You are on page 1of 7

Journal of Wildlife Diseases, 46(2), 2010, pp.

615621 # Wildlife Disease Association 2010

Babesia (Theileria) annae in a Red Fox (Vulpes vulpes) from Prince Edward Island, Canada
Noel Clancey,1,4 Barbara Horney,1 Shelley Burton,1 Adam Birkenheuer,2 Scott McBurney,3 and Karen Tefft1 1 Atlantic Veterinary College, University of Prince Edward Island, 550 University Avenue, Charlottetown, Prince Edward Island C1A 4P3, Canada; 2 College of Veterinary Medicine, North Carolina State University, 4700 Hillsborough Street, Raleigh, North Carolina 27606, USA; 3 Canadian Cooperative Wildlife Health Centre, Atlantic Region, 550 University Avenue, Charlottetown, Prince Edward Island C1A 4P3, Canada; 4 Corresponding author (email: nclancey@upei.ca)

ABSTRACT: A 46-mo-old female red fox (Vulpes vulpes) was presented to the Atlantic Veterinary College (AVC) Teaching Hospital, Prince Edward Island, Canada. On presentation, the fox was weak and had pale mucous membranes. A complete blood count and a serum biochemistry profile were performed. Blood smear examination revealed low numbers of erythrocytes containing centrally to paracentrally located, single, rarely multiple, approximately 132 mm, oval to round organisms with morphology similar to Babesia microti. Polymerase chain reaction testing and DNA sequencing of the Babesia species 18S rRNA gene were performed on DNA extracted from whole blood. Results were positive for a Babesia microtilike parasite genetically identical to Babesia (Theileria) annae. The fox was euthanized due to poor prognosis for recovery. Necropsy examination revealed multifocal to locally extensive subacute nonsuppurative meningoencephalitis, an eosinophilic bronchopneumonia, a moderate diffuse vacuolar hepatopathy, and lesions associated with blunt trauma to the left abdominal region. This is the first reported case of a red fox in Canada infected with a piroplasm. It remains uncertain whether the presence of this hemoparasite in this fox was pathogenic or an incidental finding. The potential for competent vectors of Babesia species on Prince Edward Island, the potential for this Babesia microtilike parasite to infect other wild and domestic canids, and the significance of this parasite to the health of infected individuals are yet to be determined. Key words: Babesia (Theileria) annae, Canada, Prince Edward Island, red fox, Vulpes vulpes.

A juvenile weaned female red fox (Vulpes vulpes) estimated to be 46 mo old was presented to the Atlantic Veterinary College (AVC) Teaching Hospital in August 2006 after being found in a semirural area of Prince Edward Island, Canada. On presentation, the fox was
615

weak and had pale mucous membranes. Venous blood was collected for a complete blood count and serum biochemistry analysis. The fox was humanely euthanized utilizing 3 ml IV Euthanyl (240 mg/ml; MTC Pharmaceuticals, Cambridge, Ontario, Canada) via the cephalic vein due to poor prognosis for recovery and release. Laboratory results were compared to published reference values determined from 17 male and 13 female ranched red (12) and silver (18) foxes (Benn et al., 1986). A mild to moderate macrocytic, hypochromic, mildly regenerative anemia was identified. Patient values were as follows (reference intervals in brackets): Red blood cell count, 5.631012/l (9.1 12.531012/l); hemoglobin, 94 g/l (137 203 g/l); hematocrit, 0.29 l/l (0.390.57 l/l); mean corpuscular volume, 52 fl (4048 fl); mean corpuscular hemoglobin concentration, 325 g/l (330370 g/l); absolute reticulocyte count, 1343109/l (31173109/l). The total leukocyte count (7.63109/l) was within the reference interval (3.515.03 109/l). Only mild serum biochemistry alterations were present, including a mild decrease in creatinine at 44 mmol/l (50 90 mmol/l) and mild increases in the activities of alanine transaminase (ALT) at 267 U/l (5157 U/l), aspartate transaminase (AST) at 158 U/l (1976 U/l), and creatine kinase (CK) at 223 U/l (18162 U/l). Blood smear examination revealed mild anisocytosis of the red blood cells and low numbers of polychromatophils. Low numbers of erythrocytes contained single, rarely multiple, centrally to paracentrally located, oval to round organisms (approximately 12 mm in diameter) with mor-

616

JOURNAL OF WILDLIFE DISEASES, VOL. 46, NO. 2, APRIL 2010

FIGURE 1. Blood smear from a juvenile female red fox (Vulpes vulpes) stained with Wright-Giemsa. Piroplasms morphologically similar to Babesia microti and identified by PCR as Babesia (Theileria) annae are evident within erythrocytes (arrows). Magnification51003.

