Multiexon Deletions in the Type I Collagen COL1A2 Gene in

Osteogenesis Imperfecta Type IB

MOLECULES CONTAI NI NG THE SHORTENED 2(I ) CHAI NS SHOW DI FFERENTI AL I NCORPORATI ON I NTO
THE BONE AND SKI N EXTRACELLULAR MATRI X*
(Recei ved for publ i cati on, September 22, 1995, and i n revi sed form, Apri l 9, 1996)
Stefan Mundlos, Danny Chan, Yi Ma Weng, David O. Sillence, WilliamG. Cole, and
J ohn F. Bateman
FromtheOrthopaedic Molecular Biology Research Unit, Department of Paediatrics, University of Melbourne, Royal
Childrens Hospital, Parkville, Victoria 3052, Australia, and theDepartment of Clinical Genetics, TheNew Childrens
Hospital, Paramatta, NewSouth Wales 2124, Australia
Osteogenesis imperfecta (OI) type IB is a rare subset
of the mildest form of OI, clinically characterized by
moderatebonefragility, bluesclera, anddentinogenesis
imperfecta. Cultured skin fibroblasts from two unre-
lated individuals (OI-197 and OI-165) with the typical
features of OI type IB produced shortened 2(I) chains.
Reverse transcription-polymerase chain reaction of the
2(I)-cDNA revealed deletions in the triple helical do-
main of 5 exons (exons 711) in OI-197, and 8 exons
(exons 1017) in OI-165. This exon skipping was caused
by genomic deletions in one allele of COL1A2 with the
breakpoints located in introns 6 and 11 in OI-197, and
introns 9and 17in OI-165. Thesecretion and deposition
of themutant collagen into thematrix was measured i n
vi tro inculturesof skinfibroblastsandboneosteoblasts,
grown in the presence of ascorbic acid to induce colla-
gen matrix formation and maturation, as well as in col-
lagen extracts fromskin and bone. Thesecretion of mu-
tant collagen was impaired and long term cultures of
fibroblasts showed that the mutant collagen was not
incorporated into the mature collagenous matrix pro-
duced i n vi tro by skin fibroblasts from both patients.
Likewise, theshortened 2(I) chain was not demonstra-
ble in skin extracts. In contrast, bone extracts fromOI-
197 showed the presence of the mutant collagen. This
incorporation of theabnormal collagen into themature
matrix was also demonstrated in long term cultures of
the patients osteoblasts. The deposition of the mutant
collagen by bone osteoblasts but not by skin fibroblasts
demonstratesatissuespecificity in theincorporation of
mutant collagen into the matrix which may explain the
primary involvement of bone and not skin in these
patients.
Osteogenesi s i mperfecta (OI )
1
i s a bri ttl e bone di sease that
vari es i n severi ty from peri natal l ethal to mi l d forms. I n spi te
of the cl i ni cal vari abi l i ty, mutati ons i n the genes for the pro-
1(I ) chai ns (COL1A1) and pro-2(I ) chai ns (COL1A2) of type I
col l agen have been defi ned as the basi s of the di sease i n more
than 90% of cases studi ed to date (for revi ews see Refs. 13).
The most common and mi l dest form of OI , OI type I (OI -I ), i s
characteri zed by bl ue scl eral hue, bone fragi l i ty wi th mi ni mal
deformi ti es, and autosomal domi nant i nheri tance (4). Denti no-
genesi s i mperfecta occurs i n some pati ents and thi s i s used to
subcl assi fy pati ents i nto OI -I A (no denti nogenesi s i mperfecta)
and OI -I B (denti nogenesi s i mperfecta present) (4, 5).
Bi ochemi cal l y, pati ents wi th OI -I commonl y show reduced
producti on of structural l y normal type I col l agen as a resul t of
a COL1A1 nul l al l el e caused by structural mutati ons that
prevent procol l agen assembl y (6) or more commonl y, by muta-
ti ons that i ntroduce premature stop codons, produci ng ei ther
unstabl e mRNA or the synthesi s of truncated unstabl e col l agen
(7). Structural mutati ons wi thi n the tri pl e hel i cal domai n of
type I col l agen usual l y cause more severe OI phenotypes; how-
ever, exon-ski ppi ng (7, 8) and gl yci ne substi tuti on mutati ons
(916) have been defi ned i n OI -I , but these are cl ustered to-
ward the ami no-termi nal end of the tri pl e hel i x domai n, pre-
sumabl y reduci ng thei r i mpact on hel i x propagati on and struc-
ture (10). Furthermore, i n contrast to the structural l y
abnormal col l agens, whi ch are i ncorporated i nto the extracel -
l ul ar matri x i n severe forms of OI (17, 18), the abnormal col -
l agen chai ns i n OI -I may be excl uded from matri x formati on
(12) produci ng a mi l der phenotype. Al though COL1A1 i s the
predomi nant di sease l ocus, OI -I can al so resul t from COL1A2
exon-ski ppi ng mutati ons, whi ch al so cl ustered toward the ami -
no-termi nal end of the tri pl e hel i x (1922), and i n a si ngl e
reported case, from a gl yci ne substi tuti on mutati on i n COL1A2
(23).
I t i s uncl ear whether the OI -I A and OI -I B phenotype resul ts
from di sti nct types of col l agen mutati ons. Thi s i s due, i n part,
to the pauci ty of detai l ed cl i ni cal i nformati on provi ded i n most
publ i cati ons on pati ents wi th defi ned COL1A1or COL1A2mu-
tati ons, whi ch does not al l ow cl assi fi cati on of the pati ents as
OI -I A and OI -I B wi th any degree of certai nty. However, two of
the probands wi th COL1A2 mutati ons di spl ayed denti nogene-
si s i mperfecta and coul d be cl assi fi ed as OI -I B (21, 22) and
detai l ed l i nkage anal yses by Sykes et al. (24) further suggest
* Thi s work was supported by grants from the Nati onal Heal th and
Medi cal Research Counci l of Austral i a, the Royal Chi l drens Hospi tal
Research Foundati on, and the Deutsche Forschungsgemei nschaft (to S.
M.). The costs of publ i cati on of thi s arti cl e were defrayed i n part by the
payment of page charges. Thi s arti cl e must therefore be hereby marked
advertisement i n accordance wi th 18 U.S.C. Secti on 1734 sol el y to
i ndi cate thi s fact.
Present address: Hospi tal for Si ck Chi l dren, Toronto M5G 1X8,
Canada.
To whom correspondence shoul d be addressed: Dept. of Paedi atri cs,
Uni versi ty of Mel bourne, Royal Chi l drens Hospi tal , Parkvi l l e, Vi ctori a
3052, Austral i a. Fax: 613-93456367; E-mai l : bateman@crypti c.
rch.uni mel b.edu.au.
1
The abbrevi ati ons used are: OI , osteogenesi s i mperfecta; RT-PCR,
reverse transcri pti on-pol ymerase chai n reacti on; pN-col l agen, procol l a-
gen processi ng i ntermedi ate retai ni ng the ami no-termi nal propepti de;
bp, base pai r(s); kb, ki l obase pai r(s); DMEM, Dul beccos modi fi ed Ea-
gl es medi um; TC
A
, the ami no-termi nal 3/4 fragment of fi bri l l ar col l a-
gens produced by mammal i an col l agenase di gesti on; TC
B
, the carboxyl -
termi nal 1/4 fragment of fi bri l l ar col l agens produced by mammal i an
col l agenase di gesti on.
THE JOURNAL OF BI OLOGI CAL CHEMI STRY Vol . 271, No. 35, I ssue of August 30, pp. 2106821074, 1996
1996 by The Ameri can Soci ety for Bi ochemi stry and Mol ecul ar Bi ol ogy, I nc. Printed in U.S.A.
21068
that COL1A2 mutati ons may be a major cause of OI -I B.
