JEZ 0788

JOURNAL OF EXPERIMENTAL ZOOLOGY 287:199212 (2000)

Cloning and Characterization of Salmon hsp90

cDNA: Upregulation by Thermal and
Hyperosmotic Stress
FENG PAN,2 JACQUES M. ZARATE,1 GEORGE C. TREMBLAY,2 AND
TERENCE M. BRADLEY1*
1
Department of Fisheries, Animal and Veterinary Science, University of
Rhode Island, Kingston, Rhode Island 02881
2
Department of Biochemistry, Microbiology, and Molecular Genetics,
University of Rhode Island, Kingston, Rhode Island 02881
ABSTRACT
Accumulating evidence suggests that glucocorticoids are essential for development
of hypoosmoregulatory capacity in salmon during adaptation to seawater. Heat shock protein (hsp)90
has been reported to function in signal transduction and the maturation and affinity of glucocorticoid receptors. We sought to determine whether this hsp might be upregulated by thermal and
hyperosmotic stress in salmon, a species that migrates between the freshwater and marine environments. A 2625-bp cDNA cloned from a salmon cDNA library was found to code for a protein of
722 amino acids exhibiting a high degree of identity with zebra fish (92%) and human (89%)
hsp90. Accumulation of hsp90 mRNA was observed in isolated branchial lamellae incubated
under hyperosmotic conditions and in branchial lamellae of salmon exposed to hyperosmotic stress
in vivo. In contrast, exposure of kidney to hyperosmotic stress in vitro and in vivo failed to elicit
an increase in the quantity of hsp90 mRNA. By way of comparison, accumulation of hsp90 mRNA
was observed in both branchial lamellae and kidney tissue subjected to thermal stress in vitro
and in vivo. Western blot analyses of proteins isolated from tissues under identical conditions in
vitro revealed that the pool of hsp90 increased with thermal stress but not with osmotic stress.
The results suggest that accumulation of hsp90 mRNA in response to osmotic stress is unrelated
to cellular protein denaturation and that synthesis of hsp90 may be regulated at both the level of
transcription and translation. J. Exp. Zool. 287:199212, 2000. 2000 Wiley-Liss, Inc.

One of the major classes of heat shock proteins

(hsps) induced in cells in response to thermal
stress is the hsp90 family. Hsp90 has been reported in all organisms examined and in eukaryotes may constitute 12% of total cytosolic proteins
(Parsell and Lindquist, 93). Accumulating evidence suggests that hsp90 interacts with specific
target proteins (e.g., kinases) and plays an essential role in steroidreceptor fidelity (Parsell and
Lindquist, 93; Craig et al., 94; Nathan et al., 97).
Unlike hsp70, a nonspecific chaperonin that is induced by a constellation of compounds, the hsp90
response to chemical stressors is limited (Nover,
91; Ali et al., 96).
Juvenile salmon in the wild are subjected to hyperosmotic stress during migration to the sea in
the spring of the year following parrsmolt transformation, a developmental process encompassing
numerous physiological and biochemical changes
that prepare the fish for life in the marine environment (Hoar, 88). In commercial salmon
2000 WILEY-LISS, INC.

aquaculture, exposure to hyperosmotic stress is

exacerbated by the routine practice of direct
transfer of juveniles from hatcheries in freshwater (typically < 100 mOsm) to netpens in full
salinity seawater (1100 mOsm). Plasma concentrations of chloride can increase from 110 to 200
mMol/liter by 12 hr after transfer (Handeland et
al., 96). Salmon incapable of regaining osmotic
homeostasis die or grow at a reduced rate (Bjornsson et al., 88; Duston, 94). Previous investigations in our laboratory demonstrated that hsp70
is induced up to tenfold in tissues of juvenile Atlantic salmon exposed to hyperosmotic stress

Grant sponsor: United States Department of Agriculture National

Research Initiative Competitive Grants Program; Grant number:
9404491; Grant sponsor: Rhode Island Agricultural Experiment Station.
*Correspondence to: Terence M. Bradley, Dept. of FAVS, U.R.I.,
Building 14, East Farm, Kingston, RI 02881. E-mail: tbradley@uri.edu
Received 16 April 1999; Accepted 7 March 2000

200

F. PAN ET AL.

(Smith et al., 99b). Furthermore, induction of

hsp70 by mild thermal shock of the living animal
conferred protection against subsequent osmotic
challenge (DuBeau et al., 98). Hsp70 appears to
function transiently to renature or reduce denaturation of proteins by hyperosmotic conditions until long-term hypoosmoregulatory mechanisms
develop.
In the present report, we describe the cloning
and sequencing of the cDNA coding for hsp90 of
Atlantic salmon (Salmo salar) and characterize
the response of this gene in branchial lamellae
and kidney, the two primary osmoregulatory organs of teleost fishes, during exposure to thermal
and hyperosmotic stress. The hypothesis that hsp90
is involved in adaptation of salmon to hyperosmotic
conditions was prompted by evidence demonstrating the role of this chaperonin in glucocorticoid receptor maturation and fidelity (Vamvakopoulos, 93;
Bohen, 95) and in signal transduction (Pratt, 97,
98). The glucocorticoid, cortisol, is essential for adaptation of salmon to seawater (McCormick, 95).
Indeed, previous investigations have reported
prominent increases in circulating levels of cortisol
in salmon at the time of parrsmolt transformation (Hoar, 88) and demonstrated that administration of exogenous steroid stimulates differentiation
of chloride cells and synthesis of the antiport pump,
Na+/K+ ATPase, in branchial lamellae (McCormick
and Bern, 89; Madsen, 90; McCormick, 95).
MATERIALS AND METHODS
Animals
Experiments were conducted with tissues from
juvenile Atlantic salmon (Salmo salar) reared at the
University of Rhode Island Aquaculture Center in
2-m-diameter fiberglass tanks provided with supplemental aeration and receiving single-pass water at
ambient temperature (618C). Fluorescent lights
suspended approximately 1 m above the surface of
the water provided a simulated natural photoperiod, which was adjusted weekly. Fish were fed a
commercial formulated feed to satiation (Nelson
Sterling Silver Cup, Murray, UT) five times daily.
Synthesis of salmon hsp90 and actin
cDNA using PCR
A 0.3 kilobase (kb) fragment of hsp90 was synthesized by polymerase chain reaction (PCR) for
use in screening a cDNA library and Northern blot
analyses. Total RNA was isolated from Atlantic
salmon branchial lamellae incubated for 12 hr in
culture medium supplemented with 125 mM NaCl
and maintained at ambient water temperature

