M

:
F
o
o
d
M
i
c
r
o
b
i
o
l
o
g
y
&
S
a
f
e
t
y
Detection of C. Botulinum Types
in Honey by mPCR
Ali G uc uko glu, G oknur Terzi,

Ozg ur Cadirci, Mustafa Alis arli, Onur Kevenk, and Tolga Uyanik
Abstract: The aim of this study was to determine the prevalence of Clostridium botulinum in honey samples using
conventional methods and multiplex PCR (mPCR). A total number of 150 honey samples were randomly collected from
apiaries, retail shops, weekly open bazaars, and supermarkets in Samsun, Turkey. Of 150 honey samples, 4 (2.6%) were
positive for the botulinum neurotoxin gene by mPCR analysis. A total of 4 C. botulinum isolates were obtained from the
mPCR positive samples, of which 3 were type A and 1 was type B. No samples were positive regarding the type E and
type F neurotoxin genes. This is the rst report of type A and type B spores of C. botulinum being detected and isolated in
Turkey. This study revealed that some honey samples may present a potential hazard for food borne and infant botulism.
Keywords: Clostridium botulinum, infant botulism, multiplex PCR
Introduction
Clostridium botulinum is an anaerobic, endospore-forming
bacterium that produces a lethal neurotoxin called botulinum
neurotoxin (BoNT). Of the 7 C. botulinum neurotoxin (BoNT)
serotypes, only A, B, E, and F are associated with human
intoxication (Fenicia and others 1993; Hauschild and Dodds
1993; Hatheway 1995; Lindstr om and others 2006; FDA 2012).
The illness is recognized as a severe neurological disease caused by
BoNT. BoNT acts presynaptically at the neuromuscular junction
by blocking acetylcholine release, thereby leading to muscle
weakness, paralysis, respiratory arrest, and death (Ornella and
others 2001; Shabaan and others 2011). There are 4 naturally
occurring clinical categories of botulism, depending on the mode
of acquisition of botulinum toxin: food-borne botulism, infant
botulism, wound botulism, and adult infectious botulism (Shapiro
and others 1998; Peck 2009). Food-borne botulism, still a com-
mon form of the disease, is caused by the ingestion of the toxin in
food (FDA 2012). In infant botulism, spores of C. botulinum are
ingested and germinate in the intestinal tract (Cherington 1998).
The most typical age of onset of infant botulism is between
2 wk and 6 mo (Arnon and others 1981; Morris and others 1983;
Aureli and others 2002). The infant intestinal tract often lacks
both the protective bacterial ora and clostridium-inhibiting
bile acids found in the normal adult intestinal tract (Caya and
others 2004). Infant botulism is common form of botulism and
honey has been identied as a potential source of infection
(Midura 1996). Honey is a complex material for microbiological
investigation. Its high sugar content, low pH, and the existence of
different oxidants inhibit microorganisms from growing in honey.
These properties of honey also make the detection of organisms
more difcult. Although spores of the genus Bacillus spp. are
regularly found in honey, organisms of the genus Clostridium spp.
may also be present (Snowdon and Cliver 1996). The mouse
bioassay has remained the standard procedure for determining
the presence of BoNTs (Hatheway and McCroskey 1987; FDA
2011). Moreover, enzyme-linked immunosorbent assays (ELISA)
MS 20131055 Submitted 7/26/2013, Accepted 1/19/2014. Authors are with
Dept. of Food Hygiene and Technology, Faculty of Veterinary Medicine, Ondokuz
Mays Univ., Kurupelit/Samsun, Turkey. Direct inquiries to author G uc uko glu
(E-mail: aligucuk77@hotmail.com).
have been developed for detecting BoNTs (Doellgast and others
1994). Detection of BoNT gene fragments by PCR has become
a rapid alternative method for the detection and typing of
BoNT-producing C. botulinum (Aranda and others 1997).
No studies on C. botulinum neurotoxin serotypes (A, B, E, and
F) in honey samples have been previously performed in Turkey.
