in the teaching of such subjects was carried out by the so-called party schools, which were quickly turned into fully-edged higher education institutions that enjoyed privileged conditions for study, teaching and ideologically necessary research.

86

Relations with authority technological establishments usually called the polytechnics began to diminish. In a number of academic centres an unhealthy rivalry developed, particularly between the universities and the polytechnics, as the sectors competed for political and social standing rather than scientic prestige and excellence. In line with the ideologically motivated and non-denominational character of the educational system, the theological faculties were moved out of the universities. In many cases they were closed, marginalized or turned into separate academic schools, institutes or academies.55 The essential rights and functions of universities had to face additional competition from the academies of sciences, which were reorganized or set up according to the Soviet organizational model. The so-called working academies had three functions: to act as a body of eminent scholars, as research centres, and as the state agency to supervise and coordinate the research conducted at higher-education institutions. Historically, academies had conned themselves almost exclusively to the rst function. The new academies were super-coordinators of all civil scientic activities in the country as well as bodies of international scientic cooperation. One particularly disturbing feature of the Sovietization of academic life was the introduction of a new system of graduation procedures and academic titles. A lasting legacy of these new measures was the policing and screening bodies modelled on the Soviet prototype the Higher Attestation Commission (VAK). The award of scientic titles and the conrmation of academic appointments required their approval; they took into account not only academic merit, but also political soundness.56 These quality commissions were either attached to the Council of Ministers, as in Poland and Czechoslovakia, or to the ministry responsible for higher education, as in the other countries. They were usually fairly large bodies, some consisting of more than 200 members and various disciplinerelated sub-commissions. The government and the party exercised control, more de facto than de jure, over the nominations to these bodies. In a majority of Central and Eastern European countries, these bodies handled appointments to professorial ranks. In Bulgaria, Czechoslovakia and Romania, they also had power over the nal certication of a number of advanced scientic degrees, including the doctorate granted by the universities, other higher-educational institutions and the academies of sciences. The advocates of this system argued, not without reason, that in light of the unequal quality of higher-educational institutions there was need for
55

56

In Poland, two small theological academies were created. Together with the Catholic University of Lublin, they were viewed as an integral part of the higher education system. The faculty of Protestant theology remained part of the Humboldt University in Berlin. A. G. Korol, Soviet Education for Science and Technology (New York and London, 1957), 164.

87

 Walter Ruegg and Jan Sadlak some kind of external academic review. However, the main consequence of the process of centralized screening of academic nominations was not only its politicization, but its unusually lengthy bureaucratic procedures. This too had a justication. An extended review was appropriate and desirable for the lifetime appointment of a professor. Most positions in the governing bodies of academic institutions were part of the nomenklatura system, in which any appointment required the prior acceptance of the appropriate party organization or the special regional department dealing with education and science. The degree of political control over the institutions was enhanced by reminding those academics and students who were members of the Communist Party of their obligation to observe party discipline based on the concept of democratic centralism; this was supposedly a balanced combination of democracy and central leadership, but in practice it meant an obligation of lower bodies to observe the decisions of higher ones. Based on such a paradigm, the reforms replaced institutional autonomy with central political and administrative control. In most Central and Eastern European countries, as a result of this imposed model of governance, relations between academia and authority became tense; they further deteriorated in the early 1950s, when communist regimes gained total control over the higher-education system and started to implement the vision of the socialist university with draconian zeal and discipline. In Poland in the early 1950s, students had to attend all lectures, laboratory exercises and seminars, and to pass regular compulsory examinations. In addition, male students were conscripted and their military training became part of their study programme. Stopping or extending ones studies could be treated as an irresponsible social or unpatriotic act, or even as sabotage; the result might be not only expulsion from the university, but also imprisonment. Similar control was exercised over the academic staff with regard to their teaching and research.57 In the centrally planned economic system, every institution was nanced as a government unit. The capital investments were part of a central plan that usually covered a ve-year period. The level of funding and stafng of higher education was driven by manpower considerations determined by branches of the economy and state bureaucracy. In order to attain better coordination between higher education and the different sectors of the national economy, administrative responsibility for
57

Curricula became overloaded. In Polish universities, they increased to 3638 hours per week in the academic year 1948/49. In some cases, after the introduction of compulsory military training for male students, they reached 4550 hours per week. T. Suleja, Uniwersytet Wrocawski w okresie centralizmu stalinowskiego 19501955 (Wroclaw, 1995), 139.

88

Relations with authority academic institutions was dispersed among ministries. This produced a maze of administrative procedures governing higher education. The rigid line-item budgeting left little room for the development of managerial self-reliance in institutional governance or research funding.58 Relations with authority were less contentious in the area of basic funding. Yet taking into consideration the general ineffectiveness of the bureaucratic procedures and the economic shortages, seeking political support for a particular project or capital investment constituted the norm in relations between higher-education institutions and the state. Emerging university cooperation The material and spiritual reconstruction of the destroyed universities arose through the cooperation between governments, rectors, deans, and the teachers and students, who did much to overcome the initial difculties, often enthusiastically lending a hand in clearing rubble and restoring classrooms. Western Europe A lasting effect on international cooperation between the members of the university stemmed from the initiatives taken initially by American foundations to grant scholarships that allowed European students to spend time at American universities. In 1946, upon the request of Senator J. William Fulbright (19051995), the Congress of the United States decided to promote academic exchange with other countries. The Fulbright Program provides grants for Graduate Students, Scholars and Professionals and Teachers and Administrators from the US and other countries; it was designed to increase mutual understanding between the people of the United States and the people of other countries.59 When the Federal Republic of Germany was founded in 1949 it eagerly promoted the exchange of students and professors that the Western Allied Powers had initially offered to the Germans, and the Fulbright Program was extended to the whole world. Thanks to subsidies from the Federal Government, two academic foundations, founded in
58

59

J. Sadlak, In Search of the Post-communist University The Background and Scenario of the Transformation of Higher Education in Central and Eastern Europe, in K. Hufner (ed.), Higher Education Reform Processes in Central and Eastern Europe (Frankfurt/Main, 1995), 4362. Funded at rst by war reparations and foreign loan repayments, later by Congressional contributions and additional contributions from foreign governments, the Fulbright Program sponsored from 1948 to 2006 105,400 grantees from the United States and 174,100 from other countries. The Fulbright Program awards approximately 6,000 new grants annually. (http://exchanges.state.gov/education/fulbright/ (12 February 2008)).

89

 Walter Ruegg and Jan Sadlak 1925, reopened: in 1950 the Deutscher Akademischer Austauschdienst, DAAD, began exchanging student trainees; later it primarily granted scholarships for the exchange of German and foreign students, university interns, young scholars and university teachers, funded international cooperation projects of German universities and promoted German studies in foreign universities.60 In 1953, the Alexander von HumboldtFoundation reopened. It provided scholarships and research prizes for highly qualied foreign postdoctoral students, and research scholarships for German postdoctoral students. The three institutions kept in touch with their fellows, and created ever-growing international networks of academics.61 A lasting side effect of the reconstruction activities in Western Germany was cooperation among universities, represented by their rectors, in pursuing, defending and promoting their genuine interests and tasks. Before the Second World War there existed a number of such institutions: the College of Dutch University Rectors, constituted in 1898;62 the German Rectors Conference, founded in 1903, followed in 1904 by its Prussian erence des recteurs des universit es suisses, founded in section;63 the Conf 1904;64 and the Austrian Rectors Conference, founded in 1911, but inactive from 1935 to 1944.65 In the United Kingdom, the vice-chancellors of the universities had met regularly since 1921, and in the early 1930s

60

61

62

63 64

65

P. Alter (ed.), Jubilaumsschrift Spuren in die Zukunft Der DAAD 19252000, vol. I: Der DAAD in der Zeit. Geschichte, Gegenwart, zukunftige Aufgaben (Bonn, 2000). The DAAD sponsored from 1950 to 1999 450,000 German and 550,000 foreign grantees: M. Heinemann (ed.), Jubilaumsschrift Spuren in die Zukunft Der DAAD 19252000, vol. II: Fakten und Zahlen zum DAAD (Bonn, 2000), 106f. In 2006 the annual number of grants was 55,000, and the worldwide network of DAAD alumni included 120 foreign alumni clubs and more than 250,000 academics: C. Bode and D. Jecht (eds.), 20 Jahre Prof. Dr. Dr. h.c. mult. Theodor Berchem. Wandel durch Austausch: Festschrift fur DAAD-Prasident 19882007 (Bonn, 2007), 30. Between 1953 and 2003 the Foundation promoted more than 25,000 scientists and scholars from 132 countries: C. Hansen and C. Nensa, Exzellenz weltweit: Die Alexander von Humboldt-Stiftung zwischen Wissenschaftsforderung und auswartiger Kulturpolitik (19532003) (Cologne, 2004), 8. The College of Rectors was an informal organization whose authority had a broad impact on higher education policy in the Netherlands. It resumed work in 1947 and still exists besides the Vereniging van samenwerkende Nederlandse universiteiten (VSNU), the ofcial association of the Dutch universities which in 1985 replaced the Academische raad (Academic Council) established in 1956 as both a platform for the boards of the universities and an advisory body for the Dutch government (information kindly furnished by Dr Frans A. J. van Steijn, VSNU). Information from Bernhard vom Brocke, Marburg (Germany). F. Rintelen, Die Anfange der schweizerischen Hochschulrektorenkonferenz, in A. E. von Overbeck (ed.), Das 75-jahrige Jubilaum der schweizerichen Hochschulrektorenkonferenz (Basel, 1979). W. Hoechner, Die osterreichische Rektorenkonferenz 19111938, 19451969 (Vienna, 1993).

90

Relations with authority founded the Committee of Vice-Chancellors and Principals, a body that was reorganized in 1950.66 The revival and expansion of university cooperation began in occupied Germany. On 15 September 1945 the British Control Commission sponsored the rst meeting, in Gottingen, of the main personalities involved in the university policy of the British zone German university rectors, British university advisers, civil servants of the Lander governments in charge of higher education to discuss problems of common concern.67 At their third meeting, on 2527 February 1946, they constituted the Nordwestdeutsche Hochschulkonferenz (North-West German University Conference). The purpose of the designation Hochschulkonferenz instead of Rektorenkonferenz was to stress cooperation between the rectors, the representatives of the civil and military university administrations, and the political parties.68 The conference consisted of a British section, whose agenda and chair were chosen by the military control commission, and a German section, proposed and chaired by the rector of the university hosting the meeting. Until its integration into the West German Rectors Conference, founded in April 1949, it held eighteen sessions. In the American zone, on 9 September 1945, the rector and senate of the University of Heidelberg asked the military government for permission to organize a conference bringing together the rectors of all the universities in their zone. The decision was postponed on the grounds that the highest control authority must deal with it.69 While they waited, Hesses university ofcer, Edward Y. Hartshorne, and the philosopher Julius Ebbinghaus, rector of the Philipps-University Marburg, organized the rst Marburger Hochschulgesprache (Marburg University Discus sions) over Whitsun 1946 instead. These were attended by rectors und professors from the Western zones as well as from other countries, and, in 1947, by control ofcers and professors from the Soviet zone as well.70 In November 1946, the rectors of the American zone were able to organize the South German Rectors Conference, which the universities of the French zone joined. In 1949, its fusion with the Northwest German
66

67

68 69 70

H.-A. Steger (ed.), Das Europa der Universitaten/LEurope des universit es/The Univer sities Europe: Entstehung der standigen Konferenz der Rektoren und Vize-Kanzler der europaischen Universitaten 19481962, Dokumentation (Bad Godesberg, 1964), 68. M. Heinemann and S. Muller (eds.), Nordwestdeutsche Hochschulkonferenzen 1945 1948 (Hildesheim, 1990), 1. In the Introduction to the volume (pp. 130) Muller gives a comprehensive survey on the conferences work. Heinemann and Muller, Hochschulkonferenzen (note 67), 136f. Heinemann and Muller, Hochschulkonferenzen (note 67), 1 (n. 2). Marburger Hochschulgesprache 12. bis 15.Juni 1946: Referate und Diskussionen (Frankfurt/Main, 1947); W. Ruegg, Marburger Hochschulgesprache 19461947 (Frankfurt/Main, 1966), 25.

91

 Walter Ruegg and Jan Sadlak University Conference led to the foundation of the West German Rectors Conference, a body composed exclusively of rectors.71 The autonomous interaction between universities promoted by the Western occupying powers opened the difcult path towards the European cooperation of universities. Neither the Americans nor the Russians were particularly keen on promoting the idea of Europe. The goals of their education policy consisted of Democracy and Humanism.72 A worldwide association of universities was more consonant with the framework of the United Nations. Thus, in 1950, with the strong support of UNESCO, the International Association of Universities saw the light of day.73 The British occupation policy was designed to help the Germans educate themselves in tolerable European behaviour. Thus it came as no surprise that on 24 September 1946, ve days after Churchills famous speech on Europe at the University of Zurich, the British agenda of the Northwest German University Conference included the item Development of Methods to Emphasize European Unity in Philosophy, Science and Art. The chief of the university section, Pender, mentioned the view, supported by newspaper reports, that the German universities were coresponsible for the nationalist roots of the war. But he also acknowledged the present efforts that the universities and their heads were making to fashion their students into good Europeans. For Pender, the collapse of German nationalism represented a particularly auspicious circumstance for this type of European orientation. He thus proposed to give greater space to the European dimension in lectures at the universities. In the discussions, the idea of Europe was only explicitly embraced by the representatives of the Communist Party with reference to the Eastern European dimension and by the trade unions. The rectors accepted the proposal as a way of opening the isolated German universities to the rest of the world and unanimously welcomed the idea of emphasizing the relationship with other countries in the curricula. The rector of the University of Munster, Prelate Schreiber, mentioned that the concept of the good European had also been emphasized at the Marburg University Discussions.74 There, the Swiss professor Olof Gigon had deemed the international opening of the German universities absolutely necessary for
71 72

73

74

Heinemann and Muller, Hochschulkonferenzen (note 67), note 2. Ruegg, Humanism (note 33); W. Ruegg, Humanismus. II. Die Umdeutung des Begriffs, in Staatslexikon: Recht, Wirtschaft, Gesellschaft, vol. III: Erbschaftssteuer bis Harzburger Front (Freiburg/Breisgau, 1959), 1714. G. Daillant, Universality, Diversity, Interdependence: IAU 19501990, A Commemorative Essay (Paris, 1990). Heinemann and Muller, Hochschulkonferenzen (note 67), 224f.

92

Relations with authority the future of a Europe not conned to the role of a museum celebrating the past of the West and sandwiched between the two future-oriented world powers.75 Some German professors did indeed hold out for European Union,76 and the students enthusiasm for the political European movements was even stronger. However, the universities looked on themselves as European institutions, with their teaching and research deeply embedded in European thought and tradition. Therefore they saw no need to strengthen the European orientation of their curricula. Institutional cooperation between universities from different European countries began on a bilateral basis, thanks to the initiative of the secretary general of the West German Rectors Conference, Dr Jurgen Fischer. From 1952 until 1957, yearly conferences of British and German universities were held in Konigswinter near Bonn; the seventh of the series took place in Bonn, in 1958, and the eighth in 1960, in Birmingham. The year 1958 saw the rst FrenchGerman Rectors Conference in Berlin, a meeting that continued on a yearly basis, alternating its location between the two countries. The rst ScandinavianGerman Rectors Conference followed in 1960 in Frankfurt.77 The initiative for multilateral cooperation between the Western European universities came from outside. Since Churchills speech, the idea of Europe had found an institutional basis, especially thanks to the European Congress, held in 1948 at The Hague, and the Council of Europe, founded in 1949. A resolution passed at The Hague had already called for a European cultural centre to be set up in Geneva; it was also to promote cooperation between the European universities. However, in 1950, this plan, together with the proposal for the foundation of a European Rectors Conference and a European University were all rejected by the Ministers Committee of the Council of Europe which, until 1960, had hardly dealt with university policy.78 Similarly, the universities were not included in the political and economic unication process of other international organizations. This was the case, for example, of the Organization for European Economic Cooperation (OEEC), founded in 1948
75 76

77 78

Marburger Hochschulgesprache (note 70), 111f., 134ff. Heinemann and Phillips, Hochschulofziere 1 (note 14), 70. In April 1946, before Churchills Zurich speech, the Professor of Education at the University of Hamburg, Wilhelm Flitner, spoke about The United States of Europe as a realistic political goal. See W. Flitner, Die abendlandischen Vorbilder und das Ziel der Erziehung (Bonn, 1947), 10. Steger, Europa der Universitaten (note 66), 11427. K.-J. Maass, Europaische Hochschulpolitik: Die Arbeit des Europarats im Hochschulbereich 19491969, Schriftenreihe zur europaischen Integration, 7 (Hamburg, 1970), 212.

93

 Walter Ruegg and Jan Sadlak for the implementation of the Marshall Plan, as well as that of the North Atlantic Treaty Organization (NATO), founded in 1949.79 But this did not apply to the Brussels Pact, ratied in 1948 by Belgium, France, Luxembourg, the Netherlands and the United Kingdom, with the goal of promoting economic, social and cultural cooperation and common defence. In 1952 and 1953, thanks to the initiative of the secretary general of the Netherlands Ministry for Education, Arts and Sciences, Dr H. J. Reinink, professors and administrators from the ve member states met in The Hague to discuss the common concerns of the universities. This led to a plan for organizing a conference of university heads of all the member states of the Council of Europe. On 2025 July 1955, this conference was held in Cambridge, at the invitation of the Brussels Pacts successor, the Western European Union. As a result of the Cambridge meeting, in 1959 the Standing Conference of Rectors and Vice-Chancellors of the European Universities was founded in Dijon.80 At its third plenary meeting, in 1964, in Gottingen, it promulgated its statutes. In 2009, its successor organization, the European University Association (EUA), comprises more than 800 universities and over 30 national rectors conferences from Eastern and Western Europe. Central and Eastern Europe Over the years 194855, the natural inclination of academia to seek international contacts and collaboration was subjected in the countries of Central and Eastern Europe to ideological and political restrictions, in which the glorication of Soviet higher education and science was de rigueur. There were severe constraints on travel within national boundaries and even more stringent controls on travelling abroad. References to the achievements of Soviet theory in any given academic discipline were encouraged.81 Some academies, especially those which enjoyed respectability among their peers, ridiculed this forced academic propaganda, at some personal risk. But most people complied, not only for safety, but also because of the genuine academic value of contacts with the scientists and academic organizations of the Soviet Union and other socialist countries. These contacts and collaborations, run centrally by the national academies of sciences, were particularly productive in basic research and the exact sciences. In later years, these relations expanded to include the exchange of young researchers and curricula.
79 80

81

Ibid. Steger, Europa der Universitaten (note 66), 784. The acronym CRE refers to the French title, Conf erence permanente des recteurs et vice-chanceliers des universit es europ eennes. Suleja, Uniwersytet Wrocawski (note 57), 1689.

94

Relations with authority Graduates who had studied in the Soviet Union had a certain competitive advantage with regard to academic appointments and employment opportunities. A principal mechanism for mutual assistance in the areas relevant for economic development among the communist countries of Central and Eastern Europe was the Council for Mutual Economic Assistance (Comecon), created in 1949. Until late 1960, cooperation was the ofcial strategy, followed by the more ambitious goal of integration.82 Comecon indirectly facilitated academic cooperation as it required a degree of logistic support. But much more important were the bilateral agreements forged under the auspices of cultural and scientic collaboration, which specied the number of visits, projects and so on. These barter arrangements were appropriate owing to the non-convertibility of local currencies, but were not the most effective mechanism for promoting academic cooperation.

emerging national and international university policies, 19561967 Western Europe From the mid-1950s, public opinion in Western Europe expected state intervention to train a pool of scientists that would enable European nations to withstand competition from the USA and the USSR. In FRANCE, in 1956, the prime minister, Mend` es-France, invited highranking representatives of science, politics, administration and industry to a conference at Caen to debate concrete plans for university reform. Topics included the recruitment of students; the organizing, funding and training of engineers, technicians and researchers; the status of teachers as a profession; and the institutional framework of research centres. The resulting recommendations led to a thorough reform of the study of medicine, to the foundation of the Instituts universitaires de tech coles, as well as to the establishment nologie (IUT) and new grandes e of research centres in the social sciences. The latter included the Ecole des hautes e tudes en sciences sociales (EHESS) and the Maison des sciences de lhomme (MSH) in Paris. They were founded between 1957
82

The organization forged linkages between the USSR and the other members such as Bulgaria, Czechoslovakia, Hungary, Poland, Romania, East Germany (19501990), Mongolia (from 1962), Cuba (from 1972) and Vietnam (from 1978), with Yugoslavia as an associate member. Albania also belonged between 1949 and 1961. Its establishment was prompted by the Marshall Plan. Comecon was formally disbanded in June 1991.

95

 Walter Ruegg and Jan Sadlak and 1963 thanks to the initiative of Fernand Braudel.83 In due course, the MSH became one of the most important meeting places for European humanists and social scientists. Yet the modernization promoted by these reforms met with the resistance of conservative professors, while student activists increasingly denounced them as capitalist, fascist and imperialist.84 In the FEDERAL REPUBLIC OF GERMANY the seventy-yearold lawyer Reinhold Schairer (18931971) who, before Hitler came to power, had been chief manager of the Deutsche Studentenwerk (Student Relief Organization) and one of the founders of the Studienstiftung des deutschen Volkes (a foundation for promoting outstanding students), took the lead. After an exile of more than twenty years in the United States, he founded in 1956 in Cologne the Deutsches Institut fur Talentstudien (German Institute for Talent Research). This brought together representatives of the federal government, the Lander , industry and science to discuss ways of meeting the lack of researchers and technicians. In 1957, it proposed the establishment of a national VolkswagenFoundation for the promotion of scientic research and training.85 The year 1961 saw its realization,86 while at the same time, though quite independently, the Fritz Thyssen-Foundation started. Both foundations promoted research, regardless of national setting. Another initiative with far-reaching consequences for university policymaking was the revival of the university reforms of 194653, which had been unsuccessful because the Lander administration had not been involved. That changed in 1955. A joint conference of delegates from the federal government, the Lander and the universities, in Bad Honnef, developed a programme of state subsidies for students (Honnefer Modell); its success prompted university rectors and parliamentarians to set up a Wissenschaftsrat (Science Council) composed of representatives from the federal government, the Lander , the universities, science and industry to plan reforms in higher education and research. This body was founded in 1957.87
83

84 85

86 87

cole pour les sciences sociales: De la VIe section a ` J. Revel and N. Wachtel (eds.), Une e tudes en sciences sociales (Paris, 1996); B. Mazon, Aux origines de lEcole des hautes e tudes en sciences sociales: Le role du m lEcole des hautes e ec enat am ericain (19201960) (Paris, 1988); G. Gemelli, Fernand Braudel (Paris, 1995) (information kindly given by Elisabeth Dutartre (EHESS) and Maurice Aymard (MSH). Bourricaud, France (note 10), 3751. R. Nicolaysen, Der lange Weg zur Volkswagenstiftung: Eine Grundungsgeschichte im Spannungsfeld von Politik, Wirtschaft und Wissenschaft (Gottingen, 2002), 16673, 195. Ruegg, Epilogue (note 32), 228. B. B. Burn, P. G. Altbach, C. Kerr and J. Perkins, Higher Education in Nine Countries: A Comparative Study of Colleges and Universities Abroad (New York, 1971), 16595.

96

Relations with authority In 1960, the Science Council published recommendations for the development of universities and disciplines and for the creation of new chairs, specied by university and faculty.88 Since the ministers of education and nance of the different Lander had endorsed these recommendations, they dutifully created the chairs over the following years. However, in the same period, student numbers increased twice as fast as had been expected in the prognosis of 1960, which had served as the basis for calculating the required number of chairs and assistants. The administration did not react to this unexpected increase. Beginning in 1961, student groups from the radical left rejected the Science Councils university reform as a technocratic attempt to bend the productive sector of the university to the dictates of capitalist economy.89 The government of the UNITED KINGDOM appointed a royal commission in 1961 to examine all aspects of the higher-education system, much as the Caen Conference and the German Science Council had done. The resulting guidelines, published in 1963 and widely known as the Robbins Report from the name of the committees chairman, differed radically from the reforms initiated in France and in the Federal Republic. The Report respected the autonomy of the universities in xing the number of students admitted and the curricula on offer. But it also encouraged the universities to present their individual development plans regularly to the University Grants Committee, a body set up to receive public subsidies. Since the committees members were university professors, the Report in effect proposed that the universities plan their own development, set their student numbers according to their capacity, and achieve their targets through entry exams. But the Robbins Report also sharply increased the number of universities, from seventeen to forty-four. Consequently, with the exception of the University of London a loose federation of more than thirty colleges and schools only four universities had more than 10,000 students, while the national average was below 6,000.90 Therefore British universities could handle the fourfold increase in their total student numbers from 103,011 in 1958 to 476,121 in 1966/67 without encountering structural problems.91 In the other Western European countries as well, circumstances forced the authorities to take more active steps in their higher-education policy. Switzerland, where the universities apart from the two Federal Institutes of Technology are cantonal institutions, adopted the cooperative model

88 90 91

89 Ruegg, Epilogue (note 32), 234. Wissenschaftsrat, Empfehlungen (note 8). Burn et al., Higher Education (note 87), 4590. Wissenschaftsrat, Empfehlungen (note 8), 510; Wissenschaftsrat, Empfehlungen zur Struktur und zum Ausbau des Bildungswesens im Hochschulbereich nach 1970, vol. II: Anlagen (Bonn, 1970), 383.

97

 Walter Ruegg and Jan Sadlak of the German Federal Republic, with all the delays intrinsic to the functioning of a largely direct democracy.92 In the other countries, the central governments began to expand higher education by increasing subsidies for students, by widening the range of university studies and the number of the corresponding chairs, and by carefully founding new universities, especially on the periphery, often by promoting professional schools to the rank of universities. Through such measures broader segments of the population gained access to university.93 In 1967, three or four times the number of young people were beneting from academic training than in 1956. In most countries, governments systematically promoted the universities scientic research by creating science research councils nanced by and sometimes subject to governmental oversight, but always autonomous in their decisions.94 Through these measures national governments aimed to overcome their decit in research and in training scientic experts to meet the competitive challenges their economies faced. At rst international cooperation was limited to research elds in which the costs would have exceeded the capacity of single nations. In 1953, fourteen Western European states founded the Conseil Europ een pour la Recherche Nucl eaire (CERN), followed, in 1962, by the European Space Research Organization (ESRO). These initiatives allowed Europe to attain worldwide leadership in high-energy physics and space exploration.95 But although such cooperation had an effect on both individuals and groups of researchers, it did not affect the universities as institutions. This was also the case with the scientic programme of NATO, initiated in 1959. It represented the rst attempt of a supranational institution to promote exchanges and cooperation between researchers. From 1959 to 1967 NATO awarded scholarships for advanced study at foreign universities to 800 graduate scientists and engineers: 21%
92 93

94

95

Ruegg, Switzerland (note 3), 393407. On the university policies of several states of Western Europe: Daalder and Shils, Universities (note 3); Burn et al., Higher Education (note 87); P. Seabury (ed.), Universities in the Western World (New York and London, 1975); L. Goedegebuure et al., Higher Education Policy: An International Comparative Perspective (Oxford, 1993). As it appears from the list of new universities in the Appendix to this volume, between 1956 and 1967 no country in Western Europe founded more than ve universities. Research councils founded before the war were reorganized: in the Federal Republic of Germany (1921/1949), Italy (1923/1945/1963), Belgium (1928/1968) and France (1936/1959). New ones were founded in Norway and the Netherlands in 1950, Switzerland in 1952, Sweden in 1959, Finland in 1981, the United Kingdom and Iceland in 1965, Ireland and Austria in 1967, and Denmark in 1968 (see G. Friborg (ed.), Science Research Councils in Europe: Report of the Conference of West European Science Research Councils Held on 911 February 1972 at Scanticon Conference Center, Aarhus, Denmark (Stockholm, 1972), 171282). See chapter 15 (Technology), notes 43, 44.

98

Relations with authority in physics and chemistry, 14% in engineering, 12% in biology, 8% in medicine, 7% in earth sciences, 6% in mathematics and 10% in miscellaneous elds, including agronomy, operations research and sociology. International teams cooperated on some 281 research projects in elds ranging from space science to medicine. In the mid-1960s, every year about 3,500 scientists attended NATOs summer schools for advanced studies, whose topics ranged over mathematics, astronomy, biology and medicine, psychological measurement theories and computer languages.96 In 1960, the Organization for Economic Cooperation and Development (OECD) succeeded the OEEC. According to article 2 of its statutes, its task was to promote the development of the necessary scientic and technological instruments for the attainment of its goals (economic growth, full employment and an increase in living standards) and to promote research and vocational training. This led to a series of comparative studies (still ongoing) of national education policy, especially concerning university-level studies, and also to promotion of international cooperation in the development of research facilities and the initial funding of supranational research projects. From 1962 to 1968, more than 300 institutes with 1,500 researchers participated in the research programmes of the OECD.97 In 1953, the Council of Europe passed a European Convention on the Equivalence of Certicates of Secondary Education. This was followed in 1956 by a convention on the Equivalence of the Time of Study at University in the eld of modern languages, and in 1959 by another on the Recognition of Academic Degrees and Diplomas. While the rst two conventions were signed and ratied by almost all member states, the third met with opposition and had no practical consequences.98 In 1957 the Treaty of Rome on the foundation of the European Economic Community (EEC) stipulated in article 57 a free exchange of persons and services and called for guidelines on the mutual recognition of diplomas, examination certicates and other proofs of qualication. The rst draft presented in 1969 had to be withdrawn. The Euratom Treaty, signed together with the EEC Treaty, called in articles 9 and 216 for the foundation of a European University in Italy in 1960. Although the Italian government supported this proposal, it encountered numerous obstacles. Some were due to the resistance of the universities themselves, which were unwilling to grant the name and status
96

97 98

NATO und Wissenschaft: Die Arbeit des Wissenschaftsausschusses der Nordatlantikpaktorganisation 19591967 (Brussels, n.d.), 916. Maass, Europaische Hochschulpolitik (note 78), 73f. Maass, Europaische Hochschulpolitik (note 78), 12734.

99

 Walter Ruegg and Jan Sadlak of a European University to any particular institution, thereby indirectly downgrading themselves to merely national institutions.99 National rectors conferences As a reaction to the expanding university policies of national governments, many European universities became members of the International Association of Universities or the CRE, while also institutionalizing their national cooperation by means of regular meetings of their heads.100 Before the Second World War, only ve such bodies had existed.101 After 1957, national university or rectors conferences were set up in most European countries. By 1995 such institutions had been founded in Yugoslavia102 and Italy103 (1957), France104 (1958), Belgium105 (1962, split into two in 1976),106 Denmark107 (1967), Finland108 (1969), Lithuania109 (1970), Ireland110 (late 1970s), Norway111 (1977), Turkey (1981), the Netherlands (1985),112 Iceland (1987), Hungary (1988), Romania and Greece (1990), Latvia (1991), Bulgaria (1992), Croatia and the Czech Republic (1993), and Sweden (1995).113 In 1959, the universities institutionalized their European cooperation through the CRE, but they met in plenary session only every ve years. Such gatherings had to be carefully prepared and evaluated, and between the meetings the universities common interests were defended by a permanent committee. From 1960, the latter consisted mainly of the delegates from the national rectors conferences to the Council of Europes
99

100

101 102 103

104 105 106

107 109 111 113

Documentary Material of a PolitiEuropean Parliament, Die Europaische Universitat: cal Committee (December 1967). If not otherwise stated, the foundation dates and titles of the national rectors conferences or councils were taken from A. Henzl, G. Priessnitz, K. Riegler and H. Wulz (eds.), European Rectors Conferences: Status, Composition, Role and Function of the Rectors Conferences of the European University Association, Osterreichische Rektorenkonferenz/Austrian Rectors Conference (Vienna, 2003), or graciously acquired from the national rectors conferences by Christel Vacelet, EUA Information and Communications Director. Titles differing from the usual wording (University) Rectors Conference are listed in the notes. See notes 6266. Association of Yugoslav Universities, Steger, Europa der Universitaten (note 66), 117. Conferenza permanente dei rettori degli atenei italiani. Steger, Europa der Universitaten (note 66), 118. Comit e des recteurs franc ais. Steger, Europa der Universitaten (note 66), 120. Steger, Europa der Universitaten (note 66), 132. Vlaamse interuniversitaire raad (1976), Conseil interuniversitaire de la communaut e franc aise (1980). 108 Finnish Council of University Rectors. Seabury, Universities (note 93), 184. 110 Conference of Heads of Irish Universities. Ofcially registered in 1995. 112 But see note 62. Council of Norwegian Universities. They were followed by Poland and Slovakia (1997), Estonia (2000), Cyprus and Luxembourg (2004).

100

Relations with authority Committee for Higher Education and Research (CHER), consisting of two representatives from each member state, one from the universities and one from government. The group met every six months in connection with the sessions of the CHER as the Permanent Committee of the CRE. This helped to ensure multilateral communication between the different national rectors conferences and between these collective bodies and the CRE.114 The CHER was poorly treated by the Council of Europe, however, probably because of the unofcial status of the university representatives, who were not appointed by the governments.115 Its inuence upon the rare initiatives of the Council of Europe in the eld of university policy was less effective than that of the Cultural Committee, which consisted solely of governmental delegates and communicated directly with the Conference of the European Education Ministers, which met every two years.116 Central and Eastern Europe The departure from the repressive and tyrannical communist regime was only possible after Stalins death, followed also by the deaths or dismissal of his cronies in a number of countries of the region. This brought about important changes in the organization of social relations, including the abandonment of a strict observance of the Soviet model of higher education and its way of organizing internal relations. Estrangement from the Soviet model took place within the national context of building socialism. Clear signs of the existence of a much larger breathing space in education, science and culture were felt around 1955, and still more so in 1956. Even if the fundamental precepts of the organization of the communist system had not yet been modied, the policy of the party and state had become less dogmatic, particularly in those countries where deStalinization was a powerful force, such as Hungary and Poland, and later on Czechoslovakia. Repressive policy, if applied, tended to be directed towards politically outspoken individuals within the academic community or certain disciplines such as the social sciences and the humanities, rather than towards academia as a whole. From 1956 to 1990, in most of the countries of Central and Eastern Europe, the relationship between the universities and the authorities was relatively stable, although disrupted by periodic returns to hard-nosed restrictions on academic freedom (such as in Poland in March 1968 and
114 115 116

Steger, Europa der Universitaten (note 66), 7884. Maass, Europaische Hochschulpolitik (note 78), 33f. Maass, Europaische Hochschulpolitik (note 78), 516; Steger, Europa der Universitaten (note 66), 123. Europaische Erziehungsministerkonferenzen: Resolutionen (Bonn, 1973).

101

 Walter Ruegg and Jan Sadlak after the imposition of martial law in 1981, or in Czechoslovakia after the spring of 1968). The strategy that dominated in Hungary should be viewed as a native development within its national context rather than the norm for socialist higher education; following the Hungarian revolution of 1956, higher-education policy was based on mutual concessions that produced a specic model of relations between the state and the academy described as luniversit e du compromis.117 Policy-makers improved their understanding by digesting the lessons of politically motivated research fabrications, symbolized by Lysenkoism; but this did not lead to substantial changes in the governance and management of higher education at the institutional and system level. There had been periodic calls for, and discussions pointing to, the required modications. The most frequent argument stressed the importance of a universitys basic activities: cultivating knowledge and training the intelligentsia to a high theoretical level adapted to professional and civic functions. During a debate on these issues in Poland in the mid-1960s, it was felt that a modern socialist university should be a hub radiating its inuence over the whole educational system, a centre for scientic discussion, and the untiring organizer of ever more specialized scientic disciplines. The prevailing view was that the universitys old universality must be replaced with multiplicity and diversity, its organizational unity transformed into contacts and cooperation with other schools, and its one-sidedness changed into a balanced co-existence of the natural sciences and humanities; theory must be blended with practice.118 These or similar calls, even if only partially implemented, gradually led to increased attention to meritocratic criteria in admissions and academic nominations. They also gradually brought about some substantive variations in the degree of conformity or interpretation of the original socialist model. But despite all these changes, the university system under communist rule with which the countries of Central and Eastern Europe entered the 1980s did not demonstrate any systemic departure from the orthodox model. expansion, democratization, bureaucratization, 19681982 Central and Eastern Europe The need to establish more effective mechanisms for international academic cooperation gradually came to the attention of the policy-makers in
117

118

E. Auvillain, Hongrie: Luniversit e du compromis, Le Monde de lEducation, 4 (1982), 25f. E. Kujawski, In Search of a New University, Polish Perspectives, 8:12 (1965), 31 41. J. Sadlak, The Use and Abuse of the University: Higher Education in Romania, 18601990, Minerva, 292 (1991), 186225.

102

Relations with authority Central and Eastern Europe. This led to the so-called Prague Convention covering the recognition of educational credentials between the communist countries, which was signed in Prague on 7 June 1972. The parties to the convention were Bulgaria, Hungary, the German Democratic Republic, Poland, Romania, the Soviet Union and Czechoslovakia, as well as the peoples democracies of Cuba, the Democratic Republic of Vietnam, North Korea and Mongolia. The signatories agreed mutually to recognize documents pertaining to general secondary education, vocational secondary education, higher-education, academic degrees and titles.119 Any academically justied need for international collaboration was often supplemented by ideological and international considerations. Therefore all the countries of the region, though to a lesser degree than the Soviet Union, had developed a study programme for students from developing or non-European socialist countries, many of whom also beneted from nancial support that was superior to the support available for local students. A little-known body that supposedly coordinated collaboration between the communist countries of Central and Eastern Europe was the Conference of Ministers of Higher Education of Socialist Countries, whose rst session took place in 1966 in Moscow. The nal session, the sixteenth, took place in Bucharest in October 1989. In the last years of its existence it tried to coordinate educational research plans, communist training for students, the modernization of didactic processes, and the development of postgraduate studies, computerization, and student selfgovernment. However, in view of the unforeseen pace and direction of the democratic reforms in Eastern Europe, this conference lost all political and practical meaning for its continuing existence.120 Participation in joint initiatives and projects implemented by UNESCO was particularly valued, as the organization provided an opportunity for contacts with the European academic community that had been divided along ideological and military lines. In this regard, UNESCOs European Centre for Higher Education, CEPES (Centre europ een pour lenseignement sup erieur), founded in 1972 and located in Bucharest, played a positive role.121
119

120

121

Around the year 2000, the convention ceased to function. On 11 April 1997 most of the European countries had signed and later ratied the Council of Europe/UNESCO Convention on the Recognition of Qualications concerning Higher Education in the European Region, which is often referred to as the Lisbon Recognition Convention. F. Januszkiewicz, Eastern European Socialist Countries: Regional Analysis, in A. S. Knowles (ed.), International Encyclopedia of Higher Education (San Francisco, 1977), 132935; F. Januszkiewicz, The XVIth Conference of Ministers of Higher Education of Socialist Countries: Some Decisions and Recommendations, Contemporary Higher Education, 2 (1989), 2515. M. Malitza, Reections on the Creation and Functioning of UNESCO-CEPES: Personal View of One of its Founders, Higher Education in Europe, 27:1/2 (2002), 1129.

103

 Walter Ruegg and Jan Sadlak Western Europe The strengthened cooperation between the state and university administrations might have had a positive impact on university reforms; yet its effect was nullied by the expansion of higher education that completely overwhelmed the university structures. In 1967, two to four times more young people than in 1958 were enjoying an academic education. Thanks to their autonomy, the relief provided by a 150 per cent increase in the number of universities, and the strongly expanded polytechnics sector, the British universities could deal with the education explosion without serious structural difculties. Things were very different in Continental Europe, however. This is particularly well illustrated by the case of the two countries that were rst drawn into the students revolt. In the FEDERAL REPUBLIC OF GERMANY, in 1960, the Science Council issued guidelines specifying the chairs and staff needed by each university to full its task of education and basic research. According to the Council, no university should have more than 13,000 students. It also recommended that larger universities Cologne or Munich, for example reduce their numbers and that new universities take up the surplus.122 This would have been possible if, as in Great Britain, the student numbers established as guidelines for the increase in chairs and staff had set a limit to the number of students admitted. However, for political reasons the government representatives in the Science Council refused to introduce this rule. As a result, the sparse new foundations of the 1960s fell far short of relieving the existing universities.123 The embodiment of Humboldts ideal of a university that allowed as far as possible free and easy cooperation between teachers and students in the pursuit of science124 was attempted in Frankfurt, which numbered more than 13,000 students, by splitting the university into three autonomous but cooperating units. The government considered this plan in February 1969.125 Its implementation was prevented by the students revolution. Subsequently, most of the old and, later, many new universities in the Federal Republic had to accept far more students than the 13,000 that had been advised as a limit in 1960.
122 123

124

125

Wissenschaftsrat, Empfehlungen (note 8). In 1962 the Lander concerned decided to found universities in Bochum and Regensburg. In the event, these did not reduce the student numbers in Cologne and Munich. The new universities promoted regional university studies but could not compete with the better location of the old universities. Banden W. von Humboldt, Werke in funf , vol. IV: Schriften zur Politik und zum Bildungswesen (ed. A. Flitner and K. Giel) (Darmstadt, 1964), 256. Frankfurter Allgemeine Zeitung, Frankfurter Rundschau 30 January and 19 February 1969.

104

Relations with authority In the years 19679, the students revolution that had started in the USA swept through Western Europe. The motives that triggered it and the main goals it pursued were external to university affairs.126 In Europe, it began in Berlin on 2 June 1967, when, at a demonstration against the visit of the Shah of Iran, Benno Ohnesorge, a student at the Freie Universitat, was shot by a policeman. A series of partly violent manifestations of grief and protest broke out at West German universities.127 In November 1967, the students revolution entered the universities, when protesters tried to transform the lectures of Carlo Schmid, then professor of political science at the University of Frankfurt and a social democratic federal minister, into a tribunal against the emergency laws that the federal government was preparing at the time. The attempt failed but it was widely publicized. This started a series of US-inspired direct actions, such as go-ins, teach-ins and sit-ins.128 Their declared goal was to unmask the repressive violence and intolerance of the academic and state authorities.129 Both from an ideological and organizational perspective, these actions had their basis in Marxist student groups, which since 1961 had promoted a counter model to the governmental university reform advocated by the Science Council. They wanted a university democratically constituted, co-governed by students and assistants, and independent of government and the capitalist economy.130 However, it was only after the demonstrations against the police state of the summer of 1968 that their proposals for university politics met with widespread interest among students and a few professors. In FRANCE, on the contrary, the students revolution was rst sparked by a situation within the university that was felt to be intolerable; but it soon expanded into a broad protest against the political and social status quo. Between 1960 and 1967, student numbers at the fteen French universities had soared from 214,672 to 586,466.131 In the autumn of 1967, the government prescribed reforms that provoked an ongoing series of protests by students and assistants in the academic ghetto of
126

127

128

129

130

131

For details of the student revolt see chapter 9. This chapter is concerned with its impact on the relations between the university and the authorities. Eine J. Hager, Die Rebellen von Berlin: Studentenpolitik in der Freien Universitat. Dokumentation (Cologne and Berlin, 1967). Anleitung zum Handeln: Taktik direkter Aktionen. Ubersetzt aus dem Amerikanischen von Dr. E. Krippendorf (Berlin, 1967). W. Ruegg, Die studentische Revolte gegen die burgerliche Gesellschaft (Erlenbach and Zurich, June 1968). Reprinted in W. Ruegg, Bedrohte Lebensordnung: Studien zur humanistischen Soziologie (Zurich and Munich, 1978), 22539; Cf. W. Ruegg, The Intellectual Situation in German Higher Education, Minerva, 13:1 (1975), 10320. Hochschule in der Demokratie: Denkschrift des Sozialistischen Deutschen Studentenbundes (1961; new edn, Frankfurt/Main, 1965); Ruegg, Epilogue (see note 32), 234. P. Salmon, France: The loi dorientation and its Aftermath, in Daalder and Shils, Universities (note 3), 64.

105

 Walter Ruegg and Jan Sadlak the Facult e des lettres et sciences at Paris-Nanterre, a densely overpopulated faculty with some 12,000 students. Beginning with a lecture strike in November 1967, these protests soon escalated into anti-authoritarian, anti-technocratic and anti-bureaucratic direct actions that included challenging the police forces and culminated in the occupation of the central administration building on 22 March 1968. The militant movement that adopted this date as its name worked towards the spread of the revolt to other universities, so that criticism towards the university, as in Germany, may lead to radical and permanent political action in the context of the Critical University.132 This was accomplished in May, when the campus of Nanterre was closed indenitely. The unrest immediately spread to the Sorbonne and, later, to the universities in the provinces. When the trade unions rallied to the students revolution, de Gaulle had trouble preventing a state crisis.133 In mid-May, by a hurried visit to the French occupation troops in Germany, he ensured that he had the backing of the army, and in June, through parliamentary elections, he obtained a vast majority. He then set up a new government and appointed as its education minister Edgar Faure, who had the task of drawing up a general university law. The resulting loi dorientation de lenseignement sup erieur was to have ensured the reform of the French universities according to de Gaulles basic principles of participation and autonomy. It was presented to parliament in July and passed on 12 November 1968.134 The law did just enough to accommodate the revolutionary enthusiasts claims for participation so that the government achieved the short-term goal of taking the riots off the street and starting the new academic year in November without fear of student revolts: the students were granted a 50 per cent membership in the corporate university bodies, apart from those dealing with the selection of teaching staff, research and exams, on condition that a suitable number of students took part in the election of their representatives. At the same time, the law fullled the main goals of the academic and governmental reformers, and therefore serves as a relatively moderate example of the avalanche of university laws that, during the 1970s, covered the university landscape in Continental Europe. In March 1971, some twenty-six months after the promulgation of the law, the Implementation of the Reform that it stipulated had been carried out: the fteen old universities had been replaced by fty-six new ones,
132

133

134

Bulletin der Bewegung des 22. Marz, quoted in J. Bourges (ed.), Aufstand in Paris oder ist in Frankreich eine Revolution moglich? (Reinbek bei Hamburg, 1968), 102. ` la d Bourricaud, France (note 10), 3161; F. Bourricaud, Universit es a erive (Paris, 1971); R. Aron, La r evolution introuvable: R e exions sur la r evolution de mai (Paris, 1968). Loi no 68.978 dorientation de lenseignement sup erieur, Journal ofciel de la R epublique franc aise (13 November 1968).

106

Relations with authority together with nine university centres afliated to nearby universities. The multiplication had been achieved by new foundations and by splitting up existing universities in the larger cities. The huge conglomerate in Paris and its surroundings, with its 150,000 students, was replaced by thirteen universities, three of which kept the designation Sorbonne in their names.135 The basis and starting point of the reform lay in merging related disciplines into Teaching and Research Units (UER: Unit es denseignement et de recherche). It was from these units that the universities created themselves. The government granted its authorization after an examination of the proposed statutes by the newly founded consultative bodies of the regional councils for teaching and research and the national council of the same name. Henceforth the universities had the status of public institutions with their own legal responsibility and their own administrative, nancial and teaching autonomy. They were no longer directly controlled by the state-appointed recteur who, in his or her regional administrative district called the acad emie, represented the minister of education and oversaw teaching from the elementary school to the university level. As chancellor of the universities of the acad emie he or she continued to represent the education ministers supervisory function. But the whole administration of the university was in the hands of a president elected for a ve-year period among the full professors by the university council. To what extent the Loi Faure actually achieved the aims its author had extensively justied136 remains a point of controversy.137 The universities autonomy, which represented the second pillar of the reform, remained weak and was not strengthened by the long series of decrees and laws that followed the loi dorientation. Moreover, although it had repeatedly been asserted that research within the Teaching and Research Units was of fundamental signicance for the reform, research actually remained the domain of another state institution, the CNRS. The latters existence did lead to an increase in autonomy and competition among university members engaged in research, but not among the universities themselves. University autonomy was also not helped by the founding of a national conference of university presidents, chaired by the education minister. The objectively dubious circumstance that the law did not apply to the grandes
135

136 137

In 1977, there were sixty-four universities in France, while there had been fteen in 1945/46. At the same time, the state increased the teaching staff from 26,166 teachers (1967/68) to 41,511 (1980/81), especially the tenured ma tres assistants from 6,513 to 16,771, the professors from 7,134 to 12,134, while the number of assistants remained practically unchanged (12,519/12,417). See J. C. Passeron, 195080: Luniversit e mise a ecor ou changement de cap?, in J. Verger (ed.), Histoire ` la question: changement de d des universit es en France (Toulouse, 1986), 382, 403. E. Faure, Philosophie dune r eforme (Paris, 1969). Compare the title of Passerons quoted chapter (note 136).

107

 Walter Ruegg and Jan Sadlak coles, which produced high government administrators and inuential e politicians such as Faure himself, shows how hard it had been to win over a parliamentary majority in favour of the law. As early as 1945, de Gaulle had abandoned the plan, recommended by his government in exile, to reform these cadre schools. Analysing the Loi Faure according to the criteria of democratization leads to less ambiguous results. This term is not found in the text of the law, in contrast with public discussion in France and elsewhere at that time. The revolutionary student groups were not just seeking greater participation in the universities; rather, their goal was the fundamental reform of society and its institutions. As a think-tank close to the Paris Revolt of May 1968 proclaimed: The era of democracy has begun. Throughout the entire world, the masses want to take their destiny into their own hands. To realize this, the manifesto continued, what was needed was completely autonomous universities able to renew themselves in competing for students and teachers. For this think-tank, the intellectual and moral future of society directly depended on the universities, as too, in the long run, did its economic and political future.138 Since 1945, two meanings had been associated with the concept of the democratization of the university. Firstly, this concept referred to the task of providing equal university access for all social strata. This goal was to be forwarded, if not yet fully achieved, by increasing the number of institutions of higher learning and spreading them geographically. Secondly, the inuential American educator John Dewey had called democratic a certain type of behaviour that a teacher should observe in class: instead of disciplining the students personally and with reference to the content of the course, he should permit responsible self-learning and communicative interaction. At the university level, this was widely consonant with Humboldts ideas.139 Accordingly, in his nal speech defending the loi dorientation at the National Assembly, Edgar Faure stated: if teaching is to be democratic, it is important that it should be dialogical. According to Faure, many university teachers would have practised this if student numbers had permitted it.140 By orienting the reform towards the UER, while simultaneously splitting up universities with large student populations, better circumstances were created, even if only temporarily. The French universities, however, could not limit their student numbers coles or the British universities did. in the way that the grandes e

138 139 140

Club Jean Moulin, Que faire de la r evolution de mai? (Paris, 1968). See above, 104. Il importe, par cons equent, que lenseignement soit dialogu e si lon veut quil soit vraiment d emocratique (Faure, Philosophie (note 137), 74, followed by the advice for group work).

108

Relations with authority For the students revolution, the concept of the democratization of the university signied transferring democratic forms of rule and decisionmaking to the university. This conception remained alien to the Loi Faure and not just terminologically. The participation of the students, the assistants, the administrative staff and representatives of public life opened up the consultative and administrative corporate bodies of the universities. But they continued to be subjected to the politically legitimized ofce holders of the democratic state. The university within democracy was not replaced by a politically democratized university. Last but not least, the Loi Faure achieved a university goal that had only exceptionally been attained previously: although professors of foreign nationality did not receive exactly the same status as their French colleagues (as practised in other states), they were granted the right to join the teaching staff of the French universities. In 1969, the protest wave hit the other Western European countries, spilling over into Yugoslavia, Poland and Czechoslovakia. The UNITED KINGDOM experienced the partly violent demonstrations of the neo-Marxist inspired student power.141 But the riots did not change the universities autonomy in transmitting and increasing scientic knowledge according to their own rules under the control of the democratically constituted public powers; although students and staff were given participation rights on corporate bodies, their numbers and their rights remained far below those accorded by most other states in response to the riots often all too hastily.142 In ITALY the government tried to counter the two sources of insurgence by equalizing the status of the non-professorial teaching staff with that of the students. In November 1969 it extended the general right to study at university to holders of all types of rigorous higher-school leaving examinations. At the same time, all teaching staff hired on a provisional or temporary basis received the status of lifetime civil servants. Both actions proved to be counterproductive: university teachers whose aptitude had not been ascertained either by the national qualication tests or by the local appointment procedures customary in Italy lled up the teaching staff and blocked its renewal for years. This negative effect was exacerbated by the second action, which immediately doubled student numbers, thus further overcrowding the mass universities. The quality of education dropped in many disciplines; private and state employers protested. After two new university laws failed to pass in parliament, in 1973 Urgent Actions for the Universities re-established many of the old rules and
141

142

A. Cockburn and R. Blackburn (eds.), Student Power: Problems, Diagnosis, Action (Harmondsworth, 1969); K. Jacka, C. Cox and J. Marks, Rape of Reason: The Corruption of the Polytechnic of North London (London, 1975). Shils, Great Britain (note 9), 618.

109

 Walter Ruegg and Jan Sadlak allowed participation in governance only on the basis of qualitative representation in the sense of the Loi Faure.143 Thus, appointments and important executive oversight remained exclusively the domain of the professors with tenure.144 In FINLAND, the other extreme in the spectrum of students claims, the National Student Association proposed at the end of 1968 that every member of the university have a vote in the elections to the university councils. In June 1969 an ofcial reform commission adopted the proposal. Later, the government failed twice in an attempt to carry its reform proposals through parliament. In 1975, the parliament adopted a university law that replaced the general suffrage of one man, one vote with the principle of participatory democracy. This meant the election of an equal number of representatives for each group of university members. In the FEDERAL REPUBLIC OF GERMANY, in 1968, there were proposals to put university teachers, academic staff and students on an equal footing in a tripartite division. This was presented by some professors as a positive contribution to the democratization of the university.145 In THE NETHERLANDS, in 1970, the government reacted to the insurgency with a University Government Reorganization Act, which brought together all academic teaching staff into one group and gave the non-academic staff a place in the tripartite division.146 In 1975 Finland and the other Nordic states followed this example. Other countries considered a four-part division or the additional participation of representatives from public life. In 1978, Gerrit Vossers, rector of Eindhoven University later to be president of CRE drew the following conclusions from his experiences of the preceding years:
The universities effectiveness has declined; the law has drained the executive boards of their experience, continuity and competence. Mediocrity has spread. The decision-making competencies have been spread thin and scattered. Thus, decisions are not taken or require much time and effort. The concerned people seem to lose interest. It is not primarily the politicization
143

144 145

146

See: Kriterien der qualitativen Reprasentation der Mitglieder der Universitat in den Organen der akademischen Selbstverwaltung, reprint in W. Becker (ed.), WRK, Stel lungnahmen, Empfehlungen, Beschlusse 19601989 (Bonn, 1989), vol. I, 67f. This document, dated 22 May 1968, as well as other WRK recommendations for university reforms, was known in Faures ministry; see J. Fischer, Hochschulreform in Frankreich: Rahmengesetz 1968, Dokumente zur Hochschulreform, 7 (Bad Godesberg, 1970), 17. Malintoppi, Italy (note 11), 11121. J. Habermas, Heilige Kuhe der Hochschulreform, Die Zeit, 17 September 1968. Reprint J. Habermas, Protestbewegung und Hochschulreform (Frankfurt/Main, 1969), 221f. H. Daalder, The Netherlands: Universities between the New Democracy and the New Management, in Daalder and Shils, Universities (note 3), 173231.

110

Relations with authority

that is paralyzing the universities, but rather their obesity and loss of movement and dynamism. This wrong turn that the development of university structures took is possibly the greatest causal factor in the depression of our universities. The problems that universities have to face in times of diminished or even static economic growth require even greater competence from the executive boards, so that difcult decisions about the redistribution of resources can be made.147

In fact the arrangements by university group put the professors with tenure in a minority position. This fact is illustrated by a law that assigned one-third of board representatives to the group comprising all teaching staff; it was necessary also to require that these representatives include at least one to three professors. Later, the three-thirds or four-fourths participatory laws were revised and the group of professors with tenure received special rights. In the Federal Republic of Germany, it took an appeal to the Constitutional Court by a group of university teachers from Gottingen to bring this about.148 In order to realize their constitutional right of freedom in research and teaching, the professors with tenure were to have decisive inuence (ausschlaggebenden Einuss, de facto 51 per cent of the votes) in topics concerning research and the appointment of professors, and a leading inuence (massgeblichen Einuss, 50 per cent) in teaching matters. Over time, the numeric composition of the committees lost more and more of its signicance. The prophecy of an American historian, participatory democracy would soon transform into participatory boredom, had come true.149 And the defence of interests that had sparked the foundation of the group university gradually lost its signicance compared with the defence of the interests of the entire university in the face of the worsening nancial conditions. In this context, it was not helpful that university teachers with tenure only participated in common university affairs through their delegates. In the traditional university, the vice-chancellor or rector could always make an appeal to the goodwill of competent colleagues whenever he had to draw up important position papers or prepare structural or study reforms with input from the assistants and students. In the democratized university, by merely electing their representatives the professors acquitted themselves of their corporate duties and turned their attention
147

148 149

G. Vossers, Die Rolle der Hochschule im Bildungssystem in Europa, in Westdeutsche Rektorenkonferenz, Die deutsche Hochschule in der Kritik des Auslands, Dokumente zur Hochschulreform, 33 (1978), 35. Bundesverfassungsgericht 1 BvR 424/711 BvR 325/72, 27 May 1973, V.4.a,b. F. Stern, Die deutsche Hochschule 1978 in internationaler Sicht, in Die deutsche Hochschule (note 148), 52.

111

 Walter Ruegg and Jan Sadlak to personal academic and professional interests. While in the past it had been the professors experience and competence that had contributed to the universitys image and prosperity, in the group university a huge professional and clerical staff dominated. In a middle-sized university after 1970, the new election ofce alone required as many administrative staff as the entire rectors ofce had done previously. The complex, often inefcient decision-making processes at the university required the counterpart of a strengthened state bureaucracy. At no other time in the history of the university did higher-education laws supplant each other so rapidly as after 1968. Previously, the state had contented itself with setting framework laws, often for the entire school system; or it had stipulated the tasks, rights and organizational structures of single universities in their founding charters, while regulating specic issues in the statutes. These were usually presented by the universities themselves to the government for authorization and could be revised with little bureaucratic effort. After 1968, the proportion and relative weight of laws and statutes were reversed. When it became apparent that the new university laws had failed, some governments preferred to limit the damage by increasing state control rather than run the risk of sparking new protests by revising the laws.150 Nonetheless, in most Continental countries, successful and unsuccessful law revisions succeeded each other well into the 1990s. Originally, democratization of the universities referred to opening them to the largest possible number of people. After 1968, these intentions were congruent in their results with the previous economically motivated growth of academic professional training. Hence governments continued their expansive university policies, or sometimes even increased them with breathtaking speed.151 The expansionist policies towards universities also resulted in diversication of university education in both location and curricula. Most new universities were upgraded from the secondary sector or expanded specialized universities. Technical colleges were given faculties of medicine, law, economics and social sciences and became universities by character and often by name as well. Something similar occurred in the case of trade and economics colleges. The new institutions differed from their traditional counterparts by incorporating technological and other modern disciplines. The old universities, on the other hand, limited themselves

150

151

M. N. Pedersen, The Irreversible Process of University Democratisation: The Danish Case, International Journal of Institutional Management in Higher Education, 12:1 (1988), 11528. See chapter 2 (Patterns), as well as the list of the universities founded between 1945 and 1995 in the Appendix.

112

Relations with authority to their traditional disciplines or simply retained one or several faculties, as in the case of the division of the Sorbonne. In most countries, the universities were complemented by other types of higher education, such as the polytechnics and colleges of education in Great Britain, the Fachhochschulen in the German Federal Republic, the IUT in France, and the regional colleges in Norway and Sweden. Such institutions could neither grant academic titles nor pursue basic research. But in contrast to the traditional universities, they were able to limit their student numbers and to impart in three years a scientically grounded professional training to most students. Governmental university politics of the 1970s had three positive results. Firstly, the distribution of facilities for secondary and higher education across the whole country lessened the imbalances between the centre and the periphery; secondly, as schools with only a few special disciplines were upgraded into polytechnics or universities, they could offer a greater choice of disciplines; and thirdly, these two types of diversication, together with other actions such as provision of study grants, facilitated access of a wider population to professions requiring a higher-education background. However, these three positive outcomes were counterbalanced by three negative ones: overcrowded mass disciplines with longer degree periods and higher drop-out rates; the bureaucratization of academic self-administration; and the loss of solidarity among the teaching staff of the group universities.

towards a harmonised european model, 19831995 Autonomy as scarcity management in Western Europe The problems of the educational explosion that had not been solved by the university laws of the 1970s worsened over the following decade as the university politics of Western European governments felt the effects of shortfalls in public budgets. In 1982, an internationally known university politician declared:
Within three years, the British universities will have to handle a 12% net decrease in the public funds they can spend. Hundreds of tenured university teachers are laid off with severance pay. Universities are closed down. The ratio between teachers and students is rapidly deteriorating. The real income of the teachers is dropping, just as the real value of the scholarships. In three years, numerous disciplines, including natural sciences, will only be taught in half as many universities as today.152
152

R. Dahrendorf, Die europaischen Universitaten in einem veranderten sozia der Universitat: lokonomischen Klima, in W. Kalischer (ed.), Die Internationalitat

113

 Walter Ruegg and Jan Sadlak Facing this dramatic situation, the Committee of Vice-Chancellors and Principals commissioned a study of the effects that the cuts would have on the effectiveness of the university system. Published in 1985, the Jarratt Report recommended the introduction of private business methods of accounting and assessment to strengthen competition among the faculties and institutes within the universities and between the universities themselves in a national and international context. Consequently, like private companies, the British universities received state funds on the basis of the contracts that they signed within the context of the countrys scientic policy with the descendant of the University Grants Committee, the Universities Funding Council. In the academic year 1988/9 it contributed 53% of the average university budget to ensure the infrastructure needed to maintain a high standard of research and teaching; 15% was income from student fees, paid for British students by the local authorities, 7% was made up of research grants from the national research councils, and 25% came from private contracts and subsidies.153 The idea of competition that had found an extreme manifestation in the British university system lay at the heart of the recommendations that the West German Science Council issued in 1985 on the topic of competition in the German university system. The same was true for the report that a group of professors from the Coll` ege de France produced on behalf of President Mitterrand, and which resulted in the creation of the Comit e national d evaluation des universit es.154 In other countries the governments intervened by concentrating single disciplines in a few universities (as in the Netherlands), or by differentiating between a rigid curriculum that was to prepare the majority of students for professional life and a more demanding curriculum geared towards research for the minority interested and talented enough to prot from it (as in Sweden). Collectively, all the reforms that the various governments planned and partly carried out in the 1980s had the aim of differentiating between the universities according to their productivity, and of allowing them to dene a focus and thereby improve their competitiveness, not only on the European market but also in comparison with the North American and Japanese universities.

153

154

Jahresversammlung 1982. Ansprachen und Referate, Zusammenfassung der Plenardiskussionen. Konstanz, 3. und 4. Mai 1982, Dokumente zur Hochschulreform, 50 (Bonn and Bad Godesberg, 1982), 12139, quotation 136. J. Brennan and T. Shah, Higher Education Policy in Great Britain, in Goedegebuure, Higher Education (note 93), 17693. W. Ruegg, Zementierung oder Innovation: Efzienz von Hochschulsystemen, Osterreichische Rektorenkonferenz, Hochschulpolitische Reihe, 1 (Vienna, 1987), 39f., 44; A. Bienaym e, France, in P. G. Altbach (ed.), International Encyclopedia of Comparative Higher Education (New York, 1991), 65770.

114

Relations with authority Competitiveness implies two conditions: rst, a wide-open market in which the competition can take place. With the enlargement of the European Union and the disappearance of the Iron Curtain, the market existed. Second, the freedom of action of the competing actors to implement the far-reaching autonomy of the universities in their choice of students and teachers, in planning their curricula and research, and in managing the necessary nancial resources. The reform laws had sworn by university autonomy it was not just a question of mere lip service. Increasingly, the transfer of a global budget replaced the bureaucratic nancial administration that had required administrative authorization for every expenditure. But from the 1980s on, this responsibility made austerity packages necessary. At rst they were excused as temporary, but they soon became the norm. Thus, for the universities, nancial autonomy meant having to learn how to manage scarce resources and, following the British example, to become contract partners of the government on the basis of periodic development plans and their evaluation in order to receive state funding and attract other monies. Competition for the best students, however, which represented a signicant aspect of British universities, did not come into play strongly on the Continent. Only exceptionally and in single disciplines were the universities able to select incoming students. Paradoxically, the growth of the university system led to a decrease in student mobility. Thus, there had been no substantial extension of the pool of eligible excellent students beyond state borders. Quite the contrary: in 1965/66, 6.5 per cent of the students of the six EC states had done an exchange at a foreign university;155 in the 1980s, these numbers had dropped to less than 1 per cent.156 This cannot be attributed solely to the democratization of university studies, for in the same period there was a signicant increase in programmes that facilitated student exchanges. Countless partnership agreements among universities of different countries from all parts of the globe were signed, as well as simultaneous bilateral agreements for the recognition of class attendance and study tests that the students completed at the partner countries universities.157 Despite these initiatives and despite the increased availability of foreign exchange scholarships, the majority of students from the new educated classes attended the nearest university much as in the later Middle Ages. The causes were not
155

156

157

J. Fischer, Hochschulreformen durch europaische Hochschulpolitik?, Deutsche Uni versitatszeitung , 1 (1972). Deutscher Bundestag, 10. Wahlperiode, Drucksache 10/6419 11 12.11.86, Probleme der Hochschulpolitik im Bereich der Europaischen Gemeinschaft, insbesondere der von Studierenden und Wissenschaftlern. Forderung der Mobilitat Erasmus Bureau, Akademische Anerkennung von Hochschuleingangs-, Zwischen- und die Kommission Endqualikationen in der Europaischen Gemeinschaft, vorbereitet fur der Europaischen Gemeinschaften (Brussels, 1990).

115

 Walter Ruegg and Jan Sadlak exclusively nancial. Rather, these students found the university a foreign world hard to adapt to, even in a familiar regional context. Those willing to risk the additional insecurity of doing part of their studies in a foreign culture were therefore rare. From decline to renewal the development of higher education in Central and Eastern Europe The year 1989 marked a new geopolitical reality with direct consequences for Central and Eastern Europe and its higher education and science. In place of the bankrupt concept of communist ideological order, the countries in this region became unambiguously committed to the processes of democratic change based on respect for the individual and group aspirations for freedom, political pluralism and a market economy. Students and academics often played crucial roles in the more-or-less bloodless revolutions (except for Romania), proving once again that academic institutions can be hotbeds of social and political change. They called for immediate changes in higher education and the relationship between the universities and authority. Consequently, higher education in the region has had to be radically reconstructed on a scale, and at a speed, never attempted in Western Europe. Adjustments that required long gestation in the West have had to be accomplished within four or ve years.158 These adjustments had to be made when these countries were almost bankrupt and their social institutions largely dysfunctional. After more than a decade, the reforms undertaken have achieved the desired number of students and institutions, the diversication of the system through the emergence of private higher-education institutions, and respect for academic freedom and institutional autonomy. These gains may be itemized in nine common trends: 1. introduction of an admissions system based primarily on academic criteria for student selection combined with an educational policy directed towards eliminating selectivity at the lower levels of schooling; 2. diversity in the collective representation of both academics and students, not only in the governing bodies but also in the growth and diversication of professional associations, student organizations, fraternities, etc.; 3. implementation even if at a timid pace of long-overdue reforms in the organization of curricula accelerated by a desire to comply with
158

P. Scott, Higher Education in Central and Eastern Europe: Analytical Report, in Ten Years after and Looking ahead: A Review of Transformations of Higher Education in Central and Eastern Europe (Bucharest, 2000), 341407.

116

Relations with authority the objectives of the university policy established by the European Conference of Ministers of Education, which later culminated in the Bologna Process; introduction of some key political changes, such as the dissolution of the so-called party schools; emergence of a completely new sector of higher education comprising private university-level institutions; modication of the concept of free higher education to reect the need to adopt a cost-sharing approach to nancing the whole system of higher education; consolidation of international relations no longer dependent on central political approval or subject to ideologically determined foreignpolicy objectives, but designed on the basis of academic potential, individual interests and available resources; clear distinction between intellectual study and debate, on the one hand, and political activism on the other: politics stops at the university gate;159 replacement of the political accountability of the leaders of highereducation institutions by academic and economic accountability.

4. 5. 6.

7.

8.

9.

The implementation of such systemic changes required a major overhaul of national legislation. In some cases, changes in the laws were done hastily, and subsequent modications were frequent.160 During the early years of the process, the expertise and support brought by foreign experts and international organizations such as the World Bank, the OECD, the Council of Europe and UNESCO were welcomed, provided that the advisers understood the local environment. However, their involvement could not replace the need for home-grown expertise, especially when reforms came to be implemented.161 Generally speaking, relations of the university with authority had reached a certain pattern of normalcy which required, on the side of the university, much better articulation of its mission and functioning, while having, on the side of the authority, better understanding of the necessity of respect for institutional autonomy, academic values as well as long-term opportunities coming out of the high quality of teaching and research.
159 160

161

A. Marga, University Reform Today (Cluj, 2001), 103. A. Marga, Reform of Education in Romania in the 1990s: A Retrospective, Higher Education in Europe, 27 (2002), 12335; D. Farrington, Legislative Initiatives in the Context of the Bologna Process: A Comparative Perspective (Bucharest, 2005). L. Cerych, Higher Education Reform in the Czech Republic: A Personal Testimony Regarding the Impact of Foreign Advisors, Higher Education in Europe, 27 (2002), 11121.

117

 Walter Ruegg and Jan Sadlak concluding remarks: the universities europe Das Europa der Universitaten/LEurope des universit es/The Universities Europe thus ran the title of a documentary volume on the foundation of the CRE, published by the West German Rectors Conference in 1964.162 This title, of course, did not refer to the current state of affairs but rather to a long-term goal at the end of a lengthy path. In 1991, there were ninety-eight organisations actively engaged in education and research at a European level.163 Without question, many of them helped to probe and demarcate the path; some of them trained later trailblazers. But the path could not be broadened and paved in the absence of institutions endowed with the necessary competence, the human and nancial resources and, last but not least, the decisive political instruments. Such an institution was established in 1957: the Commission of the European Communities at Brussels. Its remit in education politics, however, had been strictly limited to two items by the Treaties of Rome. On the one hand, it was to found a European University; on the other, it was to work towards the mutual recognition of academic diplomas, so that European graduates could practise their profession throughout the community. Politically speaking, these tasks were put under the umbrella of the Council of Economics Ministers. In 1971, for the rst time, the education ministers held a common meeting. University and research politics became increasingly important. From 1991, talks were no longer limited to professional training but included general education as well. The shift towards university politics within the EEC/EC/EU is illustrative of the great movements in the process of Europeanization that the universities themselves have undergone. It will therefore serve as an illustrative case study to close the present chapter. The two projects pertaining to the universities included in the Treaty of Rome reached an impasse. In 1969, the European Commission submitted the rst draft of guidelines for the mutual recognition of academic leaving certicates. In it, the free exercise of the medical profession was conceded to anyone who had successfully completed a precisely determined curriculum with a dened number of teaching hours in the customary topics. If adopted, these guidelines would have destroyed the autonomy of the universities in their special domain. The rectors conferences and universities of the EEC states put up strong resistance and the proposal was withdrawn. With the help of a liaison committee established
162 163

Steger, Das Europa der Universitaten (note 66). J. U. Clauss (comp.), Hochschulrektorenkonferenz, Informationsdienst Dokumentation, 12 (1991).

118

Relations with authority in Brussels in 1971 (which later on took the name of Confederation of European Union Rectors Conferences), the rectors conferences participated in drawing up more exible guidelines oriented towards quality rather than quantity.164 The European University, which the Euratom Agreement had planned for 1958, also failed, mainly because of the opposition of the universities themselves. They looked on themselves as European institutions. In 1972 the Italian governments efforts to full the Euratom scheme in Florence had a partial but innovative result: rather than a European University, the EC agreed to found a graduate college for advanced social studies, as the rectors conferences had suggested.165 The European University Institute at the Badia Fiesolana of San Domenico near Florence was inaugurated in 1976. A decade later it was admitting 100 applicants annually, for a one- to three-year graduate programme, and some 20 research fellows.166 The failures in implementing the educational provisions of the Treaty of Rome motivated the EC to call a rst conference of education ministers of the six member states on 16 November 1971, and to have the Commission investigate the chances of a common policy in education and science in the context of the Treaty.167 In July 1972, the Commission asked the former Belgian education minister and professor, Henri Janne, to ascertain the basic features of education policy on the level of the Community on the basis of statements from leading spokesmen for education politicians in the member states. The report, published in 1973, stated that the application of the Treaty of Rome compels us to deal with the whole issue of youth and adult education, as they are correlated to the imperative of the best possible economic development.168 More generally, the Janne Report presented considerations and recommendations on how the EC subsequently the EU could extend its activities to the framing of European policies on culture, education and research. In its introductory remarks, the report raised a question that directly concerned the universities:

164

165 166

167

168

W. Ruegg, La coop eration entre les universit es europ eennes. Kolloquium in Grenoble. Tagungsbericht, Integration. Vierteljahreshefte zur Europaforschung, 4 (1970), 323 6; W. Ruegg, Les relations entre les Communaut es europ eennes et les e tablissements denseignement sup erieur en Europe. Le point de vue des universit es, in Semaine de Bruges 1973: Universit e et soci et e. Pour une politique europ eenne de lenseignement sup erieur, Cahiers de Bruges, n.s. 32 (1974), 25360. Ruegg, Relations (note 166), 256f. Europaisches Hochschulinstitut, Promotionsstudium in Geschichte und Kul turgeschichte, Wirtschaftswissenschaften, Politikwissenschaften und Gesellschaftswissenschaften, Akademisches Jahr 1996/97 (Luxemburg, 1995). Kommission der Europaischen Gemeinschaften, Fur eine gemeinschaftliche Bil dungspolitik, Bulletin der Europaischen Gemeinschaften, Beilage, 10 (1973), 9f. Ibid., 11.

119

 Walter Ruegg and Jan Sadlak

The growth of the size of companies, the increase in specialization and international interdependence goes hand in hand with the development of science and technology. Is it really possible to envision an economic integration of Europe that takes these factors into account without envisioning a Europeanization of the great universities? By Europeanization we mean that these universities should be able to recruit their teachers, researchers and students and to provide their facilities in other words, that they can organize their own policies and initiatives as if all nine countries of the European Community represented their true habitat, just as the enormous American national territory does for the American universities.169

This vision, which culminated in the Bologna Process, was not eshed out in the report. The grading of university study would have entailed the harmonization of undergraduate studies. At the time it seemed impossible that the Continental universities would reduce their customary four years to three, or that the British universities would be willing to extend their three years to four. But common educational policy agreements with the participation of European states outside the EC were proposed, especially by the British vice-chancellors Asa Briggs and Albert Sloman, and were accepted.170 The report recommended the foundation of a common research centre and a European Science Foundation.171 But English and Swiss researchers convinced the Commission that this cooperation should include the whole of Europe, at least its free part. Thus, the European Science Foundation (ESF), with its headquarters in Strasbourg, was founded in 1974 with the approval of the European Communities but independently of them. As an umbrella organization of the national institutions for the promotion of scientic research, it initiated and coordinated common research projects into innovative elds of inquiry pertaining to science and society.172 Five years later, the EC started its own programme for the promotion of European research cooperation: FAST (Forecasting and Assessment in the eld of Science and Technology) was founded in 1979, followed by ESPRIT (European Strategic Programme for Information Technology) in 1984, by EURECA (European Research Common Action) in 1985 and by Comett (Community Programme for Education and Training for Technology) in 1987. Starting in the same year, student exchange programmes within the EC and EFTA were promoted by the Erasmus programme (European Action Scheme for the Mobility of University Students). By creating a European network of participating disciplines and professors and a scholarship programme, it sought to increase inter-European
169 172 170 Ibid., 23. 171 Ibid., 53. Ibid., 12. European Science Foundation, Report 1975 (Strasbourg, 1975).

120

Relations with authority student mobility from 1 to 10 per cent (this last gure amounted to the estimated percentage of mobile students in early modern times). In 1989, the Erasmus programme was supplemented by the Lingua programme for the promotion of foreign language skills of both students and high school teachers, and by the European Credit Transfer System (ECTS) for student workload. By 1994, 300,000 participants from 1,300 faculties had spent at least one term studying in another EC or EFTA state, thanks to 2,500 Erasmus and Lingua inter-university programmes.173 Although these numbers are signicant, they accounted for only 5 per cent of Western European students. The non-material deterrents to mobility mentioned earlier still operated. In 1992, the Treaty of Maastricht marked the transition to the European Union and extended common competence beyond professional training to include general education as well. In 1995, the Erasmus programme and the Comenius programme for school education were integrated and enlarged to form the Socrates action programme: exchange activities were supplemented by the Europeanization of the curricula, the common development of European modules, and the creation of thematic networks across the whole of Europe for the 95 per cent of those students who cannot be mobile for whatever reasons.174 Additionally, responsibility for the exchange programme was transferred from the representatives of the faculties to the central administration. This, however, did more to further bureaucratization than the scientic and educational support of the programmes. The universities welcomed this initiative of the EC/EU, but at the same time, by means of their rectors conferences, they lobbied to ensure that the principle of subsidiarity would not fall prey to a bureaucratically enforced conformity. In December 1991, a Memorandum on Higher Education in the European Community was published. After some consultation in 1992, the Confederation of European Union Rectors Conferences and the CRE put forward a detailed position statement on the Memorandum. While welcoming the orientation towards Europeanization, the rectors warned against the dangers of harmonizing the curriculum, as this would depreciate both European diversity and university autonomy. The rectors declared their readiness to make a series of concrete proposals for the continuation and extension of the mutually benecial cooperation that had begun in 1971. The outcome was positive.

173

174

H. van Ginkel, International Cooperation and Mobility and the Enhancement of Quality: The Modern University Coming of Age, CRE-Action, 104 (1994), 57f. (A University Policy for Europe, 10th CRE General Assembly Budapest). U. Dolezal, Das ERASMUS-Programm als Teil von SOKRATES, Forschung & Lehre, 8 (1996), 416.

121

 Walter Ruegg and Jan Sadlak The pilot project proposed by the CRE on the application of qualitative criteria in the evaluation of university structures and performance was accepted in 1994 by the Education Council of the EU, and the cooperation of universities in the EU and EFTA member states was welcomed.175 In addition, the CRE initiated a corresponding pilot project in three universities from different countries (Gothenburg, Porto, Utrecht).176 The experiences of implementing the EU programmes were discussed in a number of seminars by the national rectors conferences177 and in the regular meetings of the CRE. This was the beginning of a new chapter in the relationship between the European Commission and the universities. The Confederation of European Union Rectors Conferences in Brussels took on ever more work. And when signs of an upcoming eastward expansion began to appear, the CRE, with its secretariat in Geneva, merged with the Confederation of European Union Rectors Conferences to form the European University Association (EUA), with its secretariat in Brussels, at the heart of the administrative structures of the European Union.

select bibliography
Altbach, P. G. (ed.) International Higher Education: An Encyclopedia, New York/London, 1991. Anderson, R. D. European Universities from the Enlightenment to 1914, Oxford, 2004. Daalder, H. and Shils, E. (eds.) Universities, Politicians and Bureaucrats: Europe and the United States, Cambridge, 1982. Daillant, G. Universality, Diversity, Interdependence: IAU 19501990, A Commemorative Essay, Paris, 1990. Farrington, D. Legislative Initiatives in the Context of the Bologna Process: A Comparative Perspective, Bucharest, 2005. Faure, E. Philosophie dune r eforme, Paris, 1969. Goedegebuure, L. et al. Higher Education Policy: An International Comparative Perpective, Oxford, 1993. Hearnden, A. (ed.) The British in Germany: Educational Reconstruction after 1945, London, 1978.

175

176

177

die Qualitatsbewertung See, e.g., Europaische Pilotprojekte fur im Bereich der Hochschulen: Bundesrepublik Deutschland. Nationaler Bericht, Dokumente zur Hochschulreform, 105 (Bonn, 1995). F. van Vught and D. Westerheijden, Institutional Management for Quality. The CRE Programme: Background, Goals and Procedures, CRE-Action, 107 (1996), 9151. See EG-Hochschulmemorandum und Credit Transfer in Europe, Seminar der Hochschulrektorenkonferenz, Bonn, 7. und 8. November 1992, Dokumente zur Hochschulreform, 83 (Bonn, 1993).

122

Relations with authority

Heinemann, M., with Philips D. (eds.) Hochschulofziere und Wiederaufbau des Hochschulwesens in Westdeutschland 19451952, vol. I: Die Britische Zone, Hildesheim, 1990 Heinemann, M., with Schneider, U. (eds.) Hochschulofziere und Wiederaufbau des Hochschulwesens in Westdeutschland 19451952, vol. II: Die US-Zone, Hildesheim, 1990 Heinemann, M., with Fischer, J. (eds.) Hochschulofziere und Wiederaufbau des Hochschulwesens in Westdeutschland 19451952, vol. III: Die Franzosische Zone, Hildesheim, 1991. Heinemann, M. (ed.) Hochschulofziere und Wiederaufbau des Hochschulwesen 19451949: Die Sowjetische Besatzungszone, Berlin, 2000. Hufner, K. (ed.) Higher Education Reform Processes in Central and Eastern Europe, Frankfurt/Main, 1995. Kardos, J., Kelemen, E., and Szogi, L. Centuries of Hungarian Higher Education, Budapest, 2001. Knowles, A. S. (ed.) International Encyclopedia of Higher Education, San Francisco, 1977. Korol, A. G. Soviet Education for Science and Technology, New York/London, 1957. Marga, A. University Reform Today, Cluj, 2001. Nikitin, P. I. Zwischen Dogma und gesundem Menschenverstand. Wie ich die Universitaten der deutschen Besatzungszone sowjetisierte: Erinnerungen des Sektorleiters Hochschulen und Wissenschaft in der sowjetischen Militaradministration in Deutschland, Edition Bildung und Wissenschaft 6, Berlin, 1997. Phillips, D. (ed.) German Universities after the Surrender: British Occupation Policy and the Control of Higher Education, Oxford, 1984. Sadlak, J. Higher Education in Romania 18601990: Between Academic Mission, Economic Demands and Political Control, Buffalo, 1990. Seabury, P. (ed.) Universities in the Western World, New York/London, 1975. Steger, H.-A. (ed.) Das Europa der Universitaten/LEurope des universit es/The Konferenz der Rektoren und Universities Europe: Entstehung der standigen Vize-Kanzler der europaischen Universitaten 19481962, Dokumentation, Bad Godesberg, 1964. Ten Years after and Looking ahead: A Review of Transformations of Higher Education in Central and Eastern Europe, Bucharest, 2000. Tent, J. F. Mission on the Rhine: Reeducation and Denazication in American Occupied Germany, Chicago, 1982.

123

CHAPTER 4

MANAGEMENT AND RESOURCES

GEOFFREY LOCKWOOD

introduction The basics of the management of a university in Europe are little different now than in 1945, and little different whether in Malta, Troms, Limerick or Kiev. The needs are to allocate scarce resources and insufcient facilities, to understand and motivate staff, to approach, persuade and satisfy sponsors, to provide and maintain a learning environment for students, and to balance external inuences and internal culture in a permanent institution. Those are constants in university management. It is the circumstances in which those needs are pursued which have changed dramatically over the years since 1945. The term management was not part of the cultural vocabulary of the university in 1945 except to describe a process or method of organization alien to a public institution as opposed to a business rm. The university was governed and administered but not managed. The history of the internal organization and culture of the university since the war is reected in the gradual acceptance of the applicability of the term management to the processes of decision-making and decision-implementation within the university. Broadly, administration was the characteristic term until the early 1970s, with governance having a phase of dominance in the later 1960s and again in the 1990s. Management began to feature in the literature and conference papers in the 1960s. Its acceptability and usage within the university came in the 1970s, rstly as a reaction to the student-led wave of concentration upon the politics of governance as the focus of internal organization in the late 1960s, secondly under the impact upon universities of the oil-ination-inspired world economic crises of the mid-1970s.

124

Management and resources A further indication of the cultural reection of the trends in organizing activity within the universities of Western Europe was the emergence in the latter half of the 1980s of the term managerialism an American expression implying not only the existence of management within the university, but also of a philosophy based upon the dominance of management over collegiality, a preference for the executive rather than the exchange model of conducting business. The rst major work to have impact in Europe was The Managerial Revolution in Higher Education1 which described the situation whereby, in place of the loose, unstructured and somewhat casual methods of management practised in colleges and universities in the past, there was a growing commitment to data-gathering and research as a basis for policymaking, and an expanding effort to develop objective criteria for making decisions on the allocation of resources instead of leaving these matters entirely to the play of campus pressures or the forces of tradition. In cumulative effect, these innovations will certainly be regarded by future historians of higher education as giving an entirely new character to university administration. Despite the title of the book, and the impact it would have on practitioners of management in the universities, the text in 1966 still referred to university administration. Over twenty years later the UK Conference of University Administrators Report on Corporate Strategies for Change in Higher Education titled its opening chapter The Managerial Revolution.2 The analysis of the vocabulary used by members of the university to describe the decision-making structures impacting upon them is a fascinating and revealing study in its own right, but it is only touched upon here to reect the broad trend in the development of management in the university since 1945. the university as an organization In order to assess that history of management it is necessary to rst consider the nature of the university as an organization. The university is multi-formed. It is an organization: a legal rational entity which employs labour and capital in formal processes and structures to generate the outputs of teaching and research. It is an institution which maintains permanent and intrinsic values of scholarship and service vested in collegiality. It is also a community: it develops relationships between various categories of members and provides social infrastructure and cohesion. These
1

G. E. Rourke and G. E. Brooks, The Managerial Revolution in Higher Education (Baltimore, 1966). P. Temple and C. Whitchurch (eds.), Strategic Choice: Corporate Strategies for Change in Higher Education (London, 1989), 5.

125

Geoffrey Lockwood three forms of corporation coexist in most universities, and approaches to management are conditioned by the form which an external agency or an internal group believes should be dominant. An early work in Europe was Planning and Management in Universities. The authors deliberately chose the phrase Planning and Management partly because those terms were being used ever more widely in educational circles.3 Representatives of the state, whether in the Soviet Union in 1945 or the United Kingdom in 1985, thought in terms of the university as an organization. Their basic concerns were the efciency with which those organizations served the demands of the state or the needs of society. In that essence the technocratic and rigid manpower planning models of Central and Eastern Europe were no different from the student number projection models of Swedish, British and other governments. One was supply-determined and the other demand-led, but both saw universities primarily as organizations for producing graduates and other outputs. As the period developed, the states paid increasing attention to the input costs per student; they became more concerned with efciency rather than just with output. Students, whether in Paris in 1968 or Rome in 1989 at the time of the Pantera rossa movement, approached management with the dominant community form in which relationships are key, whether social or political. The emphasis amongst students tended, therefore, to be upon internal government, with equality of rights and participation amongst all categories of members of the university being the generic aim. Democratization would not only reect the true nature and needs of the internal community, but would strengthen that community in the struggle against the nation state and in support of broader international and radical actions. Most professors, whether in Germany in 1956 or Ireland in 1976, behaved in terms of the institutional form in which management should be characterized by the values of the permanent body of the collegium. In their eyes, the role of management was to serve the collegium: to do those limited things necessary to ensure the resourced freedom of the academic staff. The inuences of those differing views of the nature of the university can be traced in the actual practice of management in the university since 1945, but it is sufcient to note at this point that each of the forms has legitimacy since the university is multi-formed. The university is pluralistic and fragmented because of the nature of its activities. The pursuance of teaching and research is reliant upon the skills and motivation of individual members of the academic staff and
3

J. Fielden and G. Lockwood (eds.), Planning and Management in Universities (London, 1973), 14.

126

Management and resources students functioning in an institution possessing autonomy and within the requirements of academic freedom. The working environment involves inputs which have variable and joint effects upon outputs, which are themselves capable of only limited measurability and weak assessment feedback from society. Those features have been present in the central tradition of the European university over this period, and all of the developments in internal university management (as opposed to the external regulation of or inuences upon the universities) have sought to protect and develop them. Thousands of university managers across Europe since 1945, regardless of the state systems in which they have been working, have sought to use their industry and expertise to maintain the central core tradition of the European university under a wide variety of external and internal inuences and pressures. If there is any one measure of the effectiveness of university managers it is the extent to which they have been responsible for the maintenance of the conditions of autonomy and academic freedom in the liberal tradition under which creativity and education ourish. Clearly the degree of success in that endeavour has varied according to the nature of the external environment, but recent evidence from one country is probably of general validity: in the United Kingdom, the greatly strengthened administrative leadership of universities which has grown out of the movement I have called soft managerialism4 is the best defence of university autonomy, and in current circumstances nearly its only defence. The study referred to above (note 3) shows how effectively administrators, especially the professional managerial staff, defend their universities in a game whose rules are invented by others and are constantly changing. Yet the continuing decline in the unit of resource has gradually widened the gulf between the administration and the academic staff. There are, under the best of circumstances, inevitable tensions between the administrators and the academics, arising out of their different values and interests. In most universities, there is a healthy tension between spontaneity and predictability, creativity and accountability, centrifugal and centripetal forces. But it makes all the difference to the life of the institution whether the administrators who manage the university and take responsibility for the whole of it are inside or outside it.5 The conclusion of the article referred to in note 5 is relevant to later sections of this chapter but its main point is that the development and focus of internal university management have been directed at the protection
4 5

Fielden and Lockwood, Planning (note 3). M. Trow, Managerialism and the Academic Profession: The Case of England, Higher Education Policy, 7:2 (1994), 17.

127

Geoffrey Lockwood of the autonomy of the university, whether through economic efciency, political effectiveness or educational prociency. The thousands of administrators and managers referred to above came from a variety of backgrounds into a variety of positions that differed widely from one university to the next. One of the basic differences across Europe was whether the managers were appointed by and were employees of the university or were effectively appointed by and formally employees of the state. It is arguable that the British soft managerialism of university-appointed managers would not have been successful in Continental Europe where the culture required managers to be on the inside track with the state. Another basic difference was the formal length of the appointment. A vice-chancellor aged forty-ve years, who was appointed to the normal age of retirement at age sixty-ve, was in a very different position of authority and inuence from that of a rector elected for shorter periods. In practice, both might have been in ofce for the same number of years, but one had the crucial advantage of tenure. A further key difference was the extent to which university managers were supported by being members of recognized professions. A university ofcer, who was a lawyer, an accountant, an engineer and so on, was in a different position vis-a-vis both the collegium and the state from an ` ofcer who was a generalist administrator in the specialist service of the university. images of change The daily physical environment of the senior university ofcer provides evidence of change, in the means rather than ends of management. Todays senior university manager is typically located in an executive suite surrounded by colleagues in a modern ofce building. Located on a paper-free desk is the computer terminal which is used to check the state of the institutions 100 million annual income and expenditure, to communicate electronically and to develop policy papers and speeches; nearby is the printer and fax machine for speedy communication to maintain the global business of the university. In the corner of the ofce there is a satellite TV to keep in touch with world events and markets now that national bodies provide only 70 per cent of the universitys income. The senior manager in circa 1970 would more likely have been in an ofce with a personal secretary adjoining but with main colleagues more distanced and in a building, if not being constructed, surrounded by building works. The desk would have been dominated by paper, including sheaves of computer printout, but with a pocket electronic calculator and possibly a memo-dictating machine evident. The communications 128

Management and resources controlling the 20 million annual turnover would have been dictated to the personal secretary in the main, and the dealings with national bodies from which 90 per cent of the universitys resources were derived would be time-consuming. In the late 1940s, the senior manager might have been sharing an ofce whilst others were being repainted, and with the personal secretary in another shared ofce along the corridor. The communications, mainly internal to the university, would have been done on a manual typewriter, but many of them would have been oral on the telephone or face-to-face. The universitys 2 million budget would have been more the concern of the nancial administrator, with the rector or vice-chancellor concentrating on what salary level could be afforded for a new member of staff. Those images reect the development of technology, the shift from the local to the national to the global concern, and the growth of the typical university from the scale of a school to a village to a town. The images evident in a typical day in the diary of a senior manager have similar messages. The day in the late 1980s might have started at 8.30 a.m. with a meeting with the university fund-raising appeal director, followed by a policy meeting with internal colleagues on equal opportunities at work and a board meeting of the universitys commercial company or science park board. Lunch with visitors from a collaborating Japanese university, then an internal meeting on teaching quality audit followed by the formal signing of European Community research applications and a meeting of the institutional strategic planning team. Dinner could be with a group of local businessmen and politicians on regional economic development, including a media presentation, then a few late night faxes or telephone calls about the recruitment of a new professor from the USA. The early 1970s day might have started, after dealing with the morning post with the secretary, with a 9.30 a.m. meeting with the president of the students union about student representations on the Senate followed by discussions with senior colleagues in the physical sciences concerning applications to national research councils. Then meeting a delegation of institutional trade unionists before addressing the local Rotary Club lunch. The afternoon could have commenced with the appointment committee for a dean of a faculty, then a press conference on the universitys policy on drugs on campus, before a personal visit to the department of chemistry. Dinner might have been with a group of regional vicechancellors to exchange views on the politics of inuencing national bodies, and then late night reading of a pile of internal committee reports. In the late 1940s, the senior manager might have been free from all but the morning post until around 10.00 a.m. when he had a visit from a state ofcial about the funding and architecture of a new building, 129

Geoffrey Lockwood followed by a meeting with a group of senior professors concerning the next session of the Senate. Lunch could have been a social occasion in the senior common room after which there were two appointing committees for lecturers to chair and a meeting of the university committee on student residence. Dinner was likely to be at home, possibly entertaining a few new colleagues, after which the night would be free for personal professional activity. Those glimpses of the possible daily diaries of the university senior manager in the late 1980s, the early 1970s and the late 1940s contain broad generalizations about the development of management over those years. The shifts have been about the increasing time pressures or workloads on managers, about needing to focus attention more on the external than the internal, and about the role being full-time rather than part-time: in essence about the change from an amateur to a professional role. Since 1945, the university has gradually moved from being a closed community of scholars to a knowledge rm. This shift is true all over Europe, even in universities that have close ties to the ministry of education, as in Austria, France, the Netherlands, Spain or Italy, since governments increasingly insisted on the professional use of the resources made available to higher education and research. In a number of university towns the prestige of the institution was also measured in terms of the old seats of learning; in such cases, modern executive styles have to take into account endemic factors such as the size of the chambers and ante-chambers, the number of support staff needed to maintain them, or the rows of ofcial portraits that bear witness to the age and quality of the institution. academic structure The basic cell in the structure of the university has remained over the period that of the academic discipline. The elementary particle in academic life is the individual faculty member, but it is the subject discipline, reected in a faculty or department, which is the basic organizational unit. This unit contains sub-groups concerned with particular courses or research areas, but the academic discipline provides a boundary around the department. The internal structure of the unit has varied from subject to subject; for example, the research groups in physics would be fewer and larger than the research groups in history, because research in history is predominantly conducted by individuals, not teams. Similarly, the strength of the boundary around the unit has also varied depending upon the degree of external recognition awarded to the particular academic discipline. The boundary which denes and protects a faculty or department of law is sharper and stronger than that which surrounds 130

Management and resources philosophy, because the former discipline has greater differentiation from its neighbours and a closer relationship with an external profession. There have been many attempts to replace the academic discipline as the base unit in the European universities since 1945: for example, the development of the state research institutes separate from the teaching universities in the socialist countries; the innovations (e.g., at the University of Sussex in 1961) with emphasis upon interdisciplinary schools of studies replacing the traditional department/faculty model; and the creation of Unit es denseigement et de recherche under the French loi dorientation de lenseignement sup erieur in 1968. In Spain, the socialist government decided in the late 1970s to reorganize the various elements of teaching and research into a matrix specialization, and then into schools, with each school asking the respective departments for the necessary teaching staff. The idea was to reduce overlaps in faculties wishing to control all their taught courses, especially those required by a number of disciplines, such as mathematics, physics and languages. Flexibility and efciency were to be based on interdisciplinarity and a greater separation of teaching and research, thus reducing the dominance of the discipline, faculty or department that had prevailed in 1945. Across Europe, it is clear that interdisciplinarity and the greater separation of teaching and research meant that the discipline faculty or department was no longer as dominant in 1990 as it had been in 1945, but it remains the model state. The structure attempting to integrate those base units into a single institution has been and remains complex. In some countries the number of faculties multiplied, and a large university like Belgrade was divided into many autonomous faculties, while other institutions tried to adapt the old structures to new scientic demands without duplicating the structures. The units were protected by professional competence, fragmented but not discrete. Although the units vary in size and importance, the structure generally was and is characterized by a high number of small units. University management was complicated by the fact that the units shared few corporate tasks compared with most other forms of organization but were linked by an interlacing of cross-memberships. This has had a conservative effect against institutional management innovation. The extent to which the university as an organization possessed managerial authority over the internal basic units of activity or production has been a key issue over the period; and that issue turns largely upon the degree of institutional autonomy provided to the university by the state. The latter theme is the subject of other chapters in this volume, but from the viewpoint of the institutional management of the university in Europe since 1945, it is important to note that, although the degree of institutional autonomy has obviously varied over that period and amongst 131

Geoffrey Lockwood the different states, the degree of autonomy has also varied according to the eld of decision-taking. In broad terms, the university has had greater freedom of decisiontaking in relation to the assessment of student performance, the structure of courses or the selection of research areas to be pursued than it has had in the admission of students, the reward structure for staff or the purchase of technology; and than it has had in the allocation of nance, the purchase of sites and the construction of buildings. The reason for considering the internal characteristics of the university as an organization and the varying extents of institutional autonomy visa-vis external authority is that the period since 1945 in most of Europe ` has seen the spread of the inuence of university management seeping downwards in the institution from the university, to the faculty, to the department and to the individual; spreading horizontally across all of the activities of the university; and strengthening the institutional boundary in relation to external authorities. The major exception to that broad trend is in the universities of Eastern Europe, where management dominated from 1945 as part of the philosophy and mechanisms of the organization of the state, and where recent reforms in those states have led to a reaction to management within the university not dissimilar to the student-led political or governance model in the rest of Europe in the late 1960s. By the end of the twentieth century, however, most countries were making use of the same tools and concepts to manage higher education, and universities experienced similar periods of expansion or contraction in order to meet the common challenges of paucity, overcrowding and relevance. forces of change The reason for that development of management has been the increased scale and complexity of the university stemming from institutional responsiveness to environmental change. The broad forces of and for change have, in the main, been common across Europe, though impacting with different timescales in different countries. One force for change, to which the work of the university itself contributed signicantly, was the explosion in knowledge and the associated fact that much of the growth occurred at or across the traditional boundaries of the disciplines. The organization of curricula thus necessarily had to be more selective and interdisciplinary in 1995 than 1945 and had to develop processes for its speedy renewal and quality assurance, factors strengthening the need for organization and the involvement of management. This became especially so as individual students were recognized as being able to determine their own curricula paths to a degree qualication. One of the paradoxes of student-based modular course structures with credit 132

Management and resources transfer is that the greater exibility it offers students entails more management by course organisers.6 The same argument about the increased management requirement applies to the usage of information technology in teaching and the greater attention to teaching timetabling necessitated by the costs of space and interdisciplinarity. In addition to such internal change, the sources of the development and transmission of knowledge were such by the 1980s that the university was losing its monopoly position in its main eld of activity. The academies of science in the socialist countries and public or governmental research centres in Western Europe had long challenged the research function of the university, but as commercial and industrial activity became more knowledge-based so the research laboratories and in-company training schools of private corporations were becoming competitors of the university towards the end of the period. It was not surprising, therefore, that the extent of partnership between the university and economic enterprises increased signicantly in the latter part of the period.7 In the future the interaction between institutions of higher education and their economic environments is likely to become as important for management as relations with government.8 The factors affecting knowledge thus illustrate two of the reasons for the rise in the growth of management, that is, internal complexity and external competition. This makes a strong case for high-level practice and passing on of science and scholarships, but should this necessarily take place in the university? Will company training and company laboratories simply take over the role of the university?9 A second and major force for change has been the pressure for expansion which was initially led by the need to offer opportunities for university education to those whose education had been interrupted by the Second World War. It was then fed by the demographic increase in the university age group, and by the need to achieve the skilled manpower targets in the ve-year plans of the totalitarian countries; when those factors declined, expansion continued to be accelerated not only by the wishes of more individuals to be educated, but by social demands (for example, to improve the proportion of women receiving education) and
6

G. Williams, Total Quality Management in Higher Education: Panacea or Placebo?, Higher Education, 25:3 (1993), 22937. Karl Heinz Beckurts-Stiftung (ed.), Partnerschaft zwischen Wissenschaft und Wirtschaft: Vortragsabend und Symposium am 25. und 26. Oktober 1988 in Munchen (Munich, 1988). P. Le Vasseur, The IMHE Programme A Look ahead, International Journal of Institutional Management in Higher Education, 5:3 (1981), 181. H. Van Ginkel, University 2050. The Organisation of Creativity and Innovation, in J. Raisman (ed.), Universities in the Twenty-First Century: A Lecture Series/Paul Hamlyn Foundation (London, 1994), 6586.

133

Geoffrey Lockwood industrial requirements as the nature of work shifted to the knowledgebased variety. Thus, although most countries saw short periods of stagnation due to demographic factors or governmental economic restraint, the history since 1945 has been one of major expansion, which is well documented elsewhere in this volume. In broad terms, a typical university of 1945 doubled in size by the late 1950s, doubled again by the early 1970s and had doubled again by the late 1980s. Equally important to the role of management at the institutional level was that the expansion increased the number of universities very considerably. Brand new universities with challenging innovative courses and structures were created, and many colleges with rm reputations in particular elds were upgraded to university status. Expansion thus facilitated or necessitated the development of management through two main factors: the increase in institutional scale with the growth of external competition, and the need to increase public accountability. The point made in the opening paragraph of this chapter, concerning the similarities in the basics between 1945 and 1990 in the circumstances faced by university managers, nevertheless has to be kept in mind and can be evidenced in two quotes which could have referred to, say, the mid-1980s but were stated in August 1949:
The administrative structures of the universities have been put to a very serious test over the past few years. A sixty-six per cent increase in student numbers, ambitious new schemes of capital development and the necessity for appointing large numbers of new staff have all subjected the organization of the universities to a great strain. The increased dependence on public money makes it necessary for the administrative efciency of the universities to be visible to the outside world.10

In several countries with limited capital resources, the trend towards mass education also created bottlenecks, especially in the former socialist systems affected by an important brain drain owing to the loss in prestige of the academic profession. This often led to the ageing of staff so that, by the end of the century, the average age of teachers in many institutions was well over sixty. The third force for change was the development of technology and its impact upon the university. The technological scale of scientic research, with its high equipment and infrastructure costs, was one reason for the individual university needing to be much more selective about the areas of research on which it should concentrate, a process of selection which
10

S. Wythenshawe (ed.), University Administration An Investigation, Universities Quarterly, 3 (1949), 7967.

134

Management and resources required management to develop the particular elements of distinctiveness on which institutional mission should be based, to strengthen corporate planning, and to create internal budgetary systems that enabled units to mix labour, equipment and space costs rather than abide by traditional line item budgets for those elements. The impact was very variable according to the nature of the academic discipline. All disciplines were subject to much the same degree of change, but the management implications of that change were very different. For example, the changes affecting teaching and research in history could be managed broadly within constant resources, whereas the changes impacting upon physics required major resource adjustments and enhancements. The development of technology rst inuenced the research function but, by the 1970s, it was affecting the teaching function in ways which required management development. Even leaving aside the major development of technology-based distance learning (as in the British Open University), student learning by the late 1960s had begun to provide the individual student with access to educational lms and videos in addition to that provided by teachers directly. The impact of computing systems upon the library and other learning resources in the 1980s meant that an information technology approach was becoming as relevant to teaching as to research, with the consequential need to adjust curricula, teaching methods, the mix of inputs into learning from academic staff, resource staff, equipment and so on. The impact of technology directly upon management, including the large-scale data-manipulating planning computer models of the 1960s and the fourth-generation integrated data systems of the late 1980s, will be dealt with later in this chapter. In general, the role of technology in this rise of institutional management has been due to the fact that, if it offered widened choices, its costs required planning to be focused, all the more so as it signicantly changed the delivery systems for the basic activities of the university (teaching and research). Technology increased complexity and choice, both of which increased the importance of management. The fourth force for change can be termed the socio-political. Under this heading fall inuences as different as the control of the university as part of the state politics of a communist/socialist regime or the focus of more internal pressures by student movements (which at some times in the period did not seem to be that different); as different as the demands of customers (whether individuals, rms or states) for assurances about the quality processes and checks, a matter for debate amongst the academic staff about whether the university serves society or vice-versa; as different as the roles of university members in national political change, indeed revolutions, compared to the inuence of civic representatives on the planning of the university; as different as the impact upon the university 135

Geoffrey Lockwood of the policies of the European Community was from the pressures of the local trade unions. In terms of the impact upon university management, those inuences present sub-themes to do with the growth in the international dimension of the university (and therefore, the need for management to be globally informed and sensitive) and the switch in emphasis over the period from the internal to the external. However, the main factors were the growing complexity, and the rise in the demand and need for socio-political accountability. It is interesting to note that the term accountability did not appear in the literature of higher education in Europe before 1970 at the earliest. The growth in the scale and social importance or relevance of the university now required the institution to explain itself more fully to society, whether that was to do with the universitys distinctiveness, its quality assurance mechanisms, its stand on particular national or international issues or its role in the local or regional community. The fullment of the requirement for accountability was another factor in the development of management. Accountability to the state also changed in character over the period. Outside the socialist states, at the opening of the period the state sought broad steerage inuence upon the university; although it was not then termed accountability, the state wished to be assured that the university was using its resources to meet generally the policy objectives of the state. Gradually over the period the state moved from steerage to instruction and from broad policy objectives to specic nancial and output targets, a shift due largely to the increased importance and scale of higher education, but also due to a growing tendency on the part of governments to perceive that the universities were not adjusting sufciently to the economic and social needs of the state. Prescription and control began to take over from policy advice in many countries in Europe somewhere between the oil-led ination crisis of the mid-1970s and the public nance difculties of the early 1980s. The fth force for change was the economic impact of the growth of the university. In essence, over the period and throughout Europe the university consumed an increasing proportion of national wealth (no longer necessarily allocated directly by the state) while being required to reduce its unit costs. There were times in every country when investment was on generous terms, but over the whole period, and particularly since the mid-1980s, the price of increased investment has been greater institutional productivity or efciency, a price which led to a clearer separation of the management and development of teaching from that of research, and also to concentration upon the economic costs of different ways of delivering teaching and research. Furthermore, it gave greater impetus to the search for funds from new sources (including students or their families paying 136

Management and resources for more of their education) and led to a stronger institutional focus upon new developments and historic costs. The twin needs for institutional economic efciency and for full and effective accounting to investors (whether states or individual students) considerably increased the role of management, as can be seen from the widespread introduction of development (fund-raising) ofces, the extension of nance ofces into audit/value-for-money activities, and the major increase in attention paid to external reports on the nances of the university (and its standing with respect to comparative performance indicators). In general terms, the exercise of choice within the university about the usage of scarce resources in the face of unlimited aims and the need to explain or defend such choice to external bodies has been a signicant factor in the rise of university management. In summary, the features which the above environmental forces for change created within the university which facilitated or required the development of management in the university were increases in scale, complexity, competition, choice and accountability. effective autonomy Those forces impacted more upon the executive elements of management or administration than upon the legislative elements of management or governance, even though greater attention has been paid to the latter, both within and outside the university. Over the period since 1945, the university and society have been exercised about the degree of autonomy of the university vis-a-vis the state (i.e. the extent to which the individ` ual university was responsible for responding to the above forces for change rather than being instructed by the state) and the internal political structure of the university (i.e. the balance of forces and interests in the mechanisms through which the university responded). The subject of relations with the state forms the object of other chapters in this volume. In relation to this commentary upon management at the institutional level, the crucial question concerns the extent to which university management felt it was responsible for the constitutional standing of autonomy. At the extreme, a university management whose members were close to the national levers of power under a political system in which the university had little constitutional autonomy might have possessed more effective autonomy than a university management in a political system where the institution had autonomy but no inuence over the key external decisions affecting the university. Such a surmise is not provable, but it draws attention to the difference between the formal and the informal. The formal situation in the Federal Republic of Germany has been that the general shift over the period was towards deregulation by the state. 137

Geoffrey Lockwood However, the constitutional position by the end of the period remained that the university was obliged to detail its intentions to the Lander (in still pay directly the the Rahmen-Prufungsordnungen )11 and the Lander salaries of university staff (7080 per cent of the total running costs of the university). The formal situation in the United Kingdom over the period has been one in which the university has remained autonomous, with freedom to initiate courses, hire and pay staff, and so on, without reference to the state but subject to subsequent accountability. However, the informal, or effective, situation in these two countries was much closer, and university management in both behaved with much the same degree of responsibility. Informally, in the Federal Republic, institutional action took place in advance of Lander approval through understandings developed by university management. In the United Kingdom, consultations before action with the state or its agencies became necessary under advisory or guidance procedures initiated by the state. In university management terms, the constitutional position on autonomy has been important, but the principal concern has been about effective autonomy; and there has been more in common across Europe about the latter (i.e., the extent to which university management felt it was responsible) than about the former (the constitutional statements on autonomy). The general trend was towards the state recognizing that the delivery of teaching and research in response to environmental changes could be more productive and responsive if the university was perceived to be responsible and not fettered by state regulation. A distinguished rector was able to state in 1989 that it must be noted that intellectual independence vis-a-vis ofcial ideologies now rarely causes problems in ` universities.12 Given the situation in 1945, when a signicant number of universities were directly under the ideologies of the state or the church, that marks a major shift over the period, especially in Eastern, Central and Southern Europe. By the end of the period, across Europe, there was an understanding that, whatever the formal state of constitutional autonomy, it was best to leave delivery and responsiveness to the individual university provided that the university could demonstrate its economic efciency and quality standards, a proviso highly dependent upon its management and the external trust placed in that management. There was a plethora of national reports on the subject, as the following few examples indicate. The 1977 reform in Sweden was based upon a growing awareness that to have any signicant impact most changes and adjustments should be made by the higher-education institutions themselves. Generally there
11 12

On the German Rahmen-Prufungsordnungen , see chapter 7. R. Dillemans, Autonomy, Responsibility and Responsiveness of Higher Education Institutions after 1992, European Journal of Education, 24:4 (1989), 33343.

138

Management and resources seems to have begun a swing away from the centreperiphery social engineering reform strategy towards a more dynamic process-oriented perspective where self-evaluation (Verksamshetsuandering) and the capacity for self-renewal are key concepts.13 The 1985 decisions of the Netherlands government meant the complete abolishment of all direct governmental supervision of curricula.14 The General Plan for Further and Higher Education in Denmark was directed at individual universities re-orientating their systems more explicitly to the needs of the labour market and to improving their efciency and productivity. The Hermes Commission in Norway in 1987 placed emphasis upon the need for individual universities to relate the general goals and priorities through their efciency, quality and exibility in the development of individuals and skills. In France in the 1980s, accountability and planning were translated into four-year contracts negotiated directly with the ministry by each institution; the government ensured the agreed level of support for development priorities over the four-year period, thus making long-term strategies more feasible. In 1985 the Jarratt Report15 in the United Kingdom stressed the corporate planning responsibilities of accountable individual universities. The view was succinctly expressed at a European Commission-sponsored conference in Siena in 1991, that is, strategic management by individual institutions is the key to a generalized process of change in Europe.16 In that sense the universities Magna Charta, signed in Bologna in September 1988 by rectors from all over Europe, was more the setting of a seal upon the trend than the raising of a standard of autonomy to be struggled towards. State planning in the Western democracies had been replaced by a reliance upon the responsibilities of individuals and institutions, and that change was to be shortly brought about dramatically in Eastern and Central Europe. An interesting question is when did it emerge in the universities that they had to set their own strategies for survival and development? The timing differed across Europe. Broadly the concept of strategy came in the late 1960s and early 1970s, under the combined impact of student radicalism, which forced the university to be more explicit about what it stood for, and of the managerial revolution in large-scale organizations, where the idea of corporate planning developed at that time. Whatever
13

14

15

16

A.-M. Furumark, Institutional Self-evaluation in Sweden, International Journal of Institutional Management in Higher Education, 5:3 (1981), 208. F. van Vught, State Regulations and Innovations in Higher Education, Higher Education Management, 1:1 (1990), 34. Jarratt Report = Report of the Steering Committee for Efciency Studies in Universities in the United Kingdom (London, 1985). Higher Education in the European Community towards the Year 2000, Universitas Quaderni, 9 (1991), 53.

139

Geoffrey Lockwood the differences at that time between Nanterre, Sussex, Trier, Trondheim and Louvain-la-Neuve, they were each setting out strategic concepts.

the management quadrilateral If autonomy vis-a-vis the state was not as great a concern for university ` management in practice as it was for the commentators upon higher education, what was the situation in regard to the university management and the internal politics of the university? Viewed over the period as a whole, the conclusion is one more of stability than fundamental change. Despite periods of considerable turbulence and debate, the internal governance of the university in Europe since 1945 has been based upon a quadrilateral of power or authority, the rst of the four points of the quadrilateral being a governing body or council normally composed of internal and external representatives. In the United Kingdom that body typically had a majority of external members. In Continental Europe the body was more typically internally dominated, partly because its decisions were more subject to ratication by state authorities, but external representation was strengthened over the period. For example, the French Law in 198417 adjusted the basic law of 1968 to add external members to the Conseil universitaire (or Conseil dadministration depending upon the institution) as part of the 1980s shift towards improving the efciency and responsiveness of responsible institutions. The second point of the quadrilateral was the senior internal academic authority, or parliament, of the Senate, normally one body but sometimes a divided authority (as is the case in France with the separation of authority between teaching and research in the Conseil scientique and the Conseil d etudes et de la vie universitaire). The third point of the quadrilateral was the individual head of the university, disregarding ceremonial heads: the rector or vice-chancellor or president possessing the executive responsibility for both the academic and management leadership of the institution. The extent to which the rector had full authority over both the academic and management aspects of the university varied from country to country and within countries over the period, but the full leadership role became the norm by the end of the period. The fourth point of the quadrilateral was the role of the professional head of the administration, variously titled registrar, secretary, Kanzler, questor, gerente, secr etaire-g en eral, pro-rector (administration) and so forth. Originally such ofcers were representatives of the state placed inside the university (the Prussian Kurator model) to control resource
17

Loi no. 8452 du 26 janvier 1984 sur lenseignement sup erieur.

140

Management and resources management (separate from the rectors responsibility for academic management). The general trend since 1945 across Europe has been for them to be internalized constitutionally under the governing body and the rector, but remaining as a fourth point in the management quadrilateral because of their joint responsibilities to the council, the Senate and the rector, because of their special relationships to the state in many countries, and because the combination of their professionalism and comparative permanency gave them inuence far beyond their formal authority. The history of the internal politics or governance of the university in Europe since 1945 has been to do with the changing nature and roles of the four points in that quadrilateral. There is considerable literature on the subject, and the state of the balance has been the object of debate, legislation and militancy throughout the period. However, the basics of that generic structure have been in place in most countries in Europe for most of the time since 1945, though, in common with the cycles of all permanent institutions, the pendulum effect has operated in European universities. Over time, even under stable environmental conditions, the balance of effective power amongst the four points of the quadrilateral has changed. The relative situations of governing bodies (councils) and the internal academic parliament (Senate) has shifted basically in tune with the changes in the strength and nature of the external pressures upon the institution. In broad terms, when those pressures have been less intensive or less direct, the Senate has predominated. When those pressures have been intensive or direct, the council has been forced to be more active. Senates, therefore, were at their high point in the late 1960s/early 1970s, when the relatively generous economic terms for expansion available from governments were in vogue. Councils had to re-assert their authority from the early 1980s when the economic conditions for survival, let alone expansion, pressed hard upon the university, requiring difcult selective decisions on academic priorities and employment practices within the university. The growing relationship between the university and local/regional economic development also helped to switch the balance of inuence in the 1980s towards the externally related governing body and away from the internally focused academic parliaments. A similar trend can be perceived in regard to the effective rather than the constitutional position of the rector or vice-chancellor. Such ofcers were clearly seen as directive leaders of their institutions in the 1940s and 1950s but, in the surge of participatory internal democracy in the 1960s and in the period of industrial democracy in the 1970s, they became characterized as chairmen of assemblies or the heads of one side of university governance (the management as opposed to the leaders of the workers). They returned in the 1980s, in adverse economic conditions, to being recognized as the managerial heads of unied institutions, chief 141

Geoffrey Lockwood executives in the jargon of the day. The tradition of vice-chancellors being scholars rst and acting as chairmen of the Senate carrying out its will, rather than leading it strongly, is changing. The shift to the style of chief executive, bearing the responsibility for leadership and effective management of the institution, slowly took precedence.18 As with many other aspects of management covered in this chapter, the states of Central and Eastern Europe were an exception to the timing of that trend with democratization impacting not in the late 1960s but in the late 1980s. For example, in the USSR in 1969, rectors were given overall administrative power,19 whereas in Czechoslovakia after the Velvet Revolution, rectors are elected by Academic Senates and appointed by the head of state, whilst deans are elected by Senates in individual schools, but appointed by no-one, and therefore seem to be subordinate to nobody. Rectors, as chief administrators, have no say in the process of hiring and ring faculty.20 This cycle of change was reected in the method and terms of the appointment of rectors: broadly from being appointed by the governing body to being elected by the internal community to being again appointed by the governing body. Over most of the period, most rectors, whether appointed or elected, were effectively selected by internal bodies for relatively short periods of ofce (the UK vice-chancellors being the principal exception having been in the main appointed until the normal age of retirement in most cases over the period). Rectors functioned through the high public status of their ofce and their personal academic standing rather than through specic powers of the ofce (which tended to be fewer than those attached to a chief executive in most other types of organization). Leadership was thus more a matter of consent, particularly by Senates, than authority, a situation attuned to the traditions and times when rectors were primarily responsible for the leadership of the academic community rather than for the whole of the management of the university (e.g. in times when Kuratoren had a separate responsibility to the state for the nances and physical management of the university). The effects that rectors being recognized by the state, and the council, as the full managerial heads of their universities had upon the ofce of the rector and their relations with Senates were still evolving at the end of the period. For example, in Finland the system of internal decisionmaking will now be developed to give the heads of the institutions and
18 19

20

Jarratt Report (note 15), 26. B. Holmes, The Development of Higher Education, Paedagogica Europaea, 7 (1972), 22. J. Jarab, Higher Education and Research in the Czech Republic, Higher Education Management, 5:2 (1993), 312.

142

Management and resources Faculties more decision powers, especially in nancial matters. Some universities have adopted a decision-making system that gives the Rector power to decide on the allocation of the institutions appropriations and the deans to decide upon the allocation of resources within their Faculties. All of the institutions were not prepared to adopt this system.21 In the Dutch universities, following the upheaval of 1968, the pendulum swung in the other direction. A system of shared decision-making gave considerable inuence to the students and administrative staff through a common council, the academische raad, while the university leadership was entrusted to a troika consisting of the rector (an academic responsible for institutional development), the president (usually an outsider with a career in government or industry, who was responsible for links with the external world) and a third member in charge of the administration. In the mid-1990s, this participatory democracy was replaced by streamlined authority, with the minister appointing the board of outsiders responsible for the welfare of the university as a whole. This board nominated the rector and sometimes the other members of the troika after negotiating the strategies to be implemented within the university, while the rector chose the deans and agreed with them the resources they would be allocated. Students and administrative staff retained positions on a number of committees, but the latter were now consultative rather than executive. The trends in the role and position of the registrar or Kanzler were no less complex and interesting than in the case of the rector or vicechancellor. The main changes were in the content and context of their professional work. In regard to this summary of the internal political changes and interest, the rst point to note is that the roles of such ofcers converged across Europe over the period. In the early part of the period, the situation in the different states was very divergent. In some, the role of general management was in effect performed by state ofcials outside the university, with internal ofcers of minor responsibilities reporting to them (e.g., in France). In others, the state required the senior internal professional manager to be directly responsible to its ofcials and had inuence upon the appointment (e.g., the Federal Republic of Germany). In others, the ofcer was appointed by, and entirely responsible to, the university authorities (e.g., in the United Kingdom). Although exceptions can be quoted, the general trend across Europe over the period has been towards the professional head of the general administration of the university being appointed by, and entirely responsible to, the university as a senior member of the rectors management
21

A. Jappinen, University and Government in Finland, Higher Education Management, 1:1 (1989), 336.

143

Geoffrey Lockwood team, albeit often still with a special recognition by the state (e.g., in Austria) or with a direct responsibility in certain matters to the council, not through the vice-chancellor (e.g., in the United Kingdom). The second point to note in regard to the role of the registrar or equivalent over the period is that the role broadened. As environmental factors (e.g., technology) and internal management techniques (e.g., planning) claried that most decisions in a university have academic, resource, physical and social dimensions and effects, and also provided the means to utilize information on those dimensions in integrated decision-taking, so the managerial structure changed. The administrative resources and expertise of the university could no longer be divided between the academic and the resource elds, and over the period, the professionalism of the Kanzler in the Federal Republic of Germany was extended into academic administration, while the ofces of bursar (resources) and registrar (academic administration) were combined in the United Kingdom, and so on. Thus, more unied and comprehensive professional administrations were developed. A third point about the role of the senior professional manager is that the growth in the scale and complexity of the university, the application of new management techniques to the university and the changing nature of the politics, rules and regulations relating the university to the state and society all forced the professional managers or administrators, who were normally in ofce for periods far longer than the academic ofcers (including rectors), to master knowledge, techniques and relationships which were essential to the efciency and survival of the university, a trend which required a concentration and continuity beyond that capable of being achieved at the other three points of the quadrilateral. The history of the period is thus one of a growing political tension between the professionals or technocrats, led by the Kanzler or equivalent, and the internal academic community and its short-term ofcers. Although the internal political climates and trends in the university over the period across Europe could take volumes to summarize, it is time in this chapter to turn attention to the contents of management rather than its politics. management and governance University ofcers and administrative services were concerned over the period with the management of the primary activities of the institution (teaching and learning, research and scholarship, public service) and the support services and infrastructure necessary to those activities (resource availability, allocation and usage; student recruitment, recording and assessment; provision and maintenance of buildings, equipment 144

Management and resources and grounds; development of social services for the university community). Aspects of those roles of management are referred to in this chapter, but no attempt is made to describe the changes in the ways in which they were performed and the effects those changes had on the structure and the image of university management. Such a description would require a separate volume; but it has to be recorded that for much of the day in each of the years over the whole of Europe it was those basic operational tasks which dominated the work and lives of most university managers. This section selects one such role as an example of the changes that impacted upon the operations of management: the role of maintaining and adapting the constitutional governance of the university in the light of external pressures for change and of internal political movements. Notwithstanding the assertion made earlier in the chapter that the university over the period increased its freedom from state doctrinal politics, the rise in the inuence of the law upon the operational management in this eld was considerable. Despite the signicant differences across national boundaries in the legal relationship between the state and the university, institutional managers year by year had to increase their references to legislation before undertaking activity or advising committees. Checks on compliance with legislation (including by the end of the period the regulations and codes of the European Community) not only became the norm prior to activity, but inevitably placed constraints upon decision options. In part, that was no more than the university facing the same situation as all other private and public organizations, as states legislated in elds such as health and safety at work, equal opportunities, privacy and condentiality of information, race relations, accounting standards and so on. In part it derived from state legislation specic to the university with particular reference to their structure of governance. Even in those states which did not pass general framework laws on that subject, there was a growth in the guidance on governance attached to funding allocations, which in practice had much the same effect as legislation. A further aspect of the increasing impact of legislation on university management arose from the growth in the role and scale of contracts. Whereas in 1945 relations with research funding bodies, equipment suppliers or industrial partners would typically have been on the basis of gentlemens agreements (often with individual staff or particular institutes), by the mid-1980s such relations were normally embodied in formal contracts, licensing agreements and so on, which the university negotiated and were signed by management. Further, whereas most activity amongst members of the university remained either on an informal collegial basis, or was governed by internal regulations, there was an increase by internal parties in the resort to law to resolve internal disputes and complaints. In its operational activity 145

Geoffrey Lockwood in support of governance, management had to take into account more frequently and more seriously the possibility of dissatised members of committees challenging processes and decisions in the courts, dissatised staff or students contesting at law the actions of university bodies, and so on. In summary, university management over the period had to devote more of its expertise and resources to being knowledgeable about a wide range of laws and litigation, and to employ that knowledge in its support of institutional governance and in its own activities. In general that trend increased the inuence of management, as the legal ofce of the university, but reduced its standing as part of the community of the university. Internal members resented the increase in bureaucracy and constraint by management, but also wished to distance themselves from management as the focus for complaint by external agencies or for internal litigation. Thus, in coping with externally stimulated change, management increased both its inuence and its isolation. The trends and cycles of political movements within the European university since 1945 are dealt with elsewhere in this volume,22 and the object here is simply to draw out a few illustrative generalizations of their impact upon the role of university management in relation to governance. The rst point to note is that managements role in governance was required over the period to become more explicit and more open; often that process was gradual, but occasionally it was sudden under the impact of revolutionary political movements. There had always been balances in the university between devolution and integration, between leadership and participation, between authority and collegiality, and also in regard to the internal political representation in decision-making of the various classes of members and employees of the university. Those balances were the subject of discussion in the 1940s and 1950s, typically in closed and informal groups, but by the mid-1960s they became the subject of debate, and direct action, in public and formal arenas. Management had to adjust to that in various ways, only two of which are recorded here for illustrative purposes, both of which had continuing relevance at the end of the period. In its internal leadership role, university management had to change its style, and to some extent its philosophy or rationale, in recognition that whereas the basis of its constitutional authority might or might not have changed (depending upon the state in question), its effective authority had become much more reliant upon its ability to both develop methods of inuencing members and staff (to create a broader consensus) and to control or mitigate extremes of political action within the institution. It
22

See chapter 8 (Student Movements and Political Activism).

146

Management and resources was, for example, no longer sufcient for a rector or vice-chancellor to be procient in chairing committee meetings without also being effective in mass meetings or on internal media. In its administrative role, university management had to learn new skills as the secretariat to the institution. Ofcers in the early part of the period serviced stable constitutions, whether stemming from state legislation or instruments of governance specic to the individual institution, but from the middle of the period they were required to become expert in drafting regulations and procedures previously outside their experience. Whether those of parliamentary democracy (broadly 196875 in most Western European universities) or private company statutes (1980s), university secretaries who had previously possessed only lay knowledge of alternative forms of governance had to become expert in them in order to adapt them to the institution. Furthermore, in the 1980s and 1990s, the creation under private law of spin-off companies, technology parks or other university training initiatives, such as continuing education, required the support of staff well versed in commercial activities and with some legal training even in countries where the universities remained state institutions incorporated under public law. A particular impact upon management was the requirement to cope with internal disorder or militancy which arose from the late 1960s. This requirement both changed the image of management and extended its role. Such disorder was not unknown in the medieval European university, but its outbreak in this period was not within the experience of most members of the university. Such action placed activities within the university into the spotlight of the external media and faced management with the task of creating or strengthening the machinery for counteracting disorder. Management established information or public relations ofces and, in some countries, brought their security forces more up to the level of those in place in the external community. These two reactions were not caused uniquely by direct political radicalism, though it was the latter which accelerated their development, and the management roles which they stimulated were key functions in the latter part of the period. The university became much more a part of the external community and reected its standards of behaviour. Thus it became crucial for the university to have public relations and marketing capacities in place23 and to have internal security and disciplinary forces capable of dealing with a normal level of societal crime. University managers who had little or no experience of handling internal disorders in the 1940s and 1950s but who had to develop skills and machinery to cope with revolutionary direct
23

See W. Ruegg, Die Sprengung des Elfenbeinturms, in R. C. Schwinges (ed.), Univer im offentlichen sitat Raum, Veroffentlichungen der Gesellschaft fur und Universitats Wissenschaftsgeschichte, 10 (Basel, 2008), 46985.

147

Geoffrey Lockwood movement in the 1960s and 1970s then became responsible in the 1980s for attempting to control drug abuse, petty theft, sexual harassment, car parking offences and so on. Similarly, university managers in the 1950s might have occasionally had contact with the media, but the attention of the media attracted by the political movements in the university in the 1960s forced managers into external public roles which became the norm in the 1970s and 1980s, partly because of the growing importance of universities to society and partly because of the growth in competition amongst universities. The latter required the individual university to market itself in a wide variety of arenas, not only to counteract media publicity but to promote positively its image in the media. If student militancy provided a challenge to university management, that was more than matched by political movements within the staff of the university. The former was intensive and sporadic whereas the latter was steady and persistent, but more varied in its thrusts. Firstly, there was the same thrust as with the student militants: the demand for full democracy within the university rather than the participative but corporate governance normally provided by the constitution. Secondly, there was pressure for the industrial relations model to be replicated in the university: a partnership of governance between the representatives of authority (the management) and the representatives of the workers (the trade unions). Thirdly, there was the demand from staff, and their representatives, not for participation but for negotiation negotiation on anything that affected staff (which left little out of its scope), in a labour versus management mode.24 Although those three thrusts are contradictory, the reality is that management faced them simultaneously in the individual university for the past quarter of a century. The impact upon the structure of management was mainly by the third of the above thrusts, that of unionization. The university management of the 1950s perhaps had a small staff ofce, in those states where staff were employed by the university, to handle the mechanics of recruitment and contracts. The university management of the 1980s had to put in place ofces and expertise covering not only establishments (the authority for staff positions and the lling of those positions) but personnel (the handling of welfare, grievances, review, appraisal) and labour relations (negotiating with the trade unions, determining the contracts and conditions of employment). In addition to that growth in the institutional-level management capacity for handling staff affairs, the impact upon management was reected in two other main areas. Firstly, in those states where these matters were not already
24

See chapter 5 (Teachers).

148

Management and resources handled largely by the ofces of the state, the universities formed regional or national consortia to handle these and other matters. The creation of consortia by independent universities is a separate theme in the development of university management since the 1960s, and it covers matters as disparate as the organization of university admissions, purchasing, computer networks, management training, graduate employment and so on. A major eld has been that of dealing with the conditions and contracts of staff through regional or national consortia. Secondly, the response to staff pressures has been to increase the tendency towards devolution within the university, to judge that the thrusts for democracy, partnership and negotiation can each be better met or dealt with at the level of the department, institute or faculty, a shift requiring that level to be given the necessary governmental and managerial authority, including control over planning, resource utilization, rewards to staff and so on but usually within the framework of constraints xed by the institution or by the supervisory government, whose inuence was exerted through regular audits that also covered departmental organization. The foregoing has indicated a few illustrative examples of the changes arising from the impact upon the role of management in support of governance. In general, that impact extended the range of modes through which management has functioned. The levels of those modes have been broadly constant over the period. The three basic levels were those of the clerk (the recording of activity), the administrator (the organization of an activity within the decisions of a regularly present authority) and the manager (decision-taking management of an activity within broad policy guidelines). Over the period more activity of management moved from the clerical to the administrative to the managerial, but also the range at each level was extended. Managers functioned as civil servants, but sometimes as politicians, sometimes as bankers but sometimes as investors, sometimes as police but sometimes as counsellors, sometimes as entrepreneurs but sometimes as consumers, sometimes as legislative drafters and sometimes as prosecutors. In essence, the role of management became more complex, and more difcult for the members of the university to understand and relate to as they confronted or heard about it in the expanding and various modes through which it functioned. As duties and qualications changed, so the need for professional support increased, and national and European associations began to develop with the aim of comparing practices and ideas between institutions and systems. In July 1967, the OECD governments inaugurated the Centre for Educational Research and Innovation (CERI) to help ministries compare the educational policies. CERI in turn set up the Institutional Management of Higher Education (IMHE) programme on the basis of 149

Geoffrey Lockwood pilot experiments in higher education begun in 1969. This decentralized IMHE programme involved not only public ofcials, but also the universities themselves, and it was supervised by a directing group consisting of representatives from the participating countries and institutions. Over the years, IMHE became an important sounding board for new ideas in university management, bridging the Atlantic divide. In Europe, more specialized groups were created around specic management tasks: some examples of this are FEDORA, an association of people dealing with student orientation; the EAIA, an association of persons in charge of international relations; and EUCEN, an association for specialists of continuing education and lifelong learning. Many have national chapters or close contacts with other national organizations with similar interests, such as the Conference of University Administrators (CUA). Then there are the thematic associations like the European Centre for the Strategic Management of Universities (ESMU) a network of institutions interested in new forms of planning and a long-term understanding of possible future scenarios. This national and international consolidation of professional interests has both strengthened the managerial and administrative community of universities and promoted implicit competition with the academic leaders of the institutions, many of whom belong to their own international circles: non-governmental examples of these are the International Association of Universities (IAU) set up in 1951, and the Association of European Universities (CRE) founded in 1959, while government-sponsored groupings include the Council of Europes Committee for Higher Education and Research (CHER) set up in 1963 and UNESCO-CEPES, the Centre europ een pour lenseignement sup erieure founded in 1973. Such bodies also deal with questions linked to the management and efciency of higher-education establishments.25

resources The history of the management of resources over the period reects the increasing scale of the university, rising societal expectations of increased productivity, the growth in accountability, and the impact of technology. A key aspect has been the integration of resource management into the broader concept and practice of corporate planning. At the beginning of the period, resource administration was an activity conducted separately from academic administration and tended itself to be divided into the accounting for recurrent or operational funding and the planning of capital nancing (especially building programmes).
25

See chapter 3 (Relations with Authority).

150

Management and resources This clear separation was reected in the roles of ofcers as between the rector (academic) and the Kanzler (resources) in Germany or between the bursar (resources) and the registrar (academic) in the United Kingdom. By around the late 1960s the concepts of corporate planning, developed in other elds of enterprise, began to inuence the university partly because of the increased scale and societal importance of the university and partly because the external practitioners of such concepts became interested in their application to the university. The essence of the concept of corporate planning is the necessity to take into account all key aspects and factors bearing upon the institution in the process of structured discussions and analyses leading to decisions which shape or affect the future of the institution. The following denition of the term was stated in 1985: Planning is the continuous and collective exercise of foresight in the integrated process of taking informed decisions affecting the future.26 Many changes, therefore, occurred in and to the management of resources. Firstly, it became the concern of the many rather than the few. The technical nancial aspects of resource management (e.g., the professional accounting function, the detailed investment policy) tended to remain with the few specialists, but the tasks of maximizing the resources available, the economic decisions exercising choice in the usage of scarce resources across multiple needs, and the analysis of and accountability for that usage of resources against performance became the concern of the many. At the beginning of the period, the dean of a faculty or the head of a department would need to discuss with the rector his wish for a new or replacement appointment or to talk to the nance ofcer about how to pay a bill for a member of staff attending a conference. By the end of the period, such ofcers were the managers of signicant resources who needed to understand the universitys resource situation (sources of income, objects of expenditure, the conditions attaching to the usage of resources, the processes of the internal allocation of monies, etc.) and who was accountable for the resource health of their department or faculty. A signicant proportion of their time would be spent with the professional administrative staff in nance and planning, obtaining information and advice necessary to take decisions on stafng, the purchase of equipment, the allocation of space, the meeting of student number targets, the formulation of research funding applications and, in particular, on the usage and effectiveness of the primary resource (the time of the academic staff).

26

G. Lockwood and J. Davies (eds.), Universities: The Management Challenge (Windsor and Philadelphia, Penn., 1985).

151

Geoffrey Lockwood Such change stemmed partly from the integration of resource planning and budgeting into the open and participative process of corporate planning, and partly from the spread of devolutionary management in the university. The balance between the devolutionary thrust and the integrated framework changed over time even within an individual university. Generally, the result over the period was that the department or faculty (cost centres or budgetary units in the language employed) became much more responsible for maximizing and managing the resources available to it. The second key change in the management of resources was the shift from predictability, if not certainty, to exibility, if not instability. At the institutional level in the early part of the period, the bulk of income was a matter for negotiation with the state, typically annually but with three or four further years allocations at least agreed in principle. Once the allocation was agreed, it was guaranteed, sometimes with an automatic increase to match national ination over the year. By the end of the period, although the annual allocation by the state remained the largest source of income, the allocation might not be guaranteed in advance but was dependent upon performance during the year (e.g., the number of students enrolled). A signicant proportion of income would be dependent upon the university competing in the market, or quasimarket. In an overview of the analysis of university growth effects across Europe in the 1980s, the decline in government funding shown here has induced institutions to nd other sources of income to supplement their budgets.27 Resource managers used to dealing with state bureaucrats for grants (whether of the block nature as in the United Kingdom or the line item allocations as in the Federal Republic of Germany) had to learn new skills as they sought to maintain income from the competitive sources of student fees, research grants, development contracts, commercial trading and donations from charitable bodies or individuals. Corporate planning, including resource forecasting and allocation, thus shifted from rigid blueprints for ve or so years ahead based upon predictable income, inputs and outputs, to establishing broad concepts of mission and objects but seeking to full them through processes and means adaptable and responsive to environmental change and opportunities. That shift at the institutional level had major effects upon resource management. Frequently the initial result was crisis management. These short-term horizons led universities to put considerable effort into crisis management and, more importantly, often led to the abandonment of desirable developments to accommodate some new specic advice
27

L. Goedegebuure, F. Kaiser and F. van Vught, Disaster Warning, Times Higher Education Supplement, 7 October 1994, 13.

152

Management and resources from government.28 However, the changes had more lasting and signicant effects, particularly at the faculty or departmental level. In the 1940s and 1950s approximately 80 per cent of budgets at that level were devoted to academic staff salaries, and the predictability of institutional income, along with other historical factors, meant that most such staff were granted appointments up to the normal age of retirement (tenure). Resource management was therefore about handling the 20 per cent available in support of the permanent academic staff and about how to utilize the occasional opportunity for a new appointment arising from a vacancy or expansion. By the mid-1980s, the loss of predictability, together with factors such as the impact of technology and the emphasis upon learning rather than teaching, meant that not only was less of the departmental or faculty budget consumed by academic staff, but a signicant proportion of that staff were not on lifetime appointments. In a large science faculty it was not untypical by that time for the majority of the scientic staff to be on three- or ve-year postdoctoral contracts. Thus, the head of department or dean of faculty had both the freedom and the responsibility to manage resources in circumstances which required constant adjustment to the employment of capital and labour of various kinds rather than being concerned simply with the annual marginal adjustment capability available to his predecessor. At both the institutional and the unit level, the decline in predictability increased the role of management, its external accountability and its internal exposure to criticism and pressure. Towards the end of the period, those shifts were intensied as both the concern of the states about the effectiveness of their funding and the consumer markets focused attention upon qualitative rather than just quantitative performance. This is evidenced by the growth in the development and usage of performance indicators.29 Further, it became recognized that it was no longer sufcient to justify to the suppliers that their resources had been used legitimately and had funded quantiable inputs into teaching and research. Those funders now needed to be assured about the quality of outputs. Institutional resource management thus became not only more important, but it had also to become more transparent within the university. The area of resource management least affected by internal devolution and perhaps most affected by the increased scale of activity was that of the management of a universitys buildings and estates. In some
28 29

Jarratt Report (note 15), 13. M. Cave, S. Hanney, M. Henkel and M. Kogan, The Use of Performance Indicators in Higher Education, Higher Education Policy Series, 34 (London and Bristol, 1988; 2nd edn 1991).

153

Geoffrey Lockwood countries that management was provided by the state external to the university, but where the latter was responsible for its capital property, the pressures were considerable. In the rst half of the period the pressure was mainly about expanding the estate whilst struggling to keep older buildings usable. In the middle part of the period, Europe witnessed the architectural owering of many new campuses from the technical university in Denmark to the autonomous university in Madrid, from Sussex to Troms, from Trier to Malta. In the latter part of the period, the challenges were more related to economizing on space usage and allocation, using computer models measuring utilization and occupancy levels, timetabling activity maximally and attributing space costs to the operational budgetary centres. A further focus was on meeting the long-term maintenance and repair costs of the buildings erected in the earlier part of the period. The technical services within the estate were the major developmental factor, increasing vastly in scale, complexity and cost. They became vital for activity, but came under counter-attack from the 1980s by the environmental pressure groups, the latter taking estate management into the internal political arena for the rst time since conicts over architectural style and materials in the 1960s as energy costs and concerns clashed with the growing demands for energy for academic activity and social comfort on the campus. Estate management over the period also reected the universitys position in society. Firstly, university managers had to contend with pressures common to any large-scale organization, ranging from increased state legislation in elds such as health and safety, laboratory inspection, or food hygiene to the impact of the growth in the ownership of private motor cars on estate roads and parking provision. Secondly, the period saw a rise in the location within the university estate of interface organizations with society whether science parks, technology teachers, innovation centres or joint university/public sports and leisure facilities. In summary, the stewardship or custodial role of estate management at the beginning of the period had been extended by the end of the period into a technical organization capable of delivering and maintaining a broad range of services essential to the university as an organization and a community. The developments can be illustrated under three headings. Firstly, the management of the estate became more central to the internal nancing of the institution and, therefore, most closely integrated into its corporate planning and general resource management. Typically, the estate and its services consumed 1520 per cent of the universitys annual budget by the 1980s, leaving aside capital development. Secondly, the management became more professional; the generalist, architectural and engineering skills of the 1940s estate management were enhanced by 154

Management and resources the end of the period with safety and radiological protection ofcers, security experts, environmental advisers, computer specialists, transport economists, cost accountants specializing in option appraisal, capital evaluation and so on. Thirdly, the impact of technology was massive and reduced the limitations of the institutional boundary. Technology provided the individual student or researcher with the ability (e.g., through Internet or online public access catalogues) to use information from global sources or to access a CD-ROM with data equivalent to 200,000 pages of typewritten script, or to utilize satellite television. Technology shifted the administration of estate management from manual records, to cardex systems, to rst-generation computer programs on particular activities, to secondgeneration computers with magnetic tape storage for interaction across activities, to computer systems with integrated databases with remote online terminals, and to CAD-CAM for building design. By the end of the century, this usually meant wiring all buildings including the dormitories so that all members of the university students, teachers, researchers and administrators could have access to the Internet and use electronic mail. In management terms, this implied different access codes so that information could be both exchanged and protected. management techniques The rise in the role of management in the European university since 1945, the scale and complexity of the tasks undertaken by management and the closer relationship of the university to other forms of organization were all reected in the techniques employed by management. Up to the 1960s, administration in the university remained almost exclusively an art whose practitioners developed skills in the traditional elds of minute writing, bookkeeping, records maintenance and so on. The professional roles of the accountant, architect, engineer, and so on, were either conned to a few specialists or were conducted for the university by external agencies, with the role and techniques of the lawyer dominating the internal administration of the university in most countries. Yet for the previous twenty years, members of the universities had been closely involved in the development of a whole range of planning and management techniques being employed by the state or by private enterprise. The systems approach to management and the tools and techniques it spawned (e.g., operational research and computer modelling) were created largely by university academic staff, though often working outside the university, especially during the Second World War when many of the tools were created for military application. However, until 155

Geoffrey Lockwood the 1960s neither those academic staff members nor the institutional leaders and administrators saw the need to apply the techniques to university management. The expansion in student numbers, the increasing scale of research and the greater public focus upon the university in the 1960s changed that situation. Management remained an art, heavily reliant upon human judgment, but it became increasingly necessary to ensure that judgment was based on adequate information and was exercised by individuals and groups aware of the environment in which the university functioned and of the choices or alternatives available to it. The university turned to management science to provide that systematic information and the training of decision-makers, a process which both reected and strengthened inter-university cooperation in management. The rst major international conference on planning and management techniques was convened by the OECD in April 1969, when practitioners from twelve European countries exchanged experiences and ideas with colleagues from North America.30 Although no European university implemented the full PPBS (Planning, Programming and Budgeting Systems) developed by the US government and applied in many North American universities in the second half of the 1960s, many European universities introduced planning systems based upon similar principles: the formulation of an institutional mission, the setting of objectives under that mission, the creation of strategic and operational plans to achieve those objectives, following the explicit analysis of alternatives, assigning activities to programmes, reformatting the annual budget to match those programmes and building in a process of evaluation and feedback in order to adjust the forward plans in the light of performance. They also adopted similar techniques: for example, computer models of university resource allocation and usage, student enrolment forecasting techniques, cost-simulation exercises, stafng projection models and capital utilization studies. It is not necessary to detail the full range of techniques which impacted upon the management of the university in the 1960s and 1970s. An illustrative summary can be found in the authors article published in 1978.31 In the area of institutional structuring, organization and methods, techniques were used to examine the purpose and efciency of each unit within an institution in the context of overall institutional objectives techniques covering such topics as the division of work, the delegation of authority, the line of authority, spans of control, coordinative functions, the balance of centralization and decentralization, and so on. Work study
30 31

G. Lockwood, University Planning and Management Techniques (Paris, 1972). G. Lockwood, Planning, International Journal of Institutional Management in Higher Education, 2:2 (1978), 1356.

