Abstract

Background Stomatocytoses are a group of inherited autosomal dominant hemolytic anemias and include overhydrated hereditary stomatocytosis, dehydrated hereditary stomatocytosis, hereditary cryohydrocytosis and familial pseudohyperkalemia. Design and Methods We report a novel variant of hereditary stomatocytosis due to a de novo band 3 mutation (p. G79 !"band3 #$%&G$' associated (ith a dyserythropoietic phenotype. )and 3 genomic analysis, measurement at of hematologic parameters and red cell indices and morphological analysis of bone marro( (ere carried out. We then evaluated the red cell membrane permeability and ion transport systems by functional studies of the patient*s erythrocytes and Xenopus oocytes transfected (ith mutated band 3. We analy+ed the red cell membrane tyrosine phosphorylation profile and the membrane association of the tyrosine kinases Syk and ,yn from the Src"family"kinase group, since the activity of the membrane cation transport path(ays is related to cyclic phosphorylation"dephosphorylation events. Results -he patient sho(ed mild hemolytic anemia (ith circulating stomatocytes together (ith signs of dyserythropoiesis. .er red cells displayed increased &a / content (ith decreased 0/content and abnormal membrane cation transport activities. 1unctional characteri+ation of band 3 #$%&G$ in Xenopus oocytes sho(ed that the mutated band 3 is converted from being an anion e2changer (#l3, .#433' to being a cation path(ay for &a/ and 0/. %ncreased tyrosine phosphorylation of some red cell membrane proteins (as observed in diseased erythrocytes. Syk and ,yn membrane association (as increased in the patient*s red cells compared to in normal controls, indicating perturbation of phospho"signaling path(ays involved in cell volume regulation events. Conclusions )and 3 #$%&G$ alters function from that of anion e2change to cation transport, affects the membrane tyrosine phosphorylation profile, in particular of band 3 and stomatin, and its presence during red cell development likely contributes to dyserythropiesis. Keywords: stomatocytosis, anion e2changer, dyserythropoiesis, tyrosine phosphorylation, Src family
kinase
Other Sections

Introduction
.ereditary hemolytic disorders can be characteri+ed by abnormal red cell morphology and perturbation of cell volume regulation. 5bnormal red cells presenting a slit"like central +one of pallor on dried blood smears and named stomatocytic red cells characteri+e the hereditary hemolytic anemia kno(n as stomatocytosis. 673-(o ma8or forms of stomatocytosis have been delineated9 overhydrated hereditary stomatocytosis and dehydrated hereditary stomatocytosis (:.St'.;7< 4verhydrated hereditary stomatocytosis (4=%= 6><???' is generally associated (ith abnormal red cells characteri+ed by altered red cell membrane permeability to &a /and 0/ generating s(ollen erythrocytes (ith decreased mean corpuscular hemoglobin concentration (=#.#' and increased osmotic fragility. 3 4verhydrated hereditary stomatocytosis is usually associated (ith the absence of the red cell transmembrane protein 7.;b, (hose function is still undefined. :.St, also named hereditary 2erocytosis (.@' (4=%=69A3>?', is like(ise characteri+ed by abnormal red cells, (hich are shrunken (ith an increased =#.#. ;7< 4smotic fragility is generally reduced, (hile autohemolysis is increased and corrected by glucose. ;7A %n :.StB.@, the primary functional membrane defect is increased leakage of 0 / from red cells (ith inability of the &a"0 pump to fully compensate for this leakage, so that the net intracellular cation concentration and (ater are decreased, leading to final red cell dehydration. %n addition, in :.StB.@ red cells the increased intracellular calcium may further promote red cell (ater and potassium loss and cross"linking of skeletal proteins.A,< :.StB.@ (as first described by Glader in 697A; and several other families have since been reported.A7 #linical findings are very heterogeneous ranging from severe hemolytic anemia to symptomless disease. 5nalysis of all the cases sho(ed that the unifying phenomenon is perturbation of red cell membrane leakage of univalent cations. 5 number of case reports on the different variants have alluded to temperature"related phenomena, including 0/ loss on storage of cells at room temperature (pseudohyperkalemia' and lysis of cells (hen stored at cold temperatures (cryohydrocytosis'.6 -he molecular mechanism underlying :.StB.@ has not been identified yet. $fforts have been made in the last decade to map the :.StB.@ locus9 some at risk families have been collected, including a large, three"generation %rish kindred. -his strategy allo(ed the identification of a locus on the long arm of chromosome 6 (6 C;3"Cter' as a possible candidate. .o(ever, in a large 1rench family of 1lemish descent (ith familial pseudo" hyperkalemia (1D', microsatellite analysis e2cluded involvement of the 6 C;3"Cter locus. Genome scanning mapped 1D Lille to ;C3<"3 (ith a ,od score of >.A for the :;S633>

markes. -his duality suggests that the protein involved in abnormal membrane leakage may be a heterodimer. !ecently, )ruce et al. e2amined several individuals (ith stomatocytosis or spherocytosis associated (ith an increase in membrane permeability to cations, particularly marked at ?E#.7 -hey found a series of single aminoacid substitutions in the intramembrane domain of erythrocyte band 3 anion e2changer (5$6', sho(ing that these substitutions convert the protein from an anion e2changer into a non"selective cation conducter, making the scenario of stomatocytosis even more comple2. 3,7,> .ere, (e report a case of hereditary stomatocytosis due to a ne( band 3 mutation (band 3 #$%&G$', transmitted in a dominant fashion, characteri+ed by conversion of band 3 from an anion e2changer to a cation transporter. -his latter effect is associated (ith increased tyrosine phosphorylation of some red cell membrane proteins and increased membrane association of both Syk tyrosine kinases and ,yn tyrosine kinase, from the Src family, suggesting a pertubation of the red cell signaling path(ays involved in maintaining the optimal cell volumeBsurface ratio. %n addition, (e observed signs of dyserythropiesis that make stomatocytosis due to band 3 #$%&G$ a novel variant of hereditary stomatocytosis.

