Professional Documents
Culture Documents
http://jcmb.halic.edu.tr
Journal of Cell and
Molecular Biology
Sensitivity of the human chromosomes to EMS
Y chromosome microdeletions in spontaneous abortions
Genetic diversity of Penicillium species
stanbul-TURKEY
Journal of Cell and
Molecular Biology
Volume 7 No 2 & Volume 8 No 1
June 2010
Hali University
Faculty of Arts and Sciences
Journal of Cell and Molecular Biology
Founder
Gndz GEDKOLU
President of Board of Trustee
Rights held by
Sait SEVGENER
Deputy Rector
Correspondence Address:
The Editorial Office
Journal of Cell and Molecular Biology
Hali niversitesi
Fen-Edebiyat Fakltesi,
Kaptan Paa Mah. Darlaceze Cad. No: 14 34384
Okmeydan-ili, stanbul -Turkey
Phone: +90 212 220 96 96
E-mail: jcmb@halic.edu.tr
Journal of Cell and Molecular Biology is
indexed in ULAKBIM, EBSCO, DOAJ,
EMBASE, CAPCAS, EMBiology, and
Index COPERNICUS
ISSN 1303-3646
Printed at MART Printing House
Journal of Cell and
Molecular Biology
Published by
Hali University
Faculty of Arts and Sciences
Editor
Nagehan ERSOY TUNALI
Associate Editor
Mehmet Ali TFEK
Editorial Board
Baki YOKE
Burcu Irmak YAZICIOLU
Krat ZDLL
Asl BAAR
Advisory Board
Adil Meri ALTINZ, stanbul, Turkey
Tuncay ALTU, stanbul, Turkey
Canan ARKAN, Munich, Germany
Aglaia ATHANASSIADOU, Patras, Greece
ehnaz BOLKENT, stanbul, Turkey
Nihat BOZCUK, Ankara, Turkey
A. Nur BUYRU, stanbul, Turkey
Kemal BYKGZEL, Zonguldak, Turkey
Hande ALAYAN, stanbul, Turkey
smail AKMAK, stanbul, Turkey
Adile EVKBA, stanbul, Turkey
Beyazt IRAKOLU, stanbul, Turkey
Fevzi DALDAL, Pennsylvania, USA
Zihni DEMRBA, Trabzon, Turkey
Mustafa DJAMGZ, London, UK
Aglika EDREVA, Sofia, Bulgaria
nal EGEL, Bursa, Turkey
Deniz ERGE, stanbul, Turkey
Nermin GZKIRMIZI, stanbul, Turkey
Ferruh ZCAN, stanbul, Turkey
Fsun GMEL, stanbul, Turkey
Candan JOHANSEN, stanbul, Turkey
Asm KADIOLU, Trabzon, Turkey
Maria V. KALEVITCH, Pennsylvania, USA
Valentine KEFEL, Pennsylvania, USA
Meral KENCE, Ankara, Turkey
Uur ZBEK, stanbul, Turkey
Sevtap SAVA, Toronto, Canada
Mge TRET SAYAR, stanbul, Turkey
smail TRKAN, zmir, Turkey
Mehmet TOPAKTA, Adana, Turkey
Meral NAL, stanbul, Turkey
Selma YILMAZER, stanbul, Turkey
Ziya ZYLAN, stanbul, Turkey
Journal of Cell and Molecular Biology
CONTENTS Volume 7 No 2 & Volume 8 No 1 June 2010
Review Article
DNA repetitive sequences-types, distribution and function: A review
S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA
1
Research Articles
Genetic diversity of Penicillium species isolated from various sources in Sarawak,
Malaysia
H.A. ROSLAN, C.S. NGO and S. MUID
13
The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS)
S. BUDAK-DLER and M. TOPAKTA
25
Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate
induced renal oxidative damage in rats
M.M. AHMED and S.E. ALI
35
Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases
G. KO, K. ULUCAN, D. KIRA, D. ERGE, T. TARCAN and A.. GNEY
45
Do simple sequence repeats in replication, repair and recombination genes of
mycoplasmas provide genetic variability?
S. TRIVEDI
53
Software Review
Tcoffee : Multipurpose sequence alignments program
A. MANSOUR
71
UCSC: Genome Browser for genomic sequences
A. MANSOUR
75
Dotlet: powerful and easy strategy for pairwise comparisons
A. MANSOUR
81
Instructions for Authors 85
Journal of Cell and Molecular Biology 7(2) & 8(1): 1-11, 2010 Review Article
Hali University, Printed in Turkey.
http://jcmb.halic.edu.tr
DNA repetitive sequences-types, distribution and function: A review
Satyawada Rama RAO
*,1
, Seema TRIVEDI
2
, Deepika EMMANUEL
2
, Keisham MERITA
1
and Marlykynti HYNNIEWTA
1
1
Cytogenetics and Molecular Biology Laboratory, Department of Biotechnology and Bioinformatics, North-
Eastern Hill University, Permanent Campus, Mawkynroh, Umnsing,
Shillong- 793022, Meghalaya (INDIA)
2
Department of Zoology, Jai Narain Vyas University, Jodhpur- 342005, Rajasthan (INDIA)
(* author for correspondence; srrao22@yahoo.com)
Received: 21 September 2009; Accepted: 14 May 2010
Abstract
The development and use of molecular markers for the detection and exploitation of DNA polymorphism is
one of the most significant developments in the field of molecular genetics. DNA based molecular markers
have acted as versatile tools and have found their own position in various fields like taxonomy, physiology,
embryology, genetic engineering etc. A major step forward in genetic identification is the discovery that
about 30-90% of the genome is constituted by regions of repetitive DNA which are highly polymorphic in
nature. Microsatellites are multilocus probes creating complex banding patterns and are usually non-species
specific occurring ubiquitously. They form an ideal marker system and are dominant fingerprinting markers
and co-dominant STMS (sequence tagged microsatellites) markers. Microsatellites markers have been used
successfully to determine the degree of relatedness among individuals or groups of accessions to clarify the
genetic structure or partitioning of variation among individuals, accessions, populations and species.
Repetitive sequences have been widely used for examining genome and species relationships by in situ and
by Southern hybridization.
Keywords: Satellites, microsatellites, minisatellites, retroposons and proretroviral transposons
Tekrarl DNA dizileri-tipleri, dalmlar ve fonksiyonlar
zet
DNA polimorfizmlerinin tayini ve kullanlmas iin molekler belirtelerin gelitirip kullanlmas molekler
genetik alanndaki en nemli ilerlemelerden bir tanesidir. DNA tabanl molekler belirteler ok amal
kullanm aralardr ve taksonomi, fizyoloji, embriyoloji, genetik mhendislii gibi eitli alanlar arasnda
kendi yerlerini bulmulardr. Genetik tayine doru en byk adm, genomun hemen hemen %30-90nn
tekrarlanan, doada yksek oranda polimorfik olan DNA dizilerinden olutuunun kefidir. Mikrosatelitler
kompleks erit paterni oluturan multilokus problardr ve genellikle ska bulunup tre spesifik olmazlar.
Bunlar ideal belirte sistemini olutururlar ve dominant parmakizi belirteleri ve kodominant STMS
belirteleridirler (sequence tagged microsatellitesdizi iaretli mikrosatelitler). Mikrosatellit belirteler,
bireyler arasnda veya katlan gruplar arasnda genetik yapnn ya da bireyler, gruplar, populasyonlar ve trler
arasndaki varyasyonun gruplandrlmasnn aydnlatlmas iin, yaknlk derecesinin saptanmas amal
olarak baar ile kullanlmtr. Tekrarlanan diziler, genom ve trlerin ilikilerinin in situ ve Southern
hibridizasyonu ile incelenmesi iin yaygn olarak kullanlmaktadr.
Anahtar Szckler: Satelit, mikrosatelitler, minisatelitler, retropozonlar ve proretroviral transpozonlar
Satyawada Rama RAO et. al. 2
Introduction
The analysis of genetic diversity and relatedness
between or within different species, populations
and individuals is a central task for many
disciplines of biological science. Classical
strategies of evaluating genetic variability are
comparative anatomy, morphology, embryology
and physiology. These are complemented by
analysis of chemical constituents like plant
secondary compounds or with specific characteriza-
tion of macromolecules and allozymes. In recent
years, focus has been shifted to the development of
molecular markers based on DNA or protein
polymorphism. The importance of these studies lies
in exploitation of uniqueness of DNA sequences
that facilitate research in diverse disciplines such as
taxonomy, phylogeny, ecology, genetics and plant
breeding.
Establishing an individual's identity is one of
the uses of DNA sequence information that
highlight uniqueness of a particular sample. The
methodology focuses on ways to reduce complexity
of DNA into simple patterns that are representative
of the sample. This type of analysis is called
fingerprinting, profiling, genotyping or identity
testing. Jeffreys et al. (1985) introduced this term to
describe a method for the simultaneous detection of
variable DNA loci by hybridization of specific
multilocus probes with electrophoretically sepa-
rated restriction fragments. DNA fingerprinting is
useful for forensic identification, determination of
family relationship, linkage mapping, antenatal
diagnosis, localization of disease loci, determina-
tion of genetic variation, molecular archaeology
and epidemiology (Watkins, 1988; Donis-Keller et
al., 1987; Landegren et al., 1988; Paabo, 1989;
Golenberg et al., 1990). Molecular markers have
been used for identification of individuals, clones,
close relatives, paternity testing or in studies of
reproductive behavior and mating success.
Repetitive sequences as molecular markers
A repeat is recurrence of a pattern whereby DNA
exhibits recurrence of many features. The number
of occurrences of a pattern is called copy number.
The number of copies in a particular tandem repeat
region is termed region copy number. The term
genome copy number refers to number of copies of
tandem or interspersed repeats in genome.
The repetitive DNA family(ies) may be widely
distributed in a taxonomic family or a genus, or
may be specific for a species or chromosome.
Repeats may occur in specific locations in a
genome, e.g. in telomeric regions or scattered
throughout the genome. They may acquire large
scale variation in the sequence and copy number
over evolutionary time-scale. The repetitive
elements are under different evolutionary con-
straints as compared to the genes. Hybrid
polyploids are excellent models for studying
evolution of repetitive sequences (Kubis et al.,
1998). These variations are the basis of utilization
of repetitive sequences for taxonomic and
phylogenetic studies (Smith and Flavell, 1974).
There are many classifications of repetitive
DNA based on characteristics measured by
different techniques but consolidation of these
systems defines five broad classes: satellites,
microsatellites and minisatellites, retroposons and
proretroviral transposons. The classification
scheme makes a distinction between repetitive
regions exhibiting tandem repetition and inter-
spersed repetition but is not precise since each class
retains the characteristics of both. Some of these
repeats are described as follows:
Moderately repetitive DNA includes reiterations
of genes like tRNA, rRNA, hemoglobin etc. that
retain similar or nearly similar sequences due to
duplication. Some of these duplications result in
pseudogenes and may have many copies in the
genome. Some repetitive DNA sequences are
transposable elements since they ct not to enhance
the success of the cell (or organism) they reside in,
behave selfishly and also accumulate to the levels
restricted only by the resources available to them.
The selfish DNA hypothesis of Doolittle and
Sapienza, (1980) assumes that repetitive DNA can
behave in a selfish manner because it is not
functional. Indeed, there is some evidence that its
presence can result in losses of fitness of the host
cell due to mutations caused by transposable
elements. However, some moderately-repetitive
DNA has functions for example, in directing
chromosome movement in eukaryotes (Vogt,
1990). Variations in selfish DNA have the potential
for evolutionary changes, especially when it
changes without having any deleterious effects on
the organism (Flavell et al., 1977). Susumo Ohno
(1970) asserted that "natural selection merely
modified while redundancy created". Duplication
of genes can thus be internal source of novelty in
DNA repetitive sequences
3
the genome. If repetitive DNA is transposable, it
may create novel genes. Repetitive DNA is
therefore the "Research & Development"
laboratory of genome, creating both redundancy
and novel sequences that may prove valuable for
genome. However, these repetitive sequences are
generally not used for DNA fingerprinting.
Tandem and interspersed repeats
Tandem repetitions are consecutive head-to-tail,
direct, repetition of a pattern due to local
duplication. Interspersed repetitions are recurrence
of patterns that may or may not be proximal,
formed by either non-local duplication or multiple
introductions of the same or similar extraneous
DNA segments. These repeats are dispersed
throughout the genome and have no restriction on
the relative positions of identical occurrences
occurring in tandem locations. Research indicates
that interspersed repeats are inserts since they
resemble either processed RNAs i.e. retroposons, or
viruses i.e. proretroviral transposons. In addition, a
suspected target sequence for insertion occurs at
both ends of these repeats as expected for a circular
DNA crossover insertion. Furthermore, some
repeats actively move within the genome, such as
jumping genes in maize.
DNA repeat patterns also classify as direct,
indirect, complement, reverse complement or
palindrome. A direct or forward repeat is the
recurrence of a pattern on the same strand in the
same nucleotide order; e.g. ACCG recurs as
ACCG. An indirect, inverse or reverse repeat recurs
on the same strand but the order of the nucleotides
is reverse, e.g. the indirect recurrence of ACCG is
GCCA. Complement repeats are repeats where the
nucleotides are complemented according to Watson
Crick pairing, e.g. the complement of ACCG is
TGGC. A reverse complement repeat recurs on the
same strand but, the nucleotides are complemented
and the order of the nucleotides is reversed; e.g. the
reverse complement of ACCG is CGGT. In DNA,
most repetitions occur as forward or reverse
complement repeats and rarely as reverse or
complement repeats (Grumbach and Tahi, 1994).
Palindrome is a combination of two consecutive
occurrences in opposite orientations and read the
same when read from left to right or vice-versa.
Repetitive DNA sequences, divided into high-
repeat satellite DNA which replicates thousands or
millions of times and "moderate-repeat" mini-
satellite and microsatellite DNA which replicates
tens to perhaps a thousand times, account for
varying proportions of the genome of multicellular
eukaryotes. An example of representa-tive data
from eukaryotes has been given in Table 1.
Prokaryotes contain little or no repetitive
sequences. Noncoding repetitive DNA varies from
one group of organisms to another; individual to
individual and therefore used as DNA finger-
printing tool.
.
Table 1. Proportion of repetitive sequences of genomic DNA in different eukaryotes.
Drosophila Xenopus Mouse Tobacco
High repeat
Moderate repeat
Non repetitive
13%
13%
74%
3%
43%
54%
10%
20%
70%
5%
65%
30%
Tandem repeats and Satellite DNA
As repeats were discovered in different locations
exhibiting different copy numbers, new terms arose
such as satellite, minisatellite and microsatellite.
Some researchers refer to all types of satellites as
tandem repeats and describe a specific tandem
repeat region according to its location within the
genome, its periodicity, pattern structure and copy
number. These repeats were first identified on a
cesium chloride buoyant density gradient as peaks
separate from the primary DNA peak. The separate
or satellite peaks were composed of array of highly
conserved tandem repeats localized to hetero-
chromatic regions of chromosomes like
centromeres (Schueler et al., 2001). The structure
of a tandem repeat region has well-conserved
Satyawada Rama RAO et. al. 4
pattern but varies in size from less than 20 bp to
several thousand bp.
Structural and functional roles
Tandem repeats play significant structural and
functional roles. They occur in abundance in
structural areas such as telomeres, centromeres and
histone binding regions. They play a regulatory role
near genes and perhaps even within genes.
