Laboratory Techniques

September 2014












2
Information from Increasing Dietary a-Linolenic Acid Enhances Tissue Levels of Long-
Chain n-3 PUFA when Linoleic Acid Intake is Low in Hamsters:
Measuring FA Composition of Diets and Tissues:
o Lipids from the diets and tissues were transmethylated w 0.5 N
methanolic HCl.
o FA methyl esters were analysed by gas chromatography w a flame
ionization detector and autosampler using a Supercowax 10 flexible
fused-silica capillary column.

Information from Need for Accurate and Standardized Determination of Amino Acids
and Bioactive Peptides for Evaluating Protein Quality and Potential Health Effects of
Foods and Dietary Supplements:
Determination of a.a.s in food:
o The safety, allergenic potential and adequacy, including bioavailability
of the new bioactive peptides, should be thoroughly assessed before
they are made widely available to consumers.
o Protein digestibility assessment PDCAAS
o Determination of the total amino acid content of foods and
supplements requires protein hydrolysis by various means that must
take into account variations in stability of individual a.as and
resistence of diff peptide bonds to the hydrolysis procedure.
o Consider:
HPLC quantifying a.as; reversed C8/C18 silica-based
columns
Gas chromatography
Capillary electrophoresis
Determination of bioactive peptides in foods and dietary supplements:
o Food-derived bioactive peptides commonly contain 2-9 a.as, (Lunasin
food-derived bioactive peptide w anticancer bioactivity in skin
cancer mouse model w 43 a.a.s) larger peptides digest in intestinal
tract
o ACE-inhibitory peptides have to reach the cardiovascular system in an
active form.
o Enzymatic and acid hydrolyses generate peptides from proteins.
o Proteinases are most commonly used for the production of peptides
from food proteins.
o Fermentation is also used to produce some bioactive peptides.
o LC to isolate and purify.
o SDS-PAGE can determine M.W. and purity.
o Size-exclusion LC can give an indication of particle size.
In Canada, bioactive substances intended to have health benefits could be
considered as a functional food or nutraceutical.

KIRS:
3
People with autoimmune disease susceptibility have activating KIRs, which
slow the disease progression.
In cancer, there is a correlation to the expression of inhibitory KIRs related to
susceptibility.
Whenever you want to recognize a non-self (viruses and cancer), you want
an activator, but that leads to increased autoimmune disease.
Want to recognize self, you want an inhibitory, but that leads to increased
viral/cancer disease.




All procedures are examples from BCH3356 or the internet and not set in stone.

PCR Amplification

Theory:
1. Denaturation: During this step, a high temperature is necessary to convert
double stranded DNA (dsDNA) into single stranded DNA (ssDNA). This step
is essential so that each primer can access and anneal to its complementary
single-stranded DNA template (2
nd
step). If the denaturation step is too short,
or if the temperature is too low, dsDNA will be partially denaturated and can
renature rapidly. On the other hand, if the temperature is too high, or if the
denaturation step is too long, excessive loss of enzyme activity will occur
with each cycle.
2. Primer annealing: The melting temperature (Tm) of primers is of critical
importance in designing the parameters of a successful PCR amplification. A
simple formula for estimating the Tm of short DNA oligonucleotides is: Tm
= 64.9C + 41C x (# of Gs and Cs 16.4)/N where N is the total number
of nucleotides.
The annealing temperature (Ta), which is sometimes confused with the Tm,
corresponds to the temperature of the thermocycler during the annealing
step. The Ta is adjusted according to the length and the relative GC content
composition of the primers. A rule of thumb is to use a Ta value that is about
5C below the lowest Tm of the two primers. One consequence for using a Ta
value that is too low is that one or both primers might anneal to sequences
other than their true targets, as internal single-base mismatches or partial
annealing may be tolerated. This incorrect annealing can lead to "non-
specific" amplification (extra amplification products that can be seen on an
agarose gel) and reduced yield of the desired product. A consequence of a Ta
that is too high is lower amplification, as the likelihood of primer annealing is
reduced.
Annealing does not take long: most primers will anneal efficiently within 30
sec or less.
3. Primer extension: This is the DNA synthesis step mediated by a DNA-
4
dependent DNA polymerase. A heat-stable DNA polymerase is required to
withstand the denaturing steps carried out at 95-98C. Many commercial
DNA polymerases were originally purified from a thermophilic bacterium
such as Thermus aquaticus, which lives in hot springs. Optimal extension
activity occurs at about 72C.
DNA extension can be initiated only at a free 3 end. It is the annealing of
primers onto their complementary target sequences that generates the
necessary free 3 ends for priming DNA extension.

Materials:
Phusion High-Fidelity DNA polymerase
Reverse primer
Forward primer

Procedure:

1. Prepare two PCR reactions as indicated in the table below.

2. PCR reactions should be setup in labeled PCR tubes (0.2 mL).
(positive and negative controls)

3. Load in thermocycler.

4. The thermocycler will run the following PCR program for this experiment:

I. Initial denaturation: 95C 1 min
II. Denaturation: 95C 30 sec
III. Annealing: 55C 30 sec
IV. Extension: 72C 30 sec
V. Repeat step II to IV 24 times
VI. Final extension: 72C 10 min
VII. Hold temperature: 4C

PCR
Components
Concentration
of the stock
sample
Target
concentration
in reaction
tube
Volume per
reaction:
Positive
control
Volume per
reaction:
Negative
control
H2O (Brown tube)
PCR Buffer (Blue tube) 10X 1X
MgCl2 (Purple tube) 50 mM 1.5 mM
dNTPs (Green tube) 10 mM 0.2 mM
Forward primer (Pink tube)
Reverse primer (Yellow tube)
DNA template (Orange tube) -
Taq DNA polymerase See
TA

Total volume
5

Agrose Gel Electrophoresis

Theory:
1. Gel electrophoresis is a technique used to separate macromolecules
especially proteins and nucleic acids - that differ in size, charge or
conformation (3). When charged molecules are placed in an electric field,
they migrate toward either the positive (anode) or negative (cathode)
electrode according to their charge. In contrast to proteins, which can have
either a net positive or net negative charge, nucleic acids have a negative
charge at neutral pH, due to their backbone of phosphate groups. The relative
migration distance of each molecule is determined by the charge density of
the molecule and the resistance of the matrix (or gel) media to the passage of
the molecule.
2. The higher the agarose concentration, the "stiffer" the gel will be and the
smaller the size of the DNA or RNA fragments that can be separated.
Following separation, DNA fragments will be visualized by staining with
SYBR safe. This fluorescent dye intercalates between bases of DNA and
RNA. It is often incorporated into the gel so that staining occurs during
electrophoresis, but the gel can also be stained after electrophoresis by
soaking in a dilute solution of SYBR safe. DNA or RNA fragments appear as
green bands when the gel is exposed to UV light. Fragments of linear DNA
migrate through agarose gels with a mobility that is inversely proportional to
the log of their molecular weight. Circular forms of DNA migrate in agarose
differently from linear DNAs of the same mass. Several factors have
important effects on the mobility of DNA fragments in agarose gels, and can
be used in order to optimize the separation of DNA fragments. These factors
include: % agarose concentration, voltage (as the voltage applied to a gel is
increased, larger fragments migrate proportionally faster than small
fragments), the choice of electrophoresis buffer and SYBR safe. The
molecular weight of a linear DNA sample can be estimated by running a
mixture of linear DNA fragments of known size under the same conditions
(Figure 2).

Materials:
Plasmid DNA at an unknown concentration.
Spectrophtometer (+ cuvette)
MassRuler Express Forward DNA Ruler
bromophenol blue

Procedure:
Using a spectrophotometer, you will be required to calculate the
concentration of plasmid DNA and then determine the 260/280 ratio. Once
you know the concentration, you will load 50 ng of the plasmid DNA on an
agarose gel to validate your calculation.
6

1. Prepare a 1:50 dilution of the unknown DNA solution in a final volume of
1.0mL. Water should be used for the dilution.

2. Transfer this dilution into a 1.5 mL spectrophotometer cuvette. Prepare a
second cuvette with 1mL of water for the blank.

3. Read the absorbance of your DNA dilution at 260nm (Remember that 1 OD260


4. Once the concentration of the DNA solution has been determined, prepare an


5. Add 3.5

6. Load your aliquot and MassRuler Express Forward DNA ladder on a 1%
agarose gel.

7.
loading buffer. Make sure
that your tubes are labelled properly.

8. Close your tubes and mix the solution by gently flicking the tube. Collect the
solution from the wall of the tube by using a centrifuge.

9. Load your samples onto the agarose gel and the MassRuler Express
Forward DNA ladder marker in two pre-assigned wells.

10. Run the gel at 100 volts until the bromophenol blue, which is used as a
tracking dye, gets halfway through the gel (It should correspond roughly to
the distance travelled by a 150 bp DNA fragment).

11. A picture of your gel will be taken using a gel documentation system
(AphaImager mini).


PCR Primer Design

Theory:
1. The sense strand is the DNA strand that corresponds to the mRNA sequence,
except for Us that are substituted with Ts. By convention, the sequence of a
gene is represented as its sense strand and is displayed 5 to 3. The sense
strand is also referred as the coding strand. The antisense strand is the
strand that is complementary to the sense strand. Because the two DNA
strands are antiparallel (they are side-by-side but in opposite directions),
7
the sequence of the antisense corresponds to the reverse complement of
the sense strand.

