Characterization of NADPHcytochrome P450 reductase gene from the

cotton bollworm, Helicoverpa armigera

Dong Liu
a,b
, Xiaojie Zhou
a,b,c
, Mei Li
a
, Shunyi Zhu
a
, Xinghui Qiu
a,b,

a
State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
b
University of Chinese Academy of Sciences, Beijing 100049, China
c
Beijing Center for Disease Control and Prevention, Institute of Disinfection and Vector Control, Beijing 100013, China
a b s t r a c t a r t i c l e i n f o
Article history:
Received 24 November 2013
Received in revised form 17 April 2014
Accepted 24 April 2014
Available online 24 April 2014
Keywords:
Helicoverpa armigera
NADPHcytochrome P-450 reductase
Gene structure
Spatial and temporal expression
Enzymatic kinetics
Inhibition
A complete cDNA encoding the NADPHcytochrome P450 reductase (haCPR) and its genomic sequence fromthe
cotton bollwormHelicoverpa armigera were cloned and sequenced. The open reading frame of haCPR codes for a
protein of 687 amino acid residues with a calculated molecular mass of 77.4 kDa. The haCPR gene spans over
11 kb and its coding region is interrupted by 11 introns. haCPR is ubiquitously expressed in various tissues and
at various stages of development. Escherichia coli produced haCPR enzyme exhibited catalytic activity for
NADPH-dependent reduction of cytochrome c, following MichaelisMenten kinetics. The functionality of
CPR was further demonstrated by its capacity to support cytochrome P450 (e.g. haCYP9A14 and chicken
CYP1A5) mediated O-dealkylation activity of alkoxyresoruns. The avoprotein-specic inhibitor
(diphenyleneiodonium chloride, DPI) showed a potent inhibition to haCPR activity (IC
50
= 1.69 M).
Inhibitory effect of secondary metabolites in the host plants (tannic acid, quercetin and gossypol) on
CPR activity (with an IC
50
value ranged from 15 to 90 M) was also observed.
2014 Elsevier B.V. All rights reserved.
1. Introduction
Cytochrome P450 monooxygenases (CYPs) catalyze the oxidative
metabolism of various endogenous and exogenous substrates (see
Feyereisen, 2012). Microsomal CYPs function in partnership with their
electron donor enzyme, NADPHcytochrome P450 reductase (EC1.6.2.4,
hereafter called CPR) (Riddick et al., 2013). In eukaryotes including in-
sects, CPR is the only obligatory avoprotein intermediate that transfers
electrons from reduced nicotinamide adenine dinucleotide phosphate
(NADPH) to P450 enzymes through avin mononucleotide (FMN) and
avin adenine dinucleotide (FAD) cofactors (Louerat-Oriou et al., 2001;
Paine et al., 2001). CPR is recognized as a key factor of rate limitation for
catalytic activities of P450s (Cheng et al., 2006). In addition, CPRs donate
electrons to multiple acceptors (e.g. cytochrome b5, squalene mono-
oxygenase, and heme oxygenase), and can directly catalyze the one-
electron reductive bioactivation of some prodrugs (e.g. mitomycin D
and tirapazamine) (Riddick et al., 2013).
Typically, as with other animals, there is only one CPR gene in each
insect genome. Since the rst insect CPR gene (house y CPR) was
cloned and sequenced in 1993 (Koener et al., 1993), around 20 CPR se-
quences have been identied ininsects (Zhuet al., 2012). Heterologous-
ly expressed house y CPR has been widely used to investigate the
function of a given cytochrome P450 of eukaryotic origins (Sandstrom
et al., 2006; Wen et al., 2003). The enzymatic kinetics of insect CPRs
were investigated using heterologously expressed CPR enzymes
(Andersen et al., 1994; Kaewpa et al., 2007; McLaughlin et al., 2008;
Sarapusit et al., 2008; Wen et al., 2003). Biochemical comparisons re-
vealed key differences inthe binding of small molecules (cofactors or in-
hibitors) between mosquito and human CPRs (Lian et al., 2011). RNAi-
mediated in vivo knockdown of CPR increased pyrethroid susceptibility
in Anopheles gambiae, Cimex lectularius and Helicoverpa armigera (Lycett
et al., 2006; Tang et al., 2012; Zhu et al., 2012).
The cotton bollworm H. armigera is an extremely detrimental
polyphagous pest that may cause severe crop loss (d'Alencon et al.,
2010; Fitt, 1989). It has been long known that CYP mediated detoxica-
tion of secondary metabolites and insecticides is responsible for its
adaptation to host plant toxins and resistance to insecticides in this
pest. To better understand the molecular mechanisms of insecticide
resistance or host adaptation, it is necessary to dissect the substrate
specicity of individual P450s. However, previous attempts in this
direction have been hampered by the difculty in obtaining homoge-
neous individual P450 and its redox partners required for the reconsti-
tution of P450 reaction systems. As a crucial step towards functional
characterization of the multiple functions of versatile CYPs in the cotton
bollworm, in this study, we identied a CPR (haCPR) gene from
Gene 545 (2014) 262270
Abbreviations: CYP, cytochrome P450; CPR, NADPHcytochrome P450 reductase; DPI,
diphenyleneiodonium chloride; NADPH, nicotinamide adenine dinucleotide phosphate;
FMN, avin mononucleotide; FAD, avin adenine dinucleotide.
Corresponding author at: State Key Laboratory of Integrated Management of Pest
Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101,
China.
E-mail address: qiuxh@ioz.ac.cn (X. Qiu).
http://dx.doi.org/10.1016/j.gene.2014.04.054
0378-1119/ 2014 Elsevier B.V. All rights reserved.
Contents lists available at ScienceDirect
Gene
j our nal homepage: www. el sevi er . com/ l ocat e/ gene
H. armigera. The expression prole and enzymatic properties were also
investigated.
2. Materials and methods
2.1. Insects
A colony of cotton bollworm H. armigera (Hbner) was established
from a eld collection from Hebei Province, China, and was maintained
in the laboratory without exposure to any insecticide. Larvae were indi-
vidually reared in glass tubes on a wheat germ based articial diet (Wu
and Gong, 1997), at 25 1 Cand a relative humidity of 70%witha pho-
toperiod of 16-h light/8-h dark. Adults were kept under the same tem-
perature and light conditions, and provided with a 10% honey solution.
