European Journal of Soil Biology 45 (2009) 275282

Contents lists available at ScienceDirect

European Journal of Soil Biology

journal homepage: http://www.elsevier.com/locate/ejsobi

Original article

Identication of plant genes involved on the initial contact between

ectomycorrhizal symbionts (Castanea sativa European chestnut and Pisolithus
tinctorius)
Monica Sebastiana a, *, Andreia Figueiredo a, Bartolomeu Acioli a,1, Lisete Sousa b, Fernando Pessoa a,
Aladje Balde a, Maria Salome Pais a
a
b

Plant Molecular Biology & Biotechnology Lab, Centre for Biodiversity, Functional & Integrative Genomics, FCUL, Campo Grande, 1749-016 Lisboa, Portugal
Department of Statistics and Operational Research, CEAUL, FCUL, Campo Grande, 1749-016 Lisboa, Portugal

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 18 June 2008
Received in revised form
22 December 2008
Accepted 5 February 2009
Available online 21 February 2009
Handling editor: Kristina Lindstrom

In order to contribute to the knowledge on the genes involved in the early steps of ectomycorrhiza
development, the transcriptional response of Castanea sativa (European chestnut) during the initial
contact (6 and 12 h) with Pisolithus tinctorius was analysed by microarray. This study revealed that
among the regulated plant genes, a substantial number of up-regulated transcripts showed homology
with genes encoding for proteins involved in stress and defense responses, (a cystatin, a cystatin-like
protein, a defensin and a universal stress protein). Early contact with the fungal mycelium also altered
expression of genes that are putatively involved in cellular processes like signal transduction and
communication (receptor kinase-related protein), protein fate (papain-like cystein proteinase), and water
transport facilitation (water channel MipK protein). Expression proling of the early contact between
C. sativa and P. tinctorius revealed that changes in gene expression occur few hours after contact, long
before the development of a functional mycorrhiza. The induction of genes involved in stress and defense
suggests that the host plant reacts rapidly to the presence of the mycobiont eliciting a defense programme similar to that described for pathogenic interactions. Another plant response was the repression
of genes normally implicated in water stress accounting for a water stress relief due to the initial contact
with the ectomycorrhizal fungus.
2009 Elsevier Masson SAS. All rights reserved.

Keywords:
Castanea sativa
cDNA microarray
Differentially expressed
Ectomycorrhiza (ECM)
Pisolithus tinctorius

1. Introduction
Mycorrhizas are mutually benecial associations between plant
roots and highly specialised root-inhabiting fungi. The functional
basis of mycorrhizal symbiosis is the exchange of fungus-derived
mineral nutrients with plant-derived carbohydrates. In temperate
and boreal forests ectomycorrhizas (ECM) serve as a major organ
for nutrient uptake by trees, and it is estimated that up to 95% of the
short roots in these ecosystems form ECM [1]. This symbiosis is
essential for the stability of forest ecosystems protecting the root
system from pathogen attack and from adverse abiotic soil conditions like water stress [1]. The development of an ECM root
comprises four stages: pre-infection, initiation, differentiation and

* Corresponding author. Tel.: 351 21 7500163; fax: 351 21 7500172.

E-mail addresses: mgsebastiana@fc.ul.pt, monicasebastiana@gmail.com
(M. Sebastiana).
1
Present address: Dep. Micologia, Univ Federal de Pernambuco, Av. Prof. Nelson
Chaves s/n, Cidade Universitaria, 50670-420, Recife, PE, Brazil
1164-5563/$ see front matter 2009 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.ejsobi.2009.02.001

functioning [2]. In the pre-infection stage both partners exchange

signals in the soil leading to the determination of compatibility for
symbiosis. Once mutually recognized, root and fungal hyphae grow
towards each other and establish physical contact (initiation). Next,
the fungal hyphae grow and differentiate within the root cortex
(differentiation) forming a functional mycorrhiza, a multicellular
structure where nutrient exchange between the symbionts takes
place (functioning).
The development of ECM symbiosis is a highly regulated process
involving morphological and physiological changes that are
accompanied by alterations on gene expression in both partners
[3]. Gene proling studies led to the identication of hundreds of
transcripts that are preferentially expressed in symbiotic tissues
and that are involved in cellular functions like fungal cell division
and proliferation, differentiation and signalling, synthesis of cell
wall and extracellular matrices, plant defense or stress responses
and primary metabolism (e.g. glycolytic respiration, amino acid
biosynthesis, and the activity of transporters) [4]. These studies
conrmed that changes in morphology associated with ECM

276

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

development were accompanied by changes in gene expression

that commenced at the time of contact between the two partners,
long before the formation of a functional mycorrhiza.
The pre-symbiotic phase of ECM development, as been one of the
less studied. However, the dynamic events during the early stages of
interaction are crucial in determining the direction and ultimate
success of the formation of a symbiotic association [5]. Mutual signal
exchange (via diffusible rhizospheric molecules) between the host
plant and the mycobiont triggers the ECM developmental process
[5]. The nature of the signalling molecules and the molecular basis of
signal perception and transduction are unknown but it is clear that
the mycobiont alters auxin-regulated developmental pathways,
meristematic activity and cell shape through the action of secreted
molecules, such as auxins and hypaphorin [3,5]. The identication of
host regulated genes involved in auxin metabolism, calcium signalling pathways and transcriptional regulation, supports this
hypothesis [69]. Most studies analysing transcription in ECM
development have been focused on the colonization events that
comprise the period that spans from mantle formation (several days
of contact) to fully differentiated mycorrhizas [610]. A few studies
have been dedicated to the pre-mycorrhizal phase, and most of
them analyse gene expression in the fungal partner [1113].
Recently, plant transcriptional changes during the pre-mycorrhizal
phase of ECM development have been reported in oak and revealed
an increased expression of plant genes related to defense response,
signal perception, water regulation and cell rescue functions,
whereas genes involved in metabolism were down-regulated [14].
However, there is still limited information about the pre-infection
events when symbiotic partners establish rst contact. In the
present work, we investigated the regulation of plant gene
expression during the rst hours of interaction (6 and 12 h) between
Castanea sativa and Pisolithus tinctorius since alterations in gene
expression at this stage may be related to recognition between
symbiotic partners and probably inuence the outcome of the
symbiosis [3]. C. sativa Mill. (European Chestnut; Sweet Chestnut) is
an ecologically and economically important European forest
species, particularly in the Mediterranean region, where it is cultivated for fruit and timber production. There are reports showing
that early mycorrhizal inoculation of European Chestnut seedlings
and micropropagated plants improves the general condition of
plants [15,16], and protects plants against ink disease [17], that was
responsible for major epidemics in Europe and North America.
P. tinctorius is a widespread ECM basidiomycete forming ectomycorrhizas with a variety of hosts [18], including C. sativa [15,16]. It
has been widely used in forestry inoculation programs, and in
commercial mycorrhizal inoculum production. The fact that it can
be easily grown in vitro, and the simplicity of ECM synthesis under
controlled conditions with a range of host plants, has ensured full
documentation of the ontogeny and ultrastructure of P. tinctorius
ECM [18]. Developmental and functional aspects of P. tinctorius
ECMs are well documented and thus it has been adopted as a model
organism for investigations of the molecular basis of ECM interactions [18]. Symbiotic interactions involving a broad host range
fungus like P. tinctorius are very interesting to a broader audience of
soil biologist and ecologists, as well as agronomists, since this
fungus can interact with many forest and park trees and can
constitute an important tool in commercial tree production and
reforestation approaches.
2. Materials and methods
2.1. Biological material, media and culture conditions
Maintenance of biological material and establishment of plant
fungus contact were performed as described by Baptista et al. [19].