Therefore, there is no available information on the possible risk
of infant botulism posed by honey in Turkey. The aims of this
study were (i) to determine the prevalence of C. botulinum in
honey samples and (ii) to genotype the isolated C. botulinum for
neurotoxin gene types (A, B, E, and F) using mPCR.
Materials and Methods
Materials
In this study, a total of 150 honey samples were randomly col-
lected from September 2011 to April 2012 in Samsun (It is the
largest city on the Turkish Black Sea region.), Turkey. Honey sam-
ples (approximately 250 to 750 g) were purchased from apiaries,
retail shops, weekly open bazaars, and supermarkets.
Sample preparation
In this study, 2 honey sample preparation methods were com-
bined and used for the detection of C. botulinum spores. These
methods were the dilution centrifugation (DC) method (Austin
1998; Nevas and others 2002) and the supernatant ltration (SF)
method (Nevas and others 2002).
Each honey sample (10 g) was diluted in 90 mL of 1% Tween
80 (Merck, 822187) solution and kept in a water bath at 65 C
for 30 min to inactivate other non-spore-forming microorgan-
isms, then centrifuged for 30 min at 9000 g (Nuve NF 800
R, Turkey). Spores were captured from the supernatant by l-
ter through 0.45-m cellulose acetate membrane lters (Sarto-
rius, 11406). The ltrate was inoculated into 9 mL of TPGY
broth (tryptosepeptoneglucoseyeast extract (Special Peptone,
Oxoid LP72; Peptone Bacteriological Neutralized, Oxoid L34;
D(+) Glucose, Anhydrous Merck 346351; Yeast Extract, Oxoid
LP21; sodium thioglycolate, Merck 106691; pH 7.2 0.2; FDA
2011).
Isolation of C. botulinum
The inoculated TPGY broth was incubated under anaerobic
conditions and covered with sterile parafn oil at 26 to 28 C for
C
2014 Institute of Food Technologists
R
M600 Journal of Food Science
r
Vol. 79, Nr. 4, 2014 doi: 10.1111/1750-3841.12402
Further reproduction without permission is prohibited
M
:
F
o
o
d
M
i
c
r
o
b
i
o
l
o
g
y
&
S
a
f
e
t
y
C. botulinum types in honey . . .
Table 1Primers used for the detection of C. botulinum neuro-
toxin (BoNT) genes (FDA 2011).
Primer Sequence (5

) Product size (bp)

BotA F GTGATACAACCAGATGGTAGT TATAG 983
BotA R AAAAAACAAGTCCCAATTATTAACTTT
BotB F GAGATGTTTGTGAATATTATGATCCAG 492
BotB R GTTCATGCATTAATATCAAGGCTGG
BotE F CCAGGCGGTTGTCAAGAATTTTAT 410
BotE R TCAAATAAATCAGGCTCTGCTCCC
BotF F GCTTCATTAAAGAACGGAAGCAGTGCT 1137
BotF R GTGGCGCCTTTGTACCTTTTCTAGG
7 to 10 d. After 7 d of incubation, each culture was examined
for turbidity and gas production. A loopful from the positive bot-
tles was streaked onto AEA agar (anaerobic egg yolk agar: [yeast
extract, Oxoid LP21; tryptone, Oxoid LP42; proteose peptone,
Oxoid LP72; agar bacteriological, Oxoid LP11; sodium chloride,
Merck 567440; egg yolk emulsion, Oxoid SR47; pH 7.0 0.2]).
The plates were anaerobically incubated using a Gas Generating
Kit (Oxoid, BR38) in a jar at 35 C for 24 to 48 h. Typical colonies
of C. botulinum were large, irregularly circular, smooth, grayish,
and typical cells of C. botulinum were looked similar to a tennis
racket with Gram-positive staining. Typical colonies were grown
in TPGY broth at 26 to 28 C for 24 to 48 h for subcultures. Bac-
terial suspensions were used to prepare template DNA for mPCR
(FDA 2011).
DNA extraction
A 1.4-mL aliquot from each of the cultures was removed
and dispensed into separate sterile microcentrifuge tubes.
