ANALYSIS OF MUTATIONS IN VSX1 GENE IN KERATOCONUS PATIENTS

PROJECT REPORT submitted in partial fulfillment of the requirements for the award of the degree of BACHELOR OF TECHNOLOGY in BIOTECHNOLOGY

by

ANIRBAN KAR (10904514)

under the guidance of Dr. KANTA D. ARUNACHALM, M.Sc., Ph.D., (Professor & HOD, Department of Biotechnology)

DEPARTMENT OF BIOTECHNOLOGY SCHOOL OF BIOENGINEERING FACULTY OF ENGINEERING AND TECHNOLOGY SRM UNIVERSITY KATTANKULATHUR 603 203
April 2008

CERTIFICATE
Certified that the project report entitled ANALYSIS OF MUTATION IN VSX1 GENE IN KERATOCONUS PATIENTS submitted by ANIRBAN KAR (10904514) is a record of project work done by him under my supervision. This project has not formed the basis for the award of any degree, diploma, associateship or fellowship.

INTERNAL GUIDE

HEAD OF THE DEPARTMENT

For the purpose of viva voce 1. 2.

DECLARATION
I do hereby declare that the project report entitled ANALYSIS OF MUTATION IN VSX1 GENE IN KERATOCONUS PATIENTS is a record of original work carried out by me under the supervision of Dr. KANTA D. ARUNACHALAM, HOD, Department of Biotechnology, SRM University, Kattankulathur. This project has not been submitted earlier in part or full for the award of any degree, diploma, associateship or fellowship.

Kattankulathur Date

(ANIRBAN KAR)

ACKNOWLEDGEMENT

I place my deep sense of gratitude to All India Institute of Medical Sciences for giving me an opportunity to work on this project and to use the facilities in the department. I would heartily take the opportunity to express my sincere gratitude to my project guide Dr. Arundhati Sharma for all her inspiration and the fascinating way of getting the works done in time; without which it would have been impossible for me to finish my work within this short time span. Her patience in explaining everything is highly appreciable which was of great help for me in both theoretical and practical part of the project. I would like to thank Dr. Kanta D. Arunachalam for becoming my internal guide and giving her valuable time and help in order to pursue this project. I would further thank to Ms. Preeti Paliwal and Ms. Anuradha Singh and Ms. Sarita for their cooperation in every sphere of my work. Without their help, this venture would not have been a success. I would like to extend my thanks to Mrs. Shardaji who is working as lab assistant over there for her gentle and polite behavior which is very much appreciable. I would extend my thanks to my friends over here; who all gave me moral support in the completion of the study and helped me out in critical situations.

ABSTRACT
Keratoconus is a degenerative non-inflammatory disorder of the eye leading to progressive thinning and steepening of the central cornea, changing it to a more conical shape than its normal gradual curve. The course of the disorder is variable. The patient suffers from blurred vision, myopia, astigmatism etc. It is a major cause of corneal transplants in the western world. Keratoconus affects around one person in a thousand and occurs in populations throughout the world. This progressive condition often onsets during the teenage years or early twenties with decreased vision. Studies reveal that over 5 lakh people suffer from this disease in India.

Genetic factors are known to play a role in its causation. A positive family history has been found in 6% to 10% of the patients. Keratoconus shows an autosomal dominant mode of inheritance. It has been found in all races and in both sexes but found to affect women more often than males. VSX1 homeobox gene encodes transcription factors implicated in the control of corneal development. Recent studies suggest that mutations in the VSX1 homeobox gene might be associated with Keratoconus.

Objective: In the present study, VSX1 gene will be screened for the possible presence of mutations in the Keratoconus patients.

Methodology: Blood samples will be collected from ten Keratoconus patients and ten unaffected individuals (controls). The sample will be subjected to DNA isolation followed by PCR to amplify DNA. The DNA will then be screened for possible mutation by SSCP (Single Strand Conformation polymorphism ).

ABBREVIATIONS

APS bp D DNA dNTPs EDTA Fig FP HD hrs INTACS KC M Min ml mm mM ng no. C PCR PMD PPCD

ammonium persulphate base pair dioptre deoxyribonucleic acid deoxyribonucleotides ethylenediamine tetraacetate figure forward primer homeodomain hours intrasomal corneal ring segment keratoconus molar minutes millilitre millimetre millimolar nanogram number degree celcius polymerase chain reaction pellucid marginal degeneration posterior polymorphous corneal dystrophy

RBC RP rpm rxn sec SSCP TBE TEMED u ug ul VSX1

red blood cell reverse primer revolution per minutes reaction seconds single strand conformation polymorphism tris borate-EDTA N,N,N,N-tetramethylenediamine micron microgram microlitres visual system homeobox 1

CONTENTS
S.No.
1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 1.10 1.11 1.12 1.13 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 3.0 4.0 4.1 4.2 4.3 4.4 4.5 5.0 6.0 7.0 8.0 9.0 INTRODUCTION Cornea Importance of cornea Structure of cornea Epithelium Stroma Endothelium Diagnosis of Keratoconus Types of Keratoconus Signs associated Prevalence of the disease Treatment of Keratoconus Causes of Keratoconus VSX1 gene REVIEW OF LITERATURE The environment and Keratoconus Etiology of Keratoconus Pathophysiology Histopathology Genetics VSX1 gene Prognosis Management AIMS AND OBJECTIVE METHODS AND MATERIALS Isolation of DNA Polymerase Chain Reaction Agarose Gel Electrophoresis Single Strand Conformational Polymorphism Silver staining of SSCP gel RESULT DISCUSSION SUMMARY LONGTERM GOALS REFERENCES

CHAPTERS

Page No.
1 2 3 3 4 5 5 6 7 8 9 10 10 11 12 13 14 16 18 19 21 25 25 27 28 28 31 36 38 41 43 48 51 53

LIST OF TABLES
Table:1 Composition of RBC lysis buffer Table;2 Composition of DNA extraction buffer Table:3 List of the primers used in the PCR technique Table:4 Composition of the PCR master mix Table:5 Cycling condition of the PCR Table:6 Composition of SSCP gel

LIST OR FIGURES:
Fig:1 Anatomy of the eye Fig: 2 The tissue is arranged in three main regions, or layers Fig: 3 The three forms of Keratoconus (nipple, oval, and globus) Fig.4 Distorted vision in Keratoconus Fig: 5 Eugene Kalt, MD, first to propose the use of a contact lens for keratoconus Fig: 6 Reactive oxygen species within the Keratoconus cornea result in an accumulation of toxic by-products that can trigger cornea thinning,scarring, and apoptosis Fig: 7 Breaks in Bowmans layer Fig: 8 Central versus mid-peripheral thickness changes in advanced Keratoconus Fig: 9 Ideogram of human VSX1 with positions of sequence changes identified Fig:10 Steps involved in PCR Technique Fig:11 Genomic DNA bands on 8% agarose gel Fig:12 PCR amplified bands of the five exons of VSX1 gene Fig:13 Mutational screening of exon 2 Fig:14 Mutational screening of exon 3 Fig:15 Mutational screening of exon 4 Fig:16 Mutational screening of exon 5.1 Fig:17 Mutational screening of exon 5.2

1.0 INTRODUCTION
The eye, with its intense exposure to light, has mostly slow tissue turnover rates, and its optical demands require exact tissue organization vulnerable to oxidant stress. This is particularly true for cornea which absorbs the major part of the UV rays entering the eyes optical system. So abnormalities caused by any kind of disease to this sensitive compound system may cause partial or full visual damage. Keratoconus is one of the corneal destrophies which cause severe damage to the visual system. Keratoconus (from Greek: kerato- horn, cornea; and konos- cone), is a degenerative, bilateral, non-inflammatory disorder of the eye in which the shape of the cornea becomes distorted. Burchard Mauchart, the German oculist was the first to describe Keratoconus which he called staphyloma diaphanum. However in 1854 British physician John Nottingham clearly described Keratoconus and distinguished it from other corneal ectasia. Keratoconus is an irregular protrusion of the cornea, the clear surface over the colored part of the eye. It is similar, structurally, to the crystal of a watch. In Keratoconus, the posterior layer may tear in rare cases. When this happens, the cornea may suddenly become swollen with water (termed hydrops).Wrinkles and scars may also form on a Keratoconus cornea.