Transcription
The precise role of tandem repeats in transcription
regulation is not known. Since nucleosomes can
repress or enhance transcription initiation and
elongation (Hartzog and Winston, 1997; Kornberg
and Lorch, 1999) repeats may influence
transcription by affecting nucleosome positioning
and stability. Tighter bonds between the histone
complex and repeats restrict access for RNA
polymerase and regulatory proteins (Dai &
Rothman-Denes, 1999). This may happen by
changing the degree and direction of DNA
supercoiling or forming alternative DNA structures
such as cruciforms and hairpins (Shlyakntenko et
al., 1998; Ohyama, 2001). Tandem repeats having
an alternating purine (R=A or G) pyrimidine (Y=C
or U/T) pattern forms Z-DNA (Yang et al., 1996)
and repeats with a RRY or a YRY pattern form
triplex DNA structures (Grabcyzk and Usdin,
2000). The degree of repression is directly
proportional to repeat length.
Centromeric and subtelomeric satellite DNA
families
The tandem satellite DNA sequences exhibit
characteristic chromosomal locations, usually at
subtelomeric (or intercalary repetitive sequences)
and centromeric regions (Heslop-Harrison et al.,
2003; Jiang et al., 2003). Satellite DNA families
may arise de novo due to molecular mechanisms
like unequal crossing over, rolling circle
amplification, replication slippage and mutation.
Satellite DNA have variable repeat unit length
(sometimes equivalent to micro or minisatellite
length), often forming arrays spanning up to 100
Mb (Charlesworth et al., 1994; Kubis et al., 1998;
Schmidt and Heslop-Harrison, 1998; Vergnaud and
Denoeud, 2000). However, satellite repeat
monomer lengths of 140 180 bp and 300 360
bp, corresponding to the length of the mono and
dinucleosomes are most the common (Hemleben,
1990; Traut, 1991; Macas et al., 2002).
Centromeric tandem repeats ranging from 150-
200 bp in length (Henikoff et al., 2001) are
essential components of a functional centromere. A
functional centromere has been defined as the DNA
sequence which interacts with the kinetochore
where the interaction between centromere-kineto-
chore appears to be mediated by DNA-protein
recognition process (Jiang et al., 2003). The core
sufficient for centromeric function is an alpha
satellite about 3 Mbp long having a 171 bp pattern
recurring in a tandem fashion. (Schueler et al.,
2001; Zhong et al., 2002).
A highly repetitive 180 bps centromeric satellite
DNA family constituting between 2-5% of the
Arabidopsis thaliana genome is the key component
of its centromere/kinetochore complex (Nagaki et
al., 2003a,b). These repeats are occasionally
interrupted by the Athila retrotransposons, although
the latter are mainly clustered in pericentromeric
regions (Heslop-Harrison et al., 1999; Nagaki et al.,
2003a,b). Similarly, centromeric DNA in several
plants species including rice, maize, wheat, Beta
species and Zingeria biebersteiniana mainly
contain satellite sequence repeats and retro-
transposons (Gindullis et al., 2001; Kishii et al.,
2001; Kumekawa et al., 2001; Saunders and
Houben, 2001; Cheng et al., 2002; Nagaki et al.,
2003a,b). A high monomer divergence is observed
within several centromeric repetitive DNA families
thereby indicating presence of chromosome
specific variant sequences (Harrison and Helsop-
Harrison, 1995; Nagaki et al., 1998; Helsop-
Harrison et al., 2003). For example, chromosome
specific 180 bp satellite repeat variants in
Arabidopsis thaliana may be explained by the
possibility that either the repeat sequences on each
chromosome have been homogenizes independent-
ly or specific variants of the satellite sequence have
been amplified on each chromosome (Heslop-
Harrison et al., 1999).
The subtelomeric regions also contain repetitive
sequences (review in Pryde et al., 1997). Not all
species have the same structure but all have
structures containing tandem repeats, interspersed
repeats or both (Pryde et al., 1997). Degenerate
TTAGGG repeats enable alignment other sub-
telomeric regions allowing sequence exchange
between subtelomeres (Flint et al., 1997).
DNA repetitive sequences
5
Minisatellite and Microsatellite DNA
Hypervariable regions, also known as variable
number of tandem repeats (VNTRs) classified as
minisatellites and microsatellites are regions that
contain a variable copy number. These repeats are
found throughout the genome (Vogt, 1990) but
rarely within genes. Most regions contain short to
moderate region copy number (Jeffreys, 1985).
DNA fingerprinting capitalizes on the differences
between alleles at specific VNTR loci. Various
human diseases are attributed to high copy numbers
associated with some VNTR locus.
Minisatellites are characterized by moderate
length patterns, usually less than 50 bp (Jeffreys,
1985) with an array of 0.5 - 30kb. Two types of
variability are observed, viz., one displays copy
number variation with each replication event
whereas the other displays distinct alleles within a
population such that different alleles contain
different copy numbers.
Microsatellites, also known as simple sequence
repeats (SSRs) or simple tandem repeats (STRs)
have a short well-conserved pattern length of 2 to 6
bp and region copy number of 10 to 40 pattern
copies. Microsatellites have been found in non-
centromeric regions, many of them being located
either near or within genes.
Automatic identification and characterization of
tandem repeats is crucial as genome projects
generate an ever-increasing quantity of sequence
data. Tandem repeats increase the complexity of
genome sequence analysis algorithms. For instance,
the process of generating full chromosome
sequences often utilizes the sequence assembly
procedure; a procedure that stitches short, similar
fragments together to reconstruct a larger sequence.
The consecutive recurrence of a pattern associated
with tandem repeats confuses this process. Some
commercially available algorithms avoid
assembling tandem repeat regions. Others often
assemble moderate-sized tandem repeat regions
improperly. At present, algorithms are being
developed for handling tandem repeat regions.
The mechanism responsible for minisatellite and
simple sequence polymorphisms
Minisatellites and simple sequences are often
characterized by high mutation rates (up to 5%),
which may involve either internal heterogeneity of
repeats or their number. Mutation rates also show
positive correlation with the total size of the array
of repeats. In accordance with these observations,
high molecular weight bands within a multilocus
fingerprint are often more variable than bands
occurring in the low molecular weight range. The
molecular basis of both minisatellites and simple
sequence variability is still debatable. Possible
mechanism include replication slippage, trans-
position, recombinational events and/or unequal
exchange between sister chromatids or between
homologous chromosomes and gene conversion
(reviewed by Jarman and Wells, 1989; Jeffreys et
al., 1990; Richards and Sutherland 1992; Wolff et
al., 1991.)
The slippage hypothesis implicates mispairing
of slipped-strand during the replication process.
Strand slippage may happen due to shift in origin of
replication especially during lagging strand
synthesis. Strand slippage and mismatch appear to
be nucleotide specific. Differential activities of
mismatch pair of (CAG)
n
repeats occur but not of
(CTG)
n
repeats. Certain factors like the length of
the repeats and replication direction play a role in
destabilizing (CAG)
n
(CTG)
n
repeat. Such
positioning effects results in loop formation due to
stand slippage and results in expansion or reduction
of repeat during replication.
Several lines of evidence have lent support to
the recombination hypothesis:
A variety of minisatellite core sequences
share homology of the bacterial recombi-
nation signal chi.
Minisatellite - like sequences have been
found at sites of meiotic crossing over.
Both minisatellite and macrosatellites
behave as recombinational hot spots in
transfected mammalian cells.
Wolff et al., (1991) observed no exchange of
flanking markers in a newly created minisatellite
allele, thus ruling out unequal exchange between
homologous chromosomes as a mutational mecha-
nism. In human minisatellite locus, MS32
(reviewed by Jeffreys et al., 1985), 5 end of the
array has a strong mutation bias, suggesting
existence of a mutational hot spot. Some mutant
alleles contain segments from both parental alleles,
providing evidence for interallelic exchange. It is
suggested that the major mutational process
involves nonreciprocal transfer of repeats from a
donor allele to the 5 end of a recipient allele.
Therefore, recombinational processes as well as
replication slippage may contribute to the creation
of minisatellite and simple sequence variability.
However, other (yet unidentified) mechanisms may
Satyawada Rama RAO et. al. 6
also be involved, especially in case of the explosive
amplification of microsatellite like trinucleotide
repeats associated with human genetic diseases and
polymorphism. Structural analysis of mutated vs.
parental alleles may help to gain more information
about the mutational mechanisms. In this respect,
transgenic systems will be informative, since
successive deletion of the flanking DNA will allow
precise location of mutational hot spots.
Retroposons
Retroposons resemble processed RNAs and
transpose passively via RNA intermediate (Weiner,
1986). Each element is composed of an A-rich tail
at the 3' end and short target site duplications
(direct repeats of 5-21 bp) flanking the repeat
(Rabin, 1985). Two main subclasses dominate this
class:
Short Interspersed Elements (SINEs)
These are distributed throughout the non-
centromeric regions of genome (over 100,000
copies per genome) (Weiner, 1986). A SINE
contains one or more RNA polymerase III,
promoter sites and an A-rich region. One subfamily
is composed of a head-to-tail catenation of two
promoter site, A-rich region pairs (Weiner, 1986).
Both subfamilies are flanked by short direct repeats
of 5 to 21 bp. Primate specific Alu sequence (5 to 9
kbp) is a SINE with two promoter sites and a
dimer. The uniqueness of Alu sequences provides a
wonderful tool for separating primate DNA from
that of other species. SINEs present challenges to
sequence assembly due to their high genome copy
number (300,000 to 500,000 copies) (Rogers,
1985).
Long Interspersed Elements (LINEs)
LINEs are composed open reading frames (ORFs)
followed by a 3' A-rich region having 20,000 to
50,000 copies per genome (Hutchison et al., 1989;
Weiner, 1986). Direct repeats of 6-15 bp flank the
element. L1 family (primary LINE family) is 6 to 7
kbp long. The consensus structure of the family is
well defined but not well conserved because L1
element can deviate significantly from the structure
such that entire structural components are deleted
or duplicated (Weiner, 1986).
Proretroviral transposons
Proretroviral transposons are mobile elements that
transpose via RNA intermediate (Varmus and
Brown, 1989). Their structure and content
resembles integrated viruses and often contain
genes encoding viral products, e.g. protease,
reverse transcriptase and integrase (Boefe and
Corces, 1989). The LTRs contain transcriptional
signals for initiating and terminating transcripts, a
promoter, an enhancer and a polyadenylation signal
(Temin, 1985; Schmid et al., 1990). Inverse repeats
exist at the ends of each LTR and always begin
with the bases, TG, and end with CA (Temin,
1985). The two LTRs and the genes are flanked by
4 to 6 bp direct repeats.
Other recurring genetic features
DNA contains many recurring features that do not
classify as tandem or interspersed repeat. A gene
cluster is a group of proximal genes having similar
sequence and often, similar structure but, different
function. There may be requirement for multiple
copies of functional genes tRNA or rRNA genes.
Copies of promoters and other regulatory regions
associated with many genes also do not classify as
repetitive DNA.
Telomeres
Telomeric DNA is G-rich consisting of the
3overhang and adjacent tandem repeat with wide
variation in length across species (reviewed in
Blackburn, 1991; Hemann and Greider, 1999). For
example, length of telomere TTAGGG repeats in
humans is 5 to15 kbp but in mouse (Mus musculus)
it is ~50 kbp. Yeast, Saccharomyces cerevisiae, has
irregular pattern of TG1-3 and repeat length of
~300 bp. A recent model suggests that this region
does a d-loop-t-loop by having the 3 overhang
invade the tandem repeat (Griffith et al., 1999).
This invasion forms a triplex DNA structure, d-
loop, and encloses a large segment of duplex DNA
in a terminal loop or t-loop. Telomere length and
size of loops is species specific (Shore, 2001).
Universal presence of this structure across species
is not clear though there may be telomeres that are
unable to form a t-loop (Griffith et al., 1999).
DNA repetitive sequences
7
Nucleosomes
Periodicity of di-nucleotides (TATA-tetrads) or
tandem repeat with a 10 bp pattern of 5
TATAA(A/C)CG(T/C)C 3 band DNA and form
association with histone proteins (Widlund et al.,
1997). However, tandem repeats may increase or
decrease nucleosome stability. For example, a
tandem repeat having a CAG (=CTG) pattern
located close to a nucleosome increases its stability
(Wang et al., 1994; Wang and Griffith, 1995;
Godde and Wolffe, 1996). On the other hand,
tandem repeat CGG (=CCG) has no impact unless
it is methylated. Methylated CGG (=CCG) with a
limited copy number increase the nucleosome
stability while those with large copy numbers
decrease nucleosome stability (Godde et al., 1996;
Wang and Griffith, 1996).
Tandem repeats in genes
Tandem repeat hypervariability enables
identification of genes e.g. antifreeze gene and
several degenerative diseases. Repeats may help in
stability of transcripts or proteins but repeat
expansions and instability (particularly of
trinucleotide repeats) lead to neurological disorders
and cancer (Ashley and Warren, 1995; Mitas,
1997). Long stretch of CAG repeats translated into
polyglutamine tracts result in a gain-of-function,
possibly a toxin (Perutz et al., 1994; Baldi et al.,
1999). CGG, AGG and TGG repeats form
quadriplex and GAA repeats form triplex structures
that can block or reduce transcription and DNA
replication (Sinden, 1999). CGG repeats also
destabilize nucleosomes (Sinden, 1999) due to CpG
hypermethylation leading to promoter repression
and lack of gene expression (Nelson 1995, Baldi et
al., 1999). On the other hand, CTG repeats stabilize
nucleosomes and block replication forks in E. coli
(Sinden, 1999).
Evolution
Repeats have a role in genome evolution and
possibly in C-value paradox. Variation in nuclear
DNA amount in higher plants species exemplifies
this. The variation (>2500 fold) in 1C DNA content
in angiosperms ranges from 0.05 picograms in
Cardamine amara to 127.4 picograms in Fritillaria
assyriaca (Bennett, 1985). Part of such variation is
due to the numerical changes in chromosomes but
in many, there is substantial variation resulting
from amplification or deletion of DNA sequences.
Chromosomes of many monocot and dicot species
contain fast reassociating highly repetitive fraction,
slow reassociating middle repetitive fraction and
single copy sequences (Britten and Kohne, 1968;
Smith and Flavell, 1974; Flavell et al., 1977;
Katsiotis et al., 2000). These sequences may be
dispersed repetitive sequences including transpose-
able elements or tandem repeats. The retroelement
class forms sometimes upto 50% component of
plant genomes (Guidet et al., 1991; Heuros et al.,
1993; Kubis et al., 1998; Bennetzen, 2000;
Katsiotis et al., 2000; Linares et al., 2000; Ananiev
et al., 2002).
References
Ananiev EV, Vales MI, Phillips RL and Rines HW.
Isolation of A/D and C genome specific
dispersed and clustered repetitive DNA
sequences from Avena sativa. Genome. 45: 431-
441, 2002.
Ashley CT and Warren ST. Trinucleotide repeat
expansion and human disease. Annu Rev Genet.
29: 703-728, 1995.
Baldi P, Brunak S, Chauvin Y and Pedersen AG.
Structural basis for triplet repeat disorders: a
computational analysis. Bioinformatics. 15:
918-929, 1999.
Bennett MD. Interspecific variation in DNA
amount and the nucleotypic dimension. In Plant
genetics (UCLA symposium on molecular and
cellular biology), Freeling M (Ed). New York:
Alan R. Liss. 283-302, 1985.
