BIOL 3301 Midterm Exam #2 October 27, 2011

Morning

Blue

There are a total of 9 pages in this exam. This exam consists of 34 questions worth a total of 100 points. All questions are multiple choice and there is one best answer for each question. Record your answers on the scantron sheet, and answer only once for each question or you will be automatically marked wrong. Use a #2 pencil. Name_________________________ ID#__________________________

1) Which of the following is NOT a property of RNA? a) Uracil replaces thymine b) It contains the sugar ribose c) It is double stranded d) It is found in the nucleus e) All of the above 2) Which of the following is NOT a difference between RNA and DNA? a) Sugar ribose vs. deoxyribose b) 3-OH c) 2-OH d) Base - Uracil vs. Thymine e) None of the above. 3) Which of the following is NOT TRUE regarding the processing of the 3 end of RNA transcripts? a) Is modified by the addition of 7-methyl guanosine cap. b) Is modified by the addition of a polyA tail. c) Has a polyadenylation signal; AAUAAA or AUUAAA, near the 3 end of the transcript. d) all are true 4) Which of the following is the role of the 5 cap of the mRNA? a) The cap plays a role in the removal of introns. b) The cap helps the RNA polymerase find the promoter and initiate transcription. c) The cap acts as a binding site for the ribosome. d) The cap protects the chromosome ends 5) In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? a) Cytoplasm b) Endoplasmic Reticulum c) Nucleus d) Mitochondia e) Golgi apparatus 6) The Gal4 protein has 2 protein domains: an activation domain and . a) a repression domain b) an enhancer domain. c) heterochromatin domain d) histone binding domain e) a DNA binding domain.

7) Which of the following DNA sequences could be the template for a piece of mRNA sequence: 5 UGC CGA CGU AGG 3 a) 5 TGC CGA CGT AGG 3 b) 3 TGC CGA CGT AGG 5 c) 5 ACG GCT GCA TCC 3 d) 3 ACG GCT GCA TCC 5 8) Which of the following is an important feature of the genetic code? a) It is a triplet code. b) Each codon specifies no more than one amino acid. c) It is degenerate. d) It is non-overlapping. e) All of the above.

with the

9) Imagine a world in which the genetic code used codons (groups of nucleotides determining one amino acid) of size 4. If you make a single insertion mutation in a gene, how many additional nucleotides would need to be inserted before gene function could possibly be restored? (Each insertion mutation is of a single nucleotide.) a) Restoring protein function will not be possible. b) 1. c) 2. d) 3. e) 4. 10) What answer represents the most likely order of the severity of phenotypic effect resulting from the different types of mutations listed below. (Answers are ranked from most to least severe.) i. Insertion of a nucleotide causing a frameshift. ii. Nucleotide substitution that does change the amino acid a codon codes for. iii. Nucleotide substitution that does not change the amino acid a codon codes for. a) i>ii>iii b) i>iii>ii c) iii>ii>i d) ii>iii>i e) There is no way to predict the likely effect of different mutation types.

11) A mutant strain of E. coli has the following genotype at its lac operon (assume all other genes are functional): I+ P+ O- Z+ Y+ (I, repressor; P, promoter; O, operator; Z Y, structural genes). Which of the following best matches the environment in which the operon be expressed at a high level? A. Glucose is absent, regardless of the presence of lactose. B. Lactose is present and glucose is absent. C. Glucose is present, regardless of the presence of lactose. D. Lactose is present, regardless of the presence of glucose. E. It wont be expressed in any environment. 12) A second copy of the lac operon is introduced into the above strain (this second copy is on an Flac plasmid). This second copy has the genotype I+ P+ O+ Z- Y- (the original chromosomal copy is still I+ P+ O- Z+ Y+). In which of the following environments will functional copies of the LacZ and LacY proteins be expressed? A. Glucose is absent, regardless of the presence of lactose. B. Lactose is present, regardless of the presence of glucose. C. Glucose is present, regardless of the presence of lactose. D. Lactose is present and glucose is absent. E. It wont be expressed in any environment. 13) A newly discovered set of genes the hou operon are transcribed from the same promoter. They allow the bacteria to use a rare sugar, houstose. This sugar provides only a small amount of energy when it is broken down, but, when nothing else is available, it is better than nothing. In what combination of environmental conditions would you expect bacteria to express the hou operon? (Assume that conserving energy used in expressing a gene is important if a bacterium does not need to express a gene, it wont.) A. In the absence of houstose and the absence of any other more effective nutrient source. B. In the absence of houstose and the presence of any other more effective nutrient source. C. In the presence of houstose and the presence of any other more effective nutrient source. D. If houstose does not produce much energy when it is used hou operon should always be expressed. E. In the presence of houstose and the absence of any other more effective nutrient source. 14) In eukaryotes, which of these factors guides the RNA polymerase to the transcription start site? a) Poly A binding proteins b) rho factor c) snRNA2 d) TATA binding protein 15) What is NOT a role of nucleosomes? a) They consist of DNA and histones b) They are involved in protein synthesis c) They can regulate how accessible the DNA is to transcription factors d) They tightly pack the DNA