-1-

1.1 CORNEA
The cornea provides a physical barrier that shields the inside of the eye from germs, dust, and other harmful matter. It shares this protective task with the sclera (the white of the eye). It acts as the eye's outermost lens. When light strikes the cornea, it bends or refracts the incoming light onto the crystalline lens. The lens then focuses the light onto the retina, the paper-thin tissue at the back of the eye that starts the translation of light into vision. Although it is much thinner than the lens, the cornea provides about 65 percent of the eye's power to bend light. Most of this power resides in the center of the cornea, which is rounder and thinner than the outer part of the tissue and is thus better suited to bend light waves.

Fig: 1 Anatomy of the eye

-2-

1.2 IMPORTANCE OF CORNEA

The cornea is essential to good vision. As the eye's outermost tissue, the cornea functions like a window that controls the entry of light into the eye. For example, the cornea filters out some of the most damaging ultraviolet (UV) wavelengths in sunlight. Without this protection, the crystalline lens and the retina would be highly susceptible to injury from UV radiation. If this "window" is curved too much, as is the case in some nearsighted people, faraway objects will appear blurry because distant light waves will refract imperfectly on the retina. If this "window" has imperfections or irregularities, as is the case in people with astigmatism, light will refract unequally, causing a slight distortion of the visual image. But, if this "window" is of normal shape and curvature, light will refract with exquisite precision to the crystalline lens.

1.3 STRUCTURE OF THE CORNEA

Cornea is a highly organized group of cells and protein. The cornea receives its nourishment from the tears and aqueous humor that fills the chamber behind it. Unlike most tissues in the body, the cornea contains no blood vessels to nourish or protect it against infection. It must remain transparent to refract light properly, and the presence of even the tiniest capillaries would interfere with this process.

-3-

Fig: 2 The tissue is arranged in three main regions, or layers:

1.4 EPITHELIUM
It is cornea's outermost region. It comprises about 10 percent of the tissue's thickness. The epithelium functions primarily to: (1) block the passage of foreign material--such as dust or water--into the eye and other layers of the cornea, and (2) provide a smooth surface that absorbs oxygen and other needed cell nutrients that are contained in tears. This layer, which is about five cells deep, is filled with thousands of tiny nerve endings that make the cornea extremely sensitive to pain when rubbed or scratched.

-4-

1.5 STROMA
Located behind the epithelium, the stroma comprises about 90 percent of the cornea. It consists primarily of water (78 percent); layered protein fibers (16 percent) that give the cornea its strength, elasticity, and form; and cells that nourish it. The unique shape, arrangement, and spacing of the protein fibers are essential in producing the cornea's light-conducting transparency.

1.6 ENDOTHELIUM
This single layer of cells is located between the stroma and the aqueous humor (see diagram). Because the stroma tends to absorb water, the endothelium's primary task is to pump excess water out of the stroma. Without this pumping action, the stroma would swell with water, become hazy, and ultimately opaque. Keratoconus is characterized by progressive thinning and steepening of the central cornea. The change of its shape prevents incoming light from being focused properly. Vision may be impaired as a result of swelling or scarring of tissue. Corneal Ectasias: Keratoglobus, pellucid marginal corneal degeneration, Terrien's marginal degeneration, Posterior Ectasia, forme fruste keratoconus Corneal Dystrophies: epithelial basement membrane dystrophy and stromal dystrophies such as granular, lattice, or macular dystrophy Corneal Warpage: secondary to rigid contact lens wear or irregular astigmatism.

-5-

1.7 DIAGNOSIS OF KERATOCONUS

Keratoconus can be difficult to detect, because it usually develops so slowly. However, in some cases, it may proceed rapidly. As the cornea becomes more irregular in shape, it causes progressive nearsightedness and irregular astigmatism to develop, creating additional problems with distorted and blurred vision. Glare and light sensitivity also may be noticed. The typical patient with undiagnosed Keratoconus complains of deteriorating vision, usually in one eye first, both at distance and near. Near visual acuity may improve if the patient squints or holds printed material closer. Keratoconus patients often report multiple images or ghosting of images and often relate a history of frequent refractive correction changes without much improvement in visual acuity. Patients may also report irritating symptoms such as intolerance to glare, photophobia and a recurrent foreign body sensation. Identification of moderate or advanced Keratoconus is fairly easy. However diagnosing Keratoconus in its early stages is far difficult. Often Keratoconus patients have several spectacle prescriptions in a short period, and none has provided satisfactory vision correction. Keratoconus patients often report monocular diplopia or polyopia and complain distortion rather than blur or both distance and near vision. The other several ways through which we can identify Keratoconus are the Retinoscopy shows an irregular scissor reflex Fleischer ring which may or may not surround the base of the cone completely,

-6-

Lines of Vogt which are small vertical brush like lines in the deep layer of Keratoconic stroma,

Significant thinning (up to 1/5th cornea thickness) can be observed in the advanced stages of the disease,

Sub-epithelial corneal scarring may occur as the progress of the disease because of the ruptures in Bowmans membrane which is filled with connective tissues,

Thickening of corneal nerves make them more visible Swirl staining may appear in patients who have never worn contact lenses because basal epithelial cells drop out and the epithelium slides from the periphery as the cornea regenerates.

Corneal hydrops occurs, generally in advance cases, when Descemets membrane ruptures, aqueous flows into the cornea, and reseals.

A low intraocular pressure is generally found which is the resulted from the thinning of cornea.

Corneal protrusion causing bulging of the lower lid on downgaze (Munson sign)

1.8 TYPES OF KERATOCONUS

Keratoconus can be classified on the basis of severity of curvature (Buxton JN et al, 1984) 1. Mild: <45D 2. Moderate: 45-52D

-7-

3. Advanced: >52D 4. Severe: >62D (D- Dioptre, units of corneal power) Keratoconus can also be classified on the basis of the cone shape (Buxton JN et al, 1984) 1. Nipple: 5mm diameter 2. Oval: >5mm diameter 3. Globus: >6mm diameter)
Fig: 3 The three forms of Keratoconus (nipple, oval, and globus)

1.9 SIGNS ASSOCIATED

1. Blurring of vision 2. Progressive myopia 3. Polyopia / diplopia 4. Repeated changing of glasses

-8-

5. Irritation, itching and redness of the eye 6. Poor night vision

Fig.4 Distorted vision in Keratoconus

1.10 PREVELENCS OF THE DISEASE

About 1/ 2000 people will develop Keratoconus (Heon et al, 2002). Most people will have a mild or moderate form of the disease. Less than 10% of keratoconics will develop the most severe form. It typically is diagnosed in the late teens or twenties. However, many people have been diagnosed in their mid to late thirties. Keratoconus is not an uncommon eye condition in India. Statistics reveal that over 5 lakh people suffer from this disease. The incidence of Keratoconus in families varies in literature from 5% to 20% in India.

-9-

1.11 TREATMENT OF KERATOCONUS

The treatment of Keratoconus is possible depending upon the severity of the disorder using glasses, contact lenses, INTACS (Introsomal Corneal Ring Segment), C3-R (Corneal collagen crosslinking with riboflavin a riboflavin eye drop to the eye) or corneal transplants when the visual acuity can no longer be corrected with contact lenses.

Fig: 5 Eugene Kalt, MD, first to propose the use of a contact lens for keratoconus.