Whi l e the defi ni ti on of the spectrum of mutati ons causi ng OI
remai ns an i mportant goal , the major research chal l enge i s the
defi ni ti on of the mol ecul ar mechani sms by whi ch col l agen
structural mutati ons affect the compl ex organi zati on and ho-
meostasi s of the extracel l ul ar matri x. I n the present report, we
descri be the mol ecul ar defects i n two probands and one affected
parent wi th OI type I B. I n contrast to the mi l d cl i ni cal pheno-
type, they had mul ti -exon del eti ons of the COL1A2 gene. The
effects of these mutati ons on col l agen synthesi s, secreti on, and
matri x deposi ti on were studi ed usi ng ski n, bone, and l ong term
cul tures of fi brobl asts and osteobl asts. These studi es demon-
strate that ski n and bone cel l s respond di fferentl y to the pro-
ducti on of the mutant col l agens, di spl ayi ng di fferenti al i ncor-
porati on of the mutant col l agen i nto the extracel l ul ar matri x.
These di fferences i n the metabol i sm of the mutant col l agen i n
bone and ski n may account for the presence of bone fragi l i ty
and the absence of cl i ni cal abnormal i ti es of the ski n.
EXPERI MENTAL PROCEDURES
Clinical SummaryA di agnosi s of OI type I B was made for both
pati ents based on persi stence of gray-bl ue scl eral col or i n associ ati on
wi th denti nogenesi s i mperfecta and bone fragi l i ty (4).
OI -165Thi s 11-year-ol d boy wi th OI , whose bi rth l ength was on the
10th percenti l e, was di agnosed at bi rth because of l eg bowi ng. A skel -
etal survey showed heal i ng fractures i n the l eg, arm, and ri bs. He had
approxi matel y 40 fractures i ncl udi ng a mal uni on of a l eft femoral
fracture at 2 months that resul ted i n a shorteni ng wi th an 8.5-cm l eg
l ength di screpancy. Hi s scl era were moderatel y dark bl ue-gray, grade
4/8 (25). Denti nogenesi s i mperfecta was present i n pri mary teeth, al -
though hi s permanent teeth were not noti ceabl y affected. Head ci rcum-
ference was on the 98th percenti l e and hei ght l ess than the 3rd percen-
ti l e. He had marked hypermobi l i ty of di stal and mi ddl e i nterphal angeal
joi nts and moderate hypermobi l i ty of the l eft knee. Apart from the
l eg-l ength di screpancy and mi l d anteri or bowi ng of both l egs, there
were no other deformi ti es of the l ong bones. He had a mi l d postural
scol i osi s due to hi s l eg l ength di screpancy. Skel etal radi ographs showed
general i zed osteopeni a but rel ati vel y wi de corti ces at the mi d-shaft of
l ong bones (Fi g. 1a). Skul l x-rays showed mul ti pl e Wormi an bones. A
CT scan of the crani o-cervi cal juncti on showed basi l ar i mpressi on.
Whi l e nei ther parent was affected, heterozygosi ty for the mutati on i n
the proband i ndi cated that thi s was a new domi nant mutati on.
OI -197Thi s fami l y i ncl uded an affected father and daughter. The
proband was a femal e aged 13 years. Her bi rth l ength was on the 3rd
percenti l e. She had her fi rst fracture aged 13 months and subsequentl y
had more than 120 fractures. There were no known fractures of femora
or vertebrae. Her scl era were i ntensel y bl ue-gray, grade 5/8. Denti no-
genesi s i mperfecta was present i n both pri mary and permanent teeth.
Head ci rcumference was on the 98th percenti l e and hei ght l ess than the
3rd percenti l e. Her skul l showed temporal bul gi ng and occi pi tal boss-
i ng. The ri ght arm had a fi xed fl exi on deformi ty due to an ol d fracture.
There was no structural deformi ty i n the l ower l i mbs apart from ri ght
genu val gum. She had marked hypermobi l i ty of proxi mal and di stal
i nterphal angeal joi nts of the fi ngers and i n metarso-phal angeal joi nts.
Heari ng was normal . Skel etal radi ographs showed general i zed osteope-
ni a i n the l ong bones (Fi g. 1b) and spi ne wi th normal hei ght of most
vertebrae (Fi g. 1c). Skul l x-ray showed mul ti pl e Wormi an bones wi th-
out evi dence of basi l ar i mpressi on. The 51-year-ol d father had i ntensel y
bl ue-gray scl erae, arcus corneae, hei ght l ess than the 3rd percenti l e,
head ci rcumference on the 98th percenti l e, and heari ng i mpai rment.
Hi s teeth had prematurel y worn and were extracted at 15 years of age.
He had no fractures but suffered back and knee pai n associ ated wi th
osteoporosi s. X-rays of hi s spi ne and l ong bones showed mi l d osteopeni a
and wi dened di sc spaces.
Cell CultureSampl es of ski n and bone from pati ents and age-
matched control s were obtai ned duri ng routi ne surgery wi th i nformed
consent and approval of the Ethi cs Commi ttee of thi s hospi tal . Ski n
fi brobl asts were establ i shed from bi opsi es and grown as descri bed pre-
vi ousl y (26, 27). Osteobl asts cul tures (OI -197) were establ i shed from
mechani cal l y cl eaned bone chi ps. Soft ti ssues and surface cel l s were
removed by di gesti on wi th 2 mg of bacteri al col l agenase (Worthi ngton
CLS2)/ml of Hams F-12 medi um (Fl ow Laboratori es) contai ni ng 5%
(v/v) fetal cal f serum, 100 uni ts/ml peni ci l l i n, 100 g/ml streptomyci n,
for 2 h. The bone chi ps were then pl aced i n a Petri di sh wi th DMEM
contai ni ng 10% (v/v) fetal cal f serum, 100 uni ts/ml peni ci l l i n, and 100
g/ml streptomyci n. Osteobl asts that grew out from the bone chi ps were
subcul tured and grown i n DMEM contai ni ng 10% (v/v) fetal cal f serum.
The phenotype of the osteobl asts was veri fi ed by measurement of al ka-
l i ne phosphatase acti vi ty.
Collagen Biosynthetic LabelingAfter cul ture for 3 days i n DMEM
contai ni ng 10% (v/v) fetal cal f serum and 0.25 mM ascorbate (Si gma),
confl uent cel l s were l abel ed wi th 10 Ci /ml L-[2,3-
3
H]prol i ne (44.5 Ci /
mmol , DuPont NEN) for 18 h i n DMEM contai ni ng 10% (v/v) di al yzed
fetal cal f serum (26, 27). The cel l and medi um fracti ons were harvested
separatel y, and procol l agens were preci pi tated wi th (NH
4
)
2
SO
4
at 25%
saturati on and converted to col l agen by l i mi ted pepsi n di gesti on before
el ectrophoresi s (26, 27). I n some experi ments the 0.25 mM sodi um
ascorbate i n the l abel i ng medi um was repl aced wi th 0.1 mM ,-
di pyri dyl to prevent the post-transl ati onal hydroxyl ati on of the procol -
l agens. The cel l fracti on was col l ected, and the unhydroxyl ated procol -
l agen was anal yzed by el ectrophoresi s after preci pi tati on wi th
(NH
4
)
2
SO
4
at 25% saturati on.
I n Vitro Matrix AnalysisMatri x deposi ti on was i nduced by ascor-
bate i n l ong term cul ture of fi brobl asts and osteobl asts (18, 28). From
confl uence, the osteobl asts were grown for another 14 days, and fi bro-
bl asts for another 21 days, i n DMEM medi um contai ni ng 10%(v/v) fetal
cal f serum and 0.25 mM ascorbi c aci d. The medi um was then repl aced
wi th 10 ml of DMEM medi um contai ni ng 10% (v/v) di al yzed fetal cal f
serum, 0.25 mM sodi um ascorbi c aci d, and 10 Ci /ml L-[2,3-
3
H]prol i ne.