2.2. Enzymes and chemicals
E. coli strain DH5(Transgen Biotech, Beijing, China) was used as the
host cells for cloning and expression. Restriction enzymes, ligase,
pMD19-T Simple vector, pGEM Easy vector, Pfu polymerase, MLV re-
verse transcriptase and Genome Walking Kit were purchased from
Takara (Takara, Dalian, China). Rapid amplication of cDNA ends
(RACE) was carried out using SMARTer RACE cDNA Amplication
Kit (Clontech, CA, USA). Polymerase chain reaction (PCR) reagents,
gel purication kit and TIANcombi DNA Lyse & Amp PCR Kit were
purchased from Tiangen Biotech (Beijing, China). TRIzol was obtain-
ed from Invitrogen (Invitrogen, CA, USA). Oligonucleotide primers
were commercially synthesized by Invitrogen. Gossypol (95%)
was purchased from China Cotton UNIS (Beijing, China). All the
other chemicals were obtained from Sigma (St. Louis, MO, USA) in-
cluding cytochrome c, NADPH, glucose-6-phosphate, glucose-6-
phosphate dehydrogenase, isopropyl--D-thiogalactopyranoside
(IPTG), 5-aminolevulinic acid hydrochloride (ALA, 98%), resorun,
7-ethoxyresorun, 7-methoxyresorun, 7-benzyloxyresorun, quercetin,
tannic acid, xanthotoxin, diphenyleneiodoniumchloride (DPI), piperonyl
butoxide (PBO), permethrin, deltamethrin and DDT. The pB54
(pCWmod4) vector was kindly provided by Dr. Thomas Friedberg
(University of Dundee, Scotland).
2.3. Isolation of NADPHcytochrome P450 reductase gene from the
H. armigera
Total RNA was extracted from midguts of H. armigera 5th instar lar-
vae by using TRIzol (Invitrogen, CA, USA) according to the
manufacturer's protocol. First-strand cDNA was synthesized from total
RNA (1 g) using MLV reverse transcriptase according to the
manufacturer's instructions (Takara, Dalian, China). Total genomic
DNA was isolated from cotton bollworm larvae by using TIANcombi
DNA Lyse & Amp PCR kit (Tiangen, Beijing, China).
A pair of degenerate primers (Degenerate F/CPR and Degenerate R,
Table 1) was synthesized based on the conserved regions of the identi-
ed CPR genes fromother insects, including Musca domestica (Q07994),
Drosophila melanogaster (NP_477158), Bombyx mori (NP_001104834)
and A. gambiae (AAO24765) (Horike et al., 2000). A 1402 bp product
was amplied. The 3-end and 5-end of this cDNA fragment were ob-
tained by using SMART RACE cDNA amplication kit according to
the manufacturer's protocol. The gene-specic primers used for 3-
RACE and 5-RACE were 3GSP-F and 5GSP-R respectively (Table 1).
The full-length gene was cloned using CPR-F/CPR-R primers
(Table 1), which were designed based on the sequence information ob-
tained from 3- and 5-RACE ends. In order to detect potential genetic
polymorphisms of H. armigera CPR, the cDNA pool synthesized from
RNA of 60 individuals was used as templates. Products amplied using
the high-delity DNA polymerase (Pfu) were gel puried (Tiangen,
Beijing, China) and then subcloned into pGEM-T vector (Takara, Dalian,
China). Twenty positive clones were sequenced.
The genomic sequence of the CPR gene in H. armigera was obtained
by a combination of PCR and genome walking techniques. Genome
walking was performed according to the manufacturer's instructions
inthe Genome Walking Kit (Takara, Dalian, China). All primers are listed
in Table 1.
2.4. Sequence analysis and three-dimensional model
The molecular weight and isoelectric point (pI) of deduced haCPR
protein were predicted by using ProtParam software (http://web.
expasy.org/protparam/). BLASTP search against the non-redundant da-
tabase of GenBank was performed under default parameters. Alignment
of amino acid sequence was performed by using Sequence Alignment
tools MEGA4 and GeneDoc. The homology structure of haCPR was con-
structed through SWISS-MODEL workspace service (http://swissmodel.
expasy.org/workspace/) based on the structure of human CPR [PDB:
3QE2] (Xia et al., 2011). The haCPR structure was displayed with
Swiss-PDB viewer (Guex and Peitsch, 1997).
2.5. Spatial and temporal expression analysis
The expression prole of CPR was examined in various tissues and at
various developmental stages of H. armigera by RT-PCR. Total RNA from
eggs, female pupae, male pupae, various tissues (head, midgut, malpi-
ghian tubules, fat bodies and integument) of the fth-instar larvae,
and different parts (antennae, heads, thoraxes and abdomens) from fe-
male and male adults, was prepared using TRIzol (Invitrogen, Carlsbad,
CA) according to the manufacturer's protocol. To remove potential
genomic DNA contamination, the RNA samples were treated with
RNase-free DNase I (Takara, Dalian, China).
The rst-strand cDNA was synthesized from 1 g RNA with an
oligo(dT) primer using the MLV reverse transcriptase. The RT-PCR am-
plications were carried out in a nal volume of 25 L reaction contain-
ing 2 L of 10dilutedtemplate cDNA, 12.5 L Taq Master Mix (Tiangen,
Beijing, China), 0.5 L (10 M) of each primer and sterilized water up to
the nal volume. The primers used for the semi-quantitative PCR analy-
sis were qCPR-F and qCPR-R (Table 1). The elongation factor-1 gene
(EF-1, qEF-F/qEF-R primer set, Table 1) was used as a reference gene
(Zhou et al., 2009). The thermal cycling prole consisted of an initial
step of denaturation at 95 C for 5 min, followed by 30 cycles of 95 C
for 30 s, 5560 C for 30 s and 72 C for 30 s, and a nal extension
step of 72 C for 5 min. Aliquots of 7.5 L PCR products were analyzed
on a 2% agarose gel.
2.6. Construction of recombinant haCPR and CYP9A14 plasmids
2.6.1. Recombinant haCPR plasmid
A DNA sequence containing the intact ORF (Open Reading Frame) of
CPR and digestion sites was amplied by PCR using KpnI CPR-F and
HindIII CPR-R as primers (Table 1) and cDNA as the template. Pfu DNA
polymerase was employed in the PCR to reduce the incidence of replica-
tion error. PCR product was cloned into pMD19-T simple vector to form
a plasmid named CPR-PMD.
To construct a recombinant plasmid for functional expression of CPR
in E. coli, we followed the pelB strategy (Pritchard et al., 2006). Briey,
the vector pB54 was modied by inserting the bacterial pelB leader se-
quence (21 amino acid residues) at the Nde I and EcoR I restriction
sites. The pelB oligonucleotide leader sequence anking with digestion
sites (5-CATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCT
CCTCG CTGCCCAGCCGGCGATGGCCGAATTC-3) was commercially syn-
thesized by Invitrogen. We named the modied vector as pB508 hereaf-
ter. The ORF of haCPR was cut out from CPR-PMD and ligated into the
derived pB508 vector between the Kpn I and Hind III restriction sites.
