Biology 197 Lab Protocol: Setting up PCR for Friday morning: The purpose of this step is to anneal the

two long oligonucleotides together and then extend them. Recall that we have two oligonucleotides that we have synthesize (see colored regions). The other regions will be what are extended by Taq polymerase. We will then amplify the entire segment using PCR and a second set of primers. 1. Add the following components to a thermal cycler tube: a. 1 l of 1000 ng/l MaSp1 Type1 F1 oligonucleotide b. 1 l of 1000 ng/l MaSp1 Type1 R1 oligonucleotide c. 10 l of 2X Taq master mix (contains dNTPs, buffer, 1.5 mM MgCl2) d. 8 l of water e. Total volume should be 20 l 1 cycle: Step 1: 92C for 2 min (denaturation step) Step 2: 58C for 1 min (annealing step) Step 3: 68C for 5 min (extension) After this step is complete, the following product should be obtained:
AGTACTCATATGGGGGTCTCAGCTGGTGGCGCAGGTCAGGGTGGCCAAGGTGGCTATGGTCGTGGTGGCTATGGTCAGGGTGGCGCTGGTCAAGGTGGCGCAGGTGCAGCAGCAGCAGCTGCTGCTGCTGAGAGACGGAGCTCACTAGT TCATGAGTATACCCCCAGAGTCGACCACCGCGTCCAGTCCCACCGGTTCCACCGATACCAGCACCACCGATACCAGTCCCACCGCGACCAGTTCCACCGCGTCCACGTCGTCGTCGTCGACGACGACGACTCTCTGCCTCGAGTGATCA

The next step will be to set-up a standard PCR. We will be using a forward and reverse primer that will amplify this template and at restriction sites at the 5 termini Mix the following reaction in a fresh PCR tube: a. 25 l of 2x Taq master mix b. 0.5 l of a 1 M MaSp1 F1 (this primer will be different than the one above) a. AGTACTCATATGGGGGTCTCAGCTGG b. ACTAGTGAGCTCCGTCTCTCAGCAGC c. 0.5 l of a 1 M MaSp2 R1 (this primer will be different than the one above) d. 1 l of template (from step 1) e. 23 l of water f. After mixing, remove 5 l and store it in a separate tube g. Place the remaining 45 l into the thermal cycler set at the following parameters: PCR steps: Step 1: 92C for 2 min Step 2: 92C for 45 sec Step 3: 58C for 1 min Step 4: 68C for 1 min Step 5: Go to step 2 for 29X Step 6: 68C for 5 min Step 7: hold at 10C

Step 8: end Friday afternoon: 1. Cast a 2% agarose gel (not 1%); make sure to add EtBr 2. Remove 5 l of the PCR product (45 l reaction) and add 1 l of 6x loading dye (do this three times) 3. Take the 5 l that was saved from step f (above) and add 1 l of 6x loading dye 4. Load these 4 samples into the agarose gel into separate wells (3 + 1) 5. Load 5 l of a DNA ladder 6. Make sure when loading to place the three samples that are the same right next to each other (the ladder and the sample from step f can be next to each other) 7. Run the samples at 150V 8. Visualize the sample using the hand-held UV lamp (make sure to wear the face shield) 9. Gel-extract the DNA bands from the PCR (I will provide the protocol for this step)