Other Sections

Design and Methods Case report

5 A3"years old #aucasian female (%%";, 1igure 65' (ith unrelated parents (as admitted to our hospital for evaluation of mild anemia. -he patient had been in good health until 7 years previously (hen she began to e2perience asthenia freCuently. She (as first recogni+ed to be anemic at the age of > years (ith the presence of 8aundice and hyperchromic urine, but she never received blood transfusions. )one marro( aspirate sho(ed remarkable dyserythropoiesis (ith increased numbers of erythroblasts and binucleate erythroblasts, basophilic erythroblasts (ith alterations, irregular nuclear maturation, intererythroblastic bridges and erythroblasts (ith basophilic stippling (1igure 6)'. -hese bone marro( features in association (ith a lo( reticulocyte count and a lo( hemoglobin concentration suggested a diagnosis of congenital dyserythropoietic anemia type %.
Figure 1. (5' 1amily tree of proband %%"; and her son %%%"6. 4pen symbols, not affectedF closed symbols, affected. ()' )one marro( aspirate of proband %%"; and her son %%%"6 sho(ed remarkable dyserythropoiesis (ith an increased number of erythroblasts and binucleate(more ...'

5t the age of 3< years, the patient became pregnant and she gave birth to a boy (%%%"6' in 5ugust ;???. :elivery (as normal. 5t birth, the baby (eighed 3,??? g and (as A> cm long. .e (as breastfed and (as affected by anemia since infancy. -he mother and the child (ere admitted to our hospital for re"evaluation of their anemia. %n the mother (e observed a mild hypochromic macrocytic anemia (ith a hemoglobin level of 66.< gBd,, a mean cell volume (=#G' of 66? f,, and a mean hemoglobin concentration (=#.' of 3 .6 pgF her reticulocyte count (as AH6? 9B,. .er leukocyte count (as 7.;H6?9B, (ith a normal differential count and her platelet count (as ;<<H6? 9B, (-able 6'. She had typical hemolytic features9 high levels of indirect bilirubin (3.A> mgBd,' and lactate dehydrogenase (< 7 IB,, normal value ;A?7A>? IB,' and negative direct and indirect #oombs* tests. .er spleen (as enlarged and ultrasonography detected a longitudinal si+e of 6< cm. She had undergone cholecystectomy at the age of 6A years because of numerous symptomatic small stones in the gall bladder. Serum iron, soluble transferrin receptor, serum ferritin and transferrin saturation levels (ere all increased (-able 6'.
Ta le 1. .ematological data of the patients (%%"; and %%%"6' and their parents.

4ther blood tests including osmotic fragility (ith incubated and fresh erythrocytes, serum electrolytes, )6; and folate levels, erythrocyte en+yme levels, the eosin"<J"maleimide ($=5' test and Dink test (ere normal. 5 peripheral blood smear sho(ed anisopoikilocytosis (ith rare stomatocytes and no spherocytes (1igure 6)'. -he son (%%%"6' sho(ed mild anemia (.b 6?.<"66.> gBd,' (ith macrocytosis (=#G 6?6"66< f,' and hyperchromia (=#. 3 .6"37 pg'. %ncreased levels of serum iron and ferritin, transferrin saturation, soluble transferrin receptor, indirect bilirubin, and lactate dehydrogenase (ere detected (-able 6'. .is reticulocyte count, osmotic fragility tests, serum electrolytes, )6; and folate levels, erythrocyte en+yme levels, $=5 test and Dink test (ere all in the normal range for the patient*s age. 5t physical e2amination the spleen (as enlarged. 5 peripheral blood smear and bone marro( aspirate sho(ed the same features as those observed in his mother (%%";' (1igure 6), 6#'. %n particular a large number (appro2imately 3K' of intracytoplasmic bridges (ere present in the late erythroblastic stage in the bone marro( smears (1igure 6)'.

5fter informed consent, blood (as obtained for genetic analysis from the proband, her relatives, husband and son. )lood from healthy control sub8ects (as obtained after informed consent provided according to the :eclaration of .elsinki and processed (ithin ;A h. 5pproval for these studies (as obtained from the 1ederico %% Iniversity =edical School institutional revie( board.