1.12 CAUSES OF KERATOCONUS

Although progress had been made in understanding the molecular mechanisms of many corneal dystrophies, Keratoconus remains largely unexplained. Research suggests the weakening of the corneal tissue that leads to Keratoconus may be due to an imbalance of enzymes within the cornea. This imbalance makes the cornea more susceptible to oxidative damage from compounds called free radicals, causing it to weaken and bulge

- 10 -

forward. Risk factors for oxidative damage and weakening of the cornea include a genetic predisposition, explaining why Keratoconus often affects more than one member of the same family. The frequency of occurrence in close family members is not clearly defined, though it is known to be considerably higher than that in the general population, and studies have obtained estimates ranging between 6% and 19%. Corneal dystrophies, all of which have a genetic basis, are almost universally bilateral. Most patients with Keratoconus have bilateral disease. (In many instances the disease may initially be unilateral, but over time the contra lateral eye becomes involved). This bilateral nature of Keratoconus, similar to that of corneal dystrophies, strongly suggests that Keratoconus has a genetic basis. But a responsible gene has not been identified yet Keratoconus is also associated with overexposure to ultraviolet rays from the sun, excessive eye rubbing, a history of poorly fit contact lenses, and chronic eye irritation. Studies have revealed that VSX1 gene on chromosome 20 help convert naturally occurring but harmful superoxide radicals to molecular oxygen and water to exhibit autosomal dominant inheritance.

1.13 VSX1 GENE

The protein encoded by VSX1 gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development.

- 11 -

2.0 REVIEW OF LITERATURE

Keratoconus has well-described clinical signs, but early forms of the disease may go undetected unless the anterior corneal topography is studied. Classic histopathologic features include stromal thinning, iron deposition in the epithelial basement membrane, and breaks in Bowman's layer. Keratoconus is most commonly an isolated disorder, although several reports describe an association with Down syndrome, Leber's congenital amaurosis, and mitral valve prolapse. The differential diagnosis of Keratoconus includes keratoglobus, pellucid marginal degeneration and Terrien's marginal degeneration. Tan B et al, in 2008 described how Keratoconus influences optical performance of the eyes and found that myopic nature of spherical equivalent SE is greatly dominated by the location of the cone. Infectious keratitis and corneal perforation associated with corneal hydrops and contact lens wear were described by Schrier A et al, in 2008 where they found the tear in Descement's membrane, stromal oedema, and epithelial bedewing associated with corneal hydrops results in loss of the epithelial-endothelial barrier of the cornea, creating a conduit for infectious organisms through the cornea. H. Lichter et al, in 2000 investigated the prevalence of Keratoconus in patients with mitral valve prolapse (MVP). And they concluded that a borderline important association of MVP with Keratoconus and with allergy exists. Patients with mitral valve prolapse complaining of poor vision should be suspected of having Keratoconus.

- 12 -

Wakako Adachi et al, 2002 in their study of the association of HLA antigens with Keratoconus in Japanese patients says HLA-A26, B40, and DR9, which were found relatively frequently in the ancient Japanese population, seem to be associated with Keratoconus in younger individuals.

2.1 THE ENVIRONMENT AND KERATOCONUS

Although it is generally believed that Keratoconus has a genetic component, there are increasing data that suggest the environment might also play a role in the development of the condition. Cristina Kenneys research team has discovered that corneas with Keratoconus have been exposed to a number of factors that can produce reactive oxygen species (i.e., free radicals). These include ultraviolet light, atopy, mechanical eye rubbing, and poorly fitted contact lenses. They propose that susceptible corneas exhibit an inability to process reactive oxygen species because they lack the necessary protective enzymes (e.g., ALDH3 and superoxide dismutase). The reactive oxygen species result in an accumulation of toxic by-products such as MDA and peroxynitrites that can damage corneal proteins and trigger a cascade of events that disrupt the corneas cellular structure and function. This can result in corneal thinning, scarring, and apoptosis. If this theory is valid, it might be prudent for Keratoconus patients to minimize the factors that can cause reactive oxygen species to be formed.

- 13 -

Fig: 6 Reactive oxygen species within the Keratoconus cornea result in an accumulation of toxic byproducts that can trigger cornea thinning,scarring, and apoptosis.

2.2 ETIOLOGY OF KERATOCONUS

Recent research conducted by Steven Wilson, 1998, at the University of Washington suggests that Keratoconus somehow accelerates the process of keratocyte apoptosis, which is the programmed death of corneal cells that occurs following injury. Minor external traumas, such as eye rubbing, poorly fitted contact lenses, and ocular allergies can release cytokines from the epithelium that stimulate keratocyte apoptosis (the earliest observable stromal response to an epithelial injury). Although keratocyte apoptosis is virtually never detectable in the absence of epithelial injury in normal patients, a high percentage of Keratoconus patients show evidence of such cell death. This typically takes place first in the anterior stroma and is manifested by breaks in Bowmans layer fig:7 and later as stromal thinning fig:8 Wilson has also

- 14 -

suggested that genetics may play a role in the etiology of Keratoconus, in that some patients may have a genetic predisposition to chronic Keratocyte apoptosis.

Fig: 7 Breaks in Bowmans layer

Fig: 8 Central versus mid-peripheral thickness changes in advanced Keratoconus.

- 15 -

Cristina Kenney, MD, PhD, of Cedars-Sinai Medical Center in Los Angeles, has suggested that Keratoconus corneas may have increased enzyme activities and decreased levels of enzyme inhibitors. This combination results in the production of toxic byproducts that bring about a cascade of events throughout the cornea, resulting in corneal thinning and scarring.

2.3 PATHOPHYSIOLOGY
Despite extensive laboratory and clinical research, the aetiology of Keratoconus is poorly understood. It is thought to include biochemical, physical and genetic factors; however no single proposed theory explains the various clinical features. It is, therefore, likely that the development of Keratoconus is the final common pathway for several different disorders. Laboratory studies have indicated that keratoconic corneas show signs of increased activity of proteinase enzymes and a reduced activity in the proteinase inhibitors found within the cornea. This imbalance between corneal metalloproteinases (MMP) and its inhibitors (tissue inhibitors of metalloproteinases or TIMPs) can reduce the various extracellular matrices and proteins within the cornea, resulting in stromal thinning and breaks in Bowmans layer/epithelial basement membrane. Enzyme proteinase inhibitors found to be reduced in keratoconic corneas include 1proteinase inhibitor, 2-macroglobulin and TIMP-1 (Zhou L et al, 1998).These deficits may lead to an increase in the degradative enzymes present, including cathepsins, trypsins, and MMPs, including MMP-1, MMP-2 and MMP-13 (Brown D et al, 1993).

- 16 -

Levels of 1 are also reduced by the presence of peroxynitrate, a cytotoxic by-product from the nitric oxide pathway (Buddi R et al, 2002). It is known that as the cornea is responsible for absorbing most of the UVB light that enters the eye, it has to process the oxygen-free radicals produced. Oxygen-free radicals or reactive oxygen species (ROS) are high energy molecules that can build up and cause oxidative damage to cells by reacting with proteins, DNA and membrane phospholipids (Kenney Mc et al, 2000).

In addition, ROS produce aldehydes via ROS-mediated lipid peroxidation. These aldehydes can be destructive to cells by interfering with proteins and DNA, altering signal transduction and gene expression. Normally the cornea eliminates ROS by various antioxidant enzymes; including superoxide dismutase (SOD), catalase, glutathione reductase and glutathione peroxidise (Kenney Mc et al, 2005) and protect itself from lipid peroxidation damage by glutathione s-transferase and aldehyde dehydrogenase enzymes (ALDH3). It has been shown that keratoconic corneas are deficient in SOD, catalase and ALDH3. These deficits may cause a significant build up in malondialdehyde (MDA) a cytotoxic aldehyde from both the lipid peroxidation and nitric oxide pathways. MDA results in altered protein functions and the release of lysosomal protoeolytic enzymes. Another observation has been the evidence of increased apoptosis in keratoconic corneas. Apoptosis is the process of programmed cell death that occurs in tissue development, disease and wound healing. It has been proposed that mechanical trauma to the epithelium from RGP lenses, vigorous eye rubbing and severe atopy could cause apoptosis to occur in the underlying stroma(Wilson E et al, 1998). Within the keratoconic cornea there is evidence of an abnormality in the regulation and signaling pathways of cells. There are higher levels of leukocyte common antigen-related
- 17 -

protein (LAR) than in normal corneas. The LAR protein has the ability to interfere with the intracellular communication, cellular interaction and induce apoptosis (Chiplunkar chamblis K et al, 1999). A possible explanation for how all these observations are connected has not yet been proven. However, keratoconic corneas appear to have underlying defects in their ability to process ROS. Allowing these high energy molecules to build up in the cornea results in a greater level of oxidative damage to the cells and causes cytotoxic by-products such as MDA. These changes may subsequently lead to a cascade of further events including an imbalance in the MMP/TIMP systems, resulting in degradation of the corneal stroma and subsequent thinning and ectasia (Kenney Mc et al, 2000).

