1

Chapter 1
INTRODUCTION

Non alcoholic fatty liver disease (NAFLD) is a reversible condition where
liver cells become hoarded with large vacuoles of triglyceride fat by the process
called steatosis (Brunt, 2010). It is rapidly becoming a worldwide public health
problem. It comprises a broad range of liver damage, involving asymptomatic
steatosis with high or normal aminotransferases to steatorrhea with swelling,
ballooning degeneration and cellular fibrosis (Nonalcoholic Steatohepatitis,
NASH) to cirrhosis (Barshop and Loomba et al., 2009). On the basis of different
causative factors it is categorized as Alchoholic Fatty Liver Disease (NAFLD) and
Non Alchoholic Fatty Liver Disease (NAFLD). So it does not follow a simple
Mendelian pattern of inheritance but it involves multiple genes, environmental
factors, age effects, and their interaction (Thomas, 2004). Prevalence of NAFLD
reaches 15%-20% in general population.

Series of hepatic pathologies are associated with NAFLD which include
relatively benign steatosis that may, under the influence of multiple triggering
factors, progress to the more severe condition of non-alcoholic steatohepatitis
(NASH), characterized by accumulation of fats, necro-inflammation, and
eventually fibrosis (Brunt, 2010). Throughout the world specially including United
States fatty liver disease is more common and now 2030% of the general
population in North America and similar countries affected by NAFLD (Angulo,


2

2007) and it is also estimated that NAFLD is 20%-30 % more prevalent in western
countries (William, 2006).

In the beginning it was thought that women is more affected by NAFLD as
compared to men but this belief lacks realistic support (Fan et al., 2005).The study
on the prevalence of NAFLD showed that 26527 Asian subjects getting medical
health checkups having 31% prevalence in men and 16% in women (Chen et al.,
2004). So majority of men were patients of NAFLD showed by clinicopathological
summaries of patients from India (Sorrentino et al., 2004). An elevated
aminotransferase level in Male gender was also related to histological NASH,
hepatic fibrosis and overall mortality. Only a few studies propose that female
patients along with metabolic syndrome is an autonomous risk factor for NASH,
NAFLD and fibrosis.

Children of age 2 9 years having the most common liver abnormality
called NAFLD. It is indicated that 1 of every 10 children have macrovesicular
hepatic steatosis are important consequences for the long-term health of children
and young adults. The effects of risk factors after recognition should be taken in to
consideration in the development of protocols designed to screen at-risk children
and adolescents.

Environment also plays a major role in the etiology of NAFLD, especially
in genetically susceptible populations. In recent years, alteration of lifestyle and
dietary habits dramatically increases incidence of NAFLD (Fan et al., 2005.


3

Relationship between age and the prevalence of NAFLD shows that older
(NAFLD) patients have a higher probability of disease development or mortality
(Ong et al., 2010). In older age there is an increase chance of raising some related
problems such as severe hepatic fibrosis, hepatocellular carcinoma and type II
diabetes mellitus (Ascha et al., 2010). An increase in ALT activity

as well as with
hepatic steatosis in individuals with mysterious liver enzyme elevations was
associated with younger age.

In contrast to these findings, Hui and colleagues note
no significant differences in age between individuals with progressive NAFLD and
those who do not progress.

In fact, older age is an independent factor for important
hepatic steatosis showed by a study of potential living liver donors. (Loria et al.,
2005). Cryptogenic cirrhosis, is more frequent in older diabetic patients with
present or past obesity by Caldwell in 1999.

In addition to other factors composition of the intestinal microflora, clearly
in part considerations of diet are important factor in fatty liver disease (Solga and
Diehl, 2003). In contrast to environmental risk factors, a number of genes have also
been identified associated with fatty liver. The prevalence of NAFLD is not clear
for ethnic differences. Some correlated risk factors of NAFLD, such as the extent
of visceral adiposity, are similar across ethnic groups reported by Wagenknecht
and colleagues. On the other hand, In Hispanics age, triglycerides (TG) are only
associated with NAFLD, and level of serum adiponectin is only associated with
NAFLD in African Americans.

NAFLD is caused by Important, but unidentified,
genetic or environmental factors. The genetic variant Patatin-like phospholipase
domain containing protein-3 (PNPLA) and glucokinase regulatory protein (GCR)


4

single nucleotide polymorphism (SNPs) in pediatric population were responsible
for up to 39% of the liver fat, published in the March issue of Hepatology, a journal
of the American Association for Disease.

Peroxisome proloferator-activated receptor Gamma (PPAR) gene is one of
the main reason of NAFLD. It plays a key role in regulating the synthesis, storage,
and export of hepatic triglycerides and consequently the level of NAFLD. This
gene is responsible to encode a member of the peroxisome proliferator activated
receptor (PPAR) subfamily of nuclear receptor. DNA binding and transcriptional
activity reduces in vitro, was associated with the C/G polymorphism(rs1801282), a
Pro-Ala exchange that results in the replacement of proline with alanin at codon 12,
and the G cariers showed significant improvement in insulin sensitivity (Deeb et
al., 1998). There are strong effects of PPAR on various diseases including
osteoporosis,

atherosclerosis, inflammation, carcinogenesis, type-2 diabetes
mellitus, insulin resistance and obesity (Chen and yue, 2008 and 2010).

Unpretentious mutilation of transcriptional activity due to decrease in
binding affinity of DNA was linked with decreased activity of PPAR in adipose
tissue, and decreased diabetes and insulin resistance was associated with
Polymorphisms (Pro12Ala SNP of PPAR2), reported in Caucasians (Tonjes et al.,
2006). Some reports show that growth of cancer cells are also caused by
polymorphism of Pro12Ala (Michalik et al., 2004). Mutation in codon 12 of exon
B of the PPAR gene which code Adipocyte specific (PPAR-2 isoform) define by
amino terminal residue decreases the chance of insulin resistance with allele


5

frequency 0.03-0.12 in some population. is caused by mutation in codon 12 of exon
B of the PPAR gene. (Schmidt et al., 1998). In Asian ultrasonographically proved
fatty liver patients show strong association of PPAR with clinical and biochemical
parameters (Bhatt et al. 2013).