Briey, C. sativa seeds were germinated using a hydroponic system.

P. tinctorius (Pers.) Coker and Couch isolate 289/Marx was maintained on MMN solid medium [20]. Liquid cultures were obtained
by transferring pieces of mycelium from solid to liquid (250 ml)
MMN medium (half concentration of KH2PO4 and (NH4)2HPO4, no
malt extract) in tissue culture asks. Liquid cultures were maintained by substituting the medium every month. Interaction
between C. sativa and P. tinctorius was established in hydroponics
by randomly transferring previously washed mycelium to the asks
containing the seedlings (4 months old). Like in the system previously described [19], the roots of the seedlings used in this work
became totally covered with fungal mycelium. Early contact was
considered as dened before by Baptista et al. [19], who observed
adhesion of hyphae to the root surface 2 h after plantfungus
contact. The sampling time points for the present work (6 h and
12 h) were, thus, dened based on those results. Mock inoculations
were done with sterile water. Inoculated and control roots (whole
root system) were harvested 6 h and 12 h after contact with fungal
mycelium. Mock-inoculated controls were sampled simultaneously. About 25 inoculated or control roots were collected at each
time point. The roots were individually snap-frozen in liquid
nitrogen and stored at 80  C. Prior to RNA extraction, roots were
grouped into two (6 h) or three (12 h) pools with an average of 10
roots, which constituted biological replicates.
2.2. RNA extraction and cDNA library construction
Total RNA from 6 h and 12 h inoculated and control roots was
isolated using the hot borate method [21]. mRNA was puried using
the NucleoTrap mRNA purication kit (BD Clontech, PaloAlto, CA,
USA). cDNA library was constructed from mRNA using the SMART
cDNA Library Construction Kit (BD Clontech).
2.3. cDNA microarray, labelling and hybridization analysis
Randomly collected library clones were PCR amplied, and
inserts longer than 400 bp and amplied as a single band were
selected (2000 cDNAs). Amplied cDNA clones were puried on
multiscreen PCR plates (Milipore, Bedford, MA, USA), transferred to
96-well microplates (Corning, NY, USA), resuspended in printing
buffer (50% DMSO, 0.4% SSC) and printed (in duplicate) on poly-Llysine coated slides using a VersArray ChipWriter Compact System
(BioRad, CA, USA). The following genes and known sequences were
also included as internal quality controls: a C. sativa actin gene,
lambda DNA, and salmon sperm DNA. DNA was cross-linked to the
slides by U.V. irradiation according to protocol from Vodkin laboratory (http://soybeangenomics.cropsci.uiuc.edu/). Spot and
printing quality were assessed by staining with GelStar (FMC,
Rockland, ME). Microarray hybridization was performed using two
(6 h after contact) and three (12 h after contact) biological replicates, grown using the same setup and parameters. One hundred
micrograms of total RNA, from inoculated and control roots, were
used to synthesize Cy5- or Cy3-cDNA targets by reverse transcription primed with Oligo(dT) primer, according to Nikula et al.
[22]. RNA was degraded by incubating at 65  C for 30 min after the
addition of 10 mg of RNase A. Labelled cDNA probes were combined
and puried with the QIAquick PCR Purication kit (Qiagen).
Blocking of slides, hybridization and post-hybridization washes
were performed according to Nikula et al. [22]. Slides were scanned
at a 5 mm resolution using a VersArray ChipReader (BioRad, USA).
Laser power and detector sensitivity were adjusted to obtain an
equal distribution of signal intensities for both channels on each
slide. Spot and background intensities were quantied with VersArray Analyser software (BioRad). Data les were imported into
GEPAS (http://gepas.org), and analysed with DNMAD (Diagnosis

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

and normalization for microarray data, http://dnmad.bioinfo.cipf.

es) for background subtraction, log2 transformation and normalization by the print-tip loess method [23]. Normalized data were
imported into PreP (http://gepas.bioinfo.cipf.es/cgi-bin/preprocess)
for ltering, merging of replicate spots and imputation of missing
values. Statistical analysis was performed using the Rank Products
(RP) method [24]. Briey, for each chip genes were sorted
(in ascending and descending order) by their normalized log ratio
values and RP values were calculated. The RPs were compared with
the RPs for 1000 random permutations, with the same number of
replicates and genes as the real experiment, to correct for the
multiple testing problem inherent in microarray experiment. To
assign a signicance level to each gene we employed the false
discovery rate (FDR) [25]. ESTs with a FDR  0.06 and a fold change
of 2 were considered differentially expressed. This rank-based test
statistic is a non-parametric method shown to generate accurate
results with biological datasets presenting a small number of
replicates [24]. This method as already been used to analyse transcriptional proling in plants [2628]. To avoid bias in the microarray analysis as a consequence of dye related differences in
labelling efciency, dye labelling for each paired samples (inoculated/control) was reversed (reverse dye hybridization). Two
independent hybridizations (technical replicates) were performed
for each biological replicate, at each time-point. A total of 4 (6 h
after contact), and 6 (12 h after contact) microarray hybridizations
were analysed.
2.4. Estimation of the proportion of plant and fungal transcripts in
the plantfungus interaction transcriptome