Then the tubes were centrifuged at 14000 g for 2 min
(Hettich-Universal-320 R, Germany) and the supernatants were
discarded. The remaining bacterial pellets were washed in 1.0 mL
phosphate-buffered saline (PBS; pH 7.4) and centrifuged at 14000
g for 2 min. Supernatants were discarded again and pellets
were resuspended in 400 L PBS and 10 L lysozyme buffer
(10 mg lysozyme/mL). The suspensions were incubated for 15
min at 37 C in a water bath, inverting tubes every 5 min during
the incubation. After that, 10 L proteinase K buffer (10 mg
proteinase K/mL) was added to each suspension and incubated
for a second time for 1 h in a 60 C water bath. The tubes were
inverted every 15 min during the second incubation period. After
the incubation process, the suspensions were boiled for 10 min in
a water bath and then centrifuged for 2 min at 14000 g. Super-
natants were transferred to sterile 1.5 mL microcentrifuge tubes.
A 50 L aliquot of 3M sodium acetate and 1.0 mL of 95% ethanol
were added to supernatants, mixed by inversion, and cooled at
20 C for 30 min. The ethanolsalt preparations were
centrifuged at 14000 g. Supernatants were discarded and
pellets were dried. Pellets were resuspended in 200 L of sterile
Tris-EDTA buffer and stored immediately at 20 C (FDA 2011).
Determination of C. botulinum neurotoxin (BoNT) genes by
multiplex PCR
Atotal of 150 honey samples were tested for BoNTgenes (BotA,
BotB, BotE, and BotF) by mPCR. Primers specic for the BoNT
genes were used for the detection of the genes (FDA 2011). All
primer pairs used in this study for the mPCR are listed in Table 1.
Table 2Prevalence of neurotoxin (BoNT) genes of C. botulinum
isolates from honey.
Nr. of
Clostridium C. botulinum
Nr. botulinum neurotoxin (BoNT) genes
of positive Type A Type B Type E Type F
Samples samples samples (BotA) (BotB) (BotE) (BotF)
Honey 150 4/150 3 1
Multiplex PCR conditions
The mPCR procedure was performed according to the FDA
(2011), with some slight modications. mPCR was performed
in a reaction mixture with a nal volume of 100 L contain-
ing of 1 PCR buffer (Sigma P2192), 2.5 mM MgCl
2
, 20 pmol
(each) of BotA, BotB, BotE, and BotF primers, 2.5 U Taq poly-
merase (Sigma D1806) in 10 mM Tris-HCl (pH 8.3), 50 mM
KCl, 200 Mof each deoxynucleotide triphosphate (dATP, dGTP,
dCTP, and dTTP) and 5 L of template DNA. The volume of
this mix was adjusted to 100 L with sterile water. As posi-
tive controls, template DNA extracted from the standard strains
C. botulinum type A (BotA) ATCC 3502, C. botulinum type B
(BotB) BL 90/4 (Prevot 59-IFR, Culture Collection of the In-
stitute of Food Research, Norwich, England), C. botulinum type
E (BotE) BL 81/26 (Beluga-IFR, Culture Collection of the In-
stitute of Food Research, Norwich, England) and C. botulinum
type F (BotF) ATCC 23387, used in parallel. The reactions were
carried out in a thermal cycler (Bio-Rad MJ Mini-PTC-1148,
157, Singapore) The amplication conditions were as follows: ini-
tial denaturation at 95 C for 5 min, followed by 30 cycles of
94 C for 1 min, annealing at 60 C for 1 min, extension at
72 C for 1 min, and a nal extension at 72 C for 10 min. The
PCR products were separated on a 2% agarose gel and stained
with ethidium bromide (0.5 g/mL). Electrophoresis was carried
out at 90 V for 1.5 h 1000 to 100 bp DNA ladder (Solis Bio-
Dyne, Estonia) molecular weight marker was used to identify the
amplied products in tris borate electrophoresis buffers (Bio-Rad,
Power Pac-Basic, Singapore; Bio-Rad, electrophoresis tank, Wide
Mini, Singapore). The PCR products were visualized under UV
illumination (Wise-UV-Wuv-L50, Korea).