156

Management and resources was employed as a range of subsidiary techniques in this eld: for example, work measurement, activity sampling, time and motion studies and ergonomics. Manpower planning, job evaluation, productivity bargaining, management by objective, and management by exception provided another range of techniques made available to the university in planning the use of its main resource, that is, labour; management by objectives, for example, maximized institutional effectiveness by the setting of specic targets for individuals and groups. Quality control, management ratios, cybernetics, forecasting studies, market research, feedback surveys, communications techniques also became valuable aids to university management. Communications techniques, for example, were increasingly utilized in the university context where internal democracy had to be combined with business efciency. The techniques range from simple aids concerned with the selection of items to be communicated, to the complex mathematical information theories. In the area of nance, the techniques developed included marginal costing, discounted cash ow, net present value, budgetary control devices, variable budgeting, costbenet analysis, inputoutput budgeting, programme budgeting, value analysis, cost-control scheduling and management accountancy. Costbenet analysis, for example, involved a systematic comparison between the costs of an activity and the value or benet of the activity, the costs and benets as far as possible being quantied and extended beyond the direct and nancial ones to the indirect and social ones. Problems of physical and capital development and use over the period were assisted through the use of network or critical path analysis, cybernetics, trafc ow techniques, and so on. Network analysis, for example, enables a complex project to be planned through the logical analysis of its component parts or steps and through their recording on a network diagram, which is then used to order and control the steps in the carrying of the project to completion. In the elds of teaching, learning and research, the techniques available assisted in the designing of a curriculum, in reviewing the effectiveness and relevance of curricula, in checking assessment methods, in determining the mix of teaching inputs, in establishing and controlling research projects, and so on. Computerization of timetabling provides one example. Other techniques ranged from the simple ones concerned with the design of forms, the arrangement of statistics, and so forth, to intricate ones such as the use of game theory decision logic tables, policy analysis and techniques for diagnosing organizational ills. Together they changed the style and language of university management and, more signicantly, extended its role and inuence. Although the planning models and techniques made choice more open and decision-making more participative, 157

Geoffrey Lockwood their integrated and comprehensive nature pushed management control out from its traditional bases (resource allocation, legal/constitutional authority) into all areas of activity, including the usage of academic staff time, the development of curricula and the selection of research priorities. The quantitative analysis plus many of the qualitative assumptions necessary for the planning and the operation of the techniques were provided in the main by managers. A subsidiary effect of that impact of management science upon the university was the attraction into university management of members of the academic staff experienced in the models and the techniques, either through their disciplines or their work with external organizations. In that period, professors of operational research, economics, computing, production engineering and so on were drawn into pro-vicechancellor, vice-rector or directors of planning roles. Whilst no particular set of techniques became central to the management of the European university, as opposed to the management of particular universities at specic times, the general systems approach had broad impact and reected the growing professionalization of university managers, including the exchange of information and the transfer of experience amongst them not only nationally, but across Europe (through bodies such as the OECD, UNESCO and the European Commission). They also led to the increased interest of external parties (whether governments or management consultants) in the process of university management, which indicated that the ivory tower had been breached by the forces of change referred to earlier in the chapter. The systems and techniques employed in the 1980s differed markedly from those outlined above, but did not change the breadth and depth of that initial impact of management science upon the university. The rst generation of techniques were too mechanistic, assumed predictability in the directions of change rather than the certainty of change, and underestimated the centrifugal forces within the university. The succeeding generation of systems and techniques retained the principal elements of corporate planning (with even greater emphasis upon mission, objectives and resource planning) but focused more upon creating the capacity to adapt to unpredictable change, upon enhancing and monitoring the quality of performance, and upon positioning the university favourably with external agencies and markets. Thus the institutions capacity to change became the main focus of the assessment programmes developed by the universities themselves in an effort to strengthen their autonomy: such was the case of the evaluation programme that the Association of European Universities (CRE) offered its member universities from the early 1990s, or the EQUIS programme specically tailored to the assessment needs of business 158

Management and resources schools by the European Foundation for Management Development (EFMD). The language relating to systems and techniques shifted to terms such as Total Quality Management (TQM), performance indicators, human resource management, option appraisal, value for money, market analysis, consumer evaluation and process re-engineering. In essence, the rst generation of techniques introduced science, or the systems approach, into university management but were largely concerned with internalities (obtaining change and efciency within the university in a presumed stable or predictable external environment), whereas the second generation reected the responsibilities of management to interact with and persuade the external environment (whether the state or individual customers) of the values, performance and potential of the institution. The second-generation techniques, therefore, tended to concentrate upon internal quality management and techniques for meeting evaluation standards acceptable to the external environment. For example, in regard to quality, commercial competition and its partner, value for money, involve a combination of quality and price. Market pressures for quality enhancement and price reduction, and a perceived need for collective action to prevent exaggerated claims about quality misleading consumers, and damaging public perceptions of the sector as a whole, provided the context for the rigid growth of interest in the possible application of TQM in the management of Universities.32 Further, in regard to evaluation, the authorities, in an attempt to achieve transparency in resource allocation, rely to a considerable extent on evaluations conducted by experts or by the institutions themselves.33 Quality assessment procedures for the university management began in the United Kingdom in 1991 under university sponsorship. In France, the Comit e national d evaluation, set up in 1984, reported directly to the President of the Republic on the state of higher education around the country. In the Netherlands, the Association of Dutch Universities (VSNU) developed its own quality assessment services, especially for teaching. Thanks to the support of the European Union in the 1990s, these three models in their various forms were later emulated by most countries in Europe, including those of the former Soviet bloc. the arrival of management Few general conclusions have validity for the hundreds of European universities over a period of half a century. Experience somewhere at some
32 33

Williams, Quality Management (note 6), 22937. P. Tabatoni, Evaluation and the Decision-Making Process in Higher Education: French, German and Spanish Experiences (Paris, 1994), 197.

159

Geoffrey Lockwood time would confound such conclusions. However, the period since 1945 witnessed the arrival of management in the university. A key change was the realization by a few members of the university, and then the acceptance by the many (no matter how reluctantly), that in order to full the academic objectives of their institution in the political, social and economic environment pertaining, there was a need for management rather than just internally focused administration. Much of the managerial experience of the European university since 1945 has not been covered in this chapter, such as the experience of merging institutions under the pressures of the economies of scale, or the major differences in adapting a medieval university to societal trends, from the challenges of upgrading a collection of colleges of higher education into a university. No summary can encapsulate the managerial situation of the University of Manchester in 1945, the University of Paris in 1968, the University of Rome in 1985, but the chapter has evidenced trends in the experience of the development of management in the European university since 1945. The experience summarized in this chapter illustrates, however, the adaptability of the European university. The development of management was crucial to the ways and means through which European universities adjusted to major changes in their political and economic relations with the state and society, and to the equally major shifts in the structure of knowledge, the development of technology and the massive increase in the demand for university education. European universities adopted and adapted management concepts, developed in the private sector, in order to maximize their permanency, autonomy and efciency. The fact that at the end of the period universities were thriving, and the extent and appreciation of university education was unprecedented, is a testimony to the success with which their management developed to respond to external change.

select bibliography
Agoston, G. et al. Case Studies on the Development of Higher Education in Some East European Countries, Paris, 1974. Becher, T. and Kogan, M. Structure and Process in Higher Education, London and New York, 1990, 2nd edn. Cerych, L. and Sabatier, P. Great Expectations and Mixed Performance: The Implementation of Higher Education Reforms in Europe, Stoke-on-Trent, 1992. Cornford, F. M. Miscroscosmographica academica, London, 1949. Dreze, J. and Debelle, J. Conceptions de luniversit e, Paris, 1968.

160

Management and resources

European Commission. Memorandum on Higher Education in the European Communities, Com(91) 349 Final 1991. Fielden, J. and Lockwood, G. Power and Authority in British Universities, London, 1973. Gellert, C. (ed.) Higher Education in Europe, London, 1994. Halsey, A. H. and Trow, M. A. The British Academics, London, 1971. Lockwood, G. and Davies, J. Universities: The Management Challenge, Windsor and Philadelphia, Penn., 1985. Ortega y Gasset, J. Mission of the University, London, 1946. Rice, A. K. The Modern University: A Model Organisation, London, 1970.

161

CHAPTER 5

TEACHERS

THOMAS FINKENSTAEDT

introduction The extraordinary development from an elitist university system to an open system of higher education since the Second World War has brought about quantitative and qualitative changes for teachers in European universities that nobody could foresee in 1945 and that, in 1945, nobody would have believed were possible or even sensible. It has been a development from a more or less steady state, consisting of mostly professorial staff structures, towards systems with many more and new types of teachers and support staff. The changes that have occurred over the last two generations are, to some extent, due to the intrinsic developments that have occurred in the sciences and the humanities. They also stem from external factors, such as funding and social forces. Some trends seem to be universal, while others are a result of the European post-war situation. It is the university teachers, both as individuals and as a profession, who must resolve the tension between the intrinsic demands of their subjects and the demands of society, for governments can only regulate to a limited extent. The years following 1945 signied a break with tradition in Eastern Europe. In the West the post-war period until about 1960 was a time of reconstruction, of back to normal policies in most countries; but the origins of many later developments and difculties lie in the period before the Second World War and in the war period itself. Apart from the effects of the expulsion of Jewish university teachers and post-war purges, the age structure of the teaching staff was distorted through losses of junior staff and students during the war. The bulge of the post-war baby boom reached the universities at a time when it was difcult to nd enough new staff. Whether the new demand for higher education could have been predicted earlier is difcult to say. By and large, university teachers of the 162

Teachers post-war period were unwilling to consider a notable increase in student numbers as advisable or necessary (more means worse, was the English phrase). More important, though perhaps less noticeable at rst, was the expansion of science as a system and the growing importance of science for society and in society; the university ivory tower had to be provided with many new doors to allow the public easier access to its facilities, and the university teacher improved access to the public, with this public growing to international dimensions very rapidly. In the post-war period a number of more general social changes and attainments were beginning to affect the universities and their teachers: for example, the question of job security (tenure), unionization and the changing role of women in society and within the university. Another, but no less important, aspect was the changing climate of opinion in which the academic was expected to work. This changed from an optimistic view of science and learning, with the professor as the symbol of progress and expertise, to a sceptical and sometimes anti-science attitude. In most countries the prestige of the university teacher has declined steadily. There is also growing demand for public accountability of the university and for control of its teachers. This chapter deals primarily with full-time teaching staff. Since the available data cannot, as a rule, be transformed into comparative tables, quantitative statements are usually given as rough percentages only. In the absence of detailed research into many aspects of the post-war teaching profession in the majority of European countries, the chapter can only try to describe and analyse the main trends. It starts with quantitative developments and their impact on staff; this is followed by a discussion of different staff structures and their changes. The third section deals with the duties and working conditions of the academic as university teacher, and the nal section looks at the European university teacher in society. Basic information on staff structures and numbers in all European countries can be found in the Encyclopedia of Higher Education.1 More often than not the examples are drawn from the British, French and German university systems because of the availability of data. The enormous changes in the countries of the former Eastern bloc countries throughout the last decade cannot yet be presented adequately. new quantities new qualities Expansion The expansion of the university system and its teaching staff that began around 1960 varies considerably from country to country and between
1

Clark and Neave, Encyclopedia I.

163

Thomas Finkenstaedt the various subjects. For the period from 1960 to the end of the 1970s we nd a growth rate in teaching staff numbers ranging from 175% in the Netherlands to 600% in Italy and 700% in Portugal. Even the conservative university system of Finland shows a trebling and Norway a fourfold increase in staff.2 Staff expansion of more than 200% is found in the countries of the former Eastern bloc as well as in the major Central European countries: Poland, for instance, experienced an increase of more than 300% from 1960 to 1985. The former Czechoslovakia shows less than a doubling of staff, while in Romania total staff numbers actually decreased after 1980, resulting in an overall growth from 1960 to 1980 of 146%, but this almost doubled from 11,696 in 1989 to 20,810 in 1992.3 A fairly moderate expansion in Britain was due to the planning ideas behind the Robbins Report of 1963,4 and the modest expansion in the Netherlands is a reection of the small increase in student numbers and a parsimonious ministry of education. The German and French developments reect the aftermath of the events of 1968.5 The expansion of individual disciplines deserves to be studied too. Very little hard evidence is available. There is a more or less complete set of data for English studies in Germany from 1825 to 1990: teaching staff numbered about 65 from 1900 to 1950, rose to approximately 300 in 1966, reached 600 in 1970 and almost 1,200 in 1982.6 The overall picture is quite clear. In the countries of the former Eastern bloc, staff development was part of a planned economy, and that usually meant limited numbers of staff and students in all elds of study, while in the West staff increases were independent of political systems and the size of the countries concerned, and they were also independent of the particular structure of the respective university systems in 1960. The growth can be explained, by and large, not as a planned expansion of staff against a background of the idea of manpower planning, but rather as the consequence of developments in the sciences (e.g. specialization); but
2

G. Neave and G. Rhoades, The Academic Estate in Western Europe, in B. R. Clark (ed.), The Academic Profession (Berkeley, 1987), 230; Clark and Neave, Encyclopedia I. J. Sadlak, Planning of Higher Education in Countries with a Centrally Planned Socioeconomic System: Case Study of Poland and Romania (PhD thesis, State University of New York at Buffalo, 1988), 341, 350; J. Sadlak, Legacy and Change Higher Education and Restoration of Academic Work in Romania, Technology in Society, 15 (1993), 86. A. H. Halsey and M. A. Trow, The British Academics (London, 1971), ch. 7; M. Moss, The Staff of Scottish Universities in the Post-1945 Period, in The History of the University in Europe after World War II. International Conference,University of Ghent, 2830 September 1992, mimeo. F. Mayeur, Les carri` eres de lenseignement sup erieur en France depuis 1968 and W. Weber, Multiplizierung, Differenzierung, Diversizierung: Die personelle Transformation der deutschen Universitat seit 1945, in Conference Ghent (note 4). A. Mayer and T. Finkenstaedt, Anglistenregister 18251900 (Augsburg, 1992); T. Finkenstaedt, Kleine Geschichte der Anglistik in Deutschland (Darmstadt, 1983).

164

Teachers it was also a reaction to the vast and fast-growing student body, whose members in many countries were free to choose their subjects of study, so that an unpredictable situation arose for teaching-staff growth across the whole spectrum of subjects. Such a situation could be and indeed was exploited by a number of professors for empire building purposes in their own eld. To some extent, staff growth was also due to the upgrading of institutions of higher education, which thus gained university status: the English CATs (colleges of advanced technology) and, in 1992, the poly technics, or the German padagogische Hochschulen are examples of this upgrading. The argument that such changes are only a shifting of numbers within statistical brackets and not an actual increase in personnel misses the point. The upgrading does indeed change the overall staff picture because the size of the whole system necessarily inuences its internal structure and quality. It should also be mentioned that such qualitative, and sometimes profoundly anti-elitist, changes were not always unintended. Another quantitative change inuencing the characteristic quality of the system, if not necessarily its standards, is the size of the individual institution. Ten new universities with 3,000 students each (the Robbins idea) provide the same number of posts for staff as three with 10,000 each (the German proposals of 1960), but working conditions for staff, the communications situation among staff, and the staffstudent relationship as distinct from the staffstudent ratio are completely different. Did more mean worse? It did not as far as the growth of student numbers was concerned.7 The increase in teaching staff presents a more complicated picture. If there have been problems, it is not because not enough intelligent people were available to take up a university career, but rather because they were not available at short notice and in the disciplines requiring them. Manpower planning for university staff is difcult if not impossible even in a steady-state system. The sudden demand of large numbers could not be met satisfactorily in more than one country and in more than a few subjects; barrel-scraping, as the English called it, was resorted to, and as a result junior staff found themselves rapidly promoted to senior posts. Age structure It is not feasible to devise a model age structure for university teaching staff so that prospective staff can be encouraged and trained according to a plan. Attempts at such planning in the socialist countries failed, if only
7

See chapter 6 (Admission).

165

Thomas Finkenstaedt because they eliminated the essential element of competition once a junior post was obtained. Too many variables come into play, not least those specic to particular disciplines: mathematicians and musicians may be ready for a professorship much earlier than junior staff in an experimental science or in history. On the whole, the age structure should give junior people a reasonable chance, but not a guarantee, of obtaining a senior post. It is good to have a mix of younger and older teachers; it is good for the students taught and for the administrative duties that require experience, but also for the general communication within a discipline and a university. It is not by chance, nor just as a means of establishing and securing some kind of hierarchical order, that seniority plays such an important role in many universities. Experience is of great importance in university life, administration and teaching because of the informal nature of so many of the activities. The expansion of the 1960s brought increased opportunities to a specic age group and decreased those of the succeeding, lost generation. A few gures clearly illustrate what happened: in France 9,800 assistants were recruited between 1967 and 1971, which is about one-third of the work force in this group. In such a situation, in a system that is no longer expanding, new staff can only be hired if there is rapid selection among the newly appointed staff of those who have the ability to reach the higher echelons, and even if there are many able young scholars, it is wise to make a selection in order to facilitate new entries. What happened was the opposite. Tenure was granted freely, and the time for further qualication lengthened. Thus in the late 1980s in the French universities the average age in the junior post of assistant was quite advanced, and thirty-six to forty-one years old was quite normal for an assistant in a humanities faculty; in the sciences 45 per cent had already served for eleven years or more in the rst position on the career ladder.8 A similar picture emerges for Italy. Staff growth meant expansion in junior staff from 1950 to 1960: assistenti (assistants) grew from 10,000 to almost 20,000, and incaricati (associate) professors from 2,500 to more than 4,000. The number of full professors increased only after 1970, and many of the assistenti and former lecturers moved up into the group of associate professors. The 1986 statistics show 11,000 full professors, 22,000 associati and about 20,000 assistants or ricercatori. More than two-thirds of all professorships were set up after 1970, and the chances of obtaining one of these were limited.9
8

E. Friedberg and C. Musselin, The Academic Profession in France, in Clark, Academic Profession (note 2), 109, 112. Clark and Neave, Encyclopedia I, 364; B. R. Clark, Academic Power in Italy: Bureaucracy and Oligarchy in a National University System (Chicago and London, 1977), 119;

166

Teachers Yet the staff expansion of the 1960s generally favoured the more junior ranks. The situation of junior staff in Germany was studied in 1977 and it was found that, in the sixties, of a hundred Assistenten, seventy had a chance of obtaining a senior post. By 1975 the odds were reduced to nine out of a hundred.10 They have risen since to slightly more than 20 per cent. As the former very strict rules relating to the period allowing for an Assistent to qualify as a university teacher through the doctorate and Habilitation were not enforced in the 1970s, the age at Habilitation increased steadily. Married life very rare for an Assistent before his Habilitation in the pre-war days also took its toll and contributed to a further slowing down of a career in its early stages. The increase in average age means that in many countries an unprecedented proportion of professors will retire in the rst decade of the twenty-rst century and will thus have to be replaced from a non-existent pool of junior staff.11 In 1961 in the United Kingdom more than half of the professors and a third of the readers and senior lecturers were over fty years old; for 1969 the respective percentages were 44% and 26% only.12 A similar picture emerges for other countries, with too many young professors being appointed in the sixties. In the eighties the UK introduced a programme of early retirement and created a number of new-blood posts to redress the worst effects of the imbalance. In Germany the Fiebiger posts (named after a university president who proposed this programme) and the Heisenberg chairs tried to offer any highly gifted Privatdozent with a junior post a professorship outside the ordinary staff quota. Yet posts of this kind were too few; early retirement is a much more efcient but expensive programme, and nancial difculties will probably make such programmes no longer feasible. Specialization One of the most striking developments in the post-war university has been the growing specialization of the teaching staff. The extraordinary progress of science in the post-war period was made possible through a specialized approach to new problems. As the qualication for a university post is mainly, if not exclusively, gained through success in research,
U. Karpen and P. Hanske, Besoldung von Hochschullehrern im internationalen Vergleich (Baden-Baden, 1994), 93ff. G. Elstermann, Die Altersstruktur der Forscher (Bonn, 1977). C. Weick and P. Meusburger, Die Altersstruktur der Professoren an den badenwurttembergischen Universitaten, Mitteilungen des Hochschulverbandes, 41 (1993), 1426. G. Williams, T. Blackstone and D. Metcalf, The Academic Labour Market (Amsterdam, 1974), 24.

10 11

12

167

Thomas Finkenstaedt specialization is one of the answers to the problems created by the rapid expansion of the body of knowledge and the internationalization of science. The growth of higher education is another cause. Specialization has thus become a must, at least in the natural sciences. The differentiation and fragmentation of the old disciplinary structure can be followed closely through a study of post-war lecture catalogues and their lists of university teachers with the denomination of their posts. We nd again the sixties seem to be the beginning of a new age the gradual dissolution of the old idea of one professor one discipline or subject. The idea of an Ordinarius publicus, a professor in ordinary (whether the name was used or not), was fundamental throughout the history of the European university. It was based on the belief that a nite number of elds of knowledge constitute the totality of human knowledge,13 and that this knowledge, these elds or subjects, should be taught by qualied and salaried people. They were required to teach the whole subject, and they were also expected to present it to the general public. In the Germany of the 1920s the Ordinarius had to give an overview of his subject in a three-year cycle (Triennium), and even the post-war letters of appointment for a full professor in Germany stated that he was expected to represent his discipline in research and teaching (note the order of words, dear to almost every German professor). Theoretically this meant that there could be only one professor for each subject, and a good university would have all the necessary professorships to elucidate the world for the prospective scholar as well as the general public. The idea in its pure form had to be given up for several reasons. The rst can be traced back to the early history of the university: it is the rise of a class of unsalaried teachers with reduced rights and responsibilities. One way for them to attain recognition at least that of the students was to specialize in elds the professor himself would not treat in his lectures. A second reason for the splitting up of the old unity of professor and subject may be found in growing student numbers and, perhaps, in the American credit system, which does not require a unied course structure. This allows specialization in teaching as well as in research. No single professor could honestly say nowadays that he can master the whole of his subject area, such as English, for example. So there is a rst split into linguistic and literary studies, and then into modern and historical linguistics, and so on; in the end a large department can present our Milton man and our Joyce man. The fragmentation of a subject can of course also be used to increase the number of posts in the name of learning, and
13

The interesting question as to which elds of study and scholarship were not included, and why, is dealt with in vol. I, 415.

168

Teachers there have been cases of second-rate university teachers creating a niche for themselves. The German idea of coping with greater student numbers, by creating parallel chairs for professors willing and able to teach the whole course, has not been successful except in a few isolated cases. Genuine parallels intersect only at innity, but parallel professors will cut each other here and now: specialization is a way of avoiding trouble.14 The following gures illustrate the movement towards new and smaller disciplines: in the UK there were 123 different (statistical) subjects in 1928; by 1953 the number had risen to 382; a German catalogue of university subjects published in 1973 lists about 4,000 disciplines and subdisciplines.15 Conclusion It is too early to pass a fair judgment on the quantitative and qualitative changes in the recent history of higher education. What is so important for the university teacher is that it has brought an old problem to the fore: the relationship of (specialized) research to (generalist) teaching. It should not be forgotten in this context that, just as research is linked to publication, so teaching is connected with examining, and as examinations play such an important role in a meritocratic society, they not only mean work for the examiner, but they also endow him with power. It can be tempting to exercise such power by making a specialized eld or a discipline an obligatory part of an examination. Specialization must also be seen in connection with the internationalization of science. The partner in a scientic dialogue is as often as not no longer a colleague in ones own university, but rather a specialist somewhere else, and this has led to new forms of communication and a partial loosening of local attachment. This development is mirrored by the growing importance of professional organizations for academic subjects and of the leading international journals in many elds: they are the playgrounds in which reputations can be gained. In spite of the compartmentalization of many subjects, and in spite of the counter-movement towards the interdisciplinary organization of learning and research (which nevertheless presupposes the disciplines), the ordering of disciplines by subject matter will live on, and the idea of
14

15

T. Becher, Academic Tribes and Territories: Intellectual Inquiry and the Cultures of Disciplines (Milton Keynes, 1990). For the development of chairs for individual subjects, see the disciplines discussed in vols. III and IV in the section on Learning. When the University of Berlin was founded, Schleiermacher postulated competition among the chairs of theology. See vol. III, 407 (chapter 10). Hochschulverband (ed.), Facherkatalog (Gottingen, 1973; 2nd edn, 1977) (with an intro duction on the history of the idea of a subject and its relation to the organized world of learning in universities).

169

Thomas Finkenstaedt a natural link between a professor and his subject will not die. A good example is provided by Austria, where the chair principle was abolished, but where, in 1987, 500 out of 800 institutes which had been founded in order to have larger and more sensible (or just more democratic?) units were still one-professor shows. Specialization and growth have also led to the idea of research and teaching universities. Would such a development mean the splitting up of a unied university staff into different groups? It is too early to say which way we are heading. As a scholar and scientist can only rise in the professoriate by being successful in research, it would be difcult to invent a new type of university teacher without direct contact with research.

staff structure Teaching staff The best man or woman available for the post must be the guiding principle, and it is probably true to say that universities by and large operate according to this principle. For a number of reasons it is not easy to nd out who the best person is or in the case of young candidates will be for the whole period of service. A hire-and-re type of a pure labour market will not do for the university, and even where dismissal for good cause is possible, such dismissal is not easy, and rightly so. There must be safeguards against wrong decisions for both the university teacher and his or her employer. The university teacher must be secure from interference by politics, parties, church and state; the whole idea of a university is connected with this idea of freedom from interference and independence and the tenure of at least the ordinarii and their medieval predecessors, the magistri and doctores.16 Studies in the professoriate in many different countries have shown how highly intellectual freedom, freedom of inquiry or simply freedom is valued.17 On the other hand the employer and the students must also have some sort of guarantee that the person selected has the ability to do what is expected of them. After all, lling a professorship is a considerable investment in terms of money too. One of the safeguards is judgment by ones peers before a candidate is chosen, a second is the formalized process of qualication for prospective
16 17

See vol. I, especially p. 38 (chapter 2: Patterns) and pp. 1615 (chapter 5: Teachers). U. Teichler, The Conditions of the Academic Profession, in A. M. Maasen and F. A. van Vught (eds.), Inside Academia (Utrecht, 1996), table 2.12; Z. C. Zubiete Irun and T. Susinos Rada, Causas de satisfaccion e insatisfaccion del profesorada universitario. La Universidad de Cantabria, in J.-L. Guerena, E.-M. Fell and J.-R. Aymes a ` nos jours, vol. I: (eds.), Luniversit e en Espagne et en Amerique-Latine du Moyen Age Structures et acteurs (Tours, 1991), 470f., 475f.

170

Teachers candidates, again including judgment by senior members of the invisible college of the scientic community in a particular subject. Yet the need to secure the services of a great number of staff many of whom could easily nd a job outside the university has increasingly led to the introduction of elements of a career structure in the strict sense of the word.18 As a result a number of mixed types of staff structure have developed. Characteristic elements of each type are among others the background of the national civil service, formalized qualication and selection procedures, duration of contract (part-time, short-term, tenured), mobility, salary and status.19 The American model is nearest to a genuine career path, and the majority of staff can reach the top of the ladder, the post of full professor, in one place or another. But such a career structure only works in a system of universities of varying academic rank, with competition between these universities and a exible salary structure. The other extreme is the old German system with only the real professor (planmaiger Professor) getting a salary, and a pool of unsalaried Privatdozenten competing for free posts.20 In modern staff structures there is always a mixture of the elements of job evaluation, competition, qualications, labour market21 and peer-judgment, with political and government pressures reduced as far as possible. European countries show much more state inuence and therefore a more homogeneous staff structure in each country and less competition between the universities than the United States. A survey of staff structures in Western Europe published in 1966 still shows the traditional types: the predominance of full professors, especially in the German-speaking and Scandinavian countries; the British lecturer (three levels), reader, professor ranking; and a strict civil-service career structure in France.22 In the countries of the former Eastern bloc the traditional staff structure of pre-war Europe (e.g., the Habilitation in Poland or Hungary, or a structure more akin to the French system in Romania) soon came under the inuence of the Stalinist Soviet model.23 The following characteristics of the changes in staff structure from about 1960 onwards are typical for most European countries: (a) the growing importance of second degrees, (b) the move towards tenure at
18 19 20

21 22

23

For the French approach, see vol. III, 139f. (chapter 5: Teachers). Karpen and Hanske, Besoldung (note 9), 11f. C. von Ferber, Die Entwicklung des Lehrkorpers der deutschen Universitaten und Hochschulen 18641954 (Gottingen, 1956); A. Busch, Die Geschichte des Privat dozenten (Stuttgart, 1959). For further literature, see vol. III, notes 3141 (chapter 5: Teachers). Williams, Academic Labour Market (note 12). H. Sindal, Structure of University Staff: Schemes of Academic Hierarchy and Dictionary of Terms (Strasbourg, 1966), with a detailed description for each country. Sadlak, Planning (note 3), 21018. Cf. chapter 3.

171

Thomas Finkenstaedt an earlier stage of the career than a professorship, (c) the decline in the percentage and inuence of (full) professors, combined with (d) new types or grades of staff. The resulting staff structures usually show a division into junior and senior staff, even in countries where tenure is obtained early on in the career; (e) the period is also characterized by the growing number of people outside the teaching staff body, namely those with research contracts and the support, technical and administrative non-teaching staff. On the whole the development of staff structures in European universities has been towards a genuine career and towards earlier tenure, but all systems seem to keep the division between junior and senior staff, between the professoriate in the narrow sense of the word and the non-professorial teaching staff. The rst appointment and the rite of passage into the higher ranks deserve special consideration. For both we nd as in all other areas of university life more regulations at the end of our period than in 1945. Junior posts are still often lled at the suggestion of the academic teacher, and such patronage is not the worst of selection processes for prospective university teachers. It is, perhaps, most evident in Italy, with the inuential baroni and padroni among the full professors. The inuence of patrons and grands patrons in France is also well attested,24 but we still know too little about the machinery behind the formation of schools, how the Lehrer-Schuler-Verh altnis or a degree from a particular institute or college can lead to a university post.25 The inuence of important and powerful professors has been frequently decried as arbitrary, especially in the post-1968 period. It is probable, however, that this type of individual recommendation is a better way of nding a suitable young academic than more formalized procedures. The rst post on the career ladder is probably always lled on the basis of a short-term contract (usually three to six years), sometimes linked to the requirement that the next higher degree must be obtained within this period.26 Some countries have a specic group for the beginners (the German Assistent, the junior teaching assistant in Poland, and the probationary teacher in the former Soviet Union),27 or there exists as in the UK a denite probationary period of three years at the beginning of service as a lecturer. It was introduced in 1971 with possible extension
24

25

26 27

Clark, Academic Power (note 9), ch. 3; P. P. Giglioli, Baroni e burocrati: Il ceto accademico italiano (Bologna, 1979). Karpen and Hanske, Besoldung (note 9), 93; P. Bourdieu, Homo academicus (Paris, 1984), 122, 125. W. Weber, Priester der Klio: Historisch-sozialwissenschaftliche Studien zur Herkunft und Karriere deutscher Historiker und zur Geschichte der Geschichtswissenschaft 1800 1970, 2nd edn (Frankfurt, 1987). Sindal, Structure (note 22), passim. Clark and Neave, Encyclopedia I, 570ff., 643ff.

172

Teachers to four years in doubtful cases,28 but this was felt to be too short a period in which to decide an academics tness to hold a job for life.29 There is a dilemma here: prospective university teachers must concentrate on research because it is on the basis of their research that they will be promoted. The research is, by necessity, highly specialized. In many cases there is a danger that specialization becomes too great and the researcher too old to nd a post outside the university. This is another aspect of the dangers of a distorted age structure and shows how important it is for universities and for prospective university teachers to secure their rst post when very young. Filling senior posts has always meant some comparative evaluation of staff. On the whole, past performance counts far more than promise. Past performance is measured as scholarly and scientic work (e.g., publications or supervising doctorates) in relationship to the age of the candidates. Other factors that have come into play in recent years are an individuals teaching record, the ability to attract research funds, membership in research teams or successful Big Science projects, the capacity to work with industrial partners, and administrative experience. The mix of abilities expected will also depend to some extent on the subject and the labour market outside the university in a particular eld. Senior posts are usually awarded either by competition (concours) or on the basis of a committees recommendation. Professorships are decided upon by the Senate or another body beyond the faculty concerned, as is the case in France, Italy and Spain. For many reasons, the advertising of posts plays an increasing role in the recruitment process. The number of applications for a particular post can provide interesting information about the market in the subject concerned as well as the reputation of the university or department advertising the post. Even if there is now an overall tendency to try and nd the best candidate for a senior post among the junior faculty available at home (quite apart from union pressure), there remains the feeling and probably the evidence that it is a good thing to have mobility and to recruit experienced staff from outside.30 At least for professorships, self-recruitment, the Hausberufung (i.e., appointment from within the university), is still not normal (the personal chair is one way out of the problem). For a well-established full professor it can be a tricky business to apply elsewhere, because it could be interpreted as a sign of dissatisfaction with the current place of work. In several countries it is,
28

29

30

D. C. B. Teather, Staff Development in Higher Education: An International Review and Bibliography (London and New York, 1979), 44. H. J. Perkin, The Academic Profession in the United Kingdom, in Clark, Academic Profession (note 2), 37. Karpen and Hanske, Besoldung (note 9) has a section on mobility for each country.

173

Thomas Finkenstaedt therefore, possible to invite a particular professor to apply or to call them without application. Of course, such a system can be and indeed has been abused, but nothing better has yet been discovered.31 There are considerable differences in the degree of autonomy a university has in selecting or proposing candidates. The UK has the highest degree of autonomy, in France the university plays a minor role only, while in Germany the minister of education of the Land concerned can refuse to appoint, but it is difcult for him to propose a candidate. In Switzerland the canton plays a similar role. In Italy a national concorso is held and the faculties can choose from among the successful candidates. By and large, direct political or party political inuence on the lling of academic posts has played a relatively small part. Even in the post-1968 period it was usually the faculty itself that was or became left or right and selected candidates accordingly. Some such faculties developed a reputation for their political bias. Yet it is perhaps worth mentioning that party afliation, denomination and social background are irrelevant compared to the role played by rst-class degrees and publications.32 With the growing importance of measurable meritocratic elements (e.g., degrees or concours), the social origin of university teachers has become less middleclass. Even Oxford and Cambridge in 1971 had 23% of teaching staff whose fathers were classied as skilled manual.33 Germany in 1931/32 had only 1% of professors from a working-class background; the percentage of staff possessing the Habilitation rose to 14% by 1945.34 The following paragraphs present a number of cases showing the variety of the European professoriate, the general trends mentioned above, and some of the problems relating to staff structures. The UNITED KINGDOM:35 The development here was probably the most carefully planned of all our case studies, and yet the present situation is considered to be less than satisfactory, owing to nancial pressures and the distorted age structure. A special problem is the recent abolition of tenure. The four-tier structure of staff comprises professors and readers, senior lecturers and lecturers. Tenure had become the norm (90 per cent in 1987).36 By the end of our period the binary line (universities vs polytechnics) had been abolished, and there is a unied staff structure with
31

32

33 34 35

36

A detailed study of the effects of the then newly introduced advertising of posts in Germany is Hochschulverband, Das Ausschreibungsverfahren im Hochschulbereich (Bonn, 1976). A. H. Halsey, Decline of Donnish Dominion: The British Academic Professions in the Twentieth Century (Oxford, 1992), 205. Halsey and Trow, British Academics (note 4), 216. Ferber, Lehrkorpers (note 20), 147, 177. Halsey and Trow, British Academics (note 4); Halsey, Decline (note 32); Moss, Scottish Universities (note 4); Williams, Academic Labour Market (note 12). Karpen and Hanske, Besoldung (note 9), 232.

174

Teachers considerable internal differences of academic background and research or teaching interests.37 The system is basically meritocratic, that is, appointment to the higher ranks is based on academic achievement (a rst-class degree, a PhD, well-regarded publications), and the number of books published is a good indicator of the growing importance of research for promotion. From 1964 to 1989 the proportion who had published ve or more books rose from 4 per cent to 13.5 per cent.38 In 1962/63 there were about 15,720 full-time university teachers. Of these 12% were professors, 17% readers and senior lecturers; by 1968 the percentage of professors had already declined to 10.1% out of a total staff body of 30,755. The proportion of those under forty was 56%. By 1986 the total number of staff had increased to about 47,000. The percentage of professors showed a further decline to 9.5%; 19.7% were readers and senior lecturers. The percentage of those younger than fty was only 23.5%, which illustrates the very limited availability of posts for new junior staff.39 The inuence of the ancient universities in producing staff and on staff attitudes in general seems to be almost undiminished. The Oxbridge tradition of dons, who are all equal, has diminished tensions between the different groups of university teachers, but the extremely poor chances that many lecturers have of obtaining a senior lectureship or of becoming promoted to reader are frustrating. New blood posts and early retirement have changed prospects only slightly, because the overall economic squeeze and the general climate do not bode well for the new university sector. France :40 The French situation is a good example of the change from a professorial to a highly structured system: in 1875 professors constituted 50 per cent of all staff, in 1975 only 12 per cent. The modern four-tier staff structure distinguishes clearly between junior categories (assistant and ma tre-assistant) and senior staff (ma tre de conf erence and professeur). It must be borne in mind that there exists a separate career coles display an for researchers in the CNRS, and that the grandes e extraordinary variety of stafng mechanisms and employ many part-time teachers. One characteristic of university recruitment is the high degree of centralized decision-making and the role played by nationwide concours or listes daptitude (based on degrees). The ranking by these lists plays a considerable role in the process of appointing staff; universities have
37 39 40 38 Halsey, Decline (note 32), 191. Halsey, Decline (note 32). Karpen and Hanske, Besoldung (note 9), 227f. Friedberg and Musselin, Academic Profession in France (note 8); P. Gerbod, Sur notre personnel universitaire, Revue Administrative, 32 (1979), 4759; Mayeur, Carri` eres (note 5); F. Mayeur, L evolution des corps universitaires (18771968), in C. Charle (ed.), Le personnel de lenseignement sup erieur en France aux XIXe et XXe si` ecles (Paris, 1985).

175

Thomas Finkenstaedt Table 5.1 Categories of French university teachers in %

Ma tre -assistants 25.9 40.1 Ma tres de conf erence + professeurs 26.8 28.1

Assistants 1970 1982 47.3 31.8

Total 100 100

Taken from Clark and Neave, Encyclopedia I, 223.

been granted a certain degree of inuence since 1968. Grade and function not infrequently fall apart, that is, university teachers are required to full the duties of a post for which a higher degree is needed than they possess; they do not actually get the post before they have acquired the relevant degree. The centralized and unied structure of the degree-ladder (agr egation) makes it possible to second teachers from the secondary schools. The years since 1968 have seen a vast increase in the percentage of assistants, becoming ma tre-assistants by the 1980s (see table 5.1). GERMANY:41 The (West) German university has probably experienced arguably suffered the greatest changes. The old ideal of a purely professorial system (plus assistants with short-term contracts) was out of date already by 1945. The expansion after 1960 was at rst not met by founding new universities with a complete body of staff, but by expanding existing institutions. And the number of professors was increased far less than that of the assistants, creating a large pool of dissatised junior staff with few rights and a considerable workload, which a professor could use for his own purposes, if he so desired. The present staff structure shows a mixture of the old-style professoriate, with professors and Privatdozenten with the Habilitation, and Assistenten as junior staff, with a new career for tenured teaching staff, the Akademischer Rat or Academic Council. For these posts a rst degree (Staatsexamen, Diplom, Magister) is sufcient, and there is neither the obligation nor the right to do research. Promotion is more or less automatic according to seniority. This new Mittelbau (middle structure between junior and senior posts) was highly diversied a survey of English studies in Germany in 1980 shows a total of forty-eight different types of posts and was sufciently dened neither on a meritocratic basis nor by function; repeated legislation by the federal and state governments
41

W. Thieme, Die Personalstruktur der Hochschulen, in U. Teichler (ed.), Das Hochschulwesen in der Bundesrepublik Deutschland (Weinheim, 1990), 10122; H. Peisert and G. Frammheim (eds.), Higher Education in Germany (Bonn, 1994), 11423. Weber, Multiplizierung (note 5); W. Weber, Empfehlungen des Wissenschaftsrates zum Ausbau der wissenschaftlichen Einrichtungen, vol. I: Wissenschaftliche Hochschulen (Tubingen, 1960).

176

Teachers Table 5.2 Full-time staff in the universities of (West) Germany

1960 Professors Non-professorial 5,200 11,700 1965 8,800 24,100 1985 24,500 46,400 1991 21,400 80,100

has not solved this unsatisfactory state of affairs. The federal Hochschulrahmengesetz (Higher Education Framework Law, 1976, amended in 1985) tried to create a homogeneous class of professors with equal rights and duties but with three separate salary scales. The resulting staff structure is not very stable, and the distorted age structure will certainly create problems in the future. After a period of democratic and anti-degree policies for lling vacant posts, there has been a shift to a more meritocratic attitude, with the Habilitation almost gaining its former role again. The most recent trend, however, is towards a pseudo-American system with a six-year junior professorship leading to a permanent professorship. The end of the DDR has not made things easier. With sixteen separate Lander pursuing policies that are not infrequently widely different, it is not possible to predict how staff structures will develop. There is no early retirement for professors, and the new blood posts (the socalled Fiebiger and Heisenberg professorships mentioned above) are far too few.42 Seventy-ve of these were sponsored to encourage older staff to concentrate entirely on their research, while 500 are dedicated to allowing rst-class junior staff to become professors early. The shift towards a higher percentage of professors after 1970 is due to the massive transfer of not formally qualied staff of the Mittelbau into professorial posts, as well as the integration of the Padagogische Hochschulen (teacher training colleges). In 1991 the Mittelbau included 2% Oberassistenten (senior assistants) and Dozenten (university lecturers), 7% wissenschaftliche Assistenten (assistants), 87% wissenschaftliche Mitarbeiter (graduate assistants), and 4% other academic employees.43 AUSTRIA has experienced reforms similar to those in Germany; experiments with a Mittelbau without Habilitation were unsuccessful, and widespread tenure has lessened the chances for qualied junior people. Tenure and the title of professor are more or less gained by seniority.44 THE NETHERLANDS reorganized its staff in 1986, moving further away from the old professorial system. There is a three-tier staff structure
42 43 44

Peisert and Frammheim, Higher Education in Germany (note 41), 129. Peisert and Frammheim, Higher Education in Germany (note 41), 123. Universitats-Organisationsgesetz von 1975; cf. W. Ruegg, Zementierung oder Inno vation: Efzienz von Hochschulsystemen, Osterreichische Rektorenkonferenz, Hochschulpolitische Reihe, 1 (Vienna, 1987).

177

Thomas Finkenstaedt consisting of full professor, associate and assistant, with a quantitative relationship of 1:1.5:2.5. But the purity of the original system is spoilt by part-time professors and a growing number of non-tenured posts.45 The Scandinavian countries have developed their teaching staff structure from a system similar to the old German one, with professors, lecturers and assistants. SWEDEN introduced the tenured university lecturer in the sixties, who was expected to have a doctorate (Habilitation), but growing student numbers forced the authorities to suspend this qualication bar. It is also worth noting that, beside the old type of professor (appointed by the king), a new type of locally appointed professor has been introduced. FINLAND has differentiated the professorial group and introduced a chief assistant. There is also a growing number of part-time and temporary posts, such as the special docent.46 SPAIN, PORTUGAL and ITALY have staff structures that combine meritocratic elements with seniority, that is, there is a certain right to move into a higher position once the relevant degree has been obtained. Tenure has become frequent even for the lower ranks, denying access to new staff. The difculties of changing traditional staff structures and established recruiting procedures for professors are illustrated by developments in Spain with its high percentage of tenure and self-recruitment. Professors in Italy can choose to work part time (a tempo denito) or full time (a tempo pieno), and they frequently teach in several universities; the place(s) of work and the place of residence can be far apart, resulting in frequent travel and little contact with students. Moreover, junior academics often teach in more than one place as well (university and/or school), in order to make a living. It is worth noting that in Italy professors continue to work till the age of seventy, whereas most other countries have the usual civil service retirement age of sixty-ve (another exception is Austria; Germany is switching from the Emeritierung with full salary at sixty-eight to the normal Pensionierung at sixty-ve).47 SOVIET SYSTEM: Developments in the former Eastern bloc countries are much more difcult to describe. Not only do we lack reliable statistics, but what was ofcially stated and the reality of university life often differed in a way that is very hard for an outside observer to grasp. The overall development is characterized by the introduction of the Soviet

45 46 47

Clark and Neave, Encyclopedia I, 491ff. M. Klinge, Helsingfors Universitet 19171990 (Helsinki, 1991), 70931. For individual countries, see Clark and Neave, Encyclopedia I. A. G. Hernandez, Recruiting of Spanish University Teaching Staff: From the Recent Past to a Possible Future, Higher Education Policy, 2 (1989), 50ff.; Clark, Academic Power (note 9), 83. Karpen and Hanske, Besoldung (note 9), 102, 106.

178

Teachers model after 1945, concentrating research in the academies, centralizing decisions about teaching staff, and introducing a new and real career structure for university staff. Of special importance was the aspirantura for junior staff. The successful aspirants became candidates of science, and instead of a university Habilitation or a concours, there was the doctor of science awarded by a central committee of the Academy. The model was or had to be adopted by most Eastern countries, but despite a homogeneous terminology and overall structure many differences existed or re-emerged. The GERMAN DEMOCRATIC REPUBLIC (DDR) followed the Russian model, with its aspirants and centrally controlled examinations (Promotion A and B), most closely. POLAND introduced the socialist model of higher education in 1951, but the process of institutional restructuring was slow and only gradually achieved.48 New types of staff, the aspirantura, the scientic worker and the adjunkt, were introduced. The degree of candidate in science and the doctor of science had a limited appeal only.49 In recent years Poland has returned to degrees awarded by universities (the Dr habil. has to be recognized, however, by the prime ministers Committee for Professorial Promotions). Today in Poland the assistant (up to eight years) will become an adjunct for a maximum of six years after taking his doctorate. After the Habilitation the adjunct can become an extraordinarius and then an ordinarius. Political pressure has more than once enabled people to stay in their posts without a Habilitation. A second career path in Poland is the lecturer a senior lecturer teaching career without research obligations. As in so many countries, the language instructors are outside the career system proper. ROMANIA, like Poland, adopted many features of the Soviet model from 1948 until 1953, but the aspirantura and the title of candidate of science was quietly dropped again in the early 1960s; central control of the awarding of higher degrees was retained. Staff structure distinguishes professors and associate professors (conferentiar), lecturer, assistant lecturer and assistant. In HUNGARY strict central control lasted from 1948 to 1964. The right of the universities to award the doctorate and conduct Habilitation was abolished in 1950 and replaced by the candidate and the doctor of sciences. Reforms have been going on since 1964, but universities were granted the right to award the doctorate again only in 1993. In 1985 staff consisted of 1,651 professors (10.2 per cent), 3,219 associate professors, 6,352 principal assistants, 3,572 assistants and 448 others.50

48 50

49 Sadlak, Planning (note 3), 176f. Sadlak, Planning (note 3), 171ff. Clark and Neave, Encyclopedia I, 298, table 15.

179

Thomas Finkenstaedt Other staff One characteristic of a university system is the fact that it is impossible to maintain a completely uniform staff structure, even within the connes of a national context. Universities must react in unpredictable ways if they want to uphold their standards in the international world of science and scholarship and adapt their staff accordingly. A number of recent developments are worth mentioning, at least in passing. The number of part-time teachers has grown, sometimes in order to ll gaps in a highly specialized curriculum, more often in order to enlist the services of highly qualied personnel from outside the universities, and such people may secure one of the coveted honorary professorships (e.g., adjungerad professor in Sweden or Honorarprofessor in Germany). Similarly, a personal chair can be a token way of honouring leading members of a faculty for whom no salaried professorship can be obtained. An important post-war development is the visiting professor from abroad (very rare before 1945). The Fulbright Program, based on a motion by Senator Fulbright in 1946, was set up in order to increase understanding between the USA and other countries; its model helped to inspire a number of programmes nanced by the European Union, for example, Erasmus and Socrates, which have staff mobility as one of their goals.51 RESEARCHERS: A very large and important new group of nonteaching staff are those who are employed as full-time researchers. France has a special career for people concentrating on research within the framework of the Centre National de la Recherche Scientique (CNRS); until the collapse of the Soviet Union, Russia and the other Eastern bloc countries concentrated research in their academies. Research institutes outside the universities in countries like the UK or Germany (e.g., the institutes of the Max-Planck-Gesellschaft) did not develop a specic career for researchers. In countries with a strong research tradition in the universities, the period from 1960 onwards witnessed an enormous growth in contract work, nanced either by government (e.g., the research councils in the UK, or the Deutsche Forschungsgemeinschaft (German Research Council) in Germany), or by private foundations or industry. Contract work has been welcomed or even pressed upon universities by several governments, in order to encourage closer links with industry and thus better integrate universities into the economy, but also to save money. This development has been particularly strong in the UK. Research provides many of the necessary opportunities for the young scientist or engineer working towards a higher degree or engaged in postdoctoral work. The further training of graduates for work outside the
51

See chapter 3 (Relations with Authority)

180

Teachers university is one of the most important tasks of a university, and this could not be fullled without non-teaching research staff. In recent years young academics with short- or medium-term contracts have become, to some extent, a substitute for junior posts occupied by an older generation who were admitted to the profession after 1968. Social problems can and do arise in this context, often because such researchers are paid less than academics with the same qualications and who occupy salaried junior posts in the same department. Left-wing demands to make research posts permanent miss the point and try to make one forget that current problems are often the consequence of previous trade union inuence on staff structure and university expansion. NON-TEACHING STAFF: Modern science needs support staff to an extent unknown before the war. This is not only true of medicine and the natural sciences; large departments and the bureaucratization of the university, like that of all other public institutions, require qualied administrative staff. Little is known in detail about this important group of people, which includes the registrar and the librarians, the head of the computing centre as well as the technicians in the laboratories and the catering people, not to mention an army of secretaries. The ctional character Maureen the secretary created by Laurie Taylor in his weekly newspaper column published in the Times Higher Education Supplement (THES) is perhaps as good a representative of this group of people as any: even though she is not the head of department, in a way she runs it. Support staff seem to be taken for granted, and university teachers across Europe are neither particularly satised nor dissatised with them.52 Neither the Robbins Report in Britain (1963) nor the rst report of the German Wissenschaftsrat (1960)53 nor monographs on other countries say much about support staff. Statistics clearly show that at least in Germany the rapid growth of this sector began rather late. The German gures may not be quite average (the Federal Republic has a high proportion of support staff), but they illustrate the dimension. In 1990 the (West) German universities employed 108,000 full-time teaching staff and 205,000 nonteaching staff, and even the non-researching Fachhochschulen employed 12,000 support staff for 11,000 teaching staff.54 To quote another example: in 1985 Ireland had 2,759 full-time teaching and 3,621 other staff.55
52

53

54

55

J. Enders and U. Teichler, Der Hochschullehrerberuf im internationalen Vergleich (Bonn, 1995), table 5. Weber, Empfehlungen des Wissenschaftsrates (note 41). Higher Education. Report of the Committee . . . under the Chairmanship of Lord Robbins (London, 1963). See also chapter 3. Personal an Hochschulen 1982 bis 1990: Fachergruppen, Lehr- und Forschungsbereiche, Lander, Dienstbezeichnungen und Besoldungs- bzw. Vergutungsgruppen, Hochschularten, Geschlecht (Bonn, 1992), 2. Clark and Neave, Encyclopedia I, 334ff., table 6.

181

Thomas Finkenstaedt Actual working conditions for university teachers depend to a considerable extent on the well-oiled machinery of their university, looked after mainly by non-teaching support staff and administrators. Women The early history of women in higher education (students, womens colleges and women as university teachers) is discussed in volumes II and III of this history.56 Only a very slow growth in numbers can be observed. During the Second World War the number of female students and probably junior teachers increased, if only because their male contemporaries were soldiers. The post-war increase in the percentage of female students is a natural result of the expansion of the secondary school system, even though the result may not have been as envisaged at the start.57 The growing student numbers were not immediately followed by a corresponding increase in the number of female university teachers. This, and the fact that female academics predominantly occupy the lower ranks in the academic hierarchy, has led to occasionally heated debate about the role of women as university teachers. A common explanation of the late twentieth-century phenomenon is that there exists a clear case of discrimination against women by the male establishment of university teaching staff. More research on the history of women in the modern university is needed in this context.58 The following gures illustrate the statistical state of affairs in a number of countries towards the end of the twentieth century. In 1990 in the UK, of the junior posts, 40% were occupied by women, but only 1.7% of the women became professors as opposed to 11.4% of the men.59 In Hungary, about 30% of university posts were occupied by women; of these 41% had made it to the middle rank of principal assistant, but only 2.4% had reached the rank of professor.60 The Netherlands had only 16% women staff: in spite of ofcial policy, female staff remain scarce, especially in the higher functions and only 3% were full professors.61 In Poland in 1987/88 about 28% of all doctorates were earned by women and 20% of those who wrote a Habilitation were women.62 For Romania the percentage is 29% of staff, many in high positions.63 In Sweden there is a clear male dominance of 95% for full professors, and the overall
56

57 58

59 61

See vol. II, 242f.: Laura Bassi was the rst woman teacher at a university (Bologna 1732). See also vol. III, 133. See chapter 6. Halsey and Trow, British Academics (note 4), has only a passing remark on p. 158. For Germany, cf. F. Boedeker and M. Meyer-Plath, 50 Jahre Habilitation von Frauen in Deutschland (Gottingen, 1974). 60 Clark and Neave, Encyclopedia I, 298, table 15. Halsey, Decline (note 32), 223. 62 Ibid., 575. 63 Ibid., 601. Ibid., 501.

182

Teachers percentage of women among the teaching staff was 28%.64 By way of comparison, percentages in the United States are revealing: there were 28% women among full-time university teachers in the US in 1940; the number had increased to 31% by 1988, but in the research universities women had a share of only 20%.65 For the US a concentration of women in the more social studies like teacher training or certain elds of medicine can be observed.66 These gures make it clear that there is no connection between the general course of the emancipation of women in different countries and the number of women teachers in their respective higher-education systems, nor can a link be established between a political system and the percentage. The fact that certain subjects in medicine or teacher training have a higher than average proportion of women can perhaps be explained by the higher number of female students in these subjects. Pharmacy is a well-known example of a female subject, just like anaesthetics, as they both allow part-time work. The low gure for the Netherlands is of special interest: it corresponds to or is the consequence of a low quota of female students only 21% in 1971.67 A total of 23% female graduates in 1979 simply cannot produce enough female staff to reach even the low European average. In the UK no systematic difference could be observed between male and female career patterns in a recent study,68 and it was even noted with some surprise that the data led to the conclusion that when womens qualications, publication rate and experience are held constant it is impossible to demonstrate discrimination against women;69 the small minority of married women academics with children had published books and articles at the same rate as the men, and far more than the single and the childless married women. This suggests that a new breed of women academics committed to both family and career is beginning to emerge.70 Judging by the German experience, it is essential to encourage gifted female graduates to go on to take a doctorate, and such advice will be more readily accepted if proffered by successful women university teachers. It is not improbable that the whole development simply takes a long time and is difcult to accelerate. The problem is a real one, but it is probably not so much a consequence of discrimination as of accumulative disadvantage.71 More case studies and accurate statistics

64 66 67 68 69 70 71

65 Clark and Neave, Encyclopedia III, 1683. Ibid., 694. Clark and Neave, Encyclopedia I, 787. P. Rooij, Hollen of stilstaan (Amsterdam, 1985). Becher, Academic Tribes (note 14), 124. S. M. Lipset, in Williams et al., Academic Labour Market (note 12), 4. Perkin, Academic Profession (note 29), 35. Becher, Academic Tribes (note 14), 125.

183

Thomas Finkenstaedt will also be indispensable so that assumptions [can] be challenged and policies built around accurate data.72 Salaries Like so many other aspects of university life, the salaries of university teachers present a complicated, sometimes diffuse picture. This is due to several factors. In many countries academic salaries are linked to civil service career salaries, without quite tting into the usual civil service scales. There is the dichotomy of meritocracy vs seniority (or a mixture of the two), and there is competition, in many subjects, with the general labour market. There is also the difculty of a just evaluation of a university teachers work. Same work same pay: but what really is the work, and how is one to say whether it is the same in a profession including engineers, surgeons and Assyriologists, a profession with no xed hours of work and with products that are difcult to evaluate. University teachers have been called one-man businesses and what they sell is themselves.73 A description of university salaries and their development since 1945 must include both the internal aspect, that is, the salary scales within the profession, and the external, that is, their development in relation to other sectors of society. And it must always be borne in mind that in most if not all countries there are emoluments other than salary for university staff, which may sometimes be difcult to state in terms of money, even though they constitute one of the major attractions of the profession. The overall internal development of university salaries since 1945 has been characterized by the following elements. A more regularized salary structure has arisen, more similar to the regular civil service scales; there has also been a marked decrease in the differences between salaries for junior and senior staff. The gures for the UK show this quite clearly: in 1989 the average professor received 1.76 times the salary of the average lecturer, and 2.74 times more than the average research worker.74 In Germany in 1955 the professor had a (basic) salary at least 3 times that of an Assistent, but by 1976 the relationship had been reduced to between 1.3 and 1.75. Professors could, and in many cases would, receive special additions to the basic salary, but the overall picture is clear.75 A similar picture emerges when we look at the range of salaries within the different categories. This has narrowed too. Before the First World War in Prussia
72 73 74 75

Times Higher Education Supplement, 14 May 1993, 2. Oral contribution by A. H. Halsey during Augsburg Symposium (note 98). Halsey, Decline (note 32), 131. G. Dorff, Besoldung und Versorgung des wissenschaftlichen Personals, in C. Flamig, et al. (eds.), Handbuch des Wissenschaftsrechts (Berlin, 1982), 478501.

184

Teachers the top salary of an Ordinarius could be nine times that of the salary of a full professor at the beginning of his career, and the average salary of the full professor was twice that of an associate professor (Extraordinarius).76 It is said that the academic profession was proletarianized after World War II.77 It could, of course, be argued that a profession that is basically democratic, consisting of peers only, must not have a salary structure with too great a disparity. Alongside this narrowing of scales the differences in pay between universities have been levelled or completely abolished in most countries (apart from things like the so-called London weighting). In Germany this has made it much less attractive to move to the more expensive university towns, where any increase in the salary, or more, must be spent on the far more expensive housing and the higher costs of living. Comparing university salaries with those of the civil service or income in industry and commerce, we nd a similar development: a lowering of the top end of the scale, sometimes even of average salaries.78 A comparative study of university salaries in 1985 provides details for France, Italy, Austria, Sweden, Switzerland and the UK.79 It shows that in France there was an average rise in salary of 80% in the private sector and 50% in the civil service, whereas university salaries increased only by 36% from 1962 to 1983. This development is making it much less interesting to embark upon a university career. In Italy, on the other hand, it was quite normal for university professors to do part-time work and to have more than one post at a time; the total income of full professors was, therefore, higher than in the other countries analysed.80 In the United Kingdom the salary of a professor can be xed within a exible scale by each university; salary scales for other groups are valid for the whole system. British and Swedish staff, especially junior staff, are the least satised with their salaries.81 A narrowing of the scales of income together with high taxation is a characteristic of the Swedish situation, where the average net salary of a full professor is only one-and-a-half times that of a janitor. The purity of the salary system (the same pay for professors in all faculties, for instance) cannot be maintained in practice because of market forces.82 Engineers, mathematicians or economists with the qualications of a university teacher can command much higher salaries working outside the university. Governments, of course, have been forced to take
77 Halsey, Decline (note 32), 125. Ferber, Lehrkorpers (note 20), 112. Perkin, Academic Profession (note 29), 46; Halsey, Decline (note 32), 131. 79 Karpen and Hanske, Besoldung (note 9). 80 Karpen and Hanske, Besoldung (note 9), 38. 81 Teichler, Conditions (note 17), table 2.7. 82 Williams et al., Academic Labour Market (note 12). 76 78

185

Thomas Finkenstaedt notice of this. There are several ways of solving the problem. University laws or corresponding regulations may provide extra pay for special cases; for instance, a sabbatical term without any teaching can be a considerable bonus. In most countries there is the opportunity to earn extra money through work apart from ones teaching duties and research. Medicine is naturally the most obvious example. But science and engineering also offer many well-paid consultancies, and these can frequently be justied as a necessary link between theory and practice. Even the social sciences and the humanities offer their ways of earning a little or not so little extra income through work as an expert on government committees, as the author of popular books, through public lecturing, and perhaps even as a telly-don. The Eastern countries had interesting perks, such as better treatment in hospitals, cheaper railway fares, foreign travel, or no military service and a guaranteed university place for the son of a professor in the former DDR. The situation in the former Eastern bloc countries has changed dramatically over the last few years. Whereas during the communist period the university professors belonged to a better-off category, especially because of their open or hidden perks, the teaching profession now belongs to the new poor. In 1986 the lowest-paid professors earned between DM60,000 (Austria and France) and DM90,000 (Italy); top salaries were in the range of DM80,000 (Austria) and DM170,000 (Italy).83 Salaries in the former communist countries are not infrequently 10 per cent of those in the West. Considering the different systems of increments on the one hand and taxation and contributions to pension funds and so on on the other, such gures are only a rough indicator. It should also be noted that income is a very subjective factor, too; Dutch and German professors as well as junior staff are, on the whole, the most satised with what they earn.84 Honours and titles have lost some of their attraction during the postwar period, if only because of the proliferation of professors. There is a widespread feeling among university staff that working conditions have deteriorated, and that public respect for academics is declining, and yet, only 8 to 21% (Sweden Great Britain) say that they would not become an academic again.85 There is one attraction, frequently underrated, which until now is equally typical and valuable for the university teacher: there are no xed working-hours in this profession, and even though he or she works many more hours than the average worker, the university teacher is free to choose when and where to do the work. Time being one of the scarcest commodities of modern life, this autonomy and
83 84 85

Karpen and Hanske, Besoldung (note 9). Teichler, Conditions (note 17), table 2.7. Times Higher Education Supplement, 24 June 1994.

186

Teachers freedom in doing ones work is one of the greatest attractions of the profession, whether its members realize it or not; whatever direction the development of salaries might take, governments and funding councils would be well advised not to interfere with this essential element of a university teachers life; it would cost a lot to do otherwise. Mobility Staff mobility has generally been regarded as a valuable commodity in the European university tradition, though real mobility has probably always been less than expected or desired. Since the war many new developments have occurred. The internationalization of science and air travel have made personal contact between academics possible to an extent hitherto unknown, and scientists need such contacts in order to actually see what is going on in a particular laboratory or working group. In a number of elds (e.g., physics) experiments require the cooperation of groups of academics from several universities. Congresses and symposia are new forms of communication, and attendance has become obligatory in many cases.86 On the other hand, easy access to almost every location on the earths surface has enticed many people to engage in what has been called academic tourism (H. Markl). The old Residenzpicht (obligation to reside in ones university town) is no longer strictly observed by a new brand of turbo-profs,87 and the modern jet enabled at least one man to have a full professorship in both Germany and the United States at the same time in the 1980s. Mobility between the university and industry or national research institutes (CNRS, Max Planck Institutes etc.) is indeed desirable, but it appears to be difcult to achieve in view of the complex and often bureaucratic regulations that have come into being with the emergence of modern staff structures. For senior staff, especially in the sciences, it has often become less attractive to move to a new place because it would take a number of years to set up a highly specialized laboratory again and, as a rule, one cannot take along assistants, technicians and the graduates working on their doctoral theses. Long-term mobility occurs more towards the university (especially in medicine, the sciences and technology) than from the university to posts outside, partly because of the degree of specialization of university staff. Mobility is also being reduced in two ways that are denitely post-war, and both can be found in practically every European country, whether
86 87

Becher, Academic Tribes (note 14). Gerbod, Personnel (note 40), 477. Karpen and Hanske, Besoldung (note 9), for the countries discussed.

187

Thomas Finkenstaedt East or West. One is the lack of adequate housing in many university towns and the high costs of establishing a new home even where housing is available. Even famous universities can nd it difcult to attract celebrity professors unless their spouses decide that they would like to live in that particular town. (Exceptions are probably still Oxford, Cambridge and Paris.) The second is the inuence of new marriage and family patterns. A growing number of academic spouses do not want to end their career when the academic partner is offered a post elsewhere, or they have difculties in nding an adequate occupation in the new location. Conclusion The overall development of staff structures in European universities after 1945 has been characterized by several, sometimes conicting, trends. The trend towards a more democratic structure has indeed lessened the prestige and inuence of professors, but it has not abolished hierarchies. Differences among staff may be less visible, but they still exist. Not every member of staff can supervise graduate work (after all, a lot depends on the names of the referees of a dissertation submitted), and the choice of committee members can also be a subtle but effective way of differentiating staff. In countries where the process of democratization was enforced by law (Germany now has three different but equal classes of professors), the law also tried to establish differences: for example, who can be the director of an institute, or who is decanabilis, and so on. On the whole, more democracy has meant less autonomy for the individual, but also for the institution.88 The second development is towards a more differentiated and regulated staff structure, and towards a career based on degrees (the meritocratic system); this has also brought earlier tenure in many countries, a form of social security expected today and indeed necessary following the demise of the old Privatdozent with a rich wife, or the scholarly gentleman of independent means. Political and social developments have distorted the age structure so that the system will face growing difculties in the twentyrst century. The age of appointment to full professor has remained fairly constant and is similar in otherwise dissimilar systems, with the average being around forty-ve (though it is usually lower in new elds such as information technology or modern linguistics), but the age for rst posts has risen, partly because studies have lengthened, partly because junior posts are scarce and young academics have to spend several years working on short-term research contracts. It is not yet clear whether the different university systems will move towards a homogeneous European
88

Halsey, Decline (note 32), 125.

188

Teachers staff structure and reach a steady state. But it is not very likely. Universities have always had trouble with their staff; the dancing-masters and the Praeceptores linguarum exoticarum of the seventeenth and eighteenth centuries did not t in, nor did the Lektoren of the nineteenth century, not to mention later examples. Whatever the system, some sort of ordinarius will no doubt survive. There probably have to be independent university teachers who guarantee continuity, quality and development, whatever their individual shortcomings. Apparently, this scholarly and scientic elite must have their home in universities and not in pure research institutions, that is to say they must combine teaching, research and the supervision of research. teaching The term university teacher, some people feel, is a misnomer, because all too frequently academics are said to be, and not infrequently are, interested far more in their research and their career which depends to a large extent on their research output than in their teaching. Of course, there are variations in the different national traditions: for instance, there is still a fairly close connection between university teaching and a conscious university education in the British tradition. The other extreme is the German Humboldtian idea of Bildung through Wissenschaft (impossible to achieve, of course, for a student population of more than a few per cent of the age cohort), and if possible Freizugigkeit , the unhampered mobility from one university to another, as well as the Lernfreiheit, the freedom to choose the individual teacher and the subjects most suited to self-fullment through university studies. Some of the modern problems of teaching go back to medieval times, some spring from the German nineteenth-century tradition, while some are denitely post the Second World War. University teaching as a major problem that is widely discussed outside the university is denitely modern. Many of the problems are caused by the changes in numbers and structures discussed or alluded to above. Some of the present concerns can be illustrated by a number of binary oppositions which, of course, do not exist in pure form in the everyday reality of universities, but which underpin the theory and to a large extent the practice of university teaching. We nd the disciplinary vs the interdisciplinary, a strict course-structure (the UK) vs credit systems of varying degrees of freedom of choice, the canonical content of courses vs the ad lib approach focusing on the specialities of teachers, undergraduate vs graduate teaching, lecturing vs project work. Some recent teaching problems have come into existence because we are no longer dealing with a tiny elite group of students but with 30 and more per cent of an age group, 189

Thomas Finkenstaedt and many of these students are rst generation, with parents who had no chance of having access to higher education. The opportunities of an expanding tertiary sector have not always been exploited either, such as the chance to discover gifted students and future graduate students right at the beginning of their studies. There is some informal evidence that potential university teachers were discovered by their tutors or doctoral supervisors very early on in their careers. This talent-spotting probably requires the presence of the senior teacher-researcher in undergraduate teaching, yet another reason for not introducing the teaching-only university. The sciences, with their practical laboratory work, have fewer problems with teaching, and the British tutorial is, of course, an excellent way of discovering the best without neglecting the less gifted. But it is unfortunately true to say that in the majority of systems the dropouts are of no concern to the teaching staff. Teaching methods89 There are four traditional ways of teaching. The lecture is the oldest, frequently said to be outmoded by the invention of printing (not to mention more modern media), quite apart from its having been attacked as authoritarian and anti-democratic. In some countries like Sweden or Germany the lecture has indeed lost some of its former importance. Yet the lecture is and will continue to be one of the most effective ways of teaching: it is personal and reaches a great number of students; it forces the teacher to acquire a broad survey knowledge of the discipline and the state of research, and to nd a balance between subject matter and presentation, while combining information and personal evaluation. The specialized seminar with the active participation of students was a German invention of the nineteenth century, and it soon found its way into many university systems. The Praktikum was developed in the nineteenth century, too, and it is still the basis for teaching the sciences. The tutorial is the British contribution to teaching methods, and it is probably one of the most effective. In name it has been taken over into the German system, but in a curiously adulterated form consisting of small-group teaching by junior staff, preferably by students only. Modern forms of teaching include project work, forschendes Lernen, sandwich courses, team teaching and block seminars. Distance learning deserves a special mention as it is one of the most successful innovations in recent years, and the success of the Open University in Britain is well
89

As in the rst two volumes, teaching is presented here in a separate chapter (7: Curriculum, Students, Education) from the student point of view. In addition, it touches on reactions by the teaching staff to problems caused by changes in traditional curricular methods.

190

Teachers deserved; it has set a public standard for the didactic quality to be expected of successful university teaching everywhere. The sometimes extraordinary global changes and prots brought about by the Internet over the past few years will not leave the universities untouched. Many people look forward to a worldwide network of academic instruction at many different levels, tailored to the needs of the individual student, and to a new kind of creative freedom using such instruction. It is still too early to make denitive statements about the virtual university, though a number of examples exist. In the context of the present chapter, the following observations would seem to be justied: to make a virtual university or several competing such universities a success, much more money is needed than originally envisaged. Commercial interests play a major role, and economies of scale necessarily restrict the number of subjects taught and the languages used. The new medium will probably require and train a new type of academic teacher, but the old-style professors who combine teaching and research will probably survive as an essential element of the university world because of their independence.

Teaching conditions The number factor and concern about numbers is the most important aspect here. Student numbers in a particular course or a particular lecture have risen to extraordinary heights in some countries. The Carnegie Foundation Survey gives average numbers for introductory courses ranging from 61 (Sweden) to 128 (Netherlands), and even graduate courses average from 15 (Sweden) to 22 (United Kingdom).90 A quantitative approach to teaching is typical of post-1945 developments. There is a numerus clausus in many countries and subjects, as well as FTEs (fulltime equivalents), staffstudent ratios, and rules about admissible numbers of students in different types of courses and seminars. In Germany all this is regulated, enforced and controlled by law. In the UK the nancial approach to teaching conditions (costing) has won doubtful victories in recent years. Another modern aspect of teaching is the omnipresence of technology: microphones in huge lecture theatres, overhead projectors, video screens, duplicated hand-outs, and computers for both teachers and students. The modern university teacher has exchanged his nineteenthcentury private study for an ofce and if working in a rich country and a rich department the services of a secretary (though this service is fast disappearing, thanks to word processing!).
90

Teichler, Conditions (note 17), table 2.8.

191

Thomas Finkenstaedt A necessary by-product of modern teaching and examining is the increase in administrative work, which, in the case of large departments, can reach the scale of public administration or industrial management. In many ways life has become easier for the university teacher. On the other hand, from the sixties onwards there have been complaints about university teaching to an unprecedented extent. These complaints concern the forms of teaching as well as the content. Teaching load It is not easy to measure, to describe or to prescribe the workload of academic staff. In line with more bureaucratic arrangements in other elds, many governments have tried to do more about regularizing the workload of university teachers. There is a widespread feeling among the general public that professors do not work hard enough, partly because one sees so little of the work accomplished, partly for nancial reasons, but also because of the change from the old elite university to the new mass higher-education system and the subsequent squeeze on teaching staff. It is, of course, impossible to introduce a nine to ve oclock university: research would immediately come to an end, and teaching would not improve. Communist Romania tried to introduce regular working hours, specifying the percentage spent on teaching, examinations, research and so on. It was not a success.91 University teachers everywhere are quite prepared to work more hours than average civil servants. For full professors fty hours per week during term time and a few hours less when classes are not in session is a realistic average for Europe. Junior staff work on average about ve hours less than professors. Contrary to public opinion, teaching denitely has priority during term time.92 Nevertheless, governments try to achieve higher efciency or at least productivity by controlling and rewarding research output (the British way), by increasing the number of students per head of staff (the British and German and probably French way) and by increasing the number of hours spent teaching (the German way). Teaching hours per week vary between different countries and vary considerably between different groups of staff, even within the same group of professors. Traditionally, professors taught about four to six hours a week (Belgium, Norway ve hours), and this was supposed to constitute about a third of their total workload including class preparation time, calculated as an annual average. In Germany this meant in the humanities or the social sciences a two-hour lecture plus a seminar for the advanced students and a proseminar for the beginners. In some countries only the total number of hours
91

Sadlak, Legacy (note 3), 86.

92

Teichler, Conditions (note 17), table 2.9.

192

Teachers per year was xed: Finland 144, the Soviet Union no fewer than 150 for lectures and seminars, France 128 hours of lecturing (i.e. four hours per week) or 192 hours of seminars. The number of hours per week has been increased to eight for university professors in Germany; professors in the Fachhochschule system teach a higher number of hours (eighteen) and so did polytechnic teachers in the UK. The reason is that no research work is required of such staff. Differences between the groups can be illustrated by the traditional arrangements in Finland: full professors 144 hours, associate professors 186, lecturers (i.e., teaching only staff) 396 448, assistants (who must concentrate on their doctorates) only 60120 hours a year.93

Research Research reputation is probably the most important element in the career of a university teacher.94 This is not only because it is easier to evaluate the research of a scientist than his or her ability to teach, but because there is a symbiotic relationship between teaching and research (J. Ziman), that is to say, teaching energy is renewed through contact with research, especially active research, by the university teacher. This fact is the basis for the meritocratic staff structures based on degree work and the importance attributed to a candidates research ability when a professorship has to be lled. In elds like architecture or engineering visible success (i.e., buildings, bridges etc.) takes the place of research. The monopoly right of universities to confer the doctoral degree means that at least graduate teaching has direct links with research, and it is highly probable that overseeing research work (one of the most important of all teaching tasks) requires a supervisor who has successfully done his or her own. However much teamwork may have been praised in recent years, the fact remains that most research at least until the late sixties remained a very personal activity. Even chemistry, a subject notable for cooperation, had 32% of publications with single authorship in the UK, while sociology had 61% and mathematics 86%.95 The role played by research for the individual teacher varies considerably according to country and subject, but most professors are active in research and are often awarded external research grants.96 In France there exists a separate career for researchers, but even there improved mobility between the teaching careers, the CNRS and industry has been
93 94 95 96

Clark and Neave, Encyclopedia I, 214. R. Merton and J. Daston, The Sociology of Science in Europe (Carbondale, Ill., 1977). Becher, Academic Tribes (note 14). Teichler, Conditions (note 17), table 2.10.

193

Thomas Finkenstaedt urged.97 In other countries the number of research institutes outside the universities has increased; in Germany the slogan Die Forschung wandert aus (research will emigrate) alludes to this development. The old dichotomy of pure and applied research is no longer as clear-cut as it was fty years ago. Many university teachers nd that close links with industry do not lead to a loss of freedom of inquiry, but rather provide an opportunity to explore new ways of problem solving, not infrequently in collaboration with their graduate students. The long-term effects of grant money coming not from research councils but from the private sector (and the expectation that more money should come from this source, and that the percentage of such money is a good indicator of successful research) cannot yet be fully assessed. It is, however, clear that the growth of R&D co-sponsored with industrial partners has already transformed the place and role of professors with the entrepreneurial talents to promote their eld of study. But it is also clear that the old idea of an ordinarius with a guaranteed sum of money for his independent research must not be completely abandoned. A university teacher all other things being equal generally ranks higher as a researcher in the estimation of the scientic community than the more dependent people in other institutions. Combining teaching and independent research is probably one way of ensuring that new ideas are born and that traditional knowledge and achievements are not forgotten, because they are transmitted to the next generation in the teaching process. A separation of research and teaching would also reduce the chances of discovering the outstanding students early in their studies. The problem for modern universities seems to be the following: how to offer the opportunity of performing rst-class research to a selected group of university teachers, who will then probably play a major role in the training of prospective university staff, while enabling the others to have access to research facilities beyond a reading up of the literature, that is, how to offer scholarship for all. It must also not be forgotten that pure research across the whole spectrum of science can only be done successfully within the framework of universities and academies under the control of academics, because an economic evaluation of pure research, with its frequent long-term effects on industry, is simply not feasible. For pure research in specic elds there are public or private institutes under the leadership of independent academics, such as those of the CNRS in France, the MPG in Germany, the Wellcome Institute in London, and IBM in Zurich, all institutes that have produced a number of Nobel Prize winners. The internationalization of science and international competition for reputation has made research even more important in

97

Times Higher Education Supplement, 1 July 1994, 11.

194

Teachers countries that hope to keep their academics on a higher than provincial level. Evaluation and staff development Our period has seen a growing demand for the public accountability of the university as a system, as an individual institution, and as a group of individual teachers and researchers. Such demands have been put forward not only by administrators in the ministries, who far too often cannot understand university autonomy. The vast sums of public money spent on universities and also the absence or abolition of fees in most countries require the control of the public auditor. And it would be foolish to deny that there is any government or national interest. It is necessary for a country to know about the strengths and weaknesses of national research, particularly in elds of interest to the economy or the military establishment, as the case may be. Evaluation and planning go hand in hand today. And, nally, it is the public at large who want to know what is happening. Non-quantitative evaluation is no longer sufcient, even though peer review will no doubt remain a basic element in the whole process.98 Evaluation of university research and university staff has its origin in the United States. Research evaluation came rst. There will be few academics nowadays at least outside the humanities who would deny the possibility of a fairly objective evaluation of the research performance of individuals or departments. The large and by now sophisticated literature on the subject has uncovered many details of how research is organized in different elds and the necessary conditions for success. In Europe, the UK, the Netherlands and Germany have been the most active countries in this respect.99 Research evaluation can also discover specic career patterns, such as early success in mathematics, the books of a mature historian, the shift of interest from research to supervising, or the retreat into senior statesmanship or time-consuming committee work. Longterm studies may also discover that there is less research output than universities would like to claim, but they will also provide evidence for the importance of leading researchers among the university staff for the well-being of the whole institution.100
98

99

100

Halsey, Decline (note 32) referring to Proceedings of the Symposium on the University Funding Councils 1989 Research Assessment Exercise in Augsburg on July 2627, 1990, Beitrage zur Hochschulforschung, 4 (Munich, 1990). Proceedings (note 98); H.-D. Daniel and R. Fisch (eds.), Evaluation von Forschung (Konstanz, 1988). Becher, Academic Tribes (note 14), 119f., and, for a detailed longitudinal analysis of English studies in Germany, T. Finkenstaedt and M. Fries, in Daniel and Fisch, Evaluation (note 99), 15176.

195

Thomas Finkenstaedt Evaluation of university teaching seems to be much more difcult. The debate over whether teaching can be taught has a long tradition. In the universities the problem was more or less ignored before the sixties, or at least there was little ofcial discussion. Attempts to train university teachers in the Soviet Union in the early seventies were a failure. In the UK the Association of University Teachers took an early interest in teaching methods and staff development, and a probationary period for lecturers was introduced in 1971. Today virtually all the universities make some kind of provision for staff development or training.101 In Sweden a Committee for University Teaching Methods was set up in 1966; staff development was not concentrated on teaching only, but introduced courses for non-teaching staff as well, including courses in administration for new heads of department.102 In (West) Germany university didactics became an important topic for the student movement; after 1968 it was primarily a cause for the Assistenten, and fteen Centres of University Didactics were set up.103 In Germany staff development became linked with general university reform very early on, and the working group for Hochschuldidaktik was soon less interested in helping university teachers than in a thorough overhaul of the whole profession. With a less progressive climate in the 1980s, staff development lost much of its inuence, not only in Germany, but in its more down-to-earth form it is here to stay. Teaching evaluation is still hotly debated, and ranking-lists of university subjects and universities based, among other data, on student reports have been ercely attacked. But students rightly claim an inuence on how and how well things are taught. Evaluation will continue in one form or another, and university staff will be well advised to cooperate in nding satisfactory solutions for this problem, preferably within the connes of university autonomy.104 Other duties The idea of a university implies academic self-governance. Modern developments have led to a huge increase in administrative work, and a large part of it must be done personally, or at least be decided upon by university teachers. In the United Kingdom full professors spend 24 per cent of
101 103 102 Teather, Staff (note 28), 201ff. Teather, Staff (note 28), 42. C. Fuhr and C.-L. Furck (eds.), Handbuch der deutschen Bildungsgeschichte, vol. VI: 1945 bis zur Gegenwart, part I: Bundesrepublik Deutschland (Munich, 1998), 432. Cf. D. Spindler (ed.), Hochschuldidaktik: Dokumente zur Hochschul- und Studienreform (Bonn, 1968). Arbeitskreis fur Hochschuldidaktik (ed.), Mitteilungen (Bonn, 1967ff.). Arbeitskreis fur Hochschuldidaktik (ed.), Blickpunkt Hochschuldidaktik (Bielefeld, 1969ff.). Times Higher Education Supplement, 28 February 1992, on the British audit unit owned by the universities themselves.

104

196

Teachers their time on administrative duties and around 15 per cent in a number of other European countries.105 University teachers are often considered to be bad administrators, but apparently no university administration can do without the academic teacher. In the UK, with the most autonomous university system in Europe, there is high mobility between academic and administrative posts, whereas in German universities the administration is more or less part of the civil service. One obvious academic area in administration is the examination, which is most closely linked with teaching itself. The great importance of examinations and degrees in attributing roles to graduates in a meritocratic society has made examining a complicated, time-consuming and sometimes nerve-racking business for the academics of today. Student counselling should also be mentioned in this context. In a number of countries it has been professionalized, but the teacher of a particular subject can more often than not give the best advice in matters of study problems and a later career. Of perhaps equal importance is the work of university teachers outside the university for the benet of the general public, by serving on committees as experts in their particular elds. Work as an external examiner, in the research councils and the funding committees of foundations, in international organizations, in ministries and voluntary organizations often requires and obtains the expertise and independence of the university teacher. Membership can be based on election, co-option or delegation. In the majority of cases this type of work brings little remuneration, apart from the reimbursement of expenses. There is also a wide range of income-earning as well as status-linked work, not to mention the work carried out by university teachers within their communities, where specialized knowledge is often highly welcome. However, abuse can occur in these areas, too. the university teacher in the modern world Politicization106 Universities and academics have never been as politically neutral as they may have thought or proclaimed. Generally speaking, however, university teachers have kept their distance from active life as political animals, because such a life would interfere with their work. Italian professors with
105 106

Teichler, Conditions (note 17), table 2.4. M. J. Mulkay, Sociology of the Scientic Research Community, in J. Spiegel-Rosing and D. de Solla Price (eds.), Science, Technology and Society: A Cross-Disciplinary Perspective (London, 1977); J. Ziman, An Introduction to Science Studies (Cambridge, 1984); T. Finkenstaedt, The Political Role of the University Teacher and the Politicization of Universities, in H. Bouillon and G. Radnitzky (eds.), Universities in the Service of Truth and Utility (Frankfurt, 1991), 85100.

197

Thomas Finkenstaedt their frequent involvement in all sorts of public concerns and organizations would seem to be an exception. There have been famous and less famous cases where governments tried to curb or evict university teachers who meddled with politics too much.107 But the Nazi period, the war, Soviet rule and, in post-war years, the events of 1968 and the dissolution of the Eastern bloc brought a new dimension and a qualitative change to the relationship between learning and politics: many university teachers no longer felt that belonging to or taking sides in politics108 within the university and the lecture room should be avoided. At the same time, political parties and governments have increasingly tried to use universities for their own purposes and to make them adhere to the party line. It is in this context that the new word politicization was coined.109 The expulsion of Jewish teachers from German and Austrian universities in the 1930s (about one-third of the staff in the humanities) was accompanied by the rise of professors with National Socialist party membership or sympathies. And there were the collaborateurs in the occupied countries, as well as the inevitable post-war purges and the return after 1945 of many of those who had been dismissed in 1945. The Jewish emigration and expulsion has been researched very thoroughly,110 but the politicization of the teaching staff before and after 1933 has not been studied in the same way. What is even more disconcerting is the lack of detailed studies of the denazication process and the return of professors who had been dismissed.111 And there is little published evidence for the occupied territories.112 From what can be gathered so far, it seems that we must be very careful before passing judgment. Very few martyrs are to be found. A surprising number of scientists and scholars have survived dictatorial regimes in both the West and the East without suffering much harm. Not many rst-class scientists embraced the opportunities offered to them. There were many fellow travellers and a few cases of people joining the party or signing declarations in the occupied countries in order to camouage their department. Explicit pro-Nazi passages in letters and
107

108 109

110

111

112

E. Shils, Academic Freedom, in P. G. Altbach (ed.), International Higher Education, vol. I (New York and London 1991), 122. Shorter Oxford English Dictionary, s.v. political. OED, Supplement s.v. politicization. First occurrence 1934, with reference to the church in Nazi Germany. H. H. Christmann and F.-R. Hausmann (eds.), Deutsche und osterreichische Romanisten als Verfolgte des Nationalsozialismus (Tubingen, 1989). See also vol. III, 6539 (Epilogue). T. Finkenstaedt, Anglistik 1945 Blick zuruck ohne Zorn, in Valete: Festschrift zum Eintritt in den Ruhestand von Thomas Finkenstaedt (Wildsteig [privately printed], 1992), 1535; many details in G. Haenicke and T. Finkenstaedt, Anglistenlexikon 18251990 (Augsburg, 1992). A. Wolf, Higher Education in German-Occupied Countries (London, 1945).

198

Teachers publications must be analysed carefully to nd out the meaning or irony intended. The purges (Entnazizierung) after 1945 were not a success. In Germany about 30 per cent of professors had to leave but 25 per cent came back after the war. The story of university staff in the former DDR is, to a large extent, a repetition of the 193345 pattern, and the post1990 Abwicklung, that is, the purge of Marxists and party activists, is not a success story either.113 And there often remains a wall of silence if one wishes to uncover the details. This seems to hold true of the countries occupied by Germany as well as the fascist or communist university systems. Apparently, not many professors were active in the upheavals that led to the dissolution of the Eastern bloc. The 1968 events had a greater share of professorial participation. There are a number of well-known and important university teachers, mainly in the social sciences, who provided a clearly left-wing theory upon which the students and in many cases junior staff, too, could base their march through the institutions. And many of them have indeed arrived. It was mainly the second-rate junior staff who tried to prot from the post-1968 structures. A number of professors put forward considerable and to a certain extent successful resistance to the student movement.114 Post-war developments have made it impossible for university teachers to pretend that they can remain neutral scientists. University teachers need to be more aware of their close relationship to politics and their potential for playing a political role. It will also be necessary to nd ways of dening the limits of lawful research within universities. It is a fact that dictatorships have never tried to tamper with the doctorate, because such regimes need good scientists too. So probably the guiding principle must be found in the most basic right of any university: that the research and teaching taking place in a university context should be in elds that allow students to work towards a doctorate on research that can be published.115 Associations University teachers tend towards individualism, and yet they must act and behave like a group; much of their group behaviour is regulated informally and is learnt over many years in junior posts, and the apprenticeship lasts
113

114

115

R. Jessen, Akademische Elite und kommunistische Diktatur: Die ostdeutsche Hoch (Gottingen, schullehrerschaft in der Ulbricht-Ara 1999). H. Daalder and E. Shils (eds.), Universities, Politicians and Bureaucrats: Europe and the United States (Cambridge, 1982). W. Ruegg, 20 Jahre Bund Freiheit der Wissenschaft. Vom Defensivbundnis zum think-tank, Freiheit der Wissenschaft, 4 (1990), 814. Finkenstaedt, Political Role (note 106), 97f.

199

Thomas Finkenstaedt well into the time a professorship has been gained. Certain traits of the group behaviour of professors are reminiscent of medieval guilds and guilds they were, after all, in their early days. It is important to note that a university teacher always belongs to more than one group, each with a specic pecking order. There is the international scientic community of the discipline, and there is the faculty and the university of which he or she is a member. The scientic community is an excellent metaphor; it is not so easy to nd this community in reality, for it can be as elusive as the invisible college of the leading scholars and academics of a particular subject throughout the world. Most afliations and links of university teachers are informal networks. Faculties, faculty clubs, academic ceremonies and dinners are places where an academic community becomes visible. Yet certain changes over the past decades can be observed. On the whole there is probably less social contact within the group of university teachers than before the war. This may be due to changes in living conditions and the destruction of ceremony as an essential part of academic life in most Western countries after 1968; new faculty structures with joint management and Mitbestimmung (co-determination) have changed the atmosphere in more than one country. The old elite existence and feeling of professors has disappeared and with it many of the former close-knit circles of colleagues. In a way, university teachers have become more normal. Among professors there is still a feeling that they belong together, across disciplines and national borders. Apart from this feeling there are also visible afliations, especially the professional associations of particular disciplines and the general associations of all university teachers in a country. Professional associations have become important social forces in many elds since the war, and university staff play an important role in many of them or have a specic academic association of their own. Meetings, proceedings and publications are all important in the pursuit of reputation, and this pursuit has become more difcult with internationalization. An invited lecture at the annual meeting or chairing a session of an important association can be as valuable for a career as any prize or book or article. This explains why the general associations of university teachers are frequently considered to be less interesting, even though they may be equally important for the overall system. The British Association of University Teachers (AUT) joined the Trades Union Congress and had an extraordinarily high percentage of membership (more than 50 per cent; the polytechnics had a union of their own called NATFHE (National Association of Teachers in Further and Higher Education)). France and Sweden both have strong trade union traditions, and the choice between the different unions depends largely on individual political afliation. In Sweden university teachers have a union of their own within a comprehensive 200

Teachers union for white-collar workers with academic training. Some teaching staff prefer to join the union of the non-teaching staff, and it was this union which propagated an egalitarian university system in Sweden in the sixties. The three French syndicats are trade-union associations with political afliations too, and they had considerable inuence on the changing staff structures after 1968. In Germany the real trade unions (GEW, Beamtenbund) have very few university teachers as members. Professors and Habilitierte are organized in the Deutscher Hochschulverband with a high percentage of membership (more than 50 per cent). The role played by these associations in the different countries varies according to the legal context in which they operate. In Britain the AUT/NATFE is the partner in the annual bargaining process about salaries and can even countenance strike action; in Germany the status of Beamter of university teachers leads to more informal inuence, depending to a considerable extent on the political climate. It cannot be denied that, on the whole, staff associations have tended to react and not to act, and they have not developed new models for the future. The former communist countries did not have any voluntary staff organizations or independent, trade-specic trade unions competing for membership. The party and the general trade union did inuence university politics but, as a rule, they did not interfere with decisions about degrees, and their inuence on appointments was mostly a kind of nihil obstat. Little is known about the private lives of university teachers today. Perhaps the changes in student life a retreat from the university have their parallel in the lives of university teachers, who prefer to meet friends rather than colleagues. Developments may have been helped by the appearance of a new type of academic spouse with a career of her own. conclusion It is not possible to sum up the development of university teaching staff over half a century in a sentence or two. The countries of Western Europe have witnessed reconstruction, expansion and the upheavals of the post1968 years, followed by economic squeezes in the 1980s. In the East the Soviet model introduced after 1945 underwent many changes and nally collapsed, opening the road for a university system to be reconstructed along more or less Western lines. The overall picture after 1990 is diffuse. The European Union promises new growth for the economy. This could lead to a high priority for university teaching as an engine for growth as was the case after the Second World War. The integration of universities into a more comprehensive system of tertiary or higher education will change traditional staff structures, especially 201

Thomas Finkenstaedt the traditional qualications required for senior staff. A higher percentage of students and more mature students will force the teachers to give more thought to teaching methods, quite apart from the inuence of modern media. The inuence of global development116 and of the European Union has led to a growing differentiation between curricula taught by diverse staff, more fragmented than ever. The economic drive from Brussels reinforces the trend towards entrepreneurial universities,117 in which teachers are expected to be both innovators and good managers; such qualities tend to enhance the social status of academics, both inside and outside the institution. The Maastricht Treaty says nothing about university teachers because they are not subject to EU regulation. It proposes (Art. 130 f, g) a strengthening of the scientic foundation of industry; centres of research and universities will be assisted in science and technology. The EU will also be engaged in the training of scientists and encourage their mobility. Recent programmes that include a thematic networking of departments across national borders indicate a direction towards planning, and a gradual division of staff into the more and the less useful, which is something quite contrary to the European tradition. Not much thought seems to have been given to such problems by governments and staff associations as yet. The university mandarins have disappeared, donnish dominion has declined.118 The social prestige of university teachers is no longer what it was; the profession is now too large to constitute an elite. But the title of professor is still of considerable social and economic value in many countries, and many university teachers are experts in their elds and take part in the public debate on scientic and general issues. The trouble is that modern issues usually evoke more than one interpretation and no nal word; furthermore, some university teachers cannot resist the temptations offered by the media, politicians or industry. It can indeed be tempting to use an academic position for purposes not connected with ones discipline. But the old attractions are still there: the prestige of research conducted in the university, the considerable degree of freedom of the lifestyle, often combined with job security. We live in a period of transition, and it is not at all clear whether a new image of the university teacher and a new corporate spirit will develop.119 In many subjects it
116

117 118

119

World Bank (ed.), Higher Education: The Lessons of Experience (Washington, D.C., 1994). B. R. Clark, Creating Entrepreneurial Universities (Oxford and New York, 1998). F. K. Ringer, The Decline of the German Mandarins: The German Academic Community 18901933 (Cambridge, Mass., 1969); Halsey, Decline (note 32). Deutscher Hochschulverband (ed.), Das Berufsbild des Hochschullehrers: Thesen mit Erlauterungen (Bonn, 1991).

202

Teachers is no longer possible to know ones colleagues personally, and there is a real danger that the idea of community will disappear completely. We probably cannot do without institutions of this kind, which combine teaching and research, which award the doctorate, which have a core of staff who have chosen scholarship as a profession, and who collectively guarantee academic, scientic and scholarly standards. This important task cannot be carried out by simple majority vote, but only through the peer judgment of highly qualied university teachers this most public and yet least studied of professions, the key profession of the twentieth century120 and perhaps of the twenty-rst as well. select bibliography
Altbach, P. G. (ed.) Perspectives on Comparative Higher Education: Essays on Faculty, Students and Reform, Special Studies in Comparative Education, 22, Buffalo, 1989. Becher, T. Academic Tribes and Territories: Intellectual Inquiry and the Cultures of Disciplines, Milton Keynes, 1990. Bourdieu, P. Homo academicus, Paris, 1984. Boyer, E. L., Altbach, P. G., and Whitelaw, M. G. The Academic Profession: An International Perspective, Ewing, N.J., 1994. Charle, C. (ed.) Le personnel de lenseignement sup erieur en France aux XIXe et XXe si` ecles, Paris, 1985. Clark, B. R. (ed.) The Academic Profession: National, Disciplinary and Institutional Settings, Berkeley, 1987. Clark, B. R. and Neave, G. (eds.) The Encyclopedia of Higher Education, Oxford, New York, Seoul and Tokyo, 1992. Enders, J. and Teichler, U. Der Hochschullehrerberuf im internationalen Vergleich, Bonn, 1995. Giglioli, P. P. Baroni e burocrati: Il ceto accademico italiano, Bologna, 1979. Halsey, A. H. Decline of Donnish Dominion: The British Academic Professions in the Twentieth Century, Oxford, 1992. Halsey, A. H. and Trow, M. A. The British Academics, London, 1971. Maasen, A. M. and van Vught, F. A. (eds.) Inside Academia, Utrecht, 1996. Sindal, H. Structures of University Staff: Schemes of Academic Hierarchy and Dictionary of Terms, Strasbourg, 1966. Teather, D. C. B. Staff Development in Higher Education: An International Review and Bibliography, London and New York, 1979. Teichler, U. (ed.) Das Hochschulwesen in der Bundesrepublik Deutschland, Weinheim, 1990. Williams, G., Blackstone, T., and Metcalf, D. The Academic Labour Market, Amsterdam, 1974.
120

Perkin, Academic Profession (note 29), 1.

203

PART III

STUDENTS

CHAPTER 6

ADMISSION

A. H. HALSEY

introduction In 1945 the European universities were largely if not exclusively nishing schools for a minority of well-to-do or meritocratic young persons, mostly men. A small number of socially selected young people took matriculation examinations, usually widely based in science and arts, and some then went on to the universities to complete a degree. But the system was to be transformed. Throughout Europe since 1945 the number of students enrolled in universities and other institutions of tertiary education rose more or less continuously into the 1990s. Beginning with the American GI Bill, which enabled thousands of veterans from the Second World War to be funded by the state through tertiary education, and with the absorption of Eastern Europe into the Soviet sphere, it became more or less normal practice to engage in one form or another of what we might now see as a historic exercise in retrospective equalizing of educational opportunity. The British further education and training grant was a typical imitative scheme, and all over the Continent the devastation of war notwithstanding expansion of education became the order of the day. This trend continued, albeit at varying speeds, throughout the post-war period that ended with the oil crises of the mid-seventies to the end of the period covered in this volume. A summary of the enrolment gures from 1970 to 1990 appears in table 6.1. Growth in the Western half of Europe outside the Soviet bloc can only be described as spectacular. In the UK, for example, the number of students in universities in 1950 was outstripped by 1990 by the number of university teachers! Though it slowed in the 1980s, there was a doubling of student numbers between 1970 and 1980 in Finland, Austria and the former West Germany. Average annual growth rates were over 8 per cent 207

A. H. Halsey Table 6.1 Enrolments in higher education in European countries in thousandsa (percentage of female enrolments in brackets)
European countries Albaniab Austria Belgium Bulgaria Czechoslovakia Denmark Finland France FRGc GDRd Greece Hungary Ireland Italy Netherlands Norway Poland Portugal Romania Spain Sweden Switzerland USSR UK Yugoslavia
a

1970 14.6 (50) 59.8 (29) 124.9 (36) 99.6 (51) 131.1 (38) 76.0 (37) 59.8 (48) 801.2 () 503.8 (27) 303.1 (43) 85.8 (31) 80.5 (43) 28.5 (34) 687.2 (38) 231.2 (28) 50.0 (30) 197.9 (47) 50.1 (44) 151.9 (43) 224.9 (27) 141.2 (42) 51.4 () 4,580.6 (49) 601.3 (33) 261.2 (39)

1980 25.2 (50) 136.8 (42) 196.2 (44) 101.4 (56) 197.0 (42) 106.2 (49) 123.2 (48) 1076.7 () 1,223.2 (41) 400.8 (58) 121.1 (41) 101.2 (50) 54.7 (41) 1,117.7 (41) 360.0 (40) 79.1 (48) 589.1 (56) 92.2 (48) 192.8 (43) 697.8 (44) 171.4 () 85.1 (30) 5,235.2 () 827.1 (37) 412.0 (45)

1990 22.0 (52) 240.3 (45) 276.2 (48) 188.4 (51) 118.0 () 142.9 (52) 165.7 (52) 1,698.9 (53) 1,686.7 (41) 438.9 (52) 195.2 (50) 77.0 (49) 90.2 (46) 1,452.2 (48) 434.1 (45) 142.5 (53) 544.8 (56) 185.7 (56) 192.8 (51) 1,222.0 (51) 192.6 (54) 137.4 (35) 2,638.0 (50) 1,258.2 (48) 327.1 (51)

Sources: for 1970 and 1980 UNESCO, Statistical Digest 1990, UNESCO Yearbook 1989. D. Kallen in Clark, Encyclopedia III, 1549. The column for 1990 was established by Marilena Filip, CEPES/UNESCO, Bucharest. Main source: UNESCO Statistical Yearbook 1994. Other sources: Czechoslovakia GEO 3 Data Compendium; Greece and Yugoslavia UNESCO Statistical Yearbook 1994; Hungary Education in Hungary, Budapest: National Institute for Public Education, 1997; Romania United Nations Statistical Division; USSR UNESCO Statistical Yearbook 1998. b Only level 6. c Data for 1991. d Data for 1988.

per annum in the 1970s and over 4 per cent per annum in the 1980s. Women account for much of the increase, and by 1990 they made up half of the total, or approaching that gure in most countries. Experience differed in the East compared with the West. In the Eastern European countries in the 1970s growth was slower, at 3 per cent per annum, with Czechoslovakia, Poland and Yugoslavia in the lead and the Soviet Union and Bulgaria in the rear. Then, in the 1980s, development in Eastern Europe was virtually halted. In Hungary, Poland, Czechoslovakia, Romania and Yugoslavia, numbers actually declined in 208

Admission the economic and political crisis years at the end of the decade. Thus the gap in participation between East and West Europe widened. Behind this European-wide educational movement we can detect three motors and at least three resistances. The motors were in the rst place social and economic: the aspirations and the nancial capacity of increasing numbers to nd both wealth and welfare. Yet they were expressed in Europe for the most part politically because the East and the West lived under one of the two main versions of democracy, and both electorates across Europe believed that the state was the main instrument for delivering prosperity and justice. True, the West assumed that private enterprise was essential to liberty, but state-dominated educational systems were the legacy of centuries, and in recent experience the nation state had triumphantly defeated fascism. Governments inspired by Keynesian liberalism knew how to deliver full employment by macro-economic planning. The collapse of this belief in the 1980s is, of course, part of the very different atmosphere in which tertiary systems of education and training came to be managed. In the 1950s, however, spurred on by progressive propaganda, in the East by Soviet-style planning and in the West by the OECD, which was designed to resuscitate the West European economy, labour force efciency was the rst and most obvious motor. Second, and closely connected to the same recent experience, was condence in the capacity of universities to improve technical and technological efciency. The campus had produced the atomic bomb and penicillin. Future prosperity depended on the enthronement of academia rather than the business enterprise as the central institution of a modern economy. Third, and perhaps most powerful, was the drive by nation states to enlarge the access to higher education with which this chapter is principally concerned. Historically the problem had been phrased in both East and West Europe as one of class. Initially, as we have mentioned, it took the form of redress of some of the inequality of the pre-war period. Later, it took the more surprising form of widening access for women, ethnic minorities and mature students. Only much later did it become clear that the traditional class project, in the sense of equalizing relative class chances, had failed in both its Marxist and liberal versions. Such were the motors, but the resistances were formidable. Despite the urge to reform, the autonomy of existing institutions put up spirited defences. The universities themselves tended to remain attached to the Humboldtian and Newmanesque conceptions of the university as an institution. Bruce Truscot became a best seller,1 essentially championing the Oxbridge idea of an enlightened elite of scholars. Not until
1

B. Truscot, Redbrick University (London, 1943).

209

A. H. Halsey Clark Kerr sent a message across the Atlantic in 1963 from his Gifford lectures at Harvard did a genuinely new picture emerge of the university as the intellectual centre of the economic and cultural life of the nation.2 In Europe, moreover, the grip of the selective secondary schools on the mind of the aspiring parent remained strong the lyc ee in France, the Gymnasium in Germany. And an ideology of the pool of ability rationalized the continuing resistance to new provision for wider passage from secondary to tertiary institutions. Second, and not surprisingly, there existed the forces of class and status defence. Nothing motivates parents more, be they bourgeois or party functionaries, than the question of how to pass on their advantages to their own children. Fortunately economic advance was opening more jobs and careers to more educated people, so that the defence of the selective secondary school and the college was eased. But class and status struggles centred on the university admissions ofce increasingly throughout our period. A third and powerful resistance force emerged later in the shape of governmental reluctance to spend on higher education. Three root causes can be identied: the competing claims of warfare over welfare, the unwillingness of electorates to vote higher taxes, and the growing popularity of economic-liberal doctrines of minimal government. It all seemed paradoxical in light of the immediate post-war experience. Yet ageing populations do tend to give rst priority to spending on health and are disinclined to allow governments to spend their money for them in the face of evidence that bureaucracies are inefcient. One might have supposed a rational basis to this reluctance in the recognition that spending on higher education by government is socially regressive. In fact the determined resistance of suburban parents to attempts by economic liberals as well as socialists to cut back student subsidies attests the opposite. The gathering ow of women into the economy, and the rise of the two-earner family, generated increased demand, even within education, for pre-school and nursery provision rather than university funding. Finally, there was the resistance stemming from the anti-market, guild, or public service organization of schools, colleges and faculties, which came into play when the economic-liberal doctrines became paramount in the polities of Europe. The guild and civil service forms of the organization of teachers and researchers were powerful, but in the end they were unable to stem the reorganization of education along market lines. The background of demographic changes must also be mentioned. These, too, were Europe-wide, including the uctuations in fertility that
2

C. Kerr, The Uses of the University (Cambridge, Mass., 1963).

210

Admission occurred in unexplained concurrence. The whole region was gradually transformed after the baby-boom period following the Second World War into a region of unprecedented incipient population decline. By 1990 the typical total period fertility rate had dropped to 1.8, whereas a stable population requires 2.1. The combination of uctuating fertility and secular decline might have led to pessimistic if not catastrophic long-term prospects for the universities. But in fact the demography and relative prosperity of this advanced industrial region created a regime of the third age, in which health and leisure and income are relatively evenly distributed to those who have retired from active labour participation and who form in effect a new and powerful political class with the resources and appetite for further education. Hence the formation of the university of the third age in France, the support for the Open University in Britain, in German-speaking counor the introduction of the Seniorenuniversitat tries and similar institutions across Europe generally.

persistent inequality Properly understood, the class handicap is by no means a peculiar feature of Europe in the post-war period. It pertains to other countries and other periods. A study in comparable terms of thirteen countries supplies crucial evidence for the main themes of this chapter.3 The comparable terms are essentially statistical, as dened by Robert Mare4 to distinguish between two processes: the expansion of the educational system and the selection and allocation of pupils and students. In order to clarify the distinction, Mare uses the notion of transitions, which Boudon had labelled branching points, when children can choose or be selected to proceed to a further stage of education.5 The odds of making the transition are obviously determined by exogenous factors such as the gender, class background, ethnicity, parental education and income, family size, or geographical location of the potential student population. The odds are also an outcome of the given structure of opportunity at the time. Thus, instead of asking the simple question as to how educational attainment processes have changed historically, we can ask separately about the effects of expansion (or contraction) of opportunity and about the
3

Y. Shavit and H.-P. Blossfeld (eds.), Persistent Inequality: Changing Educational Attainment in Thirteen Countries (Boulder, Col., and London, 1993). R. D. Mare, Change and Stability in Educational Stratication, American Sociological Review, 46 (1982), 7287. R. Boudon, Education, Opportunity, and Social Inequality: Changing Prospects in Western Society (New York and London, 1974).

211

A. H. Halsey effects of shifts in the exogenous factors. Mares method or model makes the answers possible through logit regressions. Empirically he shows that when education expands, as it has done in Europe since 1945, the regressions decline across successive cohorts unless the association between social class and educational transitions (the logit effects) increases. According to the characteristic empirical pattern, logit effects tend to decrease in successive transitions. In an expansive period the growing proportions of successive cohorts reaching higher levels of the educational system have less selectivity, and the homogeneity of unmeasured factors becomes lower than for previous cohorts. Thus the logit effects of social origin on higher-educational transitions tended to increase. The end result of this interactive process was a reduction in the variance of schooling, an increase in its mean, but little change in the distribution of relative chances for education between social strata. Our question is whether this generalization applies to all the countries of Europe in the post-war period. The countries covered by the study are the Federal Republic of Germany, the Netherlands, Sweden, England and Wales, Italy, Switzerland, Poland, Hungary and Czechoslovakia. Some non-European countries are also included for comparison (the USA, Taiwan and Japan). The spread, though not comprehensive, enables us to see the general European development in a wider context and to examine the experience of the communist reforms in Eastern Europe compared with the more capitalistic social structures of Germany or the UK, or with the social democratic regimes of Sweden or the Netherlands. Experience leads us to expect educational inequality. In a period of economic and political reconstruction and growth, we would anticipate growing wealth, better health, attempts to respond to popular aspirations for a better society, and a more elevated and peaceable civilization occasioned by the vicissitudes of war. Moreover, we are interested to know how far the different political regimes were able to respond, specifically with respect to access to university or tertiary education. Did the relationship between parental, political and economic characteristics and educational opportunity change after the war, following the demise of fascism and national socialism and with the rise of communism and social democracy? Persistent inequality of educational attainment between class and ethnic groups as well as between the sexes is an old feature of European history. Modes of explaining the pattern have been of two basic kinds: cultural capital theory and the thesis of economic constraint. Cultural capital theory postulates that the poor generally lack the advantages of language, motivation and skill that promote pupils in school and equip them with the capacity to proceed successfully to the university. The alternative 212

Admission (though not necessarily incompatible) theory of economic constraint, advanced for example by Boudon,6 insists that in most countries education has to be nanced from family resources to include both direct costs and foregone earnings. Thus, according to Italian evidence, poorer families need to make higher sacrices and to have stronger ambitions than rich families if they are to negotiate a passage through tertiary studies.7 In this way, cultural and nancial inequalities between classes and status groups combine to produce educational inequalities among their children. The idea of meritocracy is also familiar as a feature of the broad trend towards modernity and the substitution of achieved for ascriptive roles in response to the requirements of an ever more technological economy. Therefore, the connection between social origin and educational qualication should diminish over time, despite the determination of most if not all countries to expand the numbers and the duration of those in statu pupillari. Whether theorists take the modernization or the reproduction view of education, they tend to agree that educational expansion whether responding to the functional requirements of a modern economy or to the competition between status groups for scarce educational resources will lead to greater equality at the lower levels of education. But the two schools tend to differ as to the consequences for tertiary education. Modernization theorists expect that the effects of class origin will evaporate over time; reproduction theorists by contrast predict stability or even increase in the inegalitarian inuences of class hierarchy. Certainly the expansion of tertiary institutions in one way or another produces a new and enlarged hierarchy of prestige and power to place alumni in the professional and managerial structure, so as to make possible both a rising proportion of graduates and a stable differential advantage for those with advantaged class origins.

models of higher education From 1945 to 1989 there emerged two contrasted models of the organization of higher education. In the Soviet Union and the countries of Eastern Europe, post-compulsory schooling was dominated by the state, seen as an antechamber to the modern economy and as the nishing school of the new socialist man or woman. Consequently, the array of appropriate studies was narrow and vocational, and the further ranges of useless
6 7

Boudon, Education (note 5). D. Gambetta, Were they Pushed or Did they Jump? Individual Decision Mechanisms in Education (Cambridge, 1987).

213

A. H. Halsey subjects, like classics, were neglected.8 In the West the movement was also towards science and technology, but less markedly so, and the traditional curricula retained their place. In the West also the private college or university was dwarfed in importance by the rapidly growing state institutions, but it was tolerated. Only outside Europe in the USA and Japan was there a serious development of private universities, and these were mostly of religious origin, especially of new American Protestant sects. In Western European practice, though tending towards the American model (which itself was largely imported from the German universities after the period of their great success in the nineteenth century), there remained a state-dominated system of colleges and universities with government as the obvious prime source of funding for post-war expansion. Expansion cannot be attributed solely to a political drive to satisfy popular desire for the egalitarian widening of opportunities. At least comparable weight must be given to governmental resolve to modernize a country through research and through the education and training of a modern labour force. In the Soviet Union the denition of postcompulsory education as a vast apparatus of production of the labour force required for a modern industrialized economy and a centralized plan seems to have led the political response to what otherwise might have expressed itself as individual aspirations for upward mobility. The slow withdrawal of religious inuences, which had so clearly shaped the evolution of the medieval European university, was also a factor in the post-war era. The triumph of a secular version of university life is evident, least perhaps in Spain, but quite clearly in France; it was particularly striking in the special case of Oxford and Cambridge in England, where foreign observers were often puzzled by the coexistence of monastic colleges and anachronistic admission to close tutorial relations alongside modern laboratory departments, where Nobel Prizes and famous scientic exploits were frequently to be observed. In the USA the separation of church and state had facilitated the expansion of private colleges, in France the Napoleonic revolution had given pride of place to coles, while in England the integration of the Church of Engthe grandes e land into the state apparatus had led to the development of the socially but not academically inferior red brick universities with, among other things, their separate admission procedures. So the picture is more of a spectrum than of a binary division. In the Soviet Union and the Eastern bloc the separation of church from state was in effect constituted after the Second World War by the abolition of the former. The ancient church foundations of Hungarian universities are a typical example.
8

N. De Witt, Basic Comparative Data on Soviet and American Education, Comparative Education Review, 2 (June, 1958).

214

Admission In one sense the intrusion of the state in Eastern Europe can legitimately be seen as a recrudescence of the religiously based controls over matriculation and membership that were previously practised in the Christian medieval and Early Modern universities of the West. It is worth recalling that penalties on opinion and entry were still in force in England until the Test Acts repealed them in 1870. In Hungary, following the 1956 uprising, some hundreds of teachers and many more students were expelled from the universities, and in 1957 organizations like KISZ (Communist Youth Association) were set up and eventually exercised monopolistic control over student life; ideological subjects transmitting MarxismLeninism became compulsory in such a way as to inuence belief, just as Christian doctrine had done in medieval Europe. Only much later, in the 1980s, did the rise of market liberal doctrines and the drive towards privatization and government at arms length begin to make serious inroads into systems of a public character (whether dominated by an established state or an established church). This culminated in the collapse of the communist command economies of Eastern Europe at the end of that decade. Only in the 1990s did new bargains and balances between private and state organizations begin to re-emerge. Many of the consequences of the communist revolutions and the counter-revolution of 1989 are traced in other chapters.9 In the context of matriculation deliberate intrusion by the Communist Party through the state attempted to change the social composition of the student intake and thus the levels of social uidity in society at large. Thus history affords (at a price) an opportunity to compare the efcacy of different social changes to bring about transformation through education. The attempted socialist transformation in Eastern Europe accordingly becomes one of the main features of this volume. Did the socialist transformation work? In fact the use of social classication for admissions was abandoned in 1963 and success in examinations substituted. We cannot know how far it was successful in achieving its aims. The period was short, there was a good deal of cheating, and the party apparatchiks were bound to look for ways of awarding opportunity to their own children; and they found them through side doors, including the right to intervene in the appeal procedures through the ministry. All in all the system of information and competition for prestige and the pursuit of modernity put great pressure on national university systems. News from the West was of paramount signicance to both researchers and to students seeking new revolutions. The importance of this aspect

See, for example, chapter 2 (Patterns), chapter 3 (Relations with Authority) and chapter 8 (Student Movements and Political Activism).

215

A. H. Halsey of university life is that a student revolution was inconceivable in East Germany for more than three decades after it began in Hungary in 1956. Meanwhile the period after the Second World War saw a growth in enrolment, a diversication of curricula, a crisis in relation to the labour market destination of alumni (from both the education and the training systems and at both the secondary school and the tertiary college level) in the mid-1970s. Then, nally, there was a phase of reconstruction in the 1980s in which access and selection were increasingly inuenced by the manifold difculties of the political economies of Western Europe, as well as the political upheavals of Eastern Europe, including sharp rises in public expenditure and unemployment and the rise or resurgence of economic-liberal doctrines of state management. Put crudely, the 1980s were the decade of the market, and the expansion of higher education had to proceed under conditions of scal constraint; this led to much redenition of the structure and purposes of the university. Conspicuous among these developments was a pronounced weakening of the traditionally close link between the academic secondary school and the university. The upper secondary school in all countries became in effect and instead a freestanding institution rather than a conveyance of selected minorities from common elementary schooling to elite advanced education. Of course, in the forties, fties and sixties, selective secondary schools continued to select, though Sweden became internationally famous in Europe as an experimental pioneer in the development of the comprehensive or common school. The crucial branching point was the upper secondary course to prepare for the baccalaur eat or the Abitur or their equivalents in Italy or elsewhere. In Britain it was the sixth form of the grammar or high school where pupils prepared for university entrance. This upper-secondary stage remained important, but its curricula afterwards became more varied in relation to slowly emerging arrangements in most European countries for vocational training as well as for academic education. By 1990 most secondary pupils left school at the age of eighteen, with many postponing entry to higher education, others choosing part-time or full-time attendance at some other form of tertiary education establishment, and still others going straight into employment. However, the patterns between countries varied, either from tradition or from adaptation to new demands or new terms of nancial support. Entry to higher education in Europe and in most developed countries was generally straight from school, sometimes from a particular type of school at which the student had concentrated on academic subjects. Italy had a very specialized structure, with certain types of school leading to specic higher-education categories. In the United Kingdom, as in Japan and the USA, the examination required for higher-education entry could 216

Admission Table 6.2 Preparation for entry to higher education: characteristics of examination requirements
Starting age France Germany Italy Japan Netherlands UKa USA
a

Study years 3 4 5 3 2 2 3

Qualication baccalaur eat Abitur ` maturita Upper Sec-Graduate Leaving certicate GCE A-Levelb High school diploma

Usual age 18 19 19 18 18 18 18

Subjects 9 5 810 6/7 5 6

15 15 14 15 16 16 15

In Scotland, one year of study, in ve or more subjects, leading to the Scottish Higher certicate. b The A-level or advanced qualication was preceded by two years of study, usually in at least six subjects (some compulsory), and generally included mathematics, the native language and one foreign modern language. England, Wales and Northern Ireland were unusual in limiting the number of subjects more narrowly and thus specializing earlier. At least ve passes at GCE (General Certicate of Education, usually taken at age sixteen) were required for degree-level courses, two of which at advanced level (usually taken at age eighteen), although most candidates for entry attempted three advanced or A-level subjects and already had at least six ordinary or O-level passes.

be taken at any type of establishment that provided for post-compulsory schooling, including the rapidly growing sixth-form colleges. In other countries (and in Northern Ireland and some other parts of the UK), children could be selected for entry to different types of secondary education, although there was provision for transfer at later stages; the highereducation entry examination was then usually taken in the more academic schools.

matriculation Each country had a specic national education qualication, which formed the main basic requirement for entry to higher education (see table 6.2). There has always been a passionate controversy over the special position of the advanced or A-level examination in England, which guards entry to the university as does the Abitur and the baccalaur eat in Germany, France and elsewhere. Behind it lie the status and class battles for possession of educational property that were intensied by the reform and expansion movements of the period under consideration. Special arrangements meanwhile exist for the growing body of mature students and those lacking traditional qualications. 217

A. H. Halsey Matriculation into higher education depends mainly on gaining the appropriate entry qualication, although limits on places may mean that a further selection process takes place either for certain types of course or for certain institutions experiencing strong demand from students. In the United Kingdom, entry to all institutions is competitive. In East and West Europe, more generally, the state has increasingly controlled entry to higher education since Napoleonic times, either through dening examination content and standards, or through varied means of student nancial support, or through special schemes of encouragement for particular social categories of students by positive discrimination or, more usually, by setting up barriers to entry. The conquest of Eastern Europe by the Red Army in 1945 brought with it a determined effort to change the terms of admission to higher education in Poland, Hungary, Albania, Yugoslavia, Czechoslovakia, Romania, Bulgaria and East Germany. Old bourgeois conceptions and domination were to be overthrown, and a new era of opportunity for workers and peasants was to dawn. The failure of the original movement within the Soviet Union did not become common knowledge until after Khrushchevs attack on Stalin at the twentieth congress of the communist party in 1956. The Hungarian experience was typical. Admission restrictions had to yield before a huge social demand for admission to a relatively small tertiary sector. Quotas were abandoned temporarily and the gates were opened to all, including women. But the number of places was too small to cope with the demand, and quotas had to be reintroduced and entrance examinations imposed. There was naturally pressure to change the class composition of the student body, given that so many sons and daughters of workers and peasants had previously been denied opportunity to use their talents, either for reasons of nance or qualication from secondary schools. In part the new movement was a continuation of pre-war liberal developments towards popular democracy. As early as 1945 in the communist countries, two-year evening courses for workers were introduced in the universities. After 1947 evening courses were offered alongside the normal day courses. After 1949 candidates for entry were classied with the intention of giving priority to those of peasant or worker origin. And since the number of such children in the secondary schools was insufcient, special matriculation courses were organized. Debate continues about the effectiveness as well as the justice of this method. But there can be little doubt that large numbers of talented and diligent youth were able to take advantage of the chances thus offered by social revolution. In the West some countries like Belgium and France used one uniform national examination. Sweden attempted the ranking of students by marks weighted according to the courses taken and work experience 218

Admission (which tacitly modies age as a selective barrier). The American system of standardized aptitude tests is not used in Europe. Positive discrimination in favour of candidates with working-class backgrounds was practised in Poland and Czechoslovakia, as well as in Hungary, though examination performance was also part of the entrance procedure. Entrance examinations were widely used with higher requirements in medicine, science and law. This led to restrictions in highly regarded professional disciplines such as medicine, pharmacy and architecture; in some countries, like Germany, the rejected students went to countries with an open entry system, such as Switzerland and Austria, thereby overloading the teaching capacity in these expensive study areas. The Norwegian government even went so far as to decide that it was cheaper to subsidize medical studies abroad for its nationals than to set up a new faculty of medicine in Norway. Rejected would-be medical students in Greece often moved to Eastern Europe, where such students were welcome because they were prepared to pay relatively high fees for their studies; this helped the receiving country to compensate for inadequate local state support. Restrictive admissions policies were common not only in highly prestigious institutions such as Oxford and Cambridge in England and the coles in France, but also in the East European communist states grandes e where, at the same time, at least a quarter of the places were reserved for working-class students. Even the lottery played a role: in the Netherlands the problem of excessive demand was overcome by its use. A lottery operated in which an individuals chances were weighted by marks attained in the secondary-school-leaving examinations. Yet the automatic right of entry to university, which is the traditional privilege of those who obtain a baccalaur eat or the Abitur, still gives admission in France and Germany, though not to other forms of higher education. The consequences are visible in the high failure or drop-out rates in the rst two years of undergraduate study. Even in England and Scotland this phenomenon has become apparent since the expansion of the system of higher education to include the former polytechnics in 1992. It is an inevitable consequence of the transformation to mass higher education. In other words, it is possible to use the rst years of university study as a selective device in place of the traditional upper secondary school. It is therefore not surprising that, as late as 1994, there was fear of rioting in Paris and reports of long queues for admission in Bologna. Other countries, like Belgium or Spain, never granted the prerogatives of the Abitur. In France, however, in spite of several university reforms, including the Loi Savary of 1984, the right of entry of a bachelier has never been modied. Of course, selective grandes coles continue to cream off the best 15 per cent of the candidates. And a e numerus clausus was increasingly applied in France and Germany so that 219

A. H. Halsey the right to be admitted became nominal. It did not guarantee a place in any particular faculty of any particular university. In summary it appears that the evolution of matriculation and the admissions system in our period has been to move the point of selection upwards from the upper secondary school and its examinations to the admissions ofces of the institutions of higher education. The traditional system was essentially controlled by teachers in universities. Control now is much more in the hands of politicians, courts and budgetary administrators. Diversity is to be found at both the secondary and tertiary levels; the unique role of the baccalaur eat, the Abitur and their equivalents in other European countries as the rite de passage to university education is no more. Instead there have developed alternative modes of entry to a diverse set of post-compulsory educational and training institutions with the parallel development of vocational equivalents to A-level, the baccalaur eat and the Abitur. In France there was a technical baccalaur eat with twelve options as well as the traditional one with eight sections, and a proposed thirty-option practical baccalaur eat, which was expected to be taken in one form or another by 80 per cent of the secondary-school leavers by the end of the century. In most countries the majority of students rst enter full-time higher education aged between eighteen and twenty-one. At the end of the 1980s the rate of full-time enrolment in this age group was more than 10 per cent in over half of the OECD countries. However, older students are also admitted everywhere; in Germany a quota of places in numerus clausus branches is reserved for them. In the Nordic countries, Austria, West Germany and Switzerland full-time enrolment was higher among persons aged twenty-two to twenty-ve than among those aged eighteen to twenty-one in 1990. Reasons for starting higher-education studies later in life are many. In some countries there is compulsory military service, while some students pursue lower-level further education full time or enter employment; still others may retake entry examinations and so increase the range of institutions that will accept them. It appeared by the end of the period that the articulation of the formal education system to the labour market in Europe was entering a new state of ux. It was not only that the macro-economic management associated with Keynes, Bretton Woods and the left-wing-planning governments of the 1950s and 1960s was collapsing. Nor was it only that the command economies of Eastern Europe were rapidly eroded at the end of the eighties. It was also that the gender division of labour was now being comprehensively renegotiated, and that the career to which university admission had been traditionally a key, with its lifelong employment in a superior trade or profession, was disappearing. Part-time and temporary contracts were becoming normal, not only for casual, unskilled and 220

Admission Table 6.3 New entrants to higher education: 1983

Duration of rst degree courses (years) 4 4 5 4 5 3e 4 Total number of students (000s) 1,144 1,503 182 2,403c 384 1,007 1,246 Enrolments per 100 of 1824 year-olds in population 19 29 18 21 22 15 44 Percentage of student cohort trained at universities 82 87 99 81 42 42 62

Country Francea Germany Italy Japan b Netherlands UKd USAf

a

Year 1983 1984 1984 1984 1983 1984 1984

Includes an unknown number of students enrolled at both university and non-university institutions simultaneously. b Includes enrolments at private colleges, estimated at 1.8 million in Japan and 2.7 million in the USA. c Includes enrolments on correspondence courses. d Includes nursing and paramedical courses at DHSS (Department of Health and Social Security) establishments. Excludes private sector enrolments, estimated at some 0.3 million. e Four years in Scotland. f Percentages of enrolments by level are based on proportions qualifying in 1982.

unschooled work, but also for professional and technical appointments. Europe, along with the rest of the advanced industrial world, was entering a profoundly different phase of the development of its economy and society. In future there was to be not simply admission or rejection, but widening opportunity for readmission, for recurrent education, and for serial partnership or cohabitation in a two-earner family, sometimes living apart, often migrating between insecure jobs. Structured youth unemployment was to accompany much greater investment in university study. Easier capital ows portended a much less stable regional division of labour. A new world was emerging in which admission to higher education was destined to take an enlarged but different role in the distribution of life chances. The standard recommended by the OECD for comparisons of entry to higher education relates all new entrants (irrespective of age) to a derived year group appropriate to each country. New entrants are intended to be rst-year students, excluding those already qualied in higher education, such as graduates, and those with a level 5 qualication, aiming for a rst degree. The relevant year group recommended by the OECD is the total population of the age group, which includes 70 per cent of new entrants, divided by the number of years involved. New entrants to parttime study are included. The overall student count is the measure most commonly available from international sources; but such gures actually 221

A. H. Halsey Table 6.4 Percentage of enrolment of women 1972 and 1984

Below degree 1972 Francea Germanya Italy Japan Netherlandsa UKg USAg, h
a

Degree 6 51 38 46 24 38 45 51

Postgraduate 7) 39 33 32 13 34 45

1984 49c 42 45 34f 42c 45 51c

(level 5 50 65 56 85 48 48 55

47b 33d 38 29e 31d 42 43

Level detail based on 1982 or 1983 data. b 1973. Universities only. c 1982. d 1974. e Includes correspondence courses. f Includes private colleges and correspondence courses. g Includes nursing and paramedical courses at DHSS (Department of Health and Social Security) establishment. Excludes private colleges. g Includes private colleges. h Level of detail based on proportions of qualiers in 19823.

provide a misleading guide to participation in higher education because of varying course lengths and wastage rates. They can, however, be used to compare and contrast the structure of higher education in each country. For example, in Italy nearly all higher education is classied as taking place in universities and only 3 per cent is indicated as being of below degree standard. By contrast, in the Netherlands only 42 per cent is attributed to universities and 59 per cent described as of below degree standard. The differences between countries are more noticeable than the similarities. The percentage of women in higher education increased in all countries considered over the period 1972 to 1984, most markedly in the Netherlands (11 percentage points). In the Netherlands and Germany the percentage of women pursuing postgraduate studies in 1982 was not below the percentage of their overall enrolment in 1972. By 1991 half of European women aged 2564 years had attained some kind of tertiary education. It may turn out, as we have suggested, that a principal feature of the post-war history of higher education in Europe was the elaboration of alternatives to the university. Ambitious expansion, doubling in a decade as the progressive slogans of the 1950s had proposed, altered the terms of entry and the denition of what was to be learned in a university all over Europe. The old stereotype of entry through completion of the baccalaur eat or equivalent leaving certicate from a lyc ee or other upper secondary school into a full-time course of three or, in Continental countries, more years in pure science or pure arts was to be transformed into 222

Admission a large variety of courses, typically vocational or preparatory to professional training, and offered in a wider range of institutions, residential and non-residential. The development of mass higher education was dawning in Europe, increasing participation to signicant proportions of the young and, in effect, replacing the older idea of the university in Europe by a much more expansive and, as some traditionalists would argue, a diluted conception of tertiary rather than higher education. social selection before 1970 Studies of social selection through education in the earlier years of our period have now become available.10 On the whole they are consistent and complementary. They conrm that, within the European region, German higher education expanded from a low point immediately after the Second World War and that, in the process, there was a reduction in social selectivity for the population as a whole and for women, but no serious change in the relative chances of children from the disadvantaged classes. Tertiary education remained linked characteristically to the socially superior end of the class structure with respect to recruitment and also to placement in an occupational career. This was the essential shape of meritocratic development in Europe and the role of the university within an expanding and elaborating system. The picture is complicated, not least by variation between countries in demography, the structure of the economy and the historical peculiarities of national arrangements for access to the stages of education, their curricular content, the type and availability of student nancial aid, and the links between educational qualications and entry to professions and trades. Thus, for example, where a country had a large agricultural sector as in France or Poland, the signicance of educational selection was minimized for the sons of farmers. Where, as in the UK, education was relatively loosely connected to qualications in the labour market, it has been possible for relatively democratized access to the universities to emerge. There was remarkable contrast between France and the UK. Adjusting for the difference in the shape of the occupational structure, it turns out that those who acquired a higher tertiary degree had serviceclass origins of 55 per cent in France and only 35 per cent in England. So, at least in the earlier post-war years, the system of selection in France
10

Shavit and Blossfeld, Inequality (note 3); W. Muller and W. Karle, Social Selection in Educational Systems in Europe. Paper presented to the meetings of the International Sociological Association, Research Committee on Social Stratication, XIIth World Congress of Sociology, Madrid, July 913, 1990, in S. J. Bail (ed.), Sociology of Education (London, 2001), 71749; Y. Shavit and W. Muller (eds.), From School to Work: A Comparative Study of Educational Qualications and Occupational Destinations (Oxford, 1998).

223

A. H. Halsey gave the offspring of the service classes compared to children from other social backgrounds better odds of surviving up to the highest educational level than they had in other countries. For nine European countries, beginning at a less than 10 per cent proportion of the pupils in primary school, the service-class children grew to a cross-national European average of about 45 per cent among those who attained a higher tertiary degree. England did not stand alone at the lower end of social selectivity but shared its relatively egalitarian position with Scotland and Northern Ireland. There is also an interesting contrast between Germany and France. By the end of compulsory schooling the proportion of service-class children was highest in France and remained so through the successive stages or transitions. In Germany the proportion of service-class children was lowest until the stage of an intermediate secondary degree, but then increased more than in most other countries until, at the end point of the educational career, Germany was placed in an intermediate position. Interestingly, the two command economies or communist countries included in the study were not among the most egalitarian from the point of view of class opportunity: Hungary in particular is near the top of the league for distributing most certicates of higher education to the higher social classes. There are two important processes common to the countries that have inherited the European university. First, educational systems are organized so as to allow ever decreasing fractions of a student cohort to survive at each successive stage of education and, second, dropping out is socially selective though with decreasing severity. The outcomes consist of an interplay between these two processes. On the one hand the policies of expansion gradually move the systems of higher education through mass towards universal provision and a fortiori towards equality. On the other hand selective forces continue to shape the composition of the student body into a selective social hierarchy. Studies of the earlier years of our period show that the European countries differed strongly in the extent to which they provided opportunities for obtaining educational qualications to each successive cohort of young people. The data were collected in the early 1970s and the analysis relates to those aged thirty to sixty-four, that is, born between 1910 and 1947. They therefore had left their schools or universities mostly before 1970. Only a small proportion of them were affected in their educational careers by the reforms of the 1960s and 1970s in the West European nations, but educational change in East Europe had been initiated earlier, as we have described in the case of Hungary. Thus, for earlier years, the data present a pattern which is essentially binary. The UK and Sweden had a similar survival pattern from which Germany, Hungary, Poland 224

Admission and France differed. The sharpest contrast was between France and Germany. In Germany 85 per cent of pupils survived beyond compulsory schooling, in France only 30 per cent. Hungary and Poland had the highest survival rates up to the end of a full secondary education. Yet, given the differences in survival rates between nations in early schooling, the remarkable feature of the systems as a whole is their similarity of outcome at the upper end. At that point only France is distinctive with its exceptionally low fraction of the population obtaining a degree from an institution of higher education. Within the context sketched above, the study draws attention to particular features of class selectivity. In Germany, Hungary and Sweden the upper service class appears to have given its children rather superior chances of educational survival. This nding ts with the observations of historians of the Bildungsburgertum , a social stratum of civil servants, professionals and teachers in higher education, which has traditionally shared a set of common values associated with the experience of higher education and a relatively higher determination to pass on high standards of educational ambition and achievement to their children. The Bildungsburgertum was probably most distinguished as a status group in Germany, but it also existed in other countries that were inuenced by the German tradition of higher education, such as Sweden and the Austro-Hungarian monarchy.11 English society in the early twentieth century was distinctive in not having such a broad and educationally dened upper class. Entry to the upper echelons of British society was not so clearly restricted to educational channels. France, like Britain and Germany, illustrates the exponential increase of admissions to universities since the Second World War. Between 1900 and 1967, student enrolments in the French faculties multiplied by fourteen (from 29,759 to 428,479). But the upward movement had been more or less halted between 1900 and 1915 and again between 1925 and 1940. Then in our period and just before 1951 the numbers began seriously to climb. The rate of increase accelerated after 1960, multiplying 2.15 times in the six years from 1960/61 to 1966/67. The proportional growth rate stayed above 10 per cent each year despite the absolute increase in the numerical base. Though aided by the increased numbers resulting from the post-war baby boom, French student numbers were predominantly a product of the rising educational aspirations of the 1950s and 1960s, and they continuously outstripped ofcial forecasts as they did elsewhere in Europe. Thus French enrolment in higher
11

W. Conze and J. Kocka (eds.), Bildungsburgertum im 19. Jahrhundert. Vol. I: Bildungssystem und Professionalisierung in internationalen Vergleichenen (Stuttgart, 1985).

225

A. H. Halsey education had been 2.0 per cent in 1946 (students aged 1924 as a percentage of the French population between those ages), while further back in 1911 it had been 0.7. It rose to 3.6 in 1960 and to 6.0 in 1966. There was a slow-down in the 1970s, but by 1983 the level was typical of the European countries, as may be seen from table 6.3 where it is recorded as 19 (per 100 of the 1824 population). Plans for the end of the twentieth century assumed, however, that 75 per cent of the relevant age group would go on to some form of higher education. With respect to the recruitment of women, it may be recalled that French critics of their own society, though pessimistic at the end of the 1960s about the democratization of access from the point of view of class inequality, saw sexual equality as a front on which France had advanced more than most other European countries. The percentage of women among students in the university faculties in 1955 was 36.4 and this proportion rose steadily to become 42.6 in 196566.12 In 1984 the proportion was 49 per cent higher than in the other major European countries.13 With respect to class inequality, we have already noted the high degree of selectivity, and this handicap of stratication appears to have persisted throughout the period.

social selection after 1970 Traditional access to higher education had been synonymous with universities, colleges of art and sports, theological universities and teacher training colleges. In the typical and model case of Germany the minimum duration of a university course was four years. The system was extended in the early 1970s through the establishment of Fachhochschulen (short-cycle higher-education institutions). These courses lasted three years, mostly in technical and economic subjects and mainly for men. In the mid-1970s a few Lander founded academies of higher education linking practical training in enterprises with theoretical education in schools and colleges. These academies (Berufsakademien) were relatively successful in placing their graduates, mostly in the companies in which they had been trained. Access had several routes, but the traditional one was through completing upper secondary school and gaining the Abitur, thus securing the right to study at a university or Fachhochschule. A few special schools were founded in the 1960s to enable young people to go on to post-secondary studies with an intermediate certicate acquired at a vocational extension school or Gymnasium (grammar school). From the mid-1970s increased
12

13

C. Grignon and J. C. Passeron, Innovation in Higher Education: French Experience before 1968 (Paris, 1970), 84. OECD, table 14. See table 6.3.

226

Admission numbers of grammar-school leavers took alternative choices. One important destination was apprenticeship training in the dual system; another was a vocational path in health-care schooling. It was also notable that some grammar-school leavers began to enter higher education after completing apprenticeship, thus having two qualications an occupational training certicate and a university (or Fachhochschule) degree. In the 1980s increased numbers of school leavers with the Abitur went to Fachhochschulen because of the relatively favourable employment prospects. High unemployment among university graduates also led to a substantial number of rst-year students transferring to Fachhochschulen for the same reasons. One background factor in all European countries has been demographic uctuation. In Germany there was a baby boom in the 1950s that by the mid-1960s had produced more than 1 million annual births. But in the following decade the birth rate dropped dramatically to 0.6 million births in 1984. Births then temporarily became steady before continuing their downward paths in the 1990s. In the long run fertility has its effects. But the demographic inuence has been minimal by comparison with the growth of individual demand. That demand is measured by participation rates. Thus in 1960 28 per cent of eighteen-year-olds took part in education and training; in 1985 the overall participation rate rose to almost 80 per cent, including apprenticeship. Germany, along with Denmark, had the highest enrolments among all the EEC countries in 1990. A clear view of the German experience has been provided by Blossfeldt14 as part of an international comparison of thirteen industrialized countries, using data from the German socio-economic panel covering a sample of the whole population of West Germany and aiming to uncover trends in the educational attainment of social-class groups arranged by birth cohorts from 1916. A commonplace assumption in sociology is that educational expansion has decreased the effect of social origin and gender on educational attainment, that is, that ascription has been displaced by achievement in the selective process. Thus for the German, as indeed for European universities generally, we would expect to nd that women and students with working-class social origins became more prominent on the campus between 1945 and 1990. Blossfeld distinguishes between attainment and opportunity. The former is reected in rising rates of qualication in successive birth cohorts. The latter is reected by measures of social selectivity at each stage or branching point in the educational system through which students pass on their way towards an occupational career.
14

See note 3.