2.4 HISTOPATHOLOGY
Anomalies of every layer of the cornea can occur in Keratoconus and depend and vary with the severity of the disease (Hollingsworth JG et al, 2005). At the apex of the cone, the epithelium is often thinned (especially with contact lens wear) with irregular, elongated, exfoliating superficial cells, irregular wing cell nuclei and flattened and reduced basal epithelium integrity with apoptotic cells. Epithelial basement membrane is often broken and irregular in appearance. There is reduced corneal nerve density and thickening of nerves, especially in the nerve fibre layers found in close association with deformities in Bowmans layer and keratocytes. Bowmans layer has structural abnormalities and defects with regions where the epithelium and stroma are in direct contact. In the stroma there is thinning due to progressive reduction in the number of

- 18 -

collagen lamellae, altered orientation of the fibrils, especially around the apex of the cone and a reduction in the volume of proteoglycans present between the fibrils. There is a loss of keratocytes with irregular arrangement immediately under Bowmans layer and folds in both the anterior and posterior stroma. Descemets membrane often shows folds and ruptures in acute hydrops. The endothelium is usually normal in appearance, however there maybe intracellular dark structures, pleomorphism, and cellular enlargement.

2.5 GENETICS
A genetic predisposition to Keratoconus has been observed (Hammerstein W et al, 1974) with the disease reported with increased incidence in some family groups (Zadnik K et al, 1998) and reports of concordance in identical twins. The frequency of occurrence in first and second degree family members of affected individuals is variable, although it is known to be considerably higher than that in the general population. Studies have estimated between 6 per cent and 19 per cent of close family members may be affected. Genetic linkage studies have demonstrated multiple loci on different chromosomes, suggesting a number of genes may contribute to Keratoconus susceptibility (Rabinowitz Ys et al, 2005) and while most genetic studies agree on a dominant autosomal model of inheritance, other models of inheritance have been suggested and variable penetrance is well documented.

The genetics of Keratoconus is extremely complex and heterogeneous. It is likely that Keratoconus is caused by multiple genes and in many instances may result from complex

- 19 -

interactions between genes and environmental factors. It is also likely that in different families Keratoconus is the result of different gene defects or different gene environmental interactions. These factors make it difficult to identify clearly a single-gene defect as has been done in other ocular genetic diseases. The best chances of identifying genes are in rare single families or in rare populations with high concentrations of keratoconics because of a common founder. In these situations, heterogeneity is significantly minimized so that results of linkage analysis become more valid.

To identify the mutant genes dealing with the corneal dystrophies Gordon K. Klintworth et al in 1999 described his molecular genetic studies of the corneal dystrophies which suggest that genes on at least 10 human chromosomes are involved in the maintenance of corneal transparency (chromosomes 1, 5, 9, 10, 12, 16, 17, 20, 21, and X). Within the 10 chromosomes to which corneal dystrophies have been mapped, specific genetic mutations in seven genes (GSN, BIGH3, KRT3, KRT12, MSS1, GLA, and ARSC1) have been identified in 15 corneal dystrophies. Some corneal dystrophies that are considered distinct clinicopathologic entities are actually caused by different mutations in the same gene. For example, lattice dystrophy types I and IIIA, granular corneal dystrophy types I, II (Avellino dystrophy), and III (Reis-Bcklers dystrophy), and Thiel-Behnke corneal dystrophy are the result of mutations in BIGH3. Mutations in three genes (GSN, BIGH3, and MSS1) are associated with amyloid deposition in the cornea. A gene for Keratoconus has been mapped to chromosome 21, which is noteworthy because of the established association of Keratoconus in Down syndrome (trisomy 21). And from this he concluded
- 20 -

that recent genetic studies on the corneal dystrophies provide insight into some of these disorders at a basic molecular level. Some corneal dystrophies that were previously believed to be distinct clinicopathologic entities are closely related at the molecular level with the different phenotypes resulting from distinct mutations in the same gene.

2.6 VSX1 Gene

Human VSX1 is a member of the Vsx1 group of vertebrate paired like-homeodomain transcription factors. The VSX1 gene was first identified in goldfish, and orthologues have been identified in the zebrafish, chicken, cow, and mouse. In situ hybridization in these species has shown that vsx1/VSX1 is expressed in the outer tier of the nuclear retina, suggesting that it plays a role in the development of bipolar interneuron. In humans, VSX1 mRNA has been detected in the inner nuclear layer of the retina, in embryonic craniofacial tissue, and in the adult cornea. VSX1 was localized to 20p11 q11 region, and its five exons are distributed across a 6.2-kb coding sequence. Because of the ocular expression of VSX1 and its chromosomal localization, Hayashis group selected it as a candidate gene for posterior polymorphous dystrophy, which has been mapped to the same region. This study was extended to isolated Keratoconus because a mutation in this gene was detected in a patient who had both posterior polymorphous dystrophy and Keratoconus. These investigators subsequently performed reversetranscription polymerase chain-reaction studies on RNA isolated from adult cornea. VISX1 was not detected in the corneal cDNA obtained from two different adult corneas.

- 21 -

Hosseini SM et al in their analysis of chromosome 20-related posterior polymorphous corneal dystrophy described the evidence of genetic heterogeneity of chromosome 20related PPCD and refinement of the original PPCD1 interval. The full genomic sequence of VSX1 and coding exons of three other candidate genes were excluded from being pathogenic in the original PPCD1 family. Gwilliam R et al in their study about Posterior polymorphous corneal dystrophy in Czech families has mapped chromosome 20 and their Linkage data and sequence analysis exclude VSX1 as causative of PPCD in two Czech families. Hon E et al in May 2002 described VSX1 as a gene for posterior polymorphous dystrophy and Keratoconus. In their study they said mutations in the VSX1 homeobox gene for two distinct inherited corneal dystrophies; posterior polymorphous dystrophy (PPD) and Keratoconus. One of the mutations (R166W) responsible for Keratoconus altered the homeodomain and impaired DNA binding. Two other sequence changes (L159M and G160D) were associated with Keratoconus and PPD, respectively, and involved a region adjacent to the homeodomain. The G160D substitution, and a fourth defect affecting the highly conserved CVC domain (P247R), occurred in a child with very severe PPD who required a corneal transplant at 3 months of age. In this family, relatives with the G160D change alone had mild to moderate PPD, while P247R alone caused no corneal abnormalities. However, with either the G160D or P247R mutation, electroretinography detected abnormal function of the inner retina, where VSX1 is expressed. These data define the molecular basis of two important corneal dystrophies and reveal the importance of the CVC domain in the human retina.

- 22 -

A recent study by Heon et al suggests that mutations in the VSX1 homeobox gene (mapped to chromosomal region 20p11q11) may play a role in up to 4.7% of patients with isolated Keratoconus.

In humans VSX1 mRNA has been found in outer tier of the inner nuclear layer of the retina, in embryonic craniofacial tissue and cornea. VSX1 is normally expressed in developing cornea and not in adult cornea. It is localized to 20p11-q11region and has 5 exons spanning across 6.2 kb of coding sequence. (Heon et al, 2002). In a study conducted on the Canadian population by Heon et al in 2002 the following mutations were found to be associated with keratoconus: R166W, L159M, D144E, H244R and L17P In another study done in a series of Italian patients by Luigi Bisceglia et al in 2005 affected by Keratoconus, the following mutations were analysed: D144E, G160D, P247R and L17P One study showed the presence of D144E mutation in VSX1 gene to be associated with Keratoconus (Aldave AJ et al, 2006).

