You are on page 1of 517

Mitochondria express enhanced quality as well as

quantity in association with aerobic fitness across


recreationally active individuals up to elite athletes
Robert A. Jacobs and Carsten Lundby

J Appl Physiol 114:344-350, 2013. First published 6 December 2012;


doi:10.1152/japplphysiol.01081.2012
You might find this additional info useful...
This article cites 45 articles, 20 of which can be accessed free at:
/content/114/3/344.full.html#ref-list-1
This article has been cited by 1 other HighWire hosted articles
Improvements in exercise performance with high-intensity interval training coincide with
an increase in skeletal muscle mitochondrial content and function
Robert Acton Jacobs, Daniela Flck, Thomas Christian Bonne, Simon Brgi, Peter Mller
Christensen, Marco Toigo and Carsten Lundby
J Appl Physiol, September 15, 2013; 115 (6): 785-793.
[Abstract] [Full Text] [PDF]

Additional material and information about Journal of Applied Physiology can be found at:
http://www.the-aps.org/publications/jappl

This information is current as of August 4, 2014.

Journal of Applied Physiology publishes original papers that deal with diverse areas of research in applied physiology, especially
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2013 by the American Physiological Society.
ISSN: 0363-6143, ESSN: 1522-1563. Visit our website at http://www.the-aps.org/.

Downloaded from on August 4, 2014

Updated information and services including high resolution figures, can be found at:
/content/114/3/344.full.html

J Appl Physiol 114: 344350, 2013.


First published December 6, 2012; doi:10.1152/japplphysiol.01081.2012.

Mitochondria express enhanced quality as well as quantity in association with


aerobic fitness across recreationally active individuals up to elite athletes
Robert A. Jacobs1,2,3 and Carsten Lundby1,3
1

Zurich Center for Integrative Human Physiology, Zurich, Switzerland; 2Institute of Veterinary Physiology, Vetsuisse Faculty,
University of Zurich, Zurich, Switzerland; and 3Institute of Physiology, University of Zurich, Zurich, Switzerland

Submitted 5 September 2012; accepted in final form 30 November 2012

exercise; skeletal muscle; fat oxidation

fitness ostensibly
represent the state of health in humans (1, 12, 24 26, 31, 34).
Although maximal aerobic capacity is primarily limited by the
oxygen transport system (3, 44), i.e., maximal cardiac output
and oxygen-carrying capacity of the blood, mitochondrial content (7, 18) and skeletal muscle respiratory capacity (9) both
also share a strong positive correlation with maximal aerobic
capacity in humans. Morphometric examination and analysis
of biochemical expression show that mitochondrial density and
content increase in response to training (15, 16, 18) and differ
between untrained and trained individuals (20, 28, 33, 46).
Skeletal muscle oxidative capacity also increases with training
(36) and varies across groups differing in activity level (28, 33,
46). There is debate whether the increase in skeletal muscle
respiration capacity that parallels aerobic fitness can be ex-

MEASURES OF WHOLE BODY CARDIORESPIRATORY

Address for reprint requests and other correspondence: R. A. Jacobs, Institute of


Veterinary Physiology, Vetsuisse Faculty and Zurich Center for Integrative Human Physiology (ZIHP), Winterthurerstrasse 190, CH-8057 Zurich, Switzerland
(e-mail: jacobs@vetphys.uzh.ch).
344

plained by quantitative differences in mitochondrial content


alone (41, 45), or whether qualitative adaptations, such as
functional modifications in respiratory control and capacity,
also improve along with whole body aerobic capacity (13).
We previously determined that mitochondrial respiratory
capacity, particularly oxidative phosphorylation capacity (P)
and electron transport system capacity (ETS), are strongly
predictive of overall exercise capacity in highly trained athletes
(22). Over many other physiological variables, including total
hemoglobin mass and cerebral oxygenation, P, exclusively,
was identified as the strongest determinant of endurance performance (22). Mitochondrial content does not always differ
between individuals who display significantly different exercise capacities (38, 40), and yet skeletal muscle P is the
strongest predictor of endurance performance (22). Moreover,
prolonged exposure to hypoxia can diminish respiratory capacity and enhance mitochondrial coupling efficiency, independent from any change in mitochondrial content (23). Together,
these data suggest that qualitative differences in mitochondria
may exist independent from mitochondrial content.
Previous reported differences in skeletal muscle mitochondria respiratory capacity across groups that differed in level of
cardiorespiratory fitness did not control for the significant
variation in mitochondrial content between the groups (33, 46).
No study has compared functional differences in mitochondria
between normal, healthy individuals vs. elite athletes. The aim
of this study is to analyze mitochondrial differences, both
quantitative and qualitative, across four different groups of
healthy and physically active subjects who differ in aerobic
capacity. As P is the strongest determining factor in endurance
performance (22) among a more homogenous group of athletes
with negligible differences in mitochondrial content (38), we
hypothesize that differences in mitochondria from AT to ET
individuals will possess distinct qualitative differences.
METHODS

Ethical Approval
All experimental protocols involving human subjects were approved by the Eidgenssische Technische Hochschule Zrich for
Kanton Zurich (2010 066/0 and EK 2011-N-51) and Kanton Vaud
(215/10), Switzerland, in accordance with the declaration of Helsinki.
Before the start of the experiments, informed oral and written consents
were obtained from all participants.
Subjects and Experimental Design
Subject characteristics are shown in Table 1. Twenty-four young
and physically active subjects (23 men and 1 woman) voluntarily participated in this study. No subjects were taking any
prescription medications nor had any known family history of type 2
diabetes, severe obesity, or cardiovascular diseases. Previous studies

8750-7587/13 Copyright 2013 the American Physiological Society

http://www.jappl.org

Downloaded from on August 4, 2014

Jacobs RA, Lundby C. Mitochondria express enhanced quality as well


as quantity in association with aerobic fitness across recreationally active
individuals up to elite athletes. J Appl Physiol 114: 344350, 2013. First
published December 6, 2012; doi:10.1152/japplphysiol.01081.2012.
Changes in skeletal muscle respiratory capacity parallel that of aerobic fitness. It is unknown whether mitochondrial content, alone, can
fully account for these differences in skeletal muscle respiratory
capacity. The aim of the present study was to examine quantitative
and qualitative mitochondrial characteristics across four different
groups (n 6 each), separated by cardiorespiratory fitness. Highresolution respirometry was performed on muscle samples to compare
respiratory capacity and efficiency in active, well-trained, highly
trained, and elite individuals. Maximal exercise capacity (ml
O2min1kg1) differed across all groups, with mean SD values of
51 4, 64 5, 71 2, and 77 3, respectively. Mitochondrial
content assessed by citrate synthase activity was higher in elite trained
compared with active and well-trained (29 7 vs. 16 4 and 19
4 nmolmin1mg wet wt1, respectively). When normalizing respiration to mitochondrial content, the respiratory capacities during
maximal fatty acid oxidation (P 0.003), maximal state 3 respiration
(P 0.021), and total electron transport system capacity (P 0.008)
improved with respect to maximal exercise capacity. The coupling
efficiency of -oxidation, however, expressed no difference across
groups. These data demonstrate the quantitative and qualitative differences that exist in skeletal muscle mitochondrial respiratory capacity and efficiency across individuals that differ in aerobic capacity.
Mitochondrial-specific respiration capacities during -oxidation,
maximal oxidative phosphorylation, and electron transport system
capacity all correspondingly improve with aerobic capacity, independent of mitochondrial content in human skeletal muscle.

Mitochondrial Quality Improves along with Aerobic Capacity

345

Jacobs RA et al.

Table 1. Subject characteristics


Group

Age, yr

Height, cm

Weight, kg

Absolute
O2max, l/min
V

Absolute
Wmax, W

Relative Wmax, W/kg

Years of Exercise

Time Training/Year, h

Time Training/
Week, h

AT
WT
HT
ET

26 4
32 8
28 2
28 6

181 5
180 7
175 7
179 8

77 5
73 10
68 10
68 6

3.96 0.39
4.68 0.60
4.82 0.67e
5.24 0.52a

326 27
378 59
389 45
417 41a

4.2 0.4
5.2 0.5a
5.8 0.3a,f
6.2 0.3a,b

8.8 5.6
13.9 5.3
9 4.8
16 6.2

190 88b,c,d
493 141a,d
636 43a,d
847 126a,b,c

3.7 1.7b,c,d
9.5 2.7a,d,g
12.3 0.8a,d,f
16.4 2.6a,b,c

Physiological characteristics for all subjects (n 24) are means SD. AT, active subjects (n 6); WT, well-trained subjects (n 6); HT, highly trained
O2max, maximal oxygen consumption; Wmax, maximal power output. Difference ( P 0.05) from aAT, bWT, cHT,
subjects (n 6); ET, elite athletes (n 6); V
and dET. Tendency of difference (0.05 P 0.1) from eAT, fWT, gHT, and hET.

Exercise Tests
O2 max were completed on an
Exercise tests to obtain values of V
electronically braked cycle ergometer (Monark, Varberg, Sweden).
The exercise protocol started with a 5-min collection of resting
O2), followed by two consecutive absolute
oxygen consumption (V
submaximal workloads, 100 W and 150 W, which were maintained
for 5 min each. Thereafter, the workload increased 25 W/min until
voluntary exhaustion. During the last minutes of the test, subjects
were vigorously encouraged to perform to complete exhaustion, and
O2 max was established by standard criteria in all
the achievement of V
tests (2). Subjects wore a face mask covering their mouth and nose for
breath collection (Hans Rudolph, Kansas City, MO), and O2 and CO2
concentration in the expired gas was continuously measured and
monitored as breath-by-breath values (Quark, Cosmed, Rome, Italy
and Innocor, Innovision, Odense, Denmark). The gas analyzers and
flowmeters of each applied spirometer were calibrated before each
test.
Skeletal Muscle Sampling
Skeletal muscle biopsies were obtained from the m. vastus lateralis
under local anesthesia (1% lidocaine) of the skin and superficial
muscle fascia, using the Bergstrm technique (6), with a needle
modified for suction at rest in the morning, and in a fasted state at least
24 h after the last bout of exercise. The biopsy was immediately
dissected free of fat and connective tissue and divided into sections for
measurements of mitochondrial respiration.
Skeletal Muscle Preparation
The skeletal muscle samples were sectioned into parts to measure
mitochondrial respiration. Each part was immediately placed in icecold biopsy preservation solution (BIOPS) containing 2.77 mM
CaK2EGTA buffer, 7.23 mM K2EGTA buffer, 0.1 M free calcium,
20 mM imidazole, 20 mM taurine, 50 mM 2-(N-morpholino)ethanesulfonic acid hydrate, 0.5 mM dithiothreitol, 6.56 mM MgCl26H2O,
5.77 mM ATP, and 15 mM phosphocreatine (pH 7.1). Muscle samples

were then gently dissected with the tip of two 18-gauge needles,
achieving a high degree of fiber separation verified microscopically.
Chemical permeabilization followed via incubation in 2 ml of BIOPS
with saponin (50 g/ml) for 30 min in 4C (27). Lastly, samples were
washed with a mitochondrial respiration medium (MiR05) containing
0.5 mM EGTA, 3 mM MgCl26H2O, 60 mM potassium-lactobionate,
20 mM taurine, 10 mM KH2P04, 20 mM HEPES, 110 mM sucrose,
and 1 g/l bovine serum albumin (pH 7.1) for 10 min in 4C.
Mitochondrial Respiration Measurements
Muscle bundles were blotted dry and measured for wet weight in a
balance-controlled scale (XS205 DualRange Analytical Balance, Mettler-Toledo), maintaining constant relative humidity and providing
hydration consistency as well as stability of weight measurements.
Respiration measurements were performed in mitochondrial respira O2
tion medium 06 (MiR05 catalase 280 IU/ml). Measurements of V
were performed at 37C using the high-resolution Oxygraph-2k (Oroboros, Innsbruck, Austria) with all additions of each substrate, uncoupler, and inhibitor titration (SUIT) protocol added in series. Standardized instrumental were performed to correct for back-diffusion of
oxygen into the chamber from the various components, leak from the
O2 by the chemical medium, and sensor V
O2. Oxygen flux
exterior, V
was resolved by software allowing nonlinear changes in the negative
time derivative of the oxygen concentration signal (Oxygraph 2k,
Oroboros, Innsbruck, Austria). All experiments were carried out in a
hyperoxygenated environment to prevent any potential oxygen diffusion limitation.
Respiratory Titration Protocol
The SUIT protocol applied in the study has been previously described (22). The protocol was specific to the examination of individual aspects of respiratory control through a sequence of coupling and
substrate states induced via separate titrations. All respirometric
analyses were made in duplicates, and all titrations were added in
series as presented. The concentrations of substrates, uncouplers, and
inhibitors used were based on prior experiments conducted for optimization of the titration protocols. Leak respiration in absence of
adenylates (LN) was induced with the addition of malate (2 mM) and
O2
octanoyl carnitine (0.2 mM). The LN state represents the resting V
of an unaltered and intact electron transport system free of adenylates.
Maximal electron flow through electron transferring-flavoprotein
(ETF) and fatty acid oxidative capacity (PETF) were both determined
following the addition of ADP (5 mM). In the PETF state, the ETF
linked transfer of electrons requires the metabolism of acetyl-CoA,
hence the addition of malate, to facilitate convergent electron flow
into the Q-junction from both complex I (C1) and ETF, allowing
-oxidation to proceed. The contribution of electron flow through C1
is far below capacity, and so here the rate-limiting metabolic branch
is electron transport through ETF, such that malate octanoyl
carnitine ADP-stimulated respiration is representative of, rather
than specific to, electron capacity through ETF (11, 13, 35, 36, 39).
State 3 respiratory capacity specific to C1, NADH dehydrogenase
(PC1), was induced following the additions of pyruvate (5 mM) and

J Appl Physiol doi:10.1152/japplphysiol.01081.2012 www.jappl.org

Downloaded from on August 4, 2014

show no main effect of sex on skeletal muscle oxidative capacity and,


consequently, grouped all data according to training status (28, 33,
46), as we have done in the present study. We divided the 24 subjects
into four different tiers, dependent on their aerobic capacity: active
(AT), well-trained (WT), highly trained (HT), and elite (ET). The AT
group performed physical activity or sport (climbing, mountain biking, tennis, karate, road cycling, hockey, skating, running, swimming,
or tour skiing) sporadically for an average of 1.58 days/wk, with no
regular routine; the WT group participated in some variation of a
regular exercise or sport program (climbing, running, Thai boxing, or
road cycling) for an average of 2.46 days out of the week; and HT and
ET athletes engaged in endurance exercise (triathlon training or
road/mountain/cyclo-cross cycling and road or mountain cycling for
HT and ET, respectively) on average for 2.49 and 2.81 days/wk,
respectively. All individuals were separated into their respective
groups based on aerobic capacities, which were obtained via tests of
O2 max).
maximal oxygen consumption (V

346

Mitochondrial Quality Improves along with Aerobic Capacity

glutamate (10 mM). P was then induced with the addition of succinate
(10 mM). P demonstrates a naturally intact electron transport systems
capacity to catalyze a sequential set of redox reactions that are
partially coupled to the production of ATP via ATP synthase. P
maintains an electrochemical gradient across the inner mitochondrial
membrane dictated by the degree of coupling to the phosphorylation
system (13, 35). As an internal control for compromised integrity of
the mitochondrial preparation, the mitochondrial outer membrane was
assessed with the addition of cytochrome c (10 M). There was no
indication of mitochondrial damage indicated by the average change
in respiration of 1.1% across all subjects (P 0.361) following
addition of cytochrome c. Phosphorylative restraint of electron transport was assessed by uncoupling ATP synthase (complex V) from the
electron transport system with the titration of the proton ionophore,
carbonyl cyanide p-(trifluoromethoxy) phenylhydrazone (0.5 M per
addition up to optimum concentrations ranging from 1.5 to 3 M),
reaching ETS. Finally, rotenone (0.5 M) and antimycin A (2.5 M)
were added, in sequence, to terminate respiration by inhibiting C1 and
complex III (cytochrome bc1 complex), respectively. With C1 inhibited, electron flow specific to complex II (C2), succinate dehydrogenase, and state 3 respiration through C2 (PC2) can be measured.
Inhibition of respiration with antimycin A then allows for the deter O2, indicative of nonmitochonmination and correction of residual V
O2 in the chamber.
drial V

Citrate synthase (CS) activities were assayed in homogenates of the


skeletal muscle samples used in respiration measurements. The contents of the Oxygraph-2k chambers (2 ml each) were removed after
each respiration experiment and washed once with 2 ml of MiR05.
One percent Triton X-100 and 2 l of a protease inhibitor cocktail
(Sigma Aldrich cat. no. 539134) were added to the combined solutions (content and wash) and then homogenized for 30 s with a T10
basic ULTRA-TURRAX homogenizer near maximum speed. The
homogenate was then centrifuged for 15 min at 4C, and the supernatant was removed, frozen in liquid nitrogen, and stored at 80C.
As has been previously described (42), CS activity was measured
fluorometrically at 412 nm and 25C (Citrate Synthase Assay Kit,
Sigma-Aldrich), according to the manufacturer.
Data Analysis
Significance was set at P 0.05, but P values of 0.10 are
also noted. Data are presented as means SD. Mitochondria-specific
respiration was calculated by dividing mass-specific respiration
(pmol O2min1mg wet wt1) by the corresponding CS activity
(nmolmin1mg wt1). Comparisons of age, weight, height, absolute
O2 max, absolute and relative maximal power (Wmax),
and relative V
years of exercise, respiratory capacities, CS, and indexes of mitochondrial coupling control were compared using a one-way ANOVA
(SPSS Statistics 17.0, SPSS, Chicago, IL). Significant main effects or
interactions were further analyzed by Tukeys post hoc test. The time
of training per year and per week did not, however, display a Gaussian
distribution, and, therefore, a Kruskal-Wallis ANOVA and MannWhitney U-tests were used to reveal differences between groups. An
analysis of covariance was also run on mass-specific respirometric
values with CS activities included as the covariant being controlled
for. Multiple linear regression analysis with backward elimination was
used to identify the strongest association between measurements of
mass-specific and mitochondrial-specific respiration to cardiorespiratory fitness.
RESULTS

VO2 max
O2 max values
O2 max (Fig. 1). Group V
All groups differed in V
presented as means SD, maximum and minimum, respec-

Jacobs RA et al.

Fig. 1. Aerobic capacities across groups. Individual values of maximal oxygen


O2 max) across groups are shown. AT, active; WT, well trained;
consumption (V
HT, highly trained; ET, elite. *Significance of P 0.05.

tively, in mlmin1kg1, were as follows: AT (51.2 4.1,


46.9 and 55.5); WT (63.9 4.7, 58.9 and 68.8); HT (71.3
1.7, 69.5 and 73.1); and ET (77.3 3.0, 74.1 and 80.4). The
AT group was lower (P 0.001) than all other groups. The
WT group was higher than AT (P 0.001), but lower than HT
(P 0.009) and ET (P 0.001). The HT group was higher
than both AT (P 0.001) and WT (P 0.009) groups, but
lower than the ET group (P 0.04).
Subject Characteristics
All subject characteristics are presented in Table 1. There
were no differences in age, height, weight, or years of exercise
across groups. The absolute Wmax only differed between the
ET and AT groups (P 0.01); however, the relative Wmax for
the AT group was lower than WT, HT, and ET (P 0.004,
P 0.001, and P 0.001, respectively). The ET also had a
greater relative Wmax than the WT group (P 0.002), and the
HT group showed a tendency for a higher relative Wmax than
the WT group (P 0.071). The time-spent training per week
and year demonstrated a progressive increase across groups, as
the AT group exhibited the least time-spent participating in
some form of physical activity, and the ET group had the most
time-spent.
CS Activity
CS values (nmolmin1mg wet wt1) across groups (mean
SD) were as follows: AT (16.2 4.9), WT (18.6 4.0), HT
(25.1 7.1), and ET (28.7 7.0). The only differences detected
in CS activity between groups were observed in ET compared
with AT (P 0.008) and WT groups (P 0.035). There was a
tendency for difference between AT and HT (P 0.072). CS
activity is an empirically established and reliable biomarker of
mitochondrial content (30). CS activities are presented in Fig. 2.
Respiratory Capacity
Mass-specific respiration. There were no differences in massspecific respiration (Fig. 3A) between AT and WT, WT and
HT, or between HT and ET groups at any respiratory states,
although PETF had a tendency to increase from AT to WT (P
0.056). The AT group had lower fat respiration, PETF (P
0.012 and P 0.001), P (P 0.015 and P 0.001), ETS
(P 0.003 and P 0.001), and submaximal PC2 (P 0.005
and P 0.002) than the HT and ET groups, respectively. The
AT group also expressed lower LN (P 0.019) and submaxi-

J Appl Physiol doi:10.1152/japplphysiol.01081.2012 www.jappl.org

Downloaded from on August 4, 2014

Citrate Synthase Activities

Mitochondrial Quality Improves along with Aerobic Capacity

Fig. 2. Citrate synthase (CS) activities. Individual values of CS activities are


presented across group as a biomarker of mitochondrial content. *Significance
from ET of P 0.05.

Jacobs RA et al.

347

PC2 (P 0.069, 0.079, and 0.052, respectively). The AT group


expressed lower respiration compared with the ET group at
PETF (P 0.004), P (P 0.005), and ETS (P 0.003) and
had a tendency for lower PC2 (P 0.067). The WT group
expressed lower ETS than the ET group (P 0.033) and also
had a tendency for lower P (P 0.067). There were no differences across groups during LN or PCI.
Mitochondria-specific respiration. Mass-specific respiration
does not take into account differences in mitochondrial content
between samples. Accordingly, respirometric analyses were
adjusted for CS activity, a biomarker shown to express strong
concordance with mitochondrial content and total cristae area,
as measured by transmission electron microscopy as well as
myocellular respiratory capacity (30). Figure 3B illustrates
mitochondrial-specific respiration across all groups. There
were no differences in mitochondrial-specific respiration between AT, WT, and HT groups across all respiratory states,
although there was a tendency for lower respiration in the AT
vs. the HT during PETF (P 0.056). When normalizing
respiration to mitochondrial content, P was greater in ET vs.
only AT (P 0.031), while PETF (P 0.003 and 0.048) and
ETS (P 0.015 and 0.029) were greater in ET compared with
both AT and WT, respectively. There was a tendency for P to
be lower in the WT vs. ET group (P 0.066). There were no
differences across all groups during LN, PC1, or PC2.
Mitochondrial Coupling Efficiency and Respiratory Control
We calculated the leak control ratio (LCR) as indication of
electron coupling efficiency during -oxidation (LCRETF), as
has been fully explained previously (23). The LCRETF did not
express any difference across groups (Fig. 4A). The phosphorylation system control ratio (PSCR), ratio of P to ETS expressing the degree of maximal P constraint by the phosphorylation

Fig. 3. Mitochondrial respiration control across groups. A: mass-specific respiratory capacity. B: mitochondria-specific respiratory capacity across groups. LN, leak
respiration in absence of adenylates; PETF, maximal electron flow through electron-transferring flavoprotein (ETF) and fatty acid oxidative capacity; PC1, submaximal state 3 respiratory capacity specific to complex I; P, maximal state 3
respiration and oxidative phosphorylation capacity; ETS, electron transport system
capacity; PC2, submaximal state 3 respiratory capacity specific to complex II.
Values are means SD. Significant difference of *P 0.05, **P 0.01, and
***P 0.001.

Fig. 4. Mitochondrial coupling efficiency and respiratory control. A: leak control


ratio (LCR), electron coupling control during -oxidation (LCRETF) across groups.
B: phosphorylation system control ratio (PSCR) across groups.

J Appl Physiol doi:10.1152/japplphysiol.01081.2012 www.jappl.org

Downloaded from on August 4, 2014

mal PC1 (P 0.033) vs. the ET group. The WT group expressed lower respiration compared with the ET group during
P (P 0.009) and ETS (P 0.001) and had a tendency to have
lower PETF (P 0.052).
Mass-specific respiration when controlling for mitochondrial content. Significant differences in mass-specific respiration were altered when controlling for CS activity as a covariate (data not shown). The lower respiratory capacities of the
AT group vs. the HT group were only apparent during ETS and
PC2 (P 0.049), but showed a tendency for lower PETF, P, and

348

Mitochondrial Quality Improves along with Aerobic Capacity

system or ATP synthase (13), was also determined. While


skeletal muscle PSCR differs significantly between mice and
humans (21), it did not differ between groups that varied in
aerobic capacity (Fig. 4B).
Correlation Between Maximal Exercise Respiratory Capacities
All mitochondrial parameters examined in this study ex O2 max, except for the
pressed a significant correlation to V
PSCR (R 0.077, P 0.361). The second weakest correlation
(behind LN respiration) was between values of mitochondrial
content and exercise capacity (R 0.635, P 0.001). The
LCRETF was the only value showing a significant negative
correlation (R 0.462, P 0.012). Finally, multiple linear
regression analysis using backward elimination for mass-specific (Fig. 5A) and mitochondria-specific respiration (Fig. 5B),
respectively, calculated ETS as the best predictive mitochon O2 max.
drial parameter of V
DISCUSSION

O2 max across groups. A: massFig. 5. Correlation of ETS capacity and V


specific respiration. B: mitochondrial-specific respiration.

Jacobs RA et al.

(PETF), P, and electron transport across the entire respiratory


system (ETS) all improve, in combination with aerobic capacity. Second, efficiency of coupling control during -oxidation
and phophorylative restraint of ATP synthase on electron
transport do not appear to differ across individuals with mark O2 max. Finally, ETS correlates
edly disparate measures of V
best, among all other respiratory states, to cardiorespiratory fitness in humans.
There is a strong correlation between mitochondrial content
and maximal aerobic capacity in both humans and animals (17,
18, 20, 32). The subjects included in this study displayed this
O2 max (P 0.001), although
correlation between CS and V
differences in mitochondrial content were not apparent between all groups (Fig. 2). It has been suggested that oxidative
capacity of skeletal muscle is dependent purely on the quantity
of mitochondria in the muscle (19, 41). Here we present strong
evidence to suggest that there are qualitative improvements in
mitochondria that correspond with whole body aerobic capacity, independent of mitochondrial content. The seemingly inconsistent results between those presented here and past studies
(41) may be due to the fact that the former study used
substrates for respiration specific to either mitochondrial C1 or
C2 individually, but never collectively (41). Our data support
these previous findings, as we also failed to identify any
respiratory differences between any groups at PC1 or PC2
respiratory states when normalizing respiration to mitochondrial content (Fig. 3B). We stimulated P with saturating concentrations of ADP and substrate supply for both C1 and C2.
This convergent electron input of both complexes provides
higher respiratory values compared with the isolated respiration of either C1 (pyruvate/glutamate malate or glutamate
malate) or C2 (succinate rotenone) (13, 37). Accordingly, P
presents with more physiological relevance to the study of
mitochondrial function, as substrate provision for both complexes is necessary to confirm a complete and intact electron
transport system and measure maximal respiratory capacity in
skeletal muscle (8).
Although the capacity for fat respiration differed between
AT and ET groups and also showed a tendency for improvement in HT over AT (P 0.056), mitochondrial coupling
efficiency during fatty acid oxidation was the same across all
groups (Figs. 3B and 4A). Fat oxidation during exercise has
been reported as greater in trained vs. untrained individuals at
the same relative workload (43). Moreover, a greater percentage of energy expenditure during exercise comes from fat
oxidation in trained vs. untrained subjects at the same absolute
workload (43). There is also a greater intramuscular triglyceride content in trained vs. untrained humans (20), which also
increases and becomes localized next to the mitochondria in
response to exercise training (18) and is increased in active vs.
nonactive individuals (14). One training study has reported
improvements in mass-specific mitochondrial respiratory capacity, along with improvements in mitochondrial fat metabolism when sedentary individuals trained for 10 wk, while
mitochondrial content, as assessed by mitochondrial DNA, did
not increase (36). Unfortunately, mitochondrial DNA does not
strongly correlate with measures of mitochondrial content and
total cristae area, as assessed by transmission electron microscopy or myocellular respiratory capacity (30), and thus does
not adequately serve as biomarker of mitochondrial content.
Therefore, satisfactory mitochondrial-specific analysis of PETF

J Appl Physiol doi:10.1152/japplphysiol.01081.2012 www.jappl.org

Downloaded from on August 4, 2014

In this study we divided one large group of healthy subjects


(n 24) into four different groups (n 6), dependent on their
aerobic capacity and studied mitochondrial function via respirometric analysis. This study presents several novel findings.
First, qualitative, independent from quantitative, differences in
mitochondrial characteristics are apparent across groups of
O2 max. Fat respiration
healthy humans in accordance with V

Mitochondrial Quality Improves along with Aerobic Capacity

Jacobs RA et al.

349

chondria across levels of cardiorespiratory fitness were not


fully understood and questioned to even exist. As such, we
divided 24 healthy and aerobically fit individuals into four
groups that differed in whole body aerobic exercise capacity.
Across these healthy individuals, both quantitative and qualitative mitochondrial variations were evident. Those with elite
aerobic capacities displayed superior respiratory capacity over
those who were active or well-trained. Specifically, these
qualitative differences observed across groups were specific to
greater capacities for fat oxidation, oxidative phosphorylation,
and electron transport across the entire respiratory system.
These results make it apparent that mitochondrial modifications with improving cardiorespiratory fitness comprise more
than just an increase in mitochondrial content. It is important
and necessary to differentiate mitochondrial content from function in future studies.
ACKNOWLEDGMENTS
The authors sincerely thank Drs. Dominik Pesta, Anne-Kristine Meinild,
Christoph Siebenmann, and Paul Robach for technical assistance with respirometric analysis, CS measurements, and maximal exercise tests, respectively.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
AUTHOR CONTRIBUTIONS
Author contributions: R.A.J. and C.L. conception and design of research;
R.A.J. performed experiments; R.A.J. analyzed data; R.A.J. and C.L. interpreted results of experiments; R.A.J. prepared figures; R.A.J. drafted manuscript; R.A.J. and C.L. edited and revised manuscript; R.A.J. and C.L. approved final version of manuscript.
REFERENCES
1. Aadland E, Robertson L. Physical activity is associated with weight loss
and increased cardiorespiratory fitness in severely obese men and women
undergoing lifestyle treatment. J Obes 2012: 810594, 2012.
2. American Thoracic Society; American College of Chest Physicians.
ATS/ACCP statement on cardiopulmonary exercise testing. Am J Respir
Crit Care Med 167: 211277, 2003.
3. Andersen P, Saltin B. Maximal perfusion of skeletal muscle in man. J
Physiol 366: 233249, 1985.
4. Befroy DE, Petersen KF, Dufour S, Mason GF, de Graaf RA, Rothman DL, Shulman GI. Impaired mitochondrial substrate oxidation in
muscle of insulin-resistant offspring of type 2 diabetic patients. Diabetes
56: 1376 1381, 2007.
5. Befroy DE, Petersen KF, Dufour S, Mason GF, Rothman DL, Shulman GI. Increased substrate oxidation and mitochondrial uncoupling in
skeletal muscle of endurance-trained individuals. Proc Natl Acad Sci U S A
105: 1670116706, 2008.
6. Bergstrm J. Muscle electrolytes in man. Scand J Clin Lab Invest 68:
1110, 1962.
7. Booth FW, Narahara KA. Vastus lateralis cytochrome oxidase activity
and its relationship to maximal oxygen consumption in man. Pflgers Arch
349: 319 324, 1974.
8. Brand MD, Nicholls DG. Assessing mitochondrial dysfunction in cells.
Biochem J 435: 297312, 2011.
9. Daussin FN, Zoll J, Dufour SP, Ponsot E, Lonsdorfer-Wolf E, Doutreleau S, Mettauer B, Piquard F, Geny B, Richard R. Effect of interval
vs. continuous training on cardiorespiratory and mitochondrial functions:
relationship to aerobic performance improvements in sedentary subjects.
Am J Physiol Regul Integr Comp Physiol 295: R264 R272, 2008.
10. Daussin FN, Zoll J, Ponsot E, Dufour SP, Doutreleau S, Lonsdorfer E,
Ventura-Clapier R, Mettauer B, Piquard F, Geny B, Richard R.
Training at high exercise intensity promotes qualitative adaptations of
mitochondrial function in human skeletal muscle. J Appl Physiol 104:
1436 1441, 2008.
11. Eaton S, Bartlett K, Pourfarzam M. Mammalian mitochondrial betaoxidation. Biochem J 320: 345357, 1996.