(see In vitro experiments for details). mRNA was

reverse transcribed to cDNA using oligo dT18 primers and Superscript II reverse transcriptase (Life
Technologies, Rockville, MD). The target cDNA
was amplified by PCR using the following degenerate primers with a NotI restriction site incorporated at the 5 end: 5CGGGGCGGCCGCTA(C/
T)TCNAA(C/T)AA(A/G)GA(A/G)AT(A/C/T)3 and
5GCCCGCGGCCGCTA(A/G)AANCCNACNCC(A/
G)AA(C/T)TG3 where N = A,C,G,T (Krone and
Sass, 94). A 100-l reaction mixture containing 1
l of the RT reaction, 50 pmols of each primer,
0.3 mM dNTPs, 2.5 mM magnesium chloride, and
5 U Taq DNA polymerase (Promega, Madison, WI)
was subjected to the following thermal cycle regimen: 2 cycles of 94C for 1 min, 50C for 1 min
and 72C for 2 min followed by 30 cycles of 94C
for 1 min, 55C for 1 min, and 72C for 2 min
with a final elongation step at 72C for 5 min. A
0.5-kb DNA fragment of salmon actin also was
generated by PCR using the primers 5GAGAAGATGACCCAGATTATG3 and 5GTTGTATGTGCTCTCGTGGAT3 (a generous gift from Dr. Marta
Gomez-Chiarri, URI) and the reaction mixture described above for hsp90. The target DNA was amplified using 30 cycles of 94C for 1 min, 46C for
1 min, and 72C for 2 min followed by a final elongation step of 72C for 5 min. PCR products were
analyzed by electrophoresis in a gel of 1.5% agarose in TAE buffer (40 mM Tris-acetate, pH 8.0, 2
mM EDTA) and 0.1% ethidium bromide. Single
product bands of 0.3 kb and 0.5 kb for hsp90 and
actin, respectively, were isolated from the gel by
filtration through a spin column (Supelco, Bellefonte, PA).
Cloning hsp90 cDNA
A cDNA library was constructed in a Uni-ZAP
XR vector (Stratagene, La Jolla, CA) using DNA
prepared from salmon branchial lamellae as described above. Approximately 10 g poly (A)+ RNA
was isolated from the total pool of RNA using magnetic separation (Promega, Madison, WI) and utilized as template for first and second strand cDNA
synthesis. The double stranded cDNAs were fractionated by passage through a column comprised
of Sepharose CL-2B gel and cDNAs ranging in
size from 1.2 to 6.0 kb were ligated into the vector and packaged in phage as per the manufacturers recommendations. The 0.3-kb amplicon
of hsp90 was radiolabeled with -32P dATP (ICN,
Costa Mesa, CA) using DNA polymerase I (Klenow
fragment; New England Biolabs, Beverly, MA) and
random dodecamer primers (Ambion, Austin, TX)

CLONING AND CHARACTERIZATION OF SALMON hsp90 cDNA

and used to screen the cDNA library. Following

two rounds of purification, nine plaques were selected and transformed into a SolR strain of E.
coli to generate the double stranded phagemid
pBluescript by in vivo excision. Cells were inoculated onto Larin Bertani agar plates containing
50 g/ml carbenicillin, and individual colonies
were screened for the presence of an hsp90 insert
using PCR with the primers described above and
the following thermal cycle: 96C for 10 min, 30
cycles of 96C for 20 sec, 37C for 1 min, 72C for
2 min, followed by a final step at 72C for 10 min.
The size of selected inserts was determined by PCR
using primers to the T3 and T7 promoters flanking the multiple cloning site followed by electrophoresis of the amplicons in a gel of 1.0% agarose
as described above. Plasmid DNA was isolated
(Qiagen, Chatsworth, CA) from a clone containing
a 2.6-kb insert and sequenced in both directions
using a primer walking strategy with Taq FS DNA
polymerase and fluorescent-dideoxy terminators
(W.M. Keck Foundation Biotechnology Resource
Laboratory, Yale University, New Haven, CT). Identity of the contiguous hsp90 cDNA with nucleic acid
and deduced amino acid sequences was determined
using BLASTN (Altschul et al., 97).
In vitro experiments
Thermal stress

Fish were killed by a sharp blow to the head

and exsanguinated by excision of the caudal fin
to reduce contamination of tissues with erythrocytes. Three to four hemibranchs of the gills were
rapidly excised, and the posterior kidney was removed through a ventral incision. Hemibranchs
were cut just above the septa to separate the
lamellae and the posterior kidney was diced into
small cubes (35 mm) using methanol-cleaned razor blades. Approximately 0.8 g of lamellae or kidney from each individual was rinsed in 30 ml of
minimum essential medium with Earles salts
(MEM; Sigma, St. Louis, MO) and 0.4 g of each
tissue transferred to a 25 ml Erlenmeyer flask
containing 8 ml MEM supplemented with 100 U/
ml penicillin and 100 g/ml streptomycin and adjusted to pH 7.3 with a 7.5% solution of sodium
bicarbonate. Flasks containing the tissues were
gassed with O2:CO2 (99:1), capped with a rubber
septum and placed on an orbital shaker (80100
rpm) and incubated at either ambient water temperature (10C) or 26C for 3 hr. Culture medium
bathing the tissues was overlaid with O2:CO2 to
reduce the potential for anoxia; molecular oxygen
does not stimulate induction of the major hsps