227

A. H. Halsey The results conrm rst the established belief that both sexes have proted from expansion in terms of the attainment of graduate status, and indeed that the post-war period has seen a convergence between womens and mens attainment levels. However, the uctuations in this trend are equally worthy of note since they reect changing historical circumstances. Most particularly it emerges that men and women born between 1926 and 1935 in Germany obtained degrees in smaller proportions than the birth cohorts of 1919 to 1925. It seems reasonable to suppose that the younger group had their educational aspirations lowered by the harsh conditions of poverty and migration of the immediate post-war years when they were ten to twenty years old. These forces acted particularly strongly on women. Afterwards, during the years of economic miracle in West Germany, the long-run trend to sexual equalization continued and accelerated. It is only with the birth cohort of 19415, which came to the appropriate age in the late 1950s and the early 1960s, that the proportions of persons taking professional qualications and degrees began to increase. These proportions then grew at an accelerating rate. Germany was a latecomer to the expansion of secondary education, and also, incidentally, expansion began before the structure of secondary and tertiary education was reformed in the late 1950s and the 1960s. The convergence of womens and mens performance in these advanced examinations emerges as a consequence of educational reform. But the relatively slower progress in the taking of professional qualications, which can be seen among women born after 1950, illustrates the higher dependence of expansion in this type of higher education on economic as compared with political conditions. After the Second World War there was renewed development of the universities in Europe based on the widespread resolve in both political democracies and state communism to plan a world of enlarged opportunities for the mass of the people. Britain, with its combination of highly restricted but socially mixed entry compared with other European countries, as well as its unique status as an impoverished victor of the war, deserves a special mention. The Robbins Report of 1963 (named after the chairman of the Committee on Higher Education, Lord Robbins) heralded further expansion in British higher education. In the following period, from 1963 to 1990, expansion continued in such a way as to obliterate Robbins as a numerical landmark. Absolute numbers of students in the higher-education system rose every year. In 1962 the total number of full-time students was 216,000. By 1988/89, including part-timers in universities, the Open University, the polytechnics and other colleges offering advanced courses, it was 964,000. Apparently, therefore, Britain had and indeed still 228

Admission has a record of successful development of its investment in higher education through uctuating economic fortunes and through Labour and Conservative governments. In fact the story is less simple and more interesting. Less simple because the numbers have risen at varying rates. More interesting because the denition has widened from the original conception with which Robbins began. Britain, including Scotland and Wales, mirrored Europe, but it was also distinctive in its sumptuous provision for undergraduates, its three-year degrees and its concept of further as differentiated from higher education. Higher education, in successive steps, invaded further education. The denition moved gradually, and continues to move, towards the American conception of higher education as including all post-compulsory or post-secondary schooling. So the statistics begin with full-time or sandwich-course students and end with all full-time and part-time students in a wide range of colleges additional to the traditionally dened universities. The system after 1992 became one in which the former polytechnics and colleges (including Scottish central institutions) contributed 55% of the student total, with the Open University taking 9% and the old universities 36%. Underlying this description lies the commitment to a unied mass provision of post-compulsory opportunities towards which educational reformers have been slowly moving for at least a century. Economic and funding vicissitudes apart, a demographic and an educational factor underlie the trend of university numbers in the UK and in other West European countries. The number of eighteen-year-olds peaked at over a million in 1965, fell to 800,000 in 1973, rose again to nearly a million in 1981 and then fell to nearly the 1973 level in 1990. These wide, even wild, oscillations were, however, evened out by the rising productivity of the secondary schools. The percentage of the age group with two or more A-levels (advanced level in the General Certicate of Education) rose from under 8% in 1962/3 to nearly double that proportion in the late 1980s (15.3% of boys and 14.1% of girls in 1984/5). Nine out of ten of those who enrolled in full-time degree courses became eligible for a grant towards tuition fees and maintenance following the Anderson Report of 1960, and the proportion of graduate students, though uctuating, also rose slightly from 16.9% in 1965/6 to 17.7% in 1989/90. As to the composition of the enlarged student body, the question arises as to whether quality has been maintained. Britain offers clearer and more detailed evidence than most other European countries on this issue. For students in higher education as a whole, there has been an increase in the age participation ratio (dened as the proportion of home students under twenty-one years to the eighteen-year-old population of the UK in the year of entry). Before the Second World War it had been less than 3%. Just before the Robbins Report in 1962/3 it was 7.2%. It rose steadily 229

A. H. Halsey Table 6.5 Age-participation ratios (APR) for students in British higher educationa
First-year home student aged under 21 in higher education (000s) 1962/3 1972/3 1977/8 1982/3 1984/5 1985/6 1986/7 1987/8 1988/9
a

18-year-old population of GB (mid-year in year of entry) (000s)

APR (col.1 as % of col. 2) 7.2 14.2 12.7 13.5 15.2 15.2 15.7 16.0 16.9

138.5 137.3 137.1 139.0 141.7

912.5 902.2 873.2 867.7 839.9

Sources: DES Statistical Bulletin, No. 1990, and OPCS Population Estimates Unit

Table 6.6 British university entrants: A-level scoresa

Scores 1971 1972 1981 1984 1988 Scores 1989 38 28.0 29.8 24.2 14.8 16.6 615 12.6 912 46.7 43.9 43.7 49.3 48.5 1625 54.2 1315 25.3 26.2 30.0 35.7 34.9 (61,225) 2630 33.2 (70,219)

Source: UCCA Statistical Supplement, 1987, table B5, 19889, table 2C a Home candidates accepted through the organization that processes applications for full-time undergraduate courses at UK universities and colleges, UCCA (the Universities Central Council on Admissions, UCAS since 1993), 197189 (% with various scores). Note: Only candidates with three or more A-levels are included and the best three counted with grade A = 5, B = 4, C = 3, D = 2 and E = 1. The scoring system was changed in 1989 to include supplementary AS qualications. The Robbins Report in 1963 recommended that the proportion of eighteenyear-olds going on to full-time education in Britain, which was then 8.5%, should rise to 17% by 1980.

230

Admission Table 6.7 Expansion of British higher education, 1970/1 to 1988/9, for various categoriesa
1970 (000s) University full-time undergraduates Male Female Polytechnics and college students, full-time Male Female Total full-time students from abroad Male Female Total full-time students Part-time university students Male Female Polytechnic part-time, day Male Female Polytechnic part-time evening only Male Female Open University Male Female Total part-time students Male Female Grand total part-time Grand total HE, full- and part-time
a

1988/9 (000s) 139.7 109.7 147.9 146.7 21.1 14.0 579.1 29.0 21.1 118.5 67.0 38.1 26.5 45.0 40.3 230.6 154.9 385.5 964.6

Addition (000s) 11.4 52.7 45.9 33.6 4.8 6.0 144.8 10.9 15.4 48.7 60.3 1.7 21.5 30.7 35.3 88.6 132.5 221.1 365.9

% 8.9 92.5 45.0 29.7 18.5 75.0 33.3 60.2 270.2 69.8 900.0 4.2 430.0 214.7 700.6 62.4 591.5 134.5 61.1

128.3 57.0 102.0 113.1 25.9 8.0 434.3 18.1 5.7 69.8 6.7 39.8 5.0 14.3 5.0 142.0 22.4 164.4 598.7

Sources: calculated from DES, Statistics of Education, iii, Further Education and vi, Universities.

until 1972/3 but then the age-grade chances fell (to 12.7% in 1977/8) and did not climb back to the 1973 level again until 1984, when they rose to 15.2% and further to 16.9% in 1988/89. The general line of development is clear. In the early 1960s British professors were looking cautiously towards modest expansion and envisaging a system of higher education not fundamentally different from the highly restricted access provided by the universities before the Second World War. Public discussion led by educational progressives and those who took optimistic views of the educability of the population joined with a growing conviction among industrialists and politicians that a much more highly educated younger generation was needed to ensure 231

A. H. Halsey the wealth of the nation. Then experience of larger numbers in the postRobbins decade encouraged more and more university teachers to believe that larger proportions of each new generation were capable of receiving what they had to offer in some form. The bulk of the expansion then took place in the polytechnics and colleges. In the process, the boundary between higher education and further education was tacitly shifted. shifts in the social distribution of opportunity At this point, it is possible to see the evolving institutional and opportunity pattern of developments since the 1960s. The general pattern of expansion is illustrated and disaggregated for the UK in table 6.7. Expansion, as should be stressed, was not a simple linear progression. Universities, and higher education generally, are always in competition for shares from the public purse and therefore vulnerable not only to shifts in national prosperity, but also to both political priorities and arguments about the social return to educational investment. Against a general international background of pro-educational policies there have been ebbs and ows of public condence as to the desirability of expanding post-compulsory schooling. If we recall Adam Smiths remark that the word scholar had been synonymous with beggar in the medieval origins of the European university, we may thereby highlight the fact that, in the debate leading to the expansions after the Second World War, the perceived relationship between scholarship and society was virtually reversed. Scholarship had been a decorative dependency; now it became received opinion that society needed scholars and scientists to be productively and efciently modern. So it was out of conviction of its usefulness that higher education was justied in the 1950s and 1960s. The arguments, true or false, persuaded politicians and constituents that the policy must be expansion. Progressive opinion held that the rise of the graduate was to be of parallel historical importance to the rise of the gentry in the sixteenth century. Educational evolution was destined to pass by stages from elite through mass to universal higher education. Down the ages exemption from exacting, lifelong labour had been the privilege of minorities, exploiting the gullibility, weakness or subservience of the majority. But now, the higher literacy and numeracy of advanced society was to be extended to all. The rich and privileged, of course, had always had more or less rigorous and lengthy education and training for their stations. These traditions, whether priestly or military, represented education as an investment. Only for the aristocracy and bourgeoisie was higher education in any serious sense a consumption good. But now, backed by orthodox economic authority, it was increasingly possible to think of education as investment in human social capital necessary for a 232

Admission modern society, and appropriately undertaken by the state, with a wide social distribution of education as consumption an appropriate and desirable consequence. Investment education was to be distributed by merit, consumption education by democratic right. Not until Fred Hirschs seminal Social Limits to Growth15 did education, expanded and democratized, come to be seen as a positional good, preserving scarcity and frustrating democracy. Expansion, it became clear, does not automatically admit everyone to the educational franchise. So long as jobs are allocated competitively according to certicates issued by educational authorities, scarcity must persist. Education, accordingly, remained a competitive struggle for positions in the queue for the more desirable jobs. Social determinants of educability retained their importance along with a politics of education, which was increasingly focused on the higher stages of schools and colleges. Expansion, despite the student troubles in Paris, Nanterre, Berlin and London in 1968, and American doubts about the graduate market, which might have given pause, were also sources of news. There were virtually inexhaustible questions about higher education, so recently an obscure rite de passage in the late adolescence of tiny and irrelevant, if privileged, minorities. What, where, how and to whom a vastly elaborated higher education was to be given were now larger and absorbing new questions. They emerged from a European society that was developing serious unease about the serviceability of its established institutions economic, political and educational for a future without the old external assurances of empire and economic superiority, or the internal solidarity of European civilization. The 1980s offered a thousand lessons in disillusion, and the rst of these was expansion itself. During the 1970s there were successive reductions in anticipated student numbers. In the preceding decade the age-participation rate had doubled from 7 per cent to 14 per cent; but in the seventies it fell back again. Moreover, this waning attractiveness of education beyond school after the waxing hope and resolve of the later sixties portended ill for the eighties and nineties, given the reduced birth rates. Here was the major disillusion of the seventies: the demolition of the fond belief that universities and colleges had an assured and, for practical purposes, an unending growth. Clearly, for the 1980s, either retrenchment or a sombrely revised programme of educational expansion with very different assumptions about the funding and working conditions of intellectual labour had to come. That had been the post-war history of the academy. Growth faltered in the mid-seventies, but European national incomes rose again, at least for
15

F. Hirsch, Social Limits to Growth (Cambridge, Mass., 1976).

233

A. H. Halsey the majority, in the 1980s. Educational expansion continued, partly by enlarging the denition of higher education, locating it in colleges that had been previously allocated and administered under the heading of vocational or, in Britain, further education, and in the Open University as well as in what had come to be labelled conventional universities. Parttime attendance and short courses multiplied, for example in the French IUTs and other centres of short-cycle education and training beyond the secondary school, thus adding to what was previously stereotyped as a full-time, three-year, residential system for young men. Why did this expansion, albeit in the form of increased but also devalued opportunity for students and their teachers, continue and even become the rst priority of both conservative and socialist parties? Why, admittedly after dropping back to 12.5 per cent in 1979, did the British participation rate for eighteen- to nineteen-year-olds rise to 16 per cent by 1989, with targets of one-third or more set for the end of the century? Taking a long view it may be remarked that idleness has two closely related, but not synonymous, alternatives: leisure and unemployment. The point of economic growth is to achieve leisure, to avoid unemployment, and to prot from a special post-industrial form of idleness, that which was praised by Bertrand Russell: the release of scientists and scholars from mindless toil so that they might invent more powerful modes of human command over nature material, aesthetic and moral. Higher education, on this view, is a justied form of idleness without stigma. It is the use of idleness to beget idleness, but the former is constructive research creativity, while the latter is the leisure of a consequently more civilized society; neither involves unemployment, except as failure. Yet the 1970s in Europe saw a dramatic shift in our appreciation of idleness. On one view the nations, whether victors or vanquished in the second war, may be said to have reaped the reward of past labour and past research, which is economic growth taken out in increased leisure. On another view Europe entered a more conspicuously dangerous phase of the so-called British disease, which is idleness in the form of overmanning, the perpetual tea break, sleeping bags on the night shift and so on. The parallel in the academy is clear. Both scientic productivity and literary inventiveness necessitate leisure (the 1:8 ratio, the sabbatical, the long vacation, dons dont keep hours), and the whole point of it all was to increase human domination of the universe so as to provide more leisure for more civilized use. Again unemployment meant failure. Then from the mid-seventies on, rst in America and later in Europe, came strident challenges to the justication of higher education. It was bound to happen. Europe was adding more students in the quinquennium of the early 1970s than the total attending universities before the war, and 90 per cent of the cost was being provided directly by the state. 234

Admission Academics had persuaded politicians, employers and philanthropists that their wares were a paying investment for the nation as well as for individuals. Education was reckoned to yield a higher rate of return than factories or machines. It was, moreover, claimed to be the source of still higher rates of return in the future, because higher learning produced technological advance. Educational expansion was widely seen as essential to competition in a global marketplace for increasingly skilled labour in technologically advancing economies. These arguments justi coles as well as Imperial College. Parallel arguments ed the grandes e had claimed that professors could guide politicians to good government. Keynesian macro-economic demand management could be supplied to governments and the international agencies of the European Communities and the OECD, and administrative intelligence could be recruited from the Ecole Nationale dAdministration. These claims now received increasingly sceptical scrutiny as the bill for buildings, salaries and student grants mounted, and nally came under direct attack especially on the weakest ank, that of the recently expanded social sciences. Arguments from utility had almost entirely displaced arguments from idleness. But monetarist, market-oriented governments, determined to reduce public expenditure, were temporarily unreceptive to both kinds of arguments so that, for the rst time, at least in living memory, the real resources of higher education, as traditionally dened, began to fall. What was perhaps especially remarkable about the 1980s was their illustration that the revolution of rising expectations was not the irresistible force that it had commonly been supposed to be in the 1960s. Not only could utility arguments be questioned, and social demand principles shown to be far from inviolable, but the attractiveness of higher education itself (as manifested in the demand for places from qualied secondary-school-leavers) could decline. Somehow European society, by 1981, could nd itself tolerating mass involuntary idleness on the scale of the 1930s, despite the continuation of social inequalities of access to universities and colleges which the post-war and post-1968 reforms had been invented to eliminate. Unhappily, then, the 1970s saw little progress towards the democratization of leisure, which a modern system of higher or continuing education should represent. Instead, the end of the decade saw governments, whether of the left or of the right, groping for solutions to external checks on economic growth, while the minority of the educated began to be more sophisticated about the nature of education as a positional rather than an investment or a consumption good, and the majority remained in blighted ignorance that education had anything seriously constructive to offer to either private or public life. Nevertheless, the story remains unnished. Both economic fortunes and political pressure moved in the later 1980s. On the economic front a much disputed restructuring of 235

A. H. Halsey the economy with an also disputed movement towards expansion of the European Union had profound educational consequences. The achievement of competitive advantage impelled renewed educational expansion. Invidious international comparison excited almost hysterical reorganization of training arrangements and reinforced pressure towards vocational education at all levels of schooling. From different standpoints and with different assumptions, parties of the left, right and centre began to share the view that a mass system of higher education was inevitable for the twenty-rst century. In the new educational era, mass higher education would accommodate one school leaver in two. It must be immediately added that plans for funding the new expansion remained vague. The drive towards increasing reliance on tuition fees became a heated debate. Governments also encouraged universities and colleges to seek funds from the private sector, particularly from industry and commerce, benefactors and alumni. A fair share of public expenditure is guaranteed to higher education, but the nal emphasis is on further efciency, which the embattled academics interpret as a levelling down of standards and still further reduction of staff/student ratios. The struggle will doubtless continue well into the twenty-rst century. But by the end of the twentieth century one thing was sure: the binary line, to use the English terminology, had lost its ofcial status and a post-binary system had begun.

select bibliography
Annan, N. Our Age, London, 1990. Ashby, E. Education, Economy and Society, Chicago, 1961. Boudon, R. Education, Opportunity and Social Inequality: Changing Prospects in Western Society, New York and London, 1974. Bourdieu, P. and Passeron, J.-C. Reproduction in Education, Society and Culture, London and Beverly Hills, Cal., 1977. Carswell, J. Government and the Universities in Britain, Cambridge, 1985. Collins, R. The Credential Society: An Historical Sociology of Education and Stratication, New York, 1979. Dore, R. P. The Diploma Disease, London, 1976. Fulton, O. (ed.) Access to Higher Education, Guildford, 1981. Gambetta, D. Were they Pushed or Did they Jump? Individual Decision Mechanisms in Education, Cambridge, 1987. Halsey, A. H. Decline of Donnish Dominion: The British Academic Professions in the Twentieth Century, Oxford, 1992. Halsey, A. H., Heath, A. F., and Ridge, I. M. Origins and Destinations: Family, Class, and Education in Modern Britain, Oxford, 1980. Halsey, A. H. et al. The Political Arithmetic of Public Schools, in P. Walford (ed.), British Public Schools, London, 1984.

236

Admission
Higher Education: A New Framework, Cm. 1541 (White Paper presented to Parliament), London, 1991. Hirsch, F. Social Limits to Growth, Cambridge, Mass., 1976. Husen, T., Tuijnman, A., and Halls, W. D. Schooling in Modern European Society: A Report of the Academia Europaea, Oxford, 1992. Kerr, C. The Uses of the University, Cambridge, Mass., 1963. Kogan, M., and Kogan, D. The Attack on Higher Education, London, 1983. Moberly, W. The Crisis in the University, London, 1949. Moser, C., Our Need for an Informed Society, Presidential Address to British Association for the Advancement of Science, London, 1990. OECD. Ability and Educational Opportunity, ed. A.H. Halsey, Paris, 1961. OECD. Education in OECD Countries 198687, Paris, 1989. OECD. From Higher Education to Employment, Vol I: Australia, Austria, Belgium, Germany, Paris, 1992 OECD. From Higher Education to Employment, Vol II: Canada, Denmark, Spain, USA, Paris, 1992 OECD. From Higher Education to Employment, Vol. III: Finland, France, Italy, Japan, Netherlands, Norway, Paris, 1992. Ringer, F. K. Education and Society in Modern Europe, Bloomington, Ind., 1979. Robbins Report. Higher Education: Report of the Committee Appointed by the Prime Minister under the Chairmanship of Lord Robbins. 196163, Cmnd. 2154, London, 1963. Shavit, Y., and Blossfeld, H.-P. (eds.) Persistent Inequality: Changing Educational Attainment in Thirteen Countries, Boulder, Col. and London, 1993. Shavit, Y., and Muller, W. (eds.) From School to Work: A Comparative Study of Educational Qualications and Occupational Destinations, Oxford, 1998.

237

CHAPTER 7

CURRICULUM, STUDENTS, EDUCATION

SHELDON ROTHBLATT

the whirligig of change At rst glance no aspect of higher education appears to be more settled, traditional and slower to change than the curriculum. No impression could be more misleading. As we move across the map of Europe in the last ve decades, the subjects taught and studied, and the forms in which they were taught and studied, changed continually. A very different type of higher education had also appeared, the distance university, beginning rst in Britain and spreading out from there, providing the example of how broadcasting technologies could reach wider publics. Consequently the most salient development in the curriculum of the European university in the second half of the twentieth century may be abruptly stated: all has been and remains in ux. Venerable agreements about suitable instruction, training and apprenticeship were reconsidered and frequently and repeatedly revised. Shared assumptions about what should be taught or learned, the intensity and duration of degree and diploma programmes, examination requirements, the depth of specialization, the correspondence between curricula and labour markets, or the source of curricular decision-making authority, all of these were constantly under review. Options, choices and varieties of educational experiences once regarded as inappropriate for Europe because they were American often became the darlings of public policy. A greater willingness to experiment was applauded by some, but ridiculed by others as faddism, consumerism or capitulation to the whims and priorities of ministries and civil servants concerned more about numbers and jobs than about education itself. As the century closed, two contradictory trends were apparent. The rst was towards diversication of mission, instruction, course structure and content, student preparation and career requirements for university-level 238

Curriculum, students, education teachers. Innovations were so numerous that heirloom national characteristics were harder to identify. Each innovation ramied to produce another, and the variations within countries were sometimes as great as between them. This was only partially true of France, which despite participation in joint European research and educational schemes, still retained many of its special dirigiste features. But even there academics discussed ways of distinguishing a university from another by devising unique learning opportunities (Spain as well) and to separate ideological from non-ideological disciplines. A second and opposite trend to diversication was the search for international equivalences in programme, degrees, teaching and quality inspired primarily by innumerable European-wide cooperative efforts, student and faculty mobility and global competition for markets and talent. Borrowings and cross-fertilization of ideas and structures were stimulated by common research assumptions, especially in areas of application centring on high technology, communications, public health, social welfare, ecology and executive management. Not all patterns established before 1946 were discarded. The lecture system, although often transformed in spirit, remained the backbone of teaching. Individual European states retained overall control of the structure of teaching, curricula and funding. Chair-holding professors still held the dominant positions in the academic hierarchy. Traditional disciplines remained the foundation of all university curricula. Despite undeniably improved levels of inter-European cooperation, the underlying structures of national systems still remained intact, however attenuated.1 But these carry-overs now had to coexist with ongoing reforms and alterations. The combined result of the two trends was a bewildering array of specialized as well as general programmes of university study, absorbing students with preparation ranging from excellent to indifferent and from families long familiar with higher education to those with no sense of what to expect. Elite universities, accustomed to admitting top undergraduates, continued to do so even while curricular and system adjustments were undertaken. Newer institutions, however, or those unable to be selective, struggled against considerable obstacles to provide a good educational experience for under-prepared students. Over half of all French universities offered courses of study based on a limited range of specialties in the 1990s.2 Yet another and different
1

U. Teichler, Structures of Higher Education Systems in Europe, in C. Oellert, Higher Education in Europe (London and Philadelphia, 1993), 301. G. Neave and R. Edelstein, The Research Training System in France: A Microstudy of Three Academic Disciplines, in B. R. Clark (ed.), The Research Foundations of Graduate Education: Germany, Britain, France, United States, Japan (Berkeley, Los Angeles and London, 1993), 218 and passim.

239

Sheldon Rothblatt pattern was for single institutions to increase course offerings by becoming multiversities containing numerous styles of academic, research and professional training programmes in the hope of fashioning multiple revenue streams. The nineteenth-century idea of a university as a holistic, organic institution based on an inherent essence, customarily expressed in the form of canonical studies (e.g., classics or philosophy), virtually disappeared, to be invoked only when the complex reality of the present appeared overwhelming. Institutions evolving into the multiversity model soon found that the organization of studies, whether by faculties, institutes, departments or clusters, had dissolved into a universe so decentralized that scholars and scientists named colleagues in other institutions or even countries as their closest associates and friends. Invisible colleges ourished, aided by electronic communication and jet aircraft, and the frequent absence of academics from their home institutions raised questions about undergraduate teaching commitments. Metamorphoses in curriculum and teaching occurring after 1946 or 1950 or 1970 can be symbolically described as architecturally baroque. In the great palaces and churches of the seventeenth and eighteenth centuries, the grammatical components orders, pilasters, arches, attics, fenestration were recognizably classical, but the syntax, the arrangement of the parts, was novel and unprecedented. The whole, supercially familiar, was in reality lled with inspiration of a different source and magnitude. And like the baroque, higher education policy and practice in Europe seemed incoherent, each aspect of it struggling for clarity against the other. The governments of Europe had weakened but hardly abandoned time-honoured control over many features of the highereducation system. Rigid regulation was replaced by a policy of steering and frameworks allowing for some research and curricular initiative. Experiments with market discipline privatization as it was called were tried as an alternative to central regulation and cost control. Many universities and their constituent parts were able to experiment with greater latitude in some specic areas of course design, teaching, appointments, remuneration or the kind, duration and content of examinations. Students themselves were presented with a wider range of curricular options. Some countries, or some universities, went much further along these lines than others. From the standpoint of governments, markets were a possible means of improving efciency and accountability. From the perspective of the universities, they were a means of keeping governments at a distance. But privatization was not synonymous with private. It meant loosening government control not abandoning it. Although more private colleges or specialized schools were in fact established in the last decades of the twentieth century, including 240

Curriculum, students, education one undergraduate university in England, the University of Buckingham, government remained the primary source of all higher-education funding. Throughout the history of the European university the curriculum had been a warring ground for rival conceptions of education, and not merely because of the different requirements of students or occupations. Scholars and scientists often disagreed amongst themselves on the rank order of disciplines and approaches to study. Basic knowledge, for example, or pure research was deemed to be of superior intellectual and cognitive worth to applied or technical knowledge. Quarrels occurred over the meaning of specialization and the depth of study to which students were to be exposed. The debates were real but also puzzling. In many elds of engineering or biological and chemical science, the distinction between basic and applied research was fuzzy. Academics dening themselves as theorists were to be found in schools and faculties devoted to vocational or professional education, the reverse being equally true. Consequently, the books in the age-old battles of books did not easily separate into clear-cut categories. Even in Jonathan Swifts celebrated archetypal allegory of 1704 on the quarrel between ancient and modern texts, the ancients were sometimes moderns and the moderns possibly ancients. The distinction often lay in the spirit in which an author wrote rather than the time period in which he (and occasionally she) lived. Yet in 1946 or 1950 the denition of a university still seemed to depend upon whether it was expected to emphasize the theoretical aspects of knowledge, while a technical institution implied practical or vocational objectives. Technical education, however, was itself diverse and ranged from the acquisition of specic skills and prociencies aimed at market entry to advanced levels where high technology could scarcely be separated from the supposed purer forms of science itself. Consequently, it became increasingly awkward to determine just how the standards of teaching, or the content of a curriculum, differed from one sector of higher education to another. Possibly this is one of several major reasons why all European education ministries or professional associations or individual institutions became so obsessed with questions concerning the evaluation of curricula, the measurement of teaching outputs, the effectiveness of courses, innovations in programme and pedagogy or the quality of research. Admittedly, the obsession was greater in countries like the UK and the Netherlands than elsewhere, especially the rst, but Eastern and Central European institutions, shaking off the effects of Communist Party domination, also began to consider similar concerns while seeking to improve their educational inheritance. Missions, disciplines and subjects overlapped. Engineering was taught in technical 241

Sheldon Rothblatt institutes and other highly specialized schools, but also in universities, and, to make the situation yet more puzzling, countries like Austria and Germany had Technische Hochschulen, a category that could include economics and business administration. Unless constrained by government policy, as in the case of the binary systems of the UK, where polytechnics were ofcially separated from universities until the early 1990s, or the Netherlands where the Hoger beroeps onderwijs sector, despite being elevated from secondary-school status in the 1980s, was still poly-technical, institutions without the historical prestige of universities tried to gain it. Some tended to drift upwards to a point where they demanded from government the same unit of resource as universities, as well as the same historical right to grant the highest degrees or conduct research. Their curricula tended to take on some of the characteristics of the older university sector, emulating established courses of instruction. Actually, battles of the books notwithstanding, the broadening of the denition of a university education was long in the making. It was at least as old as the nineteenth century, and in some respects harkened back to the Enlightenment. Quantitatively, however, the diversication of the university curriculum was relatively recent, and the pace and rate of the transformation were so swift that historians may be excused for thinking that a qualitative change had also taken place. Some institutional roles and missions remained fundamentally unaffected by other changes. In France, specialized engineering and other voca coles or e coles sup tional institutions, schools called grandes e erieures, several private and others public, continued to enjoy even higher prestige than universities. Their demanding competitive entrance requirements remained intact. Historically focused on professional training for teaching, public service, business and teaching careers, the grandes coles acquired a doctoral preparatory teaching function in the 1980s.3 e In Lyngby (near Copenhagen), Stockholm, Lausanne, Zurich, Berlin, Munich, Vienna and London very high-level engineering establishments long existed, most since the nineteenth century, that were ranked amongst their countries most elite educational institutions. Within them, the teaching of relevant history and social science courses also took place (e.g., the teaching of the history of science and technology at the Royal Institute of Technology in Sweden).

Postgraduate Research Training Today: Emerging Structures for a Changing Europe, Report of the Temporary International Consultative Committee on New Organizational Forms of Graduate Research Training (Ministry of Education and Science, the Netherlands, 1991), 14. Also for France the entry by C. Durand-Prinborgne in Clark and Neave, Encyclopedia I, 21724.

242

Curriculum, students, education responsibility for curriculum and teaching University-level studies in Europe were customarily arranged into large groupings called faculties, a structure dating back to the origins of universities. At Oxford or Cambridge, other structures had come into being, such as boards of studies or schools. Faculties were further subdivided into disciplinary or subject departments, usually called institutes on the Continent. In Sweden, a department could be further subdivided into an avdelning. From at least the eighteenth century onwards, the faculty of philosophy in the German system, a descendant of the medieval minor or arts faculty, was regarded as the carrier of the highest ideals of learning, untainted by the compromises required of merely practical subjects. (But law and medicine, with as respectable a lineage as the faculty of philosophy, escaped the pejorative meaning of utility.) Philosophy contained the disciplines comprising liberal education, called by different names in different European traditions (Bildung in Germany, bildning in Sweden). No single denition prevailed. A common theme running through all national traditions, however, was that a university education, or some signicant element of it, should ideally permit signicant self-development and should permanently affect the moral and intellectual character of those who were fortunate to have one. Maintaining that commitment, however, proved to be daunting. The internal unity required to feature liberal education was no longer available, and the demands for applied knowledge outraced the desires to be liberally educated. The issue continued to divide academic feeling throughout the period. The organization of knowledge and teaching embodied in the faculty structure, limited to three and sometimes four faculties in the medieval university, and in some cases to virtually one, had widened as the centuries succeeded one another. By the 1990s there no longer existed an absolutely single type of university curricular faculty structure. In 1994 in the Charles University of Prague, to take what appears to be a characteristic example of the changes, there were faculties of medicine (more than one in fact), pharmacy, natural sciences, mathematics and physics, pedagogy, social sciences, physical education and sport, arts and philosophy; but given the special religious history of Czechoslovakia, separate faculties also existed for Roman Catholic, Protestant and Hussite theology, a partitioning true of other universities in regions with a plural religious history, such as the University of Strasbourg with faculties for Protestant and Roman Catholic religious studies. Particularly in the Stalinist era of communist Eastern Europe, the traditional faculties were replaced by more specialized institutions oriented toward the socialist doctrine of a planned economy. A University of 243

Sheldon Rothblatt Economics was established in Hungary in 1948, followed by a University of Heavy Industries the next year and a University of Chemical Industry in 1951. Then came the Budapest University of Sciences. Curiously enough, such specialized universities were compatible with Hungarian reforms of an earlier, non-communist period, as represented by the Hungarian Agricultural University founded in 1945 before the communist takeover.4 A University of Economics existed in Prague.5 But highly specialized universities also existed in Western Europe. A University of Mining was situated in Leoben in Austria, and a new University of Educational Sciences was started in Klagenfurt in 1970. However organized or subdivided, faculties embraced a broad array of specialties, disciplines and instruction ranging from professional education in subjects like medicine to elementary and advanced instruction in the basic sciences or elds of knowledge. Seldom had two universities, even within the same country, exactly the same kind or number of faculties, nor could their departmental course offerings be guessed from name alone. The faculty of natural science at Charles University provided instruction in biology, chemistry, environmental protection, geography, demography and geology. A second faculty of medicine contained specialties in paediatrics, oncology, dentistry and infectious diseases. Before 1964 the social sciences in Sweden were normally included with humanities in a faculty of philosophy. Most philosophical faculties in European universities had been split into the faculty of arts, humanities, letters and the faculty of exact and natural sciences. But the medieval unity of the liberal arts faculty followed by the German philosophical faculty still prevailed at Cologne, Kiel and Marburg until the 1960s, in Vienna and Graz until 1975.6 Law was often paired with political science. Sociology was joined in a department with social work at Oxford, whereas many institutions would have separated an academic discipline from a vocationally oriented body of preparation. In the nineteenth century such pairings were common as some disciplines were too recent to have achieved full autonomy. Anthropology was joined to history at Cambridge University, psychology had not yet achieved independence from moral or mental philosophy. In Poland before 1962, the faculty of education (pedagogy) was generally separate from humanities (or arts), but the two merged in
4

Communication from Laszl Eotv University, Budapest, and entry on o Szogi, os Lorand Hungary by I. Vegvari in Clark and Neave, Encyclopedia I, 291300. Cf. Appendix: Universities founded in Europe between 1945 and 1995. Higher Education in the Czech Republic (Prague, 1995); J. Kotasek, Visions of Edu cational Development in the Post-Socialist Era, International Review of Education, 39 (1993), 47387. Concerning the secession of the natural sciences from the philosophical faculty see vol. III, 454f.

244

Curriculum, students, education 1962. Linz, a post-war Austrian university, did not have a humanities faculty. Klagenfurt and Salzburg did not have medicine. In some countries mathematics was included in the basic sciences, sometimes in engineering, or in both. Chemistry could be found alone in its own faculty or partnered with chemical engineering. Architecture wandered in search of a home from philosophy to engineering. A faculty of agriculture might include veterinary science, but the latter could also be included within medicine. The curricular signicance of such unions and collaborations is a subject in itself; but it is not difcult to imagine how the subordination of one discipline to another affected the development of an independent set of methods and ideas, or how a theoretical subject impacted upon a utilitarian one. For supporters of one historical idea of the university as a source of knowledge rather than as a training ground for occupations, an emphasis on theory and conceptualization equalled the difference between a university and a technical institute. On the Continent, responsibility for instruction continued to rest on a hierarchical arrangement of teaching ranks, with ordinary professors or chair-holders, Ordinarien, in the wellknown German title, at the top of a pyramid of status and authority and collected into faculties.7 Beneath them in rank, but not always in actual classroom duties, came assistants, usually working for higher degrees and lecturers, lecteurs, lettori, Lektoren. In some British universities, praelectors were employed for the teaching of foreign languages. There were also readers, a rank just below that of chair-holder. Docents existed in some systems as assistant teachers but in some countries independent. Their duties were sometimes conned only to research, but the responsibilities attached to the category of docent changed so much in the period under discussion that an adequate summary is awkward. There were also extraordinary professors whose status varied throughout Europe. They were sometimes akin to what in America was called an adjunct professor, someone in private professional practice who taught occasionally and sporadically, often in specialties otherwise unavailable in the universities. Professoren auf Zeit in Austria were used in the medical faculties, but sometimes the professors extraordinary enjoyed security of employment and taught the same courses as the ordinary chair-holders. The expansion of higher-education opportunities and the vast increase in the numbers of undergraduates and postgraduates attending European universities in the period after the Second World War, as well as an enormous increase in specialities and the availability of courses, inevitably affected the inherited system of teaching and appointments. Democracy would be too strong a word to indicate the direction of change, but it has some relevance. The decline in the inuence of older
7

See chapter 5 (Teachers).

245

Sheldon Rothblatt elites, the broadening of voter participation and the strength of public opinion and consumer pressure opened the academic profession to American-type inuences. A certain levelling of the ranks occurred, with junior members of the faculties given more authority in devising and teaching their own courses. The American system of upward, scheduled mobility through the ranks was looked upon with more favour in various countries, and the American practice of rotating the heads of disciplinary departments was adopted in particular universities so that ranks other than the ordinary professors enjoyed signicant administrative responsibilities. In general, the professorial role remained what it had usually been. Lecturing to undergraduates was part of it, but professors were expected to devote more of their time to research and postgraduate training. As the gaining of a professorship was the reward for distinction in science and scholarship and as professors were expected to continue in this vein, their undergraduate teaching assignments were reduced. But, as in the United States, the difference in mission and authority between senior and more junior academics was diminishing, and the responsibilities began to overlap. In Norway the advent of a career promotion system led to a distinct blurring of teaching loads between the ranks. The Norwegian universities altered their version of the German system as early as the 1960s. In general, the trend was supported by trade union agreements. The Swedish case is particularly useful in illuminating the responses to a demand for teaching. Until the end of the 1950s the chairholder system was largely intact. Professors had assistants and docents. In a few cases instructors called preceptors taught in humanities and social science courses while prosectors helped in medicine and science laboratories. A boom in enrolments in the 1960s led to the introduction of a new senior lecturer category to teach undergraduates. The speed of the hiring meant that possession of a doctorate, the usual qualication, could not at rst be insisted upon. By the 1970s senior lecturers had gained the right to teach at all levels. Yet despite the necessity for wider consultation on teaching and curricula, the senior professoriate retained some of its traditional authority, usually by constituting a voting majority even in the strongly social democratic Nordic countries. The relevance of changes in the structure of authority within the academic ranks to the history of curricula should be apparent. While hardly the only reason for the development of a highly diversied system of course offerings, a softening of the hierarchical differences between the academic strata and the wider distribution of authority that resulted facilitated the advance of highly diversied curricula, allowing supply to accommodate student and labour market demands, a factor of growing signicance. In Soviet-dominated educational systems, however, student curricular choice was severely restricted. All higher-education candidates 246

Curriculum, students, education had to follow a closely prescribed set of courses once they had gained entry to a specic programme. All students had to undergo compulsory teaching in the theories of dialectical materialism and were subjected to doctrinaire teaching. In the satellite states the teaching of the Russian language was compulsory. But countries like Poland expressed a taste for national independence from Moscow, leading to a somewhat more open curriculum, which even allowed for the dropping of the mandatory teaching of Marxist doctrine.8 Stronger disciplinary departments characterized some of the reforming trends of the last decades of the twentieth century. Usually subordinate to the faculties, whose governance in the old system was dominated by professors and deans, the department format featured enhanced control over curricula by its members, as well as permitting more of an emphasis on disciplinary specialism and sub-specialism. While hardly universal, the strong department was sometimes an aim of government policy, as in the reforms of 1991 in Spain. But other structural reforms in Europe led in an opposite direction, away from specialized work to broader educational intentions. New groupings of disciplines and methods were adopted in order to bypass both faculties and departments although perhaps more in the spirit of the rst than of the second and to further linkages between emerging areas of research inquiry. The School of British and American Studies or the School of European Studies at Sussex University, established as a new university in 1960, were undertaken as an alternative to conventional departments. In the 1990s, sometime polytechnics upgraded to university standing, such as Leeds Metropolitan University, created multidisciplinary groupings called cultural studies, mixing the social sciences and humanities, often within newer paradigms that had
8

For here and the national information that follows: on Austria from Hans Pechar, Ministry of Higher Education and Research, Vienna, and Karl-Heinz Gruber, University of Vienna. Also Higher Education in Austria (Bucharest, 1987). On Germany, information from Walter Ruegg, Switzerland; see also C. Gellert, The German Model of Research and Advanced Education, in Clark, Research Foundations (note 2), 544, and M. Heinemann, The German Universities after the Second World War, in A. Romano and J. Verger (eds.), I poteri politici e il mondo universitario (XIIIXX secolo): Atti del Convegno Internazionale (Madrid, 2830 agosto 1990) (Soveria Mannelli, 1994), 25775. Cf. Appendix: Universities founded in Europe between 1945 and 1995. For information on Eastern Europe generally, see J. Sadlak, Legacy and Change Higher Education and Restoration of Academic Work in Romania, Technology in Society, 15 (1993), 75100, and J. Sadlak, In Search of the Post-Communist University the Background and Scenario of the Transformation of Higher Education in Central and Eastern Europe, in K. Hufner (ed.), Higher Education Reform Processes in Central and Eastern Europe (Frankfurt/Main, 1994), 4362, and J. Sadlak, The Emergence of a Diversied System: The State/Private Predicament in Transforming Higher Education in Romania, European Journal of Education, 29 (1994), 1323. Also J. Szczepanski, Higher Education in Eastern Europe, Occasional paper International Council for Educational Development, 12 (S.l., 1974). Information on Russia communicated by A. A. Russalinova and I. V. Komarov.

247

Sheldon Rothblatt emerged as a consequence of linguistic, anthropological and philosophical theories developed in France and widely adopted in America. In the spirit of the German faculty of philosophy of a prior century, Dutch universities of the 1990s contemplated the possibility of closely integrating the different studies offered in a given faculty. Multidisciplinary studies and the cross-fertilization of autonomous disciplines were part of an international movement in higher education that accelerated in the 1970s and 1980s. But curricular innovations were also driven by the American principle of institutional competition, long shunned in Europe as demeaning and market directed. In order to attract students, funding and public attention, universities, particularly recent foundations, could offer newer types of subjects and methods of possible consumer interest. However, the capacity to compete largely depended upon whether an institution had full control over its course offerings, which was not equally true in all countries. In France and Germany institutional innovation was controlled from the outside to a greater degree than existed elsewhere in Western Europe. In France the university faculties, subject to the remarkable rationalizing tendencies of the French state, even lost their role in curricular development which was entirely controlled by the Ministry of Education. The university law of 1968 established the universities as networks of disciplinary departments called unit es denseignement et de recherche and, later, unit es de formation et de recherche (UFR). In Germany the Fakultatentage (meetings of all German faculties in the same disciplinary elds) were given the assignment of preparing and revising examination guidelines (Rahmenprufungsordnungen ) to be approved by the Conference of the Education Ministers of the Lander and the Conference of University Rectors. They were also consulted on experimental study programmes. For undergraduates,9 every higher-education system employed a number of different teaching formats. Lecturing by professorial chair-holders or by lecturers holding a less exalted rank was customary, yet smaller discussion classes led by junior teachers or assistants were also available, if less pronounced.10 The most intensive teaching took place, as it had for centuries, in British tutorial systems, especially in the collegiate structures of Oxford and Cambridge. Customarily face-to-face teaching, tutorials in the sciences also included more than one student at a time. The reforms of 1983 in Spain had many consequences, but one of them was the greater use of postgraduate students to supervise practical work in subjects like biology,11 possibly because of the shortages
9

10 11

The word is an English neologism of the sixteenth century and was connected to the stronger teaching role assigned Oxbridge colleges in the age of the Reformation. Cf. chapter 5 (Teachers). Entry on Spain by J. L. Garcia-Garrido in Clark and Neave, Encyclopedia I, 6769.

248

Curriculum, students, education in teaching staff created by the rapid expansion in enrolments. The French universities also made better use of younger staff than had been the practice, as did the Netherlands. Formats that stressed student teamwork in the model of an American import called problem-based learning were rst introduced in the 1970s in the medical faculty of the University of Limburg in Maastricht and subsequently extended to law. In the law faculty, small groups of students led either by peers selected from among third- and fourth-year students, or staff tutors, met twice weekly for two hours. A preliminary review of two control groups suggested that senior student leaders were as successful as senior staff in imparting information and encouraging self-review. Roskilde University just outside Copenhagen was well into problem-based learning in the 1990s. Undergraduates, organized into small topic study groups, met alone or with advisers (vejledere). Ample time was scheduled for intense discussion, critiques, writing and examinations.12 How widely inuential the problem-basedlearning model would become was a matter for speculation; but it had obvious relevance to other university systems for two reasons. The rst was as a means for challenging ingrained habits of passive learning by encouraging student teamwork and self and peer assessment, and the second as a possible path to cost-effective instruction. Even earlier in the 1970s, Swedish educational researchers had begun to consider an anthropological approach to evaluation as a method for stimulating students to undertake self-assessment. This was contrasted to the agricultural botany model. The prior knowledge of students, student leaders and staff was obviously relevant. Cambridge University adopted radical departures from its traditional modes of transmitting knowledge. Certain skills once taken for granted had declined, while others, unknown fty years ago and scarcely known before the 1970s, seemed to be commonplace. Entering students were computer literate and aware of how to use electronic media to obtain research information, but language competence not just speaking but basic grammatical prociency, English, foreign or classical had greatly diminished. Both changes reected curricular revision in secondary feeder schools. The teaching of history, once a pre-eminent school subject, appeared to have been neglected, even the teaching of English history. In geography the situation was serious enough to have produced a decision to drop the history component some twenty years before. The dons decided to build upon the new student competences in order to restore the lost prociencies. Computer literacy meant that valuable use could
12

J. C. Moust and H. G. Schmidt, Effects of Staff and Student Tutors on Student Achievement, Higher Education, 28 (1994), 47182. Information on Roskilde supplied by Brian McGuire.

249

Sheldon Rothblatt be made of European television satellite links in laboratory-based language learning, but instructors also started employing more intensive language methods, total immersion and interactive techniques, to restore the foreign-language skills missing from student preparation. More and more teaching was undertaken in teams, especially in courses regarded as core or foundation. This format permitted heavier emphasis on interdisciplinary learning and attention to themes rather than chronological periods in such subjects as history. Interactive teaching technologies also meant that undergraduates could be exposed to the methods of research, and this tendency alone allowed for thesis options to be joined to terminal examinations for purposes of determining the level of degree quality. It also meant that students were given more freedom in choosing examination topics. In the context of the history of Cambridge written examinations, which date back to the 1750s, the new freedoms were a radical departure. In some areas of the curriculum even the lecture format was modied, becoming less of a set piece with rhetorical ourishes than an informal presentation where the lecturer attempted to involve students by permitting interruptions and discussions.13 These introductions suggested that the undisputed reign of the unseen examination paper had declined in overall importance. No innovation is without its critics. Some Cambridge dons complained that the emphasis on the techniques of learning and on carefully devised structures for teaching did not encourage self-reliance but quite the opposite. The changes meant that undergraduates were being force fed.14 Some suspected that, whatever the good intentions behind the reforms, they and other changes in the United Kingdom were actually a response to government assessment and efciency strategies, as for example, in the use of visiting teams from the Quality Assessment Unit of the Higher Education Funding Council. The accusation doubtless contained some truth; but it is inconceivable that any university in Europe in the second half of the twentieth century could have remained unaffected by the multiple outside pressures acting upon higher education. The only uncertainty was the exact character of the response. Teaching was probably more ex cathedra in Italy, Iberia and France (or Wallonia in Belgium) than in Germany or the UK. In Italy student passivity was common because of the strict examination and study requirements in a given eld of study. However, after 1970, students were encouraged to be more outspoken, and what followed, in the words of one observer, was an excessive liberalism, particularly in humanistic subjects or elds regarded as less demanding. In general, very broad distinctions between
13

14

J. Gregson, Ars Docendi, Artium Liberalium, Cam (Cambridge University Alumni Magazine) (Michaelmas 1993), 8. Gregson, Ars Docendi (note 13), 7.

250

Curriculum, students, education Mediterranean and northern European styles of teaching began to dissolve in the periods of active reforms from the 1960s onwards. Passive learning was held to be out of step with the need for greater individual resourcefulness and initiative in an age of democracy and information technology. It was remembered that once-upon-a-time in the ideal Humboldtian system, Lehrfreiheit may have been the special prerogative of the professor, allowing him to follow the argument according to his best judgment and knowledge of the sources and to teach accordingly, but Lernfreiheit, the freedom to acquire knowledge and express it, was the special prerogative of the student. Only if the student was self-directed could he eventually become properly educated (gebildet). One conspicuous development that resists measurement was a certain informality in teaching that has already been alluded to. The tutorial system in the United Kingdom had always lent itself to casual communication, and in certain historical periods the tutors, being very young, were virtually in the same peer group as their charges. But although tutorial instruction was the backbone of elite education in the United Kingdom, its survival in an era of mass access education was questionable. Not all UK universities possessed adequate resources to support tutorial instruction, which depended upon high stafng ratios, usually 1:8 or 1:10, the benchmark ratios for elite instruction. The provision for tutorial instruction and the mix of professorial lecturing and small classes varied between Oxford and Cambridge, the University of London and the civic, Scottish, Irish and Welsh universities. Yet, even in the ancient collegiate universities, a shift was occurring to stronger university as opposed to collegiate teaching programmes owing to a heavy emphasis on research, on the training of postgraduate students and on the basis of eagerly sought-after industry funding. While UK universities struggled to retain high-cost tutorial instruction, or partial tutorials where lecturing was the principal mode of teaching, the unprecedented increase in student numbers in Europe created openings for younger (and less expensive) staff. There was need for a fuller use of the services of more advanced students and doctoral candidates. In France, Austria and Germany the overow of entering students was so great that under-prepared teachers and assistants were employed in large numbers, giving rise to an instructor class.15 Numbers affected all parts of the university inheritance and required more attention to be given to questions of teaching, since the older assumption that students could well fend for themselves, or call upon the university experience of friends and family, no longer seemed tenable. There were simply too
15

G. Neave, S eparation de corps: The Training of Advanced Students and the Organization of Research in France, in Clark, Research Foundations (note 2), 15991.

251

Sheldon Rothblatt many students attending university whose families had never been there. Observers called for better advising, counselling, guidance and other student services hitherto virtually unknown in Europe, especially on the Continent.16 Despite the increased employment of younger staff and postgraduate students, maintaining decent teaching ratios in an era of high-cost universities was a universal difculty. On the Continent teaching ratios fell, rose and fell again after the 1950s, with the gures oscillating somewhere in the 1:20 or 1:27 range. Existing national statistics are usually aggregates and are consequently an imperfect guide to teacherstudent communication. To give but one sign of the difculty, in the Norwegian universities of 1984 teacherstudent ratios stretched from a comfortable 1:11 in the faculty of humanities to an impossible 1:67 in law,17 but even the attractive humanities ratio is hardly a guide to the actual division between teaching and research or to the time really spent in personal communication with individual undergraduates. Furthermore, as the Norwegian example illustrates, universities distribute their internal teaching resources unevenly often to allow one kind of course to subsidize another, to free up time for graduate student education, for example, or to use courses with large lecture attendance to allow for the provision of smaller classes in special subjects and elds. Still, the overall picture was not encouraging. The pressures of numbers and the expense of maintaining stafng ratios in the vicinity of 1:10 or 1:12 meant that only a few universities would henceforth qualify for elite standing in that respect. Ratios tell a story, but we need to go beyond them to grasp another aspect of teaching, one that cannot be measured by any historical calculus. Within any teaching structure, conventional or innovative and including the tutorial system, styles of personal communication differed and have always varied so greatly that all that can possibly be said by way of summary is that the art and manner of communicating knowledge are themselves part of any curriculum. Separating the cognitive content of a subject from the way in which it is presented is impossible since the personality of the instructor is itself always a factor in learning. Often enough, the impact of that personality will have an effect more lasting than what was actually taught, since information is frequently forgotten, but a human relationship rarely so. Every higher-education institution subjected students to the tyranny of oral or written examinations, often both, and required them to write
16

17

G. Layer, Student Guidance and Support Changing the Approach, in M. A. Slowey (ed.), Implementing Change from within Universities and Colleges (London, 1995), 123. Entry on Norway by S. Vangsnes and K. Jordell in Clark and Neave, Encyclopedia I, 52434, and communication from Sivert Langholm.

252

Curriculum, students, education essays or theses, but the use of such hallowed measurements of achievement was by no means uniform throughout Europe. Quality control in many countries was maintained by the requirement of state-generated terminal examinations, thus avoiding the difculties that typied the American course structure where the same instructor both taught and examined in a given class, and degrees were awarded not on the basis of a nal comprehensive examination but as the result of the accumulation of a certain number of courses or credit hours. Yet in many countries considerable modications occurred in the inherited system of terminal examinations, with some countries adopting the American-style modular system of courses and others reducing a heavy reliance on terminal examinations by using other forms of assessment in conjunction with them, such as intermediate examinations. In the Soviet Union before and after the economic and political liberalization known as perestroika and glasnost, university examinations were a combination of biannual examinations (mainly oral) and a nal state-set examination, with or without a senior or graduation thesis. However, a parallel system of continuous assessment was also in place. In Belgium and Yugoslavia but mainly in the Italian university system, the qualications for the laurea (the rst degree) still depended primarily upon oral examinations. Extremely brief, these were preceded by a written thesis. Professors complained about the burden of examining but did little to alter the situation. In Norway, England, Scotland and Ireland terminal examinations given after three or four years of study remained typical but with the modications mentioned earlier. To assure objectivity, written examinations were blindly marked by more than one examiner and were sometimes (in Norway frequently) combined with oral examinations. Comprehensive, written terminal examinations and the use of external examiners were the rule in the UK until the wider adoption at some universities and former polytechnics of modularized or self-contained courses in the 1980s and 1990s, for example, at the Queens University of Belfast and the New University of Ulster founded in 1968. diplomas and degrees In every country the package of teaching, written exercises and examinations, when successfully mastered, yielded a certicate or other paper proof of completed academic work. In Europe, the degree, diploma or licence had usually been protected. The authority to grant awards was customarily assumed by the state such was certainly the case in Russia, other communist countries, and France or Germany. In the UK any institution legally designated as a university by the Privy Council (upon which members of the governing Cabinet sat) was empowered to award 253

Sheldon Rothblatt its own degrees. By contrast, students attending the polytechnics received their degrees from a national body created for that purpose called the Council for National Academic Awards (CNAA).18 Austria, which had no non-university or polytechnic sector until the mid-1990s, created for these new actors a similar accrediting body called the Fachhochschulrat. Institutions without university status could not award degrees but offered diplomas, an award that was also available for certain types of courses in degree-granting institutions. Portugal retained a separation between universities and more technical institutions, as did Germany, Belgium and the Netherlands. In Finland, a vocational sector (AMK) was created ex nihilo to relieve pressure on universities. The University of London, founded in 1836, was the historical model for the CNAA. Two university colleges had been founded earlier, and both demanded the right to give degrees. For religious and other reasons, and given the conception of a university derived from history, the Privy Council was reluctant to grant the new colleges a privilege regarded as unique. The resulting compromise was the creation of a University of London that was no more than a tiny body of corporate fellows empowered to authorize and set examinations and to award degrees. This special system, unprecedented in any other country, became the instrument by which the new teaching colleges of the British Empire and Dominions were able to secure degrees for their graduates. As the decades passed, the University of London became a wholly federated university consisting of university colleges, nearly independent specialized schools, and hospitals. In the 1990s, however, the constituent institutions of the University of Londons federal system began to clamour for greater degree-giving autonomy and closer control over their own examinations, the Imperial College of Technology (later to acquire several teaching hospitals) being foremost amongst them. The normal degree course in the universities of the English-speaking world was three or four years in length, yielding a bachelors degree, except in Scotland where the historical practice of conferring a masters degree as the rst award was maintained. In France, Spain, the Netherlands and Germany, students advanced towards formal qualication through a trio of phases fase in Dutch, cycles in French. The third phase comprised instruction considered to be advanced or, in UK terms, postgraduate. First- and second-cycle work in France was divided into separate tracks, some of which led to vocational qualications or preparation for school teaching. Each of the three cycles was of two years
18

By the end of the last decade of the century, the privilege of being able to award degrees in Britain was granted more freely as the so-called binary line legally separating universities and polytechnics was erased by act of Parliament. Polytechnics could now ask for university status and degree-granting power.

254

Curriculum, students, education duration (students routinely took three), and each was a hurdle to be overcome before the next could be encountered. Completion of the sec ond cycle led to a diplome d etudes universitaires g en erales (DEUG). A third cycle was reserved for students willing to undertake research training for a ma trise leading later to a possible doctorat de troisi` eme cycle. In the Dutch case, students were asked to complete their rst two fase within a four-year period or risked losing state nancial support. In Spain the system of cycles was close to the French after the reforms of the 1980s. The rst two cycles together covered about ve years, but subsequent reforms in 1991 made completion possible within four. A third cycle involved advanced work. Time to degree in Portuguese universities was from four to six years, depending upon eld. The polytechnic sector conferred a bacharaleto after three years, a more specialized diploma after two more.19 In Germany a rst degree equivalent could take as long as six to seven years. The work for a Magister was seven-and-a-half years on average in Austria. It is nearly impossible to correlate rst-degree level awards or second cycle completions with the length of study, the quality of a students performance, or the status and employment value of the award to the student, either within a given country or across national boundaries. Sometimes the bachelor of arts in Britain, the laurea in Italy, the Magister in Poland, Germany and Austria, the diplome in France, the licenta in Romania, the licenciatura in Spain and licenciado in Portugal, to name but a few, were designed for entry into specic occupational markets for example, radiology, agronomy, accounting, physical therapy, computer programming, social work. But in other cases they were needed for admission into yet higher or advanced programmes of study. In almost no European country were rst degrees or rst- and second-cycle competencies a measure of general culture, a rounding out or nishing off closely tied to traditional elite conceptions of liberal education or civic leadership. Such concerns, it had long been argued, were the proper focus of the secondary schools, especially those with university preparatory functions. The growth of specialization within the Western European university produced a situation where few countries required undergraduates to undertake a broadly based programme of studies, but doubts had crept in. As secondary education was now subject to the pressures of mass education, more voices began to say that schools had failed to provide the necessary skills, prociencies and ethos of liberal education. Norway, however, had kept some elements of the ideal of a liberal education within the undergraduate curriculum. A compulsory rst-year examen philosophicum composed of logic and the history of philosophy in some
19

For Portugal, entry by E. L. Pire in Clark and Neave, Encyclopedia I, 58590.

255

Sheldon Rothblatt respects represented a throwback to a time when such academic work was a sign of cosmopolitanism and cultivation.20 undergraduates and postgraduates One of the more pronounced features of the Continental university had always been (though not in the Middle Ages) the absence of a clear-cut division between undergraduate and postgraduate student status as known in English-speaking countries. Instead of occupying separate curricular spheres, undergraduates and postgraduates almost imperceptibly blended into one another. In America and England a bachelor of arts or its equivalent marked the boundary line between two major categories of education, with some confusion in areas like medicine. Professional studies, which in the United States were often if not invariably reserved for second-degree work, or could be undertaken for a rst degree in elds like engineering and architecture, were incorporated into separate tracks commencing with rst-cycle or, in the UK, rst-degree preparation. The stereotypical English or American undergraduate was considered to be callow and wayward and therefore in need of proper discipline. The English collegiate tutor stood in loco parentis to the student, and American colleges and universities devised extensive parietal rules governing all aspects of student behaviour. The student disruptions of the 1960s replaced many of those rules with a more legalistic system of judging misconduct, but even in the Oxbridge colleges there was a noticeable loosening of the authority of the tutor. But other reasons also account for the change from viewing undergraduates as adolescents in need of close supervision. One was a greater concern on the part of all categories of instructor with research, deemed more important than teaching in determining career chances. Another was a cultural change with regard to the exercise of authority. The students who entered the academic ranks after the 1960s were part of a generation that had demonstrated against the perceived paternalism of the universities. Yet another reason was a certain awkwardness in trying to enforce conduct involving dating and drug-taking, especially the latter where the long arm of the state was available. But the essential point is that academics and this was true in most countries no longer felt comfortable as role models. Solid bourgeois behaviour, so long the mark of a distinguished professor, was out of style by the end of the twentieth century. Professors and academics of all ranks shared with students a desire to lead a private life devoid of the constraints of convention.
20

S.-E. Liedman, In Search of Isis: General Education in Germany and Sweden, in S. Rothblatt and B. Wittrock (eds.), The European and American University since 1800: Historical and Sociological Essays (Cambridge, 1993), 99, 105.

256

Curriculum, students, education The postgraduate student, being older, was regarded in both Englishspeaking nations as more mature and responsible. The curriculum and styles of teaching had reected this fundamental separation. British undergraduates normally received close and attentive preparation for examinations, consisting of tutorials, essay writing, informal continuous assessment and personal advice, while postgraduates were often ignored or shunted off to archives and libraries, especially in the social sciences and humanities. In any case, until the last forty years or so of the twentieth century, they tended to be relatively few in number and concentrated in certain leading universities. On the Continent, all students no matter how old were expected to be self-reliant. The Humboldtian tradition of Lernfreiheit already alluded to may have been a factor. Universities were not schools, and professors should not be required to discipline students, who were expected to take a strong hand in their own education. (The distinction between school and university was not so clear-cut in America, Scotland or England until the later decades of the nineteenth century and possibly even later in America.) And the physical circumstances of the older Continental universities were conducive to greater independence. The campus style being imported from the United States, often housing undergraduates on the grounds of the university itself, could not be emulated unless sufcient land was available. The traditional European universities were located in urban centres, their buildings scattered throughout the city. Some housing was sometimes available through community afliation, for instance in Uppsala in Sweden where the tradition of the medieval nations persisted. Students from dispersed regions could afliate and nd accommodations through the nations. Certainly there were student accommodations, university and private, in the vicinity of university buildings. But the usual rule in Europe was that students were expected to nd their own housing or live at home. In loco parentis was hardly a viable conception in such environments. Lecture attendance was largely optional, since examinations and lectures were not necessarily in correspondence (a problem that had arisen in Oxford and Cambridge centuries before when colleges effectively took over teaching from the professors). Students in Spain and Germany actually selected the date at which they preferred to be examined. The German situation was particularly lax (the Austrian probably more so before the reforms of the later 1990s), and students in effect received permission to dawdle for up to seven years. While so-stretched times to degree or award completion became a source of concern, partly because of the numbers that had to be accommodated and the additional expense incurred as the years of education lengthened, they had the merit of leading to high 257

Sheldon Rothblatt course-completion rates, students appearing for examinations when they believed themselves to be ready. The received albeit changing Continental system of loosely coupled examination/diploma/degree sequences, minimal supervision and the relative absence of required written coursework was rooted in elite presuppositions about student achievement. Since relatively few members of a relevant age cohort had attended university, it was assumed, not incorrectly, that they possessed the necessary academic qualications and habits of study. Hence professors were not overly concerned about student welfare or dropouts, although Italian professors were eager to keep numbers up because student fees, once nominal, were a critical source of revenue when government revenues declined. Since funding was not enrolment driven in Germany, France, Italy or Austria (except in the Fachhochschulen sector begun in 1994), the neglect of students did not incur nancial penalties. In contrast, other countries tried to keep greater control over the size of the student populations. Head counts were used in Holland, the number of candidates for degrees in Denmark and the allocation of places in the UK. The result in Italy, Germany, Austria and France was the unfortunate overcrowding so pronounced in the 1980s and 1990s. Ralf Dahrendorf, the distinguished sociologist and sometime German professor who took British citizenship and was made a peer of the realm, also becoming director of the London School of Economics and head of an Oxford college, angrily criticized German policies that produced ten times as many students as there were three decades ago, crammed into the same old institutional framework. Lord Dahrendorf went on to say sardonically that the majority of students felt isolated and lonely, while their teachers spent their time lling in forms or sitting on committees. In Germany relative indifference towards students was actually justied on the basis of the traditional right of students to change universities at will, since the degree was in effect granted by the state rather than the institution. In France concern for democratic access, a policy decision dating back to the 1960s, overrode considerations of effective university teaching. Attempts by government to restrict entry in order to reduce size, as well as to improve employment possibilities, were bitterly opposed by students and could not be implemented. The demand for certain types of programmes, especially those connected to teaching like psychology, continued to produce hair-raising accounts of students trying to follow lectures sitting on the corridor oor outside a sight not seen since money began to pour into university expansion.21 Similar conditions were prevented in protected elds like medicine where a numerus clausus prevailed throughout. Despite demand for entry, dropout rates in France
21

Times Higher Education Supplement, 3 December 1993, News 10.

258

Curriculum, students, education in the 1980s were dismaying. About 40 per cent of science entrants, 45 per cent in law and economics, left in the rst year of the rst cycle.22 Only one-third of Italian matriculated students earned the laurea in 1995.23 The highest research degrees were required for entrance into the academic profession. In most countries in the second half of the twentieth century this had come to mean a doctors degree, but in Austria, Germany and German-speaking Switzerland not to speak of Spain and at one time in Italy and Scandinavia, the highest award was the Habilitation, in effect a second doctoral thesis which was also in France a prerequisite for being appointed to full professorship. Numerous reforms in France actually created a number of different kinds of doctorates, and there was provision for written work that could be substituted for the research thesis normally associated with doctoral-level undertakings. Changes were introduced into England that allowed for the award of a doctorate at a later point in an academic career on the basis of an established record of publications. Ordinarily, a highly structured programme of doctoral studies was atypical, and time to completion was unspecied. Even the vaunted German seminar system which spread throughout the Continent was not the equivalent of the tightly organized American graduate school degree programmes. Candidates seeking Habilitation, especially outside the sciences, worked on their own, often while employed full time elsewhere in teaching or non-academic occupations. But in the late 1980s graduate colleges began to appear, perhaps inspired by, yet very different from, American structures in organization and funding. They shared few organizational features with one another and remain at present in an experimental or rudimentary stage. Some Graduiertenkollegs in Germany were interdisciplinary research groups occasionally associated with the independent network of Max Planck Institutes for research. Dutch onderzoekscholen and Belgian graduate schools were able to cross university or even national boundaries to also form linkages and cooperative efforts. In France the graduate schools consisted of several advanced tracks leading to one or more kinds of diplomas, of which one, the Diploma of Advanced Studies (DEA), was required for subsequent work
22

23

France in Clark and Neave, Encyclopedia I. See also C. Musselin, Steering Higher Education in France: 19811991, Higher Education in Europe, 17 (1992), 701. Information on Italy is derived from B. R. Clark, Academic Power in Italy: Bureaucracy and Oligarchy in a National University System (Chicago and London, 1977), 124ff., 139; F. R. Monaco, Universities in Italy: Problems and Perspectives, in F. Pancaldi (ed.), Universities and the Sciences: Historical and Contemporary Perspectives (Bologna, 1993), 208; O. Amaldi, The Italian Tradition, in Pancaldi, Universities, 408; R. Moscati, Italy, in G. Neave and F. van Vught, Prometheus Bound: The Changing Relationship between Government and Higher Education in Western Europe (Oxford, 1991), 91108.

259

Sheldon Rothblatt on a doctorate. The body responsible for conducting research training was a groupe de formation doctorale which, as in the case of national PhD programmes elsewhere, could be formed from the members of other kinds of institutions, such as national laboratories. Another signicant alteration during the reforms of 1984 occurred when a breach was made in the highly centralized government control over university teaching and curricula. State degree-granting bodies yielded the privilege of awarding doctorates to individual universities in France. Yet another alteration in coles docgraduate degree programmes began in the early 1990s when e torales were established. Although based in particular universities, such schools could also move across institutional boundaries. Further discussions have since taken place concerning the relationship of the DEAs to the doctoral schools. Graduate colleges provided chances for Habilitation candidates to regularly discuss research projects with peers and senior colleagues and also to participate in special programmes. By the 1990s, except in Germany, Austria and France, the Anglo-American system of a single PhD was competing with Habilitation as the entry qualication for university teaching. Postgraduate education in the UK also underwent changes.24 The PhD as a research-based degree had been introduced at the beginning of the twentieth century in order to attract overseas students who usually attended German universities. A student entered for the degree submitted a dissertation in due course, normally after three years but often taking longer, and was required to defend the work before a committee of examiners. In some countries, a more public defence existed before a large audience the practice has not vanished in Sweden or at the Universities of Geneva and Lausanne. There was no administratively separate graduate school for academic and research training as in the United States. Other advanced degrees at the masters level or its equivalent may have occasionally involved specied coursework, but the majority of such work was based on a written thesis and oral examination. However, the taught postgraduate course, the backbone of graduate training for the rst two or three years of the American system, came to be viewed as a needed and desirable alternative, especially as the numbers of postgraduates rose and questions were asked about the actual strength of their rst degrees. By the end of the century the taught degree course was far more available than ever before, but hardly the rule since in most areas of study a critical mass of students did not exist.
24

For Britain, see M. Henkel and M. Kogan, Research Training and Graduate Education: The British Macro Structure, in Clark, Research Foundations (note 2), 71114; T. Becher, Graduate Education in Britain: The View from the Ground, in Clark, Research Foundations, 11553; L. Goedegebuure and F. van Vught (eds.), Comparative Policy Studies in Higher Education (Twente, 1994).

260

Curriculum, students, education As in other countries, other kinds of degrees or awards, undergraduate, postgraduate or somewhere in-between, were the responsibility of freestanding music conservatories, schools of dramatic arts, architecture and the practice of law (canon, civil and Jewish law degrees were given in universities). Postgraduate education in Nordic countries was reformed in the 1960s and then again in the 1980s. There too a restructuring of the traditional degree programmes took place to make the various stages of educational qualication distinct. More formal PhD training in the social sciences and humanities was provided for in Denmark to correspond with existing practices in engineering and the natural sciences, and a greater stress was placed on interdisciplinary and inter-institutional research environments. In Finland, efforts were made to replace casual arrangements for the supervision of research students with more accountability, and in Norway, where formal graduate programmes had been weak, innovations similar to those in Denmark and Finland were adopted, particularly with an eye towards improving completion rates and time to degree. Until the new programmes took hold, the older system of informal, more loosely supervised doctoral training programmes continued to exist alongside newer arrangements. In the largest of the Nordic countries, Sweden, waves of all types of structural, organizational, managerial and curricular reforms occurred from the 1960s onwards. The last doctoral thesis defence under the old system was held in the 1970s. New masters degrees were introduced, as were regulations aimed at dening a normal period of progress towards the doctors degree. The decisive part that reform of the structure of elementary and especially secondary education played in inuencing curricular and course development throughout the higher-education system cannot be overstressed. It was upon the system of meritocratic upper secondary education that the fundamental educational assumptions of the European university were built. It was that system, reinforced by high-standard school-leaving examinations, that allowed for the establishment of specialized curricula in the early stages of a university education, followed by advanced instruction resting largely on casual supervision. Consequently, when governments began to encourage a greater ow of students upwards through elementary and secondary schools, it was only a matter of a few years before the entire system of early merit selection would be questioned. Less specialization in school-leaving examinations and less emphasis on tracking, as well as a greater supply of further education or tertiary institutions, meant that universities could no longer expect to receive students with the requisite level of skills and discipline. Undercut from below, many older academics were nding themselves unable to impose the achievement standards familiar from the past. But this is a 261

Sheldon Rothblatt story that can only be continued when historians have detailed information from the eld, that is to say, from the history of classroom teaching. From the 1980s onwards, even earlier in France, the advent of mass education and the Himalayan numbers of students now qualied for university entrance shattered existing assumptions about student preparation for higher-education study. Despite the availability of American data on the impact of sheer numbers on teaching and a university curriculum, higher-education authorities in all European countries barely anticipated the budgetary, spatial or academic consequences of mass education. The growth rates in the university sector alone in the twenty years after 1959 have been calculated as over 400% for France, Germany and Italy, around 300% for Belgium, about 350% for Sweden, 364% for Holland, and 384% for the United Kingdom.25 The result throughout the 1980s and 1990s was a belated search for a means of combining access with mechanisms for assuring undergraduate and postgraduate quality, as well as creating choices for elite and non-elite students. Nearly frantic reform activity followed: modules and credit-unit systems were established, semesters and multiple diploma tracks were introduced, continuous assessment and problem-based learning entered teaching, terminal degree programmes (as in Denmark) were adopted to demarcate undergraduate and postgraduate teaching, taught courses appeared at research levels. Anglo-American degree structures spread to the Continent. One observer speculated that the BA, the MA and the PhD, as well as credit-unit systems, made greater inroads in Eastern than in Western Europe,26 possibly because of the jump start allowed by the rejection of Marxism (at least until the launch of the so-called Bologna process in 1999). research and curricula For centuries universities were essentially teaching and training institutions. While it would be erroneous to imagine that no room was made for research in the mission of the traditional university, the pursuit of original knowledge and the ethos of discovery were by-products of the leisure and reection of the academic community rather than foremost activities upon which rested all prospects for advancement, promotion and recognition. So strong was the traditional mission of universities that in the Early Modern period royal academies were founded to support the intellectual activities that were secondary to universities. But
25

26

G. Neave, A House Divided against Itself. The Changing Patterns of Authority and Participation in Western European Universities (draft paper, Berkeley, Cal., 16 November 1984), table 1 following page 10. Sadlak, Search (note 8).

262

Curriculum, students, education the foundation of the University of Berlin in 1810 changed the primary orientation of certain universities, which henceforth would adopt formal research missions, provide the equipment needed for advanced scientic work, strengthen libraries and collections of documents and, in every old and emerging domain of knowledge, guarantee the resources and support required for the advance of pure, basic and applied research. Even in Germany this new orientation was not fully realized until about 1850, but afterwards it was increasingly adopted by all universities eager to emulate the German intellectual model. Research affects curricula in a number of different ways. First, it encourages independent thought. Second, it promotes a sense of discovery, especially in the sciences, and therefore, the rhetoric of pure or basic knowledge notwithstanding, research opens a link to technological and scientic application. Third, it strengthens the specialization of knowledge and in this way (fourth) inuences the creation of new organizations for knowledge generation and dissemination, such as departments or laboratories, research centres or special library collections. At the same time, specialization spurs a contrary movement to unite disparate elds of learning. Fifth, research changes the curriculum and consequently leads to the adoption of course structures that permit more independent work or debate according to the rules of Lernfreiheit as already mentioned, more student research papers, discussion classes and open-ended examinations where students are allowed to explore ideas. Research had all of these inuences in the university of the late twentieth century. The constant generation of new ideas, new methods of pursuing those ideas, new paradigms, new ways of approaching the human condition and new viewpoints with respect to the world of natural science constantly pushed at the undergraduate, not to mention the postgraduate, experience and constantly therefore also challenged the way in which universities were funded and the ways in which resources were allocated amongst the competing faculties, departments, institutes and laboratories. The rate and pace at which curricula diversied and new organizations for acquiring and disseminating knowledge developed varied greatly among European universities, depending upon tradition, the strength of conservative feeling, student demand, the availability of resources and the policies of governments. As the earlier pages of this chapter indicate, the second half of the twentieth century was characterized by an unprecedented ferment, by contradictory policies, by continual revisions of those policies, by internal and external challenges to conventional authority, by the changeover in Eastern Europe from a totalitarian environment to one with more capacity for free expression and innovation. The rapid transformations in the knowledge base, accompanied by organizational changes, were not all positive. Confusion and instability also resulted, as is 263

Sheldon Rothblatt typical of any period of far-ranging and interlocked radical changes. The pressure to be original and to make discoveries contributed to intellectual fads, to the concoction of plausible but facile theories with a certain appeal in a world where education itself was often talked about as a purchasable commodity. Many of the theories were political and ideological or carried political or ideological implications or were replacements for discredited Marxist doctrines. In some quarters it was announced that objectivity was chimerical, that value-free knowledge did not and could not exist given human self-interest. The age-old distinction between subject and external object was pronounced false. In truth there was no distinction. For the postmoderns, all was subjectivity. Such beliefs invaded the sciences, but the stronger empirical basis of scientic research made them less effective inuences in teaching. But in the humanities and in certain areas of the social sciences the questioning of all received versions of certainty sometimes shaded off into relativism and nihilism. The curriculum reected the new sensibilities, which included hypotheses about the place of women in society (feminist theory), the treatment of minority and other marginal populations, the imperial histories of European nations and the role of past elites. Secular thought was so pronounced that theologians and scholars of religion complained that a new intolerance had entered universities, a new orthodoxy that claimed allegiance to tolerance but had little patience with or respect for the study of religion and religious morality, staples of a university curriculum in ages past. Discontents were continuous. Such dogmatic correctness was the negative side, but there can be no doubt that a new inventiveness and creativity were also abroad that promised to produce profound medical and biological discoveries and a new understanding of the fundamental processes of life. The boundaries between all elds of learning had dissipated. The social sciences crossed over into the humanities; physics, astrophysics, chemistry, engineering and the biological sciences drew liberally from each others store of knowledge and borrowed one anothers methods. Professional elds could no longer be glibly distinguished from the liberal arts and sciences. The corpus of received learning was vitally and in a sense permanently altered. Students were exposed to more and different modes of learning and to more varied courses and subject material, more unusual forms of instruction. They were allowed more ways of demonstrating their abilities than were available in the majority of universities existing before about 1950. They had more opportunities to be active participants in their own education than had once been the case. The permeation of undergraduate teaching and learning by new sources and methods of understanding was real but hard to quantify, nor can the degree of such penetration into the undergraduate curriculum be 264

Curriculum, students, education explicitly grasped. A distinction needs to be made between the reshaping of a given course or plan of study by ideas derived from research and the extent to which undergraduates themselves were allowed to participate in actual investigative tasks, especially in connection with professors and senior academics. The value of having undergraduates join a research team, at least to see how it works, was discussed, but the degree to which this happened is impossible to judge, and how many students were able to participate freely is also questionable. Critics could argue that undergraduates in the European university were not in fact closely involved in the research experience or given a chance to absorb the spirit of inquiry because so much of their education depended upon the outcome of national examinations often disconnected from teaching. In France the most favoured sector of higher education, the grandes coles, consisted essentially of specialized training institutions where the e argument concerning the union of teaching and research had never been overly relevant. The primary research mission in France had long been assigned to a national body called Centre national de la recherche scientique (CNRS) which funded full-time researchers, but other bodies also existed.27 In Germany the research mission belonged, to about the same extent, to the vast university sector through the Deutsche Forschungsgemeinschaft and to some sixty Max Planck Institutes. Yet despite a division of labour in many elds claimed by governments to be more efcient (and probably less subject to disruption by student activists), especially under the rapidly changing conditions of international competition, there were substantial crossover effects how extensive is hard to fathom. Professors in both countries had access to research programmes and teams, and in France universities and CNRS units sometimes shared facilities. Nevertheless, the formal separation of research from teaching was held by critics to undermine the great chair-holder system inherited from the classic German university paradigm in which postgraduate instruction or supervision was subsumed under a distinguished professor eminent in research. With the formal separation of the two principal professorial functions, detailed regulations and funding arrangements were outside the chair-holders direct control. The faculties, institutes, departments and laboratories that were the hoard of professors holding the exalted status of higher-ranked civil servants were now subject to external assessment and evaluation. It has been suggested that weak provision for research at provincial universities in France has made the lure of Paris irresistible, to the detriment of local teaching. Amiens was specically mentioned.28
27

28

E.g., INRA for agricultural research, CEA for atomic energy, INSERM for medicine, IFREMER for marine exploration, INRP for education, and for educational science, the Curie and Pasteur institutes. Times Higher Education Supplement, 19 August 1994, News 8.

265

Sheldon Rothblatt Yet ironies are rarely absent from historical developments. In France the tying of student grants, fellowships and instructorships to specic laboratories, programmes or universities once again provided opportunities for a few chair-holders in selected elds to retain some of the patronage long associated with professorial privilege.29 the student role in the curriculum Passing reference has been made to the consumer or demand side of higher education which includes student markets. It was suggested that the expansion of access brought with it a greater sense of how the supply of courses might interact with a demand for particular subjects or lead to novel teaching formats, shorter-term courses or credit-unit modules with continuous assessment. It may also be supposed that in a number of countries privatization, and government adoption of steering policies, stimulated increased student participation in the educational process, yet the narrative is not quite so reductionist. By the mid-1990s students had not become consumer arbiters of the availability and pricing of education, possibly because the likelihood of a possible active role was overestimated to begin with and also because governments continued to exercise constraint over markets, nding student demand to be out of step with national goals. Students tended to choose subjects in congested and underfunded elds, whereas government wanted more attention paid to applied science and engineering as these were held to be of more benet to the economy. These were also subjects that attracted investment from the high-technology sector, non-prot philanthropies or alumni. National crises provided openings for student inuence, although these were often short term in effect. The dissident movements in Hungary and Czechoslovakia helped liberalize studies within their countries communist-controlled universities, pointing to the future when Marxism would be overthrown. The 1960s student rebellions in France and Germany, following those in the United States, created short-term changes, possibly even in course content, but these did not lead to fundamental alterations in the overall curriculum. Indeed, given the history of student participation in right- and left-wing political movements in France, Germany, Italy or tsarist Russia, students collectively have attracted attention more for their negative than positive results. In France, student pressure was often expressed through protest and demonstration, especially where restrictions on entry or eld of study were proposed, or because of the heavy overcrowding on wildly underfunded campuses like
29

G. Neave in Clark, Research Foundations (note 2), 201.

266

Curriculum, students, education Saint-Etienne, Jussieu or Nanterre. The last had a planned capacity for 14,000 but burst at the seams in 1994 with two-and-a-half times that number. In the UK, the National Union of Students attempted to maintain an important voice in all university matters affecting student interest, especially regarding access and nancing, but it is doubtful whether this association in any way or at any time dramatically affected the basic structure of teaching and education. In some Western countries, however, such as Norway, students acquired active experience in the running of innumerable campus-based enterprises having to do with the larger questions of student welfare and recreation. Dormitories, bookstores, sports, health services, kindergartens, travel agencies, nanced through a combination of government grants, participation fees and membership dues and the sales of products, were important ways in which valuable life experiences were gained outside the lecture hall itself. Student leaders were often given a oneyear leave of absence to act as full-time student activists and business leaders. Overall, of the major determinants of curricula the state, the academic profession, the examination system, the employment market students historically have had a lesser role in the shaping of curricula. Because of youth and inexperience, especially in the category of undergraduate, and the relatively short duration of their stay in higher education, the direct contribution of undergraduates (or postgraduates) to the making of an educational curriculum is limited or restricted. Possibly student efforts were most effective in the German reforms of the 1960s. Yet their indirect role should not be overlooked. A students preparation for academic work is a key factor in determining the level and content of a course of studies. The European university system had beneted historically from the high quality of secondary education, especially the post-compulsory sector of the last two years, and rigorous school-leaving examinations such as A-levels in England, the Highers in Scotland, the baccalaur eat in France, the Abitur in Germany and the others that have been mentioned. Where quality secondary education was unavailable, higher education was forced to adopt remedial measures, a conspicuous feature of the rst or even second year of non-elite (in some cases elite) American universities. But Soviet-bloc countries were also forced into such measures and established propaedeutic faculties to remedy deciencies, and within the European university system of the 1990s complaints about student preparedness were frequent. Subtle or quiet revolutions in culture also have a classroom effect because attitudes to learning and habits of discipline inuence the way in which material is presented and whether students are self-reliant or require immediate attention. It is inconceivable that the extraordinary 267

Sheldon Rothblatt changes in the last forty years in personal styles of behaviour, or the improvements in Western Europe in standards of material consumption, did not have an impact on the way students and their teachers interconnected. Supercially, the observer of the 1990s noticed a greater informality in the way classes were conducted in the UK, the Nordic countries and the Netherlands, and this is underscored by the absence of a professorial dress code, the traditional badge of authority and status, connecting academic culture to the wider status world of nance, business and the civil service. The academic wanderer encountered every conceivable mode of dressing, as if costume no longer reected good taste (or social class) but just the personal preferences of the wearer, perhaps also the desire to be comfortable. It is as if the extraordinary changes in the knowledge base, the effervescence accompanying discovery and the methods developed for knowing, required more casual modes of communication, easier exchanges between teacher and taught, a freer environment for the transfer of information and ideas involving all ranks of learners, professors, lecturers, post-docs and students. What was perhaps being conveyed was an attitude of spontaneity better suited to transmitting the excitement of inquiry. Furthermore, because so many of the younger instructors were closer in age to the undergraduates and were inuenced by the same mass media and the greater permissiveness in upbringing that occurred in the decades after 1950, they were likely to be less aloof and more accessible, more a peer than a superior. Yet the greater informality of teaching, the tendency for students to omit titles when addressing their seniors or even to refer to them by their given names (still more typical of postgraduates than undergraduates) did not necessarily produce certainty and assurance about career prospects. For all the talk of the importance of student choice in the curriculum, many found that the choices were far too many and confusing. It was not surprising that, in the midst of historical afuence and an undeniable improvement in life chances, so many students should still have struggled to nd themselves and to prepare for a dynamic marketplace of opportunities and for an employment world in which more than one career change was likely. The freedom to choose from a cornucopia of subjects, each of them open to the possibilities of frequent revision, may have fostered self-reliance, but it hardly provided a clear vision of future possibilities. The casual academic environments of the late twentieth-century universities did not possess the clarity of the old university culture. The university world before 1940 or thereabouts was less relaxed, although the degree of formality depended upon the national culture and shared elitist attitudes. The model for informality was perhaps the British tutorial system; but there was a mingling of sorts between professors and students 268

Curriculum, students, education in Germany, and in countries emulating the German model. These were caught within the boundaries of a particular set of class-derived relationships, and usually the older doctoral candidates received the most attention. The connections were made possible by small numbers, a notion of Kultur, a Gymnasium experience and assumptions about respectability. Informal occasions between the professor with his assistants and with students, advanced or fresh from school, often took place in the chairholders home. Ideas were exchanged, or heard, in a setting especially conducive to their reception. The old Ordinarius was nevertheless still off-putting, whether in seminar or sitting room, a measure of both his social status as a civil servant and his potential patronage. The sociologist Hans Speier, who made a career for himself in the United States, described Karl Jaspers, his famous teacher at Heidelberg, as very reserved. Only once did he seem interested in me personally. Karl Mannheim, on the other hand, was pronounced by Speier to be a good pedagogue and free of any professorial haughtiness.30 As relaxed as the new learning environments may have been, there were also anxieties in the classroom arising from the vigorous competition offered by new generations of women pouring into the universities and into hitherto exclusively male professions. For the rst time since the foundation of universities at the end of the twelfth century, women comprised at least half or more of the undergraduate population and were highly represented in law and medicine. A much more worrisome aspect, however, was the importation into universities of renewed ethnic conict in Europe. Hardly any country was unaffected by the movement of populations, which included many that were not European to begin with, or, like the Turks who did in fact possess a corner of Europe, were not widely considered to be European given the circumstances of their arrival at the central and western nations. Catalans and Basques demanded greater independence from Spain. The disintegration of the Soviet Union and Yugoslavia, the formation of autonomous republics, the separation of Czechs and Slovaks, even the de facto linguistic partition of Belgium, once again allowed nationalist or separatist issues to invade education. The story is an old one. Even in relatively calm Finland in the 1920s separate universities had been created for Finns and Swedish Finns. But whether old or new, demands that university studies contribute to the formation of ethnic and special identities intruded into the education process, turned objective into subjective learning and created tensions, felt if not always expressed, within the classroom and lecture hall.
30

H. Speier, The Truth in Hell and Other Essays on Politics and Culture, 19351987 (New York and Oxford, 1989), 7, 38.

269

Sheldon Rothblatt student mobility Until the rise of the national university in Europe, with its mission of providing legal and administrative talent for the state, universities were open to students from all countries, who, aided by a common ancient language, migrated freely in search of subjects, teachers and environments conducive to their interests. State examinations in Germany enabled students to become gypsy scholars, wandering from university to university in search of the leading professors. The Ordinarien rather than any single university was the core of the Humboldtian university. Other systems, the British for example, did not encourage student mobility. A certain limited amount of it took place in the nineteenth century when undergraduates migrated from the newer civic universities, from the London colleges or from Scottish universities to Oxford and Cambridge, but this was largely because the newer institutions, and the Scottish ones, served younger students and had not yet quite achieved the quality levels of the two senior universities. The Scottish universities accepted student transfer, but for degree-seeking students of the eighteenth and nineteenth centuries the practice does not appear to have been very pronounced, nor was the transfer option heavily used in the twentieth century. Student transfer ourished in America from the later decades of the nineteenth century onwards, principally because the introduction of teaching modules to include student elective modules broke the typical university pattern of uninterrupted studies leading to a degree. Modules, being self-contained, could be saved and accumulated, and conveyed to welcoming colleges and universities. When at some undetermined point in the early twentieth century modules were give unit-credit value, the transition to a new system of student exibility was complete. From a European perspective, modules were usually disliked because they encouraged the proliferation of unrelated courses, inhibited specialization, at least early specialization, and did not guarantee quality, since each module was autonomous. Furthermore, modules weakened the general quality of an institutions degree-granting capacity because the transfer student may have taken as much as half of his or her coursework in another institution. National standards of student achievement could not be guaranteed because no common curriculum or marking system existed. And modules, as already suggested, compromised the authority of chair-holders by distributing classroom teaching responsibilities more equitably. A survey taken of British academics in 1996 indicated both widespread resistance and resentment. Not only did the process of conversion to modularity create formidable reorganization problems, difculties of timetabling and assessment, taking up valuable time and energy, it was also regarded by the academic community as imposed 270

Curriculum, students, education by university administrators and managers.31 As the American system had evolved over many decades, no sudden wrenching ever had to take place. Nevertheless, the revival of the medieval idea of a European university accessible to all students was almost a logical deduction from the formation of a legal and political European community. This led to a search for means to promote high student mobility to serve in the creation of a European as complementary to a national identity. Modules and modular programmes of study, to include credit-units, were therefore increasingly adopted, although often modied from their American source to preserve some of the features of the traditional European university model. The result was the formation of a series of programmes enabling students to travel widely in search of courses and teaching not available in their home countries or regions. In 1987 the European Action Scheme for the Mobility of University Students (Erasmus) was established.32 Under this umbrella were subsumed Inter-University Cooperation Programmes (ICPs) to promote staff mobility and uniform systems of credit transfer, study loads, examinations, evaluation and marking. The best known was the European Course Credit Transfer System (ECTS) established in 1989. Other programmes soon came into being to service secondary school students, postgraduates, teachers or business executives, such as Tempus (specically to assist Eastern and Central European countries),33 Lingua (for language-study business personnel and for students and teachers in secondary education) and Comett (for students in higher education, as well as business employees). Plans to connect some of these programmes into a new umbrella organization denominated Socrates unfolded in the course of 1994, but its implementation was slowed in 1995 because of hesitation and disagreements. Some 11,000 persons participated in Erasmus in its rst year. The heaviest users were students seeking business courses abroad, approximately 33% of those surveyed in 1988/89, followed by students desiring foreign language experience (18%), with law (11%) and engineering (10%) rounding out the top choices. Belgian and German university students were over-represented in the scheme, while Portuguese, Greek, Irish, Italian, Dutch and Danish students were under-represented. Given the
31 32

33

Times Higher Education Supplement, 25 October 1996, News, 4. Information on Erasmus and student mobility from ERASMUS Monographs 13, 15, 16, 17, published by Wissenschaftliches Zentrum fur Berufs und Hochschulforschung der Gesamthochschule Kassel, 1991, 1992, 1993; European Community Course Credit Transfer System (Commission of the European Communities (draft, 28 October 1993). Detailed information also available from U. Teichler and F. Maiworm, The ERASMUS Experience: Major Findings of the Erasmus Evaluation Research Project (Kassel, 1997). For other details, see chapter 3 (Relations with authority).

271

Sheldon Rothblatt varied heritages and circumstances of the nations and sub-nations participating in the European Union (as it came to be called), such differentials were hardly unexpected.34 Efforts to establish a common system of higher education were thwarted by a bewildering array of practices that did not lend themselves to internationalization. Spain in particular was singled out for having a parochial system of studies not conducive to student mobility. In general, students from the Mediterranean countries studying in northern Europe noted the differences in quality and standards, and those from the north residing in the south remarked upon the less demanding courses of studies in those regions. Not surprisingly, students reported that they had the most difculty taking examinations in a foreign language, and students from countries without a major international language spent the shortest periods abroad, three months or less. Other difculties, or rather differences indicating where European university instruction varied the most radically were teacher relations outside of the class format, patterns of student lecture attendance, readings in foreign language publications and the availability of course electives. Erasmus students surveyed in 1990/91 were on average more than twenty-three years of age and had completed 2.8 years of study before participating, although most had travelled before entering the programme. The average time spent in study in another country was seven months. From the standpoint of social origins, 39% came from families where one or more parents had experience of higher education, and 41% reported parental incomes of above average, only 13% as below average. Well over half of those surveyed were women.35

conclusion At the time of the early stages of Erasmus, A. H. Halsey summarized:

The history of curriculum can be summarized as passing through four principal phases of dominance, rst by priests, second by aristocrats and third by professionals. The fourth phase can be described as democratic, meaning the rise of student/consumer sovereignty. But thanks to the tricks
34

35

After all, even a small nation like Switzerland, with four national languages, possessed cantonal universities radically different from one another in course structures, time to degree, stafng and other components of a university system. Nor were the terminal awards equivalent. ERASMUS Monograph 17 (note 32), 1256. (Ten years later, Erasmus was to become the agship programme of the European Union soon to have facilitated more than a million exchanges a programme that was to be emulated in many other parts of the world.)

272

Curriculum, students, education

played upon the present by the goddess Clio, vestiges of the dominance of the rst three remained.36

Indeed, the foregoing pages have shown how intermixed were the origins of a curriculum and the styles that shaped its transmission. How a subject is taught, the setting in which it is taught and how it is grasped by the student is a subtle process that resists quantitative analysis. The inherited distribution of courses, vocational goals, the research programme, government planning efforts and manpower targets, demography, the operations of the supply and demand for education, the expansion of knowledge, the development of computerized learning, organized student activity and the inuence of business and the professions all played a part, if not an equal part, in shaping the curriculum and teaching. Since all causes are intertwined, the precise contributions of each are difcult to disentangle. Nevertheless, perhaps it is reasonable to conclude that if government was the most potent force acting upon the structure of the European university curriculum in the last fty years, the content of teaching was most affected by knowledge growth, especially through specialization and the cross-fertilization of disciplines. The notable exception, which cannot be ignored, was the inuence of political ideology on the humanities and social sciences in communist countries. In Western Europe ideological presuppositions penetrated the teaching of history, sociology and literature, as well as economics and politics, but individual teachers not governments were responsible. While it is by no means the case that academic specialisms have automatically found a place in teaching and examining at undergraduate levels, it is broadly correct to say that the professional interests of academics have continually, if unsystematically, pushed the content of the curriculum in new directions. The apparent demands of labour markets have been inuential but not as directly signicant, except at the lowest entry points into the economy, since research universities continued to exercise considerable inuence over the curricula required for professional qualications. In general, bold statements about the aims of a particular kind of educational curriculum provide only limited guidance to the type of teaching taking place in a seminar room, lecture hall, discussion class or laboratory. It is certainly the case, writes one historian, that a formal knowledge of what faculties teach or examine, and of the appointments that they make, will provide no adequate indication of the ethos in which the teaching of these subjects has been enveloped.37 A chapter-length map of the European higher-education curriculum can hardly be expected to identify the
36

37

A. H. Halsey, Who Owns the Curriculum of Higher Education?, Journal of Educational Policy, 2 (1987), 341. M. Cowling, Religion and Public Doctrine in Modern England (Cambridge, 1980), 390.

273

Sheldon Rothblatt ethos of each discipline or vividly capture the different kinds of teaching relationships characterizing so many different countries. At best, it is an imperfect map, a survey of known territories and unexplored regions, an approximate introduction but also a warning about the dangers residing in glib summaries about the curriculum. At the end of a century, and a millennium, the European university found itself in unprecedented circumstances. It was no longer even a university, only a link in a chain of differentiated institutions paradoxically both interdependent and incompatible. But perhaps it was just a leftover word, degraded as linguists say, on the point of losing all former meaning and only a synonym for higher education. The complexity of the higher-education curriculum in the 1990s was no less than the complexity of the modern nation itself. The result was, depending upon ones point of view, a tower of Babel destined to collapse upon itself or an intellectual world of extraordinary ferment and creativity, containing learning possibilities hitherto undreamt of in the history of the European university. select bibliography
Becher, T. Academic Tribes and Territories: Intellectual Inquiry and the Cultures of Disciplines, Milton Keynes, 1989. Clark, B. R. Academic Power in Italy: Bureaucracy and Oligarchy in a National University System, Chicago and London, 1997. Clark, B. R. (ed.) Research Foundations of Graduate Education: Germany, Britain, France, United States, Japan, Berkeley, Los Angeles and London, 1993. Clark, B. R., and Neave, G. (eds.) The Encyclopedia of Higher Education, 4 vols., Oxford, 1992. Gibbons, M. et al. The New Production of Knowledge: The Dynamics of Science and Research in Contemporary Societies, London, 1995. Halsey, A. H. Decline of Donnish Dominion: The British Academic Professions in the Twentieth Century, Oxford, 1992. Kotasek, J. Visions of Educational Development in the Post-Socialist Era, Inter national Review of Education, 39 (1993), 47387. Musselin, C. Steering Higher Education in France: 19811991, Higher Education in Europe, 17 (1992), 701. Neave, G., and Van Vught, F. (eds.) Prometheus Bound: The Changing Relationship between Government and Higher Education in Western Europe, Oxford, 1991. OECD, Education at a Glance: OECD Indicators, Paris, 1997. Papadopoulos, G. S. Education 19601990 : The OECD Perspective, Paris, 1994. Rothblatt, S., and Wittrock, B. (eds.) The European and American University since 1800: Historical and Sociological Essays, Cambridge, 1993. Sadlak, J. In Search of the Post-Communist University the Background and Scenario of the Transformation of Higher Education in Central and Eastern

274

Curriculum, students, education

Europe, in K. Hufner (ed.), Higher Education Reform Processes in Central and Eastern Europe, Frankfurt/Main, 1994, 4362. Szczepanski, J. Higher Education in Eastern Europe, Occasional paper International Council for Educational Development, 12, S.l., 1974. Teichler, U. Changing Patterns of the Higher Education System, London, 1988. Tikhonov, N. La qu ete du savoir: Etudiantes de lempire russe dans les universit es suisses, 18621920, PhD dissertation, Geneva, 2004.

275

CHAPTER 8

STUDENT MOVEMENTS AND POLITICAL ACTIVISM

LOUIS VOS

introduction Since the nineteenth century, students have taken it upon themselves to play a particular role in society as a group. In the Swedish tradition, they saw themselves as Guardians of the Light, whose job was to watch over the edication and enlightenment of the community. A student movement translated into the collectively organized activities of students under their own leadership; their goal was to inuence and transform society, driven by their own calling as students. It was a social or political movement focused on the wider society. While it had a general political orientation as a movement, it had no rigid programme. Nor did it align itself completely to any one organization, although an organization might well form the backbone of the movement.1 The development of student movements was only possible because (and as long as) the role of student was characterized by a specic social position.2 That position implied a role atypical for modern society, one that was conducive to group formation and kept the social price of protest low and the tendency to engage in expressive politics high. The same
1

Daily student life and timeless mores therefore fall outside this denition. D. Rucht, Modernisierung und neue soziale Bewegungen: Deutschland, Frankreich und USA im Vergleich (Frankfurt, 1994), 77; D. Rucht, Die Ereignisse von 1968 als soziale Bewegung: Methodologische Uberlegungen und einige empirische Befunde, in I. Gilcher-Holtey (ed.), 1968: Vom Ereignis zum Gegenstand der Geschichtswissenschaft (Gottingen, 1998), 11630. L. Vos, M. Derez, I. Depraetere and W. van der Steen, Studentenprotest in de jaren zestig: De stoute jaren (Tielt, 1988); K. R. Allerbeck, Soziologie Radikaler Studentenbewegungen: Ein vergleichende Untersuchung in der Bundesrepublik Deutschland und den Vereinigten Staaten (Munich, 1973); F. A. Pinner, Western European Student Movements: Through Changing Times, in S. M. Lipset and P. G. Altbach (eds.), Students in Revolt (Boston, 1969), 6095.

276

Student movements and political activism position also led to the development of a special intellectual habitus that allowed students even expected them to analyse society critically. Lastly, it was coloured by an individual calling, in which a self-image based on a living tradition became interwoven with the normative expectations of society. Such a calling could only exist as long as successive generations were willing to interpret it in terms of their life experiences and epoch. The ideological wave-like movement of student actions was thus rooted in broader historical developments, as well as in the handover from one generation to the next and in conicts between the generations.3 Owing to the rapid succession of age cohorts, student movements were usually sporadic phenomena: maintaining continuity across the generations was an exception rather than the rule.4 The student movement existed only through the committed efforts of activists. Initially they relied on informal personal contacts, but subsequently based on common experiences they developed a sense of involvement, solidarity and a certain structure. The pursuit of social inuence often went hand in hand with self-awareness. Although both elements awareness and action were usually present, the particular emphasis could differ according to the circumstances. As far as existing political movements or parties in the wider society were concerned, the student movement stood in a relationship of tension.5 It often regarded itself as the mobile vanguard of a broader emancipation movement at a national, religious or social level, for which it was also a source of new militants. In this classical form as part of an established movement the student movement often had a longer lifespan. The normative expectation held by the broader movement, as opposed to the student movement, made it easier for the tradition of an individual calling to be passed down from one generation to the next. This also meant that the ideologicalhistorical roots of the movement, especially the diverse student traditions of a particular national community, greatly inuenced developments within the student movement. A brief supranational outline of European student movements is therefore somewhat articial. However, while individual national traditions and historical developments were more important than those pertaining to the whole

3 4

A. Esler (ed.), The Conict of Generations in Modern History (Lexington, Mass., 1974). P. G. Altbach, Perspectives on Student Political Activism, in P. G. Altbach (ed.), Student Political Activism: An International Reference Handbook (New York, 1989), 117; L. Rosenmayr, Jugend, in R. Konig (ed.), Handbuch der empirischen Sozialforschung (Stuttgart, 1976); K. R. Allerbeck and L. Rosenmayr, Einfuhrung in die Jugendsoziologie (Heidelberg, 1976). H. Fogt, Politische Generationen: Empirische Bedeutung und theoretisches Modell (Opladen, 1982), 95102; M. Kimmel, Die Studentenbewegungen der 60er Jahre: Frankreich, BRD und USA im Vergleich (Vienna, 1998), 13132.

277

Louis Vos of Europe, student movements throughout Europe also inuenced one another strongly, especially in the 1960s.

international student organizations The rst post-war student generations were enthusiastic advocates of international co-operation.6 In 1941, the Soviet Union launched a programme designed to mobilize support on a platform focused on antifascism and world peace. As part of the Soviet initiative, fellow travellers and militants were urged to join representative and non-partisan organizations. In 1941, when student leaders of the British National Union of Students (NUS) actively made contact with students in other countries, the British initiators of the plan included a number of submarine or mole communists.7 In January 1945, representatives from thirteen countries met in London to make preparations for the founding of an International Union of Students (IUS). Before the meeting in London, the committee received an invitation to hold the rst post-war international student congress in Prague. The initiative to hold the congress in Prague, in memory of the students who had been executed by German troops on 17 November 1939 during a student demonstration at the University of Prague, came from communist student leaders in the Czechoslovakian student organization. Accordingly, the London committee planned its own congress immediately prior to the international conference, in November 1945; thus 150 delegates from thirty-eight countries travelled from London to Prague, where, nally, more than 600 participants from fty-one countries convened in a cordial atmosphere of friendship and international solidarity. During the Prague congress a preparatory committee was elected for the purpose of mapping out the organizational structures for the new umbrella organization. The latter, ultimately, became a strongly centralized organization with its headquarters in Prague, where in August 1946 the founding congress proper took place. The communists acquired the majority in the Executive Committee, although it was decided that the general political line would be determined at a congress every three years. The most important question was whether the organization, besides providing apolitical services and member representation, should also
6

R. Cornell, Youth and Communism: An Historical Analysis of International Communist Youth Movements (Buffalo, 1965); G. van Maanen, The International Student Movement: History and Backgound (The Hague, 1966); P. G. Altbach and N. T. Uphoff, The Student Internationals (Metuchen, N.J., 1973); J. Kotek, Students and the Cold War (Basingstoke, 1996); J. Kotek, La jeune garde: Entre KGB et CIA. La jeunesse mondiale, enjeu des relations internationales. 19171989 (Paris, 1998). Names based upon new archival evidence in Kotek, Students (note 6), 1043.

278

Student movements and political activism wage a political ght for peace and democracy and against fascism. The communist delegates thought it should. A minority of West European umbrella organizations (including Belgium, the Netherlands and the Scandinavian countries) advocated an apolitical orientation focused solely on the interests of the student as such, but the British, American and French students wanted to make political stands admissible, on condition that political involvement by the national student organizations was voluntary rather than mandatory. The latter motion was carried. In the meantime, contact between members was assured by World Student News, a monthly journal published by the IUS in Prague, which eventually appeared in various languages.8 In the 1940s the IUS represented most of the national student bodies, in the East as well as the West, with a majority from Europe and only a few from the developing countries. However, the initial period of cooperation was doomed to fail. Postwar relations between the United States and the Soviet Union rapidly deteriorated. In the summer of 1947, when the Soviet Union abandoned its policy of a common front with all anti-fascist powers and opted for massive cold-war propaganda, the tension within the IUS increased. An active non-communist minority tried to oppose the increasing communist dominance of the movement, albeit without abandoning the unity of the organization. In the summer of 1947, the newly established student union of the United States (the National Student Association) opted for that course of action. It planned a visit to Prague in the summer of 1948 to discuss the requirements for admission to the IUS. But the plan was thwarted by the Prague Coup, when the communists seized control of Czechoslovakia in February 1948. They immediately began to purge right-wing deviationists from the Czech student associations. When the IUS secretariat refused to object to this, the national student unions of Denmark and Sweden resigned in protest from the organization, the American and Swiss student unions decided not to join, and the British NUS which remained a member until 1952 went into opposition together with other Western delegations, thus exploiting the communist desire to preserve the unity of the IUS, which was a foremost consideration in their agenda. Disillusionment over the communist manipulations in the IUS resulted in the British and Swedish student unions calling for a meeting of national student unions in Stockholm in December 1950. This conference, which was attended by representatives of twenty-two national student unions, took the decision to found an alternative to the IUS: the International
8

In 1966 the journal appeared in Arabic, English, French, German and Spanish. World Student News. Magazine of the International Union of Students, 20:789 (1966). Special Issue: Twenty Years of the International Union of Students.

279

Louis Vos Student Conference (ISC). In 1952 it was constituted into a permanent organization, and set up a COordinating SECretariat (COSEC) in Leiden in the Netherlands. In the same year, the Danish, Swedish, Swiss and American student unions, as well as the British, Norwegian, Belgian, French, Canadian, Australian, Brazilian and Scottish organizations, all broke from the IUS to support the ISC. Thus, in the 1950s and 1960s, there were two opposing international student bodies, both of them pawns on the chessboard of the cold war. On the one hand there was the IUS, built with the support of the Soviet Union into a fully communist organization that followed a distinct left-wing political line; on the other hand there was the ISC, which was supported by the United Kingdom and the United States, whose members consisted of the national student unions that found the IUS too communist-oriented and who wanted to be politically neutral. The fourth World Congress of the IUS in Prague, in September 1956, developed into an open conict between the student representatives from the communist countries and their Western counterparts. The repression of the Hungarian Revolution in November caused many national student unions and the ISC to side with the Hungarians, whereas the IUS leadership and the leaders of all the communist student organizations except the Polish supported the Soviet Union. In the second half of the 1950s the ISC grew rapidly, culminating in a membership of eighty national student unions in 1962. From 1956 to 1968 it published a monthly journal compiled by the COSEC (The Student), which appeared in four languages. It sponsored projects and conferences, including the International Student Press Seminars, and organized international student trips. At the same time, however, the open inghting between the student responsibility proponents and supporters of the student-as-such principle began to intensify again. The former wanted the student movement to feel co-responsible for broader social issues, while the latter wanted to restrict the student movement to issues affecting the students themselves.9 The legalistic notion shared by the West European and American student unions that the student could have a political standpoint as an individual, but that representative student unions should refrain from political involvement, came under increasing pressure from student unions in developing countries, which questioned the relevancy of isolated debates on education outside the social and political context and were in favour of classical student movements. The decolonization movement that started around 1960 strengthened their position. To stop the young countries from moving over to the IUS,
9

Van Maanen, International (note 6), 11743.

280

Student movements and political activism the ISC was therefore compelled to allow politics to be included in the debate. The evolution of the ISC thus reached full circle: at the eleventh ISC conference in 1964, which was held in New Zealand, the ISC voted in favour of a charter that transformed it into a distinct political counterforce to the IUS. Apart from this aggregation of national student unions, there also existed international student associations with a pronounced ideological avour.10 The oldest of these were the religious organizations. The Protestant World Student Christian Federation (WSCF), which had existed since the nineteenth century, was sponsored after the war by the World Council of Churches. Since the beginning of the twentieth century there had been a student union for the Young Mens Christian Associations (YMCA), of which the Intercollegiate Volunteer Movement was a sister organization. The oldest international Catholic association was founded in 1921 as a confederation of Catholic student associations under the name of Pax RomanaInternational Movement of Catholic Students (IMCS). The year 1946 saw the advent of a second student union, which grouped together the student associations with a specic focus on Catholic action: the International Young Catholic Students (IYCS).11 The period between the First and Second World Wars also saw the establishment of the World Union of Jewish Students. The work of these organizations with a religious background was particularly focused on the socio-religious situation of the student world and not so much on politics, although interest in the latter grew from the 1960s onwards, inuenced among other things by Latin American liberation theology. There was an International Union of Christian Democrats (IUCD), created in 1962, and a World Federation of Liberal and Radical Youth (WFLRY), which was likewise founded in the 1960s. As for the social-democratic International Union of Socialist Youth (IUSY), when in 1968 it was discovered that it had received funds from the CIA, a crisis and a temporary suspension of the IUSYs activities ensued. Dissatisfaction with the apolitical functioning of the national student unions culminated in a series of meetings of the European representatives of the student union movement: in July 1966 in Geneva, in December of the same year in Ghent, and in FebruaryMarch 1967 in Brussels. These students were from Belgium, Germany, the United Kingdom, France, Ireland, Luxembourg, the Netherlands, Portugal, Spain and Switzerland. They accused the leadership of the national student unions of restricting

10 11

Altbach and Uphoff, Student Internationals (note 6), 98113. B. Pelegri, IMCS-IYCS: Their Option, their Pedagogy (Kowloon, 1979).

281

Louis Vos their activities to the organization of student trips, student exchange programmes or purely technical cultural cooperation, without any involvement of the students themselves. Incidentally, the content of the concept of student syndicalism changed. Less and less emphasis was placed on the defence of tangible student interests and increasing stress was put on the politicized pursuit of a democratic society as the most important student responsibility. The new syndicalists rejected the stupid theory of student-as-such and the hypocritical immobilism brought about by indifference to politics. Their aim was to initiate a militant European student movement, and their plans included the organization of annual conferences, the publication of a syndicalist newsletter, and bilateral and regional seminars and study weekends. In August 1967 a meeting in Berlin provided an opportunity for the student union leaders to forge new contacts with international colleagues, which revealed two fundamental strategy lines at cross-purposes with each other. One approach aimed at mobilizing support centred around academic issues, while the other advocated interest in major world issues such as Vietnam, developing countries or the threat to democracy. In 1967 it also became known that more than three-quarters of the resources of the ofcially apolitical and nancially independent ISC were being covertly provided by the American Central Intelligence Agency (CIA). This revelation provoked the end of the ISC, which had lost its credibility; indeed, it ceased to function when the nancing stopped. The IUS continued to operate as the sole surviving umbrella organization, but it failed to exert any inuence on the New Left tendencies. As a front organization of the Soviet Union, it was distrusted by the new student movement. However, it carried on with its normal agenda and organized congresses and other events for students from around the world. It was threatened from the inside on just one occasion. In the autumn of 1981 , an independent national student in Poland, at the time of Solidarno sc union ousted the communist student organization, condemned the IUS as a non-representative manipulative tool of Moscow, and called for an international student congress in Warsaw in December 1981 to create a new, independent international student organization.12 The plan, however, was thwarted by General Jaruzelskis coup d etat on 13 December of that year. The IUS continued to function until 1989, when its ultimate demise coincided with the collapse of the communist regimes. The signicance of the IUS and the ISC did not lie so much in the establishment of student movements in certain countries, but in the
12

L. R ev esz, Jugendbewegungen im Ostblock (Vienna, 1985), 107.

282

Student movements and political activism opportunity that it afforded student leaders from all over the world to meet one another and thus to function as a training and meeting ground.13 Secondly, the IUS and the ISC also had signicance as microcosms of the cold war, for they were attempts of the two superpowers to lure students the leaders of tomorrow into their camp. The fact that the Soviet Union started to employ inltration and front organizations during the war, and that later American behaviour was merely a response and therefore a defensive action, is correct but this does not redeem the ISC op. Anyway, both organisations contributed to the myth of the international student movement, which strengthened the self-condence of the national student movements in the 1960s without there ever having been a real New Left student international.

diverging missions (19451956) The post-war period brought diverging missions for the student movements in both democratic and non-democratic countries. In the Soviet Union and the Eastern bloc, but also in the right-wing dictatorships of Spain and Portugal, the party and the state streamlined everything. The tradition of the classical student movement was continued by students in opposition. They expressed their student responsibility towards the broader society by standing up for civil liberties or national independence. They faced merciless repression, could not count on fair treatment in the mass media, and took greater risks than activists in democratic countries. In those countries, however, if some students wanted to follow the classical model of the student movement, others wanted to limit the task of the student movement to the interests of the student as such. In the SOVIET UNION the students were de facto depoliticized in 1945, despite the formal semblance of concurring with the ofcial party line.14 In 1956, however, expressions of support for the Hungarian revolution and protests against the Soviet intervention were voiced in Tbilisi (Georgia), Vilnius (Lithuania), Leningrad, Kiev, Kharkov, Sverdlovsk and even in Moscow by means of posters, handwritten pamphlets and underground newspapers. Such activism was quickly suppressed.15 In the Soviet zone of Germany, the reopening and purging of the universities was prepared jointly by the Russian occupation authorities and local communist
13 14

15

Altbach and Uphoff, Student Internationals (note 6), 45. S. K. Morrisey, Heralds of Revolution: Russian Students and Mythologies of Radicalism (New York, 1998), 2314; R. D. Dobson, Soviet Union, in Altbach, Activism (note 4), 26378; R. J. Misionas and R. Taagepera, The Baltic States: Years of Dependence 19401990, 2nd edn (Berkeley, 1993), 115. R ev esz, Jugendbewegungen (note 12), 183.

283

Louis Vos students,16 but open resistance to the communist domination continued to exist until about 1950. In elections for the student councils in 19467, the communists at the (East Berlin) Humboldt University failed to gain a majority despite numerous arrests and expulsions.17 A similar scenario followed the communist takeover in CZECHOSLOVAKIA in February 1948, but the minority of communist students, or studentocracy (a term unique to Czechoslovakia meaning student control of university Communist Party organizations) were given a free hand to purge university professors and students alike.18 Nevertheless, there were several expressions of protest in 1951, 1953, 1955 and in 1956 against the invasion of Hungary.19 In POLAND the national reaction created a different situation.20 The non-communist professors continued to set the tone. The number of party members in the student world was still only 9% in 1953 as opposed to three to four times that number in the German Democratic Republic and Czechoslovakia and by 1958 the percentage had dropped even further to 2.5%.21 After a short-lived armed uprising in Poznan in June 1956, in which students played a part,22 the so-called Polish October in 1956 was an attempt by the Polish communists to restore condence by a move to greater openness. It was the beginning of de-Stalinization. This example had a contagious effect in HUNGARY where the students,
16

17

18

19 20 21

22

M. Muller and E. Muller, Sturmt die Festung Wissenschaft!: Die Sowjetizierung der mitteldeutschen Universitaten seit 1945 (Berlin-Dahlem, 1953); E. Richert, Sozialistis Die Hochschulpolitik der SED (Berlin, 1967), 435; W. Klose, Freiheit che Universitat: schreibt auf eure Fahnen: 800 Jahre deutsche Studenten (Oldenburg, 1967), 25460; W. Kronig and K.-D. Muller, Anpassung, Widerstand, Verfolgung: Hochschule und Studenten in der SBZ und DDR (19451961) (Cologne, 1994), 148; W. Kronig and K.-D. Muller, Nachkriegssemester: Studium in Kriegs- und Nachkriegszeit (Stuttgart, 1990), 21537; R. Jessen, Zwischen diktatorischer Kontrolle und Kollaboration: Die Universitaten in der SBZ/DDR, in J. Connelly and M. Gruttner (eds.), Zwis chen Autonomie und Anpassung: Universitaten und Diktaturen des 20. Jahrhunderts Freiheit und Menschenrechte: Der Ring (Paderborn, 2003), 22963; J. Weberling, Fur christlich-demokratischen Studenten (RCDS) 19451986 (Dusseldorf, 1990), 212, 32 46. K. W. Fricke, P. Steinbach and J. Tuchel (eds.), Opposition und Widerstand: Politische Lebensbilder (Munich, 2002), 16286; Klose, Freiheit (note 16), 24968; R. Kohler, Neubeginn und Neubestimmung. Universitaten und Hochschulen in der antifaschistisch demokratischen Umwaltung, in Magister und Scholaren, Professoren und Studenten: Geschichte deutscher Universitaten und Hochschulen im Uberblick (Leipzig, 1981), 195215; Weberling, Freiheit (note 16), 3246. J. Havranek, Die tschechischen Universitaten unter der kommunistischen Diktatur, in Connelly and Gruttner, Autonomie (note 16), 15771; Richert, Sozialistische (note 16), 590; Kohler, Neubeginn (note 17), 217. R ev esz, Jugendbewegungen (note 12), 36, 434. R ev esz, Jugendbewegungen (note 12), 2631. J. Connelly, Die polnischen Universitaten unter der Staatssozialismus. 19441968, in Connelly and Gruttner, Autonomie (note 16), 17397. R ev esz, Jugendbewegungen (note 12), 67.

284

Student movements and political activism on 22 October 1956, demanded more democracy and greater freedom. It heralded the beginning of an armed national uprising that developed into a national and democratic ght for freedom, rst against the communist security troops and, from 4 November, against the Russians, whereby many students lost their lives.23 The repression of the uprising sent a shock wave across both the Eastern bloc and the West, where a chorus of outrage found expression in many motions of protest; political reaction also led to splits in the communist ranks. Until 1956, few dissident voices were heard in the student world of the non-democratic right-wing European countries. In Francos SPAIN the Falangist SEU (Sindicato espanol universitario) was the only student association sanctioned by the regime. Membership was compulsory and it was organized on strictly authoritarian lines, albeit with internal tensions between the monarchists, supporters of Franco, and the Falangists, with the latter being purged in 1954.24 In February 1956, hundreds of Madrid students called for the democratization of the SEU: that led to clashes with Falangist students and resulted in one fatality.25 In Salazars PORTUGAL, opposition to the ofcial fascist youth and student associations likewise increased, sparking the rst student protests in Lisbon and Coimbra in 1956.26 In democratic WESTERN EUROPE, the post-war student leaders initially focused on improving the social position of the student and on democratizing the university. Their aims were twofold: on the one hand, lowering the access threshold for students from lower social groups by means of scholarships, student accommodation, student restaurants, study services and student health care on the one hand, and student participation on the other. Student syndicalism could be strictly limited to consultation on student affairs, or it could become a vindication movement embedded in the pursuit of a democratic society. In the rst case, politics and confrontation were avoided as much as possible; in the second, they formed the core of the movement. In the post-war years the apolitical line prevailed, even if, from the second half of the 1950s, the broader political context predominated. In some countries, however, the time-honoured engagement of the student movement in favour of
23

24

25 26

R ev esz, Jugendbewegungen (note 12), 11999; G. P etery, Die kommunistische Idee der Universitat ein von den Erfahrungen Ungarns inspirierter Essay, in Connelly and Gruttner, Autonomie (note 16), 12955; D. F. Burg, Encyclopedia of Student and Youth Movements (New York, 1998), 4, 155, 98100. L. S. Feuer, The Conict of Generations: The Character and Signicance of Student univerMovements (London, 1969), 2956; M. A. Ruiz Carnicer, El Sindicato espanol pol sitario (SEU), 19391965: La socializacion tica de la juventud universitaria en el franquismo (Madrid, 1996). B. Schutze, Widerstand Spaniens Universitaten, Kursbuch, 13 (June 1968), 2930. Feuer, Conict (note 24), 2914.

285

Louis Vos wider national, social or religious emancipation continued to exist and was sometimes allied with student syndicalism. Foremost in this development was FRANCE, where the post-war communist and Catholic students met in the overarching Union nationale des e ais (UNEF), the association taking advantage of the tudiants franc desire of the new Fourth Republic to integrate students into the national community.27 The Grenoble Charter, so called because the UNEF had convened a meeting there in 1946, set the tone.28 It demanded that the student be categorized as a young intellectual worker (jeune travailleur intellectuel) devoted to the search for truth and freedom, but who should now receive from the state, as an advance for services to be rendered to society at some later date, une pr evoyance sociale particuli` ere dans le domaine physique, intellectuel et moral and even, if possible, a students wage. In 1951 that demand just failed to become law and subsequently disappeared from sight. The Charter remained a point of reference for both the French student movement and its foreign counterparts until well into the 1960s. In several other countries, such as the UNITED KINGDOM, SWEDEN and THE NETHERLANDS, student leaders and the authorities were on the same wavelength. The British NUS already had a blueprint for the new post-war university, drawn up during the war in cooperation with academics and civil servants; it stated that higher education should be available to everyone, that students should be given full self-government of their own affairs, and that at the same time they should be integrated more into society.29 This was repeated in the Student Charter of 1949, which also argued in favour of more tutorials and seminars, the use of new audiovisual techniques in education, and oral examinations.30 In 1945 the Swedish student union (Sveriges forenade studentkarer SFS) was promptly given a seat on the Government Com mission on Higher Education.31 In the immediate aftermath of the war, the overarching Student Council of the Netherlands soon found itself in
27

28

29

30

31

pur C. Singer, Luniversit e lib er ee, luniversit ee ee: 19431947 (Paris, 1997), 6673; D. tudiants en France de 1945 a ` nos jours (Paris, 2000); J. P. Worms, Fischer, Lhistoire des e The French Student Movement, in Lipset and Altbach, Students (note 2), 26778. Burg, Encyclopedia (note 23), 42; Worms, French (note 27), 2723; Singer, Universit e (note 27), 118; Fischer, Histoire (note 27), 524. A. Marwick, Youth in Britain, 19201960: Detachment and Commitment, Journal of Contemporary History, 5 (1970), 3751; Burg, Encyclopedia (note 23), 1412. E. Ashby and M. Anderson, The Rise of the Student Estate in Britain (Cambridge, Mass., 1970), 86105. N. Runeby and C. Skoglund, Sweden, in Altbach, Activism (note 4), 27995; R. Tomasson and E. Allardt, Scandinavian Students and the Politics of Organized Radicalism, in Lipset and Altbach, Students (note 2), 96126.

286

Student movements and political activism difculties owing to the revival of the old fraternities, which caused the traditional aloof from society image of the student world to return.32 In GERMANY and AUSTRIA, which had been devastated by the war, the immediate post-war years were characterized by military zones of occupation. In West Germany the difcult material conditions strengthened the ohne mich (without me) mentality that followed twelve years of ideological indoctrination, so that students were more concerned about food than democracy, but also susceptible to scepticism.33 The development of democratic student organizations was encouraged by the occupying powers, while the traditional associations were forbidden because they elicited reminiscences of chauvinism, but also because of the elitism that they exuded. That appeared to be behind the times in the new democratic era.34 However, after the founding of the Federal Republic of Germany the schlagende Korporationen (duelling fraternities) and their mores including the Mensur reappeared, and by the early 1960s they had succeeded in attracting 30 per cent of the student body to their ranks.35 In Austria, where the fraternity developed an extreme right-wing ideology characterized by anti-Semitism and volkisch German nationalism, their numbers were even greater.36 The depoliticization that occurred in the rst half of the 1950s also occurred in FRANCE where, in the period 19506, the UNEF was taken over by a majority that was reluctant to initiate any political action for fear of having to take a stand on the Algerian war.37 In that period the British NUS leadership likewise became increasingly apolitical and technocratic in its negotiations with the authorities, as a result of which
32

33

34

35

36

37

A. Doeve, De Nederlanse studentenraad, in Studenten van haver tot gort (Delft, 1957), 11532; R. Hogendijk, Het studentenleven (Amsterdam, 1980), 2109; J. Janssen and P. Voestermans, Studenten in beweging: Politiek, universiteit en student (Nijmegen, 1984), 617; K. van Berkel, Academische illusies: De Groningse universiteit in een tijd van crisis, bezetting en herstel, 19301950 (Amsterdam, 2005). H. Schelsky, Die skeptische Generation: Eine Soziologie der deutschen Jugend (Cologne, 1957). Weberling, Freiheit (note 16), 31; Klose, Freiheit (note 16), 268331; L. Elm, Das Ver gangene ist nicht vergangen, in L. Elm, D. Heither and G. Schafer Burschen, (eds.), Fuxe, Alte Herren: Studentische Korporationen vom Wartburgfest bis Heute (Cologne, 1992), 180219; K. H. Jarausch, Deutsche Studenten, 18001970 (Frankfurt, 1984), 222. Klose, Freiheit (note 16), 3223; H. O. Keunecke, 250 Jahre Erlanger Studentengeschichte. Soziale Bestimmung, politische Haltung und Lebensform in Wandel, Erlangen-Nurnberg in H. Kossler (ed.), 250 Jahre Friedrich-Alexander-Universitat: (Erlangen, 1993), 153203. M. Gehler, . . . erhebich, wie ublich, die Rechte zum Gru . . . Rechtskonservatismus, Rechtsextremismus und Neonazismus in osterreichischen Studentenverbindungen von 1945 bis 1995, in D. Heither, M. Gehler, A. Kurth and G. Schafer, Blut und Paukboden: Eine Geschichte der Burschenschaften (Frankfurt, 1997), 187222. Fischer, Histoire (note 27), 185204.

287

Louis Vos they lost touch with the majority of the students.38 This alienation also occurred in Sweden, where the SFS did have a major say in the expansion plans for higher education in 1955. However, as a consequence of the question whether the student union should condemn the apartheid regime in South Africa or the war in Vietnam, sentiments were voiced by the rank and le to return to the classical student movement of the Guardians of Light. In Helsinki, the Union of Academic Freedom (VAL) argued in favour of an idealistic Finnish nationalism without materialism and hedonism, allied with a formal academic traditionalism.39 In BELGIUM there was no question of depoliticization. In the post-war period the Flemish student movement in Leuven resumed its role as avantgarde and recruitment eld for the broader Flemish national movement.40 It did, however, develop new emphases. The old national demands were avoured by social accents and converged into a single platform with the new student syndicalism. Among the better-off French-speaking students in Brussels and Leuven there was no back to the people tradition, and the concepts of nationalism and student syndicalism failed to strike a sympathetic chord. There the regional, apolitical beer-drinking student societies were still setting the tone.

a new student movement (19581969) Whereas sociologists had a short while earlier labelled the post-war youth in the democratic Europe as sceptical and apolitical, a turning point was reached at the end of the 1950s: it led to a new student movement.41 The origins and the development of this movement were inuenced by the history of individual nations.42 Everywhere, however, the movements were supported by students born during or after the war, whose own experience stratication was coloured by the fact that they were the rst in history for whom the welfare state and democracy were a given. They could permit themselves the luxury of inveighing against the hollowness of the purely consumer society and the hypocrisy of the political system. In retrospect, for the generation of 1968 the protest turned out to be
38

39

40

41

42

S. Ellis, A Demonstration of British Good Sense? British Student Protest during the Vietnam War, in G. J. De Groot (ed.), Student Protest: The Sixties and After (London, 1998), 5469; A. H. Halsey and S. Marks, British Student Politics, in Lipset and Altbach, Students (note 2), 3559. Die Universitat Helsinki 16401990 (Helsinki, M. Klinge, Eine nordische Universitat: 1992), 71547. L. Vos, Van Vlaamse Leeuw tot rode vaan . . . en verder: de naoorlogse Leuvense studentenbeweging, Onze Alma Mater, 47:3 (1993), 24159. J. Habermas, L. von Friedeburg, C. Oehler and E. Weltz, Student und Politik (Neuwied and Berlin, 1961). Kimmel, Studentenbewegungen (note 5), 13290.

288

Student movements and political activism the generational event. It gradually brought about an international convergence of the movements in terms of themes and forms of action, thus creating ultimately the image of a single movement. In terms of content, the most important new student movement developed in WEST GERMANY. New Left anti-authority views were strengthened by the ban-the-bomb movement, which held an annual Ostermarsch in the period 195967,43 and by the critical theory of the Frankfurt School centred around the sociologists Horkheimer, Adorno, Habermas and Marcuse (who remained in America) they offered dialectic criticism of value-free scientic positivism. The organizational framework was the Sozialistische Deutsche Studentenbund (SDS), which in 1961 had severed all ties with the German Social Democratic Party; its key centres were in West Berlin and Frankfurt.44 The SDS action started with a conict concerning the freedom of political speech at the Free University of Berlin, but the mass mobilization of student opinion really got into its stride with the protest against the Vietnam war, a theme that originated in the United States and became the principal catalyst for action everywhere. There were three reasons for this.45 In the rst place, it was a morally unjustiable war; in the second place, the fact that a population of peasants in a developing country was able to resist a superpower caused many to believe that repressive authority could and should be successfully challenged; and in the third place, students consequently began to regard repression elsewhere in the world and in their own country as part of one and the same system, which must be opposed worldwide. The Vietnam protest mobilized thousands of students in Germany in the period 19657. One of the meetings was addressed by Marcuse.46 He considered protest against the Vietnam war as a moral duty in light of Germanys Nazi past, and he argued referring to the student protest in the United States in favour of a negierende Opposition gegen die Gesellschaft als Ganzes via a moral, sexual and political rebellion. He emphasized that this was only possible through a coalition of both the Priviligierten (privileged students and intellectuals) and the Unterpriviligierten in the industrialized countries (the working class, ethnic minorities, social

43

44

45 46

K. A. Otto, Vom Ostermarsch zur Apo: Geschichte der auerparlamentarischen Opposition in der Bundesrepublik 196070 (Frankfurt, 1977). A. D. Moses, The State and the Student Movement in West Germany, 196777, in De Groot, Student Protest (note 38), 13949. Ellis, Demonstration (note 38), 55. I. Gilcher-Holtey, Die 68er Bewegung: Deutschland, Westeuropa, USA (Munich, 2001), 54, 6571; W. Kraushaar (ed.), Frankfurter Schule und Studentenbewegung: Von der Flaschenpost zum Molotowcoctail. 19461995, Vol. I (Hamburg, 1998), 24950, 2657.

289

Louis Vos fringe groups, the unemployed) and in the Third World (liberation movements), thus bundling together the entire socio-critical movement under a common denominator and making a link between political protest and counter-culture. The student leader Rudi Dutschke added that the greatest threat to democracy lay in the unresolved legacies of the Nazi past, which led to individuals being unconsciously moulded in their daily life into authoritarian personalities.47 Agitating against authority and authoritarian structures could contribute to personal freedom. Such critical agitation would change both the individuals and after a long march the structures themselves. It would thus be possible to construct both the new mankind and the new society at one and the same time. The killing of a German university student, Benno Ohnesorg, shot by a police bullet on 2 June 1967 in Berlin during an anti-Shah demonstration, seemed to conrm that the established order was taking the path of fascism. Thousands of outraged students took to the streets. In the ensuing debate on strategy, the anti-authoritarian line prevailed over the left-wing socialist line that was in favour of seeking co-operation with the labour movement. In 19678, the movement launched the Kritische Universitat, with the goal of precipitating ideological tenets while denouncing the so-called value-free, objective science thanks to the students self-motivation and permanent dialogue with professors. Such Critical Universities were set up in Berlin, Frankfurt, Heidelberg, Kiel, Mainz, Munich, Munster and Tubingen, and in 1967 the model was exported to Dutch, Italian and Flemish universities, but not to the French ones. These developments were paralleled by continuing demonstrations against the Vietnam war, but also against consumer society and the Notstandsgesetze that aimed to curtail parliamentary power, and against the right-wing media mogul Axel Springer. At the anti-imperialist Vietnam Congress in Berlin, on 1718 February 1968, Dutschke succeeded in rallying students from all over Western Europe. He exhorted them to join him in the Ausserparlamentarische Opposition (APO), the breeder of a world revolution. However, when public opinion turned against the students, on Maundy (or Holy) Thursday, 11 April a few days after the murder of Martin Luther King Dutschke was shot and seriously injured; violent student protests followed and led to more casualties and the increasing isolation of the movement. Student leaders tried without success to convince the workers to take industrial action against
47

The notion of Authoritarian Personality was coined by Adorno in an empirical analysis of authoritarian structures; see T. W. Adorno et al., Studies in Prejudice (New York, 1950).

290

Student movements and political activism the imminent acceptance of the Notstandsgesetze. But, on 30 May, Parliament passed the emergency bill.48 In FRANCE the decolonization and the actions against the Algerian war changed student politics at the end of the 1950s. From May 1958 the politically engaged group in the UNEF, which for years had been in the minority, regained control of the association and turned the French student union into the main centre for the entire resistance movement against the war in Algeria. Some of the students, those who continued to swear by an apolitical stance, broke away from the UNEF in 1961 and formed an apolitical student union of their own. When the conict ended in 1962, a whole generation had become aware of the decisive inuence that students could have on the course of history.49 Student organizations were formed that embraced both extreme left-wing and extreme rightwing politics. Thus, the UNEF protested against a technocratic-economic restructuring of the university, which came into force in 19678. The May Movement of 1968 joined in. It started in Nanterre with the March 22nd Movement, with Daniel Cohn-Bendit emerging as student leader, and on 2 May it moved on to the Sorbonne, where the occupation of the university was brought to an end by the police. The following days were marked by a series of violent clashes with the police, as during the Night of the Barricades (10 and 11 May 1968). Police excesses caused public opinion to side with the students. Solidarity strikes by social groups of diverse origins culminated in a general strike on 13 May, in which as many as 7.5 to 9 million people ultimately participated. The magic word was autogestion (workers control or selfmanagement), a principle that would have to be attained not only in the universities, but also in the schools and factories. In a never-ending debate at open meetings, in caf es and on the streets, radical criticism was levelled at the nature of the existing society, in the hope of sparking a left-wing revolution.50 But it never happened. De Gaulle managed to stay in power. In the student world a new phase of ideological struggle was then initiated between various left-wing factions.51 In ITALY the new student movement was born out of dissatisfaction with the academic structures.52 However, just as in Germany, it was Vietnam that mobilized the students. In March 1967 the sociology students
48

49 50 51

52

Kraushaar, Frankfurter Schule (note 46), 289312; Gilcher-Holtey, Die 68er (note 46), 902, 94. Fischer, Histoire (note 27), 22459; Gilcher-Holtey, Die 68er (note 46), 8093. J.-P. Le Goff, Mai 68: Lh eritage impossible (Paris, 2002), 45763. Fischer, Histoire (note 27), 383417; G. Statera, Death of a Utopia: The Development and Decline of Student Movements in Europe (Oxford, 1975), 181; Kraushaar, Frankfurter (note 46), 31241. R. Lumley, States of Emergency: Cultures of Revolt in Italy from 1968 to 1978 (London, 1990), 635; Gilcher-Holtey, Die 68er (note 46), 425, 712.

291

Louis Vos in Trent led the way with a student strike and occupation of the university buildings. The protests were taken over in the following weeks at the universities of Rome, Pisa, Milan, Florence and Perugia.53 In the autumn and winter of 1967/8 the confrontation resumed in Trent and spread elsewhere, as in the Catholic University of Milan; by January 1968 a total of thirty-six universities were occupied. The criticism of academic authoritarianism evolved in a short time into anti-authoritarianism per se and into a contestazione globale of society; inspired by Marcuse, Fromm and psychoanalysis, the movement also referred to beliefs held by Dutschke. The occupied buildings provided the opportunity to develop a counter-culture in which solidarity and the importance of the community transcended the individual, in which taboos were also broken in what the right-wing press called the Nights of Mao.54 In these sexual experiments a traditional gender role frequently continued to dominate but the discrimination of female students by their male colleagues was not felt as such. The rst communes were a natural extension of this development. In the Italian student protests violence played a major role, as in the clashes on 1 March 1968 between the police and students at the Villa Giulia in Rome, symbolic starting point of the confrontation.55 Police excesses, like in France, caused public opinion to side with the students; this encouraged students to opt explicitly for violence. It was no accident that their most popular battle song became La Violenza. That was the beginning of Italys decade of lead (anni di piombo).56 As in Germany and France, though slightly later, the movement likewise disintegrated. An anti-authoritarian stance placed the emphasis on student power (potere studentesco) and wanted to keep the university as a eld of activism. Insofar as the political stance centred around the newspaper Il Potere Operaio (workers power), it proposed action in the factories but clung to an anti-bureaucratic and fundamentally democratic orientation. The Maoists also went to the workers, but promptly abandoned anti-authoritarianism to develop a party structure acting as a revolutionary vanguard for the workers struggle. This move gained momentum when the French workers began action on the other side of the Alps. In the strikes of 19689, students played an important role through the comitati di base: rank-and-le committees that strengthened the workers distrust towards the ofcial reformist trade unions and zealously advocated workers autonomy.57
53 55 57 54 Lumley, States (note 52), 87107. Halsey and Marks, British (note 38), 447. 56 Gilcher-Holtey, Die 68-er (note 46), 757. Statera, Death (note 51), 1067. Statera, Death (note 51), 22159; I. Gilcher-Holtey, Die Phantasie an die Macht: Mai 68 in Frankreich (Frankfurt, 1995); I. Gilcher-Holtey, Die 68-er (note 46), 10220; G. Dreyfus-Armand, R. Frank, M.-F. L evy and M. Zancarini-Fournel (eds.), Les ann ees 68: Le temps de la contestation (Brussels, 2000).

292

Student movements and political activism In the UNITED KINGDOM the Anglo-French attack on Egypt and the Suez crisis in 1956 led to student protests against imperialism, while the Soviet invasion of Hungary accelerated the rise of the New Left, in which Oxford students played a part. The New Left subsequently grew by concentrating on the Campaign for Nuclear Disarmament. In November 1964, students in London demonstrated against apartheid, and a few months later against the war in Vietnam. The politicization increased through disappointment with the right-wing policy of the Labour Government, which had been in ofce since 1964.58 The sit-in, staged at the London School of Economics (LSE) in March 1967, was the result of a disciplinary conict that stemmed from a political stand, but here too it was mainly Vietnam that brought the students onto the streets in protest. The largest demonstrations took place in London outside the US embassy in October 1967 and in March and October 1968, but other actions also took place in other parts of the country; in 1967 and 1968 demonstrations occurred in about half of all the UK universities or colleges.59 Generally speaking, the British new student movement was less violent and less ideologically radical than anywhere else. However, it did succeed in gaining joint democratic decision-making in universities, although the leadership of the British NUS remained aloof from the student movement or even explicitly opposed it. That stamped the NUS as a conservative association that was completely out of touch with its student members. To discredit the NUS leadership, in 1967 radical students revealed the CIA nancing of the ISC. By November 1968 the position of the radicals was sufciently strong to force the NUS to leave the ISC. Dissatisfaction with the politics of the NUS caused the local student unions, like those of Keele and Hull, to withdraw from the NUS and also resulted, in 1967, in the establishment of a reformist left-wing student union (Radical Student Alliance RSA), followed in 1968 by a revolutionary student union (Revolutionary Socialist Students Federation RSSF). In 1969 the RSA, supported by the radicalization of the campuses, succeeded in taking over the leadership of the NUS. In BELGIUM, at the beginning of the 1960s, the Flemish student movement in Leuven had succeeded in reconciling student syndicalism with Flemish nationalism. Through the turmoil of two student revolts it would eventually transform itself into a new student movement. The policy of monolingualism in Flanders, which had been compulsory since 1963, prompted the Flemish nationalists to demand the siphoning off of the French-speaking department of Leuven University to the Walloon region
58 59

M. Shaw, Great Britain, in Altbach, Activism (note 4), 23648. Ellis, Demonstration (note 38), 5465; K. Mehnert, Twilight of the Young: The Radical Movements of the 1960s and their Legacy (Stanford, 1976), 601.

293

Louis Vos of Belgium. In 1966 the Belgian bishops rejected the idea and demanded unconditional obedience.60 This rejection sparked off the May Revolt of 1966, which rapidly spread across the country as a Flemish national protest movement, but above all as one with a democratic, anti-clerical and anti-authoritarian identity. In student circles the emphasis quickly changed from Flemish nationalism to anti-authoritarianism with New Left leanings. In 1967 that resulted in the establishment of a (initially small) radical Studentenvakbeweging (student trade union). Under pressure from the protest campaign, the bishops decided to leave further decisions to the political establishment, but when it was found that the French-speaking academic authority had nonetheless decided to stay in Leuven, a second revolt of the Flemish students broke out in January 1968. The three-week protest precipitated the fall of the Belgian Government and resulted in the university being split up, with the Frenchspeaking departments of Leuven University moving to a new university in the Walloon region. As a result, the Leuven militants severed their ties with the Flemish movement and became New Left supporters. In May 1968 students at the university in Brussels launched a new student movement of their own, with an association libre, which lasted precisely one month.61 In Leuven the movement resumed in the next academic year and expanded to the other Belgian universities of Antwerp, Ghent and Li` ege. Although the initial mobilization theme was student participation, the movement quickly broadened to embrace criticism of global society via the themes of the Third World and Vietnam, while radical militants tried also to establish contact with striking workers. In THE NETHERLANDS, until the beginning of the 1960s, being a student was primarily an experience set aside from social reality.62 Then a new generation suddenly rediscovered the students capacity for radical criticism and established a Studentenvakbeweging (student trade union). It soon found a following in all Dutch universities, demanding student empowerment and social facilities for students; in 1967, this led to setting up a Kritische universiteit at various locations. Concurrently, in Amsterdam an avant-gardist and provocative movement emerged, the so-called Provo, in which students and former students were active. In April 1969, government plans for technocratic reforms of the universities triggered massive student protest, rst at the Catholic universities of Tilburg and Nijmegen and subsequently in Amsterdam and Leiden, accompanied by sit-ins and a student movement that quickly broadened
60 61 62

Vos et al., Studentenprotest (note 2), 229. ` Bruxelles contestait (Brussels, 1990). S. Govaert, Mai 68: C etait au temps ou P. de Rooy, Kapitalist moet je geloof ik niet zijn: On the Reinvention of the Student in the 1960s (lecture, Amsterdam, 27 May 2005); van Berkel, Academische (note 32), 3766.

294

Student movements and political activism out to encompass social criticism.63 In the autumn of 1969 the movement lost its mass following, and political factioning gradually began to emerge. The most important structural result of the student actions was the enactment, in December 1970, of the Wet op de universitaire bestuurshervorming (Universities Administrative Reform Act), which opened the door through simplied parliamentary rules to joint democratic decisionmaking at all levels including the administrative and technical personnel in the policy of the university. It was probably the most farreaching academic democracy exacted by a student movement in the 1960s. Student protests also occurred in the Scandinavian countries, with sitins at the universities of Stockholm, Copenhagen and Helsinki. The situation remained amicable, however, without recourse to police intervention or riots.64 In SWEDEN a wide gap had developed between the leadership of the SFS and the activists, who labelled the leaders as traitors. The militants wanted joint government at university level. The protest actions did result in an adjustment of the academic legislation. Some activists, referring to the older ideal of the students as Guardians of the Light, organized protest demonstrations against the Vietnam war and against a planned tennis tournament between Sweden and the white Rhodesian regime. They also sought more contact with the people by giving up their privileges and opening their associations and student facilities to all young people. That levelling of conditions was also expressed in the ritual burning of white student caps in Lund and Uppsala. In DENMARK in the 1960s the authorities were already well disposed to the idea of involving students in the academic policy-making of the universities, but despite this concession a mass protest demonstration took place in Copenhagen in March 1968 for student empowerment at the university level.65 At the beginning of June, student participation was regulated by law at the national level.66

63

64

65

66

H. F. Cohen, De strijd om de academie: De Leidse universiteit op zoek naar een bestuursstructuur 19671971 (Meppel, 1975); H. Krijne, Geschiedenis van de Nederlandse studentenbeweging 19671973 (Amsterdam, 1978); F. de Jong (ed.), Macht en inspraak: De strijd om de democratisering van de Universiteit van Amsterdam (Baarn, 1981); J. de Vries, Katholieke Hogeschool Tilburg, Vol. II: 19551977 (Baarn, 1981), 288346; Janssen and Voestermans, Studenten (note 32); H. Righart, De eindeloze jaren zestig: Geschiedenis van een generatieconict (Amsterdam, 1995), 25661; J. C. Kennedy, Nieuw Babylon in aanbouw: Nederland in de jaren zestig (Amsterdam, 1995), 16872. Tomasson and Allardt, Scandinavian Students (note 31), 96126; Runeby and Skoglund, Sweden (note 31). S. E. Stybe, Copenhagen University: 500 Years of Science and Scholarship (Copenhagen, 1979), 21217. P. Boje and K. J. V. Jespersen, Pastures New. Odense University: The First 25 Years (Odense, 1991), 47.