J Appl Physiol doi:10.1152/japplphysiol.01081.2012 www.jappl.org

Downloaded from on August 4, 2014

could not be analyzed (36). We extend on previous findings


and show that the capacity for fat oxidation improves with
cardiorespiratory fitness; however, efficiency appears unaltered.
Another qualitative difference in mitochondria observed across groups differing in aerobic fitness was ETS (Fig. 3B).
Oxidative capacity of skeletal muscle is known to improve
with overall fitness (28), although specific modifications in
mitochondrial function in relation to fitness are much less
understood. Differences in mass-specific respiration capacity
in young and older subjects matched for aerobic capacity are
negligible until respiration is normalized to mitochondrial
content, where a reduction in respiratory capacity becomes
apparent (29). Endurance-trained individuals present with a
greater substrate flux through the tricarboxylic acid cycle over
sedentary individuals, independent from any difference in ATP
synthesis (5). The greater flux through the tricarboxylic acid
cycle without an increase in ATP led authors to speculate that
resting mitochondrial respiration in endurance-trained individuals is uncoupled from ATP synthesis to a greater degree than
their sedentary counterparts (5). Here we show that ET athletes
have a greater capacity for electron transport across the entire
respiratory chain vs. AT and WT subjects, even though they
present with similar phosphorylative restraint of electron transport (Fig. 5B). In the ETS state, the inner mitochondrial
membrane potential is completely collapsed with an open
transmembrane proton circuit. The uninhibited flow of electrons through the respiratory system can, therefore, indirectly
serve as an indication of maximal attainable mitochondrial
membrane potential. A larger capacity for electron transport
with similar phosphorylative restraint allows for a superior
uncoupling capacity, which appears to correspond with aerobic
capacity. Across all states of respiration measured, ETS fit best
with cardiorespiratory fitness (Fig. 5A). This correlation remained even when controlling for differences in mitochondrial
content across all groups (Fig. 5B), further demonstrating the
qualitative differences in mitochondrial function that are associated with whole body aerobic fitness in humans.
This study specifically highlights significant qualitative
changes in mitochondria by means of respiratory capacity.
Less is known in regards to how mitochondrial efficiency
fluctuates with aerobic capacity. While an improvement in the
coupling efficiency of electron transport during -oxidation
was not apparent across groups, the coupling control across the
entire respiratory chain could not be determined with this SUIT
protocol. Previous studies utilizing mitochondrial isolation
techniques report no change in coupling control (4), while
others report an improvement in mitochondrial efficiency between trained vs. sedentary individuals (10, 46). The malleability of mitochondria in response to training merits further attention.
One possible limitation in the present study is the supraphysiological concentrations of oxygen that are required during
respirometric analysis to overcome diffusive limitations of the
samples (35), and the potential alterations in mitochondrial
function that may accompany this hyperoxygenated environment. This, however, is not believed to have influenced our
results or conclusions, as all samples were treated similarly and
exposed to the same oxygen concentrations.
In summary, both mitochondrial quantity and quality improve with aerobic capacity. Qualitative differences in mito-

350

Mitochondrial Quality Improves along with Aerobic Capacity

Jacobs RA et al.

30. Larsen S, Nielsen J, Neigaard Nielsen C, Nielsen LB, Wibrand F,


Stride N, Schroder HD, Boushel R, Helge JW, Dela F, Hey-Mogensen
M. Biomarkers of mitochondrial content in skeletal muscle of healthy
young human subjects. J Physiol 590: 3349 3360, 2012.
31. Lyerly GW, Sui X, Lavie CJ, Church TS, Hand GA, Blair SN. The
association between cardiorespiratory fitness and risk of all-cause mortality among women with impaired fasting glucose or undiagnosed diabetes
mellitus. Mayo Clin Proc 84: 780 786, 2009.
32. Mathieu O, Krauer R, Hoppeler H, Gehr P, Lindstedt SL, Alexander
RM, Taylor CR, Weibel ER. Design of the mammalian respiratory
system. VII. Scaling mitochondrial volume in skeletal muscle to body
mass. Respir Physiol 44: 113128, 1981.
33. Mettauer B, Zoll J, Sanchez H, Lampert E, Ribera F, Veksler V,
Bigard X, Mateo P, Epailly E, Lonsdorfer J, Ventura-Clapier R.
Oxidative capacity of skeletal muscle in heart failure patients versus
sedentary or active control subjects. J Am Coll Cardiol 38: 947954, 2001.
34. Ortega FB, Lee DC, Sui X, Kubzansky LD, Ruiz JR, Baruth M,
Castillo MJ, Blair SN. Psychological well-being, cardiorespiratory fitness, and long-term survival. Am J Prev Med 39: 440 448, 2010.
35. Pesta D, Gnaiger E. High-resolution respirometry. OXPHOS protocols
for human cell cultures and permeabilized fibers from small biopsies of
human muscle. Methods Mol Biol 810: 2558, 2012.
36. Pesta D, Hoppel F, Macek C, Messner H, Faulhaber M, Kobel C,
Parson W, Burtscher M, Schocke M, Gnaiger E. Similar qualitative and
quantitative changes of mitochondrial respiration following strength and
endurance training in normoxia and hypoxia in sedentary humans. Am J
Physiol Regul Integr Comp Physiol 301: R1078 R1087, 2011.
37. Rasmussen UF, Rasmussen HN. Human skeletal muscle mitochondrial
capacity. Acta Physiol Scand 168: 473480, 2000.
38. Robach P, Siebenmann C, Jacobs RA, Rasmussen P, Nordsborg NB,
Pesta D, Gnaiger E, Diaz V, Christ A, Fiedler J, Crivelli N, Secher
NH, Pichon A, Maggiorini M, Lundby C. The role of hemoglobin mass
O2 max following normobaric live high-train low in enduranceon V
trained athletes. Br J Sports Med 46: 822827, 2012.
39. Saks VA, Veksler VI, Kuznetsov AV, Kay L, Sikk P, Tiivel T, Tranqui
L, Olivares J, Winkler K, Wiedemann F, Kunz WS. Permeabilized cell
and skinned fiber techniques in studies of mitochondrial function in vivo.
Mol Cell Biochem 184: 81100, 1998.
40. Saltin B, Kim CK, Terrados N, Larsen H, Svedenhag J, Rolf CJ.
Morphology, enzyme activities and buffer capacity in leg muscles of
Kenyan and Scandinavian runners. Scand J Med Sci Sports 5: 222230,
1995.
41. Schwerzmann K, Hoppeler H, Kayar SR, Weibel ER. Oxidative capacity of muscle and mitochondria: correlation of physiological, biochemical, and morphometric characteristics. Proc Natl Acad Sci U S A 86:
15831587, 1989.
42. Srere PA. Citrate synthase. Methods Enzymol 13: 311, 1969.
43. van Loon LJ, Jeukendrup AE, Saris WH, Wagenmakers AJ. Effect of
training status on fuel selection during submaximal exercise with glucose
ingestion. J Appl Physiol 87: 14131420, 1999.
O2 max. Exerc Sport Sci Rev 28:
44. Wagner PD. New ideas on limitations to V
10 14, 2000.
45. Weibel ER, Hoppeler H. Exercise-induced maximal metabolic rate scales
with muscle aerobic capacity. J Exp Biol 208: 16351644, 2005.
46. Zoll J, Sanchez H, NGuessan B, Ribera F, Lampert E, Bigard X,
Serrurier B, Fortin D, Geny B, Veksler V, Ventura-Clapier R, Mettauer B. Physical activity changes the regulation of mitochondrial respiration in human skeletal muscle. J Physiol 543: 191200, 2002.

J Appl Physiol doi:10.1152/japplphysiol.01081.2012 www.jappl.org

Downloaded from on August 4, 2014

12. Gander J, Lee DC, Sui X, Hebert JR, Hooker SP, Blair SN. Self-rated
health status and cardiorespiratory fitness as predictors of mortality in
men. Br J Sports Med 45: 10951100, 2011.
13. Gnaiger E. Capacity of oxidative phosphorylation in human skeletal
muscle: new perspectives of mitochondrial physiology. Int J Biochem Cell
Biol 41: 18371845, 2009.
14. Goodpaster BH, He J, Watkins S, Kelley DE. Skeletal muscle lipid
content and insulin resistance: evidence for a paradox in endurance-trained
athletes. J Clin Endocrinol Metab 86: 57555761, 2001.
15. Holloszy JO. Biochemical adaptations in muscle. Effects of exercise on
mitochondrial oxygen uptake and respiratory enzyme activity in skeletal
muscle. J Biol Chem 242: 2278 2282, 1967.
16. Holloszy JO, Booth FW. Biochemical adaptations to endurance exercise
in muscle. Annu Rev Physiol 38: 273291, 1976.
O2 max to muscle mitochondria
17. Hoppeler H. The different relationship of V
in humans and quadrupedal animals. Respir Physiol 80: 137145, 1990.
18. Hoppeler H, Howald H, Conley K, Lindstedt SL, Claassen H, Vock P,
Weibel ER. Endurance training in humans: aerobic capacity and structure
of skeletal muscle. J Appl Physiol 59: 320 327, 1985.
19. Hoppeler H, Hudlicka O, Uhlmann E. Relationship between mitochondria and oxygen consumption in isolated cat muscles. J Physiol 385:
661675, 1987.
20. Hoppeler H, Luthi P, Claassen H, Weibel ER, Howald H. The ultrastructure of the normal human skeletal muscle. A morphometric analysis
on untrained men, women and well-trained orienteers. Pflgers Arch 344:
217232, 1973.
21. Jacobs RA, Diaz V, Meinild AK, Gassmann M, Lundby C. The
C57Bl/6 mouse serves as a suitable model of human skeletal muscle
mitochondrial function. Exp Physiol. doi:10.1113/expphysiol.2012.07003:
2012.
22. Jacobs RA, Rasmussen P, Siebenmann C, Diaz V, Gassmann M, Pesta
D, Gnaiger E, Nordsborg NB, Robach P, Lundby C. Determinants of
time trial performance and maximal incremental exercise in highly trained
endurance athletes. J Appl Physiol 111: 14221430, 2011.
23. Jacobs RA, Siebenmann C, Hug M, Toigo M, Meinild AK, Lundby C.
Twenty-eight days at 3454-m altitude diminishes respiratory capacity but
enhances efficiency in human skeletal muscle mitochondria. FASEB J 26:
51925200, 2012.
24. Janssen I, Jolliffe CJ. Influence of physical activity on mortality in
elderly with coronary artery disease. Med Sci Sports Exerc 38: 418 417,
2006.
25. Katzmarzyk PT, Church TS, Blair SN. Cardiorespiratory fitness attenuates the effects of the metabolic syndrome on all-cause and cardiovascular disease mortality in men. Arch Intern Med 164: 10921097, 2004.
26. Kodama S, Saito K, Tanaka S, Maki M, Yachi Y, Asumi M, Sugawara
A, Totsuka K, Shimano H, Ohashi Y, Yamada N, Sone H. Cardiorespiratory fitness as a quantitative predictor of all-cause mortality and
cardiovascular events in healthy men and women: a meta-analysis. JAMA
301: 2024 2035, 2009.
27. Kuznetsov AV, Schneeberger S, Seiler R, Brandacher G, Mark W,
Steurer W, Saks V, Usson Y, Margreiter R, Gnaiger E. Mitochondrial
defects and heterogeneous cytochrome c release after cardiac cold ischemia and reperfusion. Am J Physiol Heart Circ Physiol 286: H1633
H1641, 2004.
28. Larsen RG, Callahan DM, Foulis SA, Kent-Braun JA. In vivo oxidative capacity varies with muscle and training status in young adults. J Appl
Physiol 107: 873879, 2009.
29. Larsen S, Hey-Mogensen M, Rabol R, Stride N, Helge JW, Dela F. The
influence of age and aerobic fitness: effects on mitochondrial respiration in
skeletal muscle. Acta Physiol (Oxf) 205: 423432, 2012.

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Mechanisms of Muscle Plasticity


with Exercise
Hans Hoppeler,*1 Oliver Baum,1 Glenn Lurman,1 and Matthias Mueller1
ABSTRACT
The skeletal muscle phenotype is subject to considerable malleability depending on use. Lowintensity endurance type exercise leads to qualitative changes of muscle tissue characterized
mainly by an increase in structures supporting oxygen delivery and consumption. High-load
strength-type exercise leads to growth of muscle fibers dominated by an increase in contractile
proteins. In low-intensity exercise, stress-induced signaling leads to transcriptional upregulation
of a multitude of genes with Ca2+ signaling and the energy status of the muscle cells sensed
through AMPK being major input determinants. Several parallel signaling pathways converge
on the transcriptional co-activator PGC-1, perceived as being the coordinator of much of the
transcriptional and posttranscriptional processes. High-load training is dominated by a translational upregulation controlled by mTOR mainly influenced by an insulin/growth factor-dependent
signaling cascade as well as mechanical and nutritional cues. Exercise-induced muscle growth
is further supported by DNA recruitment through activation and incorporation of satellite cells.
Crucial nodes of strength and endurance exercise signaling networks are shared making these
training modes interdependent. Robustness of exercise-related signaling is the consequence of
signaling being multiple parallel with feed-back and feed-forward control over single and multiple
signaling levels. We currently have a good descriptive understanding of the molecular mechanisms controlling muscle phenotypic plasticity. We lack understanding of the precise interactions
among partners of signaling networks and accordingly models to predict signaling outcome of
entire networks. A major current challenge is to verify and apply available knowledge gained in
C 2011 American Physiological Society.
model systems to predict human phenotypic plasticity. 
Compr Physiol 1:1383-1412, 2011.

Introduction
Locomotion is one of the key functions in animals and is intimately related to survival. Locomotion, and hence muscle
work, is required to gather food or to escape predation. In
land-borne vertebrates, muscle comprises up to 50% of body
mass (125) and is thus the most abundant tissue also in humans (147). Looking at the animal kingdom, muscle tissue
comes in different guises and there are distinct structural conditions associated with locomotor characteristics. Animals
with a sedentary lifestyle (goats, cows) have muscle tissue
with a low capillarity and with a low oxidative capacity, that
is, a low content of mitochondria, while athletic animals such
as dogs, the pronghorn antelope, and horses are well equipped
for endurance work with abundant capillaries and mitochondria (64, 146, 216). It is thus evident, that muscle tissue has
been under selective pressure, its structure and its related functional capacities reflecting the locomotor mode required by
the ecological niche a particular species is filling. However,
the requirements for locomotion, and hence the specific demands on muscle tissue performance can change over time or
with seasons. Migratory birds go through pronounced modifications of muscle tissue mass and muscle metabolic profile
in preparation for long distance flights (382). Similarly, some
fishes exposed to changes in ambient water temperature re-

Volume 1, July 2011

spond with distinct increases of muscle oxidative capacity and


changes in myosin isoform expression to maintain metabolic
fluxes and muscle contractile force at low temperature (123,
172). These examples indicate that expressed muscle tissue
phenotypes exhibit a significant malleability even in adult individuals and can adapt to changes in demand with specific
structural and functional changes. In humans, we observe both
inter-individual variability of aerobic performance capacity
(364) as well as a considerable phenotypic plasticity of muscle
tissue related to the particular use to which an individual puts
his or her muscles (134, 145, 149). Muscle function and phenotype is related to the specific mode of muscle activation an
individual engages in. Repetitive stressful use of muscle tissue
(exercise training) leads to characteristic muscle structural and
functional modifications resulting in an improved mechanical
performance for the particular mode that the muscle has been
stressed. Classically, we distinguish between endurance training (low load-high repetitive stimulus) and strength training

* Correspondence

to hans.hoppeler@ana.unibe.ch
of Anatomy, University of Bern, Bern, Switzerland
Published online, July 2011 (comprehensivephysiology.com)
1 Institute

DOI: 10.1002/cphy.c100042
C American Physiological Society
Copyright 

1383

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

(high load-low repetitive). These two training modalities represent the extremes of a continuum of exercise protocols of
countless options differing in load, duration, frequency, and
mode of contraction as well as any combination thereof. Much
exercise-related research between 1970 and 1990 was aimed
at characterizing the functional outcome of specific training
protocols as well as their structural and biochemical foundations. A clear pattern between changes in muscle function and
associated structural and biochemical modifications was thus
established.
Classical endurance exercise protocols usually result in an
2 max (maximal oxygen consumption) a comincrease in Vo
bined adaptive consequence of modifications in the cardiovascular system and in trained skeletal muscles (173). In muscle
tissue, we find the contractile phenotype to drift toward an increased expression of slower myosin phenotypes sometimes
associated with a fiber-type shift (17). Fiber cross-sectional
area is little affected by endurance-type exercise except when
muscles were previously immobilized or underused (303).
Muscle capillarity is enhanced to match the increased demand for oxygen flux by muscle mitochondria (288). The
muscle mitochondrial compartment can rapidly be expanded
with endurance-type exercise in particular when subjects were
previously untrained. Gains in mitochondrial volume of >30%
have been realized in periods of 6 weeks (150). Changes of
mitochondrial volume density are generally paralleled by similar increases in enzymes of the Krebs cycle and oxidative
phosphorylation such as SDH (succinate dehydrogenase), CS
(citrate synthase), and Cytox (cytochrome c oxidase) (295).
Endurance training further leads to a shift in metabolism toward a higher reliance on lipids as substrates as well as an
increase in IMCL (intramyocellular lipid) and carbohydrate
stores (145, 329).
Classic strength training protocols impact predominantly
on muscle and muscle fiber cross-sectional area. In terms of
functional changes, it is important to realize that significant
strength gains can be obtained (in particular at the beginning
of training episodes) with modifications of the neuromuscular
control (317). Early functional gains can thus occur with little
structural adjustments. With continued strength training, we
see an increase in muscle cross-sectional area, relatively more
pronounced toward the muscle origin and insertion (258).
The gain in muscle cross-sectional area is mainly due to an
increase in the number of myofibrils, whereby the fast fiber
types (type IIA and type IIX) are mostly responsible for the net
increase in muscle size in humans (119). Myosin heavy chain
expression can be modified by strength training, however, the
extent and direction of observed changes seem to depend from
the particularities of the exercise protocol. Mitochondria and
capillaries are little affected by strength training protocols
(222). As a consequence, mitochondrial volumes and capillary densities are low in strength-trained human muscles;
muscle metabolism remains dominantly carbohydrate dependent such that the relative content of cytoplasm containing
glycogen is increased (225). While concentric strength training results in muscle fiber hypertrophy, eccentric strength

1384

Comprehensive Physiology

training seems to be capable of muscle hyperplasia with neoformation of muscle fibers (9, 225).
At the beginning of the 1990s, it became feasible to
analyze human muscle biopsies using a range of molecular techniques allowing for the exploration of the mechanisms of muscle phenotypic plasticity. Problems that had to
be solved earlier included small available tissue volumes, low
abundance of RNA, and mechanical robustness of muscle
tissue. Choice of detection levels, treatment of background,
standardization and referencing of parameters of interest as
well as appropriate use of statistical methods have remained
hotly debated issues in recent muscle research. Despite these
difficulties, the understanding of the mechanisms of muscle
plasticity has advanced considerably over the last 20 years.
In some areas such as endurance exercise, it looks as if a reasonable consensus has been reached at least as far as some of
the basic adaptation mechanisms are concerned.
Before entering a more detailed and specific discussion
of muscle molecular plasticity, it may be worthwhile to expand on some of the conceptual difficulties underlying current molecular exercise physiology. Any exercise carried out
is characterized by a specific blend of stressors to which
muscle tissue is subjected when activated. We have distinguished mechanical load, hormonal adjustment, neuronal activation and metabolic disturbance as the main identifiable
stressors [Fig. 1; (100)]. Each of these stressors is linked to
several signaling pathways in muscle cells that carry information about the external circumstances under which muscle

Mechanical
load
Integrins
FAK
mTOR
p70S6K

Hormonal
adjustment

Neuronal
activation
2+

IGF1/GH
testosterone
insulin
HGF

Ca
CaM
CaMK
calcineurin

Signaling

Transcription
&
posttranscriptional
modifications
initiation
elongation
termination
RNA processing
RNA splicing
RNA stability
transport/localization

Metabolic
disturbance
AMPK
PGC-1
PPAR
TFAM
ROS
RNS

phosphorylation
allosteric regulation
ligand binding

Translation
&
posttranlational
modifications

Proteins
Quantity
activity/function
localization

initiation
elongation
termination
ribosome content
addition of functional groups
addition of peptides
changes of structure
proteolytic cleavage
transport/localization

Figure 1 Schematic outline of the muscular signal integration of


physical exercise stimuli. The stimulation of muscle tissue by exercise
bouts is integrated by complex signaling networks causing changes in
protein quantity, activity, and localization by adjusting transcriptional
and/or translational mechanisms.

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

activity is carried out. These signals have a dual purpose.


They serve to reestablish myocellular homoeostasis disrupted
by muscle activity. However, they also serve to modify muscle tissue with the consequence of making muscle tissue more
competent in dealing with similar stress in the future [adaptation; (157)]. When looking at signaling in muscle cells, we
therefore have to distinguish an acute signaling response and
signaling related to long term changes of muscles. Typically,
the latter is reflected as a change in accumulation of transcription factors and signaling molecules as well as in muscle
protein composition. The change in muscle protein composition is commonly reflected as a change in muscle structure
and thus is the substrate of the training adaptation.
Exercise training protocols consist of specific activation
patterns of muscle repeated over days and weeks. In the
strength training situation, we typically find mechanical load
to be the dominant stressor. In endurance training, mechanical
load is low and metabolic disturbance, neuronal activation as
well as hormonal adjustments usually persist over longer time
periods (Fig. 1). Depending on the exact nature of the training protocol, there is an unlimited choice in the selection of
the relevant training parameters intensity, frequency, volume,
duration, intervals, mode of contraction, etc. Moreover, it has
been demonstrated that the muscle signaling response is different in the trained and in the untrained state (98, 327). As a
consequence of the unlimited possibilities to conduct a training study, no two studies will produce directly comparable
results.
This complexity inherent in the design of training studies
is a major hindrance for a canonical description of the principles of adaptive mechanisms from a collection of training
interventions. To this we have to add the challenging nature
of the myocellular response to multiple simultaneously active
stressors. As indicated above, we are faced with a network of
multiple interlinked signaling cascades controlling transcriptional, posttranscriptional, translational, and posttranslational
events of which there is currently no comprehensive description nor understanding. The very nature of the network property of the cellular response precludes intuitive linear cause
and effect reasoning. In principle we need to map and analyze the concurrent changes for all partners of the network
to predict outcome. This task is difficult if at all possible due
partly to the fact that the available biological information is
unreliable and incomplete (72). The characterization of the
molecular mechanisms of muscle plasticity will therefore by
necessity remain tentative and incomplete.
This situation is aggravated further by the fact that in
vitro and in vivo animal and human experimentation carried
out in the context of elucidation of molecular training mechanisms are of different character and value. Experiments in cell
cultures and with model organisms generate the information
necessary to understand the structure of signaling pathways,
identify the relationships between partners in signaling networks and monitor or manipulate downstream targets. It is the
consensus that signaling pathways are very much evolutionary conserved (44, 47, 65). Hence information on the structure

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

and the interrelationship among pathways is reasonably transferable between animal models and the human situation. This
means that humans share the basic topology of their signaling
network with often used animal models such as mice and rats.
Given the likeness of the topology of signaling networks
in mammals, one would expect similar stress to cause similar
changes to muscle tissue. This is not what we observe. There is
solid evidence that rats increase myoglobin concentrations in
skeletal muscle by up to 70% with endurance exercise training (27, 270). This is not observed in humans where years
of exercise training may decrease myoglobin concentrations
(170, 232). To increase myoglobin with exercise in humans,
an added hypoxia stress may be necessary, and results remain
equivocal (361). It is well documented that high fat diets lead
to significant increases in skeletal muscle oxidative capacity
in rats with or without added exercise (41, 49, 209, 340). In
humans, there is no indication of a high fat diet increasing
the muscle mitochondrial compartment (374). By contrast,
in humans (saturated) lipid oversupply is thought to be one
of the major culprits in the metabolic syndrome, possibly responsible for mitochondrial dysfunction (39, 227, 251, 297).
Gain in muscle cross-sectional area is a major contributor to
observed functional improvements in human strength training (102, 362) whereby maximal hypertrophy is obtained by
using the heaviest possible loads (110). Interestingly, flight
muscle hypertrophy (by over 40% of initial mass) in migratory birds is achieved with no detectable increase in pre-flight
muscle activity (75, 279). These examples (and more could
be cited) are evidence for a distinct species specificity of the
muscles response to external stimuli. We are thus faced with
the question as to the nature of this species specificity. It is
currently difficult to assess in a general sense how much of the
differences in observed protein response between species is
due to differences in network structure and how much is due
to individual regulatory interactions within the same network
structure (388). Our bias is that adaptive variation in species
is importantly achieved by changing set-points of nodes in
the regulatory network and not by changing network structure. Research on the molecular mechanisms of the training
response is further complicated by the fact that all exercise
stimuli are simultaneously present and are transient (see Fig.
1). To identify the contributions of individual partners of the
signaling network, much recent research has been invested
using knockout and knockin experiments as well as pharmacological agents blocking or enhancing specific pathways.
The drawback of this approach is that it does not account for
the transient nature of the exercise stress; that is, a specific
enhancing or inhibiting function is continuously present or at
least over protracted time periods. This leads to complex and
unpredictable compensatory processes that make the interpretation of observed results in the context of human exercise
response speculative (136).
In the context of the current review, we will rely on cellculture and in vivo animal and human experimental data. We
believe however, that the main value of animal experimental models and cell culture experiments consists mainly in

1385

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

establishing the relevant molecular players while human studies are needed for the understanding of the interactions between regulatory network partners in any given human interventional situation. Moreover, the current review can only
represent a snapshot of what is an exponentially expanding
body of evidence with papers describing molecular mechanisms in muscle tissue currently being published at a rate of
>200/month (Web of Science).

Endurance Exercise Training


The functional hallmark of endurance training is its capacity to enable the organism to maintain a larger power output
over longer periods of time (minutes to hours) or more generally speaking, to become more fatigue resistant. On a muscle
level, this requires the oxidative machinery, that is, mitochondria to be increased. An increase in mitochondrial volume (or
mass) enables muscle to regenerate more ATP (adenosine-5 triphosphate) aerobically, using either lipids or carbohydrates
as a substrate source. As the muscles capacity to utilize oxygen is increased, the extent of the capillary network that delivers oxygen and substrate to muscle cells is also increased in
somewhat similar proportions (148). This increase in peripheral capacity to transport and utilize oxygen must be met by
central adaptations favoring oxygen delivery to muscles. The
nature and mechanisms of these cardiac adaptations to endurance training is not subject of this review. Skeletal muscle
tissue has additional mechanisms by which endurance capacity can be augmented. As the efficiency of muscle contraction
can be increased by slowing the actomyosin ATPase activity,
endurance exercise training is further often associated with
a slowing of muscle fibers and associated decreases in costs
of tension production and/or a switch toward the slower fiber
types (138, 352).
Mechanisms invoked in skeletal muscle tissue adaptation
to endurance exercise therefore need to explain observed
gains in mitochondrial volume, capillarity, and fiber-type
expressionall happening simultaneously and in a coordinated fashion. There is a reasonably large number of recent
reviews that elucidate various aspects of the exercise-related
metabolic plasticity of skeletal muscle tissue (11, 19, 33, 51,
104, 105, 114, 131, 134, 144, 176, 221, 324, 349, 393). The
current review is an attempt at synthesizing available knowledge in the context of a physiological understanding of the
muscle adaptive process.

Control of mitochondrial biogenesis


Using bicycle endurance exercise training for 6 weeks in previously untrained subjects, it was shown that mitochondrial
volume in M. vastus lateralis can be increased by >30% (145).
This is an altogether amazing feat of protein accretion requiring the coordinated increase of over 1000 nuclear and 12
mitochondrial-encoded proteins (human mitochondrial protein database). Early quantitative RT-PCR (reverse transcrip-

1386

Printer Name: Yet to Come

Comprehensive Physiology

tion polymerase chain reaction) studies indicated that both


mitochondrially and nuclear encoded mRNAs (messenger ribonucleic acid) (three in each group) of mitochondrial proteins were increased about in proportion (1.5 to 1.9 fold) to
the difference in mitochondrial volume observed in untrained
subjects versus endurance-trained athletes (291). The same
study further found the concentration of genomic DNA to
be similar in the trained and in the untrained state suggesting pre-translational control mechanisms to be responsible
for the increase in nuclear-encoded RNAs (ribonucleic acid).
By contrast, trained subjects showed higher concentrations
of mitochondrial DNA indicating similar expression levels
of mitochondrially encoded genes in trained and untrained
subjects. In a seminal paper, Pilegaard et al. (281) showed
for four nuclear-encoded metabolic genes a distinct upregulation of transcription using nuclear run-ons of isolated skeletal muscle nuclei following an acute bout of endurance-type
exercise. The transient increase in transcription rates was followed by an increase in the concentration of the respective
mRNAs. This was direct evidence for a transcriptional regulation of metabolic gene expression in humans as a consequence
of endurance exercise. These authors further suggested that
repetitive transient increases in transcription of metabolic
genes cumulating in elevated levels of mRNA in trained
muscle were responsible for the cellular adaptations associated with endurance-type training. There is good evidence
that transcriptional upregulation is a dominant mechanism in
endurance training-related increases in skeletal muscle mitochondrial content. The question thus arises as to the events initiating this genomic response. With continued muscle activity,
a number of cytosolic messengers such as AMP (adenosine
monophosphate), Ca2+ (calcium), Pi (inorganic phosphate)
H+ (hydrogen cation), ROS (reactive oxygen species) as well
as many others change and thus lead to activation of multiple
signaling pathways.
One key consequence of muscle activation is the immediate enormous increase in energy turnover and brake
down of ATP resulting in a myocellular energy in-balance
with AMP activating AMPK (5 adenosine monophosphateactivated protein kinase), whereby myocellular ATP/AMP ratio is considered to be an indicator of activation of the AMPK.

Energy charge and AMPK signaling


AMPK is a multisubstrate serine/threonine kinase ubiquitously expressed and highly conserved in eukaryotes. AMPK
consists of 3 subunits essential for a fully functional complex.
AMPK is a heterotrimer consisting of one catalytic -subunit
and two regulatory - and -subunits of which several tissuespecific isoforms exist (184, 387). It is suggested that both
the regulation and the downstream action of different trimeric
complexes might be different (300). Activation of AMPK is
complex but importantly occurs by the binding of 5 -AMP to
the -subunit and is hindered by ATP, the ATP/AMP ratio thus
being a good indicator of AMPK activation. Binding of AMP
makes AMPK a better substrate for upstream kinases and a

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

worse substrate for phosphatases (319, 331). In a general way,


AMPK, when activated, supports energy generating processes
such as glucose uptake and lipid oxidation and diminishes energy consuming processes such as protein and lipid synthesis
or cell growth (1, 132, 133). For muscle, there is substantial
evidence indicating that AMPK is activated by electric stimulation, by motor nerve stimulation but importantly also by
various modes of natural locomotion in animals and humans
in an exercise intensity-dependent manner (176). The expression of AMPK isoforms varies between humans and rodents,
and activation appears to be species specific and dependent
on fiber-type recruitment (108). AMPK can also be activated
by the compound AICAR (5-amino-4-imidazolecarboxamide
riboside) (389).
LKB1 (serine threonine kinase 11, STK11) has been identified as an important upstream AMPK kinase in muscle and
other tissues being responsible for the AMP-dependent activation of AMPK (319). The same authors suggest a model indicating how CaMMK (calcium/calmodulin-dependent protein kinase kinase ) activated in response to Ca2+ signaling,
functions as an alternative upstream kinase of AMPK (177).
There are a number of other activators of AMPK discussed
in the literature, their role is less well defined than that of
LKB1 and CaMMK, such as TAK1 (TGF- activated kinase 1), involved in signaling of pro-inflammatory cytokines,
ROS and SIRT1 (sirtuin 1) (177, 300). An interesting feature
of AMPK is its function as fuel sensor. It has been demonstrated that the extent of AMPK activation depends on muscle
glycogen concentration with more AMPK activation at low
glycogen concentrations (175). AMPK activation has been
implicated in the acute regulation of glucose uptake and oxidation as well as fatty acid oxidation with exercise in muscle.
However, its role in the regulation of substrate metabolism
is controversially discussed and has not been established in
humans (300). Protein synthesis is reduced during muscle
contraction with AMPK activation being implicated in this
energy saving mechanism (36, 235, 255).
AMPK has been implicated in responses to repeated exercise, leading to adaptational changes maintaining energy
homeostasis. Long et al. (221) have summarized and tabulated the reported downstream effects of AMPK on the regulation of the skeletal muscle metabolic gene program. There
is evidence for upregulations of genes involved in glucose uptake (i.e., Glut4; solute carrier family 2, member 4, SLC2A4
as well as cognate proteins), glucose utilization/storage, and
lipid uptake/oxidation from AICAR experiments (178, 220,
343) as well as from chronic electrical stimulation (127, 264).
AMPK is implicated in the induction of metabolic genes as
well as mitochondrial biogenesis mainly by way of transcriptional effectors. AMPK directly phosphorylates PGC-1 (peroxisome proliferator-activated receptor gamma coactivator
1-alpha) seen as a key activator of the mitochondrial biogenesis program (345). Overall, the available evidence suggests
that the activation of the AMPK pathway coregulates energy
homeostasis acutely during exercise and also induces a transcriptional program imitating much of the typical exercise-

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

induced adaptations without being obligatory for the effects


of endurance exercise training (131, 142).