Bennetzen JL. Transposable element contributions
to plant gene and genome evolution. Plant Mol
Biol. 42: 251-269, 2000.
Blackburn EH. Telomeres. Trends Biochem Sci. 16:
378381, 1991.
Boefe JD and Corces VG. Transcription and
reverse transcription of retroposons. Annu Rev
Microbiol. 43: 403-434, 1989.
Britten RJ and Koehne DE. Repeated sequences in
DNA. Science. 161: 529-540, 1968.
Charlesworth B, Sniegowski P and Stephan W. The
evolutionary dynamics of repetitive DNA in
eukaryotes. Nature. 371: 215-220, 1994.
Satyawada Rama RAO et. al. 8
Cheng Z, Dong F, Langdon T, Ouyang S, Buell
CR, Gu M, Blattner FR and Jiang J. Functional
rice centromeres are marked by a satellite repeat
and a centromere-specific retrotransposon.
Plant Cell. 14: 1691-1704, 2002.
Dai X and Rothman-Denes LB. DNA structure and
transcription. Curr Opin Microbiol. 2: 126-130,
1999.
Donis-Keller H, Green P, Helms C, Cartinhour S,
Weiffenbach B, Stephens K, Keith TP, Bowden
DW, Smith DR, Lander ES , Botstein D, Akots
G, Rediker KS, Gravius T, Brown VA, Rising
MB, Parker C, Powers JA, Watt DE, Kauffman
ER, Bricker A, Phipps P, Muller-Kahle H,
Fulton TR, Ng S, Schumm JW, Braman JC,
Knowlton RG, Barker DF, Crooks SM, Lincoln
SE, Daly MJ and Abrahamson J. A genetic
linkage map of the human genome. Cell. 51:
319-337, 1987.
Doolittle WF and Sapienza C. Selfish genes, the
phenotype paradigm and genome evolution.
Nature. 284: 601-603, 1980.
Flavell RB, Rimpau J and Smith DB. Repeated
sequence DNA relationships in four cereal
genomes. Chromosoma. 63: 205-222, 1977.
Flint J, Bates GP, Clark K, Dorman A, Willingham
D, Roe BA, Micklem G, Higgs DR and Louis
EJ. Sequence comparison of human and yeast
telomeres identifies structurally distinct
subtelomeric domains. Hum Mol Genet. 6:
1305-1314, 1997.
Gindullis F, Desel C, Galasso I and Schmidt T. The
large-scale organization of the centromeric
region in Beta species. Genome Res. 11: 253-
265, 2001.
Godde JS and Wolffe AP. Nucleosome assembly
on CTG triplet repeats. J Biol Chem. 271:
15222-15229, 1996.
Godde JS, Kass SU, Hirst MC and Wolffe AP.
Nucleosome assembly on methylated CGG
triplet repeats in the fragile X mental retardation
gene 1 promoter. J Biol Chem. 271: 24325-
24328, 1996.
Golenberg EM, Giannasi DE, Clegg MT, Smiley
CJ, Durbin M, Henderson D and Zurawski G.
Chloroplast DNA sequence from a miocene
Magnolia species. Nature. 344: 656-658, 1990.
Grabczyk E and Usdin K. Alleviating transcript
insufficiency caused by Friedreichs ataxia
triplet repeats. Nucl Acids Res. 28: 4930-4937,
2000.
Griffith JD, Comeau L, Rosenfield S, Stansel RM,
Bianchi A, Moss H and de Lange T.
Mammalian telomeres end in a large duplex
loop. Cell. 97: 503-514, 1999.
Grumbach S and Tahi F. A new challenge for
compression algorithms: genetic sequences. J
Inform Process Management. 30: 875-886,
1994.
Guidet F, Rogowsky PM, Taylor C, Song W and
Langridge P. Cloning and characterization of a
new rye-specific repeated sequence. Genome.
34: 81-87, 1991.
Harrison GE and Heslop-Harrison JS. Centromeric
repetitive DNA in the genus Brassica. Theor
Appl Genet. 90: 157-165, 1995.
Hartzog GA and Winston F. Nucleosomes and
transcription: recent lessons from genetics. Curr
Opin Genet Dev. 7: 192-198, 1997.
Hemleben V. Molekularbiologie der Pflanzen.
UTB. Gustav Fischer Verlag, Stuttgart. 1990.
Hemann MT and Greider CW. G-strand overhangs
on telomeres in telomerase deficient mouse
cells. Nucl Acids Res. 27: 3964-3969, 1999.
Henikoff S, Ahmad K and Malik HS. The
Centromere Paradox: Stable inheritance with
rapidly evolving DNA. Science. 293: 1098-
1102, 2001.
Heslop-Harrison JS, Murata M, Ogura Y,
Schwarzacher T and Motoyoshi F.
Polymorphisms and genomic organization of
repetitive DNA from centromeric regions of
Arabidopsis chromosomes. Plant Cell. 11: 31-
42, 1999.
Heslop-Harrison JS, Brandes A and Schwarzacher
T. Tandemly repeated DNA sequences and
centromeric chromosomal regions of
Arabidopsis species. Chromosome Res. 11: 241-
253, 2003.
Hueros GY and Ferrer E. A structural and
evolutionary analysis of a dispersed repetitive
sequence. Plant Mol Biol. 22: 635-643, 1993.
DNA repetitive sequences
9
Hutchison III CA, Hardies SC, Loeb DD, Shehee
WR and Edgell MH. LINEs and related
retroposons: Long interspersed repeated
sequences in the eukaryotic genome. In Mobile
DNA. Berg DE and Howe MM (Ed). American
Society for Microbiology, Washington D.C.,
593-617, 1989.
Jarman AP and Wells RA. Hypervariable
minisatellites, recombinators or innocent
bystanders? Trends Genet. 5: 367-371, 1989.
Jeffreys AJ, Wilson V and Thein SL. Hypervariable
minisatellite regions in human DNA. Nature.
314: 67-73, 1985.
Jeffreys AJ, Neumann R and Wilson V. Repeat unit
sequence variation in minisatellites: a novel
source of DNA polymorphism for studying
variation and mutation by single molecule
analysis. Cell. 60: 473-485, 1990.
Jiang J, Birchler JA, Parrott WA and Dawe RK. A
molecular view of plant centromeres. Trends
Plant Sci. 8: 570-575, 2003.
Katsiotis A, Loukas M and Heslop-Harrison JS.
Repetitive DNA, genome and species
relationships in Avena and Arrhenatherum
(Poaceae). Ann Bot. 86: 11351142, 2000.
Kishii M, Nagaki K and Tsujimoto H. A tandem
repetitive sequence located in the centromeric
region of common wheat (Triticum aestivum)
chromosomes. Chromosome Res. 9: 417-428,
2001.
Kornberg RD and Lorch Y. Twenty-five years of
the nucleosome fundamental particle of the
eukaryote chromosome. Cell. 98: 285-294,
1999.
Kubis S, Schmidt T and Heslop-Harrison JS.
Repetitive DNA elements as a major component
of plant genomes. Ann Bot. 82: 45-55, 1998.
Kumekawa N, Hosouchi T, Tsuruoka H and Kotani
H. The size and sequence organization of the
centromeric region of Arabidopsis thaliana
chromosome 4. DNA Res. 8: 285290, 2001.
Landegren U, Kaiser R, Caskey CT and Hood L.
DNA diagnostics-molecular techniques and
automation. Science. 242: 229-237, 1988.
Linares C, Irigoyen ML and Fominaya A.
Identification of C-genome chromosomes
involved in intergenomic translocations in
Avena sativa L., using cloned repetitive DNA
sequences. Theor Appl Genet. 100: 353-360,
2000.
Macas J, Meszaros T and Nouzova M. PlantSat: a
specialized database for plant satellite repeats.
Bioinformatics. 18: 28-35, 2002.
Mitas M. Trinucleotide repeats associated with
human disease. Nucl Acids Res. 25: 2245-2254,
1997.
Nagaki K, Song J, Stupar RM, Parokonny AS,
Yuan Q, Ouyang S, Liu J, Hsiao J, Jones KM,
Dawe RK, Buell CR and Jiang J. Molecular and
cytological analyses of large tracks of
centromeric DNA reveal the structure and
evolutionary dynamics of maize centromeres.
Genetics.163: 759-770, 2003a.
Nagaki K, Talbert PB, Zhong CX, Dawe RK,
Henikoff S and Jiang J. Chromatin
immunoprecipitation reveals that the 180-bp
satellite repeat is the key functional DNA
element of Arabidopsis thaliana centromeres.
Genetics. 163: 1221-1225, 2003b.
Nagaki K, Tsujimoto H and Sasakuma T. A novel
repetitive sequence of sugar cane, SCEN
family, locating on centromeric regions.
Chromosome Res. 6: 295-302.
Nelson DL (1995). The fragile X syndromes.
Seminars in Cell Biology. 6: 5-11, 1998.
Ohyama T. Intrinsic DNA bends: an organizer of
local chromatin structure for transcription.
BioEssays. 23: 708715, 2001.
Paabo S. Ancient DNA: extraction,
characterization, molecular cloning, and
enzymatic amplification. Proc Natl Acad Sci
U.S.A. 86(6): 1939-1943, 1989.
Perutz MF, Johnson T, Suzuki M and Finch JT.
Glutamine repeats as polar zippers: their
possible role in inherited neurodegenerative
diseases. Proc Natl Acad Sci U.S.A. 91: 5355-
5358, 1994.
Pryde FE, Gorham HC and Louis EJ. Chromosome
ends: all the same under their caps. Curr Opin
Genet Dev. 7: 822-828, 1997.
Rabin M. In "Discovering Repetitions in Strings,"
Combinatorial Algorithms on Words.
Satyawada Rama RAO et. al. 10
Apostolico and Galil (Ed). NATO ASI Series.
12: 279-288, 1985.
Richards RI and Sutherland GR. Simple repeat
DNA is not replicated simply. Nat Genet. 6:
114-116, 1994.
Rogers JH. Long interspersed sequences in
mammalian DNA: Properties of newly identi-
fied specimens. Biochim Biophys. 824: 113-120,
1985.
Saunders VA and Houben A. The pericentromeric
heterochromatin of the grass Zingeria
biebersteiniana (2n = 4) is composed of
Zbcen1-type tandem repeats that are
intermingled with accumulated dispersedly
organized sequences. Genome. 44: 955-961,
2001.
Schmid CW, Wong EF and Deka N. Single copy
sequences in galago DNA resembles a repetitive
human retrotransposon-like family. J Mol Evol.
31: 92-100, 1990.
Schmidt T and Heslop-Harrison JS. Genomes,
genes and junk: the large-scale organization of
plant chromosomes. Trends Plant Sci. 3: 195-
199, 1998.
Schueler MG, Higgins AW, Rudd MK, Gustashaw
K and Willard HF. Genomic and genetic
definition of a functional human centromere.
Science. 294: 109-115, 2001.
Shlyakhtenko LS, Potaman VN, Sinden RR and
Lyubchenko YL. Structure and dynamics of
supercoil-stabilized DNA cruciforms. J Mol
Biol. 280: 61-72, 1998.
Shore D. Telomeric chromatin: replicating and
wrapping up chromosome ends. Curr Opin
Genet Dev. 11: 189-198, 2001.
Sinden RR. Human genetics 99: trinucleotide
repeats - Biological implications of the DNA
structures associated with disease-causing
triplet repeats. Am J Hum Genet. 64: 346-353,
1999.
Smith DB and Flavell RB. The relatedness and
evolution of repeated nucleotide sequences in
the genomes of some Gramineae species.
Biochem Genet. 12: 243-256, 1974.
Susumu O. Evolution by gene duplication.
Springer-Verlag, New York, NY. ISBN 0-04-
575015-7, 1970.
Temin HM. Reverse transcription in the eukaryotic
genome: retroviruses, pararetroviruses, retro-
transposons, and retrotranscripts. Mol Biol Evol.
2: 455-468, 1985.
Traut W. Chromosomen Klassische and molekulare
Cytogenetik. Springer-Verlag, Berlin, 1991.
Varmus HE and Brown PO. Retroviruses. In
Mobile DNA. Berg D E and Howe M M (Ed)
ASM Publications, New York. 35-56, 1989.
Vergnaud G and Denoeud F. Minisatellites:
Mutability and genome architecture. Genome
Res.10: 899-907, 2000.
Vogt P. Potential genetic functions of tandem
repeated DNA sequence blocks in the human
genome are based on a highly conserved
chromatin folding code. Hum Genet. 84: 301-
336, 1990.
Wang YH, Amirhaeri S, Kang S, Wells RD and
Griffith JD. Preferential nucleosome assembly
at DNA triplet repeats from the myotonic
dystrophy gene. Science. 265: 669-671, 1994.
Wang YH and Griffith J. Expanded CTG triplet
blocks from the myotonic dystrophy gene create
the strongest known natural nucleosome
positioning elements. Genomics. 25: 570-573,
1995.
Wang YH and Griffith J. Methylation of expanded
CCG triplet repeat DNA from fragile X
syndrome patients enhances nucleosome
exclusion. J Biol Chem. 271: 22937-22940,
1996.
Watkins PC. Restriction Fragment Length
Polymorphism (RFLP): application in human
chromosome mapping and genetic disease
research. Biotechniques. 6: 310-320, 1988.
Weiner AM, Deininger PL and Efstratiadis A.
Nonviral retroposons: genes, pseudogenes, and
transposable elements generated by the reverse
flow of genetic information. Annu Rev Biochem.
55: 631-661, 1986.
Widlund HR, Cao H, Simonsson S, Magnusson E,
Simonsson T, Nielsen PE, Kahn JD, Crothers
DM and Kubista M. Identification and
characterization of genomic nucleosome-
positioning sequences. J Mol Biol. 267: 807-
817, 1997.
DNA repetitive sequences
11
Wolff RK, Plaeke R, Jeffreys AJ and White R.
Unequal crossing over between homologous
chromosomes is not the major mechanism
involved in the generation of new alleles at
VNTR loci. Genomics. 5: 382-384, 1991.
Yang CF, Kim JM, Molinari E and DasSarma S.
Genetic and topological analyses of the bop
promoter of Halobacterium halobium:
stimulation by DNA supercoiling and non-B-
DNA structure. J Bacteriol. 178: 840-845,
1996.
Zhong CX, Marshall JB, Topp C, Mroczek R, Kato
A, Nagaki K, Birchler JA, Jiang J and Dawe
RK. Centromeric retroelements and satellites
interact with Maize kinetochore protein
CENH3. Plant Cell. 14: 2825-2836, 2002.
12
Journal of Cell and Molecular Biology 7(2) & 8(1): 13-23, 2010 Research Article
Hali University, Printed in Turkey.
http://jcmb.halic.edu.tr
Genetic diversity of Penicillium species isolated from various sources
in Sarawak, Malaysia
Hairul Azman ROSLAN
*, 1
, Chua Suk NGO
1
and Sepiah MUID
2
1
Department of Molecular Biology, Faculty of Resource Science and Technology, Universiti Malaysia
Sarawak, 94300 Kota Samarahan, Sarawak Malaysia
2
Department of Plant Sciences and Environmental Ecology, Faculty of Resource Science and
Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak Malaysia
(* author for correspondence; rhairul@frst.unimas.my )
Received: 26 December 2008; Accepted 30 December 2009
Abstract
Borneo Island is one of the megadiversity centres of the world and contain vast amount of flora and fauna.
