Comparison of three different mycobacterial DNA isolation

methods

Alp A
1
, Alp S, Sariba Z, Haselik G.

ABSTRACT: The diagnosis of mycobacterial infections can be placed in a short time great
is important. Therefore, molecular methods present valuable diagnostic tools
have become. Polymerase chain reaction (PCR) prior to the application of DNA
isolation step, the test used, the sensitivity of the most important steps of
is one. In this study, for the diagnosis of mycobacterial infections of PCR method
can affect the efficiency of DNA extraction method was compared to three. to this end
boiling method "MagNA Pure LC" (Roche Applied Science, Germany) automated
isolation system and "Magtratio the 12GC" (Precision System Science, Germany)
sensitivity automated isolation system, four different mycobacterial strain (Mycobacterium
tuberculosis strain H37Ra standards, clinical isolates of M. tuberculosis, and M.smegmatis M.phle)
were tested using. Preparing serial dilutions of these strains with these three methods
DNA isolation from applied, then all mycobacteria present in the PCR
hsp65 gene was amplified using primers specific region of 441 base pairs. The resulting
The products were separated by agarose gel electrophoresis, the band lowest observable
dilution ratio, 10-5 "with the MagNA Pure" and "Magtratio" system made with the isolation
H37Ra strain has been identified. Boiling method for the isolation of DNA with H37Ra
but the band could be observed in the 10-2 dilution. M. tuberculosis isolates "magna
Pure "system," Magtratio "system by the method of boiling and 10-4, respectively, 10-3 and 10-1
band was observed at dilutions. And the amplification of strain M.smegmatis M.phle
respectively, 10-5, 10-4, 10-2 and 10-4, 10-3 and 10-2 dilutions were observed in. the study
As a result, "MagNA Pure" systems with lower amounts of DNA can be detected,
Following the boiling method whereas large quantities of DNA can be detected
was observed. Therefore, as to be more sensitive in PCR applications in routine
due both to ensure standardization, automated isolation systems
it was concluded that it would be appropriate to use.
Entrance The diagnosis of mycobacterial infections because it takes a long time, today rapid and
accurate tests are needed 1-4. This time in the diagnosis of the problem eliminate the most significant
development, the polymerase chain reaction (PCR) method girmesidir5-9 use. Nowadays, especially in
clinical samples Routinely used for the detection of Mycobacterium tuberculosis various mevcuttur10-14
commercial systems. Molecular methods for routine diagnosis, as well as clinical detected in samples in
order to identify the species level of Mycobacterium It is also used. PCR-restriction enzyme analysis
(PCR-REA) method, used for identification of mycobacteria yntemdir15 practical and inexpensive.
Molecular weight of 65 kDa, the "heat shock protein" gene (hsp65) by targeting The PCR-REA studies,
amplified using two specific primers 441 base pairs (bp) long products, the restriction enzymes BstEII
and hae cut with, thus resulting restriction fragments in polyacrylamide gels executing are separated.
Applied in routine microbiology laboratory PCR process all kinds of before nucleic acid isolation can be
performed efficiently is of great importance. In this study, the diagnosis of mycobacterial infection
which may affect the sensitivity of the PCR method used as the first step of DNA Three methods can be
used in the isolation step to compare the efficiency of is planned. Boiling method for this purpose, the
"MagNA Pure LC" automated isolation System (Roche Applied Science, Germany) and "Magtratio the
12GC" (Precision System Science, Germany) automated isolation system sensitivity, four preparing serial
dilutions of different mycobacterial species tested.

MATERIALS AND METHODS In this study, the sensitivity of three different mycobacterial DNA isolation
method, hsp65 gene 441 bp region was used to amplify by PCR method was investigated. Mycobacterial
strains used in this study were selected to 4 mycobacterium. The selected standard strains of M.
tuberculosis H37Ra, M. tuberculosis patient isolates, of M.phle and M.smegmatis the Lowenstein-Jensen
medium cultures produced in 0.5 Mycobacterial suspensions were prepared in McFarland turbidity.
Target 0.5 In order to achieve McFarland turbidity, 450'si ml aliquots into tubes containing glass beads
Tris-EDTA (TE) buffer (10 mM Tris, 1 mM EDTA, pH 8) were added and 8 units 10-1 serial dilution tube
created. Mycobacterial strains for each dilution was performed three sets and to each of the sets of DNA
isolation was performed by three different methods. Mycobacterial DNA Isolation Method: Examples for
boiling method, washed with TE buffer three times, 20 minutes was refluxed for. After boiling for 3
minutes rpm centrifuge tubes 5.000x cell debris and the supernatant was precipitated by taking portions
of DNA extracted edildi7 obtained .