2. Conversion of an mRNA into cDNA. The first step in the production of a
cDNA is the
conversion of the
messenger RNA
(mRNA) into a
complementary DNA
strand. This is done by
using a DNA
polymerase called
Reverse transcriptase
forming the antisense
strand (First strand
cDNA synthesis).
Then, RNaseH is used
to remove the mRNA
and the second strand
of the cDNA is
subsequently
synthesized by the
DNA polymerase I (in
combination with
specific primers). The
newly synthesized strand corresponds to the sense strand. In this
representation, ATG corresponds
to the start codon (AUG in the
mRNA) and the TGA (UGA in the
mRNA) represents the stop codon
(for simplicity, only one of the
three stop codons is shown). The
polyadenine tail of the transcript is
designated by five adenines.

3. To delineate the two ends of the
PCR amplicon, two primers are
necessary, a forward and a reverse
primer. The forward primer
sequence reads identical to the
coding sequence of the mRNA
molecule or the sense strand of
your cDNA. It anneals to the
antisense (non-coding) strand to
initiate elongation of the sense
strand from its 5 to 3 ends. The
8
reverse primer sequence reads as the reverse complement of the mRNA
molecule or the antisense strand of your cDNA and it anneals to the sense
(coding) strand to prime elongation of the antisense strand.
4. Primer rules:
a. Primers usually have a length of 17-28 nucleotides;
b. The primers base composition should be 50-60% (G+C);
c. Primers 3-end should have one or two terminal C or Gs. This allows a
firm adhesion of primers 3 terminal nucleotides onto the template;
d. Runs of three or more consecutive Cs or Gs within primers may
promote mispriming at GC-rich sequences (because of the stability of
annealing); this problem is more common when genomic DNA is used
as a template;
e. The 3'-ends of the forward and reverse primers should not be
complementary (i.e. they should not be able to anneal to each other)
to prevent the formation of primer dimers;

5. Subcloning:
a. The reading frame of
your T7 RNA
polymerase needs to
be adjusted to the
reading frame
provided by the
destination vector.






















A)
B)
9



FWD:
1 : Six extra nucleotides to ensure optimal Hind III activity
2 : Hind III recognition site
3 : Coding sequence (open reading frame) of the T7 RNA polymerase.
ATG of the
T7 RNA polymerase is shown in bold.

REV


Purification of the T7 RNA polymerase PCR amplicon.

Theory:
1. Purification of your amplicon is necessary because the conditions (pH, salt
concentrations, etc.) used for PCR amplification are not necessarily
compatible with the conditions to be used for the restriction digest to be
performed next week. The process works via binding of DNA to silica at high
ionic strength, and release at low ionic strength. Addition of chaotropic salts,
such as guanidine, create a salt bridge between the negatively charged
phosphate groups of the DNA and the silica column (1).

Materials:
Clontech NucleoSpin Gel and PCR Clean-Up.

Procedure:
1. After thermocycling, transfer 2 L of each PCR reaction (T7 RNA and -
control) into two labeled 1.5 mLmicrocentrifuge tubes. Make sure to write a
U on the lid of your T7 RNA polymerase aliquot (U for Unpurified). The -
controls will not be purified as it will not be used for ligation next week.
5' - GTGTATAAGCTTATGAACACGATTAACATCGCTAAGAACGACTTCT - 3'
GTGTAT AAGCTT ATGAACACGATTAACATCGCTAAGAACGACTTCT
5' - ATTTATGAATTCTTACGCGAACGCGAAGTCCGACTCTAAGATG - 3'
ATTTAT GAATTC TTACGCGAACGCGAAGTCCGACTCTAAGATG
10
Proceed to the next step with your
remaining T7 RNA polymerase PCR
reaction.

2. Combine the remaining fraction of
your T7 RNA polymerase PCR
amplicon (about 98 L) with 2
volume of the NTI buffer (196 L)
and mix thoroughly.

3. Place a Nucleospin PCR Clean-up
column into a 2 mL collection tube.

4. Apply your sample to the Nucleospin
PCR Clean-up column.

5. Centrifuge for 30 sec at 11,000 x g.
Discard the flow-through and return
the column to the collection tube.
Your PCR amplicon is now attached
to the silica column. However there
are also contaminants present that
need to be removed.

6. To remove these contaminants from
your PCR amplicon, add 700 L of
the NT3 buffer to the column and
centrifuge for 30 sec at 11,000 x g.

7. Discard the flow-through and place
the column back in the same tube. Add again 700 L of the NT3 buffer and
centrifuge for 30 sec at 11,000 x g.

8. Discard the flow-through and return the column to the collection tube, being
careful not to wet the bottom of the column with the flow-through.
Centrifuge again for 1 min at 11,000 x g to evaporate any ethanol residue on
the column. It is crucial to eliminate residual ethanol left inside the
column since it will prevent or lower the solubilization of DNA in water
and, therefore, lower the amount of DNA that can be eluted.

9. Place the column in a clean 1.5 mL micro centrifuge tube (with a cap attached
to it) and add 30 L of NE buffer directly onto the center of the membrane.
(Be careful not to touch the membrane with the tip of the pipette.)
Incubate your Nucleospin PCR Clean-up column at RT for 1 min (this step is
really important to permit the complete desorption and
11
resolubilization of your DNA), and then centrifuge for 1 min at 11,000 x g
to elute your purified T7 amplicon.

10. Discard the column and keep the 1.5 mL microcentrifuge tube containing
your purified T7 RNA polymerase amplicon.

11. Transfer 2 L of your purified amplicon into a new 1.5 mL microcentrifuge
tube. This aliquot will be analyzed in parallel with your unpurified T7
amplicon (refer to Step 5) by agarose gel electrophoresis (Experiment #3).
The remaining of your purified T7 RNA polymerase amplicon will be
stored at -20C until next week.


Ligation

Theory:
There are two basic strategies for ligating DNA fragments into plasmid vectors
depending on the kind of termini in the insert and vector:
a) Directional ligation: Double-stranded DNA fragments with compatible
cohesive termini can be covalently joined (ligated) in an ATP-dependent
reaction that involves the formation of phosphodiester bonds between 5'-
phosphate residues and 3'-hydroxyl residues.
b) Non-directional ligation: Same as directional, but with blunt ends and,
therefore, non-specific binding

The following controls are usually recommended for ligation:
Positive control: usually a plasmid vector that has been digested with only
ONE enzyme. In the presence of T4 ligase, the open plasmid should be
recircularized.
Negative control: a doubly digested plasmid with non-compatible termini.
In this lab, you will pre-digest pTAC-MAT-Tag-1 with both Hind III and EcoRI
to generate incompatible overhangs so that self-ligation cannot occur. Notice
that a partial digest for which the plasmid is cut with only one of the
two restriction enzymes would result in compatible termini that might
be ligated.

DONT FORGET TO ADJUST THE READING FRAME OF YOUR AMPLICON TO THE
MAT TAG READING FRAME.


Procedure:
Part A: Digestion of the T7 amplicon and the pTAC-MAT-Tag-1 vector by Hind
III and EcoRI.

12
1. Prepare the restriction digest of your PCR amplicon and pTAC-MAT-Tag-1 as
described in the table below. Use the remaining fraction of the undigested
pTAC-MAT-Tag-1 for preparing a positive control for your transformation
(step 3).

2. Digest your two samples for 2 hour at 37C.

3. While waiting for your digests, prepare an aliquot containing 40 ng in a final
pTAC-MAT-Tag-1 can be put for storage at -70C. This undigested aliquot
will serve as a positive control for the transformation protocol.

4. At the end of the incubation, clean up your doubly digested PCR amplicon
and pTAC-MAT-Tag-1 samples using the Nucleospin PCR clean-up column.


Part B: Estimation of the concentration of your purified doubly digested
amplicon and vector.

Estimate the concentration of your purified amplicon and vector using an
agrose gel electrophoresis or a spectrophotometer (Epoch; 3uL on each spot).


Part C: Ligation of doubly digested T7 RNA polymerase amplicon into doubly
digested pTAC-MAT-Tag-1.

5. Use the concentrations of T7 RNA polymerase amplicon and pTAC-MAT-Tag-
1 samples given by the plate reader to fill the table below targeting an
insert:vector molar ratio of 3:1 and 40 ng plasmid.

Sample Sample
volume

( )
H2O

( )
10X
Buffer
NEB4
( )
Hind III
[20units/ L]
(50 units)
EcoRI

(50 units)
Final
volume
( )
T7 Amplicon


2.5
pTAC-MAT-
Tag-1
10 100
Treatmen
ts
Description H2O




Vector
digeste
d
with
Hind III
Vector
digested
with Hind
III and
EcoRI
T7 RNA
pol.
Amplicon
digested
with Hind
Ligatio
n
buffer
5X

T4
DNA
ligase


Total
volum
e


13
6. Prepare your ligation reactions as described in the table below. First, add all
components except the T4 ligase, mix thoroughly, and quick spin all your
tubes. Add the T4 ligase, then mix and quick spin all your tubes again.

1
You will be provided with an aliquot of pTAC-MAT-Tag-1 that had already been
digested with Hind III (20 ng/ L)

7. Incubate the ligations overnight in a thermocycler pre-set to 16C. Tomorrow
store your samples at -70C.

8. Before leaving the lab, prepare an aliquot containing 40 ng of pTAC-MAT-
Tag-
will be used as your second negative control for the transformation.