Fol l owi ng i ncubati on for 18 h, the medi um was col l ected and anal yzed.
The cel l matri x was seri al l y extracted at 4 C wi th a neutral sal t buffer
(50 mM Tri s/HCl , pH 7.5 contai ni ng 0.15 M NaCl , 5 mM EDTA, 0.1 mM
phenyl methyl sul fonyl fl uori de, and 10 mM N-ethyl mal ei mi de) to extract
newl y synthesi zed col l agens, 0.5 M aceti c aci d to extract col l agens wi th
aci d l abi l e cross-l i nks, and l i mi ted pepsi n di gesti on (0.1 mg/ml pepsi n i n
0.5 M aceti c aci d) to extract mature cross-l i nked col l agens. The extracts
were col l ected by centri fugati on, and porti ons of the neutral sal t buffer
and 0.5 M aceti c aci d extracts were subjected to l i mi ted pepsi n di gesti on
before el ectrophoresi s.
I n Vivo Matrix AnalysisCl eaned trabecul ar bone fragments were
decal ci fi ed wi th 50 mM Tri s/HCl , 0.2 M EDTA, pH 7.5, for 5 days at 4 C
and washed wi th col d dei oni zed water. The epi dermi s and fat ti ssues
were mechani cal l y removed from ski n bi opsi es, and both the decal ci fi ed
bone fragments and ski n were then extracted for 18 h wi th col d chl o-
roform:methanol (2:1) to remove any resi dual fat, and then dri ed under
vacuum and wei ghed. The ti ssues were rehydrated i n neutral sal t
buffer, freeze-mi l l ed, and extracted to remove the non-col l agenous pro-
tei ns. The pel l ets were extracted wi th 0.5 M aceti c aci d and subjected to
l i mi ted pepsi n di gesti on at an enzyme substrate rati o of 1:10 (27). The
pepsi n-sol ubi l i zed col l agens were l yophi l i zed and anal yzed by
el ectrophoresi s.
SDS-Polyacrylamide Gel ElectrophoresisCol l agen chai ns were re-
sol ved on a 5% (w/v) pol yacryl ami de separati ng gel contai ni ng 2 M urea
and a 3.5% (w/v) stacki ng gel . The sampl e preparati on, el ectrophoresi s
condi ti ons, Coomassi e Bri l l i ant Bl ue stai ni ng, and fl uorography of ra-
FI G. 1. Skeletal radiographs. a, OI -165, ri ght femur at 7 years. b,
OI -197, ri ght femur at 14 months. c, OI -197 l ateral l umbar spi ne at 18
years.
COL1A2 Multiexon Deletions in Osteogenesis I mperfecta 21069
di oacti ve gel s are descri bed el sewhere (26, 27). Coomassi e-stai ned col -
l agen bands were quanti fi ed by densi tometry (Bi o-Rad GS-670 densi -
tometer) by compari son to standard col l agen sampl es l oaded on to each
gel . The radi oacti vi ty i n each col l agen band was determi ned by exci si on
and sci nti l l ati on counti ng (29).
RT-PCR and cDNA SequencingTotal cytopl asmi c RNA was puri -
fi ed from ski n fi brobl ast cul tures (30), and fi rst-strand cDNA was
synthesi zed usi ng a RT-PCR ki t (Perki n-El mer) usi ng an 2(I ) speci fi c
pri mer COL1 (Tabl e I ). cDNA correspondi ng to exons 630 of the
COL1A2 gene was ampl i fi ed wi th COL23 and COL1 pri mers (Tabl e I ).
The PCR products were puri fi ed by el ectrophoresi s on a 0.8% (w/v)
agarose gel and recovered by el ectroel uti on, phosphoryl ated wi th T4
pol ynucl eoti de ki nase and cl oned i nto the SmaI si te of M13mp18 vector
(Amersham Corp.). Si ngl e-stranded DNA preparati ons from the i ndi -
vi dual cl ones were sequenced usi ng a Sequenase ki t (U. S. Bi ochemi cal
Corp.) (31).
Southern Blot AnalysisGenomi c DNA was prepared from confl uent
ski n fi brobl asts (32) establ i shed from OI -165 and OI -197, and from
unrel ated heal thy i ndi vi dual s as control s. Whol e bl ood genomi c DNA
was al so prepared from the father of OI -197 (33). A 1341-bp PstI /NcoI
fragment encompassi ng exons 930 of the COL1A2 gene was i sol ated
from a cDNA cl one (34) and used as a probe for Southern bl ot anal ysi s.
Approxi matel y 30 ng of the probe was l abel ed wi th [
32
P]dCTP (3000
Ci /mmol , Amersham Corp.) to hi gh speci fi c acti vi ty usi ng a random
pri mer l abel i ng ki t (Boehri nger Mannhei m). EcoRI -di gested fragments
of genomi c DNA were separated on a 0.8% (w/v) agarose gel and trans-
ferred onto a nyl on Hybond N membrane (Amersham Corp.). Hybri d-
i zati on was carri ed out usi ng standard procedures at 42 C i n the
presence of 50% (v/v) formami de. The fi l ters were washed under stri n-
gent condi ti ons at 50 C wi th 0.1 SSC (sal i ne sodi um ci trate) and
exposed to Kodak XAR-5 fi l ms at 70 C wi th an i ntensi fyi ng screen.
Amplification and Sequencing of Genomic DNAThe sequence and
l ocati on of pri mers used for genomi c PCR are l i sted i n Tabl e I . To obtai n
normal i ntroni c sequences, 0.1 g of control DNA was ampl i fi ed wi th
pri mers COL32/ COL38 for i ntron 9 and i ntron 10, COL31/ COL35 for
i ntron 11, COL34/ COL39 for i ntron 17, and COL45/ COL43 for down-
stream sequence of i ntron 6. To i denti fy the breakpoi nts of the del eti on
i n OI -165 and OI -197, pri mers l ocated i n exons 9 and 18 (COL32/
COL39) and i n exons 6 and 12 (COL23/ COL31), respecti vel y, were used
for PCR ampl i fi cati on. Ampl i fi cati ons were carri ed out i n the presence
of 1 uni t of Taq extender (Stratagene) per uni t of Taq pol ymerase
(Boehri nger Mannhei m), and wi th extensi on ti mes of 1 mi n/kb of ex-
pected ampl i fi cati on product. The products were puri fi ed by centri fu-
gati on i n Centri con 100 col umns (Ami con). Approxi matel y 33 ng/kb of
the puri fi ed products were used for di rect sequenci ng usi ng a cycl e-
sequenci ng ki t (U. S. Bi ochemi cal Corp.)
RESULTS
Collagen AnalysisThe pepsi n-resi stant col l agen produced
by short term cul ture of OI -165 and OI -197 fi brobl asts con-
tai ned normal 1(I ) and 2(I ) chai ns as wel l as abnormal ,
faster mi grati ng 1(I ) and 2(I ) bands. They were desi gnated
1(I )* and 2(I )* i n OI -197 (Fi g. 2a, lanes 2 and 5) and 1(I )**
and 2(I )** i n OI -165 (Fi g. 2a, lanes 1 and 4). Mutant and
normal col l agen secreti on was determi ned by the quanti tati on
of the di stri buti on of radi oacti vi ty i n the pepsi n-resi stant nor-
mal and mutant 2(I ) chai ns i n the cel l l ayer and medi um
fracti on after the 18-h l abel i ng peri od. I n OI -165 fi brobl asts,
13% of the radi ol abel ed mutant 2(I )** chai ns and 95% of the
normal 2(I ) chai n were secreted from the cel l l ayer i nto the
medi um. I n OI -197 the percentages were 71% and 89%, respec-
ti vel y. The secreti on of the normal chai ns di d not di ffer si gni f-
i cantl y from the control val ues of 92 3% (n 10).