!ucleotide se"uence analysis o# CD$!1 and %&C'$1 #ro( geno(ic D!$

5nticoagulated ($:-5"treated' blood samples (ere obtained and stored at 3;?E#. Genomic :&5 (as isolated using a L%5mp :&5 )lood =ini 0it (Dromega #orporation, =adison, W%, IS5' according to the manufacturer*s instructions. -o screen for mutations of codanin gene (CDAN1' in the patients (mother and son', each of the ;> e2ons (ith e2on"intron boundaries (ere amplified by polymerase chain reaction (D#!' using specific primers. D#! fragments (ere seCuenced directly. 5 similar approach (as used to analy+e the SLC4A1 gene9 all coding e2ons, including splice 8unctions, and portions of the promoter region (ere amplified by D#!. -he amplified products (ere isolated by electrophoresis on 6K agarose gel and purified using a L%5amp purification kit (Liagen, Galencia, #5, IS5'. :irect seCuencing (as performed using a fluorescence" tagged dideo2y chain terminator method in an 5)% 36? automated seCuencer (5pplied )iosystem, 1oster #ity, #5, IS5', according to the manufacturer*s instructions. Drimers used for D#! and seCuencing and D#! conditions are available on reCuest. -he CDAN1 and SLC4A1 c:&5 seCuences from Gen)ank accession numbers&#M????6<.> and &#M????67.9, respectively, (ere used as reference seCuences. We investigated the identified SLC4A1 mutation in :&5 samples from <? healthy (hite controls (6?? chromosomes'. We seCuenced the amplified e2on 67 using the follo(ing primers9 sense <J"ttattcccagccccagata"3J and antisense <J"acttattcacgggcatccag"3J.

Red cell (e( rane protein analysis

!ed"cell ghosts (ere prepared according to the procedure of :odge et al.,9 e2cept that < m= phenylmethyl"sulfonyl fluoride (as added during the lysis step (for details see alsoOnline Supplementary materials'.

Measure(ents o# red cell cation content and !a)K pu(p* !a)K)+Cl* K)Cl co, transport and !a)- e.change acti/ities in red cells
-he erythrocyte content of &a/ and 0/ (as determined by an atomic absorption spectrometer (5&5,NS- ;???, Derkin"$lmer, )ranchberg, &O, IS5' using standards in double"distilled (ater. #ation transport activities (ere estimated according to previously published methods.6?,66 )riefly, the ma2imal rates of &aB0 pump and &aB0B#l co"transport

activities (ere measured in cells containing eCual amounts of &a / and 0/ (<? mmolB, of cells, obtained (ith the nystatin techniCue'. With this procedure the internal sites for both transport systems (ere saturated.6?,6;,63 -he nystatin loading solution contained 7? mmolB, &a#l, 7? mmolB, 0#l and << mmolB, sucrose. -he &aB0 pump activity (as estimated as the ouabain"sensitive fraction of &a/ efflu2 into a medium containing 63? mmolB, choline chloride and 6? mmolB, 0#l. -he ouabain concentration (as ?.6 mmolB,. &aB0B#lBco" transport (as estimated as the bumetamide"sensitive fraction of &a / efflu2 into a medium containing 6A? mmolB, choline chloride and ?.6 mmolB, ouabain. -he bumetamide concentration (as ?.?6 mmolB,. 5ll media contained 6 mmolB, =g#l ;, 6? mmolB, glucose, and 6? mmolB, -ris"=4DS p. 7.A. -he &aB. e2change rate (as evaluated as the amiloride"sensitive &a/ efflu2 stimulated by hypertonic shrinkage from cells containing eCual amounts of &a/ and 0/.6?,6A -he media contained 6A? mmolB, choline chloride and the osmolarity (as increased (ith sucrose. <"&,& he2a"methyleneamiloride, at a final concentration of 6? mmolB,, (as used as a specific inhibitor of the system. 6?,6;,63

Red cell (e( rane protein tyrosine phosphorylation pro#ile and i((uno lot analysis
!ed"cell ghosts separated by one"dimensional electrophoresis (ere solubili+ed by Sample )uffer (S)9 <? mmolB, -ris, p. .>, 6?? mmolB, P"mercaptoethanol, ;K vBv S:S, 6?K vBv glycerol, and a fe( grains of bromophenol blue', and loaded on either 6?K or >K gel. -he gels (ere either stained (ith colloidal #oomassie or transferred to membranes for immunoblot analysis and probed (ith either specific anti"phosphotyrosine antibodies (DN99" clone Santa#ru+ )iotechnology, #5, and AG6?"clone, IpState, &N, IS5' or anti",yn antibody (Santa #ru+ )iotechnologies, Santa #ru+, #5, IS5', and anti"Syk antibody (#ell Signaling, :anvers, =5, IS5'.66 -o evaluate (hether cell s(elling induced changes in the tyrosine"phosphorylation profile of red cell membrane proteins, control red cells (ere incubated (ith and (ithout urea ( ?? mmolB, final concentration' as previously described by Ooiner et al.6< and red"cell ghosts (ere prepared for immunoblot analysis (ith specific antiphosphotyrosine antibodies. %n some e2periments tyrosine"enriched proteins (ere obtained by immuno"precipitation (ith a specific anti"phosphotyrosine antibody (clone AG6?, IpState, &N, IS5' as previously reported by :e 1ranceschi et al.6 ,67 )riefly, red"cell ghosts (ere solubili+ed in a medium containing <? mmolB, -ris".#l, p. 7.A, 6?? mmolB, &a#l, < mmolB, $:-5, 6K -riton @" 6??, 6 mmolB, &a" orthovanadate, ?.??AK ben+amidine, and 6 tablet of a protease inhibitor cocktail (!oche, Germany'. 5fter incubation for ? min at AE#, the protein e2tract (as centrifuged at 6<,??? g for 6< min and the supernatant (as used for immunoprecipitation. 5nti"phosphotyrosine (clone AG6?' (as used to immunoprecipitate tyrosine"phosphorylated proteins (ith protein 5"-rysacryl follo(ed by (ashing. -he immunoprecipitated proteins

