INTRODUCTION

The beginning of the 21

ist

century has witnessed a revolution in our

knowledge of the DNA sequences of various organisms, the most notable example being the sequencing of the human genome in 2003. Analysis of genomic DNA will enable us to learn a great deal about evolution, the relationship between different organisms, the mechanisms by which genes are controlled, susceptibility to disease, and the hidden languages within the DNA sequence. The sequencing of an entire genome is not yet, however, a routine technique, and other Methods of Genetic Analysis are used to quickly and effectively analyze DNA samples. These methods, and technologies such as DNA fingerprinting, have also transformed forensic science. The DNA typing methods shows a mark able difference from 1985 (since its discovery by DR Sir Alec Jeffrey) to till date. The past 18 years have seen tremendous growth in the use of DNA evidence in crime scene investigations and paternity testing. This rapid growth is always accompanied with the revolutions in computer technology. Established methods of DNA sequencing, genetic and forensic analysis all depend on the use of labelled oligonucleotide and deoxy- or dideoxy-nucleoside triphosphates, and require a DNA polymerization step. This can be the polymerase chain reaction (Genetic analysis in STR analysis)1, a single nucleotide extension (Mini-sequencing in SNP analysis)2, or a combination of polymerization and DNA chain termination (Sanger sequencing)3.

DNA TYPING CHRONOLOGY

Year Forensic DNA science and application

1985 1986 1988 1989 1990

Sir Alec Jeffreys develops multilocus RFLP probes. DNA testing goes to public through celmark case of Colin pitch fork. FBI begins DNA casework with single-locus RFLP probes. DNA detection by gel silver-staining, slot blot, and reverse dot blots. Population statistics used with RFLP methods are questioned, PCR starts

With DQA-1.
1991 1992 1993 Fluorescent STR markers first described; Chelex extraction. FBI starts casework with PCR-DQA1, Capillary arrays first described. First STR kit available, sex-typing (amelogenin) developed. First STR results with CE. 1995 ABI 310 Genetic Analyzer and Taq Gold DNA polymerase introduced. National DNA Database developed by UK 18 loci. 1996 1997 1998 2000 FBI starts mtDNA testing, first multiplex STR kits become available. 13 core STR loci defined, Y-chromosome STRs described. FBI launches national Combined DNA. SNP hybridization chip developed, Multiplex STR kits are validated . ABI 3700 96-capillary array used. 2001 Identifier STR kit released with5-dye chemistry ABI 3100 Genetic Analyzer.

Year 2002 2003 2004

Forensic DNA science and application FBI mtDNA population database released-STR 20plex published. Human genome project completed. ENCODE PROJECT starts. 454 Gs-80 pyro sequencing used. Next GEN starts based on Sanger Dideoxy chain termination

2005 2006 2007

solexia/illumina sequencing starts. ABI SOLiD sequencing Roche 454 titanium /Illumina GAIIx used sequencing. ENCODE completed

2009 2010

Illumina GAIIx, SOLiD 3.0 Illumina Hi-Seq2000

2013 2005
HUMAN GENOME
2004

NEXT GEN 454/SOLiD/Solexia

Y-S TRs

Identifiler 5-dye kit And ABI 3100

UK National Database launched

PowerPlex CE is fairly routine 2002

CODIS loci

1998
FIRST STRFSS

developed 1990

1994 1996

2000 First commercial Multiplexes

1992
Capillary electrophoresis mtDNA

of STRs first described

1985

PCR developed

DQA1 & PM (Dot blot)

Multiplex STRs

RFLP

Historical Perspective on DNA Typing

THE BEGINNING OF THE REVOLUTION

DNA analysis constitutes the most significant aspect of biotechnology related to forensic science. Since it was first introduced in the mid-1980s, DNA analysis (formerly called DNA Fingerprinting, but now increasingly referred to as DNA Typing or DNA Profiling) has revolutionized forensic science like no other technique has, especially in the area of identification of individuals. The technique was first described in 1985 by Dr. Alec Jeffreys, a geneticist in the University of Leicester5. He discovered that certain regions of human DNA contained sequences that repeated over and over contiguously, and that the number of such repeats differed from individual to individual. By developing a technique to examine the length variation of these repeat sequences, Dr. Jeffreys devised the ability to fix the identity of individuals with a high degree of certainty. The technique developed by him came to be called restriction fragment length polymorphism (RFLP). This really triggered the era of forensic biotechnology, which has since moved at an amazing pace, and continues to do so, impacting virtually every area of forensic investigation of serious crimes such as homicide, rape, and assault. DNA Information DNA level individual people are 99.9% identical 1 out of 1000 base pairs differs. Some DNA differences lead to differences in appearance. Some differences are found in non-coding DNA. There are repeats of short nucleotide sequences which are known as VNTRs (Variable Number Tandem Repeats). There are dozens or hundreds of alleles in a given population each person having two alleles, one on each chromosome. Identification is made based on the VNTRs found in junk DNA.