The Penicillium species are among the most commonly occurring and economically important members of
micro-fungi family. In this study, morphological and random amplification polymorphic DNA (RAPD)
molecular methods were used to group and determine genetic variability and relationship among twenty
Penicillium isolates from various locations in Western part of Borneo Island that was maintained in the pure
culture collection of University Malaysia Sarawak. Comparison between morphological and molecular
method using M13 and OPD10 primers were undertaken and showed that in some cases, the groupings of
isolates based on morphological method were consistent with molecular groupings with a few exceptions.
Molecular analysis also indicated genotype variability between the isolates with little correlation with either
the origin of soil or geographical location.
Keywords: Penicillium species, morphology, RAPD, M13, variation
Malezya Sarawakta Farkl Kaynaklardan Elde Edilen Penicillium Trlerinin
Genetik eitlilii
zet
Borneo adas dnyann en ok eitlilie sahip merkezlerinden bir tanesidir ve byk miktarda flora ve
faunaya sahiptir. Penicillium (kf) trleri mikro-mantar ailesinin en sk rastlanan ve ekonomik olarak nemli
yeleri arasndadr. Bu almada Borneonun bat blgelerinden elde edilip Malezya Sarawak
niversitesindeki saf kltr koleksiyonlarnda muhafaza edilen yirmi Penicillium izolatn gruplamak ve
aralarndaki genetik eitlilii ve ilikiyi belirlemek iin, morfolojik ve polimorfik DNAnn rastgele
amplifikasyonu (RAPD) metodu kullanlmtr. M13 ve OPD10 primerleri kullanlarak morfolojik ve
molekler metodlar arasnda kyaslama yaplm ve birka istisna ile baz durumlarda, izolatlarn morfolojik
metodlara dayanarak gruplandrlmalarnn molekler gruplandrlmalar ile uyumlu olduu gsterilmitir.
Molekler analiz ayn zamanda izolatlar arasnda, topran kayna veya corafi blge ile az korelasyon
gstermesine ramen, genotip varyasyonu gstermitir.
Anahtar Szckler: Penicillium trleri, morfoloji, RAPD, M13, varyasyon
Hairul Azman ROSLAN
et al. 14
Introduction
Fungi and bacteria are the principal decomposers
that release carbon, nitrogen and other elements
that otherwise would become tied up in organic
matter (Carlile et al., 2001). Fungi play an
important role in decomposing forest litter or dung,
fruits or other organic materials. Farms fruits and
crops are vulnerable to fungal attack and 10% to
50% of the worlds harvested fruit is lost each year
due to fungal attack (Campbell and Reece, 2002).
However, fungi also have a number of practical
uses for humans. The distinctive flavours of certain
kinds of cheeses, including Roqueorti and blue
cheese, come from the fungi used to ripen them.
The soft drink industry uses Aspergillus niger to
produce citric acid. Beside that, a family of
unicellular fungi, Saccharomyces cerevisiae is the
most important fungi used in the food industries
such as in baking, alcohol brewing and wine
making. Apart from food industries, fungi are
medically valuable as antibiotic producers used to
treat infections (Thom, 1945). The Penicillium spp
are among the most commonly occurring and
economically important members of microfungi
family. Although much is known about Penicillium
physiology and mycotoxin chemistry, one of the
main challenges is in the area of rapid and reliable
identification of Penicillium in many settings
including community health care, occupational
health and food safety (Scott, 1977; Cruz-Perez et
al., 2001; Meklin et al., 2004; Portnoy et al., 2004).
Sarawak is one of the centres of mega- if not giga-
diversity region and possesses a vast potential of
undiscovered organisms including Penicillium spp.
We have isolated a number of Penicillium from
various location and sources within Sarawak. Here
we report the genotyping of Penicillium spp from
UNIMAS pure culture collections.
Materials and Methods
Collection and maintenance of fungal isolates
Twenty Penicillium isolates were obtained from
Universiti Malaysia Sarawak (UNIMAS) culture
collection. The fungi collection was isolated from
various sources in Sarawak such as from mangrove
soil, leaf litter, peat soil, soy sauce, karas and
rambutan (Table 1). A map of Sarawak state is
shown in Figure 1, indicating the sampling
locations. Fungi from stock culture were re-
cultured on Malt Extract Agar (MEA) and Czapek
Yeast Agar (CYA) in Petri dishes. Each isolate was
inoculated at three-points on each media in petri
dishes. The inoculated plates were kept at room
temperature (22-25C) for seven days.
Figure 1. Map of Sarawak state in Malaysia indicating sampling sites. 1: Karangas
Forest, 2: Mixed Dipterocarp Forest, 3: Riverine Forest, Samunsam; 4: Sematan; 5:
Kuching; 6: Kampung Bako; 7:Bako Island; 8: Kota Samarahan; 9: Bintulu
Genetic diversity of Penicillium species in Sawarak, Malaysia 15
Table 1 List of fungal collection, the substrate it was extracted from and location of the fungal (*numbers in
superscript indicate origin of isolate corresponding to Figure 1)
Fungal
isolates
UFI
(Unimas Fungi Index)
Substrate Origin
P1 1433 Mangrove soil
6
Kampung Bako
P2 1435 Mangrove soil
6
Kampung Bako
P3 0646 Leaf litter
1
Karangas Forest, Samunsam
P4 0687 Karas
8
Samarahan
P5 1439 Soy sauce
8
Samarahan
P6 1443 Soy sauce
8
Samarahan
P7 1434 Mangrove soil
6
Kampung Bako
P8 1440 Soy sauce
5
Kuching
P9 0338 Leaf litter
2
Mixed Dipterocarp Forest, Samunsam
P10 1445 Karas
8
Samarahan
P11 1446 Peat soil
8
Samarahan
P12 1436 Mangrove soil
4
Sematan
P13 1438 Soy sauce
8
Samarahan
P14 0630 Leaf litter
1
Karangas Forest, Samunsam
P15 1437 Peat soil
9
Bintulu
P16 0650 Leaf litter
3
Riverine Forest, Samunsam
P17 1441 Mangrove soil
7
Bako Island
P18 1447 Rambutan
8
Samarahan
P19 1442 Mangrove soil
7
Bako Island
P20 1444 Soy sauce
5
Kuching
Morphological study
A small tuft of mycelium and conidiophores were
lifted from a fairly young section of the colony and
placed on a drop of acid fuschin on a glass slide. A
cover slip was gently lowered on the specimen.
Slides were sealed with Canada balsam.
Identification of the fungi was based on culture
characteristics and conidiophore structure. Cultural
characteristics such as colony colour, texture,
colony growth, exudates, odour, zonation and
pigmentation were examined. Conidiophore
structure that includes its length, phialides, branch-
ing system and conidia were also examined. Images
were taken by using Nikon digital camera. Notes of
International Mycological Institute (IMI)
descriptions were used as reference for the
identification.
Molecular study
Isolation of DNA
DNA was extracted using a rapid extraction method
as introduced by Taylor and Natvig (1987). Genetic
material was also taken directly from mycelia
growing on CYA using clean, autoclaved tips. The
genetic materials were then mixed with 25-30l of
Tris-EDTA (TE) buffer and then vortexed. The
DNA was kept in -20C until required.
RAPD-PCR amplification
Two PCR primers, M13 (5-
TTATGTAAACGACGGCCAGT -3) and OPD10
(5-GTGATCGCAG-3), were used to amplify 20
Penicillium isolates. A negative control was
included in each amplification process. The PCR
mixture used for the RAPD in this study consisted
of 2.5l of 10X PCR buffer (Vivantis), 2.5l of
2mM dNTPs (Vivantis), 10 pmol/l M13 or 5
pmol/l OPD-10, 2 U Taq polymerase (Vivantis)
and 2.5l DNA template. Sterile distilled water was
added to total up the PCR reaction volume to 25 l.
Amplification was conducted using Biometra T-
Gradient (Biometra) with the following temperature
profile (Table 2):
Hairul Azman ROSLAN
et al. 16
Table 2. PCR amplification parameters using the M13 primers and OPD-10
Parameters Temperature and Reaction time
Initial denaturation 94C for 3 minutes
Denaturation 84C for 30 seconds
Annealing 46C / 30C for 1 minute (M13 /
OPD10)
Extension 72C for 2 minutes
Number of cycles 35
Final extension 72C for 7 minutes
Separation of DNA fragments by gel
electrophoresis
The amplicons were separated using 1.3 % (w/v)
agarose gel electrophoresis in 1X TAE (Tris-Acetic
acid-EDTA) buffer. The electrophoresis was
performed at 100V for 90 minutes. The gel was
visualised using ethidium bromide under UV
transilluminator and documented using Gel
Documentation System (BioRad).
Construction of phylogenetic relationships
Each individual RAPD band was considered as
equivalent independent characters and all the bands
were scored as present or absent for each isolate.
Banding patterns were converted into binary tables.
The data was analyzed using genetic data analysis
software, Numerical Taxonomy and Multivariate
Analysis System (NTSYSpc) version 2.2. The data
was quantified by similarity index, Jij = Cij / (ni +
nj Cij), where Jij= the number of individuals i and
j, ni= the number of bands in individual i, nj= the
number of bands in individual j. A dendogram was
generated using Unweighted Pair-Group Method
with Arimethrical Averages (UPGMA) as
described by Sneath and Sokal (1973).
Results and Discussion
Morphological groupings of Penicillium isolates
All the isolates were initially identified based on
the cultural characteristics and structure of
conidiophores using stereo and compound
microscopes. Among the 20 isolates, 4 isolates
were grouped as Clade 1, 2 isolates were grouped
as Clade 2, 3 isolates were grouped as Clade 3, 2
isolates were grouped as Clade 4, 4 isolates were
grouped as Clade 5, 2 isolates were grouped as
Clade 6, and one isolate each for Clade 7, Clade 8
and Clade 9 respectively. Table 3 shows the clades
based on morphological characters, isolate name,
substrate it was found and origin of the isolates.
The detailed morphological classifications of
selected isolates are presented in Figures 2 to 7
below representing Clade 1 to Clade 6.
Genetic diversity of Penicillium species in Sawarak, Malaysia 17
Table 3 Morphological groupings of Penicillium isolates.
Clade Fungal isolates Substrate Origin
1 P1 Mangrove soil Kampung Bako
P7 Mangrove soil Kampung Bako
P14 Leaf litter Karangas Forest, Samunsam
P16 Leaf litter Riverine Forest, Samunsam
2 P2 Mangrove soil Kampung Bako
P12 Mangrove soil Sematan
3 P3 Leaf litter Karangas Forest, Samunsam
P9 Leaf litter Mixed Dipterocarp Forest,
Samunsam
P15 Peat soil Bintulu
4 P4 Karas Samarahan
P13 Soy sauce Samarahan
5 P5 Soy sauce Samarahan
P8 Soy sauce Kuching
P17 Mangrove soil Bako Island
P19 Mangrove soil Bako Island
6 P6 Soy sauce Samarahan
P20 Soy sauce Kuching
7 P10 Karas Samarahan
8 P11 Peat soil Samarahan
9 P18 Rambutan Samarahan
Figure 2. Clade 1 Penicillium P7 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA colour, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore
structure (Bi-Asymmetrical), (f) Conidia globose shape
Hairul Azman ROSLAN
et al. 18
Figure 3. Clade 2 Penicillium P2 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at
100X magnification (Monoverticillata), (f) Conidia globose shape
Figure 4. Clade 3 Penicillium P15 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at
100X magnification, arrow showing swollen apex, (f) Conidiophore structure at 40X
magnification (Monoverticillata), (g) Conidia globose shape
Genetic diversity of Penicillium species in Sawarak, Malaysia 19
Figure 5. Clade 4 Penicillium P13 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at
100X magnification (f) Conidiophore structure at 40X magnification (Bi-asymmetrical), (g)
Conidia globose shape
Figure 6. Clade 5 Penicillium P17 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at
100X magnification, arrow showing lanceolate phialides, (f) Conidiophore structure at 40X
magnification (Bi-asymmetrical), (g) Conidia globose shape
Hairul Azman ROSLAN
et al. 20
Figure 7. Clade 6 Penicillium P6 isolate. (a) Colony surface on CYA, (b) Colony reverse on
CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at
40X magnification (Terverticillata), (f) Conidia elliptical shape.
Molecular groupings of Penicillium isolates
Single, simple repetitive PCR primers have been
designed to amplify the microsatelite regions of
chromosomal DNA. In most applications these
primers have provided similar levels of specificity
to those seen with RAPD, and the results have been
used to group fungi at species level (Meyer et al.,
1992; Schlick et al., 1994; Bridge et al., 1997).
Two sets of primers were used, M13 and OPD-10
primers to analyse the variations between the 20
isolates of Penicillium spp. Six isolates were
excluded from the molecular study because either
the DNA could not be isolated or amplification was
not reproducible. Each sample was repeated at least
two times to determine its reproducibility and
consistency. Bands were scored for each primer
based on the presence (1) or absence (0) of
amplicon migration in the gel. Figure 8 and Figure
9 represent the RAPD profile of M13 and OPD-10
respectively. Figure 10 is a dendogram generated
from M13 data.
Genetic diversity of Penicillium species in Sawarak, Malaysia 21
Figure 8. RAPD band profile generated using M13 primer visualized on 1.3% (v/v) agarose. The
lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas) and
Lane N: 100bp DNA ladder (Seegene)
Figure 9. RAPD band profile generated using OPD10 primer visualized on 1.3% (v/v) agarose
gel. The lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas)
and Lane N: 100bp DNA ladder (Seegene)
Hairul Azman ROSLAN
et al. 22
Figure 10. Dendrogram showing relationships among 14 isolates of Penicillium species. Genetic
distances were obtained using M13 primer.
The study compared the classification
generated from morphological data and molecular
data. Comparison of the two datasets indicated that
the RAPD banding patterns were generally
consistent with morphological data. Combination of
morphological and molecular data can be used to
increase the confidence that the isolates were
grouped correctly. Previous study carried out by
Lutzoni and Vilgalys (1995) integrated molecular
and morphological data sets in order to estimate
fungal phylogenies in lichenized and non-
lichenized Omphalina species. They found that
homogeneity testing of the 28S large subunit
ribosomal DNA sequences and the morphological
characters showed that the two data sets were
sampling the same phylogenetic history. In this
study, the dendrogram generated from
amplification with M13 primer gives approximately
79% correlation with morphological data as 11 out
of 14 isolates were observed to give similar
groupings. As in the case of OPD10, there was
approximately 69% correlation with morphological
data as 9 out of 13 isolates were observed to
correlate with morphological groupings. Molecular
analysis has shown that two isolates that were
initially grouped in different cluster based on the
morphological characterization, appeared to be
identical at the genetic levels when characterized
with RAPD analysis. For isolates P5 (peat soil) and
P19 (mangrove soil), showed minor differences in
their morphological characteristics but showed to
be identical at the genetic levels.
The dendogram generated from M13 primer
(Figure 10) also showed little correlation between
isolates isolated from the same soil type for
example isolates isolated from mangrove soil P1
and P2 are grouped into Clade 1 while P2 and P12
in Clade 5. Apart from that, geographical origin
also showed little correlation as seen in isolates
isolated from soy sauce from Samarahan area P13
and P5 found in Clade 6 and Clade 7 respectively,
indicating a wide variation of Penicillium that can
be found throughout the sampling area. Spatial
variations in microfungi communities is quite
common and have been shown to be attributed to
various factors such as soil chemistry, plant
composition such as the alpine and birch
Genetic diversity of Penicillium species in Sawarak, Malaysia 23
communities (Lumley et al., 2001; Mclean and
Huhta 2002; Bellis et al., 2007).