201

(Visner et al., 96). Upon termination of the exposure period, RNA and protein were isolated from
tissues as described below. The thermal regimen
employed in these investigations has been demonstrated to induce the major hsps of salmon
(Smith et al., 99a).
Osmotic stress

To investigate whether the hsp90 gene is upregulated in response to hyperosmotic stress, tissues were prepared and treated as described for
thermal stress above with the following exceptions:
1) tissues were maintained at ambient water temperature throughout, 2) the MEM was supplemented with 125 mM NaCl to create a hyperosmotic
condition, and 3) tissues were incubated for 12 hr.
Previous investigations in our laboratory demonstrated that hsp70 and a 54-kDa protein (osmotic
shock protein 54, osp54) are induced in isolated
branchial lamellae incubated using these conditions (Smith et al., 99b).
In vivo experiments
Thermal stress

Thirty juvenile salmon (1618 cm in length)

reared at 10C were transferred directly to a tank
containing 190 liters of water maintained at 26C
and provided with supplemental aeration. After
30 min, the fish were transferred to a 250 liter
tank supplied with single-pass ambient temperature water. Branchial lamellae and posterior kidney were excised from fish immediately following
cessation of thermal shock and after 3, 6, and 9
hr recovery. Control fish were handled in an identical manner but maintained at ambient temperature throughout. RNA was isolated and assayed
by Northern blot analysis as described below.
Osmotic stress

To reduce the confounding effects of biochemical and endocrine changes associated with smoltification, experiments to investigate the response
of hsp90 to hyperosmotic stress in vivo were conducted approximately 2 months after parrsmolt
transformation as assessed by a decline in branchial Na+/K+ ATPase activity and increase in condition factor (Robertson and Bradley, 91; data not
shown). Fifty juvenile salmon (1618 cm) were
transferred directly from freshwater to tanks containing filtered Narragansett Bay seawater (32
parts per thousand salinity). The 190-liter tanks
were equipped with charcoal filters and aeration
and surrounded with a jacket of flowing freshwa-

202

F. PAN ET AL.

ter to maintain ambient water temperature. An

additional group of 10 fish was retained under
identical conditions in freshwater to serve as a
control. Ten fish were randomly sampled 6, 12,
24, 48, and 96 hr post transfer and killed by a
sharp blow to the head. Approximately 1 ml blood
was collected into a heparinized syringe by caudal venipuncture and a 200 l aliquot of blood was
centrifuged at 5000g for 5 min for determination
of hematocrit. The remaining blood was centrifuged at 8000g for 5 min and the plasma collected
and frozen at 20C. Chloride concentration of the
plasma was determined by colorimetric assay of
thiocyanate displacement from mercuric thiocyanate (Sigma procedure no. 461-M; Cl standards 95511). Branchial lamellae and kidney tissue were
collected from four control fish and four individuals
sampled at 24 and 96 hr post transfer and processed
for isolation of RNA as described below.
RNA isolation and Northern blot analysis
Total RNA was isolated from branchial lamellae and kidney tissue using a guanidiniumisothiocyanate method (Chirgwin et al., 79). The
RNA concentration of each sample was quantified
spectrophotometrically (A260) and those with an A260/
A280 ratio > 1.6 and exhibiting no evidence of degradation, as indicated by clearly defined 28s and
18s rRNA bands on ethidium bromidestained
agarose gels, were used for subsequent analyses.
Aliquots of 30 g total RNA were resolved on a
three-(n-morpholino) propanesulfonic acid (MOPS)formaldehyde 1% agarose gel (Sambrook et al., 89)
and transferred to a charged nylon membrane
(Magnacharge, MSI, Westboro, MA) over 12 hr using a turboblotter (Schleicher & Schuell, Keene,
NH). RNA was linked to the membrane by baking
at 80C for 1 hr.
The 0.3-kb hsp90 amplicon and a 2.6-kb cDNA
clone that hybridized with this fragment were
used to synthesize probes for Northern blot analyses and for screening the library. The cDNAs were
labeled with -32P dATP using DNA polymerase I
and random dodecamer or T3/T7 primers, respectively (Sambrook et al., 89). Membranes containing RNA were incubated for 2 hr at 42C in
prehybridization buffer (5 SSC, 5 Denharts,
0.5% SDS, 100 g/ml salmon sperm DNA) as previously described (Smith et al., 99b). Hybridization was conducted in fresh buffer (5 SSC, 5
Denharts, 50% formamide, 10% dextran sulfate,
0.2% sodium dodecyl sulfate (SDS), 100 g/ml
salmon sperm DNA) containing radiolabeled probe
(1.5 106 cpm/ml) for 1820 hr at 42C. Strin-

gency washes were conducted in 2 SSC containing 0.5% SDS at 65C for 30 min followed by 2
SSC lacking SDS at room temperature for 5 min.
Blots probed with hsp90 cDNA were stripped in a
solution of 50% formamide and 3 SSC at 65C
for 30 min and reprobed with the 0.5-kb cDNA
fragment of salmon actin to allow for determination of the relative quantity of hsp90. Radiolabeling and hybridization conditions for the actin
probe were as described above for hsp90.
Western blotting
Upon termination of exposure of isolated branchial lamellae and kidney tissues to thermal or
osmotic stress, flasks containing tissues were
chilled on ice for 2 min and the medium was aspirated. Tissues were rinsed with 5 volumes of
ice-cold 0.1 M TRIS (pH 7.6) containing a cocktail
of protease inhibitors (AEBSF, pepstatin A, E-64,
bestatin, leupeptin, and aprotinin; Sigma, No. P
8340) and homogenized in 5 volumes of fresh
buffer with three 10-sec pulses of a tissuemizer
(Tekmar, Cincinnati, OH). Homogenates were centrifuged at 1000g for 10 min at 4C to remove
unlysed cells and debris. Aliquots of the resulting
supernatant (clarified homogenate) were frozen
and stored at 70C for up to 2 weeks prior to
analysis of proteins.
Fifty micrograms of protein from each sample
were resolved on SDS polyacrylamide gels (SDSPAG) with a total acrylamide concentration of 8%
and transferred to polyvinylidene difluoride membranes (Hybond, Amersham, Piscataway, NJ) using a semidry transfer apparatus (American
Bionetics model SBD-1000, Hayward, CA). Membrane-bound proteins were probed with a monoclonal antibody to hsp90 purified from rat (Stress
Gen Biotechnologies, Victoria, BC, Canada; SPA835). As with Northern blot analyses, actin was
employed as an internal control for Western blots
and all membranes were probed with a mouse
monoclonal antibody to actin (Sigma, A4700). The
membranes were blocked with 5% nonfat powdered
milk in Tris-buffered saline supplemented with
Tween 20 (TBS-T; 20 mM Tris-HCl, 137 mM NaCl,
0.1% (v/v) Tween 20) for 1 hr at room temperature, rinsed briefly in TBS-T and incubated with
primary antibody diluted in TBS-T (1:5000 hsp90;
1:500 actin), for 1 hr at room temperature on an
orbital shaker. Membranes were briefly washed
three times with fresh TBS-T, then incubated for
1 hr at room temperature with alkaline phosphatase conjugated, goat anti-rat IgG antibody
(StressGen; SAB-201; 1:30,000) for hsp90 or anti-