Techniques in RFLP

1. DNA is isolated from the tissue sample.

2. DNA is then cut (at the molecular level) using an enzyme. The restriction enzymes are able to break apart the DNA molecule in a specific place. There are over 100 different types of restriction enzymes but some are used commonly. EcoRI came from bacteria called E.coli; HIND III came from Hemolphilous influenza, strain d 3. These enzymes cut the DNA in areas which are the same in everyone (not the junk DNA which varies in different individuals) 4. HIND III recognizes the DNA sequences6 5AAGCTT3 3TTCGAA5 and it cuts between the two As leaving 5 AGCTT TTCGA 5 5. This sequence is found frequently in the human genome, therefore HIND III cuts the DNA into many pieces

6. DNA is then separated by loading it into an apparatus which will allow electricity to run through a gel plate holding the DNA sample. Different sized pieces of the DNA will separate and a banding pattern will form allowing identification of matching DNA to occur. 7. Fragments are separated by size Wells (Negative End) are filled with DNA DNA has a negative charge Small pieces of DNA move farther away from the well as electricity is run through the gel.
Note: Though RFLP was the initial method adopted for use, it is no longer the preferred approach in majority of the forensic laboratories because, it requires good amount of non-degraded DNA (~ 1.0 g) which is often very difficult to obtain from the crime scene. Moreover, it uses radiolabel

(Ethidium Bromide) which is hazardous and takes 1-2 weeks for the result to be processed7.

Polymerase chain reaction

The polymerase chain reaction (PCR) is a technique invented by kary mullis in 19808, used widely in molecular biology, diagnostics, forensic science and molecular genetics, to amplify a specific region (the amplicon) of and A sample. PCR can amplify a few molecules of a precious DNA sample (e.g. at the scene of a crime) to produce large quantities of DNA, from 50 to over 25 000 base pairs in length. In PCR, two short oligonucleotide (PCR primers) are designed such that each is complementary to the 3-end of one of the two target strands at the region to be amplified: the two PCR primers define the amplicon. The region of the template bound by the primers is amplified in a series of cycles.PCR requires a DNA polymerase enzyme. While all organisms contain DNA polymerases, the polymerase that is used in PCR comes from the thermophilic bacterium Thermus aquaticus. This Taq polymerase is heat-resistant, meaning that temperatures of up to 95 C can be used in PCR, conditions of low DNA duplex stability9.

In the first cycle, the double stranded target is separated into two single template strands by heating to 95 C. It is then cooled to 55 C to allow the synthetic oligonucleotide primers to anneal to the template strands with their 3' ends facing each other. The temperature is then increased to 72 C, the optimum temperature for activity of the thermo stable Taq DNA polymerase. The polymerase utilizes deoxyribonucleotide triphosphates (dNTPs) to extend the primers along the length of the template producing two new double strands of DNA. The second cycle of PCR is a repeat of the first cycle, and each newly synthesized single strand also acts as a template for primer annealing and extension. The polymerase can only be extend the DNA as far as the locus of the first primer, producing DNA duplexes of a specific length. In all subsequent cycles amplification produces PCR products of a length specified by the loci of the two primers, and these PCR products soon outnumber the original target molecules. In theory, n cycles of PCR will produce 2n PCR products.