295

Louis Vos In FINLAND, traditions and new insights developed side by side and the traditional Finnish nationalism continued to set the tone; yet, midway through the 1950s the national student association Suomen Ylioppilaskuntien Liitto (SYL) took the lead in advocating joint participation and the provision of social facilities for students, requests that were supported by the campus intellectuals grouped around the student newspaper Ylioppilaslehti, which called for student syndicalism.67 This led to some polarization, because left-wing students wanted the university to take a moral stand on matters of social importance, such as the Vietnam war. The governing body of the University of Helsinki was quite willing to organize joint participation, and a joint committee nalized a proposal in November 1968 for the right of representation on decision-making bodies at all levels. Left-wing students nonetheless took advantage of the one hundredth anniversary of the university to publish a critical Festschrift listing their grievances, and on the evening of the gala dinner, which was attended by thousands of students in formal dress, they staged a sit-in as pullover students in the ofces of the student union where they raised the red ag. The left-wing students remained a minority; they subsequently carved a niche for themselves as inheritors of 1968 ideas in the Association of Academic Socialists, which was Marxist-Leninist (but not Maoist); they managed to win a quarter of the seats in the students parliament. In 1973 the anarcho-syndicalists broke away, but the two left-wing associations came together and managed to maintain their position until 1981. Even more so than in France or Germany, the student world in AUSTRIA was oriented towards the right.68 During a protest demonstration against the extreme right-wing professor Borodajkewicz in 1965, one of the demonstrators was beaten to death by a radical right-wing student.69 That led to the radicalization of the socialist scholars and student unions who had already demonstrated in Easter ban-the-bomb marches. The small New Left student movement made its presence felt in 19678 by debates and discussions, participation in the SDS Vietnam Congress, a protest demonstration after the attack on Dutschke, a sit-in at the university of Vienna and a teach-in on art, which became so provocative that the organizers disbanded their association. In the elections for the student union held shortly afterwards, the left-wing candidates were found to represent a minority of 13 per cent.

67 68

69

Klinge, Nordische (note 39), 74899. A. Pelinka, Zu einem konlktfreudiger Bewutsein, in E. Welzig, Die 68-er: Karrieren einer rebellischen Generation (Vienna, 1985), 924; Gehler, Rechtskonservatismus (note 36). F. Keller, Wien, Mai 68: Eine heie Viertelstunde (Vienna, 1983).

296

Student movements and political activism In 19689 the disruption of the inauguration of a new rector led to a reaction from the corps of students who were present in full regalia; in January 1969, during a visit by the Shah of Iran, there was a violent confrontation not only with the police, but also with hostile groups of right-wing students. The left-wing following in Vienna gradually diminished, despite actions for joint participation at the university, for more freedom in student associations and despite protests against the American propaganda lm The Green Berets. In the winter of 196970, left-wing students opted for the formation of basic groups per faculty.

the leninist turn and decline (19691974) In democratic Western Europe the new student movement disappeared between 1968 and 1970.70 The decline was caused both by the repressive policies and measures taken by the authorities and by the transition from utopia to ideology, that is, from spontaneity to rigid party organization. In the summer of 1968 Leninists emerged and provoked the movement to disintegrate into warring parties of cadres, cliques and sects. Almost none of them attracted a wide following, most were distrusted by the students, and they were unable to get a real movement going again. Many militants no longer had any faith in the student movement; they believed that the only salvation lay in a revolutionary workers movement. They stopped studying, went to work in factories and served as red missionaries for the revolution. In FRANCE the collapse of the movement was the fastest and the most spectacular. The anti-authoritarian line of the March 22nd Movement had already been criticized during the May Days by existing groups, notably by the Maoists and Trotskyites who tried to canalize the movement.71 All were banned by the French government on 12 June 1968, but they were promptly replaced by new groups. A sectarian dogmatic and more open organization emerged in the Trotskyite family. In the Maoist family there was a small nucleus of maos-spontan eistes or maos-spontex, who opposed fossilized Leninism and were prepared to undertake an armed struggle against capitalism, but most of the left-wing student population found their home in several Marxist-Leninist parties. They continued to oppose the Communist Party and interpreted everything to suit their own ideological dogma. They accepted some form of democratic centralism and revived all sorts of complaints that the new student movement had about: organization, bureaucracy, centralization,
70 71

Statera, Death (note 51), 21933. Statera, Death (note 51), 22233; Gilcher-Holtey, Die 68er (note 46), 1002; Fischer, Histoire (note 27), 44856.

297

Louis Vos blind obedience or slavish ideology. With this Leninist turn the movement appeared to have gone full circle. These developments led to the disintegration of the UNEF in December 1968, when one group wanted to transform the student union into a political mass organization and another wanted to change it into a mass syndicalist organization. In 1971 two successors emerged: the UNEF-Renouveau (or UNEF-re), supported by the communists, and the UNEF-Unit e syndicale, supported by the Trotskyites. Both student unions commenced a campaign to be ofcially recognized by the authorities as the one and only union. In GERMANY the fragmentation started in the summer of 1968 after the abortive action against the Notstandsgesetze. This triggered the battle between the factions, which differed in their ideologies and their internal working procedures.72 While the anti-authoritarians wanted to continue Dutschkes activist legacy, with students and fringe groups as the revolutionary subject, the Marxist-Leninists believed exclusively in the revolutionary power of the working class, which they intended to mobilize according to the Maoist model. By the autumn of 1969 these contradictions could no longer be reconciled, and they culminated, on 21 March 1970, in the formal dissolution of the SDS. A year later several new formations were consolidated, such as the Maoist Kommunistische Partei Deutschlands/Aufbauorganisation (KPD/AO), the Kommunistischer Bund Westdeutschlands (KWB) and the Proletarische Linke Parteiinitiative (PLPI), or the Rote Zellen. They could only be regarded as the inheritors of the original movement. That also applied to the Rote Armee Fraktion (RAF), centred around Andreas Baader and Ulrike Meinhoff, who opted for bank robberies, attacks and abduction as the right road to revolution. Their murderous actions against leading representatives of justice and economy, culminating in the abduction of a German passenger airplane, were experienced by public opinion and the authorities as a strong security threat.73 A similar development took place in ITALY. In the course of 1969 a progressive demobilization of the students became apparent but did not prevent the ourishing of numerous sub-groups. At the end of 1969 the new student movement was largely dead. Here, too, its inheritors were the Maoists and the Trotskyites. The hotbed of social protest did, however, shift from the students to the workers, who turned the latter half of 1969 into a long hot summer, and a long hot autumn of militant strikes. In Italy too, a terrorist organization the Brigate Rosse grew out of disillusionment with the results of the student movement. This organization intended, as in Germany, to rise up against the established
72

73

Kraushaar, Frankfurter (note 46), 341527; Gilcher-Holtey, Die 68er (note 46), 10511; Kimmel, Studentenbewegungen (note 5), 1989; Statera, Death (note 51), 23447. Kimmel, Studentenbewegungen (note 5), 219.

298

Student movements and political activism capitalist order and secure victory by force of arms. The fact that the desperate groups remaining in Germany and Italy chose to take the route of violence and terrorism led to the complete rejection of the movement by public opinion.74 No other armed groups such as these grew out of other European student movements. Fragmentation, in fact, became commonplace. Maoist formations everywhere instructed their militants to abandon their studies and go to the factories, either to help the workers in their revolutionary struggle or to learn from them. All these tiny groups in Belgium, Denmark, Sweden, Austria and the Netherlands called themselves Marxist-Leninists and regarded the university merely as an operating base or a logistics support facility. In addition, there were Trotskyites, tricontinentalists, anarchosyndicalists and New Leftists with no party afliation. In some student communities the latter could count on a considerable following, since they showed affection for Marxism and regarded themselves as destined to revise the traditions of the new student movement. Around 1974 a new turning point was reached. The rhythm of the annual mass actions slowed down and eventually stopped. It was particularly evident in Leuven and Nijmegen, two Catholic institutions where for a long time a global orientation to the left had existed, which provided opportunities for mass actions despite ideological differences between specic factions. When, from time to time, student movements managed to organize large mobilizations, a clear shift was noticeable in their objectives. This was due to the economic crisis that started in 1974. Protest actions in the second half of the 1970s were no longer focused on the New Left themes of the 1960s but on the defence of the students position, which was now under threat. In 1977, commenting on the protest against increased tuition fees, Ralf Dahrendorf, director of the LSE, said, In 1968, students thought they were a rising social group and should demand a place under the sun. In 1977, students are behaving as though they were a declining industry. They are asking for more money and Government support.75 It was evident that the students were reverting to their own small world and that the student movement was increasingly evaporating, at least in democratic Europe.

the nature of the new student movement The new student movement that emerged in the 1960s in Western democracies differed fundamentally on at least three levels from its classical predecessor. In the rst place, it no longer aspired to be the vanguard
74 75

Kimmel, Studentenbewegungen (note 5), 199200; Statera, Death (note 51), 24759. Daily Telegraph, 15 February 1977, quoted by Mehnert, Twilight (note 59), 165.

299

Louis Vos of an existing broader institutionalized social or national movement; rather it was bent on transforming society as a whole. Secondly, it explicitly introduced new themes that developed into an anti-authoritarian utopia allowing for the creation of a community in which the creative development of individuals could go hand in hand with social justice. Thirdly, it introduced new forms of direct political action, which were to while expose and destroy the established order replacing a representative democracy with a participative democracy. Such global ambitions constituted a high point in the history of the student movement, but at the same time brought about its demise. The new social themes that the movement introduced stemmed largely from the New Left, which emerged in the early 1960s and whose cognitive orientation was most clearly summarized by Gilcher-Holtey in ve points:76 a new interpretation of Marxism with the emphasis on alienation going back to the early writings of Marx; a new socialist society model, which was expected to neutralize such an alienation; emphasis on personal development, so that the new humankind could emerge together with new social and political structures; a new organizational concept with the emphasis on provocative action, as a result of which both the activist and society would change; and instead of being promoted by the working class, this renewal movement would be carried by young intellectuals and the fringe groups in society. It therefore involved the meshing of individual and collective emancipation, social and cultural criticism, and cultural and social revolution, all of which were connected by a common utopia focused on themes that are now called post-materialistic, i.e., improving the quality of life rather than material welfare. Initially, the orientation of the new student movement could be described as more of a sentiment rather than anything else, a sentiment characterized by anti-authoritarianism, anti-dogmatism, romanticism, direct democracy, moral purity and community spirit; this, according to Statera, gave it a millenarian character.77 In contrast to ideology, which aspires merely to a partial adjustment of reality, the concept of utopia requires according to Mannheim something completely new. By demanding the impossible, the utopia appeared to liberate existing reality from its self-evident acceptance and thus open the way to change. The concept of utopia appealed to the masses, whereas the ideology belonged
76

77

Gilcher-Holtey, Phantasie (note 57), 44104; I. Gilcher-Holtey, May 1968 in Frankreich, in Gilcher-Holtey, 1968 (note 1), 1318; I. Gilcher-Holtey, La contribution des intellectuels de la Nouvelle Gauche a enition du sens de Mai 68, in Dreyfus-Armand ` la d et al., Ann ees 68 (note 57), 8998; Gilcher-Holtey, Die 68er (note 46), 1117; Kimmel Studentenbewegungen (note 5), 2930. Statera, Death (note 51), 153218.

300

Student movements and political activism to the minority group and provided the support and self-condence to steer the wider movement. The balance between the two changed everywhere in the same manner. This type of evolution was the inevitable consequence of internal logic: every social movement must either transform itself into an organization or disappear. A permanently sustained commitment cannot exist without structures.78 According to Kimmel, from a comparative international perspective, the new student movement consisted of seven features. Firstly, it was driven by a millenarian vision to bring about a new mankind in a new society.79 Secondly, it had a changed notion of politics in which the division between the public and private spheres no longer existed. Thirdly, it propagated a new way of life in which the community played a central role while individualism was to be restrained. Fourthly, it rejected the politics of reason, the cold logic of cost-benet analysis and cynical Machiavellianism: it opted instead for emotional involvement, idealistic engagement and solidarity with the community. Fifthly, it saw negation as its central attitude to life: the refusal to play a role as a cog in the system. In the sixth place, in its strategy and forms of action, it placed the emphasis on expressive politics rather than instrumental politics. And lastly, the movement was thoroughly permeated by ideological contradictions, which, starting from a comparable criticism of society, led to alternatives being developed in different directions either in a more individual libertarian sense or in a more egalitarian socialist sense. Where the psychology of the activists was concerned, there was a rigorist ideological moralism and a dualist Weltanschauung. This inevitably came complete with its own development dynamics, ranging from antiauthoritarian criticism of certain aspects of the system, through a tactic of revealing provocation, to rejection of all this and further radicalization, to Marxism-Leninism. The next step for the radical groups that remained in Italy and Germany was the path of terror, born out of frustration with the impossibility of bringing society to heel. Most of the incentives for social change stemmed from the initial anti-authoritarian phase, while the impact on society diminished in line with the metamorphosis into neo-Marxism.80 Apart from its political component the new student movement also had a cultural element that was bent on transforming daily life into an alternative experience.81 This non-conformist passion wanted to rid itself of a bourgeois lifestyle by experimenting with communes and other
78 79 80 81

Allerbeck, Soziologie (note 2), 3744. Kimmel, Studentenbewegungen (note 5), 1704. Kimmel, Studentenbewegungen (note 5), 1749. J. Tanner, The Times they Are A-Changing Zur subkulturellen Dynamik der 68er Bewegungen, in Gilcher-Holtey, 1968 (note 1), 20723.

301

Louis Vos forms of group living in order to create a new way of life in which desire could be liberated from conventional restraints and instant pleasure attained through music, sex and drugs. Naturally, this implied a total break with traditional cultural and political values and, as a result, the image and identity of the students changed over the course of the campaign.82 A sudden change in dress code was typical: blue jeans for both female and male students, jeans jackets or military style jackets, and Palestinian headscarves. In Italy the students wore Eskimo-style jackets; in Belgium and Germany the trend around 1970 was green parkas; the young men had Cuban-style beards and long hair covering their ears. This type of uniform and fashion was an expression of their political self-image, and the students attire and grooming thus became an integral part of demonstrative action against a bourgeois lifestyle and an indicator of participation in global confrontation.83 These developments created a sense of moral panic, as Stanley Cohen called it, among the civil and ecclesiastical authorities and the ordinary man in the street.84 The student movement was seen as a threat to the established social order, values and interests.85 With its aversion to the systematic accumulation of knowledge, idolizing of spontaneous self-expression and its notion that the university would become a permanent seminary under student leadership, many established academics regarded this development as an anti-intellectual movement that was bent on destroying culture, science and even the university itself. This same conviction was held by the established political parties, trade unions and churches. They all saw the movement as a threat and tried to weaken or channel it. Another example of this moral panic was demonstrated almost immediately in the form of distrust towards recently graduated activists who were trying to nd a job in education, youth work or the civil service. From 1968 to the beginning of the 1970s the fear of left-wing inltration gave rise in various countries especially Italy and Germany to a sort of Berufsverbot against former student activists. It was a curious circumstance that the New Left student movements were exceptionally strong at (of all places) Catholic universities, as in Leuven (Flanders), Tilburg (the Netherlands) and Milan (Italy). Contrary to what one might assume, the shift to the left at these universities was not the result of foreign input, but was due to a discovery of the need for reform by the young Catholic generation itself. The turmoil that followed the Second Vatican Council (19625) had exposed the authoritarian hierarchical exercise of power in a changing Catholic Church as a blurring
82 84 83 Lumley, States (note 52), 704. Le Goff, Mai 68 (note 50), 72473. S. Cohen, Folk Devils and Moral Panics: The Creation of the Mods and Rockers (London, 1972), 28 quoted by Lumley, States (note 52), 73. Ashby and Anderson, Rise (note 30), 1239.

85

302

Student movements and political activism of fundamental contradictions. And the young Catholics had discovered that the main contradiction in society lay between the rulers and the suppressed, or between capital and labour. The Catholics openness to engagement in the Movement of 68 was partly due to the fact that under the surface of this movement far more than in the existing socialist or communist parties and associations there existed an ethical (that is to say religious) element. It was a religious structure of feeling, as Lumley called it.86 Millenarian conversion had also existed in the emerging socialist movements of the nineteenth century, but it was later banned on grounds of atheism or for fear of unbridled enthusiasm. This left-wing religious emotion re-emerged in the 1960s in the student movement. It was therefore not surprising that young people with a religious background were open to the new movement. In Belgium the movement and its offshoots were particularly successful among adolescents in the Catholic youth movements, while the more traditional socialist (and non-religious) youth were more inclined to stay away.87 The Marxism of young Catholics was less quickly affected by ideological fragmentation because it was rooted neither theoretically nor practically in an existing left-wing tradition, and such Marxism was therefore more of a vague inspiration or analytical model rather than a fully elaborated ideology. The student movement of the 1960s can be seen as the rst expression of what is now called the New Social Movements, a new type of protest that rst emerged in the 1960s in the industrialized countries of the West: not centrally organized, distrustful of formal structures, standing up for threatened post-materialistic values, advocating an alternative way of life in which self-fullment and political participation by the general populace played a central role; its following was found mainly in the tertiary sector, and its message was primarily disseminated via the information, communication and mobilization channels of the modern mass media.88

fighting for freedom (19561989) In the non-democratic European countries there was no need for a new student movement because the classical movement had never disappeared. Even so, there were some similarities between the two phenomena. Despite the lack of welfare, the students in these countries were
86 87

88

Lumley, States (note 52), 84. E. Dani els, Links in Vlaanderen Contradictio in terminis, De Nieuwe Maand, 29 (1986), 99117. B. Klandermans, New Social Movements and Resource Mobilization: The European and American Approach Revisited, in D. Rucht (ed.), Research on Social Movements: The State of the Art in Western Europe and the USA (Frankfurt, 1991), 1819.

303

Louis Vos nonetheless actively engaged in non-materialistic issues and goals: freedom, truth and justice. That pursuit of a more authentic, democratic and open society was not unlike the society that the new student movement was trying to achieve in western democracies. Similarities were apparent even in the forms of action, although the risks for the students in authoritarian regimes were far greater.89 Non-democratic right-wing regimes were characterized in the second half of the 1950s by a continuous development of democratic student movements. In SPAIN the movement focused, on the one hand, on the democratization of the existing SEU. Following a series of demonstrations, a proposal was accepted to the effect that SEU delegates would be elected at faculty level as from 1958. The movement also supported striking workers in Asturias, Catalonia and the Basque provinces and planned a general strike in 1959, but that plan failed and many students were arrested. In the autumn of 1961 the three most important student associations in the opposition formed the FUDE (Federacion universitaria democratica espanola), which successfully nominated candidates for the faculty elections of the SEU. In December 1963 the FUDE had the majority in nine of the twelve university districts. In 1964, a week of university reform in Madrid was banned after some professors gave several critical lectures, which led to mass student demonstrations and sit-ins, causing the government to close the university and expel a hundred or so student leaders all over Spain. In February 1965 the situation escalated into a conict about freedom of association and freedom of speech, which resulted almost everywhere in severance of the cooperative relationship with the SEU. Despite numerous arrests, an independent student union was able to hold in March 1965 its rst national congress in Barcelona, at the end of which, in collaboration with the SDE (Sindicato democratico de estu diantes), it set up a broadly based student trade union representing all non-fascist students. Out of sheer necessity the government abolished the SEU in April 1965, while in April 1967 it was forced to reach the conclusion that its attempt to launch a new governmental student organization, Asociaciones profesionales de estudiantes (APE), had failed.90 In 19678, the still illegal SDE continued activities at every university in the country, built up a network in secondary education schools and colleges and created a complete student subculture of seminars, lectures and political debates; it issued magazines, set up a trade in (second-hand) books and raised funds for undergraduate scholarships. Above all, it wanted
89 90

Mehnert, Twilight (note 59), 1915. J. Maravall, Dictatorship and Political Dissent: Workers and Students in Francos Spain (London, 1978), 98112; Feuer, Conict (note 24), 2968; Schutze, Widerstand (note 25), 1847.

304

Student movements and political activism democratic freedom and considered that the workers movement, because of its orientation towards an immediate improvement of the workers lot, was lagging behind to some extent and curbing developments (rezagado and frenando). The protest against the manipulation of the student elections in January 1968 was violently repressed, and several of the arrested student leaders subsequently died in suspicious circumstances.91 In response to this ofcial violence, left-wing commando groups were formed, which organized terrorist actions against banks, ofces and ofcial buildings. In Catalonia and the Basque provinces, democratic nationalist student groups were secretly formed92 and the ETA (Euskadi ta askatasuna, Basque Fatherland and Freedom), which had been founded in 1959, was transformed into a terror organization.93 The assassination in 1973 of Prime Minister Carrero Blanco in a bomb explosion was seized upon by the more liberal elements in the government as an excuse to implement reforms. In 1974, three elected student councils built on grass roots initiatives were installed at each university, thus achieving joint participation in the administration of the university. The death of Franco in November 1975 led to the gradual dismantling of the dictatorial regime. When the authorities in PORTUGAL banned the traditional celebration of the Dia do estudiante, student strikes broke out in Coimbra, Porto and Lisbon, where they lasted for three months. The students demanded the establishment of a free national student union and an end to the colonial war in Angola and Mozambique. Repression followed by arrests and the dismissal of professors only harmed the movement temporarily. In January 1965, a new student strike broke out in which four-fths of the 25,000 students participated. This was again followed by repression with arrests, torture and purging at the universities. In contrast to Spain, in Portugal it was not the students but young military ofcers who toppled the authoritarian regime on 25 April 1974.94 Like the rest of the population, the students supported this Portuguese revolution, and the campuses suddenly became centres of political debate on the future of the country. On 4 August 1967, GREECE likewise ended up in the category of right-wing dictatorships following a coup d etat led by a group of military colonels. Democratic professors and staff members were dismissed, and the only student organization sanctioned by the military junta was one that was loyal to the new regime.95 At the beginning of the 1970s,
91 92

93 95

Mehnert, Twilight (note 59), 1523. in Geschichte und Gegenwart (Cologne, 1985); M. Miclescu, Die spanische Universitat Maravall, Dictatorship (note 90), 11217. 94 Mehnert, Twilight (note 59), 1756. Burg, Encyclopedia (note 23), 68. National and Capodistrian University of Athens. 18371987. One hundred fty years: Catalogue of the Exhibition of Memorabilia (Athens, 1988), 1819, 86, 173.

305

Louis Vos students staged a protest at the University of Athens. In February and March 1973 the students occupying the law faculty building were removed manu militari and the student leaders were conscripted into the army. In November 1973, students occupied the National Technical University of Athens (NTUA) demanding freedom, bread and education. The whole world was able to see on television how a tank smashed through the central gate of the campus, crushing dozens of students: thirty-four were killed.96 This military victory brought down the dictatorship and heralded a return to democracy. The students then demanded, and obtained, an agreement to purge the universities of the juntas followers and gained joint participation in the university. Through strikes, boycott actions and demonstrations they tried to retain their impact on politics, but their power gradually eroded because of political fragmentation. In the second half of the 1950s, East European student movements had to contend with an increasingly powerful neo-Stalinism, but one that differed from one country to the next. In POLAND the openness that followed the Polish October did not last long. The critical weekly newspaper for students and young intellectuals, Po Prostu97 (Quite Simple or In Plain Words), was closed down in 1957 despite massive protest. The 1960s saw the start of direct party intervention in the universities.98 Critical debating societies were banned, academics were accused of Trotskyism, and lecturers who wrote an open letter to the party to replace the communist bureaucracy with a workers democracy ended up in jail.99 The political balance sheet that the well-known philosopher Leszek Koakowski drew up at the request of a group of critical students in October 1966, ten years after the Polish October, concluded that a de facto state of lawlessness ruled in Poland. Such a statement promptly resulted in sanctions being imposed on Koakowski. In 1967, on the ftieth anniversary of the Russian October Revolution, a play written by the nineteenth-century Polish author, Adam Mickiewicz, was performed, in which the anti-Russian passages were greeted with tremendous enthusiasm by the audience. The authorities promptly prohibited further performances and violently dispersed a protest rally organized at the beginning of March on the Warsaw campus. It was the beginning of the Polish March Movement,100 which spread to
96 97

98 99

100

Mehnert, Twilight (note 59), 176. G. Z. Bereday, Student Unrest on Four Continents, in Lipset and Altbach, Students (note 2), 10813. Connelly,Die polnischen Universitaten (note 21), 18895. R ev esz, Jugendbewegungen (note 12), 726; S. M. David, Student Politics and Higher Education in Socialist Poland (Ann Arbor, Mich., 1972), 22031. David, Student (note 99), 2327; A. Friszke, Ruch protestu w marcu 1968 (w s wietle rapport od MSW dla kierownitwa PZPR), Wie z, 3 (1994), 92; Burg, Encyclopedia (note 23), 196202.

306

Student movements and political activism all the universities, gained support from writers and the Catholic Church, and also from some workers groups. The Prague Spring had an inspiring effect, for on 11 March some 10,000 students converged on the rectorate of Warsaw University chanting Caa Polska czeka na swego Dubczeka (All of Poland is waiting for its Dub cek).101 Following the anti-Zionist campaign which had been conducted since the six-day ArabIsraeli war of 1967, the government portrayed the student movement as the result of a Zionist conspiracy led by students of Jewish descent and started an anti-Jewish campaign.102 Throughout the action and confrontation with the police and a mendacious media, many students became increasingly outraged and lost faith forever in the regime.103 When the Prague Spring reform movement was crushed by Warsaw Pact troops at the end of August 1968, it brought a resurgence of the student protest, but this was quickly suppressed. In the Western student movements there was hardly any reference at all to their Polish counterpart. The French and Italian student movements simply ignored it. In the German student movement the anti-authoritarian elements kept a certain distance, while the Marxist-Leninist line actually denounced it as petit bourgeois.104 Among the Czech students after a degree of depoliticization at the end of the 1950s critical slogans were heard at the 1 May student festival, called Majales, which had been revived in 1963. For this the organizers were expelled from university.105 In the autumn of 1967 a student demonstration took place in Prague to raise awareness following trivial complaints about student housing. The brutality of the militia towards the demonstrators sparked off protest rallies at other universities.106 In January 1968, during what became known as the Prague Spring, the new party secretary, Alexander Dub cek, announced a series of reforms for socialism with a human face. The independent student body founded at the end of May for students in higher education in Bohemia and Moravia (Svaz vysoko skolsk eho studenstva Cech a Moravy, SVS) supported the reforms.

101

102

103

104 105

106

R ev esz, Jugendbewegungen (note 12), 59, 847; Wydarzenia marcowe (Paris, 1969), 501. Dossier 2: Warschauer Bilanz, Kursbuch, 13 (June 1968), 91105; Statera, Death (note 51), 14352; R ev esz, Jugendbewegungen (note 12), 7984. J. Eisler, March 1968 in Poland, in C. Fink, P. Gassert and D. Junker (eds.), 1968: The World Transformed (Cambridge, 1998), 23751; J. Eisler, Marzec 68 (Warsaw, 1995); David, Student (note 99), 238; R ev esz, Jugendbewegungen (note 12), 8995. Statera, Death (note 51), 143. R ev esz, Jugendbewegungen (note 12), 4452; Havranek, Die tschechischen Universitaten (note 18), 1669; J. Havranek and Z. Pousta, History of the Charles University, Vol. 2: 18021990 (Prague, 2001). G. Katsiacas, The Imagination of the New Left: A Global Analysis of 1968 (Boston, 1987), 60.

307

Louis Vos However, the invasion by Warsaw Pact troops on 21 August 1968 thwarted everyones plans. The repression caused seventy deaths in the rst few days, mostly young people. The Czech student movement subsequently tried to maintain the reforms as long as possible and oppose the restoration.107 On 17 November 1968, the anniversary of the last student protest against the Nazi occupier in 1939, a three-day student strike was held and the university buildings were occupied. Nearly all of the 80,000 students took part. There were solidarity actions in Prague factories, and a month later agreement was reached between the SVS and the metalworkers federation. In the months that followed, students distributed pamphlets all over the country. On 16 January 1969, philosophy student Jan Palach died after setting himself on re at Wenceslas Square in protest at the foreign occupation of Czechoslovakia. That led to a resurgence of resistance by students and workers. Huge crowds (estimated at 100,000 people) turned out for his funeral. In June 1969 the SVS was banned. The rst anniversary of the Warsaw Pact invasion, on 21 August, gave rise to a nal confrontation between students and the militia, complete with barricades and casualties. What now followed was systematic repression. It reached its climax in the spring of 1970. When Polish workers in Gdansk staged protests in December 1970, their appeal for solidarity actions by the students went unanswered.108 It was not until after the wave of strikes in 1976 that they became active again in the movement for more democracy through the Workers Support Committee. The murder of a student activist in 1977 had a catalysing action and accelerated the establishment of independent student committees Studenckie komitety solidarno sci (SKS) in various universities, which campaigned for more freedom in the academic environ movement over the govment; following the victory of the Solidarno sc ernment in the summer of 1980 they widened their campaign.109 After a student strike in od z lasting nearly a month, in February 1981 the government ofcially recognized the independent student union NZS (Narodowy zwia zek studentow), which in the same year rapidly developed into the countrys largest student organization with 80,000 members at eighty-nine universities and colleges. Following the coup d etat by General Jaruzelski on 13 December 1981, all free student associations were banned again, but the NZS continued to exist as an underground organization. In 1988, when the transformation
107

108

109

R ev esz, Jugendbewegungen (note 12), 5262; K. Bartosek, Rencontre inattendue en Tch ecoslovaquie (octobre 1968juin 1969), in Dreyfus-Armand, Ann ees 68 (note 57), 299311. -myth: the R ev esz, Jugendbewegungen (note 12), 97. This is at least the Solidarno sc reality was more complex. R ev esz, Jugendbewegungen (note 12), 98103.

308

Student movements and political activism to a democratic open society continued to make headway, the still illegal NZS was able to return to prominence, and in the nal struggle, which culminated in a transformation to democracy, it even played a spearhead role. After the regime changeover it continued to exist, but for its grassroots support it had to compete with new student associations in the selfadministered student organizations that were then formed (Samorza dy studenckie). In CZECHOSLOVAKIA, the governments hope of winning the students over to the new regime likewise turned out to be a vain one. In the 1970s, political apathy was the norm and even this was regarded by the authorities as a success because it meant that the students steered clear of the Charta 77 civil rights movement. It was not until 1987 that attitudes changed. Unofcial student associations came into being and began to distribute samizdat magazines, and even the ofcial student associations cautiously started making critical noises. The ftieth anniversary in 1989 of the closure of the universities by the Nazis and the repression of the student movement on 17 November 1939 was marked by a forbidden demonstration past the place where Jan Palach died, and a violent confrontation with the police. That became the signal for strikes and sit-ins at every university, and for a call from students urging the population to stage mass protests. That call was answered. Following a general strike on 27 November, the regime collapsed. The student activists subsequently handed over the leadership to Vaclav Havel, leader of the democratic movement Civic Forum, who was elected president of Czechoslovakia on 29 December 1989. In YUGOSLAVIA the wave of student protests around the world in 1968 created a favourable atmosphere for protest. Students living conditions were poor, and there was a high level of academic unemployment.110 Dissatisfaction with a shortage of seats for a theatrical performance in Belgrade on 2 June 1968 prompted students to destroy the building, and the next day they marched in protest from the students district to the centre of the city. Brutal police attacks scattered the demonstrators, but resulted in the university buildings being occupied by the students and the preparation of a long list of grievances. The conciliatory words and promises of the Yugoslav authorities initially had no effect, and it was not until a week later, after the students had received a solemn declaration from Tito himself, that the action was stopped. Tito commended the activists idealism, political commitment and engagement, which he presented as concern for the improved functioning of the system, and
110

R. Pervan, Tito and the Students: The University and the University Student in Self-Managing Yugoslavia (Nedlands, 1978); N. N. Soljan, Yugoslavia, in Altbach, Activism (note 4), 297312; Feuer, Conict (note 24), 302; R ev esz, Jugendbewegungen (note 12), 2002.

309

Louis Vos personally guaranteed a solution to all grievances. In the autumn of 1968 the student activists realized that their protest had been effectively stymied by the regime and had achieved nothing. Throughout Yugoslavia the critical student movement was denitively nished. In contrast to this, student movements did start to play a role at the level of the federal republics, which felt that they were being suppressed by SERBIA. In 1971, the year of the Croatian Spring, a renewal movement called for greater autonomy for Croatia and, in it, students played the major role. In November of that year 35,000 Croatian students went on strike with the same patriotic goal, and in December there were mass demonstrations.111 In Belgrade this strike was branded as a nationalist excess and counter-revolutionary and many students were arrested. In 1974 a constitutional review in Yugoslavia gave the federal republics greater autonomy, but the predominantly ethnic Albanian Kosovo remained a Serbian province. After Titos death, in 1980, the Albanian nationalist movement gained fresh impetus among Albanian students at the University of Pri stina. In 1981 they demanded that Kosovo should become linguistically and culturally Albanian and receive the status of a republic, which carried with it the right of secession. During the rst large student demonstrations on that issue in the spring of 1981, eight were killed and more than a hundred injured; more than a thousand people were arrested. Similar demonstrations were repeated in 1982. Some student leaders were expelled from university, while others ended up in prison or went into hiding and opted for violence and terrorism in order to achieve their goal. In SLOVENIA students emerged at the end of the 1980s as the vanguard of a democratic reform movement that promptly demanded greater autonomy for Slovenia. That message was disseminated to the public through diverse channels, including Radio Student and numerous student publications. The authorities in Belgrade regarded these actions as counter-revolutionary but were unable to stop the advance of the Slovenian Spring, which culminated in the disintegration of the Yugoslav Federation. In the fringe regions of the SOVIET UNION, too, the national issue became also the driving force for student movements in the 1980s.112 In LATVIA, students in the capital Riga protested against the invasion of Czechoslovakia in August 1968, a movement that reached its climax with the self-immolation of Ilia Rips on 13 April 1969 near the Independence Monument.113 He survived and was eventually deported
111 112 113

R ev esz, Jugendbewegungen (note 12), 2024. Dobson, Soviet Union (note 14), 2738. Misionas and Taagepera, The Baltic (note 14), 245.

310

Student movements and political activism to Israel on account of his Jewish origin. Outside the theatre in Kaunas, where in 1940 the annexation of LITHUANIA to the Soviet Union was ratied, the nineteen-year-old student Romas Kalanta took his life by self-immolation on 14 May 1972 in protest against the annexation.114 On the day of his funeral, thousands of demonstrating students called for Liberty for Lithuania. After ghting in the streets, hundreds of students were arrested. Within three days there were three more cases of selfimmolation elsewhere in Lithuania. In October 1980, thousands of students from the University of Tartu staged a demonstration, demanding the resignation of the (half-Russian) education minister of ESTONIA, Elsa Gret skina, whose appointment they regarded as a sign for increased Russication. The slogans ranged from Russians out to better mensa food.115 In 1978, Kazakh students in KAZAKHSTAN staged a protest against what they considered to be the disproportionate number of university places going to students from other ethnic groups at the expense of the Kazakhs. In the same year, thousands of students in GEORGIA demanded that Georgian be declared the ofcial language in the new constitution of the republic. In June 1979 and in the summer of 1986, Yakut students were involved in anti-Russian disturbances in Yakutsk. Gorbachevs proposed policies of glasnost and perestroika were an invitation for yet more action. In October 1985, students in Tartu hung the national ag of Estonia from the Opera House. In Lithuania, students formed an underground organization that published the samizdat magazine Juventus Academica in 1986. In Kazakhstan a protest was staged in December 1986 against the appointment of a Russian head of the local Communist Party, and demonstrations for independence at the university in Alma-Ata resulted in several deaths and injuries, which led to the dismissal of the rector; a number of professors were arrested and many students were expelled. Nationalist protests also took place in Soviet Central Asia and in the Caucasus. In June 1987, thousands of Latvian students took part in a protest demonstration against Stalins deportation of 15,000 Latvians to Siberia in 1941, and two months later thousands of inhabitants of the three Baltic republics staged a demonstration against the RibbentropMolotov Pact of 1939, which gave the Soviet Union a free hand to gain control of the Baltic States. In the rst half of 1989, just before the fall of the regime, student activism reached its climax in the Soviet Union. The number of members of the Komsomol fell, and the new student organizations that were formed in many cities as an alternative to the Komsomol saw their membership grow. At the same time in Estonia, Latvia, Lithuania,
114 115

Misionas and Taagepera, The Baltic (note 14), 2523. R ev esz, Jugendbewegungen (note 12), 278; Misionas and Taagepera, The Baltic (note 14), 253.

311

Louis Vos Armenia, Azerbaijan and Georgia, students with their demonstrations, strikes and boycotts of lectures formed the vanguard of the emerging nationalist movements.

beyond the student movement (19742000) In the West the legacy of 1968 lived on until the end of the 1970s. For the veterans it was the principal decisive factor for their positioning in society.116 When a political balance sheet was rst drawn up in 1978 there was still feeling for 1968, and les e enements were regarded as v` the birthplace of many of the initiatives of the 1970s. Afterwards the tradition began to lose its vibrancy. On the twentieth anniversary, in 1988, the ties with 1968 appeared to have been severed, and the student generation of that era looked back on it as something that was over and done with, while former activists of 68 launched all kinds of assumed interpretations as the basis for their convictions twenty years later. It was not until the wave of publications that appeared in 1998 that 68 was nally relegated to history, and one author was able to proclaim that mai 68 nappartient a ` personne.117 For the younger student generations the old tradition started to wane much earlier in the second half of the 1970s, when the economic crisis struck. Among student leaders, however, it hung on for another decade as a mobilizing myth, albeit reduced to the slogan democratization of the university. No-one created a new living tradition that could pass on the torch of the student movement from one generation to the next, as had happened with the classical movements. The movement therefore gradually evaporated. How that happened can be claried by looking closely at the evolution of one new student movement with a long classical tradition, the one at Leuven University, which I have studied using primary sources. I believe it is highly representative for what has happened to the student movement in the Western democracies since the 1970s.118 In the second half of the 1970s a generation made its appearance in Leuven, which, although it still thought of itself as having inherited the mantle of 68, was no longer prepared to focus student actions exclusively on radical social reform.119 Against the background of the economic crisis that started in 1974, it tried to turn the democratization of university education into a new action platform for committed students. In 1977 it basked briey in a new e lan and massive support for its action against
116 117 119

K. Ross, May 68 and its Afterlives (Chicago, 2002). 118 Fischer, Histoire (note 27), 419522. Le Goff, Mai 68 (note 50), 46575. Vos, Vlaamse Leeuw (note 40).

312

Student movements and political activism the 100 per cent increase in the university registration fee, which spread rapidly across the country and was paralleled by similar actions in France and the United Kingdom. It was unsuccessful, however, due in part to the fact that the social engagement of most students was on the decline. During the opening ceremony of the academic year in October 1980, the students spokesman himself sympathizing with the Maoist student faction used his speech to denounce the difference between the more than ample professors salaries and the miserable income of a single person entitled to benets. For a short while this echoed the spirit of radical confrontation, and that same spirit was also voiced in the same year by the student press, but it was evident that the broader student group, even the portion that was actively engaged in associations, was not on the same wavelength. Leaving aside the small marginal groups of left- and right-wing extremists and focusing on the average association student, two generational groups are clearly distinguishable in the student generation of the early 1980s. One considered itself to be the inheritor of the new student movement of 68 and continued to focus on (the defence of) the democratization of university education. In contrast, the other generational unit wanted nothing to do with the inheritance of 68 and proposed banning all politics from student associations. The rst group continued to conduct protest actions against late payment of scholarship awards, against plans to abolish scholarship awards and against price increases in student restaurants, and argued in favour of the student union on behalf of the Leuven student movement joining the movement against the deployment of American cruise missiles. That irritated the leaders of student societies in several faculties, who were of the opinion that politics had no place in modern student associations; in February 1984 the apolitical faculty societies of students in economics resigned from the existing student union, which they regarded as politicized and left wing. In 19845 they went on to set up their own alternative overarching student union, together with seven smaller ofcial overarching unions. The new student union easily gained ofcial recognition and grants from the academic authorities, which silently applauded its apolitical stance. However, the old student union continued to be supported by two-thirds of the faculty organizations, which had a broader vision of the student movement. Throughout most of the following academic year, reconciliation meetings were held, which briey threatened the very existence of the student magazine, Veto if not the magazine then the name itself as an undesirable leftover from 68. The outcome of the meetings was the establishment of a new overarching student organization, recognized again by all faculty societies. The explicit reference to the democratization of society as the mission of the student movement disappeared from 313

Louis Vos its ideological manifesto, and in the rest of the text greater emphasis was placed on the students own situation. In the summer of 1986 the students situation was threatened by external factors when the Flemish minister of education, Coens, cut the social allowances to the universities by half, decoupled them from the cost of living index and raised the registration fee. This all happened at the time when students in France were staging massive demonstrations against the plans of the French education minister Devaquet.120 That heartened the Flemish students because protests were also taking place in Ghent, Brussels and Antwerp and gave them an opportunity to target both Coens and Devaquet on their banners. The student boycott against payment of the registration fee failed. A national demonstration in October 1987 was a taste of things to come in the protest demonstration organized by Leuven students from the end of November to mid-December. Strike action, torch-lit processions, occupation of the rectorate, the central library and several faculty buildings, and incidents involving the state police, all evoked memories of 68. However, the mobilization was limited to some 3,000 students (out of a total student population of more than 20,000), mostly from the humanities, and it was characterized by internal contradictions between goal-motivated students and students who were merely looking for a confrontation with the police, as well as between those whose only aim was to stand up for student interests and still others who wanted a complete package of demands for students, the young unemployed and national servicemen. A national demonstration in December 1987 became both the climax and the end point. A subsequent demonstration in February 1988 hardly attracted any students from Leuven. Even though the actions had no political effect, for those who took part in them they became a generation-forming event. However, the hope that 86 an anagram of 68 would be the beginning of the resurgence of the student movement, turned out to be a vain one. Student politicization, which in itself was limited to the protection of the students own position and was seen by only a few students in a broader social perspective, quickly evaporated again. Midway through the 1990s, for the majority of student leaders an apolitical representation focusing on the protection of student interests became the most important guideline for student action. The overarching student organization no longer took a stand on social issues such as racism, youth unemployment or child abuse. However, as the editorial team of the weekly student magazine Veto continued to defend democratization as a common project for the student movement, the representativeness and the critical editorial line of the magazine were questioned
120

Fischer, Histoire (note 27), 4702.

314

Student movements and political activism by leaders of the student organizations. This occurred in 1989, in 1993 and again in 1996. It was then decided at an open general meeting of the student union that this assembly would in future appoint the chief editor and the editorial secretary of Veto. Thus the critical stance of the magazine was diluted. Despite the evaporation of the student movement into a vague form of mysticism, for the Leuven students who did not have a purely individualistic attitude, solidarity with their own faculty organization continued to exist, and group loyalty and sociability in the faculty society became the only student movement. Non-political, constructive cooperation with the academic authorities on the basis of formal representation became the guideline for the elected student representatives. The remaining tensions that came to the surface did not arise from a general social vision but out of dissatisfaction with specic measures or individuals. Even when the rector launched a plan, in 2003, to have his successor no longer elected but appointed, this was greeted with protests by the professors but not by the students. To all intents and purposes the student movement had ceased to exist. The most important cause of the demise of the student movement was the change in the students social position. This also caused a shift in the self-image of the new generations entering university. Students no longer saw themselves as a group but rather as individuals who spent their formative years in a certain social environment in relation to their personal learning-cum-lifetime project. They had become customers of a diploma mill, no longer members of a community. Because students were no longer exceptions in their age cohort, and since studying had become normal and the distinction between university and other forms of higher education had blurred, the normative expectation of society disappeared. Furthermore, the total role of the student was also affected. The student lived only part of the time in the university town, where his group life was largely limited to typically student-like forms of involvement. Still, volunteer work in associations continued to be very popular, but in the main it took place outside rather than inside the student environment. Moreover, student engagement remained heterogeneous, fragmented and not very visible; it was not characterized by total dedication, strong solidarity or great ideals, but was principally measured against the degree of usefulness for the individuals curriculum vitae or development.121 Against this background the tradition gradually faded away and lost its specic social student calling and hence the potential for the existence
121

As was revealed by a sociological survey of the social commitment of Leuven students in 2001: L. Hustinx, T. Vanhove, I. Verhalle, K. Lauwerys and F. Lammertyn, Het maatschappelijk engagement van de K.U. Leuven studenten: Een sociologisch onderzoek (Leuven, 2002).

315

Louis Vos of a student movement. The students resigned themselves to no longer playing a direct role in society as a group. This was facilitated by the fact that bureaucratization of their own circle had become a self-evident process, and hardly a voice was raised in protest in the wider society. With the exception of a few individuals, who still considered themselves the surviving heirs of the defunct student movement, most of the students and student leaders no longer saw themselves as links in a chain whose job it was to pass on the torch of a movement to successive generations. The deep-rooted cause of this did not lie in the aftermath of 68, or in the academic unemployment of the 1970s with its survival of the ttest mentality, or even in the heavier study load or the increase in scale of the student population in the 1980s and 1990s. Neither was it caused by a shift of the political economy to the right, or by the undermining of the big stories by postmodernism. All these elements certainly played a role, but the principal reason why young generations of students no longer came forward with a back to the people spirit to full their calling as students in the service of the broader community was structural. It lay in the fundamental change of the social position of the student, which actually coincided with that of the academics and the university itself. Whether student movements will ever develop again in the Western democracies against this background is doubtful. Elsewhere they could perhaps revive: in developing countries, dictatorships or national communities which have not (yet) gained their independence, where the social position of the student still displays all the characteristics that it enjoyed in Europe for nearly two centuries.

select bibliography
Altbach, P. G. The Student Revolution: A Global Analysis, Bombay, 1970. Altbach, P. G. (ed.) Student Political Activism: An International Reference Handbook, New York, 1989. Altbach, P. G., and Laufer, R. S. (eds.) Students Protest, The Annals of the American Academy of Political and Social Science, 395 (1971). Altbach, P. G., and Uphoff, N. T. The Student Internationals, Metuchen, N.J., 1973. Ashby, E., and Anderson M. The Rise of the Student Estate in Britain, Cambridge, Mass., 1970. Bausz, G. Die Studentenbewegung der sechziger Jahre: Handbuch, Cologne, 1977. Burg, D. F. Encyclopedia of Student and Youth Movements, New York, 1998. Connelly, J. Captive University: The Sovietization of East German, Czech, and Polish Higher Education 19451956, Chapel Hill, N.C., 2000. Connelly, J., and Gruttner, M. (eds.) Zwischen Autonomie und Anpassung: Universitaten in den Diktaturen des 20. Jahrhunderts, Paderborn, 2003.

316

Student movements and political activism

David, S. M. Student Politics and Higher Education in Socialist Poland, Ann Arbor, Mich., 1972. De Groot, G. J. (ed.) Student Protest: The Sixties and After, London 1998. tudiant: La gauche e tudiante a ` de Maupeou-Abboud, N. Ouverture du ghetto e la recherche dun nouveau mode dintervention politique. 19601970, Paris, 1974. Dreyfus-Armand, G., Frank, R., L evy, M.-F., and Zancarini-Fournel M. (eds.) Les ann ees 68: Le temps de la contestation, Brussels, 2000. Elm, L., Heither, D., and Schafer, G. (eds.) Fuxe, Burschen, alte Herren: Studen tische Korporationen vom Wartburgfest bis Heute, Cologne, 1993. Feuer, L. S. The Conict of Generations: The Character and Signicance of Student Movements, London, 1969. Fink, C., Gassert, P., and Junker, D. (eds.) 1968: The World Transformed, Cambridge, 1998. tudiants en France de 1945 a ` nos jours, Paris, 2000. Fischer, D. Lhistoire des e Fraser, R. (ed.) 1968. A Student Generation in Revolt: An International Oral History, New York, 1988. GilcherHoltey, I. Die 68er Bewegung: Deutschland, Westeuropa, USA, Munich, 2001. Gilcher-Holtey, I. Die Phantasie an die Macht: Mai 68 in Frankreich, Frankfurt, 1995. Gilcher-Holtey, I. (ed.) 1968: Vom Ereignis zum Gegentsand der Geschichtswissenschaft, Gottingen, 1998. Heither, D., Gehler, M., Kurth, A., and Schafer, G. Blut und Paukboden: Eine Geschichte der Burschenschaften, Frankfurt, 1997. Jarausch, K. H. Deutsche Studenten: 18001970, Frankfurt, 1984. Keller, F. Wien Mai 68: Eine heie Viertelstunde, Vienna, 1983. Kimmel, M. Die Studentenbewegungen der 60er Jahre: Frankreich, BRD und USA im Vergleich, Vienna, 1998. Klose, W. Freiheit schreibt auf eure Fahne: 800 Jahre deutsche Studenten, Oldenburg 1967. Kotek, J. Students and the Cold War, Basingstoke, 1996. Kraushaar, W. Frankfurter Schule und Studentenbewegung. Von der Flaschenpost zum Molotowcocktail. 19461995, Vol. I: Chronik; Vol. 2: Dokumente; Vol. 3: Aufsatze und Kommentare. Register, Hamburg, 1998. Kronig, W., and Muller, K.-D. Anpassung, Widerstand Verfolgung: Hochschule und Studenten in der SBZ und DDR (19451961), Cologne, 1994. Lipset, S. M. (ed.) Student Politics, New York, 1967. Lipset, S. M., and Altbach, P. G. (eds.) Students in Revolt, Boston, 1969. Lumley, R. States of Emergency: Cultures of Revolt in Italy from 1968 to 1978, London, 1990. Maravall, J. Dictatorship and Political Dissent: Workers and Students in Francos Spain, London, 1978. Marsh, A. Protest and Political Consciousness, London, 1977. Marwick, A. The Sixties: Cultural Revolution in Britain, France, Italy, and the United States, c. 1958c. 1974, Oxford, 1998.

317

Louis Vos
Otto, K. A. Vom Ostermarsch zur Apo: Geschichte der ausserparlamentarischen Opposition in der Bundesrepublik. 196070, Frankfurt, 1977. Pervan, R. Tito and the Students: The University and the University Student in Self-Managing Yugoslavia, Nedlands, 1978. R ev esz, L. Jugendbewegungen im Ostblock, Vienna, 1985. Ross, K. May 68 and its Afterlives, Chicago, 2002. universitario (SEU), 19391965: La Ruiz Carnicer, M. A. El Sindicato espanol pol socializacion tica de la juventud universitaria en el franquismo, Madrid, 1996. Statera, G. Death of a Utopia: The Development and Decline of Student Movements in Europe, Oxford, 1975. van Maanen, G. The International Student Movement: History and Background, The Hague, 1966. Vos, L., Derez, M., Depraetere, I., and Van Der Steen, W. Studentenprotest in de jaren zestig: De stoute jaren, Tielt, 1988. Walczak, J. Ruch studentcki w Polsce, Warsaw 1990.

318

CHAPTER 9

GRADUATION AND CAREERS

ULRICH TEICHLER

introduction In seeking to foster competence, twentieth-century European universities strove to enhance their students knowledge and develop their personalities, attitudes and values. Universities also provided, as in the past, training for those who would teach future generations, and, in a more organized and deliberate way than in the past, offered a foundation of knowledge and skills relevant for future employment. There were variations from country to country, from institution to institution and from discipline to discipline in the emphasis placed on these three functions and on the balance among them. There were also changes over time. At one extreme, universities laid the general foundation for diverse forms of professional competence; at the other, they directly trained students for a particular profession. In the latter case questions arose about the time to be devoted to the training and the division of responsibilities between universities and other institutions of higher education or professional training agencies. The more cognitively demanding educational tasks are, the less directly can their realization be conceived of in terms of training. Among their responsibilities universities were expected to carry out a critical and an innovative function. Graduates would have learnt rules and acquired tools, but they would also have had to be motivated and placed in a position where they could question established professional practices and cope with future changes in patterns of work. The rapid expansion in the number of students and continuing demand for manpower in specic elds after the Second World War made a university degree more and more a prerequisite for access to top occupational positions, those involving high levels both of systematic thinking and of cognitive 319

Ulrich Teichler competence. At the same time, there was widespread uneasiness among experts, politicians and the population in general that traditional systems were breaking down. Four general questions were raised: 1. Does the competence acquired at the university qualify graduates to meet the demands of the employment system? What are the consequences of discrepancies in quantitative terms between demand and supply, and in qualitative terms between skill and requirements? 2. How does the attainment of a university degree affect social selection and status distribution? How does the emerging meritocracy based on educational attainment affect the links between competence and work tasks, and between teaching and learning at universities? 3. How do the motivations, inclinations, and career expectations and prospects of students change as the skills required of them change? And how do altered motivations and expectations affect the character and quality of teaching and learning? 4. How have the changes just discussed altered student access, enrolment and graduation, institutional patterns, study programmes and teaching? How do universities react to the changing conditions of graduate employment and work, and how do they actively try to change these conditions? The aim of this chapter is to provide an account of quantitative changes in enrolment and graduation in Europe between about 1950 and about 1990, to summarize major political and research debates about the changing relationships between higher education and employment, to offer an overview of the modes of graduation and award of degrees as well as their links to professional practice, to analyse changes in graduate employment and work, as far as they have been set out in statistical material and empirical surveys, and to consider selectively the response of universities themselves to the changing relationships between higher education and employment. Finally, trends and policies will be discussed which could be observed in recent years. The terminology used in the preceding paragraph hints at one of the major changes facing European universities after the war. While in the 1940s they remained the core institutions of society as far as linkages between research and teaching were concerned, they tended to be viewed from the 1960s onwards as institutions of higher education, no longer the sole providers of advanced knowledge and professional skills. The distinction between universities and other establishments of higher education

320

Graduation and careers became blurred, and their respective functions overlapped. Many sources referred to in the text that follows do not distinguish clearly between universities and other institutions in discussions of or statistics relating to higher education, third-level or tertiary education and lifelong learning.

overall development of enrolment, graduation and attainment After 1945, higher education experienced an unprecedented expansion, which had far-reaching consequences for graduate employment. Since the available data vary in terms of the sources referred to, the countries included, the types of higher-education institutions taken into consideration and the statistical measure employed (whereby selection and denitions change over time), only select examples are provided here to illustrate the development. Concerning admission to and enrolment at institutions of higher education, a few aggregate data may sufce to indicate the trends: 1. According to UNESCO statistics, the ratio of students attending institutions of tertiary education in the richer countries (the top third in the world in terms of GNP per capita) increased from 3.7% of their age cohorts in 1950 to 8.4% in 1960, 13.6% in 1970 and 18.9% in 1975. Similarly, the mean enrolment ratio of students at universities and similar specialized institutions as a proportion of 20 24-year-olds in ten Western European countries was 4.5% around 1950, 6.4% around 1960, and 17.4% in 1975.1 According to OECD statistics, the number of students in higher-education institutions in the European market-oriented (OECD member) states grew annually by 5% on average during the 1950s and by almost 8% during the 1960s, when the growth rates in university-type higher education surpassed those in non-university-type education.2 2. In 1991, the entry ratio to tertiary education the number of students enrolled divided by the total age cohort had reached 38% on average in Western European member states, 24% of them in university education (see table 9.1).3 By contrast, UNESCO statistics show that the entry ratio to higher education in Eastern European
1

2 3

R. Schneider, Die Bildungsentwicklung in den westeuropaischen Staaten, Zeitschrift fur Soziologie, 11 (1982), 22. Education in OECD Countries 197888 (Paris, 1990), 813, 113. OECD, Education at a Glance: OECD Indicators 1993 (Paris, 1993), 126.

321

Ulrich Teichler Table 9.1 Entry rates into tertiary education 1991 and graduation rates 1994 in selected OECD Member States (percentage of corresponding age groups)
Entry rates 1991 Non-univ. a. Western Europe Austria Belgium Denmark Finland France Germany Ireland Italy Netherlands Norway Spain Sweden Switzerland Turkey United Kingdom Univ. Total Graduation rates 1994 Non-univ. Univ. Total

5 22 14 29 15 11 16 25 m 34 m 2 8

23 28 24 33 29 33 17 36 13 m 40 13 m 12 20 15 7 24 38

28 50 38 62 44 44 34 36 38 m 40 47 m 15 28 16 16 53 65

5 m 9 25 25 11 14 9 m 47 1 12 25 2 25 5 m m 28 22

9 m 26 21 14 13 23 11 m 23 21 13 9 7 27 14 m 14 23 32

14 m 35 46 39 24 37 20 m 70 22 25 34 9 52 19 m m 52 54

b. Central and Eastern Europe 1 Czech Republic Slovak Republic Hungary 9 c. Other countries Japan United States 29 27

m = missing 1991: Czechoslovakia Sources: OECD, Education at a Glance: 1993. OECD Indicators (Paris, 1995); OECD, Education at a Glance: 1994. OECD Indicators (Paris, 1996).

countries cooperating economically and politically with the Soviet Union remained below 20% until the late 1980s i.e., until their rapid socio-economic transformation to market-oriented economies began.4 3. The ratio of rst-degree graduates of the respective age group in thirteen Western European OECD member states in 1994 was on average 33% (see table 9.1), among them 16% in university education.5
4

Nevertheless the developments in the Eastern European countries varied substantially, as demonstrated in L. Cerych, S. Colton and J.-P. Jallade, Student Flows and Expenditure in Higher Education 19651979 (Paris, 1981). See table 9.1.

322

Graduation and careers Table 9.2 Educational attainment of the population over 25 years old 19601985 (percentages)
Year OECD 1960 1965 1970 1975 1980 1985 No school countries 6.4 6.0 5.2 5.4 4.6 3.3 Primary 61.1 58.0 54.0 47.6 39.4 37.7 Secondary 25.5 27.8 31.3 34.2 40.2 40.8 22.3 27.6 36.3 40.9 49.9 51.8 Higher 7.0 8.2 9.5 12.8 15.8 18.2 3.9 5.0 6.4 7.5 8.0 9.8 Average years of school 6.71 7.03 7.42 7.88 8.65 8.88 6.83 7.29 7.97 8.33 8.78 9.17

Centrally planned economies 1960 5.0 68.8 1965 5.3 62.1 1970 4.0 53.3 1975 3.7 47.9 1980 2.7 39.4 1985 2.3 36.1

Source: OECD Job Study (Paris, 1994).

There was a considerable and inevitable time lag in the percentage of the adult population attaining higher education. As table 9.2 shows, the proportion of the population over twenty-ve in the OECD member states who had attended a university for some period (most of whom completed their studies) increased from 7.0% in 1960 to 18.2% in 1985. The respective ratios were 3.9% and 9.8% in centrally planned economies. According to data from the early 1990s, the mean proportion of adults in sixteen European OECD member states having completed higher education was about 16%, some 10% of whom held a university-level degree.6 The proportion of persons having completed higher education naturally varies according to age. In the early 1990s, 9% of the population aged 55 to 64 in sixteen European member states had completed higher education compared with 19% of those aged 25 to 34. The entries in the tables may not be consistent across countries with respect to exclusion or inclusion of students and graduates in nonuniversity institutions. In some cases, statistics for previous years are corrected following the upgrading of an institution, in others not. Institutions may be included or excluded in international statistics that do not have the ofcial status of higher-education institutions within the countries concerned.
6

OECD, OECD Education Statistics 19851992 (Paris, 1995), 194.

323

Ulrich Teichler variations in europe The ratios of beginning students, students and graduates of the respective age cohorts did not increase continuously from 1950 to 1990 and did not follow any convergent trend. Overall across Europe, the ratio of beginners continued to grow, but stagnation or even a modest decline in the ratio occurred in individual countries for about a decade, and the differences by country are striking. According to UNESCO statistics, the ratio of students among 2024year-olds was highest in 1950 in the Netherlands (7.4%) and Poland (5.9%), but only 2.1% in Spain and even lower in Albania and Turkey. According to OECD statistics, the number of rst-time entrants to fulltime higher education per 100 in the theoretical starting age was above 40% in the majority of European OECD member states around 1990, but below 20% in Central and Eastern Europe as well as in Turkey.7 The ratio of graduates of the respective age group in 1950 was about three times as high in Austria and the Netherlands as it was in France at that time; twenty-ve years later, the ratio of graduates was more than 20% in France, while it was less than 10% in Denmark, Switzerland and the Netherlands. As table 9.2 shows, the OECD reported that more than 30% of the respective age cohort obtained a higher-education degree in Norway and Belgium, but less than 10% in Italy. Some countries moved up in the list of respective ratios and others down. Overall, there was no general growth trend in countries starting off with low ratios in the 1950s and 1960s. Higher education expanded rapidly in the 1950s and early 1960s in the planned economies and thereafter only moderately. By contrast, most European OECD states experienced high growth during the 1960s and partly during the 1970s, eventually reaching in the 1980s an enrolment ratio about twice as high on average as those in planned economies.8 Moreover the ratios of beginning students and graduates varied less by country in respect to university degrees than in respect to completion of any kind of higher education. The proportion of students enrolling in non-university higher education in Western Europe varied from less than 2% to 34% in 1991, while it ranged for students enrolling in university education from 12% to 40% (see table 9.1). The graduation ratios across different countries cannot be inferred from entering ratios a few years earlier, since dropout rates increased (and at different rates) in many European countries over time. In a study published by the Council of Europe, the success quota, dened as the
7 8

Indicators 1993 (note 3), 126. See UNESCO/CEPES, Planning in Higher Education (Bucharest, 1986).

324

Graduation and careers ratio of graduates in 1985 to the number of entrants in 1980, varied among the nine countries concerned from more than 90% to less than 50%.9 Various studies indicate dropout rates of 63% in Italy and 70% in Yugoslavia during the 1980s.10 The impact of these different developments on the educational attainment of the labour force may be illustrated by more recent OECD statistics. In the early 1990s, the proportion of 2564-year-olds having completed higher education was highest in Norway (25%) and Sweden (24%), while the corresponding ratios were less than 8% in Austria, Italy, Portugal and Turkey (see table 9.3). distribution by field of study The composition of students and graduates by eld of study changed substantially after 1945. Among the causes proposed are student choice, political or administrative policy, academic stress or interest, employer demand, professional gate-keeping and, of course, cost of facilities. In all European countries we nd a mix of elds or institutions open to everybody qualied to enrol and elds or institutions with restricted admissions.11 On the whole, planning according to perceived manpower demands dominated in the planned economies, while social demand, that is, the sum of students choice, played a substantial role in most Western European countries.12 Teacher training and related elds experienced the largest uctuations. Science and engineering elds continually gained in importance. The international organizations most actively involved in compiling educational statistics, UNESCO and OECD, changed their eld classications over time. No documents are available, therefore, which analyse the change of the composition of higher education in Europe from about 1950 to about 1990 by eld of study. In comparing the composition of students by disciplinary groups in 1955 and 1985 on the basis of UNESCO statistics,13 we note a substantial contrast between some of the planned economies in Central and Eastern Europe and most Western
9

10 11

12

13

U. Teichler, Convergence or Growing Variety: The Changing Organisation of Studies (Strasbourg, 1988), 85. OECD, From Higher Education to Employment: Synthesis Report (Paris, 1993), 58. See UNESCO, Access to Higher Education in Europe (Paris 1966); Access to Higher Education in Europe (Bucharest, 1981); OECD, Policies for Higher Education in the 1980s (Paris, 1983); B. B. Burn, Higher Education: Access, in T. Hus en and T. N. Postlethwaite (eds.), The International Encyclopedia of Education (Oxford, 1985), 217985. Cf. J. Marceau, General Report, in OECD (ed.), Individual Demand for Education (Paris, 1979), 948. UNESCO, Access (note 11), 345; V. Nicolae, R. H. M. Smulders and M. Korka, Statistics of Higher Education (Bucharest, 1989), 86.

325

Table 9.3 Percentage of the population 25 to 64 years of age that has completed a certain highest level of education 1992
Upper secondary education m+w m w w w m+w m m+w m Non-university tertiary education University education m+w Total m w

Early childhood and primary education w

Lower secondary education

m+w

m+w m

European Community Belgium 28.3 Denmark France 26.2 Germany Ireland 31.7 Italy 36.9 Netherlands 16.7 Portugal (1991) 77.6 Spain 61.1 United Kingdom 27.6 36.6 19.5 11.4 27.4 37.0 21.8 9.0 16.4 26.1 22.3 41.7 61.0 38.9 38.1 42.9 18.6 20.7 53.7 31.7 28.6 45.8 13.0 25.4 59.8 8.7 3.9 8.9 69.7 52.4 41.2 44.6 8.2 52.7 54.8 12.8 45.2 46.4 12.4 56.8 62.9 12.9 11.6 6.1 6.9 7.8 8.5 10.4 12.4 13.3 12.4 10.9 13.8 11.7 19.2 6.6 8.0 4.8 25.2 45.7 23.5 24.9 24.7 32.3 29.0 7.6 15.6 37.8 25.0 39.7 36.3 60.5 25.3 22.1 37.1 7.5 9.9 49.6 26.2 44.4 39.9 61.1 21.2 23.1 40.0 8.4 10.9 53.9 23.8 34.9 32.8 59.9 29.3 21.0 34.1 6.7 8.9 45.3 11.4 5.9 5.7 9.8 8.6 1.7 3.0 7.7 9.2 5.0 5.1 12.7 7.9 0.9 4.1 6.2 13.6 6.8 6.4 6.9 9.3 2.4 1.0 9.2 8.8 13.3 10.2 11.6 8.3 6.4 20.9 5.0 10.0 10.7

25.4 24.3 33.7 32.5 14.4 76.3 58.0

31.2 28.1 29.7 41.3 19.1 78.7 64.1

26.4 41.1 21.5 18.1 26.1 34.6 25.3 8.3 16.0 31.9

11.6 6.1 100 14.0 12.7 100 11.3 9.2 100 14.8 8.3 100 9.8 6.9 100 7.3 5.4 100 23.8 17.8 100 5.4 4.6 100 10.7 9.4 100 13.8 7.7 100 7.9 6.0 12.1 8.8 14.8 10.9 12.2 11.2 11.0 5.1 6.6 2.9 100 100 100 100 100 100

100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

Other Europe-OECD Austria Finland Norway 1.4 Sweden Switzerland Turkey 80.0

1.6 73.1

1.1 87.1

32.0 38.5 19.6 30.2 19.2 6.4

Source: OECD, OECD Statistics 19851992 (Paris 1995), 1948.

Graduation and careers European countries. The proportion of students enrolled in humanities and social sciences in Romania comprised only 29% in 1955 and declined to a mere 16% in 1985. In the Soviet Union and Czechoslovakia, the comparable gure fell from somewhat above 40% to below 30%, and engineering took a much larger share than in Western European countries. There the proportion of students in the humanities and social sciences varied from 43% to 65% in 1955 and from 45% to 62% in 1985. In an overview provided by the OECD regarding elds of study at institutions of higher education in nine European countries in the late 1980s,14 the humanities and social sciences (including teacher training, but excluding economic elds and law) garnered 61% of all students in Denmark, between 30% and 40% in the majority of countries, but only 17% in Norway, 22% in Belgium and 24% in Germany. The proportion of science and engineering students was 40% in Germany owing to the large number of engineering students at Fachhochschulen. Although science and engineering were named most frequently by planners of resources in higher education, the proportion of students in those elds varied as much across countries as in other elds: it ranged from 17% (Spain) to 34% (Norway). Finally, the proportion of students in health sciences was highest in Sweden (25%). In sharp contrast, only 7% of students in the Netherlands and 5% in the Federal Republic of Germany were enrolled in medical elds, probably because paramedical students in Germany enrolled outside higher education. Altogether, the distribution of students varied more according to discipline among the Western European countries than the public debates on higher education and its relationships to employment suggested.

changing debates about the quantitative and structural relationships between university education and employment Universities in the various European countries differed considerably in their basic approach to teaching and learning vis-a-vis employment and ` work, and, as discussed above, the ratios of the respective age group beginning and eventually completing a programme at universities or other institutions of higher education also varied substantially. Yet for the rst few years after 1945, when many European countries were absorbed in re-establishing universities following the turmoil of the war, a substantial change in the relationship between study and career was not on the agenda.
14

OECD, Synthesis Report (note 10), 40.

327

Ulrich Teichler Expansion expected to serve economic growth and social equality Thereafter changing relationships between higher education and work were accompanied by quite similar debates in different European countries at least among those pursuing similar economic and social policies. The leaders of the planned economies in Eastern Europe decided in the early 1950s that a targeted increase of highly trained cadres would provide for a rapid technological improvement and substantial economic growth. The overall number of engineers and higher technicians in the production sector of the Soviet Union increased by more than 50% in the 1950s and by more than 40% from 1960 to 1965.15 And technological development in the planned economies had a substantial impact on market-oriented industrial countries in the West, following the so-called Sputnik shock, the reaction to the successful launching of the rst space mission by the Soviet Union in 1957. Now, with the OECD playing a signicant role,16 most experts and politicians in Western Europe agreed to the view already spread previously in the domain of economics of education both in the US and Western Europe that education is a key driver of economic growth. The planned economies insisted on manpower forecasts, and individual production enterprises were asked to indicate in advance the number of graduates they would need in a few years. These projections formed the basis for deciding the number of students to be admitted in the corresponding elds of study. This system was handled in a relatively strict manner in the Soviet Union and Romania, but in a more exible way in Poland.17 Western European countries followed two approaches for relating demands for highly qualied labour to its supply from the highereducation system. First, they too used the manpower requirements approach to predict future demand through extrapolation of trends and scenarios of likely changes of directions. This approach was rst employed on a large scale in an OECD Mediterranean Regional Project in the early 1960s.18 Second, they calculated returns on educational investments on
15

16 17

18

D. Chuprunov, R. Avakov and E. Jiltsov, Enseignement sup erieur, emploi et progr` es technique en URSS (Paris, 1982), 43. OECD, The Residual Factor and Economic Growth (Paris, 1964). I. V. Ivanov, Skilled-Manpower Planning Forecasting and Training in the USSR, in R. V. Youdi and K. Hinchcliffe (eds.), Forecasting Skilled Manpower Needs (Paris, 1985), 153 72; A. Josefowicz, J. Kluczynski and T. Obrebski, Manpower and Education Planning and Policy Experience in Poland, 196080, in Youdi and Hinchcliffe, Forecasting, 13552. For the approach, see G. Psacharopoulos, The Manpower Requirements Approach, in G. Psacharopoulos (ed.), Economics of Education (Oxford, 1987), 3315; for its application, see Youdi and Hinchcliffe, Forecasting (note 17), and O. Fulton, A. Gordon and G. Williams, Higher Education and Manpower Planning (Geneva, 1980). See also

328

Graduation and careers the basis of the so-called human capital approach. Some adherents of this latter approach concluded that higher earnings for graduates indicated a shortage of highly skilled persons and lower earnings an oversupply.19 Concurrently, political efforts in Western European countries were aroused to reduce inequalities of educational opportunity related to socioeconomic background, gender and region. While admission quotas were xed for children of manual workers and farmers in some Eastern European countries, notably during the 1950s and 1960s, Western Europe abolished tuition fees, offered need-based scholarships, introduced compensatory education for the disadvantaged, provided educational opportunities in hitherto disadvantaged regions and, not least, undertook information campaigns.20

Structural moderation During the late 1960s and early 1970s, belief in the value of higher mass education waned. Doubts grew about whether an expansion of universities could be funded to the extent initially projected, whether such high numbers of graduates were needed, and whether quality could be preserved during rapid expansion. A restructuring of the higher-education system was now advocated to take account of the growing diversity of students, their talents, motives and career prospects. Some experts and politicians favoured a highly structured, diversied system of higher education to protect elite higher education while at the same time providing mass higher education for a growing number of students.21 Others pleaded for a broad range of educational goals as well as easier ways of modifying individual educational choices. Finally, some opted for limiting quality differences. In the wake of these debates, various institutions were upgraded or newly founded to form a new sector of so-called non-university or short-cycle higher education in Western European countries, such as the instituts universitaires de technologie in France, polytechnics in the United Kingdom, distrikthogskoler in Norway and Fachhochschulen in the Federal Republic of Germany. Some of these institutions tried to
H. S. Parnes, Forecasting Educational Needs for Economic and Social Development (Paris, 1962); G. Williams, The OECDs Mediterranean Regional Project, in Psacharopoulos, Economics (note 18), 3356. Cf. the critical comments by D. M. Windham, Social Benets and Subsidization of Higher Education: A Critique, Higher Education, 5 (1976), 23752. See U. Teichler, European Practice of Ensuring Equality of Opportunity to Higher Education, Journal of Higher Education Studies, 3:2 (1988), 211. M. Trow, Problems in the Transition from Elite to Mass Higher Education, in OECD (ed.), Policies for Higher Education (Paris, 1974), 51101.

19

20

21

329

Ulrich Teichler maintain the same entry requirements as universities. Some offered shortcycle study programmes similar to ones available in universities as well as a vocational or general curricular approach.22 Routes of access to higher education opened up for secondary-school leavers who traditionally would not have qualied for higher education and for adults who had not even completed secondary education. In addition, transfer routes were established from non-university higher education to university programmes. Some countries tried to limit quality differences in the expanding higher-education system. Thus, in the Federal Republic of Germany, the Framework Law for Higher Education enacted in 1976 provided for comprehensive universities that combined theoretical and practiceoriented course programmes within the same institutions. Yet only six comprehensive universities were founded offering students the opportunity to choose between the two options during their studies. According to Swedish higher-education legislation, all institutions of higher education were named hogskole , and short as well as regular degree programmes were provided within the same institution.23 No convergent structure of higher education emerged in Europe. A twotype or three-type institutional pattern spread, but did not become the rule. The comprehensive model remained exceptional. In some countries, a unitary structure was preserved (for example in Austria, Italy and Switzerland) or re-established. Re-structuring activities came more or less to a halt from the late 1970s to the late 1980s, and only re-emerged around 1990, especially in countries concerned about the long duration of studies. A number of countries established new institutions in regions remote from universities or urban centres, for example, the University of Troms, created in Norway north of the Arctic Circle in 1968.24 Pessimism and concern about over-qualication During the 1970s, the optimism of the 1960s was replaced by pessimism regarding the expansion of higher education, and by a dramatic criticism of the policies prevailing in the 1960s. Views changed in four respects. First, there was a decline of faith in a substantial growth of demand for
22

23

24

See OECD, Short-Cycle Higher Education: A Search for Identity (Paris, 1973); UNESCO/CEPES, New Forms of Higher Education in Europe (Bucharest, 1976). See H. Hermanns, U. Teichler and H. Wasser (eds.), The Compleat University (Cambridge, Mass., 1983). See J.-E. Lane, Higher Education Regionalisation, Higher Education, 13 (1984), 347 68; J.-E. Lane, Local Communities and Higher Education, in Clark and Neave, Encyclopedia II, 94656; K. N. Bie, Creating a New University: The Establishment and Development of the University of Troms (Paris, 1973).

330

Graduation and careers highly qualied human resources after the so-called oil shock in 1973, when unemployment began to grow substantially in market-oriented societies. Many politicians and researchers pointed out an increasing mismatch between demand and supply, as well as growing discrepancies between the capabilities of graduates and job requirements, and fears were expressed about the emergence of an akademisches Proletariat exposed to the sort of large-scale unemployment experienced by university graduates during the world economic crisis around 1930. Criticism was also expressed concerning an emerging displacement25 whereby university graduates took over jobs traditionally held by persons who had a secondary or vocational education, reducing the employment opportunities of the latter and perhaps performing worse on the job. Meanwhile, access to higher education for previously disadvantaged social groups had indeed increased, though more modestly than had been hoped.26 Increased educational opportunities did not seem to translate into corresponding equality of professional opportunities except in a very few countries such as the Netherlands and Sweden.27 On the one hand, employers might select graduates according to their social skills or cultural capital;28 on the other, pressures for the preservation of social inequality might increase the weight of tiny differences between educational credentials, or bigger differences between types of higher-education institutions.29 Third, the career rewards of education became a focus of inquiry. Constant oversupply set in; the previous cycle of shortage, increased income, oversupply and reduced income no longer worked. Action was called for to redress credentialism and an articial emphasis on the qualications acquired in assessing competence and performance.30 Fourth, belief eroded the rationality and possible success of targeted educational policy and planning. Macro-societal planning was viewed
25

26

27

28

29

30

A. Hegelheimer, Verdrangen und verdrangt werden, Der Arbeitgeber, 27 (1975), 10979. See M. Kotwal, Inequalities in the Distribution of Education between Countries, Sexes, Generations and Individuals, in OECD (ed.), Education, Inequality and Life Chances, Vol. I (Paris, 1975), 31108; G. Busch, Inequality of Educational Opportunity by Social Origin in Higher Education, in OECD, Education (note 26), 15981. Y. Shavit and H.-P. Blossfeld (eds.), Persistent Inequality: Changing Educational Attainment in Thirteen Countries (Boulder, Col. and London, 1993). See P. Bourdieu and J.-C. Passeron, Die Illusion der Chancengleichheit (Stuttgart, 1971); P. Bourdieu and J.-C. Passeron, Reproduction in Education, Society and Culture (London and Beverly Hills, Cal., 1977); see also R. K. Kelsall, A. Poole and A. Kuhn, Graduates: The Sociology of an Elite (London, 1972). See U. Teichler, Struktur des Hochschulwesens und Bedarf an sozialer Ungleichheit, Mitteilungen aus der Arbeitsmarkt- und Berufsforschung, 7 (1974), 197209. D. Davies, Credentialism, in Clark and Neave, Encyclopedia II, 8717; R. P. Dore, The Diploma Disease (London, 1976).

331

Ulrich Teichler more cautiously. Analysis of the economics of education lost popularity.31 Ambitious reform goals gave way to awareness of the various pitfalls in the implementation of reforms.32 In this context, the limits of the predictive power of manpower forecasts and respective planning activities were stressed.33 So too were mismatches. The debates of this period about the tasks and functions of higher education vis-a-vis employment and work were more controversial than at ` any other time since the war. But when graduates began to face employment problems on a large scale, universities felt pressed to take their employability seriously.34 Moreover, the aim of serving the academic goals of universities and professional goals now appeared incompatible, even contradictory, as did the policy of meeting economic demands on the one hand, and contributing to equality of opportunity on the other. It became more difcult to take action in any direction in times of stagnating or declining expenditure on higher education than at times of expansion.35 Signs of adjustment and diverse options Between the early 1970s and the late 1980s, however, the debate moderated. This reected changes in graduate employment as well as processes of adaptation to the changed state of affairs. Two reasons may be given. The growth in the number of graduates beyond those planned for did not lead to any single major problem. Instead, there were multiple responses. Access to higher education did not expand as much as before; some students avoided subjects where graduates faced serious employment problems; others prolonged their studies; the job search period increased marginally and initial employment became riskier.36 The
31

32

33

34

35

36

See OECD (ed.), Educational Planning: A Reappraisal (Paris, 1983); G. Williams, The Economic Approach, in B. R. Clark (ed.), Perspectives on Higher Education (Berkeley, 1984), 79105. L. Cerych and P. Sabatier, Great Expectations and Mixed Performance: The Implementation of Higher Education Reforms in Europe (Stoke-on-Trent, 1986). Cf. the summary in Youdi and Hinchcliffe, Forecasting (note 17); Arbeitsgruppen des Instituts fur Arbeitsmarkt- und Berufsforschung und des Max-Planck-Instituts fur Bildungsforschung (eds.), Bedarfsprognostische Forschung in der Diskussion (Frankfurt, 1975); U. Teichler, D. Hartung and R. Nuthmann, Higher Education and the Needs of Society: A Study (Windsor, 1980); Fulton, Gordon and Williams, Higher Education (note 18). See G. Williams, Graduate Employment and Vocationalism in Higher Education, European Journal of Education, 20 (1985), 18192. See P. Windolf, Die Expansion der Universitaten 19701985: Ein internationaler Vergleich (Stuttgart, 1990). See pp. 34153 of this chapter, and also U. Teichler, Beziehungen von Bildungsund Beschaftigungssystem: Erfordern die Entwicklungen der achtziger Jahre neue Erklarungsans atze, in A. Weymann (ed.), Bildung und Beschaftigung , Soziale Welt, Sonderband 5 (Gottingen, 1987), 2757.

332

Graduation and careers relationships between higher education and employment became more exible, not only in the United Kingdom, where about 8% of British university graduates in the humanities were employed in industry or agriculture and about 15% in private services, but in other countries as well. In the Federal Republic of Germany, the Institute for Labour Market and Occupational Research calculated on the basis of the 1970 census data that one-sixth of the occupational categories typically lled by graduates in mechanical engineering actually had been lled by graduates from other elds of study, and one-fth by non-graduates. Corresponding realized substitution was even higher for graduates from electrical engineering and law, and while in the case of scientists vertical substitution remained an exception, horizontal substitution was even higher.37 The second reason for moderation was that employment prospects for graduates had become more diverse as a function of their eld of study and the type and reputation of the institution they had attended. Graduates from some institutions had many options, while others faced serious employment problems. Making wise choices was an individual responsibility, but more moderate planning goals were now set in Western European countries, and most notably in countries in which educational planning had hitherto been ambitious, such as Sweden and Germany. There were changes, too, in the approaches of planned economies.38 The emerging mood about the possible future role of planning may be illustrated by the summary of an OECD conference in the early 1980s on policies for higher education. It did not recommend a contraction of higher-education systems, fearing that innovation in higher education, which had been encouraged under conditions of growth in the past, might come to a halt. It also recommended against a laissez-faire policy, that is, just hoping for adjustments either in terms of declining social demand for higher education or in terms of the absorption of the rising number of graduates in lower-level jobs. Students should be guided towards more occupationally-relevant courses, it suggested, and institutions encouraged to be more sensitive to employment problems by giving priority to courses that responded to the requirements of working life.39
37

38

39

R. Butler, Employment of the Highly Qualied (London, 1978); Institut fur Arbeitsmarkt- und Berufsforschung der Bundesanstalt fur Arbeit, Beruiche Flexibilitat und Arbeitsmarkt, Quintessenzen, 7 (Nuremberg, 1977), 14, 20. See also D. Mertens and M. Kaiser (eds.), Beruiche Flexibilitatsforschung in der Diskussion, 4 vols. (Nuremberg, 1978); U. Teichler and B. C. Sanyal, Higher Education and the Labour Market in the Federal Republic of Germany (Paris, 1982), 909. See K. Hufner, Higher Education in the Federal Republic of Germany: A Planned or a Market System? Or a Third Way?, in R. Avakov et al. (eds.), Higher Education and Employment in the USSR and in the Federal Republic of Germany (Paris, 1984), 18596; UNESCO, Planning (note 8). OECD, Policies (note 11), 35.

333

Ulrich Teichler During this period, a signicant change in the relationships between governments and higher-education institutions in many Western European countries took place. With the exception of the United Kingdom, governments reduced bureaucratic control, thus raising the individual universitys power to shape its own prole.40 Self-assessment systems were introduced and performance indicators were employed as criteria for the allocation of funds.41 Although aspects of academic quality in research and in teaching were paid most attention, self-assessment increased awareness within the universities of the links between study, teaching and the subsequent careers of graduates.42 Both in Western and Eastern Europe, opinion held that an increase in competence beyond what was traditionally required should not be interpreted as overqualication.43 Job roles could be reshaped in the direction of a changing combination of complex and less complex tasks, and innovation could be stimulated in neglected areas. During the late 1980s and early 1990s, eventually, discussion of the relationship between higher education and employment became more general. The views expressed, however, were strikingly divergent, not least in Central and Eastern European countries, where the socio-political system changed dramatically after 1989. First, employers pointed out more strongly than they had done in the past that graduates attitudes and social skills ranked high among the criteria that they took into consideration for recruitment and promotion.44 Second, unemployment increased in most European countries in the early 1990s both in the labour force in general and among higher-education graduates. Thus, the call for targeted employment policies returned to the agenda. Third, the proportion of entering students among their age group grew in a number
40

41

42

43

44

See G. Neave and F. A. van Vught (eds.), Prometheus Bound: The Changing Relationship between Government and Higher Education in Western Europe (Oxford, 1991). See H. R. Kells, Self-Regulation in Higher Education: A Multi-National Perspective on Collaborative Systems of Quality Assurance and Control (London, 1992). See the overview on widely used criteria and indicators in F. J. R. C. Dochy, M. S. R. Segers and W. H. F. W. Wijnen (eds.), Management Information and Performance Indicators in Higher Education: An International Issue (Maastricht, 1990). See D. Mertens, Unterqualikation oder Uberqualikation, Gewerkschaftliche Monatshefte, 27 (1976), 48897; Z. Suda, Universal Growth of Educational Aspirations and the Overqualication Problem: Conclusions from a Comparative Data Analysis, European Journal of Education, 14 (1979), 11364; D. Vaida, The University Does not Overqualify, ibid., 16574. OECD, Synthesis Report (note 10); Higher Education and the Labour Market (special issue), Higher Education in Europe, 18:2 (1993); U. Teichler, Higher Education and Employment The Issues for University Management, Higher Education Management, 6 (1994), 21725; Higher Education and Employment (special issues), European Journal of Education, 30:1 and 2 (1995); J. Brennan, M. Kogan and U. Teichler (eds.), Higher Education and Work (London, 1995); The European Round Table of Industrialists, Education and the European Competence (Brussels, 1989).

334

Graduation and careers of Western European countries, with government support in France, Sweden and the United Kingdom. The growth occurred without any single major argument in favour of expansion. Fourth, growing attention was paid to graduate employment in other countries. For example, about one-fth of students who had studied in another European country under the Erasmus programme eventually took jobs abroad.45 Finally, further expansion of enrolment was eventually to call into question the traditional view that economic and social welfare depended heavily on an elite with scarce talents. degrees and graduation At many European universities, there were two levels of awards: a university degree signalling basic academic and possibly professional competence, for example the Magister in Austria, and a doctorate given upon completion of substantial, in some cases original, academic work. In some European countries, additional awards were customary. In the United Kingdom and in the Republic of Ireland, two university degrees fell into the category of basic, the rst of them usually named bachelors and awarded after three or four years of study, and the second a masters generally awarded after one additional year of study. In Scotland both the rst and second degree were called masters. In France and traditionally in the Nordic countries, two levels of examinations and degrees were customary in the humanities and sciences: in France a licence and, after further years of study, a ma trise. In Norway, a cand.mag. was acquired after three and a half years of study, and a higher candidatus, referring to a discipline, for example cand.psychol., after two more years. In the 1960s and 1970s, the Nordic countries tried to phase out the programmes and titles because the time and effort involved corresponded almost to those leading to a doctorate in other countries, but the old way remained in Denmark and Norway. In some countries an advanced (postdoctoral) academic qualication was awarded and generally viewed as the entry card to the professoriate. This held true for the Habilitation in the German-speaking countries as well as the doctor scientiae in some of the planned economies.46 Universities across Europe differed and continue to differ in the extent of regulation of their curricula. Western European universities that followed a Humboldtian tradition, and especially the humanities and social sciences in such countries, tended to offer many options, whereas
45

46

For the Erasmus scheme and its impact, see U. Teichler and F. Maiworm, Transition to Work: Experiences of Former ERASMUS Students (London, 1994), 57. This section is based on H. Jablonska-Skinder and U. Teichler, Handbook of Higher Education Diplomas in Europe (Munich, 1992).

335

Ulrich Teichler some Southern European universities, for example in Italy and Spain, tended to provide students with little freedom except in deciding the length of their studies. In the wake of the expansion of higher education throughout the 1960s and 1970s, curricula tended to become more standardized. Many factors contributed to this trend. The growing professional relevance of higher education in many areas called for a clearer denition of the skills to be taught and the amount of the ever-increasing knowledge to be mastered. The proportion of students unable to prot from loosely structured teaching and learning processes seemed to be on the rise. The growing funds needed for higher education called for increased efciency, and the number of students leaving without a degree (dropouts) were more likely to be regarded as wastage than in the past. The trend towards the standardization of complete degree programmes, however, did not remain unchallenged. Lifelong education and recurrent education called for an opening up of highly structured programmes. British and Nordic universities in particular addressed those demands more strategically after the late 1960s and the 1970s by facilitating study opportunities for those students starting late, possibly without typical secondary education credentials, who wished to study part time or through distance-learning programmes. Increased standardization had many implications for graduation and the award of a degree. Achievements had to be monitored more carefully. A continuous assessment of study loads and credits somewhat similar to the US system was introduced from the late 1960s to the early 1980s; for ) and Finnish study weeks (opintovikko) example, Swedish points (poang were deemed equivalent to one week of study, irrespective of how much time was spent in classes or on self-study. Dutch universities began to calculate all study programmes in terms of an overall load (studiebelasting). A course programme comprised a total of 6,720 study hours (studie uren), that is, four years of study, in 40-hour weeks in 42-week terms. Some countries distinguished stages of study, as had been traditionally the case in France. From the 1960s partially and from the 1980s onwards, in all elds, for example, universities in the Federal Republic of Germany conducted major interim assessment of student progress after about two years (Vor-Diplom or similar). On graduation the student received a certicate testifying to the qualication and also, usually, a title. The certifying document might incorporate general information about the awarding institution, the institution providing the course programme, the title conferred, the level of institution and of degree programme, the legal basis of the course programme and the degree, the eld of study, and the typical duration of the programme. It also provided information about the person awarded the 336

Graduation and careers degree (name and possibly other biographical data), details of his or her studies, competence and achievements, the areas of specialization chosen, the prior examinations passed, the title of the thesis, and the grades achieved.47 Usually, the designation of the degree and the title were identical, for example the Magister in Austria, or the kandidat in Denmark or similarly in most other Nordic countries. Elsewhere they might differ. Holders of the laurea conferred by Italian universities were called dottore or dottoressa. Awards upon completion of study programmes might differ according to discipline, type of competence and professional area. For example, the Magister in the Federal Republic of Germany, mostly conferred in the humanities, underlined the academic and general nature of the course programme; the Diplom, mostly awarded in science, engineering and social sciences, indicated some basic professional competence; and the Staatsexamen was the rst professional qualication for the civil service or other publicly supervised professions. In many European countries, specic titles were awarded for those graduating in engineering for example ingenieur (ir.) in the Netherlands in Sweden or in other elds emphasizing professional and ingenjor preparation for example meester in de rechten (mr.) in the Netherlands or agronom in Sweden. In Switzerland, titles differed according to their institutional, regional or national standardization or recognition: the Dipl. Chem.-Ing. ETH is a graduate of the Eidgenossische Technische Hochschule Zurich, while the architecte diplom e EPFL is a graduate of the Ecole polytechnique f ed erale de Lausanne. Barristers are awarded the professional qualication of a Fursprecher , Fursprech , Anwalt, Rechtsanwalt or similar. As a rule institutions of higher education had the responsibility of certifying successful completion of studies. There were, however, exceptions: 1. In the United Kingdom, universities were granted the right to award degrees through a royal charter. Other colleges traditionally had to cooperate with universities to entitle their students to obtain an external degree. When polytechnics were established in the late 1960s, the Council for National Academic Awards (CNAA) was founded for the purpose of granting degrees and other awards in the non-university sector and for examining curricula. Similarly, Ireland established a National Council for Educational Awards (NCEA).
47

Cf. U. Teichler, The Informational Value of Higher Education Diplomas and the Information Needed to Understand them, Higher Education in Europe, 11:4 (1986), 1019; C. Berg and U. Teichler, Unveiling the Hidden Information in Credentials, Higher Education in Europe, 13:3 (1988), 1324.

337

Ulrich Teichler 2. In the Federal Republic of Germany, students completing a eld of study usually leading to a government-supervised profession notably in medical elds, law and teacher training did not receive a university degree. Rather, they passed a state examination conducted jointly by university professors and state examiners. 3. In the United Kingdom, the Republic of Ireland and some other countries, some professional bodies or other external institutions, for example churches, have the right to grant degrees. 4. In the planned economies, academies had the right to confer academic degrees, that is, the doctorate, as well as the advanced academic degree (or similar). 5. Since the 1970s, some institutions of higher education have cooperated with partner institutions in other countries to award a double degree, that is, a degree both of the home institution and of the partner institution abroad. Four interrelated factors contributed to a reconsideration of the structure of graduation and degrees in Europe from the 1950s to the 1980s: the establishment and expansion of non-university higher education, the concern in some European countries about the length of studies, attention to the growing professional relevance of curricula, and efforts to promote the international academic mobility of students and doctoral candidates. Most non-university institutions of higher education, newly emerging or established through upgrading, provided programmes lasting between one and four years and awarded degrees generally regarded as lower in academic standing than those awarded by universities.48 There were exceptions, however: British and Irish institutions might also award bachelors and masters degrees, and the Norwegian distrikt hogskoler could award a rst university degree as well. The degree programmes of the coles in France were generally viewed as more demanding than grandes e those at French universities. Concern about the long duration of studies along with debates about the international equivalences of degrees led to the introduction in the late 1980s of a bachelors degree in Denmark awarded after the completion of three years of study, irrespective of whether the programme was intended to last three years. Also, various European countries set up short post-degree programmes with a wide range of credentials.
48

See the overviews in OECD, Short-Cycle (note 22); R. A. de Moor (ed.), Changing Tertiary Education in Modern European Society (Strasbourg, 1978); G. Vedel (ed.), Reform and Development of Tertiary (Post-Secondary) Education in Southern Europe (Strasbourg, 1981); Teichler, Convergence (note 9), 11030; C. Gellert (ed.), Higher Education in Europe (London, 1993).

338

Graduation and careers International or supranational organizations were involved in easing the transfer of degree qualications and stimulating boundary-crossing mobility, notably through the Joint Study Programmes promoted from 1976 to 1986 and the Erasmus programme inaugurated in 1987.49 The Council of Europe adopted conventions on the equivalence of qualications for admission to higher education (1953), on the equivalence of periods of university study (1958) and on the academic recognition of university qualications (1959),50 and in 1972 in Prague ten governments with planned economies signed a convention on the validation and mutual equivalence of secondary and specialized secondary-schoolleaving certicates and of higher-education diplomas. In 1979 UNESCO went on to adopt a convention on the recognition of studies, diplomas and degrees.51 Within the framework of the European Community, the European Council adopted directives on academic recognition for professional purposes in a limited number of elds (medicine, 1975; veterinary medicine, 1978; architecture, 1985; pharmacy, 1978); in 1988, it adopted a directive according to which graduates who had successfully completed three years of study at an institution of higher education in the European Community were, in principle, entitled to be professionally active in any other country of the Community.52 The diplomas that emerged in Europe may be classied into nine categories: 1. semi-terminal diplomas, such as the Diplome d etudes universitaires g en erales (DEUG) in France after two years of study; 2. terminal diplomas awarded upon completion of courses shorter than rst degree courses, such as a Diplome universitaire de technologie (DUT) in France; 3. rst university degrees based on a relatively short course programme, such as a licence in France, a bachelors in England and Wales and in Ireland, and a cand.mag. in Norway, or degrees awarded upon completion of a relatively long course programme at non-university institutions, for example a Diplom supplemented by a bracketed (FH)
49

50

51

52

See F. Dalichow, Academic Recognition in the European Community, European Journal of Education, 22 (1987), 3958; J. Preston (ed.), EC Training, Education and Research Programmes: An Action Guide (London, 1991). Cf. Council of Europe, Report on Mutual Recognition of Degrees and Diplomas in Post-Secondary Education (Strasbourg, 1975). Cf. chapter 3. See International Recognition of Studies and Degrees: Challenges and Perspectives, Higher Education in Europe, 13:3 (1988), 566. Cf. chapter 3. See Commission des Communaut es Europ eennes, La reconnaissance mutuelle des diplomes et des qualications professionnelles (Brussels, 1980); G. Neave, The EEC and Education (Stoke-on-Trent, 1984); Bundesministerium fur Bildung und Wissenschaft, Akademische Berufe im EG-Binnenmarkt (Bonn, 1992). Cf. chapter 3.

339

Ulrich Teichler awarded by German Fachhochschulen, or a baccalaureus (abbreviated bc. or B.) conferred after the late 1980s by Dutch Hogescholen, formerly called hoger boroepsonderwijs (HBO); rst university degrees based on a course programme requiring at least four years of study, for example a Magister in Austria, a kandidaatti in Finland or a laurea in Italy; advanced university degrees in countries where the rst university degree was awarded after a relatively short period, for example a ma trise in France. This degree tended to be considered equivalent to a rst university degree based on a relatively long course programme; supplementary or add-on diplomas certifying a short academic or professional qualication based on studies undertaken after the award of a rst academic degree, for example a Postgraduate Certicate in Education (PGCE) in the United Kingdom, or a Diplom or Zertikat after a short Aufbaustudium or Weiterbildungsstudium in Germany; advanced university degrees following some years after the completion of a degree based on a relatively long degree programme, notably the licentiate degree in some Nordic countries; the academic degree of a doctor or similar; an advanced academic degree, for example a Habilitation or a doctor . scientiae, dottorato di ricerca, doctorat dEtat

4.

5.

6.

7.

8. 9.

National and international debates about the value of credentials conferred upon completion of programmes in higher education eventually led to a widespread agreement, according to which the duration of study was the single most important indicator of achievement. By the 1990s, most experts distinguished four levels, namely, 1. 2. 3. 4. diplomas beyond the level of a rst university degree; degrees equivalent to a bachelors; degrees equivalent to a masters; doctoral awards.

Yet there was no complete standardization of the length of courses between or within countries, and while, for example, most British students tended to complete their studies in the required period, students in Spain, Finland, Italy, Germany, France, Austria and possibly some other countries prolonged their studies on average by more than 50 per cent beyond the ofcially sanctioned period.53
53

zur Diskussion See U. Teichler and W. Steube, Studiendauer und Lebensalter: Beitrage aus sieben ausgewahlten Landern , Bildung und Wissenschaft international, 1/89 (Bonn, 1989); R. Ciucci, Students in 1984: A Part-Time Activity along with Other Jobs? Illustrations from Italy, European Journal of Education, 19 (1984), 299308; P. Ma at a

340

Graduation and careers Thus, the continuing debates on the need for clarication of the value of academic credentials and the establishment of international equivalences had not led until the early 1990s to a consistent system of diplomas and titles in Europe, and it was left entirely to public or private employers to judge whether or not they considered a degree as a prerequisite for certain positions. An individual might undertake certain professional activities independently, whether or not he or she had been awarded a degree, and governments might explicitly look for qualities beyond degrees, holding public qualifying examinations for entry to subsequent training or professional practice. Graduates wishing to transfer to teacher training underwent such concours in France; and the German Staatsexamen led to a period of professional internship and a second examination before those who passed it were considered to be qualied and perhaps awarded a title.54 In some countries, nally, professional bodies continued to exert power in determining access to a profession.55 For example, some professions in engineering and business in the United Kingdom and Ireland required both the successful passing of a theoretical examination and positive assessment following an extended practical phase, supervised by a licensed professional, as a prerequisite for professional licensing. They might even require examinations in addition to those leading up to the degree.

graduate employment and work Before concern grew in the 1970s about graduate employment, regular statistics about the transition from higher education to employment were scarce.56 After the 1970s, however, the number of regular annual or biennial surveys of graduate employment increased substantially. During the later period, when the transition from education to employment
and S. Valkonen, Study Careers and Productivity, in P. Hakkarainen, H. Jalkanen and P. Ma at a (eds.), Current Visions and Analyses on Finnish Higher Education System (Jyvaskyl a, 1992), 12135; R. J. Bijleveld, Programme Length and Duration of Studies in German and Dutch University Education: A Comparative Analysis, in Stifterverband fur (Essen, 1991), 83107. die deutsche Wissenschaft (ed.), Studienzeitverkurzung See C. Handle, Lehrerausbildung (Organisation), in L. Huber (ed.), Enzyklopadie Erziehungswissenschaft, Vol. X (Stuttgart, 1983), 62332; U. Branahl, Rechtswissenschaft (Studium), in ibid., 68592. See S. Goodlad (ed.), Education for the Professions: Quis custodiet . . . ? (Guildford, 1984). See E. Esnault and J. Le Pas, New Relations between Post-Secondary Education and Employment, in OECD (ed.), Towards Mass Higher Education: Issues and Dilem mas (Paris, 1974), 10569; M. Tessaring and H. Werner, Beschaftigungsprobleme von Hochschulabsolventen im internationalen Vergleich (Gottingen, 1975).

54

55

56

341

Ulrich Teichler became a protracted process, graduates required reliable information about employment opportunities and undertook sustained searches before taking a job. The increase in elaborate searches can be demonstrated in Austria: among the 1975/76 university graduates looking for a job in the private sector or public organizations, 16% applied to ten or more institutions. Ten years later, the gure was 34%.57 The increasing length of the search period can also be shown in Austria: the proportion of university graduates who waited for employment after graduation was 50% in 1975/76, declined to 40% in 1978/79 in the wake of a modest economic recovery, and eventually increased to 79% in 1985/86. The curve of those waiting more than six months 9%, 6% and 24% shows even more clearly this change over time. (The number of those stating that they waited voluntarily surpassed that of those waiting involuntarily.58 ) In Switzerland, by contrast, the proportion of those waiting more than three months to start employment remained more or less constant through the 1980s at somewhat more than 20%,59 and among Swedish graduates in 19845 only 4% of those with jobs a year later had waited more than four months for employment.60 In several countries, unemployment of recent graduates increased, although not continually. For example, the proportion of British university graduates unemployed six months after graduation increased from 2% of the 1965/67 graduate cohort to 8% of those completing study in 1972/73 and eventually to 16% of those graduating in 1980/81, but thereafter declined to 9% among the 1986/87 cohort.61 Similarly, in the Netherlands, the ratio of the number of unemployed recent university graduates in May of a given year as compared to the number of graduates of the previous year increased dramatically from 17% in 1980 to 49% in 1985; thereafter, it declined moderately to 36% in 1989.62 For graduates in some small European countries, working abroad might be a way of overcoming the problems of the local labour market. For example, when the overall unemployment in Ireland increased during the 1980s, the proportion of unemployed among graduates from institutions of higher education increased initially from 14% in 1981 to 22% in 1983, but
57 58

59

60 61

62

S. Loudon, Zum Berufseinstieg von Akademikern/innen (Vienna, 1988), 21. L. Lassnigg, S. Loudon and H. Spreitzer, Austria: Developments in Higher Education and the Changing Transition to the Labour Market, in OECD (ed.), From Higher Education to Employment, Vol. I (Paris, 1992), 113. T. Ogay, Suisse, in OECD, Employment, Vol. IV (note 58), 191; see also B. Morgenthaler, Die Beschaftigungssituation der Neuabsolventen der schweizer Hochschulen 1985, Wissenschaftspolitik (Beiheft), 34 (1986), 55. Statistika centralbyran, Hogskolan 1984/85: Elevuppfoljingar 1985 (Orebro, 1986), 20. M. Bee and P. Dolton, Patterns of Change in U.K. Graduate Unemployment, 196287, Higher Education, 28 (1990), 27. I. M. T. Coppens, The Netherlands, in OECD, Employment, Vol. III (note 58), 340.

342

Graduation and careers declined afterwards to 7% in 1989; meanwhile emigration to nd work abroad increased from 8% in 1981 to 29% in 1989.63 Fixed-term contracts became more frequent. For example, the proportion of such contracts among rst jobs of Austrian graduates doubled within a decade, from 21% in 1975/76 to 42% in 1985/86.64 In the Federal Republic of Germany, more than one-third of recently employed university graduates in the early 1980s had xed-term contracts, among them half of those employed in the public sector and one-tenth of those in the private sector. In the late 1980s, more than two-thirds of recent university graduates had xed-term contracts, among them more than 90% in the public sector and almost half in the private sector.65 It was frequently said that employment problems led graduates to continue study beyond graduation both as a possible shelter from unemployment and in order to increase their level of qualication. Yet this does not turn out to be a general phenomenon in Europe. In Austria, indeed, the proportion of 1985/86 graduates continuing study was 10% higher (42% as compared to 32%) than among their predecessors ten years earlier.66 In Germany, however, the proportion of students enrolled who had already obtained a degree remained constant at a level of 1213% from 1973 to 1991.67 In general, surveys suggested that students became accustomed to the growing complexity of the transition process. For example, the proportion of Swiss university graduates who reported having faced employment problems when surveyed one year after graduation declined from 47% in 1985 to 28% in 1989.68 By then new employment opportunities for graduates had emerged as a consequence of rapid structural change of the economy and the labour market. 1. In France, employment in the agricultural sector declined from 30% in 1949 to 6% in 1990, in industry it declined moderately, after a temporary increase, from 33% to 29%, and in the services it increased from 37% to 65%.
63

64 65

66

67

68

G. Hughes and P. J. OConnell, Higher Education and the Labour Market in Ireland, 19811991, European Journal of Education, 30:1 (1995), 7980. Lassnigg, Loudon and Spreitzer, Austria (note 58), 134. K.-H. Minks and R. Reissert, Studium, Ubergang und Berufseintritt unter veranderten Arbeitsmarktbedingungen (Hannover, 1984); K.-H. Minks and R. Nigmann, Hochschulabsolventen zwischen Studium und Beruf (Hannover, 1991). Loudon, Berufseinstieg (note 57), 30 (the percentage does not include graduates only formally enrolled). Bundesminister fur Bildung und Wissenschaft, Grund- und Strukturdaten 1993/94 (Bonn, 1993), 1545. Ogay, Suisse (note 59), 188.

343

Ulrich Teichler 2. In the Federal Republic of Germany, employment in the rst sector decreased similarly from 22% in 1950 to 4% in 1990, the industrial sector followed a similar curve on a higher level from 45% to 39%, and employment in the third sector increased from 33% to 57%. 3. Industrialization took place somewhat later in Italy. The respective gures were 44% in 1951 and 9% in 1990 for agriculture, 30% and 32% for industry, and nally 27% and 60% for the service sector. 4. In the United Kingdom, the agricultural sector had declined just after the war and decreased further, from 5% in 1951 to 2% in 1990. Employment in the industrial sector decreased more rapidly than in the other countries referred to (from 47% to 29%), while the service sector was exceptionally high initially (48%) and grew further (to 69%).69 Altogether, sectorial changes provided growing employment opportunities for graduates, and the proportion as well as the absolute number of graduates among persons active in the respective sectors increased as well. For example, the quota of university-trained persons in industry in the Federal Republic of Germany increased, according to census and micro-census data, from about 1% in 1961 to 2% in 1970 and 1980. The number of persons trained in a university or Fachhochschule increased from 3.3% in 1976 to 5.7% in 1987. The respective proportions in banking and in the insurance sector grew only from 2.7% to 3.0% and 3.4% and from 4.4% to 7.7% respectively. In government and social-security occupations, the quota of university-trained persons was 5.7% in 1961, declined slightly to 5.0% in 1970 and grew to 7.7% in 1980; the proportion of graduates of universities and Fachhochschule-trained persons increased from 9.7% in 1976 to 15.4% in 1987.70 The available data suggest that in the 1970s and 1980s graduates were absorbed into the labour market primarily through an increase in the proportion of graduates within the individual sectors. For example, in Norway the proportion of graduates in the primary and secondary sectors increased from 5% in 1975 to 11% in 1989, and in commerce and communication from 7% to 12%. It also increased in sectors traditionally accommodating larger proportions of college-trained persons: in nance and business services from 23% to 41% and in public administration from
69

70

OECD, The OECD Jobs Study: Evidence and Explanations, Part I: Labour Market Trends and Underlying Force of Change (Paris, 1994), 5. See K. Parmentier and M. Tessaring, Bildungswesen und Arbeitsmarkt fur Hochquali zierte: Eine Ubersicht, in Arbeitsgruppen, Bedarfsprognostische Forschung (note 33), 257; U. Teichler and B. C. Sanyal, Higher Education and the Labour Market, in Avakov et al., Higher Education (note 38), 105; D. Hartung and B. Krais, Studium und Beruf, in U. Teichler (ed.), Das Hochschulwesen in der Bundesrepublik Deutschland (Weinheim, 1990), 195.

344

Graduation and careers 26% to 37%. Similarly, the proportion of university-trained persons in Swedish industry grew from 2% in 1971 to 6% in 1991, in other private sectors from 3% to 9%, in the health system from 5% to 11%, and in public administration from 20% to 35%.71 Politicians and experts paid special attention to the vertical change in graduate employment. Some shift from high-status positions and from the university-trained professions towards qualied middle-level positions had occurred before 1970, and was the more pronounced in European countries in which the growth of student numbers had started relatively early. In France the proportion of persons in the labour force having completed higher education and who were active as employers, professionals and managers declined moderately from 73% in 1954 to 68% in 1968 and eventually to 62% in 1975. By contrast, the proportion of graduates employed as middle-level executives increased from 16% to 21% and 26% during the same period. Yet there was no substantial change in the proportion of degree-holders employed in occupations in which graduate employment tended to be exceptional; it remained at around 1112%.72 Changes in positions and tasks can be measured objectively in terms of occupational categories. For example, of the graduates from the second cycle of French higher-education institutions in 1975, 15% were employed three years later in intermediate occupations and 2% in lower positions (employ es and ouvriers et divers); the shares increased to 19% and 4% for 1984 graduates three years later.73 In other European countries fewer than 10% of persons having completed higher education were employed during the 1970s and 1980s in categories for which a higher degree typically was not required, and up to 20% were employed in categories that might be called middle-level occupations, such as technicians, sales and ofce workers. While some experts thought that these positions did not require a degree, others argued that self-rating judgments were more valid in such cases than objective occupational classication schemes. The same held true for functional classications within companies. In a debate among experts in the early 1990s in Germany, some claimed that about one-fth of university graduates had positions and work tasks clearly below any appropriate level,74 while others pointed out that not all Sachbearbeiter could be viewed as employed inappropriately (see table 9.4).
71 72

73 74

See OECD, Synthesis Report (note 10), 98. V. Vincens, Postgraduate Education and Employment: The French Case, European Journal of Education, 16 (1981), 345. A. Charlot and F. Pottier, France, in OECD, Employment, vol. III (note 58), 118. Akademiker-Beschaftigung: Ein Funftel unter Niveau, iwd (Informationsdienst des Instituts der deutschen Wirtschaft), 10 (1994), 30.

345

Ulrich Teichler Table 9.4 Professional function of university-trained persons in the Federal Republic of Germany 1989 by age and gender (percentages)
Total (a) All Self-employed Leading positions Qualied specialists Sachbearbeiter Workers, low-level employees No answer Total (b) Men Self-employed Leading positions Qualied specialists Sachbearbeiter Workers, low-level employees No answer Total (c) Women Self-employed Leading positions Qualied specialists Sachbearbeiter Workers, low-level employees No answer Total 15.5 20.7 47.0 6.5 9.3 1.0 100 18.0 26.7 42.3 5.0 6.7 1.3 100 10.5 8.6 56.6 9.6 14.7 100 below 35 years 8.3 13.7 50.6 11.3 14.1 2.0 100 8.7 17.5 50.1 9.4 10.9 3.4 100 7.7 8.3 51.2 14.1 18.7 100 3544 years 16.6 20.5 49.3 4.9 8.3 0.4 100 19.4 26.8 44.2 4.0 5.1 0.6 100 11.4 8.2 59.1 6.7 14.6 100 45 and older 20.7 27.1 41.7 4.0 6.3 0.3 100 23.1 32.8 35.4 2.9 5.5 0.4 100 13.4 9.7 60.8 7.2 8.8 100

Source: H. Plicht, K. Schober and F. Schreyer, Zur Ausbildungsadaquanz der Beschaftigung von Hochschulabsolventinnen und -absolventen, Mitteilungen aus der Arbeitsmarkt- und Berufsforschung, 27 (1994), 1978.

Another way of looking at the links between educational attainment and occupations is to analyse the increasing proportion of degree-holders within individual occupations. (If a degree was already required for professional practice before the process of expansion of higher education, changes of this kind cannot be expected by denition.) In Sweden, more or less all medical doctors, dentists, nurses, psychologists, lawyers and teachers professionally active in 1970 had been trained in higher education. The most obvious upgrading took place from 1970 to 1985, when the proportion of college-trained persons aged 3039 years in the overall labour force almost doubled (from 12% to 22%), among professionals. The gure broke down as follows: in electrical engineering and telecommunications, 12%/38%; architecture, civil engineering and mechanical 346

Graduation and careers Table 9.5 Ratio of earnings of university-trained persons as compared to persons having completed upper secondary education
Early 1970s (a) Men Denmark France Norway Sweden United Kingdom (b) Women Denmark France Norway Sweden 1.88 1.44 1.52 1.67 1.44 Late 1970s 2.38 1.32 2.02 Early 1980s 1.39 1.35 1.22 1.33 1.19 1.22 Middle/late 1980s 1.42 2.42 1.25 1.30 1.47 1.27 2.13 1.26 1.30 Early 1990s 1.31 1.26 1.36 1.53 1.21 1.26 1.36

Source: Selected from OECD, The OECD Job Study: Evidence on Explanations. Part II: The Adjustment Potential of the Labour Market (Paris 1994), 1601.

engineering, 14%/37%; among social welfare workers, 47%/69%; journalists, 28%/49%; system analysts and programmers, 35%/56%; preschool teachers, 71%/91%; company managers, controllers, 20%/39%; and personnel ofcers, 29%/47%.75 Available statistics on earnings of all university-trained persons in comparison to earnings of those without a degree (see table 9.5) do not suggest any consistent trend in Europe towards a decline of income differentials. Three overlapping phenomena were relevant: unemployment of graduates changed over time in accordance with the general change of unemployment; women were more likely to be unemployed than men; and graduates in almost all Western European countries faced lower risks of unemployment than persons not holding a degree. However, during the 1970s advantages of higher education in terms of a lower unemployment ratio declined in Germany and the Netherlands, while they increased in France and Italy. It is a widely shared view that after the 1970s the number of graduates surpassed substantially the number of positions for which a degree was demanded. As measurements based on occupational categories did not turn out to be valid indicators for middle-level occupations, most graduate surveys addressed the issue of suitable employment by means of
75

S. Forneng and D. Anderson, Sweden, in OECD, Employment, vol. IV (note 58), 155. One should bear in mind that some semi-professional training provisions in Sweden had partly remained in upper-secondary schools until the early 1990s.

347

Ulrich Teichler graduates self-ratings. The questions raised varied markedly, and since surveys were not regularly repeated in a similar way, change over time could hardly be analysed. The variety of questions posed, however, provides interesting insights into the diversity of underlying conceptions. Asked to state whether the training they had received in higher education had been suited to their present work, 70% of Swedish 1984 graduates employed about one year later responded that it was completely suitable, 24% conceived it as partially suitable, and 5% replied that their education did not t their work assignment at all.76 Similarly, 3% of German graduates from select elds of study stated two years after graduation in the mid-1980s that their employment did not correspond at all to their education, and a further 11% noted little correspondence.77 As few as 7% of recent Swiss graduates surveyed in 1985 reported that they held positions previously held by non-graduates.78 Other surveys asked graduates to state the level of education they considered appropriate for their successors. Accordingly, 33% of Polish graduates surveyed in 1979 one year after graduation said that nondegree-holders could do their jobs.79 By comparison, about half as many (17%) of the German graduates stated two years after graduation that the most suitable education for their jobs would have been lower than that required for a degree from an institution of higher education. The comparative data conrmed the widely held view that underemployment was a relatively frequent phenomenon in planned economies. In the German survey, 18% considered their position as inappropriate for a degree-holder, two-thirds of whom stated that they had chosen such a position voluntarily, and 19% reported that they could hardly make use of the capabilities and knowledge they had acquired in their course of university study.80 Surveys undertaken in other countries suggested that up to 20% of the graduates did not consider that their job required a degree. If wider responses are considered, the proportion of graduates who could be characterized as inappropriately employed varies dramatically. Thus, in a study undertaken in 1982, recent graduates from select elds of study in Italian and French universities were asked two questions: Does your current job correspond to your university training? and Do you know of people without degrees who do the same job as yourself? Those
76 77

78 79

80

Statistika centralbyran, Hogskolan (note 60), 9, 28. U. Teichler, Zum Zusammenhang von Studium und Beruf in der Einschatzung der Absolventen, in U. Teichler and H. Winkler (eds.), Der Berufsstart von Hochschulabsolventen (Bad Honnef, 1990), 154. Morgenthaler, Die Beschaftigungssituation (note 59), 75. A. Buttler, Probleme von Hochschulabsolventen im ersten Jahr der Berufstatigkeit, in J. Kluczynski, A. Neusel and U. Teichler (eds.), Forschung zu Hochschule und Beruf in Polen und in der Bundesrepublik Deutschland (Kassel, 1984), 1789. Teichler, Zusammenhang (note 77), 153.

348

Graduation and careers not responding afrmatively to the rst question but responding afrmatively to the second question were categorized as under-utilized, and respondents who did not know persons without degrees in the workforce, but who considered their job as not corresponding to their own university training, were categorized as partially utilized. The researchers came to the conclusion that 34% of recent graduates in both countries were under-utilized, and 8% of the Italian and 22% of the French graduates only partially utilized.81 The majority of German graduates traced a link between their status and the substantive quality of their education. Few graduate jobs were well remunerated that did not require competence fostered through study. On the other hand, demanding tasks might be shouldered that did not pay well. Some graduates opted for a junior position in a university or a research institute, thereby balancing xed-term employment and the risk of having to leave it at a stage of their lives when their fellow graduates were professionally well established. Some graduates pursued socio-political aims and opted for tasks they considered relevant, even if the material rewards left much to be desired. Many graduate surveys referred only to a potential discrepancy between a high level of competence and a moderately demanding job. By denition, they excluded the reverse relationship. One survey, however, measured possible under-qualication as well. In 1979 university-trained economists in Poland were asked to state whether higher education was necessary for taking over their jobs, and to what extent they used the knowledge they had acquired during their course of study. The authors concluded that the placing of the economists had provided a good match for 35% (28% of women and 42% of men), a surplus of qualications for 18% (15%/22%), a lack of qualications for 12% (16%/8%), a partial match for 13% (16%/8%), a waste of qualications for 12% (14%/9%), a loss of qualications for 7% (8%/5%), and a bad match for 3% (3%/5%).82 A similar result came from an employers survey conducted in the Federal Republic of Germany in the late 1970s: the distinction between suitable jobs and jobs not viewed as suitable was most clearly drawn in professional areas shaped by pronounced hierarchies of status and tasks, while this distinction was blurred in many areas of industry and private services. There were distinct cultures in the various disciplines and occupations with respect to the perception of a desirable career and desirable work tasks. Certainly a lowering of expectations was not the
81

82

J.-P. Jarousse and F. de Francesco, Lenseignement sup erieur contre le chomage (Paris, 1984), 108, 227. J. Kluczynski and B. C. Sanyal, Education and Work in Poland (Warsaw, 1985), 144.

349

Ulrich Teichler only response: some graduates were disappointed, some placed value on the interesting dimensions of their work, while still others concluded that there was a need for complex knowledge in certain middle-level occupations and were active in re-shaping their jobs. Reactions varied in part according to graduates initial eld of study and its relationship to their subsequent occupation. This may be exemplied from Finnish statistics assembled in 1985, at a time when the proportion of university-trained persons in the labour force in Finland was almost 10%. No fewer than 66% of graduates from the humanities were employed as schoolteachers, and the remaining 34% were spread over a wide range of cultural professions, public services and private services. Graduates from the social sciences were most widely dispersed, with 16% in private management, 14% in public administration, 11% in nancial, statistical etc. research and planning, 9% in social work and 11% in junior clerical or manual jobs; 67% of graduates from psychology were professional psychologists and 9% teachers; 35% of those trained in economic elds were in managerial careers in the private sector, 11% were teachers and 15% in junior clerical and manual positions; 52% of graduates from law worked in legal professions and the judicial system, 16% in higher careers of public administration and 13% in the higher ranks of the private sector; 37% of science graduates were schoolteachers and about onethird scientic professionals in the private sector. Finally, about half of the university-trained engineers were classied as respective professionals engineers (42%) or architects (75%) while 21% of them held managerial posts in enterprises and other non-public organizations.83 It was widely assumed that recent graduates would become more exible in their occupational choices, but available data did not consistently conrm this view. There was a substantial increase of British university arts graduates taking up positions in the commercial sector, from 4% on average in the graduation years 1961/62 to 1973/74, to 11% on average in the graduation years 1974/75 to 1986/87.84 By contrast, in Switzerland the proportion of graduates employed in universities (23% both in 1981 and 1989), the legal system (9% in both) and industry (14%/15%) remained more or less constant, and graduates from the humanities who did not move into the school system, their earlier principal area of employment (down from 60% to 40%), moved most often to cultural activities (15%/24%) and to private services (4%/10%). Graduates from engineering kept their professional key areas more or less unchanged.85
83

84

See A. Haapakorpi, Academic Graduates in the Finnish Labour Market, in Ministry of Education (ed.), Higher Education and Employment: The Changing Relationship (Helsinki, 1990), 7190. 85 Ogay, Suisse (note 59), 198202. Bee and Dolton, Patterns (note 61), 36.

350

Graduation and careers Over the years in Europe as a whole, students selection of elds of study changed to a limited extent in recognition of the widening span of employment opportunities. Some experts interpreted this as a sign of growing vocationalism on the part of the students. On the contrary, however, evidence suggests that a considerable proportion of students retained their intrinsic interest in the areas that they had initially chosen. Moreover, structural changes in graduate employment during the 1970s and 1980s were not so dramatic that the majority of students were forced to dissociate intrinsic and extrinsic motives. Conventional wisdom about what was happening during the 1970s and 1980s may be misleading. It was not only graduates from the humanities and from some of the social sciences who experienced above-average or serious employment problems in many European countries. Graduates from the natural sciences in some countries faced considerable employment problems as well. For example, among recent graduates from British universities, those graduating in the biological sciences, which had greatly expanded in universities, frequently faced unemployment, while those graduating in civil engineering and business studies were close to average.86 The clearest link between university study and professional work in post-war Europe was in medical education. Medical doctors were required to have completed a designated qualication, and places in medical school were controlled in most countries partly reecting professional pressures and partly the high costs of educational provision. Most places were provided by medical faculties in universities, but sometimes by separate medical universities, usually demanding six years of study. Intertwined practical training took place in hospitals that in some countries were an integral part of the universities and in others separate entities. The institutional basis of paramedical training was upgraded in a number of countries, but it remained heterogeneous. In 1990 it was provided by universities in some countries, in others by the non-university sector, and in still others partly or completely by vocational schools outside the higher-education sector. In most European countries, public service drew a clear distinction between educational credentials and career paths. A university degree in Germany, France and some Southern European countries, a law degree tended to be the prerequisite for high-level civil service careers. Entry to the legal professions likewise required a degree. In the United Kingdom, Ireland and a few other countries, experienced administrators without designated university study might qualify through shorter courses and examinations, while in other countries university study had
86

Bee and Dolton, Patterns (note 61), 2731.

351

Ulrich Teichler to be completed. If the number of law graduates increased beyond the presumed demand, many of them might opt for a legal career, fewer clients and a reduced income.87 Teacher training for academic secondary schools during the 1950s and 1960s involved university study accompanied by parallel professional training or, following university, in a one-year teacher-training programme. Training for elementary school teachers and possibly for those teaching non-academic types of secondary education was traditionally provided in most European countries by colleges, with shorter course programmes than those customary in universities. Over the years, teachertraining colleges were upgraded in a number of countries to the university sector; some countries required a regular university degree for elementary school teachers. By the 1990s, in all European countries a degree from an institution of higher education was a prerequisite for a public-school teaching position, and also pre-school teachers in many countries were being trained in universities or other institutions of higher education. The teaching profession was strongly affected by the job market. When, despite the increase in the number of students in the humanities and in teacher training during the 1960s and early 1970s, the number of teaching positions did not grow in parallel, and when the need for replenishment dropped as a result of the preceding expansion, a serious mismatch surfaced. Throughout the 1980s, the proportion of students in teacher training declined in response to the disparity between the number of teaching positions and the supply of graduates. Theology disappeared as a relevant category in most descriptions of higher education and graduate employment after the Second World War. Theology students now tended to be counted as a statistical sub-category of the humanities, with which theology was merged in many institutions. Courses were offered in humanities departments as well as in theological faculties or in separate theological seminaries. As a rule, professional control of study and of professional work continued to be high: the various churches supervised curricula, appointments of academic staff and initial professional training. Students in science elds might go on to research and development laboratories in industry, to universities and research institutes, or become schoolteachers. Their career patterns were distinct from those of laboratory technicians trained in short-cycle programmes in higher education in some countries or in higher vocational schools in others. In many countries, a transfer of scientists to managerial posts after some years of laboratory assignment happened frequently in private industry.
87

See C. Hommerich, Die Anwaltschaft unter Expansionsdruck, Anwalts Blatt, 5, Beilage (1988), 135.

352

Graduation and careers University-level training of engineers took place in the majority of European countries in specialized institutions (Technische Hochschulen, politecnica, etc.). In other countries, they were placed in multidisciplinary universities. The number of types and ranks varied across Europe. In many countries there was a hierarchy, with university-level engineers at the top, engineers trained in non-university institutions, in specic course programmes or in higher vocational schools came second, and technicians trained in advanced vocational schools or upgraded from manual workers came last. Promotion practices differed. Overlaps in different career paths were less common than in the administrative and trading sectors of private industry and services, but more common than in scientic research and development. The administrative, trade and service activities in industry and the public sector were least regulated by law, professional control and established routines. This sector, however, changed most strikingly after the Second World War. The range of managerial careers for which graduates tended to be recruited spread. Only in a few European countries and then only in a few elds did professions emerge that aimed to control qualications and standards of professional practice. Recruitment of scientists and engineers into managerial positions, a practice most pronounced in the planned economies, occurred to various degrees in Western Europe.

womens employment and work The equalization of womens educational opportunities was one of the most signicant social changes after the Second World War. According to UNESCO statistics, the proportion of women among students at institutions of higher education in 1950 was slightly less than 30% on average across European countries, and while this ratio hardly changed until 1960, it increased thereafter to 37% in 1970 and 43% in 1980, eventually reaching 48% around 1990.88 In this process, the East European and Nordic countries led the way. A similar trend can be identied for the proportion of women among graduates and the ratio of women graduates gainfully employed. The proportion of women among all highereducation trained and professionally active persons in European OECD member states reached about 40% on average in the early 1990s.89
88

89

UNESCO, Access (note 11), 28; UNESCO/CEPES, Statistical Study on Higher Education in Europe 19701975 (Bucharest, 1978), 1920; Nicolae, Smulders and Korka, Statistics (note 13), 53. Calculation based on UNESCO, Statistical Yearbook 1993 (Paris, 1993), 3/2663/273. My estimate based on OECD, OECD Education Statistics 19851992 (note 6), 194, 199.

353

Ulrich Teichler Inequities of career opportunities surfaced notably in two respects. First, womens elds of study were selective. In 1987 only 9% of Austrian graduates in engineering were women, 32% of those in economic elds and 42% in medicine, but they constituted the majority in the humanities and teacher training.90 While only 5% of British female university graduates as compared to 14% of men were awarded a degree in physics, and the respective proportions in engineering (4%/15%) differed similarly, the proportion among women having completed social sciences (15%/8%) and languages (8%/4%) was about twice as high as among men.91 Second, women faced inequities in employment, with a higher proportion in part-time employment with lower incomes, and often discrimination. In the Federal Republic of Germany, university-trained female employees earned only 57%, self-employed women 62% and female civil servants 66% of the income of their male counterparts in the mid-1980s.92

expectations, recruitment and work Whereas ample information is available about changes of graduate employment in terms of occupation, employment status, income and unemployment, analyses of the substance of work and its possible links to education were undertaken only occasionally and differed methodologically. This makes it difcult to draw comparisons within a country over time or between countries at any time. One such survey of students motives and attitudes in ve European countries (Austria, Federal Republic of Germany, the Netherlands, Poland and Yugoslavia) took place in the late 1970s. The students surveyed preferred to choose their eld of study on the basis of interest rather than on career prospects. Aiming at intellectual goals came rst, but a detailed analysis of the evidence showed that academic and career motives were not contradictory for most of the students in the countries included in the survey.93 Surveys of graduates suggested that independent and demanding work, the opportunity to make use of their competence, the effort to realize their ambitions, and a good working environment all came high on their agenda. For German graduates four to ve years after graduation, high income ranked only eighth on a list of twenty-two possible goals and
90 91

92 93

Lassnigg, London and Spreitzer, Austria (note 58), 129. J. Tarsh, Trends in the Graduate Labour Market, Employment Gazette, 93:7 (1985), 125. M. Tessaring, Germany, in OECD, Employment, Vol. I (note 58), 24. B. Dippelhofer-Stiem et al., Students in Europe: Motives for Studying, Expectations of Higher Education and the Relevance of Career Prospects, European Journal of Education, 19 (1984), 30925.

354

Graduation and careers prospects for promotion. However, status expectations had become more important for the graduates at this stage of their life than when surveyed in the last year of study or two years after graduation.94 A substantial proportion of graduates changed jobs to ensure a better match of actual and expected work. Recruitment criteria and employers expectations were surveyed in the early 1980s in a very similar manner in the United Kingdom and in the Federal Republic of Germany.95 Both studies were based on interviews of persons in charge of recruiting graduates and emphasized the great variety of selection criteria across the employing organizations. Firms developed their own styles and strategies of recruitment rather than follow the logic of technology or the economy. Higher education and students were much less pressed to obtain the single best set of curricula and skills for the job market than popular debates suggested. Both studies concluded that employers were less interested in the details of curricula and specic knowledge than academic administrators believed. In some respects UK employers differed from their German counterparts. First, they placed more emphasis on the particular institution graduates came from. Second, a higher proportion of German personnel managers involved in graduate recruitment questioned the validity of grading in higher education. Third, German employers regarded highly the type of knowledge, the specic qualications, and the cognitive skills acquired as a basis for problem solving, whereas British employers were more likely to search for the generally trained mind. A comparative study undertaken in the 1970s analysed qualication and work in selected French and German enterprises similar in size and in their products.96 It concluded that a system (German in this case) that placed strong emphasis on vocational qualication was more likely to develop complex occupational roles for manual workers and for employees of similar ranks and to allocate higher responsibilities on this level.
94

95

96

H. Schomburg, Beruiche Orientierungen und Berufszufriedenheit, in U. Teichler and M. Buttgereit (eds.), Hochschulabsolventen im Beruf: Ergebnisse der dritten Befragung bei Absolventen der Kasseler Verlaufsstudie, Studien zu Bildung und Wissenschaft, 102 (Bad Honnef, 1992), 20742. J. Roizen and M. Jepson, Degrees for Jobs: Employer Expectations of Higher Education (Guildford, 1985); see also M. Kogan, The Expectations of Higher Education Project, in D. Jaques and J. Richardson (eds.), The Future for Higher Education (Guildford, 1985), 99109; U. Teichler, M. Buttgereit and R. Holtkamp, Hochschulzertikate in der betrieblichen Einstellungspraxis (Bad Honnef, 1984); M. Buttgereit, Certicates and Recruitment, in Avakov et al., Higher Education (note 38), 21730. M. Maurice, F. Sellier and J.-J. Silvestre, Politique d education et organisation industrielle en France et en Allemagne (Paris, 1982); B. Lutz, Bildungssystem und Beschaftigungsstruktur in Deutschland und Frankreich, in H.-G. Mendius et al. (eds.), Betrieb Arbeitsmarkt Qualikation, Vol. I (Frankfurt, 1976), 83151; B. Lutz, Education and Employment: Contrasting Evidence from France and the Federal Republic of Germany, European Journal of Education, 16 (1981), 7386.

355

Ulrich Teichler By contrast, a system that placed less emphasis on vocational qualications was more likely to increase the number of supervisory positions and to allocate decisions on a high level in the business hierarchy. Businesses were relatively exible in adjusting work to the supply of qualied entrants.

the responses of universities to changing graduate employment and work Major debates and activities Universities in Europe after the Second World War constantly confronted the problem of responding to the changing careers and work assignments of their graduates. The specic issues changed over time, but the basic themes remained. For example: 1. the extent to which teaching and learning should be inwardly directed towards academic knowledge or outwardly directed towards the expected jobs of the graduates; 2. the extent to which curricula should be structured by discipline; 3. whether the university should focus on the provision of knowledge or, in addition, try to shape the personality of the students; 4. whether professional preparation should be pursued in a general way, thus trusting the transfer of knowledge, the students abilities to apply this knowledge and the subsequent training process, or whether it should be addressed directly; 5. the extent to which a critical and innovative function of the universities should be emphasized. The debates cannot be summarized as quickly as the themes because behind them lay different national philosophies about the educative functions of universities. It was generally assumed that French universities had a more positive view of professional preparation and the value of specialization than universities in many other countries,97 that German universities focused on knowledge and scholarship,98 and that British universities kept in mind more strongly the well-rounded personality.99 Whatever the validity of such assumptions, debate could not leave the institutional patterns (for example, the integration of specialized institutions into the universities and the establishment of non-university institutions of higher
97

98

99

See A. Bienaym e, France, in P. G. Altbach (ed.), Systems of Higher Education: France (New York, 1978), 65770. See L. Huber, Hochschuldidaktik als Theorie der Bildung und Ausbildung, in Huber, Enzyklopadie (note 54), 11820. See G. Squires, The Curriculum beyond School (London, 1987).

356

Graduation and careers education); curricula, teaching and learning; stafng; governance (for example, the involvement of external individuals and outside bodies in university administration and formal and informal communication with professions and employers); and support services (for example, career guidance, placement, co-operation with alumni, etc.). In all countries there were different links between study and career in different disciplines. In the humanities and some social sciences academic values were highly appreciated and regarded as potentially in conict with professional demands. In the natural sciences, academic paradigms prevailed and were predominantly interpreted as in agreement with professional demands. Structural responses A substantial proportion of previously specialized colleges in Europe with a strong emphasis on professional preparation were integrated into multidisciplinary universities, often during the 1960s and 1970s in a context of general expansion, either by merger of existing institutions or by an extension of hitherto specialized colleges. Those structural transformations led to an increase within multidisciplinary universities of the proportion of disciplines closely linked to the application of knowledge and accustomed to caring for the professional preparation of their students. This may have reinforced a professional emphasis in the universities in general, thereby contributing to an academic drift of professionally oriented disciplines that were exposed to an institutional environment in which pride in their academic emphasis prevailed. Obviously cross-fertilization took place. In the majority of European countries higher education was institutionally diversied in the process of growing student enrolment.100 Many countries chose a dual institutional model, with universities on the one hand emphasizing the pursuit of knowledge beyond the visible demands of the employment system and, on the other, institutions of higher education serving professional needs in a more direct manner. The institutional divide was meant to allow for different educational concepts in each sector, but the differences were less than had been intended.101 Nonuniversity institutions showed many signs of academic drift by trying
100

101

Cf. the overviews in OECD, Short-Cycle (note 22); U. Teichler, Changing Patterns of the Higher Education System (London, 1988); G. Neave, Foundation or Roof? The Quantitative, Structural and Institutional Dimension in the Study of Higher Education, European Journal of Education, 24 (1989), 21122; J. P. Jallade, Lenseignement valuation compar sup erieur en Europe: Vers une e ee des premiers cycles (Paris, 1991). See G. Neave, The Dynamics of Integration in Non-Integrated Systems of Higher Education in Western Europe, in Hermanns, Teichler and Wasser, The Compleat University (note 23), 26376; U. Teichler, Structures of Higher Education Systems in Europe, in Gellert, Higher Education (note 48), 2336.

357

Ulrich Teichler to raise their status, pressing, for example, for low teaching loads of academic staff, involvement in research, establishment of relatively long course programmes, and loosening communication ties with the employment system, while universities became more inclined to attend to the future professional tasks of their graduates in their study provisions in some cases implying vocational drift or, indeed, the professionalization of the higher-education sector in general.102 A strong emphasis on specialized knowledge and professional competence reinforced the binary structure, while an emphasis on general preparation and personality development favoured a blurring of the institutional divide. This might explain the fact that British polytechnics were named universities in 1992,103 that German Fachhochschulen have remained relatively stable while concurrently striving for academic components, and that French IUTs have remained clearly distinct from universities. Diversication through the establishment or extension of different types of higher-education institutions with distinct education and training philosophies, therefore, did not necessarily serve effectively as a buffer against professional pressures on the universities. Indeed, it might even be argued that the coexistence of various institutional types exerted stronger pressures on the universities towards a professional orientation than growing student numbers did in countries in which university-type institutions remained the only ofcial higher-education institutions. Most universities in Europe thus did not remain an elite sector, protected from the pressures to prepare a growing number of students for professional work. A third major structural change in the pattern of European universities was their increasing involvement in adult education. This might comprise a broad range of different activities, notably advanced academic study, advanced professional training for graduates, short professional training courses (for updating and extending knowledge), public lectures and other open forms of dissemination of knowledge to adults, regular degree programmes for adults (possibly as part-time and distancelearning arrangements), remedial or second-chance provisions (especially courses leading to entry qualications for regular course programmes), short study provisions (for example, special-status enrolment in regular course programmes and one-semester or one-year study programmes) and in-service training of university staff. In addition, special admission
102

103

See Professionalisation: Recent Trends in European Higher Education, European Journal of Education, 27:12 (special issue) (1992). M. Kogan, The End of the Dual System?, in Gellert, Higher Education (note 48), 4758.

358

Graduation and careers schemes might be introduced for adults who had not completed the necessary secondary school qualications.104 During the 1960s and 1970s, many European countries incorporated adult and lifelong education into higher-education legislation as a core function of universities. Universities differed strikingly, however, in the extent of their involvement in this area.105 There were differences too in organizational structures. At many universities, adult education was administered in separate units and taught predominantly by academic staff exclusively in charge of adult education.106 Curricular responses Curricular reforms, revisions of the structure of study provisions and the substance of what students were expected to learn, might be system led, institution led, resource led, discipline led, academically led, educationally led, profession led or consumer led. In all cases, elements of the future work of graduates might directly enter the development of the curriculum.107 Last but not least, curricula might differ in terms of their deliberate links to professional work, some being closely geared to occupational preparation, others not intentionally related to jobs at all.108 Beginning around 1950, universities in Eastern European countries moved towards a more instrumental approach than the European universities had traditionally pursued. The normative dimension of learning became the focus of compulsory courses in Marxism-Leninism. Course programmes eventually became highly specialized, possibly dividing, for example, physics into half a dozen separate programmes and degrees. An integration of education, research, and productive work was pursued, notably by requiring students to spend about two months every year in productive tasks that might range from harvesting to work closely linked to a future professional occupation.109 From the
104 105

106

107

108

109

OECD (ed.), Adults in Higher Education (Paris, 1987). See R. Sayegh, The Diversication of Post-Secondary Education in Relation to Employment, International Yearbook of Education, 16 (Paris, 1990), chapter 6. See OECD, Recurrent Education: A Strategy for Lifelong Learning (Paris, 1973); see also M. Blaug and J. Mace, Recurrent Education the New Jerusalem, Higher Education 6 (1977), 27799. C. J. Boys et al., Higher Education and the Preparation for Work (London, 1988), 668. See U. Teichler, Higher Education: Curriculum, in Hus en and Postlethwaite, Encyclopedia (note 11), 2199200. See, for example, J. Mericka, Integration of Education, Research and Productive Work of Students in Czechoslovakia, Higher Education in Europe, 4:3 (1979), 710; and the literature named by J. Kluczynski, Research on Higher Education in European Socialist Countries, in P. G. Altbach and D. H. Kelly (eds.), Higher Education in International Perspective: A Survey and Bibliography (London and New York, 1985), 5586.

359

Ulrich Teichler late 1970s onwards, however, efforts were made once more to broaden curricula.110 One of the major claims of the student movement of the late 1960s was that curricula and teaching in universities lacked social relevance. According to the critique then voiced, the ivory tower attitude of the professoriate had led to a neglect of the economic, social and cultural consequences of research and professional work. Universities had lost their critical function and had propped up the prevailing socio-political system.111 In the early 1970s, the growing concern about graduate unemployment fuelled debates about the links between higher education and employment. At the same time, many governments came to the conclusion that their planning approaches had paid insufcient attention to the content of knowledge and its implications for professional competence.112 In summarizing various curricular activities aimed at changing the links between study and professional practice,113 two major directions may be identied. First, changes in areas of study and in the content of courses were undoubtedly the main thrust. For example, the Framework Act for Higher Education enacted in 1976 in the Federal Republic of Germany called for an explicit link between academic learning and professional practice, while in Sweden all curricula were revised nationally in the late 1970s to achieve a professional emphasis to serve various professional sectors: technical occupations, administrative, economic and social professions, health occupations, educational occupations, culture and information occupations.114 Ten years later, in 1987, an academic degree (losophie kandidat, abbreviated l. kand. or F.K.) was reintroduced, thus allowing for the combination of various individual courses. In other countries, the curricular shift was less pronounced but affected many students. New cross-disciplinary course programmes emerged. For example, the study of foreign literature was often combined with social sciences or business studies for degree programmes in business, or new specializations became separate study programmes, such as information science for the health system. During the 1980s, however, the
110 111 112 113

114

Cf. Sayegh, Diversication (note 105), chapter 5. See Student Activism, Higher Education, 8:6 (1979) and 9:2 (1980) (special issues). See Fulton, Gordon and Williams, Higher Education (note 18), 102. See Boys et al., Higher Education (note 107); N. Kluge, A. Neusel and U. Teichler, Beispiele praxisorientierten Studiums (Bonn, 1981); B. Jonsson et al., Kompetensutveckling pa framtidens arbetsmarknad: Huvudrapport (Stockholm, 1991); cf. also A. Jaumotte, The Purpose of University Training, in CRE (ed.), The European University 19751985 (Oxford, 1975), 5161. See Jablonska-Skinder and Teichler, Handbook (note 46), 230.

360

Graduation and careers pendulum swung back again. Professional relevance was considered to be dependent on close substantive links between study and prospective work tasks.115 Second, systematic efforts increased to combine studies with practical work experience, not only in Central and Eastern European countries.116 In most countries, medical studies were enriched by extended internships in hospitals, and teacher training by school visits and teaching internships. There was a wide range of work arrangements, including mandatory work experience arranged by the students themselves, practical schemes co-supervised by a university professor, site visits, or on-campus activities simulating practical problem solving, such as learning in projects. Such systematic incorporation of practical experience into study programmes tended to be more pronounced in the non-university sector than within universities. Dutch hogescholen required all students to spend up to one year of their four-year study programme on the job. British polytechnics called the interchange of study and work phases sandwich programmes. German Fachhochschulen had different regulations according to eld of study and region. In the late 1980s, a general agreement was reached that one year of study should be devoted to practical phases and examinations. By contrast, German universities, though requiring practical experiences in various elds of study, tended to often discount extended practical phases as part of their course programmes, irrespective of whether students arranged them before embarking on their studies or after completing them, or whether they were carried out during vacation periods or as breaks in their academic studies. Opinions vary about the extent to which curricula at universities differed in their professional relevance from those in non-university higher education. In the late 1980s surveys undertaken in the United Kingdom and Germany presented contrasting evidence. British graduates from polytechnics faced more problems in the transition to employment, but a higher proportion of them (32% as compared to 23% of the university graduates) reported ve years after graduation that their work benets a great deal from knowledge and skills gained from their degree course. By contrast, German graduates from both types of higher education experienced similar problems in the transition to employment.
115

116

See, for example, the documentation of the dialogue between the European Roundtable of Industrialists and the European Rectors Conference documented in CRE-action (1990), 92. Note the elaborate schemes at German universities referred to in U. Teichler and H. Winkler, Praxisorientierung des Studiums (Frankfurt and New York, 1979); U. Lindner et al., Higher Education, Industry and Human Resources: The German Experience (Milan, 1992).