The resulting recombinant plasmid pB508-CPR was transformed into
an E. coli DH5 strain.
263 D. Liu et al. / Gene 545 (2014) 262270
2.6.2. Recombinant haCYP9A14 plasmid
In order to express CYP9A14 in E. coli, we followed the 17
N-terminal modication strategy, where the rst eight amino acid
residues of the CYP9A14 N-terminus were replaced with a sequence
(MALLLAVF) derived from the bovine steroid 17-hydroxylase
(Barnes et al., 1991). The forward primer (CYP9A14 NdeIF, 5AGGA
GGTCATATGGCTCTGTTATTAGCAGTTTTTGTACTCGTCGCAGCTCTGACG-
3) introduced the Nde I restriction site (underlined) as the initiation
codon and a 17 sequence modication (italic). The reverse primer
(CYP9A14 KpnIR, 5-CGGGGTACCTTACTGGCGCAGCTTGACCCT-3) in-
troduced the Kpn I site (underlined sequence). The resulting PCR prod-
uct was digested and ligated into pB54 at the Nde I and Kpn I sites to
create the recombinant plasmid pB54-17CYP9A14. The recombinant
plasmid was sequenced to ensure right nucleotide sequence. The expres-
sion plasmid pB54-17CYP9A14 was transformed into E. coli Rosseta
(DE3) (Transgen, Beijing, China) for functional expression.
2.7. Bacterial expression and membrane isolation
The functional expression of chicken CYP1A5 was described previ-
ously (Yang et al., 2013), and a similar protocol was used to express
haCPR and haCYP9A14. Briey, a single E. coli colony carrying the plas-
mid of interest was inoculated in 5 mL of Luria Broth (LB) containing
ampicillin (100 g/mL) and allowed to grow overnight at 37 C and
200 rpm. One milliliter of overnight cultures was used to inoculate
100 mL of modied terric broth with ampicillin (100 g/mL) in a 500
mL conical ask. The cultures were grown at 37 C and 200 rpm until
an OD
600
of 0.7 to 1.0. Then 1 mM IPTG (and 75 mM ALA for CYP9A14)
was added and the cultures were incubated for additional 2224 h at 30
C and 150 rpm. The cells were harvested by centrifugation at 2800 g
for 20 min at 4 C (Pritchard et al., 2006). The harvested cells from
100 mL cultures were resuspended in 10 mL of 1 TSE buffer [50 mM
Tris-acetate (pH 7.6), 250 mMsucrose, and 0.25 mMEDTA]. The protease
inhibitors PMSF (phenylmethylsulfonyl uoride) andDTT (dithiothreitol)
were added to nal concentrations of 1 mM and 0.1 mM respectively.
The resuspended cells were disrupted using an ultrasonic processor
(Scienta-IID, China), and cell debris was removed by centrifugation
at 12,000 g for 30 min at 4 C. To pellet membranes, the 12,000 g su-
pernatant was centrifuged at 180,000 g for 1 h. The membrane frac-
tions were resuspended in 1 mL of 1 TSE buffer containing PMSF
and DTT.
2.8. Protein concentration, SDS-PAGE and P450 content
The protein concentration was determined by the Bradford method
(Bradford, 1976). 10% (w/v) sodium-dodecyl-sulfate polyacrylamide
gel electrophoresis (SDS-PAGE) was performed to detect the expression
of the recombinant CPR protein. About 20 g of protein was loaded into
each lane of the gel. Protein bands were visualized by staining with
Coomassie Blue R-250. Total P450 content was determined according
to the method described by Omura and Sato (1964).
2.9. CPR activity assay
CPR activity was determined by measuring its NADPH-dependent
cytochrome c reductase activity at 30 C (Capdevila et al., 1973; Feng
et al., 1992; Lian et al., 2011). The activity assay mixture contained the
haCPR enzyme in the membrane fractions, 50 M cytochrome c, and
50 M NADPH in 0.3 M potassium phosphate buffer (pH 7.6) in a total
volume of 1 mL (Schonbrod and Terriere, 1971). The reaction was initi-
ated by the addition of NADPH. Time-dependent absorbance change at
550 nm was monitored up to 3 min by a DU800 spectrophotometer
(Beckman, USA). The extinction coefcient of 21 mM
1
cm
1
was
used to determine the amount of cytochrome c reduction. A parallel
assay with membranes from cells harboring pB508 vector was per-
formed as a control.
Kinetic experiments for cytochrome c reduction were performed at a
xed 50 M NADPH concentration with varying cytochrome c
Table 1
Primers used in this study.
Primer name Usage Sequence (53)
CPR Degenerate F cDNA Cloning TT(C/T)GGI(C/T)TIGGIAA(C/T)AA(A/G)AC(A/G/C/T)TA(C/T)GA
CPR Degenerate R cDNA Cloning GCCAT(G/A)TTITTIGC(G/A)TC(G/A/T/C)CC(G/A)CA
5GSP-R 5-RACE AGGACCTGTCGCCGCCTTTGTGTAGC
3GSP-F 3-RACE GTAATCGCAACGGTCACTTCTACATCTG
CPR-F cDNA Cloning ATGTCAGACAGCGCACAGG
CPR-R cDNA Cloning TTAACTCCATACATCTGCTG
CPR-gDNAF1 Genomic CPR cloning Same to CPR-F
CPR-gDNAR1 Genomic CPR cloning GCAACCATGCCTTTCATCTT
CPR-gDNAF2 Genomic CPR cloning AAGATGAAAGGCATGGTTGC
CPR-gDNAR2 Genomic CPR cloning TTGTAGAGAGTGCAGCCTGG
CPR-gDNAF3 Genomic CPR cloning CCAGGCTGCACTCTCTACAA
CPR-gDNAR3 Genomic CPR cloning TGGTAGTTACGCCCTTGTTAA
CPR-gDNAF4 Genomic CPR cloning TTAACAAGGGCGTAACTACCA
CPR-gDNAR4 Genomic CPR cloning Same to CPR-R
CPR-gDNASP1 Genomic CPR cloning GCAATAGCCCTTAGATAAGTACTGG
CPR-gDNASP2 Genomic CPR cloning GGTACTCACGGCATAATTCAAACC
CPR-gDNASP3 Genomic CPR cloning CCTCGCCATATGTTGCCATACAGA
qCPR-F qRT-PCR AAGACATACCATCTTGTAAGCCTC
qCPR-R qRT-PCR AGAAGTGACCGTTGCGATTACC
qEF-F qRT-PCR GACAAACGTACCATCGAGAAG
qEF-R qRT-PCR GATACCAGCCTCGAACTCAC
KpnI CPR-F Expression plasmid construction GGTACCATGTCAGACAACGCACAGG
HindIII CPR-R Expression plasmid construction AAGCTTTTAACTCCATACATCTGCTG
CYP9A14 NdeI-F Expression plasmid construction AGGAGGTCATATGGCTCTGTTATTAGCAGTTTTTGTACTC
GTCGCAGCTCTGACG
CYP9A14 KpnI-R Expression plasmid construction CGGGGTACCTTACTGGCGCAGCTTGACCCT
Fig. 1. Alignment of the amino-acid sequence of haCPR with those fromBombyx mori, Aedes aegypti, Pediculus humanus, Triboliumcastaneum, Acyrthosiphon pisum, Drosophila melanogaster,
Linepithema humile, Rattus norvegicus and Homo sapiens. Identical amino acids are shaded in black and noted in capital letters in the consensus line. Weakly conserved residues are shaded
in gray and noted in lowercase letters in the consensus line. Regions reported to be the binding sites of the cofactors are boxed. Insertion positions of the four conserved introns among
insect species are labeled with arrows.