Transformation

Theory:
There are two methods to transform E. coli cells with plasmid DNA - chemical
transformation and electroporation.
o For chemical transformation, cells are grown to mid-log phase,
harvested and treated with divalent cations such as CaCl2. Cells
treated in such a way are said to be competent. To chemically
transform cells, competent cells are mixed with the DNA , on ice,
followed by a brief heat shock. Then, cells are incubated with rich
medium and allowed to express the antibiotic resistant gene for 30-60
minutes prior to plating.

o For electroporation, cells are also grown to mid-log phase but are then
washed extensively with water to eliminate all salts. Usually, glycerol
is added to the water to a final concentration of 10% so that the cells
can be stored frozen and saved for future experiments. To
electroporate DNA into cells, washed E. coli are mixed with the DNA to


(40 ng)

III and
EcoRI
( L)






I

T7 amplicon
+pTAC-MAT-
Tag-1
0 8 2 40
II

Ligation
negative
control
0 0 8 2 40
III

Ligation
positive
control
28 2
1
0 0 8 2 40
14
be transformed and then pipetted into a plastic cuvette containing
electrodes. A short electric pulse, about 2400 volts/cm, is applied to
the cells causing smalls holes in the membrane through which the
DNA enters. The cells are then incubated with broth as above before
plating.
o For chemical transformation, there is no need to pre-treat the DNA.
For electroporation, the DNA must be free of all salts so the ligations
are first precipitated with alcohol before they are used.


DONT FORGET ANTIBACTERIAL RESISTANCE AND STERILE CONDITIONS (flame)

After, inoculate for a week and count the colonies that are not crosscontaminated w
neighbouring colonies. A hemocytometer can count the cells.

Procedure for heat shock:
Part A: Preparation of Competent Bacteria

1 mL of SOB liquid broth without ampicillin should be inoculated with a colony
of Top10 cells. This inoculated broth was incubated overnight at 37C on a rotary
shaker (225 rpm/min). Transfer
had reached the stationary phase by then, into a 500 mL Erlenmeyer containing 350
mL of fresh SOB medium without ampicillin. The flask was then kept under vigorous
agitation at 37C until an optical density at 600nm of ~0.4-0.5 was reached (about 2
hours).

1. Pour 40 mL of the Top10 liquid culture into a 50 mL conical centrifuge
tube and centrifuge at 1,000g for 15 min. at 4C.

15
2. Discard the supernatant and resuspend the pellet in 15 mL of RF1 buffer
(100 mM RbCl, 50 mM MnCl2, 30 mM Potassium acetate, 10 mM CaCl2,
and 15% glycerol).

3. Incubate on ice for 15 min.

4. Centrifuge the cells for 15 min at 1,000g and 4C.

5. Discard the supernatant and resuspend pellet by gentle swirling in 3ml of
RF2 Buffer (10 mM RbCl, 10 mM MOPS, 75 mM CaCl2 and 15% glycerol).
(Cells are very fragile at this point so handle your cells carefully.
This step will have a great impact on your transformation efficiency.
If you disrupt the cells too much, you will have a lot of mortality and
therefore, low transformation efficiency.)

6. Keep the cells on ice for 15 min.

7.
your competent cells solution in seven pre-cooled 1.5mL centrifuge tubes.
Your tubes should be labelled with your group number as well as with the
treatment number, see table on the following page. Make sure to keep
everything on ice at all times (cells are still fragile so drastic
temperature change can be disastrous).

8. Keep your tubes on ice until you are ready to proceed with the
transformation.
16
Part B: Transformation of Competent Top10 Cells with Ligation Products

You will transform Top10 cells made competent in Part A with aliquots of the
ligation treatments performed last week.

9.
tube (see table below). Mix well by gently tapping the tubes. Do not
vortex as the cells are fragile at this point.


Treatment

Description of the transformation

Volume of
Top10

Volume of
DNA

I pTAC-MAT-Tag-1 Hind III/EcoRI + T7 amplicon
Hind III/EcoRI
(Ligation treatment I)
200 40
II pTAC-MAT-Tag-1 Hind III/EcoRI
(Ligation treatment II, Negative control for the
ligation)
200 40
III pTAC-MAT-Tag-1 Hind III
(Ligation treatment III, Positive control for the
ligation)
200 40
IV No DNA
(1
st
negative control for the transformation)

200 0
V pTAC-MAT-Tag-1 Hind III/EcoRI, no T4 DNA
2)
(2
nd
negative transformation treatment)
200 40
VI 40 ng of undigested pTAC-MAT-Tag-1 (aliquot of

(Positive transformation treatment)
200 40

10. Incubate on ice for 30 min.

11. Transfer the tubes to a rack placed in a water bath preheated to 42C and
incubate for exactly 30 seconds. Do not shake the tubes.

12. Transfer the tubes to ice and allow the cells to chill for 2 min.

13. Carefully add 1 mL of pre-warmed LB broth to each tube and transfer the
solution to a 15ml inoculation tube.

14. Incubate in a shaking incubator (225 cycles/min) set at 37C for 1 hour.

17
At the end of this incubation, proceed to step 15 with treatment I, to
step 19 for treatment II to V and to step 21 for treatment VI.
15.
onto the pre-identified LB-Ampicillin agar plate (Plate Ia).

16. Spread the bacteria evenly over the entire plate surface.

17.
-warmed LB-broth (1/10
dilution).

18. -identified LB-
Ampicillin agar plate (Plate Ib). Spread the bacteria evenly over the entire
plate surface.

19.
to V) onto the pre-identified LB-Ampicillin agar plates (Plate II, III, IV and
V).

20. Spread the bacteria evenly over the entire plate surface.

21.
-warmed LB-
1.5 mL microfuge tube. Ad -warmed LB-broth (dilution
-identified
LB-Ampicillin agar plate (Plate VIa; 1/100 dilution). Spread the bacteria
evenly over the entire plate surface.

22. #2 to a new 1.5 mL microfuge tube containing
-warmed LB-broth (dilution #3). Mix well and transfer 100
-identified LB-Ampicillin agar plate (Palte
VIb; 1/1000 dilution). Spread the bacteria evenly over the entire plate
surface.

23. Leave your agar plates at room temperature until the liquid is completely
absorbed - this should take about 20 min. Put all agar plates at 37C for
24 hrs, and then transfer them at 4C until colony counting is done next
week. All plates will be put upside down to prevent condensation on the
lid; condensation droplets falling back onto the agar surface would result
in cross contamination among the colonies.

Procedure for electroporation:
I. Preparation of E. coli cells for electroporation.
18
1. Use a fresh colony of DH5 (or other appropriate host strain) to inoculate 5 ml of
SOB (without magnesium) medium in a 50 ml sterile conical tube. Grow cells with
vigorous aeration overnight at 37C.
2. Dilute 2.5 ml of cells into 250 ml of SOB (without magnesium) in a 1 liter flask.
Grow for 2 to 3 hours with vigorous aeration at 37C until the cells reach an
OD550 = 0.8.
3. Harvest cells by centrifugation at 5000 RPM in a GSA rotor for 10 min in sterile
centrifuge bottles. (Make sure you use autoclaved bottles!).
4. Wash the cell pellet in 250 ml of ice-cold WB as follows. First, add a small amount
of WB to cell pellet; pipet up and down or gently vortex until cells are resuspended.
Then fill centrifuge bottle with ice cold WB and gently mix. NOTE- the absolute
volume of WB added at this point is not important.
5. Centrifuge the cell suspension at 5,000 RPM for 15 min and carefully pour off the
supernatant as soon as the rotor stops. Cells washed in WB do not pellet well. If the
supernatant is turbid, increase the centrifugation time.
6. Wash the cell pellet a second time by resuspending in 250 ml of sterile ice-cold
WB using the same technique described above. Centrifuge the cell suspension at
5000 RPM for 15 min.
7. Gently pour off the supernatant leaving a small amount of WB in the bottom of the
bottle. Resuspend the cell pellet in the WB - no additional WB needs to be added
and the final volume should be about 1 ml. Cells can be used immediately or can be
frozen in 0.2 ml aliquots in freezer vials using a dry ice-ethanol bath. Store frozen
cells at -70C.

II. Preparing DNA for Electroporation

DNA for electroporation must have a very low ionic strength and a high resistance.
The DNA may be purified by either dilution, precipitation or dialysis.
For transformation of purified plasmid DNA, dilute DNA in 10 mM Tris pH 8-8.3 to
about 1-50 ng/l (do not use TE). Use 1 l for transformation.
For ligation reactions, use the following procedure.
Purifying DNA by Precipitation:
1. Add 5 to 10 g of tRNA to a 20 l ligation reaction in a 1.5 ml tube. Add 22 l 5M
ammonium acetate (or an equal volume of ligation reaction with added tRNA). Mix
well.
2. Add 100 l absolute ethanol (or 2.5 volumes of ligation reaction, tRNA and salt).
Ice 15 min.
3. Centrifuge at >12,000 x g for 15 min at 4C. Carefully decant the supernatant.
4. Wash the pellet with 1 ml of 70% ethanol. Centrifuge at >12,000 x g for 15 min at
room temperature. Remove the supernate.
5. Air dry the pellet (speed vac okay but don't overdry).
6. Resuspend the DNA in EB buffer (10 mM Tris-HCl, pH 8.3) or 0.5X TE buffer [5
mM Tris-HCl, 0.5 mM EDTA (pH 7.5)] to a concentration of 10 ng/ul of DNA. For
ligation reactions, it is convenient to resuspend in 10 l. Use 1 l per transformation
of 20 l of cell suspension.