FIGURE 2. Transmission electron micrograph of an organism similar to Babesia microti and Theileria equi within an erythrocyte from a juvenile female red fox (Vulpes vulpes). Bar5500 mm.

phology similar to Babesia microti (Fig. 1). A flotation performed on feces was positive for Alaria sp. (1+, out of a maximum score of 4+), Capillaria sp. (1+), and Uncinaria stenocephala (3+). Blood cells were prepared for transmission electron microscopy by mixing equal amounts of potassium ethylenediaminetetraacetic acid (EDTA) anticoagulated blood and 6% glutaraldehyde in 0.1-M phosphate buffer and incubating for 1 hr at room temperature. Further processing was performed as previously described (Cusack et al, 2001). On ultrastructural examination, intraerythrocytic parasitic trophozoites were round to ovoid and 0.51.0 mm in diameter (Fig. 2). Some organisms were elongated or had thin cytoplasmic extensions from the main body of the trophozoite (Fig. 3). The parasite cytoplasmic membrane was in direct contact with the erythrocyte cytoplasm. Internal structures included a double-membrane-covered nucleus, numerous vacuoles, smooth and rough endoplasmic reticulum profiles, and occasional tubular double-walled structures. At necropsy, the fox was found to be in moderate body condition with normal

skeletal muscle mass, minimal subcutaneous adipose tissue stores, and adequate internal adipose tissue stores. There was marked subcutaneous and intramuscular hemorrhage in the left caudolateral abdominal region. The dorsal portions of both lungs were dark red and had small pinpoint white foci randomly scattered throughout the affected pulmonary parenchyma. Intrapulmonary bronchi were filled with mucopurulent exudate. Overall, approximately 10% of the pulmonary parenchyma was affected by this lesion. The intestinal content was normal, and formed feces were present in the descending colon. Gross abnormalities were not present in other body systems. Tissues were collected for microscopic examination. They were fixed in 10% neutral buffered formalin and processed as previously described (Luna, 1968). Significant microscopic lesions were found in the brain, lung, liver, and spleen. The brain had a multifocal to locally extensive inflammatory lesion, primarily centered on blood vessels in the subarachnoid space and neuropil of the cerebrum and brainstem. The inflammation consisted primarily of lymphocytes and plasma cells admixed with a few macrophages, investing the blood vessels in cuffs of variable thickness. In some locations, the inflammation extended into the neuropil in a

SHORT COMMUNICATIONS

617

FIGURE 3. Transmission electron micrograph of an organism similar to Babesia microti and Theileria equi within an erythrocyte from a juvenile female red fox (Vulpes vulpes) showing an elongated trophozoite with prominent nucleus and double-walled tubular structure (arrow). Bar5500 mm.

multifocal or nodular pattern. In these areas, the inflammatory cells were admixed with a population of glial cells and a few gitter cells. Inclusion bodies or other infectious organisms were not visually identified within the areas of inflammation. A mild multifocal inflammatory lesion, primarily centered on bronchioles, was present in the lungs. The affected airways contained a mixture of mucus, sloughed degenerate epithelial cells, eosinophils, and neutrophils. Within one

bronchiole, there was a cross section of a single degenerating nematode, most likely Crenosoma vulpis due to the anatomical location of the parasite within the pulmonary parenchyma and high prevalence in wild foxes of the area (Nevarez et al., 2005). Diffuse hepatocellular intracytoplasmic vacuolization with a finely granular acidophilic material consistent with glycogen was present in the liver. The spleen was contracted, and the white pulp had moderate to marked lymphoid deple-