"MagNA Pure LC" automated isolation system (MagNA Pure LC Total Nucleic Acid Isolation Kit, Roche
Diagnostics, Germany), and provided in kit Reagents contain requirements related positions of the
system have been placed. more After pre-prepared in lysis buffer containing standards and quantitation
(300 L) on a special cartridge of mycobacterial suspension was added to 100 ml aliquots and automatic
operation has started. "MagNA Pure LC" in the first device, the lysis proteinase K in a buffer which was
exposed to the effect of nucleic acids; , after the high salt concentration in the lysis buffer again by the
action of the nucleic acids bind to the magnetic beads are added to the mixture was provided. Multiple
cycles, with substances which bind to the magnetic beads was removed from the medium. The effect of
high temperature and salt concentration then With declines pure nucleic acids separated from the
magnetic beads was obtained. All these operations were performed automatically by the instrument.
device example, in part, by the isolation of the nucleic acid with automatically At the end of the process
samples being expected as a heat sink were available. isolation When the process is ended (about 2-2.5
hrs) cartridges were held in this section and the obtained DNA was used for PCR.

"Magtratio the 12GC" in the automated isolation system, magnetic beads strategy was used for binding
of nucleic acids. For this, in the first stage proteinase K lysis buffer contained in the broken owing
mycobacteria was exposed nucleic acids. Nucleic acids, contained in the lysis buffer under the influence
of high salt concentrations, added to the mixture to magnetic beads was coupled with multiple cycles,
unbound magnetic beads The substances were removed from the medium. Then, high temperature and
salt effects By reducing the concentration of nucleic acids from the magnetic beads edildi.mikobakteriyel
separated and recovered as pure DNA by PCR Propagation and Evaluation of Results: Mycobacterial DNA
obtained by isolation methods, in all mycobacteriae hsp65 gene contained in the amplification by PCR of
441 bp was used. For this TB11 [5'-ACCAACGATGGTGTGTCCAT] and TB12 [5'CTTGTCGAACCGCATACCCT]
primers were used. Amplification of template DNA Mixtures were prepared for 50 nL. The mixture of
template DNA with specific primers pair 100 Pm, 1.25 U Taq polymerase, 50 mM KCl, 10 mM Tris pH 8.3,
1.25 mM MgCl2 , 200 m dATP, dCTP, dGTP and dTTP was created. tubes In the thermal cycler at 94 C
after 3 minutes denaturation, 94 C 3 minutes denaturation, 58 C for 45 seconds and 72 C for 1
minute binding The polymerization process was applied to complete 45 cycles. Recently In step 72 C
for 3 minutes by the addition of an additional polymerisation stage PCR is complete. The resulting
products were separated by 1.5% agarose gel electrophoresis and after staining with ethidium bromide
were analyzed in the presence of ultraviolet light. In this study for each sample dilution, 441 bp band in
agarose gel and note that there were.
RESULTS
The product obtained is separated by agarose gel electrophoresis, bands
rate of the lowest dilution that can be observed, with 10-5 "MagNA Pure" and "Magtratio the"
with the H37Ra strain isolation system was determined (Figure 1). Thus
M. tuberculosis from clinical specimens by PCR to determine the two
automated nucleic acid isolation system can be used safely conclude
has been reached. H37Ra strain the decoction method for isolation but
10-2 dilution bands could be observed (Figure 2). In four mycobacterial species, three
The results obtained by isolation is shown in Table II.
Figure 1 "MagNA Pure" device in the isolation of DNA from M. tuberculosis H37Ra in the PCR band
the lowest observable 10-5 dilution ratio, respectively.
Figure 2 by means of boiling in the isolation of DNA from M. tuberculosis H37Ra in the PCR band
the lowest observable 10-2 dilution ratio, respectively.
398 in the three different mycobacterial DNA isolation BULLETIN 399 YNTEMMKROBYOLOJ
Table I. Isolation Method Three PCR Band Then Observable
Best Low Dilution Rate
Microbiology Sushi
Isolation Procedure
MagNA Pure LC Magtratio boiling the 12GC
10-5 10-5 10-2 M. tuberculosis H37Ra
M. tuberculosis patient isolates 10-4 10-3 10-1
M.smegmatis 10-5 10-4 10-2
10-4 10-3 10-2 to M.phle
In M. tuberculosis patient isolates "MagNA Pure" system "of Magtratio"
and brewing system that can be observed by means of the lowest dilution rates tape
respectively, 10-4, 10-3 and 10-1 respectively. M. tuberculosis strain H37Ra
As the lower boiling method in patient isolates DNA
obtained was observed.
M.smegmatis strain "MagNA Pure" system, "Magtratio" system and
boiling the lowest dilution that can be observed by means of bands respectively
10-5, 10-4 and 10-2 identified as, respectively, for these ratios M.phle strains 10-4,
10-3 and 10-2 is set at (Figure 3).
Figure 3: DNA M.smegmatis "Magtratio the 12GC" device in isolation, PCR band
the lowest observable 10-4 dilution ratio, respectively.
DISCUSSION
Today, molecular methods, great for mycobacterial infection
gelmilerdir16,17 fast and reliable diagnostic tools become important. known
In routine practice as a method to be selected for the most important parts
feature is the high specificity and sensitivity of the test. Factors in clinical specimens
DNA or RNA of micro-organisms in large amounts and in pure form
to the PCR method Nucleic acid isolation step prior to the application