Due to alteration in dietary habits Fatty liver disease (NAFLD) is now
becoming an increasing threat to Pakistani population. However, screaning of
genotype of Fatty liver population with associated markers and its genetic
occurrence among Pakistani population are scarce. Therefore, the projected activity
was planned to screen genetic susceptibility of local Pakistani origin population
towards PPAR with following objectives;
i. PCR genotyping of PPAR gene polymorphism
ii. Association of identified polymorphic form with fatty liver disease













6

Chapter 2

REVIEW OF LITERATURE

Fatty liver disease is considering as a metabolic syndrome. This metabolic
syndrome is strongly associated with the development of diabetes mellitus and an
increased risk of cardiovascular disease. Metabolic syndrome is a state which is
characterized by a group of symptoms together with insulin resistance, abdominal
obesity, dyslipedimia, elevated level of blood pressure and a proinflammatory state.
So it increases morbidity and mortality in respect of cardiovascular disease
(Reaven, 2001 and Grundy et al., 2004). Fatty Liver Disease comprises a broad
range of liver damage, ranging from asymptomatic steatosis with elevated or
normal aminotransferases to liver inflammation, and pericellular fibrosis
(Nonalcoholic Steatohepatitis, NASH) to cirrhosis (Barshop and Loomba et al.,
2009).

Significant increase in the chance of developing end-stage of liver is caused
by progressive increase of NAFLD to non-alcoholic steatohepatitis
(Neuschwander-Tetri and Caldwell, 2003). Due to its complex metabolic condition
the exact cause of NAFLD is not known, although both lifestyle environmental
genetic factors play an important pathogenic part in NAFLD (Angulo, 2002).
Dimitrova-Shumkovska et al., 2010 demonstrated that development and
progression of NAFLD is due to oxidative stress which is a result of bulk
production of reactive oxidant species (ROS) under over nutrition. (Csiszar et al.,


7

2009). However Smoking is also related with NAFLD so it is known to be an
increase risk of developing persistent low-grade inflammation (Pirkola et al.,
2010), which later play an essential role in the development of NAFLD (Byrne,
2010). There are some potential synergistic factors which are oxidative stress and
inflammatory response of inborn immunity acting in concert in the development of
NAFLD are oxidative stress and inflammatory response of innate immunity
(Byrne, 2010). Evidence provided by many epidemiological studies showed that
the development and progression of NAFLD is caused by interactions between
genetic and non-genetic risk determinants (Day, 2006).

In addition to well-known environmental risk variables, disease
susceptibility genes and associated single nucleotide polymorphisms have been
identified which offer an important tool for the diagnosis of individuals at risk.
It is estimated that among several candidate genes, PPAR gene polymorphisms
have been identified and explored for disease association, in various groups around
the world.

Peroxisome Proliferators Activated Receptor Gamma (PPAR)

Peroxisome Proliferators Activated Receptor Gamma (PPAR) plays a
important role in regulating the production, storage, and export of hepatic
triglycerides and as a result the degree of NAFLD. And it is also known in
regulation of fatty acid storage and glucose metabolism. Location of PPAR gene is
on chromosome 3, which is linked to the development of NAFLD. Transcription


8

factor PPAR-2 is involve in regulation of transcription and translation of frequent
target genes, which have been involved in adipocyte differentiation, lipid and
metabolism, and atherosclerosis ( Stumvoll and Haring, 2002). Wherever it is also
known that PPAR is the key regulator in the control of genes which involved in
lipogenic pathways of adipocytes, promoting the uptake of Fatty Acids(FAs) and
the differentiation of the adipocyte, with the subcequent increase in the cellular
content of TAGs (Tri acylglycerides) and decrease in the FA delivery to the liver
(Lazar, 2005). This receptor is highly expressed in fat deposit tissue and Lower in
skeletal muscle, spleen, heart and liver. Also evident in placenta, lung and ovary
(Mukherjee et al., 1997). PPAR involved in the activation of genes that stimulate
lipid uptake and adipogenesis by fat cells and it is experimentally proved when
PPAR was knockout from mice, it fails to generate adipose tissue when fed a
high-fat diet (Jones, 2005) thus proving that PPAR plays an essential role in fat
metabolism and present in different tissues for metabolism.

Tissue Specific Distribution and Cellular Functions of PPAR Gene

Target genes of PPAR are involved in many functions including , lipid
storage, adipocyte differentiation, glucose metabolism and include lipoprotein
lipase, CD36, adipocyte FA binding protein aP2, FA transport protein, acyl-coA
synthetase, phosphoenolpyruvate carboxykinase, aquaporin 7, and citrate carrier
(Stienstra et al., 2007 ; Dubuquoy et al., 2002; Damiano et al., 2012 ). PPAR
interact with chemicals which cause propagation of peroxisomes and these
organelles are responsible for the oxidation of fatty acids.


9

Two proteins are produced by PPAR gene, PPAR 1 and the nearly
adipose-specific PPAR 2. PPAR 2 has 28 additional N-terminal amino acids and
these amino acids present a 5- to 6-fold increase in transcription-stimulating
activity of the ligand-independent activation function-1 domain (Tontonoz et al.,
1994; Fajas et al., 1997). In adipose tissue this gene is highly expressed where it is
an important regulator of the transcriptional chain reaction underlying adipocyte
differentiation, as established in vitro by gain-of-function (Tontonoz et al., 1994
and Kletzien et al., 1992) and loss-of-function experiments (Ren et al., and Muller
et al., 2002).

Another key role of PPAR is the entraining of adipose tissue lipid
metabolism to nutritional state. Its expression is highest after meal, and its
activation leads to up regulation of genes that mediate FA uptake and trapping
(Schoonjans et al., 1996). When PPAR is expressed in, macrophages, muscles and
adipocytes where it regulates glucose metabolism. development, lipid homeostasis.