264 D. Liu et al. / Gene 545 (2014) 262270
265 D. Liu et al. / Gene 545 (2014) 262270
concentrations, and vice versa for NADPH (Zhou et al., 2010). Kinetic pa-
rameters were determined by the nonlinear regression Michaelis
Menten equation by using GraphPad Prism 5 (San Diego, CA, USA).
For inhibition experiments, the reaction volume was 1 mL,
consisting of enzyme preparations and cytochrome c (50 M) in the
presence or absence of NADPH (50 M) in 0.3 M potassium phosphate
buffer (pH 7.6). The enzyme preparation was pre-incubated with inhib-
itors for 10 min at 30 C. Because background activity of cytochrome c
reduction was observed for tannic acid and gossypol, we measured
the activity of haCPR by subtracting the rate of cytochrome c reduction
in the absence of NADPHfromthat in the presence of NADPHwhen tan-
nic or gossypol was included in the reactions as previously reported
(Pillai and Mehvar, 2011). IC
50
values (the concentration giving 50% in-
hibition) for each inhibitor were calculated using a non-linear regres-
sion analysis program GraphPad Prism 5.
2.10. Alkoxyresorun O-dealkylase assay
The alkoxyresorun O-dealkylation (AROD) activities including
7-methoxyresorun (MROD), 7-ethoxyresorun (EROD), and 7-
benzyloxyresorun (BROD) were assayed according to the method
described elsewhere (Mayer et al., 1977). The reaction mixtures
contained the substrate (3 M 7-methoxyresofurin for MROD,
5 M 7-ethoxyresofurin for EROD, and 4 M 7-benzyloxyresofurin
for BROD) and reconstituted enzymes in the phosphate buffer
(pH 7.4, 50 mM). The reconstituted enzymes were prepared by com-
bining the membranes containing individual CYP (0.1 M) and the
membranes containing CPR (0.5 M CPR) and mildly mixing on ice
for 5 min. The reaction mixtures in a nal volume of 750 L were
pre-incubated in a water bath at 30 C for 5 min. Reactions were
started by the addition of 10 mM NADPH. Enzyme activity was mea-
sured at an excitation wavelength of 530 nm (slit 5 nm), and an
emission wavelength of 585 nm (slit 5 nm). Three other enzymatic
reactions (CYP alone, CPR alone, and NADPH minus) were performed as
controls. AROD activities were expressed as nmol of resorun per nmol
P450 per minute.
3. Results
3.1. Identication of the haCPR gene
A full length cDNA sequence named as haCPR was isolated from
H. armigera. This cDNAwas 3526 bp long, withanORF of 2064 bpcoding
for a protein of 687 amino acids, a 5-UTR of 168 bp and a 3-UTR of
1294 bp. The pI and MW of the deduced protein were 5.55 and
77.4 kDa respectively. Three cDNA forms (GenBank No. 1KF419215,
1KF555286, 1KF555287) with 17 synonymous nucleotide substitutions
in their coding regions were identied from20 clones (Fig. S1). No mis-
sense mutation was discovered.
Sequence comparison showed that the protein encoded by this
cDNA had the highest amino acid identity (N90%) to cytochrome P450
reductase from other two noctuid insects (Spodoptera exigua and
Mamestra brassicae), followed by those from other lepidopterans
(N80% for B. mori and Danaus plexippus). Similarly, haCPR exhibited
63%70% identity at the amino acid level when compared with those
from other insects. The overall similarity of haCPR to those from mam-
mals (i. e. rats and humans) was approximately 55% (Table S1).
Alignment analysis revealed that haCPR shared many highly con-
served amino acid residues with other CPR orthologs (Fig. 1). Several
of these residues were crucial for CPR activity in rats (Shen et al.,
1989). For example, Tyr-149 (haCPR numbering) was necessary for
FMN binding, and Thr-99, Tyr-187 and Asp-217 were essential for ef-
cient electron transfer (Lamb et al., 2001; Shen et al., 1989). Residues
Ser-468, Cys-639, Asp-684, and Trp-686 formed the catalytic residues
(active site) of the rat CPR (Hubbard et al., 2001; Shen et al., 1989).
The homology structure of haCPR modeled by SWISS-MODEL
displayed three distinct structural domains, i.e. FMN-binding domain,
the connecting domain, and the FAD-/NADP-binding domains (Figs. 1
and S2). Consistent with the structures of CPR from rats (Wang et al.,
1997) and humans (Xia et al., 2011), the FMNdomain, structurally sim-
ilar to avodoxins, was located at the N-terminus. The FAD/NADPH do-
main was located at the C-terminus and structurally similar to
ferredoxin reductases. The connecting domain, situated between the
two avin domains, was thought to be responsible for bringing the
two avins together and also for modulating electron transfer between
the two avins (Wang et al., 1997). A hinge region joining the FMN-
binding domain to the connecting domain was also observed in the
haCPR, as reported in the rat CPR (Wang et al., 1997).
The haCPR gene spanned at least 11 kb (GenBank No. 1KF419216).
Eleven introns were identied interrupting the coding region (Fig. 2).