(ere then either used for immunoblot analysis (ith specific anti"P spectrin antibody (clone A#3, 5cris .iddenhousen, Germany', anti"band 3 antibody (clone %G16;, :S.), %o(a #ity, %o(a, IS5', anti"stomatin antibody (a kind gift from ! Drohaska, Wein Iniversity, Wein, 5ustria' or stained (ith colloidal #oomassie for protein identification as previously described.66 Secondary antibodies (ere from G$ .ealthcare (,ittle #halfont, I0'. $#,"Dlus (5mersham, I0' (as used as the revealing system.

0rotein identi#ication
-he selected bands (ere identified by =5,:%"-41 =SB=S analysis and automated ,#" =SB=S analysis. =ass spectrometric analysis (as performed using a -ofspec S$ (=icromass, =anchester, I0'. Deptide spectra (ere obtained in positive ion mode over the mB+ range of >??7A??? :a or 6???73??? :a in reflectron mode. -he peptide solution (as prepared by mi2ing eCual volumes of matri2 (matri29 saturated Q"cyano"A"hydro2y cynnamic acid solution in A?K acetonitrile, ?K of ?.6K trifluor acetic acid'. )et(een 6??76;? laser shots (ere summed for each =S spectrum. -he measured peptide masses (ere searched for in the S(iss"Drot database (ta2a human' using the =5S#4- search engine (=atri2 Science ,td., ,ondon, I0'. 4nly protein identifications (ith a significant =ascot score (pR?.?<' (ere taken into consideration. 5 mass accuracy of ?.3 :a and a single missed cleavage (ere allo(ed for each matching peptide. Searches (ere not constrained by p% or molecular (eight.66,6> Deptide mi2tures (ere also analy+ed using microflo( capillary liCuid chromatography coupled (ith electrospray Cuadrupole time of flight tandem mass spectrometry ($S% L"-41 =SB=S'. $S%"=SB=S tandem spectra (ere recorded in the automated =S to =SB=S s(itching mode, (ith an mB+"dependent set of collision offset values. Singly to Cuadruply charged ions (ere selected and fragmented, using argon as the collision gas. $2ternal calibration (as performed (ith a solution of . 3D4A ?.?<K in .;?B=e#& <?B<?. =ass data collected during !D",#"=SB=S analysis (ere processed and converted into a D0, file to be submitted to the automated database searching Mascot, MS/MS Ions Searc . Search parameters (ere9 parent tolerance ?. :a, fragment tolerance ?.3 :a, tryptic specifity allo(ing for up to one missed cleavage, database SW%SSD!4-.

0las(id preparation and studies in oocytes

Doint mutations to get a G79 ! substitution on erythroid human 5$6 (e5$6' (ere made by D#! using the Luick change site"directed mutagenesis kit from Stratagene (ith the follo(ing for(ard primer9 G79 ! 9 5-#--##-#-5#5-G5GGG-#5#G-#G#-#5G# and reverse primer9 G#-G5G#G5#G-G5###-#5-G-5G5GG55G5-. 4ne positive clone (as entirely seCuenced before further use. pSD < e5$6 (as a gift from :r. 5ppelhans.

4ocytes (ere harvested from anestheti+ed female Xenopus laevis according to the procedure recommended by the ethical committee of the #&!S (#entre &ational de la !echerche ScientifiCue'. 4ocytes (ere defolliculated as previously described 9 (ith overnight incubation in ; mgBm, collagenase &)A Serva (.eidelberg, Germany' and 3? min incubation in #a ;/free medium. Stage G"G% oocytes (ere selected for c!&5 in8ection. c!&5 (ere prepared from c:&5 using a SD transcription kit from 5mbion (.untingdon, I0'. -he concentration and Cuality of c!&5 (ere determined by 4: measurements and (ith formamideBformaldehyde agarose gel in =4DS (3"S&"morpholineTpropanesulfonic acid' buffer. -en nanograms of (ild type or mutant e5$6 c!&5 (ere in8ected per oocyte. 4ocytes (ere kept in =)S (=odified )arth Saline' consisting of &a#l >< mmolB,F 0#l 6 mmolB,F &a.#4 39 ;.A mmolB,F =gS4A ?.>; mmolB,F #a(&43'; ?.33 mmolB,F #a#l; ?.A6 mmolB,F .$D$S (&";"hydro2"yethlylpipera+ine" &";"ethanesulfonic acid' 6? mmolB,F &a4. A.< mmolB,F p. 7.A supplemented (ith penicillin (6? IBm,' and streptomycin (6? UgBm,'. ,ithium (as used as a substitute for sodium to measure oocyte cation permeability. 4ocytes (7 per condition' (ere incubated for ; h at 69E# in =)S in (hich &a#l (as substituted by ,i&43, for a final composition of ,i&43 >< mmolB,F 0&43 6 mmolB,F 0.#43 ;.A mmolB,F =gS4A ?.>; mmolB,F #a(&43'; ?.33 mmolB,F #a#l; ?.A6 mmolB,F .$D$S 6? mmolB,F &a4. A.< mmolB,F p. 7.A. %n addition, oubain (?.< m=' and bumetanide (< U=' (ere added to block &a/B0/ pump activity and &a/"0/";#l3 co"transport. 4ocytes (ere rinsed three times in milliL . ;4 and placed one by one in a tube heated at 9<E# to desiccate them. %ntracellular lithium (as e2tracted by addition of <? U, ?.6& &a4. and further diluted by addition of ;<? Ul milliL . ;4. -he lithium content in each oocyte e2tract (as measured by atomic absorption spectrometry (ith a Derkin $lmer 55S 366? (Derkin"$lmer, )ranchberg, &O, IS5'. :ata are the means V s.e.m. of 66; oocytes (non" in8ected', 7? oocytes ((ild type e5$6', and ;6 oocytes (G79 !'. 5fter in8ection, oocytes (ere incubated at 69E# for 3 days in =)S (ith oubain (?.< m=' and bumetanide (< U=' to prevent any &a/ or 0/ recycling or movement through the &a/B0/ pump or &a/"0/";#l3 co"transporter. 1or each condition and e2periment, three sets of five oocytes (ere Cuickly rinsed t(ice in milliL. ;4 and dried overnight at >?E#. %ntracellular cations (ere e2tracted from dried oocytes by overnight incubation in A m, of milliL . ;4. &a/ and 0/ (ere Cuantified by flame photometry ($ppendorf 5G, .amburg, Germany'. :ata, e2pressed in Umol per gram of dry (eight, are the means of t(o different e2periments V s.e.m. (nW '. 4ocyte intracellular p. (as measured using selective microelectrodes as previously described.9 -he ability of (ild type e5$6 and mutant G79 ! to regulate intracellular p. (as