277

differentially expressed transcripts by multiplying log2 ratio values

by 1.25.
2.5. Sequencing and sequence analysis
cDNAs differentially expressed were sequenced using the BigDye Terminator Cycle sequencing kit (Applied Biosystems, Inc.) and
ABI Prism 310 genetic analyser (Applied Biosystems, Inc.).
Sequences shorter than 100 bases and ambiguous sequences were
discarded. Homology searches in databases were performed at the
NCBI, using the blast x and megablast algorithms [31]. Sequences
with an E-value  105 were considered to identify known genes or
have partial similarity to known genes. ESTs identied as rRNA
were discarded.
2.6. Origin assignment of the differentially expressed genes
Sequence homology, combined with information on the triplet
nucleotide frequencies, were used to assign the putative origin
(plant or fungal) of the differentially expressed transcripts
according to Emmersen et al. [32] using the EST3 server at
http://mips.gsf.de/proj/est3. Training of a classier for C. sativa and
P. tinctorius was performed using 440 unique sequences from
Fagaceae plants and 418 sequences from P. tinctorius (mRNA and
EST sequence data longer than 50 bp) obtained by clustering of
sequences retrieved from the GenBank (NCBI) with BlastClust
program. EST sequences have been deposited in the GenBank dbEST
at NCBI.
2.7. Quantitative real-time RT-PCR

Although the hybridizations have been performed using equal

amounts of labelled cDNA from inoculated and non inoculated
roots, the proportion of plant and fungal cDNA in these two
samples was not the same: samples from inoculated roots (labelled
with Cy5) had a mix of plant and fungal transcripts whereas control
roots (labelled with Cy3) had only plant transcripts. This lead to an
underestimation of Cy5 uorescence values that needed to be
corrected. To equalize the amount of plant mRNA in the two
hybridization samples we estimated the proportion of plant to
fungal transcripts in cDNA from inoculated roots using reverse
transcription real-time PCR, in order to quantify plant and fungal
ITS (Internal Transcribed Spacer) rRNA. ITS regions are considered
reliable and specic markers for the estimation of the total plant or
fungal RNAs in intermingling symbiotic tissues [29].
To isolate the ITS regions, RNA was extracted from C. sativa roots
and P. tinctorius mycelium and cDNA was synthesized by reverse
transcription, as described above, using ITS4 [30] to prime the
reaction. ITS regions from roots and fungal mycelium were PCR
amplied with ITS5/ITS4 primers [30] and cloned into pGEM-T easy
vector (Promega). Cloned ITS fragments were sequenced and
sequences were compared against the non redundant databases of
the NCBI, using the internet BLAST server [31].
To quantify the ITS transcripts from each partner and calculate
the proportion of fungal and plant transcripts, total RNA was
puried from 6 h and 12 h inoculated roots and ve micrograms
were reverse transcribed using primer ITS4. Plant and fungal realtime PCR ITS specic primers are shown in Table 1. RT-PCR and
relative quantication were performed as described above. Two
biological and two technical replicates were used for each timepoint.
The proportion of plant to fungal transcripts in the P. tinctorius
C. sativa early interaction transcriptome, calculated by relative
quantication of the ITS transcripts, was 4: 1, in the two time points
(6 h and 12 h of root-fungal contact) analysed. This proportion was
used to correct microarray signal intensities of the C. sativa

The transcript expression of two target cDNAs was quantied to

validate microarray data (gene specic oligonucleotide sequences
are shown in Table 1). An actin transcript from C. sativa (EV253704),
non-regulated in the microarray experiment, was used as internal
reference for calculating relative transcript abundance.
Total RNA, from 6 h and 12 h inoculated and control roots, was
DNase treated with Turbo DNA-free kit (Ambion Inc.) for genomic
DNA removal. Five micrograms of total RNA from each biological
replicate were used to synthesize cDNA. QRT-PCR reactions were
performed with Light Cycler Fast Start ReactionMix MasterPLUS
SYBR Green I (Roche, Mannheim, Germany) using a LightCycler
detection system (Roche, Mannheim, Germany) according to
manufacturers instructions. The transcript concentration for each
sample was calculated based on a standard calibration curve
obtained from serial dilutions of plasmid DNA containing the insert
to be analysed. A negative control reaction without template was
included for each primer combination. The specicity of each
primer set was monitored by melting curve analysis and by the
sequencing of the respective amplicons that conrmed the amplication of the expected transcripts. Molecular weight of the
amplicons was further estimated by agarose gel electrophoresis.
3. Results
3.1. Microarray analysis
To examine changes in plant gene expression associated with
the pre-symbiotic phase of ECM development, an expression
proling using cDNA microarrays was performed. The comparison
between arrays in each time point [6 (a) and 12 (b) hours after
contact] (Fig. 1) shows that there is a good reproducibility between
biological and technical replicates. Moreover, Pearson correlation
coefcients (r) for technical (0.83 < r < 0.96) and biological
(0.75 < r < 0.90) replicated microarray pairs support the same

278

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

Table 1
QRT-PCR primers, targets and expected amplicons.
Target sequence (organism)

Accession

Primer sequence

Amplicon (bp)

Receptor-like kinase (C. sativa)

ES880903

241

Isoavone redutase (C. sativa)

EV253703

Actin (C. sativa)

EV253704

ITS2 (C. sativa)

EU016360

ITS2 (P. tinctorius)

AF374709

GGGTGATGTCTCAAAAACAA (F)
ATAACCTGCTTAACAAATCC (Rev)
ACAAGGTACTCTACATCAGG (F)
GGAATTGGGGACTCTTGGAT (Rev)
ATGTTGCCCTTGACTATGAG (F)
AGATGGCTGGAAGAGGACT (Rev)
CATCGAGTTTTTGAACGCA (F)
AACCACCGATTGTCGTG (Rev)
TCGAAATCTCAAACCAAG (F)
GCAAAGTTGGAGAAGCAT (Rev)

conclusion. The r value for biological replicated arrays was lower,

probably as a result of the introduced biological variation.
In the early contact between C. sativa and P. tinctorius, transcript
prole analysis by cDNA microarray allowed the identication of 11
C. sativa transcripts differentially expressed at the initial contact
(6 h and 12 h) with the ectomycorrhizal fungus P. tinctorius. These
11 transcripts were divided into functional categories according to
the putative function of their homologues in databases (NCBI)
(Table 2). Genes involved in stress and defense (cystatin, ES880905;
cystatin-like protein, ES880898; defensin, ES880902; non-specic
lipid transfer protein, ES880901; universal stress protein,
ES880899), signal transduction/communication (receptor protein
kinase-related, ES880903), protein fate (papain-like cystein
proteinase, ES880900), transport facilitation (water channel
protein MipK, ES880908) and genes with unknown function,
showed altered expression at 12 h after contact. The transcript
encoding a putative papain-like cystein proteinase was regulated at
6 and 12 h after contact with the fungal mycelium.