Calcium-dependent signaling pathways


It has been known for more than 40 years from crossinnervation experiments as well as tonic and phasic electrical
stimulation that neuronal activity is a among the main determinants of muscle metabolic and contractile properties (277).
The Ca2+ -dependent pathways described below serve to integrate the duration, amplitude, and frequency of intracellular
Ca2+ fluctuations. It appears that there are several signaling pathways that depend on cytosolic Ca2+ and can regulate
downstream gene expression. A significant difficulty in disentangling the Ca2+ signaling pathways consisted and consists
in the fact that in most cases Ca2+ activated muscle contraction leads to energy imbalance and thus to AMPK signaling
(discussed above).
Increases in intracellular Ca2+ are initially decoded by
calmodulin, a 17-kDa protein consisting of four helix-turnhelix protein motifs each binding one Ca2+ (also known also
as EF hands) which are the Ca2+ sensing parts. Skeletal
muscle has two other important EF-hand proteins, troponin C
regulating muscle contraction on the actin filament and parvalbumin active as a Ca2+ buffer for rapid relaxation in fast
fibers (51). Calmodulin serves as a signal transducer activating
downstream kinases and phosphatases upon conformational
changes. Calmodulin decodes Ca2+ oscillations in skeletal
muscle by conformational changes induced by Ca2+ binding.
The rearrangement of calmodulin is necessary for activation
of its downstream targets (2). Translocation (i.e., to the nucleus and possibly other intracellular cites) is a second mechanism by which calmodulin exerts its function (2, 51). First
targets of calmodulin are members of the family of CamK
(Ca2+ /calmodulin-dependent protein kinases, different numbered isotypes). Calmodulin further acts through calcineurin
and through PKC (protein kinase C) as discussed below.
CaMKII II and IV are major calmodulin-dependent targets
in skeletal muscle. CaMKII is a multimeric serine/threonine
kinase consisting of two sets of six subunits. Upon binding
of the Ca2+ /calmodulin complex, CaMKII is activated by autophosphorylation remaining activated independent of Ca2+
levels (101). The various isoforms of CaMKII interact with
multiple downstream targets, specificity conferred by activated isoform(s), localization, and the specifics of the Ca2+
oscillatory signal (51). CaMKII is thus capable of translating Ca2+ oscillations into discrete levels of kinase activity.
CaMKII activity has been shown to be directly dependent
on exercise intensity in humans cycling on an ergometer;
CaMKII activity related to the level of phosphorylation and
not CaMKII abundance (307). CaMKII acts through MEF2
(myocyte enhancer factor 2), a family of transcriptional factors important in muscle development and growth. Activation
of CaMKII causes a phosphorylation of class II HDACs (histone deacetylases) repressing MEF2. Phosphorylated HDACs
leave the nucleus, thereby decreasing the repression of MEF2,

1387

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

possibly leading to an activation of slow fiber-type gene expression (218). Alternatively, CaMKII has shown to activate
SRF-kinase (serum response factor), a transcription factor
for the hypertrophy response element in the skeletal muscle
-actinin promoter but possibly also involved in the control
of the transcription of lipoprotein lipase (99). These authors
showed sustained increases in SRF-kinase activity both after stretch overloaded anterior latissimus dorsi muscle in
rooster and in white vastus lateralis muscle in voluntary wheel
running rats.
CaMKIV is a monomer and needs to be activated by a
CaMK-kinase upon which it translocates from the cytosol to
the nucleus to activate MEF2 (see above) and NFAT (nuclear
factor of activated T cell). The role of CaMKIV for exercise
adaptations in human skeletal muscle has remained ambiguous as not all studies have been able to detect CaMKIV by
immunoblotting techniques (308). In various overexpression
experiments in mice, CaMKIV has been implicated in the
activation of mitochondrial biogenesis, oxidative enzyme expression and hypertrophic growth (124, 128, 129) Transgenic
mice expressing a constitutively active form of CaMKIV were
shown to have an upregulation of the transcriptional coactivator PGC-1 (390). PGC-1 is considered the master regulator
of mitochondrial gene expression, involved in coordinated
control of nuclear and mitochondrial-coded mitochondrial
transcripts (see below). Activated CaMKIV also phosphorylates CREB (cAMP responsive element-binding protein)
which has a binding site on the proximal promoter region of
PGC-1.
Increased activity of PKC has been demonstrated in skeletal muscle of endurance trained humans (260). Cell culture
experiments showed PKC (triggered by Ca2+ and calmodulin) to translocate from the cytosol to membranes and to
be active through a MEK [mitogen-activated protein kinase
(MAPK)/extracellular signal-regulated protein kinase kinase
(ERK)] and MAPK pathway. PKC has been shown to be involved in regulating mitochondrial-encoded genes as well as
c-fos, c-jun, and myc (immediate early gene from the fos, jun,
and myc family, respectively) (106).
Calcineurin is a heterodimeric protein phosphatase with
a calmodulin-binding catalytic subunit A and a Ca2+ -binding
regulatory subunit B. Activated calcineurin has been shown to
be important in IGF-1 (insulin-like growth factor 1)-induced
hypertrophy of cultured skeletal muscle cells (252). More
importantly, activated calcineurin dephosphorylates, among
other signaling proteins, NFAT leading to selective cytosolic
and nuclear translocation of NFAT isoforms. Dephosphorylated nuclear NFAT binds to consensus DNA sequences of
gene promoter regions and transcription factors such as AP-1
(activator protein 1), MEF2, and GATA-2 (GATA binding protein 2) for activation of target genes (267). NFAT-dependent
gene activation include myosin, Glut4, and utrophin A, while
myostatin seems to be a negative effector target (243). Myostatin is a transforming growth factor- family member
known as a negative regulator of muscle growth (discussed
later in more detail) (210). There are several lines of evidence,

1388

Comprehensive Physiology

mainly from cell culture work that the calcineurin-NFAT pathway may also have a stimulatory effect on satellite cells in
hypertrophy and myogenesis and the expression of the slow
fiber-type program (73).

ROS and redox signaling


Due to the presence of unpaired valence electrons, ROS represent highly reactive small molecules such as charged oxygen
derivatives, free radicals and peroxides. Among this heterogenous group of molecules, O2 (superoxide anion), H2 O2 (hydrogen peroxide), and ONOO (peroxynitrite) are the ROS
with the highest biological impact (23). Early reports of exposure of cells to oxidative conditions focused on (lung) tissue
damage as a consequence of ozone exposure during exercise
as well as on protection from oxidative damage by application of antioxidants such as vitamin E (76). It is assumed that
protein oxidation occurs with formation of carbonyls and loss
of free thiol groups whereby the loss of enzyme function is
related to the oxidation of essential thiol groups (168). Early
on, ROS have mostly been perceived to be responsible for
cell damage through oxidative stress and use of inhibitors
(antioxidants) has been advocated (285). In fact, most currently available exercise drinks and nutritional supplements
consumed by athletes (and active, health conscious people)
contain various antioxidants. More recently, it has been recognized that ROS and RNS (reactive nitrogen species) mediate
important gene adaptive events mostly through discrete redox
pathways (168). It is well documented that contractile activity
increases ROS production in skeletal muscle (69). Mitochondria are assumed to be the major site of ROS production in
muscle with up to 5% of the oxygen flow giving rise to superoxides (40). More recent analyses indicate that the proportion
of electron flow giving rise to ROS production is closer to
0.2% (351). However, many other redox systems in muscle associated with the plasma membrane, the sarcoplasmic
reticulum, the T-tubular system, and the triads have been implicated in being able to produce ROS and NO as reviewed in
(286). It has been suggested that the activity-induced increase
in ROS in skeletal muscle is relatively small and may not represent a major stress to tissue but rather serves to activate compartmentalized redox-sensitive adaptations (167). The redox
potential of dithiol pools in the cell varies considerably and
thus opens the possibility of differential regulation of redox
systems by local ROS-generating systems (24, 130). Adult animals and humans have been shown to upregulate protective
enzyme pools and stress proteins as a consequence of contractile activity (171, 238). Transcription factors, NFB (nuclear
factor kappa-light-chain-enhancer of activated B cells), AP-1,
MAPKs, and HSF (heat shock factor) have been shown to be
redox sensitive and are implicated in the regulation of ROS
protective systems (261, 293, 372). ROS have also been implicated in contraction, but not insulin-mediated glucose uptake
in mouse skeletal muscle (322) as well as in mitochondrial
biogenesis (69). Recent evidence indicates that the key factor
of mitochondrial biogenesis, PGC-1 (discussed below), may

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

be indirectly redox regulated via AMPK activation (164). This


contention is supported by the observation that antioxidants
(vitamin C) can suppress the increase in mitochondria and antioxidant enzymes usually observed with endurance exercise
training in humans and rats (118). There are also indications
that ROS may play a role in exercise-stimulated release of
muscle cytokines and myokines [see below; (273)]. This may
be of particular importance with regard to the complex health
implications of regular exercise.

HIF-1
Skeletal muscle tissue experiences very low oxygen tension
during demanding exercise (298). The primary mechanism
by which cells respond to oxygen stress is via a transcription factor, HIF-1 (hypoxia-inducible factor) (333). HIF-1 is
recognized to be a mastergene known to be able to coregulate a multitude of downstream genes involved in oxygen
homeostasis (334). HIF-1 is a heterodimeric helix-loop-helix
containing transcription factor, of which the subunit HIF1 is controlled by cellular oxygen levels. HIF-1 is prolylhydroxylated and degraded in normoxia; in hypoxia, it combines with HIF-1 and translocates to the nucleus for gene
activation (166). Increases in HIF-1 protein (but not mRNA
levels) as well as an increased transcription of the HIF-1
target genes EPO (erythropoietin) and VEGF (vascular endothelial growth factor) were demonstrated acutely in humans with one-legged knee extensor exercise (5). Using hypoxia as an additional stimulus in human endurance training,
we found elevated HIF-1 mRNA levels in subjects training
for several weeks under high- or low-intensity hypoxic training conditions (373). Likewise, adding hypoxia training sessions to a regular endurance exercise regime in highly trained
long-distance runners resulted in a distinct modulation of the
muscle gene expressional profile, including significant upregulations of mRNA concentrations of HIF-1, Glut4, PFK
(phosphofructokinase), PGC-1, CS, Cytox1 and 4 (cytochrome c oxidase isoforms), carbonic anhydrase-3, and
SOD1 (manganese superoxide dismutase), not seen in subjects trained in normoxia only (400). The importance of
oxygen deprivation and its sensor, the HIF-1 system, as a
signal for muscle adaptation has been questioned recently
(231). These authors found that surprisingly, skeletal muscle specific HIF-1 knockout mice showed a distinct pattern of exercise training adaptation without training. Muscles of HIF-1 knockouts had elevated CS and HAD
(-hydroxyacyl CoA dehydrogenase) activities, increased
capillarity, upregulated resting Glut4 expression but no
changes in fiber-type composition. These animals also had
a lowered respiratory exchange ratio and an improved endurance capacity at low-intensity exercise (230). Mason and
Johnson (229) present evidence that the observed muscle
modifications observed in HIF-1 knockouts are brought
about by a constitutively elevated level of phosphorylated
AMPK. They contend that mitochondrial biogenesis is suppressed in normal tissue by HIF-1 and that endurance exercise

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

training suppresses HIF-1 signaling thus indirectly leading to


an adaptive response of muscle through the AMPK pathway
(229). This research demonstrates the difficulties associated
with manipulating the signaling pathways of endurance exercise, a transient stimulus by nature, with molecular techniques
that lead to lasting modifications of the properties and topology of the signaling network. It may be that the complex,
coordinated and consistent modifications of the gene expressional response we have observed with exercise training under hypoxic conditions is specific to exercising in an oxygendepleted atmosphere. This is suggested by the observation that
many transcript levels, most of them targets of HIF-1, are correlated with arterial oxygen saturation during exercise (326).

The PPAR (peroxisome proliferator-activated


receptor) system and substrate metabolism
The PPAR family of transcription factors is seen as key regulators of lipid metabolism and inflammation (26) implicated
in the shift of substrate metabolism toward -oxidation seen
with endurance training in skeletal muscle (105, 354). PPARs
are 50 kDA-proteins belonging to the gene family of zincfinger transcription factors. Monomeric PPARs are located
in the cytoplasm but may associate with RXRs (retinoid X
receptors) after binding of specific ligands (such as fatty
acids) and translocate into the nucleus (93). The PPAR/RXR
heterodimers bind to a specific promoter DNA sequences
designated PPRE (peroxisome proliferator-activated receptor response element) (292). PPRE sequences have been
found in a large number of genes coding for proteins involved in lipid and carbohydrate metabolism, including fatty
acid transporters, fatty acid binding proteins, acyl-CoA synthetase, PDK4 (pyruvate dehydrogenase kinase isozyme 4),
and PEPCK (phosphoenolpyruvate carboxykinase) (21, 280,
323, 328). Three PPAR genes (, /, and ) have been
identified; these are encoded on different chromosomes. The
PPAR ligand domain is larger than that of other nuclear receptors allowing for the binding of a broad range of fatty acid
species such as saturated and unsaturated fatty acids as well
as eicosanoid derivatives (342). Synthetic ligands with high
specificity for PPAR subtypes have been developed. PPARspecific ligands (fibrates such as fenofibrate and clofibrate)
are used as plasma triglyceride lowering drugs (109). PPAR
ligands such as thiazolidinediones are used in treatment of
type 2 diabetes because of their ability to reduce insulin resistance (237). Both PPAR and PPAR lowering drugs are
considered to be of low-toxicity and of potential use also in
tumor-associated angiogenesis and cancer (287). There are no
PPAR / ligands currently in clinical use.
The PPARs represent molecular sensors of intramyofibrillar availability of fatty acids. The binding of the fatty acids to
the ligand pocket promotes and stabilizes a conformational rearrangement of the PPARs, orchestrating the recruitment and
dismissal of coactivators and corepressors. These coactivator/corepressor complexes possess distinct catalytic activities
(acetylase, deacetylase, methylase, demethylase, and kinase)

1389

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

that facilitate decompactation of DNA and interaction of transcription factor complexes with the promoters (394). PPARs
are subject to various posttranslational modifications such as
SUMOylation (SUMO, small ubiquitin-like modifier), acetylation or phosphorylation (45, 180, 266). In the context of
the metabolic syndrome, PPARs have been postulated to reduce oxidative stress by modulation of mitochondrial UCP
(uncoupling protein) expression to reduce ROS, optimising
FOXO (family of forkhead box transcription factors) activity
by improving insulin sensitivity and suppressing the transcriptional level of NFB (265). The three PPAR proteins
have overlapping as well as distinct functions and are individually distributed in various tissues. Heart and diaphragm have
typically higher PPARs mRNA concentration than skeletal
muscle and PPAR/ being more abundant than PPAR and
PPAR mRNA in skeletal muscle (89). It must be kept in
mind that so far most knowledge on PPAR regulation is based
on estimates of PPAR mRNA content and not PPAR protein
or activation. PPAR / seems to be particularly important for
skeletal muscle metabolism. PPAR / is more abundant in
the slow-type oxidative, than in the fast-type glycolytic fibers
and increases type I fiber content with increased expression
levels in mice (381). Cycling exercise causes both acute and
chronic increases of PPAR / content in human vastus lateralis muscle (107, 312, 381) with PPAR also increased after
6 weeks of cycling endurance exercise (311) with contraction
being likely more important for the PPAR / increase than
the exercise-induced elevation of FFA (free fatty acids) (312).
Fasting and the associated systemic increase in FFA have
been shown to lead to a transient nuclear accumulation of
PPAR / and PGC-1 (71). Inactivity, such as with chronic
spinal cord injury, reduces PPAR, and PPAR / expression in humans (196). PPAR / seems further implicated
in developmental control of fiber-type composition, favoring
type I fibers (379) but may also be implicated in control of
muscle fiber phenotype in adult muscle with endurance athletes having a higher expression of PPAR/ and PGC-1
(196). PPAR / enhances a number of enzymes responsible
for uptake, transport, and oxidation of fatty acids in skeletal
muscle and is suggested to be the key regulator of muscle fuel
selection in particular with exercise and fasting (85). Crosstalk and a molecular partnership between AMPK and PPAR
/ signaling for the re-programming of the skeletal muscle
transcriptome for endurance has been suggested (259).
The roles of PPAR and PPAR are less well defined
in skeletal muscle. PPAR is preferentially expressed in tissues with a high turnover of fatty acids, such as heart, kidney brown adipose tissue, liver but also in skeletal muscle,
mostly in type I oxidative fibers (211). Transgenic mice overexpressing PPAR in skeletal muscle show a switch from
glucose to fatty acid metabolism (96). In skeletal muscle of
these mice, the transcription of genes for fatty acid uptake,
esterification, and -oxidation was upregulated to commensurate with an increase in fatty acid metabolism. Moreover,
Glut4 was suppressed and PDK induced, indicating a downregulation of carbohydrate metabolism. PPAR has mostly

1390

Printer Name: Yet to Come

Comprehensive Physiology

been studied in adipose tissue where it plays an essential


role in storing and mobilizing fatty acids (335). Mice with
a skeletal muscle-specific PPAR knockout are adipose with
normal glucose disposal in muscle and a reduced caloric intake suggesting a reduced lipid clearing in skeletal muscle, in
particular in oxidative muscles or fibers (263).
Taken together, PPARs in skeletal muscle share redundant
but also differing functions. The exact role of the individual
PPAR isoforms in skeletal muscle are currently not well defined and may have to be viewed in the wider context of PPAR
actions in other tissues as well as tissue cross-talk. The three
PPAR forms may activate different downstream target repertoires with possibly distinct preferred bona fide endogenous
ligands. Moreover, PPAR forms may be regulated independently at the transcriptional or posttranscriptional level depending on the specifics of upstream signaling. An additional
level of control is given by PPARs interacting with several
coactivators and corepressors, again likely in a tissue-specific
manner.

The nuclear receptor coregulator PGC-1


PGC-1 is the key downstream element of most signaling
pathways responsive to endurance-type exercise stress (see
Fig. 2). PGC-1 is a NR (nuclear receptor) coregulator. Transcription factors, binding to promoter, enhancer, and repressor region of target genes have traditionally thought to be the
main regulators of gene expression. More recently, the role
of nuclear receptor coregulators such as PGC-1 has received
intense attention (219). It is suggested that these multiprotein
nuclear receptor coregulators function as master regulators
accepting diverse signaling events to implement coordinated
programs of gene expression. They seem to be particularly
well suited to functionally integrate multiple transcription factors and thus enable biological programs to be executed (346).
NR coregulators are believed to be essential parts of an epigenetic regulatory scheme responsible for the dynamic nature of
the mammalian phenotype (219). PGC-1 is considered to be
the master regulator of mitochondrial biogenesis in skeletal
muscle (143). PGC-1 binds and coactivates DNA binding
transcription factors such as NRF-1 and -2 (nuclear respiratory
factor 1 and 2, respectively), MEF2, FOXO, ERR (estrogenrelated receptor ) and PPARs. When bound to transcription
factors, PGC-1 serves as a protein docking platform assembling HAT (histone acetyl-transferase), CREB, and generally
cofactors that modulate accessibility of nucleosomal DNA
such as TRAP/DRIP (thyroid hormone receptor-associated
protein/vitamin D receptor interacting protein) mediators and
SWI/SNF (SWItch/Sucrose NonFermentable) complexes resulting in a large increase in transcriptional activity (290,
378). NRF-1 and NRF-2 have binding sites located on the
promoter regions of many nuclear genes encoding mitochondrial proteins such as cytochrome c, components of the ETC
(electron transport chain), Tfam (mitochondrial transcription
factor A) as well as mitochondrial fusion/fission and import
proteins. The latter is important because with the exception

Volume 1, July 2011

P2: ABC

JWBT335-c100042
JWBT335/Comprehensive Physiology
April 9, 2011
11:9

Figure 2 A simplified scheme summarizing some known signaling pathways/networks that are preferentially activated with endurance-type training. Energy depletion and elevated
calcium levels are the main stressors initiating mitochondrial biogenesis and slow fiber programs by increasing PGC-1alpha transcription. Consult Endurance Exercise Training
paragraph for details.

P1: OTA/XYZ
Printer Name: Yet to Come

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

of 13 mitochondria-coded proteins, all proteins that constitute


mitochondria are nuclear coded and hence must be imported
into mitochondria via the mitochondrial protein import pathway. This includes all proteins necessary for replication and
transcription of mtDNA (mitochondrial DNA). Mitochondrial biogenesis requires the coordination between nuclearand mitochondrial-coded proteins [see (144)]. Tfam is an
important regulator of the replication and transcription of mitochondrial DNA and has been found to be increased with
endurance training in humans (25), rats (360), and electrically stimulated cell cultures (163). As indicated above, Tfam
is coregulated by PGC-1. It thus appears that abundance of
nuclear-coded mitochondrial proteins is regulated on the gene
expressional level, while abundance of mitochondrial-coded
mitochondria proteins is regulated by increasing the amount of
mtDNA at a constant rate of expression (144). PGC-1 thus
controls the dual genomic regulation of mitochondrial biogenesis. PGC-1 activity is modulated by many upstream kinases [as indicated in Fig. 2] including p38 (MAPK), CaMK,
MEF2, calcineurin, p53 (protein 53, a tumorsuppressor), and
SIRT1. PGC-1 is sufficient to induce mitochondrial biogenesis. However, PGC-1 is not necessary for the mitochondrial
training response as the absence of PGC-1 in PGC-1 deficient mice reduces mitochondrial transcript levels but does not
abolish the training response (212). In skeletal muscle, PGC1 is expressed more in the oxidative type I and IIA fibers than
in the glycolytic type IIX fibers (213), while activity acutely
induces PGC-1 (282), inactivity rapidly reduces PGC-1
levels (320). There is evidence from transgenic mice, overexpressing PGC-1, that PGC-1 is also involved in enhanced
muscle lipogenesis and intramyocellular lipid accumulation
(355) a hallmark of endurance trained human skeletal muscle (151). There has been some recent interest in repeated
short-duration very intense muscle work aiming at increas 2 max over very short training periods. This type of
ing Vo
high-intensity aerobic interval training has been shown to be
more effective than low-intensity or threshold-intensity endurance exercise in humans (140). Under these conditions,
signaling pathways linked to mitochondrial biogenesis such
as the PGC-1, AMPK, and p38-MAPK pathways are activated, while pathways linked to muscle growth (discussed
below), typically stimulated by high-intensity exercise remain
silent (113).
PGC-1 has been identified by homology to PGC-1 and
shown to be differently regulated from PGC-1 in brown adipose tissue (213) and in liver (214). Its role in skeletal muscle
tissue is less well defined than that of PGC-1. Transgenic
mice, overexpressing PGC-1 induce mitochondrial biogenesis as well as a conversion of the fiber type complement
toward the oxidative type I and type IIA fibers (213). PGC1 overexpression also activates the mitochondrial program
but represses type I and type IIA MHC (myosion heavy chain)
favoring oxidative type IIX fibers instead (11). The value of
this observation for the situation in humans is unclear as in
humans (unlike in mice) type IIX fibers have a distinctly glycolytic character (325).

1392

Comprehensive Physiology

Transcriptional corepressors
The PGC-1 family of transcriptional activators is seen as
a major coordinator of activity-, nutritional-, circadian-,
environmental-, and humoral-related upregulations of
metabolic pathways in many tissues including skeletal muscle
(215). Transcriptional repressors have been invoked to control situations in which global suppression of transcription
is critical, such as in hibernation in mammals (248). Upon
entry into torpor body temperature in hibernators drops to
ambient temperature and metabolic functions need to be adjusted accordingly. While transcription and translation need
to be broadly suppressed, hibernation-specific genes related
to cytoprotection need to be upregulated. It is suggested that
epigenetic mechanisms similar to those mentioned above for
the transcriptional coactivator PGC-1 such as DNA methylation, histone modification SUMOylation as well as a differential expression of miRNA (microRNA) are at work (248).
However, transcriptional corepressors, in particular RIP140
(aka NRIP1, nuclear receptor-interacting protein 1) have been
shown to be important regulatory effectors in skeletal muscle
cells playing an important role in regular metabolic homeostasis as counterparts of transcriptional activators such as
PGC-1 (385). RIP140 is an 1158 amino acid protein in humans, highly expressed in adipose tissue, liver, and muscle.
It is expressed in a fiber-type-specific manner with a low expression in oxidative (type I) fibers. RIP140 can repress the
activity of many nuclear receptors. The recruitment of RIP140
to nuclear receptors is mediated by NR boxes [consisting of
specific amino acid (AA) motifs] of which RIP140 contains
10. These motifs are highly conserved among species and
are believed to confer NR specificity as well as redundancy
(385). RIP140 is believed to function as a linker protein between nuclear receptors and chromatin remodeling enzymes
responsible for chromatin condensation and transcriptional
repression (53). There is evidence from experiments using
transgene-overexpression and knockout models for RIP140
that there is a direct interplay between PGC-1 and RIP140 as
genes involved in fatty acid oxidation and mitochondrial biogenesis are upregulated in muscle in the absence of RIP140
(337). This suggests that there is similarity between PGC-1
and RIP140 target genes with RIP140 primarily acting as a
repressor and PGC-1 as an activator.

Exercise-induced angiogenesis
The main consequence of endurance exercise training consists
of enabling muscle tissue to maintain a larger power output
aerobically, that is, to completely break down the main substrates, carbohydrates, and lipids, to CO2 (carbon dioxide) and
H2 O (water) in mitochondria. This is achieved by increasing
the mitochondrial content in trained muscle cells. It is safe to
assume that mitochondrial oxygen consumption closely tracks
training-induced increase in mitochondrial volume (150). To
meet increased mitochondrial oxygen demand, oxygen supply
needs to be augmented as well, and it is well documented that

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

muscles increase capillarity with endurance training (81, 156,


155). Likewise, upstream arterioles increase in number and
size (384) and even major arterial conduit vessels to trained
muscle groups dilate with exercise training (158).
Two different modes of angiogenesis have been described,
namely sprouting and splitting/intussusception (82, 399).
Sprouting is triggered by the activation of capillary endothelial cells, which are induced to divide and express higher levels
of MMPs (matrix metalloproteinases). These MMPs catalyze
the degradation of the capillary surrounding basement membrane permitting the abluminal outgrowth of new capillary
segments that then sprout and eventually contact and merge
with existing capillaries (370).
By contrast, intussusceptive angiogenesis is achieved by
intraluminal splitting of a preexisting capillary. Increased levels of shear stress exerted by blood components in response
to vasodilation of upstream arteries trigger the protrusion of
endothelial cell processes into the capillary lumen (77). Endothelial protrusions extending from opposing sides of the
lumen have been shown to make contact and can then form
transluminal pillars. These can increase in girth until they ultimately separate the vascular segment into two independent
microvessels without endothelial cell proliferation.
It is likely that both sprouting and intussusceptive angiogenesis contribute to the growth of the capillary bed in
response to endurance exercise (81, 288). Most investigations
have focused on the impact of the major vascular endothelial
growth factor VEGF to trigger the angiogenic process, which
is upregulated in skeletal muscle fibers after exercise (126,
299). VEGF, predominantly synthesized in skeletal muscle
fibers, is believed to augment the proliferation and migration
of endothelial cells (the hallmarks of sprouting). In addition,
VEGF also enhances the permeability of the microvasculature and influences hyperemia-dependent vasodilation (leading to intussusceptive angiogenesis). Its molecular interaction
with the endothelial located VEGF-A receptor KDR correlates with the onset of angiogenesis in skeletal muscle (155).
Higher levels of VEGF-A may also be produced in endothelial cells of capillaries in response to endurance exercise by pathways independent of adrenergic stimulation. The
molecular cascades underlying nonadrenergic induction of
VEGF expression have been shown to depend on the shear
stress-triggered, NFB-dependent upregulation of eNOS (endothelial nitric oxide synthase) concentration and activity in
vascular endothelial cells (70). As a consequence of shear
stress-induced higher availability of NO, the biosynthesis rate
of VEGF is increased (20, 155).
Numerous additional factors such as angiopoietins and
PDGFs (platelet-derived growth factor) need to be present in
a specific local distribution and temporal sequence for the
formation and maintenance of functional vessels (169). Local tissue hypoxia via HIF-1 as well as the metabolic sensor
AMPK has long been hypothesized to be important factors
inducing angiogenesis. However, tissue-specific deletion of
HIF-1 leads to an increase rather than a decrease in capillarity
(231) and mice with a dominant negative form of AMPK in

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

muscle tissue are capable of an adequate exercise-induced increase in capillarity (401). In elegant recent experiments using
mice with a muscle-specific knockout of PGC-1 (52) have
demonstrated that PGC-1 is a major mediator for exerciseinduced angiogenesis. Their data indicate that -adrenergic
signaling induces expression of isoforms of PGC-1 (PGC12 and PGC-13) from an alternative promoter of PGC-1.
This is achieved through activation of CREs (cAMP responsive elements) on the alternative promoter of PGC-1 likely
via canonical cAMP signaling. PGC-1, under -adrenergic
control, induces angiogenic factors such as VEGF, PDGF-B,
and ANG2 (angiopoietin 2) with other angiogenic factors repressed or unaffected (PDGF-A and FGF, fibroblast growth
factor). There is evidence that PGC-12 regulates VEGF by
activating the orphan nuclear receptor ERR. The alternative promoter, putting PGC-1 under -adrenergic control,
seems to be specifically induced in skeletal muscle tissue and
BAT (brown adipose tissue). Interestingly, BAT has also been
shown to be capable of angiogenesis with -adrenergic stimulation independent of HIF-1 (391). It is likely that a number
of different signaling pathways interact with -adrenergic
signaling-induced angiogenesis in skeletal muscle tissue.

Summary molecular mechanisms in


endurance exercise
Endurance-type exercise has been shown to result in immediate as well as protracted signaling in skeletal muscles. We
currently see a complex but certainly still incomplete picture
of a signaling network with multiple entry points (Fig. 2). Signaling results in a coordinated transcriptional upregulation of
a multitude of genes involved in the endurance response. The
coordinated muscle transcriptional upregulation of structure
genes results in accretion of specific muscle proteins enabling
muscle to function on a higher level of metabolic performance.
It is highly likely that exercise-associated Ca2+ signaling as
well as an altered skeletal muscle energy status, sensed by
the AMPK system are the major input determinants to the
signaling network in humans. ROS/redox signaling as well as
hypoxia sensing may serve to modify and fine tune the generic
muscle endurance response according to environmental cues
and intensities. The signaling process is sensitive to substrate
availability, whereby fatty acids rely on the PPAR system
whereas glycogen content directly modulates AMPK signaling. Exercise-related-elevated circulating epinephrine levels
are suggested to be important for the induction of angiogenesis through cAMP pathways. Interestingly, all regulatory
pathways converge on the transcriptional coactivator PGC-1
that in itself does not recognize specific DNA sequences, but
rather binds and activates multiple transcription factors and
nuclear receptors. PGC-1 can recruit chromatin remodeling complexes (215) thus facilitating transcription; it further
interacts with the splicing machinery thereby coordinating
transcriptional as well as posttranscriptional processes [see
(339)]. PGC-1 can be seen as an integrator of muscle tissue
phenotype in response to activity, hormonal and nutritional

1393

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

cues. PGC-1 is complemented by RIP140, a transcriptional


corepressor. RIP140 seems to be targeted to similar transcription factors and nuclear receptors as PGC-1 but is of opposite
action.

Strength Training
Subjecting skeletal muscles to repetitive high mechanical
stress leads to muscle hypertrophy. In classical strength training paradigms, it is suggested that novices train 2 to 3 times
per week with loads corresponding to an 8 to 12 repetition
maximum, while for more experienced subjects, heavier load
protocols and up to 4 to 5 training sessions per week are suggested by the ACSM in 2009 (American College of Sports
Medicine). Using a novice protocol, we could show that
6 weeks of strength training in a population of male college students lead to an increase of muscle cross-sectional
area [estimated by CT (computer tomography)-scan] of 8.4%
(224). Using ultrastructural morphometry on biopsies of the
vastus lateralis muscle, it was further shown that the increase
in muscle volume/mass was entirely due to an increase of
myofibrils. The calculated absolute volume of mitochondria
remained unchanged with the training intervention. Training
20 young women for 20 weeks (twice weekly) using upper
and lower body strength training increased lean tissue volume
estimated by DEXA (dual X-ray absorptiometry) of arms and
legs significantly by 9.7 and 3.3%, respectively (50). In both
studies, estimates of performance gains were larger than those
reported for muscle volume (see below). Long-term resistance
exercise leads to substantial increases in individual fiber crosssectional area, whereby there is a larger increase in the area
of fast twitch than of slow twitch muscle fibers (194, 362).
A case observation of a world champion shot putter indicates
that type II fibers can reach sizes larger than twice that of
type I fibers (32). The distribution of type I (slow) to type II
(fast) fibers is generally reported to remain unchanged with
strength training. If intense strength training is carried out for
longer periods of time (i.e., 3 times/week for 16 weeks), there
is a shift within type II subtypes with an almost complete
disappearance of type IIX fibers and a concomitant increase
of type IIA fibers (194). It is generally assumed that markers
of oxidative capacity (mitochondria) and of oxidative supply
(capillaries) of muscle tissue change little in absolute terms
with strength training, but rather get diluted in a larger muscle
fiber volume (145). It is of note, that there are several mechanisms of neuronal adaptations to strength training leading to
important functional gains independent of structural changes
(102, 112, 317). It is commonly reported that neuronal adaptations are more important in the early phase (i.e., the first
few weeks) of a strength training period, however, it has also
been suggested that neuronal mechanisms may become more
important in old age (353).
In strength training, it is customary to distinguish concentric from eccentric modes of muscle contraction. During concentric contractions, muscles shorten during activation, while

1394

Printer Name: Yet to Come

Comprehensive Physiology

in eccentric contractions activated muscles lengthen (217).