Real Time PCR Real-time PCR is a variation on the PCR theme that combines normal PCR amplification of DNA with simultaneous detection of the PCR product, usually in a single reaction tube. In PCR, the amount of double-stranded DNA increases with each cycle. After multiple cycles of PCR, there is a large increase in the amount of DNA. In real-time PCR (also called quantitative PCR, or qPCR), an agent that binds to double-stranded DNA is added to the PCR reaction. As doublestranded DNA is produced, the agent binds to the newly-synthesized DNA, and produces a signal allowing the reaction to be monitored in real time. While the aim of PCR is the amplification of DNA, the purpose of real-time PCR is the analysis of a DNA sample or reaction. Fluorescent real-time PCR is a combination of PCR amplification and fluorescence detection. In its simplest form, fluorescent real-time PCR involves the use of an organic dye that is fluorescent only when bound to a DNA duplex. When such a dye is added at the beginning of a PCR reaction an increase in fluorescence occurs as the number of DNA duplexes increases, and this is indicative of successful PCR. SYBR Green is an example of a molecule that binds to doublestranded DNA and becomes fluorescent on binding (the ds-DNA-dye complex is fluorescent).

SYBR GREEN

Note: The SYBR-Green real-time PCR method has severe limitations as it is non-specific, i.e. a positive result is obtained regardless of the nature of the PCR product. As PCR is prone to arte facts such as primer-dimer formation, simple amplification using unselective dyes is not always very informative, and probe-based methods provide more meaningful results10.

Probe Based Real Time PCR When using PCR in human diagnostics it is important to be certain of the precise nature of the product. Identification of a key sequence in the PCR product (the amplicon) can be achieved by adding a fluorogenic DNA probe (a short synthetic oligonucleotide that is complementary to a specific sequence in the PCR amplicon, and does not fluoresce unless it binds to the amplicon) to the PCR reaction. When a DNA probe is used in real-time PCR, a positive signal is obtained only if the PCR amplicon contains the complementary sequence to the fluorogenic probe: the fluorescent signal is sequence-specific. In general "fluorogenic" probes contain a fluorescent dyes and a fluorescence quencher. They are non-fluorescent in the absence of a target nucleic acid because the quencher absorbs energy from the excited fluorophore, and this energy is dissipated as heat or radiation at a higher wavelength.

Probe based Real Time PCR

The Taq Man assay The Taq Man assay is the most widely used real-time method for the analysis of PCR products, and is used extensively in SNP analysis and mutation detection. A Taq Man probe consists of an oligonucleotide labeled with a fluorophore at one end, e.g. 5-FAM (5-fluorescein), and a fluorescent quencher at the other, e.g. 3-TAMRA. Excitation of fluoresce in at its absorption wavelength of 495 nm would normally lead to fluorescence emission at 525 nm. However, this falls within the broad absorption spectrum of the TAMRA dye which is in close proximity in the Taq Man probe, so energy is absorbed by the TAMRA dye owing to fluorescence resonance energy transfer (FRET) and fluorescence is observed at the emission wavelength of TAMRA (585 nm) rather than at the emission frequency of FAM11.

The Taq Man assay

Short Tandem Repeats DNA fingerprinting depends on the analysis of short tandem repeats (STRs), short repeating patterns of two or more nucleotides (e.g. (CA)n or (ACGT)n, where n is several hundred). For example, in the sequence CGTCAGCACACACACACACACACACACACACATGGCGTG, the dinucleotide CA is repeated 13 times (n = 13). Tens of thousands of different short tandem repeats, or microsatellites have been identified in the human genome. STRs are observed at the same positions on chromosomes (loci) in different members of the population, but the number of repeats (n) varies between individuals. This variation in number of repeats is an example of polymorphism. STR Analysis STR analysis uses PCR to measure the number of repeats at specific loci. Primers bind to the DNA at specific STR loci and, are extended by PCR. The length of the PCR product depends on the number of repeats. If the PCR primers are labeled, the PCR products will be labeled, allowing the products to be detected at the end of the reaction. For each STR locus, there will be two PCR products (one for each of two alleles)12. The simultaneous analysis of multiple different STR loci enables a unique profile of an individual to be built up. Several PCR reactions are carried out simultaneously in a single tube at different STR loci, giving several products (two for each locus). The following components are required.

A DNA sample, e.g. a single human hair from the scene of a crime, or buccal cells from a mouth scrape of a suspect. Two oligonucleotide PCR primers: one primer labeled at the 5-end with 32P, and one unlabelled reverse primer

A thermo stable DNA polymerase Four deoxynucleoside triphosphates: dATP, dGTP, dCTP, dTTP.

When the labeled PCR products are run on a polyacrylamide gel, they separate according to size. The result is a "DNA ladder" that is characteristic of an individual.