618

JOURNAL OF WILDLIFE DISEASES, VOL. 46, NO. 2, APRIL 2010

tion. A moderate number of macrophages in the red pulp had intracytoplasmic accumulations of hemosiderin. No significant findings were identified in the other body systems examined. Ancillary diagnostic testing included immunohistochemical examination of the brain for rabies virus, canine distemper virus, Neospora caninum, Sarcocystis spp., and Toxoplasma gondii using an avidin biotin complex-immunoperoxidase method. All test results were negative. Using a commercially available kit, DNA was extracted from potassium EDTA anticoagulated whole blood (QIAamp DNA Blood Mini Kit, Qiagen, Valencia, California). Nearly full-length (,1.7 kb) Babesia sp. 18S ribosomal ribonucleic acid sequences were amplified by polymerase chain reaction (PCR), purified, and sequenced directly bidirectionally as previously described (Birkenheuer et al., 2003). Primers were designed for this study (59GATATGTACCAAGAGCCATTCTTATG39 and 59-TGTTACTCCACTCATAGCAGCAC-39) to amplify a partial beta-tubulin (,0.65 kb) gene from the B. microtilike parasite of domestic dogs described in Spain, referred to as Babesia annae (AY144709), and the sequence reported from a fox captured in Cape Cod (AY144707). Reaction conditions for the beta-tubulin PCR were: Each reaction was performed in a 50-ml volume and contained a 13 concentration of PCR Buffer II, 1.25 mM MgCl2, 2.5 U of AmpliTaq Gold Polymerase (Applied Biosystems, Foster City, California), 50 pM of each primer, 200 mM of each dNTP, and 5 ml of DNA template. Cycling conditions were 95 C for 5 min followed with 40 cycles of 95 C for 15 sec, 54 C for 30 sec, and 72 C for 60 sec. The amplicons were visualized by ethidium bromide staining and ultraviolet light transillumination after electrophoresis in a 2% agarose gel. Amplicons were purified and sequenced directly bidirectionally as previously described (Birkenheuer et al., 2003). A B. annaeinfected sample was used as a positive control. Ribosomal RNA

gene sequences were compared to available sequences in Genbank using the basic local alignment search tool and were determined to have 100% homology with a B. microtilike parasite of domestic dogs described in Spain, referred to as B. annae, and with a single sequence reported from a fox captured in Cape Cod, Massachusetts, USA (Genbank accession number AY144702; Goethert and Telford, 2003). Interestingly, the beta-tubulin gene sequences from the fox in this report and the B. annaeinfected dog were identical to each other, as well as the beta-tubulin sequence from the fox captured in Cape Cod (AY144707). These results suggest that this gene may not be useful in discriminating the B. microtilike parasite of North American foxes from B. annae or that they are indeed the same organism. Disease associated with babesiosis (piroplasmosis) is characterized by anemia, thrombocytopenia, variable pyrexia, and possible hemoglobinuria (Camacho Garcia, 2006; Taboada and Lobetti, 2006). Chronic infections and/or subclinical carrier states have been reported (Taboada and Lobetti, 2006). This is the first report of a B. microti like parasite in a red fox in Canada. There have been reports of B. microtilike protozoa identified in wild and domestic small mammals in many parts of the world in recent years, including North America, Europe, and Japan (Zahler et al., 2000; Goethert and Telford, 2003; Birkenheuer et al., 2007). An agent genetically and morphologically similar to the agent described in this fox was originally described in dogs in Spain and has been called both Babesia annae and Theileria annae. Babesia annae has been shown to be hyperendemic in dogs in a region of northwest Spain (Camacho Garcia, 2006) and is associated with regenerative anemia, thrombocytopenia, azotemia, and proteinuria (Camacho Garcia, 2006). Molecular studies have shown infection with a Babesia species that is genetically indistinguishable from B. annae in 15 of 30 red

SHORT COMMUNICATIONS

619

foxes from Spain (Criado-Fornelio et al., 2003a; Criado-Fornelio et al., 2007), one fox from Massachusetts (Goethert and Telford, 2003), and two of 16 domestic cats tested from southern Europe (CriadoFornelio et al., 2003b). The distinction between the morphologically similar small piroplasms in the genera Babesia and Theileria rests mainly on the presence of an extra-erythrocytic (lymphocytic) life-cycle stage found in Theileria (Taboada and Lobetti, 2006). Exact genetic classification of and distinction between these parasites are complex and controversial, since many of the small Babesia species have not been studied exhaustively to rule out the existence of extra-erythrocytic life stages. Babesia annae has been shown to be morphologically and genetically similar to but distinct from B. microti, a rodent parasite widely distributed throughout the world. Babesia microti is the most common cause of human babesiosis and is diagnosed primarily in coastal New England and the upper Midwest of the US. Babesia microti is transmitted by the tick vector Ixodes scapularis, which is a generalist tick; both nymphal and adult life stages will opportunistically feed on humans (Keirans et al., 1996). Morphologically, the internal structures of the B. microtilike trophozoites in this fox, the absence of a parasitophorous vacuole, and the lack of identifiable induced changes in the host cell are similar to those described for Theileria (Babesia) equi trophozoites (Guimaraes et al., 2003). The double-walled tubular structure is similar to the tubular food vacuole described for Theileria equi, although no direct communication between this structure and the blood plasma or erythrocyte cytoplasm was seen in the present case. While it remains uncertain whether this protozoal infection in this fox was pathogenic or an incidental finding, the latter is more likely. The most prominent postmortem finding in this case was a meningoencephalitis of undetermined origin. Six