CLONING AND CHARACTERIZATION OF SALMON hsp90 cDNA

203

mouse IgG antibody (Amersham; RPN5781;

1:10,000) for actin. Following incubation, membranes were washed once more and incubated in
enhanced chemifluorescent (ECF) substrate (24 l/
cm2 membrane; Amersham) on a sheet of plastic
wrap for 5 min. Immunoreactive proteins were visualized by scanning the membrane using a Molecular Dynamics Storm 840 Unit (Sunnyvale, CA)
in fluorescence mode and set to 520 nm with a
photomultiplier tube voltage of 450. Negative antigen and antibody controls were used to gauge
the specificity of antibody binding. Supporting evidence for the identity of hsp90 and actin was obtained by comparison with molecular weight
standards co-electrophoresed on each gel.

from nucleotides 86 through 2254, and the PCR

amplicon spanned the region of nucleotides 182
through 488 and amino acids 32 through 134. The
salmon cDNA exhibited extensive identity at the
deduced amino acid level with sequences of hsp90
of zebra fish (92% identity) and human (89% identity; Fig. 1). Further analysis of the deduced amino
acid sequence using the ExPASy Molecular Biology Server (www.expasy.ch; Swiss Institute of
Bioinformatics) suggests that the protein has a
molecular weight of 83.3 kDa and a theoretical pI
of 4.89. Dipeptide composition (Guruprasad et al.,
90) and the N-terminal residue (Gonda et al., 89)
suggest the protein to be relatively unstable, with
a projected half-life of circa 30 hr.

Quantification and analyses

Thermal stress

Digital images of Northern blots were captured

using a Molecular Dynamics Storm 840 phosphor
imager and Imagequant software. The size of the
transcripts was determined by comparison with
RNA markers co-electrophoresed on each gel and
the integrated optical density (IOD = optical density area) of hsp90, and actin bands was quantified using this instrument. For Western blot
analyses, the IOD of hsp90 and actin bands was
quantified from digital fluorescent images using
Imagequant software. The relative concentrations
of hsp90 mRNA and protein were determined by
normalizing the IOD of hsp90 to actin (hsp90:
actin). The use of actin provides an effective internal control for comparison of the effects of thermal and osmotic stress on expression of a stable
constitutive gene (actin) and an inducible gene
such as hsp90 (Wei and Roepe, 94).
Values for hematocrit and plasma Cl were analyzed statistically by repeated measures ANOVA (
= 0.05), followed by a Students t-test to identify significant differences between treatments. Relative
hsp90 mRNA and protein concentrations were compared using a Students t-test. Following statistical
analysis, the hsp90 values were converted to percentages and are presented as a percentage of the
control value, which was set arbitrarily at 100%.

To determine the magnitude of hsp90 upregulation in response to thermal stress and to allow
for comparison with the response elicited by osmotic stress, isolated branchial lamellae and kidney tissue were incubated at 26C (T = 16C)
for 3 hr and assayed for hsp90 mRNA. This thermal regimen has been demonstrated to stimulate
induction of the major species of hsps of salmon
(Smith et al., 99a). Northern blot analysis revealed a 132% increase in accumulation of hsp90
mRNA in branchial lamellae (Fig. 2A,B) and a
117% increase in kidney tissue (Fig. 2C,D) exposed
to thermal stress. Corresponding with this rise in
hsp90 mRNA, was a similar increase in the pool
of hsp90 in branchial lamellae (155%, Fig. 3A,B)
and kidney tissue (155%; Fig. 3C,D).
The response observed in isolated tissues was
compared with that of the living animal exposed
to the same thermal stress of 26C but of shorter
duration (30 min). The quantity of hsp90 mRNA
in branchial lamellae did not increase during the
30 min thermal shock, but a marginal and statistically significant increase (18%) in hsp90 mRNA was
observed following 6 hr recovery from thermal shock
(Fig. 4A,C). By hour 9 of recovery, the level of hsp90
mRNA was no longer statistically different from
that of control fish. Unlike branchial lamellae, a
marginal, but statistically significant increase
(1823%) in hsp90 mRNA in kidney tissue (Fig.
4B,D) was observed during thermal stress. The
quantity of hsp90 mRNA remained elevated for
the duration of the 9-hr recovery period.

RESULTS
Hsp90 cDNA
A 2625-bp clone from the salmon cDNA library
that hybridized with a 3.1-kb transcript on Northern blots was sequenced and found to contain an
open reading frame of 2169 nt coding for a protein of 722 amino acids (GenBank accession no.
AF135117; Fig. 1). The coding region extended

Osmotic stress
We were most interested in determining whether
hsp90 is upregulated in response to hyperosmotic

204

F. PAN ET AL.

Fig. 1. Comparison of the deduced amino acid sequences of hsp90 of Atlantic salmon (Ats), zebrafish (Zeb),

and human (Hum). * indicates identity with Atlantic

salmon sequence.