assessed by measuring intracellular p. of oocytes adapted in =)S (ithout .#4 33then incubated in the follo(ing medium9 &a#l 3.A mmolB,F 0#l 6 mmolB,F .#4 33 ;A mmolB,F =gS4A ?.>; mmolB,F #a(&43'; ?.33 mmolB,F #a#l; ?.A6 mmolB,F .$D$SB&a4. < mmolB, p. 7.3<F #4; <K, 4; 9<K and then bathed in =)S (ithout #l (&a gluconate 3.A mmolB,F 0 gluconate 6 mmolB,F .#433 ;A mmolB,F =gS4A ?.>; mmolB,F #a(&43'; ?.7A mmolB,F .$D$SB&a4. < mmolB,F p. 7.3<, #4; <K, 4; 9<K'. -races are representative of three oocyte recordings for each condition.

Other Sections

Results 1eno(ic analysis

)ased on the patient*s history and hematologic data, (e first considered the possibility of congenital dyserythropoietic anemia type %, related to a codanin"6 mutation. We seCuenced the CDAN1 gene (ithout finding mutations in either the mother or her son ( data not s o!n'. -he absence of any clinical signs of anemia during the neonatal period and the lack of skeletal malformations in both sub8ects, associated (ith the absence of any detectable mutation in the codanin gene led us to e2clude congenital dyserythropoietic anemia type % as the cause of our patients* anemia. -he increased red cell =#G and the dominant inheritance pattern led us to consider hereditary stomatocytoses, (hich are associated (ith hemolytic anemia, macrocytosis, and abnormally shaped red blood cells (stomatocytes' (1igure 6#'. We investigated the gene encoding for the red cell membrane protein band 3 ( SLC4A1', (hich is one of the genes involved in hereditary stomatocytosis.> We screened the SLC4A1 coding seCuence and e2on"intron 8unctions for mutations by direct seCuencing and identified a GX5 transition at nucleotide ;<?? in e2on 67 (1igure ;5' in both the proband and in her son in the hetero+ygous state. &o mutation (as found in the grandmotherF :&5 from the grandfather (as not available. -he mutation identified changes the GGG codon to 5GG, causing the substitution of glycine 79 (ith arginine (p.G79 !' in band 3 protein. -his novel mutation does not create or abolish any en+yme restriction site, so (e analy+ed <? controls (6?? chromosomes' by direct seCuencing of e2on 67. &one of the control population had the mutation, suggesting that this gene defect is causative of this anemia and is not a genetic polymorphism (data not s o!n'. %n addition, by using D!4G!5= blastn"S&D ( ttp"//!!!# $tls%&st%'o%&p/c'i$in/(omolo'y)*last#SN+/su$mission)v,%c'i-+.O/.AM)$lastn#SN D', (e e2cluded that this nucleotide change corresponds to a previously identified single nucleotide polymorphism.
Figure +.

(5' %dentification of the SLC4A1 mutation in %%"; and %%%"6. Dartial seCuence of e2on 67 of the proband and (ild"type :&5 identifying the GX5 transition at nucleotide ;<??. -he mutation changes the GGG codon to 5GG, causing the substitution of (more ...'

Glycine 79 is perfectly conserved in mammals as (ell as in other species, suggesting that it has an essential role in the structure and function of band 3 (see also Online Supplementary materials, 1igure ;)'. %n transmembrane segments glycine is often located at heli2"heli2 interfaces allo(ing close packing (see Online Supplementary 0i'ure S1'. -he G79 ! mutation (ould introduce a positive charge and could seriously disrupt heli2 packing.