red foxes in recent years in Atlantic Canada have had similar neurologic lesions, and, despite extensive ancillary diagnostic testing, an infectious etiology has not been determined (Canadian Cooperative Wildlife Health Centre, unpubl. data). It is currently believed that the inflammation may be associated with a previously unidentified infectious agent, or the lesion represents residual inflammation following immune clearance of an organism. Cerebral babesiosis in animals has been associated with neurologic signs and postmortem lesions, including sequestration of parasitized erythrocytes in capillary beds and pavementing of parasitized erythrocytes against the endothelium. Similar lesions were not observed in the fox in this report, making cerebral babesiosis less likely. The diagnosis of this piroplasm in a fox from Prince Edward Island is particularly interesting because, to our knowledge, locally acquired tickborne infections are not reported in the veterinary literature for this province. While the possible vector of the parasite is unknown, it is not unreasonable to suggest the potential involvement of I. scapularis. This tick has a well-known role in transmitting several infectious organisms in northeastern and central North America, including the similar protozoal parasites Babesia divergens and B. microti (Thompson et al., 2001; Swanson et al., 2006). In addition, this tick has been recently identified on Prince Edward Island, and numbers appear to be increasing, based on passive surveillance on Prince Edward Island (Cawthorn et al., 1990; Ogden et al., 2006). Ixodes scapularis is the most common tick identified on domestic animals resident on Prince Edward Island, and other tick species are not common on domestic or wild animals resident on Prince Edward Island (AVC Diagnostic Laboratory, unpubl. data). Finally, ixodid ticks are the vector most often implicated in transmission of Theileria annae in other geographic areas

620

JOURNAL OF WILDLIFE DISEASES, VOL. 46, NO. 2, APRIL 2010

(Camacho et al., 2003), and I. scapularis is a generalist tick that has been previously documented to use the red fox as a host (Anderson, 1988). No obvious hemolytic anemia or renal disease similar to that described in dogs infected with B. annae was observed in this fox. This may be similar to observations in greyhounds and American pit bull terriers, which have a high prevalence of infection by Babesia canis vogeli and Babesia gibsoni, respectively, and yet often do not show clinical disease (Birkenheuer et al., 2005). Infected dogs of these breeds may be able to infect puppies in breeding colonies or other dogs through blood transfusions or fighting. With I. scapularis numbers apparently increasing and the seriousness of B. annae infection in dogs from northern Spain, discovering identical piroplasms in additional foxes from Prince Edward Island (unpubl., study in progress), as well as the potential for foxes to spread this piroplasm via infected ticks to domestic dogs, a potential health threat to the domestic dog population of Prince Edward Island and the surrounding region exists. This case report identifies B. annae in a single red fox. While this may be an incidental finding, identical organisms have been observed in additional foxes from Prince Edward Island (unpubl. data, study in progress). Much is yet to be learned about this recently discovered hemoparasite in foxes. This includes investigations for potential vector ticks or other modes of transmission, appropriate nomenclature, life cycle, prevalence in foxes, possibility for infection of other wild and domestic canids, and the significance to the health of infected individuals. The authors wish to thank A. Dover, hematology technologist with AVC Diagnostic Services, whose sharp eyes initiated the investigation of this case, D. Wadowska for the electron microscopy work and images, and M. Zahler for kindly providing Babesia annae samples.