361

Ulrich Teichler Other responses Universities may strike a better balance between their different functions if their academic staff members are not only competent in their disciplinary knowledge, but also versatile in its professional use; in this connection outside experience could help. A comparative survey conducted in 1992 showed that on average German university professors had spent about four years, British professors ve years and Swedish professors six years of their professional life outside higher education. The gures for those teaching in non-university institutions of higher education were about twice as high.117 The involvement of part-time teachers was another means of strengthening professional preparation within higher-education institutions. In the Federal Republic of Germany, for example, the number of part-time teachers per ten full-time academic staff increased from three in the early 1970s to four around 1990. Finally, universities might be involved in direct services to help students understand the world of work and transfer easily to the employment system after graduation. During the 1970s and 1980s academic student counselling was substantially extended in many European countries in the process of increasing enrolment.118 Yet, the extent to which universities were actively involved in the professional placement of graduates and in their willingness or ability to keep in touch with alumni varied strikingly between countries. A trend toward vocationalism? Some experts suggested that pressures on universities to consider their graduates work and career prospects increased with the expansion of higher education in the 1950s and 1960s. Other experts considered that the labour market set the terms. There was agreement, however, that universities were more hard pressed to consider their graduates future employment and work in the 1970s and 1980s than in the preceding decades. four decades of trends and policies In a summary of structural and curricular developments made in the early 1990s, the author came to the conclusion that following a strong emphasis on culture and thereafter on equity university institutions
117

118

J. Enders and U. Teichler, Der Hochschullehrerberuf im internationalen Vergleich (Bonn, 1995), 16. See R. W. Dawes, The Role of the Counsellor in Mass Higher Education, Higher Education, 2 (1973), 26770.

362

Graduation and careers were by then anxious to prove themselves professionally useful.119 What remained open for future reection was whether, in acknowledging their professional function, they might lose their capacity to discharge complex and indeterminate tasks as well as their ability to respond to innovation. The growth of enrolment in higher education had been the key issue in all analyses of graduate employment and work after 1945, and for the most part the relative loss of Einsamkeit und Freiheit (exclusiveness and freedom) was a cause for concerned reection, but not for political outcry in times of growing resources, signicant public respect and a drive to stimulate economic growth and reduce inequality. The substantial increase of university-trained persons, by the 1990s more than 30 per cent of the age group, did not allow students to be among the chosen few. High-level positions traditionally open to any qualication were now being lled increasingly by graduates. A structural shift of the economy towards the service sector provided more openings for graduates. Thus universities in the 1950s and 1960s did not feel hard pressed by the process of expansion. In the late 1960s student protests upset the belief in an autonomous academic world, and governments began to rethink their long-term funding strategies for an expanding educational system. As economic growth slowed and signicant unemployment grew, a further increase in the quota of graduates in the labour force began to be viewed as a major problem. The Central and Eastern European countries, following the socio-political model of the Soviet Union, had seemed to avoid such complications. In most of them higher education had expanded signicantly during the 1950s and early 1960s, but thereafter it had only grown at a moderate rate. Study programmes became more highly specialized and more closely geared to the presumed manpower requirements. During the 1970s and 1980s the state of graduate employment and work in Western European countries was less comfortable than it had been during the preceding decades, but less miserable than the pessimism of the mid-1970s had predicted. Most graduates were absorbed within the employment system, taking over positions and tasks traditionally perceived as graduate assignments or at least not clearly demarcated from them. The proportion of graduates registered in positions of manual labour, simple services or routine white-collar jobs doubled, at most. According to available surveys, about three-fths of graduates considered themselves to be employed in graduate positions, a further fth questioned this, and only one-fth registered serious disappointments. Gradual shifts in the elds of study, in dropout and prolongation, in the
119

See also G. Neave, On Instantly Consumable Knowledge and Snake Oil, European Journal of Education, 27:1 (1992), 527.

363

Ulrich Teichler efforts undertaken to ease and shorten the transition to employment, all helped to alleviate potential problems. Opinions had changed markedly about who was expected to ensure a balance between higher education and employment. In the 1960s, many held that wise government planning, based on forecasts of manpower requirements and of supply trends, was crucial. By the 1980s, however, governments in various European countries had loosened supervisory control, expecting individual universities to be more managerial and entrepreneurial and to be held accountable to society through often elaborate evaluation procedures. Individual universities and departments had been required to attend more to the relationship between study and employment as one of the criteria for effective action, and this had led not infrequently to what is pejoratively called vocationalism. Around 1990, macro-social scenarios, in principle, could provoke similarly heated debates on the links between higher education and employment to those that had taken place in the troubled mid-seventies. Unemployment rose even more sharply in the early 1990s, and the supply of graduates was expected to increase. Various experts had predicted a growth in demand for qualied labour, but the predictions were vaguer than either the euphoric or the pessimistic scenarios put forward in the 1960s and the 1970s. Nevertheless, awareness of the complexity of the phenomenon had undoubtedly grown. There was obviously no single recipe for striking a balance between the academic, cultural and professional functions of higher education. Universities had and have to play a double role. Legitimately they were detached from society in order to facilitate the pursuit of knowledge for its own sake. Nevertheless, as a consequence of their relative autonomy, universities were called upon to concern themselves with the fortunes of their graduates and the legitimate professional demands placed upon them. It would take time to judge whether the balance they achieved was rational and effective. Have universities yielded to an overwhelming vocational drift? Is there an accelerating trend towards diversication, to the extent that common elements disappear and a division emerges between academic universities, vocational universities and a few institutions somewhere in between? Only time will tell. postscript: trends and policies since the 1990s Higher education continued to expand throughout the 1990s and the early years of the twenty-rst century. According to OECD statistics, admission to tertiary education increased in Western Europe from 38 per cent in 1991 to 62 per cent in 2003, that is, by more than half over 364

Graduation and careers twelve years.120 In this process of expansion, the non-university highereducation sector in some countries was upgraded to university status, while in others the vocational education and training sectors that had not previously been classied as higher or tertiary were upgraded as well; in most countries, however, a growth in student enrolment occurred in the established sectors of tertiary education itself. The OECD came to the conclusion that the expansionist trend had regained momentum in the mid-1980s. Subsequently, scepticism about over-education gave way to the dominant view in public debate that higher education had to grow in order to cope with the increasing demands of the knowledge society. The OECD also observed that Europe was moving towards a situation already visible in the late 1990s in a number of countries: about three-quarters of the age group had beneted from some form of tertiary education, either upon completion of secondary school or at some later stage in life.121 Available graduate surveys do not indicate that this expansion has led to serious graduate employment problems in the labour market. In the 1980s already it had become clear that the transition from higher education to employment was a protracted and uncertain time for many graduates. Also, a growing proportion of the graduate population was accepting less prestigious and less demanding assignments than had traditionally been the case. Nevertheless, the percentage of graduates ending up in positions considered inappropriate for higher-education graduates remained small. According to a representative survey in eleven European countries of higher-education graduates in 1995, 73% were employed about four years later in managerial occupations and professions, 20% as associate professionals or technicians and so on, while only 7% had accepted positions as clerks, sales persons, manual workers and other jobs for which a degree is generally not considered necessary.122 A similar survey in thirteen European countries of graduates in 2000 showed almost identical results: 74% were employed about ve years later in professions generally thought to require a degree, 19% in positions that are sometimes called semi-professional, and only 7% in occupations that obviously did not require a degree.123 The relative stability of the relationships between study and the subsequent levels of occupation does not imply that the world of work
120 121 122

123

See OECD, Education at a Glance: OECD Indicators 2005 (Paris, 2005). OECD, Redening Tertiary Education (Paris, 1997). U. Teichler, Higher Education and Graduate Employment in Europe (Dordrecht, 2006), 901. H. Schomburg, Young Higher Education Graduates the Winners of Globalization, in European Research Network on Transitions in Youth: 15th Annual Workshop (Ghent, 2007), 46.

365

Ulrich Teichler has been indifferent to changes in higher education in Europe since the 1990s. Experts can point to four major change arenas, though often without precise information regarding the degree of change that has actually occurred. First, changes in the formal structure of curricula and degrees are bound to affect graduate employment and work. In the Bologna Declaration of 1999, the education ministers of many European countries agreed to establish a framework of study programmes and degrees similar to the Anglo-Saxon tradition of the bachelors and masters qualications.124 As a result, universities on the continent were challenged to design curricula for relatively short (predominantly three-year) study programmes that would be to quote the Bologna Declaration relevant to the European labour market as an appropriate level of qualication. This structural change also led to the establishment of masters programmes at highereducation institutions that did not adhere to the academic tradition of study and the close link between research and teaching that typically prevails at universities. Second, informal structural differences in higher education are assumed to have an increasing impact on graduate employment. Ranking studies of universities and the growing competition between institutions aiming to be world-class universities125 have captured the publics attention. In those countries traditionally characterized by steep vertical diversity among universities, close links between institutional reputation and graduate employment opportunities are a conventional wisdom. It remains to be seen whether the career opportunities of graduates in countries traditionally characterized by a atter hierarchy of universities will become equally stratied. Third, efforts to reshape the substance of curricula visible in the early years of the twenty-rst century go far beyond the needs of the convergent structure of study programmes and degrees proposed in the Bologna Process. Many experts agree that the increasing use of the terms knowledge society and knowledge economy increases instrumental pressures upon the universities, both in terms of research as well as in teaching and learning. Also, the spread of evaluation and accreditation activities in Europe in recent years calls for a growing awareness of the professional implications of teaching and learning.
124

125

See the overview on subsequent trends and policies in J. Witte, Change of Degrees and Degree of Change: Comparing Adaptations of European Higher Education Systems in the Context of the Bologna Process (Enschede, 2006); cf. also U. Teichler, Higher Education Systems: Conceptual Frameworks, Comparative Perspectives, Empirical Findings (Rotterdam and Taipei, 2007), and the Epilogue of this volume. Cf. the overview in J. Sadlak and N. C. Liu (eds.), The World-Class University and Rankings: Aiming beyond Status (Bucharest and Cluj-Napoca, 2007).

366

Graduation and careers Many academics have expressed concern that the universities will lose their innovative potential for society, ironically because of pressures to make them more innovative in an instrumental manner, thereby sacricing the innovative potential of the search for knowledge for its own sake, the critical function of the university, and the training of students for indeterminate tasks. In the early years of the twenty-rst century, employability became the most popular catch phrase of curricular reorientation. A closer look at this debate suggests that the readiness of higher-education institutions to adapt curricula to the presumed needs of the employment system and to undertake many accompanying measures to sell their own institutions on the labour market might not have much to do with the notion of upholding a meritocratic notion of the links between higher education and employment. Furthermore, the interpretation of what serves the employability of graduates is extremely divergent. For example, in the United Kingdom a strengthening of generic skills is often viewed as the most appropriate means of enhancing ones employability, while in Germany the fostering of a mix of key skills, ranging from computer literacy and foreign language prociency to socio-communicative skills and problem-solving abilities, is favoured.126 Fourth, internationalization has become a key theme for highereducation policy in recent years. In this framework, universities are striving to increase staff and student mobility, foster more cross-border cooperation, strengthen European links in various ways, dene themselves as increasingly shaped by a global market of knowledge and reputation, and increase their activities in support of higher education in developing countries to name just some of the major topics under consideration.127 In fact, internationalization in higher education might well have farreaching consequences for an individuals career. For example, European students who have spent a period of study in another European country are ve times more likely to work abroad a few years after graduation than students who did not opt for mobility as part of their course. They are also more than twice as likely to take on visibly international tasks at home than their formerly non-mobile peers.128

126

127

128

Cf. U. Teichler, Higher Education and the European Labour Market, in EUA Bologna Handbook: Making Bologna Work (Berlin, 2007), 2330 (part 3.21). Cf. J. Huisman and M. van der Wende (eds.), On Cooperation and Competition, 2 vols. (Bonn, 2003 and 2005). See V. Jahr and U. Teichler, Graduates International Experience and Mobility, in U. Teichler (ed.), Careers of University Graduates (Dordrecht, 2007), 21124; U. Teichler and K. Janson, The Professional Value of Study in Another European Country: Employment and Work of Former ERASMUS Students, Journal of Studies in International Education, 11:34 (2007), 48695.

367

Ulrich Teichler A note of caution about the seemingly dramatic changes that have occurred, however: even after many years of a push towards internationalization and Europeanization, only about 5 per cent of highly qualied persons in the European labour market are foreigners, with about half of these coming from other European countries. Clear changes in the relationship between the university and the world of work are underway, but these changes might be less far-reaching and slower to implement than the current policy debates would suggest. select bibliography
Bodenhofer, H. J. (ed.) Hochschulexpansion und Beschaftigung , Vienna, 1981. Bowman, M. J. et al. (eds.) Readings in the Economics of Education, Paris, 1968. Brennan, J., Kogan, M., and Teichler, U. (eds.) Higher Education and Work, London, 1995. Higher Education and Employment (special issues), European Journal of Education, 30 (1995). Holtkamp, R., and Teichler, U. (eds.) Berufstatigkeit von Hochschulabsolven das Studium, Frankfurt and ten: Forschungsergebnisse und Folgerungen fur New York, 1983. Hus en, T. Social Background and Educational Career, Paris, 1972. Lindley, R. (ed.) Higher Education and the Labour Market, Guildford, 1981. OECD. Education, Inequality and Life Chances, 2 vols., Paris, 1975. OECD. From Higher Education to Employment, 4 vols., Paris, 1992. OECD. The Utilisation of Highly Qualied Personnel, Paris, 1973. Perkin, M. The Rise of Professional Society: England since 1880, London, 1989. Psacharopoulos, G. (ed.) Economics of Education: Research and Studies, Oxford, 1987. Roizen, J., and Jepson, M. Degrees for Jobs: Employer Expectations of Higher Education, Guildford, 1985. Sanyal, B. C. Higher Education and Employment: An International Comparative Analysis, London, 1987. Schomburg, H., and Teichler, U. Higher Education and Graduate Employment in Europe, Dordrecht, 2006. Teichler, U. Higher Education and Work in Europe, in J. C. Smart (ed.), Higher Education: Handbook of Theory and Research, Vol. 4, New York, 1988. Teichler, U., Hartung, D., and Nuthmann, R. Higher Education and the Needs of Society, Windsor, 1980. Williams, G. The Economic Approach, in B. R. Clark (ed.), Perspectives on Higher Education, Berkeley, Cal., 1984, 79105. Youdi, R. V. and Hinchcliffe, K. (eds.) Forecasting Skilled Manpower Needs, Paris, 1985.

368

PART IV

LEARNING

CHAPTER 10

SOCIAL SCIENCES, HISTORY AND LAW

NOTKER HAMMERSTEIN WITH DIRK HEIRBAUT

introduction The nineteenth and early twentieth centuries were characterized by an underlying historical approach in many academic disciplines.1 This was true of almost all disciplines, but was especially the case in the arts, that is, in the different forms of philology, philosophy, the history of art and archaeology, jurisprudence in all its related sub-disciplines, and economics. The same methodological approach was also followed in the social sciences, sociology, geography, politics, ethnology (social anthropology), economics, law, psychology and above all social psychology, all of which, with the exception of law and economics, were generally offered in European universities after the First World War. They were rarely called social sciences, but the individual subjects had been taught for a considerable time at individual universities, in Germany and France in particular, although the basic problems with which they dealt had existed for as long as humankind. And yet many tedious roundabout routes had to be pursued before the new disciplines received university status and could celebrate their triumphal arrival in the second half of the twentieth century. In the individual countries the admission of these subjects to the universities took place in very different ways. French sociology, for example, became a university subject relatively early, although not on a large scale. In England sociology was the preserve mainly of non-university personnel, entrepreneurs, journalists and intellectuals and in sharp contrast to the Continent had a strongly empirical approach right from the beginning.
1

Notker Hammerstein is responsible for the sections on Social Sciences and History, Dirk Heirbaut for the nal section on Law. Cf. vol. III, chapter 11.

371

Notker Hammerstein Ethnology, on the other hand, began in England and Germany as a sort of museum discipline, and in France as a form of by-product of anthropological curiosity. Politics was developed in Germany from nance and political science, in the United Kingdom, on the other hand, from history and moral philosophy. Comparable differences could be demonstrated for other subjects in the social sciences. The important thing was that in the twentieth century all European countries gradually opened themselves up, albeit slowly, to these disciplines, which focused on the needs of the modern world. The European universities in general had difculties in accepting new disciplines. Paradoxically, in the United States the traditional teaching programme of the colleges had expanded to incorporate German models, and as a result they came to adopt an open and pragmatic attitude to new disciplines such as those constituting the social sciences.2 It was also an advantage that the American universities were based less on faculties as in continental Europe but rather on departments. It was no coincidence that doctorates in sociology were being awarded at an early stage, whilst in Europe similar dissertations were submitted for a long time under different subject headings.3 The actual victory of the social sciences did not really begin until after 1945.4 In the USA these disciplines in particular sociology and politics were held to be an essential component of a democratic community.5 The Americans brought this conviction with them to Europe as the leading victorious power in the Second World War. Since the war itself to an even greater degree than the First World War had been a struggle for technological and scientic superiority, the importance of science and research entered into the consciousnesses of the nation states, their politicians and their citizens. As the most successful power in terms of its military strength and the strategic focus of its research, the USA was seen as the model to be copied in many countries. This was also true to an exceptional degree for the social sciences. In the post-war years sociologists like Talcott Parsons thought that it was possible with scientic means to plan for and realize a better future. It was a euphoric hope that was eagerly seized upon. The horrors of the war, the criminal policies of the National Socialists, the shattered sense of what it meant to be European, which had been
2 3

4 5

P. T. Manicas, A History and Philosophy of the Social Sciences (Oxford, 1987), 214f. A. J. Reiss, Jr, Sociology. The Field, in D. L. Sills (ed.), International Encyclopedia of the Social Sciences, Vol. XV (New York, 1968), 12. R. A. Scott, Social Sciences. Introduction, in Clark and Neave, Encyclopedia II, 2072. F. H. Tenbruck, Deutsche Soziologie im internationalen Kontext, in Deutsche Soziologie seit 1945, Kolner Zeitschrift fur Soziologie und Sozialpsychologie, Sonderheft 21 (Opladen, 1979), 71.

372

Social sciences, history and law undermined by these and other catastrophes, the loss of civil cohesion and religious faith, all made the American way of life seem so much more attractive. People began to abandon their own traditions. The march forward into the modern world, it was thought, could be successfully started thanks to these new disciplines, which would allow one to solve all social and political problems. American society was a living example and was itself grounded as for example S. M. Lipset has shown on the insights of the social sciences. A rational public opinion could be produced by means of the methods of the social sciences, and its views would be founded on the basis of social facts instead of a clash of opinions and values. As a result, democracy in the country would be secured. In the USA itself, but to a much greater degree in the countries directly affected by the war, this social optimism found ready acceptance. America appeared not only as the undoubted military, but also the intellectual victor, as the master of progress, which had built a humane and democratic society on the ideas of freedom and humanity. This appeared to be transferable to others in a way which did not apply, for example, to the European models of democratic government. America itself maintained, especially in its capacity as the victorious power in Germany, that its concepts could be applied anywhere and at the same time were safe. This, it was argued, lay in the nature of the social sciences, which, thanks to their use of veriable scientic results, guaranteed success.6 The younger intellectuals of the post-war years, who were shaken by the war and disappointed by the circumstances in Europe, eagerly seized upon these promises, and with them the scientic methods and attitudes, which seemed to guarantee democracy. In this relatively ahistorical, universal concept there lay the hope of being able to take over a life which was so successful and so admired, and which thanks to new techniques and new scientic approaches seemed to deliver constancy and resilience. To a certain extent this was the result of the war was the perhaps slightly exaggerated but still accurate formulation of G. Williams.7 An essential factor in the triumphant progress of the social sciences after 1945 was a general acceptance of the pre-eminence of the USA. Of course the social sciences had to take into account the various national traditions. But the reception of American ideas and methods brought an initial feeling of unity to the international academic landscape and gave
6

D. Bell, Die Sozialwissenschaften seit 1945 (Frankfurt and New York, 1986), 60ff.; Tenbruck, Deutsche Soziologie (note 5), 88ff. In some cases this was the result of the war. G. Williams, Introduction, in Clark and Neave, Encyclopedia II, 849.

373

Notker Hammerstein these subjects in the course of the 1950s and 1960s the great degree of recognition and public inuence almost everywhere that they have retained into the twenty-rst century. That communal, economic and social problems should arouse unusual interest during those years was partly the result of the destruction and displacement caused by the war and also the general extent of social deprivation in the countries of Europe. In the USA itself, however, the war had led to huge social convulsions which demanded solutions. The very fact that, in all the countries affected by the war, countless young men and in some cases young women had had to carry out military service or something similar, and were now, irrespective of their social status, demanding jobs and training, forced the governments into an active policy of intervention, which needed guidance and advice from the planning and measuring social sciences. There was a massive inux into the universities and colleges, confronting these institutions with tasks for which they were not prepared and which they tried to master using knowledge gained from the social sciences. This too gave further impetus to the rise of these in part controversial disciplines often to the irritation of the universities, as they tried to take hold after 1945 to an extent which could never have been imagined previously and to attract a large number of students. This development did not take place suddenly, and not always immediately after the end of the war, nor at the same time in all subjects. But by the period 19705 the social sciences had become the leading disciplines in those subjects previously known as the humanities. Their methods and ndings were held to be fundamental and methodologically exemplary for many other subjects. That this in no way protected them from internal strife or from serious disputes between differing schools and methods, but on the contrary provoked these, is simply the inevitable fate of living and trend-setting disciplines. In the late 1970s most of these subjects had to cope with what for them were quite new crisis situations. Their dominant status did not go unchallenged, however. The development of the modern sciences in their many forms and their tendency to specialization could lead to abrupt changes of course in positions and disciplines hitherto in the lead, so that what had seemed indispensable knowledge now became obsolete. The displacement by the social sciences of that historical view of the world and of academic disciplines which had prevailed into the 1940s can be attributed not only to political and historical factors, but also to elements within the subjects themselves. It is thus appropriate to look at these disciplines rst before turning to the eld of history, and, because their American models played a decisive role in the development of post-war

374

Social sciences, history and law Europe, we shall in each case start with their North American pre-history as we consider the development of universities in Europe.

sociology The United States of America The individual disciplines not only arose from different lines of questioning, they also pursued different areas of problems and different combinations of problems. In general their aim was the study of man in society, as far as this could be discerned by contemporaries. At the same time an important role was played by questions from associated elds, that is political, anthropological, economic, cultural and historical determinants. At the centre stood Man as a social entity, as a collective being and yet also as an individual. This was also true for sociology. The uniqueness of human beings and the basic rules of social life were the fundamental questions according to Edward Shils, or, as another scholar formulated it, The being of man, insofar as it is inuenced by collective behaviour or in general by the social order. Social relationships, the essence of society, social systems and structures, social stratication, organizations, institutions and associations, subcultures and so on all were thus held to be part of the problems studied by sociology.8 The early recognition and rapid spread of sociology in the United States differs markedly from the development of the subject in Europe, with the exception perhaps of the Netherlands. In 1883 Lester Frank Ward (1841 1913) published his textbook Dynamic Sociology. In 1905 the American Sociological Association was founded, and in 1905 Folksways by Frank William Summer (18401910) introduced the subject to a broad mass of the public. In 1892 Albion Small established a department of sociology at the newly founded University of Chicago. Thanks also to the work of William Isaac Thomas (18931947)9 and Florian Znaniecki (18821958) it became famous as the Chicago School. It practised its pragmatically inspired sociology with empirical eld studies into urban problems, race relations and collective modes of behaviour in order to identify the causes of disturbances in the social order and to improve its functioning.
8

Social relationships, the nature of society, social systems and structures, social stratication, organisations, institutions and communities, subcultures etc.: some of the formulations in J. F. Short, Sociology, in Clark and Neave, Encyclopedia II, 2169. Known through the Thomas theory developed in collaboration with Znanicki (W. Ruegg, Soziologie: Funkkolleg zum Verstandnis der modernen Gesellschaft, Vol. VI (Frankfurt, 196975), 249). I am particularly grateful to W. Ruegg for these passages.

375

Notker Hammerstein In 1895 there appeared at the University of Chicago Press the American Journal of Sociology. The colleges and universities, especially in the Midwest, quickly followed the example of Chicago with departments of sociology, whose teaching and research were particularly focused on the practical problems of social change caused by industrialization, urbanization and immigration. The main concerns of sociology at the time were the development and application of analytical instruments and the formulation of good questions in order to capture social reality. Many sociologists like Thorsten Veblen (18571929) and Robert S. Lymd (18921970) were preoccupied with uncovering inequalities in the structure of society and the effects of capitalist systems of government. Until the end of the 1920s the vast majority of American sociologists came from religious and rural circles. Empiricism formed the basis of their investigations. They directed their attention particularly to the motivation and shaping of the socialization of individuals and groups, both in communities and in society in general, their acculturation and de-culturalization and the political consequences of these processes.10 In the thirties the lack of coherent theories led to a successful countermovement at the old universities on the East Coast. Having been expelled from Russia in 1923, Pitirim A. Sorokin (18891968), as professor of sociology at Harvard University, opened up new perspectives to a circle of pupils. He began with the elaboration of a sociological concept and classication system, in order to analyse the phenomena of inequality, mobility, dynamics and social change.11 At the same time he made his pupils aware of the different traditions of sociological thinking.12 In this way a Pareto circle came into being, whose members were interested less in Paretos attempt to link sociology and economics than his attempt to bring about a comprehensive theory of the social sciences. With reference to Pareto and Durkheim, but also to social anthropologists like Spencer and Malinowski, his pupil Talcott Parsons (19021979) made this his lifes task using a structural and functional analysis dating back to 1937.13 He made a radical break with sociological realism and developed his own system of concepts, with which he was able to analyse social phenomena as dynamic elements interacting with their total social context and to construct an all embracing theory and methodology. His goal was the formation of a unied and scientically substantiated social milieu, whose effectiveness was no longer determined by the predominance of one sector of social reality, but by an overview of the totality of social actions. In
10 11 12 13

L. Bransom, The Political Context of Sociology (Princeton, 1961). P. Sorokin, Social and Cultural Dynamics, 4 vols. (New York, 1937). P. Sorokin, Contemporary Sociological Theories (New York, 1928). T. Parsons, The Structure of Social Action (New York, 1937).

376

Social sciences, history and law the 1960s Parsons Structural Functionalism14 extended by the work of representatives of other schools dominated almost all American and large sections of European sociology. At Columbia University in New York sociologists under the leadership of Robert K. Merton (19102003) and Georges G. Homans (191089)15 applied structural functional analysis successfully in empirical case studies. Merton rejected Parsons claim to a theory of total social systems, but developed on the basis of this a theory with medium applicability. It applied structural-functional analysis to the investigation of individual sociological themes, such as social change, the social environment of scientic and technical discoveries, the signicance of reference groups in social action and the spread of values within society.16 In this way functionalism developed mainly as a fruitful methodology for empirical investigations and lost its claim to provide a convincing sociological theory of everything. This is particularly evident in the innovative empirical works carried out by Mertons university colleague Paul Lazarsfeld (190176) which included, for example, the electoral behaviour of the US citizens or their use of radio.17 Throughout these years sociology became a professional discipline, and Lazarsfeld was commissioned by UNESCO to provide a concise survey of its general situation.18 It became an important university subject with its own academic status and ethos. As ever more social relationships were redened as social problems, the need for trained sociologists grew. Around 1960 almost all American universities had sociology departments, out of which seventy were awarding the degree of Doctor of Sociology. Other forms of graduation continued to be preferred, and they opened up diverse forms of professional activity, as is apparent in the growing number of sections and members within the American Sociological Association. This body takes in every conceivable subdivision of sociological interests. In 1963 it consisted of ve sections. In 1976 there
14

15 16

17

18

T. Parsons and E. A. Shils, Toward a General Theory of Action (Cambridge, Mass., 1951); T. Parsons, R. F. Bales and E. A. Shils, Working Papers on the Theory of Social Action (New York, 1953). R. Dahrendorf, Die angewandte Aufklarung: Gesellschaft und Aufklarung in Amerika (Munich 1961); N. Herpin, Les sociologies am ericaines et le si` ecle (Paris, 1973). G. C. Homans, The Human Group (New York, 1950). R. K. Merton, Social Theory and Social Structure: Toward the Codication of Theory and Research (Glencoe, Ill., 1949); R. K. Merton, On Theoretical Sociology: Five Essays, Old and New (New York, 1967). P. F. Lazarsfeld, An Introduction to Applied Sociology (New York, 1975); R. K. Merton, J. S. Coleman and P. H. Ross (eds.), Qualitative and Quantitative Social Research: Papers in Honor of Paul F. Lazarsfeld (New York, 1979); J. Lautman and B. Lecuyer (eds.), Paul Lazarsfeld (19011976): La sociologie de Vienne (New York and Paris, 1998). P. F. Lazarsfeld, La sociologie, in Tendances principales dans les sciences sociales et humaines: Premi` ere partie (Paris, 1970), 69197.

377

Notker Hammerstein were already fourteen and in 1988 twenty-six. After 1945 there were about 1,000 members of the organization. In 1972 there were 15,000 and in 1980 around 56,000.19 In the 1980s the numbers went down temporarily. Yet they still showed how well established the discipline had become. In the rst two to three decades after the war the social sciences were held to be the discipline that was most likely to full hopes of a better, more just and peaceful society. Yet at the end of the 1950s a radical counter-movement had emerged at Columbia University, whose spokesperson Charles Wright Mills (1916 62) opposed an engaged sociology to Mertons and Lazarfelds successful establishment of a theoretically based empirical sociology. This new form of sociology criticized the triumphant advance of statistical correlations, which, it argued, only served the interests of the American power elites under the guise of abstract theory and a scientically neutral empiricism. Its sole aim, they charged, was to manipulate by means of such investigations a politically apathetic American society devoted to consumption and pleasure. This criticism was formulated in 1970 in most extreme terms by a graduate of Columbia, Alwin W. Gouldner (192182), with a book that created a huge stir.20 The turbulent 1960s saw sociology, in common with the other social sciences, often at the centre of interest. The Civil Rights Movement, the Vietnam war, hippies, the revolt of academic youth in the universities and other events favoured those sciences which claimed not only to be able to analyse the conditions and possibilities of society and its organizations and failures, but also to be able to change them for the better. There emerged new sections, new theories and new subdisciplines and these in part survived the rapid decline in the popularity and prestige of the social sciences which set in during the 1970s. It became increasingly obvious that the frequent discussions on theory and technical terminology which were carried out with sectarian zeal in the late seventies were sterile. They did indeed lead to ever more attempts at a theoretical and practical orientation, but not one of them could nd common acceptance. Neofunctionalism, structuralism, the theory of rational choice, cognitive sociology, linguistic change, post-structuralism, postmodernism, versions of symbolic interactionism, a new ethno-methodology and such like presented so confused a picture, that politicians and indeed even scientists began to lose faith in the function of sociology as a fundamental science. This led in the 1980s to a cutback in funds and a loss of prestige for
19

20

Clark and Neave, Encyclopedia II, 2170ff.; L. J. Rhoades, A History of the American Sociological Association 19051980 (Washington, 1981). C. W. Mills, The Sociological Imagination (New York, 1959); A. Q. Gouldner, The Coming Crisis of Western Sociology (New York, 1970); S. Lukes, Emile Durkheim: His Life and Work. A Historical and Critical Study (London, 1973).

378

Social sciences, history and law sociology and made it vulnerable to the political activities of its representatives. At the same time it encouraged the spread of neo-Marxist theories, which was new in the USA. In the end, however, applied, empirically based sociology proved to be the constant and most important part of the discipline. At the same time the subject became more professional, so that leaving qualications and examination certicates were now more important. Europe The dominant position of America certainly shaped the development of the social sciences in Europe, as has been shown in the introduction to this chapter, but national concepts of science and culture and theoretical traditions were not, and are not, easily overcome and despite growing internationalism simply do not disappear. Indeed in the softer arts disciplines and the social sciences they play a larger role than in the apparently rmly established natural sciences. It is just that in the adoption and application of methods there was a faster reception in some cultures than in others. This can be shown in a survey of European countries. In FRANCE, where August Comte and Emile Durkheim (important representatives of a science focused on society) had been at work before the First World War, sociology played a relatively minor role at universities with the exception of Bordeaux and Paris. It was held to be an applied and practically useful discipline, which did not deserve a separate status at a university. Durkheim at the age of twenty-seven gained a post in Social Science and Educational Theory at the University of Bordeaux, gave lectures and published books on sociology and in 1897 founded the authoritative journal Lann ee sociologique. From 1902 onwards he taught at the Sorbonne as deputy to the professor of education and then from 1906 as the holder of the chair in education himself. It was not until 1913 that a chair in sociology was created for him, which he then held for four years until his death. Despite Durkheims continuing inuence, not least on other subjects, the ofcial coolness towards sociology did not diminish. The view in France was that sociology should deliver philosophically and theoretically based knowledge, but that it was not really called upon to carry out empirical eldwork.21 That sort of work was thought to be the province of specialized non-university institutes. The quantifying basis which is so fruitful in modern university sociology was largely absent. In the late 1940s and early 1950s the rapidly spreading notion that it might be possible to plan for an economic resurgence and a better society with
21

C. E. Lemert (ed.), French Sociology (New York, 1981), 12ff.

379

Notker Hammerstein the help of sociology hardly had any impact on the Sorbonne, the most prestigious of French universities. Not untill 1958 did Raymond Aron gain a post to teach sociology. In 1956 the government of Mend` es-France introduced university reforms. Part of these was the encouragement of the social sciences. As a direct consequence a Sixth Section for Social Sciences was set up in the Ecole pratique des hautes e tudes, which had been created in 1868 as a legally independent body, but one which was linked to the Sorbonne in terms of personnel and accommodation and which was charged with introducing advanced students to research on the model of German seminars or laboratories. In 1963 the Sixi` eme section was changed into the Ecole des hautes e tudes en sciences sociales (EHESS) and linked to the foundation of the Maison des sciences de lhomme.22 The spread of sociology as a university subject beyond Paris was decisively advanced by a second measure. Within the framework of the Centre national de la recherche scientique (CNRS) sociological research institutes began to develop. They were subject to the CNRS both administratively and legally, but were led by university professors who were then in a position to carry out research in addition to their university teaching. In this way the conditions were established at French universities for the teaching of a sociology which could draw on its own research. In broad terms it developed in four directions, which, with one exception, were heavily inuenced by North American models. The rst applied Parsons structural functional method as developed by Merton in the form of medium range theories. Franc ois Bourricaud (192291) made a great contribution to the spread of functionalism in France through his translation and critical commentary of Parsons ideas, and he also applied these in research projects in South America, which he undertook at the behest of the CNRS.23 Michel Crozier (b. 1922) after periods of study at Stanford and guest lectures at Harvard as director of the CNRS played a successful part in reorienting ideologically based approaches to sociology towards a sociology which carried out empirically concrete analyses of working relationships and forms of organization.24 The second direction was concerned with the methodology and application of mathematically based quantitative sociology. Between 1965 and 1970 its promoter Raymond Boudon (b. 1934) published with Paul Lazarsfeld the fundamental texts of this sociology. As a professor at the Sorbonne and director of state research institutes he was very inuential in
22 23

24

See chapter 3, 956. ements pour une sociologie de laction, introduction a ` T. Parsons F. Bourricaud (ed.), El ` Puno: Etude (Paris, 1955); F. Bourricaud, Changement a de sociologie andine (Paris, 1962). M. Crozier, Le monde des employ es du bureau (Paris, 1965).

380

Social sciences, history and law the professionalization of sociology and its extension to serve educational and economic policy.25 Alain Touraine (b. 1925) represents the third direction, composed mainly of Marxist-oriented sociologists in the early post-war period. After periods of study in the USA and the student revolt of 1968, he tried to achieve a more differentiated analysis and an inuence on social change.26 The fourth direction has its origins in ethnology, a social science which has long been important in France.27 Pierre Bourdieu (19302002) began his rapidly successful career with eldwork projects on the culture of the Berber. The publications of his results, which culminated in the Sociology of Algeria published in 1960, led, in 1964, to a research professorship as Directeur d etudes at the EHESS. His works on culture and educational sociology, which were largely based on an empirical analysis of daily life, made him so well known nationally and internationally that, in 1982, the Coll` ege de France created a chair in sociology for him and thus accorded the highest prestige to a subject which a quarter of a century before had been scorned by the French establishment. Bourdieus achievement consisted in bringing together the social-science paradigms of structuralism and Marxism, which predominated in France in modernized forms, and which corresponded to leading international developments. He sociologized Claude L evi-Strauss structuralism by using Max Webers categories of social action and of symbolic interaction. The category of class warfare, which is at the root of Karl Marxs works, both theoretically and practically, was extended by Bourdieu by the introduction of other social antagonisms known from conict theory. Above all, however, he replaced the doctrinally narrow concept of social milieu by the key sociological concept of habitus, now attributed to him, in order to bring the multiplicity of social and cultural conditions and interactions, which form the basis of all social action, to a common denominator.28 In ITALY in 1945 there were no independent chairs of sociology. The subject was taught by some professors in connection with philosophy, law or social policy. In 1950 sociology became a university discipline in
25

26

27 28

R. Boudon and P. Lazarsfeld, Le vocabulaire des sciences sociales: Concepts et indices (Paris, 1965); R. Boudon and P. Lazarsfeld (eds.), Lanalyse empirique de la causalit e: Choix de textes (Paris, 1966); R. Boudon, P. Lazarsfeld and F. Chazel, Lanalyse des processus sociaux (Paris, 1970); R. Boudon, Lanalyse math ematique des faits sociaux (Paris, 1967); R. Boudon, Quantitative sociology (New York, 1975). A. Touraine, La conscience ouvri` ere (Paris, 1966); A. Touraine, La soci et e invisible 19741976 (Paris, 1977). Reiss, Sociology (note 3), 14. The German-American art historian Erwin Panofsky took the term habitus from scholastic philosophy in order to describe the generalist education of Renaissance artists, but it was rst introduced to a broader public by Bourdieu.

381

Notker Hammerstein Florence and in 1952 in Rome. In 1964 an entire independent sociology faculty was created in Trento. By 1991 there were 662 professors and lecturers at Italian universities in the eld of sociology. From the 1960s sociologists have worked in all areas of the social sciences, in particular in public service and in social work.29 In addition to American sociology Marxism in all its differing modes played a leading part, so successfully that social critique became something of a mass movement. The main themes of sociological work between 1960 and 1980 were thus: work, social actions, social classes, the dominance of elites, and, above all, the capitalist organization of production and work, the adaptation mechanisms of the social body, class and the school system, sociology as the servant of the ruling classes in economics, society and culture. The state was analyzed in this period of radical social change and social mobility as the guarantor of the ruling class.30 The very chaotic modernization of Italian society on the other hand caused a good number of sociologists to support those who had political power and could inuence change. Both forms of political engagement led in general to a neglect of theoretical work. This only began to change at the end of the 1980s. Theoretical works, based on eldwork, increased. This remained, however, in many cases rather fragmentary and there was a lack of a convincing systematization with the exception of Alessandro Pizzorno (b. 1924)31 but the subject began to free itself from being used mainly as an adjunct to political science. The main areas of Italian sociology around 1995 were cultural sociology, political sociology, work and organizational sociology and sociopolitical phenomena. The perspective was just as limited. The academic development of Italian sociology could not at least up to this point overcome two obstacles: the lack of institutional connections between the individual centres of research and the distorted picture of the social sciences in an Italian academic culture dominated by history and philosophy.32 Although ENGLAND developed its own approaches to sociological investigation before 1914, culminating in surveys, a much-used word, and although it possessed in Herbert Spencer a writer on sociology and education, who left an impact on sociological thought at home and across the Atlantic, sociology as an academic subject developed only slowly and
29

30

31

32

` (Turin, 1985); F. Barbano, La F. Barbano, La sociologia in Italia: Gli anni della rinascita sociologia in Italia: Ingressi teorici negli anni della formazione (5060) (Turin, 1986); D. Pinto (ed.), Italian Sociology: A Reader (Cambridge, 1981). F. Ferrarotti, Una sociologia: Dalla sociologia come tecnica del conformismo alla sociologia critica, 5th edn (Bari, 1975). A. Pizzorno, Political Sociology: Selected Readings (Harmondsworth, 1971); A. Pizzorno, I soggetti del pluralismo: Classi, partiti, sindacati (Milan, 1980). I owe this paragraph to Giovanni Busino.

382

Social sciences, history and law hesitantly in the universities, particularly Oxford and Cambridge, before the 1950s. There was, however, a long-standing commitment within them to social work, linking the universities with local communities and professional bodies, and usually leading up through examinations and case work to the award not of degrees, but of certicates and diplomas. In academic sociology, leading to degrees, the London School of Economics played the principal role: sociology was studied there alongside economics, history and anthropology. The provincial universities that had emerged under the aegis of London University, particularly Leicester and Nottingham, established the rst professorships in sociology outside London. There were often close relations within and across universities between sociologists and historians, with the latter playing an important part in the advance of sociology. Anthropology and psychology continued to develop independently. So did the sociology of industry with stronger links with institutions in the United States, not all of them universities, than with France or Germany. In England, educational change, especially university expansion, was the major stimulus to social studies as they were usually called, divided less by academic discipline than by their perceived content. In some universities, including Oxford and Cambridge, the term social sciences was resisted. The biggest growth in the numbers of lecturers and professors in sociology and their students occurred in the 1960s, following the creation of new universities, some of them stressing curricular innovation, including the pursuit of interdisciplinarity. Lectures were a less favoured mode of learning than working together in small groups, with students preparing individual projects. During the 1970s and 1980s, largely as a result of changes in the economic situation, there were signs of a reaction. Students favoured curricula more likely to secure and guarantee employment. Yet with the reorganisation of higher education during the 1990s, social studies, now attached to the media, ourished as never before.33 GERMANY in the rst half of the twentieth century had the most university sociologists after the United States. Admittedly they rarely had a university chair in sociology. The subject was taught almost always in combination with another subject which already enjoyed recognition, usually with economics or philosophy. This did not hide the fact that a broad and inuential discussion about the essence and theory of the discipline took place. These discussions were also noticed outside Germany. Its leading gures Georg Simmel, Max Weber, Ferdinand Tonnies, Franz Oppenheimer, Alfred Vierkandt and Karl Mannheim enriched the international discussion of theory over a long period. Although oriented towards history and the arts subjects, sociology was able to use empirical
33

I owe this paragraph to Asa Briggs.

383

Notker Hammerstein methods, but preferred positions which were drawn from the German historical, political and philosophical tradition. Although the subject did not enjoy much prestige at universities as in other European countries the more traditional professors preferred to keep their distance it was regularly taught in some places from the First World War onwards.34 Apart from Berlin with its traditional openness to every kind of material, this took place rst signicantly at the new universities in the major cities, Frankfurt, Cologne and Hamburg. Then came Leipzig, Kiel and Gottingen, at which universities modern economics and the mathemati cal sciences played a considerable part. The National Socialists thought little of the discipline. The expulsion of scholars of Jewish origin and political opponents in 1933 was a painful blow to this and other subjects. Many well-known social scientists had to ee and left behind a thinned out academic eld. It did not of course as was assumed for a long time mean that sociology almost died out completely. Some younger sociologists were able to carry on working at universities, especially as demographers, agrarian sociologists, statisticians and industrial sociologists. They were mostly committed to empirical practices and advanced the professionalization of their subject. After 1945 the Americans specically encouraged the revival of the social sciences at West German universities, and this included sociology, which they wished to see conveyed as an applied discipline. Everywhere that the subject had been represented before 1933 it was quickly taken up once more in new teaching and research activity.35 It was boosted by the return of emigrants such as Ren e Konig, Max Horkheimer, Theodor W. Adorno and Helmut Plessner. Until the middle of the 1950s sociology led a peripheral existence. At the same time there was a erce debate as to how the subject should be understood, and it was not at all clear how the study of it could be presented in an attractive light. The chairs were mainly located in the economics or humanities faculties. Until the 1950s there were no binding examination regulations. Up to 1952 sociology in the Federal Republic had ten professorships. Afterwards the number of these as well as the number of students grew rapidly, particularly in the 1960s. The high point was attained in 1970/1. At this time there were no fewer than 131 professors of sociology active
34

35

D. Kasler, Die fruhe deutsche Soziologie 1909 bis 1934 und ihre Entstehungsmilieus (Opladen, 1984); K. W. Norr, B. Schefold, and F. Tenbruck (eds.), Geisteswissenschaften zwischen Kaiserreich und Republik: Zur Entwicklung von Nationalokonomie, Rechtswissenschaft und Sozialwissenschaften im 20. Jahrhundert (Stuttgart, 1994). Cf. the contributions in G. Luschen (ed.), Deutsche Soziologie seit 1945, Kolner Zeitschrift fur Soziologie und Sozialpsychologie, Sonderheft 21 (Opladen, 1979), in particular R. Lepsius, Die Entwicklung der Soziologie nach dem Zweiten Weltkrieg 1945 bis 1967, 2570. Statistics and further analyses ibid.

384

Social sciences, history and law in various positions at West German universities. From the middle of the 1970s the growth in numbers and also the expansion of the subject fell back drastically. The reason for this was the economic crisis and in consequence the reduction in funding for universities. A further factor was the problematic role of the social sciences during the student protests as well as the one-sided preferential treatment of these subjects in the planning euphoria of the late 1960s and the early 1970s. At the same time condence in the solidity and academic validity of the discipline declined. The place of sociology and its understanding of its own role, however, remained uncontested throughout. After 1945 three competing schools formed within sociology in the Federal Republic. There was rst the Cologne school under Leopold von Wiese and Ren e Konig, which was theoretical, international and empirically analytical; secondly, the Frankfurt sociologists later known as the Frankfurt School and the leading representatives of a liberal Marxist position with Horkheimer, Adorno and later Habermas; and thirdly, the Munster school led by Helmut Schelsky, who worked mainly mathematically using pragmatical, empirical methods, and without any great stress on developing theory. From this last school were recruited most of the university lecturers in the subject. Those academics who had remained in Germany during the Third Reich came together at rst both alongside and within these schools. They came partly from institutes which were outside the universities and had been founded after the war on American lines, carried out surveys and continued to exist in parallel with the universities. The subject itself, despite enjoying great popularity among students for a limited period, had no lasting inuence on the faculties in which it found itself. Its public prestige grew, but it never obtained a status comparable to that existing in the USA. This also applied to the prospects of the students, who had few real chances of a career outside the opinion research institutes and the universities. However, it had become the norm in the meantime for sociology to be taught at every university. Because of its relative lack of a unied appearance, it was all the more important to provide solid techniques and materials in order to enhance the students career opportunities and to convince sceptical colleagues from other disciplines of the scholarly basis and solidity of the subject. The sovereign level of interpretation which seemed to have been reached in the years of the student protests was soon a thing of the past, and the left-wing bias no longer informed all branches of the subject. Even the Frankfurt sociologists barely had recourse to their earlier works and ideas. Their predominant interest in the (possible) survival of fascist and National Socialist thought still made the analytical power of Marxist approaches appear viable, but this

385

Notker Hammerstein did not lead them to take up the earlier extreme Weimar positions.36 These were further developed into Critical Theory, which claimed to interpret the totality of history, but free from Leninist-Stalinist degenerations. Alienation, fetishism, false consciousness/conscience were the code words, which were to be exposed in their dependency on the reproduction mechanisms of the late capitalist system based on prot accumulation and consequently identied and brought to an end.37 In the GERMAN DEMOCRATIC REPUBLIC Marxist ideas as formulated in the Soviet Union determined relations with sociology and the other social sciences. The subjects had a subordinate position and were obliged to transmit doctrine according to the prevailing party line. Even with the passage of time they failed to achieve any greater signicance at the East German universities. It was only after unication that they were introduced or reintroduced on similar lines to the situation in West Germany.38

political science Politics along with sociology shares a certain conceptual uncertainty. In the German-speaking area this is extremely clear. There is talk there of political science, the science of politics, and politics according to how the person speaking wishes to dene the subject. Despite the long existence of disputes about the state, legitimacy, power, sovereignty, justice and other matters, the university discipline of politics is in its present form extremely recent. For, in contrast to the nineteenth century, when it was taught in France and Italy as part of jurisprudence and in Germany as constitutional studies, after 1945 it took on quite another character. This did not take place in a uniform manner or without passionate disputes. The previously normative doctrine of the constitutional state, of legitimate rule, of institutions which were in conformity with the law, was joined by and indeed displaced by a pragmatic, descriptive, behaviourist, psychologizing concept of the subject in many manifestations and combinations. It split up into subdisciplines, which often formed combinations with other
36

37

38

C. Albrecht, G. C. Behrmann, M. Bock, H. Homann and F. Tenbruck, Die intellek tuelle Grundung der Bundesrepublik: Eine Wirkungsgeschichte der Frankfurter Schule (Frankfurt and New York, 1999). O. Rammstedt, Formierung und Reformierung der Soziologie im Nachkriegsdeutschland, in K. Acham, K. W. Norr and B. Schefold (eds.), Erkenntnisgewinne, Erkennt nisverluste: Kontinuitaten und Diskontinuitaten in den Wirtschafts-, Rechts- und Sozialwissenschaften zwischen den 20er und 50er Jahren (Stuttgart, 1998), 25189. Cf. J.-S. Kowalczuk, Geist im Dienst der Macht: Hochschulpolitik in der SBZ/DDR 19451961 (Berlin, 2003); M. Parak, Hochschule und Wissenschaft in zwei deutschen Diktaturen: Eliteaustausch an sachsischen Hochschulen 19331952 (Cologne, Weimar and Vienna, 2004).

386

Social sciences, history and law social sciences. Whether with history in a return to older theories, with psychology (behavioural context), with sociology (social context) or with social anthropology (cultural context), politics has the most varied facets depending on the questions pursued.39 Reducing it to a single concept has been possible only to a limited extent. On the other hand the conviction won through that the modern world, as it was after 1945, required a theoretical investigation into, and a practical search for, the possibilities of national and international human coexistence. It was felt that the study of politics might make possible within the state system a modern democratic form of communal life serving the common good. This belief was derived from the observation that in those Western democratic states in which there was prosperity, and above all in the USA, this particular social-science discipline was taught at almost every university. Immediately after 1945 political science in the USA fought vigorously and successfully for a place in the universities, something which only happened slowly in the European countries. The example of the new world power, the USA, helped in this case too.40 The belief that this academic discipline was capable of creating better and fairer conditions in the world moved UNESCO to recommend it to all member countries as an important university subject. It was, they said, the right vehicle for successful social reconstruction after the catastrophes of the Second World War.41 Thus in the 1950s in almost all European countries the development of politics as a university subject began and culminated, like sociology, in a rst high point in the 1970s. Even if national traditions still remained important, a greater internationalism of scholarly methods and discussions had in the meantime become the norm. A European Consortium for Political Research led by the Norwegian Stein Rokkan was set up on the lines of the consortium at the University of Michigan to link up research transnationally. The Ford Foundation donated considerable means to this venture. European cooperation was to be encouraged through conferences, journals and support for young scholars in order to provide a counterweight to North America. A survey of political scientists at the end of this decade showed that there were 587 in the UK, 390 in the Federal Republic of Germany, 306 in France, 164 in the Netherlands, 112 in Italy, 92 in Belgium, 83 in Denmark, 81 in Switzerland, 80 in Sweden, 26 in Spain and 4
39

40

41

O. Ruin, Political Science, in Clark and Neave, Encyclopedia II, 2126f.; Handworterbuch der Sozialwissenschaften, Vol. XIII (Gottingen, 1964), 388ff. Particularly W. C. Andrews (ed.), International Handbook of Political Science (Westport, Conn., and London, 1982). Ibid., 3ff.

387

Notker Hammerstein in Portugal.42 The gures were of course disproportionately higher in the United States, which still had a leading role in quantitative terms and, in particular universities, could have up to thirty academic staff in this subject. In this way the many different methods and concepts of the discipline could nd expression. It also showed, however, the high esteem which it enjoyed among politicians. The central issues in political science, the theoretical discussions and also the methods changed, of course, according to the shifting political and ideological conditions. This was the natural result of the subjects claim to be able to identify, analyse and change the prevailing political circumstances and problems. A glance at some of the subject areas chosen for study shows why the university study of politics developed in a way specic to each particular country, and what direction it took. Questions of power, of raison d etat, of legitimacy and of political institutions, and also of international relations all seemed to come to the fore after the war and to last well into the 1950s. The rst post-war generation of political scientists considered these general questions, which were on the whole avoided by later more specialized researchers, as the decisive fundamental questions. Men like Quincy Wright, Raymond Aron, Jean Meynaud, Hans Morgenthau, Carl J. Friedrich, Henry Kissinger and Bertrand de Jouvenel dealt with them using a mixture of historical and political considerations. Later questions of legitimacy prevailed and their signicance for political stability was the main subject of interest for S. M. Lipset, S. P. Huntington and Zbigniew Brzezinski. At the same time there was ongoing discussion of the great world schemes, as developed by Hegel, Marx, Lenin or Oswald Spengler, Vilfredo Pareto and Max Weber. They stimulated not only the works of political scientists such as S. M. Lipset and Stein Rokkan, but also those of sociologists like Shmuel Eisenstadt. Others opted for social Darwinist approaches, which found conrmation in the works of Konrad Lorenz. Some (C. H. Waddington, Carl Sagan, Rupert Riedl) spoke in favour of a science of politics based on socio-biology in order to achieve a sort of scientically assured dignity.43 In the 1960s these themes faded into the background. More specialized questions and more limited analyses the process by which certain decisions were reached, case studies into political behaviour, analyses of elections dominated discussions, together with methodological issues about the academic effectiveness of political science itself and of the necessity for data-based methods. By means of clear guidelines the subject was to be given a by no means unanimous denition of its own understanding of itself and of its academic status. Such methodological considerations tended partly towards approaches closely related to those
42

Ibid. 6, footnote 19.

43

Ibid., 9.

388

Social sciences, history and law of the arts subjects and partly to exact scientic procedures. As was only to be expected, they were often based on well-known theories or revived versions of older ones. Following Wilhelm Dilthey, some concentrated on hermeneutics among these were Leo Strauss and Richard Cox in the USA, Peter Laslett and Michael Oakeshott in England, and Raymond Polin and Robert Derath e in France. Beginning in the 1950s a new leftwing tendency became inuential, which, among other inuences, took on impulses from Scandinavian social democratic and Marxist politics, a critical doctrine which was based on class antagonism and was concerned less with producing social wealth than with a better distribution of it. A spontaneous open society bordering on anarchy was one of their goals, and it was the states role to further this. That such ideas were contradicted, and that the free market and fair competition were thought to be enough to bring about an open and democratic society,44 is not only self-evident to most people but also characteristic of the lack of a unied understanding in political science. Devotees of a psychological understanding of political science (especially followers of Freud or Adler), those with an ethnological base (taking their inspiration from the ndings of Margaret Mead and Daniel Levinson or those of L evi-Strauss and Jean Piaget) and those who espoused game theory or mathematical analysis competed among themselves to nd and implement the correct and most fruitful method. There was also no lack of representatives of a form of political science which felt it could offer appropriate solutions to problems using nothing other than empirical evidence and correspondingly standardized procedures. Modern data technology thanks to computers and quantifying methods could provide much more secure ndings than had been possible in the years before 1950. Alongside all of these practioners there were political scientists who acknowledged a debt to political sociology and its empirical methods, and in turn laid great stress on empirical data.45 System theory, cognitive research, modelling and other concepts all inuenced scholars, without, however, the discipline becoming vague, arbitrary or limitless as a result of this multiplicity of methodological and intellectual approaches. The core substance the achievement, the possibilities and the conditions of human life in a community remained intact, and there were many levels of understanding between the schools of thought, the academics and the universities. The idea of a unied methodology and theory, which had been argued over for so long, was nally given up at the beginning of the 1970s, without raising doubts about the ability of
44

45

Amongst them Karl Popper, F. von Hayek, Milton Friedman; see Clark and Neave, Encyclopedia II, 2126ff. Cf. R. Merton, M. Lipset, Daniel Lerner, Erwin Scheuch, Pertti Pesonen.

389

Notker Hammerstein the discipline to produce knowledge. In the meantime its position at the universities had become secure. Representatives of a more normative understanding of the subject rejected the behaviourist theory long dominant in the United States. Behaviourism in the social sciences, as here in the case of political science, concentrated on those aspects of human life which were readily apparent to the eye, and about which observers could rapidly reach agreement. The motives and drives of the protagonists could admittedly not be identied from outside, but could be deduced from their actions. This also held true, it was argued, for the groups, institutions, communities and organizations which formed the actual focal points of their interest. Their starting point was always the empirical base of every analysis, that is, the individual. Verication, quantication techniques, pure science was how David Easton described the methodological steps which led to scholarly ndings.46 A combination of anthropological, psychological and sociological knowledge, in other words interdisciplinarity, was, in addition, held to be more than useful. Theory and empirical data were to be harmonized in order to make the pronouncements of this politico-behaviourism for the most part watertight. Both theoreticians and empiricists would benet from this, it was argued. It was less about nding an all-embracing synoptic theory than orienting oneself around veriable hypotheses. Any form of scientically secure (or at least apparently scientic) method could be used to produce these analyses. The hope was that in this way political scientists would come to a general theory of human life and human communities, which was based on rm, universal knowledge. This goal was not in fact achieved, but many remarkable insights were obtained, which enriched the subject. In the 1970s the inuence of this approach gradually waned. It was forced to give ground to a modied theory, that of post-behaviourism. Now ideas such as relevance, engagement, action among others were part of the programme, which again did not contribute to a unied concept of the discipline. Thus political science, like politics, is characterized by a multiplicity and a pragmatic harmonization of views both in individual countries and internationally.47 The development of political science in the individual European countries after 1945 was always determined in part by the USA. In FRANCE, which, like other countries, could look back on a long tradition of theoretical views on politics, there was nevertheless no corresponding university subject. Such questions were always addressed within the faculties
46 47

Quoted after Sills, Encyclopedia, Vol. XII (note 3), 296f. Clark and Neave, Encyclopedia II, 2133; E. M. Kirkpatrick and W. G. Andrews, United States of America, in Andrews, Handbook (note 40), 371ff.

390

Social sciences, history and law of law or the arts. Although a private Ecole libre des sciences politiques had existed in Paris since 1872, which prepared candidates for higher government service, it was not until 1945 that political science rst qualied as a discipline worthy of acceptance in the universities. This was partly attributable to the American model, but to a larger extent to the war and its effects. The starting point for the new subject at universities was history especially contemporary history together with legal and comparativist views on government, parliamentarianism, power, the state and so on, all of them familiar to lawyers. The strong links in France to anthropology/ethnology and geography where these modern questions were concerned also became much more obvious. From this starting point there was also a path to mathematical analytical methods, but they never obtained a status comparable to that in the USA. Binding syllabuses were not introduced. The subject was taught as each particular academic thought right. Thus before 1978 the universities did not award any formal qualication of their own. Only then was a ma trise in politics introduced. After 1945 only the non-university instituts d etudes politiques presented diplomas, which qualied the holder to enter the Ecole nationale dadministration.48 The subject itself grew considerably at the universities in the 1960s and 1970s. Anglo-Saxon problems and methods were, however, rarely adopted. Instead, the French tradition aimed at producing universal interpretations and analyses, which are better understood anthropologically, sociologically, historically and philosophically than in purely analytical political science terms. This is clearly shown, for example, in the works of Foucault and Bourdieu. Their empirical investigations were carried out at the EHESS. The universities of a small Nordic country like DENMARK traditionally oriented themselves on the model of the North German Lutheran universities. After 1945 and after German occupation in the war the USA took the place of these, although the older links remained effective to some extent. Theoretically determined views of the subject had to be reconciled with or weighed against empirical ones, and deductive approaches against inductive ones. At both the universities in the country there was at this time no independent political science. It was only in 1968 that at the newly founded University of Aarhus a professorship was established in the subject. Characteristically, as was later also the case at Copenhagen and Odense, the chair was occupied initially by a lawyer or a historian. The subject led a rather modest existence.
48

See particularly P. Favre, France, in Andrews, Handbook (note 40), 15467. The relative youth of the subject is evident from the fact that there is neither a history nor a sociology of French political studies. Ibid., 166, footnote 6.

391

Notker Hammerstein In the early post-war years therefore the Danish version of political science followed the American model. In particular, the works of Arnold Brecht and David Easton and behaviourism were taken over. On the other hand, there were few takers for the hermeneutic approach to problems. The disturbances of 1968, which in Denmark were relatively civilized but ideologically decisive, led to new curricula and university regulations, and to a neo-Marxist tendency in political science too. The Frankfurt Institute of Social Studies from Horkheimer to von Friedeburg together with the works of Habermas were the model for young political science academics and their students. Along with the structuralism of Althusser and Balibar as well as the Stamokap School of the Danish communists, it gained great inuence.49 In ENGLAND, political science was an important and treasured element in the tripos at Cambridge during the 1920s and 1930s. In Oxford a new degree, PPE, was introduced in 1920, which incorporated politics along with philosophy and economics. PPE was established as a modern alternative to Classics (known as Greats) because it was thought that a course in Philosophy and Ancient History was no longer relevant for those entering the civil service; it was thus initially known as Modern Greats. The independent development of politics not usually called political science in Britain at other universities was slow until the new universities were created during the 1960s, although the subject gured as a necessary element in general studies at Keele, opened as a University College in 1950. The most important new elements in the study of politics after 1945 were research on general elections, pioneered at Oxford and later specialized at Essex, and on political parties, pioneered at the London School of Economics and followed up elsewhere in studies of political culture. General textbooks on political science were few, and successive governments did not tap members of the academic profession for political advice as they did in the United States. Nor were there critical schools of political science. Politics scarcely gured at all in courses of law. Nevertheless, an increasing proportion of those Members of Parliament who were university graduates had studied some politics at university.50 In the NETHERLANDS, politics as a subject of academic study did not exist at the universities before 1945. In 1948 a rst new department of political and social sciences was founded in Amsterdam, followed in 1953 by the Free University in the same city, and the Catholic university in Nijmegen in 1955. Leiden and Groningen followed suit in 1963 without there being any attempt to unify the content of teaching and courses. The
49 50

P. Nannenstad and O. Gaasholt, Denmark, in Andrews, Handbook (note 40), 13243. I owe this paragraph to Asa Briggs.

392

Social sciences, history and law rst professors came mainly, as usual in Europe, from law. Only after the middle of the 1970s did the number of graduations in the subject increase, and it too remained at a modest level. Teaching and research generally favoured empirical investigations, and they were often carried out along with the development of theory. The American inuence predominated, and analyses of elections and research into political parties were popular. Behaviourism and then the so-called post-behaviourism were adopted. French and, to an even greater extent, German political science were held to be traditional and uninteresting.51 Political theories lost their earlier prestige, and the links with other social studies, especially sociology and psychology, became obligatory. With acceptance of the subject students and teachers showed increasing interest in daily politics. During the student protests of 1968 political science in line with other social studies took up positions close to Marxism, which in Amsterdam in particular led to disputes which were not without violence. Theory and evaluation were to give way to decisive action. For a short period academic study was seen as a vehicle for social change.52 In the FEDERAL REPUBLIC OF GERMANY the revival of political studies took place thanks to the occupying Western powers above all the USA. At conferences in Waldleiningen in 1949 and in Konigstein in 1950 German scholars, together with scholars from the occupying powers, deliberated over the hoped-for contribution of the social sciences, and especially political science, to the democratic reconstruction of Germany. Whilst the French participants at these conferences argued from a theoretical, political and historical perspective, and yet at the same time had to admit that they could point to no institutes or chairs in their own country, the Americans offered immediate help both in terms of theory and practice. Through guest professorships and scholarships the discipline most likely to secure democracy was to be anchored and developed at the universities.53 As a result there quickly followed a third founding of the subject, which had once had a great tradition in the eighteenth century as Kameralistik and Philosophia practica and then in the nineteenth century as Staatswissenschaft. Now it was to link up with the American discipline which, in part at least, had absorbed and developed that tradition.54 At the universities the subject was greeted at rst with anything but universal enthusiasm. Many of the representatives of related arts subjects
51 52 53

54

A. Hoogerwerf, The Netherlands, in Andrews, Handbook (note 40), 22745. Ruin, Political science (note 39), 2132. A. Mohr, Politikwissenschaft als Alternative: Stationen einer wissenschaftlichen Diszi plin auf dem Wege zu ihrer Selbststandigkeit in der Bundesrepublik Deutschland 1945 1965 (Bochum, 1988). Manicas, History (note 2), 213f., calls this the de-Germanization of the American social sciences.

393

Notker Hammerstein expressed reservations at a (so-called) science based purely on practice and the application of that practice.55 The determination of the Americans and the political respectability of many of its supporters in time often the rst true representatives of the subject nevertheless led to the eventual establishment of chairs at some universities. There were indeed plans for university institutions devoted to political science, as in the days of the Weimar Republic, but they could only be realized later and only in a few cases. It seemed more important to establish the subject generally, and this was achieved rst in Hessen, and then in other federal states. It was difcult to nd acceptable candidates for the academic posts. Only a few of the professors who had emigrated to the USA and were familiar with the subject there were prepared to return to a destroyed Germany. Among them were Karl Lowenstein, Franz L. Neumann, and later Ossip Flechtheim, Herman Fraenkel and Eric Voegelin. And yet it was still a higher percentage than in sociology, that is around 25 per cent.56 Suitable politicians such as Hermann Brill, Otto Suhr or Ludwig Bergstrasser, politically interested candidates from the eld of journal ism such as Eugen Kogon, Dolf Sternberger, Wolfgang Abendroth and Theodor Eschenburg, who all contributed to building up the subject, were denitely not university insiders. To a sceptic, therefore, the subject appeared unacademic and lacking in seriousness. And yet by the middle of the 1950s these outsiders had managed to secure the existence of the subject in universities in Hessen, Berlin and Baden-Wurttemberg with at least thirty university staff.57 There was no return to the older celebrated prehistory. Since this had been unable to prevent anti-democratic thought and action, one now wanted to develop a new independent form of political science. The door was thus open for American interpretations of the subject. Individual scholars, of course, followed their own ideas, often harking back to older traditions. All of this did not contribute to a theoretically and methodically unied approach. There was much discussion, but it produced no result that yielded a consensus. In 1961 a document produced by the DFG (Deutsche Forschungsgemeinschaft) called for the establishment of professorships in sociology and politics at all universities within ve years.58 To a great extent this was achieved and, as a result, politics and sociology almost became the
55

56

57 58

G. C. Behrmann, Die Verselbstandigung der Wissenschaft von der Politik; Grundung und Begrundung einer neuen Fachwissenschaft, in Acham, Norr and Schefold, Erkenntnisgewinne (note 37), 44378, here 446. C. D. Krohn, Deutsche Wissenschaftsemigration seit 1933 und ihre Remigrationsbarrieren nach 1945, in R. von Bruch and B. Kaderas (eds.), Wissenschaften und Wissenschaftspolitik (Stuttgart, 2002), 437ff., here 447. Behrmann, Verselbstandigung (note 55), 455. The same was true for the pedagogical high schools.

394

Social sciences, history and law basis for the new educational studies in the Federal Republic.59 Examination regulations and academic degrees secured its development within the universities. Moreover, the changing political conditions of the 1960s had enabled the subject, which was still strongly oriented towards the arts, to expand its use of empirical and analytical methods, so that, in conjunction with sociology, it came to be seen as a real achievement of the new young Federal Republic. Between 1960 and 1970 the number of professorships doubled. All the new universities founded in the 1970s had corresponding chairs. In 1976 there were 133 professorships in political science in the Federal Republic. The adoption of American methods was not just limited to theory. Many voices were raised against behaviourism in the Federal Republic. They returned indirectly to the discussions of methodology that had prevailed before the First World War. It was a question of defending the normative political and moral claims of the subject (in its older version) against a pragmatically oriented discipline concerned with solving social problems. As it was no longer principally a question of securing democratic conditions and a free state, which, in contrast to the second German state, the GDR, seemed to have been successfully achieved in the Federal Republic, the subject could turn its attention to broader tasks. The Freiburg school under Arnold Bergstrasser and Wilhelm Hennis and the Otto Suhr Institute at the Free University of Berlin (FU) played a particularly important role in this. The convulsions of 1968 would temporarily boost the importance of the subject, but at the same time, just as with sociology, they brought furious, intolerant and violent controversies. Politics suffered just as much from this as sociology. After a few years of apparently enjoying a leading role in dening the present as the mainly neo-Marxist activists in the student movement thought the subject entered a crisis in the late 1970s. Because a less intransigent, new-left political science was taught and supported south of the Main, the subject managed to hang on to the status which it had attained and continue the broad spectrum of what were now normal research projects in a series of theoretical and practical empirical works. However, it never again attained the status which it had enjoyed in the 1960s and 1970s.60 Developments took a quite different path in AUSTRIA, although the country in the older phase of its university history bore many resemblances to Germany. The combination of different treatment at the hands of the victorious powers and a different role in relation to the Third
59 60

Behrmann, Verselbstandigung (note 55), 468. See also K. von Beyme, Federal Republic of Germany, in Andrews, Handbook (note 40), 16976.

395

Notker Hammerstein Reich, which the country attained after 1945, enabled it to achieve more independence than was possible for defeated Germany. Political science had not existed hitherto at the universities, and thus was felt to be no loss in 1945. Related topics were taught within the law faculties as elsewhere and were prescribed centrally by the state. It was only in the 1960s that thought was given to introducing the subject on the German model, after lectures were given on social-science themes at the newly created (1961) Institute for Advanced Studies in Vienna. The courses in this area which had been given in Salzburg had not succeeded in achieving any great signicance. It was only after the institution of courses and examinations uniformly across the whole country in 1971 that political chairs were created in Vienna and Innsbruck. The subject remained small.61 Its legal and historical content was reduced and via Germany American practices and methods were taken on, but theoretical questions continued to have a high status. The introduction of political science in equally small SWITZERLAND took a somewhat different course.62 The Helvetian Republic, neutral and apparently untouched by the war, had no comparable conditions after 1945 to surmount, let alone the catastrophes which had befallen its European neighbours. A stable democracy with its long tradition did not demand remedies drawn from the social sciences. Questions relating to the political and social order could be deliberated and decided using the means of jurisprudence. Political science was unknown in the universities as late as the 1960s. Only in Geneva was an attempt made to gain distinction by means of such an unusual discipline, and there it took place on the basis of existing international institutions, on a French model, and from a feeling of being in a minority dominated by Germanspeaking universities. In 1927 an Institut universitaire de hautes e tudes internationales was founded, which achieved a high ranking in the eld of international political studies. In the process, no homogenous doctrine or theory emerged; this was as little the case in Switzerland as in other countries, but at least people had become aware of the existence of political science. And so in the 1960s in German-speaking Switzerland, that is, in Basle and Zurich, a chair in politics was introduced, which in each case belonged to the law faculty. In St Gallen a similar professorship was located with the economists and in Bern two chairs were added, in the economics and social studies sections of the law faculty. In SWEDEN the universities could equally look back on a long tradition of subjects, which, like history and jurisprudence, dealt with political theories. Thus after 1945 in contrast to the other Scandinavian
61 62

P. Gerlich, E. Talos and K. Ucakar, Austria, in Andrews, Handbook (note 40), 8592. M. Wennegah and D. Frei, Switzerland, in Andrews, Handbook (note 40), 32735.

396

Social sciences, history and law countries they kept to their established teaching practice. They did not have an independent political science discipline. It was not until the 1960s and 1970s that they accepted American practices and theories, and like the Danish and Norwegian universities, they then held fast to these. The subject experienced an enormous surge of popularity. At the ve nontechnical universities in the country social studies faculties were introduced, but even taken together they were numerically no bigger than a single American department. The late 1960s also brought student unrest in Sweden, but on a smaller scale than in Germany or France. Political science clung to behaviourism, and Marxist positions were not particularly signicant. Scandinavian socialism was more concerned with appearing socially modern than orthodox, that is, Marxist. The crisis of the 1970s also had a depressing effect on a subject which set great store by optimism about the future, but the depression did not have a lasting effect on the directions of research. There was, at most, a shift from assured knowledge about planning and improvement to an analysis of political processes and institutions.63 The famous neutral politics of Sweden, spared the upheavals of other European countries, appeared to offer no grounds for an ongoing and critical analysis. In many areas the country seemed a model. Academics were expected to support the politics of the country.64 In the UNION OF SOVIET SOCIALIST REPUBLICS developments took a quite different course from the processes described so far. Despite its assurances to the contrary, communism by its very nature allowed no free research, and especially not in the social sciences and arts. Their job was to carry out clearly prescribed tasks. The ministry responsible and the Academy of Sciences dened the contents of the textbooks and teaching materials. In addition, a thorough exegesis of Lenins writings in particular was obligatory. At the universities of Moscow, Kiev and Leningrad (St Petersburg) and also in the Urals there were special institutes, which were modelled on the Moscow Department of Higher Education and which had the task of turning their students into well-schooled political functionaries, into teachers at the schools and into the next generation of scholars. About 27,000 academically trained persons were thus produced up to the early 1970s. Around 3 per cent of them had gained their doctoral degree and thus formed the upcoming generation of scholars. It was their job to make sure that the country as well as all aspects of scholarship remained equally permeated with Marxist-Leninism and
63

64

O. Ruin, Sweden, in Andrews, Handbook (note 40), 299319; J lek, Historical Compendium. Behrmann, Verselbstandigung (note 55), 455.

397

Notker Hammerstein oriented towards it.65 The same was demanded of all the satellite states and copied most slavishly in the German Democratic Republic. With the end of communist rule the situation changed, and there emerged cautious approaches to Western ideas, but the social sciences were not able to achieve a comparable status in the universities. In many countries there was also a lack of suitable teachers. The reception of Western social sciences varied widely according to the country and its traditions. As was the case in the other European countries, national preferences and customs remained important. In general American methods and theories were the model.

economics Economics had a long tradition but developed relatively late into an independent university subject. Until the late nineteenth century it was taught in Germany especially, but in France too in the form of cameralism or national economics mostly in the law faculties, but also in the philosophy faculty within Philosophia practica and the doctrine of natural law and ethics. It was only in 1914 that a separate economics and social studies faculty was set up at the newly founded university of Frankfurt am Main. National economics, business studies and sociology were taught together here, without it ever becoming clear how a theoretical linkage of the different subjects could be achieved. National Socialism and fascism, and even more the Second World War, changed the existing parameters rst in Europe and then in the USA too. As economic matters could hardly be considered separately from politics, the catastrophe of the war and the attempt to unify Europe and its eventual success represented a considerable challenge for economics. For the most part regulatory guidelines were expected from the state and from politicians. The considerably modied German Ordoliberalism of the socalled Freiburg school, the teachings of the English economist Maynard Keynes and those of the Dutchman Jan Tinbergen, all of them, in contrast to the USA, saw the obligations of the public hand and had little regard for the market itself or for an open, self-regulatory society. Using statistics, econometrics and mathematics, an attempt was made to ascertain the fundamental conditions of national economies. The older, German, historical and arts-based formulations of the questions were largely abandoned. In economics, too, despite internationalism and the pre-eminence of the USA, national traditions carried on shaping the formulations of the problems and the lines of approach. At a time of integration Europe saw
65

V. E. Chirkin, Union of Soviet Socialist Republics. Socialist Political Science, in Andrews, Handbook (note 40), 33651.

398

Social sciences, history and law itself as an independent yet nevertheless grateful partner of the United States. Clearly the diverse treaties, measures and options which were designed to bring about a united Europe called for adequate economic and political models, for statements and for actions. From the Marshall Plan (1947), the OEEC (1948), the Council of Europe (1949), the European Coal and Steel Community (1951) right up to the Treaties of Rome via the EEC and Euratom (1957), there was a long sequence of challenges, which were met by what was throughout an optimistic view of Europe over the period 1958 to 1972. The consequent economic and oil crises, the collapse of the Bretton Woods Treaty, budget crises and the expansion of the EC put a brake on this enthusiasm and optimism, yet from 1984 into the early 1990s new hopes for a better world economy emerged. Discussions about monetarism and common scal measures dominated both academic life and politics up to the Maastricht Treaty in 1992.66 The close connection between the two, which is so characteristic of the modern world, was constantly reected in the theories and doctrines of economics after 1945. This will be evident from a survey of conditions in some European countries. In the UNITED KINGDOM questions of a new economic order and economically sound policies had long been discussed. This did not, however, lead to a growth in the discipline of economics in the university sector or a corresponding increase in its standing. The numerically restricted, elitist access to universities which continued after 1945, and the traditional regard for the gifted amateur in both the governmental and economic spheres, made arguments for the introduction of a new discipline seem anything but compelling, although the linguistically easy access to the rapidly growing social studies in America ought to have changed this perception. A change in attitude and in university policy was needed to make possible the introduction of economics as a general university subject. This began in the 1960s and nally led in the 1970s to the growing employment of economists as academically fully equal university graduates in the business world and in the civil service.67 On the whole the universities followed the American model, and continued to pay little attention to continental initiatives in this area with the exception of the London School of Economics. That a Briton in the person of Maynard Keynes had developed the leading European economic theory after 1945 did little at rst for the discipline as a university subject.
66

67

A. W. Bob Coats, Introduction, in A. W. Bob Coats (ed.), The Development of Economics in Western Europe since 1945 (London, 2000), 2f. R. E. Backhouse, Economics in mid-Atlantic: British Economics 194595, in Coats, Development (note 68), 2041.

399

Notker Hammerstein In SWEDEN, a country which was largely spared the destruction of the war, many alert observers of economic and social developments in Europe had soon recognized that exceptional efforts would have to be made in these elds. They put forward strategies designed to shape the whole of the public and private spheres. Their generally left-wing approach saw state support and planning as the means to lead the country out of the poverty of the post-war years and to shape the future positively through the welfare state on a worldwide basis.68 Indications of the importance of economics were its many representatives who became members of parliament or indeed ministers and the founding of chairs in the subject (there were eight in 1945 and fty-seven in 1996) and corresponding institutes. Anglo-Saxon methods and theories increasingly displaced the national traditions. The increase in academic posts also led to a growing specialization. In the NETHERLANDS, too, academic attitudes to economics also gradually changed after 1945. As early as the 1940s the head of the Central Planning Bureau and later professor in Rotterdam, Jan Tinbergen, formulated macroeconomic models for a successful economic policy designed to lay the basis for post-war reconstruction of the severely damaged country. They were developed with one eye on world poverty and another on a socially just economic order. These issues were to be addressed by the use of modern econometric and quantitative methods together with a theory of economics which owed much to Keynesianism. Tinbergens model had an inuence well beyond the Netherlands and was for a time almost as inuential as Keynesianism itself.69 At the Dutch universities economists were expected to study not only the national economy, but also mathematics and econometrics. The growth of specialization on the American model forced the adoption of graded, less interdisciplinary courses. The number of students, lecturers and associate professors grew rapidly. The student unrest at the end of the decade and in the early 1970s had lasting effects on the subject, in that now Marxist theories were demanded, and also as in the case of Ernest Mandel adopted by the lecturers and young assistant lecturers. This led to the establishment of Marxist professorships in Amsterdam, Groningen and Tilburg. In Tilburg this was reversed in 1993, as students in the 1990s showed little interest in a subject which had declined into provincialism. In addition to the universities, private institutes as well as a few public ones contributed to the development and extension of the knowledge of
68

69

B. Sandelin, N. Sarafoglou and A. Veiderpass, The Post-1945 Development of Economics and Economists in Sweden, in Coats, Development (note 66), 4266. H. W. Plasmeijer and E. Schoorl, Post War Dutch Economics: Internationalization and Homogenization, in Coats, Development (note 66), 6793.

400

Social sciences, history and law economics. For this reason the Netherlands was sufciently innovative and liberal to absorb modern developments in other countries. This also held true for the universities, which, after overcoming the depredations of 1968 and the following years, became more and more international and in particular American in outlook. They increasingly focused on political questions and devoted less attention to macroeconomic theories. In BELGIUM economics had no particular status until 1945, and it was only in the 1960s that it gained importance, rst in Louvain and then in Brussels, though to some extent with very different academic approaches.The USA provided the model, rather than France or the Netherlands, although the approaches in these countries were taken into account. The academic emphasis was on mathematical method, game theory and monetarism. There was no real attempt to develop independent positions. Two directions of economics teaching had coexisted in FRANCE since the nineteenth century. Professeurs d economie politique confronted conomistes. The professors of e conomie politique teaching at ing enieurs e the universities belonged to the law faculty and in consequence mainly dealt with state targets and tasks of the economy. This corresponded to coles, ing French economic practice for centuries. At the grandes e enieurs conomistes were educated in a way which focused on mathematics and e scientic procedures. Even during the course of their training they were civil servants and most of them remained in public service. The economic theories and teaching remained genuinely French at both institutions, and were largely screened from foreign inuences. They were oriented towards the state and its service and did not approach economics from a historical or philosophical perspective as was the case in Germany or England. This situation prevailed until after 1945. From this point onwards Anglo-Saxon methods gradually gained ground, especially in the content of engineering courses. The introduction of statistics and econometric practices, and a stronger orientation towards the non-state economy, did not change the subject fundamentally, but it did open it up to contemporary standards. From 1970 onwards the professors of economics detached themselves from the law faculties, which led to a closer approach to the academic culture of the engineers and lessened the old distinction. The number of students in these subjects grew continually at least up to 1995 as did the development of the subject at universities. The socialist governments also supported this social studies discipline, and by the end of the century the last sixteen of the approximately sixty universities had introduced economics and business studies departments. The founders of Dauphine University in Paris capitalized on the need for institutional change in French higher education after 1968 by creating 401

Notker Hammerstein a university base for decision-making and organizational sciences. Their initiative combined the Anglo-Saxon interest in the rm as an organization with the tradition of French economics. ITALY represents a special case in a different way from France. National economics (economia politica) was taught at the universities as in France within the law faculties. The setting up of commercial colleges (scuole superiori di commercio) in Venice, Bari, Turin and Genoa at the end of the nineteenth century strengthened the independence of the subject indirectly. As these schools were only intended to train and not to carry out research, they hardly had any effect on the universities. Here law and economics remained closely linked and empowered many of their representatives to take a direct part in the politics of the country. They represented liberal, fascist or Marxist tendencies. These positions lasted beyond 1945 and remained inuential despite strong Anglo-Saxon inuences. After Mussolini, Italy both stood on the side of free trade and the international interdependency of markets and also on the side of a strong state-controlled economy. It is only possible to talk of Americanization to a limited extent. The closeness of economics to the everyday politics of the country was just as difcult to reconcile with the abstinence shown by many American colleagues towards practical politics as it was with Soviet or Chinese theories of state planning. In the 1960s and 1970s independent economics faculties were founded. Although modern international methods of economics were adopted, they had only a limited effect on the traditional theories and modes of behaviour. Political economy viewed itself as an auxiliary discipline for the other social sciences, law in particular. And yet considerably more students than before opted for the subject, as, in view of the increased demand, the career prospects seemed attractive. In the 1990s the faculties began to take on board business studies, and the leader in this was the private Bocconi University in Milan. The academic interest which had been traditionally directed towards urban situations also grew stronger in these elds of study.70 In SPAIN the foundation of a faculty of political and economic sciences at the University of Madrid in 1944 represented the beginning of independent economics courses. In 1955 Bilbao and Barcelona followed suit.71 As one might expect from the authoritarian regime of the time, the curricula, which were laid down by a teaching syllabus in 1953, were strictly
70

71

I. Maes, E. Buyst and M. Bouchet, The Post-1945 Development of Economics in Belgium, in Coats, Development (note 68), 94112. C. Schmidt, Economics in France: A Manifold System, in Coats, Development (note 66), 12947. P. L. Porta, Europe and the Post-1945 Internationalization of Political Economy: The Case of Italy, in Coats, Development (note 66), 14890. S. Almenar, The Development of Economic Studies and Research in Spain (193995), in Coats, Development (note 66), 191226.

402

Social sciences, history and law controlled in a way which was more suited to secondary schools. During the transition from dictatorship to democracy between 1975 and 1978, the number of students increased rapidly. Economists now had access to career prospects which previously had been reserved for graduates of other disciplines. Reecting the changed situation, a new curriculum introduced new materials largely based on the American and in particular the Chicago model and made economics a very desirable subject. A law of 1970 had already incorporated the business schools into the universities, and this increased the number of faculties and the number of those teaching and studying. The increase was not, however, reected in the number of doctorates, which in general were only undertaken by those seeking a university career. Thus there was not a critical mass for high-class research, however, and, as a result, the university economics institutes failed to achieve a high ranking. In GERMANY national economics was a well-developed discipline taught mainly during the Wilhelminian era within the framework of the law or humanities faculties, even if it was never introduced independently at all universities. As has already been mentioned, the last university foundation of the Wilhelmine period, Frankfurt am Main, had introduced an economics and social studies faculty in 1914, and during the Weimar Republic other universities followed. Again, as already shown in the section on politics and sociology, economics could look back on a distinguished tradition in Germany, which continued to exert a decisive inuence after 1945.72 Because of the border with the Soviet zone and the existence of the DDR, Marxism was peripheral, and liberal, state-oriented theories prevailed. The Freiburg School, which was dominant after 1945, had emerged in the 1920s and expressed its opposition to National Socialism by formulating its liberal yet structuring principles founded on Christian freedom and the rule of law. The policy of the Federal Republic under Adenauer, and the inuence of the minister of economic affairs, Ludwig Erhard a disciple of the Frankfurt economist Franz Oppenheimer, who had emigrated to Palestine together favoured an economic understanding of the country, summed up in the phrase the social market economy. These developments also worked in favour of economic theory at universities.73 Their stress on freedom was not derived from the Western European idea of freedom, however, and in the end they leaned on the state as an organizing power. This hindered their general acceptance and stamped
72

73

H. Hagemann, The Post-1945 Development of Economics in Germany, in Coats, Development (note 66), 11328. E. Heu, Kontinuitat nach dem zweiten und Diskontinuitat in der Nationalokonomie Weltkrieg: Ordoliberalismus versus Keynesianismus, in Acham, Norr and Schefold, Erkenntnisgewinne (note 37), 33149, here 332f.

403

Notker Hammerstein them as a unique case of post-war development.74 Social policy in conjunction with economic policy was central. Admittedly this did not mean an acceptance of Keynesian positions, but it was not too far away from many of them, and in view of the catastrophic situation in the country the response in economic terms was bound to have a Keynesian form. Characteristically, university teaching was determined by the textbooks of the Kiel professor Erich Schneider, now returned from emigration, and then a little later by those of the American P. A. Samuelson. The subject gained enormous popularity in the 1960s, which was also reected in the considerable increase in the number of professorships. Between 1960 and about 1980 the number of these rose from 537 to 2,907.75 The faculty of economics grew to be the largest at the universities, although sociology and politics also contributed to its rise. From the 1980s onwards the subject grew largely thanks to business studies, which were and are more practice-based than theoretical. In addition to the universities, but in collaboration with them, six important economics institutes were founded in the 1960s, which mainly carried out empirical investigations. They not only offered career prospects for economists and sociologists but also their theoretical principles to a large extent reected the prevailing research initiatives at the universities. In AUSTRIA the development of political economy also has its roots in the nineteenth century. In contrast to Germany it was not carried along by the universities. Around the turn of the century in Vienna, schools of psychology, medicine, legal theory and political economy as well as art history emerged. They formed their own individual circles and developed through the cross-fertilization of ideas. They attracted gifted young people, with the result that teaching and research in these various subjects moved out of the universities into these open and stimulating private circles. Famous examples are the Geistkreis (Intellectual Circle), the Political Economic Society, the Private Seminar of Ludwig von Mises among others. Many participants in these loose scholarly groups had to emigrate in 1938 after the arrival of the National Socialists. The network of intellectuals was scattered. Still, their ideas and also many of their members continued to have an inuence in Western Europe, and beyond that on the study of economics in America. Gottfried von Haberler, Friedrich August von Hayek, Fritz Machlup, Ludwig von Mises, Oskar Morgenstern all emerged from the Viennese School, and as early as the 1920s and 1930s they developed and stimulated what were to become essential methods for economics after the Second World War.76
74 76 75 Hagemann, Development (note 72), 123. Heu, Kontinuitat (note 73), 353. K. H. Leube, Uber die Diskontinuitaten und Kontinuitaten der osterreichischen Schule der Nationalokonomie, in Acham, Norr and Schefold, Erkenntnisgewinne (note 37), 30124.

404

Social sciences, history and law This intellectual blossoming in Austria began before the end of the imperial era, and in the case of economics it can be traced back to the curriculum of 1856. The effect of this was to link legal education closely to the study of economics. The emperor wanted a class of civil servants with a general education, who could advance the multinational state both economically and intellectually. This not only paved the way for the much later independence of political economy, but also explains why its rst and most inuential representatives were lawyers. The disappearance of this inheritance under the Nazis has been a considerable loss to the country. Nevertheless, after 1945 and under very difcult conditions an effort was made to re-establish links with this heyday of economic studies. It was only possible to a limited extent as the division into zones of occupation and the dominant position of the neo-Marxist social democrats encouraged a concentration on other areas and favoured a cooperative, state-controlled economy.

anthropology/ethnology This often changing subject also has a long history, which at rst did not bring it independent status at universities. The concern with so-called native peoples goes back a long way, as it was hoped it might shed light on the early history of humankind. Reports from missionaries, colonial ofcials, military men and travellers formed the rst foundations of a written study of ethnology. Collections and museums were founded which took an interest in native peoples and attempted to develop a scholarly examination of their artefacts and thus of the world they came from. It was principally in Germany and England that the rst attempts were made to introduce these materials into university teaching, and anthropology as an already established subject offered itself for this purpose. It is thus understandable that among the early ethnologists scientists predominated, especially as this unusual discipline could draw support from physiology, physics, biology, geology, geography and palaeontology. The study of human nature through empirical investigation too was the goal behind this analysis of usually small populations and their social order and culture.77 How this was to be done was less clear and led to many different theories and procedures. One of the older teaching ideas, the diffusion theory, started from the assumption that an originally uniform humanity had developed in different ways in accordance with the notion of progress and that European culture and lifestyle was the as yet most perfect realization of this idea. Faced with the increasing number of empirically based studies
77

B. Shore, Anthropology, in Clarke and Neave, Encyclopedia II, 2081.

405

Notker Hammerstein in the early part of the twentieth century, this notion had to be abandoned. New theoretical approaches had to be found to take account of them. In the UNITED KINGDOM social anthropology took the lead with the development of functionalism. Under the guidance of Bronislaw Malinowski and R. Radcliffe-Browne, the subject gained university status. In 1927 the London School of Economics set up the rst chair in social anthropology for Malinowski and in 1937 Oxford followed suit with a chair for Radcliffe-Browne. Even if their understanding of functionalism was not identical, the same basic assumptions underpinned their approach to the subject. Both of them were concerned with achieving exact methodological procedures comparable to those of the natural sciences. This determined the way they carried out analyses of the societies they examined, viewing them as macro-organisms and systems, where there was a necessary connection between the study of individual elements and a grasp of the whole.78 Their work on small societies for which a comprehensive overview was possible enabled them to analyse individual social or cultural institutions and to show what and how they contributed to the totality of the society considered as a system. The result was a static rather than a historical overview since it reected the situation during the actual period of eldwork. There was a connection here with Malinowskis conviction that all cultures had to satisfy the same basic biological needs, and thus that culture was founded on nature. His pupil Talcott Parsons attempted to make such assumptions bear fruit in sociology. Radcliffe-Browne was of the view that culture was not naturally conditioned, but was instead an important function of social structures. This corresponded, he argued, to general human traits. He analysed individual institutions with regard to their integrative function for the totality, which was in turn sustained by the social structure that was essential for its existence. Thus he guaranteed the maintenance of that continuing order which is vital to societies. In the 1950s this direction came under increasing criticism. The argument was that it concentrated too much on questions of kinship, did not take into account sufciently the work of non-English colleagues, and neglected historical and social change.79 The beginning of the break-up of the colonial empire also contributed to a rejection of its concentration on statistical and synchronous analyses, and to a criticism of the related image of society as founded on a consensual balance of forces. It was now
78

79

K.-H. Kohl, Ethnologie: Die Wissenschaft vom kulturell Fremden, 2nd edn (Munich, 2000), 138ff. W. Petermann, Die Geschichte der Ethnologie (Wuppertal, 2004).

406

Social sciences, history and law thought to reect an ideological pipe dream. For British social anthropology this represented a severe crisis from which it took a long time to recover. After 1945 American cultural anthropology, thanks to the important advisory role of its representatives in the invading armies, began to play an increasingly important role in the elevation of ethnology to a university subject on the European continent. From its founding father Franz Boas to Ruth Benedict, Margaret Mead, Alfred L. Kroeber and Melville J. Herskovits, they all saw in every form of human culture something that was unmistakably unique, and thus they managed to distinguish themselves from the historicizing evolutionary theories of the Europeans. The post-war period brought about an enormous growth in ethnology in Europe and a general acceptance of the subject as a university discipline. Admittedly there had already been professorial chairs in Germany and France in the Netherlands and in Belgium which dealt with this material, but they mostly bore other names such as national psychology, or Volkerkunde . The colonial powers were often motivated to set up corresponding institutions because of their overseas possessions. Signicantly, many of these institutes in the Netherlands, England and France were closed after decolonization, and ethnology remained, initially at least, a small subject at universities despite a spate of remarkable ethnological works. In GERMANY the establishment of chairs in Hamburg, Cologne and Frankfurt am Main after the First World War could largely be attributed to a mix of motives including commercial policy, cultural and sociological interests, and romantic and philosophical impulses. In 1945 these old ideas continued to hold sway. The events of 1968, however, not only forced a change of paradigms, but also brought about an enormous surge in the popularity of ethnology largely for political motives, as foreign models were now honoured as better.80 Professorships were mainly established in the humanities, though also at times in the economics and social science faculties. In FRANCE ethnology grew after 1945 in a similar fashion. At once a new anthropological theory emerged, which built on specically French traditions and went on to become very inuential in the 1950s and 1960s. It is most closely bound up with the name of Claude L evi-Strauss and deliberately goes beyond the great inuential gures of Durkheim and Marcel Mauss. L evi-Strauss took his methodology from other subjects, in particular from Saussures linguistics, and considered geology, psychoanalysis and Marxism to be important auxiliary
80

In 1999, 12,888 students were inscribed in the twenty-two institutes then existing in the Federal Republic; see Kohl, Ethnologie (note 78), 13.

407

Notker Hammerstein disciplines.81 The investigation of kinship and marriage behaviour as well as the myths of undeveloped peoples caused him to come to the view that every social order follows logical rules, which are attributable to the roughly identical genetic make-up of human beings. Every culture is determined by clear anthropological constants founded in the cross-cultural identity of the human mind. In contrast to functionalism, which in this basic assumption it otherwise resembles, structuralism locates this identity in the unconscious. It is also ahistorical. Thanks to its debts to modern concepts of literature and language, it had a powerful inuence on the study of history and literature not only in France and also on philosophy and psychology. Michel Foucault, Roland Barthes, Jacques Lacan, Louis Althusser despite all their differences owe crucial concepts to L evi-Strauss, and all share his basic anti-historical position. In the late 1950s anthropologie structurale became the prevailing mode of thought in France, but L evi-Strauss was not accepted into the Coll` ege de France and the Sorbonne until the 1960s. He had already built up a following at the Mus ee de lhomme, the Ecole pratique des hautes e tudes and the Institut dethnologie. Forming a sharp contrast to the previously dominant existentialism, this way of thinking had a formative inuence on the French, and in part also the European intelligentsia, into the late 1970s, before it was replaced by Foucault and Derridas poststructuralism. Outside France this line of thought found no followers within ethnology.

geography Geographers describe, analyse and explain human and physical (material) characteristics of the earth. One peculiar feature of their work is that they both store and express this information in maps. The broad spread of the natural landscape as well as the built environment is their concern and has been from time immemorial. Methodologically this points to an empiricism which divided itself between physical and human geography, since the subject took hold in many universities in the late nineteenth century.82 Merely tolerated and not taken really seriously in its early stages, geography developed as a university subject in Europe from the 1920s onwards, and in the USA it formed part at least of the basic curriculum
81 82

Kohl, Ethnologie (note 78), 856ff.; Petermann, Geschichte (note 79), 854ff. J. Bird, The Changing Worlds of Geography: A Critical Guide to Concepts and Methods (Oxford, 1989).

408

Social sciences, history and law for undergraduates.83 It was considered to be particularly helpful for historians, and this connection was made obligatory in France, which makes its elevated status there understandable. It was not only in the Annales school that geographical considerations were given a central signicance in the study of the human condition. Because of its interest not only in human artefacts, but also in natural phenomena, geography appeared useful to the representatives of the humanities and social sciences, and indeed more than that: it appeared essential as an easy bridge to relevant facts about the natural world. It was either integrated in the humanities faculty and/or into the science faculty. As economic geography it sometimes found a home in the social sciences. What actually constitutes geography remained a matter for debate, even if the relative ease with which an overview of the subject could be achieved encouraged cooperation between colleagues. The Second World War demonstrated the usefulness of geographers and led after 1945 to a sort of boom in the subject, especially in France, England and the Federal Republic of Germany. Between 1950 and 1970 it grew considerably. Many of the geographers who came back from the war were shocked at the conservative university policies of their older colleagues who dominated the subject, and they initiated new developments. The theoretical bases for these were often derived from older German approaches; the practical, methodological ones were taken from the post-war Swedish school of the University of Lund. The growth of the subject encouraged specialization, which in turn led to criticism from both the left-wing and traditional representatives of the subject. In England in particular the criticism was especially vocal, as the subject had become as popular there as history or economics. In the 1990s the methodological and theoretical conicts between the various concepts of geography diminished, as geographers were able to provide important contributions to the new eld of ecology.84 The simultaneous contemporary postmodern criticism from Marxists and phenomenologists had as little effect on the subject as the claim of deconstructivists to be able to demystify geographical language and maps.

history In contrast to most of the other social sciences, history, if not always treated as one, was already represented at all universities in the nineteenth century. Its academic bona des were as little questioned as its prominent
83

84

B. W. Blouet (ed.), The Origins of Academic Geography in the United States (Hamden, Conn., 1981). D. E. Leary, in Clark and Neave, Encyclopedia II, 213650.

409

Notker Hammerstein role as a discipline and its central signicance for each particular nation. As a result, 1945 did not bring a sudden breakthrough to recognition and effectiveness. History shared, however, in the spread of professorships and the founding of new institutes throughout the years of re-building and growth. In another respect 1945 did represent a turning point, for the subject changed along with the value previously placed on it. The study of history had not been able to prevent the horrors of the twentieth century, although it had often posed as a political tutor. Nor had it contributed anything to the development of a modern democratic society in those countries of Europe which did not already enjoy such a political structure. Historical study had tended to support positions of power, it was alleged, rather than examining them critically. Many were inclined to place more hope in the new social sciences. History reacted in turn against this re-evaluation, and increasingly moved away from the depiction of national and political history, of great men and great powers and favoured other themes. The post-war period, though continuing older approaches, brought a fundamental change of direction from the history of states to social history.85 This reected not only contemporary ideas and experiences, but also a change in scholarly methods. At the same time positions were adopted, which from the 1920s onwards had led in the USA to the development of social history and in France to the Annales school. It was an approach thought to be better suited to a highly rationalized and technologically driven world and permitted the focus to be on the state, law, administration, anonymous structures, emotional movements and mass phenomena rather than individuals. The new economic history, histoire s erielle, not only used a mass of computerized data and other technical innovations, but also expected to gain new knowledge and new directions for research from apparently ahistorical phenomena such as climate, birth and death rates, prices and agricultural techniques. In FRANCE Philippe Ari` es, Franc ois Furet and Emmanuel Le Roy Ladurie in the 1970s hoped to gain insights into clear historical laws which could be revealed using these methods. The Annales school even went beyond such social and historical questions. Its founders Marc Bloch and Lucien Febvre, who used these approaches long before the Second World War, strove for a broader cultural history. They saw religion, the geographical region and ideas as highly inuential and to be taken into account. In the Sixi` eme section de lEcole pratique des hautes e tudes, Fernand Braudel and Ernest Labrousse sought to reduce these to one concept. History, they argued, did not follow a linear pattern but
85

G. G. Iggers, Geschichtswissenschaft im 20. Jahrhundert (Gottingen, 1996), 9f.

410

Social sciences, history and law moved along different timescales according to the region. Traditional national history lacked reality, and regional or even transnational and super-regional investigations were what was needed to gain access to the historical past. Geographical and biological preconditions as the permanent basis of human action received transforming impulses from the prevailing social and economic circumstances, and they in turn set the trends and recurring cycles that formed the basis of the collective and programmed political and social conicts. Only against such a background could the political and military events of the great men and their ideas be viewed and analysed.86 It was not a question of the actions of persons or of idealized notions of individuals. What was of interest was the complex of interhuman relationships and modes of behaviour. In the history of mentalit es pursued by a younger generation, this approach was taken a stage further into the realm of cultural history. Robert Mandrou, Georges Duby and Jacques LeGoff attempted to link agrarian, economic and social history to cultural history. All the various directions of the ourishing Annales school of the 1960s and 1970s were concerned with themes from the Middle Ages and the Early Modern period. They avoided the nineteenth and twentieth centuries and contemporary history. On the whole this form of historical thought was deeply embedded in French traditions, which partly explains the fact that it never achieved the same unied and successful form elsewhere. Some impulses from it were adopted in Europe, particularly in Italy, the Netherlands, Belgium and the German Democratic Republic, and even in the USA, but only to a limited extent in other countries. In the 1980s, however, the French historian and publisher, Pierre Nora, launched an important collection on the sites of memory, Les lieux de m emoire, which included in its scope not only major national events and mythologies, but also places, objects and festivals.87 This was a new approach to rethinking France and the French nation, and it had repercussions on other European national histories. In the FEDERAL REPUBLIC OF GERMANY history took another turn. The experience of the Nazi era and the knowledge of the crimes committed caused the younger representatives of social history, which also ourished there, to ascribe a critical function to every form of historical investigation.88 The older historiography had in their view failed completely; as the inuential French Annales school was only concerned with the pre-modern, they were left with the task of describing the recent
86

87 88

L. Raphael, Geschichtswissenschaft im Zeitalter der Extreme: Theorien, Methoden, Tendenzen von 1900 bis zur Gegenwart (Munich, 2003), 96ff. P. Nora (ed.) Les lieux de m emoire (Paris, 198492; 3 vols. in 7). W. Schulze, Deutsche Geschichtswissenschaft nach 1945 (Munich, 1989), particularly 207ff.

411

Notker Hammerstein past using an approach based strictly on social history, so as to analyse the errors and unique features of the national German past. To many the critical theory of the Frankfurt School seemed to provide adequate guidelines. In ENGLAND, in the leading social history journal Past & Present, founded in the 1950s, Lawrence Stone opted in 1979 for a return to narrative history, which, as the cultural history of the everyday, could initiate a move away from grand structures and back towards the individual. In so doing he was in tune with a much older form of criticism of social history such as that practised by the Annales school, which was sceptical towards a belief in progress and scientic methods, the paradigms of modernization. This criticism was repeated in other countries, and in France it came from post-structuralism and deconstructivism (Foucault, Derrida and Lyotard). Alterity, otherness, became a new code word, not least thanks to the related American New Cultural History. Thus a heterodox culture, which had hitherto been neglected, suddenly became evident, and it was of a kind corresponding to the oppositional commitment of many of these historians of the post-68 generations. It made it possible to carry out reliable reconstructions of past ages, which were an alien and distant realm for modern historians. At the same time, the great models of social studies had to plead guilty to the charge of harbouring an all too optimistic belief in progress. Literature before 1970 was no longer needed, so the argument went, and a canon of guiding values and leading works was as obsolete as the idea of national culture. Pluralism was the name of the game.89 Not much trust was placed in a rationally determined history. This was certainly true for French post-structuralism with its emphasis on linguistic theories. Outside the texts there were no historical facts according to Jacques Derrida and Roland Barthes; instead it was always simply a matter of linguistic codication. History, Barthes and Hayden White postulated, was like poetry: objective knowledge was not possible. In so far as language appears as a closed text, it cannot explain anything beyond itself, and only its inner purposes and ever present pretensions to power can be decoded (Foucault). Power is not only a matter of central institutions; everywhere it determines human communal life. From here it was but a small step to womens and gender history, to a political history of ideas, and to discourse as the linking together of an authors intentions in the context of time. The eld of historical questions has expanded enormously without there now being a general paradigm, such as still existed in the nineteenth and early twentieth centuries, to hold the various lines of questioning
89

Raphael, Geschichtswissenschaft (note 86), 215ff.

412

Social sciences, history and law together and to lead them back to one another. The most that can be cited is that an unusually critical attitude to the modern world, which after 1980 included certain anti-enlightenment components, are characteristic features of this development.90 The fact that the older form of historiography continued to exist in many countries does not detract from the value of the new developments after 1945. Biographies continued to be written as before and also monographs on particular epochs and events, intellectual and political history, treatises on the history of science and universities, on the history of international relations, on ecclesiastical and religious history; all paid due homage to the new theories and their results, while attempting to meet the need felt by every generation to confront or come to terms with the past appropriate to their times. A sub-eld of history peculiar to the post-war period, whose development well illustrates the themes of this chapter, is the history of science and technology. Apart from a few episodic cases, the institutionalization of the history of science in universities began shortly after the war, in the USA, in order (as the Harvard programme put it) to teach future citizens of the republic what they needed to know about the tactics and strategies of science. The intellectual structure of the discipline, however, was built (again in the US) on the teachings of Alexandre Koyr e, a French philosopher who approached the history of science as the history of ideas. The union of Koyr es ideas and Harvards programme produced Thomas S. Kuhn, whose Structure of Scientic Revolutions (1962) became the paradigm (to use the concept that made the book famous) of science for practitioners of the social sciences throughout the world. Beginning in the late 1960s, in response to the role of science-based technologies in the wars in South East Asia and in large-scale industrial pollution, historians of science, by then ensconced in departments of history, science faculties, institutes of history and philosophy of science and/or sociology of science, and programmes in science, technology, and society, deconstructed science to what many of them saw as its ugly core. Scientists turned out to be as susceptible to ambition, power, reputation and greed as anyone else; their theories were no more than negotiated settlements in what amounted to power politics, that is, social constructs. This tendency originated in academics who knew little science, whereas the older intellectual history of Koyr es type was cultivated mainly by converts to history who had been trained in science. The intellectual direction has dominated some European countries, notably Italy, Spain, Denmark and, though to a lesser degree, France, whereas the social direction has characterized university work in the history and sociology of
90

Iggers, Geschichtswissenschaft (note 85), 101ff.

413

Dirk Heirbaut science in the UK and, to a lesser extent, in Germany and Sweden. Since the 1960s, and increasingly, some historians have tried to integrate the two approaches. As in the special case of the history of science and technology, general history developed along parallel lines in Europe and the United States after 1945. The possibility of a new start, the determination to learn from the errors of the past and the desire of ever more young people for a university education contributed to an optimistic expansion of all elements in the tertiary education sector. New professorial chairs opened up unheard of opportunities for the new generation of academics and led to a further specialization of disciplines.91 New journals appeared together with new specialized academic societies, to serve an increasingly internationally oriented generation of scholars. New means of transport as well as the change in the new self-esteem of the professoriate facilitated interchange of people and ideas.92 But this fairly long phase of reconstruction came to an end in the 1980s. Support for the social sciences and the humanities faltered and their disciplinary foundations were questioned. A new phase of international university and academic history had begun.

law The history of the faculties of legal education and legal research is a part of the history of the universities, but it is more than that. Law schools belong to two worlds: the academic and the legal, and many law professors, teachers and researchers are more familiar with legal professionals than with their colleagues from other faculties. In fact, many academic lawyers are also practising lawyers, and true academics are a rare breed in law schools, only to be found in some non-practical, and hence very minor, elds like the philosophy of law. Moreover, unlike the subject of other sciences, law is not universal, but national, which means that national law, national legal culture and national legal professions have done as much to shape the law schools in the second half of the twentieth century as the global evolution of science and education,93 which is generally disregarded by lawyers, even academics, when they discuss the history, the current situation or the reform of law faculties. Nevertheless, law schools took part in the general evolution of the European universities,
91

92 93

In the historiographical sciences there is in addition to the traditional division into ancient, medieval and modern history the division into early modern, contemporary, economic, regional, scientic, ecclesiastical and administrative history. See chapter 5 (Teachers). Cf. J.-F. Flauss, Deux si` ecles denseignement de droit constitutionnel: Esquisse dun bilan, in J.-F. Flauss, Lenseignement du droit constitutionnel (Brussels, 2000), 2045.

414

Social sciences, history and law but sometimes the common pattern was warped by elements specic to the legal world, and some developments were unique to law schools. After the Second World War, the wind changed.94 European universities lost their leadership in the legal eld to their American counterparts for a host of reasons, such as the political and economic domination of the United States and the emigration of some of the brightest and most creative German scholars thence95 (and also to England96 ) in the 1930s. In this, law only conformed to a general tendency in which the United States displaced Germany as the worlds scientic leader. However, the decline of German law had already started before the 1930s. After the great codications around 1800, European countries had developed their own national legal systems instead of the ius commune, the common law of Europe, which had prevailed until then. This meant that legal education and legal science had become national, without much inuence beyond a countrys borders. Germany was an exception, as the country was not politically unied until 1871 and thus adhered to the old ius commune, which allowed German lawyers to keep and even expand upon their leading role in European law gained in the eighteenth century. This ended with the codication of private law in 1900, when German law also became national and German lawyers lost their universal status.97 Even without the Nazi era and the emigration it engendered, German law would have lost its key position, though the decline would have been more gradual. The atrocities of the Nazi regime also meant that, even if German lawyers still had the ability to lead the way in the eld of law, they no longer had the moral authority to do so. German lawyers themselves were aware of this, and the rst years after the Second World War therefore saw a (short) owering of the study of natural law in Germany.98 The success of German refugee lawyers in the United States and the inuence of American legal science in Europe were less marked than in other elds, because the national character of law was an obstacle for the
94

95

96

97

98

U. Mattei, Why the Wind Changed: Intellectual Leadership in Western Law, American Journal of Comparative Law, 42 (1994), 195218. M. Lutter, E. C. Stiefel and M. H. Hoeich (eds.), Der Einuss Deutscher Emigranten auf die Rechtsentwicklung in den USA und in Deutschland (Tubingen, 1993). J. Beatson and R. Zimmermann (eds.), Jurists Uprooted: German Speaking Emigr e Lawyers in Twentieth Century Britain (Oxford, 2004). R. C. Van Caenegem, An Historical Introduction to Private Law (Cambridge, 1992), 1559; see also R. Zimmermann and M. Reimann (eds.), The Reception of Continental Ideas in the Common Law World, 18201920 (Berlin, 1993). A. Kaufmann, Die Naturrechtsrenaissance der ersten Nachkriegsjahre und was daraus Sten Gagner geworden ist, in M. Stolleis, Die Bedeutung der Worter, Festschrift fur (Munich, 1991), 10532. See, however, also M. Stolleis, Reluctance to Glance in the Mirror: The Changing Face of German Jurisprudence after 1933 and post-1945, in C. Joerges and N. Ghaleigh (eds.), Darker Legacies of Law in Europe: The Shadow of National Socialism and Fascism over Europe and its Legal Traditions (Oxford, 2003), 118.

415

Dirk Heirbaut diffusion of ideas. Hence, the achievements of the e e lawyers in the migr United States were limited to elds in which the national element is less important or even absent: philosophy of law, legal history, Roman law, public and private international law, and most of all, comparative law, and even then acceptance was sometimes only achieved after retraining.99 National boundaries also hindered the transplant of American legal ideas and theories in Europe, even though the United States became the foreign country of choice for European lawyers to study for a postgraduate degree. Nevertheless, important new American schools of jurisprudence, such as law and economics or critical legal studies,100 have not really taken root in Europe; European education and research have remained much more positivistic and authority based: law is what the law lords, the legislators, the judges and the leading professors say it is.101 There are of course exceptions to this. For example, even though the traditional lectures were not replaced by the American case-study method, in which leading decisions by the courts are analysed in a Socratic dialogue between a teacher and his students, casebooks based on the American model that supplement the lectures have become popular, but they are used in another context more to teach the rules than to teach the process of legal reasoning that has shaped these rules.102 The case-study method, which is only t for small bodies of students, was not transplanted to Europe after the Second World War not only because of differences in the legal culture, but also because of the democratization and massication of education in Europe since the 1960s, which had an even greater impact on law faculties than on other parts of the university. Both university boards and governments considered law teaching to be cheap. As long as the lecture hall was not lled, no extra cost accrued for adding an additional student and, if one, why not hundreds? The result was that classes of hundreds of students became the norm, although this did not lead to any greater investment in staff or facilities. In many countries law faculties are the faculties that receive the least money,103 even though law professors have been increasingly burdened with advising government about new legislation. Nevertheless,
99

100 101

102

103

K. Graham, The Refugee Jurist and the American Law Schools, 19331941, American Journal of Comparative Law, 50 (2002), 777818. See N. Duxbury, Patterns of American Jurisprudence (Oxford, 1997). J. H. Merryman, Legal Education There and Here: A Comparison, Stanford Law Review, 27 (1975), 869. Cf. F. Ranieri, Juristen fur Europa: Wahre und falsche Probleme in der derzeitigen Reformdiskussion zur deutschen Juristenausbildung, in D. Strempel (ed.), Juristenaus und Individualitat (Baden-Baden, 1998), 292301. bildung zwischen Internationalitat R. Wahl, Die Misere der Betreuungsrelation in der Juristenausbildung. Wie eine Juristenausbildung durch gesetzlich vorgesehene Normen denaturiert wird, in Strempel, Juristenausbildung (note 102), 37994.

416

Social sciences, history and law law faculties became popular with students in the 1960s for a number of reasons: a legal education was the best general education on the market, it opened the door to some high-status professions or top jobs in the administration, and students had to work less to obtain their degree. Hence the law faculty became a refuge for superuous young people wanting an easy ticket to a diploma a tendency that was more marked in the Latin countries than in the north of Europe.104 The popularity of law studies made them harder. Although a law degree is necessary, it is not sufcient for being allowed entry into most of the legal professions. The greater inux of newcomers has led to stricter entrance requirements; new lawyers, judges, notaries and so on have to take mandatory professional training and/or exams. Apart from Germany and Switzerland, where the regional authorities organize the exams, entry to the legal professions is controlled by professional organizations.105 Whereas other faculties acquired more freedom after the war, with less government intervention in their affairs, law schools slipped under the tutelage of the legal professions. As these tend to be rather conservative, new and unconventional forms of law teaching have not been able to break through, and the same holds for legal scholarship.106 The increased importance of legal practitioners has also led to a certain disdain for academics, and this trend is most pronounced for those professions with their own training schools, as in France, where magistrates study at a special school.107 Experiments to integrate theory and practice into university education, such as in Germany from 1971 to 1984, have failed.108 In general, the legal professions, supported by students who wanted their education to be as useful as possible, have promoted the idea that a legal education should be practical instead of liberal, and this has led to the disappearance or reduction of meta-juridical courses in the curriculum. A victim was the study of Roman law, which for centuries had been the only law (together with canon law) to be studied at universities.109
104 105 106

107

108

109

Cf. W. Twining, Blackstones Tower: The English Law School (London, 1994), 51. J. Lonbay, et al., Training Lawyers in the European Community (London, 1990). Cf. M. Feldman, The Transformation of an Academic Discipline: Law Professors in the Past and Future (or Toy Story Too), Journal of Legal Education, 54 (2004), 47198; R. Zimmermann, An Introduction to German Legal Culture, in W. F. Ebke and M. W. Finkin (eds.), Introduction to German Law (The Hague, 1996), 22. C. Atias, Enseigner le droit, in Lenseignement du droit civil a ecle. ` la n du XXe si` Libres propos sur une question fort d ebattue, Revue trimestrielle de droit civil, 96 (1998), 287. J. Brunn ee, The Reform of Legal Education in Germany: The Never-Ending Story and European Integration, Journal of Legal Education, 42 (1992), 41618. See, e.g., for France, J. Hilaire, La place de lhistoire du droit dans lenseignement et dans la formation du comparatiste, Revue internationale de droit compar e, 50 (1998), 323.

417

Dirk Heirbaut Apart from the greater interference of the legal profession, law studies have also become harder because of the enormous proliferation of laws. Like the United States, the countries of Europe are nations under lawyers.110 In the decades after the Second World War, law has intruded into all parts of society. Law and lawyers have invaded factories, farms, hospitals, schools, sports clubs and so on. Consequently, all kinds of new elds of law, such as aviation law or sports law, have come into existence and are studied at university, but mostly in the form of electives. Insurance or labour law, for example, may have become of extreme importance to ordinary citizens, but the law curriculum does not always give them their due.111 Law has come to dominate society because it is an instrument of government for social engineering. Public law, which deals with government and its relationship with the citizens, has thus overtaken private law, which deals with the relationships of citizens amongst themselves. In many law schools, however, private law still dominates, because its professors are well entrenched; public law has only been taught as a separate discipline since the seventeenth century or even later.112 The rise of public law is a minor effect of government interference when compared with the growing body of legislation. In other sciences the basics may be rather stable, but in law one has to keep in mind the following adage: With three words from the legislator, whole libraries become waste paper.113 Unfortunately, regular overhauls of major parts of the law have become so common and judges have become so active in the creation of case law that many jurists can no longer nd the time for new research, but have to limit themselves to describing the latest changes. This does not enhance their status among their colleagues at the university.114 Not writing for the practitioners would, however, lead to an even greater rift with the legal professions. From the 1960s critics have been stating that it would be better to educate lawyers than to teach

110

111

112

113

114

M. A. Glendon, A Nation under Lawyers: How the Crisis in the Legal Profession is Transforming American Society (Cambridge, Mass., 1996). B. Bercusson, Law, Legal Education and Practice and Labour and Social Law, in B. De Witte and C. De Forder (eds.), The Common Law of Europe and the Future of Legal Education (Deventer, 1992), 42931. See, e.g., J. W. F. Allison, A Continental Distinction in the Common Law: A Historical and Comparative Perspective on English Public Law (Oxford, 2000). Drei Berichtigende Worter des Gesetzgebers und ganze Bibliotheken werden zu Maku latur. From an 1847 lecture by J. H. von Kirchmann (for a recent edition of this lecture, see H. Meyer-Tscheppe, Julius Hermann von Kirchmann: Die Wertlosigkeit der Jurisprudenz als Wissenschaft (Heidelberg, 2000). W. Twining, W. Farnsworth, S. Vogenauer and F. Teson, The Role of Academics in the Legal System, in P. Cane and M. Tushnet (eds.), The Oxford Handbook of Legal Studies (Oxford and New York, 2003), 940.

418

Social sciences, history and law the law.115 In reality, this has not happened, and the exploding body of case law has led to ever growing demands on students, because, although professors may claim to be interested in general principles only, exams still focus on ever more detailed problems.116 One reaction to the ood of legislation was the call for deregulation, which was started by the law and economics movement in the United States in the 1970s,117 but adherents of law and economics have been less inuential in Europe, despite some successes in the 1980s, because their scholarship has been associated with right-wing anti-welfare state politics. (In fact, the 1990s saw another great growth of legislation.) Another way of dealing with the growing body of law is specialization,118 but this is not always welcomed; many lawyers prefer a generalist over a specialist, and most law programmes reect this. Specialization is growing, however, in professional practice and research, where the isolation of individual elds of law is becoming a growing problem.119 The evolution outlined above inuenced all countries in different ways, not only because their universities are different, but also because of their national legal tradition. England is a special case, as its legal system went its own way and relegated the universities to the sidelines.120 Not until after the war were most practitioners willing to answer yes to the question: Can English law be taught at the universities?121 Universities have since come to dominate legal studies in Britain, but even today it is still possible to become a solicitor without having an LL B.122 Nevertheless, there is a convergence of legal systems in Europe and thus also of legal education and research.123

115

116

117

118 119

120

121

122

123

E.g. M. Storme, Beschouwingen over de juridische opleiding, in F. Fleerackers (ed.), Recht en vorming: Juridisch onderwijs in de kering (Brussels, 2003), 23. See, e.g., for Germany, E. W. Bockenf orde, Juristenausbildung auf dem Weg ins Abseits?, Juristenzeitung, 52 (1997), 31726. See about this subject in general, J. Den Hertog, General Theories of Regulation, in B. Bouckaert and G. De Geest (eds.), Encyclopedia of Law and Economics, Vol. III (Cheltenham, 2000), 22370. H. Palm, Gedanken zum Einheitsjuristen, Juristische Zeitschrift, 45 (1990), 60918. Cf. more generally A. Kronman, The Lost Lawyer: Failing Ideals of the Legal Profession (Cambridge, Mass., 1993). See R. C. van Caenegem, Judges, Legislators and Professors: Chapters in European Legal History (Cambridge, 1987). This question was posed by A. V. Dicey in his inaugural lecture as holder of the Vinerian chair in Oxford (A. V. Dicey, Can English Law be Taught at the Universities? (London, 1883)). R. Burridge, Landmarks, Signposts and Directions in Legal Education in the United Kingdom, Journal of Legal Education, 51 (2001), 31524; A. Wilson Green, Legal Education in England, Journal of Legal Education, 28 (1976), 13780. Cf. B. Markesinis, Learning from Europe and Learning in Europe, in B. Markesinis (ed.), The Gradual Convergence: Foreign Ideas, Foreign Inuences and European Law on the Eve of the 21st Century (Oxford, 1993), 130.

419

Dirk Heirbaut The main cause of this is the drive towards European Union, which began in the 1950s. Initially, its impact upon the law schools was limited, and in many cases even in some of the old Member States European law only became part of the curriculum in the 1990s,124 which proves that law faculties were slow to catch on to this evolution. Europeanization was contrary to the experience of European lawyers. Law was national, and at the university one could only study the national law of ones own country; the diploma one obtained had an effect limited to that country. However, from the 1970s both the institutions and the citizens of Europe strove for a European-wide recognition of diplomas. Several directives (in 1977, 1989 and 1995) and, since the 1990s, famous cases (Reyners, Van Binsbergen, Thieffry, Klopp, Vlassopoulou, Kraus and Gebhard) enlarged the market for lawyers.125 Yet the freedom to establish oneself in another country as a lawyer is still limited, mainly because at university one is still taught the law of ones own country, not the legal systems of the other Member States of the Union. Universities have therefore placed a greater emphasis on European and comparative law, but the bulk of what most of them teach is still national. Several scholars have called for a European law school, modelled on the American national schools,126 in which one does not learn the law of the home state but rather the general principles of the law of all fty states of the US. Likewise a European law school should teach the general principles of the legal systems of the European countries rather than that of only one country. The rst example is the European Law School at Maastricht University, founded in 1995,127 but the Maastricht experience has shown that a truly European law school is not yet a reality, as the Maastricht students still have to study Dutch law. Moreover, at rst, the Maastricht teachers had a problem, because they wanted to teach a subject that had led only a marginal existence when they started. The bulk of law is still national, and before the 1990s textbooks, law reviews,
124

125

126

127

Cf. R. Bakker, Europeanization of Law and Lawyers v. National Provincialism in Legal Education, in B. S. Jackson and D. McGoldrick (eds.), Legal Visions of the New Europe (London, 1993), 346. H. Schneider, The Free Movement of Lawyers in Europe and its Consequences for the Legal Profession and the Legal Education in the Member States, in M. Faure, J. Smits and H. Schneider (eds.), Towards a European Ius Commune in Legal Education and Research (Antwerp, 2002), 1538. See for references, the rst articles in De Witte and De Forder, Common Law (note 111). A. W. Heringa, Towards a European Law School: A Proposal for a Competitive, Diversied Model of Transnational Co-operation, in Faure, Smits and Schneider, European Ius Commune (note 125), 56.

420

Social sciences, history and law casebooks and the like were still national, with only a few exceptions such as comparative law or legal history.128 However, in the 1990s, several international groups of lawyers started to write down the general principles of European law,129 the rst and most famous of these collaborations of European lawyers being the Lando commission for contract law.130 The enthusiasm these projects have engendered is enormous. In 2001 the European Parliament accepted a resolution calling for a common body of rules on contract law in 2010131 and, less ambitiously but more realistically, the European Commission put forward an action plan in 2003 to establish a common frame of reference for European contract law.132 Moreover, European journals appeared in the 1990s,133 as did European casebooks134 and textbooks.135 One may wonder whether some scholars are not exaggerating, as there is even a commission that wants to harmonize and unify European family law.136 The new enthusiasm for European law also received stimulation from research into legal history, for example, from Reinhard Zimmermanns The Law of Obligations.137 Its message can easily be reduced to:
Europe had one legal science in the past, the ius commune of the era before the great codications, and it will once again have a common legal science.

This message has been misunderstood by many who thought it wanted to have one common law instead of one common legal culture, in which national or regional rules would not disappear, but in which lawyers
128

129

130

131

132

133

134

135

136

137

Since 1974 the European University Institute in San Domenico di Fiesole near Florence (see chapter 3, 119) promotes in its law department graduate studies on the legal implications of the EC/EU. R. Zimmermann, Roman Law, Contemporary Law, European Law: The Civilian Tradition Today (Oxford, 2001), 1089. The work of the Lando commission is available in several European languages. In English: O. Lando and H. Beale (eds.), Principles of European Contract Law, Vols. I and II (Dordrecht, 1999); O. Lando, E. Clive, A. Prum and R. Zimmermann, Principles of European Contract Law, Vol. III (Dordrecht, 2003). Resolution for the Approximation of the Civil and Commercial Law of the Member States 15 November 2001, Ofcial Journal of the European Union (2001), C 140 E, 538. Communication from the Commission to the European Parliament and Council, a More Coherent European Contract Law an Action Plan, COM 2003, 68 (nal). Europaisches E.g. Zeitschrift fur Privatrecht and European Review of Private Law, both since 1993. E.g. W. van Gerven, P. Larouche and J. Lever, Cases, Materials and Text on National, Supranational and International Tort Law (Oxford, 2000). E.g. H. Kotz and A. Flessner, European Contract Law, Vol. I (Oxford, 1997) (rst published in German in 1996). See K. Boele-Woelki (ed.), Perspectives for the Unication and Harmonisation of Family Law in Europe (Antwerp, 2003). R. Zimmermann, The Law of Obligations: Roman Foundations of the Civilian Tradition (Cape Town, 1990; Munich, 1992; Oxford, 1996).

421

Dirk Heirbaut would use a common legal grammar, common textbooks, casebooks and so on.138 One should not overestimate the importance of the new ius commune. There will always be a need for purely local lawyers,139 and it can be argued that there will also be more need of them, as the decades since the war have also seen a growing importance of regional law and institutions in countries as diverse as the United Kingdom and Spain.140 Moreover, todays lawyers can still get by, even if they only read publications from their own country, and there are still many obstacles to be overcome, not least the lack of a common language.141 However, thanks to Europeanization there exist once again scholars like Zimmermann, Lando, von Bar, Gandol and Van Gerven, to name only a few, who are known all over Europe, at least in academic circles. Perhaps the new European lawyers will be able to regain the leadership lost to the American law schools, but that belongs to the future, not to history.

138

139 140

141

S. Mittelsten Scheid, Zimmermann und das romisch-kanonische Recht als Grundlage einer europaischen Zivilrechtsordnung, in T. Hoeren (ed.), Zivilrechtliche Entdecker (Munich, 2001), 442. See also D. Heirbaut, Comparative Law and Zimmermanns New ius commune: A Life Line or a Death Sentence for Legal History?, in Ex iusta causa traditum: Essays in Honour of Eric Pool, Fundamina, Editio specialis (Pretoria, 2005), 13653. E. Hondius, Juridisch onderwijs in vergelijkend perspectief (Deventer, 1999). H. L. MacQueen, A. Vaquer and S. Espiau (eds.), Regional Private Laws and Codication in Europe (Cambridge, 2003). Hence the importance of law and language programmes (P. Goldsmith, Globalization: The European Experience, Journal of Legal Education, 46 (1996), 319).

422

Social sciences, history and law select bibliography

Acham, K., Norr, K. W., and Schefold, B. (eds.) Erkenntnisgewinne, Erkennt nisverluste: Kontinuitaten und Diskontinuitaten in den Wirtschafts-, Rechtsund Sozialwissenschaften zwischen den 20er und 50er Jahren, Stuttgart, 1998. Albrecht, C., Behrmann, G. C., Bock, M., Homann, H., and Tenbruck, F. H. Die intellektuelle Grundung der Bundesrepublik: Eine Wirkungsgeschichte der Frankfurter Schule, Frankfurt and New York, 1999. Andrews W. C. (ed.) International Handbook of Political Science, Westport, Conn., and London, 1982. Barbano, F. La sociologia in Italia: Ingressi teorici negli anni della formazione (5060), Turin, 1986. Beatson, J., and Zimmermann, R. (eds.) Jurists Uprooted: German Speaking Emigr e Lawyers in Twentieth Century Britain, Oxford, 2004. Bell, D. The Social Sciences since the Second World War, New Brunswick, N.J., 1982 (German translation, Die Sozialwissenschaften seit 1945, Frankfurt and New York, 1986). Cane, P., and Tushnet, M. (eds.) The Oxford Handbook of Legal Studies, Oxford and New York, 2003. Clark, B. R. and Neave, G. (eds.) The Encyclopedia of Higher Education, Vol. II: Analytical Perspectives, Oxford, New York, Seoul and Tokyo, 1992. Coats, A. W. Bob (ed.) The Development of Economics in Western Europe since 1945, London 2000. De Witte, B., and De Forder, C. (eds.) The Common Law of Europe and the Future of Legal Education, Deventer, 1992. Faure, M., Smits, J., and Schneider, H. (eds.) Towards a European Ius Commune in Legal Education and Research, Antwerp, 2002. Heilbron, J. L. (ed.) The Oxford Companion to the History of Modern Science, Oxford and New York, 2003. Iggers, G. G. Geschichtswissenschaft im 20. Jahrhundert, Gottingen, 1996. Kohl, K. H. Ethnologie, die Wissenschaft vom kulturell Fremden, 2nd edn, Munich, 2000. Lemert, C. E. (ed.) French Sociology, New York, 1981. Lonbay, J. et al. Training Lawyers in the European Community, London, 1990. Lutter, M., Stiefel, E. C., and Hoeich, M. H. (eds.) Der Einuss deutscher Emigranten auf die Rechtsentwicklung in den USA und in Deutschland, Tubingen, 1993. Manicas, P. T. A History and Philosophy of the Social Sciences, Oxford, 1987. Petermann, W. Die Geschichte der Ethnologie, Wuppertal, 2004. Raphael, L. Geschichtswissenschaft im Zeitalter der Extreme: Theorien, Methoden, Tendenzen von 1900 bis zur Gegenwart, Munich, 2003. Sills, D. L. (ed.) International Encyclopedia of the Social Sciences, New York, 1968. und IndividuStrempel, D. (ed.) Juristenausbildung zwischen Internationalitat , Baden-Baden, 1998. alitat

423

CHAPTER 11

THE MATHEMATICAL, EXACT SCIENCES

JOHN ZIMAN

a traditional scene in a larger frame Our concern in the present chapter is with the mathematical, exact sciences. What should that include? As always in university affairs, reality can never be simply categorized. Mathematics has a proud humanistic tradition and important applications throughout the natural and social sciences: in many universities, it is not even in the same faculty as physics, the epitome of an exact science. Chemistry is normally arithmetically exact, but is not limited in principle to what can be described mathematically. Geology is usually classed as one of the physical sciences (although with important biological elements), but relies very much on diagrammatic and verbal description. The increasing difculty of demarcating between these great areas of university activity is one of the historical phenomena with which we shall deal. Another long-established boundary is between science as knowledge and science as know-how, between the basic sciences and their associated technologies. Previous volumes have traced the emergence of the physical sciences as disciplines in their own right, differentiated academically from the various branches of engineering to which they are cognitively connected. Nevertheless, university-type institutions devoted explicitly to the education of technological practitioners, such as tech coles techniques and colleges of technology, nische Hochschulen, hautes e have always provided their students with formal instruction in the fundamentals of physics, chemistry and mathematics, to which their faculty

The late John Ziman was a theoretical physicist and an expert on science policy. His chapter is as much a primary as a secondary source for the development of the exact sciences since the Second World War. Its particular value lies in its treatment of the physical sciences that deal with the solid state and of policy considerations related particularly to them.

424

The mathematical, exact sciences members have often made distinguished research contributions. By the middle of the twentieth century, a frontier that was never easy to dene in principle was already becoming indefensible at many points. By this time, university education in the exact sciences focused on preparing students for research careers in academic, governmental or industrial institutions, or for teaching the same subjects to aspiring scientists in secondary schools. For the last half-century, the history of the exact sciences and mathematics in the university in Europe has been dominated by attitudes and activities related to original research, at the expense of attention to undergraduate teaching, learning and career development. This again is a theme which we shall explore further. By 1945 the centre of the research enterprise had migrated across the Atlantic, along with many eminent European scientists seeking refuge in a free country not ravaged by war. Following the American example, governments and industrial rms throughout the developed world began to invest much more heavily in basic research inside their own laboratories, as seedcorn for technological innovation. The history of the mathematical, exact sciences in the university in Europe can no longer be presented as a chronicle of research developments conned principally to universities or to Europe. A much larger frame is now required to enclose a scene whose origins lie deep in the past. The interval from 1945 to 1995 divides conveniently into three equal periods of some fteen years each. Post-war reconstruction 19451960 In the cynical language of soldiering, the physical scientists had a good war. They came back into civilian life with a very high reputation for their military achievements, especially radar and the atomic bomb. The public were encouraged into great expectations of future peaceful benets on the same grand scale.1 The scientists themselves had become accustomed to a high level of government funding for their defence research, and in this period had no difculty in retaining this privileged status for all their work. They had also acquired a taste for much more elaborate instrumentation, and had learnt to use a wider range of engineering techniques. In Europe, however, material resources were still very scarce, and the main desire of most university scientists was to take up again the lines of research that had made the rst half of the century scientically so exciting. It took them a while to realize and to persuade their governments that a much more sophisticated research methodology had developed in the United States during and after the war, and that their
1

V. Bush, Science: The Endless Frontier (Washington, D.C., 1945).

425

John Ziman countries would have to invest much more boldly in advanced equipment if they were to keep up.

Expansion 19601975 In this period, the resources and personnel devoted to the exact sciences expanded at an enormous rate. It is not clear whether this was driven by the mass expansion of higher education itself (as it might have been in the humanities) or whether it fed on the hope of technological benets. For example, student numbers in the exact sciences may not have risen in proportion to research activity. European laboratories were now being re-equipped on a scale comparable to those of North America, many European scientists had had experience of working in the United States, and the German research machine was back on the road. Although science in Europe was still fragmented and incoherent, with no central source of massive funds to compare with the US Departments of Defense and Energy, it was becoming competitive with the US effort in many areas.

Steady state 19751995 The levelling off in research funding in this period was more marked in the UK than elsewhere.2 Nevertheless, there was a distinct transition from an almost freely expanding system, and much more questioning of the priorities of academic research, especially in relation to its economic capabilities. Yet this was a time of unprecedented scientic progress, fuelled and lubricated by the new communications technologies. In the West, the scientic programmes of the European Community and other international bodies were beginning to play an important part in university science. In Central and Eastern Europe, however, earlier hopes of catching up with the West were fading, as economies slumped, technology faltered and the national scientic academies, which had taken over basic research from the universities after the war, stagnated. The detailed history of developments in different countries, disciplines and institutions is obviously far more complicated and diverse than could possibly be presented here. But this scheme does indicate the successive changes in the general climate of the scientic enterprise, as experienced in Europe by the author since 1945.
2

S. Cozzens, P. Healey, A. Rip and J. Ziman, The Research System in Transition (Dordrecht, 1990).

426

The mathematical, exact sciences policing the internal frontiers of knowledge The history of the university, like the history of the nation state, is of a dialectic between small and large domains and internal consolidation. At the beginning of our period, the exact sciences were sharply delineated into a few separate disciplines, such as chemistry, physics, geology and mathematics. Each of these was taught to undergraduates as if it were a single subject, dealing with a particular aspect of the world according to a distinctive and unique method. It was the task of the university to turn out chemists or physicists or geologists or mathematicians who understood things in the appropriate way and knew how to improve that understanding. At that time, also, the various sciences were carefully differentiated academically from their corresponding technologies. Physicists might eventually become expert at applying their knowledge, but they did not attend the same courses as mechanical or electrical engineers. Real chemists were not supposed to be interested in the messy reactions that take place in petrochemical plants and so-called applied mathematicians learnt how to solve the equations of uid ow without ever studying the properties of a real propeller or turbine. These boundaries between pure and applied science, and between the various disciplines, extended upwards and outwards from the university. In the UK, for example, it was not until the 1960s that the Physical Society, whose members were mostly university teachers, merged with the Institute of Physics, representing physics graduates working in industry. German industrial rms still do not employ physicists in engineering roles. In most countries, professional scientists working side by side in government R&D establishments were classied separately as chemists, physicists, mathematicians and so on, with their own career paths to pursue. This ideological disciplinism was both a reection of and a resource for professional and organizational differentiation within universities. Like all other academic subjects, the exact sciences were separated into distinct departments or faculties, each staffed almost entirely by graduates of the corresponding discipline, all supposedly engaged in original research on topics within that discipline. Even if they had been qualied formally to move to other departments, university teachers were trapped in their disciplines, not so much by their teaching expertise as by their heavy personal investments in highly specialized research. Interinstitutional mobility within the same discipline was strongly encouraged in most European countries by the arrangements for personal promotion, but it was only the ablest, most enterprising, or most pressed, that would move permanently to another country. 427

John Ziman It has been argued3 that organizational structures within academia correlate with intellectual structures for example, that an abstract discipline such as mathematics would develop quite different departmental arrangements from an observational discipline such as geology. This may be so across the whole academic spectrum, but structural variations of this kind within the exact sciences are completely swamped by the general variation of university systems from country to country in Europe.4 It was recognized that certain elds of research lay athwart the regular disciplinary boundaries. But interdisciplinary subjects, such as chemical physics, geophysics, mathematical statistics and meteorology (to name but a few), were marginalized both for teaching and research, and often led a precarious institutional existence in small, poorly esteemed districts of the academic map. It was also understood, though seldom ofcially acknowledged, that the major scientic disciplines, like the major states of Europe, were internally subdivided into provinces whose inhabitants had little in common. The organic and inorganic chemists were as united as the Czechs and the Slovaks. Pure mathematics claimed a nobler heritage than its various applications but was as divided as North Italy into the ancient republics of analysis, number theory, algebra, geometry and so on. Physics, which had been forcibly united, like nineteenth-century Germany, by Newton and Maxwell, was falling apart into those who used quantum theory, those who used relativity, those who used both, and those still quite a number in the 1940s and 1950s who used neither, and did not understand them well enough to teach them properly. There were signicant local institutional variations in the institutional location of theoretical physics. It might be housed in a professional institute of its own, as at Copenhagen, or in an informal research group of a physics laboratory, as at Bristol, or bundled in with applied mathematics in a mathematics faculty, as at Cambridge. Exactly the same research in theoretical chemistry might be practised as chemistry, physics, or mathematics, according to the circumstances. According to the way that it had developed locally, metallurgy was studied as a part of chemistry or of physics or of engineering or it might even boast a department of its own. The honours list of outstanding centres, whose research advances prior to the war had set the pace of curriculum development in particular subjects, retained its inuence over the national ow of students, faculty, research funds, and the trans-national trafc in scientic visitors from outside Europe. But the excision of the great German schools of research that had dominated the exact sciences in the previous era opened the
3 4

R. Whitley, The Intellectual and Social Organization of the Sciences (Oxford, 1984). See chapters 2 (Patterns) and 7 (Curriculum, Students, Education).

428

The mathematical, exact sciences way for new centres of excellence to emerge in various other European countries, even though these could not compete seriously with the leading American departments in their various specialties. The best European research groups, along with the many, many mediocre groups who aspired to emulate them, sought their scientic inspiration across the Atlantic, rather than in neighbouring countries. Those who experienced the broad but intensive education characteristic of American graduate schools returned to Europe (if they did return) with important shared experiences and ambitions. Another spur to integration was the textbook. Translations of such famous works as P. A. M. Diracs Quantum Mechanics or Richard Courant and David Hilberts Methoden der mathematischen Physik could be used throughout Europe, showing that there was already an established common culture of teaching and research. It was thus easy from a scientic point of view, although often still very difcult for other reasons such as language or conditions of employment, for physicists to cross national boundaries for work. The differences between national university systems and, indeed, between different universities within the same country were not so much in the subjects taught or in the approach to these subjects, as in the depth and competence of the instruction. In the rst phase of our period (194560), professional disciplinism was still the dominant ideology in the exact sciences in European universities. Nevertheless, these traditional disciplinary and subdisciplinary boundaries were actually becoming as obsolete as national and regional frontiers. The exact sciences were beginning to merge into what might be called a language area, characterized by mathematical models built around differential equations. The frontiers of this area were not ofcially dened, since they ran right through the centres of several entrenched disciplines. Inorganic chemists belonged to this area, in so far as they were mainly concerned with simple compounds whose properties could best be understood in the terminology of quantum theory. They could scarcely understand the organic chemists, across the border, who spoke a very different technical language centred on a subtle non-quantitative phenomenology for inferring the structures of more and more elaborate molecules of biological signicance, such as DNA. Within the language area of the physical sciences, however, it was already intellectually feasible to move from one discipline to another, using the same repertoire of basic skills. In the 1950s and 1960s, this could be risky, since it usually meant abandoning a hard-won academic niche and scholarly reputation for a new speciality.5 But as time went
5

J. Ziman, Knowing Everything about Nothing: Specialization and Change in Scientic Careers (Cambridge, 1987).

429

John Ziman on, the social barriers that previously differentiated the various exact sciences, and framed them off from the non-academic world, began to fade and dissolve. This shows up in the emergence of new interdisciplinary research areas and trans-sectoral institutions, for example, centres for research on materials, systems, the atmosphere and so on, jointly funded by universities, governments and industrial rms. Beneath the surface there was more cross-fertilization and interdependence of the disciplines, university departments, scientic professions, government agencies and economic sectors that span the many dimensions of R&D in the exact sciences. Interdisciplinarity is one of the perennial slogans of academic reform and perennially its champions are disappointed. How was it that it has developed so extensively in the exact sciences in European universities in the last twenty years? A number of factors have contributed, some internal to the academic enterprise, some stemming from changes in the social, political and economic environment of advanced science. The most obvious factor is the diffusion of new research technologies from physics and electronic engineering into all the neighbouring disciplines. This methodological revolution began during the interwar years, with the introduction of electronic measuring instruments into chemical and geological research. This process was hastened by scientists returning to their laboratories with wartime communications and radar experience; by the 1960s ability to apply these techniques was essential for experimental or observational research in all the exact sciences. But the real revolution came in the 1970s, as microelectronic control, dataprocessing and digital computing capabilities were linked to, combined with and eventually incorporated into every kind of research instrument. This development was irresistible. By denition, all research in the exact sciences involves the acquisition and logical manipulation of quantitative data. This is a task that can be performed by digital microelectronics with ever-increasing capacity, speed and algorithmic sophistication. The European universities did not play a major role in initiating this revolution. Their scientists were only marginally involved in the invention and development of the hardware and software that made it possible, and they were relatively slow in adopting the new instruments and techniques that were becoming common in American research laboratories. But by the early 1980s, they had caught up; university physics or chemistry laboratories in Western Europe were as well equipped with computers, data terminals and computerized instruments as their counterparts in the United States. The same cannot be said of the exact sciences in the universities of Central and Eastern Europe, where the lag in instrumental capabilities sometimes made it impossible to keep at the international frontier in experimental research. 430

The mathematical, exact sciences The penetration into all the exact sciences (including pure mathematics) of information technology brought them closer together. The linkages were not merely technical, in the sense that the same visual display units, circuit boards and high-level languages were in use in almost every building of the science area of every campus. All the sciences were beginning to learn the same new intellectual procedures, such as pattern recognition, computer simulation of spatial phenomena, or tomographic reconstruction of observational data. A procedure that had been developed in geophysical prospecting could be just what was needed for non-destructive testing of materials. A massively parallel supercomputer acquired originally for oceanographic studies could later be used for working out the whole history of the universe, or the interaction of quarks inside a nucleus, or the chemical reactions in a ame. X-ray diffraction, electron microscopy, laser optics, synchrotron radiation, radioactive isotopes, mass spectrometry the list is endless are put to use nowadays in all branches of the natural sciences from astronomy to zoology. The scanning tunnelling microscope can provide exquisitely detailed topographic information about a solid surface, whether of a structural alloy, a silicon chip, a meteorite, a mineral or a large organic molecule. A laser beam may be used to measure the creep of continents or catch a chemical reaction in a state of transition. This diffusion of new experimental techniques does not stop at the boundaries of the exact sciences. X-ray optics is exploited to study stars and starsh, macromolecules and membranes. Synchrotron radiation has applications throughout the sciences. The recent emergence of a whole cluster of generic research technologies is a major force for change in every European university. trans-disciplinary disciplines According to the old image of the tree of knowledge, various aspects of the natural world can be characterized according to an innate structure, ranging from the quark to the quasar in scale, and from the particle to the political party in complexity. An observation or theory could be assigned to a particular science according to the aspect of nature that it illuminated. By the middle of the twentieth century, the tree metaphor was in trouble. To switch metaphors, all the Dark Continents, the terrae incognitae, had been traversed, roughly surveyed and colonized by eager pioneers. At the junctions of the continental plates, buffer zones were established, whose compound names geochemistry, astrophysics, geophysics, chemical physics (not to be confused with physical chemistry!), mathematical physics and so on indicated their hybrid status. Only molecular biology, located between the biochemical and cellular aspects of organic nature, 431

John Ziman has emerged as a brand new science with a previously unexplored subject matter. Despite the wonderful progress and amazing discoveries the exact sciences have made in the past fty years, they did not open doors to quite unsuspected realms of being. Physics, for example, seeking the fundamental constituents of the natural world, has dug down into the atomic nucleus, through the strata of electrons and nucleons, photons and neutrinos, to lay bare the deeper levels of quarks and gluons. But most physicists would regard these discoveries, including their theoretical interpretations and unications, as successive stages in a grand research programme that began with the discovery of the constituents of the nucleus in the 1930s.6 Astronomy, similarly, has obtained striking evidence of a much wider range of objects and phenomena than was imagined in the 1930s, but its general conception of the cosmos is not totally different from what was being taught to students at that time. Since the early 1970s, most European universities have been participants in a new academic phenomenon: the coalescence of elements drawn from a number of existing disciplines into a broad new eld of science. Indeed, these trans-disciplinary elds are often so wide in their scope that they extend far beyond the exact sciences. Cognitive science, for example, involves philosophy, psychology and physiology, as well as mathematics and computing. Earth science includes many geographical aspects of the social sciences as well as geology and geophysics. Information technology is not just advanced engineering, since it depends fundamentally on mathematics and physics on the one side, and on psychology, sociology and management science on the other. As a case in point, materials science extends right across the established exact sciences and their associated technologies.7 The knowledge and techniques that it derives from physics and chemistry come from the main stream of research in these traditional disciplines, whilst its applications are radically transforming all branches of electrical, mechanical and structural engineering. Originally it might have been described as a very loose alliance of recognized subdisciplines such as metallurgy, continuum mechanics, crystallography, polymer chemistry and solid state physics. Now it might be represented as a confederation of innumerable research specialities, concerned with a variety of material properties such as semiconductivity, magnetism, crystal growth, mechanical strength and so on. Or it could be dened in practical terms as the search for peculiarly strong,

6 7

A. Pais, Inward Bound: Of Matter and Forces in the Physical World (Oxford, 1986). I. Bernstein, Materials Science and Engineering, in Clark and Neave, Encyclopedia IV, 236272.