At the same angular velocities, eccentric contractions provide
more torque at lower metabolic costs and with less neuronal
activation than concentric contractions (30, 31, 183). While
most exercises commonly used during strength training sessions contain both a concentric (shortening) and an eccentric
(lengthening) phase, protocols have been developed that allow for exclusive eccentric exercise (206, 250). Meta-analyses
indicate that eccentric exercise is superior to concentric exercise with regard to gain of muscle volume and strength
(304) related to the fact that higher training intensities (muscle loads) generally show better results in resistance exercise
(276) whereby loads of minimally 60% of the individual one
repetition minimum seem to be required (203). In the context
of the current review, we will only discuss effects of concentric vs. eccentric training modes when explicit mention is
made as to the mode of contraction. In most cases, it is assumed that training interventions contain both concentric and
eccentric exercise components.

Nutrition and muscle protein synthesis


Muscle mass is rather constant throughout human adult life.
This is achieved by a balance between the processes of muscle protein synthesis and muscle protein degradation. With
advancing age, this balance is disturbed and muscle functions
decline as a consequence of a loss of muscle mass through
muscle fiber atrophy and a reduction of the number of motor units as well as a loss of intrinsic muscle contractile and
metabolic properties. This condition is referred to as sarcopenia and is not subject of the current review. As sarcopenia
is seen as a major public health problem in ageing developed societies, it has received considerable recent attention
[see (174, 316, 330)]. As long as our bodies are capable of
maintaining a balance between muscle protein accretion and
muscle protein loss, this can be attributed to the ingestion of
protein containing meals, resulting in hyperaminoacidemia. It
has been shown that circulation of anabolic nutrients (leucine
in particular) is sensed by mTOR (mammalian target of rapamycin) resulting in considerable increase in muscle protein
synthesis through both enhanced translation initiation and
translation elongation (111). mTOR is considered to be a key
integrator of multiple positive and negative stimuli affecting
skeletal muscle mass as discussed in some detail below and
as shown in Figure 3. mTOR is importantly involved in the
control of translation initiation, a key event in regulation of
protein synthesis, by phosphorylation of downstream targets
that modulate binding of mRNA to the 43S ribosomal preinitiation complex [see (187)].
Current evidence suggests that in the nondiseased state,
the regulation of muscle mass is more importantly dependent
on modifications of muscle protein synthesis than of protein
degradation [see (278)]. During acute exercise, it is found that
protein synthesis is blunted through suppressed mRNA translation initiation and elongation, whereas the fate of muscle
protein breakdown under exercise conditions has remained

Volume 1, July 2011

Contractions
JWBT335/Comprehensive Physiology
April 9, 2011
11:9

of mechanical stress and hormonal stimulation. Downstream activation of p70S6K, initation, and elongation factors leads to an increased mRNA translation. As a consequence of the
gain in muscle mass, number of nuclei (proliferation of satellite cells) must be adjusted to maintain a constant myonuclear domain. Consult Strength Training paragraph for details.

P2: ABC

JWBT335-c100042

Figure 3 A selection of stressors and subsequent signaling pathways and networks engaged with strength-type training. The Akt-mTOR pathway is thought to be the main integrator

HGF, androgens,
IGF, FGF, BMP, NO

P1: OTA/XYZ
Printer Name: Yet to Come

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

less well defined (202, 309). Cellular protein synthetic rate


depends on translational efficiency (protein synthesis per unit
amount of mRNA) and on translational capacity (i.e., ribosomal content per unit tissue) (244). The modulation of translational efficiency has received the major share of scientific
scrutiny, although it is certain that both mechanisms are active
and coordinated in muscle hypertrophy (254).
Muscle protein synthesis has been shown to depend on the
ingestion of essential amino acids (375) whereby the amino
acid leucine alone can act as a stimulatory signal (8). A sensor
for extracellular essential amino acid concentration (leucine)
has thus been proposed by Bohe et al. (35), while Wackerhage and Rennie (376) suggest that leucine is capable of
direct mTOR activation additive to Akt (protein kinase B,
PKB) activation. The response of the (extracellular) amino
acid concentration driven muscle protein synthesis in skeletal
muscle in young and old male subjects is found to be curvilinear reaching a plateau at 10 g of ingested essential amino
acids independent of age but with a decreased responsiveness
of protein synthesis rate in older individuals (66, 203). To
reach a plateau in protein synthesis rate after an intense bout
of leg-resistance exercise 20 g of dietary proteins are required
(247). These authors showed signaling protein phosphorylation (p70S6K1) to be independent of protein dose suggesting
that exercise had already fully stimulated the signaling machinery and that protein synthesis had thus become essentially
dependent on amino acid availability. The literature currently
shows a considerable mismatch between signaling events and
muscle protein accretion (121) and it remains somehow elusive how amino acids alone or in combination with resistance
exercise affect muscle protein synthesis.

The IGF-Akt-mTOR axis


IGF-1 is a peptide hormone that shares a 50% amino acid
identity with insulin. As opposed to the insulin gene, the IGF1 gene locus encodes multiple protein isoforms in multiple
tissues, notably in liver and skeletal muscle. The rodent IGF-1
gene consists of 6 exons with multiple transcription start sites
on exon 1 and exon 2 (330). It is known that IGF-1 transcripts
that are initiated at exon 2 are mostly restricted to the liver
and are highly growth hormone sensitive, while transcripts
initiated at exon 1 are expressed in many tissues to act in
an autocrine and paracrine fashion and are less GH (growth
hormone) dependent. IGF-1 acts as a circulating hormone as
well as a local growth factor. IGF-1 action is modulated by
a family of six circulating IGF-binding proteins (97) as well
as through posttranscriptional regulation involving miRNAs
(see below) on the tissue level (207). Considerable interest was
generated by the report that in response to mechanical stimuli
muscle is capable of generating a peptide distinct from the
canonical mature IGF-1 peptide by alternative splicing (117).
This mRNA now commonly referred to as IGF-1Eb is also
called MGF (mechano-growth factor). However, the role of
IGF-1Eb as well as its putative peptide (and a syntetically
manufactured peptide also called MGF) in satellite cell and

1396

Comprehensive Physiology

myoblast proliferation, in aging and as a neuroprotective agent


has remained controversial (233).

Insulin- and insulin-like growth factor receptors


Skeletal muscle contains tetrameric receptors binding insulin,
IGF-1 and/or IGF-2. These receptors (IR, insulin receptor;
IGF-1R, type-l insulin-like growth factor receptor) consist of
two extracellular ligand binding domains and two membrane spanning domains acting as tyrosine kinases (Fig. 3).
While insulin receptors are involved in metabolic regulation,
the type-l insulin-like growth factor receptor controls normal
growth and development. In muscle tissue, IGF-1R specifically regulates various aspects of satellite cell-driven myogenesis such as proliferation, differentiation, and fusion (3).
By contrast, IGF-2R is a single transmembrane domain protein that is involved in clearing IGF-2 from the cell surface,
attenuating signaling, and tumor growth as stimulated by cytokines (271). The function of IGF-1R is to activate several
intracellular signaling pathways mainly the PI3K (phosphoinositide 3-kinase)-Akt-mTOR pathway, but also the ERKMAPK pathway and the PKC pathway in cultured muscle
cells and myoblasts (67, 305). The PI3K pathway is seen as
the main pathway through which muscle protein synthesis is
stimulated in response to IGF-1 and in part also in response
to mechanical activity. However, it has also been shown that
IGF-1 receptor signaling is not critical for the induction of
muscle hypertrophy, and that there are other upstream mechanisms for induction of mTOR (344).
IGF-1R binds IGF-1 with a 6-fold higher affinity than
IGF-2. Upon binding of IGF-1, the receptor undergoes a
conformational change leading to activation of the tyrosine
kinases. Additional tyrosines are phosphorylated serving as
docking sites for signaling proteins such as IRS-1 (insulin
receptor substrate-1) which is subsequently phosphorylated
(56). IRS-1 in turn serves as docking protein for signaling intermediates such as p85, the regulatory subunit of PI3K. The
PI3K-mediated increase in PIP3 (phosphatidylinositol 3,4,5trisphosphate) leads to recruitment of Akt from the cytosol to
the sarcolemma and phosphorylation of Akt at sites Thr308
and Ser473 (269).

The Akt proteins


The Akt protein family consists of three genes, coding for
Akt1, Akt2, and Akt3, respectively, all enzymes of the
serine/threonine-specific protein family. In muscle tissue Akt1
appears to be more involved in muscle hypertrophy, while
Akt2 plays a dominant role in insulin-stimulated glucose uptake (55). The pivotal role of Akt activation for muscle protein
accretion has been demonstrated in situ in the rat plantaris
overload model (34). It is further interesting to note that Akt
is activated in rats in treadmill running as well as with passive
stretch of muscles in a fiber-type specific manner (315). Activation of Akt is sufficient to induce muscle hypertrophy in

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

vivo as shown by transgene-models conditionally expressing a


constitutively active form of Akt (165, 204). However, details
of the factors that control Akt activation in human exercise are
scant, much of what we know has been learned from cell culture experiments and from the role of the IGF-1-Akt-mTOR
axis in other tissues and in tumors. An important mode of
Akt downstream function is that activated Akt leads to phosphorylation of TSC2 (tuberous sclerosis protein 2, tuberin) in
the TSC1 (tuberous sclerosis protein 1, hamartin)/TSC2 protein complex which is translocated from the sarcolemma to
the cytosol likely through the 14-3-3 scaffold protein (245).
TSC2 is a GAP (GTPase-activating protein) for Rheb (Ras homolog enriched in brain) (160). Rheb in its GTP (guanosine5 -triphosphate) charged form is the dominant positive regulator of mTORC1 (mTOR complex 1), one of the two distinct
mTOR complexes (see below). This activation occurs possibly through a lipid signaling cascade (356). Phosphorylated
Akt further suppresses GSK3 (glycogen synthase kinase 3
) (199) an enzyme that has been shown to have an inhibitory
effect on elF-2B (eukaryotic translation initiation factor 2B)
a well known translational enhancer (246). In addition to its
role in stimulating muscle hypertrophy, Akt has also been
shown to inhibit the induction of atrophy signaling through
FOXO (see below) (321, 350).
The IGF-1-Akt-mTOR axis is not only instrumental in
increasing protein accretion but there is also good evidence
that it is capable of counteracting atrophy signaling occurring in disease states (sepsis, cachexia, high doses of external glucocorticoids, diabetes, etc.) through factors such as
TNF (tumor necrosis factor ) or IL-1 (interleukin-1). Muscle atrophy in these conditions is partly dependent on the
induction of E3 ubiquitin ligases such as MuRF-1 (muscle
ring finger protein 1) and MAFbx [Muscle atrophy F box, Fbox only protein 32 (FBXO32), aka Atrogin-1] (314) which
ubiquitinate structural muscle proteins such as myosin heavy
chains. Ubiquitinated muscle proteins are thus targeted for
proteosomal degradation. FOXO1/3 (forkhead box O1/O3)
transcription factors have been shown to be important for
the transcriptional control of MuRF-1 and MAFbx. Human
experimentation shows that repetitive resistance exercise is
capable of attenuating MuRF-1 and MAFbx gene expression
(228). As nuclear location and DNA binding are necessary for
FOXO action, the exclusion of FOXO from the nucleus by
activated Akt, suppresses MAFbx and possibly MuRF-1 transcription (321). Discordant results of the control of MAFbx
and MuRF-1 transcription in various systems open the possibility of a distinct role of these ubiquitin ligases in muscle
atrophy (336, 377).

mTOR and associated proteins


mTOR is a highly conserved serine-threonine kinase. mTOR
is a key regulatory protein for cell processes such as cell
proliferation, cell growth, differentiation, protein synthesis,
cytoskeletal organization, energy homeostasis, and substrate
metabolism (301). The major downstream effector of mTOR

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

is p70s6K (ribosomal protein S6 kinase -1). The latter has


been shown to negatively feed back on IRS-1 (313). mTor
has been established both as an integral component of the
insulin signaling cascade and an insulin-independent nutrient
sensor (137, 197, 366). mTOR is further a key mediator of
strength exercise-induced adaptations in skeletal muscle (58).
mTOR exists in two structurally and functionally different
multiprotein complexes mTORC1 and 2 (mTOR complex 1
and 2, respectively). mTORC1 is mTOR with several associated proteins including raptor (regulatory associated protein of mTOR) (301). mTORC1 has p70S6K1 as a primary
phosphorylation target and enhances translation via 4E-BP1
(eukaryotic translation initiation factor 4E-binding protein)
inhibition (see also Fig. 3). The mTORC1 signaling pathway
is seen as critical in control of muscle protein synthesis in
response to nutrition and exercise (79). These authors point
out that mTORC1 is a key node in muscle intracellular signaling, integrating inputs from insulin signaling, energy status,
amino acids, and other nutrients as well as growth factors.
mTORC2 (mTOR associated among other proteins with rictor, rapamycin-insensitive companion of mTOR) seems to be
a positive regulator of insulin-stimulated glucose uptake via
feedback on Akt (200) but not involved in contraction signaling. mTORC1 can negatively regulate glucose uptake by
p70S6K1-mediated repression of IRS-1 and thus can act as
an antagonist to mTORC2 in glucose homeostasis.
As indicated above, mTOR is positively regulated by
growth factors (IGF-1) and insulin through the PI3K-AktTSC1/TSC2-Rheb pathway. It is further well established that
amino acid availability (specifically leucine) is an important
regulator of mTOR in human strength training protocols (78).
However, it is currently unclear by which mechanisms nutrients modulate mTOR and whether this occurs through the
Akt-Rheb pathway, independent of it or both. hVps34 (vacuolar sorting protein 34; a Class III phosphinositide kinase 3)
a known regulator of autophagy has been suggested to be an
Akt independent nutrient sensor for mTOR (16). It has further been suggested that Rag proteins (a family of four related
small GTPases) can stimulate mTOR activity possibly by collocating mTOR with its activator Rheb (186, 318). It remains
to be seen how the latter findings gained in drosophila and in
cell culture apply to mTOR regulation in adult differentiated
mammalian skeletal muscle.
As first shown by Bodine et al. (34) and well established
since, there is a strong association of mechanical loading
and mTOR activation. Mechanical load is sufficient to activate mTOR and mTOR activation can occur in a PI3K independent manner. This implies a cytoskeletal contribution
for mTOR signaling with mechanical load. In this context,
FAK (focal adhesion kinase) has been shown to play a role
in mechano-regulated signaling of muscle protein synthesis
(192). These authors identify FAK as an Akt independent
element of the mechano-sensory pathway of p70S6K activation. Further, Hornberger et al. (152) have shown a PI3KAkt independent mechanical activation of mTOR involving
PLD (phospholipase D) and its lipid second messenger PA

1397

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

(phosphatidic acid). Likewise, cell culture and in vitro experiments suggest that PLD1 is a downstream effector of Rheb
and activator of mTORC1 (357).
It is well established that mTOR is sensitive to cellular
energy status through the input of the AMPK pathway (161).
It is suggested that an AMPK-dependent phosphorylation of
TSC2 leads to subsequent inhibition of mTOR activity under
low-energy conditions (162). Cell culture experiments further
suggest that AMPK is capable of directly phosphorylating the
mTORC1 binding partner raptor, required to inhibit mTOR
activity (162). The role of AMPK is emphasized by the finding
of an inhibition of leucine stimulated protein synthesis in rat
skeletal muscle by AICAR (an AMPK activator, see above)
through repression of mTOR signaling (289). The relevance of
the AMPK suppression of mTOR activity in skeletal muscle
tissue is underscored by the observation that AICAR also
suppresses mTOR activation induced by eccentric electrical
stimulation of rat EDL (extensor digitorum longus muscle)
(363).
REDD1 and REDD2 (regulated in development and DNA
response) have been identified in drosophila as negative factors regulating mTOR (363). The authors suggested that
REDD could mediate cross-talk between oxygen sensing and
growth. There are several lines of evidence suggesting that
REDD1 and REDD2 can negatively regulate mTOR downstream of Akt and upstream of TSC2 under various stress
conditions such as hypoxia, alcohol intoxication, and high
doses of glucocorticoids (245). In low-intensity strength training in humans, it was shown that expression of REDD1 (and
myostatin) mRNA was significantly decreased 3 h after exercise (80), while REDD2 mRNA expression was found to be
reduced 3 and 6 h after a single bout of heavy resistance exercise combined with essential amino acid ingestion (79). This
suggests that the REDD pathways are relevant for contractionmediated control of skeletal muscle size in humans by negative control over mTOR activation.
The IGF-1-Akt-mTOR axis is the major integrator of signaling related to maintenance and in training to the increase
of adult skeletal muscle tissue. Several feedback controlled
signaling pathways bring together information on hormone,
cytokine, mechanical, and nutrient status of muscle cells and
influence muscle mass by modifying translational events at
multiple sites. There is important crosstalk with cellular energy status as well as with metabolic signaling mainly related
carbohydrate and amino acids.

Printer Name: Yet to Come

Comprehensive Physiology

the main myostatin receptor ActRIIB (activin A receptor, type


IIB), all show an increase in skeletal muscle size. In plasma,
the secreted myostatin can complex with different regulatory
proteins whereby follistatin seems to play a dominant role
in regulating bio-available myostatin levels (268). It has been
suggested that other members of the TGF- superfamily (such
as activins and GDF-11) also show myostatin-like activity.
Myostatin signals through ActRIIB that then allows for
interaction with type I receptors Alk4 (aka ACVR1B, activin receptor type-1B) and Alk5 (aka TGFRI) (369). Binding of myostatin to these receptors results in phosphorylation and nuclear relocation of the transcription factors Smad
2/3 (downstream transcription factors of ActR-mediated signalling) (294). Skeletal muscles secrete myostatin which is
thought to act both through systemic circulation (210) and
possibly more importantly through autocrine/paracrine mechanisms in a muscle and fiber-type-specific manner (86, 241).
During development, myostatin action is temporally and spatially regulated in part by the presence or absence of expression of ActRIIB by muscle stem cells. While myostatin
may induce cellular quiescence in the limb bud of the developing embryo; in the myotome, myostatin induces myogenic differentiation and depletion of muscle progenitor cells
(226, 268).
In adulthood, myostatin appears as a secreted factor
that negatively regulates muscle size and is seen as a pivotal procachectic growth factor and key molecule in muscle wasting (240). Using gene-electrotransfer to overexpress
myostatin in rat tibialis anterior muscle (6), myostatin decreased skeletal muscle mass by acting as a negative regulator of the Akt-mTOR pathway. Additionally, Welle et al.
(383) showed that reducing myostatin expression with conditional gene targeting experiments exploiting the cre/lox system by more than 60% resulted in increased muscle mass.
Myostatin depletion resulted in an increase of RNA to DNA
concentration without evidence of altered Akt-mTOR or p38MAPK signaling. Myostatin has further been shown to activate JNK (c-Jun N-terminal kinase) through the TAK1MKK4 (aka MAPK4) cascade in differentiating C2C12 cells
(mouse myoblast cell line) (154). These authors showed that
the myostatin-dependent activation of the JNK pathway suppresses muscle cell growth and differentiation by downregulation of myogenin and MyoD. Taken together these findings
indicate that myostatin is a major factor for the control of
adult skeletal muscle mass using both mTOR-dependent and
mTOR-independent mechanisms.

Myostatin
Myostatin, a TGF- (transforming growth factor ) superfamily member is a master regulator of embryonic myogenesis and early muscle growth (6, 241). Transgenic mice lacking
myostatin show a massive increase in skeletal muscle mass
with some muscles increasing in size by 2- to 3-fold when
compared to wild-type mice. Similarly, mice engineered to
overexpress the myostatin propeptide, the naturally occurring
myostatin inhibitor follistatin or a dominant negative form of

1398

Satellite cells in muscle growth and repair


Skeletal muscle is a highly differentiated tissue comprising
postmitotic myonuclei. Repair and growth of muscle fibers
therefore depend on myogenic precursor cells called satellite cells initially described in 1986 by Mauro (236). Satellite
cells (accounting for 1-4% of the sublaminal nuclei of muscle fibers) are the resident stem cells of muscle tissue. They
are wedged between the basal lamina and the sarcolemma of

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Comprehensive Physiology

the myofiber. They fulfill the basic criteria of stem cells as they
can give rise to postmitotic myonuclei used in maintenance,
growth, and repair of myofibers but also maintain the stem
cell population by self renewal (397, 398). The mechanisms
that govern self renewal and commitment to differentiation
are still being actively investigated (310). In unstressed muscle tissue, satellite cells are essentially quiescent expressing
several markers including Pax7 (paired box protein pax-7),
M-cadherin (aka CDH15, cadherin 15), Myf5 (myogenic factor 5), and CD34 (cluster of differentiation 34) whereby there
is no single marker specific for or inclusive of entire population (22, 159). Upon activation, MyoD is rapidly induced in
satellite cells. It has been suggested that the satellite cells that
downregulate Pax7 and maintaining MyoD expression commit to myogenesis, while those that maintain Pax7 and downregulate MyoD become quiescent again (397). FGF, HGF
(hepatocyt growth factor), IGF, NO, and BMP (bone morphogenetic protein) have been reported to be involved in satellite
cell activation (57, 95, 302, 338, 392). However, the detailed
molecular mechanisms responsible for satellite cell activation
remain sketchy and may well be different for maintenance,
growth, and repair (116, 201, 359)
As discussed above, recent literature has established a central role for mTOR in the control of muscle mass by integrating
signaling by growth factors, nutrients, mechanical stress, energy status, and hormones through translational mechanisms
(see Fig. 4). Hypertrophy, that is, growth of muscle fibers by
accretion of protein, is the obvious consequence of mTORassociated signaling. Muscle growth at a constant number
of myonuclei has been shown to be limited to approximately
20% in humans with resistance exercise (182). Muscle growth
beyond some 20% of muscle mass therefore needs satellite
cell induction to maintain the nucleus/cytoplasm ratio.
A critical role in skeletal muscle growth (and repair) is
assigned to Notch and Wnt signaling pathways. Notch is a
receptor acting as a membrane-tethered transcription factor.
Notch ligands trigger proteolytic cleavage of the receptor releasing an intracellular domain that translocates to the nucleus
and interacts with the CSL (CBF1, Su(H), Lag-1) family of repressors. Activation of Notch target genes then occurs through
activation of chromatin modifying enzymes (84). Notch signaling allows cells to adopt or forfeit a particular fate (83).
Notch signaling occurs hours to days after muscle injury (63).
Upregulation of Notch signaling commits activated satellite
cells to become proliferating myogenic precursor cells and
prevents myoblasts to differentiate into myotubes (62, 190).
Notch signaling thus seems particularly critical in the early
phase of muscle repair, in cooperation with other signaling
pathways, such as TGF- and FOXO1, also involved in myoblast proliferation (189, 193). Wnt signaling is also essential
at least in muscle repair (332). Notch signaling is required
for the expansion of myogenic progenitor cells, while Wnt
upregulated later during a muscle injury response (283) coincides with myoblast differentiation (42). This indicates that
crosstalk between early Notch signaling and later Wnt signaling is necessary for the orderly progression of the repair

Volume 1, July 2011

Molecular Plasticity of Skeletal Muscle

response in postnatal myogenesis. It is currently less well understood how these mechanisms operate during physiological
muscle hypertrophy. More physiological models of muscle
cell injury, such as forced eccentric contractions or overload
hypertrophy, also involve MAPK, ERK, JNK, and p38 signaling [see (367)]. However, the involvement of Notch and
Wnt signaling is not well defined under these conditions and
needs further scrutiny (368).

Androgens
Meta-analyses of clinical trials provide evidence that testosterone application increases skeletal muscle mass, muscle
strength, and power in a dose-dependent manner inducing
muscle fiber hypertrophy (both fiber types) and increases the
number of myonuclei as well as satellite cells in young and
elderly men (28). However, the precise mechanisms are complex and only partially studied and understood (see below).
Due to the favorable profile of androgen supplementation in
men and in view of age-associated sarcopenia, large-scale
clinical trials have been conducted to evaluate potential functional benefits in a population of elderly men (>65 years) with
limited mobility and normal to low total serum testosterone
levels (18). It was found that testosterone therapy was associated with significant improvements in leg-press and chestpress strength as well as in stair-climbing performance. However, the trial was terminated ahead of schedule and before
enrollment had been completed because the incidence of adverse cardiovascular events was significantly higher in the
testosterone than in the placebo group.
In steroid using athletes, muscle biopsies indicate that
both muscle fiber hypertrophy and hyperplasia by formation
of new muscle fibers are responsible for observed gains in
muscle mass (181). The authors infer that activation and incorporation of satellite cells in preexisting muscle fibers are the
main mechanisms of muscle growth. Comparing steroid using
power-lifters to power-lifters abstaining from steroid use, it
was found that steroid users had significantly larger muscle
fibers than nonusers (by approx. 50% in vastus lateralis and
trapezius muscle), with the number of myonuclei, both subsarcolemmal and central, linearly correlated to fiber size (88).
Using a murine model of age-induced sarcopenia, Kovacheva
et al. (195) showed that the age-dependent loss of muscle
mass was associated with an increase in muscle cell apoptosis. High-dose testosterone treatment entirely suppressed
age-related changes in mice. Testosterone treatment resulted
in a reduction of oxidative stress and a concomitant reduction
in muscle cell apoptosis. Testosterone treatment further prevented processing of precursor myostatin, resulting in lower
levels of active myostatin. As a consequence, the JNK pathway involved in preventing muscle growth is downregulated
to levels comparable to young animals. In this murine model
of sarcopenia, testosterone-induced muscle fiber hypertrophy
was also associated with a stimulation of Notch1 signaling and
a suppression of the CDK (cyclin-dependent kinase) inhibitor
p21 (cyclin-dependent kinase inhibitor 1). The latter is known

1399

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

to play an important role in the growth arrest of differentiating myoblasts (191). Last but not least, testosterone treatment
increased Akt phosphorylation in a dose-dependent manner.
Taken together, this study provides evidence for a number
of independent pathways involved in testosterone action in
muscle tissue. Using a murine C3/H/10T1/2 (mouse embryo
fibroblast) cell line under myogenic conditions, Singh et al.
(341) demonstrated that androgens could regulate myogenic
differentiation by the interaction of androgen receptor with
-catenin and TCF-4 (T-cell factor 4) activating a number
of Wnt target genes such as follistatin (a myostatin antagonist, see above). An interesting aspect of androgen action
lies in its reciprocal activity on muscle and fat tissue and its
effects on bone mineral density. Possible mechanisms of the
opposite influence of androgens on muscle and fat tissue have
been discussed by Fernando et al. (94). The current mostly
correlative evidence on the molecular mechanisms of androgen action mainly gained in cell culture experiments suggests
that androgens interfere with multiple signaling pathways,
stimulating cellular metabolism, enhancing growth and inhibiting apoptosis. In view of the unfavorable cardiovascular
and prostate cancer-related side effects of testosterone treatment, it is not surprising that pharmacological substances
with a favorable activity profiles (SARMselective androgen
receptor modulator) witness a substantive discovery effort
[see (29)].

Summary molecular mechanisms in


strength training
Unlike endurance training that modifies muscle structure
mainly by changes in gene expression level, strength-type
training is more associated with enhanced translation. The
key component and major integrator of multiple signaling cascades is mTOR. There are three major activators
of mTOR. Insulin- and GH-dependent growth factors act
through the IGF-R (insulin receptor)-Akt pathway. Mechanical stress (relayed partially through integrins) signals through
Akt-dependent and Akt-independent pathways. Nutritional
cues, particularly the presence of leucine and other essential
amino acids are directly sensed by mTOR. Activated mTOR
increases protein synthesis, both through translation initiation and elongation, by phosphorylation of its effector kinase p70S6K. There are two important negative regulators of
mTOR. A low cellular energy status decreases mTOR activation via AMPK. Myostatin, a major muscle procachectic
factor, can repress mTOR directly and indirectly (discussed
later in more detail). As protein synthesis-dependent hypertrophic growth of skeletal muscle tissue is limited by nuclear domain size, muscle fiber growth beyond 20% must
be supported by recruitment of satellite cells. Satellite cells,
located beneath the basement membrane of muscle fibers,
have stem cell character and can be activated by a number of
growth factors (i.e., FGF, HGF, BMP, etc.), their further fate
in terms of proliferation and differentiation being controlled
by Notch and Wnt signaling and the myogenic regulatory fac-

1400

Printer Name: Yet to Come

Comprehensive Physiology

tors MyoG (myogenin) and MyoD (myogenic differentiation


factor, Myf3). Chronic low-level elevation of inflammatory
cytokines such as TNF- and IL-6 (interleukin-6) are important players in muscle atrophy by repressing the Akt-mTOR
signaling cascade as well as myogenic regulatory factors.
By contrast, muscle activity decreases chronic inflammation
partly by acute secretion of anti-inflammatory myokines. Androgens have been shown to interfere with multiple signaling
pathways involved in enhancing muscle cellular metabolism
as well as muscle growth and inhibiting apoptosis. Recent evidence further suggest that miRNAs might be redundantly but
comprehensively involved in myogenesis and possibly also
in muscle phenotypic plasticity with endurance and strengthtype exercise training.

Interactions of Endurance
and Strength Training
Hickson (141) was the first to systematically analyze the adaptational outcome of strength and endurance exercise alone
and in combination. He showed that simultaneous training
for strength and endurance resulted in a reduced capacity
to develop strength but did not compromise the increase in
2 max. This is not surprising in view of the fact that there are
Vo
distinct molecular pathways responsible for the training adaptations in strength and endurance as outlined above. There
have been several reviews covering molecular aspects of concurrent training for strength and endurance (13,14, 135, 255).
As reviewed by Nader (255), compromised neuronal activation, low glycogen content, diverging fiber-type transformations, and overtraining have all been implicated in reducing
strength development in concurrent strength and endurance
training protocols but these assertions fail to satisfactoraly
explain the observed phenomena. It has been observed that
sustained dynamic exercise results in decreased protein synthesis and increased protein degradation; the latter being compensated in long-term training (296). By using short bursts of
high-frequency stimulation (simulating strength training) or
continuous low-frequency stimulation (simulating endurance
training) in isolated rat EDL and soleus muscle, Atherton
et al. (12) could show preferential activation of the AktmTOR signaling cascade with the strength and preferential
activation of AMPK-PGC-1 signaling with the endurance
protocol. Based on this data they introduced the concept of
an AMPK-Akt master switch determining the adaptive response between endurance- and strength-type exercises. It is
evident that this is a too simplistic explanation for strengthendurance exercise interactions (see Fig. 4). Independent of
the suppression of mTOR by activated AMPK, Rose et al.
(306) have shown rapid phosphorylation of eEF2 (eukary 2 max
otic elongation factor 2) during cycling at 67% of Vo
in humans potentially also being responsible for a reduction
in protein synthesis under these conditions. Exposing cyclists
and power lifters to strength training and an endurance type

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Comprehensive Physiology

Molecular Plasticity of Skeletal Muscle

Endurance training

Strength training
High-frequency stimulation

Low-frequency stimualtion

Growth factors
i.e. IGF1

Sustained
contractions

2+

Ca

Energy
AMP:ATP

Growth factor
receptors

Mechanical
signaling

integrins

PI3K

FAK
PDK1

Akt

CamK

P
PGC-1

TSC2

AMPK
mTOR

Tfam

FoxO

Tfam

mtDNA

Tfam

MuRF

p70s6K

MAFBx

mtDNA

Mitochondrial
biogenesis

eEF2K

eEF2
4E-BP1

Protein
degradation

Slow fiber programs

Protein
synthesis
Fast fiber programs

Figure 4 Simplified model of the molecular interference of endurance and strength training. AMPK (endurance) and mTOR (strength) activity are
thought to be the main points of divergence with concurrent endurance and strength exercise training. Consult Interactions Between Endurance
and Strength Training paragraph for details.

exercise session mainly demonstrated an attenuation of the


molecular training response in the training session concordant
with training history but a retained capacity to respond to the
alternative training stimuli (61). The same authors also evaluated the molecular response of endurance exercise immediately followed by strength training or vice versa (59). Their
data indicates that acute concurrent training leads to compromised activation of anabolic and aerobic training responses.
Aerobic exercise preceding strength exercise lessens the anabolic response whereas training in the inverse order (strength
followed by endurance) increases inflammation and protein
degradation. Looking at repeated sprint followed by strength

Volume 1, July 2011

training or vice versa, Coffey et al. (60) could demonstrate a


moderate interference of exercise modes with repeated sprint
training being the overriding stimulus attenuating translation
initiation and increasing ubiquitin ligase expression. These
authors therefore suggested that divergent training activities
should be incorporated into dedicated training periods. The
interference of strength and endurance training on a molecular level therefore seems to support the tendency in elite sport
to dedicate entire training periods to specific training modes.
This is of particular interest in sports that require both a high
competence in strength and endurance such as alpine skiing,
decathlon, or American Football.