147
105
189
203

sequences had to be used to construct the classier, and that few

C. sativa sequences are available in the public databases, could be
responsible for the decreased classication accuracy of these
sequences. The predicted accuracy also decreases for short
sequences or poor quality sequences. The developed classier
enabled the origin assignment of 35 C. sativa and 53 P. tinctorius
cDNA library clones (including no homology sequences) and the

3.2. Origin assignment of the differentially expressed genes

The microarray was constructed based on a library containing
transcripts from both symbiotic partners, C. sativa and P. tinctorius.
A traditional way to classify the origin of genes sampled from a pool
of mixed cDNA is through sequence similarity to known genes from
the two organisms or from other closely related species. However,
this approach is prone to error and does not work when the
identied sequence has no close homologues in the sequence
databases. Using sequence homology combined with triplet
nucleotide frequency [32] we were able to predict the origin of the
genes that were differentially expressed in the microarray
experiments.
Since there was no classier developed for the C. sativa
P. tinctorius pair we developed our own classier, based on 440
database unique sequences from Fagaceae plants (C. sativa belongs
to the family Fagaceae) and 418 unique sequences from P. tinctorius.
After input of the sequences at the EST3 server, accuracy of the
training and test set obtained was 87.7% and 88.5%, respectively,
indicating the reproducibility of the output obtained with the
developed classier. The performance of the classier, tested with
88 ESTs from C. sativa and P. tinctorius, already compared to
sequences in the GenBank, revealed that 90% of the sequences were
correctly assigned, which agrees with the accuracy predicted for
the developed classier. Sequences belonging to the same TC,
including No Homology TCs, were all assigned the same origin by
the classier, showing its consistency. Incorrectly assigned
sequences included sequences coding for highly conserved proteins
such as ubiquitins or histones, short sequences (less than 150 bp) or
poor quality sequences. Within eukaryotic organisms, it may be
more difcult for the classier to separate sequences that are highly
conserved such as ubiquitins or histones. The fact that Fagaceae

Fig. 1. Array quality and variation within and between experiments. Box plot graphs of
normalized log2 ratio values for the 6 h (a) and 12 h (b) plantfungus contact microarrays. Box plots 1, 2 and 3 represent biological replicates (arrays hybridized with
uorescent cDNAs prepared from different RNA extracts from inoculated/control
roots); box plots 1_rev, 2_rev and 3_rev represent the technical replicates of each
biological replicate, in which Cy5 was used to label control roots and Cy3 was used to
label inoculated roots (reverse dye).

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

279

Table 2
Differential expression of Castanea sativa genes after 6 h and 12 h of contact with Pisolithus tinctorius assessed by microarray analysis.
GenBank ID

GenBank homolog descriptiona

E-value

Fold changeb
6h

Stress and defense

ES880898
Cystatin-like protein (Arabidopsis thaliana) (AAM64661) [52]
ES880905
Cystatin (Castanea sativa) (CAA11899) [38]
ES880899
USP-like protein (Astragalus sinicus) (ABB13620)
ES880902
Putative gamma-thionine mRNA (Castanea sativa)c (AF417297) [53]
ES880901
ns-Lipid transfer protein (Medicago truncatula) (ABE79318)
Signal Transduction/Communication
ES880903
Receptor protein kinase-related (Arabidopsis thaliana) (NP_566697)
Protein Fate
ES880900
Putative papain-like cystein proteinase (Gossypium hirsutum) (CAE54306)
Transport Facilitation
ES880908
Water channel protein MipK (Mesembryanthemum crystallinum) (AAD31848) [54]
Unknown
ES880907
Nucleic acid binding protein (Arabidopsis thaliana) (NP_565781)
ES880906
Hyphotetical protein (Vitis vinifera) (CAN69971)
ES880904
Unknown (Glycine max) (AAG00940)
a
b
c

12 h

1e15
9e29
3e21
1e47
2e14

3.56
4.06
4.19
6.95
2.30

8e34

5.67

4e54

3.19

2.78

1e15

2.02

35

11.53
4.68
3.75

4e
2e9
6e30

Database match (blast x), corresponding species, accession number and references.
Fold change between inoculated roots and non inoculated roots.
Database match (megablast), corresponding species and accession number.

11 C. sativa differentially expressed genes, showing that this new

methodology is very useful to discriminate between plant and
fungal sequences in symbiotic interactions.
3.3. Microarray validation by quantitative real-time RT-PCR
To conrm the reliability of microarray expression prole
analysis, QRT-PCR was performed on 2 randomly chosen target
genes: an isoavone redutase-like protein and a receptor-like
kinase. The isoavone redutase-like protein transcript was downregulated in the microarray but was not considered differentially
expressed by the Rank Products statistical method. The receptorlike kinase transcript was up-regulated in the microarray and was
considered as differentially expressed at 12 h post contact with the
fungal mycelium. The data from QRT-PCR conrmed the gene
expression pattern obtained by microarrays for both genes tested
(Table 3). However, for the receptor-like kinase protein, the ratio
between inoculated and control root tissue, obtained by QRT-PCR at
6 h (5.50) and at 12 h (68.15) after inoculation was higher than
those obtained by microarray analysis (1.67 and 4.48 respectively).
Nevertheless, the expression levels of the transcripts veried by
QRT-PCR were found to be consistent with the microarray data.
4. Discussion
Several papers have reported on molecular changes occurring
during the development of ECM [610,14]. However, a very limited
number of them concern the early molecular events occurring
during the pre-infection stage, before the establishment of symbiosis, especially in the plant partner [14]. For this reason we
considered it important to analyse plantfungus interaction over

Table 3
Comparison between fold changes obtained by microarrays and quantitative realtime PCR for genes expressed in Castanea sativa roots inoculated with Pisolithus
tinctorius mycelium for 6 h (two biological replicates) and 12 h (three biological
replicates).
Fold change