LITERATURE CITED ANDERSON, J. F. 1988. Mammalian and avian reservoirs for Borrelia burgdorferi. Annuals of the New York Academy of Sciences 539: 180191. BENN, D. M., D. B. MCKEOWN, AND J. H. LUMSDEN. 1986. Hematology and biochemistry reference values for the ranch fox. Canadian Journal of Veterinary Research 50: 5458. BIRKENHEUER, A. J., M. G. LEVY, AND E. B. BREITSCHWERDT. 2003. Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. Journal of Clinical Microbiology 41: 41724177. , M. T. CORREA, M. G. LEVY, AND E. B. BREITSCHWERDT. 2005. Geographic distribution of babesiosis among dogs in the United States and association with dog bites: 150 cases (2000 2003). Journal of the American Veterinary Medical Association 227: 942947. , C. A. HARMS, J. NEEL, H. S. MARR, M. D. TUCKER, A. E. ACTON, A. D. TUTTLE, AND M. K. STOSKOPF. 2007. The identification of a genetically unique piroplasma in North American river otters (Lontra canadensis). Parasitology 134: 631635. CAMACHO, A. T. 2006. Piroplasma infection in dogs in northern Spain. Veterinary Parasitology 138: 97102. N, A. S. , E. PALLAS, J. J. GESTAL, F. J. GUITIA OLMEDA, S. R. TELFORD III, AND A. SPIELMAN. 2003. Ixodes hexagonus is the main candidate as vector of Theileria annae in northwest Spain. Veterinary Parasitology 112: 157163. CAWTHORN, R. J., B. S. HORNEY, AND R. MALONEY. 1990. Lyme disease vector, Ixodes dammini (the northern deer tick), identified on Prince Edward Island. Canadian Veterinary Journal 31: 220. CRIADO-FORNELIO, A., A. MARTINEZ-MARCOS, A. BUL A, AND J. C. BARBA-CARRETERO. 2003a. ING-SARAN Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe Part I. Epizootiological aspects. Veterinary Parasitology 113: 189201. , , , AND . 2003b. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in cats from southern Europe: A molecular study. Veterinary Microbiology 93: 307317. , C. REY-VALEIRON, A. BULING, J. C. BARBACARRETERO, R. JEFFERIES, AND P. IRWIN. 2007. New advances in molecular epizootiology of canine hemic protozoa from Venezuela, Thailand and Spain. Veterinary Parasitology 144: 261269. CUSACK, R. R., D. B. GROMAN, A. MACKINNON, F. S. B. KIBENGE, D. WADOWSKA, AND N. BROWN. 2001. Diseases of Aquatic Organisms 44: 716. GOETHERT, H. K., AND S. R. TELFORD III. 2003. What is Babesia microti? Parasitology 127: 301309.

SHORT COMMUNICATIONS

621

GUIMARAES, A. M., J. D. LIMA, AND M. F. RIBEIRO. 2003. Ultrastucture of Babesia equi trophozoites isolated in Minas Gerais, Brazil. Pesquisa ria Brasileira 23: 101104. Veterina KEIRANS, J. E., H. J. HUTCHESON, L. A. DURDEN, AND J. S. KLOMPEN. 1996. Ixodes (Ixodes) scapularis (Acari:Ixodidae): Redescription of all active stages, distribution, hosts, geographical variation, and medical and veterinary importance. Journal of Medical Entomology 33: 297318. LUNA, L. G. (ed.). 1968. Manual of histologic staining methods of the Armed Forces Institute of Pathology. McGraw-Hill Company, New York, New York, 258 pp. REZ, A., A. LO PEZ, G. CONBOY, W. IRELAND, AND NEVA D. SIMS. 2005. Distribution of Crenosoma vulpis and Eucoleus aerophilus in the lung of freeranging red foxes (Vulpes vulpes). Journal of Veterinary Diagnostic Investigation 17: 486489. OGDEN, N. H., L. TRUDEL, H. ARTSOB, I. K. BARKER, G. BEAUCHAMP, D. F. CHARRON, M. A. DREBOT, T. D. GALLOWAY, R. OHANDLEY, R. A. THOMPSON, AND L. R. LINSAY. 2006. Ixodes scapularis ticks collected by passive surveillance in Canada:

Analysis of geographic distribution and infection with Lyme borreliosis agent Borellia burgdorferi. Journal of Medical Entomology 43: 600 609. SWANSON, S. J., D. NEITZEL, K. D. REED, AND E. A. BELONGIA. 2006. Coinfections acquired from Ixodes ticks. Clinical Microbiology Reviews 19: 708727. TABOADA, J., AND R. LOBETTI. 2006. Babesiosis. In Infectious diseases of the dog and cat. 3rd edition, C. E. Greene (ed.). WB Saunders, St. Louis, Missouri, pp. 722736. THOMPSON, C., A. SPIELMAN, AND P. J. KRAUSE. 2001. Coinfecting deer-associated zoonoses: Lyme disease, babesiosis, and ehrlichiosis. Clinical Infectious Diseases 33: 676685. ZAHLER, M., H. RINDER, E. SCHEIN, AND R. GOTHE. 2000. Detection of a new pathogenic Babesia microtilike species in dogs. Veterinary Parasitology 89: 241248.

Submitted for publication 28 May 2008.