DNA Fingerprinting By STR

The use of multiple loci provides a very high degree of certainty that no two individuals in a population will have the same profile (unless they are identical twins). Some current forensic systems use 10 (e.g. United Kingdom) or 13 (e.g. United States) and others 16 STR loci . Kits containing PCR primers for the standard STR loci are sold commercially.

13 CODIS Core STR Loci With Chromosomal Positions13

TPOX D3S1358 D8S1179 D7S820 TH01 VWA

D5S818 FGA CSF1PO

AMEL D13S317 D16S539 D18S51 D21S11

AMEL

Fluorescent STR Analysis In a more modern variant of STR analysis, the PCR primers are labeled with fluorescent dyes. Primers for different STR loci are labelled with different fluorescent dyes, adding a second dimension to the assay .As it has so far been possible to develop only a limited number of fluorescent dyes with well-resolved spectral characteristics, three different fluorescent dyes are typically used.

Fluorescent STR Analysis

NOTE: Conventional STR multiplex analysis works best where there is at least 1ng of good quality DNA present and fewer than 28 PCR cycles are required to generate sufficient material for a full PCR profile. However, many forensic samples contain much lower levels of DNA than this and/or the DNA is degraded and in these circumstances a different approach is required. Low copy number STR analysis (LCN - STR) is employed where there is less than 100 pg DNA and despite the miniscule amounts of DNA present a full STR profile can be generated. Some workers consider that defining LCN - STR in terms of the amount of DNA present in the sample is not appropriate and prefer to consider it to be an approach adopted for the analysis of results that occur below the stochastic threshold (i.e. the point below which their interpretation of peaks or bands would be considered unreliable) using normal techniques. Using LCN - STR, it is possible to obtain a full profile from the DNA of a single cell. LCN - STR may employ up to 60 PCR cycles and although it is extremely sensitive the results need to be interpreted with care, especially where the DNA of two or more people is present14.15.

Randomly Amplified Polymorphic DNA Since most DNA applications in the early years had been developed for the specific detection of human DNA,only a few VNTRs of invertebrate DNA were known. This limitation was overcome by a new technique that could be used on virtually any organism: randomly amplified polymorphic DNA (RAPD). In this method, non-specific primers are used that can amplify many regions of a sample DNA at once. The resulting PCR products are separated by electrophoresis, and a band or peak of a particular length can be considered a locus even though it is not known what portion of the sample DNA it represents. RAPDs can allow up to 100 or more loci in one PCR. Since the high number of amplified RAPD loci can render the sorting of informative PCR polymorphisms from non-informative ones difficult or confusing, specialised

electrophoresis unit and software programme must be used. In the forensic area, RAPD has special importance in the entomological investigation of decaying corpses16.

RAPD Profile

Mitochondrial DNA Testing In comparison to nuclear DNA, mitochondrial DNA (mtDNA) has some significant advantages in forensic investigations. Firstly, it is present in high copy number, and can provide better results when nuclear DNA is scanty, e.g., analysis of hair shafts, teeth, skin, etc.Secondly, mtDNA is transmitted exclusively maternally to the offspring without undergoing recombination. This clonal inheritance is of great use in identity testing because it allows direct comparison of DNA sequences of relatives with the same maternal lineage, without the ambiguities caused by meiotic shuffling and the mixing of nuclear genes.

In fact, when the sample sequence is compared to that of a reference person, the possibility of a maternal relationship can be assessed. One significant disadvantage of mtDNA has been that compared to nuclear DNA, the genome organization is very compact and, therefore less polymorphic: over 90.0% of the genome is coding, introns are lacking, intergenic sequences are very small or absent, and repetitive classes of DNA are relatively uncommon. For forensic DNA testing, the most extensively studied region of mtDNA has been the non-coding DNA replication control region (D-loop), located between the genes for tRNA-Pro and tRNA-Phe, at positions 16,024 to 576. mtDNA has been used with great success in the forensic analysis of bones and historical or ancient remains. However, amplification of mtDNA D-loop fragments with a length of 200 bp or more from ancient and even from fairly recent biological samples, can lead to erroneous results. Use of short PCR fragments for the analysis of mtDNA from shed hair, in

combination with competitive PCR assay to determine the state of degradation, should improve the reliability of forensic mtDNA analysis considerably. Due to the erroneous database collection, the validity of sequence analysis of the mtDNA-loop hypervariable regions for anthropological information about the maternal lineage has been questioned in many cases. To avoid this, recommendations and guidelines have been proposed for the validity of mtDNA sequence analysis and their interpretation in the forensic context17.