1401

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

Cytokines and Myokines


Over the last 10 years, it has become increasingly clear that
skeletal muscle tissue and molecular phenomena related to
use and adaptations of skeletal muscle tissue are important
determinants in a variety of chronic diseases. CNCD (chronic
noncommunicable diseases) such as cardiovascular conditions, some cancers, metabolic syndrome-related disorders
(insulin resistance, type 2 diabetes, dyslipidemia, hypertension, obesity, etc.), muscle- and joint-related diseases (osteoarthritis, rheumatoid arthritis, myositis, osteoporosis, fibromyalgia, etc.), depression, and others have become the
major burden on health care systems world wide (68). It has
become increasingly clear that low-grade chronic inflammation plays a major role in the pathogenesis of most of these
diseases (234). Moreover, energy expenditure in physical activity and exercise capacity have been shown to be better
predictors of all cause mortality than established risk factors such as hypertension, smoking, diabetes, and obesity
(253). Regular physical activity has been shown to offer protection from chronic diseases with low grade inflammation
(274). There is evidence that regular physical activity lowers
level of systemic inflammation markers such as C-reactive
protein and interleukins (256). These authors have therefore
advocated exercise in clinical conditions such as polymyositis and dermatomyositis for which exercise was previously
contraindicated (223). Physical activity has been shown to
induce systemic levels of cytokines with anti-inflammatory
properties (275). This lead to the introduction of the concept of myokines, defined as cytokines that are produced and
released by contracting skeletal muscle fibers, exerting an effect in other organs of the body making muscle an endocrine
organ (92). A number of cytokines have been suggested
to fulfill the criteria of myokines such as IL-6, IL-8, IL-15,
BDNF (brain-derived neurotrophic factor), LIF (leukemia inhibitory factor), FGF21, and follistatin-like-1 [see (43)].There
is extensive cytokine crosstalk between adipocytes and active
muscle cells, in regulating long-term and short-term energy
metabolism a topic not discussed in depth in this review [see
(234, 347)].
With regard to skeletal muscle activity and skeletal muscle loss in various pathological conditions and in ageing, two
cytokines, TNF- and IL-6, are of particular notion. It is
suggested that TNF- secreted from adipocytes around arterioles and from adipocytes in visceral fat could play an
important role in chronic inflammation (395). TNF- has further been implicated as a critical mediator in insulin resistance
by interfering with insulin receptor signaling (153). Dietary
restriction alone and in combination with exercise as well
as a shift from a high to a low fat diet reduces TNF- and
other inflammatory markers and suggests that a decrease in
body (fat) mass is important in reducing chronic inflammation
(208, 396). In this context, IL-6 and its somewhat controversial role in muscle and low grade inflammation needs to be
mentioned. IL-6, mainly produced by immune cells in adipose tissue, is consistently found to be moderately elevated in

1402

Comprehensive Physiology

inactivity, obesity and insulin resistance (273). However, the


same authors also demonstrate that IL-6 levels are increased
up to 100-fold during muscle activity and in the postexercise
period. It has therefore been hypothesized that IL-6 effects
may differ greatly between chronic elevation as with inactivity/obesity and acute more pronounced elevation as seen
with exercise (262, 272). Several signaling pathways have
been proposed for TNF- and low-level IL-6 action; common to both cytokines seems to be the activation of JNK with
a consequent decrease in IRS-1 signaling and a repression of
myogenic regulatory factors MyoD and MyoG. The positive
effect of activity-associated acute elevations of IL-6 appears
to be integrated via AMPK phosphorylation (262).
Cytokines such as IL-6 and TNF-, but also leptin,
adiponectin, resistin, ghrelin, and many others are involved
in the dynamic control of energy metabolism communicating
energy and nutrient status of the organism to the hypothalamus, the liver, adipose tissue and to skeletal muscle. In this
context, AMPK has emerged as one of the major integrators
of cytokine signaling (348).

Role of miRNAs
miRNA are small (approx. 19-23 nucleotide long) noncoding
RNAs characterized by the association with Argonaute (Arg)
proteins and by their function to guide these RNA/protein
complexes to specific nucleic acid sequences (4, 91, 242).
miRNA base pair with complementary sequences of untranslated regions of target mRNAs leading to the formation of a
so-called RNA-induced silencing complex (RISC). The RNAmediated silencing machinery functions by silencing RNA in
various regulatory networks, thus regulating gene expression
by degradation of RNA, inhibition of translation initiation
and elongation, co-translational protein degradation and premature termination of translation (ribosome drop-off). Vital
functions of the RNA silencing comprise also epigenetic alterations in DNA and chromatin structure as well as accurate
chromosome segregation during cell division (90, 242, 380).
In humans close to 400 miRNAs have been identified
(205) with a single miRNA being capable of repressing
100 to 200 target mRNAs (198). miRNAs have been shown
to be critically involved in the regulation of myogenesis. This
has amply been documented in the C2C12 cell line in which
distinct miRNAs have been shown to modulate skeletal muscle proliferation and differentiation (48, 179). Not surprising
then is the demonstration that miR-181 is involved in muscle
regeneration as demonstrated in an in vivo model of muscle
injury by repressing a repressor of muscle differentiation, the
homeobox protein Hox-A11 (257). In heart it was shown that
three myosin genes encode miRNAs on highly conserved introns that are involved in redundant regulation of muscle fiber
identity mediated by transcriptional repressors (371). These
authors present evidence that the same miRNAs (miRNA208b and miRNA-499) are also involved in activation of the
slow fiber program in skeletal muscle with some regulatory

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Comprehensive Physiology

interactions shared between heart and skeletal muscle. Consistent with this observation, these miRNAs have been shown
to be significantly downregulated by 60% and 40%, respectively, after hindlimb suspension-induced muscle atrophy in
rat soleus muscle (239). The same study detected expression
of 151 miRNAs of which 18 were significantly regulated after
2 and 7 days of hindlimb suspension.
While there is substantial support of the involvement of
miRNAs in cardiac hypertrophy [see (46, 386)], there is so
far scant direct evidence of miRNA involvement in plasticity
of adult skeletal muscle. However, in view of the pervasive
occurrence of miRNAs, it is not surprising to find instances
for the role of miRNAs in endurance- and strength-type adaptations as well as in skeletal muscle control of metabolism.
As examples, miRNA-696 was shown to be involved in the
regulation of PGC-1 both by exercise and by immobilization in mice (10). miRNA-1 has been shown to be involved in
the regulation of IGF-1 transduction cascade (87) and demonstrated impaired regulation of miRNA-1 and miRNA-133 by
insulin in skeletal muscle of type 2 diabetic patients (120).
As shown by the myosin-controlled regulatory network,
MyomiR, in heart and skeletal muscle (371), miRNAs can
represent an additional layer of phenotypic control, whereby
protein coding genes with critical roles for tissue function
encode miRNAs ensuring coregulation of the gene program
with a set of associated miRNAs. An interesting twist to the
role of miRNAs in the regulation of gene expression is offered by the observation in tumors, that miRNA abundance
can be controlled by mRNA emanating from pseudogenes. In
this situation, transcription of a pseudogene can regulate coding gene expression by competing for miRNA binding (284).
In addition to their role in posttranscriptional regulation of
gene expression, miRNAs are recognized as potentially useful targets for therapeutic use. They offer an option to modify
tissue modeling or pathological processes by interfering with
mRNA function without perturbing coding gene-related tissue
function.

Epigenetic Modifications and their


Relevance for Muscle
In this review, we have pointed in various instances at epigenetic modifications of DNA as being responsible for acute
changes in gene expression. Specifically, these epigenetic
modifications comprise changes in DNA methylation, alterations in chromatin folding as a consequence of histone modifications and miRNA-dependent gene silencing (37, 115, 122,
249). As indicated in previous sections, epigenetic modifications can be of transient nature, occurring during ongoing
transcriptional activation or repression (54). However, they
can also be more permanent serving a molecular memory
function (see below) or even establish an epigenetic state that
is heritable in the absence of changes to the sequence of
the genome (188). Epigenetic mechanisms are invoked in in-

Volume 1, July 2011

Molecular Plasticity of Skeletal Muscle

stances where perturbations of the perinatal environment are


known to have persistent pathological consequences through
adolescence and adulthood of offsprings (358). Epigenetic
mechanisms may further function to store information of exposure of organisms to previous challenges and thus function
as molecular memory, that is, metabolic memory in diabetes
(365). Looking at epigenetic markers over time, it has been
shown in young monozygotic twins that they are both genetically and epigenetically indistinguishable (103). Older twins
vary remarkably with regard to content and distribution of
methylated DNA and histone acetylation. The authors suggest that this may be an important mechanism by which different phenotypes arise from the same genotype. In the context
of muscle tissue this might imply that exercise history may
change the muscle epigenome with consequences on future
trainability, metabolic signaling of muscle or on the development of sarcopenia. There is currently no direct experimental
evidence for any of these conjectures. Baar (15) has recently
reviewed the evidence for epigenetic control of the skeletal
muscle fiber type. He concludes that in animal models, there
is considerable evidence for epigenetic imprinting of muscle precursor cells predisposing them to develop into fast- or
slow-type muscle fibers. In humans, the data is not conclusive and satellite cells may not be confined to distinct slow or
fast lineages (38). However, epigenetics is a field with a rapid
development and with many opportunities and surprises for
muscle research in the immediate future.

Conclusion
Papers relevant to the molecular mechanisms of muscle plasticity currently appear at a rate of more than 200 papers/month
and over 300 reviews have covered aspects of this topic in the
last 2 years. It seems therefore practically impossible to keep
track of the explosive growth of the field and the exponential
accretion of knowledge. Over the last 20 years, this scientific
onslaught has unveiled many of the mechanisms underlying
phenotypic plasticity of adult (human) skeletal muscle tissue.
In endurance exercise, the transcriptional-coactivator PGC1 has been identified as the major integrator of signaling
associated with low-level long-term activation of muscle activity with the main consequences of inducing mitochondria
and capillaries. In strength training, mTOR coordinates the
translational enhancement leading to accretion of proteins of
the myofibrillar contractile apparatus. In both endurance and
strength training, we see us confronted with multiple parallel
networks of signaling cascades sharing crucial nodes making
these networks interdependent and endowed with redundancy.
We know with certainty that not all relevant nodes or connections of these networks have been identified. We realize that
the organization of the signaling networks is not hierarchical
or in any way logical and the interaction of the partners of the
network is promiscuous. This chaotic nature of the control of
the phenotype essentially reflects the outcome of evolution.
Feed-back and feed-forward control connects network nodes

1403

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

over single and multiple signaling levels making networks


robust but rendering intuitive guesses about the behavior of
these networks and their input-output functions all but completely unfeasible (7). Computer simulations combined with
experimentation will be necessary to understand even simple signaling networks (74). We need to continue to collect
data on experimentally accessible parts of the adaptational
machinery and integrate knowledge gained in vitro, in cell
culture and in model animals. We further need to consider
a number of additional factors important for understanding
the behavior of signaling. In eukaryotic cells, localization and
spatial restriction of proteins are part of the network functionality. Likewise, transient activation-deactivation, degradation,
diffusion, transport, and crosstalk of proteins are all important attributes of partners in signaling networks and need to be
considered in modeling gene regulatory networks (139, 185).
We currently understand on a mostly static and descriptive
level how internal and external cues are integrated and contribute to phenotypic plasticity of skeletal muscle tissue. Any
mechanical understanding of the precise interactions of the
critical partners constituting the signaling machinery is still
beyond reach. We have therefore to be extremely cautious
in extrapolating knowledge gained in models of any level of
complexity to the human situation. We see it as a particular
challenge at present to design experiments that make use of
available knowledge to test regulatory predictions in human
skeletal muscle plasticity.

Comprehensive Physiology

8.

9.
10.

11.

12.

13.
14.
15.
16.
17.
18.

19.
20.

Acknowledgements
The authors gratefully acknowledge yearlong support of
the Swiss National Science Foundation, the University of
Bern, the Eidgenossische Sportkommission, and the Schweizerische Stiftung fur die Erforschung der Muskelkrankheiten.

21.
22.

23.
24.

References
1.

2.
3.

4.
5.
6.

7.

Adams J, Chen ZP, Van Denderen BJ, Morton CJ, Parker MW, Witters LA, Stapleton D, Kemp BE. Intrasteric control of AMPK via the
gamma1 subunit AMP allosteric regulatory site. Protein Sci 13: 155165, 2004.
Al-Shanti N, Stewart CE. Ca2+/calmodulin-dependent transcriptional
pathways: Potential mediators of skeletal muscle growth and development. Biol Rev Camb Philos Soc 84: 637-652, 2009.
Allen RE, Boxhorn LK. Regulation of skeletal muscle satellite cell
proliferation and differentiation by transforming growth factor-beta,
insulin-like growth factor I, and fibroblast growth factor. J Cell Physiol
138: 311-315, 1989.
Ambros V. The functions of animal microRNAs. Nature 431: 350-355,
2004.
Ameln H, Gustafsson T, Sundberg CJ, Okamoto K, Jansson E,
Poellinger L, Makino Y. Physiological activation of hypoxia inducible
factor-1 in human skeletal muscle. FASEB J 19: 1009-1011, 2005.
Amirouche A, Durieux AC, Banzet S, Koulmann N, Bonnefoy R,
Mouret C, Bigard X, Peinnequin A, Freyssenet D. Down-regulation
of Akt/mammalian target of rapamycin signaling pathway in response
to myostatin overexpression in skeletal muscle. Endocrinology 150:
286-294, 2009.
Amit I, Citri A, Shay T, Lu Y, Katz M, Zhang F, Tarcic G, Siwak D,
Lahad J, Jacob-Hirsch J, Amariglio N, Vaisman N, Segal E, Rechavi
G, Alon U, Mills GB, Domany E, Yarden Y. A module of negative

1404

25.

26.
27.
28.

29.
30.
31.
32.

feedback regulators defines growth factor signaling. Nat Genet 39:


503-512, 2007.
Anthony JC, Reiter AK, Anthony TG, Crozier SJ, Lang CH, MacLean
DA, Kimball SR, Jefferson LS. Orally administered leucine enhances
protein synthesis in skeletal muscle of diabetic rats in the absence of
increases in 4E-BP1 or S6K1 phosphorylation. Diabetes 51: 928-936,
2002.
Antonio J, Gonyea WJ. Skeletal muscle fiber hyperplasia. Med Sci
Sports Exerc 25: 1333-1345, 1993.
Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H,
Yoshikawa T. The microRNA miR-696 regulates PGC-1{alpha} in
mouse skeletal muscle in response to physical activity. Am J Physiol
Endocrinol Metab 298: E799-E806, 2010.
Arany Z, Lebrasseur N, Morris C, Smith E, Yang W, Ma Y, Chin S,
Spiegelman BM. The transcriptional coactivator PGC-1beta drives the
formation of oxidative type IIX fibers in skeletal muscle. Cell Metab 5:
35-46, 2007.
Atherton PJ, Babraj J, Smith K, Singh J, Rennie MJ, Wackerhage
H. Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR
signaling can explain specific adaptive responses to endurance or resistance training-like electrical muscle stimulation. FASEB J 19: 786-788,
2005.
Baar K. The signaling underlying FITness. Appl Physiol Nutr Metab
34: 411-419, 2009.
Baar K. Training for endurance and strength: Lessons from cell signaling. Med Sci Sports Exerc 38: 1939-1944, 2006.
Baar K. Epigenetic control of skeletal muscle fibre type. Acta Physiol
(Oxf) 199: 477-487, 2010.
Backer JM. The regulation and function of Class III PI3Ks: Novel roles
for Vps34. Biochem J 410: 1-17, 2008.
Baldwin KM, Haddad F. Effects of different activity and inactivity
paradigms on myosin heavy chain gene expression in striated muscle.
J Appl Physiol 90: 345-357, 2001.
Basaria S, Coviello AD, Travison TG, Storer TW, Farwell WR, Jette
AM, Eder R, Tennstedt S, Ulloor J, Zhang A, Choong K, Lakshman
KM, Mazer NA, Miciek R, Krasnoff J, Elmi A, Knapp PE, Brooks B,
Appleman E, Aggarwal S, Bhasin G, Hede-Brierley L, Bhatia A, Collins
L, Lebrasseur N, Fiore LD, Bhasin S. Adverse events associated with
testosterone administration. N Engl J Med 263: 109-122, 2010.
Bassel-Duby R, Olson EN. Signaling pathways in skeletal muscle remodeling. Annu Rev Biochem 75: 19-37, 2006.
Baum O, Da Silva-Azevedo L, Willerding G, Wockel A, Planitzer
G, Gossrau R, Pries AR, Zakrzewicz A. Endothelial NOS is main
mediator for shear stress-dependent angiogenesis in skeletal muscle
after prazosin administration. Am J Physiol Heart Circ Physiol 287:
H2300-H2308, 2004.
Beale EG, Forest C, Hammer RE. Regulation of cytosolic phosphoenolpyruvate carboxykinase gene expression in adipocytes. Biochimie
85: 1207-1211, 2003.
Beauchamp JR, Heslop L, Yu DS, Tajbakhsh S, Kelly RG, Wernig A,
Buckingham ME, Partridge TA, Zammit PS. Expression of CD34 and
Myf5 defines the majority of quiescent adult skeletal muscle satellite
cells. J Cell Biol 151: 1221-1234, 2000.
Beckman JS. Oxidative damage and tyrosine nitration from peroxynitrite. Chem Res Toxicol 9: 836-844, 1996.
Bellomo G, Vairetti M, Stivala L, Mirabelli F, Richelmi P, Orrenius
S. Demonstration of nuclear compartmentalization of glutathione in
hepatocytes. Proc Natl Acad Sci U S A 89: 4412-4416, 1992.
Bengtsson J, Gustafsson T, Widegren U, Jansson E, Sundberg CJ. Mitochondrial transcription factor A and respiratory complex IV increase
in response to exercise training in humans. Pflugers Arch 443: 61-66,
2001.
Bensinger SJ, Tontonoz P. Integration of metabolism and inflammation
by lipid-activated nuclear receptors. Nature 454: 470-477, 2008.
Beyer RE, Fattore JE. The influence of age and endurance exercise on
the myoglobin concentration of skeletal muscle of the rat. J Gerontol
39: 525-530, 1984.
Bhasin S, Calof OM, Storer TW, Lee ML, Mazer NA, Jasuja R, Montori VM, Gao W, Dalton JT. Drug insight: Testosterone and selective
androgen receptor modulators as anabolic therapies for chronic illness
and aging. Nat Clin Pract Endocrinol Metab 2: 146-159, 2006.
Bhasin S, Jasuja R. Selective androgen receptor modulators as function
promoting therapies. Curr Opin Clin Nutr Metab Care 12: 232-240,
2009.
Bigland-Ritchie B, Graichen H, Woods JJ. A variable-speed motorized bicycle ergometer for positive and negative work exercise. J Appl
Physiol 35: 739-740, 1973.
Bigland-Ritchie B, Woods JJ. Integrated electromyogram and oxygen
uptake during positive and negative work. J Physiol 260: 267-277,
1976.
Billeter R, Jostarndt-Fogen K, Gunthor W, Hoppeler H. Fiber type
characteristics and myosin light chain expression in a world champion
shot putter. Int J Sports Med 24: 203-207, 2003.

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

33.
34.

35.
36.

37.
38.

39.
40.
41.
42.
43.
44.
45.
46.
47.
48.

49.
50.

51.
52.

53.
54.
55.

56.
57.

58.
59.

60.

Bloor CM. Angiogenesis during exercise and training. Angiogenesis 8:


263-271, 2005.
Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein
R, Zlotchenko E, Scrimgeour A, Lawrence JC, Glass DJ, Yancopoulos GD. Akt/mTOR pathway is a crucial regulator of skeletal muscle
hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol 3:
1014-1019, 2001.
Bohe J, Low A, Wolfe RR, Rennie MJ. Human muscle protein synthesis
is modulated by extracellular, not intramuscular amino acid availability:
A dose-response study. J Physiol 552: 315-324, 2003.
Bolster DR, Crozier SJ, Kimball SR, Jefferson LS. AMP-activated protein kinase suppresses protein synthesis in rat skeletal muscle through
down-regulated mammalian target of rapamycin (mTOR) signaling. J
Biol Chem 277: 23977-23980, 2002.
Bonasio R, Tu S, Reinberg D. Molecular signals of epigenetic states.
Science 330: 612-616.
Bonavaud S, Agbulut O, Nizard R, DHonneur G, Mouly V, ButlerBrowne G. A discrepancy resolved: Human satellite cells are not preprogrammed to fast and slow lineages. Neuromuscul Disord 11: 747-752,
2001.
Bonen A, Dohm GL, van Loon LJ. Lipid metabolism, exercise and
insulin action. Essays Biochem 42: 47-59, 2006.
Boveris A, Chance B. The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J
134: 707-716, 1973.
Boyadjiev N. Increase of aerobic capacity by submaximal training and
high-fat diets. Folia Med (Plovdiv) 38: 49-59, 1996.
Brack AS, Conboy IM, Conboy MJ, Shen J, Rando TA. A temporal
switch from notch to Wnt signaling in muscle stem cells is necessary
for normal adult myogenesis. Cell Stem Cell 2: 50-59, 2008.
Brandt C, Pedersen BK. The role of exercise-induced myokines in
muscle homeostasis and the defense against chronic diseases. J Biomed
Biotechnol 2010: 520258, 2010.
Burgin M, Eberbach E. Cooperative combinatorial optimization: Evolutionary computation case study. Biosystems 91: 34-50, 2008.
Burns KA, Vanden Heuvel JP. Modulation of PPAR activity via phosphorylation. Biochim Biophys Acta 1771: 952-960, 2007.
Callis TE, Wang DZ. Taking microRNAs to heart. Trends Mol Med 14:
254-260, 2008.
Carriere A, Ray H, Blenis J, Roux PP. The RSK factors of activating
the Ras/MAPK signaling cascade. Front Biosci 13: 4258-4275, 2008.
Chen JF, Mandel EM, Thomson JM, Wu Q, Callis TE, Hammond SM,
Conlon FL, Wang DZ. The role of microRNA-1 and microRNA-133
in skeletal muscle proliferation and differentiation. Nat Genet 38: 228233, 2006.
Cheng B, Karamizrak O, Noakes TD, Dennis SC, Lambert EV. Time
course of the effects of a high-fat diet and voluntary exercise on muscle
enzyme activity in Long-Evans rats. Physiol Behav 61: 701-705, 1997.
Chilibeck PD, Calder A, Sale DG, Webber CE. Twenty weeks of weight
training increases lean tissue mass but not bone mineral mass or density
in healthy, active young women. Can J Physiol Pharmacol 74: 11801185, 1996.
Chin ER. Role of Ca2+/calmodulin-dependent kinases in skeletal muscle plasticity. J Appl Physiol 99: 414-423, 2005.
Chinsomboon J, Ruas J, Gupta RK, Thom R, Shoag J, Rowe GC,
Sawada N, Raghuram S, Arany Z. The transcriptional coactivator PGC1alpha mediates exercise-induced angiogenesis in skeletal muscle. Proc
Natl Acad Sci U S A 106: 21401-21406, 2009.
Christian M, Tullet JM, Parker MG. Characterization of four autonomous repression domains in the corepressor receptor interacting
protein 140. J Biol Chem 279: 15645-15651, 2004.
Clayton AL, Hazzalin CA, Mahadevan LC. Enhanced histone acetylation and transcription: A dynamic perspective. Mol Cell 23: 289-296,
2006.
Cleasby ME, Reinten TA, Cooney GJ, James DE, Kraegen EW. Functional studies of Akt isoform specificity in skeletal muscle in vivo; maintained insulin sensitivity despite reduced insulin receptor substrate-1
expression. Mol Endocrinol 21: 215-228, 2007.
Clemmons DR. Role of IGF-I in skeletal muscle mass maintenance.
Trends Endocrinol Metab 20: 349-356, 2009.
Clever JL, Sakai Y, Wang RA, Schneider DB. Inefficient skeletal muscle
repair in inhibitor of differentiation knockout mice suggests a crucial
role for BMP signaling during adult muscle regeneration. Am J Physiol
Cell Physiol 298: C1087-C1099, 2010.
Coffey VG, Hawley JA. The molecular bases of training adaptation.
Sports Med 37: 737-763, 2007.
Coffey VG, Jemiolo B, Edge J, Garnham AP, Trappe SW, Hawley JA.
Effect of consecutive repeated sprint and resistance exercise bouts on
acute adaptive responses in human skeletal muscle. Am J Physiol Regul
Integr Comp Physiol 297: R1441-R1451, 2009.
Coffey VG, Pilegaard H, Garnham AP, OBrien BJ, Hawley JA. Consecutive bouts of diverse contractile activity alter acute responses in
human skeletal muscle. J Appl Physiol 106: 1187-1197, 2009.

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

61. Coffey VG, Zhong Z, Shield A, Canny BJ, Chibalin AV, Zierath JR,
Hawley JA. Early signaling responses to divergent exercise stimuli in
skeletal muscle from well-trained humans. FASEB J 20: 190-192, 2006.
62. Conboy IM, Conboy MJ, Smythe GM, Rando TA. Notch-mediated
restoration of regenerative potential to aged muscle. Science 302: 15751577, 2003.
63. Conboy IM, Rando TA. The regulation of Notch signaling controls
satellite cell activation and cell fate determination in postnatal myogenesis. Dev Cell 3: 397-409, 2002.
64. Conley KE, Kayar SR, Roesler K, Hoppeler H, Weibel ER, Taylor CR.
Adaptive variation in the mammalian respiratory system in relation to
energetic demand: IV Capillaries and their relationship to oxidative
capacity. Respir Physiol 69: 47-64, 1987.
65. Croce JC, McClay DR. Evolution of the Wnt pathways. Methods Mol
Biol 469: 3-18, 2008.
66. Cuthbertson D, Smith K, Babraj J, Leese G, Waddell T, Atherton P,
Wackerhage H, Taylor PM, Rennie MJ. Anabolic signaling deficits
underlie amino acid resistance of wasting, aging muscle. FASEB J 19:
422-424, 2005.
67. Czifra G, Toth IB, Marincsak R, Juhasz I, Kovacs I, Acs P, Kovacs L,
Blumberg PM, Biro T. Insulin-like growth factor-I-coupled mitogenic
signaling in primary cultured human skeletal muscle cells and in C2C12
myoblasts. A central role of protein kinase Cdelta. Cell Signal 18: 14611472, 2006.
68. Daar AS, Singer PA, Persad DL, Pramming SK, Matthews DR, Beaglehole R, Bernstein A, Borysiewicz LK, Colagiuri S, Ganguly N, Glass RI,
Finegood DT, Koplan J, Nabel EG, Sarna G, Sarrafzadegan N, Smith
R, Yach D, Bell J. Grand challenges in chronic non-communicable
diseases. Nature 450: 494-496, 2007.
69. Davies KJ, Quintanilha AT, Brooks GA, Packer L. Free radicals and
tissue damage produced by exercise. Biochem Biophys Res Commun
107: 1198-1205, 1982.
70. Davis ME, Grumbach IM, Fukai T, Cutchins A, Harrison DG. Shear
stress regulates endothelial nitric-oxide synthase promoter activity
through nuclear factor kappaB binding. J Biol Chem 279: 163-168,
2004.
71. de Lange P, Farina P, Moreno M, Ragni M, Lombardi A, Silvestri
E, Burrone L, Lanni A, Goglia F. Sequential changes in the signal
transduction responses of skeletal muscle following food deprivation.
FASEB J 20: 2579-2581, 2006.
72. de Silva E, Stumpf MP. Complex networks and simple models in biology. J R Soc Interface 2: 419-430, 2005.
73. Delling U, Tureckova J, Lim HW, De Windt LJ, Rotwein P, Molkentin
JD. A calcineurin-NFATc3-dependent pathway regulates skeletal muscle differentiation and slow myosin heavy-chain expression. Mol Cell
Biol 20: 6600-6611, 2000.
74. Di Ventura B, Lemerle C, Michalodimitrakis K, Serrano L. From in
vivo to in silico biology and back. Nature 443: 527-533, 2006.
75. Dietz MW, Piersma T, Dekinga A. Body-building without power training: Endogenously regulated pectoral muscle hypertrophy in confined
shorebirds. J Exp Biol 202 (Pt 20): 2831-2837, 1999.
76. Dillard CJ, Litov RE, Savin WM, Dumelin EE, Tappel AL. Effects
of exercise, vitamin E, and ozone on pulmonary function and lipid
peroxidation. J Appl Physiol 45: 927-932, 1978.
77. Djonov V, Baum O, Burri PH. Vascular remodeling by intussusceptive
angiogenesis. Cell Tissue Res 314: 107-117, 2003.
78. Dreyer HC, Drummond MJ, Pennings B, Fujita S, Glynn EL, Chinkes
DL, Dhanani S, Volpi E, Rasmussen BB. Leucine-enriched essential
amino acid and carbohydrate ingestion following resistance exercise
enhances mTOR signaling and protein synthesis in human muscle. Am
J Physiol Endocrinol Metab 294: E392-E400, 2008.
79. Drummond MJ, Dreyer HC, Fry CS, Glynn EL, Rasmussen BB. Nutritional and contractile regulation of human skeletal muscle protein
synthesis and mTORC1 signaling. J Appl Physiol 106: 1374-1384,
2009.
80. Drummond MJ, Fujita S, Abe T, Dreyer HC, Volpi E, Rasmussen BB.
Human muscle gene expression following resistance exercise and blood
flow restriction. Med Sci Sports Exerc 40: 691-698, 2008.
81. Egginton S. Invited review: Activity-induced angiogenesis. Pflugers
Arch 457: 963-977, 2009.
82. Egginton S, Zhou AL, Brown MD, Hudlicka O. Unorthodox angiogenesis in skeletal muscle. Cardiovasc Res 49: 634-646, 2001.
83. Ehebauer M, Hayward P, Arias AM. Notch, a universal arbiter of cell
fate decisions. Science 314: 1414-1415, 2006.
84. Ehebauer M, Hayward P, Martinez-Arias A. Notch signaling pathway.
Sci STKE 2006: cm7, 2006.
85. Ehrenborg E, Krook A. Regulation of skeletal muscle physiology and
metabolism by peroxisome proliferator-activated receptor delta. Pharmacol Rev 61: 373-393, 2009.
86. Elashry MI, Otto A, Matsakas A, El-Morsy SE, Patel K. Morphology
and myofiber composition of skeletal musculature of the forelimb in
young and aged wild type and myostatin null mice. Rejuvenation Res
12: 269-281, 2009.

1405

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

87.

88.
89.
90.
91.
92.
93.

94.

95.
96.

97.
98.
99.
100.
101.
102.
103.

104.
105.
106.

107.

108.

109.

110.
111.

Elia L, Contu R, Quintavalle M, Varrone F, Chimenti C, Russo MA,


Cimino V, De Marinis L, Frustaci A, Catalucci D, Condorelli G. Reciprocal regulation of microRNA-1 and insulin-like growth factor-1 signal
transduction cascade in cardiac and skeletal muscle in physiological
and pathological conditions. Circulation 120: 2377-2385, 2009.
Eriksson A, Kadi F, Malm C, Thornell LE. Skeletal muscle morphology
in power-lifters with and without anabolic steroids. Histochem Cell Biol
124: 167-175, 2005.
Escher P, Braissant O, Basu-Modak S, Michalik L, Wahli W, Desvergne
B. Rat PPARs: Quantitative analysis in adult rat tissues and regulation
in fasting and refeeding. Endocrinology 142: 4195-4202, 2001.
Eulalio A, Huntzinger E, Izaurralde E. Getting to the root of miRNAmediated gene silencing. Cell 132: 9-14, 2008.
Fabian MR, Sundermeier TR, Sonenberg N. Understanding how miRNAs post-transcriptionally regulate gene expression. Prog Mol Subcell
Biol 50: 1-20, 2010.
Febbraio MA, Pedersen BK. Contraction-induced myokine production
and release: Is skeletal muscle an endocrine organ? Exerc Sport Sci Rev
33: 114-119, 2005.
Feige JN, Gelman L, Tudor C, Engelborghs Y, Wahli W, Desvergne
B. Fluorescence imaging reveals the nuclear behavior of peroxisome
proliferator-activated receptor/retinoid X receptor heterodimers in the
absence and presence of ligand. J Biol Chem 280: 17880-17890,
2005.
Fernando SM, Rao P, Niel L, Chatterjee D, Stagljar M, Monks DA.
Myocyte androgen receptors increase metabolic rate and improve body
composition by reducing fat mass. Endocrinology 151: 3125-3132,
2010.
Filippin LI, Moreira AJ, Marroni NP, Xavier RM. Nitric oxide and
repair of skeletal muscle injury. Nitric Oxide 21: 157-163, 2009.
Finck BN, Bernal-Mizrachi C, Han DH, Coleman T, Sambandam N,
LaRiviere LL, Holloszy JO, Semenkovich CF, Kelly DP. A potential
link between muscle peroxisome proliferator- activated receptor-alpha
signaling and obesity-related diabetes. Cell Metab 1: 133-144, 2005.
Firth SM, Baxter RC. Cellular actions of the insulin-like growth factor
binding proteins. Endocr Rev 23: 824-854, 2002.
Fluck M. Functional, structural and molecular plasticity of mammalian
skeletal muscle in response to exercise stimuli. J Exp Biol 209: 22392248, 2006.
Fluck M, Booth FW, Waxham MN. Skeletal muscle CaMKII enriches
in nuclei and phosphorylates myogenic factor SRF at multiple sites.
Biochem Biophys Res Commun 270: 488-494, 2000.
Fluck M, Hoppeler H. Molecular basis of skeletal muscle
plasticityfrom gene to form and function. Rev Physiol Biochem Pharmacol 146: 159-216, 2003.
Fluck M, Waxham MN, Hamilton MT, Booth FW. Skeletal muscle
Ca(2+)-independent kinase activity increases during either hypertrophy or running. J Appl Physiol 88: 352-358, 2000.
Folland JP, Williams AG. The adaptations to strength training: Morphological and neurological contributions to increased strength. Sports
Med 37: 145-168, 2007.
Fraga MF, Ballestar E, Paz MF, Ropero S, Setien F, Ballestar ML,
Heine-Suner D, Cigudosa JC, Urioste M, Benitez J, Boix-Chornet M,
Sanchez-Aguilera A, Ling C, Carlsson E, Poulsen P, Vaag A, Stephan
Z, Spector TD, Wu YZ, Plass C, Esteller M. Epigenetic differences
arise during the lifetime of monozygotic twins. Proc Natl Acad Sci U
S A 102: 10604-10609, 2005.
Francaux M. Toll-like receptor signalling induced by endurance exercise. Appl Physiol Nutr Metab 34: 454-458, 2009.
Freyssenet D. Energy sensing and regulation of gene expression in
skeletal muscle. J Appl Physiol 102: 529-540, 2007.
Freyssenet D, Di Carlo M, Hood DA. Calcium-dependent regulation of
cytochrome c gene expression in skeletal muscle cells. Identification of
a protein kinase c-dependent pathway. J Biol Chem 274: 9305-9311,
1999.
Fritz T, Kramer DK, Karlsson HK, Galuska D, Engfeldt P, Zierath
JR, Krook A. Low-intensity exercise increases skeletal muscle protein
expression of PPARdelta and UCP3 in type 2 diabetic patients. Diabetes
Metab Res Rev 22: 492-498, 2006.
Frosig C, Jorgensen SB, Hardie DG, Richter EA, Wojtaszewski JF.
5 -AMP-activated protein kinase activity and protein expression are
regulated by endurance training in human skeletal muscle. Am J Physiol
Endocrinol Metab 286: E411-E417, 2004.
Fruchart JC, Duriez P, Staels B. Peroxisome proliferator-activated
receptor-alpha activators regulate genes governing lipoprotein
metabolism, vascular inflammation and atherosclerosis. Curr Opin
Lipidol 10: 245-257, 1999.
Fry AC. The role of resistance exercise intensity on muscle fibre adaptations. Sports Med 34: 663-679, 2004.
Fujita S, Dreyer HC, Drummond MJ, Glynn EL, Cadenas JG,
Yoshizawa F, Volpi E, Rasmussen BB. Nutrient signalling in the regulation of human muscle protein synthesis. J Physiol 582: 813-823,
2007.