PPAR may also involve in bootless cycling in adipocytes between
triglyceride (TG) esterification and de-esterification (Guan et al., 2002). However,
the upregulation of glycerol kinase in human adipocytes is regulated by PPAR
was not replicated by a second study, which furthermore failed to find any
physiological confirmation of such glycerol cycling in human adipose tissue in
vivo (Tan et al., 2003).

An important feature of steatotic liver is increased expression of PPAR and


10

several studies shows its fundamental in steatosis development by mechanisms
involving activation of lipogenic genes and de novo lipogenesis. Adipose cells In
humans are much more abundant of PPAR ; yet reasonable levels of PPAR
mRNA can also be found in other organs including skeletal muscle, colon, lung,
and placenta but when we compare them we see that little amount of PPAR is
also expressed in liver and heart in contrast to adipose tissue, however, under
certain disease conditions, these tissues can express significant amounts of PPAR
that have an important impact on metabolic homeostasis and tissue function
(Wang, 2010).

Cytogenetic Location and Gene Map of PPAR
PPAR gene consist of 9 exons and have size more than 100 kb. 8 exons
are involved in coding PPAR 1and 7 exons in PPAR 2 and PPAR 1 uses exons
A1 and A2, whereas PPAR 2 uses exon B; both use exons 1 through 6. Location
base pair of this gene is start at 12329349 and ends at 12475855 bp. The
cytogenetic location of gene is 3p25.2 Fajas et al. (1997). The protein encoded by
this gene is the regulator of adipocyte differentiation called PPAR.

Polymorphism Associated With PPAR Gene
By multivariate analysis it is seen that NAFLD was associated with these
two polymorphisms (Bhatt et al., 2013). Two types of polymorphism are there in
PPAR gene. Out of which one is Pro12Ala polymorphism which is significantly
associated with higher serum TG, waist-hip ratio and alkaline phosphatase whereas
the C161T polymorphism with increased TG and total cholesterol. The C/G


11

polymorphism (rs1801282), in which Pro-to-Ala exchange take place is the results
of substitution of proline with alanine at codon 12, which in turn related with
reductions in both transcriptional activity and DNA binding in vitro, and the G
carriers showed significant improvement in insulin sensitivity (Deeb et al., 1998).
It has been demonstrated that other variant locus of PPAR gene are associated
with NAFLD in Chinese (Hui et al., 2008).

Recent studies have also indicated that insulin sensitivity improved by
Ala12 allele- which may involve enhanced suppression of lipid oxidation, which
permits more proficient glucose disposal (Thamer et al., 2002). Some studies
showed that polymorphism in PPAR may influence body mass index (BMI).and
BMI reflects the amount of fat, lean mass, and body build and it is also seen that
genetic variations in PPAR influence the carotid intimal medial thickness (CIMT)
which is a measure of atherosclerosis that is independently associated with
traditional atherosclerotic cardiovascular disease risk factors and coronary
atherosclerotic burden. 35 to 45% of the variability in multivariable-adjusted CIMT
is explained by genetic factors. Age is another factor responsible for fatty liver.
The Ageing Liver
Decline in liver function, hepatic blood flow (by 33%) and hepatic volume
(up to 25%), occurs between the ages of 20 and 70 (Frith, 2009), the reason of
reduction of liver volume and hepatic blood flow in the elderly is unknown, but it
tends to alter the pharmacokinetic profiles of drugs that undergo mandatory hepatic
oxidation (Schmucker, 1998). Furthermore, reductions in bile acid synthesis with
resultant change to bile acid secretion and bile flow. It is also seen that decline in


12

hepatic metabolism of LDL (Low Density Lipoprotein) cholesterol is also related
to age which leading to elevated serum cholesterol. Therefore, there combined
effects of changes in bile acid secretion and cholesterol metabolism possibly
contribute to increased serum cholesterol levels and an increased frequency of
gallstones formation.

A more important cause of NAFLD may come from dysregulation or
failure of peripheral adipose tissue storage sites leading to store excess energy as
TG, to abnormal lipid partitioning to the liver and other nonphysiological storage
sites like muscles (Larter et al., 2010 ). The ageing liver does appear to be more
susceptible to the effects of drugs and other toxins, having diminished regenerative
capacity to recover from insults, as evident by an increase in morbidity and
mortality in hepatic resections in experimental studies in patients greater than 60
years old (Mentha, 1992).

Anyhow, there are some pathways which provide an incomplete
explanation that why insulin resistance and premetabolic syndrome is strongly
associated with steatosis. Insulin involves in the activation of several nuclear
transcription factors that control a remaining process (in the case of sterol
regulatory element binding proteins (SREBP) 1 and 2) and glucose (in the case of
carbohydrate-responsive sterol regulatory element binding protein (ChREBP) 1)
(Musso, 2010, Larter et al., 2010, Shiota, 2009) . Both SREBP1 and ChREBP are
involve in activation of Fatty acid synthase (FAS) (activate biosynthesis of long
chain fatty acids) and regulation of cholesterol biosynthesis.


13








14

Chapter 3
MATERIALS AND METHODS
The present study was approved from Ethics Committee for the use of
human subjects, PMAS-AAUR. Blood sampling of human subjects was done on a
case control study design. Both fatty liver patients and healthy controls were aware
of study participation.