Since heteroplasmy (same individual harboring more than one mtDNA sequence) is a potential drawback to forensic mtDNA analysis, newer methods have focused on overcoming this problem by enhancing detection capability of this phenomenon, for e.g., denaturing gradient gel electrophoresis (DGGE). Several other technologies are also now being applied to mtDNA analysis to make it more popular among the forensic community, including Mass spectrometry18, Microchip instrumentation19, and Molecular beacon analysis20.

Y-Chromosome STR There has been an increasing interest among forensic investigators, in Y-chromosome markers, not only for gender determination, but also for identity fixation. Y-chromosome markers are useful for discriminating male DNA from female DNA in forensic situations such as sexual assault, when a vaginal swab is submitted for DNA analysis. However, the amplification of Ychromosomal STRs is also known to result in the formation of artefactual amplification products, mainly due to insufficient PCR specificity. This is a major drawback of the method, as both the sensitivity as well as the correct Y-STR interpretation are affected. The addition of a PCR enhancer to the reaction master-mix is claimed by some investigators to result in significant increase of specificity of Y-STR typing-STRs are also useful for tracing paternal lineages, just as mtDNA is used to match maternal lineages.21.22

Y Chromosome STR

Single Nucleotide polymorphisms (SNPs) Single nucleotide polymorphisms (SNPs) represent the ultimate in the trend toward smaller DNA fragments. Recent advances in SNP research have raised the possibility that these markers could replace the forensically established STRs. SNPs are more numerous than other polymorphisms, and occur in coding and non-coding regions throughout the genome. They are single base-pair changes in the DNA sequence, which can be detected by sequencing, RFLP-PCR or singlestrand conformational polymorphism (SSCP) techniques. A set of SNPs decoding identification of an individual demands only a short stretch of DNA (<100 bp) for analysis. This is of great advantage over the conventional methods in genotyping highly degraded forensic and archaic samples. The presence of 1.8 million SNPs in the human genome makes it even more attractive for forensic investigations. The most important attribute of SNPs is their suitability to new automated instrumentation platforms, especially mass spectrometry and microchip

instrumentation, as well as in-solution techniques such as molecular beacon and fluorescence polarization. A single nucleotide polymorphism (SNP) multiplex has been developed recently to analyze highly degraded and low copy number (LCN) DNA template, i.e. <100 pg, for scenarios including mass disaster identification. The multiplex consists of 20 autosomal non-coding loci plus amelogenin for sex determination, amplified in a single tube PCR reaction and visualized on a capillary electrophoresis system. As the multiplex is intended for use with samples too degraded for conventional profiling, a computer program has been specifically developed to aid interpretation. The discrimination power of the system is estimated at 1 in 4.5 million, using a White Caucasian population database. Reproducibility studies are claimed to have showed concordance between SNP profiles for different sample types, such as blood, saliva, semen and hairs, for the same individual, both within and between different DNA extracts. However, some other recent reports demonstrate that a battery based exclusively on SNPs, matching the informative power of current STR kits, if applied to routine paternity investigation, would be statistically inadequate. The current consensus is that the introduction of an SNP-based strategy, as a substitute to the now classical STR approach can pose statistical problems that must be carefully evaluated.23,24
TTGACGT AA C T G C A TTAACGT AATTGCA

Mobile Element Insertion polymorphism An alternative to SNPs for the identification of racial characteristics from DNA is the analysis of mobile element insertion polymorphisms based on short interspersed elements (SINEs). The commonest class of these are the so - called Alu elements that are about 300 nucleotides long25. Most Alu elements are fixed at a particular locus but a few subfamilies are polymorphic for insertion presence/absence and can be used to determine genetic relationships between populations .Alu family of short interspersed nuclear elements (SINEs) is distributed throughout the primate lineage and is the predominant SINE within the human genome. The Alu family has spread throughout the genome by an RNA-mediated transposit ion process known as retro position and is present in the genome in extremely high copy number (in excess of 500,000 copies per haploid human genome). The majority of Alu family members are pseudo gene products of a single master gene. Sequence divergence in the master gene and its progeny occurs with time, resulting in subfamilies. Young Alu subfamilies are polymorphic and are present or absent on given chromosomes. The first appearance of the Alu insertion represents the beginning of the family tree, and can be used as a molecular clock to estimate the time that family or subfamily arose. Thus, unlike other forensic DNA markers, the distribution of Alu insertions, and possibly long interspersed nuclear elements (LINEs) and other SINEs loci, permit tracing of population ancestral heritages. Information about the likely ethnicity of the sources of the sample is one piece of information that investigators may use when pursuing leads based on the genetic analysis of crime scene evidence.26