1406

Printer Name: Yet to Come

Comprehensive Physiology

112. Gabriel DA, Kamen G, Frost G. Neural adaptations to resistive exercise:


Mechanisms and recommendations for training practices. Sports Med
36: 133-149, 2006.
113. Gibala M. Molecular responses to high-intensity interval exercise. Appl
Physiol Nutr Metab 34: 428-432, 2009.
114. Gibala MJ, McGee SL, Garnham AP, Howlett KF, Snow RJ, Hargreaves
M. Brief intense interval exercise activates AMPK and p38 MAPK
signaling and increases the expression of PGC-1{alpha} in human
skeletal muscle. J Appl Physiol 106: 929-934, 2009.
115. Gibney ER, Nolan CM. Epigenetics and gene expression. Heredity 105:
4-13, 2010.
116. Gill R, Hitchins L, Fletcher F, Dhoot GK. Sulf1A and HGF regulate
satellite-cell growth. J Cell Sci 123: 1873-1883, 2010.
117. Goldspink G. Gene expression in muscle in response to exercise. J
Muscle Res Cell Motil 24: 121-126, 2003.
118. Gomez-Cabrera MC, Domenech E, Romagnoli M, Arduini A, Borras C, Pallardo FV, Sastre J, Vina J. Oral administration of vitamin
C decreases muscle mitochondrial biogenesis and hampers traininginduced adaptations in endurance performance. Am J Clin Nutr 87:
142-149, 2008.
119. Gonyea WJ, Sale D. Physiology of weight-lifting exercise. Arch Phys
Med Rehabil 63: 235-237, 1982.
120. Granjon A, Gustin MP, Rieusset J, Lefai E, Meugnier E, Guller I, Cerutti
C, Paultre C, Disse E, Rabasa-Lhoret R, Laville M, Vidal H, Rome S.
The microRNA signature in response to insulin reveals its implication in the transcriptional action of insulin in human skeletal muscle
and the role of a sterol regulatory element-binding protein-1c/myocyte
enhancer factor 2C pathway. Diabetes 58: 2555-2564, 2009.
121. Greenhaff PL, Karagounis LG, Peirce N, Simpson EJ, Hazell M, Layfield R, Wackerhage H, Smith K, Atherton P, Selby A, Rennie MJ.
Disassociation between the effects of amino acids and insulin on signaling, ubiquitin ligases, and protein turnover in human muscle. Am J
Physiol Endocrinol Metab 295: E595-E604, 2008.
122. Grewal SI, Elgin SC. Transcription and RNA interference in the formation of heterochromatin. Nature 447: 399-406, 2007.
123. Guderley H. Functional significance of metabolic responses to thermal
acclimation in fish muscle. Am J Physiol 259: R245-R252, 1990.
124. Guerfali I, Manissolle C, Durieux AC, Bonnefoy R, Bartegi A,
Freyssenet D. Calcineurin A and CaMKIV transactivate PGC-1alpha
promoter, but differentially regulate cytochrome c promoter in rat skeletal muscle. Pflugers Arch 454: 297-305, 2007.
125. Gunn HM. Heart weight and running ability. J Anat 167: 225-233,
1989.
126. Gustafsson T, Puntschart A, Kaijser L, Jansson E, Sundberg CJ.
Exercise-induced expression of angiogenesis-related transcription and
growth factors in human skeletal muscle. Am J Physiol 276: H679H685, 1999.
127. Hamilton MT, Etienne J, McClure WC, Pavey BS, Holloway AK. Role
of local contractile activity and muscle fiber type on LPL regulation
during exercise. Am J Physiol 275: E1016-E1022, 1998.
128. Handschin C, Chin S, Li P, Liu F, Maratos-Flier E, Lebrasseur NK,
Yan Z, Spiegelman BM. Skeletal muscle fiber-type switching, exercise
intolerance, and myopathy in PGC-1alpha muscle-specific knock-out
animals. J Biol Chem 282: 30014-30021, 2007.
129. Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM. An autoregulatory loop controls peroxisome proliferator-activated receptor gamma
coactivator 1alpha expression in muscle. Proc Natl Acad Sci U S A 100:
7111-7116, 2003.
130. Hansen JM, Zhang H, Jones DP. Mitochondrial thioredoxin-2 has a key
role in determining tumor necrosis factor-alpha-induced reactive oxygen species generation, NF-kappaB activation, and apoptosis. Toxicol
Sci 91: 643-650, 2006.
131. Hardie DG, Sakamoto K. AMPK: A key sensor of fuel and energy
status in skeletal muscle. Physiology (Bethesda) 21: 48-60, 2006.
132. Hardie DG. AMP-activated/SNF1 protein kinases: Conserved
guardians of cellular energy. Nat Rev Mol Cell Biol 8: 774-785,
2007.
133. Hardie DG. Energy sensing by the AMP-activated protein kinase and
its effects on muscle metabolism. Proc Nutr Soc, in press.
134. Harridge SD. Plasticity of human skeletal muscle: Gene expression to
in vivo function. Exp Physiol 92: 783-797, 2007.
135. Hawley JA. Molecular responses to strength and endurance training:
Are they incompatible? Appl Physiol Nutr Metab 34: 355-361, 2009.
136. Hawley JA, Holloszy JO. Exercise: Its the real thing! Nutr Rev 67:
172-178, 2009.
137. Hawley JA, Lessard SJ. Exercise training-induced improvements in
insulin action. Acta Physiol (Oxf) 192: 127-135, 2008.
138. He ZH, Bottinelli R, Pellegrino MA, Ferenczi MA, Reggiani C. ATP
consumption and efficiency of human single muscle fibers with different
myosin isoform composition. Biophys J 79: 945-961, 2000.
139. Hecker M, Lambeck S, Toepfer S, van Someren E, Guthke R. Gene
regulatory network inference: Data integration in dynamic models-a
review. Biosystems 96: 86-103, 2009.

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

140. Helgerud J, Hoydal K, Wang E, Karlsen T, Berg P, Bjerkaas M, Simonsen T, Helgesen C, Hjorth N, Bach R, Hoff J. Aerobic high-intensity
intervals improve VO2max more than moderate training. Med Sci Sports
Exerc 39: 665-671, 2007.
141. Hickson RC. Interference of strength development by simultaneously
training for strength and endurance. Eur J Appl Physiol Occup Physiol
45: 255-263, 1980.
142. Holmes BF, Lang DB, Birnbaum MJ, Mu J, Dohm GL. AMP kinase
is not required for the GLUT4 response to exercise and denervation
in skeletal muscle. Am J Physiol Endocrinol Metab 287: E739-E743,
2004.
143. Hood DA. Mechanisms of exercise-induced mitochondrial biogenesis
in skeletal muscle. Appl Physiol Nutr Metab 34: 465-472, 2009.
144. Hood DA, Irrcher I, Ljubicic V, Joseph AM. Coordination of metabolic
plasticity in skeletal muscle. J Exp Biol 209: 2265-2275, 2006.
145. Hoppeler H. Exercise-induced ultrastructural changes in skeletal muscle. Int J Sports Med 7: 187-204, 1986.
146. Hoppeler H. [Morphology of human skeletal muscle and its adaptability
to different training conditions]. Sportverletz Sportschaden 1: 71-75,
1987.
147. Hoppeler H. The different relationship of VO2max to muscle mitochondria in humans and quadrupedal animals. Respir Physiol 80: 137-145,
1990.
148. Hoppeler H, Fluck M. Normal mammalian skeletal muscle and its
phenotypic plasticity. J Exp Biol 205: 2143-2152, 2002.
149. Hoppeler H, Fluck M. Plasticity of skeletal muscle mitochondria: Structure and function. Med Sci Sports Exerc 35: 95-104, 2003.
150. Hoppeler H, Howald H, Conley K, Lindstedt SL, Claassen H, Vock
P, Weibel ER. Endurance training in humans: Aerobic capacity and
structure of skeletal muscle. J Appl Physiol 59: 320-327, 1985.
151. Hoppeler H, Luthi P, Claassen H, Weibel ER, Howald H. The ultrastructure of the normal human skeletal muscle. A morphometric analysis on
untrained men, women and well-trained orienteers. Pflugers Arch 344:
217-232, 1973.
152. Hornberger TA, Chu WK, Mak YW, Hsiung JW, Huang SA, Chien S.
The role of phospholipase D and phosphatidic acid in the mechanical
activation of mTOR signaling in skeletal muscle. Proc Natl Acad Sci U
S A 103: 4741-4746, 2006.
153. Hotamisligil GS. Mechanisms of TNF-alpha-induced insulin resistance.
Exp Clin Endocrinol Diabetes 107: 119-125, 1999.
154. Huang Z, Chen D, Zhang K, Yu B, Chen X, Meng J. Regulation of
myostatin signaling by c-Jun N-terminal kinase in C2C12 cells. Cell
Signal 19: 2286-2295, 2007.
155. Hudlicka O, Brown MD. Adaptation of skeletal muscle microvasculature to increased or decreased blood flow: Role of shear stress, nitric
oxide and vascular endothelial growth factor. J Vasc Res 46: 504-512,
2009.
156. Hudlicka O, Brown M, Egginton S. Angiogenesis in skeletal and cardiac
muscle. Physiol Rev 72: 369-417, 1992.
157. Hull-Thompson J, Muffat J, Sanchez D, Walker DW, Benzer S, Ganfornina MD, Jasper H. Control of metabolic homeostasis by stress
signaling is mediated by the lipocalin NLaz. PLoS Genet 5: e1000460,
2009.
158. Huonker M, Schmid A, Schmidt-Trucksass A, Grathwohl D, Keul
J. Size and blood flow of central and peripheral arteries in highly
trained able-bodied and disabled athletes. J Appl Physiol 95: 685-691,
2003.
159. Ieronimakis N, Balasundaram G, Rainey S, Srirangam K, YablonkaReuveni Z, Reyes M. Absence of CD34 on murine skeletal muscle
satellite cells marks a reversible state of activation during acute injury.
PLoS ONE 5: e10920, 2010.
160. Inoki K, Li Y, Xu T, Guan KL. Rheb GTPase is a direct target of TSC2
GAP activity and regulates mTOR signaling. Genes Dev 17: 1829-1834,
2003.
161. Inoki K, Li Y, Zhu T, Wu J, Guan KL. TSC2 is phosphorylated and
inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4:
648-657, 2002.
162. Inoki K, Ouyang H, Zhu T, Lindvall C, Wang Y, Zhang X, Yang Q,
Bennett C, Harada Y, Stankunas K, Wang CY, He X, MacDougald
OA, You M, Williams BO, Guan KL. TSC2 integrates Wnt and energy
signals via a coordinated phosphorylation by AMPK and GSK3 to
regulate cell growth. Cell 126: 955-968, 2006.
163. Irrcher I, Adhihetty PJ, Sheehan T, Joseph AM, Hood DA. PPARgamma
coactivator-1alpha expression during thyroid hormone- and contractile
activity-induced mitochondrial adaptations. Am J Physiol Cell Physiol
284: C1669-C1677, 2003.
164. Irrcher I, Ljubicic V, Hood DA. Interactions between ROS and AMP
kinase activity in the regulation of PGC-1alpha transcription in skeletal
muscle cells. Am J Physiol Cell Physiol 296: C116-C123, 2009.
165. Izumiya Y, Hopkins T, Morris C, Sato K, Zeng L, Viereck J, Hamilton
JA, Ouchi N, LeBrasseur NK, Walsh K. Fast/Glycolytic muscle fiber
growth reduces fat mass and improves metabolic parameters in obese
mice. Cell Metab 7: 159-172, 2008.

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

166. Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ,
Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell
PH, Pugh CW, Ratcliffe PJ. Targeting of HIF-alpha to the von HippelLindau ubiquitylation complex by O2 -regulated prolyl hydroxylation.
Science 292: 468-472, 2001.
167. Jackson MJ. Redox regulation of adaptive responses in skeletal muscle
to contractile activity. Free Radic Biol Med 47: 1267-1275, 2009.
168. Jackson MJ, Papa S, Bolanos J, Bruckdorfer R, Carlsen H, Elliott RM,
Flier J, Griffiths HR, Heales S, Holst B, Lorusso M, Lund E, Oivind
Moskaug J, Moser U, Di Paola M, Polidori MC, Signorile A, Stahl W,
Vina-Ribes J, Astley SB. Antioxidants, reactive oxygen and nitrogen
species, gene induction and mitochondrial function. Mol Aspects Med
23: 209-285, 2002.
169. Jain RK. Molecular regulation of vessel maturation. Nat Med 9: 685693, 2003.
170. Jansson E, Sylven C, Nordevang E. Myoglobin in the quadriceps
femoris muscle of competitive cyclists and untrained men. Acta Physiol
Scand 114: 627-629, 1982.
171. Ji LL, Gomez-Cabrera MC, Vina J. Exercise and hormesis: Activation
of cellular antioxidant signaling pathway. Ann N Y Acad Sci 1067:
425-435, 2006.
172. Johnston IA, Temple GK. Thermal plasticity of skeletal muscle phenotype in ectothermic vertebrates and its significance for locomotory
behaviour. J Exp Biol 205: 2305-2322, 2002.
173. Jones AM, Carter H. The effect of endurance training on parameters of
aerobic fitness. Sports Med 29: 373-386, 2000.
174. Jones TE, Stephenson KW, King JG, Knight KR, Marshall TL, Scott
WB. Sarcopeniamechanisms and treatments. J Geriatr Phys Ther 32:
39-45, 2009.
175. Jorgensen SB, Nielsen JN, Birk JB, Olsen GS, Viollet B, Andreelli
F, Schjerling P, Vaulont S, Hardie DG, Hansen BF, Richter EA, Wojtaszewski JF. The alpha2-5 AMP-activated protein kinase is a site 2
glycogen synthase kinase in skeletal muscle and is responsive to glucose
loading. Diabetes 53: 3074-3081, 2004.
176. Jorgensen SB, Richter EA, Wojtaszewski JF. Role of AMPK in skeletal
muscle metabolic regulation and adaptation in relation to exercise. J
Physiol 574: 17-31, 2006.
177. Jorgensen SB, Rose AJ. How is AMPK activity regulated in skeletal
muscles during exercise? Front Biosci 13: 5589-5604, 2008.
178. Jorgensen SB, Treebak JT, Viollet B, Schjerling P, Vaulont S, Wojtaszewski JF, Richter EA. Role of AMPKalpha2 in basal, training-,
and AICAR-induced GLUT4, hexokinase II, and mitochondrial protein expression in mouse muscle. Am J Physiol Endocrinol Metab 292:
E331-E339, 2007.
179. Juan AH, Kumar RM, Marx JG, Young RA, Sartorelli V. Mir-214dependent regulation of the polycomb protein Ezh2 in skeletal muscle
and embryonic stem cells. Mol Cell 36: 61-74, 2009.
180. Juge-Aubry CE, Hammar E, Siegrist-Kaiser C, Pernin A, Takeshita
A, Chin WW, Burger AG, Meier CA. Regulation of the transcriptional activity of the peroxisome proliferator-activated receptor alpha
by phosphorylation of a ligand-independent trans-activating domain. J
Biol Chem 274: 10505-10510, 1999.
181. Kadi F, Eriksson A, Holmner S, Thornell LE. Effects of anabolic
steroids on the muscle cells of strength-trained athletes. Med Sci Sports
Exerc 31: 1528-1534, 1999.
182. Kadi F, Schjerling P, Andersen LL, Charifi N, Madsen JL, Christensen
LR, Andersen JL. The effects of heavy resistance training and detraining
on satellite cells in human skeletal muscles. J Physiol 558: 1005-1012,
2004.
183. Kelley DE, Williams KV, Price JC, McKolanis TM, Goodpaster BH,
Thaete FL. Plasma fatty acids, adiposity, and variance of skeletal muscle
insulin resistance in type 2 diabetes mellitus. J Clin Endocrinol Metab
86: 5412-5419, 2001.
184. Kemp BE, Stapleton D, Campbell DJ, Chen ZP, Murthy S, Walter M,
Gupta A, Adams JJ, Katsis F, van Denderen B, Jennings IG, Iseli T,
Michell BJ, Witters LA. AMP-activated protein kinase, super metabolic
regulator. Biochem Soc Trans 31: 162-168, 2003.
185. Kiel C, Yus E, Serrano L. Engineering signal transduction pathways.
Cell 140: 33-47, 2010.
186. Kim E, Goraksha-Hicks P, Li L, Neufeld TP, Guan KL. Regulation
of TORC1 by Rag GTPases in nutrient response. Nat Cell Biol 10:
935-945, 2008.
187. Kimball SR, Jefferson LS. Control of translation initiation through
integration of signals generated by hormones, nutrients, and exercise.
J Biol Chem 285: 29027-29032, 2010.
188. Kirkland JG, Kamakaka RT. tRNA insulator function: insight into inheritance of transcription states? Epigenetics 5: 96-99.
189. Kitamura T, Kitamura YI, Funahashi Y, Shawber CJ, Castrillon DH,
Kollipara R, DePinho RA, Kitajewski J, Accili D. A Foxo/Notch pathway controls myogenic differentiation and fiber type specification. J
Clin Invest 117: 2477-2485, 2007.
190. Kitzmann M, Bonnieu A, Duret C, Vernus B, Barro M, LaoudjChenivesse D, Verdi JM, Carnac G. Inhibition of Notch signaling

1407

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

191.
192.
193.
194.

195.

196.

197.

198.
199.

200.

201.

202.
203.

204.

205.

206.
207.
208.
209.
210.
211.
212.

induces myotube hypertrophy by recruiting a subpopulation of reserve


cells. J Cell Physiol 208: 538-548, 2006.
Kitzmann M, Fernandez A. Crosstalk between cell cycle regulators and
the myogenic factor MyoD in skeletal myoblasts. Cell Mol Life Sci 58:
571-579, 2001.
Klossner S, Durieux AC, Freyssenet D, Flueck M. Mechanotransduction to muscle protein synthesis is modulated by FAK. Eur
J Appl Physiol 106: 389-398, 2009.
Kluppel M, Wrana JL. Turning it up a Notch: cross-talk between TGF
beta and Notch signaling. Bioessays 27: 115-118, 2005.
Kosek DJ, Kim JS, Petrella JK, Cross JM, Bamman MM. Efficacy of
3 days/wk resistance training on myofiber hypertrophy and myogenic
mechanisms in young vs. older adults. J Appl Physiol 101: 531-544,
2006.
Kovacheva EL, Hikim AP, Shen R, Sinha I, Sinha-Hikim I. Testosterone supplementation reverses sarcopenia in aging through regulation
of myostatin, c-Jun NH2-terminal kinase, Notch, and Akt signaling
pathways. Endocrinology 151: 628-638, 2010.
Kramer DK, Ahlsen M, Norrbom J, Jansson E, Hjeltnes N, Gustafsson
T, Krook A. Human skeletal muscle fibre type variations correlate with
PPAR alpha, PPAR delta and PGC-1 alpha mRNA. Acta Physiol (Oxf)
188: 207-216, 2006.
Krebs M, Brunmair B, Brehm A, Artwohl M, Szendroedi J, Nowotny
P, Roth E, Furnsinn C, Promintzer M, Anderwald C, Bischof M, Roden
M. The Mammalian target of rapamycin pathway regulates nutrientsensitive glucose uptake in man. Diabetes 56: 1600-1607, 2007.
Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M. Silencing of microRNAs in vivo with antagomirs.
Nature 438: 685-689, 2005.
Kubica N, Bolster DR, Farrell PA, Kimball SR, Jefferson LS. Resistance exercise increases muscle protein synthesis and translation of
eukaryotic initiation factor 2Bepsilon mRNA in a mammalian target of
rapamycin-dependent manner. J Biol Chem 280: 7570-7580, 2005.
Kumar A, Harris TE, Keller SR, Choi KM, Magnuson MA, Lawrence
JC Jr. Muscle-specific deletion of rictor impairs insulin-stimulated glucose transport and enhances Basal glycogen synthase activity. Mol Cell
Biol 28: 61-70, 2008.
Kumar AH, Metharom P, Schmeckpeper J, Weiss S, Martin K, Caplice
NM. Bone marrow-derived CX3CR1 progenitors contribute to neointimal smooth muscle cells via fractalkine CX3CR1 interaction. FASEB
J 24: 81-92, 2010.
Kumar V, Atherton P, Smith K, Rennie MJ. Human muscle protein
synthesis and breakdown during and after exercise. J Appl Physiol 106:
2026-2039, 2009.
Kumar V, Selby A, Rankin D, Patel R, Atherton P, Hildebrandt W,
Williams J, Smith K, Seynnes O, Hiscock N, Rennie MJ. Age-related
differences in the dose-response relationship of muscle protein synthesis to resistance exercise in young and old men. J Physiol 587: 211-217,
2009.
Lai KM, Gonzalez M, Poueymirou WT, Kline WO, Na E, Zlotchenko
E, Stitt TN, Economides AN, Yancopoulos GD, Glass DJ. Conditional
activation of akt in adult skeletal muscle induces rapid hypertrophy.
Mol Cell Biol 24: 9295-9304, 2004.
Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer
S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida
L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller
RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB,
Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G,
Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler
CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W,
Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan
M, Tuschl T. A mammalian microRNA expression atlas based on small
RNA library sequencing. Cell 129: 1401-1414, 2007.
Lastayo PC, Reich TE, Urquhart M, Hoppeler H, Lindstedt SL. Chronic
eccentric exercise: improvements in muscle strength can occur with
little demand for oxygen. Am J Physiol 276: R611-R615, 1999.
Lee EK, Gorospe M. Minireview: Posttranscriptional regulation of the
insulin and insulin-like growth factor systems. Endocrinology 151:
1403-1408, 2010.
Lee IS, Shin G, Choue R. Shifts in diet from high fat to high carbohydrate improved levels of adipokines and pro-inflammatory cytokines in
mice fed a high-fat diet. Endocr J 57: 39-50, 2010.
Lee JS, Bruce CR, Spriet LL, Hawley JA. Interaction of diet and training
on endurance performance in rats. Exp Physiol 86: 499-508, 2001.
Lee SJ. Regulation of muscle mass by myostatin. Annu Rev Cell Dev
Biol 20: 61-86, 2004.
Lefebvre P, Chinetti G, Fruchart JC, Staels B. Sorting out the roles of
PPAR alpha in energy metabolism and vascular homeostasis. J Clin
Invest 116: 571-580, 2006.
Leick L, Wojtaszewski JF, Johansen ST, Kiilerich K, Comes G, Hellsten
Y, Hidalgo J, Pilegaard H. PGC-1alpha is not mandatory for exerciseand training-induced adaptive gene responses in mouse skeletal muscle.
Am J Physiol Endocrinol Metab 294: E463-E474, 2008.

1408

Printer Name: Yet to Come

Comprehensive Physiology

213. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver
P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R, Spiegelman BM.
Transcriptional co-activator PGC-1 alpha drives the formation of slowtwitch muscle fibres. Nature 418: 797-801, 2002.
214. Lin J, Yang R, Tarr PT, Wu PH, Handschin C, Li S, Yang W, Pei L, Uldry
M, Tontonoz P, Newgard CB, Spiegelman BM. Hyperlipidemic effects
of dietary saturated fats mediated through PGC-1beta coactivation of
SREBP. Cell 120: 261-273, 2005.
215. Lin JD. Minireview: The PGC-1 coactivator networks: chromatinremodeling and mitochondrial energy metabolism. Mol Endocrinol 23:
2-10, 2009.
216. Lindstedt SL, Hokanson JF, Wells DJ, Swain SD, Hoppeler H, Navarro
V. Running energetics in the pronghorn antelope. Nature 353: 748-750,
1991.
217. Lindstedt SL, Lastayo PC, Reich TE. When active muscles lengthen:
Properties and consequences of eccentric contractions. News Physiol
Sci 16: 256-261, 2001.
218. Liu Y, Shen T, Randall WR, Schneider MF. Signaling pathways in
activity-dependent fiber type plasticity in adult skeletal muscle. J Muscle Res Cell Motil 26: 13-21, 2005.
219. Lonard DM, OMalley BW. Nuclear receptor coregulators: Judges,
juries, and executioners of cellular regulation. Mol Cell 27: 691-700,
2007.
220. Long YC, Barnes BR, Mahlapuu M, Steiler TL, Martinsson S, Leng
Y, Wallberg-Henriksson H, Andersson L, Zierath JR. Role of AMPactivated protein kinase in the coordinated expression of genes controlling glucose and lipid metabolism in mouse white skeletal muscle.
Diabetologia 48: 2354-2364, 2005.
221. Long YC, Zierath JR. Influence of AMP-activated protein kinase and
calcineurin on metabolic networks in skeletal muscle. Am J Physiol
Endocrinol Metab 295: E545-E552, 2008.
222. Luethi JM, Howald H, Claassen H, Roesler K, Vock P, Hoppeler H.
Structural changes in skeletal muscle tissue with heavy- resistance
exercise. Int J Sports Med 7: 123-127, 1986.
223. Lundberg IE, Nader GA. Molecular effects of exercise in patients with
inflammatory rheumatic disease. Nat Clin Pract Rheumatol 4: 597-604,
2008.
224. Luthi JM, Howald H, Claassen H, Rosler K, Vock P, Hoppeler H. Structural changes in skeletal muscle tissue with heavy-resistance exercise.
Int J Sports Med 7: 123-127, 1986.
225. MacDougall JD, Sale DG, Elder GC, Sutton JR. Muscle ultrastructural
characteristics of elite powerlifters and bodybuilders. Europ J Appl
Physiol 48: 117-126, 1982.
226. Manceau M, Gros J, Savage K, Thome V, McPherron A, Paterson B,
Marcelle C. Myostatin promotes the terminal differentiation of embryonic muscle progenitors. Genes Dev 22: 668-681, 2008.
227. Manco M, Calvani M, Mingrone G. Effects of dietary fatty acids on
insulin sensitivity and secretion. Diabetes Obes Metab 6: 402-413,
2004.
228. Mascher H, Tannerstedt J, Brink-Elfegoun T, Ekblom B, Gustafsson T,
Blomstrand E. Repeated resistance exercise training induces different
changes in mRNA expression of MAFbx and MuRF-1 in human skeletal
muscle. Am J Physiol Endocrinol Metab 294: E43-E51, 2008.
229. Mason S, Johnson RS. The role of HIF-1 in hypoxic response in the
skeletal muscle. Adv Exp Med Biol 618: 229-244, 2007.
230. Mason SD, Howlett RA, Kim MJ, Olfert IM, Hogan MC, McNulty W,
Hickey RP, Wagner PD, Kahn CR, Giordano FJ, Johnson RS. Loss of
skeletal muscle HIF-1alpha results in altered exercise endurance. PLoS
Biol 2: e288, 2004.
231. Mason SD, Rundqvist H, Papandreou I, Duh R, McNulty WJ,
Howlett RA, Olfert IM, Sundberg CJ, Denko NC, Poellinger L, Johnson RS. HIF-1alpha in endurance training: Suppression of oxidative
metabolism. Am J Physiol Regul Integr Comp Physiol 293: R2059R2069, 2007.
232. Masuda K, Okazaki K, Kuno S, Asano K, Shimojo H, Katsuta S.
Endurance training under 2500-m hypoxia does not increase myoglobin
content in human skeletal muscle. Eur J Appl Physiol 85: 486-490,
2001.
233. Matheny RW Jr, Nindl BC, Adamo ML. Minireview: Mechano-growth
factor: A putative product of IGF-I gene expression involved in tissue
repair and regeneration. Endocrinology 151: 865-875.
234. Mathur N, Pedersen BK. Exercise as a mean to control low-grade
systemic inflammation. Mediators Inflamm 2008: 109502, 2008.
235. Matsakas A, Patel K. Intracellular signalling pathways regulating the
adaptation of skeletal muscle to exercise and nutritional changes. Histol
Histopathol 24: 209-222, 2009.
236. Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem
Cytol 9: 493-495, 1961.
237. Mayerson AB, Hundal RS, Dufour S, Lebon V, Befroy D, Cline GW,
Enocksson S, Inzucchi SE, Shulman GI, Petersen KF. The effects of
rosiglitazone on insulin sensitivity, lipolysis, and hepatic and skeletal
muscle triglyceride content in patients with type 2 diabetes. Diabetes
51: 797-802, 2002.