To establ i sh the ori gi n of the faster mi grati ng col l agen
chai ns, i ntact unhydroxyl ated procol l agens were produced by
i ncubati on of OI -165 and OI -197 fi brobl asts wi th ,-di pyri -
dyl . Thi s unhydroxyl ated procol l agen i s retai ned wi thi n the cel l
i n an unprocessed pro--chai n form, al l owi ng a cl earer i nter-
pretati on of el ectrophoreti c gel s wi thout the compl exi ti es i ntro-
duced by the presence of procol l agen processi ng i ntermedi ates.
El ectrophoreti c anal yses showed normal and shortened forms
of the unhydroxyl ated pro-2(I ) chai ns i n OI -165 and OI -197,
but onl y normal unhydroxyl ated pro-1(I ) chai ns (Fi g. 2a, lanes
7 and 8). The rati o of the normal and mutant unhydroxyl ated
pro-2(I ) chai ns were approxi matel y 1:1 for OI -165 and 1:3 for
OI -197. The rati os of the unhydroxyl ated pro-1(I ) chai ns to
the combi ned unhydroxyl ated normal and shortened forms of
the pro-2(I ) chai ns were 2.46 i n OI -165 and 2.65 i n OI -197.
These val ues were si mi l ar to the control rati o of 2.38. From
these resul ts we concl uded that each proband was heterozy-
gous for a mutati on of COL1A2 that yi el ded a shortened 2(I )
chai n. We al so concl uded that the shortened 1(I ) chai ns ob-
served fol l owi ng pepsi n di gesti on were due to abnormal cl eav-
age of the normal pro-1(I ) chai ns resul ti ng from the presence
of shortened pro-2(I ) chai ns i n col l agen heterotri mers.
I n each proband, cl eavage of pepsi n-di gested col l agens wi th
fi brobl ast col l agenase yi el ded two forms of the NH
2
-termi nal
TC
A
and one form of the carboxyl -termi nal TC
B
fragment of
2(I ) chai ns (Fi g. 2b, lanes 2 and 3). Thi s observati on l ocal i zed
the pepti de del eti on to the NH
2
-termi nal three-quarter frag-
ment of the tri pl e-hel i cal domai n of the mutant 2(I ) chai ns
(see Fi g. 3). The del eti ons were esti mated to be approxi matel y
15 kDa for OI -165 and 10 kDa for OI -197 by semi -l og pl ot
anal ysi s usi ng 2(I ) col l agen chai ns and CNBr-cl eavage pep-
ti des as mol ecul ar wei ght standards.
Characterization of theCOL1A2 MutationsCNBr cl eavage
of the pepsi n-di gested col l agen (see Fi g. 3 for 2(I ) pepti de
FI G. 2. Electrophoresis of collagens produced fromskin fibro-
blasts in culture. a, fi brobl asts were l abel ed wi th [
3
H]prol i ne i n the
presence of ascorbi c aci d (see Experi mental Procedures for detai l s).
The col l agens i n the cel l l ayer (lanes 13) and secreted i nto the medi um
(lanes 46) were di gested wi th pepsi n and anal yzed on a 5% (w/v)
pol yacryl ami de gel s unreduced. Unhydroxyl ated procol l agens were al so
produced from fi brobl ast cul tures i n the presence of ,-di pyri dyl , and
the procol l agens i n the cel l l ayer were anal yzed after reducti on wi th 10
mM di thi othrei tol (lanes 79). Shortened forms of the type I col l agen
chai ns were desi gnated as 1(I )* and 2(I )* for OI -197 and 1(I )** and
2(I )** for OI -165. b, pepsi n-di gested col l agens from the medi um frac-
ti ons were al so subjected to fi brobl ast col l agenase di gesti on, and the
resul tant TC
A
and TC
B
fragments were anal yzed on a 7.5% (w/v) pol y-
acryl ami de gel s.
TABLE I
Primers used for PCR amplification of 2(I ) cDNA and COLI A2
genomic DNA
Pri mer sequences were sel ected based on publ i shed cDNA sequence
of the pro-2(I ) chai n (35) (COL143), or determi ned by genomi c se-
quenci ng (COL45).
Pri mer Sequence (5 to 3) Posi ti on Ori entati on
COL1 GGAGACCAAACTCACCA Exon 30 Anti sense
COL23 TGCTGCTCAGTATGATGG Exon 6 Sense
COL31 CTTCAATCCATCCAGACC Exon 12 Anti sense
COL32 CTGGCAAGGCTGGTGAAG Exon 9 Sense
COL34 TAACGCTGGTCCTACTGG Exon 17 Sense
COL35 GGTGCTCGTGGTTTCCCT Exon 11 Sense
COL38 CTAATGCCTTTGAAGCCAG Exon 11 Anti sense
COL39 GTAAGGCCGTTTGCTCCAG Exon 18 Anti sense
COL43 CCTCTAGGTCCCATTAAG Exon 7 Anti sense
COL45 gaagataggcagcaataaag I ntron 6 Sense
COL1A2 Multiexon Deletions in Osteogenesis I mperfecta 21070
l ocati ons) generated onl y normal l y mi grati ng 2(I )CB3.5 pep-
ti des and reduced amounts of the 2(I )CB4 pepti de i n both
pati ents (data not shown), further demonstrati ng that the de-
l eti ons were most l i kel y to be ami no-termi nal to the 2(I )
CB3.5 pepti de, and therefore wi thi n the ami no-termi nal 300
ami no aci ds of the 2(I ) hel i cal domai n. The correspondi ng
regi on of cDNA was ampl i fi ed wi th COL1and COL23(Tabl e I ).
I n addi ti on to the expected 1513-bp fragment, whi ch was the
onl y fragment ampl i fi ed from control (Fi g. 3, lane2), shortened
products of 1252 and 1055 bp were observed for OI -197 (Fi g. 3,
lane3) and OI -165 (Fi g. 3, lane4), respecti vel y. Sequenci ng of
these shortened fragments showed tri pl e-hel i cal i n-frame del e-
ti ons of exons 1017 i n OI -165 and of exons 711 i n OI -197
(Fi g. 4). Fi ve cl ones of each of the PCR products were se-
quenced, and no PCR errors were detected.
To i denti fy the l ocati on of the mul ti -exon del eti ons, a South-
ern bl ot anal ysi s was performed on genomi c DNA. Hybri di za-
ti on of EcoRI -di gested DNA to a cDNA probe speci fi c for thi s
regi on of the COL1A2gene showed the expected 5.5- and 14-kb
fragments from control s. Wi thi n the 14-kb fragment, there i s a
pol ymorphi c EcoRI si te (35) resul ti ng i n cl eavage of thi s frag-
ment i nto 10.5- and 3.5-kb fragments. The proband and the
affected father of OI -197 were (/) for the EcoRI pol ymor-
phi sm. An addi ti onal fragment of approxi matel y 11 kb was
evi dent i n OI -197 and her affected father, whereas an addi -
ti onal 8-kb band was observed i n OI -165 (Fi g. 5). These fi nd-
i ngs i ndi cated genomi c del eti ons of approxi matel y 3 and 6 kb
wi thi n the 14-kb EcoRI fragment of OI -197 and OI -165, respec-
ti vel y. OI -165 was (del /) for the EcoRI pol ymorphi sm si nce
the del eti on encompasses the regi on of the pol ymorphi c EcoRI
si te wi thi n the mutant al l el e. Whi l e the affected father of
OI -197 showed a mi l der phenotype, he i s unl i kel y to be a
mosai c for the mutati on si nce the mutant and normal bands
are of equal i ntensi ty i n both the father and the proband
(Fi g. 5).
Genomic Deletion BreakpointsThe del eti on breakpoi nts
were i denti fi ed usi ng genomi c PCR wi th pri mers posi ti oned i n
adjacent exons (Tabl e I ). The pri mer sets sel ected for genomi c
PCR woul d not have ampl i fi ed any fragments from control s as
the expected products were too l arge for the PCR protocol used.