CLONING AND CHARACTERIZATION OF SALMON hsp90 cDNA

205

Fig. 2. Northern blot analyses of hsp90 mRNA in (A) branchial lamellae and (C) posterior kidney tissue isolated from
three individual salmon and incubated at 10C (ambient) or
26 for 3 hr. Values in the histograms of (B) branchial lamel-

lae and (D) kidney are presented as the mean SD (n = 3

fish per temperature). Values in the same figure marked with
* are statistically different (P < 0.05).

stress. To investigate the response in vitro, isolated

branchial lamellae and posterior kidney, the primary osmoregulatory organs of teleost fishes, were
incubated in MEM supplemented with 125 mM
NaCl for 12 hr. Northern blot analysis revealed a
133% increase in hsp90 mRNA in branchial lamellae (Fig. 5A,B) but the levels of hsp90 mRNA in
the kidney were unaffected by this osmotic stress
regimen (Fig. 5C,D). Despite an increase in hsp90
mRNA, no increase in the quantity of hsp90 in either tissue was detected by Western blot analysis
(data not shown).
Finally, we sought to determine whether osmotically induced accumulation of hsp90 mRNA
might be observed in the living animal. Juvenile
salmon were transferred directly from freshwater to seawater, and blood, branchial lamellae,
and kidney tissue were collected from individuals at designated intervals for assay of hematocrit, plasma Cl, and hsp90 mRNA. Transfer
from freshwater to full-salinity seawater resulted

in a rise in the concentration of plasma chloride

from 115 mM/liter to 155 mM/liter by hour 6,
and the levels remained elevated until 96 hr
when the study was terminated (Fig. 6A). Conversely, hematocrit levels declined from 48 to 29%
during the first 6 hr exposure to seawater and
remained depressed for the duration of the experiment (96 hr; Fig. 6B). Similar to the results
obtained with isolated tissues, hsp90 mRNA was
upregulated (73%) by osmotic stress in vivo in
branchial lamellae 24 hr following transfer to
seawater, but was unaltered in kidney tissue
(Fig. 7AD). After 96 hr in seawater the quantity of hsp90 mRNA in branchial lamellae declined to freshwater levels, as did plasma Cl
indicating successful adaptation to seawater.
DISCUSSION
The nucleotide sequence of the Atlantic salmon
2625 bp cDNA contained an open reading frame
of 2169 nt coding for a protein of 722 amino acids

206

F. PAN ET AL.

Fig. 3. Western blot analyses of hsp90 in (A) branchial

lamellae and (C) posterior kidney tissue isolated from three
individual salmon and incubated at 10C or 26C for 3 hr.
Values in the histograms of (B) branchial lamellae and (D)

kidney are presented as the mean SD (n = 3 fish per temperature). Values in the same figure marked with * are statistically different (P < 0.05).

consistent with hsp90 of zebrafish (724 amino

acids, 92% identity; GenBank no. AF068772) and
human (724 amino acids, 89% identity; Rebbe et
al., 87) suggesting that this cDNA does indeed
code for hsp90 of Atlantic salmon, The Atlantic
salmon hsp90 also exhibited 82% identity with
the deduced amino acid sequence of hsp90 of
chinook salmon (Oncorhynchus tshawytscha;
GenBank no. U89945). Most higher vertebrates
possess two closely related hsp 90 genes ( and
) (Nover, 91; Krone and Sass, 94).
Expression of hsp90 was upregulated in salmon
tissues exposed to thermal shock in vitro and in
vivo. The quantity of hsp90 mRNA and protein in
gill and kidney tissues following thermal shock
in vitro increased more than 100% above the levels in tissues maintained at ambient temperature.
In the living animal, hsp90 mRNA also increased
during exposure to thermal stress, but to a lesser
degree (1823%) than observed in isolated tissues.

The more prominent response in vitro could be

related to the degree of protein denaturation and
the specific proteins affected by the extended thermal shock (3 hr vs. 30 min). A recent report suggests that hsp90, in contrast to hsp70, maintains
a restricted role in thermal stress and interacts
only with specific classes of proteins that fail to
readily attain native conformation (Nathan et al.,
97). The relatively high constitutive levels of
hsp90 observed in salmon tissues might be sufficient to contend with all but the most extreme
thermal stress. Krone and Sass (94) reported a
similar increase (100200%) in hsp90 mRNA
following heat shock of early stage zebrafish embryos. The magnitude of response declined dramatically with age and increased constitutive
levels of hsp90.
In salmon, the response of hsp90 to thermal
shock was less prominent than that of hsp70. The
quantity of hsp70 mRNA increased by 300% in

CLONING AND CHARACTERIZATION OF SALMON hsp90 cDNA

207

Fig. 4. Northern blot analyses of RNA isolated from (A)

branchial lamellae and (B) kidney tissues of salmon subjected
to a 30 min thermal shock at 26C (T = 16C) and sampled
either immediately after shock (0) or following 3, 6, or 9 hr
recovery in ambient temperature water. Control fish (Con)

were subjected to the same experimental procedures at ambient temperature. Values in the graphs of (C) gill and (D)
kidney are presented as the mean SD (n = 2 fish per time
point). Values in the same figure marked with * are statistically different from the control (P < 0.05).

branchial lamellae of juvenile salmon exposed in

vivo to thermal shock conditions (26C for 15 min)
similar to those employed in these investigations
(Zarate and Bradley, unpublished data). These results agree with a previous report demonstrating

that the accumulation of hsp90 mRNA in Xenopus laevis exposed to thermal shock was much
less pronounced than the increase in hsp70 mRNA
(Ali et al., 96).
Of greater interest, hsp90 was upregulated in

208

F. PAN ET AL.

Fig. 5. Northern blot analyses of hsp90 mRNA in salmon

(A) branchial lamellae and (C) kidney tissue incubated for
12 hr in tissue culture medium (0) or medium supplemented
with 125 mM NaCl (125). Values in the graphs of (B) branchial lamellae and (D) kidney are presented as the mean
SD (n = 3 fish per time point). Values in the same figure
marked with * are statistically different (P < 0.05).