3.1: CRITERIA FOR SAMPLE COLLECTION OF NAFLD CASES
Sample collection for NAFLD patients was conducted in the OPDs of
various hospitals in Rawalpindi/Islamabad whereas controls were sampled from
ethnically matched general population. The definition of fatty liver disease
(NAFLD) requires that:-

a) There is evidence of hepatic steatosis, either by imaging or by histology.
There are no causes for secondary hepatic fat accumulation such as
significant alcohol consumption, use of steatogenic medication or
hereditary disorders.

b) In the majority of patients, NAFLD is associated with metabolic risk factors
such as obesity, diabetes mellitus, and dyslipidemia. NAFLD is
histologically further categorized into nonalcoholic fatty liver (NAFL) and
nonalcoholic steatohepatitis (NASH). NAFL is defined as the presence of
hepatic steatosis with no evidence of hepatocellular injury in the form of


15

ballooning of the hepatocytes. NASH is defined as the presence of hepatic
steatosis and inflammation with hepatocyte injury (ballooning) with or
without fibrosis.

c) High serum triglyceride levels and low serum HDL levels are very common
in patients with NAFLD. The prevalence of NAFLD in individuals with
dyslipidemia attending lipid clinics was estimated to be 50% (Chalasani et
al., 2012).

d) Samples were collected on basis of above requirements of NAFLD defined
by liver ultrasound and Questionnaire based with written informed consent.

3.2: SAMPLE COLLECTION FOR RESEARCH PURPOSE
Sample size was about 219 subjects, 106 patients studied in comparison
with 113 controls. Blood sampling was done at the OPDs of various hospitals in
Rawalpindi/Islamabad. About 4-5ml venous blood samples was collected using
disposable multiple sampling needles in two vacutainers for biochemical analysis.

The EDTA coated (BD Vacutainer) genomic DNA extraction with blood
sample a questionnaire was also filled by subject regarding all necessary
information for research purpose. (Appendix). These blood samples were kept on
ice at 4C for further analysis. And all syringed incinerated carefully for public
health concern.



16

3.3: BIOCHEMICAL TESTING

After collecting Samples proceed for the biochemical analysis for
distinction of cases and controls subjects. We requested PIMS and NIH labs for
biochemical tests of our subjects. In biochemical tests ALT (SGPT) and lipid
profile was included. To perform this test gel coated Vacutainers were centrifuged
at 3500 rpm for 15 minutes to separate serum from whole blood. From EDTA
vacutainers plasma were also separated from whole blood. By the serum and
plasma on spectrophotometer Microlab 300 (Merck) according to the standard
protocol all above analysis were performed.

3.4: DNA ISOLATION FROM WHOLE BLOOD
For Genomic DNA whole blood was used as a source of Genomic DNA using
extraction method recommended by sambrook (Sambrook and Russel, 2001).
Following are the steps of DNA extraction method:

RBC lysis buffer (750l) was mixed with 750l blood in eppendrof and
incubated for ten minutes at room temperature.
The tubes were centrifuged at 13,000 rpm for two minutes to form a pallet
of WBCs. This step was repeated till complete lysis of RBCs and discared
the supernatant and resupspended the nuclear pallet.
The tubes were overturned on a blotting paper.
Nuclear lysis buffer (400l) was added along with 60-70l of ten percent
Sodium Dodecyl Sulphate (SDS) and 10l of Proteinase K (Bio Ron) for
protein digestion.


17

The tubes were kept in incubator at 37C for overnight.
After this 250l of phenol and 250l TE Buffer were added and mixed
them.
Then tubes were centrifuged for 10 min at 13000 rpm.
Collected the upper aqueous phase in new eppendrof and added equal
quantity of Chloroform/Isoamylalcohol (24/l).
Then tubes were centrifuged for 10 min at 13000 rpm and again collected
upper aqueous phase in new eppendrof.
To the collected aqueous phase 70l of 3M Na-acetate and equal volume of
Isopropanol were added.
Inverted the tubes gently to precipitate DNA.
Then centrifuged for 10 min at 13000 rpm.
Removed the solvent phase without disturbing the DNA pallet.
350l of 70% ethanol were added in a tube containing palleted DNA then
centrifuged at 13000 rpm for 10 min.
Ethanol was removed and DNA pallet was dried by kept in incubator.
Then DNA was dissolved in 90l of DNA dissolving solution (TE Buffer).
Small aliquots of extracted DNAs were stored at 20C.

3.5: AGAROSE GEL ELECTROPHORESIS
Agarose based isolated genomic DNA stocks was checked for purity using
0.8 - 1% w/v agarose (1gm of agarose in 100ml of 0.5 x TBE buffer), whereas PCR
products was run on 2% agarose gel. Gels were stained with ethidium bromide
(5g/100ml will be used after boiling in microwave oven) and DNA was analyzed


18

by placing the gel on uv-transilluminator (Sambrook et al., 2001). Known
molecular weight DNA markers were also run on gels along with sample DNAs to
estimate size. 2% agarose was run for PCR Amplified product along with known
molecular weight markers. Gel pictures were taken and saved by gel
documentation system for record keeping.

3.6: DNA QUANTIFICATION
Isolated genomic DNA was also quantified by using nanodrop (avans
Cudrop). Quantification was done by taking absorbance at 260nm, 280 and 230 nm
wavelengths. Ratios of 260/280 and 260/230 was used to check the protein and
alcoholic impurities. DNA was quantified in ng/ul.

3.7: PCR PRIMER DESIGN
Sequence of PPAR gene SNP rs1801282 were retrieved from NCBI
dbSNP database. Primers were designed by using online web source Primer3
program. Insert dp SNP sequence (Appendix III) and selected of SNP flanking
primers, the primers designed by software were of following sequence:
Upstream Primer: 5 CCAATTCAAGCCCAGTCCTTTC 3
Downstream Primer: 3 CAGTGAAGGAATCGCTTTCCG 5
The above given primers were used in each separate vial. Tm or Melting
temperatures of primers were calculated using online Tm calculator by Applied


19

Biosystems, Life Technologies for estimation of PCR annealing temperatures.
Methods or annealing temperature.

3.7.1: Primer Re-suspension and Dilution
The forward and reverse primers were suspended in nano-pure water
(GIBCO) based on primers concentrations provided by the manufacturer to get a
final dilution of 100M primer stocks. The working 10M primer stocks were
prepared by further dilution of main stocks. All stocks were kept at -20C.