However, a 2.7-kb product was obtai ned usi ng pri mer set
COL23/ COL31 from OI -197 and her affected father (Fi g. 6b)
and a 0.27-kb product was obtai ned usi ng pri mer set COL32/
COL39 from OI -165 (Fi g. 6a). Sequenci ng of the 0.27-kb frag-
ment from OI -165 showed the del eti on breakpoi nts to be i n
i ntrons 9 and 17 (Fi g. 6a). Sequenci ng from both the upstream
and downstream ends of the 2.7-kb product from OI -197
showed sequences from i ntron 6 and i ntron 11, respecti vel y
(36). The del eti on breakpoi nt i n i ntron 6 was approxi matel y
2250 bp from i ts upstream end and approxi matel y 1150 bp from
FI G. 3. Electrophoresis of RT-PCR products amplified from
fibroblast mRNA. cDNA was ampl i fi ed for 35 cycl es of the PCR usi ng
pri mers COL1 and COL23 as descri bed under Experi mental Proce-
dures. The l ocati on of the pri mers rel ati ve to the pro-2(I ) chai n and
the CNBr pepti des i s shown di agrammati cal l y. Al i quots of the reacti on
mi xture were resol ved by el ectrophoresi s on a 0.8% (w/v) agarose gel
and stai ned wi th ethi di um bromi de. The si zes of the ampl i fi ed products
was determi ned i n retrospect from the publ i shed sequence (35) and are
i ndi cated. Lane 1, HaeI I I -di gested X174 mol ecul ar wei ght markers;
lane2, control ; lane3, OI -197; lane4, OI -165.
FI G. 4. Amino acid sequence deduced from cDNA sequencing
of the RT-PCR products. The i n-frame mul ti -exon del eti on of the
COL1A2gene from the probands are shown i n rel ati on to the nucl eoti de
and the ami no aci d sequence of the pro-2(I ) chai n.
FI G. 5. Southern blot analysis.
EcoRI -di gested genomi c DNA were re-
sol ved on a 0.8% (w/v) agarose gel , trans-
ferred onto a nyl on Hybond N mem-
brane, and hybri di zed to an 2(I ) cDNA
probe (see Experi mental Procedures for
detai l s). wt (/) represents the wi l d type
DNA homozygous for an EcoRI pol ymor-
phi c si te wi thi n the 14-kb fragment. wt
(/) represents the homozygous wi l d
type DNA, whi ch l acks the EcoRI pol y-
morphi c si te. The posi ti on of the EcoRI
fragments, the pol ymorphi c EcoRI si te
(arrow E) and the genomi c del eti ons i n
the probands rel ati ve to the exon/i ntron
organi zati on of the COL1A2 gene are
shown. The COL1A2exons that hybri di ze
to the l abel ed cDNA probe are i ndi cated.
COL1A2 Multiexon Deletions in Osteogenesis I mperfecta 21071
i ts downstream end. The del eti on breakpoi nt i n i ntron 11 was
63 bp from i ts upstream end and 458 bp from i ts downstream
end (Fi g. 6b). The breakpoi nts for both OI -165 and OI -197 were
determi ned preci sel y by compari son wi th normal ampl i fi ed
i ntron sequences usi ng pri mers detai l ed under Experi mental
Procedures. The l ocati on of al l the pri mers used i n genomi c
PCRs al so shown i n Fi g. 6. The pri mer upstream to the break-
poi nt i n i ntron 6 (pri mer 45) was desi gned based on sequence
obtai ned from the mutant al l el e of OI -197 PCR-ampl i fi ed wi th
pri mers COL23 and COL31.
Deposition of theMutant Collagen intotheMatrixFormed in
Vitro and in Vivo The deposi ti on of an ascorbate-i nduced
col l agenous matri x was studi ed i n fi brobl asts (OI -165 and OI -
197) and osteobl asts (OI -197) cul tured for 21 and 14 days,
respecti vel y (Fi g. 7) by seri al extracti on wi th neutral pH i so-
toni c buffer (newl y synthesi zed procol l agens and col l agens),
aceti c aci d (newl y cross-l i nked col l agens) and pepsi n (i nsol ubl e
mature cross-l i nked col l agens). The compl ete extracti on of the
l abel ed col l agens from the in vitro matri ces was confi rmed by
sci nti l l ati on counti ng of the aci d hydrol yzed pepsi n resi dues.
The col l agenous matri ces of ski n and bone were al so studi ed.
Col l agen deposi ti on by OI -197 osteobl asts after 14 days of
cul ture was reduced to approxi matel y 30% of the control i n
three separate experi ments. The col l agen content of extracts of
OI -197 bone was al so reduced to approxi matel y 35% of control .
OI -197 osteobl asts synthesi zed mutant 2(I )* chai ns. The se-
creti on of mutant col l agen was i mpai red (comparabl e to that
demonstrated for OI -197 ski n fi brobl asts) as there was a
greater proporti on of mutant chai ns i n the neutral sal t extract,
whi ch contai ned mai nl y i ntracel l ul ar col l agen, than i n the me-
di um. However, a si gni fi cant proporti on of the mutant col l agen
was deposi ted i nto the osteobl ast-produced extracel l ul ar ma-
tri x in vitro (Fi g. 7a), demonstrated by the presence of the
mutant 2(I )* chai n i n the col l agen extracted wi th 0.5 M aceti c
aci d and, to a l esser extent, i n the pepsi n extract. Thi s resul t
was al so consi stent wi th anal ysi s of OI -197 bone, whi ch dem-
onstrated the presence of mutant mol ecul es i n pepsi n extracts
of the mature bone matri x (Fi g. 7a).
I n contrast, mutant 2(I ) chai ns were not detected i n the
matri x of l ong term (21 days) ski n fi brobl ast cul tures from
OI -197 and OI -165 (Fi g. 7b). Thi s fi ndi ng was consi stent i n
three separate experi ments. The mutant 2(I ) chai ns were
produced by the fi brobl asts but were l argel y restri cted to the
neutral sal t extracts. I n OI -165 fi brobl asts, the l abel ed mutant
chai ns were poorl y secreted wi th onl y a trace amounts of the
mutant mol ecul es i n the medi um fracti on, whi l e more si gni fi -
cant proporti on of the mutant mol ecul es were secreted from
OI -197 fi brobl asts (Fi g. 7b). These fi ndi ngs were agai n consi st-
ent wi th the in vivoanal ysi s of the col l agen extracted from ski n
for OI -165 and OI -197, whi ch showed a normal col l agen com-
posi ti on wi th no detectabl e mutant 2(I )* (OI -197) or 2(I )**
(OI -165) chai ns. As expected, the fi brobl asts from both pati ents
produced a matri x in vitro wi th a reduced col l agen content
(esti mated from three separate experi ments to be approxi -
matel y about 45% for OI -197 and 29% for OI -165 of that pro-
duced by control cel l s) consi stent wi th the reduced col l agen
content of ski n extracts.
DI SCUSSI ON
The two OI type I B pati ents were shown to be heterozygous
for l arge mul ti -exon del eti ons i n the COL1A2gene for the 2(I )
FI G. 6. Genomic breakpoints. Genomi c DNA fragments from both
probands were ampl i fi ed usi ng pri mers descri bed under Experi mental
Procedures. The resul tant PCR products were cl oned and sequenced.
The exact nucl eoti de breakpoi nts for OI -165 (a) and OI -197 (b) are
shown rel ati ve the exon/i ntron organi zati on of the COL1A2 gene. The
numbers above the vertical bars (exons) represent the exon numbers.
The arrows and the corresponding numbers represent the rel ati ve l o-
cati on and ori entati on of the pri mers used for genomi c PCR of both
normal and mutant sequences. Al l the pri mers are wi thi n the exons
i ndi cated wi th the excepti on of COL45, whi ch i s a pri mer i n i ntron 6.