Results and Discussion
Of the 150 honey samples, 4 (2.6%) were positive for the
BoNT gene by mPCR analysis. Some of the PCR amplica-
tion products are shown in Figure 1. The positive samples in-
cluded 3 type A isolates and 1 type B isolate. This is the rst
report of C. botulinum spores type A and type B being iso-
lated from honey samples in Turkey. Prevalence of neurotoxin
(BoNT) genes of C. botulinum isolates from honey are listed in
Table 2.
Neurotoxin-type determination is important in identifying the
bacterium. The mouse bioassay has remained the standard pro-
cedure for determining the presence of BoNTs (Hatheway and
McCroskey 1987; FDA 2011). Moreover, ELISA have been devel-
oped for detecting BoNTs (Doellgast and others 1994). Recently,
PCR-based analysis methods for detecting the (BoNT) gene have
been introduced in an attempt to replace time-consuming con-
ventional methods (Campbell and others 1993; Fach and others
1993; Szabo and others 1993; Hielm and others 1996; Aranda
and others 1997). The PCR method may also be used in con-
junction with the mouse bioassay to determine toxin types. In
general, PCR-based analysis methods and ELISA have been used
Vol. 79, Nr. 4, 2014
r
Journal of Food Science M601
M
:
F
o
o
d
M
i
c
r
o
b
i
o
l
o
g
y
&
S
a
f
e
t
y
C. botulinum types in honey . . .
in several studies concerning the isolation of C. botulinum in
honey.
The presence of C. botulinum spores in honey has been investi-
gated in several studies applying various methods. The incidence
obtained in this study was 2.6% (4/150) in honey from Turkey.
The results were consistent with those (1.9%) reported by Made
and others (2000), who used PCR to assess 52 honey samples from
Germany. Our results are also, in general, in agreement with the
results of Rall and others (2003), who conducted a prevalence sur-
vey on C. botulinum spores in 100 honey samples. They detected
C. botulinum spores in 3 (3%) honey samples in Sao Paulo, Brazil.
Relatively similar incidence levels were obtained by other inves-
tigators, including Kautter and others (1982), who microbiologi-
cally analyzed 100 honey samples in the United States and detected
the presence of C. botulinum in 2% (2/100) of the samples. Du and
others (1991) determined that 1% of 152 honey samples were
contaminated by C. botulinum spores in Taiwan. Forty-two honey
samples collected in Argentina were microbiologically tested by
Centorbi and others (1994), who stated that 2% of the samples
contained C. botulinum spores. In Turkey, reports associated with
C. botulinum have been very scarce. K upl ul u and others (2006)
analyzed 48 honey samples and the bacterium was detected in 6
of 48 (12.5%) honey samples. However, in their study, the mouse
bioassay was used to determine the presence of BoNT. In addition,
the 6 isolates were not further assessed to determine the type of
toxin.
In our study, the overall contamination rate was relatively low
(2.6%) in comparison with previous studies, which reported
high contamination rates of the honey samples analyzed for
C. botulinum. Huhtanen and others (1981) microbiologically
analyzed 80 honey samples in the United States and found a
high prevalence of botulinum spores (13%) in honey. Monetto
and others (1999) determined that 5% of 44 honey samples were
contaminated with C. botulinum spores in Argentina. Schocken-
Iturrino and others (1999) reported that 6 of 85 (7%) honey
samples were contaminated with C. botulinum spores in Brazil.
The high prevalence rates reported in these studies might have
been due to inadequate cleaning and disinfection of both equip-
ment and poor hygiene conditions and/or due to geographical
reasons.
However, there are some studies reporting lower contamination
levels with C. botulinum spores in honey. In Germany, C. botulinum
spores were not detected in 282 honey samples (Flemming and
Stojanowic 1980; Hartgen 1980). Berry and others (1987) re-
ported that all 122 samples of honey purchased from retail markets
in the United Kingdom were negative for C. botulinum. C. bo-
tulinum was not detected in over 150 honey samples from shops
in Canada (Hauschild and others 1988) as well. In France, 116
honey samples were analyzed for the presence C. botulinum and all
samples were negative (Delmas and others 1994).