Conclusion
In this study, most isolates showed correlation and
consistency in morphological and molecular data.
Molecular analysis was also able to show that in the
instance of P5 and P19 to be genetically identical
when characterized with RAPD compared to
morphological analysis. The study also indicated
that the isolates showed considerable genotypic
variations within Penicillium spp isolated from a
wide area in Sarawak and little correlation to both
the type of soil they originated from and also
geographical location.
Acknowledgement
This work is supported by Unimas Fundamental
Research Grant.
References
Bellis TD, Kernaghan G, Widden P. Plant
community influences on soil microfungal
assemblages in boreal mixed-wood forests.
Mycologia. 99(3):356-367. 2007.
Bridge PD, Prior C, Sagbohan J, Lomer CJ, Carey
M and Buddie A. Molecular characterization of
isolates from locusts and grasshoppers.
Biodiversity and Conservation. 6:177-189.
1997.
Campbell NA, Reece JB. Biology sixth edition. pp
616-630. 2002.
Carlile MJ, Watkinson SC and Graham WG. The
Fungi. Second edition. San Diego, California:
Academic Press; 2001.
Cruz-Perez P, Buttner MP and Stetzenbach LD.
Specific detection of Stachybotrys chartarum in
pure culture using quantitative polymerase
chain reaction. Mol. Cell. Probes. 15 (23), pp.
129138. 2001.
Lumley TC, Gignac LD and Currah RS.
Microfungus communities of white spruce and
trembling aspen logs at different stages of decay
in disturbed and undisturbed sites in the boreal
mixedwood region of Alberta. Canadian J Bot.
79:7692. 2001.
Lutzoni F and Vilgalys R. Integration of
morphological and molecular data sets in
estimating fungal phylogenies. Canadian J Bot.
73(suppl. 1):S49-659. 1995.
Mclean MA and Huhta V. Microfungal community
structure in anthropogenic birch stands in
central Finland. Biology and Fertility of Soils.
35:112. 2002.
Meklin T, Haugland RA, Reponen T, Varma M,
Lummus Z, Bernstein D, Wymer LJ and Vesper
SJ. Quantitative PCR analysis of house dust can
reveal abnormal mold conditions. J. Environ.
Monit. 6 pp. 615620. 2004.
Meyer W, Moraywetz R, Borner T and Kubicek
CP. The use of DNA fingerprint analysis in the
classification of some species. Curr Genet.
21:27-30. 1992.
Portnoy JM, Barnes CS and Kennedy K. Sampling
for indoor fungi. J. Allergy Clin. Immunol. 113
pp. 189198. 2004.
Schlick A, Kuhls K, Meyer W, Lieckfeldt E,
Borner T and Messner K. Fingerprinting reveals
gamma-ray induced mutations in fungal DNA:
implications for identification of patent strains
of Trichoderma harzianum. Curr Genet. 26: 74-
78. 1994.
Scott PM. Penicillium mycotoxins. In "Mycotoxic
Fungi, Mycotoxins, Mycotoxicoses, an
Encyclopedic Handbook. Vol. 1. Mycotoxigenic
Fungi' eds. T.D. Wyllie and L.G. Morehouse.
New York: Marcel Dekker. pp. 283-356. 1977.
Sneath PHA and Sokal RR. Numerical Taxonomy.
W.H. Freeman, San Francisco; 1973.
Taylor JW and Natvig D. Isolation of fungal DNA.
In: Fuller, M.S. and Jaworski, A. (eds)
Zoosporic Fungi in Teaching and Research.
South-eastern Publishing Corporation, Athens,
Georgia. pp. 252-258. 1987.
Thom C. Mycology presents penicillin. Mycologia.
37:460-475. 1945.
24
Journal of Cell and Molecular Biology 7(2) & 8(1): 25-34, 2010 Research Article
Hali University, Printed in Turkey.
http://jcmb.halic.edu.tr
The sensitivity of the human chromosomes to ethyl methane
sulfonate (EMS)
Songl BUDAK DLER
*,1
, Mehmet TOPAKTA
2
1
University of Nide, Department of Science and Letters, Nide, 51200, Turkey
2
University of Cukurova, Department of Science and Letters, Adana, 01330 Turkey
(* author for correspondence; budakdiler@gmail.com)
Received: 03 March 2009; Accepted 19 March 2010
Abstract
The aim of this study was to determine the chromosomal susceptibility to breakages by the mutagen Ethyl
methanesulfonate (EMS). For this reason, human peripheral blood lymphocytes were treated with varying
concentrations of EMS (5x10
-4
M, 10
-3
M and 2x10
-3
M) for 24 and 48 hours. The percentages of chromosomal
fragmentations in EMS-treated and untreated (control) cells were found to be statistically significant. In
addition, the extent of breakages of the same chromosomes correlated with the concentrations of the chemical.
The chromosomes that were fragmented most as a result of EMS-treatment in descending order were 1, 2, 6,
4, X, 7, 3, 5, 9, and 8.
Keywords: Ethyl methanesulfonate (EMS), human lymphocytes, chromosome damage, lymphocyte culture.
Etil Metansulfonat (EMS)ye nsan Kromozomlarnn Hassasiyeti
zet
Bu almann amac, mutajen Etil metansulfonat (EMS)nin insan kromozomlarnda oluturduu kromozom
krklarn incelemek ve en ok krlan kromozomlar saptamaktr. Bu ama iin hcreler, 5x10
-4
M, 10
-3
M ve
2x10
-3
M konsantrasyonlardaki EMS ile 24 ve 48 saat muamele edilmitir. 24 ve 48 saat EMS ile muamele
edilen insan periferal lenfositlerinde kontrolde ve ayn dozda, farkl kromozomlarda grlen kromozom
krlma yzdeleri bir birleriyle karlatrlm ve aralarndaki farkn istatistik bakmnda nemli olduu
bulunmutur. Ayrca ayn kromozomun farkl dozlardaki krlma yzdeleri kontroldeki krlma yzdeleriyle
karlatrlm, aradaki farkn nemli olduu saptanmtr. EMS ile muamele sonucu en fazla kromozom
krlmas 1., 2., 6., 4., X, 7., 3., 5., 9., ve 8. kromozomlarda tespit edilmitir.
Anahtar Szckler: Etil metansulfonat (EMS), insan kromozomlar, kromozom kr, lenfosit kltr.
Introduction
Ethyl methanesulfonate (EMS) is a colorless liquid.
When heated to decomposition, EMS emits toxic
fumes of sulfur oxides. EMS is reasonably
anticipated to be a human carcinogen based on
sufficient evidence of carcinogenicity in
experimental animals. EMS is used experimentally
as a mutagen, teratogen, and brain carcinogen and
as a research chemical (IARC 1974, IARC 1987,
HSDB 2000, Merck The Merck Index 1989). When
administered as a single intraperitoneal injection,
EMS induced lung tumors in male mice and lung
adenomas in mice of both sexes. Three
intraperitoneal injections of EMS in arachis oil
induced lung and kidney tumors in male mice. In a
similar study, EMS induced renal carcinomas in
Songl Budak DLER and Mehmet TOPAKTA
26
female rats and a variety of benign and malignant
tumors, including lung carcinomas, in rats of both
sexes (Ueo et al., 1981).
The tests sister chromatid exchange (SCE) and
chromosome aberrations (CA) are used to assess
the genotoxicicity of mutagenic and carcinogenic
chemicals (Perry and Evans, 1975). It was also
established that in fish cells, EMS increased SCE
and CA in a concentration dependent manner but
had no effect on their replicative index (RI)
(Maddock et al., 1986). Furthermore, Adhikari and
Grover showed that EMS caused CA in the rat bone
marrow cells (Adhikari and Grover, 1988). In 1990,
it was established that EMS enhanced SCE in the
peripheral leukocytes of humans in a concentration
dependent manner and decreased the RI in a dose-
independent manner (Topakta and Speit, 1990).
The sensitivities and clastogenicities of human
chromosomes with high gene density (1, 19 and 20)
and with low gene density (4 and 18) to
combinations of EMS and cytosine arabinoside
(Ara-C) were measured and the high gene density
chromosomes were found to be sensitive (Surralles
et al.,1997). Human peripheral blood lymphocytes
were treated with EMS (1,5x10
-4
M and 1,5x10
-3
M)
and MMS (1,5x10
-5
M and 1,5x10
-4
M) and the
treatment resulted in enhanced SCE compared to
untreated corresponding cultures (Harish et al.,
1998). it was demonstrated that the chemical EMS
enhanced SCE in whole blood and lymphocyte
cultures (During, 1985). In addition, EMS
treatment at various concentrations (5x10
-4
M, 10
-
3
M and 2x10
-3
M) of human peripheral blood
lymphocytes enhanced CA (Renczoullari and
Topakta, 2000). Therefore, we aimed at
investigating the degree of sensitivity of human
chromosomes to EMS by employing the
mutagenicity tests mentioned above.
Materials and Methods
In this study, we used peripheral blood and
lymphocytes from healthy donors, two males (23
and 24 years old), and two females (23 years old).
EMS (Sigma M-0880) was used as a test substance.
The preparation of chromosome was performed in
accordance with Evans 1984. In addition, this study
was prepared according to IPCS guidelines
(Albertini et al., 2000). Whole blood (0.2 ml) from
four healthy donors (two male and two female,
nonsmokers, aged: 23 and 24) was added to 2.5 ml
chromosome medium B (Biochrom, F5023). The
cultures were incubated at 37C for 72 h. The cells
were treated with concentrations of 5x10
-4
M, 10
-3
M
and 2x10
-3
M of EMS for 24 h (EMS was added 48
h after initiating the culture) and 48 h (EMS was
added 24 h after initiating the culture). The test
substance EMS was dissolved in ethanol (50%).
There was clear evidence that ethanol was not a
bacterial or mammalian cell mutagen in vitro
assays for chromosome aberration. Reported tests
for chromosome aberration induction in vivo were
all negative and only a minority of micronucleus
tests were positive (Phillips and Jenkinson, 2001).
Colchicine (0.06g/ml, Sigma C 9754) was added
for the last 2 h of culture. To collect the cells, the
cultures were centrifuged (1200 rpm, 15 min),
treated with hypotonic solution (0.4% KCl) for 13
min at 37
o
C, and then fixed in cold methanol:
glacial acetic acid (3: 1) for 20 min at room
temperature. The treatment with fixative was
repeated three times. Then the cells were spread on
glass slides and air dried. The slides were stained
with giemsa (5%). Well spread metaphases per
donor were examined 1000 magnification for
occurrence of different types of chromosome
aberration (CA). 100 metaphase cells with
chromosomes aberrations were examined in each
treated groups and control groups. Karyotyping was
performed using Olympus BX50 microscope and
Cytovision 3.00 Windows NT Applied Imaging
software. For statistical analysis, the ONE WAY
ANOVA and DUNCAN test was used and the
results were tabulated.
Results
In this study, the sensitivity of human
chromosomes to EMS was revealed by observing
the chromosomal breakages in each of the
chromosomes. The percentage of chromosomal
fragmentation varied among chromosomes in the
control groups. In the control groups (24h),
chromosomes 1, 2, 6, X, and 4 were found to be
sensitive to first degree fragmentation whilst
chromosomes 22, 20, 19, 18, and 11 were
insensitive (Table 1). In the solvent control groups
(ethanol, 50%) while chromosomes 2, 1, 6, 3 and 4
were sensitive to first degree fragmentation,
chromosomes 22 and 18 were completely
insensitive (Table 1).
In cells that had been treated with 5x10
-4
M of
EMS for 24 h, chromosomes 1 and 2 were the most
sensitive and chromosomes 22, 19 and 20 were the
least sensitive to fragmentation (Table 1). In those
that were treated with 10
-3
M of EMS for 24 h,
chromosomes 1 and 2 were the most fragile while
chromosomes 17, 11, 18, 21, 22, 19 and 20 were
Chromosomal fragmentation by EMS
27
the least sensitive (Table 1) (Figure1). Karyotyping
and fragmentation of human chromosomes 1, 2,
and 10. At the 2x10
-3
M concentration of EMS for
the same duration, chromosomes 6 and 1 were
sensitive to first degree while chromosomes X, 2, 5,
and 4 were less fragile. In the same cultures,
chromosomes 18, 19, 22, 20 and 21 remained
completely insensitive to the chemical (Table 1). In
cultures that had been treated for 24 h with varying
concentrations of EMS, and in all concentrations
tested, the fragmentation observed in chromosomes
2, 5-11, 13 and 16-8 was higher than that in the
control group and in the solvent control group. On
the other hand, the breakages of chromosomes 3, 12
and 19 were significant only in comparison to the
control groups. While the 4th chromosome showed
significant fragmentation at all of the concentra-
tions tested in comparison to the controls, this was
significant only at 5x10
-4
M and 10
-3
M EMS
concentrations in comparison to the solvent
controls. The fragmentation of chromosomes 14, 15
and X at EMS concentrations of 5x10
-4
M and 2x10
-
3
M was significantly higher than the control groups
and the solvent control groups. On the other hand,
there was no increase in breakages of chromosomes
1, 20 22 as a result of EMS treatment (Table 1).
As a result of treatment with EMS for 24 hours, the
chromosomal fragmentation observed in
comparison to control groups and solvent control
groups was found to be dose independent (Table 1).
In the solvent control groups chromosomes 2
and 1 are the most susceptible to breakages. There
was no breakages observed on chromosomes 22, 21,
20, 18 and 17 (Table 2).In cultures that had been
treated with 5x10
-4
M of EMS for 48 h,
chromosomes 1, 2 and 4 were the most sensitive to
fragmentation. The least sensitive were
chromosomes 20, 18 and 17, with chromosome 22
never showing fragmentation (Table 2). There was
no statistical significance in the observed breakages
among chromosomes treated with 10
-3
M of EMS
for 48 h (Table 2, Figure 2). At 2x10
-3
M
concentration of EMS chromosomes 1 and 2 are
susceptible to the first degree, with the least
sensitive being 22 and 20 (Table 2). In cultures
treated with different concentrations of EMS for 48
h, there was significant fragmentation of
chromosomes 10 and 11 while at these concentra-
tions chromosomes 17, 18 and 21 showed more
fragmentation in comparison to the control group.
On the other hand, chromosomes 1-9, 12-14, 19, 20,
22 and X did not any show any significant
fragmentation the control group (Table 2).
Songl Budak DLER and Mehmet TOPAKTA
28
Figure 1. Karyotyping and fragmentation of Human Chromosomes 1, 2, and 10 (10
-3
M EMS Treatment for
24h,).
Chromosomal fragmentation by EMS
29
Table 1. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that
were treated with different concentrations of EMS for 24 h.