Alu Repeats

DNA Microarray

DNA microarray technology (also known as DNA arrays, DNA chips or biochips) represents one of the latest breakthroughs and indeed major achievements in experimental molecular biology. This novel technology, which started to appear during the second half of the 1990s, Oligonucleotide can be chemically attached to the surface of materials such as glass or silicon, on which they form small "spots" of around 100 m (104 m) in diameter. Large numbers of oligonucleotide can be laid down on a single slide to form a microarray, and single strands of fluorescently-labelled DNA (labelled PCR products or cDNA) can be captured by hybridization. (cDNA is single stranded DNA complementary to the RNA from which it is synthesized by reverse transcription. It gives indirect information on the nature of the various RNA messages expressed in a cell (expression analysis)). If such a microarray contains 1000 spots then in theory it is possible to hybridize a unique complementary nucleic acid sequence to each spot. The identity of the DNA sequence is deduced from the location of the spot to which it hybridizes using a fluorescence scanner. The fluorescent label attached to the captured nucleic acid strand can be added by a number of different methods. PCR products can be labelled at the 5-end simply by using a PCR primer containing a 5-fluorescent dye. PCR primers can be labelled with multiple fluorophore, but these tend to quench each other and also inhibit the PCR reaction. A better way to introduce multiple labels into the PCR product is to use fluorescently labelled deoxynucleoside triphosphates in the PCR or reverse transcriptase reaction (e.g.fluoresceinlabelled dT). However, the efficiency of the PCR reaction may be compromised by the chemical modification on the heterocyclic base, which can inhibit the Taq polymerase. A carefully determined mixture of unlabelled and labelled deoxynucleoside triphosphates must therefore be used, and it is rare to achieve labeling densities greater than one fluorophore per 30 nucleotides. Microarray assays can also be carried out in the reverse format by attaching individual PCR

products to the slide as discrete spots and probing with a pool of fluorescently labeled oligonucleotide.27 DNA microarrays are useful in high-throughput mutation, SNP and gene expression analysis because very large numbers of DNA strands can be attached to a single array. Microarrays are amenable to automation by robotic systems, allowing very high throughput. However, they present challenges owing to some undesirable chemical and biophysical properties of molecules on surfaces. Firstly, it is difficult to create very dense arrays. A spot size of 100 m is achievable, but smaller spots (e.g. 1 m) would allow far higher numbers of spots per array, permitting the use of smaller volumes of solution-phase DNA and greater throughput. Secondly, the hybridization of complementary DNA molecules on a surface is not nearly as efficient as solution hybridization. To make the system workable, the properties of the surface and the nature of the linker between the surface and the attached DNA must be carefully controlled.

DNA Microarrays

Fluorescence In Situ Hybridization (FISH)

In situ hybridization (ISH), which allows the identification and visualization of specific DNA sequences on chromosomes using radioactive labels, are discussed in. The synthesis and applications of chemically modified oligonucleotide. Fluorescence in situ hybridization (FISH), which extends ISH by employing fluorescence-based detection and visualization by fluorescence microscopy, is an important tool in genetic analysis. The principle of FISH lies in the annealing of a labelled probe to its complementary strand within the chromosomes of fixed cells or tissues, followed by detection of the fluorescent label. The probes (DNA or RNA) are usually prepared by one of three polymerase enzyme-based methods (nick translation, random priming or PCR) which allow the incorporation of fluorescently-labelled deoxynucleoside triphosphates. An average incorporation level of one fluorescent label per 30 nucleotides is typical. The length of a DNA probe can be between 100 bp and 1000 bp. Longer probes increase non-specific background fluorescence but short probes can be difficult to detect owing to insufficient hybridization and low levels of labeling. It is important that the target is accessible to the probe and must be retained in situ, not degraded by nuclease enzymes. Visualization limits span from an entire chromosome to a 40 kb chromosomal section.28