Microarray
QRT-PCR

Isoavone-redutase

Receptor-like kinase

6h

12 h

6h

12 h

1.83
0.82

1.85
0.70

1.67
4.68

5.50
68.15

a 12 h time course since alterations in gene expression at this stage

may be related to recognition between symbiotic partners and
probably inuence the outcome of the symbiosis.
Using a microarray approach, 11 C. sativa transcripts were found
to be differentially expressed in inoculated roots when compared
with non inoculated control roots. Compared to other data on global
gene expression prole in symbiotic interactions [68] the number
of genes differentially expressed in the system C. sativaP. tinctorius
is low. Most studies analysing transcription in ECM development
have been focused on the colonization events that comprise the
period that spans from mantle formation (several days of contact)
to fully differentiated mycorrhizas [610], and so they do not
analyse ECM development earlier than 2 days after initial contact.
Nevertheless, in 2 day old ECM between Betula pendula and Paxillus
involutus a number of differentially expressed transcripts similar to
the one presented in the present work was reported [10]. The low
number of regulated transcripts found in C. sativa may be related to
the very early stage of plantfungus contact (6 h and 12 h). Probably, at this early stage of ECM development, the plant has only
started to respond to the presence of the fungus.
QRT-PCR analysis for microarray validation showed higher fold
changes for one of the transcripts tested. The dynamic range of
microarrays tends to be lower than of QRT-PCR [33] and several
authors have reported higher fold changes with QRT-PCR when
compared to microarrays [34,31]. This difference on the dynamic
range of these two techniques is generally attributed to microarray
probe saturation or to cross-hybridization with members of the
same gene family having a different expression pattern [33,34].
Other authors ascribed these discrepancies to the normalization or
background subtraction methods used in microarray analysis [36].
Since this experiment was performed using cDNA microarrays,
which are less specic than oligo arrays, and using an organism
with an unknown genome like chestnut, cross-hybridization with
transcripts from the same gene family could have happened,
reducing the range of fold change values on arrays.

4.1. Genes involved in plant defense and stress response

A considerable amount of the regulated C. sativa genes displayed
sequence similarities with genes known to be involved in plant
defense and stress responses From the identied C. sativa transcripts two showed sequence similarity with protease inhibitors,

280

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

such as a cystatin and a cystatin-like protein. One of the identied

transcripts is homolog to the CsC gene from C. sativa that is transcriptionally activated after infection with pathogenic fungi,
wounding and abiotic stress [37]. This cystatin shows a strong
antifungal activity on several pathogenic fungi, which is probably
related to its inhibitory activity against fungal proteases [38,39]. A
cysteine proteinase inhibitor gene has been reported to be induced
in Eucalyptus globulus during the early ECM development [8].
During the development of other root symbioses, like arbuscular
mycorrhizas (AM) and root nodules, up-regulation of transcripts
coding for proteinase inhibitors also occurs [40,41].
A C. sativa putative gamma-thionin homolog was signicantly
up-regulated in inoculated roots when compared to the non inoculated ones. Plant gamma-thionins, or defensins, are ubiquitous in
plants and inhibit the growth of various plant pathogens by binding
to specic fungal membrane targets, causing severe membrane
damage [42]. The induction of plant defensins (syn. Kunitz-type
protesase inhibitors) has been reported to occur in AM [41]. In
ECMs from B. pendula and P. involutus a gene coding for a defensin
protein was down-regulated at 25 days old ECM root tips [7], an
inverse pattern of regulation compared to the C. sativa identied in
this work. This difference may be due to the late stage of ECM
development studied by those authors.
A gene with sequence similarity to a plant lipid transfer/seed
storage/trypsin-alpha amylase inhibitor, which belongs to the nonspecic lipid transfer protein (nsLTPs)like subfamily, appears
down-regulated in C. sativa roots in contact with P. tinctorius
mycelium. Plant nsLTPs are small, soluble proteins that facilitate the
transfer of fatty acids, phospholipids, glycolipids, and steroids
between membranes. LTPs have been correlated with resistance to
biotic and abiotic stress, some of them having antibiotic activity
against fungi and bacteria [43,44]. Other authors suggest that LTPs
can have a role in signalling and recognition between plants and
fungi [45]. The down regulation of a transcript coding for a nsLTPs
at 12 h of contact between P. tinctorius and C. sativa is consistent
with the regulation pattern described for the homolog PVR3-like
protein identied in the pre-mycorrhizal stage during the formation of Quercus robur ECMs with Piloderma croceum [46]. The exact
function of the nsLTPs is still, not clear.
The Universal Stress Protein (USP) is a small cytoplasmic
bacterial protein overexpressed when the cell is exposed to stress
agents. USP enhances the cell survival rate during prolonged
exposure to such conditions and may provide a general stress
endurance activity. The up regulation of this gene in C. sativa roots
may account for its role in increasing the capability of the plant
roots to cope with the stress imposed by the invading mycobiont.
According to several authors, mycorrhizal fungi induce in the
host plants, the transcription of stress responsive genes similar to
those induced by pathogenic fungi [69]. In ECMs this induction is
apparently transient, occurring only in the early stages of symbiosis, probably to control fungal ingress, and being repressed as the
interaction proceeds [8,9]. Our results conrm earlier reports on
the activation of the plant defense system during the initial stages
of ECM development. At initial contact, P. tinctorius induces in
C. sativa roots, the production of reactive oxygen species like the
oxidative burst occurring in early plantpathogen interactions [19].
It is tempting to speculate that this oxidative burst could modulate
the expression of genes involved in the plant defense system,
switched-on in early steps of C. sativaP. tinctorius ECM formation.
4.2. Signal perception related genes
A transcript encoding a putative signal perception/transduction
component was up-regulated in C. sativa roots, 12 h after contact
with P. tinctorius mycelium. The deduced peptide sequence shares