Chromoso
me
Control group Solvent Control
group
5x10
-4
M 10
-3
M 2x10
-3
M Sig
1 3.01.0a 3.71.0ab 11.72.0a 9.21.4a 9.02.7ab
_
2 2.50.9abB 4.21.4aB 10.70.9aA 8.71.9aA 8.00.4abcA **
3 1.00.7bcdefB 3.01.4abcdAB 5.00.7bcdA 5.00.4bcdA 4.71.1cdefA *
4 1.70.7abcdC 2.50.5abcdBC 7.01.4bcA 6.70.4bcA 6.50.9abcdAB ***
5 1.50.6abcdeB 1.00.7cdefB 5.01.0bcdA 5.00.7bcdA 6.50.9abcdA **
6 2.20.4abB 3.01.0abcB 7.00.7bA 7.20.4bA 9.20.7aA ***
7 1.20.4abcdeB 2.20.7abcdeB 5.00.7bcdA 6.70.9bcdA 4.20.7defA ***
8 1.20.2abcdeB 1.20.2abcdefB 4.20.4bcdeA 5.50.8bcdeA 3.70.4defA ***
9 1.20.4abcdeB 1.00.7cdefB 4.50.6bcdeA 5.50.6bcdeA 3.50.5defghA **
10 0.20.2efB 0.70.4cdefB 3.70.6bcdefA 4.50.2bcdefA 3.50.9defghA ***
11 0.00.0fC 0.50.5fC 2.20.8efghB 4.70.4efghA 2.70.7efghAB ***
12 0.70.2bcdefB 1.50.5abcdefA
B
3.00.4defgA 4.00.7defgA 3.01.0efghAB *
13 0.50.2defB 1.20.4bcdefB 4.01.2bcdefA 3.50.2bcdefA 5.20.7bcdeA **
14 0.70.4cdefB 0.70.4cdefB 3.71.1cdefA 2.20.6cdefgA
B
3.00.5efgA *
15 0.20.2efB 0.20.2fB 3.00.7defgA 1.20.7defgA
B
3.00.7efgA **
16 1.00.7bcdefB 0.20.2fB 3.50.8defA 3.50.5defA 3.50.2defgA ***
17 0.20.2efB 0.20.2fB 2.00.7efghA 1.50.2efghA 2.00.4efghA **
18 0.00.0fB 0.00.0fB 1.20.6ghA 0.70.2ghA 1.20.2ghjA **
19 0.00.0fB 0.50.2fAB 0.70.2hA 1.00.0hA 1.00.4hjA *
20 0.00.0f 0.20.2f 0.20.2 0.70.2 0.70.4j
_
21 0.20.2ef 1.00.7cdef 1.50.2fgh 2.20.6fgh 0.50.2j
_
22 0.00.0f 0.00.0f 0.70.4h 1.00.5h 0.70.5j
_
X 2.00.5abcdB 1.70.8abcdefB 5.20.6bcdA 6.00.4bcdAB 8.01.0abcA ***
Sig. *** *** *** *** ***
Key: *** P<0.001, ** P<0.01, * P<0.05
_
P>0.05
Small Letter(s): Denote(s) the significance of chromosomal breakage percentages in the controls and
differently treated cultures (same column)
Capital Letter(s): Denote(s) the significance of chromosomal breakage (same row) in the controls and
treated cultures.
Songl Budak DLER and Mehmet TOPAKTA
30
Figure 2. Karyotyping and fragmentation of human chromosomes 1, 2, 3, 8, 9 and 21 (10
-3
M EMS Treatment
for 48h, ).
Chromosomal fragmentation by EMS
31
Table 2. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that
were treated with different concentrations of EMS for 48 h.
Chromosome Control
group
Solvent
Control
group
5x10
-4
M 10
-3
M 2x10
-3
M Sig
1 3.01.0a 4.72.1ab 8.01.9a 8.52.9 10.21.3a _
2 2.50.9ab 5.71.3a 6.72.0a 8.02.8 8.21.8ab _
3 1.00.7bcdef 2.00.7cdefg 3.72.2cde 3.21.4 4.00.9cdef _
4 1.70.7abcd 3.20.4abc 6.51.5ab 5.22.0 5.50.6bcd _
5 1.50.6abcde 2.70.4bcd 4.00.4abcd 2.51.3 3.01.0def _
6 2.20.4abc 3.20.4abc 5.20.7abc 6.02.0 7.20.8abc _
7 1.20.4abcde 1.20.9efghj 4.00.7abcd 3.21.1 3.70.6def _
8 1.20.2abcde 2.00.4bcdef 2.70.2bcde 2.71.1 3.50.2def _
9 1.20.4abcde 1.50.2cdefgh 2.50.2cde 2.50.8 3.20.2def _
10 0.20.2efB 1.20.2cdefgh
AB
1.20.6efgAB 2.51.0A 3.20.4defA *
11 0.00.0fB 1.20.4defgh
AB
1.70.4defA 2.71.1A 3.50.6defA **
12 0.70.2bcdef 0.50.5hj 1.70.4def 2.20.7 2.70.7def _
13 0.50.2def 1.70.4cdefg 2.50.6cdef 3.21.7 4.71.0bcde _
14 0.70.4cdef 1.20.2cdefgh 1.20.6efg 2.21.0 0.30.7def _
15 0.20.2efB 0.20.2jB 1.00.4efgAB 1.00.4AB 2.50.9efgA *
16 1.00.7bcdef
B
0.70.4fghjB 2.70.6cdeA
B
2.50.9AB 4.00.7cdeA *
17 0.20.2efB 0.00.0jB 0.20.2fgB 2.00.7A 2.50.6efgA **
18 0.00.0fC 0.00.0jC 0.20.2fgBC 1.00.4B 2.20.6efgh
A
***
19 0.00.0f 0.50.2fghj 1.00.0efg 1.00.7 1.70.8fgh _
20 0.00.0f 0.00.0j 0.50.5fg 1.00.5 0.70.4h _
21 0.20.2efB 0.00.0jB 1.00.5efgAB 1.50.6A 2.20.4efgh
A
**
22 0.00.0f 0.00.0j 0.00.0g 1.50.6 1.00.7gh _
X 2.00.5abcd 2.20.4bcde 4.71.2abcd 4.71.7 5.00.5bcde _
Sig *** *** ***
_
***
Songl Budak DLER and Mehmet TOPAKTA
32
Discussion
The sensitivity of human chromosomes to EMS
treatment was measured by determining the
breakages of each chromosome. In cultures treated
with different concentrations of EMS for 24 h and
48 h, the chromosomal breakage percentages were
statistically significant compared to control groups.
In addition, the percentage of fragmentation of each
chromosome at different concentrations of EMS
was significantly higher the controls. 24h EMS
treatment caused more fragmentation than 48h
treatment due to repair of damaged cells after 24h
treatment (Franke et al., 2006). Similar findings
also reported by several groups (akmak et al.,
2004, Renczoullar et al., 2004, Bayram and
Topakta 2008).
In the control groups, chromosomes 1, 2, 6, X,
4 and 5 are susceptible to breakages to the first
degree. As can be seen, those chromosomes that are
tend to (natural) breakages in the control groups are
also susceptible to fragmentation in EMS-treated
cultures.
These results illustrate that the clastogens
cause more fragmentation of those chromosomes
that are prone to natural breakages. It has been
proposed that there may be a correlation between
the length of chromosomes and degree of
susceptibility to breakages. However, in this study,
in cultures treated with EMS, exception to this
assumption was discovered. For instance,
chromosome 3 fell into the second degree
susceptibility category in both untreated and EMS
treated cultures. This finding suggests that
chromosomal susceptibility to fragmentation may
correlate with its length as well as its composition.
Some investigators have discovered mutations
in some of the chromosomes derived from some
malignant cells, which we have found to be
sensitive to EMS treatment. The chromosomes we
found to be susceptible (chromosomes 1, 2, 3, 4, 5,
6, X, 7 and 8) were also found to be sensitive in
other studies. For instance, Bayani et al. showed by
spectral karyotyping that chromosomes 8, 7 and 20
were fragmented and rearranged in bone marrow
malignancies (Bayani et al.,2003). In cell lines
derived from stomach cancers, found that the p arm
of chromosome 17 showed partial deletion whilst
the q arm demonstrated partial duplication (Chun et
al., 2000). Selzer et al. studied neroblastomas and
their cell line derivatives, and discovered that there
was a loss in 3p and 11q whilst 17q showed
enlargement (Selzer et al., 2005). Gorunova et al.
showed that in gull bladder carcinomas,
chromosome 7 was the most frequently rearranged
one, followed by chromosomes 1, 3, 11, 6, 5 and 8.
(Gorunova et al., 1999). Morrissette et al.
discovered aberrations of chromosome 18 in
patients with partial mosaic tiresome (Morrissette et
al., 2005).
From these findings, it can be deduced that the
EMS test may prove to be indicative in some types
of cancer. Honma et al. compared the mutagenic
and cytotoxic response of the p53 tumor suppressor
gene in normal cells (TK6) and in cells with a
mutated p53 gene (WTK-1), both of which were
derived from he same ancestor. These two cell lines
were subjected to treatment with X-rays, EMS,
MMS and MMC. They found that the WTK-1 cells
were more resistant to induced cytotoxicity than the
TK6 cells, whiles their thymidine kinase (tk) gene
was more susceptible to mutation due to loss of
heterozygosity (LOH). These studies shows that
EMS can cause malignancies not only by the
cytogenetically specified chromosomal fragmenta-
tions but also by alterations at the genetic level
(Honma et al., 1997).
In our study EMS caused chromosomal
breakages that are similar to the ones described by
these investigators. It can be argued that EMS may
constitute a risk factor in malignant transformations
due to its effect on chromosomal stability.
Acknowledgments
This study was supported by the C.U. Research
Fund. Project No. FBE2002D117.
References
Adhikari N and Grover IS. Genotoxic effects of
same systemic pesticides: In vivo chromosomal
aberrations in bone marrow cells in rats.
Environmental and Molecular Mutagenesis 12:
235-242, 1988.
Albertini RJ, Anderson D, Douglas GR et al., IPCS
Guidelines for the Monitoring of Genotoxic
Effects of Carcinogenes in Humans. Mutat Res
463: 111-172, 2000.
Bayani J, Zielenska M, Pandita A et al. Spectral
Karyotyping Identifies Recurrent Complex
Rearrangements of Chromosomes 8, 17 and 20
Chromosomal fragmentation by EMS
33
in Osteosarcomas. Genes Chromosomes Cancer
36(1): 7-16, 2003.
Bayram S and Topakta M. Confirmation of the
Chromosome Damaging effects of Lamivudine
in in vitro Human Peripheral Blood
Lymphocytes. Environmantal and Molecular
Mutagenesis 49: 328-333, 2008.
akmak T, Topakta M and Kayraldiz A. The
Induction of Chromosomal Aberration by Tetra
Antibiotic in Bone Marrow Cells of Rats in vivo.
Russian Journal of Genetics 40(8): 867-870,
2004.
Chun YH, Kil JI, Suh YS et al. Characterization of
Chromosomal Aberrations in Human Gastric
Carcinoma Cell Lines Using Chromosome
Painting. Cancer Genet. Cytogenet. 119(1): 18
25, 2000.
During R. Vergleichende Untersuchungen zur
Induktion von Schwester-chromatidaustauschen
(SCEs) in Menschlichen Lymphozyten in vitro
Nach Kultivierung von Vollblut oder Isolierten
Lymphozyten. Dissertation zu Erlangung des
Doktorgrades der Medizin der Fakltt fr
Theoretische Medizin der Universitt Ulm, 80s.
1985.
Evans HJ. Human peripheral blood lymphocytes
fort he analysis of chromosome aberrations in
mutagen tests, Handbook of Mutagenicity Test
Procedures: Kilbey, B.J., Legator, M., Nichols,
W., Ramel, C. (eds.), Second edition, Elsevier
Science Publishers, BV. pp. 405-427, 1984.
Franke SI, Pra D, Giulian R et al. Influence of
orange juice in the levels and in the
genotoxicity of iron and copper. Food-Chem-
Toxicol 44(3): 425-35, 2006.
Gorunova L, Parada LA, Limon J et al. Nonrandom
Chromosomal Aberrations and Cytogenetic
Heterogeneity in Gallbladder Carcinomas.
Genes Chromosomes Cancer 26(4): 312-321,
1999.
Harish SK, Guruprasad KP, Mahmood R et al.
Adaptive Response to Low Dose of EMS or
MMS in Human Peripheral Blood Lymphocytes.
Indian J Exp Biol 36: 1147-50, 1998.
Honma M, Hayashi M, Sofuni T. Cytotoxic and
Mutagenic Responses to X-Rays and Chemical
Mutagens in Normal and p53-Mutated Human
Lymphoblastoid Cells. Mutat. Res. 4;374(1):
89-98. 1997.
HSDB Hazardous Substances Data Base. National
Library of Medicine.
http://toxnet.nlm.nih.gov/cgi-bin/sis/htmlgen?
HSDB, 2000.
IARC Same Anti-thyroid and Related Substances,
Nitrofurans and Industrial Chemicals. IARC
Monographs on the Evaluation of Carcinogenic
Risk of Chemicals to Humans, Lyon, France:
International Agency for Research on Cancer,
vol.7. pp 326, 1974.
IARC. Overall Evaluations of Carcinogenicity.
IARC Monographs on the Evaluation of
Carcinogenic Risk of Chemicals to Humans,
Lyon, France: International Agency for
Research on Cancer. Supplement 7. pp 440,
1987.
Maddock ML, Northrup H, Ellingham TJ.
Induction of Sister-Chromatid Exchange and
Chromosomal Aberrations in Hematopoietic
Tissue of a Marine Fish Following n vivo
Exposure to Genotoxic Carcinogens. Mutat Res
29: 145-147, 1986.
Merck The Merck Index, 11th ed. Rahway, NJ:
Merck&Company, Inc. 1989.
Morrissette JJ, Medne L, Bentley T et al. A Patient
with Mosaic Partial Trisomy 18 Resulting From
Dicentric Chromosome Breakage. Am J. Med.
Genet. A. 30;137(2): 208-212, 2005.
Perry P and Evans HJ. Cytological Detection of
Mutagen-Carcinogen Exposure by Sister
Chromatid Exchange. Nature 258: 121-125,
1975.
Phillips BJ and Jenkinson P. Is Ethanol Genotoxic?
A Review of the Published Data. Mutagenesis
16(2): 91-101, 2001.
Renczoullari E and Topakta M. Chromosomal
Aberrations in Cultured Human Lymphocytes
Treated with the Mixtures of Carbosulfan, Ethyl
Carbamate and Ethyl Methanesulfonate.
Cytologia 65: 83-92, 2000.
Renczoullar E, la HB, Kayraldiz A et al. The
Genotoxic Effect of the New Acaricide
Etoxazole. Russian Journal of Genetics 40(11):
1300-1304, 2004.
Selzer RR, Richmond TA, Pofahl NJ et al. Analysis
of Chromosome Breakpoints in Neuroblastoma
at Sub-kilobase Resolution Using Fine-tiling
Oligonucleotide Array CGH. Genes
Chromosomes Cancer 44(3): 305-19, 2005.
Surralles J, Sebastian S and Natarajan AT.
Chromosomes with High Gene Density are
Preferentially Repaired in Human Cells.
Mutagenesis 12: 437-442, 1997.
Songl Budak DLER and Mehmet TOPAKTA
34
Topakta M and Speit G. Sister Chromatid
Exchange (SCE) Test Make Use of Detemine in
the Mutagen and Carcinogen. C.U. Salk Bil
Der 5: 73-84, 1990.