- 23 -

Fig: 9 Ideogram of human VSX1 with positions of sequence changes identified.

However Anthony J et al found no VSX1 gene mutations to be associated with Keratoconus. In their study they said about the four previously identified presumed pathogenic mutations in the VSX1 gene (Leu17Pro, Asp144Glu, Leu159Met, and Arg166Trp); only Asp144Glu was identified in a single affected patient. Two novel single nucleotide polymorphisms (SNPs), both resulting in synonymous substitutions, were identified: c.53G>T (Ser6Ser) in four affected patients and c.209G>T (Pro58Pro) in two affected patients. Two previously reported SNPs were also identified: c.426C>A (Arg131Ser) in one affected patient and c.581A>G (Ala182Ala) in 51 of the 100 affected patients. So they concluded saying that only one of the presumed pathogenic mutations in the VSX1 gene, Asp144Glu, was identified in a single member of the cohort of affected patients. However, as previously demonstrated, Asp144Glu is a nondisease-causing polymorphism. The absence of pathogenic mutations in the VSX1 gene in a large number of unrelated Keratoconus patients indicates that other genetic factors are involved in the development of this disorder.

- 24 -

2.7 PROGNOSIS
Individuals with Keratoconus typically present with mild astigmatism in adolescence initially correctable with spectacles and soft contact lenses and are usually diagnosed a few years after initial presentation. In rare cases, Keratoconus presents in childhood or later in adulthood. Early age of onset appears to indicate a greater risk of disease severity later in life. The course of the disorder can be quite variable, with some patients remaining stable for years or indefinitely, while others progress rapidly or experience occasional exacerbations over a long and otherwise steady course. Most commonly, Keratoconus progresses for a period of 10 to 20 years8 before the course of the disease stabilises in middle age.

2.8 MANAGEMENT
Robert B et al in their article has described about the management of Keratoconus with the modern technological advances. Management of Keractoconus has undergone a major revision due to the recent introduction of videokeratography. This instrumentation has provided a method by which Keratoconus can be classified and evaluated in a way that was never possible before. Videokeratography has improved the diagnosis of Keratoconus and provided a means for accurately measuring its progression. It has allowed a better understanding of the shape of the cornea and the position and power of the cone apex. In addition, videokeratography has provided a basis for new contact lens designs and methods for fitting.
- 25 -

According to M.P. Rubinstein et al the use of SoftPerm hybrid lenses was investigated as part of a 10 year retrospective audit of Keratoconus in the Contact Lens Service at Nottingham University Hospital which serves a population of approximately one million. DOS.N. Cox Described an event where in a retrospective analysis of 88 new patients with a five year follow up who presented with Keratoconus, contact lenses, particulary hard corneal lenses, provided the major contribution to the management of early and moderate Keratoconus with an immediate improvement of up to 7 lines of Suellen visual acuity at diagnosis.

- 26 -

3.0 AIMS AND OBJECTIVE

The objective of this project work is to study the mutation spectrum in VSX1 gene for the Keratoconus patients 1. Isolating DNA from peripheral blood 2. Study the banding patterns in the SSCP gel 3. Screen the VSX1 gene for the possible presence of mutations

- 27 -

4.0 METHODS AND MATERIALS

Blood from 10 patients, diagnosed with Keratoconus and 10 controls were collected from Rajendra Prasad Centre of Opthalmic Sciences (RPC) outpatient clinic (OPD) of AIIMS and taken in separate vials containing EDTA.

4.1 ISOLATION OF DNA (sambrook et al, 1989)

MATERIALS
RBC lysis buffer solution DNA extraction buffer solution ProteinaseK solution Chilled absolute ethanol TBE buffer 5M NaCl solution

Reagent preparation
RBC lysis buffer solution:

- 28 -

500ml of RBC lysis buffer solution was prepared in the composition given bellow:
Table:1 Composition of RBC lysis buffer

Sucrose Triton X100 MgCl2 Tris HCl

54.78g 5ml 0.508g 5ml

Necessary amount of distilled water was added to make the content up to 500ml.

DNA extraction buffer solution: 500ml of DNA extraction buffer solution was prepared in the composition given bellow:
Table;2 Composition of DNA extraction buffer.

Tris HCl 0.5M EDTA 0.1% SDS 0.5M N- lauryl darcosine

5ml 1ml 0.5g 2.5g

Distilled water was added to make the content up to 500ml.

- 29 -

METHOD
Genomic DNA from 5ml of the peripheral blood was isolated. The protocol followed in the process is give bellow: 1. 5ml of peripheral blood was drawn in EDTA. 2. Approximately 2-3 times the volume of RBC lysis buffer was added and was mixed well. 3. This mixture was centrifuged at 4C for 10 minutes in 2000rpm. 4. The supernatant was discarded and the pellet was resuspended. 5. 2-3times the volume of RBC lysis buffer was added and was mixed well. 6. The solution was centrifuged for 5minutes at 2000rpm at 4C. 7. Supernatant was discarded and the pellet was resuspended. 8. 2-3times the volume of RBC lysis buffer was added again was mixed well and kept for centrifugation at 2000rpm for 5minutes at 4C. 9. Supernatant was discarded and the pellet was resuspended. 10. 600ul of DNA extraction buffer was added and 10ul of 100ug/ml proteinaseK enzyme was added. 11. This mixture was then kept for incubation at 55C for 2-3hours. 12. 250ul of Sodium chloride solution and 6ml of chilled absolute ethanol was then added one after another to each tube and was mixed well. White DNA Precipitates as long strands. 13. The DNA was transferred to another tube and was centrifuged at 2000rpm for 2minutes. 14. The DNA was then washed with 500ul of 70% ethanol.
- 30 -

15. The pellet was kept for drying in 37C for approximately 3hrs. 16. In the next step the pellets were resuspended in 500ul of TE buffer and were kept over night at 37C.

4.2 POLYMERASE CHAIN REACTION (PCR)

The polymerase chain reaction (PCR; Erlich, 1989) is a powerful technique that has rapidly become one of the most widely used techniques in molecular biology. The technique amplifies specific DNA fragments from minute quantities of source DNA material, even when that source DNA is of relatively poor quality. PCR is a rapid, inexpensive and simple way of copying specific DNA fragments. It does not necessarily require the use of radioisotopes or toxic chemicals It involves preparing the sample DNA and a master mix with primers, followed by detecting reaction products

STEPS INVOLVED IN PCR

PCR is an iterative process, consisting of three elements: denaturation of the template by heat, annealing of the oligonucleotide primers to the single stranded target sequence, and extension of the annealed primers by a thermostable DNA polymerase.

Denaturation:
In this process DNA fragment is heated in high temperature which reduces the DNA double helix to single strand thus becoming accessible to the primers. Double stranded DNA templates denature at a temperature that in determined in part by their GC content.

- 31 -

Higher the proportion of G+C, higher the temperature required to separate the strands of the DNA. In PCR catalyzed by Taq polymerase, denaturation is carried out at 94-95C.

Annealing of primers to template DNA:

In this step the reaction mixture is cooled down. Primers anneal to the complementary regions in the DNA template strands, and double strands are formed again between primers and complementary sequences. The temperature used for the annealing step is critical. If the annealing temperature is too high the oligonucleotide primers anneal poorly on the other hand if the annealing temperature is too low nonspecific annealing of primers may occur resulting in the amplification of the unwanted segments of the DNA.

Extension of oligonucleotide primers:

In this step the DNA polymerase synthesizes a complementary strand. The enzyme reads the opposing strand sequence and extends the primers by adding nucleotides in the order in which they can pair. The whole process is repeated over and over. The optimal temperature for this process is 72-78C
Fig:10 Steps involved in PCR Technique

- 32 -

The DNA of each patient was amplified using specific primers for all the 5 exons of the VSX1 gene:

PRIMERS USED IN THE PCR TECHNIQUE:

Table:3 List of the primers used in the PCR technique.