Radio Active Chips

DNA Sequencing

All this has been possible because of methods developed by Fred Sanger in Cambridge over 30 years ago. Sanger developed a novel method of DNA sequencing (the dideoxy method) for which he was awarded his second Nobel Prize, in 198029.
Sanger Dideoxy DNA Sequencing

Sanger's dideoxy method of DNA sequencing was the first method that was used routinely for sequencing of DNA in the laboratory. The following components are required for Sanger sequencing:

A DNA template to be sequenced An oligonucleotide primer labelled at the 5-end with 32P A DNA sequencing polymerase Four deoxynucleoside triphosphates: dATP, dGTP, dCTP, dTTP Four dideoxy nucleoside triphosphates (nucleoside triphosphates lacking both 2- and 3hydroxyl groups): ddATP, ddGTP, ddCTP, ddTTP .

Sanger sequencing is a modified form of DNA Raplication.The primer hybridizes to a specific locus on the template and the polymerase binds and incorporates nucleotides to assemble a reverse complimentary copy of the template.30

Dideoxy Sequencing

Fluorescence Dideoxy DNA Sequencing

In the automated high-throughput fluorescent version of Sanger sequencing, an unlabelled oligonucleotide primer is used, along with a thermostable DNA polymerase, four normal deoxynucleoside triphosphates, and four dideoxy nucleoside triphosphates with different fluorescent labels on them.31 Now only one sequencing reaction is necessary because termination in ddA gives the DNA fragment a particular fluorescent colour, ddG a different colour, ddC a third colour and ddT a fourth colour. The nature of the fluorescent dyes depends upon the DNA sequence used, but the basic requirement is four dyes with well-resolved fluorescence emission spectra. A common system uses FAM, JOE, TAMRA and ROX as the four dyes.

Fluorescence Dideoxy Sequencing

Existing DNA sequencing methods (including next-generation sequencing) are not able to detect modified bases. With the recent surge in interest in Epigenetic, the failure to distinguish between cytosine and 5-methylcytosine (both of which form Watson-Crick base pairs with guanine) is a serious drawback of current sequencing technologies.

Bisulfite Sequencing

Bisulfite (HSO3-) deaminates unmethylated cytosine to uracil, but does not react with methyl cytosine (Figure 7). This provides a method for sequencing DNA containing 5-methylcytosine bases. The DNA is sequenced before and after bisulfate treatment: any change from cytosine to uracil is ascribed to unmethylated cytosine, while cytosine bases that remain after bisulfite treatment are assumed to be methylated in the original sample. This provides a method for sequencing DNA containing 5-methylcytosine bases. The DNA is sequenced before and after bisulfite treatment: any change from cytosine to uracil is ascribed to unmethylated cytosine, while cytosine bases that remain after bisulfite treatment are assumed to be methylated in the original sample.32

Bisulfite Sequencing

Three main companies occupy the bulk of the next generation sequencing market.

454/pyrosequencing (Roche). SOLiD (Applied Biosystems). Solexia Illumina.

However, increased bases sequenced at a reduced cost have always been desired. For this reason new theories were developed in the late 90s. These have come to fruition in the last 5 years or so with advances in chemical and physical technology. Thus, we have now entered the next generation era of sequencing. The analysis techniques are always being improved with new algorithms developed all the time. In addition, we are now seeing newer sequencing theories being developed, so called, next-next generation sequencing.

National Human Genome Resource Institute

Conclusion

Over the recent years, DNA profiling has become a cutting-edge crime investigating technique and an invaluable instrument in search of justice. With its capability to implicate or eliminate, DNA evidence may play a significant role at various points throughout the life of a criminal case, from initiation of a case to post-conviction confirmation of the truth. There are few techniques in the history of forensic science that have thoroughly scrutinized and validated than forensic DNA typing. The introduction of this new technology therefore, would be considered a milestone in criminal investigation and legal system of our country. The main aims of the new technology can be summarized: To enable faster processing. To reduce costs. To improve sensitivity To produce portable instruments. To de-skill and to automate the interpretation process. To improve success rates. To improve quality of the result and to standardize processes. To develop the kits for individual identification.

The next few years will probably see a new revolution as this new technology comes of age with advances in the next generation era of sequencing and becomes widely available.