432

The mathematical, exact sciences elastic, light, insulating, transparent, superconducting, biologically inert, new materials. The champions of this new science tend to exaggerate its academic coherence. In spite of the pervasive inuence of some very powerful postwar conceptual developments, such as lattice defects, it does not have a unifying intellectual theme. Its practical goals and research problems are so diverse that it fragments into subdisciplines dened in terms of classes of materials, such as ceramics, metallic alloys, semiconductors and optical materials. Nevertheless, each of these subdisciplines is multidisciplinary, if not fully trans-disciplinary, since it requires the combined efforts of physicists, chemists, mathematicians and engineers with a sound general understanding of these distinct disciplines as well as special expertise relevant to a particular type of material. Whether or not materials science is recognized within a particular university as a distinct discipline, it is no longer a reformist slogan, but is rmly established in many institutions as an academic category that cuts right across the traditional scheme of the exact sciences. In effect, it does not belong to that scheme at all, but presents itself as a member of an alternative classication. The emergence of a genuine matrix structure of this kind is empirical evidence of the growth of interdisciplinarity in the exact sciences. In a later section we discuss the very severe educational and organizational problems that this is posing for European universities. The increasing trafc across the interfaces between the exact sciences is both a cause and a consequence of closer contacts between the sciences and their associated technologies. Thus, on the one hand, interaction between chemistry and physics suggests new developments in chemical engineering; on the other hand, practical problems encountered in the petrochemical industry can only be solved by the joint application of chemical, physical and mathematical knowledge. But the gap between basic and applied science has also been closing as a result of nalization. This refers to the degree to which research in a particular eld can be nalized, that is, usefully oriented towards realistic goals. The original Finalisierung thesis,8 which was put forward by a science studies group at a Max Planck Institute at Starnberg near Munich in 1973, ran into a political storm because it seemed to advocate greatly increased state control of academic research. This interpretation was not justied, since the thesis was descriptive rather than normative, but it has tended to divert attention from the common factor in a series of major historical developments in the place of the exact sciences in most European universities in the past half-century.
8

G. Bohme, W. van den Daele, K. Hohlfeld, W. Krohn and W. Schafer, Finalization in Science: The Social Orientation of Scientic Progress (Dordrecht, 1983).

433

John Ziman The nalization thesis depends on Thomas Kuhns account of the life cycle of a eld of study,9 which typically falls into two phases. One phase is characterized by an agreed-upon paradigm, which so structures a eld that its practitioners do not quarrel over fundamental questions of method or interpretation. The other phase, revolution, is characterized by anomalous observations that do not t into any existing interpretations together with a general feeling that conditions exist for a breakthrough into a more coherent theoretical regime. In this phase, it is still unrealistic to direct research towards designated technological objectives; instead, a major effort towards better basic understanding is likely to be very rewarding in the long term. We might say that high energy physics, astrophysics and cosmology are in a protracted revolutionary phase in that there remain fundamental phenomena that are quite unexplored, there is still widespread uncertainty about the theoretical framework within which research ought to be planned, and a broad spectrum of highly speculative projects are being actively pursued, mostly under academic auspices.10 One of the exciting features of science since the Second World War is that many major elds have undergone a Kuhnian revolution apparently so conclusive that they are now denitively nalized. At the beginning of the period, classical macroscopic physics (e.g. hydrodynamics) had already established a paradigm within which research could be concentrated on the unexplained but important phenomena already observed, for example, in the oceans and atmosphere as well as in many engineering systems. By the end of the period, this condition applied to many aspects of condensed matter physics (e.g., in semiconductor devices), simple molecular structures (as in physical and inorganic chemistry), and to macroscopic terrestrial phenomena (through the theory of plate tectonics). This development is clearly of peculiar signicance in the exact sciences since a strong theoretical paradigm is the essential condition for the realistic computer modelling of any natural or articial system. Such models, in turn, are essential tools in the advancement of both knowledge and practice. University scientists are increasingly requiring access to more and more supercomputing facilities to simulate chemical reactions in the upper atmosphere, the folding of protein molecules, uid ows and magnetic elds in the core of the earth, the interactions of quarks inside nucleons, the rst ve minutes of the history of the Universe. Industrial scientists and engineers are putting the same paradigms through their paces on even more supercomputers in order to model the ow of gases
9 10

T. Kuhn, The Structure of Scientic Revolutions (Chicago, 1962). J. Barrow, Theories of Everything: The Quest for Ultimate Explanation (Oxford, 1990).

434

The mathematical, exact sciences in a jet engine, the electron currents in a microchip memory, the geological shaping of a mineral deposit, the ux of neutrons in a nuclear warhead, or whatever else they are employed to make or do. The possibility of carrying out research more systematically, according to a more certain schedule, inuences all the other dimensions of the scientic enterprise. The immediate effect of nalization is usually for scientic work to move out of the university into industrial R&D laboratories, where it can be pursued on a much larger scale with serious commercial intent. An obvious example of this is in basic semiconductor physics, where the pace is set by the multinational electronic rms, mostly outside Europe, in spite of determined efforts in many European countries to maintain a university presence in this eld. But nalization (which is basically a concept of applied science) makes the results of academic research seem more relevant to practical goals, and potentially more immediately exploitable for prot. It thus brings the university and industrial sectors closer together for the basic education of scientists and engineers, for training in advanced research, and for the formulation and support of research projects. These considerations, in turn, affect the institutional and sectoral location and framing of scientic activity, and the place of the university in society.

collectivism During our period, the performance of research in the exact sciences has changed even more radically than its subject matter. This change is most economically described as a move from individual scientic effort towards highly organized collective modes of research.11 The most direct evidence of the change is the phenomenon of multi-authored scientic papers.12 Before the Second World War, the great majority of such papers in the physical sciences and mathematics were published either in the name of a single author or of two scientists in close collaboration, typically a student or junior researcher together with his or her professor. This did not necessarily mean that people were doing their research entirely alone. In most cases, there would have been students or staff members of a university department or institute, with a dozen or so scientists and technical staff sharing the basic facilities of a research and teaching laboratory. But they would normally have had their own stretch of laboratory bench and their own personal projects, for which they took individual responsibility from conception through performance to publication. This applied in principle even in a large research school where almost all the research
11 12

J. Ziman, Of One Mind: The Collectivization of Science (New York, 1995). D. Price, Little Science, Big Science (New York, 1963).

435

John Ziman was actually being carried out under the close supervision of a famous professor, who also claimed much of the credit for its successes. What we now nd, in all the exact sciences, is that papers that are not exclusively theoretical usually appear above the names of a group of authors ranging in number from two or three up to dozens, or even hundreds. This reects a reality of collaboration, whether in voluntary partnership as professional colleagues or under managerial instruction as members of an organized research team. Although the group may have an easily recognized leader, the research is presented as the collective product of the labour of all its members. This phenomenon varies in scale and intensity from eld to eld, but it is not conned to the exact sciences. Indeed, it is so pervasive that it cannot be ascribed to any single simple cause. It may represent a cultural form diffusing back to Europe from the richer, more business-like universities of the United States. The example of military research during the war, and of technological R&D in large industrial rms, demonstrated the effectiveness of large research teams focused on the solution of well-dened problems. In some elds of the exact sciences notably high energy physics and space research this model is almost unavoidable. Even in a revolutionary phase of a science, the effective nalization of many technical aspects of the research makes it feasible to mount projects that are so elaborate that they can only be undertaken by large highly organized groups of very skilled people. Where the science itself has effectively become interdisciplinary or trans-disciplinary, research programmes cannot be broken down into independent projects suited to the limited range of expertise of individual researchers. Progress requires the active, day-to-day collaboration of specialists from a number of different scientic traditions. Even when the investigation is apparently located within the main stream of a traditional discipline, it may require inputs from a number of different technical specialities. Few physicists nowadays are masters of both the experimental and theoretical techniques that contribute to their eld and, as a result, it may be found advantageous to publish jointly with colleagues with complementary skills. One of the most obvious and signicant developments during this period has been the rapidly increasing sophistication and cost of the equipment required for useful research and for up-to-date instruction in most elds of the exact sciences.13 This is owing to factors already noted the application of discoveries in one eld as research technologies in others (e.g., NMR in chemistry), systematic redesign and manufacture of novel but very powerful standardized instruments by commercial rms,

13

J. Ziman, Prometheus Bound: Science in a Dynamical Steady State (Cambridge, 1994).

436

The mathematical, exact sciences and the automatic control of instruments by electronic computers. A particular investigation may not always involve the construction and use of one dedicated piece of apparatus, but it will often require the routine use of several elaborate instruments such as electron microscopes, mass spectrometers, infra-red spectrographs, and access to high-powered computers and databases. An effective research institution such as a university department has to make a heavy investment in such instruments, even though their use is shared by many little science research groups. The scale of aggregation necessary to make such a department economically viable is a matter of opinion, but it is now quite clear that it is of the order of dozens, if not hundreds, of research scientists. This does not necessarily mean that their research plans have to be closely coordinated (as they would certainly be in an industrial R&D laboratory) or that they come under a single centralized management. Indeed, it is possible in principle, though often difcult in practice, to arrange for sharing such facilities amongst several academic departments in different university buildings, or even by the staffs of other institutions in the locality. In any case, the scientic staff of a university must have regular access to a wide range of research instruments supported by a strong communications network and other infrastructural facilities. This requirement is expensive in organizational effort as well as money. But it is a sine qua non. Since the Second World War, the standard of equipment necessary for competitive research in the exact sciences has been set by the United States. One of the signs of completion of the phase of post-war reconstruction in Western Europe was that university laboratories could claim parity with the United States in this dimension. One of the most grievous signs of current scientic weakness in Central and Eastern Europe is the crippling lack of such resources, especially in the universities, but also throughout their academic research institutions.

internationalization The economic and administrative advantages of funding and managing research resources in relatively large units do not mean that the research itself needs to be organized on the same scale.14 Quite small research units, say half a dozen professional researchers with accompanying assistants, students and technical staff, are still optimal for strategic basic research over wide areas of the exact sciences, provided that they have access to the necessary instrumental facilities. Systematic intellectual collaboration
14

M. Franklin, The Community of Science in Europe: Preconditions for Research Effectiveness in European Community Countries (Aldershot, 1988).

437

John Ziman between such units in several universities can also bring their combined efforts above the critical mass required for a competitive contribution to knowledge. But there are research elds where the essential instruments are so large and so indivisibly costly that they are far beyond the personnel and material resources of even the largest university, and can only be provided as national or international facilities. This is a peculiar feature of the exact sciences, and a major aspect of their place in the university world. Physical scientists throughout Europe are having to spend more and more of their research time as active users of Big Science institutions outside their home universities. Some of these facilities were originally provided and managed nationally, but elementary economies of scale continually push towards multinational sharing of investments, running costs and usage.15 We cannot cover here the diverse historical origins and contemporary status of such collectivized scientic institutions as CERN and DESY, ILL, EMBL and the ISIS, Garching and JET, not to mention the astronomical telescopes, computer networks, space platforms and so on which now constitute a major fraction of all European effort in the exact sciences. Sufce it to say that the arrangements by which such facilities are constructed, managed and shared in use are major factors in the way that European universities now perform their research and educational missions. The emergence and institutionalization of this highly practical transnational dimension to their activities may be considered one of the most signicant developments in the collective history of the European universities since the Reformation.16 However, international institutions are not taking over all the roles and functions of universities in the exact sciences, even in the realm of research. There are a few institutions like JET the Joint European Torus where research scientists from a number of countries are employed full time, under international management, to carry out largescale experiments on the magnetic connement of high temperature plasmas. But this particular enterprise scarcely belongs in the university sphere, even though it is still very far from its ultimate practical objective of generating electric power by nuclear fusion. Such self-contained research establishments are quite rare at the international level, and have been set up mainly to full very special scientic or technological needs. Even CERN, with its enormous resources and facilities, does not have a large academic staff of its own. The extraordinarily elaborate and costly experiments that are performed on its immense particle accelerators are
15

16

A. Hermann, J. Krige, U. Mersits and O. Pestre, History of CERN, Vol. I (Amsterdam, 1987); Vol. II (Amsterdam, 1990); J. Krige (ed.), History of CERN, Vol. III (Amsterdam, 1996). R. Herman, The European Scientic Community (Harlow, 1986).

438

The mathematical, exact sciences planned and carried out by so-called collaborations that is, by ad hoc teams of hundreds of academic scientists drawn from dozens of universities in many different European countries. They remain employees or students of their home universities, to which they return from time to time to carry out their normal academic duties, although with useful international experience. Many of the Big Science facilities that seem to dominate research in the exact sciences are sources of special radiations or very powerful observing instruments used by small research groups working independently. Thus, a university researcher may go to Grenoble for a few days, carrying a previously prepared specimen to be placed in a beam of neutrons workstation at the high ux nuclear reactor of the Institut Laue-Langevin. Or astronomers from Northern Europe may spend time at La Palma, observing at the Northern Hemisphere Observatory. The intergovernmental agreements for running such facilities are often very elaborate and sometimes contentious, but they are very distant from the affairs of universities, and scarcely impinge directly on the working lives of the scientists who routinely use the instruments. Another way in which academic science is going European is through the development of international programmes where the individual projects require the active collaboration of university research groups based in several different countries. Sometimes this is done for political reasons, to emphasize transnational cohesion between stronger and weaker scientic communities, or to foster pre-competitive research as a basis for marketable technological innovations. But it may also have a compelling scientic rationale, particularly in the earth sciences. Thus the European Geo-Traverse Project involves the systematic study of geological formations running right across the Continent, regardless of national frontiers. But here again, however closely and harmoniously the individual research groups collaborate in such projects, they do not merge their legal or administrative identities, and they remain rmly rooted in their home institutions. The Europeanization of research is not, therefore, diminishing or superseding the role of the universities in the exact sciences. There is no signicant pressure for the creation of an all-Europe institution for undergraduate or postgraduate instruction in any of these disciplines.17 Most research in the physical sciences is still carried out by university or national research council employees in laboratories located on university campuses. Even where the research is actually performed by a multinational team working most of the time at an international facility, its results are attributed to all the separate universities involved in the collaboration.
17

See chapter 3 (Relations with Authority).

439

John Ziman In fact, the political and economic unication of Western Europe and the expectations for similar developments towards the East have strengthened the universities as independent corporate actors in the exact sciences. A European research system, or a European science base, is emerging, not as a command structure centred on Brussels, but as a loose network of non-governmental organizations such as the European Science Foundation, learned societies such as the Academia Europaea, multilateral intergovernmental agencies such as CERN and the European Space Agency, not to mention the shadowy powers of multinational commercial rms such as Siemens, Airbus Industries or Shell. Many of the coordinating and funding functions of national research councils and other agencies are moving upwards into this network, leaving universities and their research entities intact as performers or joint contractors for research projects. Many professors and research directors in European universities now nd that they are dealing as directly with the Community or with ESA as with their own governmental agencies. Because of these developments, the exact sciences are taking the lead in making European universities more cosmopolitan. It is a commonplace, exemplied in every volume and chapter of this history, that European scholarship, learning and science has always been an international activity, and that scholars have moved from university to university and from country to country in the course of their careers. Nevertheless, for most physical scientists and mathematicians, such movements were incidental to personal circumstances an offer of employment, political exile, apprenticeship to a research leader and so on rather than constitutive of their scientic work. The work that counted was done at home with a small group of colleagues and students. The sheer research technology of the exact sciences has forced scientists to become much more cosmopolitan in their outlook and working practices. High energy physicists were in the vanguard of this transformation, rst by building on their scientic camaraderie to create a permanent research facility where they could work together, then by demonstrating the effectiveness of multinational research teams and by establishing data networks linking scientists in their own laboratories. The history of the development of the academic electronic mail system has still to be written, but the web arose at CERN in Geneva as an auxiliary function of data networking in the exact sciences. The informal use of this network for personal communication acquired a life of its own, and now provides a permanent public space, open day and night, for the cosmopolitan invisible colleges of all our academic disciplines. Since the Second World War, international homogeneity in the formal and technical cultures of the exact sciences has spread outwards from the written paper, the conference hall and the laboratory bench to other 440

The mathematical, exact sciences aspects of scientic life. It now seems quite normal to be working in a multinational research team, communicating in the lingua franca of broken English, and united against the obstructive local bureaucracy. A days scientic business in Paris or Geneva is no more out of the way for an Oxford scientist than one in Edinburgh or in Swindon. An international committee allocating observation time on a European telescope seems just as natural as a national peer review panel doing the same job. If, as is often asserted, it is desirable to create a United States of Europe on a par with the United States of America, then the exact sciences have already gone further down this path than most other components of Europes universities. For nearly half a century, university science in Europe has been strongly motivated by the desire to catch up with science in the United States. But this rivalry is only one element in a symbiotic relationship of partnership and collaboration. The transatlantic linkages of people, research groups, projects, programmes, industrial rms, military commands, computer networks and so on have broadened in bandwidth and carrying capacity since they helped European science back on to its feet after the war. These linkages now extend right round the world. The rapid development of international programmes of global environmental research shows that the cultural infrastructure is already in place for much closer collaboration on a global scale where this is necessary. Research in elds such as meteorology is already worldwide in its technical management. The same will surely apply to all forms of Big Science. Elementary economic considerations will force competitors to cooperate and merge. For example, thanks to international cooperation the Large Hadron Collider at CERN came on line in 2009, despite budgetary problems, whereas foreign support was unable to prevent the United States from abandoning the Super Collider. If an even bigger particle accelerator is ever built, it will be a world machine, where high energy physicists from European universities will be working in teams with their peers from all over the world. linking the academy with industry As observed earlier, at the end of the Second World War distinct frontiers still existed between the exact sciences and their associated technologies, reecting the professional differentiation between the academic and industrial sectors of society. It is true that students of electronic engineering were often taught their basics alongside students of physics and mathematics, and some universities established departments of applied physics to bridge the gap. It is also true that these frontiers were much less marked in chemistry and geology than in physics. Chemistry was one 441

John Ziman of the rst of the physical sciences to be applied systematically in industry, and the relatively modern profession of chemical engineering developed from the beginning as an interdisciplinary subject, both in the basic education of industrial engineers and in its research themes. Geology has always been professionally linked with mining, oil prospecting and other extractive industries. Nevertheless, the distinct role of academic research was clearly maintained in all these disciplines. Any history of technology will show, however, that the interfaces with the exact sciences were essentially ideological and always highly permeable. Indeed, the major premise of the linear model of technological innovation is that basic scientic discoveries (e.g., of electromagnetic induction) eventually give rise to technological inventions (the electric dynamo). The signicant feature of our present era is that the ideology maintaining the boundaries was dissolved by the acid of practice, especially at the research front. The characteristic research activities and interests of the industrial and academic sectors interpenetrate in detail, on university campuses, in science parks and in corporate R&D laboratories. A typical research question in materials science is What are the optical properties of an isolated chemical impurity in a glassy material? This question might have been posed in the course of a basic study of the fundamental quantum-mechanical states of electrons in such systems; it might equally well have arisen along the way to developing and manufacturing a more transparent glass bre for opto-electronic communications. The research would involve exactly the same instruments, specimens, theories, archival sources and technical expertise. Precisely the same investigation might have been mounted in a university department of chemistry, physics, materials science or electronic engineering, in the R&D laboratory of a multinational electronics rm, or in a research establishment of a national ministry of defence. And in every case, serious consideration would be given to whether the research results might give rise to an application that could be patented or otherwise exploited commercially. This does not mean that all university work in the exact sciences is now directed towards technological invention. Curiosity-driven, exploratory, blue skies research is still being done for its own sake by thousands of academic scientists honestly seeking the truth all over Europe. A great deal of the research carried out in European universities is indeed academic in that it is not undertaken in response to a specic, immediate, practical need. Private-sector rms are not doing all the basic research they think they might need to support their industrial R&D. Although some elds of academic science like solid-state electronics have

442

The mathematical, exact sciences moved out of the university into industry, the training of students and researchers in these elds is still a university responsibility. Academia and industry are much more open to each other than they used to be, but they are still essentially complementary in their scientic and technological activities. The notion of strategic or pre-competitive research provides an umbrella slogan for most of the exact sciences, except astrophysics, cosmology, very pure mathematics, and very high energy particle physics. It is not implausible to say of any research project in the rest of physics, in all of chemistry or in the earth sciences that it might produce knowledge that might improve our basic understanding of a generic technology that could eventually enable a protable practical invention. This notion is proving a valuable rhetorical resource for university scientists seeking moral justication and nancial support for their projects, however distant these may actually be from the marketplace. There is still a signicant cultural divide between the academic and industrial setting. Well-established academic attitudes and practices freedom of problem choice and of publication, theoretically dened objectives, reference to disciplinary peer groups, personal autonomy within a collegial structure, and so on are not easily reconciled with adherence to a programme designed to produce marketable intellectual property relevant to the urgent solution of a practical problem already dened by corporate management. This cultural mismatch deters the academyindustry trafc more effectively than is usually recognized in public exhortations, and they have not been altogether nullied by the wide range of new institutions that have been set up to bridge the divide. These include science parks designed to tempt high-technology industry on to university real estate, German-style Fraunhofer Institutes seeking an honest living as brokers and developers of exploitable academic ideas, semi-autonomous interdisciplinary research centres drawing support from universities, industrial rms and government agencies, joint research centres located inside universities but heavily endowed by specic rms claiming rst call on their research results, and venture companies set up by universities to market the research output, scientic services and technical expertise of their academic staff. Some of these organizational developments are so radical that they threaten the intellectual, social, nancial and administrative principles on which European universities are founded. The enabling and generic functions of the exact sciences in the high-technology chemical and electrical industries have opened these fundamental sciences up to very powerful social, political and economic inuences. Even in a university laboratory, the goals and outcomes of research projects may be determined by

443

John Ziman commercial or military considerations, rather than by traditional academic values. This is one of the most signicant developments in the history of the exact sciences in European universities in the past halfcentury. Attention is mainly focused on the administrative and career problems of opening up the organizational interfaces between universities and industrial rms. From a pragmatic, managerial point of view, these are not really more difcult to solve than those that arose in reconciling academic ofce with professional practice in medicine, law, engineering and architecture. The promise of large nancial benets overcomes many high-minded scruples about scientic autonomy and academic freedom. In justication it is said that the creative integration of theory (the academy) with practice (industry) promises substantial advantages to society and demonstrates the vital social role of the university even in its most esoteric and expensive activities. In these activities, as in all others, the university cannot survive unless it continually renews itself by its services and responses to society at large. But these linkages transmit moral responsibilities along with lavish funds. Some areas of academic research in the exact sciences, such as nuclear and plasma physics, have ridden high on their contributions to military and energy technologies and are now at risk as these technologies fall out of public favour. At the other extreme, branches of the exact sciences epitomized by high energy particle physics, which seem to have no strategic escape from ever more expensive and intellectually baroque ivory towers, are menaced. teaching and/or research The dynamism of the exact sciences is centred on their research capabilities rather than their educational functions. The European university tradition depended on a symbiotic relationship between teaching and research within a disciplinary department or a faculty aggregated out of specialized professorial institutes. The developments described above have put this relationship under very severe stress. In effect, the research frontiers have proliferated, diversied, intermingled and moved on, so that they are no longer directly connected with the basic subjects that need to be taught to students. It is not that courses and curricula are out of date, irrelevant to current practice or inconsistent with current knowledge. They are simply inadequate to the long-term career needs of the majority of students. Some of these will go on into highly specialized subelds of academic research; others will move out of academia into rapidly advancing areas of industrial research and development. To do these jobs properly, they will require

444

The mathematical, exact sciences acquaintance with a variety of exquisitely sophisticated theoretical concepts and manipulative techniques, and a broad grasp of the capabilities and inter-relationships of different approaches to a certain range of scientic or technological problems. Three or four years of undergraduate education in the exact sciences are not sufcient for a complete preparation either for professional employment or for an apprenticeship to independent research. This curriculum pressure is particularly strong in the physical sciences, where knowledge is cumulative and progressive. New understanding builds on past understanding, but does not supersede it. For example, most theoretical understanding in physics and chemistry is based on quantum mechanics. This is a sophisticated intellectual discipline, whose principles and methods cannot be boiled down to a few elementary notions. A meaningful introduction to quantum theory takes time, and has to occupy a considerable proportion of every university course in disciplines that rely on it. The way in which certain central lines are interconnected and built on one another makes it very difcult to construct a coherent curriculum for these new subjects out of a limited number of otherwise unrelated modules taught by several different academic departments. European universities have therefore been forced to follow the American lead in developing formal instruction beyond the rst degree to take students up to a research frontier. The traditional professorial seminar is no longer satisfactory as an introduction to the latest research topics. The doctoral degree, which used to be a sign of mastery of scholarly practice achieved through personal apprenticeship, is being transformed into a certicate of advanced instruction and training in research methods. The exact sciences have been amongst the rst disciplines to establish more regular graduate schools for this purpose. Other bodies, such as the NATO Science Committee, have also been active in organizing advanced study institutes and summer schools with similar functions.18 Traditionalists naturally lament this downgrading of rst-degree (or rst-cycle) courses, especially where this means the dilution of mainstream courses in the established disciplines with material from other subjects. But the notion (already obsolescent before the war) of the preformed, fully trained physicist, chemist, mathematician or geologist is obsolete, and lives on only as a straitjacket restricting radical reform to a exible system of further and continuing education even for the academic and technical elite.

18

See chapter 3 (Relations with Authority) 989.

445

John Ziman The American concept of postdoctoral training in research is catching on in European universities. But that does not solve the problem of reconciling the relatively permanent disciplinary structure appropriate for undergraduate teaching with the changing, interdisciplinary, multinational intersectoral groupings that are now typical of advanced research in all the exact sciences except, perhaps, pure mathematics. One solution is to cut the cord tying teaching to research by setting up a separate system of institutes, units, laboratories or centres staffed by full-time research scientists. This is the French policy in the CNRS, the German policy with its Max Planck Institutes and the practice of concentrating almost all academic research in a national academy of sciences that was copied from the Soviet Union throughout Central and Eastern Europe. The same considerations underlie the establishment of in-house research laboratories by the UK research councils, although these are not predominant in the exact sciences. The pros and cons of the policy of hiving off the premier research activities of universities, leaving very limited research facilities for university teaching staffs, are discussed elsewhere in this volume.19 At rst sight, this arrangement would seem particularly favourable for the exact sciences with their gargantuan instrumental needs and high technological potentialities. And yet experience in countries such as the USA, the UK, Holland and Sweden shows that these complications can still be handled inside the university framework without separating teaching from research in the working careers of academic scientists. The key point here, as has been hinted previously, is not to allow the traditional disciplinary departments to manage the research activities of their teaching staffs, but to give them research time in a matrix of relatively independent research entities units, centres, groups, laboratories, committees and so on within, across and beyond the departmental structure. Something like this is emerging in some UK universities and may well spread, in due course, to other universities in Europe.

looking backward and forward The end of the cold war is a convenient standpoint for a backward look and a peep into the future. Throughout the period, the exact mathematical sciences have ourished. Scientically and technologically, they have lived up to the promise of immense cognitive progress and practical achievement with which they came out of the Second World War. These have been good times for the knowledge industry. An immense
19

See chapter 7 (Curriculum, Students, Education).

446

The mathematical, exact sciences amount of reliable, signicant information about the physical world has accumulated. The application of this knowledge has also proved a very prosperous enterprise, in which the university has been a major partner. To be sure, some of the prospects seen from 1945 were illusory. Euphoria for the new age of nuclear ssion and/or fusion has evaporated. Civil nuclear power was oversold, and the mad rush into nuclear weaponry is now seen as a fearful and loathsome moral aberration. The scheduled take-off into planetary space was also disappointingly delayed. On the other hand, there have been unforeseen successes. The European academic physicists who had led the way, before the war, to an understanding of semiconductors would scarcely have predicted the immense information and communication potentialities of their obscure specialty. The post-war revival of the university in Europe was not expected to re-establish its pre-eminence in the exact sciences. But it came back into a relatively comfortable position of high repute in most elds, and world leadership in many. It is no longer meaningful, as it was in earlier periods, to single out particular universities, departments, institutes or individuals as centres of outstanding excellence in particular subjects. Of course there is an unleavened lump of mediocre research in the less competitive universities, but top quality work is being done by immensely talented scientists in a large number of institutions distributed across the whole region. This solid achievement was made possible by a vast expansion of material and human resources. The former came from national governments convinced of the value of the exact sciences as a long-term techno-economic investment. The latter were the fruit of a long European tradition of very high standards of secondary and technical schooling in these sciences. This was the secret of the rapid regrowth of high science in West Germany. It also facilitated the extension of industrially relevant R&D into southern Italy, Spain, Portugal, Ireland and Greece. In other words, the general modernization of society throughout Western Europe has been accompanied by an upgrading of the conventional sciences of technological modernity that is, the exact, mathematical sciences. The challenge now is to bring the scientic communities of Eastern and Central Europe up to the same standard. Despite the desperate shortages of scientic apparatus and communication facilities, the exact sciences probably suffered least of all academic disciplines under communism. They were favoured by the regime, and not interfered with ideologically. The universities, although downgraded for research by comparison with academy institutes, maintained their strong tradition for thorough, if unimaginative, technical education in the fundamentals of the various disciplines. Indeed, these countries are seriously overstocked with 447

John Ziman well-trained scientic workers, who could, with a little experience with more modern facilities, compete for research employment in academia or industry anywhere in the world. This is one of the most serious problems facing the university in Europe at the turn of the century. The only way to stem the drain of the best young scientic brains from Central and Eastern Europe to other regions is to build up attractive research conditions in their own countries. This is bound to be costly in terms of scientic instrumentation and other material facilities. But a lot could be done at quite modest expense by proper connections to the international electronic networks and other channels of scientic communication. This is both essential and relatively easy for the physical scientists, who must have access to the vast international databases in astronomy, geophysics, chemistry and so on, and who have learnt the hard way to make the most out of electronic hardware and software. For the research system as a whole, however, the real need is for a far-reaching structural reform to t it for post-socialist conditions. Since these conditions have not yet stabilized, the precise objectives of these reforms cannot be stated. A general move towards the established West European model would require selective downsizing of research establishments, linking strategic and applied research directly with industrial development, and revitalizing the tradition of combining high-quality basic research with university teaching. These structural changes are already under way, especially in what was once East Germany, but they are still far from complete, and still quite uncertain in their ultimate effect. One consequence of the scientic crisis in the former Soviet Union and other socialist countries is to draw attention to the social function of the university, and of the sciences it advances. This heightened consciousness applies even to the exact sciences with their relatively uncomplicated technical roles. Until, perhaps, the 1970s, it was generally assumed that the advancement of basic knowledge in the physical sciences and mathematics was an unquestionable social good, to be promoted without moral qualms. Academic scientists were often involved personally in general debates about the ethics of nuclear war, but they usually argued that these were about the unanticipated uses of scientic knowledge, not about the processes by which this knowledge was originally obtained. A career devoted to the honest search for truth was valued by many physical scientists for its relative insulation from social corruption, whether communist or capitalist. The university was considered an autonomous knowledgegenerating and knowledge-transmitting social institution, which could not be held directly responsible for the follies or crimes of politicians, industrialists, gangsters or generals.

448

The mathematical, exact sciences Paradoxically, the attempt by these very same politicians and others to squeeze more utility out of the research system has fractured this notion of ethical neutrality. As we have seen, the university is much more tightly wired-up into society than ever before. One of the major trends in the exact sciences is tacit recognition of the validity of the call for social responsibility in science and of the need for education and research on science, technology and society.20 Reformers with objectives ranging from managerial corporatism to critical anarchism are working to introduce such matters into the school and university curriculum. This runs against the long-established academic tradition of emphasizing technical objectivity, rationality and impersonality to the exclusion of all that is human in many other respects.

select bibliography
Barrow, J. Theories of Everything: The Quest for Ultimate Explanation, Oxford, 1990. Bohme, G., Van den Daele, W., Hohlfeld, K., Krohn, W., and Schafer, W. Final ization in Science: The Social Orientation of Scientic Progress, Dordrecht, 1983. Bush, V. Science: The Endless Frontier, Washington, D.C., 1945. Cozzens, S., Healey, P., Rip, A., and Ziman, J. The Research System in Transition, Dordrecht, 1990. Franklin, M. The Community of Science in Europe: Preconditions for Research Effectiveness in European Community Countries, Aldershot, 1988. Galison, P. Image and Logic: A Material Culture of Microphysics, Princeton, 1997. Herman, R. The European Scientic Community, Harlow, 1986. Hermann, A., Krige, J., Mersits, U., and Pestre, D. History of CERN, 2 vols., Amsterdam, 198790. Hoddeson, L. et al. Out of the Crystal Maze: Chapters from the History of Solid State Physics, New York, 1992. Kragh, H. Quantum Generations: A History of Physics in the Twentieth Century, Princeton, 1999. Krige, J. (ed.) History of CERN, Vol. III, Amsterdam, 1996. Kuhn, T. The Structure of Scientic Revolutions, Chicago, 1962. Lemaine, G., MacLeod, R., Mulkay, M., and Weingart, P. (eds.) Perspectives on the Emergence of Scientic Disciplines, The Hague, 1976. Pais, A. Inward Bound: Of Matter and Forces in the Physical World, Oxford, 1986. Price, D. Little Science, Big Science, New York, 1963.
20

J. Ziman, Teaching and Learning about Science and Society (Cambridge, 1980).

449

John Ziman
Veltman, M. Facts and Mysteries in Elementary Particle Physics, River Edge, N.J., 2003. Whitley, R. The Intellectual and Social Organization of the Sciences, Oxford, 1984. Ziman, J. Knowing Everything about Nothing: Specialization and Change in Scientic Careers, Cambridge, 1987. Ziman, J. Of One Mind: The Collectivization of Science, New York, 1995. Ziman, J. Prometheus Bound: Science in a Dynamical Steady State, Cambridge, 1994. Ziman, J. Teaching and Learning about Science and Society, Cambridge, 1980.

450

CHAPTER 12

THE BIOLOGICAL SCIENCES

HERBERT C. MACGREGOR

from bones to biotechnology The rst forty years of the twentieth century saw steady progress in our understanding of living systems. No particular eld of biology dominated. The major hypotheses of the nineteenth century were tested and in some cases conrmed and integrated into other elds of science. Biology was represented by zoologists who studied animals, botanists who studied plants, physiologists who, if they were not zoologists, studied humanrelated animal systems, geneticists who worked mainly with fungi, cereal plants or the fruit y Drosophila, and biochemists who were the pioneers of investigation into the molecular events that characterized living systems. All branches of biological science were academic subjects. There were some clear medical objectives, such as understanding cancer or dealing with pathogenic microbes, and amongst the geneticists there was an ongoing commitment to selective breeding in the service of agriculture, but for the most part the biological sciences were distant from application. After 1945, biology and its divisions transformed under the pressure of new discoveries and their technologies. Stronger links were forged between medicine, science and technology, and new breeds, like cell-, developmental-, molecular-, marine- and neuro-biologists made their appearance. Questions and hypotheses became smaller and more circumscribed, therefore more quickly and objectively tested. An investigator who examined animal cells with an electron microscope could be called a cell biologist although he or she might be a zoologist interested in the growth of eggs in insect ovaries. Accordingly, a wide range of new job descriptions emerged. Today European universities offer over fty different rst-degree titles in the biological sciences. In addition to diversication, the biological sciences in the early post-war years became 451

Herbert C. Macgregor capital-intensive and more collaborative as the increasing complexity of techniques made it difcult for one person to accomplish a useful research objective without the help of others with different expertise. Science by numbers meant working as a team, publishing as a team and sharing success. One of the most important trends over the past fty years relates to our attitude towards animals, plants and the environment. In the immediate post-war years, the vast majority of European adults regarded animals as pets, game, pests or food. Plants commanded a little more respect and interest, perhaps because in wartime many of us learned, through necessity, how to cultivate them for food and took pleasure in constructing pretty and productive gardens around our homes. The concept of the environment did not exist in 1945. Few species were known to be endangered. The major oil products had yet to be developed. Oil consumption itself was relatively low. There were few automobiles, no pesticides and no herbicides. The harvesting of forests seemed to be under control and commercially sustainable. The construction industry was in its infancy, though slated to expand at a truly phenomenal rate. Perhaps most signicantly, there was no television. Mass media impact in defence or glorication of the natural world was impossible. It took the deaths of over three thousand people following the famous London smog of December 1952 to begin to convince us that we might be abetting environmental changes that adversely affected the quality of our lives. Television changed all that by bringing the natural world into the living room and by making news out of environmental catastrophes. For many the condition of the air was unimportant until the London smog, and there was no life in the sea until the fully laden oil tanker Torrey Canyon foundered off the south-west of England in 1967. Environmental science and all its related elds suddenly became respectable, and the living world became more precious and exciting.

progress, development and discovery in biology 19452004 Nearly all the major new techniques developed for biological science since 1945 were aimed at improving the resolution and understanding of living systems at the molecular level.1 Chromatography allowed the separation of amino acids, the building blocks of proteins, on paper, with
1

For overviews, see B. Glass, Milestones and Rates of Growth in the Development of Biology, Quarterly Review of Biology, 54 (1979), 3153; H. C. Macgregor (ed.), Biological Sciences, in Clark and Neave, Encyclopedia IV, 2181270.

452

The biological sciences the result that proteins could be analysed and compared. Electrophoresis, centrifugation and ultra-centrifugation were all used to separate and purify the molecules of living organisms. Thus the signicance of their variation from organism to organism, from cell to cell and from time to time within cells and organisms could be evaluated. Electron microscopy was perfected in the 1950s and became readily available to biologists for the examination of living organisms at the macromolecular level by the early 1960s. Radioisotopes employed as tracers followed molecules through cells and tissues and, most importantly, helped determine the behaviour of macromolecules that seemed to be specially important in inheritance and development.

the unravelling of dna All of the core technologies for molecular biology were in place by 1953 when James Watson and Francis Crick made one of the greatest discoveries of the twentieth century in biological science. After their revelation of the structure of DNA, its signicance in relation to inheritance, evolution and development quickly became clear. Never before and never since has there been an advance in biology that was so swift and so instantly enormous in its impact. Biologists have come to understand how information contained in DNA is transferred and expressed in living cells. They have learned how this expression is controlled, how DNA itself replicates and passes on information to generation after generation of cells and organisms according to specic rules implicit in the nature of the molecule itself, and they have learned how DNA changes and some of the effects of these changes in living organisms. Understanding of the molecular biology of DNA has changed every eld of biological science. The study of the immune system is a good example. Until 1976 most of the effort in immunology went into understanding the shape of antibodies and the specicity of antigen/antibody interaction. In the early 1970s the three-dimensional structure of immunoglobulin was solved,2 the essential step for an understanding of the basis of antibody diversity. There followed a complex history of investigation and experimentation, leading to the publication of nearly a thousand papers a year over the past fteen years into the genes, the DNA sequences, concerned with antibody specicity. There is now little that is not known about the genes of the immune system and the information transfer processes that regulate antibody production. The greatest challenge, the cell biology
2

D. R. Davies, E.-A. Padlan and D. M. Segal, Three-Dimensional Structure of Immunoglobulins, Annual Review of Biochemistry, 44 (1975), 63967.

453

Herbert C. Macgregor of the immune system, remains, involving complex cellular interactions, information transfer between cells, transformations of cells, changes in cellular behaviour all of which happens with lightning speed amidst huge numbers of cells swimming in the almost endless system of blood vessels and lymphatics that keeps the vertebrate body in good living condition. A major technological advance came in the late 1960s with the discovery of restriction enzymes, for which Werner Arber and Daniel Nathans received a Nobel Prize in 1978. Restriction enzymes can cut DNA at specic sites, creating pieces that can be rearranged and tied together by ligating enzymes. These discoveries and older techniques for injecting foreign DNA into bacteria or integrating it into the DNA of viruses combined to furnish the tools for genetic engineering. Specic pieces of DNA could be isolated, trimmed with restriction enzymes in a controlled manner, and joined with other pieces or ligated into special places in whole genetic systems of living organisms. Quite suddenly scenarios previously conned to the pages of science ction became possible. In so far as genes control the entire working of a living cell, it became possible to change their orders and compositions in ways that would have predictable consequences for the cells. In this sense molecular biology through its techniques of genetic manipulation has come to dominate almost every branch of biology. In 1940 cancer was a sure killer. Twenty-ve years earlier Theodore Boveri (18621915) had suggested that cancer was associated with changes in chromosomes,3 and between 1940 and 1950 scientists in Europe became convinced that cancer had to do with changes in cells that involved their nucleic acids.4 Then, following the discovery of the Philadelphia chromosome (an abnormality causing leukaemia that arises from an exchange of genetic material between two chromosomes),5 there came a general realization that the transformations that produced the cells of malignant tumours were caused primarily by lesions in the chromosomal DNA brought about by environmental factors, radiation, toxic chemicals, free radicals and so on. Molecular biology suddenly zoomed in on cancer, and only a few years later most of the general cellular characteristics of malignant tumour cells were known and DNA became the prime target for future research. In the early 1980s, after an intricate series of investigations by several laboratories, Michael Bishop and Harold Varnus proved the existence and established the nature of oncogenes, for which they received the Nobel Prize in 1989. By 1990 more
3 4

T. Boveri, Zur Frage der Entstehung maligner Tumoren (Jena, 1914). T. Caspersson, Cell Growth and Cell Function (New York, 1950); J. Brachet, Biochemical Cytology (New York, 1957). J. D. Rowley, The Philadelphia Chromosome Translocation: A Paradigm for Understanding Leukaemia, Cancer, 65 (1990), 217884.

454

The biological sciences than fty good correlations had been recognized between specic tumour types and specic chromosome lesions, and by far the greater part of the world effort in search of a better understanding of the biology of cancer was sharply focused on the DNA, the genes and the expression of genes in cancer cells. People are still dying of cancer, but at least we now know more or less exactly what we are up against. Molecular biology has to do with more than DNA. Watson and Crick may have announced their discovery of DNA as the revelation of the secret of life, but theirs was just one of the secrets. Fifteen years before them, another young scientist, also working at Cambridge University, explained how green plants, using only water and carbon dioxide (CO2 ), utilize the energy from sunlight to synthesize carbohydrates.6 Since then, the molecular biology of photosynthesis has progressed step by step to the point at which we now understand the transfer of energy among the light-harvesting pigments in plant cells, the molecular arrangement at the reaction centres and the events that characterize the primary photochemical reaction and bring about the conversion of the energy of the photon to a form of chemically based energy that is usable by a living cell. The molecular biology of energy systems, which includes everything to do with movement and growth as well as the original capture of the suns energy by green plants, shares two important characteristics with the molecular biology of DNA but differs from it in one very interesting respect. Both elds seek to understand and explain the key events in living systems; both choose biological objects for study that provide the simplest model systems for experimental analysis. The difference between them is with respect to the instruments and procedures applied. The molecular biology of energy has relied almost entirely on tools developed in the physical sciences and modied for application to biological problems. In the early days, the study of DNA also relied on equipment and techniques that originated in physics: ultracentrifuges, radioisotope detection systems and transmission electron microscopes. All this has disappeared. The tools of molecular genetics in the twenty-rst century are either whole micro-organisms or have been forged by biologists out of selected components of living systems. The molecular biology of DNA and the information-transfer processes of cells are now examined using some of the most primitive approaches known to humankind: we investigate things by taking them apart using a blunt instrument in the expectation that we will discover sharper tools that will enable us to do the job more quickly and more carefully the next time round. This is the story of restriction enzymes, of vectors, of recombinant organisms and all the
6

R. Hill, Oxygen Evolution by Isolated Chloroplasts, Nature, 139 (1937), 8812.

455

Herbert C. Macgregor galaxy of natural implements that are employed in todays molecular biology labs. the rise of ecology The study and measurement of the interactions between living organisms and with their environment made a second revolution in biology during the twentieth century. Up to 1950, ecology was a relatively lowtechnology and low-cost science focused in the United States on succession in plant communities and in Europe on statistical description of community types, the causes of population uctuations and species interactions in the wild. The ecology of the 1950s also was descriptive and speculative. The ecosystems under study were immensely complicated and immensely variable, so statistical data analysis was of paramount importance. Breakthroughs required computers. After 1970, computing and statistical techniques allowed ecologists to design experiments, to undertake more extensive sampling programmes, to analyse their data more quickly and more searchingly and to construct testable models. Charles Krebs Ecological Methodology of 1989,7 which ranks as one of the most important texts of the twentieth century, describes these modern approaches. Like all other branches of biology, ecology proted from technological developments in other kinds of science. Gasliquid chromatography with electron capture amplication permitted the detection and measurement of toxic chemicals, such as the residues of pesticides. Radioisotopic tracers followed the ow of chemicals through ecosystems and of elements through nutrient cycles. More recently, the use of photography from aircraft and from orbiting space satellites, coupled with sophisticated computer modelling and analysis, has proved to be immensely valuable in the study of the mapping and classication of vegetation communities and of global changes that relate to human activity and intervention. Inevitably, DNA technology has penetrated into ecological science. During the 1950s and 1960s, ecologists and molecular biologists did not talk to one another. One group wore wellington boots, the other white coats. Then it was shown that different species could be identied by certain quite easily detectable properties of their DNA and that, by examining these properties, taxonomic relationships and species divergence times could be determined with remarkable resolution and precision. This was something ecologists had wanted to do for a long time. DNA technology crept in. The rst users were molecular biologists who needed to know more about the rates at which different classes of DNA sequence were changing in nature, and others who were curious about the relationships
7

C. J. Krebs, Ecological Methodology (New York, 1989).

456

The biological sciences between genes and speciation. Then, quite suddenly, DNA ngerprinting was invented.8 Ecology is concerned with interactions between individuals and species. These interactions are difcult to follow in animal populations, in which individuals are much harder to identify and trace than they are in human populations. How can we examine family relationships among birds, for example, when to our eyes all the males look exactly alike and young adults are not easy to distinguish from old ones? DNA ngerprinting has solved all that. It has transformed and accelerated an important section of ecology. There is now not much that we do not know about life except how to make it. We can manipulate organisms of all kinds at a level that was science ction in the 1950s. We understand nearly all the major aspects of living systems. There are still problems with animal development, but most of them are well dened, and there is no doubt that we will solve them in due course. We can control most of the diseases and afictions of the human species. We may never nd a cure for cancer, but it represents real progress to be able to say that we have given up looking for one; modern strategies are more informed, more reasonable and much more promising than those available fty years ago. We have it within our grasp to eliminate ageing and establish virtual immortality. The greatest problem for the human species today is how to keep pace with evolution and with our own articial forces of planetary destruction. Microbes, HIV, cancer and the major parasitic diseases of the tropics represent the evolution and diversication of cells and organisms at speeds that often outstrip both our immune defence systems and our scientic ingenuity. Future generations may wonder why it took us so long to discover how living systems work. A hundred years ago, E. B. Wilson (18561939) concluded his book The Cell in Development and Inheritance with the words, The study of the cell has, on the whole, seemed to widen rather than to narrow the enormous gap that separates even the lowest forms of life from the inorganic world.9 Sixty years later, Jean Brachet, one of the most advanced and experienced cell biologists of his time, concluded his book Biochemical Cytology (1957) with the words, The more we delve into these problems [he was referring to the basic concept of a living system], the more life remains a mystery.10 Today, there is not much mystery left, which is perhaps just as well, because the practical problems relating to human survival and quality of life on earth today
8

9 10

A. I. V. Jeffreys, D. Wilson and S. L. Thein, Hypervariable Mini Satellite Regions in Human DNA, Nature, 314 (1985), 6773. E. B. Wilson, The Cell in Development and Inheritance (London and New York, 1896). Brachet, Cytology (note 4), 4646 (Final remarks).

457

Herbert C. Macgregor are formidable, and a comprehensive understanding of living systems is fundamental to our success in meeting them. The Human Genome Project was a fteen-year research programme spanning most of the last two decades of the twentieth century. It cost around 200 million dollars a year, which, although a very large sum of money, was less than 1 per cent of the total research budget of the United States National Institute of Health. The project was acclaimed as the rst internationally coordinated effort in the history of biological research. Although the US provided most of the funds and investigators, the European involvement, particularly that of France and the United Kingdom, was signicant. European laboratories already had experience of large-scale collaborative genome research from their work on the yeast genome, and in the early 1990s French scientists led in gene mapping technologies. The aim was to determine the complete sequence of nucleotides that make up the DNA of one complete set of twenty-three human chromosomes. DNA is composed of very long sequences of four nucleotides designated A, C, T and G in varying order, for example,
ATTCGCTAGCTAAGTCGAGTCCATGCATC

The longest human chromosome has 300 million nucleotides. To give a sense of dimension, if we were to type out the entire arrangement of A, C, T and G on the longest human chromosome using the type size and format of the boxed sequence just given, the row of letters would extend for 400 miles. The Human Genome Project set out to determine the precise sequence of A, T, C and G that makes up this enormous string, as well as that in the twenty-two other strings (chromosomes) that make up the human chromosome set. It was a massive task that required the bringing together of a wide range of sophisticated technologies and expertise on an unprecedented scale. The sequencing made clear how DNA determines an organisms phenotypic characteristics and controls its development. The sequencing also pointed to genes that govern a variety of human diseases. It was hoped that this information would lead to the development of new strategies for diagnosis, prevention, therapy and cure. As of 2005, the project started to pay off. Molecular prognostics and diagnostics the sciences of pre-disease by examining DNA are developing fast. The Human Genome Project has spawned technologies that are now being applied to mapping the genomes of a range of commercially important organisms, both plant and animal, and it has provided molecular tools for tackling all kinds of questions and problems across the entire spectrum of living organisms. The claims of some of the early 458

The biological sciences proponents of the project back in the early 1990s were shockingly bold, doubtless intended to encourage nancial backing, but it is beginning to look as if they were not entirely unjustied. Something like the Human Genome Project had to be done. Technologies were there, looking for problems. Questions were there looking for answers. At the end of the 1980s, biology was in danger of stalling if a new level of investigation could not be initiated. DNA sequencing was the answer. The kind of money that was needed could only be raised if the DNA was human.11 the role of the university In the authors view, the business of a university is to transfer existing knowledge and to develop new and more effective transfer processes, to generate new knowledge through analysis and discovery, and to develop potential for future enhancement of knowledge. The marketable products of a university are, therefore, units of new knowledge and units of personal ability. In common parlance they are called research and graduates. The two are closely linked to the needs of the community. Knowledge and ingenuity must outpace the inexorable expansion of world human activity, and future generations of men and women must be equipped to cope with a faster and more complex environment than that of their ancestors. It is imperative that the manufacture of these two products continues apace. National policies vary, but in general a student can obtain training in some aspect of the biological sciences at virtually any university in Europe. Some universities do better at this than others. In general, however, the production of undergraduates is neither a good nor an objective way of assessing the contribution made by universities to the advancement of biology. Research is a much better yardstick and, since it is reported in small measurable bits that we call scientic papers, it is entirely possible to assess and compare institutional performance by counting papers. Table 12.1 shows the extent of growth in scientic literature overall since the seventeenth century and the growth in biomedical literature during the past 100 years. Is Europe a signicant contributor to biological research in terms of publications in learned journals? According to the authors personal research on the geographical locations of authors of scientic articles published in 1991, Western Europe, the UK and Eire together represent the second largest source of publications in biological sciences, next to the United States and Canada. Eastern Europe and the former USSR
11

N. Grant Cooper (ed.), The Human Genome Project: Deciphering the Blueprint of Heredity (Mill Valley, Cal., 1994).

459

Herbert C. Macgregor Table 12.1 Scientic literature and biomedical literature published in Western Europe a
Year 1670 1800 1879 1900 1979 1991
a

No. of science journals 4 90

No. of biomedical articles

20,000 10,000 70,000 250,000 400,000

Personal communication from Dr A. P. Swan, Senior Managing Editor, Current Awareness in Biological Sciences (Oxford and New York, 1991).

represented only 4 per cent of published work in 1991, although that proportion has certainly increased in recent years. How much of this work is generated by universities? Table 12.2 disaggregates the publications of 1991 in eleven different areas of modern biology with respect to the kinds of institution in which the research was carried out. Data for Eastern and Western Europe are presented separately. At the time of the survey, just 43 per cent of Western European science came from universities, whereas in Eastern Europe and the former USSR the corresponding gure was 86 per cent. The fact that now well under half of research in biology takes place in universities gives rise to considerations that are best developed here from the authors experience in the UK. There, fty years ago, the main functions of a university were to educate young people, to promote and maintain scholarship amongst those who were responsible for conducting the education process, and to provide an environment within which particularly able scholars could apply their brains with the concentration and intensity needed to advance the frontiers of knowledge. It was an elitist sector of society but a highly respected one. Today more young, and not so young, people want educating, and the task of teaching them is exceedingly hard work and only rewarding to those few teachers who have the skills to do it properly. Also knowledge in all elds is more diverse, more complex and much more abundant than it was fty years ago, so that promoting and maintaining scholarship is, like teaching, an exceedingly demanding and potentially overwhelming process. But perhaps the greatest change of all concerns the relations between universities, government and industry. In recent years, government has invested money, taxpayers money, in universities. For a time, universities enjoyed their nations condence 460

Table 12.2a Different areas and origins of biological publications 1991: Western Europe

Genetics & Physiology & Ecological & Pharmacology molecular Plant Clinical developmental environmental Microbiology & toxicology Biochemistry Immunology biology science Neuroscience chemistry Cell biology science Total 1905 79 145 491 1596 773 4989 38 43 50 36 4134 4365 378 1533 47 1797 140 237 317 1373 270 2181 324 683 333 625 219 135 11 28 31 140 33 723 42 59 164 384 161 1583 3367 70 191 321 621 231 486 1181 2197 156 537 3542 7399 45 46 1173 232 369 127 82 180 2163 54 21639 2093 4151 5742 13364 4596 51585 42

Universities 2403 Polytechnics 370 Colleges 473 Companies 619 Institutes 1543 National 1059

2784 247 409 2144 2159 707

3588 387 806 799 2084 501

Total

6467

8450

8165

University percentage

37

33

44

Table 12.2b Different areas and origins of biological publications 1991: Eastern Europe and the former USSR

Genetics & Physiology & Ecological & Pharmacology molecular Plant Clinical developmental environmental Microbiology & toxicology Biochemistry Immunology biology science Neuroscience chemistry Cell biology science Total 638 0 0 6 80 160 884 72 82 87 85 590 1599 60 350 89 485 0 2 4 29 70 1399 0 15 8 143 34 51 0 2 1 1 5 310 1 0 2 3 34 884 1416 0 0 0 13 2 12 20 54 70 72 976 1567 91 90 420 0 7 0 5 10 442 95 9124 3 47 143 451 818 10586 86

Universities 1048 Polytechnics 1 Colleges 0 Companies 16 Institutes 65 National 111

851 0 2 71 28 145

1622 1 6 21 23 107

Total

1241

1097

1780

University percentage

84

78

91

The data for table 12.2 were kindly provided by Dr A. P. Swan, Senior Managing Editor of Current Awareness in Biological Sciences (Oxford and New York, 1991).

The biological sciences and were expected to deploy their resources responsibly. Then several things happened. Science and technology became very expensive, and industry turned to universities for help. These events were to set in motion a cycle of change that would have far-reaching effects in and beyond our educational systems. Universities had to be held accountable to their governments. Their business had to be inspected, their policies criticized, their methods evaluated and their expenditure justied. Universities had become industries with shareholders. At the same time their relations with real industry were expanding. The private sector was less willing to commit capital and staff costs to advanced research and development programmes, so they turned to universities for help. Universities were quick to respond. This was a new dimension and a lucrative one too for the impecunious but enterprising academic who was tired of teaching badly and having to account for every penny spent on his or her favourite research programme. Education and the promotion of scholarship had to be replaced by training, contract and consultancy. Research was expensive and so had to be accurately targeted. Finance was foremost in the minds of management. Management learned from its new-found industrial partners and, in effect, converted the laboratory, the library and the lecture theatre into factory workshops occupied by employees and manufacturing materials. There remain a few old-timers who deplore these trends and yearn for a return to old traditional values and practices. The changes, however, have not all been misguided, even though the happier consequences have often emerged by luck rather than through good judgment! There were times when the industrial inuence seemed likely to stie scientic progress by overfocusing on applied research that might generate prot. There were cries of anguish when university departments were closed, merged or starved out of existence by overzealous government. There were serious misgivings when universities in the UK tried to bribe their senior academics to quit the system: the most astonishing aspect of that policy was the discovery that many of our ablest men and women actually wanted to quit and were only too glad to accept the bribes of the premature retirement compensation schemes, much to the detriment of a system that was actually looking for ways of conserving talent and ofoading deadwood. The system, however, is emerging from thirty years of change looking healthier, more streamlined, more efcient and very much better equipped to operate at the pace that is needed in modern times. Industrial support is widespread and substantial. An appropriate level of high-quality fundamental research is ourishing amidst the hubbub of applied projects. Objectives are clear, universities are retaining public respect, and very little of real substance has been lost along the way. Real scientic progress at a rate that would have satised the demands of 463

Herbert C. Macgregor modern society simply would not have been possible within the framework of the traditional university system of the 1950s and 1960s. The most signicant factor affecting policies relating to university biological science has been the spiralling costs of research. In 1979 Bentley Glass published some remarkable and signicant data on this subject.12 According to him, the number of scientic research publications in biology has doubled every fteen years since 1750. The enormous proliferation in scientic literature, mentioned earlier in this chapter, reached a total of nearly half a million publications a year in 1993. Glass also examined the rate of increase in breakthroughs or milestones of achievement in the biological sciences, and he found that this rate, although still exponential, is far slower than the rates of increase in publications, the cost of science or number of scientists. Accordingly, although the rate at which new major achievements are recorded is still increasing, the ratio of normal or ordinary scientic papers to major breakthrough reports is also increasing dramatically. Glass observed that it took more and more effort to produce appreciable gain. Therefore more and more money and resources must be allocated in order to maintain our progress. Glass took a pessimistic view of these circumstances and anticipated that we would have to develop science in the next century on the basis of non-expanding scientic human resources and a xed, non-increasing, proportion of gross national product. He also anticipated that in the relatively near future, a few hundred years hence, scientic knowledge of nature will be so complete that there will only be a scattering of inconsequential matters to explore. A different view and one held by the author is that we are really only at the end of the beginning of biological science and that future progress can and indeed must be sustained by our own efciency and technical ingenuity. One thing is absolutely certain, however: in the year 2100 we will not be communicating scientic progress in the form of a million articles a year written on 20 tonnes of paper.

the biology undergraduate Three very different categories of person present themselves at the desks of admissions tutors in universities throughout the world. The rst category come in by default. They nd the arts and social sciences subjective and intellectually unappealing. They cannot or will not come to grips with the concepts of mathematics and natural philosophy, so they opt for biology. Then there are those who fail to make the grades for medicine or veterinary science and for whom biology is a second best, offering
12

Glass, Milestones (note 1).

464

The biological sciences the chance of a modest return on the investment of effort that went into competing for medicine or vet school. Thirdly, there are the few who are already biologists with enough experience to know that they want to continue as biologists for the rest of their lives. No other subject in the entire compass of learning has been more haphazard in its recruitment of talent. What has been on offer for young would-be biologists in our universities? Here, once again, we see an intricate interplay between the development of technology, the expansion of knowledge, the ability of a young person to cope with advancing science and, most important of all, the resources of the science educator. The transition may well signify an ominous trend towards the loss, decay and fossilization of vast tracts of knowledge and experience, devalued and neglected beneath the logarithmic curve of technology. The technology of modern discovery, with its young, immaculate, white-coated operators in clean, colour-coded and usually very expensive laboratories, is a powerful attractant for the young and impressionable. The old knowledge gathers dust in the basement. University undergraduate biology in the 1950s was an almost comprehensive reconstruction of developments since the beginnings of scientic discovery. It was possible to teach and learn within the space of three or four years almost all there was to know about plants, animals and microbes. Fifty years on, three years is scarcely enough to establish a foundation in biotechnology, and only just enough to implant the principles of some branches of modern biology that were mere twigs in the 1950s. There has been a precipitous decline in the world bank of deep knowledge in areas like animal comparative anatomy, plant diversity, adaptive radiation, growth and form. There are now very few persons who could teach in these areas, still fewer who could do it effectively, and probably even fewer who would wish to learn. But let there be no mistake, biology of this kind is of absolute value. It represents the catalogue of life, and without it all the magnicent technological progress of the past fty years would be impotent. Universities should consider the relative merits of adopting specic policies for the conservation of knowledge and operating a free-market economy in their recruitment of undergraduates. New recruits into the biological sciences are better equipped for their advanced training than ever before. So too is the educational system that is committed to teaching them. Freshmen undergraduates of the 1950s and 1960s probably knew more about animals and plants than their counterparts in the twenty-rst century, but they were generally weak in the mathematical and physical sciences, naive in scientic logic, unaccustomed to the experimental approach, and hopelessly terried of data. The educational technology of those times consisted of the blackboard, the textbook and a library stacked with weighty journals full of articles written in disparate unconventional styles so that the science could often only 465

Herbert C. Macgregor be truly evaluated by those who knew something of the authors personality and background. Conference proceedings, symposia volumes, subject reviews were scarce. The abstracting journals of the 1950s were, of course, of immense value, but they were difcult and slow to use. Without doubt, The New Scientist, rst published in 1956, represented an important milestone for the advancement of science in Europe. The editors proclaimed that their aims were to make an intensive effort to stimulate nation-wide interest in scientic and technological development, to capture the imagination of young people who have latent scientic aptitudes, but are uncertain about a choice of career and to appeal to all those men and women who are interested in scientic discovery and in its industrial, commercial and social consequences.13 They also made life much easier for teachers by making them more aware of current science and providing them with something other than dry textbooks or learned journals to supplement their classroom activities. Those same teachers presented information in lectures and in the teaching laboratory, and they recommended books. They had no video equipment and no computers. Visual aids in the form of projection slides were expensive to make and of unrewarding quality. Overhead projectors arrived in the late 1960s. Photocopiers were denitely not available for undergraduate use, and such reprographic equipment as did exist could only be exploited with the aid of a secretary or clerical assistant. The principal source of advanced undergraduate learning right through to the mid-1960s was the single author book. Some remain as classics and are still widely recommended and read today. All were written by leading scientists and scholars. By the most modern of standards, the best of them were absolutely magnicent productions of timeless value. E. B. Wilsons The Cell in Development and Heredity (1896)14 appeared in several editions down to 1924. The 1896 edition was reprinted as a facsimile in 1966 and the 1924 edition was last reprinted in 1955. The book occupied 370 pages in 1896 and 1,232 pages in 1924. It still serves as a major source of information on natural variation at the cellular level. Michael Whites Animal Cytology and Evolution, rst published in 1945, with second and third editions in 1954 and 1973, also remains a classic, a fund of timeless valuable information on chromosomes and the evolution of genetic systems.15 Goldschmidts Theoretical Genetics, 563 pages of facts and ideas based on a lifetime of involvement with the genetics of the fruit y Drosophila, is the kind of book that no one would consider writing today, yet in its time it was one of the most important
13 15 14 Wilson, Cell (note 9). Editorial, New Scientist, 1:1 (1956), 5. M. J. D. White, Animal Cytology and Evolution (Cambridge, 1973).

466

The biological sciences pieces of literature in its eld.16 Bullock and Horridges Structure and Function in the Nervous Systems of Invertebrates in two volumes and 1,715 pages stands as one of the very last truly monumental, beautifully produced and illustrated classics of modern zoology.17 Today, such is the pace of progress in all elds of biology that, for everyone above the rst grade of university undergraduate biology, the textbook has been replaced by review journals such as Current Biology, BioEssays, the Recent Advances series and a host of other quarterly or monthly publications that specialize in helping scientists, teachers and students to keep abreast in the trendiest areas of modern biology. These publications have their shortcomings, but they do seem to be appropriate for scientists whose entire efforts are necessarily concentrated into sharply dened and fast-moving areas of biological science. And, of course, all this has changed dramatically since the birth of the Internet. Some say that biology is a practical subject and that it can only be taught effectively in the eld and the laboratory. That view was rarely contradicted when universities were richly funded, teachers were in plentiful supply, technology was simple, animals and plants were exploitable and computers did not exist. Then technology expanded and became expensive, universities had less cash to spare, teachers were encouraged to spend more time on research, animals and plants became endangered, and computers became available for modelling and data processing on an unprecedented scale. The graduates of the 1950s commanded a broad eld of simple science and possessed a wide range of practical transferable skills. They were generalists and stood a good chance of survival and success on their own. The graduates of the twenty-rst century are products of a system that generates specialists who have learned more science than would ever have been thought possible in earlier times, but whose real expertise is conned to highly specic areas. Just as in nature, specialists succeed by being members of a community made up of individuals with complementary skills. Universities across the world have adjusted their philosophies and practices accordingly. The most important advance was recognition of the unity of biology, the inevitability of specialization in the face of a vastly expanding volume of science, and the importance of providing enough early experience in all aspects of modern biology to allow young persons to choose the specialization that best suited their individual personalities. The pattern of training changed from the steady progression through one major eld of biology, occupying three or four years, to one-year
16 17

R. B. Goldschimidt, Theoretical Genetics (Berkeley and Los Angeles, 1955). T. H. Bullock and G. A. Horridge, Structure and Function of the Nervous System of Invertebrates (San Francisco and London, 1965).

467

Herbert C. Macgregor broad-based introductory courses, followed by short modular courses in specic areas, capped by one or two years of intensive study right through to the very frontiers of a narrow area of modern science. Emphasis was on the production of graduate technologists. The trend began in the early 1960s, reached its climax in the mid-1980s and reversed suddenly in the 1990s. The reasons for the reversal were simple. Technology is expensive. Progress in biological science is struggling to remain costeffective. Biology retains its identity as a science of living organisms, and all that is happening is that the organism is proving to be more intrinsically interesting and rewarding than the technologies we adapted for investigating it. the internet The Internet has had an impact on the entire fabric of university life of unprecedented magnitude. Its effects have been swift and dramatic. The main areas of change have been the accessing and publishing of scientic information, methods of teaching, and the conduct of undergraduate study. In the 1990s, European scientists in universities or research institutes accessed published work by using abstracting services that scanned and classied all publications across the entire eld of biomedical science. Having identied items of particular interest, the scientist would then go to a library, pull journals off shelves and read the relevant articles. As the Internet became established, publishers started selling online versions of their journals as well as the printed versions, so that teachers and researchers could consult recent publications from the computer in their ofce or laboratory. The practice became more widespread as publishers added more and more archival material to their websites. Now, in 2005, the past ten years or more of published material in most reputable scientic journals can be accessed online. For a few journals, the older archives of science and medicine cannot, for the moment, be consulted online. Library usage is changing in the US as a result of the advent of networked electronic services in the medical eld. It shows that remote users outnumbered in-house users of electronic information. At ve major medical libraries, medical library users, and especially faculty, staff and fellows, found that virtually all of their information needs could be satised from outside the library. The trend is happening in other disciplines, including the biological sciences, as more and more networked electronic resources become available. For many users, library is now just a word on an authentication or link page. The only thing tying them to the library

468

The biological sciences is that access to content is currently purchased by and controlled by the library. That tie will be cut when open access to all scientic literature becomes the norm. This does not mean that libraries will become irrelevant. It means that they will not look the way they do today, and paper journals, and perhaps also books, will disappear entirely. The most remarkable change brought about by the Internet is speed of communication. Recently published scientic literature can be accessed in minutes from home, ofce or laboratory. Messages, data and images can be instantly transmitted and exchanged worldwide. Whereas in the 1960s a scientist might write a dozen letters and make a few phone calls to colleagues each week, in 2005 the exchange of a hundred e-mails a week would be regarded as conservative. This easy and cheap high-speed communication has proved in many instances to be an enemy of diplomacy, careful planning, decisiveness and acceptance of responsibility. Teaching by computer is now commonplace in European universities. Teachers provide students with suggested strategies for accessing online information. Models, graphics and video recordings replace laboratory and eldwork. E-mail communication between students and teachers is encouraged, essays and projects are written and submitted online, and feedback takes place the same way. Self-assessment tests and even examinations are conducted by e-mail. The average science undergraduate may spend up to 90 per cent of his or her formal learning and private study time in front of a computer. Just where this trend is leading is impossible to tell. The quality of the teaching material currently available on the Internet is highly variable but it is improving, as are the means for accessing the most appropriate and the best material for the job in hand. Putting modern science in a proper perspective remains difcult without going to a library and reading the printed page a facility that fewer and fewer universities are able to provide. Opportunities for hands-on practical experience of science are diminishing because it is much cheaper and simpler to use the Internet. In biology, the Internet is proving to be a timely and welcome facility, since laws relating to health and safety and the use of animals, dead or alive, in teaching have strangled traditional approaches to laboratory and eldwork. universities, graduates and employment The time taken to reach rst degree seems to be broadly related to the density of students on university campuses. In general, the larger the institution and the less money allocated by government per year per student, the longer it takes an individual to reach rst-degree level. In this regard, the British system, with its small campuses, low staffstudent

469

Herbert C. Macgregor ratios and relatively generous government support has always succeeded in producing reasonably good quality rst graduates after an average of just ninety weeks of on-campus training. Other systems that are based on very large campuses with high staffstudent ratios take longer to bring their undergraduates up to the same academic standard. A major concern related to the widespread increase in student numbers has been ensuring that they nd employment that will utilize their talents. Approximately 2545 per cent of biological science graduates become professional biologists or biology teachers. The remainder are recruited into all manner of occupations that tend to exploit transferable personal skills rather than specic biological knowledge.18 In the 1960s, during the rst phase of the great expansion of European universities, those who wished to be researchers were happy to follow up their PhD training with short-term contracts as postdoctoral fellows or research assistants, condent that they would eventually be able to secure a permanent post in a university. The expansion phase ended in the late 1970s. There was a drop in recruitment of academics. Researchers were forced to hop from one short-term contract to another, and if they did not nd a secure foothold in academia by the time they reached their mid-thirties, they moved away from biology into industry or management. Up to 1975 most undergraduates in biology expected to nd employment as professional biologists of one kind or another. Between 1975 and 1980 jobs were scarce and the outlook seemed bleak. Of course, it was nothing of the sort. It took some coldly objective surveys to prove in the early 1980s that most biology graduates were nding employment appropriate to their qualications within one year of graduating. Of the remainder, the majority were occupied with further training or parenthood and less than 2 per cent were convincingly and involuntarily unemployed.19 But the early 1980s did see a decided shift in attitudes amongst both prospective biology graduates and employers. Employers came to recognize that biologists can cope with large amounts of information in a systematic way. Biologists have a broader scientic training than most other scientists because biology cannot be studied in isolation from the physical sciences. Biologists have to know about statistics and computing. They often have to work in groups and are accustomed to responsibility for their own part of a project and to working with other people. Living organisms are exceedingly complex, and designing experiments to
18

19

S. Green, Biological Science Graduates Employment Prospects and Flexibility, Biologist, 36 (1989), 20913. R. W. Pethen and P. Calow, Zoology Graduates of 1980 Where are they Now?, Biologist, 35 (1988), 1268.

470

The biological sciences study them usually involves a wide range of variables, analysis of complex datasets, and skilful interpretation. A background of this kind is an excellent training for management. A 1987 survey by David Hind at Newcastle Polytechnic showed that 38 per cent of advertisements for new graduate recruits in industry made explicit reference to personal transferable skills.20 Apart from the undoubted lure of the United States, European graduates have until recently opted to stay at home. Exchange between European countries has been conned largely to the leading universities and research establishments and has involved the very best of researchorientated graduates. Language and culture have doubtless been strongly inuential in this regard. Winds of change are now being fanned quite vigorously by government commitment to the funding of cooperative research between Western European universities and institutions, and by a widespread tendency for big industry to become multinational and to operate above the level of language and cultural barriers.

select bibliography
Boveri, T. Zur Frage der Entstehung maligner Tumoren, Jena, 1914. Brachet, J. Biochemical Cytology, New York, 1957. Bullock, T. H., and Horridge, G. A. Structure and Function of the Nervous System of Invertebrates, San Francisco and London, 1965. Caspersson T. Cell Growth and Cell Function, New York, 1950. Davies, D. R., Padlan, E. A., and Segal, D. M. Three-Dimensional Structure of Immunoglobulins, Annual Review of Biochemistry, 44 (1975), 63967. Glass, B. Milestones and Rates of Growth in the Development of Biology, Quarterly Review of Biology, 54 (1979), 3153. Goldschmidt, R. B. Theoretical Genetics, Berkeley and Los Angeles, 1955. Green, S. Biological Science Graduates Employment Prospects and Flexibility, Biologist, 36 (1989), 20913. Hill, R. Oxygen Evolution by Isolated Chloroplasts, Nature, 139 (1937), 8812. Jeffreys, A. I. V., Wilson, D., and Thein, S. L. Hypervariable Mini Satellite Regions in Human DNA, Nature, 314 (1985), 6773. Krebs, C. I. Ecological Methodology, New York, 1989. Macgregor, H. C. (ed.) Biological Sciences, in Clark and Neave, Encyclopedia IV, 2181270. Pethen, R. W., and Calow, P. Zoology Graduates of 1980 Where are They Now?, Biologist, 35 (1988), 1268. Rowley, J. D. The Philadelphia Chromosome Translocation: A Paradigm for Understanding Leukemia, Cancer, 65 (1990), 217884.
20

Green, Biological Science Graduates (note 18).

471

Herbert C. Macgregor
Watson, J. D., and Crick, F. H. C. Genetical Implications of the Structure of Deoxyribonucleic Acid, Nature, 177 (1953), 964. White, M. J. D. Animal Cytology and Evolution, Cambridge, 1973. Wilson, E. B. The Cell in Development and Inheritance, London and New York, 1896. Zallen, D. T. Redrawing the Boundaries of Molecular Biology, Journal of the History of Biology, 26 (1993), 6587.

472

CHAPTER 13

THE EARTH SCIENCES

GORDON CRAIG AND STUART MONRO

introduction Given the diverse interests of European geologists, we decided to ask some of our more distinguished geological friends to choose the three major topics that have revolutionized geology in Europe since the Second World War. All mentioned plate tectonics and all identied their own research area as particularly exciting. The third choice was a potpourri. But not one mentioned the study of planetary geology accompanying the enormous post-war efforts to conquer solar space, which arose from the rocket research of the Germans towards the end of the Second World War, the spectacular ight into space by the Russian astronaut Yuri Gagarin, and the ensuing enormous American effort which led to the landing of man on the moon in 1969. But geology, after all, is about rocks rocks which are economically useful and which frequently serve to mark national boundaries by mountain chains, river courses or coastlines. In the early development of geology, natural scientists looked at local rocks. The Netherlands with few rock outcrops has a vast amount of sand, silt and mud derived from the Rhine delta. Not surprisingly, Dutch geologists were particularly renowned for their work on sediments and hydrology. Most of Norway and Sweden is underlain by metamorphic rocks rocks that have been changed by burial at higher temperatures and pressures. Teaching and research naturally focused on that group of rocks. Landlocked Switzerland is not known for its marine geology but is understandably famous for its contribution to the understanding of mountain-building and glaciation. Italy has the only active volcanoes in Continental Europe and its scientists have made distinguished contributions to our understanding of vulcanology. And so on. 473

Gordon Craig and Stuart Monro After the Second World War this understandable parochialism gave way to research into geological problems extending beyond the boundaries of countries and the geological sciences. The question of continental drift and its mechanism, the desire for quantitative explanation of climatic changes in the geological record, and an increasing curiosity about outer space have led to unparalleled international cooperation among geologists and other scientists in related disciplines. Somewhat surprisingly, many of the answers to geological questions are being found in the rocks and mud on the bottom of the major oceans. Our choice of the three major themes is: 1. planetary geology, which examines the origin and rocks of the solar system and the unexpected consequences of that research, 2. plate tectonics, the all-embracing theory that seeks to explain changes in the crust of the Earth as the result of movements of crustal plates, driven by the heat of the Earth, and 3. climatic change, which reects changes in the solar system, atmosphere and lithosphere. We shall look at how each problem arose, how it was or is being solved, and to what extent European universities contributed to that research. We will also explore what we consider to be a landmark in the teaching of earth sciences that was brought about by the formation of the Open University in the United Kingdom. That involved the use of new technologies and the incorporation of rapidly changing research results into a frequently updated curriculum. planetary geology The research carried out by astronomers, geophysicists, geologists, petrologists, geochemists and geomorphologists in preparation for and following the conquest of space was a great triumph of international cooperation. Space research developed from the German rocket effort1 towards the end of the Second World War and culminated in the ights of Sputnik and Gagarin. He was the rst to observe the planet as a whole a small blue ball hanging in space. The interaction between the geosphere, the atmosphere, the cryosphere, the hydrosphere and the biosphere became clear, and the subject we now call earth system science was born although we doubt that it was recognized at the time. In the same year President Kennedy announced the intention of the USA to land a man safely on the Moon within a decade. Following on the early USSR Luna spacecraft and the US Surveyor, the US Apollo missions took a man
1

W. von Braun, Across the Space Frontier, ed. E. Ryan (New York, 1952).

474

The earth sciences to the Moon in 1969. Space photographs and lunar rock samples from these missions were studied more thoroughly than any rocks and pictures of the surface of the earth. The Earth and its satellite the Moon, Jupiter, Mars, Mercury and Venus are among the major planets in the solar system. Age dating from available material from the solar system including meteorites indicates a common date of formation of about 5,0004,600 million years ago. The planets have a similar chemical composition, but the Earth, because of its atmosphere and continuing internal heat, has evolved both structurally and lithologically insofar as it can be compared with the dead planets and the Moon. The initial intense meteoritic bombardment which pock-marked the surface of the Moon and the planets decreased about 4,000 million years ago so that the shapes of the continuing active volcanoes and volcanic rifts have not been destroyed by meteoric re. Volcanic craters and widespread lava ows the maria are plainly visible. But this volcanic activity also waned and nally stopped about 2,500 million years ago as the Moon cooled down. The Moons present residual core heat is now insufcient to generate volcanic activity. From space photography and craft that have landed on Mars we know that it has impact craters and volcanic eruptions, but unlike the Moon it also has an atmosphere of carbon dioxide, which is capable of generating dust storms and other aeolian features. In the distant past, water owing on Mars cut channels. Much of it is now locked in subsurface ice and permafrost. The space competition between the USSR and the USA was founded on political decisions based on perceived military advantage and necessity, and on an estimate of national prestige. The unexpected winner at the end of the three decades has been science certainly the most expensive science project ever unwittingly authorized by two nations. The geological rewards include an understanding of the similarity of the planets of the solar system, especially the discovery of fossil planets, which reveal in great detail what planet Earth must have been like in the early stages of its evolution. The landing on Titan, a moon of Saturn, in January 2005 produced new insights into this process. There must have been a considerable amount of impact cratering during the rst 1,0002,000 million years of Earths history. The most interesting spin-off was a resurgence of interest in the effects of impact craters on the Earth transient features because they are gradually lost by erosion which must have had catastrophic effects at the time of impact. Meteoric impacts may have caused mass extinction of major groups of organisms such as the dinosaurs by generating dust storms, blotting out the Suns rays and causing marked climatic and vegetative 475

Gordon Craig and Stuart Monro changes. Impact craters have been mapped and early records such as the Ensisheim meteoritic impact have been investigated.2 Harrison Schmitt, the only geologist to have walked on the moon, which he did in 1972, is a Harvard graduate whose PhD thesis was concerned with metamorphic rocks in Scandinavia.

plate tectonics At the beginning of the twentieth century a few scientists argued that the present continents had once been a super-continent, which had broken into a fragmented jigsaw and drifted apart. The most obvious clue was the apparent t between the eastern coast of the Americas and the western coast of Europe and Africa. Alfred Wegener (18801930), astronomer and meteorologist, born in Berlin and educated at the Universities of Heidelberg, Innsbruck and Berlin, was the leading proponent of the hypothesis of continental drift. Continents consist of lighter rocks (granite etc.), whereas the oceans are oored by heavier rock (principally basalt). This heavier rock behaves as a very viscous liquid on which the continents oat. Wegener suggested that the present continents had at one time been one super-continent, which had broken apart. The close similarity between rocks and fossils on either side of the Atlantic Ocean was an excellent indication of this early togetherness. After the First World War the hypothesis of oating continents received guarded support among geologists in Europe, but in North America opposition remained strong. In the UK, the two leading geophysicists disagreed. Harold Jeffreys (1891 1989), professor of geophysics at Cambridge, argued that the Earth was too strong to allow such a drift. Arthur Holmes (18971965), a graduate of Imperial College London and professor of geology successively at Durham and Edinburgh, guardedly supported the hypothesis of continental drift for which he proposed a a mechanism in 1928: hot, rising, convective magma mantle plumes, which could act as a horizontal conveyor belt capable of moving the relatively light continental masses. The Second World War turned the attention of geologists to the essentially practical business of reserves of fuel and other raw materials. Younger academics in universities and potential research students were called up. Most of the remainder were over the age for military service or were employed in more essential work. Opportunities for scientic research were minimal. After the war, staff returned and a new generation of students was educated. Geologists could turn to investigating the major problems of pure science, including the enigma of continental
2

U. B. Marvin, The Meteorite of Ensisheim: 1492 to 1992, Meteoritics, 27 (1992), 2872.

476

The earth sciences drift. Had the continents really been part of one mass, and, if so, by what possible mechanism or mechanisms might it have been torn apart? In the 1950s geophysicists at Imperial College London3 and the University of Cambridge began to measure remnant magnetism in rocks by the use of sensitive magnetometers. Many rocks contain iron in one form or another. The iron is locked into position in accordance with the direction of the earths magnetic eld at the time that the rock formed. The magnetometer determines the magnetic declination and inclination at the time of formation. It is also possible to date the age of the rock by analysing the isotopes of radioactive minerals. By these techniques the original geographical latitude of the rock and its time of formation can be determined. Gradually it became apparent that rocks were formed in latitudes far from their present position and that either the Earths poles or the continental masses (or both) had moved, leaving behind a palaeomagnetic trail of evidence in successively younger rocks. These trails were consistent within each continental mass but differed between continents. They revealed that Europe and North America had moved apart by about 30 degrees of longitude. Yet the mechanism of movement remained elusive. Detailed magnetic studies in Iceland by J. Hospers of Cambridge University4 showed that the magnetic NS direction in successive lava ows was frequently reversed. Similar magnetic reversals were also mapped during oceanographic surveys carried out in the Pacic and Atlantic oceans, especially by Henry Hess of Columbia University.5 The surveys also revealed rocks that were, without exception, geologically young. The two studies are complementary; magnetic ips occur from time to time and are recorded in lava ows, notably those anking volcanic mid-oceanic ridges. In 1963 Fred Vine and Drummond Matthews of Cambridge University postulated that the main crustal layer of the ocean is formed over a convective up-current in the mantle along an oceanic ridge. (In 1981 they received for this discovery the Balzan Prize for Geology and Geophysics.) Successive volcanic eruptions became magnetized according to the then current polarity of the Earths eld.6 Here, then, was a mechanism sea-oor spreading that could account for the physical separation of major continents.
3

P. M. S. Blackett, Comparison of Ancient Climates with the Ancient Latitudes Deduced from Rock Magnetic Measurements, Proceedings of the Royal Society, A263 (1961), 130. J. Hospers, Remnant Magnetism and the History of the Geomagnetic Field, Nature, 168 (1951), 111112. H. H. Hess, History of Ocean Basins, in A. E. J. Engel, H. L. James and B. F. Leonard (eds.), Petrologic Studies: A Volume in Honor of A. F. Buddington (New York, 1962), 599620. F. J. Vine and D. H. Matthews, Magnetic Anomalies over Ocean Ridges, Nature, 199 (1963), 9479.

477

Gordon Craig and Stuart Monro There was more to come. In 1965 Tuzo Wilson, a Canadian geophysicist, postulated that the Earths surface was divided into large rigid plates.7 In 1968 Xavier Le Pichon, a French geophysicist, recognized six major plates that moved relative to each other.8 The continents were seen as parts of plates rather than as discrete entities dened by a coastline. The revolutionary theory of plate tectonics had been born. What one believes in depends on ones education and colleagues. As a very junior member of staff in 1947 in Edinburgh, under Arthur Holmes, one of us (GYC) believed in continental drift. The way that he explained it made it seem logical. And yet when GYC spent a year in 1958 at a midwest university in the United States and in California he met almost total disbelief and was made acutely aware of the battles that even John Crowell of the University of California encountered when he demonstrated a strong lateral movement of hundreds of miles along the San Andreas Fault in California.9 Geologists and geophysicists in the North American continent were as united in their opposition to drifting as the pro-Europeans and distinguished drifters in South Africa, like Alexander du Toit and Lester King, were for it.10 Isolationists could be geological as well as political.

palaeoclimates and global warming Switzerland is the only country in Europe with substantial mountain glaciers. Large foreign boulders of granite and schist (erratic blocks) lie on outcrops of sediment on the valley oors. They had obviously been carried there. The only realistic means of transport were water or ice. Horace B en edict de Saussure was the rst to describe (in the eighteenth century) these piles of waste rock that we now call moraines. He concluded that a catastrophic ood had been the cause.11 Over two hundred years ago James Hutton, the Edinburgh geologist, had argued although he had never visited Switzerland that the most probable explanation for the transport of these foreign boulders was by owing rivers of ice.12 They were able to carry erratic blocks many kilometres from their source. Towards the end of the nineteenth century it had become accepted that
7

10 11 12

J. T. Wilson, A New Class of Faults and their Bearing on Continental Drift, Nature, 207 (1965), 30347. X. Le Pichon, Sea-Floor Spreading and Continental Drift, Journal of Geophysical Research, 73 (1968), 366197. J. C. Crowell, Displacement along the San Andreas Fault, California, Geological Society of America Special Paper, 71 (New York, 1962). A. L. du Toit, Our Wandering Continents (Edinburgh, 1937). H. B. de Saussure, Voyages dans les Alpes (Neuchatel, 177996). J. Hutton, Theory of the Earth, Vol. II (Edinburgh, 1795), 218.

478

The earth sciences ice had at one time covered most of northern Europe, and that the climate had then been much colder. In 1842 the French mathematician J. A. Adhemar founded an astronomical theory to account for glaciation.13 The theory was developed in 1864 by the Scottish geologist James Croll14 and expanded by the Yugoslavian geophysicist Milankovitch in 1930 and 1941.15 This theory is based on changes in insolation brought about by variations in the eccentricity of the orbit of the Earth and by the tilt of its rotational axis and its wobble or precession. The periodicity resulting from these changes has recently been found to agree with the waxing and waning of the ice sheets, which are reected in temperature changes in the major oceans in the recent past.16 This exciting work is the result of an international initiative (Climate Project) involving scientists from many countries. Cores drilled in the mud of the major oceans have provided a geological succession from which microscopic organisms, especially foraminifera and diatoms, have been collected. The relative abundance of the different species, some of which lived in warm waters, some in colder waters, can be used to pinpoint former ocean temperatures, and the age of the layer of sediment in which the fossils were found can be determined by radiometric and palaeomagnetic analyses. Ocean oor sediments thus record the changing temperatures of the seas over many thousands of years. This deep-sea fossil record has proved to be one of the most important sources of past climatic patterns worldwide. Understandably, the evidence for former glacial periods is much more continuous in undisturbed marine deposits than in the incomplete record left behind by former continental ice sheets after thousands and millions of years of erosion. Nevertheless, rocks in the Sahara reveal that the area had been covered by ice some 400 million years ago, when Africa was still near the South Pole. Rudolf Staub, professor of geology at Zurich, reckoned as early as 1924 that Africa had drifted north some 5,000 kilometres since Precambian times, and that the strongly folded Alpine chain of mountains the product of the closure of Africa and Europe involved crustal shortening of some 1,0001,500 kilometres.17 But perhaps geologists are too blas e about such matters. As we sit here in Edinburgh, comfortably warm from our gas central heating derived from
13 14

15

16 17

J. A. Adhemar, R evolutions de la mer (Paris, 1842). J. Croll, On the Physical Cause of the Change of Climate during Geological Epochs, Philosophical Magazine, 28 (1864), 12137. M. Milankovitch, Mathematische Klimalehre und astronomische Theorie der Klimaschwankungen, in W. Koppen and R. Geiger (eds.), Handbuch der Klimatologie, Vol. I (A) (Berlin, 1930), 1176. J. Imbrie and K. P. Imbrie, Ice Ages: Solving the Mystery (London, 1979), 1224. R. Staub, Der Bau der Alpen, Beitrage zur geologischen Karte der Schweiz, N.F. 52 (Bern, 1924).

479

Gordon Craig and Stuart Monro natural gas (which might be a mere 100 million years old) in the North Sea, we are aware that only some 10 thousand years ago a kilometre or so of ice sheet would have covered us, and that the Carboniferous coal seams below ground were once trees that grew in a tropical climate when Scotland was hovering near the equator about 350 million years ago. Evidence from other continents has enabled geologists and meteorologists to piece together climatic changes associated with the drift of continental landmasses across many degrees of latitude. During these great movements of plates, the circulation of ocean currents has repeatedly changed the complexity of climatic patterns. In the 1990s it was shown that meteoritic impacts have not only played an important part in changing the Earths topography, but that it is possible that larger impacts in the geological past caused res, dust clouds blanking out the Suns radiation, chemical changes leading to acid rain and other damage to the environment. The scenario of a nuclear winter is frequently used. And it has been argued that such impacts could well have led to the extinction of major fossil groups such as the dinosaurs.18 Such grand, long-term perspectives must now include the shorter and more urgent consideration of the possible consequences of what has been called mans greatest geochemical experiment the burning of our fossil fuels, accumulated over nearly 400 million years, in a mere 400 years or so. The considerable increase of CO2 and other gases, with its implications for changes in the greenhouse effect, is now a matter of worldwide concern. It has prompted the creation of taskforces by the International Council of Scientic Unions, such as the International Geosphere-Biosphere Programme,19 which sets out to examine global change through cooperation among scientists from a wide variety of disciplines biology, chemistry, geology, physics working closely with social scientists. impact on earth science education Two major political actions have recently transformed geological teaching and research in the United Kingdom. The rst was to create a distance-learning university, the Open University, the second to concentrate resources on fewer but larger departments following implementation of the Oxburgh Report.20 Many of these advances in understanding the way the Earth operates can be related to the development of what is now called earth system
18

19

20

A. Hallam, Catastrophes and Lesser Calamities: The Causes of Mass Extinction (Oxford, 2004). W. Steffen et al., Global Change and the Earth System: A Planet under Pressure (Berlin, Heidelberg and New York, 2004). R. Oxburgh, Strengthening Earth Sciences: Report of the Earth Sciences Review Ad Hoc Committee (Oxburgh Report) (London, 1987).

480

The earth sciences science, echoing James Huttons concept of looking at the planet as a holistic entity. In particular, the development of the plate tectonic theory brought together many of the subdisciplines within earth science and demanded a new way of teaching. At the same time as the researchers were developing new concepts of plate tectonics, in Britain a new idea in higher education was emerging. This was what Harold Wilson, the then prime minister, described as the University of the Air, subsequently known as the Open University. The vision was to make higher education accessible to all, regardless of previous academic qualications. Some called it The University of the second chance. Accessibility was achieved through the new medium of television to communicate with students in their own homes. For earth science, as a visual science, this presented enormous opportunities and challenges opportunities to present the science in a new and holistic way and challenges to deliver this science using the new technology. The concept of a teaching text emphasizing the vitality of the earth sciences gave rise to the commissioning of a textbook entitled Understanding the Earth.21 Twenty-six internationally known scientists were invited to contribute. The list of authors now reads like a Whos Who of modern geology: Sir Edward Bullard, E. R. Oxburgh (now Lord Oxburgh), the late John Sutton, P. C. Sylvester-Bradley and Fred Vine all contributed. Moreover this was a teaching text, a reader, through which current research inuenced the content of the curriculum, even at the level of a rstyear student. The book was conceived in March 1970 and published in December of the same year a remarkable achievement. The concept of academic currency at a time when the ideas and concepts taught were continuing to move forward was retained, and in October 1972 a second edition was published with updates of the various chapters and, in some chapters, with complete revision. In this way landmark research found its way both into the journals and into the teaching materials of higher education. A further major political action that transformed geological teaching and research in the United Kingdom was the decision to concentrate resources as recommended by the Oxburgh Report, which resulted from a government enquiry into ways of strengthening university earth science departments in British universities. The report, published in 1987, concluded that there were too many geology departments and advised that, by reducing the number by about one-third and redistributing resources and staff, the remaining departments would have greater critical mass and better research potential. As a result, the number of geology departments fell
21

I. G. Gass, P. J. Smith and R. C. L. Wilson, Understanding the Earth: A Reader in the Earth Sciences (Sussex, 1971).

481

Gordon Craig and Stuart Monro from thirty-three to twenty-two. Opponents saw it as a divisive, destructive, and insensitive imposition.22 The exercise cost many millions of pounds and prudently was not repeated, as had been the intention, in the other sciences. But worse was still to come. Another government department later recommended that the polytechnics (the technical centres of higher education) should become universities. Consequently there now existed almost as many university geology departments as before! The Open University, which is funded by the Higher Education Funding Council for England, despite its spread across England, Scotland, Wales and Ireland, is recognized as a great success: it has introduced many tens of thousands of students to geology since its inception, and thus helped to undo the consequences of the Oxburgh Report. The political aspects illustrated here are generally valid for other European countries as well.23 Although the Open University experience is unique to the UK, its principal idea can be found in other forms of earth science education, such as in the many regular and special broadcast or television programmes aimed at the general public.24 New problems, ideas or methods are incorporated into university courses or aired at conferences of learned societies or in the international research programmes of the European Union or the European Science Foundation, which are open to students from all participating universities. Unfortunately, the tendency to concentrate resources on ever fewer earth science departments has become a general problem. Germany, the Netherlands and Switzerland all suffered from this policy. The opposition of geological experts to this concentration has been only partially effective. This is because earth science education retains strong regional aspects. A student has rst to gain experience by mapping in the eld, working in mines or aboard a research vessel, notwithstanding all the fascinating global topics available in the elds of planetary geology, plate tectonics or palaeoclimatology. These new elds of research are, of course, inuencing university education and curricula directly, but in different ways. Planetology, for example, seems to evoke less interest than marine research. The oceans, from the coasts to the deep sea, have become a major focus in earth science over the past decades. Consequently, many new classes and even departments, some with their own ships, have been established. To run national research vessels or even international ones requires students with special knowledge. Incidentally, learning about international cooperation
22

23

24

E. N. K. Clarkson, Academic Geology in the UK: A Matter for Grave Concern, European Geologist, 17 (2004), 67. The information on earth-science education outside the United Kingdom was kindly contributed by Eugen Seibold, from Freiburg-im-Breisgau (Germany). See chapter 1, 19.

482

The earth sciences can never be better acquired than aboard a research vessel with an international team of scientists! Although this is only one example of the specialization needed in todays higher-education systems, the general problem for universities remains that of nding ways to help students digest all the new specialisms, with their different methods, at a given moment of time in their curricula. In addition to the classic courses offered by universities across Europe, several innovations are now necessary. Resolving new problems and methods in earth science requires intensive training in computer technologies; quantitative aspects and approaches are now essential, even when considering geology as a historical science; collecting, documenting and using ever more data from observations constitute a challenge of data handling; and, nally, modelling implies new sophistication in visualization techniques. Finally, the development of environmental earth sciences stems from global, regional or even local needs. Such needs require the application of geology, geophysics, satellite geodesy, isotope technology, geochemistry, many branches of biology, as well as other sciences. A modern and increasingly important trend concerns mineral resources oil, gas, coal, ores, building materials or water. The challenge for the future is not only how to nd and use them, but also how to protect and exploit them in a sustainable way. conclusions In this short review it has been shown that initial speculative ideas, which came from individuals in Europe in the earlier part of the twentieth century, were developed by teams of scientists especially in the United States, which rapidly became the worlds leading nation in the geological sciences after the war. Money was available for ships and mega-science in the USA, and the universities there had access to bright young scientists in a country physically undamaged by war. Moreover, with high salaries and good research funding, they were able to attract many of the brightest young earth scientists who had studied at European universities. International collaboration across many disciplines has resulted in a new understanding of our solar system and the planetary bodies within it. The oceans have played an unexpectedly major part in contributing to our understanding of plate tectonics (volcanic activity and magnetic stripes in the hard rock oor) and past global climatic changes (fossils in the overlying mud). The consequences of climate change, the foundations of which were laid down through science developed over two hundred years ago, are now regarded as the greatest challenge facing humanity. The study of earth sciences in the European universities continues to meet and 483

Gordon Craig and Stuart Monro face up to the challenges of life on an ever-changing planet; understanding a little better how the Earth works is essential for our survival. select bibliography
Braun, W. von. Across the Space Frontier, ed. E. Ryan, New York, 1952. Gass, I. G., Smith, P. J., and Wilson, R. C. L. Understanding the Earth: A Reader in the Earth Sciences, Sussex, 1971. Glen, W. The Road to Jaramillo: Critical Years of the Revolution in Earth Science, Stanford, 1982. Hallam, A. Catastrophes and Lesser Calamities: The Causes of Mass Extinction, Oxford, 2004. Imbrie, J., and Imbrie, K. P. Ice Ages: Solving the Mystery, London, 1979. Le Pichon, X. Sea-Floor Spreading and Continental Drift, Journal of Geophysical Research, 73 (1968), 366197. Oxburgh, R. Strengthening Earth Sciences: Report of the Earth Sciences Review Ad Hoc Committee (Oxburgh Report), London, 1987. Steffen, W. et al. Global Change and the Earth System: A Planet under Pressure, Berlin, Heidelberg and New York, 2004.

484

CHAPTER 14

MEDICINE

JOHN ELLIS

the changing context of university medicine 19451995 From 1945 onwards university faculties of medicine functioned in a context characterized by constant rapid change in medical knowledge, in medical and educational practice, and in the material way of life, including the political life, of most people in Europe. The growth of medical knowledge increased very rapidly during the Second World War. Three developments in particular ensured that after the war medicine would be very different from what it had been before: blood transfusion, anaesthesia and antibiotics. In 1939 blood transfusion in some countries, such as Britain, had been an infrequent procedure largely dependent on relatives as donors, but at the end of the war a national blood transfusion service was rmly established, and intravenous therapy was beginning to play a major role in therapy everywhere. Before 1939 anaesthetics had been in use for upwards of a century but, while improvements had been made in the means of administering them, the actual agents had changed little nitrous oxide, ether and chloroform. Intravenous anaesthesia was much extended during the war, and muscle relaxants heralded a new era. Countries that had been training anaesthetists in their armed forces found themselves with many more specialists in this eld at the end of the war than at the beginning, and this enabled peacetime surgery to advance far more quickly than would otherwise have been the case. The revolution in the control of some infections (such as lobar pneumonia, a major killer) brought about by the use of sulphonamides in the late 1930s faded into relative insignicance with the introduction of penicillin during the war. From 1945 onwards the development of antibiotic drugs, limited at rst by their scarcity or unavailability in Britain and 485

John Ellis continental Europe, continued ceaselessly, keeping ahead of the development of organisms resistant to them. The range of antibacterial drugs widened, and antifungal and even some antiviral drugs were added. Much of that development was achieved by the pharmaceutical industry, much by universities, and still more by collaboration between the two. After the war great advances were made in chemotherapy for noninfective illnesses, both physical and mental, including cardiovascular conditions such as high blood pressure, leukaemia and other forms of cancer, depression and some psychoses such as schizophrenia. Equally dramatic progress took place in the whole eld of surgery and by the growing capacity articially to take over the function of organs such as the kidneys, heart and lungs. The ability accurately to measure the various functions of the body likewise increased continuously after 1945, as did the capacity to visualize its structure by endoscopy, radiology and nuclear magnetic resonance imaging. These advances enabled diagnoses to be made with ever greater precision and steadily increased the possibility of successfully intervening in the course of disease at any time in the life of a patient from before birth to extreme old age. Surgery, which in the 1930s was largely concerned with removing damaged parts of the body, became more and more involved with repair in the 1950s and 1960s, and in the 1970s began the successful replacement of hips and other joints by prostheses, and in the 1980s (thanks to advances in immunology) successful organ transplantation. Bone marrow transplants opened up new avenues of therapy in blood disorders, and the development of molecular biology led in the 1980s to a greater understanding of genetic disease with possibilities for prevention and perhaps treatment. Unfortunately all too often the new medicine had initially to be practised in the premises and under the conditions of the old. In Britain, where perhaps medicine changed more rapidly after 1945 than elsewhere in Europe, the total cost of maintaining a National Health Service (NHS), introduced on comprehensive lines in 1947, was so much greater than had been anticipated that capital investment in hospitals had to be ruthlessly cut. In a period of general capital shortage and austerity, capital investment on the NHS averaged roughly 10 million a year from 1948/9 compared with more than 30 million in 1938/9. Nearly half the countrys hospitals pre-dated 1891 and one in ve pre-dated 1861. Specialization, which had developed slowly in the medical profession in the rst half of the twentieth century, progressed rapidly in the second, with sub-specialties like paediatrics and geriatrics soon forming within older specialisms. Dentistry similarly became more specialized. Meanwhile, the demand from all the new branches for nurses specially trained to work in special departments led in the 1970s to the development of 486

Medicine post-basic courses and to organizations for controlling them. Those other health professions that had existed before the Second World War, such as physiotherapy and radiography, expanded and themselves began to subdivide into new specialties, while in most countries new categories of health-care workers were brought into action. The practice of medicine soon came to range from simple rule-of-thumb procedures easily and safely applied by non-medically qualied personnel to highly complex and costly activities requiring teams of health-care professionals of various kinds using special facilities in purpose-built premises. Cultural, social and economic changes doubtless had more effect on the pattern of disease than did the advance of medical practice, great though that was. Within years of the end of the Second World War infant mortality began to decline and the incidence of acute orid organic disease began to fall in many parts of Europe, especially in the West. Tuberculosis was brought under control, osteomyelitis virtually disappeared, and great killers of the past such as lobar pneumonia, diphtheria and rheumatic fever became rarities to be replaced as major causes of mortality by road trafc accidents, suicide and diseases of unknown origin such as cancer, high blood pressure and coronary artery disease. Chronic disorders and degenerative disease soon exceeded acute bacterial (but not viral) infections among the causes of morbidity. Life expectancy lengthened in most countries. For a man in the East End of London in the late 1930s it had been estimated at 42; in 1990 the average life expectancy at birth for men in England was 72.5.1 The lowest increase in life expectancy at birth in 1990 in OECD countries was in Denmark, where male life expectancy was 72.2 and female 77.7.2 In 1988, WHO gures showed all Eastern European countries to have shorter life expectancies than any in Western Europe; Portugal, with a life expectancy of 74.1, ranked below all other Western countries but still above all Eastern ones. Romania and Hungary had the lowest expectancies, that for Hungarian males being 66.1 years.3 Despite this increased life expectancy and a rising standard of living, the late twentieth century was characterized by much ill health, particularly in the form of emotional disorders, as well as by a considerable increase in all forms of crime both likely to be related, at least partly, to rapidly changing environments and lifestyles. The number of old people increased in every country, and in 1992 the European ofce of the WHO forecast that twenty-one European countries would have less than 30 per cent of their population under the age of twenty by the year 2000. Whilst
1 2 3

World Health Organization, Health for All (Geneva, 1990). Danes Life Expectancy Stagnates, British Medical Journal, 306 (8 May 1993), 12267. D. Rowland, Health Status in East European Countries, Health Affairs, 10:3 (1991), 20215.

487

John Ellis progress was made in overcoming the disabilities of the mentally and physically handicapped through medicine and the law, the pace of life quickened even in rural areas to make independent existence beyond the scope of those with minor mental or physical defects. Peoples attitudes to health, disease and medical care altered in many ways. By the 1950s the right to medical care was widely seen as a basic human right. Expectations of what it could achieve quickly became grossly inated, not least because of the often ignorant and irresponsible reporting of new therapeutic agents by the media. Not surprisingly the accelerating advance, complexity and specialization of medicine made it difcult to comprehend. The sense of personal responsibility for maintaining health tended to diminish, particularly in the face of increasing faith in the capacity of medicine to cure all ills and in the presence of national health services designed to dispense it to all. In much of Europe immunization was accepted as a means of preventing infectious disease and employed by governments to a varying extent. Lowering the incidence of diseases such as cancer or AIDS, the presence of which was announced in 1982, by means of a change in lifestyle (by abandoning smoking or lessening promiscuity) progressed slowly despite heavy investment in health education. The medical professions own contribution to health education remained limited, partly because of a longstanding tradition that doctors are more concerned with treatment than prevention and partly because the profession was nowhere organized to present the public at large with an agreed view on anything. National medical associations might represent the majority of doctors on matters of nance and employment, but in many countries specialization resulted in a fragmented profession. Not infrequently one fragment would contradict another. The doctor came to be rated more by his demonstrated competence than by the mystique of his calling4 and not infrequently to be seen more as a gure of authority than as a guide and friend. The investigation of physical, chemical, psychological and social factors, frequently necessary in the elucidation of acute illness in the elderly, tended (by prolonging doubts and fears) to worry patients and relatives, while doctors employing scientic means of helping the patient were in danger of being seen as impersonal and interested only in high technology. They faced not only criticism but litigation, although not on the same scale as in the United States. They were also confronted by alternative medicine, which appeared to many to be more human, less demanding, more attractive and in some countries cheaper than orthodox medicine. The demand, though not necessarily the need, for medical care increased everywhere during the 1950s, especially where free care became
4

Report of the Royal Commission on Medical Education (London, 1968), 30.

488

Medicine available. But it was specialization, which rapidly increased the amount of care given in the wards and out-patient clinics of hospitals, that produced in all countries an urgent need for more doctors, nurses and other health-care workers. Each new specialized department necessitated not only more senior and junior doctors as well as nurses, but also more physicists, chemists, technicians, physiotherapists and medical social workers. More administrators were needed to manage this expansion, with a concomitant demand for cleaners, porters and catering staff. There was less change, however, during the 1950s in the total number and different kinds of personnel providing health care outside hospitals in the community. Some countries, such as the Netherlands and Britain, continued to depend very largely on general practitioners, dentists, district nurses and midwives, and to discourage direct access to specialists. At the other end of the spectrum, as in the Soviet Union, more reliance continued to be placed on less highly trained cadres of middle grade medical personnel.5 It was not until the 1970s and 1980s that it became increasingly apparent that primary health care requires many kinds of personnel, each trained to full particular functions but working together as a team. Different kinds of health professionals emerged in most countries, including eventually paramedics trained and licensed to administer drugs and carry out life-saving procedures. Alterations in the pattern of delivery of health care occurred partly in response to rising costs and even more because of the requirements of changing medicine. Thus, specialized departments had to be grouped together in one institution, not just in order that they might share expensive supporting services, but because diseases and accidents commonly affected more than one part of the body, especially in the elderly. In planned health services it became necessary for the catchment areas of hospital departments to be large enough to ensure that specialist teams had sufcient practice to remain competent. A doctor who had spent the 1970s undergoing training in a number of specialties would not be able to provide a rural community with high quality care in any of them in the 1980s unless called upon to practice them frequently and provided with adequate assistants to enable them to do so. In most countries each decade of the last quarter of the twentieth century ended with fewer but larger hospitals, size being measured not in numbers of beds so much as in the range of departments, clinics and facilities for out-patient care. Each decade ended also with a more varied range of community services, mainly comprised of nurses and other categories of non-medically qualied personnel.
5

Ministry of Health of the USSR, The Training and Utilisation of Feldshers in the USSR, WHO Public Health Papers, 56 (1974), 752.

489

John Ellis The new pattern of delivery of health care differed greatly in the early 1990s from that seen as ideal in some Western European countries fty years before, when a family doctor met the immediate needs of every 2,000 or so people and every local community had its own full range of hospital services. Instead, the emerging concentration of medical resources in fewer centres, reaching out to surrounding areas through non-medically qualied staff, resembled the pattern of health-care delivery found in the rst half of the twentieth century in Soviet Russia and in the colonial territories of Western European empires. In Britain, which for most of the period after 1945 spent a lower proportion of its wealth on health care than many countries, net government expenditure on the NHS in 1949/50 amounted to 446 million, or 3.5% of GDP. It rose to 5.7% of GDP during the next 45 years to almost 40 billion (1994/5). The cost of drugs prescribed by general practitioners during the 1990s was a little less than half the cost of primary care. No two European countries ratios were the same, nor the share in the costs of medical care borne by government (national or regional), by private health insurance and by charitable organisations. Throughout Europe, however, central government played an ever-increasing role not only in the nancing but also in the planning and management of health care. Nonetheless, nowhere were all the needs of all the people met from public funds alone, and everywhere private medical care was available alongside public provision. Everywhere the demand for medical care continued to rise throughout the half-century, almost certainly exceeding, in some countries, the need for it. Screening for conditions such as cancer of the breast or cervix revealed previously undetected need in symptomless disease, whereas in dentistry need probably exceeded demand.6 Increasingly the conict between the demands of individuals and the good of the community as a whole necessitated hard decisions on national priorities. Not surprisingly, there were many critics who questioned the way in which medicine was developing, with the questioning reaching a peak in the 1970s. Supporters of alternative medicine considered that doctors, dominant in policy-making, did more harm than good.7 A different view was that the past contribution of medicine to the improvement of health had been much overrated nutrition had played a bigger part and, as a result, there were unrealistic expectations for the future.8 Others held that medical services were less effective and more costly than they should have
6

7 8

J. S. Bulman, N. D. Richards, G. S. Slack and A. J. Willcocks, Demand and Need for Dental Care (London, 1968). I. Illich, Medical Nemesis: The Expropriation of Health (London, 1974). T. McKeown, The Role of Medicine: Dream, Mirage or Nemesis? (London, 1976).

490

Medicine been because of the poor use of scientic method in health management,9 for example in the failure to use experimental designs such as randomized control trials.10 There was a need for audit. the adaptation of medical education to a changing context The WHO, calling in 1977 for Health for All by the Year 2000, redened the objectives to be pursued in medicine, placing emphasis on primary health care.11 In fact, since 1945 there had been substantial progress in the organization of primary medical care. Nevertheless, deliberate educational changes tended to be made at relatively infrequent intervals and often met with as much opposition as support. During the Second World War many medical schools had been damaged, destroyed or forced to close, and many that continued to function had necessarily been required to alter their courses to meet wartime needs. At the end of hostilities, however, most countries took immediate steps to restore their education to its pre-war state, and by the late 1940s European medical education was for the most part re-established on pre-war lines. In some countries, notably West Germany, however, the return to pre-war conditions was slowed by a shortage of university teachers, and most countries in Eastern Europe enjoyed only a brief period of liberation before communist regimes imposed new and usually alien arrangements generally similar to those in the Soviet Union. With the exception of the Soviet Union, all countries set out in their medical school courses (with or without an internship) to produce general practitioners, some of whom might later become specialists by means of further study and experience. The courses were of two main kinds. The majority were modelled on the German system that aimed at the unity of teaching and research in the university. Teaching was by lectures and demonstrations. Students were still largely free to determine their own route to completion of the syllabus, although some schools might recommend a particular curriculum. Licensing was by state examination. Originally intended to foster the scientic method, the approach was increasingly criticized for failing to do so because of its essentially theoretical nature.12 Practical clinical work was largely limited to an internship
9

10

11 12

A. L. Cochrane, Effectiveness and Efciency: Random Reections on Health Services (London, 1972). C. Alvarez-Dardet and M. T. Ring, Thomas McKeown and Archibald Cochrane: A Journey through the Diffusion of their Ideas, British Medical Journal, 306 (8 May 1993), 12524. World Health Organization, Alma-Ata, 1977. R. Dahrendorf, Traditionen der deutschen Universitat, in P. Kipphof (ed.), Hochschulfuhre (Hamburg, 1965).

491

John Ellis of one year, which in Germany had been extended in 1939 to include three months supervised practice in a rural area.13 In France and Britain the medical schools in the immediate post-war period were more under the inuence of hospitals than universities. Some secondary medical schools in France had no university connection. The four old faculties of medicine in Scotland were inuential, but in London the connection between the twelve hospital medical schools and the University of London was in many respects more nominal than real. All French and British schools emphasized practical clinical work. In France the last year of a six-year medical school course contained compulsory periods of duty in clinical departments, but the main opportunity for practical experience was through the system of externat and internat. Externs, chosen by competition through examinations set by hospital authorities, spent three months assisting in hospital and thereby becoming eligible to compete for internships offering longer periods of residential hospital practice. Around one in eight individuals achieved an internship.14 In the UK students in the hospital medical schools of London had always been regarded as apprentices rather than undergraduates, although coming to the wards as informed apprentices by virtue of a short period of vocationally orientated study of basic medical science.15 After the war the emphasis remained on bedside teaching and clinical clerkships, although no internship was required in the UK in 1950. In Scotland lectures were a more important method of teaching. Courses in the English provincial medical schools suffered from a lack of standardization and a compromise between London and Scotland. In Scandinavia16 and the Netherlands, universities that had modelled themselves on the German pattern had increased the amount of practical clinical work in the years before 1939, and were now anxious to extend it further. In general, teaching everywhere in Europe in the immediate post-war period remained didactic, dogmatic and authoritarian, whether it was pursued with a small group of students at the bedside in London, Uppsala or Leiden, or encapsulated in ex cathedra lectures to scores of students in Bologna, Berlin, Edinburgh or Paris. The minimum length of course was nowhere less than ve years, more often six, but many students took longer. When they emerged at the end, most of them had been
13

14

15 16

H. H. Simmer, Principles and Problems of Medical Undergraduate Education in Germany during the 19th and Early 20th Centuries, in C. D. OMalley (ed.), The History of Medical Education (Berkeley, 1970), 173200. C. Coury, The Teaching of Medicine in France from the Beginning of the Seventeenth Century, in OMalley, History (note 13), 12172. A. Flexner, Medical Education: A Comparative Study (New York, 1925). W. Kock, Medical Education in Scandinavia since 1600, in OMalley, History (note 13).

492

Medicine programmed to identify (mainly by physical examination) currently common conditions and to respond to them in a given way; this was generally recognized as satisfactory preparation for practice when diagnosis was by pattern recognition and when treatment was changing only slowly. When licensed by state or university examinations (or in the case of many British students by examinations held by professional organizations) most newly registered doctors in the late 1940s were capable, as their pre-war predecessors had been, of providing most of what medicine then had to offer in the home (of patient or doctor), in a nursing home or in a small hospital. Post-war changes in medicine, however, soon made competence in the basic clinical skills of gaining information from the patients (by taking a history and making a physical examination) both more important and more difcult to acquire. Diagnosis came to depend more upon a full and accurate case history, including highly personal details difcult to obtain even when there were no language barriers, as there came to be in Europes increasingly multiracial communities. Coincidentally, from the 1950s onwards patients had less and less time to spare in which to allow students to practise their basic clinical skills. Although chronic disorders increased and the amount of acute illness lessened, medical and socioeconomic changes combined steadily to shorten the length of patients stay in hospital. Those attending casualty, out-patient and general practitioner clinics preferred to hurry home after seeing the doctor than to suffer delay while students made their inevitably slow enquiries. The impact of such changes on the German model of medical education (and in any medical school where the size of the annual entry prohibited the supervision of students in clinical practice) fell mainly on the period of internship. For undergraduate courses it was not difcult to nd, even amongst a declining number of acutely ill people, the relatively small number of patients needed to illustrate the diagnosis and treatment of disease by lectures and demonstrations to large classes of students. The direct effects of the changing context of medical education on the acquisition of clinical skills were not immediately great or obvious. The direct effects of changing medical practice were much greater in the schools in which the emphasis was on bedside teaching and practical clinical work. They were immediate and profound in the UK, where what students learned was decided more by the range of conditions seen in the wards than by lectures and demonstrations. Opportunities for practising basic clinical methods, to carry out diagnostic procedures and to perform minor surgical operations, declined. Moreover, with the advent of the National Health Service in the UK in 1948, the kind of student participation in medical care that had been necessary in charity hospitals was considered inappropriate once they had been taken over by the state. 493

John Ellis While many doctors in the UK continued to consider the traditional apprenticeship approach to British medical education both necessary and still possible, and struggled to maintain it despite specialization and the changing patterns of disease, it was progressively eroded during the 1950s. By the mid-1960s questionnaire studies of all the nal-year students in the UK17 revealed that they had become observers rather than providers of medical care. The average number of student lumbar punctures performed by the end of the course was 1.1, 75 per cent of students had never washed out a stomach, and only 33 per cent believed that they had ever contributed to the making of a decision of any importance to a patient. (Most of this last group had done so during holidays spent as interns in American hospitals unable to attract local doctors.) Meanwhile, the continuing belief that students must learn from acutely ill patients in non-specialized units led to their dispersal around an increasingly large number of widely scattered district hospitals, swelling medical schools body of teachers (already expanded by specialization). While the effects of changing medical practice on clinical training varied from country to country according to its type of medical school, all were directly affected in much the same way and at much the same speed by the growth of medical knowledge and specialization. New material and new subjects had to be included in the syllabus, whilst older departments struggled to maintain their share of it. Curricula rapidly became more crowded and fragmented, and students lost their freedom to proceed at their own pace. In most countries the minimum length of studies remained at ve to six years (followed by internship). Extensions became increasingly difcult, especially where grants to cover fees and living expenses were limited to the minimum period. Attempts by individual teachers, or even faculties, to revise the syllabus and lessen the burden of memorizing facts could be easily frustrated by the examinations system controlled in the 1950s either by departments, universities or central state licensing authorities. Details varied. In Sweden in the 1950s each student was still examined individually at a time of their choosing by the professor in each subject. In Denmark, the professors interrogation might be witnessed by two local practitioners, who might suggest, but could not themselves ask, additional questions. In very many countries, however, national licensing examinations were set by state authorities who, with public safety in mind, tended to concentrate more on what had been common and important in the past than on what might become so in the future. When examinations by universities or professional bodies were used for licensing purposes,
17

Survey of Medical Students in 1966. Summary report by the Association for the Study of Medical Education and the National Foundation for Educational Research. Report of the Royal Commission (note 4), Appendix 19.

494

Medicine as in Britain, they too were of the pass-fail variety. Even when one year of pre-registration training or internship became compulsory in 1953, nals continued to be dominated more by concepts of what a doctor should know or be able to do than by the needs of an intern practising under supervision.

the reform of medical education As the direct effects on medical education of changes in medical practice and in society proceeded inexorably, medical schools could no longer turn out doctors in six or seven years. By the 1950s it was accepted everywhere that nobody could in future master the whole of medical knowledge. It was accepted, too, that it would remain necessary, and possible, for all doctors to acquire an understanding of the sciences basic to medicine, to comprehend the normal human being and the causes and results of abnormality, and to become competent in basic clinical skills. Beyond that, each student would have to acquire the detailed knowledge and skills relevant to the current practice of a particular branch of medicine a single body system (e.g., neurology), a specic age group (e.g., neo-natal paediatrics) or a specied range of care (e.g., primary health care). To be safe and effective, all doctors would clearly have to measure as precisely as possible all aspects of a patients problem, both scientic and humanitarian approaches to it. They would have to think like scientists but be prepared to make decisions and take action while still lacking sufcient evidence to be altogether certain. All doctors were being required too to accept change as normal in every feature of their professional life and work.18 They would be certain to be confronted with clinical problems that could not be solved by pattern recognition, with situations about which they had received no instruction during training, and with new, unfamiliar ethical dilemmas. In future, doctors unable to work in a changing context with some degree of equanimity in all but the narrow specialties would be likely to become insecure, forced either into referring increasing numbers of their patients to other doctors, or turning into uncomprehending technicians applying a limited range of remedies, or pursuing an unending and inevitably unsuccessful search for all knowledge.19 Those, on the other hand, who developed the ability to think and reason for themselves would be able and willing to make good use of continuing education.
18 19

Report of the Royal Commission (note 4). E. E. Boesch, Psychological Basis for the Education of the Physician, in Preparation of the Physician for General Practice, WHO Public Health Papers, 20 (Geneva, 1963).

495

John Ellis Educational strategies and the employment of methods not previously included in all undergraduate courses would facilitate the process. Curricula in continuing postgraduate training would need to minimize the conict between training and education, between programming students to do precisely what they have been told and encouraging them to question everything they are told to do. The translation of as much vocational training as possible from undergraduate education to a later stage in medical education, necessary on other grounds, would help, and so would postponing the teaching of the very considerable amount of empirical knowledge still useful in medical practice. Logically, therefore, the preparation of all doctors would need to be a three-stage process, with undergraduate education no longer seeking to provide the knowledge and skills relevant to general practice. All medical students would need to take up an internship not only for vocational training, but in order to learn those aspects of many subjects (such as therapeutics, community medicine and ethics) which could not be fully meaningful without some experience of actively participating in the care of patients. All medical students would need a postgraduate in-service training to equip them with the knowledge and skills relevant to the practice of a particular branch of medicine and to enable them to learn how to work as members of a multidisciplinary team and to participate in management. All doctors would need continuing education to enable them to keep abreast of developments in their own eld of work and aware of change in others. Their ability to make use of continuing education would depend on the success of their initial university course, which in turn would depend on the adequate provision of the second and third stages of training. In the absence of a university course enabling doctors to learn for themselves and evaluate new developments, there would be no alternative but to provide regular compulsory retraining. That would lead inevitably, wherever medical education depended on government funding, to making public decisions relating to what branches of the profession to maintain, the functions of each branch, and the number of students required to full those functions. Dening functions in a relatively narrow specialty would not be particularly difcult, and updating would consist mainly of keeping abreast of development in the specialty. Dening the functions of a generalist, however, would be far from easy and would extend the role of government in medical education. The situation in the Soviet Union, when government was already to dene the objectives and context of medical education, differed in 1945 from that anywhere else. In 1930 Soviet medical schools had been separated from the universities and academic research institutes and placed under the Ministry of Health, and in 1934 the medical schools (renamed 496

Medicine institutes of medicine) had been subdivided into three segments: one in general medicine, one for paediatricians and one for public health ofcers. The rst part of the course was taken by all the students. This partially specialized basic vocational training was followed by compulsory post-basic training tailored to adult or paediatric care or to public health work with opportunities for some to proceed on to further training in other specialties. This pattern of medical training remained little changed over four decades, although adjustments were occasionally made so as to match government decisions about medical care. In 1958, however, it was laid down that attention had to be paid to inculcating a scientic method of cognition, a creative approach towards the study of sciences, a responsible attitude towards study, and the ability to work independently. This did not lead to the return of the medical schools to the universities, but scientic circles were established in medical schools where, on an optional basis, students could consider and discuss new developments in medicine and in the process practise a foreign language. Most other countries in Eastern Europe continued to maintain medical faculties in their universities, though much inuenced by the Soviet Unions approach to medical care and medical training. It was not until the late 1980s that the restoration of the Russian institutes of medicine to universities began to be considered. No Western country followed the Soviet system. All set out instead to strengthen and improve the inuence of the university on basic medical education. The rst countries to embark on a policy of reform in the 1940s were those in which the pre-war system was most rapidly altered by the direct effects of changing practice. Sweden and Britain were among them. Their reliance on practical clinical experience by students, which had made them vulnerable to those direct effects, had also ensured that their medical schools (three in Sweden and thirty in Britain) were small, and had made a numerus clausus necessary. Both sought to reform the university course and to improve the period of general professional training, and in the 1960s both recognized the need to provide a third stage of postgraduate training for all doctors. The difference in their speed of progress reected the inuence of factors acting as a spur or as a barrier to change. Agitation among the younger doctors in Sweden produced a royal committee on medical education in 1948. It reported in 1953. Fifteen of its proposals were accepted by the government in 1954, and a new undergraduate curriculum, which had the sole aim of preparing the doctor for the coming years of postgraduate studies, was set in motion in the medical faculties in 1955. Organization of postgraduate training in the specialties followed, and in 1967 postgraduate training for general 497

John Ellis practice was made compulsory. This rapid progress was much assisted by the fact that medical education had always been based on universities, that higher education was under the central control of a government well positioned to consult with a small number of universities, and that postgraduate training was, from 1960 onwards, under a single authority, the National Board of Health. Moreover most generalist doctors were salaried employees of the state. In the UK, over half the countrys medical students before the war received all or part of their training in medical schools in London owned and run by the governors of charity hospitals. The planning of a state medical service led to the setting up in 1941 of an interdepartmental committee to consider its implications for medical education, and its report, the Goodenough Report (1944), recommended that every medical school become an integral part of a university with a much increased number of university-appointed teachers.20 Each university should offer an undergraduate course that, by its nature and standard, would provide the student with a university education on broad and liberal lines, and follow it up by a one-year period of internship and further postgraduate training for specialists. Each medical school should relate to, but be separately nanced from, a group of hospitals and clinics. The committee warned that the standard of a national health service would depend on the quality of medical education and research, which in turn would depend on a great increase in government funding. It recommended, as a means of shortening the inevitable time-lag between the initiation of educational reforms and their fruition, the urgent building up of an adequate supply of teachers, the granting of priorities for building materials and labour, and the provision of postgraduate courses. The report attracted little attention from the profession or the public in 1944, as both were fully occupied with the war. But it was not forgotten. Implementation began in 1948 with the closing of non-university schools, and proceeded thereafter with government funds made available through a medical sub-committee of the University Grants Committee to medical schools willing to have more university-appointed teachers. The inuence of universities over British medical schools increased throughout the 1950s as the number of full-time medical staff rose from 432 in 1938/39 to 2,163 in 1961/62.21 One year of compulsory internship was introduced in 1953. In 1957 the General Medical Council abandoned its previous policy of recommending a detailed minimum curriculum, and, in exhorting the medical faculties to instruct less and educate more, it
20

21

Report of the Interdepartmental Committee on Medical Schools (Goodenough Report) (London, 1944). University Grants Committee, University Development 195762 (London, 1964).

498

Medicine reminded them of their right and duty to experiment with different courses and methods of teaching. An Association for the Study of Medical Education was founded in the same year to collect and transmit information on medical education and to promote and conduct research into it, leading later to the publication of the British Journal of Medical Education. Universities now began to introduce new curricula.22 A programme of rebuilding the countrys medical schools (to about twice their previous size) began in the 1960s, and three new schools were started. The policy of combining modernization with expansion was adopted because most existing schools lacked facilities for university education. Early in the 1950s an optional scheme for the postgraduate training of general practitioners was introduced, based on one year as a traineeassistant in an approved practice. The University of London set up its British Postgraduate Medical Federation, comprising fourteen specialist institutes and the Postgraduate Medical School of London. Between them they offered courses in all specialties. In 1961/2 they provided postgraduate education for 3,800 students, of whom 2,500 came from other countries, mainly from the British Commonwealth.23 In Britain and Ireland registration of specialized postgraduate training was not required before one engaged in private practice as a specialist, but appointment as a specialist to a hospital was conditional on years of in-service assistantships in large hospitals and on passing examinations set by the Royal Colleges of Physicians and Surgeons, traditional, longestablished institutions. The introduction of the National Health Service was followed by a vast increase in junior hospital posts offering further experience to young graduates who in Britain, as everywhere else in the world, were already determined to specialize. The posts were not designed for training, however, and working conditions were poor. When the government imposed restrictions on the expansion of specialist appointments, therefore, not surprisingly many graduates chose to emigrate, especially to the United States, where residency training programmes provided everything a trainee needed to gain accreditation. Their departure facilitated the immigration into the UK of graduates from other countries, especially from hastily established, over-large and understaffed medical schools in poorer newly independent countries prepared to recognize as specialists anyone with a British higher diploma, even if obtained after little more than theoretical courses of study. Between 1962 and 1967 some 800 UKborn medical graduates left the UK each year, only about 400 of whom
22

23

P. O. Williams and V. M. J. Rowe, Undergraduate Medical Curricula: Changes in Britain (London, 1963). University Grants Committee, University Development 196267 (London, 1968).

499

John Ellis were later to return.24 The country received, however, more doctors than it lost. Those taking up medical occupations in Britain in 1967 consisted of 2,050 non-British doctors, compared with 1,810 British medical graduates. In 1969 almost a quarter of all doctors employed in the NHS were born, and mostly trained, outside the UK, even though the annual entry to British medical schools had been doubled from around 1,500 in 1959 to around 3,000 in 1969.25 Since the net effect of migration was in the countrys favour, little was done in the 1950s and 1960s to improve postgraduate training for the specialties by dening its content or duration, approving training posts or establishing training programmes. Completion of training continued to be signalled by appointment as a consultant (specialist) in the NHS, rather than by completing a given period of apprenticeship or passing examinations. In the 1960s, however, conditions of work for junior hospital doctors were improved and short periods of study leave were allowed. Continuing education for all doctors continued to be necessary, and to assist in its provision 300 postgraduate medical centres were established (complete with library, lecture theatre, study rooms and ofces), nanced partly by foundations, partly by public appeals and partly by the Ministry of Health. In 1965 a Royal Commission on Medical Education was set up to advise on better organization of postgraduate training, the need for more doctors and the rationalization of the many university medical institutions in London. It reported in 1968, recommending that the policy begun by the committee of 1944 be continued, with a more exible undergraduate course (providing for optional studies in addition to basic knowledge and skills), a period of general professional training, and postgraduate training for all doctors, specialists and general practitioners, followed by continuing education. Ways of organizing postgraduate training were recommended, as was an indicative register informing the public of the branch of medicine in which each doctor had been trained. The Commission also recommended the regrouping of Londons 27 university medical institutions (12 undergraduate schools and 15 postgraduate institutions) into six centres, each joined with a multi-faculty university college. Organization of postgraduate training for the specialties then began, dening the content of each course, and designing training programmes for linked in-service posts. Appointment as consultant in the NHS marked completion of training. Coincidentally, general practitioners were trained to contribute to the training of the next generation. The hostility of the
24

25

O. Gish, British Doctor Migration 196267, British Journal of Medical Education, 4 (1970). O. Gish, Medical Education and the Brain Drain, British Journal of Medical Education, 3 (1969).

500

Medicine profession to postgraduate training of general practitioners was gradually overcome and the range of continuing education increased. It was not, however, until 1978 that postgraduate vocational training for those wishing to become principals in general practice was made mandatory, and not until 1983 that the General Medical Council (GMC) was made responsible for the standard of all stages of medical education. But when, ten years later, the GMC proposed recommending all medical faculties to adopt a curriculum combining a compulsory core of basic knowledge and skill with optional studies aimed at intellectual development, university medical institutions in London resisted this reform, despite the urging of reports done in 1979 and 1992. It took Britain some fty years, therefore, to achieve much the same degree of reform reached in less than twenty years in Sweden, where the production of doctors had also been doubled in the sixties. It was said of the UK in the 1960s that no country had produced so many wise reports on the reform of medical education, and no country had done so little about them. In fact, the progress made in the UK was remarkable, especially considering the many difculties in the way, such as the absence of university hospitals, great resistance by many clinical teachers (particularly in London) to any increase in university stafng, a system of hospital organization consisting of as many autonomous clinical units as senior members of staff (mainly part-time clinicians appointed by the NHS), the wide range of licensing bodies, including the Royal Colleges of Medicine (in London, Edinburgh and Glasgow), and an even larger number of professional colleges and associations involved with universities and the NHS in the organization of postgraduate training. Even the one great spur to reform, the emigration of young doctors to countries providing better postgraduate training, was to some extent blunted by the immigration of equally large numbers from other countries willing to work in British hospitals while taking examinations for British diplomas. Moreover, general practitioners, instead of being salaried employees of the NHS, which had originally been intended but was unacceptable to the British Medical Association, remained independent of it, contracting with it to provide the same general medical services for all that had been provided for insured working men since the National Insurance Act of 1911. A similar line of development to that pursued quickly in Sweden and more slowly in the UK was followed in Norway, Denmark, Finland and Iceland, allowing sufcient uniformity to enable a free interchange of doctors. In the Netherlands the absence of national licensing examinations and of close government control over universities gave medical faculties, especially new ones like Rotterdam, considerable freedom to determine the nature of their own courses. The powerful position of general 501

John Ellis practitioners in the health-care system led in 1968 to an optional year of vocational training for those entering general practice, the basic course being reduced from seven to six years.26 In 1974 postgraduate training for general practitioners became compulsory. The period was extended to two years in 1987 and to three years in 1993. Consideration of reform began in France in the 1940s, with the countrys medical education still based on a mixture of medical faculties and secondary medical schools.27 University teachers were appointed by central authorities and many lacked both hospital and research facilities. The Paris faculty had upwards of twenty-one municipal hospitals at its disposal, but had no say in the appointment of their staff, who provided much of the clinical teaching a problem not unlike that in the UK, but complicated by the lack of a numerus clausus. A loosely dened curriculum began with clinical studies in wards crowded with students. A fundamental restructuring of medical schools was deemed essential, therefore, and was carried through as the R eforme Debr e by Professor Robert Debr e, whose son was prime minister and later nance minister of France. An inter-ministerial committee, set up in 1956 with Professor Debr e as chairman, led in 1958 to proposals for the establishment of new medical teaching centres in which universities and hospitals would be more closely integrated, and in which university teachers in all subjects would be fulltime and required to combine teaching with patient care and research. As this reform began, the curriculum was revised, entry to the second year was limited by examinations to relate student numbers to clinical facilities, and the system of externat and internat was expanded; the high cost of reform, however, slowed its progress, leading to increasing dissatisfaction with the part played by medical students, assistants, chief residents and researchers, leading in turn to the dramatic events of May 1968.28 By that time the reform of medical education had made less progress than in England as far as a university course culminating in the licensing doctorate of medicine was concerned. The postgraduate situation, however, was different. To obtain a certicate of special studies, teaching spread over some three years and the passing of theoretical and practical examinations were necessary.
26

27 28

P. A. J. Bouhuijs et al.,The Rijksuniversiteit Limburg, Maastricht, Netherlands: Development of Medical Education, in F. M. Katz and T. Ful op (eds.), Personnel for Health Care, WHO Public Health Papers, 70 (Geneva, 1978); J. C. van Es, Clinical Teaching in General Practice, in H. Beukers and J. Moll (eds.), Clinical Teaching, Past and Present, Clio Medica (Acta Academiae Internationalis Historiae Medicinae), 21 (1989). Coury, Teaching (note 14). C. Escofer-Lambiotte, Review and Analysis of Medical Education in France, in J. R. Krevans and P. G. Cunliffe (eds.), Reform of Medical Education: The Effect of Student Unrest (Washington, D.C., 1970).

502

Medicine Postgraduate teaching was provided not only in universities, but in ofcial organizations under the control of or with the support of the National Centre for Scientic Research and the National Institute of Health and Medical Research. Since there was no control over the number of specialists, the number of graduates choosing to specialize increased rapidly. In 1967, 5,300 postgraduates were registered in Paris in the faculty of medicine alone. In other parts of Europe, where medical faculties were modelled on the pre-war German pattern and were less immediately subject to the direct effects of change in medicine, there was a less-obvious need in the 1950s for haste in adapting medical education to changing circumstances. There were also numerous impediments to change: the post-war condition of medical schools and hospitals and the degree of central control over them, the tendency to maintain large medical faculties, a tradition of powerful, autonomous professorial units rmly under the direction of centrally appointed professors with no retirement age, national licensing examinations controlled by central authorities, and, not least, the state of the national economy and the degree of priority given to the nancing of medical education. In some countries, such as Belgium, racial differences added further difculties.29 Pressure for change came mainly from three sources: teachers, students and new graduates. While the most senior and powerful teachers tended to wish to maintain the status quo, many with less seniority (both clinicians and researchers) were anxious to see reform, if not necessarily prepared to risk promotion prospects by public criticism of the existing state of affairs. Groups wishing to discuss change sometimes thought it wise to meet in secret. Teachers from many countries, including Greece, became members of the Association for the Study of Medical Education in London, where their attendance at meetings would not be noticed back home. In West Germany in the 1950s it was easier for one of the ten different states to construct new university buildings than to change the federal laws regulating the requirements for qualifying as an MD or being approved by the state board to enter practice. A ministerial committee made relatively small changes apart from extending the internship to two years. The Federal Research Council suggested various improvements, but the rst major step forward came with the start of new universities and a medical faculty in one of them, the University of Ulm. Planning began in 1954, preclinical teaching in 1969, and postgraduate teaching earlier. The teachers planning the new medical school were not so much concerned with curriculum as with organization seeking a system of
29

J. E. Dumont, The Example of the University of Brussels, in Krevans and Cunliffe, Reform (note 28).

503

John Ellis governance and departmental structure which would facilitate interdisciplinary teaching and research, achieve the unity of the two so long desired, and foster the acquisition of scientic method by students.30 The second pressure for change in much of Western Europe in the late 1960s was student unrest. Unrest among medical students was least in countries like the UK where efforts had already been made to reform undergraduate medical education. Elsewhere, medical students shared the antagonism of youth to authority. But they differed from others in suffering the frustration of having no responsibility for anything but their own education while spending long years preparing for an occupation carrying great responsibilities for others. In at least the early years of that long preparation they had difculty in seeing the relevance of much that they were required to learn. Many had probably chosen to take up medicine for reasons other than an interest in science and, whether altruistic or not, they were readily moved by the growing gap between the haves and the have-nots and inadequate medical care for the poor. Most were well aware that the range of conditions to be seen in teaching hospitals no longer mirrored that to be seen outside.31 Students were not the only ones to imagine that less science in the curriculum would somehow lead to providing the patients with more of what they really need. They were also able in the 1960s to travel and to see in other lands aspects of medical care or medical education which, though difcult to evaluate, they would like to see adopted at home.32 In general, however, when unrest reached its peak in 1968, medical students were far from clear what reforms they wanted, other than a share in the reforming process. In Paris, where demands were most vociferous, through the shattering noise of offensive grenades and tear-gas bombs outside the bronze doors of the faculty, the students imperturbably concentrated all the power of their imagination to drawing up a white paper setting out their proposals and demands.33 They claimed to have won the battle for substantially more clinical practice in the curriculum. Those who demonstrated in other countries may have achieved their aim of a place in the decision-making process in universities, although succeeding generations of medical students proved less keen to use it. Ironically, one change of great importance to the reform of medical education, a numerus clausus, was opposed by students in some countries as
30

31 32

33

E. F. Pfeiffer, Organisation of New Medical Schools, in Krevans and Cunliffe, Reform (note 28). J. R. Ellis, Demands and Responses, in Krevans and Cunliffe, Reform (note 28). M. Zelter, The Need for Reforms as Seen through Students Eyes, in Krevans and Cunliffe, Reform (note 28). Escofer-Lambiotte, Review (note 28).

504

Medicine the loss of a democratic right. Nonetheless, limitation of entry to medical schools was imposed by various means throughout Western Europe, beginning with Germany and the Netherlands in the 1960s, and introduced in Italy in the early 1990s. Belgium was left (without a numerus clausus) as the main recipient of foreigners unable to gain access to a medical school in their own countries. Student unrest undoubtedly drew attention to the need for reform in medical education, but the determination of young doctors to specialize proved a more powerful force leading inexorably to changes not only in postgraduate training but in undergraduate education as well. Some indication of the speed at which specialization progressed is given by the increase in the number of separate special departments in Sweden, 10 in 1890, 332 in 1940 and 778 in 1960.34 In England and Wales, despite tight government control over the expansion of consultant (specialist) posts, the number of specialists rose from 3,037 (full-time equivalent) in 1949 to 4,634 in 1955, an increase of 52.6 per cent.35 In 1975, out of 20,200 registered doctors in the Netherlands, a country placing much emphasis on general practice, 4,800 were general practitioners, 6,600 were specialists, and the number of specialists was rising faster than that of general practitioners.36 In the UK as late as 1990 general practitioners made up less than half of the total number of doctors. In most European countries universities offered higher medical degrees, obtainable mostly by thesis, but sometimes by examination, and most required graduates to take further courses of instruction and pass examinations for some kind of certicate (like the French Certicate of Special Studies) before being licensed to practice as specialists. The mode and content of training for each specialty had to be adjusted promptly to advances in medicine, but as the number of specialists was decided more by market forces than by state health services, postgraduate training had to meet demand if emigration were to be controlled. During the 1950s and 1960s more and more graduates attended postgraduate courses in universities, separate postgraduate medical schools or specialized institutes, with accreditation of specialists ranging from theoretical examinations at one extreme to apprenticeship in British state hospitals at the other. In the 1970s and 1980s, however, the importance of practical experience was increasingly recognized throughout Western Europe. Even so, the European Community, as it tackled the task of standardizing the accreditation of specialists in Member States in the 1990s, was confronted with the fact that many more years were required
34

35 36

H. Bergstrand, Lakaekaren och provisiallakarevandet: Medicinalvasendet i Sverige (Stockholm, 1963). C. Webster, The Health Services since the War, Vol. I (London, 1988). Bouhuijs et al., Rijksuniversiteit Limburg (note 26).