similarity with a receptor kinase-related protein from Arabidopsis

thaliana. This transcript presents the DUF26 domain (pfam 01657,
4e-12), which is found in serine/threonine kinases and has
unknown function. In Arabidopsis and rice, members of this
subfamily are rapidly induced upon pathogen infection [47,48] and
can trigger the hypersensitive response against pathogens by
causing increased accumulation of salicylic acid [48]. Several genes
with a putative function in signal transduction are up-regulated in
symbiotic tissues, including AM [40,41], root nodules [34] and ECM
[6,14]. The induction of this receptor kinase-related protein in
C. sativa roots 12 h after contact with P. tinctorius mycelium
suggests that a signalling process similar to that operating during
pathogenic interactions may take place during the rst hours of
contact between C. sativa roots and P. tinctorius hyphae. The
proliferation of root tissue and fungal hyphae forming the symbiotic organ and the need of both to adapt to rapid changes of the
environment (changes in pH, enhanced uxes of nutrients, presence of ROS) probably involve the activation of signalling networks
[4]. Very little is known about transduction pathways in mycorrhizas. However, several clues came from studies using arbuscular
mycorrhizas (AM), the other major group of mychorrizas in which,
contrary to ECM, the fungal partner penetrates inside the root cells,
and the root nodule symbiosis with rhizobia (both endosymbioses).
These studies, using legume (Lotus japonicus, Medicago sativa and
Medicago truncatula) mutants impaired in early symbiosis development, revealed that AM and root nodule symbiosis share
a common set of genes (referred to as the SYM genes) [49]. Some of
the common SYM genes encode typical signal transduction
components, like a receptor-like kinase (M. truncatula DMI2,
doesnt make infection), or a calcium-calmodulin-dependent
protein kinase (M. truncatula, DMI3). These proteins are involved in
a signal transduction network that is required for the development
of intracellular accommodation structures for symbiotic fungi and
bacteria by the host cell, during the early steps of symbiosis [49].
Although evidence of the recruitment of SYM genes in ECM early
signalling hasnt been, to our knowledge, reported yet, DMI genes
are found in the genome of Populus trichocarpa [50], a host of both
ECM and AM symbiosis. Interestingly, in P. trichocarpus a quantitative trait locus (QTL) linked to the ECM infection rate is localized to
a linkage group already characterized as involved in the interaction
between poplar leaves and pathogenic fungi [51]. These evidences
provide a genetic indication that the ECM trait could be associated
with plant loci and genes that might be common to interaction with
symbiotic and pathogenic fungi [4]. In rice (an AM host) studies
revealed a conservation of the plant transcriptional response to
symbionts and pathogens, including genes involved in signal
transduction, leading to the suggestion that plants might use the
same genetic program for responding to these different fungi [35].
4.3. Transport facilitation
A plant gene down-regulated in 12 h inoculated C. sativa roots,
displays sequence similarity with a water channel MipK protein
from Mesembryanthemum crystallinum [54]. Major intrinsic
proteins (MIPs) (syn aquaporins) are thought to play a role in
passive water ux across biomembranes [54]. During early ECM
development between Birch (B. pendula) roots and P. involutus, MIP
proteins were down-regulated together with dehydrins, which are
proteins reported as having a function in protection against water
stress [7,9]. According to Le Quere et al. [9], at a later stage of
infection, when fungal mantle and Hartig net are established, the
expression levels of water channel Mip genes decreases in reference
root tissue to levels below the expression on the mycorrhizal roots,
suggesting a plant water stress relief due to the formation of the
fungal mantle, which accounts for the role of water channel MipK

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

in protecting the roots from the water stress that constitutes

a major problem for the non mycorrhizal roots of young plant
seedlings [9]. In Eucalyptus ECMs, a water stress-inducible protein
gene, repressed during the initial symbiosis development (until day
7), is up-regulated and increases its expression as symbiosis
proceeds (from day 12 to day 21) [8]. Since the transcriptional
response of C. sativa was analysed at 6 and 12 h of contact with
P. tinctorius it cannot be ruled out the hypothesis that the identied
aquaporin may be up-regulated in latter stages of the symbiotic
interaction, being the 12 h, probably the turning point.
Elucidation of the nature of genes differentially expressed
during the development of ECMs can help in understanding the
molecular basis of the early events in plantectomycorrhizal fungus
interaction [5]. To our knowledge, this is the rst transcriptome
study concerning the rst hours of contact between plant and
fungus in an ECM symbiosis.
Expression proling of the early contact between C. sativa and
P. tinctorius shows that changes in gene expression occur few hours
after contact, long before the development of a functional mycorrhiza. A clear and evident plant response concerns the induction of
genes involved in stress and defense response indicating that the
host plant reacts rapidly to the presence of the mycobiont eliciting
a defense programme similar to that found in pathogenic interactions. Another plant response was the repression of genes normally
implicated in water stress suggesting a water stress relief due to the
initial contact with the ectomycorrhizal fungus.

Acknowledgments
We thank Dr. Silvia Ferreira for the critical reading of the
manuscript. The authors are grateful to the anonymous reviewer
for the constructive suggestions. Financial support for this work
was obtained from Fundaao para a Ciencia e Tecnologia through
fellowship (SFRH/BD/825/2000) and the projects FCT/POCI 2010
and PTDC/MAT/64353/2006.

References
[1] S. Smith, D. Read, Mycorrhizal Symbiosis, Academic Press, London, 1997.
[2] F. Martin, F. Lapeyrie, D. Tagu, Altered gene expression during ectomycorrhiza
development, in: P. Lemke, G. Caroll (Eds.), The Mycota, Springer, Berlin, 1997,
pp. 223242.
[3] D. Tagu, F. Lapeyrie, F. Martin, The ectomycorrhizal symbiosis: genetics and
development, Plant and Soil 244 (2002) 97105.
[4] F. Martin, A. Kohler, S. Duplessis, Living in harmony in the wood underground:
ectomycorrhizal genomics, Curr. Opin. Plant Biol. 10 (2007) 204210.
[5] F. Martin, S. Duplessis, F. Ditengou, H. Lagrange, C. Voiblet, F. Lapeyrie,
Developmental cross talking in the ectomycorrhizal symbiosis: signals and
communication genes, New Phytol. 1511 (2001) 145154.
[6] C. Voiblet, S. Duplessis, N. Encelot, F. Martin, Identication of symbiosisregulated genes in Eucalyptus globulusPisolithus tinctorius ectomycorrhiza by
differential hybridization of arrayed cDNAs, Plant J. 25 (2001) 181191.
[7] T. Johansson, A. Le Quere, D. Ahren, B. Soderstrom, R. Erlandsson, J. Lundeberg,
M. Uhlen, A. Tunlid, Transcriptional responses of Paxillus involutus and Betula
pendula during formation of ectomycorrhizal root tissue, Mol. Plant Microbe.
Interact. 17 (2004) 202215.
[8] S. Duplessis, P. Courty, D. Tagu, F. Martin, Transcript patterns associated with
ectomycorrhiza development in Eucalyptus globulus and Pisolithus microcarpus, New Phytol. 165 (2005) 599611.
[9] A. Le Quere, D.P. Wright, B. Soderstrom, A. Tunlid, T. Johansson, Global patterns
of gene regulation associated with the development of ectomycorrhiza
between Birch (Betula pendula Roth.) and Paxillus involutus (Batsch) Fr. Mol.
Plant Microbe. Interact. 18 (2005) 659673.
[10] D.P. Wright, T. Johansson, A. Le Quere, B. Soderstrom, A. Tunlid, Spatial
patterns of gene expression in the extramatrical mycelium and mycorrhizal
root tips formed by the ectomycorrhizal fungus Paxillus involutus in association with birch (Betula pendula) seedlings in soil microcosms, New Phytol. 167
(2005) 579596.
[11] G.K. Podila, J. Zheng, S. Balasubramanian, S. Sundaram, S. Hiremath, J.H. Brand,
M.J. Hymes, Fungal gene expression in early symbiotic interactions between
Laccaria bicolor and red pine, Plant and Soil 244 (2002) 117128.