FI G. 7. Electrophoretic analysis of i n vi tro and i n vi vo collag-
enous-matrix fromskin and bone. An in vitro matri x was i nduced
by usi ng l ong term cul ture of osteobl asts (a) and ski n fi brobl asts (b),
wi th ascorbate. The cul tures were l abel ed for 18 h wi th [
3
H]prol i ne, and
the radi ol abel ed col l agens deposi ted i nto the in vitro matri ces were
sequenti al l y extracted wi th 50 mM Tri s/HCl , pH 7.5, contai ni ng 150 mM
NaCl , 5 mM EDTA, 5 mM phenyl methyl sul fonyl fl uori de, and 10 mM
N-ethyl mal ei mi de (NS), 0.5 M aceti c aci d (HAC), and l i mi ted pepsi n-
di gesti on (pepsi n) as descri bed under Experi mental Procedures.
These extracts, together wi th the medi um fracti on (med), were quanti -
tati vel y l oaded and anal yzed on 5% (v/v) pol yacryl ami de gel s. The
col l agens extracted from the bone matri x (OI -197), and ski n matri x
(OI -165 and OI -197) were al so anal yzed fol l owi ng l i mi ted pepsi n di ges-
ti on. These sampl es were not l oaded quanti tati vel y, but i nstead l oadi ng
vol umes were adjusted to obtai n si mi l ar col l agen concentrati ons. The
shortened forms of the 1(I )* and the 2(I )* (OI -197) are i ndi cated by
small and large arrows, respecti vel y, and 1(I )** and the 2(I )** (OI -
165) are i ndi cated. The sampl es were anal yzed under non-reduci ng
condi ti ons. The mi grati ons of 1(I ), 2(I ) chai ns and cross-l i nked
-chai n di mers (-components), type I I I col l agen tri mers (1(I I I ))
3
, and
type V col l agen 1(V) and 2(V) chai ns are shown.
COL1A2 Multiexon Deletions in Osteogenesis I mperfecta 21072
chai n of type I col l agen. I n one pati ent (OI -197) the genomi c
del eti on of 3 kb encompassed exons 711, and i n the other
pati ent (OI -165) the 6-kb del eti on removed exons 1017. Both
del eti ons yi el ded i ntron juncti ons that di d not al ter the spl i ce
donor and acceptor si tes. The 5 and 3 exons were spl i ced
normal l y, mai ntai ni ng the transl ati onal readi ng frame and the
repeti ti ve Gl y-X-Y tri pl et sequence. The del eti ons removed
ami no aci ds 145-296
2
and 94200 from the tri pl e hel i cal do-
mai n of OI -165 and OI -195, respecti vel y.
Large del eti ons of the type I col l agen genes are i nfrequent i n
OI , and the majori ty of mutati ons are poi nt mutati ons, whi ch
resul t i n hel i x-destabi l i zi ng gl yci ne substi tuti ons, si ngl e exon-
ski ppi ng mutati ons, premature stop codons; and frameshi ft
mutati ons, whi ch produced shortened or el ongated dysfunc-
ti onal col l agens (1, 3, 14). There are two previ ousl y descri bed
l arge del eti ons, both of whi ch l ead to OI type I I (peri natal
l ethal ). I n one of them, a del eti on i n COL1A1extends from exon
23 to exon 25 (84 ami no aci ds) (3739); i n the other, the del e-
ti on i n COL1A2 extends from exon 34 to exon 40 (40). I n these
cases i t was suggested that the del eti ons were produced by
nonhomol ogous recombi nati on. I n the two pati ents descri bed
here, anal ysi s of the sequences around the i ntron del eti on
breakpoi nts di d not demonstrate the present of i nverted se-
quences or di rect repeats and there was no si gni fi cant homol -
ogy between the 5 and 3 del eti on juncti ons. Furthermore, i t
was unl i kel y that Alu repeti ti ve el ements were i nvol ved i n the
del eti on, si nce the Alu repeat el ements of COL1A2 (41) are
l ocated wel l away from ei ther of the del eti on juncti ons. Thus, i t
i s most l i kel y that the del eti ons al so arose through nonhomol o-
gous i ntron-medi ated recombi nati on.
The del eti ons produced pro-2(I ) chai ns wi th l arge i nternal
hel i cal del eti ons, and the type I col l agen mol ecul es contai ni ng
these shortened chai ns were secreted poorl y. I t shoul d be noted
that the cal cul ati on of secreti on was based on the di stri buti on
of pepsi n-stabl e col l agens, and therefore di d not take i nto ac-
count i ntracel l ul ar mutant col l agen degradati on or any al tered
pepsi n stabi l i ty of mutant 2(I ) chai n-contai ni ng col l agen tri -
mers. However, the presence of shortened 1(I ) chai ns fol l ow-
i ng pepsi n di gesti on, and the rel ati vel y constant rati o of total
1(I ):2(I ) i n combi ned cel l and medi um pool s (1.98 for OI -165;
2.12 for OI -197; 2.12 for control s) suggests that the col l agen
tri pl e hel i x carboxyl -termi nal to the mutati on i s l argel y pepsi n
resi stant. I ncreased pepsi n sensi ti vi ty, i f present, woul d prob-
abl y be most evi dent i n i ntracel l ul ar mutant col l agens under-
goi ng assembl y and hel i x fol di ng, and resul t i n dramati cal l y
reduced i ntracel l ul ar col l agen l evel s after pepsi n di gesti on.
Both thi s and i ntracel l ul ar degradati on of mutant-contai ni ng
col l agen mol ecul es woul d resul t i n an arti fi ci al overesti mate of
mutant col l agen secreti on effi ci ency. These arguments suggest
that the reduced col l agen secreti on measured i n our experi -
ments i s probabl y an underesti mate of the extent of the mutant
col l agen secreti on defect.
The retarded secreti on of structural l y abnormal type I col l a-
gen i s a common fi ndi ng i n OI and represents an i mportant
i ntracel l ul ar qual i ty control mechani sm (26, 42). The reten-
ti on of the mutant-contai ni ng col l agen tri mers wi thi n the cel l s
resul ts i n i ncreased i ntracel l ul ar breakdown, vi a endopl asmi c
reti cul um-medi ated and l ysosomal degradati ve pathways (43),
resul ti ng i n reduced col l agen i n the extracel l ul ar matri x. Thi s
defi ci ency was refl ected i n the marked reducti on i n the col l ag-
enous matri x deposi ted by fi brobl asts (OI -165 and OI -197) and
osteobl asts (OI -197) grown i n l ong term cul tures i n the pres-
ence of ascorbi c aci d. Thi s col l agen defi ci ency was confi rmed i n
the ski n and bone from OI -197 and ski n from OI -165.
I n OI -165, seri al extracti on of the in vitro extracel l ul ar col -
l agen matri x formed by dermal fi brobl asts wi th aceti c aci d and
then pepsi n to extract the progressi vel y more cross-l i nked col -
l agen, demonstrated that the mutant col l agen was excl uded
from the mature in vitro matri x. Pepsi n extracts of ski n ti ssue
sampl es confi rmed the absence of the mutant col l agen. Excl u-
si on of col l agen contai ni ng mutant pro-1(I ) chai ns from a
dermal fi brobl ast matri x formed in vitro i n the presence of
dextran sul fate has been previ ousl y reported (12). Unfortu-
natel y bone sampl es or osteobl ast cul tures were not avai l abl e
from OI -165, and we were unabl e to determi ne whether thi s
mutati on was i ncl uded or excl uded from the bone matri x.