19
III. Electroporation.

1. Mark the required number of micro centrifuge tubes. Place the required number
of Micro-electroporation Chambers on ice. Fill the temperature control
compartment of the Chamber Safe with ~250 ml of ice-water slurry and place the
Chamber Rack in the Chamber Safe.
2. Thaw an aliquot of cells that have prepared as in Section I and aliquot 20 l of
cells to the required number of microfuge tubes on ice. Add 1 l of the DNA (or
ligation reaction) prepared as in Section II.
3. Using a micro pipette, pipette 20 l of the cell-DNA mixture between the bosses in
a Micro-Electroporation Chamber. Do not leave an air bubble in the droplet of cells;
the pressure of a bubble may cause arcing and loss of the sample. Place the chamber
in a slot in the Chamber Rack and note its position. Repeat the process if more than
one sample is to be pulsed. Up to 4 samples can be placed in the Chamber Rack at
one time. Handle the chambers gently to avoid accidentally displacing the sample
from between the bosses.
4. Close the lid of the Chamber safe and secure it with the draw latch.
5. Plug the pulse cable into the right side of the Chamber safe.
6. Turn the chamber selection knob on top of the Chamber Safe to direct the
electrical pulse to the desired Micro-Electroporation Chamber.
7. Set the resistance on the Voltage Booster to 4 k; set the Pulse Control unit to
LOW and 330 F; double check connections.
8. Charge the Pulse Control unit by setting the CHARGE ARM switch on the Pulse
Control unit to CHARGE and then pressing the UP voltage control button until the
voltage reading is 5 to 10 volts higher than the desired discharge voltage. For E. coli,
the standard conditions are 2.4 kv, which means setting the Pulse Control unit to
405 volts (400 volts is the desired discharge voltage + 5). The voltage booster
amplifies the volts by ~6-fold such that the total discharge voltage is 2400 volts, or
2.4 kv. The actual peak voltage delivered to the sample will be shown on the Voltage
Booster meter after the pulse is delivered.
9. Set the CHARGE/ARM switch to the ARM position. The green light indicates that
the unit is ready to deliver a DC pulse. Depress the pulse discharge TRIGGER button
and hold for 1 second.
NOTE: The DC voltage display on the Pulse Control unit should read <10 volts after a
pulse has been delivered. If not, discharge the capacitor using the DOWN button.
10. For additional samples, turn the chamber selection knob to the next desired
position and repeat steps 8 and 9 until all samples are pulsed.
11. For ampicillin selection, inoculate the samples into 2 ml of SOC medium and
shake for 30 minutes (for amp), 60 minutes (for Kan) to allow expression of the
antibiotic gene. Plate cells on LB medium with appropriate antibiotic or screening
reagent (e.g. 100 g/ml ampicillin, and/or 40 l of 20 mg/ml X-Gal, XP, and 40 l of
100 mM IPTG).



Screening and sequencing
20

Theory:
1. Minipreparation of plasmid DNA
a. The miniprep protocol permits the rapid isolation of small amounts of
plasmid DNA (1-10
the covalently closed circular nature of bacterial plasmids and their
small size in relation to the bacterial chromosome. In the alkaline lysis
method that you will be using, bacterial cells are lysed in a solution
containing NaOH and sodium dodecyl sulphate (SDS) (Figure 1.).
Effective lysis of bacterial cells is a key step in plasmid isolation and it
directly affects DNA yield and quality. The alkaline conditions (pH 12-
12.5) denature both the chromosomal DNA and the plasmid DNA and
SDS denatures proteins. The solution is then neutralized with
potassium acetate. Under these renaturing conditions, the plasmid
DNA, whose two strands remained intertwined during the alkaline
lysis, rapidly reanneals. The chromosomal DNA cannot renature as
quickly and is therefore trapped along with proteins in an insoluble
complex. The precipitate is removed by centrifugation and the
plasmid is precipitated from the supernatant through the addition of
ethanol. Typical yield for the alkaline lysis protocol is about 1-
plasmid DNA per mL of liquid culture.
2. DNA sequencing:
a. PCR amplification w ddNTPs (w ++dNTPs) ddNTPs are end
terminators and fluroescin donor dye directly linked to an energy
acceptor dichlororhodamine dye (Applied Biosystems BigDyes)
b. Analysis of PCR amplicons by capillary electrophoresis
c. Automated base calling

Procedure:
Minipreparation of plasmid DNA (miniprep)

1. Recover and vortex the five culture tubes, which you inoculated
yesterday, to resuspend the cells.

2. Transfer 0.5 mL of each of your five culture tubes into a distinct, labelled
1.5 mL microcentrifuge tube.

Those five microfuge tubes are to be kept on ice until you can identify,
by restriction digest (Part C), which one(s) contain(s) the expected
pTAC-MAT-Tag-1/T7 recombinant plasmid. Once you have identified at
least one positive clone, you will retrieve the appropriate tube and
proceed to its cryopreservation as described at step 25.

3. Centrifuge your five polystyrene culture tubes at 3,000g for 5 min using
the centrifuge with a swinging bucket rotor. Discard the supernatant.

21
4. -HCl
vortex at high speed to resuspend the pellets. Once the pellets have been
completely resuspended, transfer the contents of each polystyrene
culture tube into a pre-labeled 1.5 mL microcentrifuge tube.

5.
tubes and mix the content by inverting the tubes five times. Observe how
the properties of the samples have changed.

Do not vortex, shake or incubate your minipreparations for more than
5 min to minimize shearing of genomic DNA. Breakdown of genomic
DNA into small fragments is not desirable as the smaller fragments
might be extracted along with plasmid DNA.

6. -acetate buffer (3M potassium, 5M acetate,
pH4.8) into each of your tubes. Mix thoroughly by inverting your tubes 3
times.

7. Centrifuge your tubes at maximum speed for 5 min to pellet cell debris
and chromosomal DNA.

8. Use a 1 mL pipettor to transfer about 75-80% of the supernatants into
clean 1.5 mL microcentrifuge tubes. Avoid transferring any of the
white precipitate. If some of the precipitate gets transferred, it can be
removed with a pipet tip.

9. -99% that has been pre-cooled to -20C. Mix well
by shaking.

10. Centrifuge at maximum speed for 5 min.

11. Discard the supernatants. Add 1 mL of 70% ethanol in each tube and
rinse the pellets by vortexing for 5-10 sec (pellets do NOT have to be
completely resuspended). Centrifuge again at maximum speed for 5 min
then invert the tubes over absorbent paper for ten minutes to drain out
the remaining ethanol.

After the 70% ethanol wash, the pellets tend to weakly adhere to the
bottom of the tubes: be careful not to lose your plasmid DNA pellets!

12.

Analysis of the Minipreparations by Restriction Digest and Cryopreservation
of One Positive Clone

22
18. Prepare a Master mix to digest your five minipreps knowing that you will
add 1 more reaction to the master mix to create a buffer zone so you dont
run short of your master mix)

Components Volume per
reaction


Volume of the
master mix (6
reactions)

H2O 13 78
10X NEB4 buffer 2 12
1 6
Hind III (20

1 6
Total volume 17
1
102
2
1

2
To verify that your calculations were done properly, you can divide the total volume of
Master mix by the number of reactions and you should get the total volume of one

19.

20.

21. Mix each tube well and incubate for at least one hour at 37C.

22. Cast a 1% agarose gel with a 20-well comb. Three groups can share one gel
as follows:
a. Lanes 1-6: 5 digested and 1 undigested samples from 1
st
group
b. MassRuler Express Forward DNA ladder
c. Lanes 8-13: 5 digested and 1 undigested samples from 2
nd
group.
d. MassRuler Express Forward DNA ladder
e. Lane 15-20: 5 digested and 1 undigested samples from 3
rd
group.

23
23. Prepare your samples to be loaded on the agarose gel as follows:
a. 10X
loading buffer
b.
H2
of its digested preparation: band intensities should be similar).

24.
40 minutes. Take a picture of your results.

25. Refer to your gel picture to identify one positive colony whose band profile
corresponds to the expected bands for pTAC-MAT-Tag-1/T7. This positive
miniprep is to be used as a template for DNA sequencing (Part D). You
should also retrieve the transformant cell line corresponding to your
positive miniprep among the five cell lines that were put on ice at
step 7. You will require this cell line next week for the protein
expression procedure. Cell cultures can be cryopreserved for long
periods of time if frozen at -70C in presence of 25% glycerol. Add the
appropriate volume of 50% glycerol to your positive cell culture (0.5 mL)
to reach a final concentration of 25% glycerol, invert a few times to
homogenize the content, and store it at -70C.

DNA Sequencing

Each sequencing reaction can accurately sequence about 600 to 800 bp. In this
experiment, you will use five sequencing reactions to ensure the full coverage of
your T7 RNA polymerase insert containing about 2,655bp. Once the five sequencing
results will be returned to you, your challenge will be to examine the overlaps
among the five sequencing results to deduce the complete sequence of your insert.
The assembly process of different sequencing results is commonly referred to as
gene assembly.