Atlantic salmon branchial lamellae in response to

hyperosmotic stress in vitro and in vivo. Upregulation in vivo coincided with cellular dehydration as indicated by a prominent increase in
plasma chloride and a sharp decline in hematocrit.
Exposure of cells to hyperosmotic conditions and
consequent dehydration concentrates ions and
macromolecules and disrupts the internal milieu.
Such changes can denature proteins, alter enzyme
kinetics, and disrupt ionic bonds (Yancey et al.,
82; Somero, 86; Burg et al., 97). Accumulating
evidence suggests that hsps provide a rapid response to this cellular perturbation, limiting protein denaturation until such time that mechanisms
for long-term regulation of cell volume (e.g., osmolyte transporters and antiport pumps) develop.
Upregulation of hsp70 in response to osmotic stress
has been observed in mammalian renal cells (Cohen
et al., 91; Petronini et al., 93; Sheikh-Hamad et
al., 94; Rauchman et al., 97) and more recently in
fish tissues (Smith et al., 99b). Additionally,
upregulation of osp94, a member of the hsp110/
SSE gene family, has been reported during hy-

Fig. 6. Plasma Cl concentrations and hematocrit (Hct)

of salmon maintained in freshwater (0) or 6, 12, 24, 48, and
96 hr following transfer to seawater (32 ppt). Values are presented as the mean SD (n = 10 fish per time point). Time
points marked with different superscripts are statistically different (P < 0.05).

perosmotic stress of renal cells (Santos et al., 98).

The present study is the first report of upregulation of hsp90 in response to hyperosmotic stress.
The absence of an increase in hsp90 accompanying the marked elevation of hsp90 mRNA in
branchial lamellae subjected to osmotic stress was
unexpected. Previous investigations suggested
that hyperosmotic conditions can disrupt the protein synthetic machinery and reduce the rate of
synthesis of all but a limited number of proteins
(Harrington and Alm, 88; Cohen et al., 91; Kultz,
96; Kurz et al., 98; Smith et al., 99b). Preferen-

CLONING AND CHARACTERIZATION OF SALMON hsp90 cDNA

209

Fig. 7. Northern blot analyses of hsp90 expression in (A)

branchial lamellae and (C) kidney of salmon from the experiment described in Figure 6. RNA was collected from fish
maintained in freshwater (0) or following 24 or 96 hr expo-

sure to seawater. Values for (B) branchial lamellae and (D)

kidney are presented as the mean SD (n = 4 fish per time
point). Time points in the same figure are marked with * are
statisitically different (P < 0.05).

tial synthesis of hsp70 during osmotic stress

(Cohen et al., 91; Petronini et al., 93; Rauchman
et al., 97; Santos et al., 98; Smith et al., 99b),
but not hsp90, might be related to the different
functions of these chaperones. Translation of hsp90
mRNA may lag behind transcription because of cellular perturbation caused by elevation in the concentrations of intracellular Na+ and Cl. The
possibility also remains that synthesis of hsp90 is
regulated at both the levels of transcription and
translation. Although osmotic stress markedly
stimulated gene expression, translation of the
message may require additional factors for initiation or elongation.
We had anticipated increased transcription of
hsp90 in both branchial lamellae and kidney tissue subjected to osmotic stress because of the role
of these tissues in osmoregulation. Although in
vitro and in vivo exposure of salmon to thermal
stress stimulated an increase in hsp90 mRNA in

both tissues, exposure to osmotic stress elicited

an hsp90 response only in branchial lamellae. Several plausible explanations might account for this
tissue specific response to osmotic stress. It could
be argued that the anatomical location and physiology of the kidney reduce exposure to osmotic
stress. The kidney of teleost fishes is incapable of
concentrating ions to produce the hypertonic urine
characteristic of the mammalian renal system,
limiting exposure to ion concentrations no greater
than those of the plasma (Evans, 98). In contrast,
the mucosal cells of the branchial lamellae are
exposed directly to full salinity seawater, increasing the potential for denaturation of cellular
proteins. Consistent with this hypothesis, tissuespecific responses to thermal shock of salmon and
other species of fish indicate that the hsp response
is more rapid and prominent in the gill than in
internal organs (Koban et al., 91; Smith et al.,
99a). However, the absence of an hsp90 response

210

F. PAN ET AL.

in isolated kidney tissue exposed to osmotic stress

suggests a response unrelated to protein denaturation. Interestingly, hsp70 but not hsp90, is induced in the mammalian renal medulla where the
concentrations of ions and urea can exceed molal
levels (Guyton, 86; Burg et al., 97).
Upregulation of hsp90 in branchial lamellae
during hyperosmotic stress could facilitate the role
of cortisol in ion transport in the fish gill, the primary site of monovalent ion excretion. Cortisol
stimulates differentiation of branchial chloride
cells and an increase in the activity of branchial
Na+/K+ ATPase in several species of fish, including salmonids (McCormick, 95). Consistent with
this role, circulating levels of cortisol increase during the parrsmolt transformation of salmonids,
leading to increased tolerance of seawater (Hoar,
88). The capacity of the gill to respond to endogenous cortisol appears related to the population
of high-affinity cortisol receptors present (Shrimpton and Randall, 94). Investigations with mammalian cell lines indicate that hsp90 is essential
for effective glucocorticoid action (Dalman et al.,
89; Vamvakopoulos, 93; Bohen, 95; Kang et al.,
99). It has been hypothesized that hsp90 binds
to the nascent glucocorticoid receptor and forms a
multimeric complex that conveys affinity for ligand
to the aporeceptor and reduces non-specific interaction. Indeed, glucocorticoid receptors synthesized
in vitro in the absence of hsp90 or in vivo in yeast
producing mutant hsp90 fail to bind ligand (Dalman et al., 89; Bohen, 95). Stimulation of gill hypoosmoregulatory capacity by cortisol suggests an
increased requirement for cortisol receptors and
hsp90 during adaptation to seawater.
Implication of hsp90 in signal transduction (for
reviews see Pratt, 97, 98) lends additional support
to a role in branchial osmoregulation. Of specific
relevance is the demonstration that the families of
mitogen-activated protein kinases (MAPK) and
stress-activated protein kinases (SAPK) are markedly activated by osmotic shock (Matsuda et al.,
95, Kultz et al., 98). Hsp90 binds to specific kinases of the MAPK system and may be involved
in activation of this system (Pratt, 97). Although
investigation of these osmosensing cascades in fish
is lacking, Kultz (96) reported modification of
cJun, an AP-1 transduction factor of the SAPK
system, in the gills of a euryhaline teleost (Gillichthys mirabilis) exposed to osmotic shock.
The results of these studies and a previous
report from our laboratory (Smith et al., 99b)
suggest that hsps are essential elements for adaptation of salmon to hyperosmotic stress. In the