3.8: OPTIMIZATION OF PCR AMPLIFICATION CONDITIONS FOR
PPAR SNP
Genotyping was done based on PCR-RFLP method. Genomic DNA was
first amplified using polymerase chain reaction (PCR) based on designed primers.
PCR conditions were optimized like; PCR cycle times and temperatures, annealing
temperature, Mg
+2
concentration and dNTPs concentration based on laboratory
conditions. The PCR products were run on 2% Agarose gel and visualized by gel
doc system after ethidium bromide staining and results were recorded and saved.
For PCR amplification, 7l reaction mixtures were prepared. The PCR cycling
conditions,reported in literature by (Su et al., 2008) were followed initially but a
number of parameters were changed for optimum amplification of the required
SNP region. The SNP rs1801282 (244bp) fragment of PPAR gene was amplified
by Polymerase chain reaction (0.2xE Thermal cycler).



20

Initial denaturation at 94C (7 min)
Denaturation at 94C (30 sec)
Annealing at 58C (45sec) (36 cycles)
Extension at 72C (45sec)
Final Extension 72C (10 min)
Hold at 4C
Final extension takes place at 72C for 7 min. The PCR products (244bp)
were loaded on 2% agarose gel wells along with 100 bp ladder (Thermo Scientific)
at 120Volts 30 min to confirm the amplification of desired fragments of rs1801282
SNP (figure 2).






21


Figure 2: Amplified PCR product of PPAR separated on 1%
agarose gel














M 1 2 3 4


22

3.9: RESTRICTION FRAGMENT LENGTH POLYMORPHISM
For digestion of amplified PCR products sequence specific restriction
enzyme were used called restriction fragment length polymorphism (RFLP) to
identify the variation in homologous DNA sequence. Resulting digested fragments
were isolated by Agarose gel electrophoresis according to their sizes. Based on size
of fragment a finger prints were generated.

3.10: Digestion of PCR Amplified PPAR Gene rs1801282 SNP

The PCR amplified PPAR Gene rs2854116 SNP products (244bp) were
digested with Bsh (BstU1) 10U/L (Thermo Scientific) restriction enzyme at 37C
for 16 hours. Standardized conditions already reported in literature were used (Su
et al., 2008). The BstU1 recognition site is as follows;
5C G C G3
3G C G C5
A L restriction digestion reaction mixture was used (Table 2). Digestion
products were run on 3% Agarose gel electrophoresis along with 50bp ladder at 80
/ 100V for an hour. BstU1 produce cuts at specific site 5 C G C G 3,
digested PCR-RFLP products were loaded on 3% Agarose gel.

The 244bp fragment of gene rs1801282 SNP may have C to G substitution,
where site of BstU1 is located, while the fragment containing G allele remains


23

undigested heterozygous for AG. Enzyme will cut once before G and produces two
bands of size 223bp and 21bp respectively. Homozygous for C allele will remain
uncut and produce one band of 244bp on gel. Homozygous for G allele will
produce two bands of size 223bp and 21bp on gel. The result analysis of present
study was shows in 106 NAFLD patients, 103were homozygous for CC, 3 were
homozygous for GG whereas in 113 healthy controls, 112 were homozygous for
CC, 1 was homozygous for GG (Figure 3)

3.11: MAINTANANCE OF DATA RECORDS
Data was saved including all the anthropometric data and genotype data.
The data sheet contained information regarding name of patient, age, gender,
weight in kilogram (Kg), height in inches, circumference of waist (WC),
circumference of hip (HP), biochemical tests and the area of Pakistan to which
patient belonged.

3.12: GENOTTYPE/ALLELE FREQUENCY
PPAR rs1801282 genotyping was carried out by directly counting bands
From gels (homozygous/heterozygous) to establish the polymorphism profile by
Comparing the number of individuals in each group. Restriction digestion results
indicate genotype distribution among case and control groups. Hardy Weinberg
equation as described by Miller and Hardy was used for calculation of
genotype/allele frequencies (Su et al., 2008).



24






Figure 3: PCR-RFLP based Amplification of PPAR SNP rs1801282
PCR-RFLP products of rs1801282 were run along 50bp ladder in lane M. In above
gel Fatty Liver patients samples were run in wells. In well number 2, 4 shows
homozygous G/G genotype while well numbers 1, 3, 5, 6, 7, 8, 9, 10, 11 shows
homozygous C/C.






M 1 2 3 4 5 6 7 8 9 10 11


25





3.13: STATISTICAL ANALYSIS

Genotype/allele frequencies were estimated by allele counting and
comparing observed genotype frequencies to the expected frequencies. Deviations
from HardyWeinberg equilibrium were calculated through Chi-square goodness-
of-fit test. The descriptive statistics of means with 95% coefficient interval was
calculated to summarize the collected data. One-way Analysis of Variance
(ANOVA) was conducted for the comparison of risk parameters and disease
associations with genotype were calculated by using logistic regression. A
significance level of 0.05 was be used in all statistical analyses. The data analysis
was carried out using SPSS version 16.0 software (SPSS Inc., Chicago, IL, USA).








26

TABLE 1: PCR Reaction Mixture for Amplification of SNP rs1801282
PCR Reagents Stock Conc. Working Conc. Volume used
PCR Master Mix 5x - 1l
GIBCO Water - - 1l
Primer Forward 100M 10M 1l
Primer Reversed 100M 10M 1l
25mM MgCl2 0.25l
PCR Enhancer 0.25l
Genomic DNA 50ng/l 50ng 2l
Total PCR
Reaction Mixture
-

- 7 l




27

Table 2: Reaction Mixture for Restriction Digestion of SNP rs1801282 PCR-
Amplified product
Reagents Volume Used (l)
PCR Amplified Product 5 l
GIBCO Water 0.5 l
10X buffer for Enzyme 0.5 l
BseGI (BtsCI) Enzyme 1 l
Total Reaction Mixture 7 l














28


RESULTS AND DISCUSSION
In present study, 200 blood samples were collected from fatty liver patients
and healthy individuals. Samples were genotyped for PPAR associated SNPs;
rs1801282 (C/G). PCR-RFLP based genotyping study was conducted on 223
samples to find out the association of PPAR SNPs rs1801282 with NAFLD risk
factors such as ultrasound proved fatty liver. In the present study of 217 samples,
106 were cases were analyzed in comparison with 113 controls.