PRIMER

SEQUENCE

AMPLICON SIZE (base pairs)

CODING REGION (base pairs)

1F 1R 2F 2R 3F 3R 4F 4R 5F 5R

5cagctgattggagcccttc3 5ctcagagcctaggggacagg3 5gcccactaaaaatgcagaa3 5gcctcctaggaactgcagaa3 5cattcagaggtggggtgtt3 5tcttgtggtgccttcagcta3 5gatcatgatcgggagagaag3 5cgttgctttgctttggaaat3 5ccccagagataggcactgac3 5tggacaatttttgtcttttgg3

599

424

393

79

419

124

394

181

495

290

- 33 -

Preparation of PCR master mix:

Master-mix of the PCR reaction is the solution which will be used for the amplification of all the 5 exons. The composition of the mix is given bellow:
Table:4 Composition of the PCR master mix.

Reagents Rxn buffer

Stock 10X

Working solution 1X

MgCl2

20mM

3.2mM

dNTPs

10mM

0.2mM

Forward Primer Reverse Primer Taq polymerase

10mM 10mM 0.5U

0.2mM 0.2mM 0.5U

- 34 -

PCR cycling condition for the five exons:

The cycles in the PCR reaction was carried out as follows:
Table:5 Cycling condition of the PCR

Initial Denaturation Denaturation Annealing

95C for 12 minutes 94C for 30 seconds 58C for (exon1) 30 seconds 59C for (exon2, 4, 5) 30 seconds 62C for (exon3) 30 seconds

Extension Final extension

72C for 30 seconds 72C for 7 minutes

The PCR was run for 35cycles and the end products were subjected to agarose gel electrophoresis to check the quality of the DNA.

- 35 -

4.3 AGRAOSE GEL ELECTROPHORESIS

Electrophoresis is a method of separating substances based on the rate of movement while under the influence of an electric field. Agarose is a polysaccharide purified from seaweed. Agarose gel electrophoresis is employed to check the progression of a

restriction enzyme digestion, to quickly determine the yield and purity of a DNA isolation or PCR reaction, and to size fractionate DNA molecules, which then could be eluted from the gel. Prior to gel casting, dried agarose is dissolved in buffer by heating and the warm gel solution then is poured into a mold which is fitted with a well-forming comb. Ethidium bromide is included in the gel matrix to enable fluorescent visualization of the DNA fragments under UV light. DNA molecules are long polymers, and the size of the strand is proportional to its negative charges because of the phosphate backbone. Longer the DNA fragment, the greater its charge. Thus, when placed in a semi-permeable buffered media, DNA will migrate by size, in a rate roughly proportional its charge to mass ratio, toward the positive electrode. Fragments will separate during the course of the gel run, with larger fragments migrating more slowly.

The DNA sample was further subjected to agarose gel electrophoresis (Sambrook et al, 1989).

A stock solution was prepared for agarose gel.

- 36 -

Preparation of the casting tray

The casting tray was sealed from all sides by tape to prevent leakage. Then the comb was placed in the tray.

Casting of gel
The prepared gel was then poured carefully in the casting tray and was left to solidify. After the gel was set the comb was taken out carefully. Gel was then placed in the electrophoresis chamber. TBE buffer was added so that there is about 2-3mm of buffer above the gel.

Loading the gel

5ul of the amplified DNA solution was taken from each tube and was mixed with 5ul mixture of xylene cynol and bromophenol blue. The sample was loaded using a 10ul pipette. Cathode and anode lid were connected to the electrophoresis chamber and the voltage was set at 130volts. Power was run until the blue dye approached to the end of the gel. Power supply was then stopped and the gel tray was then carefully removed from the chamber using gloves and visualized under UV light.

- 37 -

4.4 SINGLE STRAND CONFORMATIONAL POLYMORPHISM (SSCP)

Single stranded DNA molecules fold into complex three dimensional structures as a result of intrastrand base pairing. Single strand of equal length but different sequence can therefore vary considerably in electrophoretic mobility as result of looping and compaction caused by intrastrand pairing. Alteration of nucleotide sequence of the molecule by as little as a single base can reshape the secondary structure, with consequent changes in electrophoretic mobilities through native gels. SSCP exploits the differences in mobility between wild type and mutant strands of DNA.

Principle of SSCP:
The SSCP technique relies on the ability of mutational changes to affect the electrophoretic mobility of the single strand DNA in a non-denaturing polyacrylamide gel. During electrophoresis the negatively charged DNA polyion is dragged by the electric field through the fixed obstacle represented by the polymerized acrylamide. The electrphoretic mobility of ssDNA under non-denaturing conditions is dependent upon several factors including the charge which which naturally remains constant in molecules of same size. A more important factor, however, is the shape or configuration that the ssDNA adopts.

The steps involved in this technique are (Sambrook et al, 1989) Amplification by PCR. Denaturing the PCR product.
- 38 -

Electrophoresis of the single stranded DNA through a gel at neutral pH.

MATERIALS
Buffer and solutions Formamide loading buffer Sucrose gel loading buffer 10X TBE electrophoresis buffer Acrylamide solution (45% w/v) APS (10% w/v) Glycerol TEMED(N,N,N,N-tetramethylenediamine)

Equipment Elecrophoretic apparatus and plates with 1mm spacers

METHOD Preparation of SSCP gel

Table:6 Composition of SSCP gel

10x TBE buffer 29:1% acrylamide:bisacrylamide solution Ammonium persulphate Glycerol Water

4ml 7ml 240ul 4ml 25ml

- 39 -

The reagents were then mixed by gentle swirling.

Two 40*40-cm glass electrophoresis plates with 0.4mm spacers were assembled and attached together using tapes.

44ul of TEMED was added to the gel solution and was mixed by gently swirling the flask and the gel was poured.

The polymerized gel was then assembled in to the electrophoresis apparatus at room temperature. The buffer tanks were filled with 1x TBE buffer made from the same stock as the gel solution.

Preparation of samples for SSCP Electrophoresis

3ul of amplified products were diluted in 10ul of sucrose gel loading buffer. Similar aliquots were diluted into 10ul of formamide dye mix. The formamide containing buffer was boiled at 95C for 6 minutes and immediately chilled by keeping in ice water for 10minutes.

Analysis of DNA fragments by SSCP gel electrophoresis

Wells of the polyacrylamide gel were washed 1x TBE gel buffer and then 2ul of each sample were loaded with a gel loading buffer.

150V was applied to the gel for ~16hrs.

- 40 -

4.5 SILVER STAINING OF SSCP GELS

Silver staining is a highly sensitive technique for post electroporetic detection of DNA bands in polyacrylamide and agarose gel (sambrook et al, 1989). The three types of silver staining are:

Photo Development:
This process is same as the conventional photography where photonic energy is used the silver ions to metallic elements. This process is simple and comparatively faster but sensitivity is less.

Diammine staining:
In this method ammonium hydroxide is used to generate silver diammine complexes. Silver ions are then liberated from the complexes by decreasing the concentration of ammonium ions with citric acid. The liberated silver ions are finally reduced to metallic silver by formaldehyde.

Nondiammine staining:
This process involves fixation of DNA, sensitization of the DNA with glutaraldehyde, impregnation of the gel or membrane with silver nitrate at weak acidic pH, and reduction of bound silver ions to metallic silver by alkaline formaldehyde.

MATERIALS
Acetic acid (3% v/v) Developer
- 41 -

Ethanol (10% v/v) Formaldehyde (37% v/v) Nitric acid (0.7% v/v)

METHOD
1. After electrophoresis, the gel was placed in a tray which was still attached to one of the plates. 2. The gel was washed twice with distilled water to remove the electrophoresis buffer and to detach the gel from the plate. 3. The gel was fixed in 10% ethanol for 10minutes. 4. Ethanol was removed and the process was repeated. 5. Ethanol had been removed from the solution and 0.7% nitric acid was added for 6 minutes. 6. The nitric acid was removed and two washes with distilled water were given. 7. Staining of the gel was done with 0.2% of silver nitrate for 30 minutes. 8. Silver nitrate was removed and the gel was washed with three changes of distilled water. 9. 125ul of formaldehyde was added to 100ml of the developer and was left for developing. 10. Developer was discarded. 11. The gel images were documented.