and this operation is performed, the sensitivity of the test used, the most important
is one of the steps. Of molecular methods for the diagnosis of tuberculosis
specificity, were higher in many studies. about sensitivity
If applied according to the test results edilebilmektedir9-11,14 quite different.
Obtaining results different in sensitivity, in addition to the PCR method is used,
Examples of the type and amount of bacilli in the sample also plays an important role. Thus
without causing a loss in the amount of bacilli in the sample DNA isolation is of great importance to
ensure. Theoretical perspective, in example
Even when there are few bacilli positive PCR results can be found
are indicated. However, in practice, many studies of tuberculosis PCR
gsterilmitir1,5,6,8,12,13,18 sensitivity is not so high. The reasons
between M. tuberculosis DNA can not be uncovered in a good way, for example,
In the processing examples in bacilli lost or inhibitory substances
There is illustrated.
In this study the most significant digits before PCR DNA
Isolation methods can be used in step three of insulation efficiency
were compared with each other. Boiling method for this purpose, "MagNA Pure
LC "automated isolation system and" Magtratio the 12GC "automated isolation
The sensitivity of the system, four different serial dilutions of mycobacterial species
prepared and tested. The resulting duplication of DNA in order
mycobacterium used for the identification of PCR-restriction enzyme analysis method
The PCR protocol used in the first stage and the hsp65 gene selected 441 base
double the length of the target region was amplified. Upon selection of this protocol, three
of different nucleic acid isolation methods of efficiency in different mycobacterial species
aimed to understand.
In conclusion, the best results of mycobacterial DNA isolation
automated "MagNA Pure" obtained with the system were observed (Table I). is this
in four different mycobacterial strains isolated by the method, other methods
larger amounts of DNA were obtained and these systems routinely
can be used reliably, quickly, and it was concluded that there is a practical method.
"Magtratio the 12GC" system, the isolation of M. tuberculosis H37Ra "magna
Pure "system, the same result is obtained, the other three of mycobacterium
"MagNA Pure" less DNA was obtained from the system log. the study
in a short time and ease of isolation in this system because it can provide
A nucleic acid isolation methods that can be used routinely in practice
was considered.
Mycobacterial DNA extraction methods used in the literature on
When scanning both "MagNA Pure" system, as well as "Magtratio the
12GC "system has not been a study on this subject. However,
studies both methods are available with different microorganisms.
For example in samples of urogenital Chlamydia trachomatis and Neisseria gonorrhoeae
One study using PCR method for the detection of the nucleic acid
insulation and isolation methods with standard manual as well as automated
"MagNA Pure LC" was carried out with the system and "the MagNA Pure LC" system
the amount of DNA is obtained bildirilmitir19 more. From clinical specimens
by quantitative PCR in the detection of HIV-1 RNA "MagNA Pure LC" nucleic
acid isolation system in another study that investigated the sensitivity of these
the analytical sensitivity of 95% and the specificity was 100% and HIV
Molecular diagnosis "in the MagNA Pure LC" nucleic acid isolation system safely
It was concluded can be used
20 people from clinical specimens by PCR method
papillomavirus (HPV) in a study for determining the "magna
400 in the three different mycobacterial DNA isolation BULLETIN 401 YNTEMMKROBYOLOJ
Pure LC "nucleic acid isolation system of the results obtained with manual
that correspond to the results obtained by the method, ease of operation and low
In terms of the risk of contamination "MagNA Pure LC" system of HPV molecular
a preferable method for the diagnosis is concluded that
21.
In studies previously carried out with different microorganisms
As highlighted, the first phase of the nucleic acid molecular methods
isolation, is of great importance in PCR applications routine. generally
With this operation performed manually, time-consuming, labor intensive than
aamadr18 and should be performed with caution. Nucleic acids from clinical samples
or contamination that may occur during isolation Proceeding
technical errors made during, directly affect the results. In recent years,
In parallel with advances in technology developed automated nucleic acid isolation
systems, seems to be able to remove these problems. Thus, routine
laboratory services, labor and time savings, as well as contamination
and techniques will be possible to prevent errors. Automated nucleic
acid isolation systems, because they are both more sensitive and rapid,
to ensure standardization in terms of both routine PCR applied
It was concluded in the laboratory can be used. However, these systems
It should be noted that the economic costs are higher.
In conclusion, "MagNA Pure" systems with lower amounts
mycobacterial DNA can be detected, but the higher the boiling method
amounts can detect mycobacterial DNA was seen, so the routine
In PCR applications, instead of boiling method for the isolation of nucleic acids
Wherever possible financial possibilities of the use of automated systems, it is possible
If the implementation of other protocols would be useful manual isolation
was concluded.