The length of introns in haCPR ranged from 86 to 6678 bp (Fig. S3). In
comparison with the exonintron organization of CPR genes from
other insects (Figs. 2 and S3), haCPR showed a highly similar genomic
structure to that of B. mori CPR (bmCPR). Both haCPR and bmCPR had
11 introns and, interestingly, they shared identical insertion phase, po-
sition for each corresponding intron, and length for each corresponding
exon. Notably, for all the insect CPRs under investigation, the last exon
(145 bp) encoding FAD/NADPH binding domain region was found to
be highly conserved in length and sequence identity. However, the
length of introns differed considerably among these CPR genes.
3.2. Spatial and temporal patterns of CPR expression
The spatial and temporal patterns of haCPR expression were de-
termined by RT-PCR, and the elongation factor-1 (EF-1) was
used as a reference. Similar to EF-1 expression, haCPR mRNA was
detected ubiquitously in various tissues including larva integument
and adult antennae, during all developmental stages (egg, larvae,
pupae, and adults) (Fig. 3).
3.3. Heterologous expression of CPR and CYP9A14
Recombinant haCPR was expressed by fusing the bacterial pelB se-
quence with haCPR. Translation initiated at the pelB ATG initiation
codon was expected to produce a precursor protein, and the fused
pelB leading sequence was proteolytically removed when the precursor
protein was transported to the periplasmic space of E. coli cell (Pritchard
et al., 2006). SDS-PAGE showed that the target haCPR protein (with an
expected protein band of 77.4 kDa) was present in the membrane frac-
tion, but absent in the cytosolic fraction of cells transformed with the re-
combinant haCPR plasmid; this band was not observed in samples
prepared from cells transformed with the control plasmid (Fig. 4). The
cytochrome c reduction assay showed that the specic activity in the
membrane fraction was 6-foldhigher than that inthe corresponding cy-
tosolic fraction of cells transformed with the haCPR recombinant plas-
mid. In contrast, much lower activity was detected in the cytosolic
fraction and no detectable activity was observed in the membrane frac-
tion of cells transformed with the control plasmid. These results clearly
indicated that haCPRwas functionally expressed and localized primarily
in the membrane of E. coli cells (Table 2).
By applying 17 N-terminal modication strategy, a high yield of
haCYP9A14 (700900 nmol/L culture) was produced in E. coli as de-
termined using whole cells. The membranes prepared from E. coli
cells expressing haCYP9A14 showed a typical CO difference spec-
trum at 450 nm (Fig. 5). The content of haCYP19A14 in the mem-
brane preparations was 0.671.51 nmol/mg protein.
3.4. Kinetics of recombinant haCPR
Kinetic studies were conductedusing membrane fractions as sources
of enzymes. Results showed that haCPR obeyed MichaelisMenten
266 D. Liu et al. / Gene 545 (2014) 262270
kinetics with respect to both cytochrome c and NADPH(Fig. 6). The Km
values for cytochrome c and NADPH were 19.35 1.54 M and 3.29
0.17 M, respectively.
3.5. Alkoxyresorun O-dealkylation (AROD) activity assay
To examine whether recombinant haCPR supports P450 mediat-
ed metabolism, the O-dealkylation activities (AROD) were assayed
using a reconstituted CYP system. 7-Methoxyresorun (MROD), 7-
ethoxyresorun (EROD), and 7-benzyloxyresorun (BROD) were used
as substrates (Table 3). Chicken CYP1A5-haCPR and haCYP9A14-haCPR
reconstituted systems showed ARODactivities (Table 3), while no detect-
able ARODactivity was observed in the CPR alone, CYP alone, and NADPH
minus controls.
3.6. CPR inhibition
Potential inhibitory effects of nine chemicals on CPR were investigat-
ed. The nine chemicals included the classical avoprotein inhibitor
(DPI), four main allelochemicals in the host plants of H. armigera (querce-
tin, tannic acid, xanthotoxin, and gossypol), three insecticides (permeth-
rin, deltamethrin, andDDT), andPBO(a P450 inhibitor commonly usedas
insecticidal synergist). The results showed that four of the nine tested
chemicals (quercetin, tannic acid, gossypol, and DPI) signicantly
inhibited haCPR activity, while other chemicals had no signicant inhibi-
tory effect at a dose up to 50 M (data not shown). The four inhibitors
were found to cause a concentration-dependent inhibition of cytochrome
c reduction catalyzed by the haCPR enzyme (Fig. 7). DPI showed the
strongest inhibitory effect among all the tested chemicals with IC
50
value of 1.69 M. The IC
50
values of the three allelochemicals on cyto-
chrome c reduction activity ranged from 10.5 to 88.6 M. It was also no-
ticed that tannic acid and gossypol, neither DPI nor quercetin, could
directly reduce cytochrome c in the absence of either haCPR enzyme or
NADPH.
4. Discussion
The haCPR gene was identied from the cotton bollworm in this
study. Sequence and structural alignments indicate that haCPR shares
a high similarity with the known CPRs from other species (Table S1,
Figs. 1 and S2). However, the N-terminal hydrophobic domain responsi-
ble for membrane anchor is diverse, possibly due to its involvement in
interaction with cytochrome P450 within each species (Murataliev
et al., 2004).
A previous study showed that vertebrate CPR genes had highly con-
served genomic structure (Zhou et al., 2010). By examining the intron
exon organization of the available insect CPRs, we found that although
varying intronamount (412) and intronsize (4919,124 bp) are present
among the nine representative insect CPRs (Fig. 2, S3), high conservation
in gene structure is evident. For instance, four introns (at positions 1, 3, 4,
and 14) are conserved in all these sequences (and in human CPR) and
they share the same insertionpositionandthe same phase (Fig. 2). Partic-
ularly, the insertion phase of the last intron is identical, and the length of
the last exon is exactly the same (145 bp), reecting the evolutionary
Fig. 2. Exonintron organization of nine insect CPR genes from six orders. Vertical lines indicate introns located at the same position. : phase-0 intron (splicing between codons),
: phase-1 intron (splicing between the rst and second nucleotides of a codon), : phase-2 intron (splicing between the second and third nucleotides of a codon). The CPR genome
sequences of Aedes aegypti (Transcript ID: AAEL00349) and Pediculus humanus (Transcript ID: PHUM101680) are from VectorBase. Sequences for Tribolium castaneum (Transcript ID:
XM966081.2) and Acyrthosiphon pisum(Transcript ID: XM001945227.2) are from GenBank. Sequences for Drosophila melanogaster (FlyBase ID: FBgn0015623) and Drosophila grimshawi
(FlyBase ID: FBgn0118220) were from FlyBase. The genomic CPR sequence for Bombyx mori (Load ID: KBtr3006767) is obtained from the database of SGP (silkworm genome program).