ASSOCIATION STUDIES OF NAFLD RISK FACTORS IN SELECTED
POPULATIONS
According to NAFLD definition following risk parameters were studied in
our population; Age, height, weight, waist circumference, hip circumference, ALT,
cholesterol, HDL, LDL and TG. One way ANOVA was applied to calculate
descriptive state on all risk factor with comparison among cases and controls to
find their association in different Age groups in both males and females with
PPAR SNPs rs1801282. Also genotyping results were analyzed in association
with all risk factors with 5% significance level to estimate the association of SNPs
rs1801282 with NAFLD risk factors in comparison among case control population.

NAFLD Risk Factors Analysis in among Case Control Population


29

Comparison of all variables (Age, Height, Weight, Weight Circumference
(WC), Height Circumference (HC), ALT, TG, cholesterol, HDL, and LDL) among
cases and controls expressed as MeansSD. The data presented in Table 4.1 shows
that W, WC, HC, ALT, CHOL and HDL are the parameters which are significantly
different among cases and controls. In cases the values of all the risk parameters
(weight 74.8715.889, WC 111.72016.342, HC112.40015.346, ALT
84.22275.8218, Cholesterol 220.49126.428 and HDL 139.95104.645) are
higher than the values in control weight(61.3819.772, WC78.80025.3189, HC
80.25027.5070, ALT 19.11317.2946, Cholesterol 165.7246.814 and HDL
36.4119.016). The descriptive in table shows that risk factors are highly prevalent
in cases than in control (0.05).

In this data we shows that there is no significant difference of Age, Height,
LDL and TG among cases and control and >0.05 with an earlier reported study
(Chuang et al., 2012) which shows that Age, Height, LDL are non significant risk
for NAFLD. According to another literature (Mattias Ekstedt., 2008) shows a
similar results that TG is non significant factor of NAFLD.









30

Table: 4.1. Anthropometric and biochemical parameters in fatty liver Cases and
Controls Expressed in Mean and Standard Deviation

Variables
Controls NAFLD Cases
p value
Mean SD Mean SD
Age (Years) 35.9316.17 38.2512.59 0.213

Height (ft) 6.5114.04 5.280.31 0.658

Weight (Kg) 61.3819.77 74.8715.89 0.001

WC (cm) 78.8025.32 111.7216.34 <0.0001

HC (cm) 80.2527.51 112.4015.35 <0.0001

ALT (IU/L) 19.1117.29 84.2275.82 <0.0001

TG (mg/dL) 152.88109.03 159.9676.74 0.755

Cholesterol (mg/dL) 165.7246.81 220.49126.43 <0.0001

LDL (mg/dL) 56.9544.08 75.1847.038 0.064
Association of Risk Phenotypes with Disease

Risk phenotype shows that there is no significant difference in Age and
biochemical parameter TG with value=0.268 and 0.063 (Table 4.2), while
gender, Cholesterol, HDL, ALT are significantly differ ( 0.05) among NAFLD
patients. This results shows that the disease is more in males with o.268=R as
compared with females.


31


Gender Based Frequency
By comparison of risk phenotypes between cases and controls of both male
and female population we assume that frequency of ALT and HDL in male patients
(59.09% and 50.8%) is higher than control (40.9% and 49.1%), whereas
TG(45.61%), CHOL(30.3%), LDL(9.52%) have low frequency in cases ( Table 3).
By comparing this data with female patients it is showing that HDL frequency
(84.5%) is higher in female patients but not ALT, whereas all other variables are
low








Table 2: Association of Risk Phenotypes with Disease

Risk Phenotypes Odds p- values
Age 0.76(0.460-1.241) 0.268
Male
Female
2.36(0.258-0.692)
Ref(1)
0.001

Cholesterol 5.80(2.314-14.512) 0.0001


32

HDL 0.06(0.019-0.165) 0.0001
TG 2.31(0.956-5.565) 0.063
ALT 48.8(21.247-112.05) 0.0001

















Table 3: Gender Based Frequency Table

Male Female


33

Variable Control% Case% Control% Case%

ALT

45 (40.9%)

65 (59.09%)

64 (68.8%)

29 (31.1%)

TG

31 (54.3%)

26 (45.61%)

39 (44.7%0

31 (44.2%)

Cholesterol

39 (69.6%)

17 (30.3%)

54 (76.05%)

17 (23.9%)

HDL

28 (49.1%)

29 (50.8%)

11 (15.49%)

60 (84.5%)

LDL

38 (90.4%)

04 (9.52%)

59 (90.7%)

06 (9.23%)




GENOTYPIC ASSOCIATION WITH NAFLD AND CONRTROL
Association analysis of genotyping with the disease showed that the subject
having G/G genotype is at 2.89 odds more risk of getting fatty liver disease as
compared to CC genotype, but statistically results are not significant ( >0.005).