previous investigation, hsp70 was upregulated in

isolated branchial lamellae, erythrocytes, and liver
of salmon incubated in hyperosmotic medium. The
relative quantity of hsp70 mRNA in branchial
lamellae increased as much as 900% above the
levels in tissue maintained under isoosmotic conditions. In contrast, hyperosmotic stress of salmon
in vitro and in vivo elicited a 73133% increase
in hsp90 mRNA in branchial lamellae and failed
to stimulate upregulation of hsp90 in kidney. The
tissue specificity and differences is not the magnitude of response suggest distinct but complementary roles of hsp70 and hsp90 in the initial
stages of adaptation of salmon to seawater. Consistent with its role in protein renaturation and
nonspecific chaperonin function, hsp70 likely decreases the lability of or renatures proteins susceptible to denaturation upon an increase in the
concentration of intracellular ions (i.e., Na+ and
Cl) following transfer of salmon to seawater. The
less prominent response of hsp90 in salmon tissue suggests a more specific role, perhaps in signal transduction and subsequent development of
hypoosmoregulatory capacity in the gill (e.g.,
chloride cell differentiation and increased Na+/
K+ ATPase activity). Investigations are in progress
to determine the role of other hsps and novel proteins in adaptation of salmon to seawater.
ACKNOWLEDGMENTS
The authors thank Larry Lofton of the North
Attleboro National Fish Hatchery, North Attleboro, MA, and Peter Angelone of Lafayette State
Hatchery, North Kingstown, RI, for supplying the
Atlantic salmon used in these investigations (RI
Agriculture Experiment Station contribution no.
3710).
LITERATURE CITED
Ali A, Krone PH, Pearson DS, Heikkila JJ. 1996. Evaluation of stress-inducible hsp90 gene expression as a potential
biomarker in Xenopus laevis. Cell Stress Chaperones
1:6265.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z,
Miller W, Lipman DJ. 1997. Gapped blast and psi-blast: a
new generation of protein database search programs.
Nucleic Acids Res 25:33893402.
Bjornsson BT, Ogasawara T, Hirano T, Bolton JP, Bern HA.
1988. Elevated growth hormone levels in stunted Atlantic
salmon, Salmo salar. Aquaculture 73:275281.
Bohen SP. 1995. Hsp90 mutants disrupt glucocorticoid receptor ligand binding and destabilize aporeceptor complexes.
J Biol Chem 270:2943329438.
Burg MB, Kwon ED, Kultz D. 1997. Regulation of gene expression by hypertonicity. Ann Rev Physiol 59:437455.
Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. 1979.

CLONING AND CHARACTERIZATION OF SALMON hsp90 cDNA

Isolation of biologically active ribonucleic acid from sources
enriched in ribonuclease. Biochemistry 18:52945299.
Cohen DM, Wasserman JC, Gullans SR. 1991. Immediate
early gene and hsp70 expression in hyperosmotic stress in
MDCK cells. Am J Physiol 261(Cell Physiol 30):C594C601.
Craig EA, Weismann JS, Horwich AL. 1994. Heat shock proteins and molecular chaperones: mediators of protein conformation turnover in the cell. Cell 78:365372.
Dalman FC, Bresnick EH, Patel PD, Perdew GH, Watson SJ,
Pratt WB. 1989. Direct evidence that the glucocorticoid receptor binds to hsp90 at or near the termination of receptor translation in vitro. J Biol Chem 264:1981519821.
DuBeau SF, Pan F, Tremblay GC, Bradley TM. 1998. Thermal shock of salmon in vivo induces the heat shock protein
hsp 70 and confers protection against osmotic shock. Aquaculture 168:311323.
Duston J. 1994. Effect of salinity on survival and growth of
Atlantic salmon (Salmo salar) parr and smolts. Aquaculture 121:115124.
Evans DH, editor. 1998. The physiology of fishes, 2nd ed. Boca
Raton, FL: CRC Press. 519 p.
Gonda DK, Bachmair A, Wunning I, Tobias JW, Lane WS,
Varshavsky A. 1989. Universality and structure of the Nend rule. J Biol Chem 264:1670016712.
Guruprasad K, Reddy BV, Pandit MW. 1990. Correlation between stability of a protein and its dipeptide composition: a
novel approach for predicting in vivo stability of a protein
from its primary sequence. Prot Engineer 4:155161.
Guyton AC. 1986. Textbook of medical physiology, 7th ed.
Philadelphia: Saunders. 1057 p.
Handeland SO, Jarvi T, Ferno A, Stefansson SO. 1996. Osmotic stress, antipredator behaviour and mortality of Atlantic salmon smolts. Can J Fish Aquat Sci 53:26732680.
Harrington HM, Alm DM. 1988. Interaction of heat and salt
shock in cultured tobacco cells. Plant Physiol 88:618625.
Hoar WS. 1988. The physiology of smolting salmonids. In:
Hoar WS, Randall DJ, editors. Fish physiology, vol. 11B.
San Diego: Academic Press. p 275343.
Kang KI, Meng X, Devin-Leclerc J, Bouhouche I, Chadli A,
Cadepond F, Baulieu EE, Catelli MG. 1999. The molecular
chaperone hsp90 can negatively regulate the activity of a
glucocorticosteroid-dependent promoter. Proc Natl Acad Sci
USA 96:14391444.
Koban M, Yup AA, Agellon LB, Powers DA. 1991. Molecular
adaptation to enviornmental temperature: heat-shock response of the eurythermal teleost Fundulus heteroclitus. Mol
Mar Biol Biotech 1:117.
Krone P, Sass JB. 1994. Hsp90 and hsp90 genes are present
in the zebrafish and are differentially regulated in developing embryos. Biochem Biophys Res Comm 204:746752.
Kultz D. 1996. Plasticity and stressor specificity of osmotic
shock and heat shock responses of Gillichthys mirabilis gill
cells. Am J Physiol 271(Cell Physiol 40):C1181C1193.
Kultz D, Madhany S, Burg MB. 1998. Hyperosmolality causes
growth arrest of murine kidney cells: induction of GADD45
and GADD153 by osmosensing via stress-activated protein
kinase 2. J Biol Chem 273:1364513651.
Kurz AK, Schliess F, Haussinger D. 1998. Osmotic regulation of the heat shock response in primary rat hepatocytes.
Hepatology 28:774781.
Madsen SS. 1990. The role of cortisol and growth hormone in
seawater adaptation and development of hypoosmoregulatory mechanisms in sea trout parr (Salmo trutta trutta).
Gen Comp Endocrinol 79:111.