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Printer Name: Yet to Come

Comprehensive Physiology

238. McArdle A, Vasilaki A, Jackson M. Exercise and skeletal muscle ageing: Cellular and molecular mechanisms. Ageing Res Rev 1: 79-93,
2002.
239. McCarthy JJ, Esser KA, Peterson CA, Dupont-Versteegden EE. Evidence of MyomiR network regulation of beta-myosin heavy chain
gene expression during skeletal muscle atrophy. Physiol Genomics 39:
219-226, 2009.
240. McFarlane C, Sharma M, Kambadur R. Myostatin is a procachectic
growth factor during postnatal myogenesis. Curr Opin Clin Nutr Metab
Care 11: 422-427, 2008.
241. McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle
mass in mice by a new TGF-beta superfamily member. Nature 387:
83-90, 1997.
242. Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded
RNA. Nature 431: 343-349, 2004.
243. Michel RN, Chin ER, Chakkalakal JV, Eibl JK, Jasmin BJ.
Ca2+/calmodulin-based signalling in the regulation of the muscle fibre phenotype and its therapeutic potential via modulation of utrophin
A and myostatin expression. Appl Physiol Nutr Metab 32: 921-929,
2007.
244. Millward DJ, Garlick PJ, James WP, Nnanyelugo DO, Ryatt JS. Relationship between protein synthesis and RNA content in skeletal muscle.
Nature 241: 204-205, 1973.
245. Miyazaki M, McCarthy JJ, Esser KA. Insulin like growth factor-1induced phosphorylation and altered distribution of tuberous sclerosis
complex (TSC)1/TSC2 in C2C12 myotubes. FEBS J 277: 2180-2191,
2010.
246. Mohammad-Qureshi SS, Jennings MD, Pavitt GD. Clues to the mechanism of action of eIF2B, the guanine-nucleotide-exchange factor for
translation initiation. Biochem Soc Trans 36: 658-664, 2008.
247. Moore DR, Robinson MJ, Fry JL, Tang JE, Glover EI, Wilkinson SB,
Prior T, Tarnopolsky MA, Phillips SM. Ingested protein dose response
of muscle and albumin protein synthesis after resistance exercise in
young men. Am J Clin Nutr 89: 161-168, 2009.
248. Morin P Jr, Storey KB. Mammalian hibernation: Differential gene expression and novel application of epigenetic controls. Int J Dev Biol 53:
433-442, 2009.
249. Morris KV. RNA-directed transcriptional gene silencing and activation
in human cells. Oligonucleotides 19: 299-306, 2009.
250. Mueller M, Breil FA, Vogt M, Steiner R, Lippuner K, Popp A, Klossner
S, Hoppeler H, Dapp C. Different response to eccentric and concentric
training in older men and women. Eur J Appl Physiol 107: 145-153,
2009.
251. Muoio DM, Koves TR. Lipid-induced metabolic dysfunction in skeletal
muscle. Novartis Found Symp 286: 24-38; discussion 38-46, 162-163,
196-203, 2007.
252. Musaro A, McCullagh KJ, Naya FJ, Olson EN, Rosenthal N. IGF-1 induces skeletal myocyte hypertrophy through calcineurin in association
with GATA-2 and NF-ATc1. Nature 400: 581-585, 1999.
253. Myers J, Kaykha A, George S, Abella J, Zaheer N, Lear S, Yamazaki
T, Froelicher V. Fitness versus physical activity patterns in predicting
mortality in men. Am J Med 117: 912-918, 2004.
254. Nader GA. Molecular determinants of skeletal muscle mass: Getting
the AKT together. Int J Biochem Cell Biol 37: 1985-1996, 2005.
255. Nader GA. Concurrent strength and endurance training: From
molecules to man. Med Sci Sports Exerc 38: 1965-1970, 2006.
256. Nader GA, Lundberg IE. Exercise as an anti-inflammatory intervention
to combat inflammatory diseases of muscle. Curr Opin Rheumatol 21:
599-603, 2009.
257. Naguibneva I, Ameyar-Zazoua M, Polesskaya A, Ait-Si-Ali S, Groisman R, Souidi M, Cuvellier S, Harel-Bellan A. The microRNA miR-181
targets the homeobox protein Hox-A11 during mammalian myoblast
differentiation. Nat Cell Biol 8: 278-284, 2006.
258. Narici MV, Hoppeler H, Kayser B, Landoni L, Claassen H, Gavardi C,
Conti M, Cerretelli P. Human quadriceps cross-sectional area, torque
and neural activation during 6 months strength training. Acta Physiol
Scand 157: 175-186, 1996.
259. Narkar VA, Downes M, Yu RT, Embler E, Wang YX, Banayo E, Mihaylova MM, Nelson MC, Zou Y, Juguilon H, Kang H, Shaw RJ, Evans
RM. AMPK and PPARdelta agonists are exercise mimetics. Cell 134:
405-415, 2008.
260. Nielsen JN, Frosig C, Sajan MP, Miura A, Standaert ML, Graham
DA, Wojtaszewski JF, Farese RV, Richter EA. Increased atypical PKC
activity in endurance-trained human skeletal muscle. Biochem Biophys
Res Commun 312: 1147-1153, 2003.
261. Niess AM, Simon P. Response and adaptation of skeletal muscle to
exercisethe role of reactive oxygen species. Front Biosci 12: 48264838, 2007.
262. Nieto-Vazquez I, Fernandez-Veledo S, de Alvaro C, Lorenzo M. Dual
role of interleukin-6 in regulating insulin sensitivity in murine skeletal
muscle. Diabetes 57: 3211-3221, 2008.
263. Norris AW, Hirshman MF, Yao J, Jessen N, Musi N, Chen L, Sivitz WI,
Goodyear LJ, Kahn CR. Endogenous peroxisome proliferator-activated

Volume 1, July 2011

Molecular Plasticity of Skeletal Muscle

264.

265.
266.
267.
268.
269.
270.
271.
272.
273.
274.
275.
276.
277.
278.

279.

280.
281.

282.
283.
284.
285.
286.
287.
288.
289.

290.
291.
292.

receptor-gamma augments fatty acid uptake in oxidative muscle. Endocrinology 149: 5374-5383, 2008.
Nuhr M, Crevenna R, Gohlsch B, Bittner C, Pleiner J, Wiesinger G,
Fialka-Moser V, Quittan M, Pette D. Functional and biochemical properties of chronically stimulated human skeletal muscle. Eur J Appl
Physiol 89: 202-208, 2003.
Nunn AV, Bell J, Barter P. The integration of lipid-sensing and antiinflammatory effectsHow the PPARs play a role in metabolic balance.
Nucl Recept 5: 1, 2007.
Ohshima T, Koga H, Shimotohno K. Transcriptional activity of peroxisome proliferator-activated receptor gamma is modulated by SUMO-1
modification. J Biol Chem 279: 29551-29557, 2004.
Olson EN, Williams RS. Calcineurin signaling and muscle remodeling.
Cell 101: 689-692, 2000.
Otto A, Patel K. Signalling and the control of skeletal muscle size. Exp
Cell Res 16: 3059-3066, 2010.
Pain VM. Initiation of protein synthesis in eukaryotic cells. Eur J
Biochem 236: 747-771, 1996.
Pattengale PK, Holloszy JO. Augmentation of skeletal muscle myoglobin by a program of treadmill running. Am J Physiol 213: 783-785,
1967.
Pavelic K, Bukovic D, Pavelic J. The role of insulin-like growth factor
2 and its receptors in human tumors. Mol Med 8: 771-780, 2002.
Pedersen BK. The diseasome of physical inactivityand the role
of myokines in musclefat cross talk. J Physiol 587: 5559-5568,
2009.
Pedersen BK, Febbraio MA. Muscle as an endocrine organ: Focus on
muscle-derived interleukin-6. Physiol Rev 88: 1379-1406, 2008.
Pedersen BK, Saltin B. Evidence for prescribing exercise as therapy in
chronic disease. Scand J Med Sci Sports 16 (Suppl 1): 3-63, 2006.
Petersen AM, Pedersen BK. The anti-inflammatory effect of exercise.
J Appl Physiol 98: 1154-1162, 2005.
Peterson MD, Rhea MR, Sen A, Gordon PM. Resistance exercise for
muscular strength in older adults: A meta-analysis. Ageing Res Rev 9:
226-237, 2010.
Pette D, Vrbova G. What does chronic electrical stimulation teach us
about muscle plasticity? Muscle Nerve 22: 666-677, 1999.
Phillips SM. Physiologic and molecular bases of muscle hypertrophy
and atrophy: Impact of resistance exercise on human skeletal muscle
(protein and exercise dose effects). Appl Physiol Nutr Metab 34: 403410, 2009.
Piersma T, Gudmundsson GA, Lilliendahl K. Rapid changes in the size
of different functional organ and muscle groups during refueling in a
long-distance migrating shorebird. Physiol Biochem Zool 72: 405-415,
1999.
Pilegaard H, Neufer PD. Transcriptional regulation of pyruvate dehydrogenase kinase 4 in skeletal muscle during and after exercise. Proc
Nutr Soc 63: 221-226, 2004.
Pilegaard H, Ordway GA, Saltin B, Neufer PD. Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am J Physiol Endocrinol Metab 279: E806-E814,
2000.
Pilegaard H, Saltin B, Neufer PD. Exercise induces transient transcriptional activation of the PGC-1alpha gene in human skeletal muscle. J
Physiol 546: 851-858, 2003.
Polesskaya A, Seale P, Rudnicki MA. Wnt signaling induces the myogenic specification of resident CD45+ adult stem cells during muscle
regeneration. Cell 113: 841-852, 2003.
Poliseno L, Salmena L, Zhang J, Carver B, Haveman WJ, Pandolfi
PP. A coding-independent function of gene and pseudogene mRNAs
regulates tumour biology. Nature 465: 1033-1038, 2010.
Powers SK, Hamilton K. Antioxidants and exercise. Clin Sports Med
18: 525-536, 1999.
Powers SK, Jackson MJ. Exercise-induced oxidative stress: Cellular
mechanisms and impact on muscle force production. Physiol Rev 88:
1243-1276, 2008.
Pozzi A, Capdevila JH. PPARalpha ligands as antitumorigenic and
antiangiogenic agents. PPAR Res 2008: 906542, 2008.
Prior BM, Yang HT, Terjung RL. What makes vessels grow with exercise training? J Appl Physiol 97: 1119-1128, 2004.
Pruznak AM, Kazi AA, Frost RA, Vary TC, Lang CH. Activation of
AMP-activated protein kinase by 5-aminoimidazole-4-carboxamide-1beta-D-ribonucleoside prevents leucine-stimulated protein synthesis in
rat skeletal muscle. J Nutr 138: 1887-1894, 2008.
Puigserver P, Adelmant G, Wu Z, Fan M, Xu J, OMalley B, Spiegelman
BM. Activation of PPARgamma coactivator-1 through transcription
factor docking. Science 286: 1368-1371, 1999.
Puntschart A, Claassen H, Jostarndt K, Hoppeler H, Billeter R. mRNAs
of enzymes involved in energy metabolism and mtDNA are increased
in endurance-trained athletes. Am J Physiol 269: C619-C625, 1995.
Qi C, Zhu Y, Reddy JK. Peroxisome proliferator-activated receptors,
coactivators, and downstream targets. Cell Biochem Biophys 32: 187204, 2000.

1409

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

293. Rahman I, Biswas SK, Jimenez LA, Torres M, Forman HJ. Glutathione,
stress responses, and redox signaling in lung inflammation. Antioxid
Redox Signal 7: 42-59, 2005.
294. Rebbapragada A, Benchabane H, Wrana JL, Celeste AJ, Attisano L.
Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol 23: 7230-7242,
2003.
295. Reichmann H, Hoppeler H, Mathieu-Costello O, von Bergen F, Pette
D. Biochemical and ultrastructural changes of skeletal muscle mitochondria after chronic electrical stimulation in rabbits. Pfluegers Arch
404: 1-9, 1985.
296. Rennie MJ, Tipton KD. Protein and amino acid metabolism during and
after exercise and the effects of nutrition. Annu Rev Nutr 20: 457-483,
2000.
297. Riccardi G, Giacco R, Rivellese AA. Dietary fat, insulin sensitivity and
the metabolic syndrome. Clin Nutr 23: 447-456, 2004.
298. Richardson RS, Noyszewski EA, Kendrick KF, Leigh JS, Wagner PD.
Myoglobin O2 desaturation during exercise. Evidence of limited O2
transport. J Clin Invest 96: 1916-1926, 1995.
299. Richardson RS, Wagner H, Mudaliar SR, Saucedo E, Henry R, Wagner
PD. Exercise adaptation attenuates VEGF gene expression in human
skeletal muscle. Am J Physiol Heart Circ Physiol 279: H772-H778,
2000.
300. Richter EA, Ruderman NB. AMPK and the biochemistry of exercise:
Implications for human health and disease. Biochem J 418: 261-275,
2009.
301. Rivas DA, Lessard SJ, Coffey VG. mTOR function in skeletal muscle:
A focal point for overnutrition and exercise. Appl Physiol Nutr Metab
34: 807-816, 2009.
302. Rochat A, Fernandez A, Vandromme M, Moles JP, Bouschet T, Carnac
G, Lamb NJ. Insulin and wnt1 pathways cooperate to induce reserve
cell activation in differentiation and myotube hypertrophy. Mol Biol
Cell 15: 4544-4555, 2004.
303. Roesler KM, Conley KE, Claassen H, Howald H, Hoppeler H, Gehr
P. Transfer effects in endurance exercise: Adaptations in trained and
untrained muscles. Eur J Appl Physiol 54: 355-362, 1985.
304. Roig M, OBrien K, Kirk G, Murray R, McKinnon P, Shadgan B, Reid
DW. The effects of eccentric versus concentric resistance training on
muscle strength and mass in healthy adults: A systematic review with
meta-analyses. Br J Sports Med 43: 556-568, 2009.
305. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stitt TN, Yancopoulos GD, Glass DJ. Mediation of IGF-1-induced skeletal myotube
hypertrophy by PI(3)K/Akt/mTOR and PI(3)K/Akt/GSK3 pathways.
Nat Cell Biol 3: 1009-1013, 2001.
306. Rose AJ, Broholm C, Kiillerich K, Finn SG, Proud CG, Rider MH,
Richter EA, Kiens B. Exercise rapidly increases eukaryotic elongation
factor 2 phosphorylation in skeletal muscle of men. J Physiol 569:
223-228, 2005.
307. Rose AJ, Hargreaves M. Exercise increases Ca2+-calmodulindependent protein kinase II activity in human skeletal muscle. J Physiol
553: 303-309, 2003.
308. Rose AJ, Kiens B, Richter EA. Ca2+-calmodulin-dependent protein
kinase expression and signalling in skeletal muscle during exercise. J
Physiol 574: 889-903, 2006.
309. Rose AJ, Richter EA. Regulatory mechanisms of skeletal muscle
protein turnover during exercise. J Appl Physiol 106: 1702-1711,
2009.
310. Rudnicki MA, Le Grand F, McKinnell I, Kuang S. The molecular
regulation of muscle stem cell function. Cold Spring Harb Symp Quant
Biol 73: 323-331, 2008.
311. Russell AP, Feilchenfeldt J, Schreiber S, Praz M, Crettenand A, Gobelet C, Meier CA, Bell DR, Kralli A, Giacobino JP, Deriaz O. Endurance training in humans leads to fiber type-specific increases in levels of peroxisome proliferator-activated receptor-gamma coactivator-1
and peroxisome proliferator-activated receptor-alpha in skeletal muscle. Diabetes 52: 2874-2881, 2003.
312. Russell AP, Hesselink MK, Lo SK, Schrauwen P. Regulation of
metabolic transcriptional co-activators and transcription factors with
acute exercise. FASEB J 19: 986-988, 2005.
313. Ruvinsky I, Meyuhas O. Ribosomal protein S6 phosphorylation:
From protein synthesis to cell size. Trends Biochem Sci 31: 342-348,
2006.
314. Sacheck JM, Ohtsuka A, McLary SC, Goldberg AL. IGF-I stimulates
muscle growth by suppressing protein breakdown and expression of
atrophy-related ubiquitin ligases, atrogin-1 and MuRF1. Am J Physiol
Endocrinol Metab 287: E591-E601, 2004.
315. Sakamoto K, Aschenbach WG, Hirshman MF, Goodyear LJ. Akt signaling in skeletal muscle: Regulation by exercise and passive stretch.
Am J Physiol Endocrinol Metab 285: E1081-E1088, 2003.
316. Sakuma K, Yamaguchi A. Molecular mechanisms in aging and current
strategies to counteract sarcopenia. Curr Aging Sci 3: 90-101, 2010.
317. Sale DG. Neural adaptation to resistance training. Med Sci Sports Exerc
20: S135-S145, 1988.

1410

Printer Name: Yet to Come

Comprehensive Physiology

318. Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen CC, BarPeled L, Sabatini DM. The Rag GTPases bind raptor and mediate amino
acid signaling to mTORC1. Science 320: 1496-1501, 2008.
319. Sanders MJ, Grondin PO, Hegarty BD, Snowden MA, Carling D. Investigating the mechanism for AMP activation of the AMP-activated
protein kinase cascade. Biochem J 403: 139-148, 2007.
320. Sandri M, Lin J, Handschin C, Yang W, Arany ZP, Lecker SH, Goldberg AL, Spiegelman BM. PGC-1alpha protects skeletal muscle from
atrophy by suppressing FoxO3 action and atrophy-specific gene transcription. Proc Natl Acad Sci U S A 103: 16260-16265, 2006.
321. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh
K, Schiaffino S, Lecker SH, Goldberg AL. Foxo transcription factors
induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal
muscle atrophy. Cell 117: 399-412, 2004.
322. Sandstrom ME, Zhang SJ, Bruton J, Silva JP, Reid MB, Westerblad
H, Katz A. Role of reactive oxygen species in contraction-mediated
glucose transport in mouse skeletal muscle. J Physiol 575: 251-262,
2006.
323. Schachtrup C, Emmler T, Bleck B, Sandqvist A, Spener F. Functional
analysis of peroxisome-proliferator-responsive element motifs in genes
of fatty acid-binding proteins. Biochem J 382: 239-245, 2004.
324. Schiaffino S, Sandri M, Murgia M. Activity-dependent signaling pathways controlling muscle diversity and plasticity. Physiology (Bethesda)
22: 269-278, 2007.
325. Schiaffino S, Serrano A. Calcineurin signaling and neural control of
skeletal muscle fiber type and size. Trends Pharmacol Sci 23: 569-575,
2002.
326. Schmutz S, Dapp C, Wittwer M, Durieux AC, Mueller M, Weinstein F,
Vogt M, Hoppeler H, Fluck M. A hypoxia complement differentiates
the muscle response to endurance exercise. Exp Physiol 95: 723-735,
2010.
327. Schmutz S, Dapp C, Wittwer M, Vogt M, Hoppeler H, Fluck M. Endurance training modulates the muscular transcriptome response to
acute exercise. Pflugers Arch 451: 678-687, 2006.
328. Schoonjans K, Watanabe M, Suzuki H, Mahfoudi A, Krey G, Wahli W,
Grimaldi P, Staels B, Yamamoto T, Auwerx J. Induction of the acylcoenzyme A synthetase gene by fibrates and fatty acids is mediated by
a peroxisome proliferator response element in the C promoter. J Biol
Chem 270: 19269-19276, 1995.
329. Schrauwen-Hinderling VB, Hesselink MK, Schrauwen P, Kooi ME.
Intramyocellular lipid content in human skeletal muscle. Obesity (Silver
Spring) 14: 357-367, 2006.
330. Scicchitano BM, Rizzuto E, Musaro A. Counteracting muscle wasting
in aging and neuromuscular diseases: The critical role of IGF-1. Aging
(Albany NY) 1: 451-457, 2009.
331. Scott JW, Hawley SA, Green KA, Anis M, Stewart G, Scullion GA,
Norman DG, Hardie DG. CBS domains form energy-sensing modules
whose binding of adenosine ligands is disrupted by disease mutations.
J Clin Invest 113: 274-284, 2004.
332. Seale P, Polesskaya A, Rudnicki MA. Adult stem cell specification by
Wnt signaling in muscle regeneration. Cell Cycle 2: 418-419, 2003.
333. Semenza GL. Hypoxia-inducible factor 1: Master regulator of O2 homeostasis. Curr Opin Genet Dev 8: 588-594, 1998.
334. Semenza GL. Regulation of oxygen homeostasis by hypoxia-inducible
factor 1. Physiology (Bethesda) 24: 97-106, 2009.
335. Semple RK, Crowley VC, Sewter CP, Laudes M, Christodoulides C,
Considine RV, Vidal-Puig A, ORahilly S. Expression of the thermogenic nuclear hormone receptor coactivator PGC-1alpha is reduced in
the adipose tissue of morbidly obese subjects. Int J Obes Relat Metab
Disord 28: 176-179, 2004.
336. Senf SM, Dodd SL, Judge AR. FOXO signaling is required for disuse
muscle atrophy and is directly regulated by Hsp70. Am J Physiol Cell
Physiol 298: C38-C45, 2010.
337. Seth A, Steel JH, Nichol D, Pocock V, Kumaran MK, Fritah A, Mobberley M, Ryder TA, Rowlerson A, Scott J, Poutanen M, White R,
Parker M. The transcriptional corepressor RIP140 regulates oxidative
metabolism in skeletal muscle. Cell Metab 6: 236-245, 2007.
338. Sheehan SM, Allen RE. Skeletal muscle satellite cell proliferation in
response to members of the fibroblast growth factor family and hepatocyte growth factor. J Cell Physiol 181: 499-506, 1999.
339. Shoag J, Arany Z. Regulation of hypoxia-inducible genes by PGC-1
alpha. Arterioscler Thromb Vasc Biol 30: 662-666, 2010.
340. Simi B, Sempore B, Mayet MH, Favier RJ. Additive effects of training
and high-fat diet on energy metabolism during exercise. J Appl Physiol
71: 197-203, 1991.
341. Singh R, Bhasin S, Braga M, Artaza JN, Pervin S, Taylor WE, Krishnan V, Sinha SK, Rajavashisth TB, Jasuja R. Regulation of myogenic
differentiation by androgens: Cross talk between androgen receptor/
beta-catenin and follistatin/transforming growth factor-beta signaling
pathways. Endocrinology 150: 1259-1268, 2009.
342. Smith SA. Peroxisome proliferator-activated receptors and the regulation of mammalian lipid metabolism. Biochem Soc Trans 30: 10861090, 2002.

Volume 1, July 2011

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

Comprehensive Physiology

343. Song XM, Fiedler M, Galuska D, Ryder JW, Fernstrom M,


Chibalin AV, Wallberg-Henriksson H, Zierath JR. 5-Aminoimidazole4-carboxamide ribonucleoside treatment improves glucose homeostasis
in insulin-resistant diabetic (ob/ob) mice. Diabetologia 45: 56-65, 2002.
344. Spangenburg EE, Le Roith D, Ward CW, Bodine SC. A functional
insulin-like growth factor receptor is not necessary for load-induced
skeletal muscle hypertrophy. J Physiol 586: 283-291, 2008.
345. Spiegelman BM. Transcriptional control of energy homeostasis through
the PGC1 coactivators. Novartis Found Symp 286: 3-6; discussion 6-12,
162-163, 196-203, 2007.
346. Spiegelman BM, Heinrich R. Biological control through regulated transcriptional coactivators. Cell 119: 157-167, 2004.
347. Stefanyk LE, Dyck DJ. The interaction between adipokines, diet and
exercise on muscle insulin sensitivity. Curr Opin Clin Nutr Metab Care
13: 255-259, 2010.
348. Steinberg GR, Watt MJ, Febbraio MA. Cytokine Regulation of AMPK
signalling. Front Biosci 14: 1902-1916, 2009.
349. Stepto NK, Coffey VG, Carey AL, Ponnampalam AP, Canny BJ, Powell
D, Hawley JA. Global gene expression in skeletal muscle from welltrained strength and endurance athletes. Med Sci Sports Exerc 41: 546565, 2009.
350. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO,
Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway
prevents expression of muscle atrophy-induced ubiquitin ligases by
inhibiting FOXO transcription factors. Mol Cell 14: 395-403, 2004.
351. St-Pierre J, Buckingham JA, Roebuck SJ, Brand MD. Topology of
superoxide production from different sites in the mitochondrial electron
transport chain. J Biol Chem 277: 44784-44790, 2002.
352. Stubbings AK, Moore AJ, Dusmet M, Goldstraw P, West TG, Polkey
MI, Ferenczi MA. Physiological properties of human diaphragm muscle
fibres and the effect of chronic obstructive pulmonary disease. J Physiol
586: 2637-2650, 2008.
353. Suetta C, Hvid LG, Justesen L, Christensen U, Neergaard K, Simonsen
L, Ortenblad N, Magnusson SP, Kjaer M, Aagaard P. Effects of aging
on human skeletal muscle after immobilization and retraining. J Appl
Physiol 107: 1172-1180, 2009.
354. Sugden MC, Zariwala MG, Holness MJ. PPARs and the orchestration
of metabolic fuel selection. Pharmacol Res 60: 141-150, 2009.
355. Summermatter S, Baum O, Santos G, Hoppeler H, Handschin C. Peroxisome proliferator-activated receptor {gamma} coactivator 1{alpha}
(PGC-1{alpha}) promotes skeletal muscle lipid refueling in vivo by
activating de novo lipogenesis and the pentose phosphate pathway. J
Biol Chem 285: 32793-32800.
356. Sun Y, Chen J. mTOR signaling: PLD takes center stage. Cell Cycle 7:
3118-3123, 2008.
357. Sun Y, Fang Y, Yoon MS, Zhang C, Roccio M, Zwartkruis FJ, Armstrong M, Brown HA, Chen J. Phospholipase D1 is an effector of Rheb
in the mTOR pathway. Proc Natl Acad Sci U S A 105: 8286-8291, 2008.
358. Tamashiro KL, Moran TH. Perinatal environment and its influences
on metabolic programming of offspring. Physiol Behav 100: 560-566,
2010.
359. Tatsumi R. Mechano-biology of skeletal muscle hypertrophy and regeneration: Possible mechanism of stretch-induced activation of resident
myogenic stem cells. Anim Sci J 81: 11-20, 2010.
360. Taylor EB, Lamb JD, Hurst RW, Chesser DG, Ellingson WJ, Greenwood LJ, Porter BB, Herway ST, Winder WW. Endurance training
increases skeletal muscle LKB1 and PGC-1alpha protein abundance:
Effects of time and intensity. Am J Physiol Endocrinol Metab 289:
E960-E968, 2005.
361. Terrados N, Jansson E, Sylven C, Kaijser L. Is hypoxia a stimulus for
synthesis of oxidative enzymes and myoglobin? J Appl Physiol 68:
2369-2372, 1990.
362. Tesch PA. Skeletal muscle adaptations consequent to long-term heavy
resistance exercise. Med Sci Sports Exerc 20: S132-134, 1988.
363. Thomson DM, Fick CA, Gordon SE. AMPK activation attenuates
S6K1, 4E-BP1, and eEF2 signaling responses to high-frequency electrically stimulated skeletal muscle contractions. J Appl Physiol 104:
625-632, 2008.
364. Tongprasert S, Wattanapan P. Aerobic capacity of fifth-year medical
students at Chiang Mai University. J Med Assoc Thai 90: 1411-1416,
2007.
365. Tonna S, El-Osta A, Cooper ME, Tikellis C. Metabolic memory and
diabetic nephropathy: Potential role for epigenetic mechanisms. Nature
Rev 6: 332-341.
366. Tremblay F, Gagnon A, Veilleux A, Sorisky A, Marette A. Activation
of the mammalian target of rapamycin pathway acutely inhibits insulin
signaling to Akt and glucose transport in 3T3-L1 and human adipocytes.
Endocrinology 146: 1328-1337, 2005.
367. Tsivitse S. Notch and Wnt signaling, physiological stimuli and postnatal
myogenesis. Int J Biol Sci 6: 268-281, 2010.
368. Tsivitse SK, Peters MG, Stoy AL, Mundy JA, Bowen RS. The effect of
downhill running on Notch signaling in regenerating skeletal muscle.
Eur J Appl Physiol 106: 759-767, 2009.

Volume 1, July 2011

11:9

Printer Name: Yet to Come

Molecular Plasticity of Skeletal Muscle

369. Tsuchida K, Nakatani M, Uezumi A, Murakami T, Cui X. Signal


transduction pathway through activin receptors as a therapeutic target of musculoskeletal diseases and cancer. Endocr J 55: 11-21,
2008.
370. van Hinsbergh VW, Koolwijk P. Endothelial sprouting and angiogenesis: Matrix metalloproteinases in the lead. Cardiovasc Res 78: 203-212,
2008.
371. van Rooij E, Quiat D, Johnson BA, Sutherland LB, Qi X, Richardson
JA, Kelm RJ, Jr, Olson EN. A family of microRNAs encoded by myosin
genes governs myosin expression and muscle performance. Dev Cell
17: 662-673, 2009.
372. Vasilaki A, McArdle F, Iwanejko LM, McArdle A. Adaptive responses
of mouse skeletal muscle to contractile activity: The effect of age. Mech
Ageing Dev 127: 830-839, 2006.
373. Vogt M, Puntschart A, Geiser J, Zuleger C, Billeter R, Hoppeler H.
Molecular adaptations in human skeletal muscle to endurance training under simulated hypoxic conditions. J Appl Physiol 91: 173-182,
2001.
374. Vogt M, Puntschart A, Howald H, Mueller B, Mannhart C, GfellerTuescher L, Mullis P, Hoppeler H. Effects of dietary fat on muscle
substrates, metabolism, and performance in athletes. Med Sci Sports
Exerc 35: 952-960, 2003.
375. Volpi E, Kobayashi H, Sheffield-Moore M, Mittendorfer B, Wolfe RR.
Essential amino acids are primarily responsible for the amino acid
stimulation of muscle protein anabolism in healthy elderly adults. Am
J Clin Nutr 78: 250-258, 2003.
376. Wackerhage H, Rennie MJ. How nutrition and exercise maintain the
human musculoskeletal mass. J Anat 208: 451-458, 2006.
377. Waddell DS, Baehr LM, Van Den Brandt J, Johnsen SA, Reichardt
HM, Furlow JD, Bodine SC. The glucocorticoid receptor and FOXO1
synergistically activate the skeletal muscle atrophy-associated MuRF1
gene. Am J Physiol Endocrinol Metab 295: E785-E797, 2008.
378. Wallberg AE, Yamamura S, Malik S, Spiegelman BM, Roeder
RG. Coordination of p300-mediated chromatin remodeling and
TRAP/mediator function through coactivator PGC-1alpha. Mol Cell
12: 1137-1149, 2003.
379. Wang YX, Zhang CL, Yu RT, Cho HK, Nelson MC, Bayuga-Ocampo
CR, Ham J, Kang H, Evans RM. Regulation of muscle fiber type and
running endurance by PPARdelta. PLoS Biol 2: e294, 2004.
380. Wassenegger M. The role of the RNAi machinery in heterochromatin
formation. Cell 122: 13-16, 2005.
381. Watt MJ, Southgate RJ, Holmes AG, Febbraio MA. Suppression of
plasma free fatty acids upregulates peroxisome proliferator-activated
receptor (PPAR) alpha and delta and PPAR coactivator 1alpha in human
skeletal muscle, but not lipid regulatory genes. J Mol Endocrinol 33:
533-544, 2004.
382. Weber JM. The physiology of long-distance migration: Extending the
limits of endurance metabolism. J Exp Biol 212: 593-597, 2009.
383. Welle S, Burgess K, Thornton CA, Tawil R. Relation between extent of
myostatin depletion and muscle growth in mature mice. Am J Physiol
Endocrinol Metab 297: E935-E940, 2009.
384. White FC, Bloor CM, McKirnan MD, Carroll SM. Exercise training in
swine promotes growth of arteriolar bed and capillary angiogenesis in
heart. J Appl Physiol 85: 1160-1168, 1998.
385. White R, Morganstein D, Christian M, Seth A, Herzog B, Parker MG.
Role of RIP140 in metabolic tissues: Connections to disease. FEBS Lett
582: 39-45, 2008.
386. Williams AH, Liu N, van Rooij E, Olson EN. MicroRNA control of
muscle development and disease. Curr Opin Cell Biol 21: 461-469,
2009.
387. Winder WW. Energy-sensing and signaling by AMP-activated protein
kinase in skeletal muscle. J Appl Physiol 91: 1017-1028, 2001.
388. Wittkopp PJ. Variable gene expression in eukaryotes: A network perspective. J Exp Biol 210: 1567-1575, 2007.
389. Wojtaszewski JF, Jorgensen SB, Hellsten Y, Hardie DG, Richter
EA. Glycogen-dependent effects of 5-aminoimidazole-4-carboxamide
(AICA)-riboside on AMP-activated protein kinase and glycogen
synthase activities in rat skeletal muscle. Diabetes 51: 284-292,
2002.
390. Wu H, Kanatous SB, Thurmond FA, Gallardo T, Isotani E, Bassel-Duby
R, Williams RS. Regulation of mitochondrial biogenesis in skeletal
muscle by CaMK. Science 296: 349-352, 2002.
391. Xue Y, Petrovic N, Cao R, Larsson O, Lim S, Chen S, Feldmann HM,
Liang Z, Zhu Z, Nedergaard J, Cannon B, Cao Y. Hypoxia-independent
angiogenesis in adipose tissues during cold acclimation. Cell Metab 9:
99-109, 2009.
392. Yablonka-Reuveni Z, Seger R, Rivera AJ. Fibroblast growth factor
promotes recruitment of skeletal muscle satellite cells in young and old
rats. J Histochem Cytochem 47: 23-42, 1999.
393. Yan Z. Exercise, PGC-1alpha, and metabolic adaptation in skeletal
muscle. Appl Physiol Nutr Metab 34: 424-427, 2009.
394. Yu S, Reddy JK. Transcription coactivators for peroxisome proliferatoractivated receptors. Biochim Biophys Acta 1771: 936-951, 2007.

1411

P1: OTA/XYZ

P2: ABC

JWBT335-c100042

JWBT335/Comprehensive Physiology

April 9, 2011

11:9

Molecular Plasticity of Skeletal Muscle

395. Yudkin JS. Inflammation, obesity, and the metabolic syndrome. Horm
Metab Res 39: 707-709, 2007.
396. Zahorska-Markiewicz B, Janowska J, Olszanecka-Glinianowicz M, Zurakowski A. Serum concentrations of TNF-alpha and soluble TNFalpha receptors in obesity. Int J Obes Relat Metab Disord 24: 13921395, 2000.
397. Zammit PS. All muscle satellite cells are equal, but are some more
equal than others? J Cell Sci 121: 2975-2982, 2008.
398. Zammit PS, Partridge TA, Yablonka-Reuveni Z. The skeletal muscle
satellite cell: The stem cell that came in from the cold. J Histochem
Cytochem 54: 1177-1191, 2006.

1412

Printer Name: Yet to Come

Comprehensive Physiology

399. Zhou AL, Egginton S, Brown MD, Hudlicka O. Capillary growth in


overloaded, hypertrophic adult rat skeletal muscle: An ultrastructural
study. Anat Rec 252: 49-63, 1998.
400. Zoll J, Ponsot E, Dufour S, Doutreleau S, Ventura-Clapier R, Vogt
M, Hoppeler H, Richard R, Fluck M. Exercise training in normobaric
hypoxia in endurance runners. III. Muscular adjustments of selected
gene transcripts. J Appl Physiol 100: 1258-1266, 2006.
401. Zwetsloot KA, Westerkamp LM, Holmes BF, Gavin TP. AMPK regulates basal skeletal muscle capillarization and VEGF expression, but is
not necessary for the angiogenic response to exercise. J Physiol 586:
6021-6035, 2008.

Volume 1, July 2011

Am J Physiol Regul Integr Comp Physiol 299: R1254R1262, 2010.


First published August 18, 2010; doi:10.1152/ajpregu.00348.2010.