- 42 -

5.0 RESULTS

The blood was drawn from 10 keratoconus patients and 10 controls and DNA from the peripheral blood was isolated. The DNA samples were run in agarose gel to check the quality. The bands of the DNA in the agarose gel were visualized under UV light and the gel image was documented.

Fig:11 Genomic DNA bands on 8% agarose gel

Banding pattern of DNA isolated from keratoconus patients

Amplification of the 5 exons of the VSX1 gene in the DNA samples was carried out in PCR (Polymerase Chain Reaction) technique.

- 43 -

Fig:12 PCR amplified bands of the five exons of VSX1 gene

Loading Wells 1.5% Agarose gel 100bp ladder

Exon 2 (393bps)

Exon 3 (419bps)

Exon 4 (394bps)

Exon 5 (495bps)- 44 -

The amplified products were run in SSCP (Single Strand Conformational Polymorphism) gel. The gel was stained with silver nitrate to look for changes. After staining the gel image and band pattern was documented.

- 44 -

Fig:13 Mutational screening of exon 2

ssDNA

controls

patients
Sequenced

Non denatured

sample

In fig:13 no changes were found between the banding patterns of the control and the patient samples.

Fig:14 Mutational screening of exon 3

ssDN A

Non denatured

patients

Sequenced samples

controls

In the fig:14 band shifts of the patients and the control samples were compared and the banding patterns were fond to be similar.
- 45 -

Fig:15 Mutational screening of exon 4

Nondenature

controls

Sequenc ed

patients

Fig:15 describes the comparison between the amplified products of the patient and control samples of exon 4 of the VSX1 gene where there is no unusual band shift was found.

Fig:16 Mutational screening of exon 5.1

Non

Controls

Denatured

sequenced Samples

Patients

Fig:16 shows no considerable band shift in between the control and the patient samples.
- 46 -

Fig:17 Mutational screening of exon 5.2

Sequenced

Non denatured

samples

control patients

In the fig:17 the band shifts of the control and the patient samples are found to be alost similar. So no considerable mutational changes can be predicted from it.

In the present study no mutations were detected in the samples analyzed by SSCP.

- 47 -

6.0 DISCUSSION
In most cases of Keratoconus studied till now no definite cause of the disease has been found. The genetic locus of Keratoconus or VSX1 on chromosome 20p11.2 has been identified as one possible candidate gene for the occurrence of Keratoconus apart from other loci. Expression of vsx1 is evident in mouse retina however no exp of vsx1 gene has been detected in mouse or human cornea. VSX1 gene is a homeobox gene distinguished by presence of a CVC (chx10/vsx/ceh) domain (a highly conserved region of unknown function) which lies C terminal of homeodomain. In human VSX1 mRNA has been found in the outer layer of retina, in embryonic craniofacial tissue and cornea. It is localized to 20p11-q11 region and has 5 exons spanning across 6.2kb of coding sequence. This gene also controls the centre cone bipolar cell differentiation and visual signaling.

Heon et al selected the VSX1 gene for screening as a positional candidate gene for PPCD (MIM, 122,000) because it is positioned within the chromosome 20p11-q11 PPCD1 candidate region. She had chosen to screen the VSX1 gene in Keratoconus patients because of previous reports of the coexistence the corneal disorder with PPCD. Sequence variants were identified in four patients. Two mutations (Leu159Met and Arg166Trp) were not identified in control subjects and were considered pathogenic; however the other two mutations (Asp144Glu and His244Arg) were also identified in subjects without Keratoconus and thus were considered possibly pathogenic. Insufficient evidence exists to consider either the Leu159Met or the Arg166Trp mutation to be causing disease
- 48 -

because neither was demonstrated to sort with the disease phenotype: the Leu159Met mutation was identified in one pedigree (three affected siblings and one affected parent), but no unaffected family members were examined. In addition, the Arg166Trp mutation was identified in a single sporadic patient with Keratoconus; VSX1 screening was not performed in any family members. Heon considers that her inability to detect the VSX1 gene in the adult cornea suggests that the VSX1 gene is normally expressed in the developing cornea but not in the adult cornea. Alternatively, she suggests that VSX1 may be required in non corneal cell types for the production of a signaling molecule that is essential for normal corneal development or maintenance. A possibility that they did not discuss about it in the paper was because patients had subtle retinal disease that would put this disease outside the realm of isolated Keratoconus. In her report, patients with posterior polymorphous dystrophy had abnormal electroretinogram results, but there is no evidence that electroretinograms were performed on the patients with isolated Keratoconus studied by her group. Keratoconus is strongly associated with retinal disease, in particular Lebers congenital amaurosis. Gene loci for families with Keratoconus and Lebers congenital amaurosis have been identified on chromosome 17, but there is no evidence from these studies that any genes in these regions play a role in isolated Keratoconus. In Besceglia et al study 2005 D144, G160D, P247R and a novel L17P mutation was found in 7 of 80 unrelated patients studied. D144E has earlier been reported in controls. G160A and P247R may not be linked to Keratoconus as these mutations have earlier been found to be associated with PPCD. Aldave et al 2006 reported only 1 case of this

- 49 -

mutation A144G in one of the 100 patients he studied however its occurrence was also traced back to 2 unaffected individuals thus considering its a possible polymorphism.

In the present study of 10 patients, the exons amplified in the SSCP as shown in the fig:13, fig:14, fig:15, fig:16 and fig:17 shows no considerable band shifts when compared with the control samples. So no mutation was found in this process. Earlier study by Heon et al and Besceglia et al are also lack of sufficient evidence to prove the pathogenicity of the gene. So it can be concluded from the study that the mutation in human VSX1 gene may not play a role in causing Keratoconus.

- 50 -

7.0 SUMMARY
Keratoconus is an eye disorder where in the cornea becomes thin and gradually cone shaped leading to visual distortion. Keratoconus cases account for approximately 1 in 2000 general population. Around 5% of the cases of the disease show familial history following mode of inheritance. Most Keratoconus cases are found to have an approximate onset in the teenage. Genetic factors have been implicated in the inheritance of Keratoconus.

VSX1 gene located on chromosome 20 has been suspected a candidate gene causing keratoconus. In this study, Vsx1 gene has been screened for the presence of mutation in the Keratoconus patients.

In the study 10 cases and 10 unrelated controls were analysed for mutations.

Age onset of Keratoconus showed 60% of the patients acquired the disease in between 12 to 19 years of age and the remaining was in between 20 to 28. The development of the eye occurs in majority during the teenage years. Thus it is very rare to observe the onset of the disease in children or aged patients.

The blood samples from the patients and the controls were collected and the DNA was isolated from the samples.
- 51 -

Quality of the DNA was checked in agarose gel electrophoresis.

DNA samples were further run in PCR so as to amplify the specific regions.

Amplified products were run in SSCP and then Stained in Silver nitrate solution to screen the mobility shifts and the possible sequence variants in molecular level.

From the present study it may be concluded that the VSX1 gene may not have a major role in the occurrence of Keratoconus. There may be other genes involved or VSX1 gene may be acting in conjunction with the other genes to cause the disease phenotype.

- 52 -

8.0 LONG TERM GOALS

There may a lot of possibilities which will be considered in my future work which includes: Bidirectional sequencing of the exons (2-5.2) will be done at the next stage of my work where all the exons will be sequenced. In the next stage the sequences will be compared with the gene bank databases and the mutational analysis will be verified. The sequencing of the exon 1 was not possible to be done with the SSCP method as the region of the exon was very large. So it will directly be analysed in bidirectional sequencing method. In the present study it was found that VSX1 gene is probably not involved directly in the occurrence of Keratoconus. But it may be a cause which influences the disease. So in my future study the actions of VSX1 gene on the teenage and the adult cornea will be screened elaborately.