211

Matsuda S, Kawasaki H, Moirguchi T, Gotoh Y, Nishida E.

1995. Activation of protein kinase cascades by osmotic shock.
J Biol Chem 270:1278112786.
McCormick S. 1995. Hormonal control of gill Na+,K+-ATPase
and chloride cell function: In: Wood CM, Shuttleworth TJ,
editors. Cellular and molecular approaches to fish ionic regulation, fish physiology vol. 14. New York: Academic Press. p
285313.
McCormick SD, Bern HA. 1989. In vitro stimulation of Na+K+-ATPase activity and ouabain binding by cortisol in coho
salmon gill. Am J Physiol 256:R707R715.
Nathan DF, Vos MH, Lindquist S. 1997. In vivo functions of
Saccharomyces cerevisiae Hsp90 chaperone. Proc Natl Acad
Sci USA 94:1294912956.
Nover L. 1991. Heat shock response. Boca Raton, FL: CRC
Press. 509 p.
Parsell DA, Lindquist S. 1993. The function of heat-shock
proteins in stress tolerance: degradation and reactivation
of damaged proteins. Ann Rev Genet 27:437496.
Petronini R, Alfieri R, De Angelis E, Campanini C, Borghetti
AF, Wheeler KP. 1993. Different HSP70 expression and cell
survival during adaptive response of 3T3 and transformed
3T3 cells to osmotic stress. Br J Cancer 67:493499.
Pratt WB. 1997. The role of the hsp90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Ann Rev Pharmacol Toxicol
37:297326.
Pratt WB. 1998. The hsp90-based chaperone system: involvement in signal transduction from a variety of hormone and
growth factor receptors. Proc Soc Exp Biol Med 217:420434.
Rauchman MI, Pullman J, Gullans SR. 1997. Induction of
molecular chaperones by hyperosmotic stress in mouse inner medullary collecting duct cells. Am J Physiol 273(Renal Physiol 42):F917.
Rebbe NF, Ware J, Bertina RM, Modrich P, Stafford DW. 1987.
Nucleotide sequence of a cDNA for a member of the human
90-kDa heat shock protein family. Gene 53:235247.
Robertson JC, Bradley TM. 1991. Hepatic ultrastructure
changes associated with the parrsmolt transformation of
Atlantic salmon (Salmo salar). J Exp Zool 260:135148.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed. Plainview, NY: Cold Spring
Harbor Laboratory Press.
Santos BC, Chevaile A, Kojima R, Gullans SR. 1998. Characterization of the Hsp110/SSE gene family response to
hyperosmolality and other stresses. Am J Physiol 274:
F10541061.
Sheikh-Hamad D, Garcia-Perez A, Ferraris JD, Peters EM,
Burg MB. 1994. Induction of gene expression by heat shock
versus osmotic shock. Am J Physiol 267(Renal Fluid Electrolyte Physiol 36):F28F34.
Shrimpton MJ, Randall DJ. 1994. Downregulation of corticosteroid receptors in gills of coho salmon due to stress and
cortisol treatment. Am J Physiol 267(Reg Integr Comp
Physiol 36):R432R438.
Smith TR, Tremblay GC, Bradley TM. 1999a. Characterization of the heat shock protein response of Atlantic salmon
(Salmo salar). Fish Physiol Biochem 20:279292.
Smith TR, Tremblay GC, Bradley TM. 1999b. Hsp70 and a 54
kDa protein (osp54) are induced in salmon (Salmo salar) in
response to hyperosmotic stress. J Exp Zool 284:286298.
Somero G. 1986. Protons, osmolytes and fitness of internal
milieu for protien function. Am J Physiol 251(Reg Integr
Comp Physiol 20):R197R213.
Vamvakopoulos NO. 1993. Tissue-specific expression of heat

212

F. PAN ET AL.

shock proteins 70 and 90: implication for differential sensitivity of tissues to glucocorticoids. Mol Cell Endocrinol
98:4954.
Visner GA, Fogg S, Nick HS. 1996. Hyperoxia-responsive proteins in rat pulmonary microvascular endothelial cells. Am
J Physiol 270(Lung Cell Mol Physiol 14):L517L525.

Wei L-Y, Roepe PD. 1994. Low external pH and osmotic shock
increase the expression of human MDR protein. Biochemistry 33:72297238.
Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN.
1982. Living with water stress: evolution of osmolyte systems. Science 217:12141222.