Fluorescent inding studies and protein (e( rane co(position o# red lood cells
We then evaluated the amount of mutated band 3 in the red cell membrane. )and 3 red cell membrane content (as Cuantified using t(o separate methods9 by flo( cytometry of $=5" labeled red cells and by sodium dodecyl sulphate"polyacrylamide gel electrophoresis (S:S" D5G$' analysis. Drevious studies have sho(n that the intensity of fluorescence detected by fluorescence microscopy follo(ing $=5 binding is directly proportional to the abundance of cellular band 3 protein.69 We compared $=5"labeled red cells from patients %%"; and %%%"6 and normal controls and did not observe significant differences, indicating neither deficiency nor defective band 3 protein in diseased red cells ( data not s o!n'. %n addition, S:S"D5G$ analysis did not sho( any ma8or changes in red cell membrane band 3 content or in other cell membrane proteins, so (e further e2cluded hereditary spherocytosis but also congenital dyserythropoietic anemia type %% ( data not s o!n'.

2rythrocyte cation content and (e( rane cation transport pathways

-he fact that the =#G and hemoglobin distribution (idth of reticulocytes from %%"; and %%%"6 (ere increased (-able 6 and 1igure 35' suggested that abnormalities in red cell volume regulation (ere already present in reticulocytes and (ere not related to the permanence of red cells in the peripheral circulation.
Figure 3. (5' $rythrocyte cation content and membrane cation transport path(ays. !ed blood cell histograms generated for erythrocyte volume (!)# G' and cell hemoglobin concentration (!)# .#' and plot of !)# .# (1#a1is2 vs% !)# volume (y#a1is' from control red blood(more ...'

#ell &a/ content (as significantly higher in red cells from %%"; and %%%"6 than in those from %"; and controls, (hile red cell 0/ content in %%"; and %%%"6 (as significantly lo(er than in %"; and control erythrocytes, indicating a reduction in total red cell cation content similarly to (hat has been observed in other cases of dehydrated hereditary stomatocytosis (1igure 3)'.;? Since previous reports suggested a possible functional relationship bet(een red cell membrane proteins and cation transport path(ays, 63,6A,6>,69 (e evaluated the activity of the main cation transport path(ays in normal and diseased red cells. We observed a significant decrease in the activity of the &a"0 5-Dase pump in %%"; and %%%"6 compared to the level in %" ; and in control erythrocytes, suggesting a perturbation in &a"0 pump 5-Dase in our anemic sub8ectsF &a"0";#l co"transport, 0"#l co"transport and &a". e2change (ere significantly increased in %%"; and %%%"6 compared to in %"; and in control erythrocytes (1igure 3#'.

Functional studies o# and 3 C24!12 in oocytes

-o investigate the ion functional properties of the G79 ! mutation, Xenopus oocytes (ere in8ected (ith control e5$6 ((ild type erythroid anion e2changer 69 (t e5$6' or G79 !" e5$6. Whole cell membrane preparations of (ild type or mutated 5$6 (ere loaded on an electrophoresis gel. %mmunodetection sho(ed similar patterns of e2pression bet(een the t(o proteins (Online Supplementary 0i'ure S3'. 5s in red cells G79 ! (as correctly addressed to the plasma membrane, there being no indication to suspect a fault in G79 ! e2pression in oocytes. -he &a/ and 0/ contents of oocytes (ere measured 3 days after in8ection and the cation permeability (as also assessed by measuring ,i / influ2. -o prevent cation movements through the &a"0"5-Dase and the endogenous &a"0";#l co"transporter, measurements (ere done in the presence of their specific inhibitors, ouabain and bumetanide. Whereas (t e5$6 did not change oocyte &a / and 0/contents, (hich (ere similar to those in control oocytes (&%' (1igure A5', the G79 ! mutation induced a reversal of &a/ and 0/ oocyte contents. -here (as a net &a/uptake of 39V UmolBg d.(. compensated by a similar net 0/ loss of 36VA UmolBg d.(. (pR?.??< versus (t e5$6'. -hese changes in oocyte cation contents (ere associated (ith increased cation permeability (1igure A)'. -he cation transport induced by the G79 ! mutation (as not sensitive to ?.6 mmolB, S%-S (data not s o!n', in contrast to previously studied 5$6 point mutations also inducing cation transport through the anion e2changer. 7,;6
Figure '. (5' #ation transport properties of the G79 ! mutation. %ntracellular &a / and 0/ contents of oocytes non"in8ected (&%' or e2pressing (t e5$6 or G79 ! e5$6 mutation 3 days after in8ection. 4ocytes had been kept in =)S (ith ?.< m= ouabain and < U= (more ...'

-he #l3B.#433 e2change activity of G79 ! mutation (as also assessed. 4ocyte intracellular p. (as recorded as a function of e2tracellular medium. %n medium buffered (ith ;A m= .#433B<K #4; the rapid #4; eCuilibration through oocyte plasma membrane induced intracellular acidification. -hen, in this medium #l 3 (as substituted by gluconate, an anion to (hich the oocytes are impermeable. %n the presence of functional #l 3B.#433 e2change, this condition induced rapid intra"cellular alkalini+ation.1igure A# sho(s representative p.i recordings of oocytes e2pressing (t e5$6 or G79 ! mutant. 1ollo(ing intracellular acidification, oocytes e2pressing (t e5$6 alkalini+ed in the absence of e2tra"cellular #l 3. %n contrast, oocytes e2pressing G79 ! mutant did not recover from the initial acidification. We also carried out e2periments in the presence of co"in8ected glycophorin 5 (hich did not modify the cation transport properties of the mutated band 3 ( data not s o!n'. -hus, the band 3 point mutation G79 ! abolishes anion e2change activity (hereas it induces &a / and 0/ transport.