According to our analysis, 4 C. botulinum isolates were found in
the honey samples (4/150; 2.6%); 3 of them were type A (3/4;
75%) and 1 of them was type B (1/4; 25%). There are limited
studies on this subject performed in other countries. Nevas and
others (2005) reported that C. botulinum isolated from Danish,
Norwegian, and Swedish honey samples produced BoNT type A
(1/42; 2.3%), type B (35/42; 83.3%), type E (5/42; 11.9%), and
type F (1/42; 2.3%).
Although not all the infant botulinum cases may attributed to
consumption of honey literature survey reveals the importance of
honey in the infant botulinum cases in the world. Honey has been
known to contain C. botulinum spores and is considered a potential
source of infant botulism (Midura and Arnon 1976; Arnon and
others 1979; Midura and others 1979). To date, the CDC has
documented more than 1400 cases on all continents, except Africa.
Approximately 90% of these cases have been diagnosed in the
United States (CDC 1998; Shapiro and others 1998). Only a small
number of cases have been reported in Italy, Germany, the United
Kingdom, Spain, Denmark, Japan, Australia (Fox and others 2005),
and Finland (Nevas and others 2005). Most infant botulism cases
were due to C. botulinum type A and type B (Arnon 1992). Since
2010, the CDC has documented more than 2000 cases of infant
botulism in the United States, principally produced by type A and
type B (CDC 2012).
This study revealed that honey samples in Turkey may present
a potential hazard for food-borne and infant botulism. However,
there are insufcient data at present to adequately assess this issue.
Therefore, to minimize the risk of acquisition of infant botulism,
we recommend that honey should not be given to infants younger
than 12 months of age.
Figure 1Electrophoreses image of BotA, BotB, BotE, and BotF genes from honey samples isolates by mPCR. (M: 100 bp DNA marker; lane 1: positive
control for BotA gene (C. botulinum type A, ATCC 3502); lane 2: positive control for BotB gene (C. botulinum type B, BL 90/4: Prevot 59-IFR, Culture
Collection of the Institute of Food Research, Norwich, England); lane 3: positive control for BotE gene (C. botulinum type E, BL 81/26: Beluga-IFR,
Culture Collection of the Institute of Food Research, Norwich, England); lane 4: positive control for BotF gene (C. botulinum type F, ATCC 23387); lane
5: negative control; lane 68: honey isolates, BotA; lane 9: honey isolates, BotB.)
M602 Journal of Food Science
r
Vol. 79, Nr. 4, 2014
M
:
F
o
o
d
M
i
c
r
o
b
i
o
l
o
g
y
&
S
a
f
e
t
y
C. botulinum types in honey . . .
Acknowledgments
This study was supported by the Univ. of Ondokuz
Mays, Scientic Research Center, under the project nr.:
PYO.VET.1901.11.012. The authors thank Univ. of Helsinki,
Faculty of Veterinary Medicine, Dept. of Food Hygiene and En-
vironmental Health for the positive DNA samples.
References
Aranda E, Rodriguez MM, Asensio MA, Cordoba JJ. 1997. Detection of Clostridium botulinum
types A, B, E and F in foods by PCR and DNA probe. Lett Appl Microbiol 25:18690.
Arnon SS. 1992. Infant botulism. In: Feigen R and Cherry J, editors. Textbook of pediatric
infectious diseases. Philadelphia, Pa.: W.B. Saunders. p. 1095102.
Arnon SS, Werner SB, Faber HK, Farr WH. 1979. Infant botulism in 1931. Discovery of a
misclassied case. Am J Dis Child 133:5802.
Arnon SS, Damus K, Chin J. 1981. Infant botulism: epidemiology and relation to sudden infant
death syndrome. Epidemiol Rev 3:4566.
Aureli P, Franciosa G, Fenicia L. 2002. Infant botulism and honey in Europe: a commentary.