Sequence for Linepithema humile is from Hymenoptera Genome Database (Load ID: LH22946). Positions of conserved motifs of CPR are shown on the top. Human CPR (Transcript ID:
NM00941.2) at the bottom is used as a reference.
Fig. 3. Spatial and temporal expression of haCPR detected by RT-PCR analysis. Egg; LMi: larva midgut; LFa: larva fatbody; Lin: larva integument; LHe: larva head; LMt: larva malpighian
tubules; FPu: female pupae; FAn: female adult antennae; FHe: female adult head; FTh: female adult thorax; FAb: female adult abdomen; MPu: male pupae; MAn: male adult antennae;
MHe: male adult head; MTh: male adult thorax; MAb: male adult abdomen The elongation factor-1 gene serves as a reference.
267 D. Liu et al. / Gene 545 (2014) 262270
constraint acting upon this exon. The genomic structure of insect CPRs is
more conserved between evolutionarily close species than distant spe-
cies. For example, there are very similar genomic structures of CPR
genes fromcotton bollwormand silkworm, and among the 12 Drosophila
(Figs. 2 and S3). Most of the observed variations in intronexon orga-
nization may be attributable to intron loss or gain. For example, only
the four aforementioned conserved introns were identied in Tribolium
castaneum, and in ve Drosophila species, which suggest that several in-
trons may be lost in these species. It seems that haCPR has experienced
loss of two introns (at positions 7 and 12). The unique intron (at position
9) observed in 7 Drosophila species implies that an event of intron gain
has occurred in the evolution of Drosophila CPRs.
CPR is a membrane-bound protein. Reliable measurement of CPR ac-
tivity andreconstitutionwithCYPand/or cytochrome b5require the use
of its membrane-bound form. Heterologous expression of cloned insect
CPRs has been achieved in E. coli (Andersen et al., 1994; Kaewpa et al.,
2007; Lian et al., 2011; McLaughlin et al., 2008; Sarapusit et al., 2008)
Fig. 4. SDS-PAGE proles of different fractions isolated from E. coli cells, harboring recom-
binant plasmid (with haCPR, lanes 1 and 3), harvested 24 h after IPTG induction and con-
trol plasmid (without haCPR, lanes 2 and 4). The gel is stained with Coomassie Brilliant R-
250. Lanes 1 and 2: membrane fractions; lanes 3 and 4: cytosolic fractions; The arrow in-
dicates the expected band of CPR protein with a size of about 77.4 kDa. Lane Mrepresents
the protein molecular weight of standard.
Table 2
The specic activity of cytochrome c reduction of recombinant haCPR.
Fractions Specic activity
a
Vector control Cytosol 0.018 0.001
Membrane ND
b
haCPR Cytosol 0.151 0.007
Membrane 1.054 0.039
a
The specic activity of cytochrome c reduction is determined using different fractions
isolated from the E. coli cells harboring control plasmid (pB508) and recombinant plasmid
(pB508-CPR) for 24 h cultivation after IPTGinduction. Values are means SE of three inde-
pendent experiments with each determination in triplicate (mol cytochrome c/min/mg
protein).
b
ND = not detectable.
Fig. 5. Reduced CO-difference spectra of E. coli membranes expressing haCYP9A14.
Fig. 6. Kinetic analysis of the recombinant haCPR. Substrate saturation of CPR with
increasing cytochrome c concentrations at 50 M NADPH (A) and increasing
NADPH concentrations at 50 M cytochrome c (B). Velocities are expressed as micromole
reduced cytochrome c produced per minute per microgram of membrane protein. Results
are expressed as mean SE from three independent experiments with each determination
in duplicate.
268 D. Liu et al. / Gene 545 (2014) 262270
and in the baculovirus expression system(Wen et al., 2003). Our results
demonstrate that the active haCPR protein can be successfully
expressed in E. coli by fusing the pelB signal peptide to the N-terminal
of haCPR using pB54 as the vector. The E. coli produced haCPR is mainly
localized in the membrane fraction (Table 2). This heterologously
expressed enzyme has the capacity to reduce cytochrome c, and transfer
reducing equivalent from NADPH to CYP of different origins, as evi-
denced by the ndings that both haCYP9A14/haCPR and chicken
CYP1A5/haCPR catalyze NADPH-dependent AROD reactions (Table 3).
Investigation of substrate specicity of CYPs could be accomplished by
reconstitution of heterologously expressed P450 and CPR enzymes
invitro (Andersenet al., 1994; Kaewpa et al., 2007). Therefore, the avail-
ability of the haCPRenzyme will undoubtedly facilitate further function-
al characterization of CYPs in this dreaded pest.
So far, kinetics studies of few insect CPRs have been conducted (see
Feyereisen, 2012). We used the recombinant haCPR in the membrane
fractionof E. coli cells to performa preliminary kinetic analysis. Our results
showed that the estimated Km values of haCPR for cytochrome c
(Km
cytc
= 19.35 1.54 M) and NADPH (Km
NADPH
= 3.29
0.17 M) were higher than those of CPR from the mosquito [1.24
0.25/2.58 0.28 M (Kaewpa et al., 2007)], but similar to those of CPRs
from chickens [21.9 2.3/2.4 0.3 M (Zhou et al., 2010)] and rats
[21.1 2.5/6.4 1.0 M (Shen et al., 1989)]. In addition, the binding
afnity of haCPR was similar for cytochrome c to that of A. gambiae
CPR (AgCPR, Km
cytc
= 23 M, Lian et al., 2011), while haCPR exhibited
much stronger afnity for NADPH than AgCPR (Km
NADPH
= 30 M,
Lian et al., 2011). Differences in protein structure and assay condi-
tions may partly explain the variation in the reported kinetic param-
eters among these CPRs. The Vmax of haCPR cannot be estimated
accurately from the present set of data, as the protein used for the
enzymatic assay was obtained from the membrane fraction, where
lots of other proteins were present (Fig. 4).
CPR is a vital component of P450 monooxygenase systems, there-
fore, disruption or inhibition of CPR should affect the activities of micro-
somal P450 enzymes. We compared the inhibitory effect of nine
chemicals on haCPR in vitro and found that the avoprotein specic in-
hibitor (DPI) has potent inhibitory activity against haCPR, consistent
with the results of other studies (Doussiere and Vignais, 1992; Lian
et al., 2011; Portal et al., 2008). Notably, haCPR (IC
50
= 1.69 M) is
much more sensitive to DPI than AgCPR (IC
50
= 28 M, Lian et al.,
2011). Our data (Fig. 7) also demonstrate that some secondary metabo-
lites existing in the host plants (e.g. tannic acid, quercetin and gossypol)
of H. armigera have a strong inhibitory effect on haCPR. Similarly, tannic
acid is able to inhibit the CPR enzyme from rats and humans (Xia et al.,
2011; Yao et al., 2008) and quercetin can reduce CPR activity in human
liver microsomes (Liu et al., 2006).