Ueo HR, Takaki HY, K. Sugimachi. Mammary
carcinoma induced by oral administration of
ethyl methanesulphonate. Determination of
some of the parameters affecting tumor
induction. Carcinogenesis 2(12): 1223-8, 1981.
Journal of Cell and Molecular Biology 7(2) & 8(1): 35-43, 2010 Research Article
Hali University, Printed in Turkey.
http://jcmb.halic.edu.tr
Protective effect of pomegranate peel ethanol extract against ferric
nitrilotriacetate induced renal oxidative damage in rats
Mahgoub Mohammed AHMED
*, 1
and Safaa Eid ALI
2
1
Molecular Drug Evaluation Department, National Organization for Drug Control and Research
(NODCAR), Giza, Egypt
2
Food Technology Research Inst., Agricultural Research Center (ARC), Giza, Egypt
(* author for correspondence; dr_mahgoub1@yahoo.com )
Received: 18 December 2009; Accepted: 02 April 2010
Abstract
Pomegranate is an important source of bioactive compounds. The nephroprotective effect of pomegranate
peel ethanol extract against ferric nitrilotriacetate (Fe-NTA)-induced renal oxidative stress was studied. The
results showed that Fe-NTA enhances renal lipid peroxidation with reduction in renal glutathione content,
antioxidant enzymes, viz., glutathione peroxidase, catalase, glutathione reductase and phase-II metabolizing
enzyme, glutathione-S-transferase. It also enhances serum urea and creatinine. Treatment of rats orally with
pomegranate peel extract (100 and 200 mg/kg/day, for seven days) resulted in significant decrease in lipid
peroxidation and serum urea and creatinine levels. Renal glutathione content, glutathione-S-transferase and
antioxidant enzymes were also recovered to a significant level (P<0.05). The obtained data demonstrate that
pomegranate peel ethanol extract is a potent nephroprotective agent and suppresses Fe-NTA-induced renal
oxidative damage in rats.
Keywords: Nephroprotection; Fe-NTA; pomegranate peel ethanol extract; oxidative stress, antioxidant
enzymes, glutathione-S-transferase.
Sanlarda Nar Kabuu Etanol ztnn Ferrik Nitrilotriasetat ile ndklenen
Renal Oksidatif Hasara Kar Koruyucu Etkisi
zet
Nar nemli bir biyoaktif bileke kaynadr. Nar kabuu etanol ztnn ferrik nitrilotriasetat (Fe-NTA) ile
indklenen renal oksidatif hasara kar bbrek koruyucu etkisi allmtr. Sonular Fe-NTAnn renal
glutatyon ieriindeki antioksidan enzimler olan glutatyon peroksidaz, katalaz, glutatyon redktaz ve faz-II
metabolize eden enzim olan glutatyon-S-transferazdaki azalma ile renal lipit peroksidasyonunu artrdn
gsterdi. Ayn zamanda, Fe-NTA serum resini ve keratinini de artrr. Sanlara nar kabuu ztnn oral
muamelesi (100 ve 200 mg/kg/gn, 7 gn boyunca), lipit peroksidasyonunun ve serum re ve keratin
deerlerinin nemli lde dmesi ile sonuland. Renal glutatyon ierii, glutatyon-S-transferaz ve
antioksidan enzimler de nemli lde tekrar geri kazanld (P<0.05). Elde edilen bulgular, nar kabuu etanol
ztnn gl bir bbrek koruyucu ajan olduunu ve sanlarda Fe-NTA ile endklenen oksidatif hasar
baskladn gsterir.
Anahtar Szckler: Bbrek koruyucu; Fe-NTA; nar kabuu etanol zt; oksidatif stres, antioksidan
enzimler; glutatyon-S-transferaz
Mahgoub Mohammed AHMED and Safaa Eid ALI 36
Introduction
Pomegranate (Punica granatum L., Punicaceae), is
one of the oldest known drug. It is mentioned in the
Ebers papyrus of Egypt written in about 1550 BC
(Ross, 1999). Dried fruit peel is used for diarrhea
and to treat respiratory and urinary tract infections.
Also, pomegranate fruit peel exerted diverse
pharmacological functions as antioxidant activity
(Yunfeng et al., 2006 and Thring et al., 2009),
antifertility effect (Gujraj et al., 1960), cytotoxic
activity (Sato, 1990 and Kulkarni et al., 2007),
hepatoprotective activity (Murthy, 2002) and
hypoglycemic activity (Dhawan et al., 1977 and
Hontecillas et al., 2009). Also, pomegranate peel
ethanol extract (500 mg/kg b.wt.) has ameliorative
effect against chlorpyrifos-ethyl-induced oxidative
stress in rats (Ahmed and Zaki, 2009). Pomegranate
peel contains substantial amounts of polyphenols
such as ellagic tannins, ellagic acid and gallic acid
(Naser et al., 1996).
Iron is the most abundant metal in the human
body. Although iron is an essential nutritional
element for all life forms, iron overload may lead to
various diseases (De Freitas and Meneghini, 2001).
The iron complex of the chelating agent
nitrilotriacetic acid is nephrotoxic (Khan and
Sultana, 2005). Intraperitoneal injection of Fe-NTA
induces renal proximal tubular damage associated
with oxidative damage that eventually leads to a
high incidence of renal cell carcinoma in rodents
after repeated administration (Okada and
Midorikawa, 1982). Intraperitoneally injected of
ferric nitrilotriacetate (Fe-NTA) is absorbed into
portal vein through mesothelium and passes into
circulation via the liver (Umemura et al., 1990).
The low molecular weight Fe-NTA is easily filtered
through the glomeruli into the lumen of the renal
proximal tubules where Fe
3+
-NTA is reduced to
Fe
2+
-NTA by the glutathione degradation products
cysteine or cysteinylglycine (Taso and Curthoys,
1980). In the brush border surface of the renal
proximal convoluted tubules, -glutamyl
transpeptidase hydrolyses glutathione to
cysteinylglycine that is rapidly degraded to cysteine
and glycine by dipeptidase (Khan and Sultana,
2005). Cysteinylglycine and cysteine
are the
proposed thiol reductants that reduce Fe
3+
-NTA to
Fe
2+
-NTA. The auto-oxidation of Fe
2+
-NTA
generates superoxide radicals (O
.-
2
) which
subsequently potentiate the iron catalysed Haber-
Weiss reaction to produce hydroxyl radical (OH
.
),
leading to induction of lipid peroxidation and
oxidative DNA damage (Umemura et al, 1990 and
Khan and Sultana, 2005).
For the present study, we prepared the ethanol
extract (80%) of the pomegranate peel which
exerted the highest antioxidant effect in vitro. The
objective of the study was to determine the possible
effect of prophylactic treatment with pomegranate
peel extract on Fe-NTA induced renal oxidative
damage in rats.
Materials and methods
Plant material
Pomegranate fruit peel purchased from local market
was dried and powdered before extraction.
Plant extract
Powdered plant material (500g) was repeatedly
extracted with 2000 ml solvents of increasing
polarity starting with benzene, chloroform, ethyl
acetate, ethanol (80%) and distilled water. The
percolation time for each solvent was 24h. The
extracts were filtered, concentrated and freeze
dried. The residues yielded for each solvent were
stored at 4
o
C. The ethanol extract (80%) was used
for further study after preliminary in vitro tests viz.
lipid peroxidation, deoxyribose and DPPH assays.
Chemicals
Ferric nitrate, NTA disodium salt, reduced
glutathione, 1-chloro-2,4-dinitrobenzene (CDNB),
bovine serum albumin, 1,2-dithio-bis-nitrobenzoic
acid (DTNB) and thiobarbituric acid (TBA) were
obtained from Sigma Chemical (St Louis, USA).
All solvents used were HPLC grade (Merck,
Darmstadt, Germany).
Total phenolics
Total phenolics in the pomegranate peel ethanol
extract were determined according to
Jayaparakashsa et al. (2001) using Folin-Ciocalteu
reagent. Four hundred microlitres of sample were
taken in test tubes; 1.0 ml of FolinCiocalteu
reagent (diluted 10-fold with distilled water) and
0.8 ml of 7.5% sodium carbonate were added. The
tubes were mixed and allowed to stand for 30 min
Pomegranate peel extract against renal oxidative damage 37
and the absorption at 765 nm was measured against
a blank, which contained 400 l of ethanol in place
of sample. The total phenolic content was
expressed as gallic acid equivalents in mg/g of
ethanol extract.
Animals
Albino male rats (17030 g) were used in the
present study. The rats were obtained from the
animal house of the National Organization for Drug
Control and Research (NODCAR), Egypt. The
animals were kept under standard laboratory
conditions of light/dark cycle (12/12h) and
temperature (252C). The rats were allowed food
and water ad libitum. They were provided with a
nutritionally adequate standard laboratory diet.
Animals diet
The basal diet consists of casein 10%, cotton seed
oil 4%, salt mixture 4%, vitamin mixture 1%,
carbohydrates (sucrose, starch 1:1) 80.8% and
choline chloride 0.2% (American Institute of
Nutrition, 1980).
Preparation of Fe-NTA solution
The Fe-NTA solution was prepared as described in
Deiana et al. (2001) and Khan and Sultana (2005),
ferric nitrate and NTA disodium salt were dissolved
in distilled water to form a 300 and 600 mM
solution, respectively. The two solutions were
combined in a volume ratio of 1:2 with magnetic
stirring at room temperature and the pH was
adjusted to 7.4 with sodium bicarbonate.
Experimental design
Thirty albino rats were randomly allocated to five
groups of six rats each:
Group 1 received only saline injection
intraperitoneally at a dose of 10 ml/kg body weight.
Group 2 received only a single intraperitoneal
injection of Fe-NTA solution at a dose of nine mg
Fe/kg body weight (Athar and Iqbal 1998).
Group 3 received pomegranate peel extract by
gavage once daily for seven days at a dose of 100
mg body weight, p.o. (Parmar and Kar, 2008).
Group 4 received pomegranate peel extract once
daily for seven days at a dose of 200 mg/kg body
weight, p.o. (Parmar and Kar, 2008).
After the last treatment with pomegranate peel
extract, the animals of group 2, 3 and 4 received a
single intraperitoneal injection of Fe-NTA at a dose
level of 9mg Fe/kg body weight.
Group 5 received pomegranate peel extract orally
once daily for seven days at a dose of 200 mg/kg
body weight (Parmar and Kar, 2008). We used the
high dose of pomegranate peel ethanol extract (200
mg/kg b.w. p.o.) to study its effect on kidney.
All rats were sacrificed 12 h after the treated
with Fe-NTA. Blood was collected and the
separated serum was used for the estimation of
creatinine (Bartless et al., 1972) and urea (Patton
and Crouch, 1977).
Post-mitochondrial supernatant and microsomal
fraction preparation
Kidneys were removed quickly and washed in cold
isotonic saline. The kidneys were homogenized in
50 mM phosphate buffer (pH 7) using an electronic
homogenizer to prepare 10% w/v homogenate. The
homogenate was centrifuged at 3000 rpm for 10
min at 4
o
C by cooling ultracentrifuge (model Sigma
3K 30) to separate the nuclear debris. The aliquot
so obtained was used at 12000 rpm for 20 min at
4
o
C to obtain post-mitochondrial supernatant
(PMS), which was used as a source of enzymes
(Khan and Sultana, 2005). A portion of the PMS
was centrifuged for 60 min at 34000 rpm at 4
o
C.
The pellet was washed with phosphate buffer (50
mM pH 7).
Estimation of reduced glutathione (GSH) in PMS
Reduced GSH in mitochondria was determined by
measuring the rate of formation of chromophoric
product in a reaction between 5,5-dithiobis-2-
(nitrobenzoic acid) (DTNB) and free sulphydryl
groups, such as GSH, at 412 nm as described by
Ellman (1959).
Estimation of Lipid peroxidation (LPO) in
micrososmal fraction
The measurement of microsomal fraction lipid
peroxide by a colorimetric reaction with
thiobarbituric acid was done as described by
Okhawa et al. (1979), and the determined lipid
peroxide is referred to as malondialdehyde. Briefly,
in a test tube, 2.5 ml of 20% trichloroacetic acid
solution and 1ml of 0.67% thiobarbituric acid
solution were added to the samples. The color of
thiobarbituric acid pigment was developed in a
Mahgoub Mohammed AHMED and Safaa Eid ALI 38
water bath at 100
82
The distribution is in
ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet.
Limitations in use
Dotlet is an ideal pairwise comparisons tool for
sequences with lengths of less than 10,000 amino
acids or nucleotides. So, it can be helpful for most
proteins sequences but is restricted to small DNA
sequences.
Dotlet availability online
(IBM users): http://myhits.isb-sib.ch/cgi-bin/dotlet
(Mac users):
http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html
Other online dot plot programs
Dnadot
This program can use a range of 100,000 long
characters of either proteins or DNA sequences and
it has been designed using Java language. Dnadot is
available online on the following URL:
http://arbl.cvmbs.colostate.edu/molkit/dnadot/
http://www.vivo.colostate.edu/molkit/dnadot/
Dotter
This program can use as long as 100.000 characters
of either proteins or DNA sequences like Dnadot,
However, it is designed to use Unix, Linux and
Windows as a platform. It is available online on the
following URL:
http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte
r.html
Dottup
Although this program is also using the same range
of DNA as the previous program, it can also be
used for complete genomes. It also uses Unix and
Linux as a platform. It is available online as a
useful integrated module in emboss package.
URL: http://emboss.sourceforge.net/
References
Junier T. and Pagni M. (2000) Dotlet: diagonal
plots in a web browser. Bioinformatics.
16(2):178-9.
Ahmed MANSOUR
Genetics Department,
Faculty of Agriculture,
Zagazig University, Egypt
(author for correspondence; amansour@zu.edu.eg)
Received: 01 September 2008; Accepted: 11 December 2009
83
Dotlet: kili karlatrmalar iin gl ve kolay strateji
Yazarlar: Marco PAGNI & Thomas JUNIER, the Swiss Institute of Bioinformatics,
Epalinges, Switzerland
Lisans: cretsiz
Ksa Bir Bakla Dotlet
Bir molekler biyolog iin, iki diziyi eletirmenin
en basit yolu dot blot yapmaktr. nk dot ya da
matriks blotlar dizi analizini kolay ve gl ekilde
salar. rnein, iki dizi arasndaki benzer
blgelerin ve bir dizideki tekrarlayan blgelerin
aratrlmasnda ok kullanldr. Bu bakmdan
Dotlet internet yoluyla ulalabilen dot-plot
programlarnn en kullanc dostu olandr. Dotlet
program cretsiz ve kolay kullanml olduu,
kuruluma ihtiyac olmad ve internete girilebilen
her bilgisayarda alabildii iin dot plotlar
yapmak iin ok uygun bir aratr. Son gnlerde
ok sayda benzer bilimsel makalede ikili
eletirmeleri yapmak iin yaygn olarak
kullanlmaktadr.
Dotletin Tarihi
Yazarlar, dotlet programn yazmalarnn sebebini
Aralk 1998de sviredeki Biyokimya
Enstitsnde kendi biyoinformatik almalar
srasnda diyagonal bir plota ihtiya duymalar
olarak akladlar. Bu arada world-wide web tabanl
web taraycsnda alabilen bir programa da
ihtiyalar vard. Bildiim kadaryla bu program o
zamanlarda internet tabanl ilk dot plot yazlmyd.