Tyrosine phosphorylation pattern o# red cell (e( rane and tyrosine kinase %yk and &yn (e( rane association
Since changes in protein tyrosine phosphorylation state have been sho(n to be involved in the modulation of membrane transport and channels involved in cell volume regulatory events,;;7;A (e evaluated the red cell membrane tyrosine phosphorylation profile in %%"; and %%%"6. 5s sho(n in 1igure <5, membrane tyrosine phosphorylation (as markedly increased in the affected sub8ects compared to in normal controls.
Figure 5. (5' -yrosine phosphorylation profile of red cell membrane from controls (#', %%"; and %%%"6 and effects of cell s(elling induced by urea on control erythrocytes. !ed cell ghosts (ere separated by one"dimensional electrophoresis and blotted (ith specific (more ...'

%n order to evaluate (hether changes in the tyrosine"phosphorylation pattern of red cell membrane proteins (ere part of the physiological response to a cell s(elling stimulus, (e incubated normal erythrocytes (ith and (ithout urea and then evaluated the red cell membrane tyrosine"phosphorylation profile.6< %n urea"treated red cells, (e observed increased tyrosine"phosphorylation of proteins (ith a molecular (eight greater than 6>6 0:a, one band bet(een 6>6"66< 0:a and one at >; 0:a (hich (ere also found in diseased red cells (bands 6, ;, 3F 1igure <5', suggesting a possible adaptive mechanism of

red cells to s(elling involving these proteins. .o(ever, in diseased red cells (e observed additional changes in tyrosine phosphorylation state of other membrane proteins, indicating an independent effect of the hematologic phenotype (1igure <5'. %n order to identify the erythrocyte membrane proteins differently tyrosine"phosphorylated, (e analy+ed anti" phosphotyrosine immunoprecipitated proteins separated by one"dimensional electrophoresis (1igure <)'. )ands that (ere differently tyrosine phosphorylated (ere e2cised and analy+ed by mass spectrometry. We identified the follo(ing proteins9 P spectrin, ankyrin, band 3, band A.6, band A.;, P actin and stomatin (-able ;'. We then evaluated the amount of P spectrin, band 3 and stomatin on anti"phosphotyrosine immunoprecipitated proteins separated by one"dimensional electrophoresis (1igure <)'. We observed a slightly increased amount of P spectrin in diseased red cells compared to in normal controls but a marked increase of both band 3 and stomatin compared to in control erythrocytes (1igure <)'. -hese data suggest that the mutated band 3 might affect membrane organi+ation either directly favoring the e2posure of phosphorylable docking sites on red cell membrane proteins or indirectly through activation of signal transduction path(ays related to abnormal red cell volumeBsurface ratio (1igure <'. Since band 3 is a kno(n substrate for both Syk tyrosine kinase and ,yn tyrosine kinase of the Src family, ;67 ;3 (e evaluated the amount of both tyrosine kinases bound to the membrane in red cells from both patients and controls. 5s sho(n in 1igure <#, Syk and ,yn kinase membrane association (as markedly higher in patients* red cells than in normal controls, most likely being responsible for the increased band 3 tyrosine"phoshorylation state in patients* red cells.
Ta le +. %dentification of proteins differently phosphorylated from those of the patient*s red cell membrane.

Other Sections

Discussion
.ere, (e report a case of hereditary stomatocytosis due to a de novo band 3 mutation (p. G79 !' associated (ith signs of dyserythropoiesis. )and 3 is a 966 aminoacid multispanning membrane protein that conducts bicarbonate"chloride e2change in red cells. =utations in the band 3 gene resulting in a decrease of band 3 protein in red cells are freCuent causes of hereditary spherocytosis. :eletion of A??7A?> amino acids near the first trans"membrane domain causes Southeast"5sian ovalocytosis. !ed cells from patients (ith this condition have been sho(n to leak cations at lo( temperature, this phenotype 8ustifying the inclusion of Southeast"5sian ovalocytosis in the group of hereditary