For OI -197 ski n fi brobl asts, bone cel l s and ti ssue sampl es
were avai l abl e, enabl i ng us to compare the behavi or of the
mutant col l agen i n these ti ssues. The resul ts confi rm that the
mutant pro-2(I ) chai ns are expressed by both fi brobl ast and
osteobl ast cul tures (44). Studi es compari ng matri x formati on
in vitroi n l ong term fi brobl ast and osteobl ast cul tures provi ded
some i nteresti ng fi ndi ngs. Col l agen deposi ti on i nto the matri x
was dramati cal l y reduced i n both fi brobl ast and osteobl ast
matri ces, consi stent wi th the ti ssue col l agen defi ci enci es and
wi th previ ous in vitro experi ments demonstrati ng the reduced
col l agen deposi ti on by OI fi brobl asts (18). A reducti on i n col l a-
gen producti on has al so been demonstrated for OI osteobl asts
(45), but i n these studi es matri x deposi ti on was not assessed.
However, whi l e seri al extracti on demonstrated that the mu-
tant col l agen was excl uded from the mature in vitroand in vivo
ski n matri x, when bone cel l cul ture and bone ti ssues were
exami ned a total l y di fferent pattern emerged. I n extracts of the
osteobl ast in vitro matri x, the mutant col l agen was i ncorpo-
rated i nto the mature cross-l i nked col l agenous matri x. The
presence of the mutant col l agen i n pepsi n extracts of mature
bone ti ssue di rectl y demonstrated that not onl y i s the mutant
i ncorporated i nto the matri x, but the mutant col l agen i s not
degraded and remai ns a stabl e component of the mature
matri x.
The mechani sm of how bone and ski n matri ces di scri mi nate
and di fferenti al l y i ncorporate the OI -197 mutant col l agen i s
not known. I t i s becomi ng i ncreasi ngl y cl ear that col l agen
fi bri l l ogenesi s and maturati on i s a compl ex mul ti step process
i nvol vi ng heterotypi c col l agen associ ati ons and i nteracti ons
wi th other matri x components such as decori n and fi bromodu-
l i n (46, 47). Whi l e the predomi nant col l agen of both ski n and
bone i s type I col l agen, there are many di fferences i n the
composi ti on of other matri x components between these ti ssues,
i ncl udi ng the abi l i ty to mi neral i ze, whi ch may i nfl uence the
pattern of col l agen deposi ti on and maturati on. Several detai l ed
structural studi es have determi ned that the packi ng of col l agen
i nto fi bri l s, and the resul ti ng mol ecul ar arrangement of adja-
cent col l agen mol ecul es, i s di fferent i n bone to that i n soft
ti ssues such as ski n and tendon (48, 49). Thi s al ternate packi ng
i s most noti ceabl y refl ected i n the di fferent patterns of i nter-
mol ecul ar cross-l i nks i n soft and hard ti ssues (50, 51). The
i ncl usi on of the mutant col l agen i n the bone, but not ski n
matri x, may refl ect thi s di fference i n packi ng, suggesti ng that
the mol ecul ar arrangement i n bone may be more permi ssi ve for
the i ncorporati on of the mutant mol ecul es.
Previ ous studi es have demonstrated that some col l agen hel -
i cal mutati ons have a l ong range effect on procol l agen structure
at the N-protei nase cl eavage si te (52). The resul ti ng al tered
conformati on of thi s cl eavage si te reduces procol l agen process-
i ng and resul ts i n an accumul ati on of pN-col l agen. The reten-
ti on of the type I procol l agen N-propepti de on a proporti on of
the mutant col l agen mol ecul es in vivo woul d present a steri c
barri er to correct fi bri l l ogenesi s anal ogous to that seen i n
2
Ami no aci ds are numbered from the NH
2
-termi nal end of the col l a-
gen tri pl e hel i x, and nucl eoti des numbered from the transcri pti on start
si te (35).
COL1A2 Multiexon Deletions in Osteogenesis I mperfecta 21073
Ehl ers-Danl os syndrome type VI I (53, 54). I n these Ehl ers-
Danl os syndrome pati ents, cl eavage si te mutati ons or N-pro-
tei nase defi ci ency resul t i n the processi ng defect, whi ch mani -
fests cl i ni cal l y i n ski n and joi nt l axi ty, al though there are
reports of Wormi an bones and bl ue scl era (55) suggesti ng that
the defects are not total l y confi ned to the soft ti ssues. I n both
the OI type I B pati ents, the mutant col l agens are excl uded
from the ski n matri x, and thus there i s no opportuni ty the
expressi on of the Ehl ers-Danl os syndrome type VI I cl i ni cal
phenotype. I n OI -197 bone the mutant col l agen, whi ch i s short-
ened by a mul ti -exon del eti on i n the hel i cal domai n, may al so
have reduced N-propepti de processi ng, and the i ncl usi on of thi s
structural l y abnormal col l agen pN-col l agen i nto the bone ma-
tri x may contri bute to the pathol ogi cal effect of the mutati ons
on the bone matri x.
These studi es al so hi ghl i ght i mportant i ssues i n the extrap-
ol ati on from bi ochemi cal data obtai ned i n fi brobl ast cul ture to
the defi ni ti on of the mol ecul ar pathol ogy of the mutant protei n
i n bone, the pri mary affected ti ssue. Li kewi se, these studi es
al so demonstrate the di fferenti al matri x i ncorporati on of col l a-
gens wi th di fferent mutati ons, si nce our previ ous studi es have
shown that col l agen wi th a hel i cal gl yci ne substi tuti on muta-
ti on i s effi ci entl y i ncorporated i nto the in vitro fi brobl ast ma-
tri x but i s then sel ecti vel y degraded (18). Thus, the effect of the
mutati on on the i ncorporati on of col l agen i nto a functi onal
matri x depends on the mutati on posi ti on and type, i ts effect on
parameters such as the i ntracel l ul ar and extracel l ul ar stabi l i ty
of the mutant col l agen, secreti on, and presumabl y al so on i ts
abi l i ty to i nteract appropri atel y wi th the devel opi ng fi bri l l ar
matri x. I n an attempt to address these questi ons, further ex-
peri ments are under way i nvol vi ng the stabl e transfecti on of
fi brobl ast and bone cel l s wi th mutant 1(I ) col l agen genes and
the compari son of the bi ochemi cal phenotypes that resul t.
REFERENCES
1. Byers, P. H. (1993) i n ConnectiveTissueand I ts HeritableDisorders: Molecu-
lar, Genetic, and Medical Aspects (Royce, P. M., and Stei nmann, B., eds) pp.