Conict of interest
The authors declair there is no conict of interest.
Acknowledgments
This work was supported by grants fromthe National Basic Research
Program of China (973 program, No. 2012CB114103) and the State Key
Table 3
AROD activity of the enzymes recombinant CYP-CPR system
a
.
MROD EROD BROD
CYP9A14-haCPR 3.94 0.16 2.63 0.14 0.36 0.04
CYP1A5-haCPR 1.04 0.09 1.02 0.06 0.25 0.03
a
The alkoxyresorun O-dealkylation (AROD) activity is determined using the
reconstituted CYPCPR system by combining membrane fractions isolated from the
E. coli cells that expressed CYP9A14, CYP1A5 and CPR respectively. ARODactivities including
MROD, EROD, and BROD are expressed as nmol resorun per nmol P450 and per minute.
Values are means SE of three independent experiments with each determination in
triplicate.
Fig. 7. Inhibitory effects of chemicals on the cytochrome c reduction activity of recombinant haCPR. Each data point represents mean SE of three independent experiments with each
determination in triplicates. IC
50
(M) represents the concentration exhibiting 50% inhibition of the initial CPR activity and the 95% condence interval of IC
50
is given in bracket.
269 D. Liu et al. / Gene 545 (2014) 262270
Laboratory of Integrated Management of Pest Insects and Rodents
(Chinese IPM1201). The authors thank the reviewers for their helpful
suggestions.
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.gene.2014.04.054.
References
Andersen, J.F., Utermohlen, J.G., Feyereisen, R., 1994. Expression of housey CYP6A1 and
NADPHcytochrome P450 reductase in Escherichia coli and reconstitution of an
insecticide-metabolizing P450 system. Biochemistry 33, 21712177.
Barnes, H.J., Arlotto, M.P., Waterman, M.R., 1991. Expression and enzymatic activity of re-
combinant cytochrome P450 17 alpha-hydroxylase in Escherichia coli. Proceedings of
the National Academy of Sciences of the United States of America 88, 55975601.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of proteindye binding. Analytical Bio-
chemistry 72, 248254.
Capdevila, J., Morello, A., Perry, A.S., Agosin, M., 1973. Effect of phenobarbital and naphtha-
lene on some of the components of the electron transport systemand the hydroxylating
activity of house y microsomes. Biochemistry 12, 14451451.
Cheng, J., Wan, D.F., Gu, J.R., Gong, Y., Yang, S.L., Hao, D.C., Yang, L., 2006. Establishment of
a yeast system that stably expresses human cytochrome P450 reductase: application
for the study of drug metabolism of cytochrome P450s in vitro. Protein Expression
and Purication 47, 467476.
d'Alencon, E., Sezutsu, H., Legeai, F., Permal, E., Bernard-Samain, S., Gimenez, S., Gagneur,
C., Cousserans, F., Shimomura, M., Brun-Barale, A., 2010. Extensive synteny conserva-
tion of holocentric chromosomes in Lepidoptera despite high rates of local genome
rearrangements. Proceedings of the National Academy of Sciences of the United
States of America 107, 76807685.
Doussiere, J., Vignais, P.V., 1992. Diphenylene iodonium as an inhibitor of the NADPH ox-
idase complex of bovine neutrophils. European Journal of Biochemistry 208, 6171.
Feng, R., Houseman, J.G., Downe, A., Atkinson, J., Arnason, J., 1992. Effects of 2, 4-dihydroxy-
7-methoxy-1, 4-benzoxazin-3-one (DIMBOA) and 6-methoxybenzoxazolinone (MBOA)
on the detoxication processes in the larval midgut of the European corn borer. Pesti-
cide Biochemistry and Physiology 44, 147154.
Feyereisen, R., 2012. Insect CYP genes and P450 enzymes. In: Gilbert, L.I. (Ed.), Insect
Molecular Biology and Biochemistry. Elsevier B.V., London.
Fitt, G.P., 1989. The ecology of Heliothis species in relation to agroecosystems. Annual
Review of Entomology 34, 1753.
Guex, N., Peitsch, M.C., 1997. SWISSMODEL and the SwissPdb Viewer: an environment
for comparative protein modeling. Electrophoresis 18, 27142723.
Horike, N., Takemori, H., Nonaka, Y., Sonobe, H., Okamoto, M., 2000. Molecular cloning of
NADPHcytochrome P450 oxidoreductase from silkworm eggs. European Journal of
Biochemistry 267, 69146920.
Hubbard, P.A., Shen, A.L., Paschke, R., Kasper, C.B., Kim, J.J.P., 2001. NADPH-cytochrome
P450 oxidoreductase structural basis for hydride and electron transfer. Journal of Bi-
ological Chemistry 276, 2916329170.
Kaewpa, D., Boonsuepsakul, S., Rongnoparut, P., 2007. Functional expression of mosquito
NADPHcytochrome P450 reductase in Escherichia coli. Journal of Economic Entomol-
ogy 100, 946953.
Koener, J., Carino, F., Feyereisen, R., 1993. The cDNA and deduced protein sequence of
house y NADPHcytochrome P450 reductase. Insect Biochemistry and Molecular Bi-
ology 23, 439447.
Lamb, D.C., Warrilow, A.G.S., Venkateswarlu, K., Kelly, D.E., Kelly, S.L., 2001. Activities and
kinetic mechanisms of native and soluble NADPHcytochrome P450 reductase.
Biochemical and Biophysical Research Communications 286, 4854.
Lian, L., Widdowson, P., McLaughlin, L.A., Paine, J.I., 2011. Biochemical comparison of
Anopheles gambiae and human NADPH P450 reductases reveals different 25 ADP
and FMN binding traits. PLoS One 6 (5), e20574.
Liu, K., Kim, M., Jeon, B., Shon, J., Cha, I., Cho, K., Lee, S., Shin, J., 2006. Inhibition of human
cytochrome P450 isoforms and NADPHCYP reductase in vitro by 15 herbal
medicines, including Epimedii herba. Journal of Clinical Pharmacy and Therapeutics
31, 8391.
Louerat-Oriou, B., Perret, A., Pompon, D., 2001. Differential redox and electron-transfer
properties of puried yeast, plant and human NADPHcytochrome P-450 reductases
highly modulate cytochrome P-450 activities. European Journal of Biochemistry 258,
10401049.