505

John Ellis to become a specialist in the NHS in the UK than anywhere else. The criteria were different. Nowhere was there adequate postgraduate training for general practice. Optional training was provided in 1973 in the Netherlands and made compulsory the following year, and elsewhere the period of internship was extended, but in general the failure of graduates to enter general practice was not attributed to the paucity of training for it or to any other possible reason but to over-specialization in an undergraduate course of studies given mainly in hospitals. In the 1970s, in a number of countries new experimental medical schools were set up, among them the medical faculty of the Autonomous University of Madrid in 1969 and of the new University of Maastricht in 1974. In 1975 the Department of Community Medicine at the new University of Haceteppe in Ankara provided a two-month rural internship in community medicine in addition to the teaching of preventive medicine, and a two-month clerkship in rural health centres. The planning of a new course at the Medical University of P ecs in Hungary was completed in 1975; it set out to educate a community-orientated general practitioner. All these schools had limited entries. P ecs took in 200 annually on the basis of performance in biology and physics, and social factors such as being children of industrial workers or farm-labourers.37 Social factors also determined the choice in Norway, of Troms, north of the Arctic Circle, as the site of a new medical school in 1969.38 In the 1970s all medical schools in Europe faced the problem of nding time in already crowded undergraduate curricula for both additional educational activities and additional training to meet specic local needs or to encourage a community orientation. Many schools began to integrate teaching around organ systems, as pioneered in the 1950s at the University of Western Reserve in the United States, as a means of freeing part of the curriculum for educational activities such as study in depth, projects and problem solving.39 Some faculties in the UK were thereby able to set aside one year of the ve-year course for such activities, while others continued to persuade as many students as possible to spend an additional year studying for a BSc degree in a single subject. More commonly, in countries unable or unwilling to provide postgraduate training for general practice, the time saved by integrated teaching was used to provide additional training for community medicine or some other aspect of medical practice. Growing awareness that different students had different aims and educational needs led to the concept of an
37 38

39

Katz and Ful op, Personnel (note 26). L. Cerych and P. Sabatier, Great Expectations and Mixed Performance: The Implementation of Higher Education Reforms in Europe (Stoke-on-Trent, 1986), ch. 6. A. G. Swanson, Medical Education in the USA and Canada, in J. Walton et al. (eds.), The Oxford Companion to Medicine, Vol. I (Oxford, 1986).

506

Medicine integrated core curriculum followed by options. A continuing desire to relate the educational process as much as possible to medical practice led to the concept of integrating teaching around problems of medical practice or around competencies required in practice, rather than around organ systems.40 Meanwhile, the advance of educational technology in the 1970s and 1980s produced much of great value to medical education. Selflearning devices ranged from tape-slide programmes to computer-assisted learning all of which could be used by individual students working in their own time at their own speed. Similarly, many of the difculties surrounding the teaching of the practice of basic clinical skills could be overcome by the use of closed-circuit television, one-way screens and videos, together with simulation techniques ranging from the use of models to the employment of actors playing the parts of patients. All these developments contributed in the 1980s to the advance of medical education as a subject, with the establishment of departments of education in medical schools, the setting up of courses (including degree courses) in education for medical teachers, and an increased amount of research into techniques of teaching, methods of learning, and reliable methods of assessment. Unfortunately, measurements of the quality of care given by the products of new forms of medical education remained tantalizingly out of reach.

the cost of medical education Medical education had been very cheap in a few European countries before the Second World War. In Britain it was largely a by-product of patient care in charity hospitals, and most teachers were hospital staff. It was more costly in countries that relied on university courses. After 1945 costs rose rapidly, especially in the UK. Everywhere specialization and improvements in technology necessitated more teachers, and in most countries more research facilities. To the rising cost of basic medical education (making medicine the most expensive faculty in a university) was added that of providing more and better-organized postgraduate training and, before long, the cost of continuing education. In the late 1950s, however, before the cost of reform could be met, and in some countries before reform even began, it became essential to increase the number of doctors as quickly as possible. In countries without a numerus clausus this could be done without great difculty, provided no great change was made in the type of education provided.
40

W. C. McGaghie, G. E. Miller, A. W. Sajid and T. V. Telder, Competency-Based Curriculum Redevelopment in Medical Education, WHO Public Health Paper, 68 (Geneva, 1978).

507

John Ellis In France, the faculty of Paris had 7,690 students in 1964, with 4,050 in the preliminary pre-medical year. In 1966 there were 9,481 students, with 4,903 in the pre-medical year. The increase continued: the number of medical doctorates issued in France rose from 3,000 in 1968 to 9,000 in 1978.41 Where medical faculties were small and a numerus clausus was in operation, increased production was more difcult and costly. Nevertheless, both Sweden and the UK doubled their production of doctors between 1960 and 1970. In Sweden each of the existing three schools was increased in size, and three new ones started. The total number of medical students rose from 3,316 in 1960 to 6,575 in 1969.42 The UK began a programme of rebuilding all its existing schools so as to equip them for a university education and at the same time to allow them to take a student entry (120160) about twice that of the countrys previous average annual entry.43 One new medical school was started, and two more added in the 1970s. The annual national student entry rose from about 1,500 in 1959 to around 3,000 in 1969. In addition, students were no longer admitted from countries such as Norway and South Africa, from which many had previously come for medical education and then returned home. In the UK, and everywhere else, the need for expansion of medical education inevitably slowed its reform. After the war the cost of medical education throughout Europe was met mainly by government funds, though very considerable sums continued to be raised by teachers from other sources for research in medical faculties and postgraduate institutes. The University of Witten/Herdecke, established in Nordrhein-Westfalen, Germany, in 1982, was a very rare instance of a private state-independent university with a medical faculty.44 The combination of rising costs and state funding led to an increasing number of decisions affecting medical education and training being taken at national level. Whereas before the Second World War such decisions related to national mechanisms for granting licences to practise medicine and for maintaining standards, they soon came to include such matters as: 1. how many and what kind of doctors the country needed and what it could afford; 2. how much should be invested in medical education and research; 3. how such investment would be distributed across the country;
41 42 43 44

Coury, Teaching (note 14). Svenska utbiedningestatistic arsbok (Stockholm, 1978). University Grants Committee, University Development (note 23). R. Wedersheim, The First Private Medical Faculty in the Federal Republic of Germany, Medical Teacher, 11 (1989).

508

Medicine 4. what proportion of the total resources available should be devoted to ensuring, through better education today, better health care tomorrow; 5. how the clinical resources provided by and for the medical schools would be related to the remaining health-care services of the country or province or region; 6. how postgraduate training would be spread across the country, and who was to be responsible for organizing it, providing the necessary facilities, recognizing the satisfactory completion of it by each individual, and maintaining its standards. Countries differed as to which ministry or ministries were responsible for funding medical education. In some a single authority, usually the ministry of health, was made responsible for both health care and all stages of medical education and training. In the Soviet Union this system allowed the training of doctors to be tailored very precisely to the perceived needs of medical care, or the needs (present and future) perceived by the government. It was less satisfactory in regard to education as a preparation for a changing future, particularly in medical schools separated from universities and research institutes. In most of the rest of Europe the ministry of education carried responsibility for funding universities and through them basic medical education. The same ministry might also fund postgraduate medical education where universities provided the bulk of postgraduate training and continuing education. In the Netherlands, the ministry of education was until the 1980s responsible also for the teaching hospitals and other clinical facilities needed by the medical faculties. Alternatively, the ministry of education was responsible for funding universities, and the ministry of health for providing the clinical resources needed by medical schools. This last alternative overcame the disadvantages of an educational department being responsible for a countrys most complex and expensive hospitals, but brought about the difculty that each university faculty of medicine had to deal with a government health service on a detailed day-to-day basis. Regional and local health authorities, being solely concerned with local health needs, were often reluctant to provide the clinical facilities necessary to full the national functions of a medical faculty. National health authorities were better placed to perceive the national role of medical schools, but often too remote to recognize variation in local health-care needs.45 Some European countries endeavoured to ensure that government funding did not restrict academic freedom. Thus, in the UK, the University
45

J. R. Ellis, The Responsibility of Medical Schools for Teaching Hospitals and the Provision of Clinical Services, Medical Education, 15:3 (1981), 17183.

509

John Ellis Grants Committee (composed mainly of academics recruited on a parttime basis, backed by a small permanent secretariat) was responsible for giving government an estimate of the universities nancial requirements and for dividing between the universities the funds allocated by government. This buffer mechanism worked well on a quinquennial basis, but was inevitably less effective when forced by economic circumstances to function on an annual basis. Its replacement by the University Funding Council after 1988,46 followed by the elevation of polytechnics to university status in 1992, meant closer government control. In countries where medical schools provided educationally oriented preparation for later training, it was not easy to dene a single set of clinical facilities that was essential to every undergraduate medical school. Education of course can adapt to a clinical situation to a degree that is impossible in training. A student can learn how to solve clinical problems in any one of a number of specialties, but a doctor training to be a neurologist must see and treat neurological disorders. Education requires a much smaller quantity of clinical facilities than does training. In many European countries, however, failure to dene the training to be given in the later stages of the preparation for medicine left medical faculties with the virtually impossible task of trying to provide both a general training and a university education in the same course, and contributed still further to the lack of clarity as to the nancial and clinical requirements of the basic course. The situation in such countries was not helped by the fact that in others the purpose of the undergraduate course continued for many years to be the production of generalist doctors, some of whom might later specialize. And in the seventies and eighties international agencies ardently advocated matching the content of courses to current national health needs, a policy likely to appeal not only to politicians but to a general public unlikely to be able to judge the soundness of university education. It is perhaps surprising that medical faculties in a number of European countries were to some extent enabled to orientate their basic courses to the needs of education rather than to current practice, considering the pressures on government and the fact that not all political parties were particularly anxious to see the medical profession intellectually well equipped to query the aims and methods of treating individuals or the priorities of health care or the pattern of its delivery. The general public, however, easily appreciated the need for postgraduate training, at least for the specialties, and for continuing education. In most countries governments responded relatively promptly to the need,

46

See chapter 1, 15 (note 27).

510

Medicine nancing either the universities or other organizations (including government health services) as the main providers of postgraduate medical education. Postgraduate training for general practice, on the other hand, even when considered essential, suffered from the fact that general practitioners were employed by the state in only a few countries. In the UK, for example, hospital doctors, being employees of the NHS, could easily be incorporated as trainers of postgraduates, but general practitioners, being independent contractors providing general services, could be employed as trainers only with difculty and at much greater cost. In many ways, therefore, the cost of medical education had a profound effect on the speed with which it was adapted to the changing medicine of the second half of the twentieth century. Although all countries were eventually striving to introduce more education into the university course and to postpone much general training to a later period, their governments had difculty in curtailing the range or standard of care so as to ensure future improvement by devoting more current resources to education. The public, as always, was more concerned with the present than with the future.

the outcome of reform All available indicators, however, suggest that the health of all European nations improved during the second half of the twentieth century, to a greater extent in the West than in the East.47 But the part played in that improvement by medicine, as opposed to socio-economic changes, was as difcult to assess in the twentieth century as it had been in the nineteenth. The quality of medical care remained equally difcult to measure and the extent of iatrogenic disease was seldom explored. Even in countries with state health services facing escalating costs, medical audit began on a large scale only during the last decade of the twentieth century. Poor quality of care might be due to poor education or training, but it might just as well be the result of other factors the type of persons attracted to medicine as a career, unsatisfactory facilities or terms and conditions of service. Litigation against doctors rose rapidly in some countries in the 1980s; in the UK, the great majority of doctors turning for help to the Medical Protection Society were general practitioners. Yet only a small minority of such cases came to court. In hospital practice, increasingly under the scrutiny of the media during the 1990s, the cases that were published often suggested a lack of adequate supervision in the earlier stages of long in-service apprenticeship.
47

Rowland, Health (note 3).

511

John Ellis Although undergraduate examinations tended to become multiplechoice, the nal examination at the end of the medical school course was a more rigorous assessment of basic competence in the 1990s than it had been in the 1920s. As no student could begin to practise or enter the next stage of training without passing such examinations, it might be expected that he or she had truly demonstrated the achievement of the aims and objectives of the undergraduate medical course. During the 1970s and 1980s medical schools spent much effort dening aims and objectives. By the 1990s it was becoming evident that their precise denition was more relevant to postgraduate training than to undergraduate education. Public safety demanded detailed specication and careful testing of the competences required for licensing, but no limit could wisely be set as to the extent of intellectual development to be aimed at in the university course. Nevertheless, in some countries greater faith in the length of training than in examinations as a means of ensuring public safety removed testing at the end of postgraduate training from many specialties, and in the absence of adequate objective evidence as to the ability of doctors to perform satisfactorily, it was customary in virtually all European countries throughout the second half of the twentieth century to criticize medical education on one or other of several different counts. Critics convinced that university medical faculties should be producing graduates prepared for and anxious to engage in primary health care (with emphasis on the prevention of disease) continued to blame the medical faculties for placing insufcient emphasis on preventive medicine and general practice. Such criticism was commonly accompanied by a plea that university medical faculties should be inuenced by a rmly declared government policy. A main obstacle to the primary health care orientation approach, as far as education of future doctors is concerned, has been the communication gap that exists between ministries and the medical education system in their countries.48 Nonetheless, while every patient might be the better for the presence of listening and caring doctors mostly concerned with primary care, substantial sections of the European public demanded specialists who were involved in or in touch with current scientic research.49 In 1985 a survey of the teaching of primary health care in Europe revealed that not all medical schools had departments of primary medical
48 49

H. Walton, Primary Health Care in Europe, Medical Education, 19 (1985). The Edinburgh Declaration of 1988, promoted by the World Federation for Medical Education and assisted by the WHO, stated that the aim of medical education is to produce doctors who will promote the health of all people, and that this aim is not being realised in many places despite the enormous progress made during this century in the biomedical sciences.

512

Medicine care (e.g., general practice).50 In Belgium, Denmark, the Netherlands, Norway and the UK there were departments in all medical schools, and there were also departments in some schools in Finland, France, the Federal Republic of Germany, Ireland, Poland, Sweden, Turkey and Yugoslavia. There were, however, no departments of primary medical care in any medical school in Austria, Bulgaria, Czechoslovakia, the German Democratic Republic, Greece, Hungary, Iceland, Italy, Portugal, Romania, Spain, Switzerland or the USSR, although many schools in these countries may in fact have used polyclinics for teaching. The evidence that undergraduate medical education was responsible for students choosing to specialize rather than engage in primary health care (often referred to as working in the community, with the inference that in some way hospitals were not part of the community) was never very strong. Nevertheless, in the last quarter of the twentieth century great efforts were made in many countries to ensure that students observed medical practice in the community, thus substituting one practical emphasis for another and in the process weakening the university atmosphere of the undergraduate course. Very probably Fisek, responsible for the progressive community medicine teaching programme at Haceteppe University, Turkey, was correct when he observed in 1978 that the behaviour of physicians is determined by the socio-economic structure of their society, not by their undergraduate education.51 The outcome of medical schools dedicated to the production of preventive and community-orientated graduates keen to practise in isolated areas tended to conrm that view.52 Teachers in some schools in the 1990s reported the transformation of eager, motivated school-leavers into narrow-minded, disillusioned medical graduates,53 echoing earlier criticism in the United States that its very different four-year medical school course developed cynicism. In Europe evidence of such a transformation was largely anecdotal and at any time varied from place to place. In the UK, discontent and disillusion was not uncommon or surprising among graduates emerging at the age of twenty-four from a ve- or six-year undergraduate course, lacking any responsibility for others, to face an internship requiring them to care for patients from eighty to a hundred hours per week. So abrupt a passage from modied education to traditional training was not, however, to be found in other countries, and even in the UK the much-publicized low
50 51

52

53

Walton, Primary (note 48). N. Fisek, School of Medicine, Haceteppe University, in Katz and Ful op, Personnel (note 26). B. Porter and W. E. Seidelmann, The Politics of Reform in Medical Education and Health Service: The Neger Project (New York, 1992). S. Lowry, Whats Wrong with Medical Education (London, 1993).

513

John Ellis morale of junior hospital doctors (attributed by the media to inadequate government funding of the NHS) did not prevent a 15 per cent rise in the number of applicants for medicine in 1992. Criticism of the products of medical education continued from the 1940s to the 1990s. Their criticism varied considerably from country to country, even among those within the European Community, despite Article 23 of Council Directive 93/16 stipulating that the period of basic medical training for the medical profession should comprise six years or 5,500 hours of theoretical and practical instruction in a university or under the supervision of a university. Everywhere, however, the main criticism was the same and remained unchanged the undergraduate curriculum was overcrowded. The curriculum actually followed by individual students was doubtless much less crowded than the ofcial reports on which criticism was based, but there was general agreement throughout Europe that students were handicapped by overloading. In the Federal Republic of Germany, despite major changes in the established pattern of medical training in 1970 and the replacement of old oral examinations with new multiple-choice question papers, the course content constantly increased, forcing the students to concentrate on shortterm learning. In the UK, where reform of medical education had begun in 1944, the General Medical Council stated in 1993 that there was still gross overcrowding of most undergraduate curricula, acknowledged by teachers and deplored by students. The scarcely tolerable burden of information that is imposed taxes the memory but not the intellect. The emphasis is on the passive acquisition of knowledge, much of it to become outdated or forgotten, rather than on its discovery through curiosity and experiment. The result is a marked tendency to under-provide those components of the course that are truly education. In perspective, the striking feature of the very considerable changes that took place in European medical education over fty years was that they all moved in the same direction. Recognition of the need for a university medical course concentrating on education rather than training ought to have produced such courses, especially in countries in which medical education had long been university-based. Teachers were no doubt to some extent to blame, as the British General Medical Council concluded in 1993. There was a persisting drive towards an unrealistic degree of completeness in the curriculum, reinforced no doubt by the understandable reluctance of quasi-autonomous departments to surrender what they see as their entitlement and by the laudable if sometimes excessive enthusiasm for their own subject.54 The German reforms of 1970 aimed to
54

Consultative Paper, in Recommendations on Undergraduate Medical Education (London, 1993).

514

Medicine overcome the problem of the fragmentation of medicine by integrating examinations and relating the content of them to prescribed attainment targets. Failure to get agreement as to the precise make-up of the targets led inevitably to an increasing number of specialized examinations. Much depended on the preparedness of medical faculties to change their ways. However, much also depended on the cost of modernization and expansion. By the 1990s not all the pre-war medical schools in Britain had been rebuilt, and the faltering of reform schemes proposed in West Germany in the 1970s could be largely explained by the fact that they were based on a national student entry of around 5,000. By 1980 the entry had risen to over 11,000 (reduced thereafter to 10,000).55 Without doubt, however, the most important factor accounting for delay in implementing reforms recognized as necessary was the failure to appreciate the difculties involved in producing generalists, once medicine had grown beyond the connes of a single mind. General practitioners had emerged during the second half of the nineteenth century; specialists were henceforth general practitioners who, on completion of their training, had acquired additional knowledge and skills, entitling them to higher status and rewards. By 1945 this hierarchical concept of the profession was nearly a century old and strongly held, especially by the ever-growing army of specialists. It masked the fact that the wheel had turned full circle, that while good specialists could easily be produced by intensive training, it would be increasingly difcult to make good generalists and even more difcult to maintain their level of competence. Their functions were seldom dened with any precision. In the UK, where more than 20,000 independent general practitioners contracted with the Department of Health to provide certain services, those services were decided nationally by negotiation between the department and the most powerful professional body, the British Medical Association. The inevitable compromise led to terms such as general medical services, making it extremely difcult to dene the content and duration of a postgraduate training for general practice. When in 1990 a significant change in the contract was made for the rst time since 1911, it was to increase payment for various preventive measures, such as screening the elderly, and to reduce that for the general medical services provided by family doctors a term which took little account of the divorce rate or of partners choosing to have different general practitioners. Thus, in many countries, teachers of undergraduates, having no way of knowing which of their students would become general practitioners, had good excuse for ensuring that the undergraduate course provided
55

R. Toellner, personal communication 1993.

515

John Ellis full coverage of their particular portion of medical knowledge. In 1992 the British General Medical Council, in its consultative statement on new recommendations for undergraduate medical education, observed that there is now no reason why some of the factual learning embodied in the undergraduate course should not be transferred to a later stage.56 It did not, however, dene this had to be included later what aspects could not be fully meaningful until the learner had some experience of responsible participation in the care of sick people. It was not surprising that the reform of medical education in the UK (requiring increasingly heavy expenditure and several Acts of Parliament) was very gradual, but as an English professor of medicine noted in 1993, it is no use developing a generation of creative critical thinkers only for many of them to become disillusioned by a ridiculously long period of apprenticeship of the mindnumbing requirements of our specialist examinations.57 At the end of fty years of change, therefore, problems remained in medical education in most of Europe. There was general agreement that all medical practitioners needed those attributes that it was always the primary purpose of a university to develop, but the undergraduate medical course was still rendered largely ineffectual because of the failure to translate much general and all specialized training to later periods under other auspices.

teachers and students The number of teachers employed by each medical faculty increased from 1945 onwards because of the greater involvement in medicine of both basic and behavioural scientists and because of specialization. In the clinical eld, specialties themselves began to subdivide, giving rise to subspecialties such as, in the case of paediatrics, neonatal paediatrics and paediatric neurology. With increasing demand, the so-called supporting specialties such as pathology, anaesthetics and radiology also proliferated as they advanced. A hospital which had been well served by a department of histopathology and a central clinical laboratory in 1945 already needed departments of microbiology, virology, chemical pathology, immunology and haematology. The number of teachers also increased because the medical faculty became responsible for teaching people other than medical students. After the war dental schools became the responsibility of a university medical faculty in more European countries, with the number of dental teachers
56 57

Consultative Paper (note 54). D. Weatherall, Crisis in Medical Education?, British Medical Journal, 307 (1993), 55.

516

Medicine increasing as oral pathology advanced along with oral medicine, periodontology and oral surgery. Degree courses in nursing and other health professions further widened the range of teachers. In countries such as France and the UK, where before the war the majority of teachers in medical schools were hospital staff, the changeover to more university-based undergraduate courses also led to a great increase in staff appointed by universities. In most European countries, however, increasing the number of teachers failed to result in an acceptable staffstudent ratio, partly because of the rise in student numbers and partly because of additions to the total workload of medical academies. The departmental basis of faculty governance became increasingly strained by the proliferation of departments, many of them small. Many professorial heads of department became as reluctant to full increasingly onerous administrative functions as some of the more junior members were anxious to share in them. The authoritarian head of department gave way to various kinds of management, including committees and rotating headships. Both teaching and research called more and more for interdepartmental activities, and many faculties searched for new and more appropriate systems of governance than the traditional departmental organization. Thus, some institutions grouped departments into divisions composed of related subjects, for example, medical, surgical, dental or pathology, while others organized much of their research in areas of like activity rather than through departments. No new system of faculty governance emerged, however, to be universally recognized as an ideal answer. In most countries some kind of departmental structure lingered on, and most medical schools continued to wonder how best to discover a dean, rector, principal or director with rst-class professional qualications and reputation, an abiding interest in education, a deep respect for research, wide experience of administration, the ability to lead and a clear vision of what the future should be. Secondary problems included how to prevent such leaders from swelling the ranks of those medical educators who had long since abandoned the practice of both medicine and education. In most parts of Europe the relationships between staff and students in medical faculties changed considerably. In countries such as the UK, long periods of close apprenticeship to a small number of masters were replaced by brief opportunities to observe a wide variety of practitioners at work. Small-group teaching, however, and in some schools tutorial systems opened up new ways of ensuring close personal contact. Elsewhere, the great gap between senior teachers and their students narrowed. In Sweden, for example, it became not unusual for a professor to take his class on an ofcial visit to some other university or medical centre. 517

John Ellis Medical academics continued to be held in high regard in Europe throughout the twentieth century. Their numbers increased without appreciably lessening the esteem in which they were held. In countries in which they were previously few and far between their increase brought heightened respect. While Londons twelve medical schools had between them only eight professors of medicine or surgery, they tended to be regarded as doubtless very clever and scientic but perhaps a little out of touch with the real world, and too accustomed to experimenting to make a consultation desirable save in a dire emergency. By the 1990s, attending a university clinic was seen as at least the equal of seeing a Harley Street specialist, even if the professor was away at a conference. In the 1940s and 1950s the students entering many European medical schools were a mixture of men and women returning from war service and boys and girls fresh from school. Students in the Soviet Union were required to complete two years work of some kind after leaving secondary school before entering medicine, and special arrangements were made to facilitate the progress of nurses and feldshers through medical school. Many other countries came to favour older applicants by giving credit for experience gained outside medicine. As a result of that policy the average age of entry to Swedish medical schools rose to twenty-ve at one period in the early 1980s. In the UK the majority of students continued to enter the medical faculty at eighteen, some at seventeen, younger than anywhere else in the world. The main criterion used in selecting medical students in countries operating a numerus clausus was academic achievement in examinations (commonly, but not exclusively, in scientic subjects) taken at secondary school. Intelligence and aptitude tests were little used. Where interviews were included, as in some British medical schools, comparison of unsuccessful with successful candidates showed the difference to lie in academic attainments.58 The level of attainment leading to entry rose not to keep pace with the intellectual demands of the courses but with the intensity of competition for entry. Judged by success in secondary school examinations, during the rst few decades after the war very many medical students were considerably brighter than the majority of their teachers. Yet the situation in medical schools in the Netherlands, where entry was decided by lottery, did not appear to be signicantly different from that elsewhere. By the end of the war more than half the medical students in the USSR were women. Gradually a ftyfty ratio was reached in many other
58

M. L. Johnson, A Comparison of the Social Characteristics and Academic Achievements of Medical Students and Unsuccessful Medical School Applicants, British Journal of Medical Education, 5:1 (1971).

518

Medicine countries, with positive discrimination in favour of men being used in Poland to ensure that there was not a preponderance of women. But easy access of women into medicine was not accompanied by equally easy advance within the profession. In the UK fewer women than men reached senior positions in surgery, perhaps because fewer attempted to do so. The advent of a larger number of women into British medical schools may have contributed to a change in the public image of medical students. Before 1939 they had over a long period earned a reputation for being coarse but kind, keen sportsmen, heavy drinkers and quite irresponsible. From the 1960s onwards, however, medical students, though younger, generally resembled those in the rest of Europe: hard-working, impecunious and struggling through a long course of studies and an endless series of examinations still fond of fun and games, but with a more alert social conscience than their forebears. Although the main cost of medical education was borne by the state in all European countries, living expenses over the long university course (with only brief holidays in some countries) tended to result in a high proportion of students being drawn from better-off families. Though frequently thought to have received secondary schooling too quickly narrowed down to basic sciences, most medical students enjoyed a reasonably broad-based education even in the UK, where medical faculty entrance requirements had to be obtained at an early age. For those drawn into medicine by genuine altruism, it was hard to spend long years with no chance to help anyone but themselves. The wastage rate in the UK, however, often as high as 10 per cent, was almost entirely due to students discovering they had made a wrong career choice. Most students welcomed almost any opportunity to engage in the care of sick people. An elective period of some two months was introduced into the curriculum of some British schools in the 1950s, with the initial idea of allowing the students to work on a project of their choice, and it soon became accepted as a chance to travel, preferably to the Third World, and to treat people with easily diagnosed, easily remedied, acute organic disease. Coincidentally, German students welcomed every opportunity to see practical work in British hospitals. Students in Eastern Europe sought electives of whatever kind were available in the countries of Western Europe, in the process meeting up with New Zealanders and Americans also on electives. Government-funded European exchange programmes such as Erasmus, Nordplus and Tempus added still further to the movement of students.59

59

See chapter 3, 11516; Epilogue, 56466.

519

John Ellis education and training Although some universities continued to rely heavily on lectures and demonstrations, especially where classes were very large, increasingly didactic coercive teaching was seen as a hindrance, stiing intellectual curiosity, reducing initiative and diminishing self-reliance. Many universities attempted to concentrate on those forms of teaching (normally to small groups) that enabled students to participate, and on the creation of learning situations in which the teachers role was to encourage rather than to instruct. Some medical schools designed the early years of the curriculum so that teachers from both clinical and basic science departments together introduced students to the basic knowledge of each body system in the context of its anatomy, cellular biology and physiology, while identifying the clinical manifestations of disease and the effects of therapeutic agents.60 Students were thus helped to see the relevance of what they had to learn to the practice of medicine; instruction was orientated to the needs of students rather than the aspirations of departments. Where the curriculum was of the traditional kind, the content was selected for its relevance to current practice, ensuring a comprehensive coverage of common conditions. Where the aim of the course had changed to the production of graduates capable of independent thought and ready for postgraduate training, it related more to educational needs and anticipated changes in medical care. Remodelling long-established courses for medical students was naturally more difcult than fashioning courses for other health personnel not previously taking degrees. In some universities courses for nurses called for less passive and more active learning than those for doctors. Dentistry also beneted from small numbers and from the fact that although considerable instruction and practice remained necessary for the mastery of its manual skills, such training could be relatively easily kept separate from education. The British medical faculty was ahead of most others in Europe in its efforts to improve techniques of teaching and to encourage more effective methods of learning. Faculties sought and received the assistance of educational psychologists, and many established their own departments of education. Efforts were also made to increase the interest of individual teachers in education. Universities provided courses to improve teaching skills, without perhaps always appreciating that the rst requirement of the clinical teacher (especially in postgraduate teaching) was to be a good

60

Swanson, Medical Education (note 39).

520

Medicine clinician: improving the teaching skills of a poor clinician might well do more harm than good. By the 1980s, many countries had some kind of national association for medical education, and the deans of the European medical and dental schools began regular meetings. By the 1990s computer-based learning began to make students more easily able to direct their own learning and much less dependent on teachers. Increased ability accurately to simulate situations for practising basic clinical skills also reduced the need for teachers and lessened the burden on patients. The possibility of using computers in restorative dentistry pointed to similar advances in dental training. Social changes, on the other hand, continued to make the discussion of a patients problems by a group of staff and students in an open ward harmful and unsatisfactory for all concerned. The provision of teaching rooms and the separation of teaching from the concomitant care of patients added to the costs of medical education. In some countries, however, specialization and the dispersal of students to observe medicine outside hospitals resulted in a large and widely scattered body of teachers over whom the medical faculty could exert little close control. A similar but greater problem affected internship and general professional training. Whether or not the university was responsible for this important stage of preparation for medicine, its apprenticeship basis necessitated very large numbers of trainers, most of whom carried heavy service responsibilities. Clear-cut objectives could have enabled most to ensure that their trainees achieved them, but precise objectives were seldom laid down. Varying in length from country to country (and often voluntarily extended by graduates), this stage of training soon became, as practical experience diminished in the undergraduate course, the most intensive learning period in the long preparation for medicine. While falling short of the ultimate incentive to learning in medicine, being left entirely alone to face the care of the sick and injured, the rst experience of responsible practice under supervision provided a powerful motivation which was rarely made full use of. All too frequently trainees were kept fully occupied, often for very long hours, dealing with immediate cares and left with little time for study or reection. They were provided with little teaching on those aspects of their work in which practical experience had kindled new interest.61 Nor were they able to acquire the understanding of people that comes more easily from caring for patients than from reading, lectures, small group discussions or seminars.

61

J. Grant and P. Marsden, Service-Based Learning (London, 1991).

521

John Ellis In many countries, postgraduate training was based mainly on relatively short theoretical courses given by universities. In others, particularly Scandinavia and the UK, it was based mainly on apprenticeship in hospitals. Gradually more practical training was introduced in most countries, in contrast to undergraduate medical education in which all countries moved towards greater university involvement. Where universities controlled major departments of special clinical expertise they inevitably carried the burden of training in those subjects, but the primary role of the university was to provide trainees with an opportunity to engage in some original work, completing that part of their education aimed at preparing them for the critical evaluation not only of new developments, but also of their own clinical practice. The universitys role in continuing education varied much between countries. In all of them, the twofold aim was the same: enabling the individual to keep abreast of developments in his or her own eld and become aware of advances in others. Continuing education could be obtained in the same three ways: by daily working on the job, by attending organized teaching or courses, and by studying at home. Specialists could engage in all three ways with relatively little help from a university. General practitioners working alone or in small groups had less opportunity to learn on the job and were more dependent on what was provided for them in courses or for home consumption. Where, as in the UK, their take-up of continuing education was fuelled by extra payments, the demands made on university personnel became considerable, even if the hard work of organization was done by clinical tutors drawn from the hospital staff. Although some countries established separate institutes for continuing medical education, in most of the others the universities collaborated with health services and professional associations in its organization at central, regional and local levels.62 Technological advances in communication and interactive learning such as electronic mail, computer-based expert systems, satellite TV and video presaged the possibility of new national and possibly international organizations. Calls for help with continuing education came also from other professions beside medicine. Dentists, for example, having little in the way of hospitals, were in most countries more dependent than doctors on the university for refresher courses and the updating of their skills. An increasing number of dental auxiliaries, differently named in different countries, were also dependent on the same source of training and retraining. Postbasic courses to provide nurses with special skills such as coronary care or intensive care required a special organization of their own in most
62

J. Vysohlid and H. J. Walton, Development of Continuing Medical Education in Europe: A Review, Medical Education, 24 (1990), 40612.

522

Medicine countries, but universities found an increasing demand from nurses and other health professionals for courses leading to a masters degree or a doctorate in some aspect of the health eld.

research The importance of research to the medical faculty, always great, became still greater as the need grew for more education and less training in the undergraduate medical course. Unless the student associates with men bent on the search for new knowledge he will never learn to appraise accepted beliefs, or acquire that understanding which will allow him in his turn to face the unknown.63 As one British scientist put it, Students should be able to drink deep from the clear waters of a running stream rather than sip the green mantle of a stagnant pool.64 From the Second World War onwards faith in the potency of the experimental method encouraged the idea that much-wanted answers to current problems could be quickly forthcoming, if only sufcient money and human resources were put to work. Organizations engaging in research into the health eld were mobilized, in addition to universities. These included research institutes, scientic academies, professional colleges and associations, health services and hospitals, industry (particularly the pharmaceutical industry) and government departments. The sources of funds included government, industry, foundations and the public. In some countries government remained the major source, and in all it increased its total contribution over the years. The amounts spent by foundations and industry and collected by the public increased also. Up to the 1970s the funds reaching universities from multiple sources were in many cases very substantial in total, though difculties occurred in relation to projects that failed to catch the imagination of the public or interest other sources. After the 1970s, costs continued to escalate, and in many countries support failed to keep pace. In these circumstances it was government support that was most curtailed. By the 1990s most European countries had well-established national organizations for biomedical research complementing that provided by universities, their role being that of assisting the balanced development of medical and relevant biological research in the country as a whole, in partnership with, but not in replacement of, the other instruments of research in the same elds.65 The extent to which governments funded medical research in universities, either directly or through research councils, varied from country
63 65 64 D. Dunlop, personal communication. Ibid. Report of the Medical Research Council, 19601961 (London, 1961).

523

John Ellis to country and from time to time. In Germany, where medical research in the universities had been outstanding in the early twentieth century, basic research after the war was concentrated more in research institutes. In the Soviet Union, on the other hand, research was carried out in the universities from which the medical schools had been removed. In the UK the amount of medical research in the universities increased greatly as medical faculties were expanded and strengthened. From the 1980s onwards, however, government funding of research councils faltered in the UK, affecting universities indirectly, while their direct funding was altered to take account separately of teaching and research. Attempts were made to measure the quantity and quality of research in the departments and faculties of each university and to relate future funding to perceived past achievement. Those judged to have performed poorly had perforce to do less research or seek greater funding from nongovernment sources. Intense competition began between universities for aid from and collaboration with industry. Many achieved more funds for research than they were previously receiving for it from government. Nonetheless, the overall trend was towards some universities becoming major centres of research in many elds and becoming centres of excellence in a single eld, leaving others with little opportunity for more than a limited amount of applied research. Everywhere applied research in the health eld increased far more than basic research spreading from clinical medicine into methods and systems of health care and into education and training, carried out by health professionals of every kind in every kind of hospital, school and healthservice facility as well as in universities. The introduction of medical audit further increased the number of medical personnel engaged in a new form of applied research. In the process fundamental research in medicine and allied elds increasingly became interdepartmental, interdisciplinary and international; consequently, the traditional departmental basis of faculty governance became as much of a hindrance to research as to the development of a student-orientated undergraduate medical curriculum, perhaps more so. Devising a system of governance minimizing the control of departments over the appointment of staff, the design of curricula, the choice of research projects, the deployment of space and the use of resources, while desirable in many ways, nevertheless threatened the freedom of professors to engage in research of their own choosing, already eroded for other reasons in the case of clinicians. The vital freedom of academics to pursue knowledge for its own sake was, at least in theory, safeguarded from government control in countries where universities could turn to a multiplicity of sources of funding rather than be dependent on government alone. In reality, it was commonly 524

Medicine more difcult for university researchers carrying major responsibilities for teaching and patient care than for those without such responsibility to attract support from industry, the public or foundations. Where support was secured, teachers were sometimes led to concentrate so much on research as to threaten the necessary but delicate balance of the essential trinity of teaching, patient care and research. The trend towards the concentration of research resources (similar to the inexorable concentration of medical care resources into fewer but larger hospitals) posed a further threat to research in the medical faculties by limiting it in some and by siphoning off academic staff from others to work full time in research organizations outside universities. Collaboration between European countries, however, did much to strengthen Europes overall research activity. And the European Commission itself started a biomedical and health research programme (BIOMED) in 1978, its four main target areas being: 1. 2. 3. 4. prevention, care and health systems, major health problems, human genome analysis, and biomedical ethics.

There were three projects in 197881 and over 200 by 19904. Expenditure rose from 1.09 million to 133 million over the same period, with funds being spent on coordination rather than on particular projects.66 In addition to the European Communitys programme, collaborative research activities included the European Molecular Biology Organization, founded in 1963, a private self-governing organization with a laboratory in Heidelberg,67 encouraging and funding interaction between 700 European molecular biologists. The European Science Foundation (with fty-six member research councils, academics and institutes from twenty countries, and funded by its members) was founded in 197468 to bring European scientists together to work on topics of common concern, to coordinate the use of expensive facilities and to discover and dene new endeavours likely to benet from a cooperative approach. It included a standing committee of European Medical Research Councils. Such effort still left Europe far behind the United States in research outlays. The total expenditure on health research of the twelve countries in the European Community was $2,045 million in 1990, compared with $8,572 million in the United States of America.69
66 67 68 69

Commission of the European Communities, EC Research Funding (Brussels, 1990). European Molecular Biology Organisation, 19641989 (Heidelberg, 1989). See chapter 3, 120. Organization for Economic Cooperation and Development, Basic Science and Technology Indicators, ACCEDE (Paris, 1991).

525

John Ellis Although the adaptation of medical education was still incomplete in most of Europe by the 1990s, a decade of striking advances in biomedical research, there was near consensus that university courses, once freed from what were seen as impediments, offered the best, if not the only, way to prepare doctors able to learn for themselves, critically evaluate new data, face the unfamiliar with equanimity, and contribute usefully to decisions on priorities in health care and how to meet them. By 1990 universities were responsible for more medical care and a wider range of it than at any previous time, and their contribution to fundamental and applied research in the eld of health, which had increased continuously over fty years, was still growing. Great as were the challenges ahead for the universities that could be clearly visualized at the end of the twentieth century, the problems with which they were confronted appeared equally formidable, especially as regards the faculty of medicine. Problems of governance threatened the ability to provide the necessary interdepartmental integration of teaching and the interdisciplinary basis of much research. Problems of achieving an appropriate balance between education, research and patient care might grow, as might problems of collaborating with government health services more concerned with the demands of today than the needs of tomorrow. Above all, problems of rising costs and of nancing research might threaten academic freedom, making the medical profession more vulnerable, more dependent on and more exposed to the control of governments, increasingly hard pressed to meet escalating demands for every kind of medical care. Not only might the freedom of teachers to research into areas of their own choosing be curtailed, but at any time a government might decide to restrict the preparation of doctors to a process of vocational training in whatever aspects of health care it thought t to provide at the time with periodic compulsory reprogramming. Within this context, the establishment of internationally sponsored projects in selected universities (inevitable though not without risks, especially for smaller universities) might result in medical faculties developing a more powerful voice with which to draw the attention of governments to their common purpose and needs.70

70

B. Rexed, The Role of the University in the Future, British Journal of Medical Education, 1 (1967).

526

Medicine select bibliography

Beukers, H., and Moll, J. (eds.) Clinical Teaching Past and Present, Clio Medica (Acta Academiae Internationalis Historiae Medicinae), 21, 1989. Bie, K. N. Creating a New University: The Establishment and Development of the University of Troms, Studies in Research and Higher Education, 3, Oslo, 1981. Boesch, E. E. Psychological Basis for the Education of the Physician, in Preparation of the Physician for General Practice, WHO Public Health Papers, 20, Geneva, 1963. Briggs, A. The History of the Royal College of Physicians, Vol. IV, London, 2005. Christie, R. V. Medical Education and the State, London, 1969. Ellis, J. R. The Future Doctor, in Priorities for the Use of Resource in Medicine, Washington, D.C., 1976. Ellis, J. R. Medical Education in the UK and Europe, in J. Walton et al. (eds.), The Oxford Companion to Medicine, Oxford, 1986. Himsworth, H. Society and the Advancement of Natural Knowledge, London, 1962. Krevans, J. R., and Condliffe, P. G. (eds.) Reform of Medical Education: The Effect of Student Unrest, Washington, D.C., 1970. Medawar, P. B. Induction and Intuition in Scientic Thought, London, 1969. Miller, G. E. et al. Teaching and Learning in Medical School, Cambridge, Mass., 1961. OMalley, C. A. (ed.) The History of Medical Education, Berkeley, 1970. Pickstone, J. V. (ed.) Medical Innovations in Historical Perspective, London, 1992. Popper, K. The Logic of Scientic Discovery, London, 1972. Report of Interdepartmental Committee on Medical Schools, London, 1944. Report of the Royal Commission on Medical Education, London, 1968. Rothstein, W. G. Medical Education, in Clark and Neave, Encyclopedia II, 116373. Wall, W. D. Child of our Time, London, 1959. Wilson, C. The Place of the University in Medicine, British Journal of Medical Education, 8:3 (1974), 16071.

527

CHAPTER 15

TECHNOLOGY

CHRISTOPHER WATSON

the post-war context The universities of Europe had two very different faces in 1945. Seen from without, they represented to millions of young men and women the embodiment of hope repositories of knowledge, expertise and wisdom, oases of detachment and objectivity from which they had been cut off by seven years of world war. Seen from within, by those who had struggled to keep them alive during the war years, they seemed to be in a state of grave debility, if not mortal danger. Their buildings and equipment had all too often been destroyed or diverted to non-educational uses, their teaching staff had been run down (particularly at the young and perhaps most creative end of the spectrum) and they had been starved of their principal life-blood young people with enquiring minds who could gratify their teachers and challenge them. Both of these views, from without and from within, have been overpainted, the rst in too rosy, the second in too black a hue. And this is particularly true if we consider those aspects of university life which relate to technology. Although about half of the German universities suffered severe bomb damage (particularly those in large cities),1 as did both the main and technical universities of Helsinki,2 and Poland suffered particularly badly, losing over half of its pre-war laboratories and over 75 per cent of its libraries, many of the universities of Europe in fact escaped comparatively lightly overall from the physical destruction of the war.3 The use of their buildings and facilities for war work did not always lead far from their pre-war purposes. Military and political leaders of Europe
1

N. Hammerstein, Statement at the International Conference on The History of European Universities after World War II, Ghent University, September 1992. 3 J. Sadlak, ibid. M. Klinge, ibid.

528

Technology turned to the universities to provide much of the technical leadership, especially in the early war years, and so ensured that the universities were not completely stripped of their best and most creative teaching staff. Their war work did not destroy, although it distorted, their pre-war strategy for pushing back the frontiers of knowledge. They continued to recruit teaching staff and to attract students, though not always on the scale, and of the quality, of the pre-war years. The young adults of 1945 were by no means starry-eyed about what the universities had to offer. Both those whose university careers had been cut short by the outbreak of war and those who had missed out altogether had been exposed to a harsher education, and they were not prepared to revert to the old-style discipline in 1945. Many of them had seen technology in action, on a scale which dwarfed the provisions of a pre-war university laboratory, and the traditional academic courses were no longer relevant to their needs. But they did have needs to re-establish a civilian (if not academic) point of view, and to learn the skills appropriate to a world of post-war reconstruction. The universities were ill-equipped to meet these needs immediately. Rewriting a curriculum takes time and requires motivated and energetic teachers. Since these were not yet available on the necessary scale, the universities continued for a while along the course set during the war years. Their technology teaching and research continued to focus on the wartime priorities, outstandingly on the technologies of electronics (especially its applications to communications and radar), aerospace (aerodynamics, control, engines, rocketry), nuclear weapons (nuclear physics, chemistry and engineering). This was not merely a matter of acquired habit it reected the fact that seven years of priority study had made these the exciting, leading-edge subjects, in which teachers could point to their recent achievements, and draw on the personal experience of those that they taught.

technology-related developments in the universities The developments driven by problems indigenous to the universities themselves, and not imposed by other institutions, were of enormous diversity across Europe. Higher education in technology is ordered quite differently in each of the major European nations; it is not obvious where the line should be drawn between university and non-university higher education. The list of hard cases includes the former UK colleges of advanced coles, the German Fraunhofer Institutes technology, the French grandes e and all the institutes of the Eastern European academies of science. In this 529

Christopher Watson Table 15.1 Percentage of students entering to read science and technology subjects at Oxford University
1951 21 1961 32 1971 38 1981 37 1986 39 1991 39

Table 15.2 Percentage of students entering to read science and technology subjects at Birmingham and Manchester Universities
1940 Birmingham Manchester 38 1945 42 1950 46 1955 49 33 1960 50 34 1965 1970

38

40

section, the term university is used in a narrow sense, which excludes such institutions. Overall growth Immediately after the war, science and technology enjoyed a prestige among would-be university entrants, and within the European public at large, which allowed admission standards in these subjects to rise above the national average for all subjects. The universities responded by expanding admissions in these areas. At Oxford, the percentage of students entering to read science and technology subjects evolved as shown in table 15.1 above.4 Similar trends held elsewhere in the UK, as shown in table 15.2.5 In British universities as a whole, science and technology accounted for 45% of all students as early as 1961.6 Still, this was regarded as too low. The Robbins Report in 19637 recommended that to meet the needs of the economy, the British government should actively encourage a 266% increase in higher education as a whole over a twenty-year period, and a 392% increase in science and technology (these gures excluded medical subjects). Within these gures, the committee recommended a particularly strong growth in technology, to bring British higher education in this area
4 5 6 7

Oxford University Gazette (8 June 1992). R. Low and A. Gaukroger, Ghent Conference (note 1); S. V. Barnes, ibid. Lord Robbins, Higher Education, Cmnd. 2154 HMSO, para 66, 166. Ibid., para 509, 165.

530

Technology Table 15.3 The percentages of technology degrees among all rst degrees in science and technology in 1959
UK France USA Sweden Switzerland Canada Germany (FR) 36 48 49 54 59 65 68

Table 15.4 The percentages of technology degrees among all rst degrees in science and technology in 1980
UK Switzerland Germany Sweden France USA 41 42 48 49 53 82

up to the level enjoyed elsewhere. It cited the comparison with Europe shown in table 15.3; the gures are the percentages of technology degrees among all rst degrees in science and technology in 1959.8 The Robbins blueprint was implemented in broad outline. During its twenty-year planning period, the university population did indeed rise by 252% close to the projected 266%.9 If one sets aside doubts about the comparability of the statistics, science and technology grew slightly faster than proposed (341% as compared with 312%), and technology, as a fraction of science and technology, grew faster still (445% as compared with 331%).10 However, on the Continent and in the USA technology grew even faster in respect to science. By 1980, the Robbins league table read as shown in table 15.411
8 10 9 See chapter 6, table 6.6. Ibid., table 46, 127. A. Barblan and J. Sadlak, Higher Education in OECD Countries: Patterns and Trends in the 1980s, CRE Standing Conference (April 1988), table 1. Ibid., calculated from gures in table 1.

11

531

Christopher Watson By this date, however, people questioned the link between the education of technologists and general national economic growth accepted by the Robbins Committee. A signicant trend has been the rise and (more recently) fall in the relative importance of the second degree. In some measure, the rise resulted from a form of competition with the US educational system. There, because of the broad subject spread and relatively slow start during secondary education, a three- or four-year rst degree was required to raise students of science and technology to a standard that European students had already achieved on admission to university. The second degree course, leading to the PhD, could then build on a strong undergraduate preparation. European graduates who went to study at such postgraduate schools as MIT or CalTech in the 1960s reported that the experience was like drinking water from a rehose. Their enthusiasm for the US-style second degree was infectious. Within Europe pressure mounted in the same direction. Its strength varied from one country to another. In France, for example, the technological elite (some 3,000 stu cole pr dents per year) had a two- to three-year course in an e eparatoire coles for a further three-year course. before entering one of the grandes e In Germany, degree courses in technology typically lasted ve and a half to six and a half years.12 A second novelty was joint degrees in two or more subjects which an earlier generation would have regarded as unlikely partners. Engineering and economics, physics and philosophy, science and management studies, psychology, philosophy and physiology. The list has grown continuously since the war, with a ne tuning in the 1960s. Teachers and students alike wanted to ensure that scientic and technical education did not become too narrow. The value of breadth as an end in itself was expounded by many leaders of public opinion throughout the 1950s and beyond. This was perhaps a natural reaction in a generation returning to the academic scene from the mind-broadening experience of a world war. It provoked a negative response from a strand of academic opinion, which saw the pursuit of breadth as a chimera which interfered with the achievement of excellence in a chosen eld. A compromise resulted in which either two(or three-) subject courses coexisted with the traditional single-subject course (for example the physics and philosophy, and engineering and economics courses introduced in Oxford in 1968), or a smattering of broadening course material was introduced across the whole technical curriculum. A third trend, opposing the second, has favoured rst degrees in a much narrower speciality than earlier academics would have regarded as
12

Ibid., table 2.

532

Technology suitable for a degree. Examples within British universities are biotechnology, acoustic engineering, mining engineering, food technology and paper science.13 This trend became evident in the 1950s, with the establishment of chairs in subjects in which there was already a strong research activity in the university, often funded by local industries, and it received a strong boost in the late 1960s as the relevance of academic studies came to be debated widely by students and their teachers. Another trend was decline in the relative importance of practical work in the rst-degree syllabus. In the pre-war era, practical work was undertaken using state of the art equipment in most university courses. In the post-war period, universities increasingly found it impossible to maintain the quantity and standard of equipment required to sustain the concept of across the board practical work at this level. The equipment had become too expensive and specialized, and changed too fast. Increasingly the choice came down to maintaining practical work across the board, but using out-of-date equipment, or narrowing the focus to a few selected projects, leaving the main burden of developing practical skills to postgraduate education. Technical infrastructure A symptom, and also a cause, of the decline in practical work at the undergraduate level was retrenchment in resources for the maintenance of the technical infrastructure of science and technology departments within the universities. Surprisingly, no major public debate took place about the matter. The Robbins Report devotes just 2 of its 837 paragraphs to the differential cost of educating science as against arts students.14 It notes that the average public expenditure in 1962/3 per UK university student (undergraduate and postgraduate) was 568 in arts, 774 in applied science and 902 in pure science and then drops the matter. In partial compensation for this general decline in the technical infrastructure, the past twenty years has seen a large relative increase in the resources devoted to information technology. The electronic computer was born in the military establishments of the USA and the UK during the war (the motivation included re control, design of atomic weapons and breaking codes). In 1945 work began in the National Physical Laboratory and in Manchester University (under Williams and Kilburn),15 and in 1951 this led to the development by Ferranti of the rst commercial
13 14 15

B. Heap, Vocational Degree Course Offers 1987: A Students Guide (Richmond, 1987). Robbins Report (note 6), paras 6078, 201. N. Metropolis, J. Howlett and G. C. Rota (eds.), A History of Computing in the 20th Century (New York, 1980), 37; M. Croarken, Early Scientic Computing in Britain (Oxford, 1990).

533

Christopher Watson computer, the Ferranti Mark 1. In the late 1950s, the idea emerged that a university should have a computer. Oxford purchased one of the earliest commercial computers (for 100,000) in 1958 the valve-based Ferranti Mercury and a small but faithful band of enthusiasts tended it night and day. Its computing power was much less than that of a cheap PC today (its disk capacity was 32K and its add time was 0.18 ms),16 but its inuence on the minds of a generation of university students was enormous. For the mathematicians and scientists, access to a computer led to a shift from analysis to computation as a means of solving most practical problems. For engineers, it brought a vast range of problems which had hitherto been tackled by exercising judgment, craftsmanship or rules of thumb within the scope of quantitative analysis (and hence appropriately considered by universities rather than by apprenticeship schemes). For nearly two decades, the idea persisted that a university should have a single computer, or at most a very few, probably located in The Computer Centre. The machines grew rapidly in power and cost: by 1971, Oxford was spending 67,000 per annum on its computer laboratory, which by then had a professor and several research staff, and by 1985 annual costs had risen to 1,680,000.17 Then suddenly in the 1980s the personal computer (PC) broke in. Individual scholars, or at least small groups of them, could now afford to have their own computers, not one with the number-crunching power of the supercomputer of the 1970s, but something enormously more accessible and user-friendly. It was soon discovered that, for the vast bulk of the problems facing an academic, the power of the supercomputer was not really necessary, and even when it was, a link from a PC through to the mainframe was the appropriate solution. Links between PCs became increasingly important during the 1980s, initially as a means to communicate programs and data, but soon as a general means of academic communication, which combined high speed with an appropriate respect for the academics need for freedom from interruption during periods of creative thought. PCs also provided word processing. In the 1980s, a new generation of students emerged who used the keyboard in preference to the pen as a means of committing their thoughts to paper. Surprisingly little research has been published on the impact of this change on the nature and quality of the resulting thought processes. Certainly, the ease with which a text can be altered has led to a tendency to commit half-baked ideas to paper. Arguably, the comparative clumsiness of the process of shifting sentences and paragraphs around within a word-processed text has tended to freeze
16 17

S. Lavington, Early British Computers (Manchester, 1980), 119. As reported in the Oxford University Gazette for 26 May 1971 and 1985.

534

Technology the initial macro-structure of the text at an early stage in the writing process, to the detriment of logic and clarity. On the other hand, it is now easier for several scholars to collaborate instantly over great distances in the process of creative writing. A second technological invention which dramatically altered academic life in the late twentieth century was the photocopier. Prior to the introduction of the Xerox (it was launched commercially in Europe in 1956,18 but did not become generally affordable by universities until the early 1970s), multiple copies of documents required for academic purposes were either typeset and printed or made by a messy process involving waxy paper, inks and jellies. In either case, the process was laborious, and in consequence writers tried to get the text right the rst time. The arrival of cheap photocopiers has dramatically altered the style of academic life. It has made it possible for the enormously increased numbers of students in the late twentieth century to read material that no university library could otherwise have made available to all of them. It has enabled scholars to circulate ideas before they have been frozen in the mind or in print, so that their peers can judge, extend or improve them. These liberating effects have to be set against the decline in the use of the library, with its vast store of uncensored thought, and a reluctance among scholars to take the time to put their thoughts into nal form. A third technology to revolutionize the university world was affordable nationwide radio and television communications to support distance learning. The idea of the University of the Air was pioneered in the UK by Harold Wilson in 1963, when the Labour Party was in opposition. The necessary legislation to create the Open University was passed in 1965, and the rst students enrolled in 1971. By 1974 there were 40,000 undergraduates and by 1991, 120,000.19 Similar ideas were introduced on the Continent: in 1974 in the Federal Republic of Germany the FernUniversitat Hagen began, attended in 1994/5 by 40,000 students;20 the Open University of the Netherlands began in 1984, and had a total of 60,000 students by 1992.21 Student pressures In the rst two decades after the war, students in science and technology accepted established curricula. During the late 1960s, however, student representatives demanded a say in the curricula and management of the
18 19 20

21

J. Jewkes, D. Sawers and R. Stillerman, The Sources of Invention (London, 1962), 408. W. A. C. Stewart, Statement, Ghent Conference (note 1). C. Boden, W. Becker and R. Klofat (eds.), Universitaten in Deutschland, Universities in Germany (Munich, 1994), 104. H. C. de Wolf, Statement, Ghent Conference (note 1). Cf. chapter 1, 19.

535

Christopher Watson universities. In relation to technology, the nub of their demands was greater relevance to the outside world (and in particular to their subsequent careers). In varying degrees, all the European universities made the changes demanded. In parallel with this movement, and to some extent inuencing it, was an upsurge of negative attitudes to technology. These rst found their focus in campaigns to abolish nuclear weapons, particularly the Campaign for Nuclear Disarmament (CND), which was founded in 1958 and enjoyed strong student support in the 1960s. Many students expressed an unwillingness to allow universities to accept funding from military sources. During the 1970s this evolved into a more general antitechnology movement. Among its inuential sources was growing concern about environmental pollution (e.g., as expressed by Friends of the Earth) and about the limits to economic growth set by nite natural resources (e.g., the publications of the Club of Rome). These concerns had an immediate impact on students of secondary school age, and in due course fed through into a decline in the number of students applying to study science and technology. In Oxford, the numbers reading chemistry began to decline in 1981, and similarly in physics from 1989 and in engineering from 1990.22 More positively, it led to a growth in the demand for courses in green subjects: ecology, alternative technology, renewable energy sources, environmental and earth sciences. The response of university teachers to these student pressures was generally positive, though the decline in student numbers in conventional science and technology has been a cause of serious concern. The general public shared the tenor of student complaints, but disliked the militancy of student politics in the 1960s and the apparent willingness of some teachers to endorse the opinions which they so forcefully expressed. During the 1970s there was a gradual decline in the level of popular support for the funding of university education generally, and, by the 1980s, an associated decline in the status of academics within the community. This affected the willingness of the gifted technology graduates to stay on within the university community after graduation. Throughout the rst two decades following the war, national governments were overwhelmingly the dominant source of funding in all but a handful of well-endowed ancient universities, but they were uncharacteristically restrained in the exercise of the power which this gave them. In the UK, this was a consequence of the arms length relationship with government which had been established in 1919 in the form of the University Grants Committee (UGC), which though appointed by the government
22

Oxford University Gazette, 6 June 1994.

536

Technology was independent of ministerial and departmental control.23 In the 1960s, government began gently to exert inuence: the Treasury-appointed Robbins Committee, while bowing graciously to the principle of academic freedom, recommended a substantial shift in the direction of more technology. By the early 1980s, Mrs Thatchers Conservative government no longer felt the need to be so discreet when it imposed a substantial cut in the UGC grant.24 Perhaps unexpectedly, the UGC distributed the cut in a manner which directly penalized technology.25 This trend towards direct government intervention developed rapidly, and by 1989 the UGC had been abolished in favour of the Universities Funding Council, a body much more concerned to see that the government obtained value for money from the funds that it allocated to the universities.26 the marketplace for knowledge and research in technology Universities exist because there is a demand for what they have to offer access to existing knowledge and to the processes which create new knowledge. They are not unique in offering to meet that demand: they exist in a marketplace dened by it, and their survival depends on their ability to adapt to the changing demands of that marketplace. The part of that market labelled technology has changed dramatically during the twentieth century, and any account of the university response has to begin with a survey of those changes. The universities have faced the rise of technology in this modern sense with a certain ambivalence conscious that they have contributed to its birth and development, but also aware that it has acquired an independent existence, and has created a set of values to which a university cannot always easily subscribe. The information explosion It is a familiar observation27 that information, however it is measured, has been growing since the seventeenth century at a fairly steady exponential rate. The numbers of books or journal articles published, the number of radio and television channels, the number of telephone calls made, all these measures tell the same story. In a sense therefore there has been nothing special about the period since 1945. However, the resources required to sustain this growth have, for the rst time in recorded history, become a signicant fraction of the national economy. Equally,
23 25 26 27 24 See chapter 1, 15. Robbins Report (note 6), para 728, 235. A. Sampson, The Changing Anatomy of Britain (London, 1982), 52. D. E. Bland, Managing Higher Education (London, 1990), 2. D. J. de Solla Price, Little Science, Big Science and Beyond (New York, 1986).

537

Christopher Watson the human resources required to access the stock of information have become inadequate. The universities have made heroic efforts to improve the means of access. The process advanced in several phases. In the 1950s and 1960s, the main repositories of information were libraries. In the older universities at least, these were broadly adequately resourced, and the emphasis was on expanding the shelving and sustaining the cataloguing of an exponentially growing number of books and journals. These publications and their readerships became progressively more specialized. The issue was crystallized in a lecture by C. P. Snow entitled The Two Cultures (1959),28 in which he lamented the disappearance of the Renaissance Man equally at home in the worlds of arts and science. How many of his arts friends, he asked, could even state the Second Law of Thermodynamics? Considerable effort was devoted to popularizing the ideas of science for the benet of the arts community and adding a cultural element to the education of scientists and engineers. The 1970s saw computerized information technology. Library catalogues were computerized, titles of journal articles and often also keywords or abstracts were transferred into computer databases which could be searched for relevant material. This approach has done much to soothe the perennial fear of the academic of missing signicant material in his/her eld; it has done nothing to stem the growth of information. Now information is often held only in computer-accessible storage, and the user consults it on a screen. Without some such development, the continuing expansion of information will certainly be stopped by the nite budgets of libraries, which already impose a severe and sometimes arbitrary restriction on the books and journals purchased. At least within a computerized IT environment, decisions about which information is preserved may be made more rationally. Big Science Many academics returning to civilian life after the Second World War had participated in a large team-research project, or knew of this style of research from the experience of others. Governments were also keenly aware of its effectiveness, and were therefore sympathetic to requests for funds to introduce it into universities. The rst examples concerned subjects that derived more or less naturally from wartime military projects. In the nuclear sphere, the scene had been set by the Manhattan Project the $2 billion29 project to construct the rst atomic bombs. That project and wartime radar work provided the model for all the Big Science
28 29

C. P. Snow, The Two Cultures and the Scientic Revolution (Cambridge, 1959). R. G. Hewlett and O. E. Anderson, The New World (University Park, Pa., 1962), 724.

538

Technology projects in the next three decades. The common themes were a hierarchical organization, with a new breed of scientist-administrator at the top (General Leslie Groves and Dr J. Robert Oppenheimer being the two role models), specialized divisions with specic responsibilities within the overall project, rigidly dened objectives with timetables, budgets and human resources, and benevolent governmental (or latterly multigovernment) sponsors, committed in advance to the whole package, and not expecting to interfere in detail in management. The Manhattan Project demonstrated that this approach could work well even before the basic science and technology were established. When there was serious doubt, several parallel approaches were initiated, with decision points along the route once their relative merits had been established. In the post-war era, the rst such projects in Europe were the creation of nuclear weapons by France and by the UK.30 In both countries, these were run concurrently with projects to create nuclear reactors capable of generating electricity for civilian purposes. The success of these projects (the UK bomb in 1952, the French bomb in 1960, the Calder Hall power station in 1956)31 conrmed the belief in government circles that this approach to science and technology should receive a large proportion of the available resources. It also ensured that the establishments created to provide the physical infrastructure for these projects (Harwell, Capenhurst and Windscale in the UK, Fontenay, Saclay and Cadarache in France) enjoyed a unique prestige, and sustained large teams of gifted scientists and engineers long after the initial project objective was achieved. Once the initial nuclear projects had reached fruition, participants in the process and others, including some in the universities who had been watching or assisting from the side, conceived a range of new big projects. These included fusion weapons, controlled fusion reactors and high energy accelerators. Initially, all these projects were pursued on a national scale. However as the size and cost of the projects rose, the pressures grew for a more integrated European approach. In relation to controlled fusion, this began under the auspices of Euratom, the organization set up by the European Community in 1957 to coordinate nuclear research. Initially this amounted to no more than the funding by the Commission of the European Communities (CEC) of selected projects at the national laboratories. However, in 1977 it was agreed to establish a rst European Community big project the Joint European Torus (JET) controlled fusion project at Culham in the UK.32 With a German
30 31

32

M. Gowing, Britain and Atomic Energy 193945 (London, 1964). M. Gowing, Independence and Deterrence: Britain and Atomic Energy 194552 (London, 1974). E. N. Shaw, Europes Experiment in Fusion: The JET Joint Undertaking (Amsterdam, 1990).

539

Christopher Watson director, a French chief engineer, an Irish administrator, and a staff drawn from all the community countries, it represented a model for Big Science collaboration, and has been a world leader in controlled fusion research, outperforming its US, Soviet and Japanese competitors. In relation to high energy accelerators, a similar cooperation was established, but in this case the key step was taken by the governments of eighteen European nations (including several not in the European Community) to set up CERN (the Conseil europ een pour la recherche nucl eaire) in 1952. The success of the rst project, the Proton Synchrotron, completed under the leadership of J. B. Adams in 1959, led to a series of more ambitious projects, including the Intersecting Storage Rings in 1971, the Super Proton Synchrotron in 1976, and the Large Electron Positron Collider an accelerator of 27 km circumference built in a tunnel under the Jura mountains near Geneva. The next step, the construction of the Large Hadron Collider in the same tunnel, which smashes together beams of protons with an energy of 14 TeV, has recently been agreed, and came into operation in 2009. Here again, European collaboration has been the key to the achievement of outstanding research including the discovery of a range of new particles.33 In aerospace, the big projects grew out of the military rocketry programmes in Germany in the Second World War directed by General Dornberger and Wernher von Braun.34 In the years immediately following the war, military and civilian projects proceeded in parallel, of rockets for delivering nuclear weapons and rockets for space research. In this sphere, Western Europe lost its pre-eminence to the US, where von Braun led a series of large projects culminating in the Saturn rocket, which launched the astronauts to the moon, and to the USSR, which sent up the rst two Sputniks in 1957.35 This unexpected achievement led to the establishment of NASA in the USA in 1958 and to a series of European initiatives to re-enter the eld. In 1962 six European countries (Belgium, France, Germany, Italy, the Netherlands and the UK) formed the European Space Vehicle Launcher Organization (ELDO) to develop major launchers, and in 1964 the same group plus Denmark, Spain, Sweden and Switzerland formed the European Space Research Organization (ESRO) to develop satellites and other space-research equipment. ELDO and ESRO had a number of successful launches, and a number of highly public failures. They merged in 1975 into the European Space Agency (ESA), which had a highly successful series of missions based on its Ariane rocket. It
33

34 35

M. Goldsmith and E. Shaw, Europes Giant Accelerator (Andover, 1977); A. Hermann, J. Krige, U. Mersits and D. Pestre, History of CERN (Amsterdam, 198790). Jewkes et al., Sources (note 18), 357. 20 Years of European Cooperation in Space, European Space Agency Report (Paris, 1984), 64.

540

Technology has carried up a number of telecommunication satellites (including ECS1 and Intelsat) and a number of scientic missions, including Giottos rendezvous with Halleys comet and the Meteosat space meteorology station. A feature of the ESA programme has been its close coordination with the US programme, using NASA launchers when a European one was not available, and collaborating on a 50:50 basis with NASA on the Spacelab mission, launched on the US shuttle in 1983, with a laboratory designed and made in Europe. Other Big Science projects in Europe concerned astronomy (the Jodrell Bank radio telescope in 195736 and the Cambridge radio telescope in 195837 , both with strong university connections), molecular biology (the European Molecular Biology Organization was set up in 1963), computing (the UK Alvey project of 1985 and the CEC-funded Esprit project of 1984 deserve special mention) and meteorology (the UK, Norwegian and German meteorological organizations have led in developing large computer models for short-term weather prediction, and a European organization established at Reading in 1973 focused on medium-term weather prediction). sources of funding and competition National and regional government In the 1940s and early 1950s the principal source of funding for university research in technology remained, as it had been before the war, a grant from the national or regional government, with little if any earmarking. Universities asserted, and were generally granted, autonomy in the allocation of government grants. During the 1960s, the grants no longer met the demands of the expanding universities, and governments began to create (or extend the role of) non-university organizations through which funds could be channelled, albeit increasingly with strings attached. In the UK, as recently as 1962 (the year in which the Robbins Committee reported) the government, acting through local government (which largely funded student fees) and the University Grants Committee, provided 88% of the external income of the British universities.38 The balance came largely in the form of research grants from the three research councils which had by then been established the Agricultural Research Council (1931), the Medical Research Council (1920) and (predominantly) the Department of Scientic and Industrial Research (1916).39 By 1987/8 (the last year before the UGC was replaced by the UFC), 68%
36 37 38

B. Lovell, Jodrell Bank (Oxford, 1968). G. P. Kuiper and B. M. Middlehurst, Telescopes (Chicago, 1969). 39 Sampson, Anatomy (note 25), 241. Robbins Report (note 6), Appendix 4, 103.

541

Christopher Watson came from the UGC and local government sources, 10% from the (by now ve) research councils, and 10% from other research sources (industry, charities etc.).40 By this date the research councils were no longer primarily concerned with funding work at universities: they had become agents in their own right, and had created major establishments in their areas of speciality. A further, and in some ways especially unwelcome, source of government funding grew up in the 1970s the military. In the immediate post-war era, the separation of the Ministry of Defence (MoD) from civilian research was for a while almost complete, owing to the perceived need for secrecy, and the secure position of the various defence establishments. Thus although military R&D accounted for some 25% of all European R&D expenditure during the period 195570 (and an even higher proportion in the UK),41 it was not a signicant contributor to university funding during this period. However, the technological demands of the cold war grew to a point where no source of technical expertise could be ignored, and the MoD began to place contracts with the universities to tackle the less sensitive work. This posed moral and practical dilemmas. The research topics were often on interesting frontiers of knowledge, the funding generous and often without onerous restrictions, but the applications were often repugnant and the security requirements on publication irksome. Perhaps for these reasons, and unlike the US, MoD funding has never been a major element in European university budgets. (It was less than 1% of Oxfords revenue in 1992.)42 Nevertheless, NATO has been a steady source of enabling funding for conferences to bring European technology experts together.43 These sources of national government funding were increasingly complemented during the 1970s and 1980s by funds from supra-national government agencies. Within Europe, interest in establishing such agencies began to develop almost immediately after the war, with initiatives such as the European Coal and Steel Community leading in 1957 to Euratom and the formation of the European Community. The role of the Commission of the European Communities (CEC) in R&D was initially that of a coordinator; however, by the 1970s the funds made available to it by the Member States had increased such that it could take signicant independent action. It did so by funding research in universities, at national government laboratories, and at its own Joint Research Centres, such as those at Ispra and Mol. By 1980 the scale of this funding had come to

40 42 43

41 Eurostat 197080. D. Hague, Beyond Universities (London, 1991). Vice-Chancellors oration, Oxford University Gazette (1992). See chapter 3, 989.

542

Technology Table 15.5 Percentage breakdown in R&D expenditure for 1983

Higher-education State/nonestablishments prot-making UK 21 France 25 Germany 40 41 52 36 Industrial research 38 23 24

rival the total R&D expenditure of a small nation. Its inuence has been felt especially in the nuclear and information technology sectors.44 In parallel with government-led activity, private industry was also increasing its R&D capability. In the years immediately following the war, many industrial R&D labs were modest outts devoted to minor product enhancements or quality assurance. The few exceptions in the chemical, pharmaceutical and electronics industries included AEG, ICI, Shell, BP, Glaxo and Philips, which had labs that matched those of university departments. During the 1970s industrial R&D grew enormously in scope and quality, and began to compete signicantly with the universities for staff and resources. Most European universities now enjoy research sponsorship from high technology industries, which ranges from the funding of chairs and lectureships, often with no overt strings attached, to specic contracts for the investigation of problems where the university has skills to offer, or even the establishment of complete departments in subjects of interest to the sponsor. An indication of the overall balance between the various sources of funding is the percentage breakdown in R&D expenditure for 1983 shown in table 15.5.45 Quasi-university institutions In every European country, a number of institutions undertake research or teaching (or both) at a level comparable with that of a university, without actually being one (or at least, without satisfying CRE criteria). In coles, the Universit France, the grandes e e de technologie de Compi` egne, and the CNRS are examples of such institutions. Collectively they now play a dominant role in the education of French technologists (especially those who reach the top) and account for a larger fraction of the R&D
44

45

For the developments between 1971 and 1995, see chapter 3, for those between 1996 and 2005, see the Epilogue. Eurostat 197585, 12.

543

Christopher Watson budget than the universities (CNRS alone spent 7.5% of the French nonmilitary R&D budget in 1985).46 In Germany, the corresponding institutions include the Max Planck Institutes and the Fraunhofer Institutes. In many Eastern European countries, the counterparts are the academy of sciences institutes and the technical institutes. In the UK, the comparable institutions are the Research Council laboratories and the colleges of advanced technology. The common feature of all these bodies is that they derive much, if not all, their funding from government sources but do not have a narrowly prescribed technical mission. The majority enjoy a prestige in the eyes of potential members related to the level of funding for research which they enjoy and the career prospects of those who pass through them. Government establishments In every European country, the war caused a step change in the number and importance of government-funded research establishments with a well-dened research mission. Although a few such centres existed before the war (e.g., the Physikalisch-Technische Reichsanstalt, the National Physical Laboratory, the Royal Aeronautical Establishment), their numbers and relative importance grew substantially in the post-war years, and (excepting the Federal Republic of Germany, as we have seen) by 1983 they had come to account for a higher proportion of R&D expenditure than the higher-education sector. In the UK, the major players included the United Kingdom Atomic Energy Authority (formed in 1954) and the research laboratories of the nationalized industries the Central Electricity Generating Board, the National Coal Board, the Gas Board, the British Transport Commission, and so on, all brought into the public sector in the late 1940s.47

successes and failures of the universities in meeting the competition We come to an assessment of the role of the European universities in the development of technology since the war. Did they educate most of the key individuals? Did they generate most of the key ideas? Did they make the important innovations and then pass them on for development? Did they play a major part in that process of exploitation? The rough answer to the rst of these questions is yes, and to all the remainder no. It appears that the European universities have played, at best, a marginal
46 47

Innovation Policy France, OECD (1986), 77. Sampson, Anatomy (note 25), 533.

544

Technology role in what has surely been one of the dening developments of the twentieth century. Many academics might think this judgment unfair. But in a complex modern world there has to be specialization, and the specialities of the universities are education and basic research. This line of defence is negated both by the way in which the universities actually behave and by the demands made of them by their paymasters, their students and society at large. No university applied science or engineering department would concede that applied (or applicable) research is outside its remit: even the core science departments would put their research funding and their ability to attract students at risk if they pursued basic research exclusively. And, certainly since 1980, society has expected that universities will operate in the marketplace for applicable ideas on broadly the same basis as other organizations private sector rms, government establishments and the like. The education and careers of technology graduates With the exception of France, where the dominating position of the coles creates a special situation, almost all the key men had unigrandes e versity degrees, and indeed a very high proportion also had PhDs or equivalent. (A rare exception was J. B. Adams, director of the Culham Fusion Laboratory in the UK and director of CERN from 1969 to 1980, who achieved these positions without any degree qualication.) This training has had important consequences for the style of R&D even in government establishments and private sector laboratories their senior management have generally retained a nostalgic affection for the lifestyle of the academic researcher, and have sometimes sought to reproduce it (at least in part) in a non-university setting. It also meant that these managers knew, and could protect against, the limitations of the university style. It is also true that most of the key individuals received their entire university education within Europe; problems in the timings of the different phases of higher education in Europe and elsewhere made it difcult to pick and mix. However, many of them did postdoctoral research in the USA or elsewhere. Thus although Europe has retained its own distinctive technological culture, it has been strongly cross-fertilized from the USA and (more recently) other parts of the academic world. At levels below the top echelons, university technology graduates also have had excellent career prospects throughout almost all the period under review. However, the pattern of their employment has shifted considerably. Until the late 1960s, many who had the necessary high qualications to stay on in the university on graduation (or even on completion of a further degree) generally did so: a university research/teaching 545

Christopher Watson post was a prestigious and relatively well-paid job with tenure for life, and offered considerable personal freedom to choose the mix of research and teaching and the area of research. During this period the strongest pressure experienced by the gifted technologically inclined graduate was whether to work in the USA, where salaries and research resources were better than at home. However, during the late 1960s, 1970s and 1980s, the salaries and prestige of posts in the production and service industries moved ahead of those in education, research and other government service. This did not prevent academic technologists from playing a useful role in society. Indeed, as they have stepped down from their pedestals, they have come to be valued as a source of independent, commercially unprejudiced expertise. They appear as chairs of committees of enquiry into technical disasters, as the articulators of informed protest against commercially motivated abuses of individuals and the environment, as the defenders of the long-term view against short-term benets. The connection between the universities and the green trend in politics has strengthened and played a part in the striking decline in the popularity of technology among the younger generation. This did not stop the rise of technology graduates to the upper reaches of the new high-technology commercial world. On the contrary, in the 1980s and 1990s, as in previous decades, members of the boards of the advanced companies continued to include a good proportion of technology graduates. However, the proportion of accountants grew at their expense, and ambitious graduates began to take the point that the route to the top in the commercial world might pass through the marketing and sales department, rather than the research department. Technology involves the embodiment of ideas in hardware or in an activity or process, and it is not easy to identify unambiguously the point at which the idea has taken off, or the stage in the development process which really generated the added value. Take nuclear energy for example. The idea of nuclear ssion was rst published by Ida Noddack in 1934 and the theoretical possibility of a nuclear chain reaction was described by Houtermans, Szilard and Joliot-Curie at about the same time. The rst experimental evidence for nuclear ssion was obtained by Houtermans, Szilard and Joliot-Curie, and Hahn and Strassman in 1938, and for a chain reaction by Joliot, Halban and Kowarski in 1939.48 The steps which converted all this academic work into the basis for a new technology were the proposal by Peierls and Frisch in 1940 of a scheme for separating uranium isotopes, and the ideas of Fermi (1939) and Weizsacker (1939)

48

R. Jungk, Brighter than a Thousand Suns (Harmondsworth, 1960).

546

Technology on the construction of a pile capable of manufacturing plutonium.49 Almost every one of these individuals worked in a university. But their ideas might never have taken off without the wartime imperative that used them to found a huge industry. This sequence of events beginning with pure research in a university setting and ending in a successful industry continued to be the paradigm of planners. During the 1960s, this trickle-down theory came into question. Was it true that the best research ideas were generated by academics who did not feel a strong commitment to the subsequent exploitation of those ideas? The dramatic growth in the government establishment and private-sector laboratories during this period suggested not. From them had come a steady ow of ideas that any university might have been proud to produce. The university response to this challenge took several forms. At the level of the individual, a system of consultancies grew up in which academics could offer some of the time they did not devote to teaching to government or industry for a fee. The motivation mixed self-interest with an idealistic concern to make the skills of the universities available for the benet of the national defence or economy. Initially, universities regulated this activity lightly. During the 1970s, however, they moved to protect their interest in the intellectual property generated by their staffs, taking out patents in the name of the university and using public agencies, such as the (UK) National Research Development Corporation, to help bring their ideas to the marketplace. A second development in relations with industry was the formation of links at the departmental level: industries were encouraged to fund the establishment of posts, chairs or even whole departments, in areas of mutual interest. Examples of this were the links of Manchester University with ICI and Metropolitan-Vickers dating back to the 1940s.50 In a few cases, a third, much more ambitious approach was taken at the university level the establishment of a science park, a commercial enterprise adjacent to the university, with a signicant university investment, either in the form of buildings or equipment, or through the secondment of senior staff. Early examples in the UK were the science parks established at Cambridge and at Heriot-Watt University in Edinburgh. Nonetheless, European universities did not invent the technologies which have had a major impact on the post-war world. They can claim credit for some part in the invention of the jet engine, radar, rocket propulsion, nuclear energy, wind energy, polythene, Perspex, synthetic detergents, integrated circuits, valve-based computers, robots, particle accelerators, space exploration and radio astronomy. But this list is rather
49 50

Gowing, Atomic Energy (note 30). Barnes, Statement, Ghent Conference (note 1).

547

Christopher Watson unimpressive when set against the achievements of the non-university organizations. The role of universities in the development of innovative ideas to the point of commercial exploitation has been still more modest. However, for the most part the role of the universities in this phase has been to solve minor problems to which the need for a solution was not urgent, so that the contract duration could be aligned with the three-year life-cycle of the typical graduate student. These contracts are important to the balance sheet of some universities, and usually marginal to that of the funding organization. In sum, in the area of top-level technological education, universities have retained a commanding position, with signicant competition only coles in France and the technical institutes in Eastern from the grandes e Europe. In basic or blue skies research they have maintained a strong but by no means dominant position. And in applied research and development the government establishments and private sector R&D organizations have become the leaders while the universities have had to withdraw to a few niche markets. Why did this happen, and could the outcome have been different? Clues to the answer to this question come from comparisons with the USA, where the universities have been signicantly more successful both in fathering inventions and in nurturing them up to the point of exploitation. Many more American than European academics leave the university laboratory to set up a small rm which goes on to success. Their science parks are more extensive and more signicant in the technology of the country. And they derive a much larger fraction of their funding from industrially sponsored R&D. Europe has been slower to go down this path in part because of an anti-commercial culture within the universities themselves. In part it is due to the legislative framework, which in many countries still inhibits universities from exploiting their intellectual property commercially. In some measure it is owing to the organizational structures within the universities, in which individual freedom is given primacy over collective action, which inhibits promising starts from reaching critical mass. But in large measure, it is surely due to the success of technology itself, which has grown to the point that no one social institution can expect to dominate it.

select bibliography
Barblan, A., and Sadlak, J. Higher Education in OECD Countries: Patterns and Trends in the 1980s, CRE Standing Conference, April 1988. Bland, D. E. Managing Higher Education, London, 1990. Carson, R. Silent Spring, Boston, 1962. Croarken, M. Early Scientic Computing in Britain, Oxford, 1990.

548

Technology
de Solla Price, D. J. Little Science, Big Science and Beyond, New York, 1986. Forrester, T. (ed.) The Microelectronics Revolution, Oxford, 1980. Goldsmith, M., and Shaw, E. Europes Giant Accelerator, Andover, 1977. Gowing, M. Britain and Atomic Energy 193945, London, 1964. Gowing, M. Independence and Deterrence: Britain and Atomic Energy 194552, London, 1974. Hague, D. Beyond Universities, London, 1991. Hermann, A., Krige, J., Mersits, U., and Pestre, D. History of CERN, 2 vols., Amsterdam, 198790. Hewlett, R. G., and Anderson, O. E. The New World, University Park, Pa., 1962. Jewkes, J., Sawers, D., and Stillerman, R. The Sources of Invention, London, 1962. Jungk, R. Brighter than a Thousand Suns, Harmondsworth, 1960. Krige, J. (ed.) History of CERN, Vol. III, Amsterdam, 1996. Krige, J., and Russo, A. Europe in Space, 19601973, Noordwijk, 1995. Kuiper, G. P., and Middlehurst, B. M. Telescopes, Chicago, 1969. Lavington, S. Early British Computers, Manchester, 1980. Lovell, B. Jodrell Bank, Oxford, 1968. Metropolis, N., Howlett, J., and Rota, G. C. (eds.) A History of Computing in the 20th Century, New York, 1980. Sampson, A. The Changing Anatomy of Britain, London, 1982. Shaw, E. N. Europes Experiment in Fusion: The JET Joint Undertaking, Amsterdam, 1990. Snow, C. P. The Two Cultures and the Scientic Revolution, Cambridge, 1959. Williams, T. I. (ed.) A History of Technology, Vol. VI: The Twentieth Century, 2 vols., Oxford, 1978. Wolovich, W. A. Robotics: Basic Analysis and Design, New York and London, 1986.

549

EPILOGUE

FROM THE UNIVERSITY IN EUROPE TO THE UNIVERSITIES OF EUROPE

ANDRIS BARBLAN

the origins of the project The History of the University in Europe was rst conceived in 1979, when, as secretary general of the CRE, the European rectors conference that has brought together European university leaders since 1955, I was preparing a meeting in Galway on the regional role of higher education. I was fascinated by the early history of the colleges set up in Ireland in the 1840s, following the terrible potato blight, to address the urgent social and economic needs of a population decimated by famine and emigration. They seemed to foreshadow the land-grant colleges of the USA, but their role soon changed when Cardinal Newman reformed them to implement his vision of an education-centred institution of higher learning. This pragmatic vision was quite different from the Humboldtian model of the German university that was spreading across much of Europe in the nineteenth century. The issue at play reminded me of those taken up at CRE meetings, when the role of the university was discussed in terms of social service, research innovation and educational renewal. Could there not be something to learn from an analysis of the past, especially at a time when, with the growing differentiation of institutions, many universities were going through some kind of identity crisis? In Manila at the end of August 1980, during the seventh general conference of the International Association of Universities, I had a fascinating conversation with Asa Briggs, the modern historian and former vicechancellor of the University of Sussex. In the air-conditioned humidity of a tropical night, we agreed that a history of the university in Europe, written from the perspective of its contribution to social development, would offer new insights to academics willing to explore the underlying forces shaping their own activities. It would try to identify similarities in 550

From the university in Europe to the universities of Europe the behaviour of academics and universities over time, and to ascertain whether the behaviour had led to parallel social development in Europe. A history along these lines would be especially valuable at a time of tension between the Eastern and Western parts of the Continent, following the failed attempt in 1975 to transform the CRE into an Association of European Universities, a pan-European organization for intellectual cooperation. Out of that seminal discussion in the Philippines, and following the later advice of several historians and sociologists of education, the board of the CRE set up in 1981 an international consortium of researchers. With the help of Guy Neave, the historian of higher education, who acted as group facilitator, the consortium decided to embark on an interdisciplinary inquiry into the current situation of academia and its historical and social context. The CRE member universities gave their support to this venture, by appointing experts who agreed to participate as National Correspondents with information on national specicities. In March 1983, the common inquiry resulted in a meeting, held in Berne, Switzerland, where leading historians and sociologists of European universities discussed the feasibility of the CRE project and came to a positive result. In September 1983, the board of the CRE appointed an editorial board, responsible for executing and publishing the CRE project under the leadership of Walter Ruegg, professor of sociology at the University of Berne and a former rector of Frankfurt University. In 1984, to mark its twenty-fth anniversary, the CRE presented its members with a brief chronology of all the universities in Europe, past and present. This 350-page book, entitled a Historical Compendium of European Universities,1 was the preliminary stage of the much more ambitious History of the University in Europe, a four-volume work depicting the development of the university in European society during the late Middle Ages, the Early Modern period (up to the French Revolution), the age of industrialization and colonialism (up to the Second World War), and the post-war years. An editorial board headed by Walter Ruegg included historians and sociologists of universities from different parts of Europe as experts in their respective elds: Asa Briggs (Oxford), Hilde de RidderSymoens (Ghent), Aleksander Gieysztor (Warsaw), Notker Hammerstein (Frankfurt am Main), Olaf Pedersen (Aarhus), John Roberts (Oxford), Edward Shils (Cambridge) and Jacques Verger (Paris). Their task was to identify specialists for each of these historical periods and to edit and coordinate the contributions of the different authors. They had the responsibility of highlighting the current state of historical research on higher education, the gaps to be explored, and debates about questions
1

J lek, Historical Compendium.

551

Andris Barblan of special interest. Because many aspects of the university in society have been neglected, the project was set up to encourage original approaches and comparisons that delayed its completion. Although many of the chapters were written in other languages, the editors did their work on the English version. Overall, however, the work can claim the success of wide international interest, since it has been translated into Chinese, German, Portuguese, Russian and Spanish. the lessons of history Apart from operational questions, intellectual concerns added to the difculties of the project. Was it possible to commission a study that could furnish the institutions under scrutiny (and their members) with explanations, references and inspiration about their situation, both yesterday and today? What is objectivity when the subject matter encompasses nearly a thousand years of intellectual and institutional development? To counter doubts of this kind, all four volumes were thematically structured in the same way and, for each of them, a set of questions was presented to each author based on common guidelines for all four volumes. This approach also facilitated comparisons from one country to another and from one century to another. The canvas helped the editors to locate areas needing further research, while stepping back from the historical narrative. It also showed that European perspectives are rare, as most authors are accustomed to working in a specic language area or cultural context. This led to the creation of a network of national correspondents who were invited to comment on the authors contributions and to suggest changes that would reect their own countrys concerns. Subjectivity is an inherent part of an ambitious project of this nature. For instance, when the period to be covered by each volume was debated, the presuppositions of each partner predominated. When do the Middle Ages end? Are the Renaissance and humanism a terminus ad quem or the beginning of a new intellectual era? What is the Early Modern period and why should it end with the French Revolution? When does the nineteenth century begin or end as a historically meaningful period? Each school of thought came up with different answers reecting different conceptions of what history is and does. The solution was to divide the four volumes of the history according to major established social/cultural cleavages. Despite the fact that the various parts of the Continent did not experience humanism, nationalism or the industrial revolution at the same time, all of these were developments that the university both shaped and adapted to, and they can therefore serve as period limits for all. The fourth volume was planned to cover the period from 1945 to 1990, because that year promised the best opportunities for statistical 552

From the university in Europe to the universities of Europe comparisons; it could not be foreseen that in 1989 the fall of the Berlin Wall would have proved more of a historical landmark. The year 1992, with the Single European Act, could be considered almost as important, marking as it did the transformation of the European Community into a Union. Eventually, the end date of volume IV became 1995. Rather than choosing a xed date, however, this epilogue focuses on the last years of the twentieth century, in so far as they heralded potential changes in the academic world of the early twenty-rst century. I will refer to events of the last two decades when they document changes of perspective supporting my basic hypothesis: that national universities in Europe are slowly turning into European universities. european images of the university European academic institutions have recourse to narratives to express their identity. These narratives can be tools for action or grounds for resistance to change, depending on whether a situation is perceived as an opportunity or a possible threat. Humboldt, Newman and Jaspers are the usual references for institutional self-portraits; to a lesser degree, academics also refer to the students university of Bologna or to the teachers institution of Paris. They rarely claim a Napoleonic heritage. The Bologna model in which the students hired the professors and managed the institution serves academics who stress the role of demand and the importance of social relevance in the development of higher education. It reinforces proposals such as student vouchers that allow the clients to vote with their feet; that is what the universitas bononiensis did when the institution left for Reggio Emilia to protest against the city fathers who opposed student demands and behaviour. The Paris model encourages professorial emphasis on quality and gives precedence to the needs of the supply side in the teaching process, while controlling standards by a community of scientic peers. Both these models of academic corporations, as discussed in the rst volume of this History, had as their social role the training of clerics, physicians and lawyers the professions that catered for individuals well-being in medieval society. The modern university still serves the professions. The second volume continues with the history of universities and adds that of higher training facilities set up to full practical needs in shipbuilding, civil and military engineering, and mining. Usually, these institutions aimed at instilling a high level of competence that gave their members a sense of participation in promoting national prestige, and often comfortable material rewards as well. Their development was systematized by Napoleon and the imperial university, a centralized education system with branches over much of the continent. Together with 553

Andris Barblan coles, the elite technical schools, the Napoleonic university the grandes e enforced the idea that academic professions in the French Empire were state services. In the nineteenth century, as explained in the third volume, many of those establishments and the schools of engineering in particular prospered, and recently many of them have become uni coles remain independent versities. But not all: in France the grandes e to this day, and most of them are funded by ministries other than the Ministry of Education. The same is true for Russia. However, practical training provided within an academic context has been incorporated as an increasingly important function of the modern university. The third volume also considers the Humboldtian model, which gives academia a leading role in the development of science (in the broad sense of Wissenschaft) as part of the development of the people. John Henry Newman, the future cardinal, stressed the latter concept in his Idea of the University a book published in 1852, one year after he had accepted the rectorship of the proposed national Catholic university in Ireland. Though often found wanting and unrealistic, the Humboldtian model remains a key reference in todays Europe for those who believe the link between research and teaching to be a fundamental feature of true academic identity. The emphasis placed by Newman on education and scholarship as a means of preparing good citizens has found new academic acceptance, as mass higher education characterized by the declining funding of universities as centres of scientic innovation has spread. The fourth volume shows that these various narratives have conicted, converged or combined in the self-dening effort of institutions of higher education after 1945, when the American model also became a reference point; as a result, the term university today covers many different realities. The documents of the European Union, such as the Decision of the Parliament and Council of 24 January 2000 establishing the second phase of the Socrates programme, state that the term university means any type of higher-education institution, according to national legislation or practice, which offers qualications or diplomas at that level, whatever such establishment may be called in the Member states. In practical terms, the university sector according to Brussels seems to be the equivalent of tertiary education, namely, a very diversied supply of services including every possible form of post-secondary training. This is not necessarily the image that insiders would like to have of their institution. For most of them, todays university balances between the poles of modernity and tradition. Propelled forward by this tension, it fulls three roles in society as creator, curator and critic of knowledge. In doing so, it can aim either for social reproduction that is, the use of knowledge and people for the survival of communities as they are and should be or for the cultivation of heterodoxy, which is the exploration 554

From the university in Europe to the universities of Europe of the unknown through questioning of accepted truths. To take one image, the university is an institution for consent and dissent, for shortterm ambitions and long-term expectations, for Creons who implement social order and Antigones who claim obedience to higher values of truth. Inner tension is thus a constitutive component of academic identity. Some institutions place more emphasis on their integrative role, others on their innovative function. Or the same institution might incline towards integration at one moment and towards innovation at another. Moreover, both roles can be pursued simultaneously in different parts of the university. The mix is so varied that academics of different persuasions often do not feel that they belong to the same institution; and this fragmentation has been reinforced by the many functions that society has required of the university since 1945. With the tremendous increase in numbers of students, staff and institutions, an increase so large that, in several countries, more than half the age cohort now enjoys some form of higher education, the university has gone through an important democratization process; consequently, it has lost the prestige of distance and secrecy. In many regions of Europe, the university is often perceived as being yet another training centre, a quality school intended for the local community, its employers and businesses, whether public or private. This role has been strengthened by the need for lifelong learning: the return to academia of a growing number of adult students has made the university experience for many people something other than a place of passage between adolescence and adulthood. When so large a sector of the population attends university, the institution can no longer satisfy all the expectations of social mobility that prevailed in earlier years. It has nevertheless retained a high social prole when viewed as a stepping-stone towards the knowledge society of the future, which will require for most occupations a higher level of literacy and skill than in the past. These transformations have been documented in the preceding chapters. Where will they lead us in the twenty-rst century, and how have they affected the recent past of the European university?

the premises of europeanization in higher education In 1985, Jacques Delors, as president of the Commission, proposed the Single Act that would turn the European Community into a European Union by 1992. In 1986, Spain and Portugal joined the Community, bringing its membership to twelve. As far as the universities were concerned, these two years (19856) were dominated by debate over the 555

Andris Barblan transformation of the Joint Study Programme2 which had been a success but in a rather limited way into the Erasmus programme, proposed to encourage multilateral collaboration in the teaching programmes of the universities in the Community. In 1986, the universities had had to pressure the European authorities to launch this programme of academic mobility and to by-pass last minute objections by some Member States unwilling to internationalize their higher education. Erasmus was considered a unique opportunity to offer some European experience to help young people discover the shared attributes and differences of their respective cultures. Erasmus was preceded by a few months by Comett, an exchange programme between higher education and industry. These programmes were designed not only to encourage comparisons between institutions and national systems of higher education, but also to consider the compatibility of curricula, the equivalence of studies, the importance of common norms, and the need for a shared evaluation of university activities. Thanks to them, Europeanization became a phase of academic internationalization, even though it was restricted to the twelve countries of the Community. Meanwhile, in the Eastern part of the Continent, Mikhail Gorbachev was launching the perestroika that would lead to a complete change of structures in the communist countries of Europe. As a result, the Soviet Union reappraised the modalities of cooperation in higher education. In February 1987, a conference of universities from Comecon countries held in Moscow decided to extend the possibilities for institutional cooperation between Eastern and Western universities. The rectors of the universities in capital cities in the East asked their Polish colleagues who had always maintained links with other European universities through the CRE to organize a meeting with Western colleagues on the model of the CRE bi-annual conferences.3 Grzegorz Biakowski, rector of the
2

In the Joint Study Programme (JSP), begun in 1976, the Commission moved away from traditional student exchange by offering a structured learning experience that could be used in different Member States as a constituent part of academic training. Joint underlined the need for and the implementation of common practice freely decided by the teaching departments of the universities taking part. JSPs were the testing ground for convergence procedures that were to become typical of academic integration in Europe. In 2002, the joint degrees project entrusted by the Commission to the European University Association, the organization that succeeded CRE after March 2001, encouraged the same dynamics of change: to progress from simple programme elements (JSP-style) to full curricular integration, which was to be the common responsibility of several institutions in different countries. On the early history of CRE see chapter 3, 94 and 1001. CRE was created in 1959 in Dijon, France, after a meeting of European university leaders organized in 1955 in Cambridge under the presidency of the Duke of Edinburgh. It was incorporated into Swiss law in 1964 at its third General Assembly in Gottingen when it was also decided to locate the organization in Geneva. From 1969, CRE developed for its members a regular series of half-yearly conferences to discuss aspects of academic management and university development.

556

From the university in Europe to the universities of Europe University of Warsaw, hosted a conference in June 1988 on The University as a Crucible of European Culture. The more than ninety participants thirty-ve of whom represented universities from every socialist country, except for Albania and Romania insisted on academic cooperation as a necessity. At the same time, the origins of the university as a European institution were being commemorated in Italy on the occasion of the nine hundredth anniversary of the University of Bologna, the alma mater of all European academic institutions. The festivities lasted a full year and culminated on 18 September 1988 on the Piazza Maggiore in a festive act involving some 430 university rectors, two-thirds from Europe, both West and East, and one-third from other parts of the world. They all signed the Magna Charta Universitatum, a document outlining the principles of academic integrity for the future. The text had been drafted over the preceding months by a small party of academic leaders brought together by the rector of the University of Bologna, Fabio Roversi-Monaco, under the chairmanship of the CRE president, Carmine Romanzi. Traditional partners of academia witnessed this symbolic assertion of institutional autonomy and academic freedom and of the universities concomitant social responsibilities. The president of the Italian Republic attended, as did several ministers and a host of ambassadors, church prelates and municipal leaders. Following the lead of Giosu e Carducci, the poet and professor of Italian literature who had masterminded the eighth-centenary celebrations of the University of Bologna in 1888 around the role of universities as the common institution of Italian unity, the universities were recognized in 1988 as institutions common to all countries in the region, perhaps even as the crucible of Europe in the making. That is why, during the centennial year, the university granted honorary doctorates not only to famous scientists, but also to political gureheads of the continent from Pope John Paul II to Mikhail Gorbachev, from Franc ois Mitterrand to the king of Spain. The idea of the rector and his adviser, Giuseppe Caputo, was to reafrm the political function of the university in the development of society; the leaders of the various governments invited throughout the year to Bologna were thus expected to acknowledge the critical role of academia in shaping the ideas that would lead to the integration of the different cultures of the continent into one harmonious, European whole. lowering the iron curtain: 1989 and beyond To some extent, all these moves and conferences the CRE had also welcomed some twenty-ve new members from Bulgaria, Czechoslovakia, Hungary and the Soviet Union willing to renew pan-European cooperation at its Durham Assembly in September 1989 had been portents of 557

Andris Barblan the big changes occurring two months later, in November 1989, when, with the fall of the Berlin Wall, the iron curtain that had divided Europe since the war disappeared. The polarization of European politics suddenly vanished (in a rather unexpected manner for most European citizens), sweeping away more than forty years of intellectual habits, political reexes and cultural prejudices based on mutual fear of the other side. Greater Europe was becoming a possibility, but turning it into reality proved to be a monumental task, given the scope of the transformation opening the way to regional differentiation, ethnic divisions, and the activation of long-repressed group identities. The unication of Germany, involving a realignment of the countrys Eastern provinces according to the rules and organizational patterns of the Western Lander , led to changes in personnel and structures in the universities of the former German Democratic Republic, many of whose new leaders were academics from the Federal Republic. Important public investments made this transformation possible, so much money indeed that learning conditions sometimes became more attractive in the Eastern than the Western part of the country. Thus, Germany braced itself for a new role, becoming the axis of regional cooperation in Europe rather than a player on the sidelines. With the end of Soviet inuence, loyalties shifted, and, at a time of opening frontiers, Europe fragmented into ever smaller pieces rather than uniting. Because of the cost of the economic and social transformation of the East, as demonstrated by the German case, solidarity was fast vanishing as an accepted political mode, and the easy solution seemed to lie in laissez-faire. In a few years, Europe moved from grand ideals to uncertainty, revealing a world without common reference points and a society of interest groups at each others throats. During the period of bipolar politics, from 1948 to 1989, Yugoslavia developed a mediating role that allowed both sides to meet in Belgrade, Zagreb or on the Adriatic coast. The yearly seminar, Univerzitet Danas, organized in Dubrovnik by the University of Belgrade and the League of Yugoslav Universities beginning in the sixties, offered a neutral ground for EastWest academic relations and facilitated multilateral academic cooperation. This important international role was recognized in 1971 by the establishment of the Inter-University Centre, also in Dubrovnik. With the fall of the iron curtain, however, Yugoslavia lost this special role and, in 1991, the Yugoslav Federation fell to pieces. Slovenia and Croatia were the rst to afrm their independence and cultural differences. The war then spread to Bosnia in 1992, as Serbia tried to maintain its earlier ascendancy over the region. The universities, as centres of culture, became prime targets for ethnic cleansing: academic centres in Osijek, Sarajevo and Dubrovnik, for instance, were shelled and burned. 558

From the university in Europe to the universities of Europe In Kosovo, a former autonomous province of Serbia, the Belgrade government dismissed the majority of Albanian-speaking lecturers during the summer term of 1991, and, in October, it effectively closed the University of Pristina to Albanian-speaking students. This led, in November, to the creation of a parallel structure, the unofcial Albanian-speaking University of Pristina, which would function semi-clandestinely over the next eight years. Another unrecognized Albanian-speaking academic institution appeared in Tetovo, in Macedonia, a province whose secession from Yugoslavia in 1991 was recognized internationally only in 1993. In 1998, the Milo sevi c government in Belgrade passed a law that suppressed the institutional autonomy of the Serbian universities; henceforth, the ministry directly appointed the rectors and other key staff. This led to resignations of professors and strikes by students; many of them decided to organize an alternative academic education network (AAEN) to uphold the traditional academic values of tolerance and critical awareness. A few months later, in 1999, NATO strikes on Yugoslavia resulted in the UNs taking over the administration of Kosovo; in Belgrade, the fall of the Milo sevi c government in 2000 brought AAEN members to leadership in the reconstruction of the university system in Serbia. The European academic community as represented by the CRE in particular had been very much concerned by the deteriorating university situation in the area. As early as 1990 it had sponsored an Academic Taskforce (ATF) to intervene in the Balkans. With nancial support from Austria, Germany, Sweden and Switzerland in particular, but also from individual universities, the ATF helped oppressed academics in the former Yugoslavia to maintain their international links. An example of this support was CREs decision in 1998 to suspend the membership of Serbian universities in order to limit access of the newly appointed regime rectors to the European academic community. However, in conjunction with the Council of Europe, the UN Mission in Kosovo, and the European Union, the CRE organized meetings, summer schools and international audits to contribute to the educational and management renewal of the academic community of the region. The European Community reacted quickly to the new situation. Already in 1989 it had decided to set up the Tempus programme that would contribute to the restructuring of higher education in the former socialist countries. Initially conceived for Poland, Hungary and Czechoslovakia, the programme soon embraced most of the other Central and Eastern European nations, helping university departments to acquire modern equipment as well as new connections with colleagues from the European Union. The Union became the major political focus for reform and transformation. Its inuence increased still further when, in 1995, Austria, Finland and Sweden countries close to the old post-war 559

Andris Barblan divide joined it. EU universities in the 1990s were absorbed by the growing scale of student exchange, embodied by the success of Erasmus, the agship programme of European cooperation, which, since its inception in 1987, had involved thousands of participants. The success of this programme depended on the commitment of professors ready to compare their courses with those taught by colleagues in other countries, and to adapt their teaching so that home and guest students could develop a set of common values; in practice, these values were translated into the European Credit Transfer System (ECTS). Universities in the former communist countries considered that belonging to Erasmus was proof of European identity. In the late 1990s, Central and Eastern nations asked to move from the Tempus programme seen as a kind of European antechamber to Erasmus, even at the cost of less favourable nancial conditions. For those countries, Euro-compatibility had become a greater force for university reform than in the countries of the Union, where the European dimension was only too often a marginal aspect of academic mobility. All this would change at the end of the decade with the Sorbonne and Bologna Declarations.4 Earlier, associative activities bringing together institutions from both sides of the old iron curtain had nonetheless ourished, as in the case of the Conference of Baltic University Rectors, founded in Gdansk in 1990 on the model of the Conference of Danubian Rectors that had existed since 1983. Others followed, linking institutions from Eastern and Western traditions: Alps-Adria, Amos (in the south-east of Europe) and the Black Sea universities are examples. With the demise of communism, Russia was also obliged to redene its position. It rst looked to US higher education as a benchmark for academic quality and a tool for innovation especially for those disciplines that previously had been taught along Marxist lines. In most former socialist countries, American institutions, whether universities, foundations or governmental agencies, developed important programmes to encourage change in the area after 1989, from the creation of private universities in individual countries to the setting up of the Central European University (CEU). First based in Prague, then in Budapest, the CEU used funds from the Soros Foundation (OSI) to offer graduate training to rstclass students recruited from all over the region, including Russia. The teaching of English was a key innovation in countries that had not been accustomed to cultivating it as a lingua franca for world communication. From 1995 on, the Salzburg Seminar, a US-backed institution for intellectual cooperation set up in Austria after the Second World War, involved European as well as American academic leaders in a broad programme of
4

See below, 56772, for the analysis of these two governmental declarations of 1998 and 1999 that asked for the transformation of European higher education into a harmonious system of knowledge exploration and dissemination.

560

From the university in Europe to the universities of Europe collaboration in university management for Central and Eastern Europe, including Russia after 1998. As for European initiatives, in 1991 the CRE had organized a meeting in what was then still Leningrad to discuss strategies for achieving quality in higher education. In a follow-up in February 1993, the CRE together with the University of St Petersburg convened a seminar for those CIS5 political and academic leaders interested in the extension of the Tempus programme to the Republics of the former Soviet Union (the future Tempus-Tacis programme). Various activities thus developed over the years, often with the support of the Union or of individual EU member countries like Germany, the Netherlands, Finland or Sweden. In general, however, the universities of Russia, hindered by a difcult nancial situation that provoked a considerable brain drain of both staff and students, did not play an important part in the development of a European academic community in the 1990s.

the main issues of the 1990s: quality and mobility As a network of knowledge institutions, universities are centres of social integration, forums for showing that cooperation is not only desirable but also possible in a European continent where work and life conditions are still very dissimilar. Mobility and quality are two areas with strong potential for overcoming structural differences, and they were both frequently discussed throughout the 1990s. It was a question of identity: as the founders of the European movement had claimed during and after the Second World War, the integration of the region would only become a reality if people, goods and capital were all mobile and comparable with each other. Rather than being forced into the same mould for the sake of compatibility, products, producers, nations and governments (as well as universities) would need to recognize their common features and use them as the basis for convergence policies that could be translated into commonly accepted rules. Such was the incremental strategy developed by the European Union. It often proved to be slow and cumbersome, since it required consensus or at least agreement of the majority of the people and countries concerned. A shared understanding of concepts that had evolved differently over the years in different parts of the region imposed a comparative approach or quality framework dening common procedures, modalities and standards. In this way it was hoped that there would be less waste of human and national experience, and that the work and intellectual capacity of citizens in one part of the continent might dovetail with the know-how and knowledge in another. The resulting
5

CIS: Commonwealth of Independent States (i.e., the countries of the former Soviet Union, excluding the Baltic states).

561

Andris Barblan shared language about quality would facilitate the mobility of people and ideas. Such a sentiment prevailed in an academic community that had always claimed that its activities were intrinsically international even if higher education in the everyday experience of teachers and students seemed primarily inuenced by national interests, especially in the new states emerging from the communist breakdown. Their renewed sense of national identity clashed with the urge for a greater commitment to their European allegiance. After forty years of internationalism, the intellectual elites of Central and Eastern Europe needed some grounding in the national past denied to them even if this proved to be somewhat mythical before they could consider their cultural specicity in relation to a wider European community. Taken alone, the quality debate (i.e., the search for shared norms) seemed very idealistic, if not purely ideological. However, linked to mobility problems it came down to earth: how does the others experience echo my own and, if so, is it possible to join in common ventures, either here, there or in other parts of Europe? The practicality and feasibility of common standards adapted to common needs proved much easier to develop in the production of goods than that of services, such as higher education, even if, in theory, academia everywhere dedicated itself to the same search for truth. Some argued that academic activities have an intrinsic value that reects the dynamics of a discipline, with each eld developing over the years criteria of excellence that are recognized as quality pointers by the scientists involved. Others had a more process-oriented approach: once an institution sets itself goals, be they scientic, social or political, quality consists in achieving them as efciently and effectively as possible. Still others took a practical view and asked if the outcome of academic activities served society as expected. In the 1980s, the French, the Dutch and the English all tried out evaluation procedures and developed very different institutional structures combining the three approaches just mentioned. In the 1990s, the debate was enlarged by the European Commission to include all the countries of the European Union while, in the East, the reshufing of university systems induced governments to ask whether the institutions could operate at an advanced academic level particularly where there was a need to accredit the many new private institutions set up to meet the growing demand for higher education that traditional providers were unable to full. To foster cooperation in the eld of quality, in the spring of 1991 the CRE organized the previously mentioned Leningrad conference on managing quality in higher education. It was followed by an autumn meeting in Utrecht, where the Dutch experience of universitydriven quality assessment encouraged CRE members to consider a programme to analyse the quality strategies of academic institutions; the 562

From the university in Europe to the universities of Europe programme was to be run by the Association of European Universities on behalf of its members, both East and West, and would help to develop their capacity to face current quality challenges. Between 1995 and 2003, more than 100 universities in some thirty-ve countries agreed to expose their activities and management processes to the criticism and advice of experienced colleagues from other European countries. This gave rise to the development of a common language, shared concepts and a set of references that reected the needs of academic transformation all over Europe. In 1991, the European Commission broached the question of quality in its Memorandum on European Higher Education. At the same time, its members were experimenting with procedures for the assessment of higher education that focused mainly on the relevance, cost and efciency of academic programmes rather than on institutional tness for teaching and research. The emphasis placed on programmes reected the need for social accountability, whereas the stress on quality management usually upheld the internal capacity for change of institutions confronted with a great variety of obligations. Although concepts and modalities of evaluation were being tested in most countries of the region, often in very similar ways, the claim to national specicity remained so strong that governments and their quality agencies would agree to meet and exchange information on their national practices, but refused to embrace common approaches and joint standards. On the basis of a study on quality management delegated in 1993 to the Confederation of EU Rectors Conferences, the Commission launched a number of pilot projects in 1994. This led the fteen States of the Union to recommend in 1998 that the comparison of national practices be institutionalized. Governments nonetheless refused to recognize common standards. There were two main reasons: rstly, the fear of European centralization and of a sprawling bureaucracy that could reduce the role of national governments in establishing university programmes and developing academic training; secondly, the growing autonomy of institutions of higher education granted usually not for ideological but rather for nancial reasons, owing to the growing costs of an expanding system of higher education and research. With this autonomy, they could look widely for external support. The resultant change in orientation and conception of students and funders as customers inspired a very inuential book by an American specialist of higher education, Burton Clark, who studied the development of ve entrepreneurial universities across Europe.6 In many countries, ministries were unwilling to continue to oversee detailed academic operations, and in the nineties laws changed to substitute public
6

B. R. Clark, Creating Entrepreneurial Universities (Oxford and New York, 1998).

563

Andris Barblan monitoring for state control of academic affairs. Thus the quality debate increasingly took place in institutions in charge of their own development, while governments checked to see that quality was maintained. This division of responsibilities did not do much to encourage the development of a European dimension in assessment, however. After quality, mobility highlighted the need for a European dimension in higher education across the Continent. Erasmus and Comett proved to be ideal instruments for showing the commonality of purpose and action of higher-education institutions. They were so successful that the Commission soon had difculties running programmes requiring thousands of multilateral agreements between university departments (and companies, too, in the case of Comett). In 1995, in an effort to simplify the administration, both Erasmus and Comett (now renamed Leonardo da Vinci) were subsumed into the new Socrates framework, under which the Commission contracted with institutions rather than individual departments. As a result, the universities leadership became aware of the many European activities that had been developing in their establishments; they discovered not only that they had a signicant European practice already but also responsibility for pursuing it. This meant that each of the 2,000 institutions taking part in the programme was able to foster a European policy of its own. And to underline this strategic aspect, after 1995 the Commission asked participating establishments to draw up a European policy statement indicating the strengths and weaknesses of their academic commitment to Europe, and the measures they planned to take to develop and consolidate their European prole over the next three years. The Commission asked the Association of European Universities (CRE) to monitor this aspect of the Socrates institutional contract. Over a period of several years, the CRE analysed these statements and measured possible gaps between intent and practice by visits to hundreds of universities. At rst, no link was made between funding and the institutions European vision; in a second stage, however, following the renewal of the Socrates programme, it was decided to implement such a link. Consequently, at least at a central level, Europe was slowly becoming more than a slogan in universities. With Socrates, the Commission insisted not only on student mobility, but also on mechanisms that facilitate mobility, such as staff exchange, joint curriculum development, and the use of the common European credit transfer system, ECTS. Owing to minimal external support, however, the complementary mechanisms remained secondary to student mobility. By 2002, Erasmus could claim to have exchanged more than one million people among the member nations thereby making it the most visible and popular programme of the Union and providing clear proof of the importance of intercultural learning for European integration. 564

From the university in Europe to the universities of Europe This success highlighted the usefulness of universities in achieving European integration. The variety of cross-border and international projects that each institution participated in also dened the universitys European prole and its image in the other countries of the region. That is why so many institutions located outside the Union expressed the desire to join the programme, or at least to mirror its activities, such as the former socialist countries of Central and Eastern Europe or associated countries like Switzerland, where the government paid all the costs normally paid by the Union for its Member States. Non-EU students wanted to benet from the cultural opportunities offered to colleagues and sister organizations in other parts of the Continent. The exchange tools introduced by the Union proved to be workable outside its borders: for instance, ECTS offered a new approach to the assessment of student workload that was no longer dependent entirely on examinations. In 1999, when visiting Masaryk University in Brno the Czech Republic was not yet a participant in the Socrates programme a team of foreign advisers was surprised to see that the deans of this large Moravian institution had decided to implement ECTS internally, in order to compare the workload imposed on students by the various faculties. By applying ECTS to all elds and all years of study, the university was already turning the credit transfer system originally conceived as a tool to expedite mobility into a credit accumulation system. This helped to bring transparency and comparability to assessment to the benet of the 90 per cent of the student body that would never travel abroad. This innovative use of ECTS outside the Union (Masaryk University was not the only institution to experiment in this area) heralded the later development of credit systems for compatibility purposes in the Bologna Process begun in 1999. It also highlighted the European dimension that all universities of the Continent were beginning to discover as their own, whether their country was a member of the Union or not. Another important element of the Socrates programme, although considered marginal even in Brussels, was the development of thematic networks. The original success of Erasmus built on the dedication and interest of the teachers of one discipline, who offered joint studies forming the core of the original contracts established with the Commission. When the institutions took over responsibility for student mobility, the thematic networks offered the possibility for teachers to pursue the comparative work initiated in the early stages of the programme. Thus, historians, chemists or geologists from all over the Continent continued to meet to discuss the educational needs of students in their eld. Did something akin to a European understanding of what a historian, chemist or geologist should know exist? This question prompted the so-called Tuning Project, an EU-supported contribution to the development of a European 565

Andris Barblan understanding of higher education, which became a reference for the Bologna process. The success of Erasmus and Socrates in Europe had consequences for the internationalization of higher education. Rather than following the successful systems in terms of prestige or costbenet ratios operating in North America or Japan, Europe did its own multicultural experiments and exported the results. Thus, in 1993, the universities of the Asia/Pacic region, from Japan to Australia and including most South-East Asian countries, decided to develop UMAP, a mobility programme very similar to Erasmus, to which the ECTS credit transfer system was adapted in 1998. In North America, efforts made to overcome differences in higher education between the US, Canada and Mexico also drew lessons from the successes and difculties encountered in Europe, as illustrated in the Wingspread Declaration of 1997 that calls for wider cooperation among North American countries. In Latin America, the Columbus programme launched by the CRE with early Commission support in 1987 opened the gate to multilateral collaboration, not only in transatlantic terms but also between the countries of Latin America, long accustomed to focusing their international links on overseas institutions rather than on their neighbours. The ALFA programme supported by the European Union (mainly to promote student exchange) built on that experience and on the success of Erasmus. And so did Asia-Link, the Unions programme for EuroAsian academic exchanges based on specic disciplines and multilateral cooperation involving at least three institutions in any one project. The European model was thus both publicized by the Commission through its intercontinental projects and studied for inspiration by decision-makers from other parts of the world. To some extent, comparability for convergence purposes, which is the European approach to internationalization, was becoming attractive to other systems of higher education. Would the approach also be useful in the wider debate linked to the globalization of higher education considered as a marketable service, the so-called GATS negotiations? In 1995, at the end of the Uruguay round that brought to a close decades of negotiations on tariffs and trade rst initiated after the Second World War, governments decided not only to upgrade the GATT system of international trade negotiation into a full UN agency, the World Trade Organization (WTO), but also to extend the eld of bargaining from goods now nearly free in terms of international mobility to services, still a highly protected area but one that represented the fastest-growing sector in world economy. Among these services, education was to be included, though it would remain less conspicuous than banking, insurance, transport and health. Several countries indicated that they would be willing to discuss trade liberalization in educational services to enable 566

From the university in Europe to the universities of Europe their own providers of higher education to export educational know-how or to welcome foreign providers at home, thus stimulating competition in their home market. The question was not of major importance for highereducation leaders until 2001, however, as the whole discussion was in the hands of trade representatives who rarely consulted either their education colleagues at ministerial level or training institutions at an academic level. In sum, in the late nineties, Europe was recognized around the world for its innovations in higher education. Although it continued to be hampered by regulations of the sort that governments were thinking to cancel within the WTO framework, European higher education enjoyed untrammelled support from other UN agencies, especially UNESCO. In 1997, 400 university leaders from more than forty European countries met in Palermo under the aegis of CRE and CEPES7 to prepare the European position for the World Conference on Higher Education, scheduled to take place one year later in Paris at UNESCO headquarters. Attended by more than 4,000 delegates from all over the world, this conference made clear that Europe, as a cluster of nations and problems, had a view of higher education signicantly different from approaches in other parts of the globe. When confronted with outside issues, European universities discovered that they had more in common than they had thought, and that their common ground could be the basis for shared self-understanding. For instance, most European countries held that the role of ministries was essential. This view was anchored in the idea that higher education is a public good, and that its development shapes the future of society as a whole much more than the interests of individual graduates wishing to enter a well-paid career, and for whom academic training might represent a private good or stepping stone to social mobility. In this context, institutions were becoming the direct partners of governments wishing to grant them ever more autonomy. The Lisbon Convention on the recognition of degrees, signed in 1997 under the aegis of the Council of Europe and UNESCO, helped to dene a possible European model of higher education, which was to coalesce in the so-called Bologna Process.

the return of european integration policies In May 1998, Claude All` egre, then minister of education and research in France, presided over the commemoration of the eight hundredth anniversary of the Sorbonne, the old University of Paris. He had asked his ministerial colleagues from the UK, Germany and Italy to participate in the
7

CEPES is the Centre europ een pour lenseignement sup erieur, set up by UNESCO in 1973 in Bucharest, Romania.

567

Andris Barblan meeting not only for reasons of protocol, but also as leaders of group discussions in a two-day event, to which university heads, professors, students, and representatives from the unions, the media and industry were also invited. The idea was to give a voice to the people directly involved in the successful outcome of university education and research: the four ministers would discuss with the stakeholders the political conditions needed to improve higher education in Europe. The conference ended with a statement, the so-called Sorbonne Declaration, which invited governments and institutions to harmonize academic services and university provisions. This constituted a challenge to the Commission in Brussels, the habitual initiator of innovations in European integration, and a provocation to the other governments of the Union, who might conclude that the big four were taking the lead without consulting their smaller neighbours. The proposal was to start an inter-governmental process and to give a new lease of life to European integration, which seemed to be stumbling over bureaucratic obstacles particularly at the federal level represented by Brussels. When marginalized players expressed their concern, Luigi Berlinguer, the minister of education in Italy, responded in the autumn of 1998 by inviting to Bologna in June 1999 not only the fteen members of the Union but all the countries of Europe interested in the transformation of higher education. The big four agreed that the Sorbonne document could be used as the basis for a new Declaration covering the expectations of the wider group of nations invited to join the ministerial summit. In Paris, the ministers and university representatives had sat around the same table; in Bologna, the rst day of discussions involved only academics. Their discussion of the proposals prepared for the ministers were forwarded by the CRE president to the political leaders. On the second day, the politicians nalized the Bologna Declaration, a text outlining their plans as governmental representatives for the development by 2010 of a single European Higher-Education Area (EHEA). Since Finland and then Austria chaired the EU at the time, they organized the preliminary work with the support of the host country, Italy. In June 1999, the Italian government presented the nal draft to ministerial colleagues from twenty-nine countries. The document provoked heated discussions in Bologna before being signed solemnly in the Aula Santa Lucia. The ministers agreed to a follow-up meeting in Prague two years later. Three elements made up the strength of the Bologna Declaration: 1. It was a declaration of intent, not a treaty requiring detailed compromise, so it could present a series of intentions with no binding value, i.e., a long-term vision for higher education in Europe, resulting in a European Higher-Education Area. 568

From the university in Europe to the universities of Europe 2. It was also a calendar, with 2010 as the planned date for the completion of the EHEA. 3. It was a toolkit for action, since it outlined six concrete ways in which governments could converge to the EHEA: a two-tier degree structure (BA and MA); the use of a Diploma supplement to make explicit the content of learning; the development of ECTS into an accumulation system; the strengthening of a culture of academic quality; the promotion of academic mobility; and the Europeanization of curricula. The Declaration did not pretend to be a blueprint or to dene the characteristics of the higher-education area to be completed by 2010. It left the future open while pointing to tools that would require the development of a shared understanding of how and why to use them. These tools had been discussed and tested in the EU mobility programmes; they included practical mobility support, the Diploma supplement, and the ECTS or European curriculum development. The two-tier structure came from the Sorbonne Declaration, and quality had long been debated within the EU. What was new was the proposal to link together these different elements to reinforce one another. Higher-education reform was on national agendas in all the countries represented in Bologna, and making change part of a European intergovernmental process helped unblock stalemates in most instances. The Declaration also kept alive the modalities of cooperation put forward at the Sorbonne in 1998 by calling for permanent dialogue and partnership with the academic world and its representatives, such as the CRE, the Association of European Universities, the Confederation of Rectors Conferences and ESIB, the Association of Students Unions in Europe. These NGOs played a key role in the preparation of the Prague summit in 2001 and, joined at that time by the European Commission, the Council of Europe and the European Association of Institutions in Higher Education (EURASHE), they kept the political dialogue moving during the preparation of the summits that followed in Berlin in 2003 and in Bergen in 2005. The idea was to progress from mutual distrust to collaboration. Bologna thus became a process that encouraged coordinated legislative and administrative reforms in signatory countries. The reforms were usually prepared by scores of meetings at an institutional, national or European level, which were open to government and academic experts invited to compare experiences from all parts of the Continent, often on the basis of studies solicited and paid for by the Commission. The process was not only open in terms of content and implementation, but also in terms of geography: in Prague another four countries joined, including Turkey, while in Berlin the number of signatories reached forty countries, including Russia. 569

Andris Barblan For learners, teachers and administrators, the goal beyond 2010 was to attain freedom of movement in a common European intellectual space. In hosting countries like in their countries of residence, they would enjoy: 1. comparable conditions of access to the many providers and users of higher education; 2. comparable conditions of support for knowledge development through investment in people and institutions; 3. comparable conditions of assessment and recognition of services, skills and competence; 4. comparable conditions of work and employment. The tools provided by the Bologna declaration were designed to build a European model of higher education strong enough to foster discussions about such difcult topics as lifelong learning, the social contribution of students to institution building, the attractiveness of European higher education to the rest of the world (themes added by the ministers in Prague), and links between teaching and research (an issue stressed in Berlin). The Bologna Declaration was signed at a time that required adaptation to new constraints by both European universities and governmental authorities. It acted as a catalyst for change, and, because of its unique character as a shared enterprise of all partners in higher education, from students to ministers, it had important consequences not only in signatory countries the rst to be affected by its snowballing implementation but also in other parts of the world. There was resistance. It emerged rst among groups of students and professors who considered that collaboration between the public authorities and university representatives amounted to a sell-out of academic interests, exposing higher education to commercialization and subjecting it to the economic strategies of transnational corporations. This generated confusion between the Bologna process and the GATS discussions on trade in services, as if governmental moves towards the EHEA were preparations for globalization led by private interests. In the autumn of 2001, however, the European University Association,8 the American Council of Education (ACE) and the Association of Universities and Colleges in Canada (AUCC) signed a joint declaration drawing the attention of education ministers and higher-education
8

EUA, the Association of European Universities, succeeded CRE on 31 March 2001 after the latters merger with the Brussels-based Confederation of National Rectors Conferences of the European Union. Both had been heavily involved in the preparation of the Bologna Declaration, and their representation of the same universities seemed rather odd to outsiders hence the decision to have them merge as the only cooperative organization of European universities.

570

From the university in Europe to the universities of Europe institutions in Europe and North America to the dangers of trade discussions on services developed by the ministries of trade without much consultation with academia and its stakeholders. To meet the danger of the expansion of commercial providers, whose interest was their own growth rather than the development of the systems of higher education in which they operated, advocates lobbied at a national level and at WTO meetings for higher education as a key ingredient in national development strategies. Thus, in Prague and Berlin the governments of Europe solemnly reafrmed the importance of higher education as a public good in terms of trade, employment and research transfer. The Bologna Declaration itself, by proposing multiple exit points to reduce the student drop-out rate, diminished the sense of wasted time among students wishing to nd employment after only three years of academic training. But was this not also a way of depriving young people of their right to higher education, by offering education on the cheap (the terminal three-year BA) while making the MA the only true academic degree? The new system would deprive most students of a chance at true higher education, since governments could not muster the resources needed to support the number of students who might want to proceed beyond the BA some 60 per cent of the age cohort according to government forecasts. Resistance to change also grew with the success of reforms that forced transformation in academic units long accustomed to traditional routines. Thus, the French realized that European comparability would reveal the unequal value of degrees that, nationally at least, were considered equal. Old nationalist arguments about quality were then used against the Bologna Process of European convergence. Moreover, the speed of reforms, some of which were hasty, gave ammunition to opponents who could point out that in Italy the reorganization of some 1,600 disciplinary curricula in less than eighteen months amounted to little more than switching labels. But owing to the general desire for change in Europe and the urging of thousands of people who had proted from mobility under Erasmus and other programmes, the resistance was only a rearguard action. Whatever its strengths, however, the Bologna Process could still collapse, since it is based on tools that could fail in the face of ideological choices. European convergence has contributed to the vision of a coherent and cohesive system of higher education on other continents. Latin American countries have not only discussed similar developments in their own academic space, but they have also urged the creation of a Euro-Latin American Higher Education Area exploiting the tools of the Bologna Declaration. A step in this direction was taken in Berlin, where the German host of the 2003 summit welcomed ofcials from Latin American governments as observers at the ministers session. The Bologna Process, 571

Andris Barblan especially the model of comparability for convergence purposes, has aroused interest in North America, Asia and Africa. Still, academic training in Europe has not yet become attractive enough to compete well with the USA, the main benchmark for Europe. a european model of higher education For nine centuries, the universities have been key institutions in Europe, even if, since the French Revolution, their character has evolved in different ways to accommodate the nationalism of the societies that support them. Despite the movement for European integration developed after 1945, the universities were slow to cultivate the European dimension of their activities. It was initially considered to be a marginal part of international relations facilitating the exchange of students, teachers and ideas, preferably with North American institutions. In the European Community, however, this dimension slowly became an obligation as the idea of free circulation of people, goods and capital gained acceptance among member countries and their associates. The upheaval of 1989, with the collapse of the Berlin Wall, raised urgent questions about the idea and its implementation. What is Europe, what are the elements of a cultural model that can be called European, how can a core European identity be dened, what role do universities play in its denition? The answer to all these questions was a structured development based on comparison, convergence and cooperation, the so-called Bologna Process requiring the commitment not only of governments but also of the institutions of higher education, their students and their teachers. The approach was novel, even if the aim of integration was ancient. In Bologna in 1988, universities emphasized the similarity of their roles throughout Europe as nodes of a single network of intellectual activities. In a discrete way, they were the living proof that Europe existed as a cultural entity. To come out in the open, they had to wait until 1999 when, again in Bologna, the European ministers of education launched a new process of academic integration. The tools mentioned in their Declaration excavated deeper levels of integration. But although the Diploma Supplement and the BA/MA architecture of studies invited changes at a national level, they did not call for adaptation to other members needs and ambitions. ECTS asked for more, however, as the comparison of learning outcomes could entail changes in national curricula or institutional activities in order to facilitate mobility and, at a later stage, to allow for credit accumulation and the development of joint degrees.9 Cooperation
9

Such was the aim of the Tuning Project, which brought together with EU support hundreds of university representatives after 2001 to explore the commonalities of curricula taught all over the region.

572

From the university in Europe to the universities of Europe in quality assessment nally translated comparability into compatibility, so that institutions could have condence in the level of higher education provided all over Europe. Each stage required still greater commitment to a commonality of purpose and action in the eld of higher education so that, by 2010, educational services might ow freely from one side of the Continent to the other, as material goods have done for many years. The Bologna Process has something of the structure of our History of the University. Both move from relationships with the state to teaching developments, from a study of the human and nancial resources available to curricula and student life. Should Bologna succeed, the providers of education would be able to draw upon resources (people or funding) from all corners of Europe to develop and package their most enticing services, whether courses or research projects, data or publications perhaps in cooperation with publishers, media companies and other specialized communicators. Students of all ages would then be able to draw on the most convenient services for their intellectual interests, career development or social commitments. This model would be completed by common measurements allowing for comparisons of the value of the service, a kind of euro of the intelligence for assessing the compatibility and cohesion of the knowledge society announced by the Lisbon Summit of EU heads of state in 2000. The function of higher education, apart from exploration (the university as a creator) and conservation (the university as a curator) of knowledge, could therefore consist in making explicit the new commonalities of Europe, be they economic, social or cultural (the university as a constructive critic). This criticism would reinforce the potential for integration based on the search for the public good rather than on the support of private interests. If this were the case, the European model would certainly differ from its American counterpart while adhering in the twenty-rst century to the three basic roles of the university since its medieval origins. Will the European universities of 2010 have enough condence in their own cohesive strength to assume global responsibilities as their American competitors did in the twentieth century? One of the underlying themes in European integration has been the rise of fortress Europe, a continent big enough and sufciently rich to develop a protective system around its borders in an attempt to divert external forces too difcult to face directly. Certain aspects of European initiatives in higher education might seem to favour the fortress. European competitiveness, a part of the Bologna Declaration, could be understood as an effort to draw to Europe the best brains to enrich the continents long-term future. The richly endowed Erasmus-Mundus programme launched in 2004 could be interpreted as European self-indulgence. However, the vitality of the Bologna Process, complex and multi-faceted as it is, should strengthen Europes condence 573

Andris Barblan in its capacity to invent the future without a fortress. The true test will be the external relations of the European higher-education community with its counterparts around the world. A tting end to the long history of the university in Europe is the emergence of universities of Europe institutions expressing and defending in the wider world the specicity of an integrated culture for Europe. select bibliography
A travers lhistoire, CRE-Information, 39, Geneva, 1977. futur des universit Carrier, H. Role es, Rome, 1975. CRE: 40 Years of History, CRE-action, 115, Supplement, Geneva, 1999. , Frankfurt, 1999. Daxner, M. Die blockierte Universitat Marga, A. University Reform Today, 4th edn, Cluj, 2005. Minogue, K. R. The Concept of a University, London, 1973. Neave, G. Abiding Issues, Changing Perspectives: Visions of the University across a Half Century, Paris, 2000. Neave, G. Apocalypse Now: The Changing Role of the University in the Emerging Information Society, in A. Tuijnman and T. Schuller (eds.), Lifelong Learning Policy and Research, Stockholm, 1999. Neave, G. The Bologna Declaration: Some of the Historic Dilemmas Posed by the Reconstruction of the Community in Europes Systems of Higher Education, Educational Policy, 17:1 (2003), 14164. ` la recherche de luniversit Sonder le pass e a e, CRE-Information, 69, Geneva, 1985. Steger, H.-A. (ed.) Das Europa der Universitaten/LEurope des Universit es/The Universities Europe: Entstehung der standigen Konferenz der Rektoren und Vize-Kanzler der europaischen Universitaten 19481962, Dokumentation, Bad Godesberg, 1964. Stewart, W. A. C. Higher Education in Postwar Britain, London, 1989. Town and Gown: The University in Search of its Origins, CRE-Information, 62, Geneva, 1983. Weber, L. Challenges Facing Higher Education at the Millennium, Phoenix, Ariz., 1999. Zimmerli, W. D. Proceedings of the 1964 General Assembly, Gottingen, 1966.

574

APPENDIX

UNIVERSITIES FOUNDED IN EUROPE BETWEEN 1945 AND 1995

EGG WALTER RU The following list is based on L. J lek, Historical Compendium of European Universities (Geneva, 1984), prepared and published by CRE as a preparatory work for the History Project. The national entries were revised and completed, partly by the National Rectors Conferences (EUA), and partly according to the information given by the universities listed in the IAU World Higher Education DATABASE 2005/6 and 2006/7 (IAU). The list gives for each country the new universities in chronological order of their foundation year with the following information: 1. Year of foundation referring to the ofcial recognition of the right to grant the doctors degree (/ indicates year of inauguration or opening to students, if reported to be different from the year of foundation). 2. Location. 3. Name (U. alone refers to the location: (University of loc.) or (loc. University). 4. Later name and/or earliest precursors name.
ALBANIA (IAU) 1957 Tirana

U.

incorporating former Institutes of Engineering, Medicine, Economics, Law and Science, 1991 without Engineering

1991

Tirana

Polytechnic U. U. Hochschule of Economics and Social Sciences

AUSTRIA (EUA) 1962 Salzburg 1962/6 Linz

1975 Johannes Kepler U.

575

Appendix
AUSTRIA (EUA) (cont.) 1970 Klagenfurt Hochschule of Pedagogical Sciences 1973 Linz Hochschule of Art and Industrial Design BELARUS (IAU) 1945 Brest 1961 1978 1992 1992 1993 1993 1994 Brest A. S. Pukin State U. Gomel Gomel State U. Francisk Skorina Grodno Grodno State U. Janki Kupaly Minsk Byelorussian State Academy of Music Gorki Byelorussian State Agricultural Academy Minsk Byelorussian State Technological U. Novopolotsk Polotsk State U. Minsk Vitebsk Byelorussian State Pedagogical U. M Tank Vitebsk State Academy of Veterinary Medicine

1940 State Teacher Training Institute 1932 Academy of Music 1840 Gory-Gorecky Agricultural School 1930 Forestry Institute 1968 Novopolotsk Polytechnical Institute 1924 Pedagogical Institute 1924 Higher Agricultural Technical School

1994

BELGIUM (EUA/IAU) 1965 Mons Centre universitaire de l etat 1965 Mons Polytechnical faculty 1965 Mons Centre universitaire 1968 1968 1969 1969 1969 1991 Leuven Louvain-laNeuve Brussels Brussels Brussels Hasselt Katholieke U. U. catholique Facult es universitaires Saint-Louis (FUSL) U. libre de Bruxelles Vrije U. Brussel Universiteit Hasselt

Merger of different faculties and institutes 1837 Mining school 1971 U. of Mons-Hainaut; 1899 Institute 1425 Studium generale 1425 Studium generale 1898 Facult es universitaires Saint-Louis 1834 U. libre de Bruxelles 1834 U. libre de Bruxelles 1964 Postuniversitair Centrum, 1991 Limburgs Universitair-Centrum at Diepenbeek-Hasselt, changed its name to Universeit Hasselt in 2005 Merging of 1965 Rijksuniversitair Centrum van Antwerpen RUCA (1852 Dutch Higher Trade School, 1520 Jesuit Trade School), 1965 Universitaire Faculteiten Sint-Ignatius Antwerpen (UFSIA), and 1971 Universitaire Instelling Antwerpen (UIA) (2nd cycle and PhD faculty of subjects taught at UFSIA and RUCA)

2003

Antwerp

Universiteit Antwerpen

576

Universities founded in Europe between 1945 and 1995

BELGIUM (EUA/IAU) (cont.) 2007 Brussels Hogeschool en Universiteit Brussel (HUB) Merging of the 1969 Universitaire Faculteiten Sint-Aloysius (UFSAL) (1898 Facult es universitaires Saint-Louis) and two nonuniversity schools for higher education (VLEKHO and EHSAL)

BOSNIA-HERZEGOVINA (IAU) 1949 Sarajevo U. 1976 Tuzla U. BULGARIA (IAU) 1971 Veliko 1972 1995 1995 1995 1995 1995 1995 1995 Plovdiv Bourgas Gabrovo Pleven Soa Soa Soa Varna Turnovo St. Cyril and Methodius U. Paillii Hilendarski U. Prof. Dr. Assem Zlatarov U. Technical U. Medical U. Medical U. Technical U. Agricultural U. Prof. Dr. Parasker Stoganov Medical U.

1960 Faculty of mines 1963 Teachers Training College 1964 Teachers Training Institute 1961 Higher Institute of Chemical Technology 1963 Higher Institute for Mechanical and Electrical Engineering 1974 Higher Institute of Medicine 1917 Faculty of Medicine U. of Soa 1945 State Polytechnical Institute 1945 Higher Institute of Agriculture 1961 Higher Insitute of Medicine

CROATIA (EUA/IAU) 1973 Rijeka U. 1974 Split U. 1975 Osijek U. CYPRUS (IAU) 1989 Nicosia U. of Cyprus

1624 Jesuit College

CZECH REPUBLIC (EUA) 1945/6 Prague Academy of Performing Arts in Prague 1946 Prague Academy of Arts Architecture and Design in Prague 1947 Brno Janacek Academy of Music and Dramatic Arts in Brno 1950 Pardubice Institute of Chemical Technology 1952 Prague College of Agriculture 1952 1953 1991 1991 1991 1991 1991 Prague Institute of Chemical Technology U. of Economics U. of South Bohemia

1885 School of Decorative Arts

1994 U. of Pardubice 1994 Czech U. of Agriculture in Prague

Prague Cesk e Budejovice Ostrava U. Opava Silesian U. in Opava Pilsen U. of West Bohemia in Pilsen nad Ust Jan Evangelista Purkyne nad Labem Labem U. in Ust

1948 independent Faculty of Education 1954 Faculty of Education

577

Appendix
CZECH REPUBLIC (EUA) (cont.) 1994 Pardubice U. 1994 Liberec Technical U. of Liberec DENMARK (EUA) 1966 Odense 1972 Roskilde 1974 Aalborg ESTONIA (EUA) 1951 Tartu 1991 Tallin FINLAND (EUA) 1950 Turku 1950 Institute of Chemistry 1973 College of Mechanical Engineering

U. U. U. Estonian Agricultural U. U. Nord

formerly Baccalaureate Private College

1958 1966 1966 1966/9 1972 1977 1977 1979 1980 1982 1983 1984 1984 1987 1987 1993

School of Economics and Business Administration Oulu U. Tampere U. Jyvaskyl a U. Lappeenranta U. of Technology Tampere U. of Technology Business School Business School Faculty of law and social sciences U. Sibelius Academy U. of Art and Design U. U. Theatre Academy U. of Lapland National Defence College

1956 Teacher training college 1926 Citizens College Helsinki Teachers seminar 1863 1966 part of Helsinki U. of Technology in Tampere 1950 private foundation 1966 private foundation 1966 School of Economics and Business Administration 1882 Helsinki Music Institute 1871 Crafts School 1966 Institution of Higher Education 1966 Institution of Higher Education 1943 without U. status 1979 Institution of Higher Education 1779 Cadet School in Joroinen

Turku Vaasa Rovaniemi Vaasa Helsinki Helsinki Loensuu Kuopio Helsinki Rovaniemi Helsinki

FRANCE (IAU)1 1964 Villeurbanne Ecole nationale sup erieure des sciences de linformation et des biblioth` eques (ENSSIB) 1965 Paris Ecole nationale du g enie 1824 National School of Water and rural et des eaux et Forests of Nancy des for ets (ENGREF) 1968 Ecole des hautes e 1885 without U. status tudes ding enieur (HEI)
1

In 1793, the universities were suppressed and in the bigger cities replaced by schools of medicine and law; later on also by faculties of letters, sciences and, to a lesser degree, of theology. In 1896, these institutions of higher education were locally united by the name but without the structure of a university. In 1970, following the University Reform Law of 1968, they were re-founded as legally, but still not structurally, autonomous state institutions, divided in the bigger cities into smaller universities.

578

Universities founded in Europe between 1945 and 1995

FRANCE (IAU) (cont.) 1970 Amiens U. de Picardie 1970 Talence U. Bordeaux I 1970 Bordeaux U. Victor Segale (Bordeaux II) 1970 Pessac U. Michel de Montaigne (Bordeaux III) 1970 Brest U. de Bretagne occidentale 1970 Caen U. de Caen Basse Normandie 1970 ClermontU. Clermont-Ferrand Ferrand 1970 1970 1970 1970 1970 1970 1970 1970 ClermontFerrand Dijon Grenoble U. Clermont-Ferrand 1964 Centre universitaire 1441 Studium generale 1441 Studium generale 1441 Studium generale 1461 Studium generale Nantes 1412 Studium generale 1977 U. dAuvergne (Clermont-Ferrand I). 1854 Fac. lettres, sciences 1977 U. Blaise Pascal (Clermont-II) 1854 Fac. lettres, sciences 1722 U. Dijon 1339 Studium generale 1339 Studium generale 1339 Studium generale 1560 U. Douai 1560 U. Douai 1560 U. Douai 1626 School of Medicine 1245 Studium generale 1245 Studium generale 1413 Studium generale 1220 Studium generale 1220 Studium generale

1970 1970 1970 1970 1970 1970

1970 1970 1970 1970 1970 1970 1970

U. de Bourgogne U. Joseph Fourier (Grenoble I) Grenoble U. des sciences sociales (Grenoble II) Grenoble U. Stendhal (Grenoble III) Villeneuve U. des sciences et dAscq technologies (Lille I) Lille U. du droit et de la sant e (Lille II) Villeneuve U. Charles de Gaulle dAscq Sciences humaines, lettres et arts (Lille III) Limoges U. Villeurbanne U. Claude-Bernard (Lyon I) Lyon U. Lumi` ere (Lyon II) Marseille U. de Provence (Aix.-Marseille I) Montpellier U. Montpellier I Montpellier U. des sciences et techniques du Languedoc (Montpellier II) Montpellier U. Paul Val ery (Montpellier III) Nancy U. Henri Poincar e (Nancy I) Nancy U. Nancy II Nancy Ecole darchitecture de Nancy (EAN) Orl eans U. Panth eon-Sorbonne Paris2 (Paris I) Paris U. de droit, d economie et de sciences sociales (Paris II)

1220 Studium generale 1572 U. Nancy 1572 U. Nancy 1306 Studium generale

The U. of Paris, founded around 1200 as Universitas Magistrorum et Scholarium Parisiensium, was split into thirteen universities.