stomatocytoses.3,A =utations in the 976?thmembrane spanning domains are associated (ith hereditary cryo"stomatocytosis and cation leak. -he present de novo mutation is located in this latter area and causes the same effect on cation leak, but appears to be associated (ith some dyserythropoietic features. .ereditary stomatocytoses can be classified in dehydrated hereditary stomatocytosis, overhydrated hereditary stomatocytosis, hereditary cryo hydrocytosis and familial pseudohyperkalemia. %n our case there (as no pseudohyperkalemia, and the ion content (as similar to that in hereditary cryohydrocytosis. -hus, it could be considered a variant of hereditary cryohydrocytosis because the reticulocyte count (as associated (ith several dyserythropoietic findings, as supported by the lo( reticulocyte count, bone marro( abnormalities and increased soluble transferrin receptor but near normal hemoglobin content (-able 6'. 5 literature revie( of hereditary stomatocytosis revealed t(o case reports (ith similar findings. 4ne case had mild anemia, increased =#G, slightly reduced red cell 0/ content and normal &a/ content, reduced reticulocyte count (ith respect to the anemia and alterations of erythroid progenitors in bone marro( consistent (ith atypical congenital dyserythropoietic anemia type %. -he red cell membrane sho(ed reductions of band 7 and > on S:S"D5G$ analysis.;< -he second case, reported by Oarvis et al., had an abnormal intracellular cation content and increased =#G, inherited in a dominant manner, interestingly due to a de novomutation. Infortunately, the biochemical and molecular defects (ere not reported.; $vidence of connections bet(een dyserythropoiesis and band 3 mutation has been recently found in +ebrafish mutant retsina (ret', (hich is characteri+ed by band 3 mutations associated (ith an erythroid"specific defect in cell division causing marked dyserythropoiesis similar to that occurring in human congenital dyserythropoietic anemia.;7 %n our cases (e observed dyserythropoiesis characteri+ed by a large number of intracytoplasmic bridges (appro2imately 3K' bet(een late erythroid precursors, suggesting a possible role of mutated band 3. !ecently the analysis of 66 human pedigrees (ith dominantly inherited hereditary stomatocytosis (hereditary cryohydrocytosis subtype' and hereditary spherocytosis has sho(n an increased membrane permeability to &a/ and 0/, related to a series of single amino acid substitutions in the band 3 anion e2changer, characteri+ed by a conversion of the mutated band 3 function from an anion e2changer into a non"selective cation leaker.>,9 We, therefore, searched for band 3 mutations and identified a GX5 transition at nucleotide ;<?? in e2on 67 (1igure ;5' in the proband and in her son in the hetero+ygous state. -his molecular $ona4ide event (as due to ade novo mutation since the red cell =#G of the proband*s parents (as normal. 1unctional studies sho(ed that mutated band 3 converted the anion e2changer (#l3, .#433' function to a cation path(ay for &a/ and 0/.

-he patients* red cells sho(ed abnormal cation content, associated (ith decreased &a"0 pump activity, most likely related to metabolic alterations already described in stomatocytosis,;> but also increased &a"0";#l co"transport activity (hich is strictly dependent on the intracellular &a/ content, and may contribute to the net &a/e2trusion from diseased red cells. -he &a". e2change and 0"#l co"transport might be secondarily activated either by possible abnormal functional interactions bet(een membrane proteins and the transmembrane ion transport path(ay or by perturbations in signal transduction path(ays modulating ion movements through the membrane, as previously described in mouse red cells genetically lacking band A.6. 6?,;9 Since the activity of the membrane cation transport path(ays is related to cyclic phosphorylation"dephosphorylation events by kinase phosphatases, (e evaluated the membrane tyrosine phosphorylation profile in diseased red cells. %n diseased red cells, (e observed an increase of band 3 tyrosine phosphorylation, most likely due to increased membrane association of Syk and ,yn kinases (hich have already been reported to tyrosine"phosphorylate band 3. 3?73; %n addition, changes in the tyrosine"phosphorylation of band A.6, band A.;, and stomatin (ere evident in diseased red cells and (ere independent of the adaptive mechanisms to cell s(elling (1igure <', suggesting a perturbation of intracellular signaling path(ays to(ard the membrane" cytoskeleton net(ork.;;,3373< Drevious studies in skate red cells have sho(n that volume e2pansion is associated (ith increased Syk and ,yn activity and changes in phosphorylation state of various membrane proteins and in their association (ith membrane lipid rafts.;;,3<,3 .ere, it is of interest to note that the patients* red cells sho(ed increased tyrosine"phosphorylation of stomatin, (hich is the ma8or protein in lipid raftsF changes in tyrosine"phosphorylation state of stomatin may affect its conformational state and function, most likely contributing to the red cell phenotype. 37,3> -hese finding, together (ith the demonstration of the causative role of this band 3 mutation, led us to classify this case as stomatocytosis, but as a novel variant because of the lack of appearance of anemia in the neonatal period, normal or reduced reticulocyte count and normal hemoglobin level in the mother and her affected son. %n addition, the reduced reticulocyte count and appearance of the bone marro( erythroid compartment supported our conclusion that this is a ne( variant of stomatocytosis (ith several dyserythropoietic features.

Footnotes
5% and ,:1 contributed eCually to this paper. -he online version of this article contains a supplementary appendi2. $uthorship and Disclosures

5% obtained institutional revie( board approval and consent, designed and conducted studies and prepared the manuscriptF ,:1 performed :&5 and red cell membrane analysesF 1) and .G performed oocyte studiesF !55 and =!$ performed red cell membrane analysesF D% and #D contributed to the clinical care of the patients and to morphological studies. ,:1 and 5) performed cation flu2 studies, phosphotyrosine analysis and contributed to the manuscript*s preparationF 5D carried out the mass spectrometric analysis. -he authors reported no potential conflicts of interest. 1unding9 this research (as supported by the %talian =inistero dell*IniversitY e della !icerca, pro8ect DS 3<"6; B%&:, -elethon (5%' and (,:1' (%taly', grants from the #onven+ione #$%&G$"!egione #ampania"5ss. SanitY, the #&!S (#entre &ational de la !echerche ScientifiCue' and IniversitZ de &ice.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2719027/