Pediatr Infect Dis J 21:8668.
Austin JW. 1998. Detection of Clostridium botulinum spores in honey and syrups. Laboratory
Procedure MFLP 50. Government of Canada.
Berry PR, Gilbert RJ, Oliver RWA, Gibson AAM. 1987. Some preliminary studies on low
incidence of infant botulism in the United Kingdom. J Clin Pathol 40:121.
Campbell KD, Collins MD, East AK. 1993. Gene probes for identication of the botulinal
neurotoxin gene and specic identication of neurotoxin types B, E, and F. J Clin Microbiol
31:225562.
Caya JG, Agni R, Miller JE. 2004. Clostridium botulinum and the clinical laboratorian: a detailed
review of botulism, including biological warfare ramications of botulinum toxin. Arch Pathol
Lab Med 128:65362.
CDC, Centers for Disease Control and Prevention. 1998. Botulism in the United States,
18991996. Handbook for epidemiologists: clinicians and laboratory workers. Atlanta, Ga.:
Centers for Disease Control and Prevention.
CDC, Centers for Disease Control and Prevention. 2012. Botulismin the United States, summary
of notiable diseases-United States, 2010. MMWR 59:1111.
Centorbi OP, Alcaraz LE, Centorbi HJ. 1994. An alisis bacteriol ogico e investigaci on de esporas
de Clostridium botulinum en mieles. Rev Arg Microbiol 26:96100.
Cherington M. 1998. Clinical spectrum of botulism. Muscle Nevre 21:70110.
Delmas C, Vidon DJM, Sebald M. 1994. Survey of honey for Clostridium botulinum spores in
eastern France. Food Microbiol 11:5158.
Doellgast G, Triscott MX, Beard A, Bottom JD. 1994. Enzyme-linked immunosorbent assay
for detection of Clostridium botulinum neurotoxins A, B, and E and solution-phase complexes
with dual label antibodies. J Clin Microbiol 32:10511.
Du SJ, Cheng CM, Lai HY, Chen LH. 1991. Combined methods of dialysis, cooked meat
medium enrichment and laboratory animal toxity for screening Clostridium botulinum spores
in honey and infant foods. Zhonghua Min Guo Wei Sheng Wu Ji Mian Yi Xue Za Zhi 24:
2407.
Fach P, Hauser D, Guillou JP, Popoff MR. 1993. Polymerase chain reaction for the rapid
identication of Clostridium botulinum type A strains and detection in food samples. J Appl
Bacteriol 75:2349.
FDA. 2011. BAM, Bacteriological analytical manual online: Clostridium botulinum, Chapter 17.
Available from: http://www.fda.gov. Accessed 2013 June 28.
FDA. 2012. Bad bug book: Clostridium botulinum foodborne pathogenic microorganisms and
natural toxins handbook Clostridium botulinum. Available from: http://www.fda.gov. Accessed
2013 June 28.
Fenicia L, Ferrini A, Aureli P. 1993. A case of infant botulism associated with honey feeding in
Italy. Eur J Epidemiol 9:6713.
Flemming R, Stojanowic V. 1980. Untersuchungen von Bienhonig auf Clostridium botulinum-
Sporen. Arch Lebensmittelhyg 31:17980.
Fox CK, Keet CA, Strober JB. 2005. Recent advances in infant botulism. Pediatr Neurol
32:14954.
Hartgen H. 1980. Untersuchungen von bonigproben auf botulinustoxin. Arch Lebensmittelhyg
31:1778.
Hatheway CL. 1995. Botulism: the present status of the disease. Curr Top Microbiol 195:5575.
Hatheway CL, McCroskey LM. 1987. Examination of feces and serum for diagnosis of infant
botulism in 336 patients. J Clin Microbiol 25:23348.
Hauschild AHW, Dodds KL. 1993. Clostridium botulinum: ecology and control in foods, Vol. 26.
New York: Marcel Dekker Inc.