Dotletin Aratrmalara Katks
Molekler biyolojinin bu sahasndaki ou
aratrmac kendi orijinal aratrmalar sresince
ikili karlatrmalarn yaplandrlmasnda Dotlet
modllerini kullanmtr. Yaplan yzlerce atfla
Dotlet biyolojideki biyoinformatik programlar
arasndaki yerini almtr. Bu gnlerde cretsiz
yazlm lisans ve onun etkili modlleri dnda
sonu retme yeteneinin abukluu onu, ikili
karlatrmalar yapmak iin en popler program
haline getirmitir.
Dot Plotn Avantajlar ve Dezavantajlar
Avantajlar
Dotletin kullanm kolay ve cretsizdir.
Dotlet internet tabanl bir program olup
internete balanabilen her bilgisayarda
alabilir.
Dotlet sunucu bir program deildir ama
bilgisayarnz kapalyken Dotletin yapabildii
her eyi yapan bir Java uygulamasdr.
Dotletin kullanm Dotlet ile karlatrdnz
her dizi bilgisayarnzda kald iin gvenlidir.
Dotlet DNA, RNA ve protein dizilerini
karlatrabilir.
Dezavantajlar
Dotlet sonularn yorumlamak iin biraz
altrma ve iyi bir deneyim gerekmektedir.
Baka bir deyile, bilgi verici bir dot plot
salamak iin Dotlete nasl ince ayar
yaplaca renilmelidir.
Dotlet uzun diziler (10,000 amino asit ya da
nkleotitten daha fazlas) ile almayabilir.
Programn hz bilgisayarnza baldr.
Bilgisayarnz ne kadar hzlysa dotlet o kadar
hzl alr. 1000 rezidden daha uzun diziler
ile belirgin farkllklar oluabilir.
Yazlm Dizayn
Dotlet ak kaynakl bedava bir yazlmdr. Verilen
bir ift protein ya da DNA dizisi iin ikili
karlatrmalar retebilir. Java uygula-mac
olarak yaplandrlmaktadr. Dotlet kaynak kodu
akademik kullanclar iin cretsiz olarak
eriilebilir.
84
Datm:
ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet
Kullanm Snrlamalar
Dotlet 10,000 amino asit ya da nkleotitten daha
ksa uzunluktaki diziler iin ideal bir ikili
karlatrma aracdr. Bylece ou protein dizileri
iin yardmc olabilir ama ufak DNA dizileri iin
snrlanmtr.
evrimii Dotlet Eriilebilirlii
IBM users): http://myhits.isb-sib.ch/cgi-
bin/dotlet
(Mac users): http://www.isrec.isb-
sib.ch/java/dotlet/Dotlet.html
Dier evrimii Dot Plot Programlar
Dnadot
Bu program protein ya da DNA dizilerinin 100,000
uzunluundaki bir dizi karakterini kullanabilir ve
Java dilini kullanarak dizayn edilebilir. Dnadota
aadaki URL ile evrimii ulalabilir:
http://arbl.cvmbs.colostate.edu/molkit/dnadot/
http://www.vivo.colostate.edu/molkit/dnadot/
Dotter
Bu program da protein ya da DNA dizilerinin
100,000 uzunluundaki bir dizi karakterini Dnadot
gibi kullanabilir. Bununla birlikte, platform olarak
Unix, Linux ve Windows kullanlarak dizayn
edilebilir. Aadaki URL ile evrimii eriilebilir:
http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte
r.html
Dottup
Bu program nceki program gibi DNAnn ayn
araln kullanmasna ramen tm genom iin de
kullanlabilir. Platform olarak Unix ve Linux
kullanabilir. Emboss paketinde kullanl
birletirilmi bir modl olarak evrimii ulalabilir.
URL: http://emboss.sourceforge.net/
Kaynaklar
Junier T. ve Pagni M. (2000) Dotlet: web
taraycsndaki diyagonal plotlar. Biyoinfor-
matik. 16(2):178-9.
Ahmed MANSOUR
Genetik Blm,
Ziraat Fakltesi,
Zagazig niversitesi, Msr
REVISED
May 17, 2010
85
Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS
(Revised: May 17, 2010)
General
Journal of Cell and Molecular Biology
(JCellMolBiol) is an international journal which
covers original works in the field of cell biology,
molecular biology, genetics, microbiology,
neurobiology, bioinforma-tics and related topics.
The official language of the journal is English,
but manuscripts in Turkish are accepted as well.
Manuscripts should be submitted on a CD or by e-
mail to:
Journal of Cell and Molecular Biology
Hali University
Faculty of Arts and Sciences,
Department of Molecular Biology and Genetics
Kaptan Paa Mah. Darlaceze Cad. No: 14
Okmeydan-ili 34384, stanbul-TRKYE
Tel: +90 212 220 96 96 Ext. 155
E-Mail: jcmb@halic.edu.tr
Conditions for publication
This journal publishes research articles, review
articles, short communications, book/software
reviews, case reports and letters to the editor.
Research articles: Only original contributions will
be accepted which have not been published
previously. Manuscripts should not exceed 15
papers of printed text, including tables, figures and
references
Review articles: Reviews of recent developments in
a research field and ideas will be accepted.
Manuscripts should not exceed 15 papers of printed
text. Illustrations are encouraged.
Short communications: These include small-scale
investigations or innovative methods, techniques,
clinical trials and epidemiological studies. It should
not exceed 3 pages.
Letters to editor: These include opinions, news and
suggestions. Letters should not exceed 2 papers of
printed text.
Case Reports: These include individual
observations based on small numbers of subjects.
This type of research cannot indicate causality but
may indicate areas for further research.
Book/software reviews: Short but concise
description of the book/software, not exceeding a
page. Book/software reviews are not peer reviewed.
Presentation
Papers should be typed clearly, double-spaced with
3 cm wide margins.
Manuscripts should be prepared using Word
Processor.
Cover Letter: You may briefly explain your work
and its contribution to present knowledge.
Title Page: The first page of your manuscript
should be a title page containing the type of paper;
the title; all authors' full names, and affiliations;
and the corresponding author's contact address
(including phone and fax numbers) and e-mail
address. The title should be as short as possible, but
should give adequate information regarding the
contents. Authors should also state a running title
of no more than 50 characters including spaces.
All pages must be numbered.
Full Paper
The full paper should be divided into the following
parts in the order indicated:
REVISED
May 17, 2010
86
Abstract: A brief, informative abstract, not
exceeding 200 words, should be provided in
English and in Turkish. For authors who are not
native Turkish speakers, JCellMolBiol can provide
the Turkish abstract.
Keywords: Immediately following the abstract,
authors should provide 5 keywords or phrases that
reflect the content of the article.
Introduction should include theory, hypotheses,
prior work
Material and methods may include subheadings
Results: If the study consists of different parts,
subheadings in this section should be consistent
with subheadings in the methods.
Discussion
Acknowledgements should precede the list of
references
References: Papers cited in the manuscript should
be listed in alphabetical order according to the first
author's surname.
Tables and Figures
Tables and figures should be embedded within
the text in their appropriate positions.
Each table should be accompanied by a short
instructive title line plus an explanatory caption at
the top. Indicate footnotes within tables by
superscript letters and type footnotes below the
table.
Electronically submitted figures are preferred
in *.jpg or *.tiff (min. 300 dpi) formats. Each figure
should be supplied with a short instructive title line.
Do not give magnification on scales in the figure
titles; instead draw bar scales directly on the
figures.
All the tables and figures must be referred to
within the text.
Units, Abbreviations and Scientific Names
Only SI units should be used. Current
abbreviations can be used without explanation,
others must be explained.
All acronyms/abbreviations must be explained
in parenthesis after their first occurrence. If many
unfamiliar acronyms/abbreviations are used, please
compile them in an "Abbreviations" section at the
end of the paper.
Latin expressions should be underlined or typed
in italics.
Referencing
Citation in the text should take the form: (Smith
and Robinson,1990).
If several papers are cited by the same author in
the same year, they should be lettered in sequence
(1990a), (1990b), etc. When papers are by more
then three authors they should be cited as (Smith et
al.,1990).
In the list, references must be placed in
alphabetical order. The following models for the
reference list cover all situations. The punctuation
given must be exactly followed.
Redford IR. Evidence for a general relationship
between the induced level of DNA double
strand breakage and cell killing after X-
irradiation of mammalian cells. Int J Radiat
Biol. 49: 611- 620, 1986.
Tccioli CE, Cottlieb TM and Blund T. Product of
the XRCCS gene and its role in DNA repair and
V(D)J recombination. Science. 265: 1442-1445,
1994
Ohlrogge JB. Biochemistry of plant acyl carrier
proteins. The Biochemistry of Plants: A
Comprehensive Treatise. Stumpf PK and Conn
EE (Ed). Academic Press, New York. 137-157,
1987.
Weaver RF. Molecular Biology. WCB/Mc Graw-
Hill.1999.
Brown LA. How to cope with your supervisor. PhD
Thesis. University of New Orleans, 2005.
Web document with no author: Leafy seadragons
and weedy seadragons 2001. retrieved
November 13, 2002, from http:// www.
windspeed.net.au/jenny/seadragons/
Web document with author: Dawson J, Smith L and
Deubert K. Referencing, not plagiarism.
Retrieved October 31, 2002 from http:
//studytrekk.lis.curtin.edu.au/
Only papers published or in press should be
cited in the literature list. Unpublished results,
including submitted manuscripts and those in
preparation, should be indicated as unpublished
data in the text.
REVISED
May 17, 2010
87
Submission Policies and Authorship
Upon submission of a manuscript, it is accepted
that all co-authors have approved the contents of
the manuscript and its submission by the
corresponding author, and that the corresponding
author is authorized to represent all co-authors in
pre-publication discussions with JCellMolBiol.
The corresponding author is responsible for
ensuring that all the contributors to the relevant
work are listed as authors and that all authors have
aggreed to the manuscripts content and its
submission to the JCellMolBiol. In case the Journal
happens to be aware of an authorship dispute,
authorship must be approved in writing by all of the
parties.
Cost
There are no submission fees or page charges.
Criteria for the Selection of Manuscripts
Manuscripts should meet the following criteria: the
study conducted is material is original and ethical,
the writing is clear; the study methods are
appropriate, the data are valid, the conclusions are
reasonable and supported by the data; the
information is important; and the topic is
interesting to our readership.
Editorial Processes
Researchers may request informal feedback from
the editors in a particular manuscript. The
presubmission process aids in the submission
decision for authors
When JCellMolBiol receives a manuscript, the
Editor and Associate Editor will first decide
whether the manuscript meets the formal criteria
specified with Guidelines for Authors and
whether it fits within the scope of the Journal. In
case of doubt on the basis of initial review, the
editor will consult other members of the Editorial
Board.
Manuscripts that are found suitable for peer
review will be assigned to two expert reviewers.
Reviewers may either be Editorial Board members
or external experts selected by the Editorial Board.
The corresponding author is notified by e-mail
when the editor decides to send a paper for review.
The reviewers will have up to three weeks to
review the submitted article. After peer review, the
editor will contact the author. If the author is
required to submit a revised version, the revised
version has to be submitted by the author within
two weeks. Otherwise, the manuscript will be
removed from the manuscript submission queue
and will be considered rejected.
In cases where the referees have requested well-
defined changes to the manuscript, editors may
request a revised manuscript that addresses to
referees concerns. The revised version is sent back
to the original referees for re-review. In cases
where the referees concerns are more wide-
ranging, editors may reject the manuscript. The
revised manuscript should be accompanied by a
cover letter that includes a point-by-point response
to referees comments and an explanation of how
the manuscript has been changed.
As a matter of policy, we do not suppress
referees reports, any comments directed to authors
are transmitted regardless of what we may think of
the content. On rare occasions, we may edit a report
to remove offensive language or comments to
reveal confidentiality.
The final decision to accept or reject a
manuscript will be made by the Editor. If it
becomes apparent that there are serious problems
with the scientific content or with violations of our
publishing policies, the Editor also reserves the
right to reject a paper even after it has been
accepted
After acceptance, the Editor may make further
changes to the text and figures so that the
manuscript is readable and clear. Page proofs will
be sent to the corresponding author via email for
checking before publication. Corresponding authors
are sent proofs and are welcome to discuss
proposed changes with the Editor, but
JCellMolBiol reserves the right to make the final
decision about the style. Corrected proofs should be
sent back to the Editor within three days of receipt,
otherwise the Editor reserves the rights to correct
the proofs himself and to send the material for
publication.
Appeals
Authors have the right to ask the Editor to
reconsider a rejection decision, which is considered
an appeal. Decisions are reversed only if the Editor
is convinced that the original decision was a serious
mistake. If an appeal merits further consideration,
the Editor may send the authors response or the
revised paper to one or more referees, or Editor
REVISED
May 17, 2010
88
may ask one referee to comment on the concerns
raised by another referee.
Advance Online Publication
JCellMolBiol provides Advance Online Publication
of articles, which benefit authors with an earlier
publication date and allows the readers access to
accepted papers several weeks before they appear
in print
Ethical Issues
For manuscripts reporting experiments on live
vertebrates or higher invertebrates, authors must
declare that the study was approved by the
institutional ethics committee. Papers describing
investigations on human subjects must include a
statement that informed consent was obtained from
all subjects.
Plagiarism
If portions of the manuscript have already been
published by the author on other journals or
websites, JCellMolBiol Editorial Board needs to
know which portions of the manuscript have been
previously published and where. The author should
include a note in the cover letter indicating which
portions have been published elsewhere.
In case of any suspicion on scientific misconduct or
dishonesty in research, JCellMolBiol reserves the
right to forward any submitted manuscript to an
appropriate authori-ty for investigation.
Copyright Notice
It is the responsibility of the submitting author to
ensure that the authorship of the paper reflects the
contributions of the authors to the work described,
and that all listed authors have agreed to the
submission of the manuscript in its current form.
Conditions of publication in JCellMolBiol are
that the paper has not already been published
elsewhere; that it is not currently being considered
for publication else-where; all persons designated
as authors should qualify for authorship, and all
those who qualify should be listed. If accepted,
Hali University and JCellMolBiol have the
exclusive license to publish.
JCellMolBiol is freely available to individuals
and institutions. Copies of this Journal and articles
in this journal may be distributed for research or for
educational purposes free of charge. However,
commercial use of articles contained herein is
prohibited without the written consent of the editor.
Publication Agreement
The corresponing author is required to assign the
Publication Agreement Form in order to publish the
submitted manuscript in JCellMolBiol.
Journal of Cell and
Molecular Biology
see page 75 UCSC: Genome Browser for genomic sequences
A. Mansour
see page 81 Dotlet: powerful and easy strategy for pairwise comparisons
A. Mansour
see page 85
Instructions for authors
see page 71 Tcoffee : Multipurpose sequence alignments program
A. Mansour
Software Reviews
see page 53 Do simple sequence repeats in replication, repair and recombination genes of mycoplasmas
provide genetic variability?
S. TRIVEDI
see page 45 Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases
G. KO, K. ULUCAN, D. KIRA, D. ERGE, T. TARCAN and A.. GNEY
see page 35 Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate
induced renal oxidative damage in rats
M.M. AHMED and S.E. ALI
see page 25 The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS)
S. BUDAK-DLER and M. TOPAKTA
see page 13 Genetic diversity of Penicillium species isolated from various sources in Sarawak, Malaysia
H.A. ROSLAN, C.S. NGO and S. MUID
Research Articles
see page 1 DNA repetitive sequences-types, distribution and function: A review
S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA
Review Article