317350, Wi l ey-Li ss, I nc. New York
2. Byers, P. H., and Stei ner, R. D. (1992) Annu. Rev. Med. 43, 269282
3. Kui vani emi , H., Tromp, G., and Prockop, D. J. (1991) FASEB J . 5, 20522060
4. Si l l ence, D. O., Senn, A., and Danks, D. M. (1979) J . Med. Genet. 16, 101116
5. Paterson, C. R., McAl l i on, S. J., and Mi l l er, R. (1983) J . Med. Genet. 20,
203205
6. Wi l l i ng, M. C., Cohn, D. H., and Byers, P. H. (1990) J . Clin. I nvest. 85, 282290
7. Wi l l i ng, M. C., Deschenes, S. P., Scott, D. A., Byers, P. H., Sl ayton, R. L., Pi tts,
S. H., Ari kat, H., and Roberts, E. J. (1994) Am. J . Hum. Genet. 55, 638647
8. Wi l l i ng, M. C., Pruchno, C. J., and Byers, P. H. (1993) Am. J . Med. Genet. 45,
223227
9. Shapi ro, J. R., Stover, M. L., Burn, V. E., McKi nstry, M. B., Burshel l , A. L.,
Chi pman, S. D., and Rowe, D. W. (1992) J . Clin. I nvest. 89, 567573
10. Byers, P. H., Wal l i s, G. A., and Wi l l i ng, M. C. (1991) J . Med. Genet. 28,
433442
11. Deak, S. B., Schol z, P. M., Amenta, P. S., Constanti nou, C. D., Levi -Mi nzi , S.
A., Gonzal ez-Lavi n, L., and Mackenzi e, J. W. (1991) J . Biol. Chem. 266,
2182721832
12. Val l i , M., Zol ezzi , F., Mottes, M., Antoni azzi , F., Stanzi al , F., Tenni , R.,
Pi gnatti , P., and Cetta, G. (1993) Eur. J . Biochem. 217, 7782
13. Starman, B. J., Eyre, D., Charbonneau, H., Harryl ock, M., Wei s, M. A., Wei ss,
L., Graham, J. M., Jr., and Byers, P. H. (1989) J . Clin. I nvest. 84,
12061214
14. Byers, P. H. (1990) Trends Genet. 6, 293300
15. Mottes, M., Sangal l i , A., Val l i , M., Li ra, M. G., Tenni , R., Butti tta, P., Pi gnatti ,
P. F., and Cetta, G. (1992) Hum. Genet. 89, 480484
16. Cohn, D. H., Apone, S., Eyre, D. R., Starman, B. J., Andreassen, P.,
Charbonneau, H., Ni chol l s, A. C., Pope, F. M., and Byers, P. H. (1988)
J . Biol. Chem. 263, 1460514607
17. Ni yi bi zi , C., Bonadi o, J., Byers, P. H., and Eyre, D. R. (1992) J . Biol. Chem.
267, 2310823112
18. Bateman, J. F., and Gol ub, S. B. (1994) Matrix Biol. 14, 251262
19. Ni chol l s, A. C., Ol i ver, J., Renouf, D. V., Heath, D. A., and Pope, F. M. (1992)
Hum. Genet. 88, 627633
20. Zhuang, J., Tromp, G., Kui vani emi , H., Nakayasu, K., and Prockop, D. J.
(1993) Hum. Genet. 91, 210216
21. Mottes, M., Sangal l i , A., Val l i , M., Forl i no, A., Gomez-Li ra, M., Antoni azzi , F.,
Constanti nou-Del tas, C. D., Cetta, G., and Pi gnatti , P. F. (1994) Hum.
Genet. 93, 681687
22. Superti -Furga, A., Raghunath, M., Pi stone, F. M., Romano, C., and
Stei nmann, B. (1993) Connect. TissueRes. 29, 3139
23. Wenstrup, R. J., Shrago-Howe, A. W., Lever, L. W., Phi l l i ps, C. L., Byers, P. H.,
and Cohn, D. H. (1991) J . Biol. Chem. 266, 25902594
24. Sykes, B., Ogi l vi e, D., Wordsworth, P., Wal l i s, G. A., Mathew, C., Bei ghton, P.,
Ni chol l s, A. C., Pope, F. M., Thompson, E., Tsi pouras, P., Schwartz, R.,
Jensson, O., Arnason, A., Borresen, A., Hei berg, A., Frey, D., and
Stei nmann, B. (1990) Am. J . Hum. Genet. 46, 293307
25. Si l l ence, D., Butl er, B., Latham, M., and Barl ow, K. (1993) Am. J . Med. Genet.
45, 183186
26. Bateman, J. F., Mascara, T., Chan, D., and Col e, W. G. (1984) Biochem. J . 217,
103115
27. Bateman, J. F., Chan, D., Mascara, T., Rogers, J. G., and Col e, W. G. (1986)
Biochem. J . 240, 699708
28. Chan, D., Lamande, S. R., Col e, W. G., and Bateman, J. F. (1990) Biochem. J .
269, 175181
29. Bateman, J. F., Harl ey, V., Chan, D., and Col e, W. G. (1988) Anal. Biochem.
168, 171176
30. Gough, N. (1988) Anal. Biochem. 173, 9395
31. Bateman, J. F., Chan, D., Moel l er, I ., Hannagan, M., and Col e, W. G. (1994)
Biochem. J . 302, 729735
32. Mi l l er, S. A., Dykes, D. D., and Pol esky, H. F. (1988) Nucleic Acids Res. 16,
1215
33. Dougl as, A. M., Georgal i s, A. M., Benton, L. R., Canavan, K. L., and Atchi son,
B. A. (1992) Anal. Biochem. 201, 362365
34. Bateman, J. F., Lamande, S. R., Hannagan, M., Moel l er, I ., Dahl , H. H., and
Col e, W. G. (1993) Am. J . Med. Genet. 45, 233240
35. de Wet, W., Bernard, M., Benson-Chanda, V., Chu, M.-L., Di ckson, L., Wei l , D.,
and Rami rez, F. (1987) J . Biol. Chem. 262, 1603216036
36. Vasan, N. S., Kui vani emi , H., Vogel . B. E., Mi nor, R. R., Wootton, J. A. M.,
Tromp, G., Weksberg, R., and Prockop, D. J. (1991) Am. J . Hum. Genet. 48,
305317
37. Barsh, G. S., and Byers, P. H. (1981) Proc. Natl. Acad. Sci. U. S. A. 78,
51425146
38. Barsh, G. S., Roush, C. L., Bonadi o, J., Byers, P. H., and Gel i nas, R. E. (1985)
Proc. Natl. Acad. Sci. U. S. A. 82, 28702874
39. Chu, M., Wi l l i ams, C. J., Pepe, G., Hi rsch, J. L., Prockop, D. J., and Rami rez,
F. (1983) Nature304, 7880
40. Wi l l i ng, M. C., Cohn, D. H., Starman, B., Hol brook, K. A., Greenberg, C. R.,
and Byers, P. H. (1988) J . Biol. Chem. 263, 83988404
41. Myers, J. C., Di ckson, L. A., de Wet, W. J., Bernard, M. P., Chu, M.-L., Di
Li berto, M., Pepe, G., Sangi orgi , F. O., and Rami rez, F. (1983) J . Biol. Chem.
258, 1012810135
42. Bi enkowski , R. S. (1983) Biochem. J . 214, 110
43. Lamande, S. R., Chessl er, S. D., Gol ub, S. B., Byers, P. H., Chan, D., Col e, W.
G., Si l l ence, D. O., and Bateman, J. F. (1995) J . Biol. Chem. 270, 86428649
44. Chi pman, S. D., Shapi ro, J. R., McKi nstry, M. B., Stover, M. L., Branson, P.,
and Rowe, D. W. (1992) J . BoneMiner. Res. 7, 793805
45. Fedarko, N. S., Moeri ke, M., Brenner, R., Gehron Robey, P., and Vetter, U.
(1992) J . BoneMiner. Res. 7, 921930
46. Vogel , K. G., Paul sson, M., and Hei negrd, D. (1984) Biochem. J . 223, 587597
47. Hei negrd, D., and Ol dberg, A. (1989) FASEB J . 3, 20422051
48. Katz, E. P., and Davi d, C. W. (1992) J . Mol. Biol. 228, 963969
49. Otsubo, K., Katz, E. P., Mechani c, G. L., and Yamauchi , M. (1992) Biochem-
istry 31, 396402
50. Eyre, D. R., Paz, M. A., and Gal l op, P. M. (1984) Annu. Rev. Biochem. 53,
717748
51. Yamauchi , M., and Mechani c, G. (1988) i n Collagen: Biochemistry (Ni mni , M.,
ed) pp. 157172, CRC Press, Boca Raton, FL
52. Dombrowski , K. E., Vogel , B. E., and Prockop, D. J. (1989) Biochemistry 28,
71077112
53. Hul mes, D. J. S., Kadl er, K. E., Moul d, A. P., Hoji ma, Y., Hol mes, D. F.,
Cummi ngs, C., Chapman, J. A., and Prockop, D. J. (1989) J . Mol. Biol. 210,
337345
54. Hol mes, D. F., Watson, R. B., Stei nmann, B., and Kadl er, K. E. (1993) J . Biol.
Chem. 268, 1575815765
55. Stei nmann, B., Royce, P. M., and Superti -Furga, A. (1993) i n ConnectiveTissue
and I ts Heritable Disorders (Royce, P. M., and Stei nmann, B., eds) pp.
351407, Wi l ey-Li ss, I nc., New York
COL1A2 Multiexon Deletions in Osteogenesis I mperfecta 21074