Lycett, G.J., McLaughlin, L.A., Ranson, H., Hemingway, J., Kafatos, F.C., Loukeris, T.G., Paine,
M.J.I., 2006. Anopheles gambiae P450 reductase is highly expressed in oenocytes and
in vivo knockdown increases permethrin susceptibility. Insect Molecular Biology
15, 321327.
Mayer, R.T., Jermyn, J.W., Burke, M.D., 1977. Methoxyresorun as a substrate for the u-
orometric assay of insect microsomal O-dealkylase. Pesticide Biochemistry and Phys-
iology 7, 349354.
McLaughlin, L., Niazi, U., Bibby, J., David, J.P., Vontas, J., Hemingway, J., Ranson, H., Sutcliffe,
M., Paine, M., 2008. Characterization of inhibitors and substrates of Anopheles
gambiae CYP6Z2. Insect Molecular Biology 17, 125135.
Murataliev, M.B., Feyereisen, R., Walker, F.A., 2004. Electron transfer by diavin reductases.
Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1698, 126.
Omura, T., Sato, R., 1964. The carbon monoxide-binding pigment of liver microsomes. I.
Evidence for its hemoprotein nature. The Journal of Biological Chemistry 239,
23702378.
Paine, M.J.I., Ayivor, S., Munro, A., Tsan, P., Lian, L.Y., Roberts, G.C.K., Wolf, C.R., 2001. Role
of the conserved phenylalanine 181 of NADPHcytochrome P450 oxidoreductase in
FMN binding and catalytic activity. Biochemistry 40, 1343913447.
Pillai, V.C., Mehvar, R., 2011. Inhibition of NADPHcytochrome P450 reductase by tannic
acid in rat liver microsomes and primary hepatocytes: methodological artifacts and
application to ischemiareperfusion injury. Journal of Pharmaceutical Sciences 100,
34953505.
Portal, P., Villamil, S.F., Alonso, G.D., De Vas, M.G., Flawi, M.M., Torres, H.N., Paveto, C.,
2008. Multiple NADPHcytochrome P450 reductases from Trypanosoma cruzi: sug-
gested role on drug resistance. Molecular and Biochemical Parasitology 160, 4251.
Pritchard, M.P., McLaughlin, L., Friedberg, T., 2006. Establishment of Functional Human
Cytochrome P450 Monooxygenase Systems in Escherichia coli, Cytochrome P450
Protocols. Springer pp. 1929.
Riddick, D.S., Ding, X., Wolf, C.R., Porter, T.D., Pandey, A.V., Zhang, Q.-Y., Gu, J., Finn, R.D.,
Ronseaux, S., McLaughlin, L.A., 2013. NADPHcytochrome P450 oxidoreductase:
roles in physiology, pharmacology, and toxicology. Drug Metabolism and Disposition
41, 1223.
Sandstrom, P., Welch, W.H., Blomquist, G.J., Tittiger, C., 2006. Functional expression of a
bark beetle cytochrome P450 that hydroxylates myrcene to ipsdienol. Insect Bio-
chemistry and Molecular Biology 36, 835845.
Sarapusit, S., Xia, C., Misra, I., Rongnoparut, P., Kim, J.-J.P., 2008. NADPHcytochrome P450
oxidoreductase from the mosquito Anopheles minimus: kinetic studies and the inu-
ence of Leu86 and Leu219 on cofactor binding and protein stability. Archives of Bio-
chemistry and Biophysics 477, 5359.
Schonbrod, R.D., Terriere, L.C., 1971. Inhibition of housey microsomal epoxidase by the
eye pigment, xanthommatin. Pesticide Biochemistry and Physiology 1, 409417.
Shen, A.L., Porter, T.D., Wilson, T.E., Kasper, C.B., 1989. Structural analysis of the FMNbind-
ing domain of NADPHcytochrome P-450 oxidoreductase by site-directed mutagen-
esis. The Journal of Biological Chemistry 264, 75847589.
Tang, T., Zhao, C., Feng, X., Liu, X., Qiu, L., 2012. Knockdown of several components of cy-
tochrome P450 enzyme systems by RNA interference enhances the susceptibility of
Helicoverpa armigera to fenvalerate. Pest Management Science 68, 15011511.
Wang, M., Roberts, D.L., Paschke, R., Shea, T.M., Masters, B.S.S., Kim, J.J.P., 1997. Three-
dimensional structure of NADPHcytochrome P450 reductase: prototype for FMN-
and FAD-containing enzymes. Proceedings of the National Academy of Sciences of
the United States of America 94, 84118416.
Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear and angular
furanocoumarins by Papilio polyxenes CYP6B1 co-expressed with NADPHcytochrome
P450 reductase. Insect Biochemistry and Molecular Biology 33, 937947.
Wu, K., Gong, P., 1997. A new and practical articial diet for the cotton bollworm. Insect
Science 4, 277282.
Xia, C., Panda, S.P., Marohnic, C.C., Martsek, P., Masters, B.S., Kim, J.-J.P., 2011. Structural
basis for human NADPHcytochrome P450 oxidoreductase deciency. Proceedings of
the National Academy of Sciences of the United States of America 108, 1348613491.
Yang, J., An, J., Li, M., Hou, X., Qiu, X., 2013. Characterization of chicken cytochrome P450
1A4 and 1A5: inter-paralog comparisons of substrate preference and inhibitor selec-
tivity. Comparative Biochemistry and Physiology Part C 157, 337343.
Yao, H.-T., Chang, Y.-W., Lan, S.-J., Yeh, T.-K., 2008. The inhibitory effect of tannic acid on
cytochrome P450 enzymes and NADPHCYP reductase in rat and human liver micro-
somes. Food and Chemical Toxicology 46, 645653.
Zhou, X., Ma, C., Li, M., Sheng, C., Liu, H., Qiu, X., 2009. CYP9A12 and CYP9A17 in the cotton
bollworm, Helicoverpa armigera: sequence similarity, expression prole and xenobi-
otic response. Pest Management Science 66, 6573.
Zhou, X., Li, M., Sheng, C., Qiu, X., 2010. NADPHcytochrome P450 oxidoreductase from
the chicken Gallus gallus: sequence characterization, functional expression and kinet-
ic study. Comparative Biochemistry and Physiology Part C 153, 5359.
Zhu, F., Sams, S., Moural, T., Haynes, K.F., Potter, M.F., Palli, S.R., 2012. RNA interference of
NADPHcytochrome P450 reductase results in reduced insecticide resistance in the
bed bug, Cimex lectularius. PLoS One 7 (2), e31037.
270 D. Liu et al. / Gene 545 (2014) 262270