34

















Table 4: GENOTYPING GENOTYPE FREQUENCIES
GENOTYPING genotype frequencies (n=217)

All subjects Control Case
Genotype Count Proportion Count Proportion Count Proportion


35

C/C 212 0.98 104 0.99 108 0.97
G/G 4 0.02 1 0.01 3 0.03
NA 1 --- 0 --- 1




Table 5: ALLELE FREQUENCY

GENOTYPING allele frequencies (n=216)

All subjects Control Case
Allele Count Proportion Count Proportion Count Proportion
C 424 0.98 208 0.99 216 0.97
G 8 0.02 2 0.01 6 0.03


Table 6:
GENOTYPING exact test for Hardy-Weinberg equilibrium (n=216)

CC CG GG C G P-value
All subjects 212 0 4 424 8 <0.0001
respons=0 104 0 1 208 2 0.0048


36

respons=1 108 0 3 216 6 <0.0001


GENOTYPING association with response respons (n=216, crude analysis)
Model Genotype respons=0 respons=1 OR (95% CI) P-value
---
C/C 104 (99%) 108 (97.3%) 1.00
0.33
G/G 1 (1%) 3 (2.7%) 2.89 (0.30-28.22)








SUMMARY

Fatty liver, also known as Fatty Liver Disease (NAFLD) is a
reversible condition where a large vacuoles of triglyceride fat accumulated
in liver cells via the process of steatosis. Regardless of the development in
the disease treatment/management, the number of affected individuals are
increasing very rapidly and becoming a worldwide public health problem.
Mutation especially single nucleotide polymorphisms (SNP) in codig and
non coding region of PPAR gene have been found to be associated with


37





Throughout the world specially including United States it is the
most common liver disease and now 2030% of the general population in
North America and similar countries affected by NAFLD. A number of
genes are found to be associated with fatty liver disease but resently
discover that PPAR is now considered candidate gene for Fatty Liver
Disease. peroxisome proliferator activated receptor gamma (PPAR) gene
encodes a member of the Peroxisome proliferator activated receptor
(PPAR) subfamily of nuclear receptors. Gene functions are affected by
several environmental factors such as dietary habits and composition of
intestinal microflora. The receptor PPAR binds chemicals that induce
proliferation of peroxisomes, organelles which contribute to the oxidation
of fatty acids. Several polymorphisms in PPAR have been identified in
various ethnic groups around the world. Some of them have shown strong
association with insulin resistance, obesity, Diabetes mellitus, and
metabolic syndrome. Thus PPAR is proposed an important candidate gene
for the diagnosis of various metabolic complications. Present study is
designed to identify PPAR gene risk variant in local NAFLD patients
under following objectives; PCR based genotyping of PPAR gene
polymorphism in selected population and association of identified
polymorphic forms with fatty liver. Blood samples of NAFLD diagnosed


38

patients will be conducted from OPDs of local hospitals for genomic DNA
extraction. PCR based genetic typing of selected PPAR SNP will be
performed. The genotypic data will be statistically analyzed to find disease
association. The expected outcomes of this study include identification of
PPAR genetic variants in selected Pakistani population and their
association with fatty liver specific environmental factors.







LITERATURE CITED

Angulo, p. 2007. Obesity and Nonalcoholic Fatty Liver Disease. Nutr Rev, 65:857-
863.
Brunt, E. M. and D. G. Tiniakos. 2010. Histopathology of nonalcoholic fatty liver
disease. World J.Gastroenterol., 16(42): 52865296.


39

Caldwel, S. H., D. H. Oelsner , J. C. Iezzoni, E. E. Hespenheide, E. H. Battle, C. J.
Driscoll. 1999. Cryptogenic cirrhosis: clinical characterization and risk
factors for underlying disease. Hepatology., 29: 664669.
Chen, Z. W., L.Y. Chen, H.L. Dai, J.L. Chen, L.Z. Fang. 2008. Relationship
between alanine aminotransferase levels and metabolic syndrome in
nonalcoholic fatty liver disease. J Zhejiang Univ Sci B., 9: 616622.
Damiano, F., G.V. Gnoni, L. Siculella. 2012. Citrate carrier promoter is target of
peroxisome proliferator-activated receptor alpha and gamma in hepatocytes
and adipocytes. Int. J. Biochem. Cell Biol., 44(4): 659668.
Day, C. P., E. Henderson, A. D. Burt and J. L. Newton.2006. Non-alcoholic fatty
liver disease in older people. Gerontology., 55: 607613.
Dubuquoy, L., S. Dharancy, S. Nutten, S. Pettersson, J.Auwerx, P. Desreumaux.
2002. Role of peroxisome proliferator-activated receptor and retinoid X
receptor heterodimer in hepatogastroenterological diseases. The Lancet.,
360(9343): 14101418.
Erickson, S. K. 2009. Nonalcoholic fatty liver disease. J. Lipid. Res., 50(suppl):
412- 416.
Evans, R. M., G. D. Barish, Y. X. Wang. 2008. PPARs and the complex journey to
obesity. Nature Med. 10: 355-361.sss
Fajas, L., D. Auboeuf, E. Raspe, K. Schoonjans, A. M. Lefebvre, R. Saladin, J.
Najib, M. Laville, J.-C. Fruchart, S. Deeb, A. Vidal-Puig, J. Flier, M.R.


40

Briggs, B. Staels, H. Vidal, J. Auwerx. 1997. The organization, promoter
analysis, and expression of the human PPAR-gamma gene. J. Biol. Chem.,
272: 18779-18789.
Fajas, L., D. Auboeuf, E. Rasp, K. Schoonjans, A. M. Lefebvre, R. Saladin, J.
Najib, M. Laville, J.C. Fruchart, S. Deeb, A. Vidal-Puig, J. Flier, M.R.
Briggs, B. Staels, H. Vidal, J. Auwerx. 1997. The organization, promoter
analysis, and expression of the human PPARgamma gene. J Biol Chem.,
272(30): 18779-187789.
Fan, J. G., J. Zhu and XJ. Li. 2005. Prevalence of and risk factors for fatty liver in a
general population of Shanghai, China. J. Hepatol., 43: 508514.
Fan, J. G., J. Zhu, X. J. Li, L. Chen, S. Lu, L. Li, F. Dai, F. Li, S. Y. Chen. 2005.
Fatty liver and the metabolic syndrome among Shanghai adults. J.
Gastroenterol Hepatol., 20(12): 18251832.
Frith, J., D. Jones and J. L. Newton. 2009. Chronic liver disease in an ageing
population. Age and Ageing., 38(1): 1118.
Jones, J. R., C. Barrick, K. A. Kim, J. Lindner, B. Blondeau, Y. Fujimoto, M.
Shiota , R.A. Kesterson, B.B. Kahn, M.A. Magnuson. 2005. Deletion of
PPAR in adipose tissues of mice protects against high fat diet-induced
obesity and insulin resistance. Proc. Natl. Acad. Sci. U.S.A., 102(17):
620712.
Khuram, M., S. Abdul, M.M. Arshad, H. Khaar, Z. Hasan. 2004. Characteristic
features of NAFLD patients. Rawal Med J., 29: 82.