The five sequencing primers you will use for priming DNA sequencing are:

Seq F1: 5-CTGTTGACAATTAATCATCGG-3
Seq F2: 5-GGGCACGTCTACAAGAAAGC-3
Seq F3: 5-TACAAAGCGATTAACATTGCGC-3
Seq F4: 5-GCTGAGCAAGATTCTCCGT-3
Seq F5: 5-GCTGCTGGCTGCTGAGGTC-3

26. Retrieve the miniprep corresponding to your positive transformant and
purify it using the Nucleospin PCR clean-up system as explained in
Appendix E3 with one important modification. You should elute once
24
with 30 and then, elute a second time with 30 (see step 8 in
Appendix E3). This modification will help ensure that the final
concentration of the purified plasmid DNA is enough to meet the minimum
concentration requirement for DNA sequencing.

The procedure for DNA sequencing is relatively straightforward, but very
sensitive. The amount of DNA template is critical: either a too low or a too high
concentration of DNA can significantly reduce the number of nucleotides that can be
read or sequenced. To ensure a good estimate of the DNA concentration of your
purified miniprep product to be sequenced, an aliquot will be analysed using the
Epoch microplate spectrophotometer.

27. Take 3 of your purified plasmid to be sequenced and transfer it onto an
empty spot on a Take3 microplate (see Lab 2 Procedures Part B). Please
note where your sample was loaded (row and column, e.g. A1, G2, )

28. Use the output file to calculate the concentration of your purified
recombinant plasmid DNA.

The minimal concentration required for proceeding to DNA sequencing is
100 ng/ . If your concentration is below that minimum threshold, you
will have to borrow the sequencing results of another group having
worked with the same mutant number.

DNA sequencing will be performed at the McGill and Genome Quebec
Innovation Centre in Montreal. Samples are to be labeled as
Day_lab#_Group#_Mutant#_Primer (e.g. Monday_202_Gr8_M2_SeqF1). You will
be asked to enter your sample names in an electronic file to be directly sent to the
sequencing centre along with your samples. The sample names you enter will be the
ones used when the sequencing results are posted.

29. Samples are to be loaded on a 96 well plate with 1 row for each group.
Load 7.5 of your purified DNA plasmid into each of the first five wells of
your lane, and 10 of the appropriate primer in each of the next five
wells. It is very important that you follow these guidelines when loading
the 96 well plates.



Protein Expression Induction

Theory:
Expression of the T7 RNA polymerase from the recombinant pTAC-MAT-Tag-1/T7
construct is tightly regulated by a repressor system (usually the Lac operon).
25


Procedure:
Groups 1, 9 and 17

These groups will be in charge of preparing the 1
st
set of extra controls (see
schematic on next page)

Groups 2, 10 and 18
26

These groups will be in charge of preparing the 2
nd
set of extra controls (see
schematic on next page)

Groups 3, 11 and 19

Prepare 500 mL of 1X Binding Buffer (0.5 M NaCl, 20 mM Tris-HCl, 10 mM
imidazole, pH 7.9)

Groups 4, 12 and 20

Prepare 200 mL of 1X Binding Buffer (0.5 M NaCl, 20 mM Tris-HCl, 10 mM
imidazole, pH 7.9). This binding buffer will be used to wash the column.

Groups 5, 13 and 21

Prepare 20mL of 4X Elute Buffer (1M imidazole, 2 M NaCl, 80 mM Tris-HCl,
pH 7.9)

Groups 6, 14 and 22

Prepare 10 mL of 4X Strip Buffer (2 M NaCl, 400 mM EDTA, 80 mM Tris-HCl,
pH7.9)

Groups 7, 15 and 23

Prepare 10 mL of 8X Charge Buffer (400 mM NiSO4)

Groups 8, 16 and 24

Prepare 100 mL of 1X T7 Storage Buffer (30 mM HEPES, 0.15M K-Acetate,
0.25 mM EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5)

27
Part A: Induction of the expression of the T7 RNA polymerase

Step 1 is to be completed between 8-10:30am on the day preceding your
regular lab class. Monday groups are to return to the lab on the preceding
Thursday morning. You should plan about 20 min to complete the inoculation
procedure.
The schematic below is a summary of this weeks experiment (presented in A).
Groups 1, 9 and 17 will be asked to do the 1
st
set of extra controls (B) whereas
groups 2, 10 and 18 will have the responsibility of preparing the 2
nd
set of extra
controls (C).



28
1. Put your tube with your cryopreserved transformant cell line on ice
into a snap-cap tube containing 3 mL of liquid LB medium with 100
Put your inoculated tube in the shaking incubator at
37C overnight.

2. Recover your inoculated snap cap tube from the incubator and transfer
0.5 mL of the cell suspension into a flask containing 50 mL of liquid
LB+AMP. Return your inoculated flask to the shaking incubator at 37C
for 2 hours.

You can now prepare the solution that was assigned to your group and
that will be used for the MAT tag affinity chromatography next week.

3. After 2 hr of growth, check the A600 of your cell culture. This can be done
by swirling the flask gently to homogenize the contents of the flask,
tilting the flask to fill the sidearm with some liquid broth, and then
inserting the sidearm into the aperture of the spectrophotometer to
read the absorbance at 600nm. If the absorbance is below 0.25, return
your flask in the incubator for another 30 min before verifying the
absorbance again.








Culture flask with a sidearm

A reference aliquot (before induction) is to be put aside before
proceeding to induction with IPTG. This initial aliquot is to be
compared with a second aliquot to be sampled at the end of the
induction with IPTG (after induction; see steps 6 and 8).

4. Transfer 1 mL of the culture into a 1.5 mL microfuge tube. This non
induced aliquot (before induction control) is to be used to prepare a
total protein extract at Step 8. The groups that are responsible for the
collective controls should also take a sample at this step.

5. Figure out the volume of a 100 mM IPTG stock that should be added to
your culture to obtain a final concentration of 1 mM. Add the IPTG to the
flask and put it back in the shaking incubator at 37C for 2 hours.

29
6. Transfer 1 mL of the culture into a 1.5 mL microfuge tube. This IPTG-
induced aliquot (after induction control) is to be used to prepare a total
protein extract at Step 8. The groups that are responsible for the
collective controls should also take a sample at this step.

7. Transfer the contents of your flask into a 50 mL Nalgene centrifuge tube
and centrifuge at 6,000g for 5 min at 4C . Discard the supernatant and
freeze your pellet of cells at -20C until next week.

Next week, only your IPTG-induced cell pellet will be used for the
purification of your MAT-tagged T7 RNA polymerase by MAT tag affinity
chromatography. The other two 1 mL aliquots put aside at steps 4 and 6
are to be kept for SDS-PAGE analysis.

8. Recuperate the two 1 mL aliquots put aside at Steps 4 and 6, and
centrifuge them for 1 min at 13,000 rpm. Discard the supernatants and
hypotonic environment triggering cell bursting and release of cytosolic
These two aliquots are to be stored at -20C ; you will recuperate those
aliquots for SDS-PAGE analysis to be done in lab 6.

The extra two series of controls prepared by pre-designated groups
should be similarly mixed with the 2X loading buffer and returned to
the TA. Those controls are to be assessed by SDS-PAGE.


30


Immobilized Metal Ion Affinity Chromatography (IMAC)

Theory:
Fractionate protein extracts based on their affinity for metal ions
o The molecular principle of the IMAC purification is based on the
formation of a coordination bond between an immobilized metal ion
(usually Ni
2+
or Co
2+
) and an electron donor present on the
recombinant protein to be purified. His-Bind (Novagen) is an
example of an IMAC column. These columns are composed of agarose
beads that are covalently linked to a metal chelater known as
iminodiacetic acid (IDA). The IDA molecules chelate nickel ions (Ni
2+
)
that can form co-ordination bonds with others substances. There are
3 sites of the coordination bond available for interaction with metal
ions in the column(Site 1 to 3 that are occupied by water molecules).
Purification of MAT-tagged proteins by IMAC.
o Histidine residues were chosen mainly because they have a strong
affinity for metal ions. They are present in most proteins, but due to
the fact that they are mildly hydrophilic, they are not always found on
the protein surface. We can therefore use IMAC to specifically purify
recombinant proteins by using plasmid vectors that have been
genetically engineered to add histidines to the C or N-terminals of
recombinant proteins. These adjacent histidines can interact with the
metal-ions of the IMAC column via the nitrogen of the imidazole ring.
The MAT tag contains four histidines alternating with another amino
acid (HXHXHXH). These interactions between metal ions and proteins
are extremely complex. They can also be the combined effect of
electrostatic (or ionic), hydrophobic, and/or donor-acceptor
(coordination) interactions.
Elution of MAT-tagged proteins bound to the IMAC column.
o Imidazole is used to elute recombinant MAT-tag proteins bound to the
Ni
2+
of the IMAC column. An excess of imidazole is added to the
column and this results in a competition between histidine and
imidazole for the coordination bonds. The excess of imidazole in the
column leads to the displacement of the histidines and therefore, the
elution of the recombinant proteins.

Procedure:
Part A: Cell Lysate Preparation

1. Resuspend your cell pellet from last week in 10 mL ice-cold 1X Binding
Buffer.

31
2. Set the knob of the sonicator to half power and sonicate your cell suspension
for 1 min while maintaining your tube on ice. Incubate your tube on ice for 1
min. Repeat sonication/cooling two more times.