16) Many transcription factors have a DNA binding domain and an activation domain. LexA is one of them. The LexA transcription factor normally binds to lexA binding sequences on the DNA to activate transcription. What happens if you make a protein that has the lexA binding domain and the Gal4 activation domain? a) it will bind to the UAS sequence and activate transcription b) it will not activate transcription c) it will bind to both UAS and lexA binding sequences and activate transcription d) it will bind to lexA binding sequences and activate transcription 17) In general, eukaryotic promoters need additional a) transcription factors b) Poly A signals c) rho factors d) Gal4 18) Eukaryotic chromosome regions that contain heavily transcribed genes a) can be seen as Barr bodies b) are imprinted c) are highly condensed d) contain histones that are methylated and acetylated 19) You are working in a molecular genetics lab on a newly discovered mouse gene, and your boss tells you to individually mutate every base upstream of the transcription start site and record how each individual mutation effects transcriptional activity. What is your boss trying to determine? a) If the gene is methylated b) If the gene is embedded in heterochromatin. c) If the operon is under negative control of a repressor. d) Where transcription factors are binding in the promoter. e) If alternative splicing is occurring in your gene. 20) The mRNA sequence of a gene is shown below. 5 CCAGCAUAUGCCUAAUCGCAGUUCGGAAUAGCAAGCC 3 The amino acid sequence of the protein which is translated from the mRNA is? (Use the codon table at the end of the exam) a) N-Met-Pro-Asn-Arg-Arg-Ser-Glu-C b) C-Pro-Alal-Met-Pro-Asn-Arg-Ser-Ser-Glu-Tyr-Gln-Ala-N c) N-Met-Pro-Asn-Arg-Ser-Ser-Glu-C d) N-Pro-Ala-Met-Pro-Asn-Arg-Ser-Ser-Glu-Tyr-Gln-Ala-C e) C-Met-Pro-Asn-Arg-Ser-Ser-Glu-N

21) In mammals, females have two X chromosomes and males one X chromosome. Females inactivate one X chromosomes. How can one recognize an inactivated X in a cell? a) by the presence of two aligned X chromosomes b) by the presence of a Barr body c) by the presence of imprinting d) by alternative splicing 22) Which is NOT true about snRNAs, siRNAs and microRNAs a) they are functional RNAs b) they are involved in protein synthesis in the ribosome c) they bind to complementary RNA sequences d) they are associated with proteins in a complex 23) Which of the following is an example of a primary protein structure? a) The linear sequence of amino acids in a polypeptide chain. b) The folding of a polypeptide chain. c) The polypeptide chains stacked on top of each other. d) A beta pleated sheet. e) Several polypeptide subunits. 24) You have found a new Drosophila mutation that affects early embryonic development. In the mutant embryos, every other segment is missing. What kind of gene is likely mutated? a) A homeotic gene b) A gap gene c) A pair rule gene d) A dorsal-ventral defining gene 25) Which is NOT true about the Drosophila gene 'eyeless' and the mouse gene 'Pax 6'? a) They are conserved in both sequence and function b) They both specify eye development c) They contain a homeodomain and their sequences are very similar d) They are both non-essential for eye development 26) A wildtype (normal) fly has a pair of wings on the second thoracic segment and a pair of halteres on the third thoracic segment. You find a fly with wings on both segments. What happened? a) Flies always have four wings b) Halteres are recessive c) A homeotic mutation, which has transformed segment three into a second thoracic segment d) This is an Antennapedia mutation

27) Sex in fruit flies is determined by a) imprinting b) alternative splicing c) X inactivation d) The dicer complex 28) Which is NOT true about homeodomain containing genes a) are transcription factors b) always produce legs at inappropriate locations c) are called HOX genes in vertebrates d) are master regulators 29) The Drosophila mutant 'dorsal' a) lacks dorsal structures b) is caused because the mRNA can not be tethered c) is a homeotic mutation d) lacks ventral structures 30) The anterior-posterior axis in Drosophila embryos is a) set up only by a dorsally tethered mRNA b) controlled by the gene dorsal c) set up by two opposing protein gradients d) controlled by the gene eyeless 31) Establishment of the dorsal-ventral axis of the Drosophila embryo: a) involves the presence of localized Dorsal protein on the ventral side of the developing embryo b) involves the production of localized Dorsal mRNA on the ventral side of the developing embryo c) Depends on the activity of anterior-posterior morphogens, such as BCD or HB-M d) None of the above 32) It looks as if you fell asleep during lecture when sequencing via shotgun and ordered clone methods were discussed. Below are the steps you have written in your notebook, unlabeled. Which is NOT part of the ordered clone method? a) Create a physical or molecular map of the chromosome. b) Sequence regions of the chromosome randomly. c) Organize the sequences by where they overlap. d) Create a minimal set of clones using those overlaps. e) Assemble into a consensus sequence.

33) Once the sequence of a genome is known which method would you use to learn about the genes it contains: a) Comparison with other genomes b) Looking for stretches that could code for proteins c) Search for transcription start and termination sites d) Make reporter constructs e) All of the above 34) What color is your exam? a) yellow b) blue c) pink d) green