579

Appendix
FRANCE (IAU) (cont.) 1970 Paris U. Sorbonne nouvelle (Paris III) 1970 Paris U. Paris-Sorbonne (Paris IV) 1970 Paris U. Ren e-Descartes (Paris V) 1970 Paris U. Pierre et Marie-Curie (Paris VI) 1970 Paris U. Denis Diderot (Paris VII) 1970 Paris U. de Vincennes a ` St-Denis (Paris VIII) 1970 Paris U. Paris-Dauphine (Paris IX) 1970 Paris U. Paris-Nanterre (Paris X) 1970 Paris U. Paris-Sud (Paris XI) 1970 Paris U. Paris-Val-de-Marne (Paris XII) 1970 Paris U. Paris-Nord (Paris XIII) 1970 Pau U. de Pau et des Pays de lAdour 1970 Poitiers U. 1970 Reims U. Reims Champagne-Ardenne 1970 Rennes U. Rennes I 1970 Rennes U. Rennes II Haute-Bretagne 1970 MontU. Rouen SaintAignan 1970 SaintU. Jean Monnet Etienne Saint-Etienne 1970 Strasbourg U. Louis-Pasteur (Strasbourg I) 1970 Strasbourg U. des sciences humaines (Strasbourg II) 1970 Strasbourg U. des sciences juridiques, politiques, sociales et de technologie (Strasbourg III) 1970 Toulouse U. des sciences sociales (Toulouse I) 1970 Toulouse U. Toulouse-le-Mirail (Toulouse II) 1970 Toulouse U. (Toulouse III) 1970 Tours U. Franc ois-Rabelais 1971 Nice U. Nice-Sophia Antipolis 1972 Angers U. 1972 Compi` egne U. de technologie de Compi` egne 1973 Marseille U. de la M editerran ee (Aix-Marseille II) 1973 Marseille U. de droit, d economie et des sciences (Aix-Marseille III) 1973 Lyon U. Jean Moulin (Lyon III) 1975/61 Corte U. of Corsica Pascal Paoli 1975 Mulhouse U. de Haute-Alsace

1969 Centre universitaire 1431 Studium generale 1548 U. Reims 1461 U. Nantes 1461 U. Nantes 1966 U. Rouen 1961 Centre universitaire 1537 higher humanist school 1537 higher humanist school 1537 higher humanist school

1229 Studium generale 1229 Studium generale Institut national polytechnique 1306 U. Orl eans 1965 U. Nice 1337 Studium generale 1413 Studium generale 1413 Studium generale 1808 fac. th eol., lettres, sciences 17658 U. of Corte 1970 Centre universitaire du Haut-Rhin

580

Universities founded in Europe between 1945 and 1995

FRANCE (IAU) (cont.) 1976 Vanduvrel` es-Nancy 1976 Nantes 1976 Nice 1976 Valenciennes 1978 Le Mans 1978 Perpignan 1979 1979 1984 Chamb ery Toulon Toulouse National Polytechnic Institute of Lorraine U. du Hainau-Cambr esis U. du Maine U. Perpignan Via Domitia U. de Savoie U. du Sud Toulon Var Institut national polytechnique de Toulouse (INP Toulouse) Ecole centrale de Nantes (ECN) Georgian Technical U. Georgian State Agrarian U. Medical School Johannes Gutenberg U. Technical U. German U. of Administrative Sciences U. of the Saarland Free U. Hochschule of Economics and Politics Technical Hochschule Ruhr-U. U. U. U. of Medicine U. U. U. U. 1971 Institut national polytechnique de Nancy 1970 Centre universitaire 1960 Centre scientique universitaire Centre universitaire de Perpignan 1970 Centre universitaire de Savoie 1970 Centre universitaire 1970 Institut polytechnique

1991

Nantes

Institut polytechnique de lOuest

GEORGIA (IAU) 1990 Tblisi 1991 Tblisi 1992 Aieti

1922 Faculty of Tblisi U. 1919 Faculty of Tblisi

GERMANY (EUA) 1946 Mainz 1946 Berlin 1947 Speyer Saarbrucken Berlin Hamburg Ilmenau Bochum Regensburg Dortmund Hannover Dusseldorf Konstanz Ulm Hohenheim

14771798 U. 1879 Technical College

1948 1948 1948

1953 1962/5 1962/6 1962/8 1963/8 1965 1966 1967 1967 1967 1969 1970 1970

1992 Technical U. 1894 Private Technical School

1978 Heinrich-Heine-U. 1923 Medical Hochschule 1818 College for Agricultural Teaching and Research 1907 Municipal Trade College 1975 split into Trier (14751798) and Kaiserslautern (1779 College of Public Administration) 1947 German College for Physical Education and Sport (without university rights)

Mannheim U. Bielefeld U. Augsburg U. TrierU. Kaiserslautern Cologne German Sports U.

1970

581

Appendix
GERMANY (EUA) (cont.) 1971 Bremen U. 1971 Kassel U. 1972/5 Bayreuth U. 1972/5 Bamberg U. 1972/5 1972/5 1972/5 1972/5 1972/5 1972/5 1973 1973 1973/4 1973/8 1973/8 1974 1978 1978 1980 1985 1986 1989 1990 1991 1991 1991 1993 1994 Duisburg Essen Hamburg Paderborn Siegen Wuppertal Munich Oldenburg Osnabruck Passau Vechta Hagen HamburgHarburg Hildesheim Eichstatt Lubeck Chemnitz Luneburg KoblenzLandau Cottbus Frankfurt (Oder) Potsdam Magdeburg Flensburg Gerhard-Mercator-U. U. U. of the Federal Armed Forces U. U. Bergische U. U. of the Federal Armed Forces Carl von Ossietzky-U. U. U. U. Tele U. Technical U. U. Catholic U. Medical U. Technical U. U. U. Technical U. Europa U. Viadrina

1988 Otto-Friedrich U. 1647 Jesuit College

1830 Teacher Training School

1643 College of Art and Theology 1619 Jesuit Seminary 1964 Medical Academy 1836 Trade Academy 1946 College of Education

15061811 U.

U. Otto-von-Guericke-U. Bildungswissenschaftliche 1946 College of Education Hochschule-U. U. U. Democritus U. of Thrace U. of Crete Technical U. U. of the Aegean U. of Thessaly U. Harokopia U. U. of Macedonia U. of Veterinary Medicine Technical U. of Heavy Industry U. of Medicine Semmelweis U.

GREECE (EUA) 1964 Patras 1970 Ioannina 1973 Komotini 1973 Rethymno 1977 Chania 1984 Mytilene 1984 Volos 1989 Piraeus 1989 Athens 1989 Thessaloniki HUNGARY (IAU) 1949 Budapest 1949 1951 1951 Miskolc Budapest Veszpr em

1964 Department of U. Thessaloniki

1938 Free School 1948 Industrial School 1787 Veterinary School, Buda U. 1990 Miskolc U. 1769 Medical Fac. Buda U. 1949 Fac., Technical U. Budapest

582

Universities founded in Europe between 1945 and 1995

HUNGARY (IAU) (cont.) 1952 God U. of Agriculture oll o 1953 Budapest U. of Horticulture 1962 Sopron U. of Forestry 1970 Debrecen U. of Agriculture 1970 1971 1990 Keszthely Budapest Budapest Budapest U. of Agriculture Hungarian U. of Crafts and Design Budapest U. of Economics Pazm any Peter Catholic U. Iceland University of Education U. School of Business The Institute of Public Administration (IPA) The Milltown Institute of Theology and Philosophy Athlone Institute of Technology Institute of Technology Carlow Institute of Technology Institute of Technology Cork Institute of Technology City U. U. Dublin Institute of Technology Limerick Institute of Technology 1955 Istituto autonomo di Magistero

1894 School of Gardening 1808 School of Forestry 1868 National High School for Economics 1865 School of Forestry 1880 School of Crafts 1920 Fac. of Economics, Evangelical-Lutheran Theological U., 1557 Latin School 1638 Theological Fac. Nagyszombat

1993

ICELAND (EUA) 1971 Reykjavik 1987 1989 Akureyri Bifrost

1907 Iceland College of Education 1918 Co-operative School of Iceland

IRELAND (IAU) 1957 Dublin 1968 Dublin Athlone Carlow Sligo Tralee Cork Dublin Limerick Dublin Limerick

1970 1970 1971 1977 1978 1989 1989 1992 1992

1975 National Institute for Higher Education 1972 National Institute for Higher Education

ITALY (EUA) (U. = Universita ` degli Studi) 1967 Lecce U. 1968 Arcavacata U. della Calabria di Rende (Cosenza) 1971 Ancona U. 1977 Roma Libera U. internazionale degli studi sociali Guido Carli 1978 Udine U. 1979 Cassino U 1979 Viterbo U. della Tuscia 1981 Potenza U. della Basilicata 1982 Roma U. Roma Tor Vergata

1969 Libera U. 1966 U. pro Deo

1964 Istituto privato di Magistero 1969 Libera universita ` della Tuscia

583

Appendix
ITALY (EUA) (U. = Universita ` degli Studi) (cont.) 1982 Brescia U. 1969 Ente universitario della Lombardia orientale 1982 Campobasso U. del Molise 1982 Chieti U. Gabriele DAnnunzio 1965 Libera U. Abruzzese degli studi 1982 LAquila U. 1952 Istituto universitario di magistero 1982 Reggio U. Mediterranea 1968 Libero istituto universitario di Calabria architettura 1982 Trento U. 1962 Istituto U. di scienze sociali 1982 Verona U. 1987 Pisa Scuola superiore di studi Merger Scuola superiore di studi universitari e di universitari e di perfezionamento perfezionamento S. (f.1967) + Conservatorio S. Anna Anna (founded in 1785) 1990 Bari Politecnico 1990 Bergamo U. 1968 Istituto universitario di lingue e letterature straniere 1991 Castellanza U. Carlo Cattaneo (Varese) LIUC 1991 Napoli Seconda U. 1991 Roma Libera U.-Campus bio-medico 1992 Roma U. Roma Tre 1993 Teramo U. LATVIA (IAU) 1954 Lilpaja 1990 1991 Riga Jelgava Lilpaja Academy of Pedagogy Latvian Academy of Culture Latvian U. of Agriculture

1863 Department of Riga Polytechnical Institute

LITHUANIA (EUA) 1945 Kaunas Kaunas Kaunas Klapeda Vilnius

1950 1950 1991 1994

Lithuanian National 1999 Lithuanian Academy of Institute of Physical Physical Education Education Kaunas Medical lnstitute 1989 Kaunas Medical Academy Polytechnic Institute 1990 Kaunas U. of Technology U. Vilnius Gediminas 1956 Vilnius Evening division of the Technical U. Evening faculty of Kaunas Polytechnic Institute U. Sts. Cyril and Methodius U. St. Kliment Ohridski

MACEDONIA (IAU) 1949 Skopje 1979 Bitola

MALTA (no new U.) MOLDAVIA (IAU) 1992 Chis inau 1993 Chis inau Free International U. of Moldavia Technical U. of Moldavia

1964 Polytechnic Institute

584

Universities founded in Europe between 1945 and 1995

MONTENEGRO (IAU) 1973 Podgorica U. of Montenegro THE NETHERLANDS (IAU) 1952 Den Haag Institute of Social Studies for Graduate Studies 1956 Eindhoven Technische Hogeschool Eindhoven 1961 Enschede Technische Hogeschool Twente 1967 Amsterdam Catholic Theological U. 1973 Rotterdam Erasmus U. 1975 1982/4 2004 Maastricht Heerlen Nijmegen U. The Open U. of the Netherlands Radboud U.

1986 Technische U. Eindhoven (TU/e) 1986 Twente U. 1913 The Netherlands School of Economics 1974 Faculty of Medicine 1923 Katholieke Universiteit Nijmegen (KUN) 1825 Bergen Museum 1910 Norwegian College of Advanced Technology

NORWAY (EUA) 1946 Bergen 1968/72 Troms 1968 Trondheim POLAND (EUA) 1944/5 Lublin 1944/5 1945 1945/6 1946 1968 1970 1984/5 1994 Wrocaw Gdansk od z Torun Katowice Gdansk Szczecin Opolski

U. U. U.

Maria CurieSkodowska U. Polish U. Politechnic U. Mikoaj Kopernik U. Silesian U. U. U. U.

Merger Educational Institute and Jagiellonian U. branch Merger Education Institute + Sopot Economics College Merger Educational Institute + Technical U. Merger Educational Institute + Theological-Pastoral Institute

PORTUGAL (EUA) 1973 Lisbon 1973 Aveiro 1973 Braga 1979 Evora ROMANIA (IAU) 1948 Timis oara

Universidade nova U. U. of Minho U. Banats U. of Agricultural Sciences and Veterinary Medicine U. of the West Politecnica U. U. U.

15591759 U. 1945 Faculty of Technical Institute

1962 1965 1966 1971

Timis oara Bucharest Craiova Bras ov

1949 Institute of Education 1867 School of Bridges, Roads and Mines 1947 Institute 1956 Transylvania U.

585

Appendix
ROMANIA (IAU) (cont.) 1974 Galat i U. Dunarea de Jos din Galat i 1989 Bucharest Carol Davila U. of Medicine and Pharmacy 1991 Petros ani Technical U. 1992 Bucharest National Academy of Physical Education and Sports 1992 Ias i Grigore T. Popa U. of Medicine and Pharmacy 1992 ClujTechnical U. Napoca 1994 Bucharest Technical U. of Civil Engineering 1951 Naval and Mechanical Engineering Institute 1857 National School of Medicine and Surgery 1995 U. 1864 Institute of Coal 1922 National Institute of Physical Education 1879 Medical Fac. U. Ias i 1922 Electromechanical Institute 1818 School of Land Surveyors

RUSSIAN FEDERATION (IAU)3 1951 Moscow All-union Extra-Mural 1995 Russian State Open Technical Institute of Railway U. of Railway Communication Engineering 1956 Jakutsk Jakutsk State U. M. K. 1934 Pedagogical Institute Ammosov 1957 Bashkir Bashkir State U. 1909 Teacher Training Institute 1957 Mahachkala Dagestan State U. 1931 Pedagogical Institute 1957 Nal cik Kabardino-Balkarian 1932 Pedagogical Institute State U. H. M. Berbekov 1957 Saransk Mordovian State U. 1931 Mordovian State Teachers N. P. Ogarev Training Institute 1958 Vladimir Vladimir State U. 1959 Novosibirsk Novosibirsk State U 1959 Moscow Peoples Friendship U. of Before 1992 Peoples Friendship U. Russia Patris Lumumba 1959 Briansk Briansk Institute of 1995 Briansk State Engineering Technology Academy, 1930 Institute of Forestry Engineering 1967 Cheboksary Chuvash State U. I. Ulianov 1969 Krasnojarsk Krasnojarsk State U. 1963 Afliated to Novosibirsk State U. 1969 Vladikavkaz North Ossetian State U. 1920 Pedagogical Institute K. L. Hetagurov 1970 Belgorod Belgorod State Institute 1994 Belgorod State Technical U. of Building Materials V. G. Shuhov and Technology 1970 Krasnodar Kuban State U. 1924 Kuban Institute of Public Education 1972 Kemerovo Kemerovo Technological Institute of Food Industry
3

The information about the fty-nine universities founded between 1945 and 1995, listed in the IAU DATABASE among almost 800 Russian institutions of higher education, as having the right to grant the doctorate, was kindly checked and supplemented according to their websites by Natalia Nosova, Executive Assistant for International Affairs to the Rector of Saint-Petersburg State University.

586

Universities founded in Europe between 1945 and 1995

RUSSIAN FEDERATION (IAU) (cont.) 1972 Jo skar-Ola Marij State U. 1973 Altaiskijkraj Altaj State U. 1973 Krasnodar Kuban State U. of Technology 1973 Tjumen Tjumen State U. 1974 Ivanovo Ivanovo State U. 1974 Kemerovo Kemerovo State U. 1974 Omsk Omsk State U. 1974 I zevsk Udmurt State U. 1976 Celjabinsk Celjabinsk State U. 1980 Volgograd Volgograd State U 1981 Novosibirsk Siberian State U. of Telecommunications and Informatics 1982 Krasnojarsk Krasnojarsk State Academy of Architecture and Civil Engineering 1984 Rjazan Rjazan State Pedagogical U. 1988 Moscow Moscow Institute of Physics and Technology (State U.) 1989 Moscow Moscow State Pedagogical U. 1989 Samara Samara State U. 1989 Moscow Moscow Medical Academy I. M.Se cenov 1990 Krasnojarsk Krasnojarsk State Technical U. 1991 SaintHerzen State Petersburg Pedagogical U. 1991 Moscow International Independent Ecological and Political U. 1991 Moscow International U. in Moscow 1991 Moscow Moscow State Social U. 1991 Moscow Russian Law Academy 1991 Novosibirsk Novosibirsk State Agrarian U. 1991 SaintSaint-Petersburg State Petersburg Agrarian U. 1991 SaintSt. Petersburg State Petersburg Mining Institute G. V. Plekhanov 1991 Tomsk Tomsk Polytechnic U. 1992 Moscow International Institute of Marketing and Management 1992 Moscow Moscow Power Engineering Institute (Technical U.)

1918 previous institution 1930 previous institution 1930 previous institution 1954 previous institution 1931 Pedagogical Institute 1952 Novosibirsk Institute of Electrotechnics and Communications

1853 College for Women 1946 founded without U. status 1872 Moscow Higher Womens Courses 1758 Faculty of Medicine of Moscow U. 1956 previous institution 1797 Hospice educating orphans

1970 previous institution 1936 previous institution 1904 Agricultural Courses 1773 previous institution 1896 Technological Institute

1930 previous institution

587

Appendix
RUSSIAN FEDERATION (IAU) (cont.) 1992 Moscow Moscow State Automobile and Highway Engineering Institute (Technical U.) 1992 Moscow Moscow Technical U. of Communication and Informatics 1992 Moscow Russian State Academy of Physical Education 1992 Novosibirsk Novosibirsk State Technical U. 1992 SaintSaint-Petersburg State Petersburg Electrotechnical U. 1992 Samars Samara State Aerospace U. 1992 Saratov Saratov State Technical U. 1992 Tomsk Siberian State Medical U. 1992 Tula Tula State Technical U. 1992 Ekaterinburg Ural State Academy of Law 1992 Volgograd Volgograd State Pedagogical U. 1993 Irkutsk Irkutsk State Technical U. 1992 Ivanovo Ivanovo State U. of Power Engineering 1992 Izevsk Izevsk State Technical U. 1992 Kursk Kursk State Medical U. 1992 Maykop Maykop State Technological Institute 1993 Moscow Moscow State U. of Forestry Engineering 1993 Moscow Moscow State Academy of Law 1993 Moscow Moscow State Institute of Electronics and Mathematics (Technical U.) 1993 Moscow Moscow State U. of Geodesy and Cartography 1993 Moscow Moscow State U. of Railway Engineering 1993 Omsk Omsk State Pedagogical U. 1993 Rjazan Rjazan State Radio Engineering Academy 1993 Rostov-naRostov State Donu Pedagogical U. 1993 Samara Samara State Medical U. 1993 Tambov Tambov State Technical U. 1930 previous institution

1921 Electrotechnical Institute 1918 previous institution 1950 previous institution 1886 as Engineering College of Post and Telegraph 1907 Psychoneurological Institute 1930 previous institution 1878 previous institution 1995 Tula State U. 1931 Sverdlovsk Institute of Law 1931 previous institution 1930 previous institution 1918 Ivanovo-Voznesensk Polytechnical Institute 1952 Institute 1935 previous institution

1919 Moscow Institute of Forestry Engineering 1931 previous institution 1962 previous institution

1779 Moscow Institute of Geodesy 1896 Engineering School 1932 previous institution 1951 previous institution 1931 previous institution 1919 previous institution 1958 Tambov Chemical Engineering Institute

588

Universities founded in Europe between 1945 and 1995

RUSSIAN FEDERATION (IAU) (cont.) 1993 Volgograd Volgograd State University of Medicine 1994 Ekaterinburg Ural State Academy of Mining and Geology 1994 Krasnojarsk Krasnojarsk State Medical Academy 1994 Rybinsk Rybinsk State Academy of Aviation Technology 1994 SaintSaint-Petersburg State Petersburg Medical Academy 1994 Stavropol Stavropol State Medical Academy 1994 Tambov Tambov State U. 1994 1994 1994 1994 Ufa Uljanovsk Kirov Vorone z Vorone z Vorone z Groznyj Kirovy Kostroma Kurgan Jo skar-Ola Ussurijsk Primorskij Krai Ulan-Ude Ulan-Ude Ufa State Petroleum Technological U. Uljanovsk State Technical U. Vjatka State U. Vorone z State Academy of Forestry Engineering Vorone z State Academy of Technology Vorone z State Medical Academy N. N. Burdenko cen State U. Ce Vjatka State Humanitarian U. U. of Technology Kurgan State U. Marij State Technical U. Primorsky State Academy of Agriculture Burjat State Academy of Agriculture Burjat State U. 1962 previous institution 1917 previous institution 1942 Krasnojarsk Medical College 1955 previous institution 1907 Psychoneurological Institute 1937 previous institution 1930 Pedagogical Institute. 1994 merging with Institute of Culture 1948 Ufa Petroleum Institute 1957 Evening Polytechnic Institute 1963 previous institution 1918 Forestry and Agriculture Institute 1930 previous institution 1918 department of Voronezh U. ceno-Ingu 1972 Ce s State U. 1914 Pedagogical School 1932 Textile Institute Incorporating Kurgan Pedagogical Institute and Kurgan Mechanical Engineering Institute 1932 Povolzsky Forestry Institute 1957 Primorsky Agricultural Institute 1931 Agropedagogical Institute 1932 Pedagogical Institute, 1995 merged with local branch of Novosibirsk U. 1929 Higher School of the Ministry of Internal Affairs

1994 1994

1995 1995 1995 1995

1995 1995

1995 1995

1999

Moscow

Academy of Management of the Ministry of Internal Affairs of Russia U. U. U. of Pristina U. of the Arts U.

SERBIA (IAU) 1960 Novy Sad 1965 Ni s 1970 Kru sevac 1973 Belgrade 1977 Kragujevac

589

Appendix
SLOVAK REPUBLIC (EAU) 1949 Bratislava Academy of Fine Arts and Design 1949 Bratislava Academy of Music and Dramatic Arts in Bratislava 1949 Ko sice U. of Veterinary Medicine 1952 Nitra Slovak U. of Agriculture 1952 Trnava U. 1952 Zvolen Technical U. 1952 Ko sice Technical U. 1953 Zilina U. arik 1959 Ko sice Pavol Jozef Saf U. General Milan Rastislav 1973 Liptovsky anik Mikula Stef Military s Academy 1990 Tren c n College of Management 1992 Bratislava Police Academy 1992 Banska Matej Bel U. Bystrica 1992 Tren c n Alexander Dub cek U. SLOVENIA (EUA) 1975 Maribor SPAIN 1945 U. 1961 Association of Higher Education institutions 1387 Studium generale 1890 in Santander 1952 Estudio general de Navarra Opus Dei 1878 Jesuit College 1973 U. of Basque country

El Escorial Madrid Pamplona Bilbao Barcelona Bilbao Badajoz Madrid Madrid Cordoba Madrid Malaga Santander Valencia Barcelona Alcala de Henares Alicante Palma de Mallorca Cadiz Las Palmas

1960 1962 1963 1968 1968 1968 1968 1971 1971 1971 1971 1971 1971 1973 1977 1978 1978 1979 1979

Royal College of Higher Education Maria Cristina Pontical U. Comillas U. of Navarra Pontical U. de Deusto Autonomous (State) U. U. U. of Extremadura Autonomous (State) U. Polytechnic U. of Madrid U. National U. of Distance Education (UNED) U. U. Polytechnic U. Technical U. U. U. U. U. Polytechnic of Canary Islands

1847 Veterinary school National Tele-U. 1967 Civil Engineering School 1969 Polytechnical School 1968 Polytechnical Institute 1499 Studium generale 1483 Studium generale 1748 School of Medicine 1989 University of Las Palmas de Gran Canaria

590

Universities founded in Europe between 1945 and 1995

SPAIN (cont.) 1979 Leon 1982 Ciudad Real 1987 1989 1989 1989 1990 1991 1991 1992 1992 1993 1993 1994 1995 1995 Pamplona Madrid Vigo La Coruna Barcelona Barcelona Castello de la Plana Lleida Tarragona Ja en Madrid Seville Madrid Madrid U. U. of Castille-La Mancha Public U. of Navarra U. Carlos III U. U. U. Pompeu Fabra U. Ramon Llull U. Jaime I U. U. Rovira i Virgili U. U. San Pablo-CEU International U. of Andalusia U. San Antonio de Nebrija European U. of Madrid U. U. U U. 1968 Colleges U. Barcelonas faculties

Separated from U. of Santiago de Compostela

SWEDEN (EUA) 1954 Gothenburg 1960 Stockholm 1965 Umea 1973 Linkoping

1891 U. College 1878 U. College 1956 School of dentistry 1956 Branch of Stockholm U.

SWITZERLAND (No new U.) TURKEY (EUA) 1946 Ankara 1955 1955 1955 1955 1957 1959 1967 1973 1973 1974 1975 1975 1975 1975 1975 1978 1982 1982 Izmir Trabzon Istanbul Eskis ehir Erzerum Ankara Ankara Adana Diyarbakir Sivas Elazig Matatya Samsun Konya Bursa Kayseri Antalya Izmir U. Ege (Aegean) U. Karadeniz Technical U. i U. Bogazic Anaadolu (Anatolian) U. Ataturk U. Middle East Technical U. Hacettepe U. C ukurova U. Dicle U. Cumhuriye U. Firat (Euphrates) U. Inon u U. Ondokuz Mayis (19th May) U. Selc uk U. (Mount Ululag Olympos) U. Erdyes U. Akderiiz U. Dokuz Eylul U. 192543 Fac. Law, Letters, Science, and Medicine 1863 Private Liberal Arts College 1958 Academy of Commercial and Economic Sciences

1967 State Academy of Engineering and Architecture

591

Appendix
TURKEY (EUA) (cont.) 1982 Ankara 1982 Istanbul 1982 1982 1982 1982 1984 1987 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1993 1993 Istanbul Edirne Istanbul Van Ankara Gaziantep Bolu Aydin Afyon Balkesir Manisa C anakkale Kutahya Tokat Gebze S anlurfa Izmir Kara Kahraman Maras Krkkale Kocaeli Mersin Mugla Hatay Nigde Denizli Sakarya Isparta Zonguldak Istanbul Eskis ehir Istanbul Ankara Gazi U. Marmara U. Minar Sinan U. Trakya (Thracian) U. Yldz Technical U. Yuc unc u Yil U. Bilkent U. U. . Abant Izzet Baysal U. Adnan Menderes U. Afyon Kocatepe U. U. Celal Byar U. C anakkale Onsekiz Mart U. Dumlupnar U. Gaziosman Pas a U. Gebze Institute of Technology Harran U. Izmir Institute of Technology Kafkas U. Kahraman Maras Sutc u . Imam U. U. U. U. U. Mustafa Kemal U. U. Pamukkale U. U. Suleyman Demirel U. Zonguldak Karaelmas U. Koc U. Osmangazi U. Galatasaray U. Bas kent U. 1923 Teacher Training College 1883 Academy of Commercial and Economic Sciences 1911 Vocational College 1975 Teacher Training College

UKRAINE (IAU) 1954 Kharkhov 1965 1989

1992 1993 1993

Kharkiv Institute of Fire Safety Donetsk Donetsk State U. Kiev Inter-Regional Academy of Personnel Management Donetsk Donetsk State Academy of Management Donetsk Donetsk Technical U. Dnipropetrovsk Ukrainian State Chemical Technology U.

1937 Donetsk Pedagogical Institute

1921 Donetsk Mining College 1930 Dnipropetrovsk Chemical Engineering Institute

592

Universities founded in Europe between 1945 and 1995

UKRAINE (IAU) (cont.) 1993 Kharkov Technical U. of Radio Electronics 1993 Odessa Odessa State Polytechnic U. 1993 IvanoPrecarpathian Vasyl Frankivsk Stefanyk U. Ivano-Frankivsk 1994 Kramatorsk Donbas State Mechanical Engineering Academy 1994 Kharkova Kharkiv State Technical U. of Construction and Architecture 1994 Khmelnitsky Khmelnitsky State U. 1994 1994 1994 Kiev Kiev Kharkov Odessa Odessa Vinniytsya Kiev Kiev National Linguistics U. National Agricultural U. of Ukraine National Technical U. Odessa State Maritime U. Odessa State Medical U. 1930 Kharkiv Engineering Civil Construction Institute 1918 Odesa Polytechnical Institute 1940 Stanislav Teacher Training Institute 1953 Part-Time Branch of Donetsk Industrial Institute 1930 Kharkiv Engineering Civil Construction Institute 1967 Khmelnitsky Technological Institute of Consumer Services 1948 Kiev State Pedagogical Institute of Foreign Languages 1898 Department of Agriculture at Kiev Polytechnic Institute Kharkiv Polytechnical Institute, 1885 Kharkiv Practical Technological Institute 1930 Odessa Institute of Marine Engineers 1900 Medical Department of Novorosiysk U. Vinnytsya 1934 Vinnytsya Medical Institute

1994 1994 1994

1995

Vinnytsya State M.I. Pyrogov Memorial Medical U. National Technical U. of 1898 Kiev Polytechnical Institute Ukraine Kiev Polytechnic Institute 1881 U. College 1921 U. College

UNITED KINGDOM (IAU) 1948 Nottingham U. 1957 Leicester U. 1961 Brighton U. of Sussex 1961 Colchester U. of Essex 1962 Keele U. 1963 NewcastleuponTyne York Canterbury Hull Lancaster Norwich Exeter Coventry Bath U. U. U. of Kent U. U. U. of East Anglia U. U. of Warwick U. of Technology

1949 U. College of North Staffordshire 1834 Newcastle College of Medicine and Surgery 1953 Borrhwick Institute for Historical Research 1927 U. College 1922 U. College 1971 U. of Bath, 1804 Merchant Venturers Technical College 1831 Mechanics Institute 1891 Battersea Polytechnic Institute 1909 Technical Institute

1963 1964 1964 1964 1964 1964 1964 1966 1966 1966 1966

Bradford U. Guildford U. of Surrey Loughborough U.

593

Appendix
UNITED KINGDOM (IUA) (cont.) 1966 Uxbridge Brunel U. 1966 Edinburgh Heriot-Watt U. 1967 1967 1967 1969 1982 1983 1983 1990 1992 1992 1992 1992 Salford Stirling Dundee Milton Keynes Bolton Buckingham Southampton Edinburgh Chelmsford Poole Coventry KingstonuponThames Leeds Liverpool London Edinburgh NewcastleuponTyne Oxford Shefeld London Stoke-onTrent Manchester U. U. U. Open U. Bolton Institute U. Southampton Institute The Scottish Agricultural College Anglia Polytechnic U. Bournemouth U. U. U. Leeds Metropolitan U. Liverpool John Moores U. Middlesex U. Napier U. Northumberland U. Oxford Brookes U. Shefeld Hallam U. South Bank U. Staffordshire U. 1957 Regional College 1821 Edinburgh School of Arts and Mechanics Institute 1896 Royal Technical Institute 1881 U. College

1973 U. College 1856 Private Art School 1838 School of Art in Cambridge 1990 Bournemouth Polytechnic 1970 Coventry (Lancaster) Polytechnic 1970 Kingston Polytechnic 1970 Leeds Polytechnic 1970 Liverpool Polytechnic 1973 Middlesex Polytechnic 1964 Napier College of Commerce 1969 Newcastle Polytechnic 1970 Oxford Polytechnic 1969 Shefeld City Polytechnic 1892 Borough Polytechnic 1992 Staffordshire Polytechnic

1992 1992 1992 1992 1992

1992 1992 1992 1992 1992 1992 1992 1992 1992 1992 1993 1993

The Manchester 1970 Manchester Polytechnic Metropolitan U. Hudderseld U. 1970 Polytechnic of Hudderseld Wolverhampton U. 1989 Wolverhampton Polytechnic Birmingham U. of Central England in 1971 City of Birmingham Birmingham Polytechnic Preston U. of Central Lancaster 1828 Preston Institute for the Diffusion of Knowledge London U. of East London 1893 West Ham Municipal College Craneld U. 1945 College of Aeronautics Glasgow Glasgow Caledonian U. 1985 Central Institution

594

NAME INDEX

Abendroth, Wolfgang (190685), German jurist and political scientist 394 Adams, John Bertram (192084), British nuclear physicist 540, 545 Adenauer, Konrad Hermann Josef (18761967), German statesman 403 Adhemar, Joseph Alphonse (17971862), French mathematician 479 Adler, Alfred (18701937), Austrian psychologist 389 Adorno, Theodor Wiesengrund (190369), German philosopher 289, 290, 384, 385 Albee, Edward (b. 1928), American playwright 30 Alfred the Great (849899), king of Wessex 4 All` egre, Claude (b. 1937), French politician and scientist 5678 Althoff, Friedrich (18391908), Prussian Minister of Culture 18 Althusser, Louis Pierre (191890), French philosopher 392, 408 Arber, Werner (b. 1929), Swiss microbiologist and geneticist 454 Ari` es, Philippe (191484), French historian 411 Aristotle (384322 BC), Greek philosopher 4, 7 Aron, Raymond (190583), French philosopher, sociologist and political scientist 380, 388 Attlee, Clement (18831967), British statesman 77 Baader, Andreas (194377), leader Rote Armee Fraktion (= BaaderMeinhof group) 298

Bacon, Francis (15611626), English philosopher, scientist and statesman 9 Balibar, Etienne (b. 1942), French philosopher 392 Bar, Christian von (b. 1952), German jurist 422 Barlow, (James) Alan (Noel) (18811968), public servant 75 Barthes, Roland (191580), French philosopher 408 Bassi, Laura (171178), Italian physicist 182 Benedict, Ruth (18871948), American anthropologist 407 Bergstrasser, Arnold (184197), German political scientist 395 Bergstrasser, Ludwig (18831960), German statesman 394 Berlinguer, Luigi (b. 1932), Italian statesman 568 Biakowski, Grzegorz (193389), rector of the University of Warsaw 5567 Bishop, J. Michael (b. 1936), American immunologist 454 Bloch, Marc (18861944), French historian 411 Blossfeld, Hans-Peter (b. 1954), German sociologist 227 Boas, Franz (18581942), GermanAmerican anthropologist 407 Borodajkewicz, Taras (von) (190284), Austrian professor 296 Boudon, Raymond (b. 1934), French sociologist 211, 21213, 3801 Bourdieu, Pierre (19302002), French sociologist 381, 391

595

Name index
Bourricaud, Franc ois (192291), French sociologist 380 Boveri, Theodore (18621915), German biologist and cytogeneticist 454 Brachet, Jean Louis August (190998), Belgian biochemist 457 Braudel, Fernand (190285), French historian 96 Braun, Wernher von (191277), German physicist and astronautics engineer 540 Brecht, Arnold (18841977), German political scientist 392 Brill, Hermann (18951959), German statesman 80, 394 Brocker, Walter (190292), German philosopher 83 Brzezinski, Zbigniew (b. 1928), American statesman 388 Bud e, Guillaume (14671540), French legal humanist, diplomat and royal librarian 9 Bullard, Sir Edward (190780), British geophysicist 481 Bullock, Theodore Holmes (19152005), American zoologist 467 Caputo, Giuseppe (193691), Italian university politician 557 Carducci, Giosu e (18351907), Italian poet 557 Carrero Blanco, Luis (190373), Spanish statesman 305 Charlemagne (c. 742814), Holy Roman Emperor 4 Churchill, Winston (18741965), British statesman 77, 92, 93 Cicero, M. Tullius (10643 BC), Roman statesman and author 28 Clark, Burton (19212009), American educationalist 563 Coens, Daniel (193892), Belgian Minister of Education 314 Cohen, Stanley (b. 1942), American sociologist 302 Cohn-Bendit, Daniel (b. 1945), German-French politician 291 Comte, Auguste (17981857), French philosopher 379 Cossiga, Francesco (b. 1928), President of the Italian Republic 557 Courant, Richard (18881972), German mathematician 429 Cox, Richard Howard (b. 1925), American philosopher 389 Crick, Francis Harry Compton (19162004), British molecular biologist 453, 455 Croll, James (182190), Scottish geologist 479 Crowell, John (b. 1917) American geologist 478 Crozier, Michel (b. 1922), French sociologist 380 Dahrendorf, Ralf (19292009), German-British sociologist and philosopher 113, 258, 299 Darwin, Charles (180982), British naturalist 382 Debr e, Robert (18821978), French physician 502 Delors, Jacques (b. 1925), French economist and politician 555 Derath e, Robert (190592), French philosopher 389 Derrida, Jacques (19302004), French philosopher 408 Descartes, Ren e (15961650), French mathematician, scientist and philosopher 8 Devaquet, Alain (b. 1942), French politician 314 Dewey, John (18591952), American philosopher 278, 108 Dicey, A. V. (18351922), British jurist and constitutional theorist 419 Dilthey, Wilhelm (18331911), German historian 389 Dirac, P. A. M. (190284), British theoretical physicist 429 Dornberger, Walter Robert (18951980), German Army artillery ofcer 540 du Toit, Alexander (18781949), South African geologist 478 Dub cek, Alexander (192192), Slovak statesman 307 Duby, Georges (191996), French historian 411 Durkheim, Emile (18581917), French sociologist 376, 379, 407 Dutschke, Rudi (194079), spokesperson of the German student movement 290, 292, 296, 298 Easton, David (b. 1917), Canadian political scientist 390, 392 Ebbinghaus, Julius (18851981), German philosopher 91 Eisenstadt, Shmuel (b. 1923), Israeli sociologist 388 Erasmus, Desiderius (c. 14661536), Dutch humanist 9, 21 Erhard, Ludwig (18971977), German statesman 403

596

Name index
Eschenburg, Theodor Rudolf Georg (190499), German political scientist 394 Euclid (. c. 300 BC), Greek mathematician 28 Faure, Edgar (190888), French politician, essayist and historian 1069, 110 Febvre, Lucien (18781956), French historian 411 Fermi, Enrico (190154), Italian physicist 5467 Fiebiger, Nikolaus (b. 1922), German physicist and university politician 167, 177 Fischer, Jurgen (192394), German historian and university reformer 93 Fis ek, Nusret Hasan (191490), Turkish scientist and politician 513 Flechtheim, Ossip K. (190998), German political scientist 394 Flitner, Wilhelm (18891990), German educational theorist 93 Foucault, Michel (192684), French philosopher 391, 408 Fraenkel, Hermann (18881977), German classical scholar 394 Franco, Francisco (18921975), Spanish general and statesman 285, 305 Frederick I Barbarossa (112390), Holy Roman Emperor 6 Frederick William III (17701840), King of Prussia 10 Freud, Sigmund (18561939), Austrian psychiatrist 389 Friedeburg, Ludwig von (b. 1924), German philosopher and sociologist 392 Friedrich, Carl J. (190184), American political theorist 388 Frisch, Otto Robert (190479), Austrian-British physicist 546 Fromm, Erich Seligmann (190080), social psychologist, psychoanalyst and humanistic philosopher 292 Fulbright, J. William (190595), American senator 22, 33, 89, 180 Furet, Franc ois (192797), French historian 411 Gadamer, Hans-Georg (19002002), German philosopher 83 Gagarin, Yuri (183468), Russian cosmonaut 473, 474 Gandhi, Mohandas Karamchand Mahatma (18691948), political and spiritual leader of India 22 Gandol, Giuseppe (b. 1927), Italian jurist 422 Gaulle, Charles de (18901970), French statesman 75, 106, 108, 291 Gerven, Walter van (b. 1935), Belgian jurist 422 Gigon, Olof (191298), Swiss classical philologist 923 Gilcher-Holtey, Ingrid (b. 1952), German political theorist 300 Glass, H. Bentley (19062005), American geneticist and columnist 464 Goldschmidt, Richard Benedict (18781958), American geneticist 4667 Gorbachev, Mikhail (b. 1931), Russian statesman 311, 556, 557 Gouldner, Alwin W. (192182), American sociologist 378 Gret skina, Elsa (b. 1932), Estonian politician 311 Groves, Leslie (18961970), American Army Engineer ofcer 539 Haberler, Gottfried von (190095), Austrian economist 404 Habermas, Jurgen (b. 1929), German philosopher 289, 385, 392 Hahn, Otto (18791968), German chemist 546 Halban, Hans von (190864), French physicist 546 Hallstein, Walther (190182), German jurist and statesman 80 Hartshorne, Edward Y. (191246), American sociologist and university politician 91 Havel, Vaclav (b. 1936), Czech writer and statesman 309 Hayek, Friedrich August von (18991992), Austrian economist 404 Hegel, Georg Wilhelm Friedrich (17701831), German philosopher 388 Heisenberg, Werner (190176), German theoretical physicist 167, 177 Hennis, Wilhelm (b. 1923), German political scientist 395 Herskovits, Melville J. (18951963), American anthropologist 407 Hess, Harry Hammond (190669), American geologist 477 Hilbert, David (18621943), German mathematician 429 Hirsch, Fred (193278), American economist 233 Hitler, Adolf (18891945), German statesman 13, 74, 76, 96

597

Name index
Holmes, Arthur (18971965), British geologist 476, 478 Homans, Georges G. (191089), American sociologist 377 Horkheimer, Max (18951973), German philosopher and sociologist 289, 384, 385, 392 Horridge, G. Adrian (b. 1927), British geologist 467 Hospers, Jan (19272008), American geologist 477 Houtermans, Friedrich Georg (190366), Dutch-Austrian-German atomic and nuclear physicist 546 Humboldt, Alexander von (17691859), German scientist and explorer 22, 90 Humboldt, Wilhelm von (17671835), German philologist, philosopher, politician and educational reformer 1112, 1617, 289, 31, 86, 104, 108, 189, 209, 251, 257, 270, 335, 550, 553, 554 Huntington, Samuel Phillips (19272008), American political scientist 388 Hutton, James (172697), British geologist 478, 481 Janne, Henri (b. 1908), Belgian university politician 11920 Jarratt, Sir Alexander (b. 1924), British senior civil servant and Chancellor of Birmingham University 15, 114, 139 Jaruzelski, Wojciech Witold (b. 1923), Polish communist political and military leader 282, 308 Jaspers, Karl Theodor (18831969), German psychiatrist and philosopher 269, 553 Jeffreys, Harold (18911989), British mathematician, statistician, geophysicist, and astronomer 476 J lek, Lubor (192675), Czech academic historian 44 John Paul II (19202005), pope 19802005 557 Joliot-Curie, Ir` ene (18971956), French scientist 546 Joliot-Curie, Jean Fr ed eric (190058), French physicist 546 Jouvenel (des Ursins), Bertrand de (190387), French philosopher 388 Juan Carlos I (b. 1938), King of Spain 557 Kalanta, Romas (195372), Lithuanian student 311 Kallen, Denis (19222004), French educational commentator 40 Kennedy, John Fitzgerald (191763), American statesman 474 Kerr, Clark (19112003), American economist and university politician 20910 Keynes, John Maynard (18831946), British economist 209, 220, 235, 398, 399, 400, 404 Khrushchev, Nikita (18941971), Soviet statesman 218 Kilburn, Tom (19212001), British engineer 533 Kimmel, Michael Scott (b. 1951), American sociologist 301 King, Lester Charles (190789), South African geologist 478 King, Martin Luther (192968), American clergyman, activist and civil rights leader 290 Kissinger, Henry (b. 1923), American political scientist and statesman 388 Kogon, Eugen (190387), German sociologist and politician 394 Koakowski, Leszek (19272009), Polish philosopher and historian of ideas 306 Konig, Ren e (190692), German sociologist 384, 385 Kowarski, Lew (190779), French physicist 546 Koyr e, Alexandre (18921964), French philosopher of Russian origin 413 Krebs, Charles J. (b. 1936), Canadian zoologist 456 Kroeber, Alfred L. (18761960), American anthropologist 407 Kuhn, Thomas S. (192296), American philosopher 413, 434 Labrousse, Ernest (18951988), French historian 411 Lacan, Jacques-Marie-Emile (190181), French psychoanalyst and psychiatrist 408 Lando, Ole (b. 1922), German jurist 421, 422 Laslett, Peter (19152001), English historian 389 Lazarsfeld, Paul (190176), American sociologist 3778, 380 Le Pichon, Xavier (b. 1937), French geophysicist 478 Le Roy Ladurie, Emmanuel (b. 1929), French historian 411 LeGoff, Jacques (b. 1924), French historian 411 Leisegang, Hans (18901951), German philosopher 83

598

Name index
Lenin (Vladimir Ilyich Ulyanov, 18701924), Russian politician 82, 301, 388, 397 L evi-Strauss, Claude (b. 1908), French anthropologist 381, 389, 4078 Levinson, Daniel (192094), American psychologist 389 Lipset, Seymour Martin (19222006), American sociologist 373, 388 Litt, Theodor (18801962), German philosopher 83 Loewenstein, Karl (18911973), German philosopher and political scientist 394 Lorenz, Konrad (190389), Austrian zoologist 388 Lumley, Robert, British professor of Italian cultural history 303 Lynd, Robert Staughton (18931970), American sociologist 376 Lyotard, Jean-Franc ois (192498), French philosopher 412 Lysenko, Trom (18981976), Soviet agronomist 102 Machlup, Fritz (190283), AustrianAmerican economist 404 Malinowski, Bronislaw Kasper (18841942), Polish anthropologist 376, 406 Mandel, Ernest (192395), German philosopher 400 Mandrou, Robert (192184), French historian 411 Mannheim, Karl (18931947), German sociologist 269, 300, 383 Mao Zedong (18931976), Chinese statesman 292, 2979, 313 Marcuse, Herbert (18981979), German-American philosopher 28990, 292 Marshall, George (18801959), American military leader 23, 94, 399 Marx, Karl (181883), German philosopher and politician 300, 301, 303, 379, 3812, 388, 397, 400 see also under Soviet bloc in Subject index Matthews, Drummond (193197), British marine geologist and geophysicist 477 Mauss, Marcel (18721950), French sociologist 407 Maxwell, James Clerk (183179), British physicist 428 Mead, Margaret (190178), American anthropologist 389, 407 Meinhoff, Ulrike (193476), German left-wing militant 298 Mend` es-France, Pierre (190782), French statesman 13, 95, 380 Merton, Robert K. (19102003), American sociologist 3778, 380 Meynaud, Jean (191472), French political commentator 388 Mickiewicz, Adam (17981855), Polish writer 306 Milankovitch, M. (18791958), Yugoslavian geophysicist 479 Mills, Charles Wright (191662), American sociologist 378 Milo sevi c, Slobodan (19412006), Serbian and Yugoslavian statesman 559 Mises, Ludwig von (18811973), Austrian economist and philosopher 404 Mitterrand, Franc ois (191696), French statesman 114, 557 Mohammad Reza Shah Pahlavi (191980), Shah of Iran 14, 105, 290, 297 Moli` ere (Jean-Baptiste Poquelin, 162273), French playwright 10 Morgenstern, Oskar (190277), Austrian economist 404 Morgenthau, Hans (190480), American political scientist 77, 388 Mozart, Wolfgang Amadeus (175691), Austrian composer 10 Mussolini, Benito (18831945), Italian statesman 402 Napoleon I (Napoleon Bonaparte, 17691821), French emperor 11, 12, 31, 86, 214, 218, 5534 Nathans, Daniel (192899), American microbiologist 454 Neumann, Franz Leopold (190054), German political scientist 394 Newman, John Henry (180190), British Anglican, later Catholic theologian 209, 550, 553, 554 Newton, Isaac (16431727), British mathematician, physicist and astronomer 428 Noddack, Ida (18961978, born Ida Tacke), German chemist and physicist 546 Nora, Pierre (b. 1931), French historian 411 Oakeshott, Michael (190190), English philosopher 389 Oelssner, Fred (190377), German economist 83 Ohnesorg, Benno (194067), German student 105, 290

599

Name index
Oppenheimer, Franz (18641943), German sociologist 383, 403 Oppenheimer, J. Robert (190467), American theoretical physicist 539 Oxburgh, Lord (Ernest Ronald Oxburgh, b. 1934), British geologist and university politician 4802 Palach, Jan (194869), Czech student 308, 309 Pareto, Vilfredo (18481923), Italian sociologist and philosopher 376, 388 Parsons, Talcott (190279), American sociologist 372, 3767, 380, 406 Peers, E. Allison see Truscot, Bruce Peierls, Rudolf Ernst (190795), German-born British physicist 546 Pender, R. H., British university administrator 92 Piaget, Jean (18961980), Swiss philosopher 389 Pieck, Wilhelm (18761960), German politician 83 Pizzorno, Alessandro (b. 1924), Italian sociologist 382 Planck, Max (18581947), German physicist 80, 180, 187, 259, 265, 433, 446, 544 Plato (c. 427c. 347 BC), Greek philosopher 4, 13, 28, 76 Plessner, Helmut (18921985), German philosopher and sociologist 384 Polin, Raymond (19102001), French philosopher 389 Popper, Karl (190294), Austrian/British philosopher and economist 76 Radcliffe-Brown, Alfred Reginald (18811955), English social anthropologist 406 Riedl, Rupert (19252005), Austrian zoologist 388 Rips, Ilia (b. 1948), Latvian-born Israeli mathematician 31011 Robbins, Lionel Charles, Lord (18981984), British economist 1314, 97, 164, 165, 181, 22830, 5302, 533, 537, 541 Rokkan, Stein (192179), Norwegian political scientist 387, 388 Romanzi, Carmine Alfredo (191394), Italian microbiologist and university policy leader 557 Roosevelt, Franklin Delano (18821945), American statesman 77 Rousseau, Jean-Jacques (171278), French philosopher 910 Roversi-Monaco, Fabio (b. 1938), Italian jurist and university administrator 557 Russell, Bertrand (18721970), British philosopher 234 Sagan, Carl (193496), American astronomer 388 Salazar, Antonio de Oliveira (18891970), Portuguese statesman 285 Samuelson, Paul Anthony (b. 1915), American economist 404 Saussure, Ferdinand de (18571913), Swiss linguist 407 Saussure, Horace B en edict de (174099), Swiss physicist, geologist and meteorologist 478 Schairer, Reinhold (18931971), German educational expert 96 Schelsky, Helmut (191284), German sociologist 385 Schleiermacher, Friedrich Ernst Daniel (17681834), German theologian and philosopher 1112, 169 Schmid, Carlo (18961979), German politician and academic 105 Schmitt, Harrison (b. 1935), American geologist 476 Schneider, Erich (190070), German economic theorist 404 Schreiber, Georg (18821963), German historian and politician 923 Schweitzer, Bernhard (18921966), German archaeologist 83 Short, James F. (b. 1924), American sociologist 375 Simmel, Georg (18581918), German philosopher and sociologist 383 Sloman, Albert Edward (b. 1921), British Hispanicist and university policy leader 120 Small, Albion (18541926), American sociologist 375 Smith, Adam (172390), British economist 232 Snow, Charles Percy (190580), English physicist and novelist 538 Sorokin, Pitirim A. (18891968), Russian-American sociologist 376 Soros, George (b. 1930), American university sponsor 560 Speer, Albert (190581), German politician and architect 74 Speier, Hans (190590), American sociologist 269 Spencer, Herbert (18201903), English philosopher, liberal political theorist and sociological theorist 376, 382

600

Name index
Spengler, Oswald (18801936), German historian 388 Spranger, Eduard (18821963), German philosopher and psychologist 83 Springer, Axel (191285), German journalist and publisher 290 Stalin, Joseph Vissarionovich (18781953), Soviet statesman 76, 77, 82, 101, 218, 243, 311 Statera, Gianni (194197), Italian sociologist 300 Staub, Rudolf (18901961), German geologist 479 Stein (Heinrich Friedrich) Karl (17571831), German statesman 17 Sternberger, Dolf (190789), German philosopher 394 Stone, Lawrence (191999), British historian 412 Strassman, Fritz (190280), German chemist 546 Strauss, Leo (18991973), American philosopher 389 Suhr, Otto (18941957), German statesman 394, 395 Summer, Frank William (18401910), American sociologist 375 Sutton, John (191992), British geologist 481 Swift, Jonathan (16671745), Anglo-Irish political writer 241 Sylvester-Bradley, P. C. (191378), British geologist 481 Szilard, Leo (18981964), Hungarian-born American physicist 546 Taylor, Laurie (Laurence John) (b. 1936), British sociologist 181 Thatcher, Margaret (b. 1925), British stateswoman 537 Theodosius II (401450), Byzantine emperor 4 Thomas, William Isaac (18931947), American sociologist 375 Thyssen, Fritz (18731951), German businessman 96 Tinbergen, Jan (190394), Dutch economist 398, 400 Tito, Josip Broz (18921980), Yugoslavian revolutionary and statesman 30910 Tonnies, Ferdinand (18551936), German sociologist 383 Touraine, Alain (b. 1925), French sociologist 381 Trotsky, Leon (18791940), Bolshevik revolutionary and Marxist theorist 2979 Trow, Martin (19272007), American historian 58 Truman, Harry S. (18841972), American statesman 77 Truscot, Bruce (pseud. of E. Allison Peers) (18911952), British professor of Spanish 209 Ulbricht, Walter (18931973), German politician 83 Vadianus (Joachim von Watt) (14841551), Swiss humanist and professor, poet, reformer and rector of the University of Vienna 9 Varmus, Harold (b. 1939), American virologist 454 Veblen, Thorsten (18571929), Norwegian-American sociologist 376 Vierkandt, Alfred (18671953), German sociologist 383 Vine, Fred (b. 1939), British marine geologist and geophysicist 477, 481 Virchow, Rudolf (18211902), German physician 17 Voegelin, Eric (190185), German political philosopher 394 Voltaire (Franc ois-Marie Arouet, 16971784), French writer and philosopher 10 Waddington, C. H. (18191914), British philosopher 388 Wandel, Paul (190595), German politician 83 Ward, Lester Frank (18411913), American sociologist 375 Watson, James Dewey (b. 1928), American molecular biologist 453, 455 Weber, Max (18641920), German economist, jurist and sociologist 52, 381, 383, 388 Wegener, Alfred (18801930), German scientist, geologist, and meteorologist 476 Weizsacker, Carl Friedrich von (b. 1920), German physicist and philosopher 5467 White, Hayden (b. 1928), American historian 413 White, Michael (191083), British biologist and geneticist 466 Wiese, Leopold von (18761969), German sociologist 385 Wilamowitz-Moellendorf, Ulrich von (18481931), German classicist 18 Williams, Frederic Calland (191177), British engineer 533

601

Name index
Williams, Gareth (b. 1935), British economist 373 Wilson, Edmund Beecher (18561939), American zoologist and geneticist 457, 466 Wilson, J. Harold (191695), British statesman 481, 535 Wilson, J. Tuzo (190893), Canadian geophysicist 478 Wirz, Charles, museum curator 10 Wright, Quincy (18901970), American political scientist 388 Ziman, John Michael (19252005), British physicist 193, 424 Zimmermann, Reinhard (b. 1952), German jurist 4212 Znaniecki, Florian (18821958), Polish philosopher and sociologist 375

602

SUBJECT INDEX

Aarhus (Denmark), University 391 AAU see Association of American Universities Abitur see school-leaving examinations abstracting services 468 Academia Europaea 440 Academic Task Force 559 academies Early Modern 10, 262 Soviet 39, 87, 133, 446, 529, 544 access (to higher education) 52 equality of, as objective 108, 209, 228, 258, 271, 329, 481 increased 98, 112, 113, 331 Soviet policies 3940 see also mass higher education; persistent inequality accountability, calls for 1367, 195 ACE see American Council of Education administration head of see Registrar usage of term 1245 see also management admission increasing exibility 221 qualications for 18, 45, 21723 see also class; school-leaving examinations; social selection adult education, university involvement in 3589 see also lifelong learning advertising (of academic posts) 1734 AEG 543 age (of academic staff) 1657, 188 desirable structure 166 distortion of structure 173 increasing 134, 175

ageing population see third age agriculture faculties of 245 role in national economy 223 agriculture, graduate employment in 3434 Airbus Industries 440 Albania 557 student numbers 324 Albanians (in Kosovo) 310, 559 ALFA Programme 566 Algerian War, student organizations position on 287, 291 Algiers, University of 22 allocation of funds xed levels 152 exible 152 alterity 412 American Council of Education (ACE) 5701 American Journal of Sociology 376 American Sociological Association 375, 3778 Amiens (France), University of 265 Amsterdam Free University 392 University of 294, 3923, 400 anaesthesia, advances in 485 anaesthetics 183 animal populations, ecological study 457 Ankara (Turkey), University of Haceteppe 506, 513 Annales school 41011 anthropology 4058 cultural 407 diffusion theory 4056 links with political science 391 social 4067

603

Subject index
anti-nuclear movement, student involvement 289, 293, 536 antibiotics, development of 4856 Antwerp (Belgium), University of 294 apartheid, protests against 288, 293 APE see Asociaciones profesionales de estudiantes Apollo missions 4745 ArabIsraeli War (1967) 307 Arabic science 5 architecture 1819, 154 faculties of 245 Asia-Link 566 Asia/Pacic region, mobility programmes 566 Asociaciones profesionales de estudiantes (APE) 304 aspirantura (Soviet bloc qualication) 179 assessment international standards 23 political legitimization of procedures 23 see also evaluation; examinations; staff, academic Association for the Study of Medical Education 499, 503 Association of American Universities (AAU) 27 Association of Dutch Universities 159 Association of European Universities (CRE) 434, 59, 1001, 150, 158, 563, 564, 569, 570 Association of Universities and Colleges in Canada (AUCC) 5701 Association of University Teachers (AUT) 196, 2001 associations (of university staff) 199201, 210 political role 201 social signicance 200 astronomy 432 astrophysics 434, 443 Athens, University of 3056 Atomic Energy Authority 544 AUCC see Association of Universities and Colleges in Canada Austria 46, 130, 330, 568 accession to EU 55960 accreditation body 254 course structure 255, 257 degrees 337 economics, teaching of 4045 faculty structure 245 funding system 2589 graduate employment 342, 343; female 354 growth in student numbers 41, 61 management structure 144 Ministry of Science and Research 35 Nazi educational policies 198 non-university institutions 62, 63, 242 political science 3956 rectors conference 90 research council 98 salaries 186 specialized universities 244 staff structure 170, 177, 178, 245, 2512 student/graduate numbers 324, 325 student migrations to 219 student movements 287, 2967 AUT see Association of University Teachers autogestion, as rallying principle of French movement 291 autonomy, university 289, 345, 115 increasing 5634 loss of: in former Yugoslavia 559; in Soviet bloc 86 of management 13740 (perceived) threats to 118 in post-1968 France 1078 in post-war Germany 80 relationship with management 1312 in staff appointments 174 Azerbaijan 31112 baby boom 1623, 211, 227 baccalaur eat see school-leaving examinations bachelors degree 2545, 335 downgrading of value (in exact sciences) 445 equivalence 33940, 366 in medieval universities 67 non-university 338 status/employment value 2556 in US colleges 21 Baden-Wurttemberg (Germany), University of 394 Barcelona (Spain), University of 402 Basel (Switzerland), University of 396 behaviourism 390, 392, 393, 395, 397 Belarus 117 Belfast, Queens University 253 Belgium 37 admissions policy 218, 219 course structure 253 degree awards 254 economics, teaching of 401 graduate schools 259 history, teaching of 412 information policy 5960 linguistic/administrative divisions 37, 53, 55, 269, 503

604

Subject index
medical studies 505 ministries of higher education 35 non-state sector 556 non-university education 55, 567 rectors conference 100 research council 98 student movements 279, 288, 2934, 302, 303 student numbers 324; by subject 327 student/university expansion 41, 50, 262 teaching conditions 192 wartime resistance movement 32, 33 Belgrade (Serbia), University of 131, 558 Berkeley, Cal., student activism 14 Berlin Free University 44, 84, 289, 395 School of Engineering 242 University of see Humboldt University, Berlin Wall, fall of 553, 5578 (see also Soviet bloc, impact of collapse) Bern (Switzerland), University of 396 Big Science institutions (EU) 4389, 53841 Bilbao (Spain), University of 402 biological sciences availability of training 459 challenges facing 4578 costbenet analysis 464 costs of research 464 divisions 4512 early retirements of academics 463 educational resources 4657 graduate employment 4701 historical development 4512 impact of environmental movement 452 new subdivisions 4512 new techniques/approaches 4513, 465, 4678 publications 45960, 464 reasons for study 4645 review journals 467 role of Internet 4689 role of university 45964; limited extent of 4604 speed/scale of advance 457, 464 teaching methods 4678 textbooks 4667 undergraduate study 4648 see also molecular biology BIOMED (research programme) 525 birth rates, uctuations in 21011, 227, 229 see also baby boom blood transfusions 485 Bochum (Germany), University of 104 Bologna (Italy), University of 4, 219, 492 1988 anniversary festival 557, 572 as medieval model 4, 20, 553 Bologna Declaration (1999) 560, 56874 as catalyst for change 5701 criticisms 571 innovations 569 objectives 570 strengths 5689 Bologna Process 117, 120, 139, 262, 366, 565, 567, 5714 Bordeaux (France), University of 379 Bosnia, political upheavals 558 BP 543 brain drain 134, 448 Bretton Woods Treaty (1944) 399 Brigate Rosse (Red Brigade) 2989 Bristol (UK), University of 428 British disease 234 British Journal of Medical Education 499 British Medical Association 515 British Transport Commission 544 Brno (Czech Republic), Masaryk University 565 Brussels, Free University of 55, 294, 401 Brussels Pact (1948) 24, 94 Buckingham (UK), University of 2401 Budapest (Hungary) 7 University of Sciences 244 Bulgaria 467, 103, 208 rectors conference 100 restrictions on university curriculum 38 screening bodies 87 student/university expansion 50 business administration, schools of 55 business studies, as university subject 404 Cadarache (France) 539 California Institute of Technology (CalTech) 532 Cambridge University 188 admissions policy 219 collegiate system 16, 214 earth sciences 477 exact sciences 428 faculty structure 243, 244 migrations to 270 political science 392 radio telescope 541 science park 547 social sciences 383 staff traditions/background 174, 175 teaching methods 248, 257; innovations 24950 Campaign for Nuclear Disarmament (CND) 536 campus layout 257

605

Subject index
Canada 566 cancer biological research 4545, 457 screening 490 Capenhurst (UK) 539 car travel/parking, provision for 154 Carlsbad see Karlsbad Carnegie Foundation Survey 191 Catholic Church, as organizing power 62 Catholic universities, support for New Left 3023 CCC see Council for Cultural Cooperation CEA see Commissariat a energie atomique ` l CEC see Commission of the European Communities Central Electricity Generating Board 544 Central European University (CEU) 560 Central Intelligence Agency (CIA), funding of student organizations 281, 282, 293 Centre europ een pour lenseignement sup erieur (CEPES) 103, 150, 567 Centre for Educational Research and Innovation (CERI) 14950 Centre national de la recherche scientique (CNRS) 107, 175, 180, 187, 1934, 265, 380, 446, 543 centrifugation 453 CEPES see Centre europ een pour lenseignement sup erieur CERI see Centre for Educational Research and Innovation CERN see Conseil europ een pour la recherche nucl eaire CEU see Central European University chairs see professors chemistry 193, 424, 436 curricular design 445 decline in numbers 536 inorganic 429 interaction with other sciences 433, 4412 theoretical 428 chemotherapy 486 CHER see Committee for Higher Education and Research; Council of Europe Chicago, University of 27, 375 Childrens University 20 chiliastic utopianism 3001 China 22 chromatography 4523 chromosome research 4545 CIA see Central Intelligence Agency class (social) diminishing connection with academic achievement 213 and resistance to expansion 210 and university entrance 21113, 22332 (see also social selection) climate change/research 474, 47880, 482, 4834 Club of Rome 536 Cluj (Romania), King Ferdinand I University 85 CNAA see Council for National Academic Awards CND see Campaign for Nuclear Disarmament CNRS see Centre national de la recherche scientique cognitive science 432 cold war, mirrored in student organizations 283 College of Dutch University Rectors 90 colleges of advanced technology 165 collegiate universities 9, 214 Cologne University 244, 384, 407 Cologne School (sociology) 385 colonies, universities in 22 see also North America Columbia University, New York 3778 Columbus Programme 566 Comecon see Council for Mutual Economic Assistance Comenius programme for school education 121 Comett see Community Programme for Education and Training for Technology Comit e national d evaluation (France) 159 command economy, impact on higher education 3640, 46, 4950 commerce, schools of 55 Commissariat a energie atomique (CEA) ` l 265 Commission of the European Communities (CEC) 29, 11819, 122, 139, 158, 421, 525, 539, 5423, 556, 5623, 564, 569 Committee for Higher Education and Research (CHER) 24, 1001, 150 Committee of Vice-Chancellors and Principals (CVCP) 15, 901, 114 communications techniques 157 Communist Youth Association (KISZ) 215 Community Programme for Education and Training for Technology (Comett; later Leonardo da Vinci) 26, 120, 271, 556, 564 competence fostering of, as universities mission 31920 qualication for employment 320

606

Subject index
competition for employment opportunities 233 government incentives 11416 relationship with expansion 235 for staff 171 for students 248 Compi` egne (France), Universit e de technologie 543 comprehensive schools 216 comprehensive universities 330 computers/computerization 5335 cost 534 EU research projects 541 resource management 156 role in medical studies 521 role in science teaching 469 role in scientic research 4345 students skills, curricular incorporation of 24950 timetabling 157 see also information technology; Internet; personal computers condensed matter physics 434 Confederation of European Union Rectors Conferences 26, 11819, 1212, 563, 569 Conf erence des recteurs des universit es suisses 90 Conference of Baltic University Rectors 560 Conference of Danubian Rectors 560 Conference of European Rectors (CRE) 24, 25, 26, 94, 118, 1212, 361, 5502, 556, 557, 559, 561, 5623, 567, 569 Conference of Ministers of Higher Education of Socialist Countries 103 Conference of University Administrators (CUS) 150 conscription 88 Conseil europ een pour la recherche nucl eaire (CERN) 98, 4389, 440, 441, 540 consortia, formation of 149 consultancies 547 consumer side of education 266 continental drift 476, 478 Continental Europe (distinguished from UK) attitudes to students 2579 completion rates 2578 technology, study/research 5312 undergraduate/postgraduate division 256 contract law 421 contracts rst academic appointments 172 growth in role/scale 145 handling by national consortia 149 cooperation, inter-university 8995 within Eastern Europe 1023 across EU 934, 1201 scientic 98101 Soviet restrictions on 945 Copenhagen Roskilde University 249 University of 295, 391 Corpus iuris, as qualication 7 correspondence (between scholars), as academic forum 9 Cosenza (Italy), University of 523 cosmology 434, 443 costbenet analysis 157 council(s) see governing body Council for Cultural Cooperation (CCC) 24 Council for Mutual Economic Assistance (Comecon) 95, 556 Council for National Academic Awards (CNAA) 254, 337 Council of Europe 24, 934, 99, 117, 339, 399, 569 see also Committee for Higher Education and Research; Council for Cultural Cooperation Cracow (Poland) 7 CRE see Association of European Universities; Conference of European Rectors credits, course system based on 168, 253, 270, 271, 336, 560 crime rates 487 crisis management 1523 critical path analysis 157 Critical Theory 386 critical universities, establishment of 290, 294 Croatia 100 political upheavals 558 Croatian Spring (1971) 310 Cuba 103 cultural capital theory 212 cultural change, impact of 2679 cultural studies, departments of 2478 Curie Institute 265 curricula baroque features 240 debates on 241 design 157 developments in organization 1323 diversication 263, 264 Eastern vs Western models 21314, 2467 evolution 23842, 2723 extent of regulation 3356

607

Subject index
curricula (cont.) impact of changes in staff structure 2467 impact of governmental policies 273 impact of research 2636 medical 520 overloading 88 post-war reform 529 professional relevance 338, 356, 35961, 4445; reforms in line with 3601, 3667 reorganization 571 responsibility for 24353 social inuences 274 specialization 23940, 255, 263 standardization 336 student role 2669 CUS see Conference of University Administrators customers, demands of 135 CVCP see Committee of Vice-Chancellors and Principals Cyprus 100 Czech Republic 61, 100, 565 Czechoslovakia 103, 212 admissions policy 219 division of students by subject 327 non-university education 57, 63, 64 political division 269 post-1956 reforms 1012 post-war reconstruction 46, 2089 rectors role in administrative structure 142 religious foundations 55 screening bodies 87 Soviet occupation (1948) 279 stafng levels 164 student movements 109, 266, 284, 3078, 309 university curriculum 38 Dartmouth College (USA) 28 DEA see Diploma of Advanced Studies degrees attempts at standardization 33941 (see also European Union); limited success 3401 certication 3368 course structure 2545 impact on social selection 320 levels of 335 occupation-specic 255 respective value, debates on 340 right to grant 2534, 3378 stages of study 336 status/employment value 2556 structural reforms 33841 title designations 337 see also bachelors; doctorates; Habilitation; masters degree; terminal degrees democracy/ies, university systems under 21 democratization (of universities) 1089, 126 dual meanings 1089 in Eastern Europe 142 aws in process 11012 impact on law faculties 416 legal enforcement 188 of staff structures 188, 2456 student movements calls for 31213, 31415 demographics see birth rates Denmark 50 admission controls 258 degrees 335, 337, 338 enrolment rates 227 life expectancy 487 medical studies 494, 501 non-university institutions 62, 63 political science 3912 postgraduate studies 261 rectors conference 100 research council 98 student movements 27980, 295 student numbers 324; by subject 327 technical university 154 university management 139 dentistry 486, 490, 520, 521 postgraduate training 522 departments see faculties deregulation 1378 devolution, tendency towards 149, 152 dinosaurs, extinction of 480 Diploma of Advanced Studies (DEA, France) 25960 diplomas see degrees discipline see security discipline(s), academic see faculties disease, incidence/treatment of 4878, 511 impact on medical studies 4934 distance learning 135, 1901, 238, 535 diversication (of university education) 11213, 2389, 3578 positive impact 113 see also curricula DNA (deoxyribonucleic acid) 429 discovery 453 ngerprinting 457 importance 4534 role in later research 4547, 4589 docent, rank of 245 doctorates 335, 340

608

Subject index
defence of thesis, requirement of 260, 261 and denition of university 434 downgrading of value (in exact sciences) 445 honorary 557 as requirement for university teaching 25960 in sociology 372, 377 from Soviet academies 39 university monopoly on 193 see also Habilitation; postdoctoral research/training doctors (medical) compulsory retraining 496 contracts with UK Department of Health 515 contribution to health education 488 migrations to/from UK 499500, 501 professional requirements 48990, 495 protests by 4978 public attitudes to 488 see also health care; medical students; medicine dropout rates 224, 2589 in medicine 519 dual institutional model (of higher education) 3578 Dubrovnik, Croatia 558 duration of courses 226, 46970 concerns expressed about 338 extension 340 as indicator of achievement 340 Durham Assembly (1989) 557 EAIA (association dealing with international relations) 150 Early Modern universities curriculum 8 role in European society 810 study perspective (horizontal vs vertical) 89 earth science see earth system science; geology earth system science 474, 4803 East Berlin see Berlin East Germany see German Democratic Republic Eastern Europe academic relations with West 117 admissions systems 116 delayed response to Western trends 142 educational legislation 117 graduate employment 334 involvement in EU integrative programmes 565 low academic salaries 186 national identities, resurgence of 562 post-cold war reconstruction 59, 11617; common trends 11617 technological institutes 544, 548 technological limitations 426, 430, 437, 4478; structural reforms required 448 university management 132 wartime devastation 3 see also Soviet bloc ecology 4569 modern approaches 456 economic constraint theory 21213 economic crisis, global (1970s) 299, 31213, 3301 economic enterprises, partnerships with universities 133 economics 398405 changing parameters 3989 international treaties/agreements 399 Leuven faculty 313 specialization of courses 400 specialized institutes 4001, 404 ECTS see European Course Credit Transfer System Edinburgh Heriot-Watt University 547 University of 492 Edinburgh Declaration (1988) 512 Education Act (UK 1944) 75 education policy/ies debates on viability 3312 incoherence 2401 EFMD see European Foundation for Management Development Egypt, Anglo-French invasion of (1956) 293 EHESS see under Paris ELDO see European Space Vehicle Launcher Organization electron microscopy 453 electrophoresis 453 employability 367 employment, graduate analysed by profession 3467 areas of change 3658 in biological sciences 4701 career rewards 331 changing opportunity structure 3435 cross-border 335 displacement 331 diversity of prospects 333 earnings 347, 349 easing of problems/attitudes (1970s/80s) 3325, 3634, 365 educational level appropriate to 348 employers expectations 3556, 4701

609

Subject index
employment, graduate (cont.) xed-term contracts 343 impact of post-war expansion 321 increasing exibility 2201, 3323, 350 pessimism regarding 3302, 363, 470 in physical sciences 4445 preparation for 31920 pressure on universities 3623, 3667 recruitment criteria 334 relationship with eld of study 348, 3503 responsibility for 364 role of professional bodies 341, 353 selection criteria 349, 3545 student expectations 320, 4701 suitability to qualications 34750 in technology 5456 transition to, duration/complexity 3412, 343, 470 universities adaptation to changing conditions 320, 32735, 35662; debates/problems 332, 3567, 364; range of options 3289, 3325; structural reforms 32930, 3579, 366 value of planning 3312, 333, 364 vertical shift 345 vocational qualications 3556 (see also vocationalism) widening of debate on 3345 see also unemployment energy systems, biology of 4556 engineering 242 decline in numbers 536 degree titles 337 distinguished from pure science 4245, 441 graduate employment 353 England, collegiate university system 9, 214 see also United Kingdom Enlightenment era/ideology 1011 entrepreneurial management, transition to 1920, 28, 11416, 202, 364, 563 see also economic enterprises environmental movement concerns about technology 536 impact on curricula 536 impact on estate management 154 interaction with biological sciences 452 interaction with geological sciences 483 EQUIS programme 1589 Erasmus see European Action Scheme for the Mobility of University Students Erasmus-Mindus programme 573 Erfurt (Germany) 7, 113 ESF see European Science Foundation ESIB see European Student Information Bureau ESMU see European Centre for the Strategic Management of Universities ESPRIT see European Strategic Programme for Information Technology Essex (UK), University of 392 estate management 1535 changing priorities 154 increasing professionalism 1545 proportion of annual budget 154 social implications 154 technical services 154 wiring of buildings 155 Estonia 61, 31112 rectors conference 100 ETA see Euskadi ta askatasuna ethnic conict, impact on university life 269, 5589 ethnology 381, 405, 4078 links with political science 391 EUA see European University Association EUCEN (association dealing with continuing education) 150 EURASHE see European Association of Institutions in Higher Education Euratom Treaty (Treaty establishing the European Atomic Energy Community, Rome 1957) 99100, 119, 399, 539, 542 EURECA see European Research Common Action Europe contributions to biological research 45960 educational/cultural model 5724 fragmentation 558 management associations 14950 moral reconstruction (post-war) 325 pan-European ideology 910, 11822 (see also Europeanization) staff structures 171 university management 1312; general trends 138; transfer of experience 158 university model, decline in inuence of 34, 212 see also Continental Europe; European Union European Action Scheme for the Mobility of University Students (Erasmus) 26, 29, 1201, 180, 271, 272, 273, 335, 339, 519, 556, 560, 5646, 571 participation levels 2712 European Association of Institutions in Higher Education (EURASHE) 569

610

Subject index
European Centre for the Strategic Management of Universities (ESMU) 150 European Coal and Steel Community 399, 542 European Commission see Commission of the European Communities European Conference of Ministers of Education 11617, 118, 119 European Congress 93 European Convention on the Equivalence of Certicates of Secondary Education 1953 99 European Convention on the Equivalence of the Time of Study at University 1956 99 European Convention on the Recognition of Academic Degrees and Diplomas 1959 99 European Council of Economic Ministers 118 European Course Credit Transfer System (ECTS) 121, 271, 560, 5645, 569, 572 European Foundation for Management Development (EFMD) 1589 European Graduate College, Florence 25 European Higher Education Area 645 European Molecular Biology Organization 525 European Research Common Action (EURECA) 26, 120 European Roundtable of Industrialists 361 European Science Foundation (ESF) 26, 120, 440, 482, 525 European Space Agency 440, 5401 European Space Research Organization (ESRO) 98, 540 European Space Vehicle Launcher Organization (ELDO) 540 European Strategic Programme for Information Technology (ESPRIT) 26, 120 European Student Information Bureau (ESIB) 569 European Union/Community 246, 1356, 202 application of qualitative criteria 122 categorization of diplomas 33940 Common Educational Policy 29 conference of education ministers 256, 30 denition of university 554 development of university systems 601 directives on academic recognition 339 enlargement 2356 establishment of guidelines 25 funding agencies 5423 harmonization 239; of degrees 30, 99100, 118, 33941, 366, 420; of medical accreditation 5056, 514; opposition to 121, 563; problems of 2712; of undergraduate studies 120 integrative strategies 55960, 5612, 5724 (see also Europeanization) inter-university cooperation 934 law: convergence of systems/studies 4202; establishment of general principles 421; European Law School, calls for 4201; historical research 4212; rules on contract law 421 management initiatives 159 medical research programmes 525 mobility programmes 26, 11516, 1201, 180, 1878, 2712, 3678, 5556, 5646, 569; popularity/ imitation outside EU 565, 5667, 5712 moves towards 93 national variations 330, 5634 opposition to pan-European institutions 246, 11819 relations with university leaders 1212 retention of national systems 239 scientic initiatives 43841, 482, 53941; collaboration of research groups 439 European University, proposals for 24, 99100, 118 academic opposition to 119 see also European Graduate College; European University Institute European University Association (EUA) 26, 29, 59, 94, 570, 571 European University Institute, Florence 119 Europeanization 2930, 11920, 5558 Euskadi ta askatasuna (ETA, Basque Fatherland and Freedom) 305 evaluation 1956, 562 anthropological approach 249 see also assessment; management; self-assessment; staff exact (mathematical) sciences collaboration of research groups 439 collective research 4357 common culture 429 curricula/course structure 4446 dened 424 divisions between 4268; erosion/ rearrangement 429 equipment, increasing cost/sophistication 4367 ethical debates 4434, 448

611

Subject index
exact (mathematical) sciences (cont.) European role in global developments 4256, 447 expansion in resources/personnel (196075) 426, 447 focus on research 425 future challenges 4479 global collaboration 441 hybrid subdisciplines 4312 increasing cosmopolitanism 4401 industrial involvement 435, 437, 440; in research 4424 interdisciplinarity 428, 42935, 436 international exchanges/collaborations 429, 43741 levelling off period (197595) 426 major research centres 4289 multi-author papers 4356 new research technologies 4301 overlap with other sciences 432 post-war reconstruction period (194560) 4256, 429, 437 staff requirements 437 subdivisions 428 summary of post-war developments 4467 textbooks 429 examinations administration 197 national (for university admission) 21819 role in degree structure 2523; diminishing 250 students selection of date 2578 see also school-leaving examinations exchanges, academic 8990 decrease 11516 EastWest 117 see also mobility; names of subjects expansion, in university/student numbers 3, 12, 40, 416, 104, 1334, 201, 2079, 426 arguments for 2325 continuation/renewal (1980s) 2334, 2356 desirability 2323 driving forces 1334, 209, 214 economic impact 1367 (fears of) decline in standards 165, 22930 funding 236 impact on age structures 1667 impact on class distinctions 212 impact on curricula 262 impact on graduate employment 321, 3645, 470 impact on staff structure/numbers 1635, 2456 newsworthiness 233 patterns of development 2313 resistances 20910 socio-economic objectives 3289 statistics 44, 4652, 601 Fachhochschulen (FRG) 2267, 329, 358, 361 faculties/departments as basis of university structure 1301, 239, 243; weakening 131, 1689 distribution of student numbers 3257 diversity of organization 2445 divisions between 1301, 4278 nancial responsibilities 152 fragmentation 1689 loss of role in curricular development 248 in medieval university 4, 9, 16, 243 ordering by subject matter 16970 over-subscription 45 ranking order 241 rearrangements 243, 2478 resource management 1512, 153 strengthening 247 see also heads of department Faculty of Workers and Peasants, Greifswald 40 Falangists see Franco (index of names); Sindicato espanol universitario FAST see Forecasting and Assessment in the eld of Science and Technology Federacion universitaria democratica espanola (FUDE) 304 Federal Republic of Germany 46, 212, 544 academic exchanges 8990 access routes/gures 2268 age structure 167 birth rates 227 career structures 2512 course structure 2545, 25760, 336, 361 curricular reform 360 degrees 337, 338 distance learning 535 division of students by subject 327 geography, teaching of 409 graduate employment 333, 3434, 3546; female 354 history, teaching of 412 Institute for Talent Research 96 as international model 978 medical studies 4912, 5034, 505, 514, 519 migration of rejected students 219

612

Subject index
Ministry of Education and Science 35 new foundations 52 non-university education 57, 64, 113, 2267, 32930 (see also Fachhochschulen) political science 3935 professional qualications 341 research council 80, 98, 180, 3945, 503 resource management 152 science council 967, 104, 114 scientic training/research 967 social selectivity 223, 2245 sociology 3846 stafng 1767, 362; data 163; numbers 164 student movements 105, 266, 287, 28991, 301, 302, 307 (see also Berlin); collapse 298; governmental/ social response 110, 111, 267, 2901, 302 student/university expansion 412, 44, 48, 50, 104; growth rates 262 support staff 181 teaching posts/course structure 169 university management 1378; role of Kanzler 143, 144; separation of roles of ofcers 151 upgrading of establishments 43 women students 222, 228 FEDORA (association dealing with student orientation) 150 feminist theory 264 FernUniversitat Hagen (Germany) 535 nalization, theory of 4335, 436 nance 117 administration 129 crisis (1980s) 1516, 11314, 124 techniques 1578 Finland 46, 568 accession to EU 55960 course structure 336 degree awards 254 ethnic divisions 269 graduate employment 350 management structure 1423 medical studies 501 non-university institutions 62, 63 postgraduate studies 261 rectors conference 100 research council 98 staff structure 178 stafng levels 164 student movements 110, 288, 296 student/university expansion 41, 48, 50 teaching conditions 193 university locations 53 Florence University 292, 381 Fontenay (France) 539 Ford Foundation 387 Forecasting and Assessment in the eld of Science and Technology (FAST) 120 fortress Europe 5734 fossil fuels, burning of 480 founders/foundation dates, fabrication of 4 France 46, 130, 571 admission controls 45, 218, 21920 age structure 166 anthropology 4078 assessment system 114, 159, 562 attendance levels 58 biological research 458 career structures 171, 172, 2512 course structure 2545, 336 cultural theory, developments in 248 curricula 239; responsibility for determining 248 degrees 253, 335 economics, teaching of 398, 4012 educational ideology 356 educational system 7, 31, 239 foreign teachers 109 funding system 2589 geography, teaching of 409 graduate employment 343, 345, 347, 3489, 351, 355 history, teaching of 41012 law studies 417 mature students 211 medical studies 492, 5023, 517; costs 508; postgraduate 5023 Ministry of Universities 35 Nazi occupation 74 new universities 20, 48 non-university education 32, 423, 55, 57, 58, 59, 113, 234, 242, 329, 358, 5434, 545 nuclear projects/capability 539 policy in occupied Germany 789 political science 3901 post-revolutionary university model 11 post-war reforms 1314, 75 professional qualications 341 professorial appointments 173 public lectures 17 rectors conference 100 regionalization 53 research organizations 98, 180, 1934, 265, 266, 446 Revolution 10, 572 salaries 185, 186 scientic training/research 956 secondary education 210 secularization of education 214 social sciences 3712

613

Subject index
France (cont.) social selectivity 2236 sociology 37981 specialized training institutions (Revolutionary/Napoleonic era) 1011, 5534 staff associations 2001 stafng 1756; control of appointments 174; data 163; numbers 164 student movements 14, 1056, 2667, 279, 286, 287, 291, 307, 313, 314; collapse 2978; governmental response 1069 (see also Loi de lorientation . . . ) student numbers 324 student/university expansion 412, 50, 61, 107, 335; growth rates 262 teaching conditions 1923 teaching structure 249 technology, study/research 532 university administration/management 131, 139, 140, 143 wartime resistance movement 32 Frankfurt, University of 19, 80, 104, 384, 398, 403, 407 Frankfurt School 28990, 3856, 392 Fraunhofer Institutes 443, 529, 544 freedom, intellectual, principle of 12, 170, 251, 524 Freiburg University 79 Freiburg School (economics) 395, 398, 4034 Friends of the Earth 536 FUDE see Federacion universitaria democratica espanola functionalism 3767, 380, 406, 408 further education, use of term 229, 234 Gas Board 544 General Agreement on Tariffs and Trade (GATT) 566 General Medical Council 4989, 501, 514, 516 general practitioners independence of central system 501 numbers 505 postgraduate training 5002 production, as aim of medical studies 491, 510, 51213, 51516 Geneva University 260, 396 Ghent University 294 gentleman see honn ete homme Geo-Traverse Project 439 geography 249, 4089 links with political science 391 geology 424, 428, 432 concentration of resources 4813 future requirements 483 interaction with other sciences 4412 local nature of studies 4734, 4823 major topics 473, 474, 4834 marine 4823 planetary 473, 4746, 482, 483 political transformations 4803 Georgia 31112 German Democratic Republic 40, 103, 395 academics perks 186 adaptation to Soviet system 824 assimilation after reunication 62, 177, 558 defections to West 83 defence of German traditions 83 history, teaching of 412 post-war reconstruction 467, 814 sociology 386 staff structure 179 student movements 284 student/university expansion 50 German Rectors Conference 90 Germany admissions policy 21920 anthropology 407 curricula, responsibility for 248 decline of legal system 415 degree awards 2534 diversity of Lander policies 177 duelling fraternities 287 economics, teaching of 398, 4034 educational ideology 356 faculty structure 243, 244 foreign students 22 geological studies 482 graduate employment 34550, 351, 367, 427 international/global inuence 1213, 267, 1778, 214, 225, 372, 391, 550 junior academic staff 172 law studies 417 mature students 211 military technology 540 Nazi educational policies 198 non-university institutions 62, 63, 165, 242, 544 political history 415 post-war exodus 415, 4289 post-war reconstruction 1314, 7684, 913; academic societies 801; Four Ds programme 778; fundamental reform plans 81; promotion of international contacts 7980; university autonomy 80 professorial appointments 168, 169 research institutes 180, 194, 265, 446 retirement ages 178

614

Subject index
role of research 2623 salary structure 1845 science council 13 secondary education 210 social background of academics 174 social sciences 3712 sociology 3834 staff appointments 174 staff associations 201 staff experience 362 staff/research evaluation 1956 staff structure 171, 180, 188 student mobility 258, 270 teaching conditions 191, 1923 teaching traditions 189, 190, 2689 university administration 197 wartime destruction of universities 528 women academics 183 see also Federal Republic of Germany; German Democratic Republic; Nazis/Nazism; Prussia Germersheim (Germany), Higher School for Translators 79 GI Bill see Servicemens Readjustment Act glaciation, geological investigations 47880 Glaxo 543 globalization 226, 2023 Goodenough Report (1944) 498 Gothenburg, University of 122 Gottingen, University of 111, 384 governance, university adaptation to new requirements 145 structure 1401 see also management governing body, role in management structure 140, 141 government agencies, supra-national 5423 government(s) see state(s) coles (France) 1078, 175, 214, grandes e 219, 235, 242, 265, 338, 401, 529, 543, 545, 548, 5534 grants 19 research 5414 Graz University 244 Greece 46, 503 growth in student/institution numbers 41, 47 rectors conference 100 student migrations from 219 student movement 3056 Greifswald, University of 40 Grenoble, Institut Laue-Langevin 439 Grenoble Charter 286 Groningen University 392, 400 Habilitation 167, 1767, 179, 25960, 335, 340 habitus, sociological concept of 381 Hamburg (Germany), University 384, 407 Harvard University 27, 3767, 413 Harwell (UK) 539 heads of department, resource management responsibilities 151, 153 health care assessment of quality 511 costs 490 demand for 4889, 490 as human right 488 international prioritization 491 patterns of delivery 48990 personal responsibility, diminishing awareness of 488 professionals, increasing range/ specialization 487, 489 (see also doctors (medical); nursing) Heidelberg (Germany) molecular biology laboratory 525 University 91 Helsinki (Finland), University 295, 296, 528 Hessen (Germany), University 394 high energy accelerators 540 high energy physics 434, 436, 440, 443, 444 Higher Attestation Commission (Soviet bloc) 87 Higher Education Framework Law (Hochschulrahmengesetz, FRG 1976/1985) 177, 330, 360 higher education institutes see non-university institutions historical approach to study 371 displacement 3745 Historical Compendium of European Universities (1984) 5512 history of science and technology 413 history, teaching of 249, 40914 career opportunities 414 heterodox nature 41213 links with geography 409 post-war change of direction 410 History of the University in Europe (Vols. IIV) 573 genesis 5502 structure/volume divisions 5525 honn ete homme, as product of university system 8 honours see titles Hull (UK), University of 293 human capital, education as investment in 2323 Human Genome Project 4589 benets 4589

615

Subject index
humanism 810 degeneration 10 Humboldt University, Berlin 169, 284, 492 1893/1900 public addresses 1718 foundation/founding ideals 1012, 289, 2623 social sciences 384, 394 student unrest 14, 84, 233 Hungary 103, 212 admissions policy 218, 219 ideological control 215 life expectancy 487 post-1956 reforms 1012 post-war reconstruction 46, 85, 208 rectors conference 100 restrictions on university curriculum 378 secularization of religious foundations 214 social selectivity 2245 specialized universities 2434 staff structure 171, 179 student movements 266, 2835 uprising against Soviet control (1956) 280, 2845, 293 women academics 182 hydrodynamics 434 IAU see International Association of Universities IBM 194 Iceland geological studies 477 medical studies 501 rectors conference 100 research council 98 ICI 543, 547 ICPs see Inter-University Cooperation Programmes idleness, social/philosophical attitudes to 234 involuntary 235 IFREMER see Institut franc ais de recherche pour lexploitation de la mer IMCS see International Movement of Catholic Students IMHE see Institutional Management of Higher Education India 22 industry collaboration on scientic research 435, 4414, 4604, 543, 547; benets 4634; cultural divide 4434; new institutions 443; R&D departments 442; threat to academic ideals 4434, 449 funding of medical research 5245 graduate employment in 3435, 353 infant mortality, decrease in 487 informality (in staffstudent relations) 251, 2689 information technology 133, 135, 4301, 432, 5335, 538 Innsbruck (Austria), University of 396 INRA see Institut national de la recherche agriculturelle INRP see Institut national de la recherche p edagogique INSERM see Institut national de la sant e et de la recherche m edicale Institut franc ais de recherche pour lexploitation de la mer (IFREMER) 265 Institut national de la recherche agriculturelle (INRA) 265 Institut national de la recherche p edagogique (INRP) 265 Institut national de la sant e et de la recherche m edicale (INSERM) 265 Institute of Physics 427 Institutional Management of Higher Education (IMHE) 14950 instructor class 2512 Inter-University Cooperation Programmes (ICPs) 271 interdisciplinarity 1323, 3601 in exact sciences 428, 42935, 436 Interdisciplinary Research Centres 443 International Association of Universities (IAU) 234, 5960, 92, 100, 150 International Council of Scientic Unions 480 International GeosphereBiosphere Programme 480 International Movement of Catholic Students (IMCS, Pax Romana) 281 International Student Conference (ISC) foundation 27980 growth 2801 loss of credibility/downfall 282, 293 signicance 2823 International Union of Christian Democrats (IUCD) 281 International Union of Socialist Youth (IUSY) 281 International Union of Students (IUS) 2789, 282 breakdown of relations within 27980 departures from 27980 opposition to ISC 280 signicance 2823 International Young Catholic Students (IYCS) 281

616

Subject index
internationalization 3678 Internet origins 440 provision of access to 155 role in science teaching 467, 4689 speed of communication 469 invisible university see virtual university Ireland 46 degrees 335, 3378 graduate employment 3423, 351 information policy 5960 medical studies 499 nineteenth-century institutions 550, 554 non-university education 57 professional qualications 341 rectors conference 100 research council 98 support staff 181 ISC see International Student Conference Italy 130, 212, 330, 568 age structure 166 class system 213 course structure 253 curricula 336, 571 degrees 337 economics, teaching of 402 geology 473 graduate employment 344, 347, 3489 history, teaching of 412 medical studies 505 Ministry of Higher Education and Research 35 new foundations 523 non-state sector 556 non-university education 57 post-war policies 75 professorial appointments 173 proportion of universities to other institutions 222 rectors conference 100 research council 98 salaries 185, 186 sociology 3812 staff appointments 174 staff structure 178 stafng levels 164 student/graduate numbers 324, 325 student movements 10910, 266, 2912, 301, 302, 307; disintegration 2989; governmental/social response 302 student/university expansion 41, 44, 48, 61; growth rates 262 support for European University 99 teaching methods 250 tuition fees, importance to university economy 2589 IUCD see International Union of Christian Democrats IUS see International Union of Students IUSY see International Union of Socialist Youth ivory tower, university as criticism/demolition of concept 3, 1521, 158, 163, 360 evolution of image 16 as nineteenth-century ideal 1617 IYCS see International Young Catholic Students Japan 22, 212, 216 European competition with 114 private universities 214 Jena (Germany), battle of (1806) 31 JET see Joint European Torus Jewish teachers/students Nazi expulsions 198, 384 Soviet bloc campaign against 307 Johns Hopkins University, Baltimore 27 Joint European Torus (JET) 438, 53940 Joint Research Centres 443, 5423 Joint Study Programme 5556 junior staff 1723 duration of appointments 1723 progression within institution 173 promotional opportunities 167, 2512 relations with undergraduates 268 role in teaching structure 2489 Jussieu University 267 Kaiserslautern, University of 52 Kanzler see registrar Karlsbad (Germany) agreement (1819) 12 Kazakhstan 31112 Keele (UK), University of 293, 392 Kharkov (Ukraine), University of 283 Kiel (Germany), University of 244, 384, 404 Kiev (Ukraine), University of 283, 397 KISZ see Communist Youth Association Klagenfurt (Germany) 245 University of Educational Sciences 244 knowledge, growth in 1323, 1678, 273, 3667, 460, 5378 Koln see Cologne Kondratieff cycle 58 Konigstein (Germany), Agreement (1949) 801, 393 Kosovo 310, 559 La Palma (Canary Is.), Northern Hemisphere Observatory 439

617

Subject index
labour market efciency, as driving force for expansion 209 gender ratios, shift in 220 relationship with educational systems 2201, 273, 3289 language teaching, new methods 24950 laser technology 431 Latin America 22, 54, 566, 5712 Latvia 100, 31012 Latvian Academy of Agriculture 37 Lausanne (Switzerland) school of engineering 242 University 260 law 1301, 244, 41422 case-study method 416 celebrated cases 420 convergence of European systems 41920 difculty of courses 41719 graduate employment 3512 links with economics 401, 402 national character 41416, 41920, 422 new elds 418 popularity with students 41617 private, study of 418 professional training 417 public, study of 418 rapidity of change 41819 reduction of course options 417 specialization 419 teaching methods 249, 416 teaching of, combined with legal practice 414 underfunding of faculties 416 law and economics movement 419 laws see legislation; litigation; management lecturer, rank of 245 lectures 190, 239 optional attendance 257 Leeds (UK), Metropolitan University 2478 legislation compliance with 145 health and safety 154 proliferation, impact on law studies 41819 rapid changes in 112 see also names of countries/laws Leicester (UK), University of 383 Leiden (Netherlands), University of 294, 392, 492 Leipzig (Germany), University of 384 Leningrad (Russia) Conference (1991) 561, 562 University 283, 397, 561 Leoben (Austria), University of Mining 244 Leonardo da Vinci programme see Community Programme for Education and Training for Technology Leuven (Belgium), Catholic University 55, 288, 2934, 299, 302, 31215 library usage, pre-/post-Internet 4689 licentiates degree 67, 340 Li` ege (Belgium), University of 294 life cycle, of elds of study 434 life expectancy, increasing 4878 lifelong learning 336, 359, 555, 570 see also third age Limburg, University of 249 Lingua programme (for the promotion of foreign language skills) 121, 271 Linz (Austria), University 245 Lisbon Recognition Convention (European Convention on the Recognition of Qualications concerning Higher Education in the European Region 1997) 103, 567 Lisbon Summit (2000) 573 Lithuania 100, 31112 litigation medical 488, 511 settlement of internal disputes by 1456 Liverpool (UK), University of 392 od z (Poland), University of 308 logit regressions 212 Loi dorientation de lenseignement sup erieur (Loi Faure) (France 1968) 1069, 110, 131, 140 achievement of objectives 1079 implementation 1067 provisions 106 Loi no. 8452 sur lenseignement sup erieur (France 1984) 140, 25960 London charity hospitals 498 Imperial College of Technology 254, 477 medical schools 498, 500, 501, 518 School of Economics (LSE) 293, 299, 383, 392, 399, 406 School of Engineering 242 smog, deaths from (1952) 452 student congress (1945) 278 University of 49, 55, 97, 233, 254; medical studies 492, 499 weighting 185 lottery, role in admissions 219, 518 Louvain (Belgium), University of 401 Lublin (Poland) Catholic University 85, 87 Maria Curie-Skodowska University 85 Lund (Sweden), University of 295, 409 Luxembourg 100

618

Subject index
Lyngby (Denmark), school of engineering 242 Maastricht (Netherlands), University of 506 European Law School 4201 Maastricht Treaty 1992 121, 202, 399 Macedonia 559 Madrid Autonomous University 154, 506 Complutense University 44, 402 Magna Charta Universitarium 557 magnetometry 477 Mainz (Germany), University 79 Malta, University of 154 man, nature of 5 management, university 1245 accountability 1367 areas covered by 1489 balance of power 141 changes in routine/equipment 12830 competition with academic leaders 150 consortia/support networks 14950 degree of autonomy 13740 evaluation standards 159 external parties involvement in 158 and governance 14450 handling of internal disorder 1478 historical development 1324, 137, 15960; national variations 13940 impact of technological change 1345, 155 increased openness 1467 increased size/complexity of operation 148, 149 increasing inuence/role 132, 137, 146, 1578 inuence of law on 1456 interaction with external environment 159 internal forces for change 1324 internal leadership role 1467 internal quality management 159 isolation from academic community 146, 149 levels of functioning 149 maintenance of old traditions 127 new skills/techniques 144, 147, 1569; in 1980s 158; in 1990s/2000s 1589 quadrilateral structure 1404; shifting roles within 141 range of positions/activities 128, 160 role of rector/vice-chancellor 1413 separation of teaching and research 1367 socio-political forces for change 1356 support from specialized professions 128 techniques 1559 traditional skills 155 usage of term 124 see also estate management; resource management; systems approach The Managerial Revolution in Higher Education (Rourke/Brooks, 1956) 125 managerialism 125 Manchester (UK), University of 55, 160, 533, 547 Manhattan Project 5389 Manila (Philippines), Conference (1980) 5501 Marburg (Germany), University of 244 Discussions 91, 923 market, relationship of university with 20, 59, 115, 216, 2401, 537 Mars, geological investigation 475 Marxism see Soviet bloc; names index mass higher education, drive towards 413, 329 see also access Massachusetts Institute of Technology (MIT) 27, 532 masters degree 335 and denition of university 434 equivalence 340, 366 as rst degree 254 in medieval universities 67 non-university 338 in political science 391 in university type establishments 43 in US colleges 21 materials science 4323, 442 subdisciplines 433 mathematical sciences see exact sciences mathematics 193, 424, 428 links with political science 391 pure 428, 443, 446 matriculation 21723 evolution 220 mature students 220, 555 see also adult education; lifelong learning; third age Max Planck Institutes see Planck, Max, in names index media internal 1467 managers dealings with 148 medical students 51819 age of entry 518 background 518, 519 lifestyle/popular image 519 motivations 519

619

Subject index
medical students (cont.) selection 518 unrest among 5045 work experience 518, 519 medicine, practice of advances 4856, 48990 alternative 488, 490 critiques 4901 EU regulations 118 graduate employment 346, 351, 499500 public attitudes to 4889 redening of objectives 491 specialization 486, 488, 489; young doctors preference for 505 universities contribution to 526 working conditions 486, 499, 500 see also doctors (medical); health care; nursing medicine, study of aims/objectives, debates on 512 breakdown of system (1950s) 4935 certication 505 clinical facilities, selection of 510 costs 50711, 515, 521 course structure 492, 520 criticisms 512, 51314 disillusionment among graduates 51314, 516 examinations system 4945, 512 experimental schools 506 faculty governance 517, 524 funding criteria 5089 future challenges 526 graduation process 505 integrated teaching 5067 internships 4912, 493, 494, 496, 498, 521 length of courses 492, 494, 514; national variations 5056 limitation of entry 505 national associations 521 overcrowding of curriculum 514 postgraduate training 496, 499, 5001, 5023, 505, 51011, 5213; extent of universitys role 522 practical experience 4912, 4934, 5056, 519, 522 primary health care courses 51213 professional preparation 491, 4923, 4956, 510, 513 public attitudes to 51011, 518, 526 reforms 95, 495507; outcome 51116; problems of implementation 51416 research 5236; concentration of resources 525; evaluation 524; funding 5235; international collaborations 525; national organizations 523; spread across departments/areas 524 responsibility for funding 50910 sources of pressure for change 5035 specialized colleges/academies 37, 492, 4967, 517 specialized courses 495, 516; student preference for 51213 staff structure 245, 517 strengthening of universities role 4978 studentteacher relationships 51718 teaching methods 4914, 517, 5201 teaching staff: incomes outside university 186; numbers 51617 technological advances 507 three-stage structure 496, 497 see also medical students medieval universities alternatives to 7 completion rates 7 criticisms 7 curriculum 67 degree structure 67 guilds 200 key values 56 marketing 20 models for 46, 553 openness 6 prescribed texts, attitudes to 6 revival of ideals 271 social function 7, 16 sources, attitudes to 56 student unrest 147 study norms 5 teaching posts/ideology 168 see also faculties Memorandum on University Education in the European Union (1991) 26 mental illness, incidence/treatment 486, 4878 mergers 357 meritocracy 175, 188, 213, 2234, 320 metallurgy 428 meteoric impacts, geological investigation 4756, 480 meteorology 441, 541 Metropolitan-Vickers 547 Mexico 566 Michigan, University of 267, 387 microscopy 431 Middle Ages see medieval universities middle-level positions, graduate employment in 345 migrations, impact of 269 Milan (Italy) Bocconi University 402 Catholic University of 292, 302

620

Subject index
ministers (of state), role/remit 35 see also European Conference of Ministers of Education Ministry of Defence (MoD, UK) 542 Mittelbau (German staff structure) 1767 mobility (of academic staff/students) 1878, 202, 2702, 561, 5646 efforts to promote 338, 33941, 3678, 570 (see also European Union) opposition to 270 problems of (in science subjects) 427, 471 reductions in 1878 thematic networks 5656 between university and industry/research institutes 187 models, organizational 21317 modules, course structure based on 2701 European adoption 271 objections to 2701 molecular biology 4312, 4536 EU research projects 525, 541 relationship with ecology 4567 Mongolia 103 Montan Union see European Coal and Steel Community Morrill Act (US 1862) 31 Moscow Conference (1987) 556 University 283, 397 multiversities 23940 Munich School of Engineering 242 University 44 Munster (Germany), University/School 385 Nanterre (France), University 233, 267, 291 Narodowy zwia zek studentow (NZS) 3089 narratives 5535 National Aeronautics and Space Administration (NASA) 5401 National Coal Board 544 National Defense Education Act (US 1960) 38 National Health Service 486, 493 creation of career opportunities 499501 planning 498 relationship with medical education 498 National Insurance Act (UK 1911) 501 National Physical Laboratory 533, 544 National Research Development Corporation 547 national service, compulsory 220 National Union of Students (NUS) 267, 278, 27980, 286, 2878 opposition to libertarian moves 293 nationalism 562, 571 involvement of student movements 31012 NATO see North Atlantic Treaty Organization navigational colleges 7 Nazis/Nazism 1989 execution of student protesters 278, 308 impact on education: in Germany 384; in occupied territories 32, 334, 745, 84, 117, 4045 impact on German legal system 415 impact on post-war consciousness 3723 see also resistance movements; Second World War Netherlands 130, 212 admission controls 45, 219, 258 attendance levels 58 course structure 2545, 336, 361 curricular divisions 114 degrees 254, 337 economics, teaching of 4001 evaluation procedures 562 exact sciences 446 faculty structure 248 geology 473, 482 graduate employment 331, 347; unemployment 342 graduate schools 259 health care 489 history, teaching of 412 information policy 5960 medical studies 492, 5012, 505, 506, 509, 518 Nazi occupation 74 non-state sector 55 non-university education 57, 2412 political science 3923 proportion of universities to other institutions 222 rectors conference 90, 100 research council 98 sociology 375 staff/research evaluation 195 staff structure 1778, 249 stafng levels 164 student movements 11011, 279, 2867, 2945 student numbers 324; by subject 327 studentteacher relations 268 student/university expansion 41, 50, 55; growth rates 262 teaching conditions 191

621

Subject index
Netherlands (cont.) university management 139, 143, 159 wartime resistance movement 32, 33 women academics 182, 183 network analysis 157 New Left 283, 293, 296, 3003 The New Scientist (periodical) 466 New Social Movements 303 new student movement (195869) 14, 97, 1056, 124, 233, 2667, 28897, 360, 363 afliation with workers movements 292, 2989, 304, 3089 aims 108 anniversary celebrations 312 at Catholic universities 3023 cultural element 3012 disintegration 292, 2979, 31213, 315; causes 31516 dress codes 302 fragmentation 297, 299 governmental responses 10613; negative impact 113; positive impact 113 impact on management 135 impact on social sciences 378, 393, 395 impact on teaching 198, 199, 256 inheritors (1980s) 313, 314 key features 301 legacy 31216 managerial responses 1478 media attention 148 medical students protests 502, 5045 nature 299303 in non-democratic countries 30312 occupation of university buildings 2912, 3056, 308 orientation 3001 origins/development 2889 public attitudes to 2901, 292, 302, 536 suicide protests 308, 31011 underlying psychology 301 violence employed by 292, 2989, 301, 305 violent suppression 292, 30512 new universities (1960s/70s) 14, 201 architecture 154 social sciences 383 Newcastle Polytechnic 471 Night of the Barricades (1011 May 1968) 291 Nijmegen (Netherlands), Catholic University 294, 299, 392 non-state sector 546 range of disciplines 55 non-university institutions 1213, 568, 613 academic drift 3578 categorization 567 degrees, awarding/status 338 dividing line from universities 423 expanding range of types 412, 113, 2223 integration into multidisciplinary universities 357 prestige, superior/equal to universities 242, 5434, 548 rivalry with universities 87 in Soviet bloc 367, 45, 867 specialization 1011, 201, 378, 43, 867, 11213, 353 upgrading to university status 43, 4852, 65, 165, 2334, 32930, 3645 see also dual institutional model; polytechnics; short-cycle higher education Nordplus 519 North America colonial period 22, 28, 29 integration/mobility programmes 566 North Atlantic Treaty Organization (NATO) 934, 989, 445, 559 North Korea 103 North-West German University Conference 913 Northern Ireland 217 Norway course structure 253 degrees 335, 338 educational ideals 2556 geology 473 graduate employment 3445 medical studies 501, 508 non-university education 57, 113, 329 postgraduate studies 261 rectors conference 100 regionalization 53 research council 98 staff structure 246 stafng levels 164 student/graduate numbers 324, 325; by subject 327 student involvement in administration 267 student/university expansion 412, 48 subsidy of studies abroad 219 teacherstudent ratios 252 teaching conditions 192 university management 139 Nottingham (UK), University of 383 nuclear physics development of technology 5467 ethical debates 448 industrial involvement in research 444

622

Subject index
misguided application 447 wartime/post-war developments 53840 see also anti-nuclear movement nursing 4867, 520 postgraduate training 5223 NUS see National Union of Students NZS see Narodowy zwia zek studentow Odense (Denmark), University of 391 OECD see Organization for Economic Cooperation and Development OEEC see Organization for European Economic Cooperation ofce equipment 1289 oil supply/crisis see economic crisis, global open system, change to 1467, 162 Open University (UK) 19, 135, 1901, 211, 228, 229, 234, 474, 4801, 482, 535 Open University of the Netherlands 535 Ordinarius, ofce of 168, 194, 245, 269 organization and methods techniques 1567 Organization for Economic Cooperation and Development (OECD) 23, 99, 117, 149, 156, 158, 209, 2212, 3213, 3257, 3289, 333, 353 Organization for European Economic Cooperation (OEEC) 23, 934, 399 over-qualication, and graduate employment 3301, 334, 3489 overcrowding 258 protests against 2667 Oxford University 188 admissions policy 219 collegiate system 16, 214 computer equipment 534 faculty structure 243, 244 foundation 4 funding 542 joint degrees 532 migrations to 270 political activism 293 PPE degree 392 social sciences 383, 406 staff traditions/background 174, 175 teaching methods 248, 257 technological studies/research 530, 536 Paris Acad emie royale des sciences 9 Dauphine University 4012 Ecole des hautes e tudes en sciences sociales (EHESS) 380 Ecole libre des sciences politiques 391 Ecole nationale dadministration 13, 32 Ecole pratique des hautes e tudes 380, 410 World Conference on Higher Education (1998) 567 Paris University 553 800th anniversary celebrations 5678 appeal to staff/students 188, 2656 division into specialized institutions 11213 foreign students 22 management 160 medical faculties 492, 502, 508 as model for academic world 4, 12, 20 social sciences 37980 student unrest 14, 1056, 219, 233, 291, 504 party schools 86 passive learning, challenges to 249, 2501 Pasteur Institute 265 patronage, role in academic appointments 172 Pax Romana see International Movement of Catholic Students P ecs (Hungary), Medical University 506 performance indicators 153 persistent inequality (of educational opportunities) 21113 historical background 21213 personal computers, use of 5345 Perugia (Italy), University of 292 pharmaceutical industry, contribution to medical research 486 pharmacy, study of 183 Philadelphia chromosome 454 Philips 543 philosophy, study of 1301, 243, 244 in East Germany 83 photocopiers, development/academic importance 535 photosynthesis 455 physical sciences 4245 Physical Society 427 physics 424, 428, 432 curricular design 445 decline in numbers 536 interaction with other sciences 433 new research technologies 430 subdivisions 4345 theoretical 428 see also names of subdivisions e.g. high energy physics Physikalisch-Technische Reichsanstalt 544 PISA see Programme for International Student Assessment Pisa (Italy), University of 292 planning, corporate dened 151

623

Subject index
planning, corporate (cont.) increasing exibility 152 integration of resource management with 1502, 158 Planning and Management in Universities (Fielden/Lockwood, 1973) 126 plate tectonics 473, 474, 481, 482, 483 birth of theory 478 precursors/evolution of theory 4767 Poland 103, 212 admissions policy 219 control of student/staff activities 88 curriculum 247 faculty structure 2445 graduate employment 348, 349 growth in student/institution numbers 50, 61, 62 junior academic staff 172 March Movement 3067 medical studies 51819 non-university institutions 63 overloading of curricula 88 post-1956 reforms 1012 post-war reconstruction 46, 845, 2089 rectors conference 100 religious foundations 55, 85, 87 screening bodies 87 social selectivity 223, 2245 staff structure 171, 179 stafng levels 164 student movements 109, 280, 282, 284, 3069 student numbers 324 views on role of university 102 wartime destruction 528 wartime resistance movement 32, 33, 74 women academics 182 working-class students 39 political economy, shift to right 316 political science 244, 38698 conceptual uncertainty 3867 evolution as university subject 3878, 3917 key issues 38890 left-wing tendencies 389 numbers of teachers 3878 (perceived) need for study 387 psychological approach 38990 political/social change 2201, 2635 impact on management 146 impact on teaching/research 274; negative 2634; positive 2645 role of university in 135 see also new student movement political theory/ies, development/ implications 264, 273 see also under Soviet bloc politicization (of university staff/teaching) 1979 coinage of term 198 polytechnics 104, 113, 165, 329 course structure 361 curricula 58 degree awards 337 dividing line from universities 42 staff association 200 student numbers 2289 teaching conditions 193 upgrading to university status 49, 63, 1745, 2478, 254, 358, 482 Porto (Portugal), University of 122 Portugal 7, 46 accession to EU 555 course structure 255 degree awards 254 growth in student/institution numbers 47, 50, 61 life expectancy 487 non-university education 57, 63 post-war policies 756 staff structure 178 stafng levels 164 student/graduate numbers 325 student movements 285, 305 post-behaviourism 390, 393 post-structuralism 408 postdoctoral research/training 446, 470, 545 postgraduates changes in system 2601 deferring of career choices/ unemployment 343 diplomas 340 staff/public attitudes to 257 postmodernism 264, 316, 409 Potsdam Agreement (1945) 34, 778 Poznan (Poland) 284 University 37 PPBS (Planning Programming and Budgeting Systems) 156 Prague (Czech Republic) Charles University 243, 244 Coup (1948) 279 IUS Congresses (1946/56) 2789, 280 Spring (1968) 307 University 278 Prague Convention 1972 1023, 339 president see rector press ofces, introduction of 19 printing, development of 7 Pristina (Kosovo), (unofcial) University of 559 private academic circles 7, 10 see also academies

624

Subject index
private sector, funding of universities/ colleges 236, 266 see also research private universities 214 privatization 545, 59, 601, 2401 problem-based learning 249 professors abolition 170 administrative duties 1967 age of appointment 188 appointment 1734; from within university (Hausberufung) 1734 division from junior staff 172 dress code 268 of economics 404 extraordinary 245 female 1823 nancial/social position (in East) 186 guarantees 1701 honorary 180 of medicine 51718 multiple salary scales 177, 188 national variations 1749 one per subject, dissolution of theory 168 parallel chairs 169 part-time 178, 185, 245 professional experience outside academia 362 proliferation 186 proportion of teaching staff 175, 176, 177 qualications 259 retirement age 178 role in academic structure 239, 246, 265 social status 202 of sociology 3845 visiting (from abroad) 180 working hours 1923 see also Ordinarius Programme for International Student Assessment (PISA) 23 provincialization, processes of 34, 21, 524 deciding factors 53 Prussia 1718 academic salaries 1845 modernization programmes 1012, 1819 rectors conference 90 university administration 1401 see also Germany public relations, managerial experience/ requirements 1478 public service professions, graduate employment in 3512, 353 public undertaking, education as 54 publications, role in academic careers 175 quality, as integrative factor 5614 cooperation initiatives 5623, 5723 criteria 562 relationship with national interests 562, 5634 quantum theory 445 Radical Student Alliance (RSA) 293 radioisotope technology 453 reader, rank of 245 reconstruction, processes of 645, 7495, 162, 201, 3278 expectations 73 national policies 756 phases 74 speed 745 rector (vice-chancellor/president) appointment 142, 143, 315 new requirements 1467 recognition as managerial head 1423 role in management structure 140, 1413, 151 see also rectors conferences rectors conferences 904, 1001, 11819, 1212 in Eastern Europe 560 international 934 see also names of specic bodies Red Army Faction see Rote Armee Fraktion red brick universities 214 Red Brigade see Brigate Rosse reformatio in melius, medieval concept of 45 reforms 3, 30 administrative 14 Early Modern 89 nineteenth-century modernizations 1113 post-war 1314, 323 see also reconstruction; reformatio in melius Regensburg (Germany), University of 104 Reggio Emilia, Italy 553 regionalization see provincialization registrar (head of administration), role in management structure 1401, 1434, 151 broadening of role 144 convergence across Europe 1434 registration fees, increases in 31213, 314 religion/religious studies dwindling inuence 21415 international student organizations 281 modern institutions 55, 65, 87, 214

625

Subject index
religion/religious studies (cont.) partitioning of universities by 243 relationship with medieval scholastic ethos 56 separation from universities 87 see also Catholic Church; Catholic universities research as basis of reputation 193, 459 challenges to universities supremacy in 133 collective 4357 costs 464 evaluation 195, 524 full-time employment in 1801 funding 426, 5235, 5413 government-funded establishments 544 impact on curricula 2636 international centres 4389 international programmes 23, 1201 medical 5236 movement of frontiers 4445 multinational teams 441 originality, need for 264 personal nature 193 place in universities mission 262; shift in emphasis 2625 preparation for careers in 425 private sector funding 194 pure vs applied 194, 241, 4423, 5245, 545 relationship with teaching 16970, 1945, 444, 446 role in academic careers 173, 1801, 189, 1934, 246, 256 separation from teaching 170, 1934, 2656, 446 small units, optimal use of 4378 Soviet policy 389 strategic 443 techniques 157 technological requirements 1345 in technology 529 undergraduate participation 2645 see also exact sciences research centres/institutes 131, 133 research councils 98 resistance movements, relationship of universities with 32, 33, 74 resource management 1505 buildings/estates 1535 departmental 1512 increased unpredictability/exibility 1523, 1589 increasing numbers involved in 151 integration with corporate planning 1502 new skills required 152 separation of roles of ofcers 151 transparency 153 see also crisis management resources, decline in 235 restriction enzymes 454 Revolutionary Socialist Students Federation (RSSF) 293 Riga (Latvia), University of 37, 310 right to education 45 right-wing politics see under student movements Roman law 5, 417 Romania 86, 103, 116, 557 division of students by subject 327 life expectancy 487 post-war reconstruction 467, 85, 208 rectors conference 100 screening bodies 87 staff structure 171, 179 stafng levels 164 student/university expansion 50 teaching hours 192 women academics 182 Rome La Sapienza University 44 University of 160, 292, 382 Rome Treaty (Treaty Establishing the EEC 1957) 24, 25, 99, 11819, 399 Rote Armee Fraktion 298 Rotterdam (Netherlands), University of 501 Royal Aeronautical Establishment 544 Royal Society 9 RSA see Radical Student Alliance RSSF see Revolutionary Socialist Students Federation Russia (post-Soviet) 5601 Russia (pre-revolutionary) 554 dissident movements 266 Russian (language), teaching of 247 Saarbrucken (Germany), University of 79 sabbaticals 186 for student leaders 267 Saclay (France) 539 Saint-Etienne (France), University of 267 salaries (of academic staff) 153, 1847 compared with other careers 1856 decrease in inequality 1845 income additional to 184, 186 regularization 184 Salzburg (Austria) Seminars 5601 University 245, 396 sandwich courses 361

626

Subject index
Scandinavia degrees 335 mature students/curricular exibility 336 medical studies 492, 522 postgraduate studies 261 student movements 279 studentteacher relations 268 see also names of individual countries school-leaving examination(s), as qualication for university alternatives to 220, 226 automatic/traditional entry route 18, 45, 210, 217, 21920, 2267, 267 diminishing importance 21617 science demarcation of elds of study 4245 graduate employment 351, 3523 importance in post-war world 163, 1678, 372, 4256, 5302, 538 income outside teaching 186 interdisciplinarity 264 international cooperation 98101, 202 new elds 432 organization of faculty structure 2445 public attitudes to 163 pure vs applied 241, 4245, 427, 4335, 4412 staff contracts 153 state intervention in training 95102 study in Soviet bloc 867 support staff 1812 teaching 190 see also biological sciences; exact sciences; physical sciences science parks 443, 547 science research councils 98 Scotland 254, 270, 335 medical studies 492 SDE see Sindicato democratico de estudiantes SDS see Sozialistische deutsche Studentenbund second route see working classes Second World War aftermath 3, 13, 223, 29, 315, 73, 749, 849, 1623, 201, 31920, 5289; Allied territorial arrangements 34, 7684; and earth sciences 4767; and exact sciences 4256; and social sciences 3724, 387, 409, 415 destruction of buildings/resources 528 impact on medical knowledge/education 485, 491 increase in women students/academics 182 interruption of studies 1334 loss of staff/students to 162 management techniques 155 military/technological research 436, 5289, 533, 544, 547 secondary schools educational function 255 poor quality, remedying of 267 productivity 229 reforms, inuence on university curricula 2612 see also school-leaving examinations secretarial posts 181 secretariat, role/skills 147 secularization, exaggerated impact on teaching 264 security, internal 1478 stafng levels 1478 self-assessment by employed graduates 34750 by students 249 by universities 334 semiconductor physics 434, 435, 447 seminars 190 Senate, role in management structure 140, 141 senior staff 173 see also professors Serbia political upheavals 5589 student movements 310 service classes see working classes service industries, graduate employment in 3435, 353 Servicemens Readjustment Act (GI Bill, US 1944) 207 SEU see Sindicato espanol universitario SFS see Sveriges forenander studentkarer Shell 440, 543 short-cycle higher education 567, 58, 226, 234, 32930 complementarity to university system 57 relationship with labour market 578 Siemens 440 Siena (Italy), Conference (1991) 139 Sindicato democratico de estudiantes (SDE) 3045 Sindicato espanol universitario (SEU) 285 abolition 304 democratization 304 Single European Act (1992) 553, 555 SKS see Studenckie komitety solidarno sci Slovakia 61 rectors conference 100 Slovenia 310 political upheavals 558

627

Subject index
Social Science Research Council (SSRC) 392 social sciences 956, 186, 235, 244 decline in popularity (1970s) 3789 evolution into academic subjects 3715 historical approach 371; supersession 3745 leading role of USA 3724, 379, 384, 387, 390415; exceptions 402, 41516 progress to scholastic pre-eminence 3745 social selection after 1970 22632 patterns of development 2326 prior to 1970 2236 sociology 193, 244, 3712, 37586 career opportunities 414 developments in 1960s 378 focus of study 375, 376, 37980, 382 movements/counter-movements 3769, 3801, 3856 as professional discipline 3778 research institutes 380 US inuence in Europe 379, 3801 Socrates programme 29, 121, 180, 271, 554, 5646 Sorbonne see Paris University Sorbonne Declaration (1998) 560, 5678, 569 South Africa 508 see also apartheid South German Rectors Conference 912 Soviet bloc 3540 academic cooperation 1023 academic interchanges with West 40; restrictions on 40, 945 academics perks 186 adherence to traditional structures 856 admissions policy 21516, 218, 219; effectiveness 21516 age structure 1656 career structures 171 comparisons with West 4952, 635, 212, 21314 curricular restrictions 2467, 35960 de-Stalinization 101 degree structure 262 educational model 21316; break from tradition 36, 201 graduate employment 363 graduation procedures 878 impact of collapse 64, 115, 11617, 198, 199, 201, 215, 220, 241, 263, 334, 55761, 572 imposition of Marxist-Leninist ideology 356, 38, 82, 834, 86, 198, 215, 273, 35960 labour force planning 209, 328 life expectancy 487 limitation of universitys role 86 medical studies 491, 519 non-university education 57 (see also academies) policy shifts: post-1948 868; post-1956 1012 politicization of academic system 878 post-war reconstruction 467, 849, 162 reconstruction, 1980s 216 relations between academia and authority 88, 1012 research institutions 180, 446 restricted entry policy 45 role of university in social system 367, 389, 102 secondary education, need to compensate for quality of 267 separation of church and state 214 shortage of data 163 specialized universities 2434 staff structures 1789 stafng levels 164 stagnation in growth rates 41, 445, 2089, 3212, 324 State Planning Commissions 39 student funding 207 student movements 2834, 30612 student numbers 456 university management 138 see also Eastern Europe; Soviet Union; state control of universities Soviet Union 103 attitudes to European unity 92, 5567 degree awards 253 dissolution 269 division of students by subject 327 employment policy 328 enrolment levels 367 European competition with 14 growth rates 208 health care 489 international relations, impact on student movement 279 junior academic staff 172 medical studies 4967, 509, 518 non-university institutions 367, 38 policy in occupied Germany 76, 814 political science 3978 post-war academic reorganization 13 rectors role in administrative structure 142 role in international student movement 278, 282 staff structure 171, 1789 staff training 196

628

Subject index
student movements 31012 teaching conditions 193 Sozialistische deutsche Studentenbund (SDS) 28991, 298 space exploration 436, 447, 473, 4745, 5401 scientic benets 4756 Spain 7, 46, 130, 214, 239, 247 accession to EU 555 admissions policy 45, 219 course structure 253, 2545, 257 criticisms of educational system 272 curricula 336 degree structure 259 economics, teaching of 4023 legal system 422 non-state sector 556 non-university education 55 political reforms 53 post-war policies 756 professorial appointments 173 regional independence movements 269 staff structure 178 student movements 285, 3045 student numbers 324; by subject 327 student/university expansion 41, 44, 47, 50, 61 teaching methods 2489 university administration 131 Speyer (Germany), Academy for Administrative Sciences 79 spin-off companies, creation of 147 Sputnik 38, 328, 474 SSRC see Social Science Research Council St Gallen (Switzerland), University 396 St Petersburg (Russia) see Leningrad staff, academic associations 199201 attitudes to management 126 attraction into management side 158 attraction of chosen career 1867 career structure 1713 changes affecting 162, 163 decline in prestige 163 dismissal 170; for political reasons 1989, 215, 559 evaluation/development 173, 1956 expansion in numbers 1635, 51617; relationship with political systems 1645 future, discovery among students 190, 31920 internal debates 135 international associations 150 multiple afliations 200 non-academic duties 1967 non-teaching 1812 numbers 175, 2078 part-time 180, 362 personality, impact on learning process 252 political inuence on appointments 174 political stance/activities 1489, 1979 professional experience outside academia 362 proletarianization 185 public perceptions of 192 ratio to students 191, 252, 46970 representation on governing bodies 10912, 116 Residenzpicht (duty to reside in university town) 187 safeguards against wrong decisions 1701 social background 174 social lives 200, 201 social status 186, 2023, 536 specialization 16770 teaching techniques 157 work outside university 197 working hours 1923; exibility 1867 see also age; junior staff; mobility; professors; salaries; senior staff; staff structure; teaching; tenure staff, administrative/managerial commercial experience 147 daily routine 12930 explosion of numbers 112 length of appointments 128 tension with academics 127 staff structure 1709, 2456 changes in 1712, 1802, 1889 division between senior and junior staff 172; diminishing 246 guiding principles 170 impact of expansion 2456 regulation 172, 1889 Stamokap School 392 standardization see curricula; degrees; European Union Standing Conference of Rectors and Vice-Chancellors of the European Universities see Conference of European Rectors (CRE) state(s) attitudes of representatives to universities 126 bureaucracy 112 changing relationship with universities 334 funding: of medical research 5234; reluctance to provide 210; of students 207, 2345; of universities 11314

629

Subject index
state(s) (cont.) increased cooperation with universities 104 investment in scientic research 4604 professional use of university resources 130 representation in university administration 1401 role in scientic training 95102 state control of universities 4, 11, 135 admissions 21819 decreasing 13740, 2401, 334 retention/increase in wake of 1968 protests 109, 112 retention within EU 239 in Soviet bloc 356, 39, 86, 21516 (supposed) calls for 433 statutes, medieval 4, 5 Stockholm (Sweden) school of engineering 242 University 295 Strasbourg (France), University of 243 Strathclyde (UK), University of 392 structuralism 392, 4078 Studenckie komitety solidarno sci (SKS) 308 student movements 2768 86 surge in activism 314 activists role 277 conict between student-as-such and wider political involvement 2789, 280, 2812, 2856, 2878, 31315 dened 276 in democratic West 2858 dissatisfaction with national organs 2812 enabling factors 2767 European meetings 2812 in (ex-)Soviet bloc 116, 21516 formation of alternative unions 31314 international cooperation 27883 Leninist turn 2979 loss of faith in 297, 2989 medieval 553 mutual inuence 2778 myth of unity 283, 2889 opposition to anti-democratic regimes 2835, 3046 relationship with wider political movements 2778 right-wing orientation 287, 2967 shift in objectives (1970s) 299 syndicalism 2856 see also new student movement student syndicalism see under student movements studentteacher ratios see under staff, academic student unrest (1960s) see new student movement students accommodation 257 (anticipated) reduction in numbers 233 approach to management 126 attitudes in aftermath of war 529 career choices, confusion over 268 choice of subject 351, 354, 4645, 504 counselling 197, 362 decreasing numbers at succeeding stages 224 degree of autonomy 278, 108, 1323, 251, 2578, 268 distribution by eld of study 3257 evaluation of teaching staff 196 former, proportion of population 323 gender ratios see women growth in numbers 418, 104, 156, 1623, 165, 1689, 191, 2078, 2256, 22832, 234, 2512, 262, 316, 3212, 357, 363, 470 (see also overcrowding) increased involvement in teaching process 24851 international organizations 27883 migrations 258, 270 minimal supervision (in Continental system) 258 national variations in numbers 3245 personality, shaping of 356 proportion of age group 220, 2212, 22930, 233, 234, 3212, 3345 representation on governing bodies 106, 10911, 116, 129, 293 role in curricula 2669 social position, changes in 31516 studium generale 81 subsidiarity, principle of 121 Suez crisis (1956) 293 suppliers, relations with 145 surgery 486 Sussex (UK), University of 131, 154, 247 Sverdlovsk (Russia), University of 283 Sveriges forenander studentkarer (SFS) 286, 295 Sweden 212 accession to EU 55960 admissions policy 21819 course structure 336 curricula 114, 360 degrees 337 departmental structures 243 economics, teaching of 400 exact sciences 446 faculty structure 244 geology 473

630

Subject index
graduate employment 331, 333, 342, 345, 3467, 348 growth rates 262 medical studies 494, 4978, 501, 505, 508, 517, 518 National Board of Colleges and Universities 35 non-university education 57, 113, 330 political science 3967 postgraduate studies/degrees 260, 261 post-war policies 75 rectors conference 100 reforms/foundations, 1970s 523 research council 98 Royal Committee on Medical Education 4978 Royal Institute of Technology 242 secondary education 216, 347 social selectivity 2245 staff associations 2001 staff experience 362 staff satisfaction 186 staff structure 178, 180 staff training 196 student/graduate numbers 325, 335; by subject 327 student movements 276, 27980, 286, 288, 295 teaching conditions 191 teaching methods 190, 249 unionization 246 university management 1389 women academics 1823 Switzerland 46, 978, 212, 330, 565 cantonal variations 272 degree structure 259 degree titles 337 geology 473, 4789, 482 graduate employment 342, 343, 348, 350 law studies 417 non-university education 57 political science 396 research council 98 staff appointments 174 student migrations to 219 student movements 27980 student numbers 324 wartime/post-war developments 73, 75 synchrotron radiation 431 systems approach 1556, 159 application to university management 156 tabula rasa, theory/practice of 76 Taiwan 212 Tartu (Estonia), University of 311 Tbilisi (Georgia), University of 283 teacher training 341 job opportunities 352 teaching and research units (France) 107 teaching (school), graduate employment in 352 teaching (university) 18993 as agent of growth 201 conditions 1912 criticisms 192 debates on 18990 ethos, difculty of establishing 2734 evaluation 196 interactive technologies 250 methods 1901, 24851 range of communication styles 252 responsibility for 24353 in teams 250 workload 1923 technical/technological colleges 4245 diversity 2412 in France 423, 5534 in Soviet bloc 38 upgrading to university status 49 see also colleges of advanced technology; non-university institutions technology, as eld of study career prospects 5456 funding 5367, 5413 graduate employment 5456 joint degrees 532 military backing/relevance 533, 542 negative attitudes to 536 new chairs/departments 533, 547 participants role in society 546 post-war growth 5303 postgraduate degrees 532 practical component 533 process of development of ideas 5468 proportion of student population 5302 specialization 5323 student pressures 5357 technical infrastructure 5335 universities role in global developments 5448 wartime priorities 529 technology, developments in 1345 impact on biological sciences 465 impact on estate management 155 impact on exact sciences 442 impact on medical studies 507, 522 impact on teaching conditions 191 role of non-university organizations 5478 role of universities 5448 see also computers; information technology

631

Subject index
Tempus (mobility programme) 271, 519, 55960, 561 tenure 163, 178 abolition 174 impact on age structure 166, 188 impact on staff representation 111 reduction in 153 terminal degrees 57 terrorism see new student movement, violence employed by Test Acts (UK 1870) 215 Tetovo (Macedonia), (unofcial) University of 559 theological colleges see religion theology, study/graduate employment 352 third age, increased role in society/ education 211, 4878 Tilburg (Netherlands), Catholic University 294, 302, 400 Titan (moon of Jupiter), landing of spacecraft on 475 titles (academic), (diminishing) social value 186 Torrey Canyon (oil tanker) 452 Total Quality Management (TQM) 159 totalitarianism 34 tourism, academic 187 TQM see Total Quality Management trade unions 1356, 163 formation amongst university staff 1489, 246 transparency, in resource management 153 Trento (Italy), University of 2912, 382 trickle-down theory 547 Trier (Germany), University of 52, 154 Troms (Norway) medical school 506 University of 154, 330 Tubingen (Germany), University of 79, 83 tuition fees, increases in 299 Tuning Project 5656, 572 Turkey 100 migrations from 269 student/graduate numbers 324, 325 tutorials 190, 248, 251, 268 UCCA see Universities Central Council on Admissions UFC see University Funding Council UGC see University Grants Committee Ulm (Germany), University of 5034 Ulster, New University of 253 UMAP (mobility programme) 566 Umea (Sweden), University of 52 under-qualication, and graduate employment 349 undergraduates distinguished from postgraduates 256 staff/public attitudes to 256 terminology 248 see also students Underground Universities see resistance movements Understanding the Earth (textbook) 481 UNEF see Union national des e tudiants franc ais unemployment graduate: compared with non-graduate 347; (feared) increases 316, 3423, 347; relationship with eld of study 351 in society at large 3301, 334, 364 UNESCO see under United Nations Union national des e ais tudiants franc (UNEF) 286, 287, 291 disintegration 298 unionization see trade unions United Kingdom 212, 334 admission controls 258 age structure 167 anthropology 4067 attendance levels 58 attitudes to expansion 163 attitudes to modular system 2701 biological research/teaching 458, 4604, 46970 career structures 171 course structure 16970, 253, 361 degrees 335; awarding of 2534, 3378 distance learning 238 (see also Open University) doctorates 259 economics, teaching of 399 educational ideology 356 equality of access 22832 evaluation procedures 562 exact sciences 426, 427 funding 15, 5367, 5412 (see also grants; Universities Funding Council; University Grants Committee) geography, teaching of 409 geological studies/policies 4803 government assessment strategies 250 government-funded research establishments 544 graduate employment 3323, 344, 350, 351, 355, 367; female 354; unemployment 342, 351 health-care system 4856, 489; contracts 515; costs 486, 490; doctors morale 51314; migrations of practitioners 499500, 501 history, teaching of 412 junior academic staff 1723

632

Subject index
law studies 419, 422 life expectancy 487 mature students/curricular exibility 336 medical studies 492, 4935, 497501, 505, 506, 511, 514, 516, 517, 51819, 5201, 522; costs 507; rebuilding of medical schools 499, 508; responsibility for funding 509; slow pace of reform 501 non-university education 567, 58, 113, 234, 2412, 544 (see also polytechnics) nuclear projects/capability 539 policy in occupied Germany 767, 78, 91, 923 political science 392 post-war reconstruction 75 postgraduate medical centres 500 postgraduate studies 2601 professional qualications 341 reforms, 1960s 1314 research councils 98, 180, 5412, 544 research institutes 180, 446 resource management 152 Royal Commission on Medical Education 500 salary structure 1845 scientic training/research 97 secondary education/university entrance 21618, 219 social sciences 3712, 3823 social selectivity 2235 sociology 3823 staff (academic) 1745; administrative duties 1967; associations 2001; control of appointments 174; data 163; evaluation 1956; job satisfaction 186; non-academic experience 362; numbers 164 student grants 207 student mobility, restrictions on 270 student movements 109, 267, 278, 279, 286, 293, 313 (see also NUS) studentteacher relations 268 student/university expansion 412, 48, 61, 97, 104, 108, 22832, 335; growth rates 262 support staff 181 teaching conditions 191, 1923 teaching methods/traditions 189, 1901, 251 technology, study/research 5302 theological regulations (pre-1870) 215 undergraduate/postgraduate division 2567 university administration/management 127, 131, 138, 139, 140, 142; assessment procedures 159; role of registrar 1434; separation of roles of ofcers 151 upgrading of non-university institutions 49, 63 (see also polytechnics) women academics 182, 183 see also Northern Ireland; Scotland United Nations Educational, Scientic and Cultural Organization (UNESCO) 234, 92, 103, 117, 158, 3212, 324, 3257, 353, 377, 387, 567 (see also CEPES) Institute for Educational Planning (Paris) 23 Institute for University Education (Bucharest) 23 United States 212, 216 adaptation of foreign university model 278 admissions policy 219 anthropology 407 attitudes to European unity 92 biological research 458 campus design 257 career structure 171 Civil Rights movement 378 Civil War 31 comparisons with Europe 54, 548, 573 course structure 168, 253, 336 (see also credits) cultural studies 248 denition of higher education 229 degree of student autonomy 278 development of education system 31 European competition with 14, 114, 426, 441 exact sciences 4256, 429, 430, 437, 446 exchange of ideas with Europe 156, 545 geology 483 global primacy in post-war world 3734 graduate schools 260 history, teaching of 412 as international model 34, 22, 269, 81, 214, 238, 2456, 248, 253, 429, 445, 554, 560 international relations, impact on student movement 279 land-grant colleges 550 legal system/teaching 41516, 419 library usage 4689 medical litigation 488 medical research 525 medical studies 494, 513 migrations to 499, 546

633

Subject index
United States (cont.) national law schools 420 policy in occupied Germany 767, 78, 912, 373, 384 political science 387, 388 postdoctoral training 446 PPBS programmes 156 private universities 28, 214 provincial institutions 21 research evaluation 195 role in post-war reconstruction 33 scholarships for foreign students 89, 180 secondary education, need to compensate for quality of 267 separation of church and state 214 social sciences 372, 375 sociology 3759; East Coast movements 3767 state universities 28 student funding 207 student mobility 2701 student movements 14, 105, 27980 teaching methods 249 technology, study/research 5312 undergraduate/postgraduate division 2567 university administration 28 university numbers 27 women academics 183 see also North America Universities Administrative Reform Act (Netherlands 1970) 110, 295 Universities Central Council on Admissions (UCCA) 230 Universities Funding Council (UFC) 15, 114, 510, 537, 541 University Grants Committee (UGC) 15, 75, 97, 498, 509, 5367, 5412 university/ies abolition 10 adaptability 160 aims/principles 2556, 31920, 356, 4434, 459, 460, 573; national variations 3567 alternatives to see non-university institutions central role in planned economy 209 creation/foundation, distinction between 489 critical function 319, 356 decline in attractions 235 denitions 1617, 27, 434, 59, 86, 240, 2412, 52930, 554 destruction 3, 13 division into specialized units 378, 50, 104, 11213, 2434 funding 11314 geographical distribution 523 growth in size 44, 134, 165 ideological/social criticisms 10, 14, 2346, 360 (see also new student movement; student movements) increase in scale/complexity 1323 innovative function 319, 356, 5545 integrative function 5545, 5612 (limits of) public visibility 17 nature of organization 1258; differing views of 126; as pluralistic/fragmented 1267; shift over post-war period 130 outnumbered by non-university institutions 367, 613 scale of consumption of national resources 1367 separation from everyday life 1617 social position/function 37, 389, 154, 2323, 3201, 364, 448, 550, 5545 social prestige 1819, 130 structure 1302 see also autonomy; expansion; governance; management university system creation in Soviet bloc 36, 889 evolution of concept 35, 2012 system-wide legislation 35 university type establishments 43 Uppsala (Sweden), University of 1819, 257, 295, 492 Uruguay Round (of trade negotiations) 5667 Utrecht (Netherlands) Conference (1991) 5623 University 122 venture companies 443 Versailles, Treaty of (1919) 76 Veto (Leuven student magazine) 313, 31415 vice-chancellor(s) see Committee of Vice-Chancellors and Principals; rector Vienna Institute of Advanced Studies 396 School of Engineering 242 University 244 Vietnam war, protests against 103, 282, 288, 28990, 2912, 293, 294, 296, 378 Vilnius (Lithuania), University of 283 Virginia, University of (Charlottesville) 77 virtual university 191, 240 vocationalism 362, 364

634

Subject index
Waldleiningen Conference (1949) 393 war continuation of scholastic friendships in spite of 9 destruction of universities 3, 13, 5289, 5589 impact on development of university 31 Warsaw (Poland), University of 307 Conference (1988) 5567 Warwick (UK), University of 55 websites 20 Wellcome Institute 194 West German Rectors Conference 912, 93, 118 West Germany see Federal Republic of Germany Western Reserve, University of 506 WFLRY see World Federation of Liberal and Radical Youth WHO see World Health Organization Windscale (UK) 539 Wingspread Declaration (1997) 566 Witten-Herdecke (Germany), University of 508 women 1824 changing social/academic role 163 discrimination against 182; in student movement 292 elds of study 183, 354 graduate employment 3534; inequalities 347, 354 growth in staff/student numbers 1823, 208, 269 married/with children 183 medical students 51819 mobility 272 proportion of student population 182, 222, 226, 2278 word processing 5345 work experience, integration with university courses 361 in Soviet bloc 35960 working classes political movements see under new student movement positive discrimination in favour of 39, 219 proportion of student population 2234, 2278 special facilities 3940, 218 World Bank 117 World Federation of Liberal and Radical Youth (WFLRY) 281 World Foundation for Medical Education 512 World Health Organization (WHO) 4878, 491, 512 World Student Christian Federation (WSCF) 281 World Student News (periodical) 279 World Trade Organization (WTO) 5667 World Union of Jewish Students 281 WSCF see World Student Christian Federation WTO see World Trade Organization X-ray optics 431 Yakutsk (Georgia) 311 Young Mens Christian Association (YMCA) 281 Yugoslavia 84 course structure 253 dissolution 269, 5589 mediation between East and West 558 non-university education 57 post-war reconstruction 467, 85, 2089 rectors conference 100 student movements 109, 30910 student/university expansion 41, 50 Zurich (Switzerland) School of Engineering 242 University 396

635

http://avaxhome.ws/blogs/ChrisRedfield