Sonication helps solubilize proteins, but it also shears DNA. Always
keep your tube on ice during sonication to prevent overheating and
protein denaturation.

3. Centrifuge your sonicated cell suspension at 14,000g for 20 min at 4C. Then
put your tube on ice. This fraction is to be loaded on the IMAC column at Step
9.

4.
microcentrifuge tube. This solution will be your Input Control.


Part B: MAT-Tag Affinity Chromatography

Column Preparation

4. Remove the bottom and top column caps and allow the remaining stripping
buffer to flow through. Discard this fraction.

Put the caps in a safe place so you can recover them to seal your
column when you have completed the process of purification. We need
to reuse these columns and a column without its caps cannot be reused.

5. Add 3 bed volumes of distilled water onto the column and let it flow
through. The column bed corresponds to the matrix that is packed into the
column. For the column you use, the bed volume is 1.25 mL.

When pouring a solution into a column, make sure that the level of
liquid has just reached the bed surface before proceeding to another
solution. If another solution is added while some liquid from the
previous step still remains above the resin, the transferred solution will
be diluted and this might negatively affect the chromatography process.
On the other hand, avoid extended delays between steps as the surface
of the bed resin might dry out.

6. Add 5 bed volumes of 1X Charge Buffer and let it flow through the column
(column should turn to a blue/green color).

7. Add 3 bed volumes of 1X Binding Buffer and run through column.


Purification of MAT-Tagged Proteins
32

8. After the Binding Buffer has drained, load column with prepared cell extract
(10 mL). Take a 1.5 mL aliquot of this 10 mL solution after it has gone
through the column (Flowthrough control).

9. Wash column with 12.5 ml 1X Binding Buffer. Take a 1.5 mL aliquot of this
12.5 mL solution after it has gone through the column (Wash 1 control).

10. Wash column with 7.5 ml 1X Binding Buffer. Take a 1.5 mL aliquot of this 7.5
mL solution after it has gone through the column (Wash 2 control).

11. Elute protein from column with 7.5 ml 1X Elute Buffer in a 15 mL tube. The
solution coming out of your column contains your recombinant T7 RNA
polymerase. Keep this solution on ice until the Desalting procedure.

Keep all the protein fractions you generated from the purification
procedure so you can assess their concentrations by absorbance at
280nm BEFORE leaving the lab. You should measure the absorbance at
280nm of all your controls as well as your purified protein


Column Stripping

12. Wash column with 3 column bed volumes of 1X Strip Buffer. Allow half of
the buffer to run through column and then cap both ends of the column.
Return the capped column back to TA.

Part C: Desalting of the Purified MAT-Tagged T7 RNA Polymerase

Some contaminants that are found in the elution buffer, especially the high
imidazole concentration, might interfere with the activity of your recombinant T7
RNA polymerase that will be assessed next week. In this experiment, you will use a
centrifugal filter column with a molecular weight cut-off of 50kDa for substituting
the elution buffer (250 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) of your
eluted fraction with T7 Storage Buffer (30 mM HEPES, 0.15 M K-Acetate, 0.25 mM
EDTA, 0.05% Tween 20, 1 mM DTT, pH 7.5). The underlying principle for buffer
substitution is to use a column with a filter that allows small molecules to flow
through, but not the larger ones. After the solution has been filtered, the appropriate
buffer is used to resuspend the large molecules that stayed inside the column. The
figure below illustrates the procedure to be used.

33


13. Transfer the final eluted sample from Part B by filling the inner column
provided in the tube. Notice that not all of your eluted sample can fit into the
column tube, but you will be able to add the remaining fraction after the first
centrifugation.

14. Centrifuge at 4,000g using a swinging bucket for 8 min at 4C .

15. Transfer the rest of the purified protein sample into the column tube, and
centrifuge again at 4,000g for 8 min.
before adding the second fraction. If too much is left inside your column
after the first centrifugation, you can simply centrifuge for another 5
min before loading the remaining fraction. The rate of filtration during
centrifugation can vary significantly due to the occlusion of the pores
with large cell fragments. Never let the membrane dry out completely.


16. Fill up the inner column with T7 storage buffer and centrifuge at 4,000g
again for 10 min.

17. Repeat step 16.

18. Transfer the solution remaining in the inner column to a 15 mL conical
centrifuge tube and fill it up to 2 mL with T7 Storage Buffer.

SDS-PAGE (Polyacrylamide Gel Electrophoresis)

Theory:
o When an electric potential difference is applied to two electrodes immersed
in a solution of substances whose molecules bear an electric charge, the
electrostatic attraction causes movement of the charged particles towards
the electrode of opposite charge. This phenomenon is called electrophoresis
34
and may lead to discharge at the electrode, electrolysis, if the particle reaches
it at the appropriate potential. The sample is usually applied to a porous solid
support, such as a gel, wetted with the appropriate buffer. The porous
support not only decreases diffusion but it also provides a molecular sieving
effect. For protein separation, the most common support is a gel of
polyacrylamide poured between 2 glass plates forming a very thin vertical
slab.
o The rate of electrophoretic migration of a protein is a function of the voltage
gradient, the pore size of the support matrix and the charge and "size" of the
protein; the latter parameter combines both molecular weight and
conformational effects. The overall size of a protein molecule is determined
by the folding of the protein and by the presence of intra- or intermolecular
disulphide bridges. These bridges can hold the folded molecule together or
form polymers of protein molecules by linking different molecules together.
To be able to distinguish between these folding and bridging effects, the
sample can be treated to insure that all molecules have the same
conformation, thereby making migration solely dependent upon molecular
weight and electrical conditions. This treatment involves dissolving the
sample in a buffer containing 1-2% sodium dodecyl sulfate (SDS, a detergent)
and 0.5- -mercaptoethanol (SHCH2CH2OH). Mercaptoethanol reduces -
S-S- cross-linked polymers to monomers and SDS binds to all proteins at a
high ratio (1.4 g SDS/ g protein) and also unfolds the protein at the same
time. Since SDS is negatively charged at the pH used for the electrophoresis,
the SDS-protein complex becomes negative with a charge density that is
independent of the protein size. Thus, the mobility in SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) is independent of the intrinsic protein charge or
conformation and is solely dependent on the protein molecular weight. A
linear relationship is obtained when the log molecular weight of standards is
plotted against mobility, thus serving as one of the major means to determine
protein molecular weight. This technique (SDS-PAGE) has become the most
widely used techniques for determining the molecular weight of a protein
and is now generally used to analyse proteins in conjunction with the
Western blot method.
o Once separated, the components of the sample may be recognized by a
variety of means such as staining with Coomassie Blue R or other stains.
o In order to determine the molecular weight of a protein on a SDS-PAGE gel,
we need to have a reference marker. In this lab, you will be using a molecular
weight marker called, Rainbow
TM
ladder. This ladder is a mixture of
individually colored and purified proteins of known molecular weights.
35


Procedure:
1. In this section, the protein profile of the different controls that were
prepared by some groups in lab 5 will be compared to your IPTG-induced
sample. For the electrophoresis, you will be using two pre-cast gradient gels
(4-20% acrylamide).
2. Run a gel electrophoresis with a rainbow marker (7.5ug/5uL -- load 5 uL), 1
mL aliquot before induction and 1 mL aliquot after induction (load 10 uL),
same w sets of controls.
3. Heat all samples, except the Rainbow marker, in a thermocycler at 95C for 5
min. After the sample has been boiled, briefly spin down your tubes to collect
your sample at the bottom.

4. Assemble the gel support and position the gels in the electrophoresis
apparatus. Prepare 1X Running (HEPES) Buffer and fill the upper and lower
chambers. The running buffer in the outer chamber should be at least
halfway between the tops of the short and the long glass plates. The level of
the buffer in the inner chamber should be at least 3 cm above the bottom
edge of the gel sandwich.

5. Load of each sample, but only of the Rainbow markers. Position
the tip above the well and insert it not more than 1mm into the well, and
slowly release the sample.

Do not force the pipette tip too far into the well as this will separate the
plastic casing around the gel and let your sample diffuse into the
surrounding buffer. This will cause the entire gel to fail.

6. Run the gel at 150V until the blue tracking dye gets close to the very bottom
of the gel (about 30 to 45 minutes).

36
Gel staining

7. After electrophoresis, place your gel into a microwavable tray containing
about 100 mL of distilled water, and microwave for 90 seconds without a lid.

8. Discard the water and repeat step 24.

9. Add distilled water to fully cover your gel and transfer the tray onto the
waver for for 5 minutes under gentle agitation. Discard water from gel.

10. Use the pump dispenser to add just enough of the GelCode Blue Stain
Reagent to cover your gel, and microwave without a lid for 1 minute or until
the solution begins to boil. Do not let solution boil to evaporation.

11. Remove the tray from the microwave oven, put the lid on it and transfer the
tray onto the waver for 5 min under gentle agitation.

12. To destain, discard staining reagent in the sink and replace with 200 mL of
distilled water. Incubate on the orbital waver with the lid on for about 10 min
or until bands become clearly visible.

13. Scan gels


Western Analysis

Theory: Allows better resolution of the protein bands than SDS PAGE
o Protein transfer from polyacrylamide gels can be accomplished by
electrophoretic transfer that is done by placing the buffer-soaked gel-membrane
"sandwich" between plate electrodes (semi-dry transfer).