41

Kletzien, R. F., S. D. Clarke, R. G. Ulrich. 1992. Enhancement of adipocyte
differentiation by an insulin-sensitizing agent.Mol. Pharmacol., 41: 393
398.
Kuk, J. L., T. J. Saunders, L. E. Davidson and R. Ross. 2009. Age-related changes
in total and regional fat distribution. Ageing Research Reviews., 8(4): 339
348.
Lazar, M. A. 2005. PPAR, 10 years later. Biochimie., 87(1): 913.
Loria, P., A. Lonardo, S. Lombardini. 2005. Gallstone disease in non-alcoholic
fatty liver: prevalence and associated factors. J. Gastroenterol Hepatol., 20:
11761184.
Madan, K., Y. Batra, S.P. Gupta., B. Chander, K.D Rajan, M.S. Tewatia et al.
2006. Nonalcoholic fatty liver disease may not be a severe disease at
presentation among Asian Indians. World J. Gasteroenterol., 12: 3400
3405.
Mauro, K., C. Crdova, R. Jac de Oliveira, M. Gomes de Oliveira Karnikowski, O. de
Toldo Nbrega. 2007. Non-alcoholic fatty liver disease and metabolic syndrome
in Brazilian middle-aged and older adults. Med. J., 125(6).
Mentha, G., O. Huber, J. Robert, C. Klopfenstein, R. Egeli, and A. Rohner. 1992.
Elective hepatic resection in the elderly. Bri. J. Surg., 79(6): 557559.
Mueller, E. S. Drori, A. Aiyer, J. Yie, P. Sarraf, H. Chen, S. Hauser, E. D. Rosen,
K. Ge, R.G. Roeder, B. M Spiegelman. 2002. Genetic analysis of


42

adipogenesis through peroxisome proliferator-activated receptor gamma
isoforms. J. Biol. Chem., 277: 4192541930.
Mukherjee, R., L. Jow, G. E. Croston, J. R. Paterniti. 1997. Identification,
Characterization, and Tissue Distribution of Human Peroxisome
Proliferator Activated Receptor (PPAR) Isoforms PPARgamma2 Varsus
PPARgamma1 and Activation wuth Retinoid X Receptor Agonist and
Antagonists. J. Biol Chem., 272: 8071-8076.
Musso, G., R. Gambino, F. De Michieli, M. Durazzo, G. Pagano, and M. Cassader.
2008. Adiponectin gene polymorphisms modulate acute adiponectin
response to dietary fat: possible pathogenetic role in NASH. Hepatol. 47:
11671177.
Ong, J. P., A. Pitts and Z. M. Younossi. 2008. Increased overall mortality and liver-
related mortality in non-alcoholic fatty liver disease. J. Hepatol., 49: 608
612.
Paola., D. and L. Valenti. 2012. Peroxisome Proliferator-Activated Receptor Genetic
Polymorphisms and Nonalcoholic Fatty Liver Disease: Any Role in Disease
Susceptibility? Int. Med., 2013.
Qari, F. A., A. Al Ghamdi. 2005. Fatty liver in overweight and obese patients in
Western part of Saudi Arabia: a study of sonological prevalence. Pak J Med
Sci., 21: 1437.
Ren, D., T. N. Collingwood, E. J. Rebar, A. P. Wolffe, H. S. Camp. 2002.
PPARgamma knockdown by engineered transcription factors: exogenous


43

PPARgamma2 but not PPARgamma1 reactivates adipogenesis. Genes
Dev., 16: 2732.
Schmucker, D. L. 1998. Aging and the liver: an update. J. Gerontol. Series., 53(5):
315320.
Solga, S. F. and A. M. Diehl. 2003. Non-alcoholic fatty liver disease: lumen-liver
interactions and possible role for probiotics. J. Hepatol., 38: 681687.
Sorrentino. P., G. Tarantino and P. Conca. 2004. Silent non-alcoholic fatty liver
disease-a clinical-histological study. J. Hepatol., 41: 751757.
Stienstra, R., C. Duva, M. Muller, S. Kersten. 2007. PPARs, obesity, and
inflammation. PPAR Research. 2007: 95964-95974.
Tan, G. D. C. Debard, C. Tiraby, S. M. Humphreys, K. N. Frayn, D. Langin, H.
Vidal, F. Karpe. 2003. A futile cycle induced by thiazolidinediones in
human adipose tissue? Nat. Med., 9: 811812.
Tonjes, A. M. Scholz, M. Loeffle, M. Stumvoll. 2006. Association of Pro12Ala
polymorphism in peroxisome proliferator-activated receptor gamma with
Pre-diabetic phenotypes: meta-analysis of 57 studies on nondiabetic
individuals. Diabetes Care., 29(11): 2489-2497.
Tontonoz, P. E. Hu and B. M. Spiegelman.1994. Stimulation of adipogenesis in
fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell.,
79: 11471156.


44

Tontonoz, P. E. Hu., R. A. Graves, A. I. Budavari, B. M. Spiegelman. 1994.
mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer.
Genes Dev., 8: 12241234.
Wang, Y. X. 2010. PPARs: diverse regulators in energy metabolism and metabolic
diseases. Cell Research. 20(2): 124137.
Williams, C. D., J. Stengel, M. I. Asike, D. M. Torres, J. Shaw, M. Contreras, C. L.
Landt, S. sA. Harrison. 2011. Prevalence of nonalcoholic fatty liver disease
and nonalcoholic steatohepatitis among a largely middle-aged population
utilizing ultrasound and liver biopsy: a prospective study. Gastroenterol.,
140: 124131.