Hauschild AHW, Hilsheimer R, Weiss KF, Burke RB. 1988. Clostridium botulinum in honey,
syrups and dry infant cereals. J Food Protect 51:8924.
Hielm S, Hyyti a E, Ridell J, Korkeala H. 1996. Detection of Clostridium botulinumin sh and
environmental samples using polymerase chain reaction. Int J Food Microbiol 31:35765.
Huhtanen CN, Knox D, Shimanuki H. 1981. Incidence and origin of Clostridium botulinum
spores in honey. J Food Protect 44:8124.
Kautter DA, Lilly T Jr, Solomon HM, Lynt RK. 1982. Clostridium botulinum spores in infant
foods: a survey. J Food Protect 45:10289.
K upl ul u

O, G onc uo glu M,

Ozdemir H, Koluman A. 2006. Incidence of Clostridium botulinum
spores in honey in Turkey. Food Control 17:2224.
Lindstr om M, Nevas M, Korkeala H. 2006. Detection of Clostridium botulinum by multiplex
PCR in foods and feces. Method Biotech 21:3745.
Made D, Tr umper K, Stark R. 2000. Nachweis von Clostridium botulinum in Honig durch
Polymerase-Kettenreaktion. Arch Lebensmittelhyg 51:6870.
Midura T F. 1996. Update: infant botulism. Clin Microbiol 9:11925.
Midura TF, Arnon SS. 1976. Infant botulism: identication of Clostridium botulinum and its toxin
in faeces. Lancet 2:9346.
Midura TF, Snowden S, Wood RM, Arnon SS. 1979. Isolation of Clostridium botulinum from
honey. J Clin Microbiol 9:2823.
Monetto AM, Francavilla A, Rondini A, Manca L, Siravegna M, Fernandez R. 1999. A study
of botulinum spores in honey. Anaerobe 5:1856.
Morris JG, Snyder JD, Wilson R, Feldman RA. 1983. Infant botulism in the United States: an
epidemiologic study of cases occurring outside of California. Am J Public Health 73:13858.
Nevas M, Hielm S, Lindstr om M, Hom H, Koivulehto K, Korkeala H. 2002. High prevalence of
Clostridium botulinum types A and B in honey samples detected by polymerase chain reaction.
Int J Food Microbiol 72:4552.
Nevas M, Lindstr om M, Hautam aki K, Puoskari S, Korkeala H. 2005. Prevalence and diversity
of Clostridium botulinum types A, B, E, and F in honey produced in the Nordic countries. Int
J Food Microbiol 105:14551.
Ornella R, Michela S, Paola C. 2001. Tetanus and botulinum neurotoxins: turning bad guys
into good by research. Toxicon 39:2741.
Peck M. 2009. Biology and genomic analysis of Clostridium botulinum. Adv Microb Physiol
55:183265.
Rall VLM, Bombo AJ, Lopes TF, Carvalho LR, Silva MG. 2003. Honey consumption in the
state of S ao Paulo: a risk to human health? Anaerobe 9:299303.
Schocken-Iturrino RP, Carneiro MC, Kato E, Sorbara J, Ross OD, Gerbasi LER. 1999. Study
of the presence of the spores of Clostridium botulinum in honey in Brazil. FEMS Immunol Med
Mic 24:37982.
Shabaan HA, Badary MS, Wegdan AM, Elkhawaga AA. 2011. Multiplex PCR for detection
and genotyping of C. botulinum types A, B, E, and F neurotoxin genes in some Egyptian food
products. J Am Sci 7:17690.
Shapiro RL, Hatheway C, Swerdlow DL. 1998. Botulism in the United States: a clinical and
epidemiologic review. Ann Intern Med 129:2218.
Snowdon JA, Cliver DO. 1996. Microorganisms in honey. Int J Food Microbiol 31:126.
Szabo EA, Pemberton JM, Desmarchelier PM. 1993. Detection of the genes encoding bo-
tulinum neurotoxin types A to E by the polymerase chain reaction. Appl Environ Microbiol
59:301120.
Vol. 79, Nr. 4, 2014
r
Journal of Food Science M603