Figure 1. Components of the semi-dry protein transfer sandwich.

37
o Use a a PVDF membrane with high binding capacity, 140-
2

membrane, allowing for efficient protein retention.
o The immune probing of your MAT-tagged T7 RNA polymerase will be achieved
with a primary monoclonal anti-MAT tag antibody able to bind with any protein
containing the MAT epitope (HNHRHKH). Denaturing conditions are used to
ensure full linearization and optimal exposure of the MAT tag for binding of the
anti-MAT tag antibody (the MAT tag could remain concealed within the protein
core under non denaturing conditions). You will be using a polyclonal secondary
antibody raised against the constant or Fc fragment of the primary antibody that
has been conjugated with alkaline phosphatase. This enzyme, which mediates
the conversion of a colourless substrate into an insoluble blue product, is
responsible for the colorimetric detection.



Figure 2. Detection of the recombinant MAT-taggedT7 RNA polymerase by
western blotting. (A) Summary of the various steps in a western blotting
procedure. (B) This cartoon is a zoom in of the antigen-antibody complex which is
38
representative of your western blot membrane at the end of the western blot
procedure (step 7).
D. Enzymatic activity of the T7 RNA polymerase

The T7 RNA polymerase catalyzes the synthesis of RNA in a 5 to 3 direction. T7
RNA polymerase is often used in molecular biology since it can synthesize RNA from
any piece of DNA located downstream of its specific promoter, the T7 promoter. T7
RNA polymerase is relatively easy to assay as its activity doesnt require any
cofactors. The four essential reagents for assessing T7 RNA polymerase activity are:

o An enzyme source, which will be your recombinant T7 RNA polymerase

o A DNA template T7 RNA Polymerase exhibits extremely high specificity for
its cognate promoter sequence. The DNA template to be used in a
transcription assay for T7 RNA polymerase should therefore contain the T7
promoter motif, 5 T AAT ACG ACT CAC TAT A 3, upon which the T7 RNA
polymerase can bind and initiate transcription. In this experiment, you will
use a plasmid pre-digested with a restriction enzyme as the DNA template.
The linearization of the plasmid DNA template is desirable to ensure that
transcription can be terminated at a specific position and, therefore, ensure
that all transcripts are the same length. In the lab, you will be provided with
an open DNA template derived from a recombinant pBluescript vector whose
transcription product should be approximately 1.8 kb.

o Free ribonucleoside triphosphates

o Pyrophosphatase is added to remove inorganic pyrophosphate, a T7
polymerase inhibitor that is released during the transcription assay.

o (Optional) Ribonucleases inhibitor is facultative, but highly recommended
for preventing the enzymatic degradation of the transcribed product.

o In the protocol that you will use, the transcription product will be assessed
by agarose gel electrophoresis. Transcription activity will therefore be
estimated based on the intensity of the RNA transcript visible on an agarose
gel. In research labs, diethylpyrocarbonate (DEPC) is used to inactivate any
contaminating ribonucleases, which will quickly digest your RNA transcript.
Buffer and water are treated with DEPC before performing the transcription
assay. However, since DEPC is toxic and volatile, our solutions wont be
treated with DEPC and therefore, you should be extremely careful while
preparing your enzymatic assay. Samples collected during the enzymatic
39
assay should always be kept on ice. You should also proceed quickly when
loading your agarose gel with your RNA samples.

Procedure:

Part A: Electrophoresis of the purification samples on SDS-PAGE gel

You will be using a pre-cast gradient gel with 4-20% acrylamide.

1. Prepare aliquots for electrophoresis by mixing them with an equal volume of
2X Sample Loading.

Table 1. Loading sequence on SDS-PAGE gel


2. Refer to steps 23-30 of Experiment D in lab 6 for details on the preparation
and staining of SDS-PAGE.

At the end of the electrophoresis, place the gel on a clean surface and
cut it at Well #8 with a blade. The first part of the gel corresponding to
Lanes 1 to 7 will be transferred to the PVDF membrane whereas the
second part of the gel (Lanes #9 to 15) will be stained using the Gel code
blue staining reagent.
Lane Sample Sample
volume


2X
Loading
buffer

Loading
volume


1 Rainbow marker (7.5ug/5ul) - - 5
2
3
4 Wash1 control,
5 Wash2 control,
6 Purified protein,
7
-8- --------------------------Blank: cut zone-------------------------- -------- ----------- -----------
9
10 Rainbow marker (7.5ug/5ul) - - 5
11
12
13 Wash1 control,
14 Wash2 control,
15 Purified protein,
40
Part B: Electrophoretic semi-dry protein transfer

3. Carefully remove the piece of the gel dedicated to the transfer and place it in
a plastic dish containing 50 mL of Transfer Buffer (25mM Tris, 192mM
glycine, pH 8, 20% methanol). Wash with gentle shaking for 15 minutes.

4. Meanwhile, cut a piece of PVDF membrane the same dimensions (6 cm x 5
cm) as your gel. You should cut one corner of the membrane diagonally so
that you can orient the membrane correctly after transfer. Prepare the
membrane for transfer as follows:

a. Soak the membrane in methanol for a few seconds. The colour will
change from opaque white to uniform, translucent gray. Be
careful working with the methanol as it is toxic. Do not get
any methanol on exposed skin and wipe up any spills
immediately.
b. Soak the membrane in distilled water for at least 2 minutes.
c. Soak the membrane in transfer buffer for at least 10 minutes.

The membrane should not be allowed to dry out during any of the above
hydration steps. If any drying occurs (opaque areas appear on the
membrane), perform quick rinses as in steps 4a-c above. Handle the
membrane on the edges with forceps at all times!! Finally, make sure to
smooth out any air bubbles between each layer of the transfer assembly. Air
bubbles will prevent efficient transfer of the proteins and will make
subsequent analysis difficult.

5. Transfer will be carried out using the BioRad Transblot semi-dry transfer
unit. The
unit is
large
enough to
simultaneo
usly
accommod
ate four
SDS-PAGE
gels.
6. Assemble
the Trans
Blot Semi-
Dry
Transfer
System as
follows:
41
a. Load the bottom of the transfer unit (the platinum anode) with
two sheets of filter paper pre- in the Transfer Buffer and cut to the
same size as your membrane. Be careful not to introduce any air
bubbles.
b. Roll a pipette or glass rod over the surface of the paper to exclude
all air bubbles that would interfere with ionic conductivity and
protein transfer.
c. Place your pre-soaked PVDF membrane on top of the filter paper
and roll out any air bubbles.
d. Carefully lift the gel from the transfer buffer, place it on top of the
membrane and roll a pipette or test tube over the gel to make sure
that good contact is achieved with the membrane.
e. To complete this 'sandwich' put a piece of transfer buffer-
saturated filter paper on top of the gel and remove any air bubbles.
f. Place the cathode of the transfer unit on top of the stack, being
careful not to disturb the stack.
g. Place the safety cover on the unit and connect the cables (these are
colour-coded, too).

7. Transfer is done at 0.3A for 45 minutes.

8. Turn off the power supply, remove the cover and carefully peel off the upper
layer of filter paper and the gel, without the membrane.

9. Rinse the membrane two times for 5 min in a plastic dish with 50 mL of TBS
+ 0.05% Tween20. Maintain gentle agitation during the rinses.

If the transfer was successful, the colored markers should be visible on
the membrane.

10. At this point the transfer membrane can be sealed wet in a plastic bag and
stored at 4C for a week.

Completion of the western blot analysis
Blocking membrane

11. Recuperate your membrane and transfer it to a plastic dish with 50 mL of
blocking buffer (TBST, 5% non-fat dry milk). Put your plastic dish onto the
waver and incubate for 30 min with gentle mixing. (TBST: 20mM Tris,
150mM NaCl, pH 7,4 + 0.05% Tween20)

12. Wash the membrane with 50 mL of wash buffer (TBST) for 5 min with
gentle mixing. Discard the wash buffer and repeat the wash two more times.

Primary anti-MAT antibody binding

42
13. A 5000X dilution of the commercial anti-T7 RNA polymerase antibody
(Novagen) has already been prepared by the Support Staff. Place the
membrane on a Ziplock bag and pipette all 3 mL of the pre-diluted primary
antibody (TBST) onto the protein side of the membrane. Carefully push out
all air bubbles between the membrane and close the bag. Place the bag with
your membrane onto the waver for 1 hr, but gently massage the bag content
with your fingers every 10-15 min to ensure complete mixing.

14. Discard the antibody/buffer solution and transfer the membrane to a plastic
dish.

15. Wash the membrane with 50 mL of wash buffer (TBST) for 5 min with
gentle mixing. Discard the wash buffer and repeat the wash two more times.

Binding of secondary rabbit anti-mouse IgG conjugated with alkaline
phosphatase

16. A 3000X dilution of the commercial secondary antibody has already been
prepared by the Support Staff. Place the membrane in a new baggie (refer to
step 3) containing 3 mL of the pre-diluted secondary antibody (TBST) and
put on the waver for 1 hour. Again gently massage the bag every 10-15 min.

17. Decant and discard the antibody/buffer. Transfer the membrane to a plastic
dish.

18. Wash the membrane with 50 mL of wash buffer (TBST) for 10 min with
gentle mixing. Discard the wash buffer and repeat three more times.

19. Rinse the membrane with 50 mL of distilled water for about 30 sec. Discard
water and repeat the rinse procedure one more time. Discard the water of
the second rinse.