281

[12] M. Mennota, A. Amicucci, D. Sisti, A.M. gioacchini, V. Stocchi, Differential gene

expression during pre-symbiotic interaction between Tuber borchii Vittad. and
Tilia americana L, Curr. Genet. 46 (2004) 158165.
[13] M. Zarestsky, Y. Sitrit, D. Mills, N. Roth-Bejerano, V. Kgan-Zur, Differential
expression of fungal genes at preinfection and mycorrhiza establishment
between Terfezia boudieri isolates and Cistus incanus hairy root clones, New
Phytol. 171 (2006) 837846.
[14] P. Frettinger, J. Derory, S. Herrmann, C. Plomion, F. Lapeyrie, R. Oelmuller,
F. Martin, F. Buscot, Transcriptional changes in two types of pre-mycorrhizal
roots in ectomycorrhizas of oak microcuttings inoculated with Piloderma
croceum, Planta 225 (2007) 331340.
[15] A. Martins, J. Barroso, M.S. Pais, Effect of ectomycorrhizal fungi on survival and
growth of micropropagated plants and seedlings of Castanea sativa Mill,
Mycorrhiza 6 (1996) 265270.
[16] A. Martins, A. Casimiro, M.S. Pais, Inuence of mycorrhization on physiological
parameters of micropropagated Castanea sativa Mill, Plants. Mycorrhiza 7
(1997) 161165.
[17] M.B. Branzanti, E. Rocca, A. Pisi, Effect of ectomycorrhizal fungi on chestnut ink
disease, Mycorrhiza 9 (1999) 103109.
[18] J.W.G. Carney, S.M. Chambers, Interactions between Pisolithus tinctorius and its
hosts: a review of current knowledge, Mycorrhiza 7 (1997) 117131.
[19] P. Baptista, A. Martins, M.S. Pais, R.M. Tavares, T. Lino-Neto, Involvement of
reactive oxygen species during early stages of ectomycorrhiza establishment
between Castanea sativa and Pisolithus tinctorius, Mycorrhiza 17 (2007) 185
193.
[20] D.H. Marx, The inuence of ectotrophic mycorrhizal fungi on the resistance of
pine roots to pathogenic infections I. Antagonism of mycorrhizal fungi to root
pathogenic fungi and soil bacteria, Phytopathology 59 (1969) 153163.
[21] C.Y. Wan, T.A. Wilkins, A modied hot borate method signicantly enhances
the yield of high-quality RNA from cotton (Gossypium hirsutum L.), Anal.
Biochem. 223 (1994) 712.
[22] T. Nikula, A. West, M. Katajamaa, T. Lonnberg, R. Sara, T. Aittokallio,
O.S. Nevalainen, R.A. Lahesmaa, Human Immuno Chip cDNA microarray
provides a comprehensive tool to study immune responses, J. Immunol. Meth.
303 (2005) 122134.
[23] Y.H. Yang, S. Dudoit, P. Luu, D.M. Lin, V. Peng, J. Ngai, T.P. Speed, Normalization
for cDNA microarray data: a robust composite method addressing single and
multiple slide systemic variation, Nucleic Acids Res. 30 (2002) e15.
[24] R. Breitling, P. Armengaud, A. Amtmann, P. Herzyk, Rank products: a simple,
yet powerful, new method to detect differentially regulated genes in replicated microarray experiments, FEBS Lett. 573 (2004) 8392.
[25] J.D. Storey, The positive false discovery rate: a Bayesian interpretation and the
q-value, Ann. Statist. 31 (2003) 20132035.
[26] P. Armengaud, R. Breitling, A. Amtmann, The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient
signalling, Plant Physiol. 136 (2004) 25562576.
[27] A. Figueiredo, A.M. Fortes, S. Ferreira, M. Sebastiana, Y.H. Choi, L. Sousa,
B. Acioli-Santos, F. Pessoa, R. Verpoorte, M.S. Pais, Transcriptional and metabolic proling of grape (Vitis vinifera L.) leaves unravel possible innate resistance against pathogenic fungi, J. Exp. Bot. 59 (2008) 33713381.
[28] A.M. Fortes, F. Santos, Y.H. Choi, M.S. Silva, A. Figueiredo, L. Sousa, F. Pessoa,
B.A. Santos, M. Sebastiana, K. Palme, R. Malho, R. Verpoorte, M.S. Pais, Organogenic nodule development in hop (Humulus lupulus L.): transcript and
metabolic responses, BMC Genomics 9 (2008) 445.
[29] E.C. Diaz, D. Tagu, F. Martin, Ribosomal DNA internal transcribed spacers to
estimate the proportion of Pisolithus tinctorius and Eucalyptus RNAs in ectomycorrhiza, Appl. Environ. Microbiol. 63 (1997) 840843.
[30] T.J. White, T. Bruns, S. Lee, J.W. Taylor, Amplication and direct sequencing of
fungal ribosomal RNA genes for phylogenetics, in: M.A. Innis, D.H. Gelfand,
J.J. Sninsky, T.J. White (Eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, 1990, pp. 315322.
[31] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller,
D.J. Lipman, Gapped blast and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 33893402.
[32] J. Emmersen, S. Rudd, H.W. Mewes, I.V. Tetko, Separation of sequences from
hostpathogen interface using triplet nucleotide frequencies, Fungal Genet.
Biol. 44 (2007) 231241.
[33] J.C. Rockett, J.M. Hellmann, Conrming microarray data is it really necessary? Genomics 83 (2004) 541549.
[34] F. Yahyaoui, H. Kuster, B. Ben Amor, N. Hohnjec, A. Puhler, A. Becker, J. Gouzy,
T. Vernie, C. Gough, A. Niebel, L. Godiard, P. Gamas, Expression proling in
Medicago truncatula identies more than 750 genes differentially expressed
during nodulation, including many potential regulators of the symbiotic
program, Plant Physiol. 136 (2004) 31593176.
[35] S. Guimil, H.S. Chang, T. Zhu, A. Sesma, A. Osbourn, C. Roux, V. Ioannidis,
E.J. Oakeley, M. Docquier, P. Descombes, S.P. Briggs, U. Paszkowski, Comparative transcriptomics of rice reveals an ancient pattern of response to microbial
colonization, PNAS 102 (2005) 80668070.
[36] C. Gachon, A. Mingam, B. Charrier, Real-time PCR: what relevance to plant
studies? J. Exp. Bot. 55 (2004) 14451454.
[37] M. Pernas, R. Sanchez-Monge, G. Salcedo, Biotic and abiotic stress can induce
cystatin expression in chestnut, FEBS Lett. 467 (2000) 206210.
[38] M. Pernas, R. Sanchez-Monge, L. Gomez, G. Salcedo, A chestnut seed cystatin
differentially effective against cysteine proteinases from closely related pests,
Plant Mol. Biol. 38 (1998) 12351242.