- 53 -

REFERENCES
Anthony J. Aldave,1 Vivek S. Yellore,1 Andrew K. Salem,1 Gina L. Yoo,1 Sylvia A. Rayner,1 Brown D, Lin B, chwa M, saghizadeh M, atilano sr, Ljubimov aV, Kenney Mc. Peroxynitrate can degrade tIMP-1 and increase gelatinase activity in human corneal cell cultures. Exp Eye Res. Brown D, chwa M, Opbrock a, Kenney MC. 1993. Keratoconus corneas increased gelatinolytic activity appears after modification of inhibitors. Curr Eye Res,;12:571581. Buddi r, Lin B, atilano sr, Zorapapel Nc, Kenney Mc, Brown DJ. 2002; evidence of oxidative stress in human corneal disease. J Histochem Cyctochem, 50:341-351. Chwa M, Atilano sr. reddy V, Jordan N, Kim DW, Kenney Mc. 2006 Increased stress-induced generation of reactive oxygen species and apoptosis in human keratoconus fibroblasts. Invest Ophthalmol Vis Sci,;47:1902-1910.) Chiplunkar chamblis K, chwa M, rosenberg s, Kenney Mc, Brown DJ. 1999; enhanced expression of a transmembrane phosphotyrosine phosphatase (Lar) in keratoconus cultures and corneas. Exp Eye Res, 68:283-293. Davis LJ. Keratoconus: 1997. Current understanding of diagnosis and management. Clin Eye Vis Care, 9(I): 13-22, Donnenfeld ED, Schrier A, Perry HD, Ingraham HJ, Lasonde R, Epstein A, Farber B. 1996 May. Infectious keratitis with corneal perforation associated with corneal hydrops and contact lens wear in keratoconus. Br J Ophthalmol.;80(5):409-12. )
I

Edwards M, McGhee cN, Dean s. 2001the genetics of keratoconus. Clin Experiment Ophthalmol,;29(6):345-51.)

(FRCS, DOS.N. Cox, April 1984. Management of keratoconus in Moorfields Eye Hospital, Journal of The British Contact Lens Association Volume 7, Issue 2, , Pages 86-91)

Gordon K. Klintworth December 1999. Advances in the molecular genetics of corneal dystrophies American Journal of Ophthalmology, Volume 128, Issue 6, , Pages 747-754)

Gwilliam R, Liskova P, Filipec M, Kmoch S, Jirsova K, Huckle EJ, Stables CL, Bhattacharya SS, Hardcastle AJ, Deloukas P, Ebenezer ND, Posterior polymorphous corneal dystrophy in Czech families maps to chromosome 20 and excludes the VSX1 gene

Xiaohui Li, Yaron S. Rabinowitz, Karim Rasheed and Huiying Yang; Issue 3, March 2004.Longitudinal study of the normal eyes in unilateral keratoconus patients. Ophthalmology, Volume 111, , Pages 440-446

H. Lichter MD, N. Loya MD, A. Sagie MD, N. Cohen MD, L. Muzmacher MD, Y. Yassur MD and D. Weinberger MD, May 2000. Keratoconus and mitral valve prolapse , American Journal of Ophthalmology, Volume 129, Issue 5, , Pages 667668)

II

Hammerstein W. Zur 1974; genetic des keratoconus. Albrecht Von Graefes Arch Klin Exp Ophthalmol, 190:293-308.

Heon E, Greenberg A, Kopp KK, et al. 2001; Related VSX1: a gene for posterior polymorphous dystrophy and keratoconus. Hum Mol Genet 11(9):1029 36.)

Hollingsworth JG, efron N, tullo aB. 2005; In vivo corneal confocal microscopy in keratoconus. Ophthalmic Physiol Opt, 25:254-60.

Hollingsworth JG, Bonshek re, tullo aB. 2005; Correlation of the appearance of the keratoconic cornea in vivo by confocal microscopy and in vitro by light microscopy. Cornea, 24:397-405.)

Hosseini SM, Herd S, Vincent AL, Hon E. Genetic analysis of chromosome 20related posterior polymorphous corneal dystrophy: genetic heterogeneity and exclusion of three candidate genes

Huiying Yang,2 George Y. Tang,2 Yoana Piconell,2 and Yaron S. Rabinowitz2, 2006 No VSX1 gene mutations associated with keratoconus. Invest Ophthalmol Vis Sci. Jul;47(7):2820-2.)

Kaldawy rM, Wagner J, ching s, seigel GM. 2002; Evidence of apoptotic cell death in keratoconus. Cornea, 21:206-209.)

Kenney Mc, Brown DJ. 2003; the cascade hypothesis of keratoconus. Contact Lens Anterior Eye, 26:139-146.)

Kenney Mc, Brown DJ, rajeev B. everett Kinsley Lecture. 2000, the elusive causes of keratoconus: a working hypothesis. CLAO J,;26:10-13)

III

Kenney Mc, chwa M, atilano sr, tran a, carballo M, saghizadeh M, Vasiliou V, adachi W, Brown DJ. 2005; Increased levels of catalse and cathepsinV/L2 but decreased tIMP-1 in keratoconus corneas: Evidence that oxidative stress plays a role in this disorder. Invest Ophthalmol Vis Sci, 46:823-832.)

Tan B, Baker K, Chen YL, Lewis JW, Shi L, Swartz T, Wang M. 2008 Feb. How keratoconus influences optical performance of the eye. J Vis. 28;8(2):13.1-10.

Kenney Mc, Brown DJ, rajeev B. everett Kinsley Lecture. 2000; the elusive causes of keratoconus: a working hypothesis. CLAO J, 26:10-13

Li X, rabinowitz Ys, tang YG et al. 2006: Two stage genome wide linkage scan in keratoconus sib pair families. IVOS, 47:3791-5.

M.P. Rubinstein*, and S. Sud 1999 The use of hybrid lenses in management of the irregular cornea , Contact Lens and Anterior Eye , Volume 22, Issue 3, , Pages 87-90)

Merin s (2005). Inherited Eye Disorders: Diagnosis and Management. Robert B. Mandell OD, PhD March-April 1997 Contemporary management of keratoconus, International Contact Lens Clinic Volume 24, Issue 2, , Pages 43-58)

IV

Sawaguchi s, twining ss, Yue BY, Wilson PM, sugar J, chan sK. 1990. alph-1 proteinase inhibitor levels in keratoconus. Exp Eye Res,;50:549-554.)

Sawaguchi S Yue BY, Sugar J, Gilboy Je. 1989; Lysosomal enzyme abnormalities in keratoconus. Arch Ophthalmol, 107:1507-1510.

Wakako Adachi MD, PhD , , Yoko Mitsuishi MD, PhD, Kazuto Terai MD, Chisato Nakayama MD, PhD, Yoko Hyakutake MD, Junko Yokoyama MD, Chikako Mochida and Shigeru Kinoshita MD, PhD, April 2002. The association of HLA with young-onset keratoconus in Japan, American Journal of Ophthalmology, Volume 133, Issue 4, , Pages 557-559)

Wilson e, Kim WJ. 1998; Keratocyte apoptosis: implications on corneal wound healing, tissue organization, and disease. Invest Ophthalmol Vis Sci, 39:220-226

Yaron S. Rabinowitz, The genetics of keratoconus, Ophthalmol Clin N Am 16 (2003) 607 620

Zadnik K, Barr Jt, edrington tB, everett DF, Jameson M, McMahon tt, shin Ja, sterling JL, Wagner H, Gordon MO. 1998; Baseline findings in the collaborative Longitudinal evaluation of Keratoconus (cLeK) study. Invest Ophthalmol Vis Sci, 39(13):2537-46)

Zhou L, sawaguchi s, twining ss, sugar J, Feder rs, Yue BY. 1998. Expression of degradative enzymes and protease inhibitors in corneas with keratoconus. Invest Ophthalmol Vis Sci.;39:1117-1124.