20. Apply 5 mL of Western Blue Substrate and monitor the appearance of
the blue bands. Reaction takes about 30 sec to 10 min. Longer reaction times
will result in higher background. The reaction can be stopped at any time by
quickly decanting the Western Blue Substrate and substituting it with
distilled water. You can rinse with water one or two more times to
completely remove the Western Blue Substrate.
21.

Part C: Optimization of the T7 RNA polymerase enzymatic assay





43



















Figure 4. Examples of enzymatic assay. In A), four individual reactions are
prepared. One reaction will be kept on ice as a T
o
control. The remaining three
reactions will be placed in a water bath at 37C. At each specific time point (T
1
to
T
3
), one reaction will be taken out of the water bath and placed on ice to stop the
reaction. In the second method (B), 3 to 5 reactions are combined in one tube to
taken and transfered to a new tube on ice which is pre-labeled (T
0
). The master
reaction is then transferred to a water bath at 37C. At each time point, you will take
a 5-
should be kept on ice.


General Guidelines for the Transcription Assay


75 ng of DNA template (1
120mM MgCl2, 10mM spermidine,
200mM DTT, 400mM Tris pH 8.0)


100U/mL
0.05-


1. Incubate @ 37C for up to 30 min.

44
2. Remember that each time you take an aliquot or take out a reaction
from the water bath, you should immediately mix with 10X Loading
Buffer.

3. Keep all your reaction on ice until you have collected all your samples.

4. Proceed to electrophoresis and take a picture of your agarose gel.



Transfection
Theory:
o Transfection is the process of deliberately introducing nucleic acids into cells.
The term is often used for non-viral methods in eukaryotic cells.[1] It may
also refer to other methods and cell types, although other terms are
preferred: "transformation" is more often used to describe non-
viral DNA transfer in bacteria, non-animal eukaryotic cells, including plant
cells. In animal cells, transfection is the preferred term as transformation is
also used to refer to progression to a cancerous state (carcinogenesis) in
these cells. Transduction is often used to describe virus-mediated DNA
transfer.
o One of the cheapest methods uses calcium phosphate. HEPES-buffered saline
solution (HeBS) containing phosphate ions is combined with a calcium
chloride solution containing the DNA to be transfected. When the two are
combined, a fine precipitate of the positively charged calcium and the
negatively charged phosphate will form, binding the DNA to be transfected
on its surface. The suspension of the precipitate is then added to the cells to
be transfected (usually a cell culture grown in a monolayer). By a process not
entirely understood, the cells take up some of the precipitate, and with it, the
DNA. This process has been a preferred method of identifying many
oncogenes.
o Electroporation


ELISA (Enzyme-Linked Immunosorbent Assay) Method

Theory:
ELISA uses colour changes to identify a substances prescence
45


SI Units
Length: meter (m)
Mass: kilogram (kg)
Time: second (s) [lower case]
Electric current: ampere (A)
Amount of substance: mole (mol)

SI prefix SI symbol Decimal value 10
x

(scientific)
value
pico- p 0.000000000001 10
-12

nano- n 0.000000001 10
-9

micro- 0.000001 10
-6

milli- m 0.001 10
-3

centi- c 0.01 10
-2

deci- d 0.1 10
-1

(no
prefix)
1 10
0

deca- da 10 10
1

hecto- h 100 10
2

kilo- k 1,000 10
3

mega- M 1,000,000 10
6

giga- G 1,000,000,000 10
9

tera- T 1,000,000,000,000 10
12



46
Absorbance

Beer-Lambert Law:


Where A is the absorbance at a specific wavelength, Io is the intensity of incident
light, It is the transmitted intensity, is the absorption coefficient at the specified
wavelength, c is the concentration of compound and l is the path length of the cell
(cuvette).




Percent Error and Yield



Molar Ratios for Ligations

Add ratio of insert to vector (e.g. 10:1)



Bacterial competence
(example)

You did a transformation with your new stock of competent cells. You used 10 ng of
plasmid and you got 100 colonies on your petri dish. Knowing that you only plated
1/10 of your transformed bacteria, what is the level of competency of your bacterial
stock?

With 10 ng, you get 100 colonies but this is only 1/10 of the transformation and
therefore, you have to multiply by the dilution factor (10x).
47

100 colonies X 10 (dilution factor) for 10 ng

5
colo


Making Agrose Gel and TAE buffer

1% Agarose gel casting

1. If necessary, prepare 1 liter of 1X TAE buffer using the 25X stock
solution available. Write down your name and the preparation
date on the flask.

2. In a 500 mL Kimax flat bottle (see figure) prepare 100 mL of 1%
(weight/volume) agarose in 1X TAE buffer.

3. To prevent evaporation, the plastic lid should be loosely added
mto the bottle, but not tightened.

Tightening the lid could lead to pressure buildup into the bottle during
heating and possible explosion.

4. Microwave until the agarose is completely dissolved in 3 x 30 sec pulses.
Do not allow the agarose to boil over!

5. Allow the agarose solution to cool down to 50-55C (if the agarose is too
hot it will warp the gel mold).

6.

7. Pour the agarose solution slowly into a casting tray fitted with a 20-well
comb. Dislodge any bubbles.

8. The gel should be ready (cooled, hardened and translucent) in about 30
min.

9. Once the gel has hardened, remove the comb carefully. Pouring a little
buffer on the surface of the gel around the comb can help.

10. Transfer the gel into the electrophoresis tank and add 1X TAE buffer up to
5mm above the gel upper surface the gel should be completed covered.


For 1 litre of 25X TAE buffer
121g Tris base (2-amino-2-hydroxymethyl-propane-1,3-diol)
48
28.6 mL glacial acetic acid
50 mL 0.5M Na2EDTA (pH 8.0)
Add H2O up to 1000 mL

Clontech Nucleospin PCR Clean-up system
(DNA purification by affinity chromatography)

1. Combine your DNA sample with 2 volume of the NTI buffer and mix
thoroughly.

2. Place a Nucleospin PCR Clean-up column into a 2 mL collection tube.

3. Apply your sample to the Nucleospin PCR Clean-up column.

4. Centrifuge for 30 sec at 11,000 x g. Discard the flow-through and return the
column to the collection tube. Your PCR amplicon is now attached to the
silica column. However there are also contaminants present that need to be
removed.

5. To remove these contaminants from your PCR
NT3 buffer to the column and centrifuge for 30 sec at 11,000 x g.

6. Discard the flow-through and place the column back in the same tube. Add


7. Discard the flowthrough and return the column to the collection tube, being
careful not to wet the bottom of the column with the flowthrough. Centrifuge
again for 1 min at 11,000 x g to evaporate any ethanol residue on the column.
It is crucial to eliminate residual ethanol left inside the column since it
will prevent or lower the solubilization of DNA in water and, therefore,
lower the amount of DNA that can be eluted.

8. Place the column in a clean 1.5 mL micro centrifuge tube (with a cap attach to
E buffer directly onto the center of the membrane. (Be
careful not to touch the membrane with the tip of the pipette.) Incubate
your Nucleospin PCR Clean-up column at RT for 1 min (this step is really
important to permit the complete desorption and resolubilization of
your DNA), and then centrifuge for 1 min at 11,000 x g to elute your DNA.

9. Discard the column and keep the 1.5 mL microcentrifuge tube containing
your purified DNA.

49
Chromatin Immunoprecipitation (ChIP)

Theory:
Chromatin immunoprecipitation (ChIP) is the technique used to identify and
characterize the DNA motifs onto which transcription factors can bind, that is the
transcription factor binding sites (TFBS). ChIP is particularly interesting as it can
directly assess protein-DNA interactions under in vivo conditions. This means that
ChIP results are truly representative of what happens inside the cells rather than
inside plastic reaction tubes such as for conventional in vitro studies. ChIP can also
be combined to high throughput sequencing such as displayed on the diagram
below. The main steps of a ChIP proctocol are:

Infiltration of the cells with formaldehyde to crosslink DNA-binding
proteins onto DNA.

Figure adapte de EMBO, 2008

DNA is extracted and sheared usually by sonication, which involves an
exposure to ultrasound frequencies above 20kHz, to release fragments of
300-1000bp in length.
DNA fragments can be further digested with nuclease(s) to remove as much
as possible the unprotected DNA. This step ensures better quality results by
cutting out the unbound DNA ends located on each side of the immediate
TFBS.
Cell debris in the sheared lysate is then cleared by centrifugation. The
proteinDNA complexes, which remain in suspension in the supernatant,
are incubated in presence of antibodies that can specifically bind onto the
protein(s) or transcription factor(s) of interest. There are several protocols
that can easily separate or immunoprecipitate the antibody-protein
complexes.
The DNA-binding proteins crosslinks can be reversed to release the DNA
targets.
The DNA fragments can then be analysed and sequenced using different
techniques, but high-throughput sequencing has now become a common
practice owing to lower sequencing costs.
The DNA sequences or the reads can then be aligned to visualize the binding
position of transcription factors along chromosomal DNA.
50
It is a common practice to proceed with a single antibody that can bind onto
one specific DNA-binding protein. For such a scenario, the sequencing
results correspond to the different DNA motifs (TFBS) onto which a given
transcription factor of interest can bind. Further alignment analysis can be
done to identify a consensus of the different DNA motifs recognized by a
single transcription factor of interest.