282

M. Sebastiana et al. / European Journal of Soil Biology 45 (2009) 275282

[39] M. Pernas, E. Lopez-Solanilla, R. Sanchez-Monge, G. Salcedo, P. RodrguezPalenzuela, Antifungal activity of a plant cystatin, Mol. Plant Microbe. Interact.
12 (1999) 624627.
[40] H. Kuster, N. Hohnjec, F. Krajinski, F. El Yahyaoui, K. Manthey, J. Gouzy,
M. Dondrup, F. Meyer, J. Kalinowski, L. Brechenmacher, D. van Tuinen,
V. Gianinazzi-Pearson, A. Puhler, P. Gamas, A. Becker, Construction and validation of cDNA-based Mt6k-RIT macro- and microarrays to explore root
endosymbioses in the model legume Medicago truncatula, J. Biotechnol. 108
(2004) 95113.
[41] N. Hohnjec, M.E. Vieweg, A. Puhler, A. Becker, H. Kuster, Overlaps in the
transcriptional proles of Medicago truncatula roots inoculated with two
different Glomus fungi provide insights into the genetic program activated
during arbuscular mycorrhiza, Plant Physiol. 137 (2005) 12831301.
[42] P.B. Pelegrini, O.L. Franco, Plant-thionins: novel insights on the mechanism of
action of a multi-functional class of defense proteins, Int. J. Biochem. Cell Biol.
37 (2005) 22392253.
[43] F. Garca-Olmedo, A. Molina, A. Segura, M. Moreno, The defensive role of
nonspecic lipid-transfer proteins in plants, Trends Microbiol. 3 (1995) 7274.
[44] A. Molina, F. Garca-Olmedo, Enhanced tolerance to bacterial pathogens
caused by the transgenic expression of barley lipid transfer protein LTP2, Plant
J. 12 (1997) 669675.
[45] J.P. Blein, P. Coutos-Thevenot, D. Marion, M. Ponchet, From elicitins to lipidtransfer proteins: a new insight in cell signalling involved in plant defence
mechanisms, Trends Plant Sci. 7 (2002) 293296.
[46] S. Herrmann, F. Buscot, Cross talks at the morphogenetic, physiological and
gene regulation levels between the mycobiont Piloderma croceum and oak
microcuttings (Quercus robur) during formation of ectomycorrhizas, Phytochemistry 68 (2007) 5267.

[47] S.T. Kim, S.G. Kim, D.H. Hwang, S.Y. Kang, H.J. Kim, B.H. Lee, J.J. Lee,
K.Y. Kang, Proteomic analysis of pathogen-responsive proteins from rice
leaves induced by rice blast fungus, Magnaporthe grisea, Proteomics 4
(2004) 35693578.
[48] B.R. Acharya, S. Raina, S.B. Maqbool, G. Jagadeeswaran, S.L. Mosher, J. Appel,
H.M.C. Schultz, D.F. Klessig, R. Raina, Overexpression of CRK13, an Arabidopsis
cysteine-rich receptor-like kinase, results in enhanced resistance to Pseudomonas syringae, Plant J. 50 (2007) 488499.
[49] M. Parniske, Arbuscular mycorrhiza: the mother of plant root endosymbioses,
Nat. Rev. Microbiol. 6 (2008) 763775.
[50] G. Tuskan, S. DiFazio, S. Jansson, Bohlmann, I. Grogoriev, U. Hellsten,
N. Putnam, S. Ralph, S. Rombauts, A. Salamov, et al., The genome of black
cottonwood, Populus trichocarpa, Science 313 (2006) 15961604.
[51] D. Tagu, C. Bastien, P. Faivre-Rampant, J. Garbaye, P. Vion, M. Villar, F. Martin,
Genetic analysis of phenotypic variation for ectomycorrhiza formation in an
interspecic F1 poplar full-sib family, Mycorrhiza 15 (2005) 8791.
[52] B.J. Haas, N. Volfovsky, C.D. Town, M. Troukhan, N. Alexandrov, K.A. Feldmann,
R.B. Flavell, O. White, S.L. Salzberg, Full length messenger RNA sequences greatly
improve genome annotation, Genome Biol. 3 (6) (2002) research0029.1
0029.12.
[53] R. Schaeitner, E. Wilhelm, Isolation of wound-responsive genes from
chestnut (Castanea sativa) microstems by mRNA display and their differential expression upon wounding and infection with the chestnut blight
fungus (Chryphonectria parasitica), Physiol. Mol. Plant Pathol. 61 (2002)
339348.
[54] H. Kirch, R. Vera-Estrella, D. Golldack, F. Quigley, C.B. Michalowski, B.J. Barkla,
H.J. Bohnert, Expression of water channel proteins in Mesembryanthemum
crystallinum, Plant Physiol. 123 (2000) 111124.