Muscle protein synthesis and gene expression during recovery from aerobic
exercise in the fasted and fed states
Matthew P. Harber, Adam R. Konopka, Bozena Jemiolo, Scott W. Trappe, Todd A. Trappe,
and Paul T. Reidy
Human Performance Laboratory, Ball State University, Muncie Indiana
Submitted 27 May 2010; accepted in final form 12 August 2010

Harber MP, Konopka AR, Jemiolo B, Trappe SW, Trappe TA,


Reidy PT. Muscle protein synthesis and gene expression during
recovery from aerobic exercise in the fasted and fed states. Am J
Physiol Regul Integr Comp Physiol 299: R1254 R1262, 2010. First
published August 18, 2010; doi:10.1152/ajpregu.00348.2010.The
purpose of this investigation was to assess mixed-muscle fractional
synthesis rate (FSR) and the expression of genes involved in skeletal
muscle remodeling after aerobic exercise in the fasted and fed states.
O2 max: 52 2
Eight recreationally active males (25 1 yr; V
mlkg1min1) performed 60-min of cycle ergometry at 72 1%
O2 max on two occasions in a counter-balanced design. Subjects
V
ingested a noncaloric placebo (EX-FAST) or a beverage containing
(per kg body wt): 5 kcal, 0.83 g carbohydrate, 0.37 g protein, and 0.03
g fat (EX-FED) immediately and 1 h after exercise. FSR was assessed
at rest and following exercise with the use of a L-[ring 2H5]-phenylalanine infusion combined with muscle biopsies at 2 and 6 h postexercise. mRNA expression was assessed at 2 and 6 h postexercise via
real-time RT-PCR. FSR was higher (P 0.05) after exercise in
both EX-FAST (0.112 0.010%h1) and EX-FED (0.129
0.014%h1) compared with rest (0.071 0.005%h1). Feeding
attenuated the mRNA expression (P 0.05) of proteolytic factors
MuRF-1 (6 h) and calpain-2 (2 and 6 h) postexercise but did not alter
FOXO3A, calpain-1, caspase3, or myostatin mRNA expression compared with EX-FAST. Myogenic regulatory factor (MRF4) mRNA
was also attenuated (P 0.05) at 2 and 6 h postexercise in EX-FED
compared with EX-FAST. These data demonstrate that a nonexhaustive bout of aerobic exercise stimulates skeletal muscle FSR in the
fasted state and that feeding does not measurably enhance FSR
between 2 and 6 h after aerobic exercise. Additionally, postexercise
nutrient intake attenuates the expression of factors involved in the
ubiquitin-proteosome and Ca2-dependent protein degradation pathways. These data provide insight into the role of feeding on muscle
protein metabolism during recovery from aerobic exercise.
protein turnover; endurance; proteolysis; muscle-specific RING finger
protein-1; calpain

(8, 44) and chronically (41, 45) alters


skeletal muscle protein metabolism. The influence of nutrient
supply (i.e., feeding) on skeletal muscle protein kinetics following exercise that is considered to be aerobic or endurancenatured remains relatively unexplored. Levenhagen et al. (29)
initially showed that ingestion of minimal amounts of carbohydrate (8 g) combined with 10 g of protein creates a positive
protein balance across the leg following aerobic exercise,
apparently through promoting muscle protein synthesis with
little influence on protein breakdown. Recently, it was reported
that coingestion of protein and carbohydrate following aerobic
exercise stimulates muscle protein synthesis greater than car-

AEROBIC EXERCISE ACUTELY

bohydrate intake alone and yields a net positive whole-body


protein balance (24). While the study by Howarth et al. (24)
described the important role of protein on muscle protein
synthesis following aerobic exercise, the lack of a resting or
noncaloric (i.e., fasting) trial prevents a complete understanding of the stimulatory effects of feeding on muscle protein
synthesis after exercise. Despite continued interest in the role
of nutrition on muscle recovery from aerobic exercise, the
direct effect of feeding on muscle protein synthesis after
exercise has yet to be fully elucidated.
Muscle protein breakdown is also elevated acutely (44) and
chronically (41) in response to aerobic exercise. Skeletal muscle protein breakdown is primarily mediated through the ATPdependent ubiquitin-proteosome pathway (UPP), which degrades myofibrillar and sarcoplasmic proteins in concert with
the calpain system (1, 16). Atrogin-1 and muscle-specific
RING finger protein-1 (MuRF-1) are the primary atrogenes of
the UPP and are induced through Forkhead box (FOXO)
signaling (16). These factors are acutely responsive to aerobic
exercise, presumably as part of the muscle remodeling process
(20, 32). Furthermore, the mRNA expression of these atrogenes is elevated in sarcopenic muscle (43) and reduced
following muscle hypertrophy (51), suggesting a role in the
regulation of muscle mass. The calpains are components of the
Ca2-dependent protein degradation pathway and have been
implicated in muscle proteolysis following muscle-damaging
exercise (14, 28). The role of these factors in regulating
exercise-mediated protein breakdown to nondamaging exercise
is not well defined. Collectively, these markers of muscle
proteolysis are a potential mechanism by which feeding may
alter muscle protein metabolism following exercise; however,
to our knowledge, this interaction has not been investigated.
Therefore, the purpose of this study was to examine the
influence of postexercise feeding (0.83 g carbohydrate, 0.37 g
protein, 0.03 g fat/kg body wt) on muscle protein synthesis and
the mRNA expression of proteolytic markers following a
session of aerobic exercise. Our primary hypothesis was that
feeding would result in higher muscle protein synthesis rates
following exercise compared with exercisefast (EX-FAST),
similar to what was observed with resistance exercise (34). We
further hypothesized that postexercise feeding would attenuate
the mRNA expression of proteolytic markers in skeletal muscle, which would be mediated primarily through a feedinginduced elevation in circulating insulin levels.
METHODS

Subjects and Experimental Overview


Address for reprint requests and other correspondence: M. Harber, Human
Performance Laboratory, Ball State Univ., Muncie, IN 47306 (e-mail:
mharber@bsu.edu).
R1254

Eight recreationally active males (means SE; 25 1 yr, 177


3 cm, 74 3 kg) volunteered to participate in this investigation. Prior
to enrollment, subjects participated in an introductory visit to the

0363-6119/10 Copyright 2010 the American Physiological Society

http://www.ajpregu.org

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

laboratory, where they were given an overview of the study protocol


and a medical history questionnaire, including exercise and dietary
screening. Subjects were excluded if they had a body mass index 28
kg/m2; any acute or chronic illness; cardiac, pulmonary, liver, kidney,
or metabolic disorder(s); uncontrolled hypertension; or were smokers.
None of the subjects were taking medications or supplements known
to effect protein metabolism. This investigation was approved by the
Institutional Review Board at Ball State University, and written
informed consent was obtained from each subject prior to participation.
Each subject completed the protocol over the period of 4 wk.
Subjects performed a cycle ergometer test for the assessment of
O2 max), which was used to determine
maximum aerobic capacity (V
the exercise intensity during the exercise trials. Each subject then
performed the resting trial followed by the two exercise trials in a
counter-balanced study design. The two exercise trials differed only in
the type of beverage consumed after exercise. Subjects refrained from
exercise for 3 days prior to all experimental trials. Additionally,
subjects consumed a standardized meal the evening prior to all
experimental trials and reported to the laboratory in the fasted state on
the morning of each trial. Approximately 1 wk was allocated between
each of the three experimental trials.
Aerobic Capacity
Prior to the experimental trials, subjects performed a test for the
O2 max) using an electronically
assessment of aerobic capacity (V
braked cycle ergometer (Velotron; RacerMate, Seattle, WA). During
the test, subjects performed a warm-up consisting of 2 min at 100 W
and 4 min at 150 W. Thereafter, the workload was increased in 25-W
increments every 2 min until exhaustion. During the test, subjects
perceived exertion and heart rate were recorded and respiratory gases
were measured with gas analyzers (Applied Electrochemistry, Ameteck S3A and CD3A).
Resting Assessment of Muscle Protein Synthesis
The resting trial served as a baseline assessment for protein synthesis, gene expression, and muscle glycogen content. Subjects reported to the laboratory in the fasted state following a standardized
meal the evening before. A catheter was placed in an antecubital vein
for infusion of the stable, isotopically labeled amino acid (Cambridge
Isotopes, Andover, MA). The amino acid tracer (2H5-phenylalanine)
was dissolved in 0.9% saline, passed through a 0.2-m filter, and
infused at a constant rate after an initial priming dose, as we have
previously described (6, 9, 20). The stable isotope infusion was
administered for five continuous hours to ensure that steady state
tracer enrichment in the plasma and muscle was maintained. During
the infusion, two muscle biopsies were obtained from the vastus
lateralis muscle. Both the 2-h and 5-h biopsies were used for the
measurement of resting protein synthesis. The 2-h biopsy was obtained for the assessment of basal gene expression and preexercise
muscle glycogen.
Additionally, a venous catheter was placed in the contralateral arm
for blood sampling. Blood samples (5 ml) were taken at 0, 2, 3, 4, and
5 h for the measurement of plasma amino acid tracer enrichment.

R1255

Fig. 1. Schematic of resting (A) and exercise (B) experimental trials. Subjects
performed two exercise trials in a counterbalanced design. Trials differed only
in the composition of the postexercise beverage. MB, muscle biopsy; 1,
feeding; *, blood sample.

topes). The stable isotope infusion was administered for six continuous hours. Following the initiation of the infusion, subjects consumed
a beverage containing 5 kcal/kg body wt (exercise-fed, EX-FED; 0.83
g carbohydrate/kg body wt, 0.37 g protein/kg body wt, 0.028 g fat/kg
body wt), or an isovolumetric, noncaloric placebo beverage (EXFAST). On average, subjects consumed 62 3 g of carbohydrate,
27 3 g of protein, and 2.1 0.1 g of fat at each feeding.
[2H5]-phenylalanine was added to the EX-FED beverage to maintain
steady plasma enrichment. The protein component of the supplement
was a milk protein isolate containing the proteins of milk (both whey
and casein) in their original proportions. The amino acid profile of the
protein was (in g/100 g of amino acids): 3.09 alanine, 3.28 arginine,
7.13 aspartic acid, 0.63 cystine, 19.72 glutamic acid, 1.80 glycine,
2.57 histidine, 5.19 isoleucine, 8.93 leucine, 7.77 lysine, 2.49 methionine, 4.55 phenylalanine, 9.95 proline, 5.47 serine, 4.71 threonine,
1.56 tryptophan, 4.98 tyrosine, and 6.18 valine. Following the exercise session, and beverage consumption, subjects rested in the supine
position within the laboratory for the duration of infusion. One hour
after the exercise session, subjects consumed another beverage identical to the one provided immediately after exercise. At each time
point, subjects consumed the beverage within a 15-min period.
A second catheter was placed in an antecubital vein of the contralateral arm for blood sampling at 2, 3, 4, 5, and 6 h of the infusion
for the measurement of plasma isotope enrichment and plasma substrate and insulin concentration. Muscle biopsies were obtained from
the vastus lateralis at 2 and 6 h during the isotope infusion for
determination of the incorporation of [2H5]-phenylalanine into mixedmuscle protein, gene expression, and muscle glycogen content.

Exercise Trials

Muscle Biopsy

Each subject performed two exercise trials in a counterbalanced


design (Fig. 1). The exercise trials differed only in the composition of
the postexercise beverage. During each trial, subjects performed 60
O2 max.
min of cycle ergometry at 70% of their predetermined V
Indirect calorimetry was used to assess energy expenditure and exercise intensity every 15 min during the exercise period. Immediately
following exercise, a catheter was placed in an antecubital vein for
postexercise blood draw and infusion of the stable, isotopically
labeled amino acid tracer ([2H5]-phenylalanine) (Cambridge Iso-

For each subject, a total of six muscle biopsies were obtained for
the entire study protocol. At each time point, percutaneous needle
biopsies were obtained under a local anesthetic (2). Muscle samples
were dissected free of any visible connective and adipose tissue and
divided into 20-mg sections. Sections to be used for mRNA analysis
were placed in 0.5 ml of RNALater (Ambion, Austin, TX) and stored
at 20C until RNA extraction. The other muscle sections were
immediately frozen and stored in liquid nitrogen (190C) until
analysis.

AJP-Regul Integr Comp Physiol VOL

299 NOVEMBER 2010

www.ajpregu.org

R1256

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

Plasma Substrates and Insulin


Plasma glucose (ThermoDMA, Arlington, TX) and fatty acid
(Wako Chemicals, Neuss, Germany) concentrations were measured
using commercially available colorimetric assay kits. Plasma insulin
was determined using an ELISA immunoassay kit (Alpco Diagnostics, Salem, NH).
Muscle Glycogen
Muscle glycogen content was determined from muscle biopsy
samples from the vastus lateralis muscle during the resting trial and 2
and 6 h following the cycle exercise. Glycogen content was determined from the measurement of glucose after acid hydrolysis of
muscle samples with hydrochloric acid (37).
Analysis of Mixed-Muscle Protein Synthesis
The rate of mixed-muscle protein synthesis was determined by
quantifying the tissue fluid and protein-bound [2H5]-phenylalanine
enrichment (tracer to tracee) in muscle samples (20 mg) from the
vastus lateralis, as we have previously described (6, 9, 20). All
samples were analyzed using GC-MS (6890N GC coupled with 5973
inert MSD; Agilent Technologies, Wilmington, DE) in triplicate using
electron impact ionization and selected ion monitoring of m/z 234
(m0), 235 (m1), 237 (m3), and 239 (m5), with m0 representing the lowest molecular weight of the ion. Plasma and muscle
tissue fluid [2H5]-phenylalanine enrichments were measured using the
m5-to-m0 ratio. Enrichments of the protein-bound samples were
determined using the m5-to-m3 ratio and a single linear standard
curve from mixtures of known m5-to-m0 ratios, as previously
described (7, 38). Elimination of bias due to any potential concentration dependency was accomplished by injecting nearly equal amounts
of phenylalanine (i.e., similar m0 abundances) for all samples and
standards.
Mixed-muscle fractional synthesis rate (FSR) was calculated as the
rate of [2H5]-phenylalanine tracer incorporated into muscle protein
using the muscle tissue fluid phenylalanine enrichment as the precursor and the following equation: FSR (%/h) {[(Et1 Et0)]/[Ep(t1
t0)]}100, where Et1 and Et0 are the phenylalanine tracer enrichments
in the protein-bound fraction, (t1 t0) is the phenylalanine trace
incorporation time, and Ep is the muscle tissue fluid phenylalanine
enrichment.
Plasma Phenylalanine Rate of Appearance
Whole body proteolysis was measured as phenylalanine rate of
appearance (Ra) into plasma under steady-state conditions using the
following formula: Ra F/Ep, where Ra is the rate of appearance
(molkg1min1), F is the infusion rate, and Ep is the plasma
enrichment.
mRNA Expression
Total RNA extraction and RNA quality check. Total RNA was
extracted in TRI reagent (Molecular Research Center, Cincinnati,
OH). The quality and integrity [RNA Integrity Number of 8.35 0.07
(SE)] of extracted RNA (165.15 ng/l) was evaluated using an RNA
6000 Nano LabChip kit on an Agilent 2100 Bioanalyzer.
RT and real-time PCR. Oligo (dT) primed first-strand cDNA was
synthesized (150 ng total RNA) using SuperScript II RT (Invitrogen,
Carlsbad, CA). Quantification of mRNA transcription (in duplicate)
was performed in a 72-well Rotor-Gene 3000 Centrifugal Real-Time
Cycler (Corbett Research, Mortlake, NSW, Australia). HKG GAPDH
was used as a reference gene. The validation of GAPDH was performed to ensure that its expression was unaffected by the experimental treatments, as we have previously described (25).
All primers used in this study were mRNA specific (on different
exons and crossing over an intron) and designed for real-time PCR
AJP-Regul Integr Comp Physiol VOL

analysis using Vector NTI Advance 9 software (Invitrogen). Primers


for muscle regulatory factor 4 (MRF4), muscle-RING-finger protein-1
(MuRF-1), forkhead box [FOXO]3A, peroxisome proliferator-activated receptor-gamma coactivator 1- (PGC-1), mitochondrial transcription factor A (TFAM), calpain-1, calpain-2, caspase-3, and myostatin have been reported previously by our laboratory (20, 32, 55).
A melting curve analysis was generated to validate that only one
product was present. The details about RT and PCR reaction parameters have been reported previously (32, 42).
The data were analyzed using 2CT method (30). The 2CT
method was used to calculate the fold change (compared to rest) in
gene expression at 2 and 6 h in each of the experimental trials. In this
method, gene of interest (GOI) expression was normalized to housekeeping gene (HKG) expression and calibrated to control resting value
(CT CT GOI timeX CT HKG timeX) (CT GOI average time zero
CT HKG average time zero). In using this analysis, the fold changes at time 0 (control
rest), if not influenced by external stimulus, should be very close to 1.
Statistical Analysis
Data from the exercise trials (i.e., exercise intensity, energy expenditure) were compared using a paired Students t-test. A one-way
ANOVA with repeated measures was used to compare muscle protein
synthesis rates and plasma Ra. A two-way ANOVA with repeated
measures on trial (EX-FAST vs. EX-FED) and time (postexercise, 2
h, 3 h, 4 h, 5 h, 6 h) was used to compare plasma substrates and
insulin. A two-way ANOVA with repeated measures on trial (rest vs.
EX-FAST vs. EX-FED) and time (2 h vs. 6 h) was used to compare
muscle glycogen concentration. Changes in mRNA expression (expressed as fold-change from rest) between the exercise trials were
analyzed with a two-way ANOVA with repeated measures on trial
(EX-FAST vs. EX-FED) and time (2 h vs. 6 h). In the presence of a
main effect, a Bonferroni post hoc analysis was performed to make
pairwise comparisons. Significance for all analysis was set a priori at
P 0.05. Data are presented as means SE.
RESULTS

Exercise Trials
Aerobic capacity, assessed as maximum oxygen consump O2 max) during cycling, was 3.9 0.2 l/min and 52 2
tion (V
mlkg1min1. All subjects successfully completed all three
experimental trials. There were no differences in external
O2, exercise intensity, average
power output (W), average V
heart rate, or energy expenditure between the two exercise
trials (Table 1).
Plasma Glucose and Fatty Acids
No differences were present in plasma glucose concentration
immediately postexercise or during the 6-h postexercise recovTable 1. Performance and physiological measures from each
exercise trial
Average power output, W
O2, l/min
Average V
O2max
Intensity, % V
Average HR, bpm
Energy expenditure, kcal
RER

EX-FAST

EX-FED

187 11
2.8 0.1
71.9 1.2
160 4
832 36
0.95 0.01

187 11
2.8 0.1
72.6 1.2
159 5
840 40
0.94 0.01

Data are expressed as means SE. Subjects performed 60-min of cycle


ergometry during each trial. EX-FAST, exercisefast (noncaloric placebo
ingestion); EX-FED, exercisefed (5 kcal, 0.83 g carbohydrate, 0.37 g protein,
and 0.03 g fat); HR; heart rate, RER; respiratory exchange ratio.
299 NOVEMBER 2010

www.ajpregu.org

R1257

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

Table 2. Plasma substrates and insulin in the postexercise period during EX-FAST and EX-FED trials
Postexercise

2h

5.9 0.3
6.3 0.3

5.2 0.2
5.2 0.4

3h

4h

5h

6h

5.2 0.2
5.1 0.1

5.2 0.2
5.3 0.2

5.2 0.2
5.2 0.1

0.58 0.05
0.42 0.06*

0.53 0.06
0.58.06

0.61 0.07
0.62 0.05

5.8 1.9
7.9 2.6*

5.5 2.0
5.8 2.1

5.3 1.7
5.3 1.7

Glucose, mM
EX-FAST
EX-FED

5.2 0.1
5.3 0.3
Fatty Acids, mM

EX-FAST
EX-FED

0.68 0.08
0.84 0.09

0.77 0.11
0.21 0.02*

0.64 0.12
0.19 0.01*
Insulin, U/ml

EX-FAST
EX-FED

9.3 2.5
9.7 2.6

6.1 2.0
24.1 3.2*

5.3 1.8
15.5 5.3*

Data are expressed as means SE. *P 0.05 compared to EX-FAST.

ery period between trials (Table 2). Plasma fatty acids were
lower at 2 h, 3 h, and 4 h postexercise in EX-FED compared
with EX-FAST (Table 2).
Plasma Insulin
Plasma insulin concentrations were similar between trials immediately postexercise. Plasma insulin was higher at 2 h, 3 h, and
4 h postexercise in EX-FED compared with EX-FAST (Table 2).
Muscle Glycogen
Resting muscle glycogen concentration (468 30 mmol/kg
dry wt) was higher (P 0.05) compared with postexercise
during EX-FAST and EX-FED, suggesting that the exercise
session significantly lowered muscle glycogen. Muscle glycogen was higher (P 0.05) at 2 h and 6 h during EX-FED
(223 36 and 231 38 mmol/kg dry wt, respectively)
compared with EX-FAST (162 29 and 165 28 mmol/kg
dry wt for 2 h and 6 h, respectively).
Mixed-Muscle Protein Synthesis
Plasma [2H5]-phenylalanine enrichments were stable during
the infusion periods for REST, EX-FAST, and EX-FED trials,
demonstrating isotope steady-state (Fig. 2). The average
plasma [2H5]-phenylalanine enrichment was 0.051 0.001,

Fig. 2. Plasma [2H5]-phenylalanine enrichments during the resting and


exercise trials. TTR, tracer-to-tracee ratio (m 5/m 0). Data are
expressed as means SE.
AJP-Regul Integr Comp Physiol VOL

0.052 0.001, and 0.065 0.002 for REST, EX-FAST, and


EX-FED, respectively. Muscle intracellular free [2H5]-phenylalanine enrichments were 0.040 0.003, 0.044 0.002, and
0.054 0.001 for REST, EX-FAST, and EX-FED, respectively.
Mixed muscle FSR was higher (P 0.05) during both
EX-FAST (0.112 0.010%h1) and EX-FED (0.129
0.014%h1) compared with REST (0.071 0.005%h1)
(Fig. 3). No significant differences were apparent between
EX-FAST and EX-FED.
Plasma Ra
Whole-body proteolysis, reflected by phenylalanine Ra
into plasma, was lower (P 0.05) in EX-FED (0.83 0.03
molkg1min1) compared with REST (1.06 0.02
molkg1min1) and EX-FAST (1.05 0.02 molkg1min1).
mRNA Expression
All gene expression data are presented as fold change from
REST. MuRF-1 was higher (P 0.05) at 2 h and 6 h after
exercise during EX-FAST and only at 2 h during EX-FED
(Fig. 3). There was an interaction between trials at 6 h,
indicating that MuRF-1 mRNA expression was attenuated at 6
h during EX-FED. FOXO3A was lower (P 0.05) at 6 h
postexercise for both EX-FAST and EX-FED (Fig. 4).
Calpain-1 was unchanged (P 0.05) after exercise in both
EX-FAST and EX-FED (Fig. 4). There was an interaction (P
0.05) between EX-FAST and EX-FED for calpain-2 at 2 h and

Fig. 3. Mixed muscle protein fractional synthesis rate (FSR) at rest and
following exercise during exercise-fasting (EX-FAST) and exercise-fed
(EX-FED) conditions. *P 0.05 compared with rest. Data are expressed as
means SE.
299 NOVEMBER 2010

www.ajpregu.org

R1258

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

Fig. 4. Top: muscle-specific RING finger protein-1


(MuRF-1) and FOXO3A mRNA expression in skeletal
muscle during recovery from exercise under EX-FAST and
EX-FED conditions. Bottom: Calpain-1 and calpain-2
mRNA expression in skeletal muscle during recovery from
exercise under EX-FAST and EX-FED conditions. *P
0.05 compared with rest. #P 0.05 for interaction between
trials.

6 h postexercise, suggesting that calpain-2 mRNA expression


was attenuated during EX-FED (Fig. 4). Caspase-3 remained
unchanged (P 0.05) after exercise in both EX-FAST and
EX-FED. Myostatin was lower (P 0.05) at 2 h and 6 h
postexercise during both EX-FAST and EX-FED. However, no
differences were apparent between EX-FAST and EX-FED
(data not shown).
MRF4 was elevated (P 0.05) at 2 h and 6 h during
EX-FAST only (Fig. 5). Additionally, an interaction (P
0.05) between EX-FAST and EX-FED was apparent at both 2
h and 6 h, indicating that MRF4 was blunted during EX-FED
(Fig. 5).
PGC-1 was elevated (P 0.05) at 2 h and 6 h postexercise
during both EX-FAST and EX-FED (Fig. 6). Conversely,
TFAM was unchanged after exercise in both trials.
DISCUSSION

The primary findings from this investigation were that


1) mixed muscle protein synthesis is elevated in the immediate
AJP-Regul Integr Comp Physiol VOL

hours following one session of aerobic exercise performed with


O2 max) in the
moderate duration (60 min) and intensity (72% V
fasted state; 2) ingestion of carbohydrate plus protein (i.e.,
feeding) after exercise did not measurably stimulate mixed
muscle FSR above fasted state values between 2 and 6 h
postexercise; 3) feeding after exercise attenuated skeletal muscle mRNA expression of proteolytic markers MuRF-1 and
calpain-2; and 4) feeding after exercise blunted skeletal muscle
mRNA expression of the myogenic marker MRF4. These
findings indicate that aerobic exercise stimulates muscle FSR,
even in the absence of exogenous nutrient provision. While
feeding in the postexercise period did not significantly
further augment muscle FSR, the suppression of whole-body
proteolysis and proteolytic markers suggests that feeding
may reduce muscle protein breakdown. Collectively, these
data indicate that nutritional intake following aerobic exercise may create a net anabolic environment that would
enhance muscle recovery and potentially optimize adaptations to exercise training.
299 NOVEMBER 2010

www.ajpregu.org

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

Fig. 5. Myogenic regulatory factor-4 (MRF4) mRNA expression in skeletal


muscle during recovery from exercise under EX-FAST and EX-FED conditions. *P 0.05 compared with rest. #P 0.05 for interaction between trials.

To our knowledge, this is the first study to report muscle


FSR after aerobic exercise in both the fasted and fed states.
Several studies have reported muscle FSR following aerobic
exercise (5, 8, 20, 24, 33, 44, 48, 50); however, most have
induced hyperaminoacidemia through feeding or infusion of
amino acids (20, 24, 33, 50) or have not included a resting
measure (5). There is precedent in human skeletal muscle that
aerobic exercise stimulates muscle FSR in the absence of
feeding (8, 44); however, both of these studies used relatively
O2 max) and walking exerlow exercise intensities (i.e., 45% V
cise, which incorporates both concentric and eccentric loads on
the muscle examined (i.e., vastus lateralis). Our results extend
these findings to show that cycling exercise performed at
O2 max) also significantly stimulates
moderate intensity (72% V
muscle FSR in the hours immediately postexercise. Interestingly, providing a meal containing adequate carbohydrate for
glycogen resynthesis (0.83 gkg1 body wth1) and sufficient
protein (0.37 gkg body wt1h1 or 27 g/h) to stimulate
muscle FSR did not result in a further increase in mixed muscle

R1259

FSR above values obtained in the fasted state. In comparison,


postexercise feeding has been shown to exert a stimulatory
influence on mixed-muscle protein FSR following resistance
exercise (34). However, it is unclear whether the divergent
response between studies is due to the mode of exercise
(aerobic vs. resistance) or the timeframe of feeding and FSR
assessment after exercise.
Our aim was to examine a practical feeding regimen that
provides physiological relevance to real-world applications. To
achieve this, we used a two-bolus-feeding regimen of a commercially available product instead of inducing hyperaminoacidemia via intravenous infusion of nutrients or with consistent pulse feedings throughout the entire assessment timeframe, as we and others have previously performed (20, 24, 33,
50). A similar single-bolus-feeding approach has been used
previously to assess the influence of varying protein amounts
on muscle FSR following resistance exercise (34). The stimulatory effect of amino acids on muscle FSR is transient (4),
although this relationship may be prolonged in the postexercise
state (35). Therefore, it is possible that the feeding response
may not have been robust enough to be detected during the 2 6
h timeframe after exercise, which was initiated 1 h after
feeding. Despite this possibility, these data provide novel
insights into the interactions between feeding and muscle
metabolism during recovery from aerobic exercise.
In addition to the influence of exercise on muscle protein
synthesis, muscle protein breakdown is elevated after both
aerobic (44) and resistance (3, 40) exercise. We have previously shown that the mRNA transcripts of proteolytic factors
(e.g., FOXO3A, MuRF-1) are elevated following exercise (20,
32), which may serve as a mechanism through which exercise
elevates muscle proteolysis. MuRF-1 and FOXO3A are components of the ubiquitin-proteosome pathway that is responsible for the majority of skeletal muscle protein degradation (16).
Specifically, these factors target myofibrillar proteins for degradation and have been implicated in the degradation of select
mitochondrial proteins (52, 53). To our knowledge, these are
the first data to report that feeding after exercise attenuates
MuRF-1 mRNA expression after aerobic exercise. Glynn et al.
(17) recently reported that feeding after resistance exercise did

Fig. 6. Peroxisome proliferator-activated receptor-gamma


coactivator 1- (PGC-1) and mitochondrial transcription factor A (TFAM) mRNA expression in skeletal
muscle during recovery from exercise under EX-FAST
and EX-FED conditions. *P 0.05 compared with rest.

AJP-Regul Integr Comp Physiol VOL

299 NOVEMBER 2010

www.ajpregu.org

R1260

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

not alter MuRF-1 mRNA or protein levels 2 h postexercise,


which is consistent with the current data reporting a blunting of
MuRF-1 mRNA at 6 h but not 2 h after exercise. Because of
the role of MuRF-1 in mediating protein breakdown, these data
suggest that the feeding regimen may inhibit or reduce protein
breakdown after aerobic exercise. Future studies are warranted
to further explore this relationship, incorporating direct measures of protein breakdown.
Calpain-1 and -2 (also known as - and -m) are components
of the Ca2-activated protein degradation that appear to be
initiators of myofibrillar protein degradation (26). Little is
known regarding the role of calpains in response to exercise;
however, they are generally thought to play a pivotal role in the
muscle remodeling process after muscle-damaging exercise
(1). In support of this, calpain-2 mRNA abundance is elevated
2 days after exhaustive jumping exercise (28), 1 day after
eccentric exercise (14), and in response to muscle reloading
following hindlimb suspension (46). Our data reveal that calpain-2 mRNA is elevated in the immediate hours following
cycling exercise, which is not typically associated with muscle
damage. Furthermore, feeding after exercise blunted the increase in calpain-2 mRNA, providing another potential mechanism suggesting that feeding may influence myofibrillar
breakdown following exercise. The influence of exercise on
myofibrillar breakdown has not been clearly elucidated; however, our laboratory has previously reported that myofibrillar
breakdown is not altered after aerobic exercise in the fed state
(22). The blunting of calpain-2 mRNA induction after exercise
by feeding is consistent with a lack of elevation of myofibrillar
breakdown.
The mechanisms underlying the influence of feeding on the
attenuation of proteolytic mRNA expression after exercise is
likely mediated through insulin, as insulin exhibits an antiproteolytic influence on skeletal muscle (15, 18, 31). Greenhaff et
al. (18) comprehensively investigated the influence of amino
acids and insulin on muscle protein metabolism in the absence
of exercise, incorporating measures of proteolytic mRNA expression. Interestingly, they reported an inhibitory influence of
insulin on muscle protein breakdown without an appreciable
change in the expression of proteolytic genes (i.e., MuRF-1,
calpain-1, calpain-2) (18). In the current study, we report that
feeding and the resultant increase in circulating insulin attenuates the transcriptional response of MuRF-1 and calpain-2
following exercise. MuRF-1 transcription was likely induced
after exercise through NF-B signaling (27), while MuRF-1
mRNA expression was likely suppressed by the presence of
insulin through the Akt-FOXO signaling pathway (47) during
the feeding trial. Another plausible mechanism for the attenuated MuRF-1 mRNA expression with feeding is through
AMPK signaling as AMPK activation has recently been linked
with myofibrillar degradation (36) and induction of MuRF-1
transcription (49). On the basis of previous research (10), it is
reasonable to suspect that AMPK activity was elevated after
the exercise protocol in the current study. AMPK is sensitive to
muscle glycogen levels (11, 54), and therefore, the glycogen
resynthesis during the feeding trial may have altered AMPK
signaling and ultimately attenuated MuRF-1 expression. The
suppression of calpain-2 mRNA with feeding was potentially
mediated through a similar mechanism; however, this is only
conjecture at this point, as relatively little is known regarding
AJP-Regul Integr Comp Physiol VOL

the regulation of calpain-2 expression by exercise and nutrition.


An unexpected finding from the current study was the
attenuation of MRF4 mRNA with feeding. MRF is a member
of the family of muscle regulatory factors and is involved in
myogenesis and differentiation of myoblasts into mature myofibers (23). Consistent with our previous work (20, 55), we
observed that MRF4 mRNA expression is upregulated during
recovery from exercise. Contrary to our hypothesis, feeding
attenuated MRF4 mRNA expression following exercise. Our
laboratory has previously shown that both myogenic and proteolytic genes are upregulated in sarcopenic muscle (43), and it
has been proposed that during muscle atrophy, MRF4 mRNA
expression is upregulated in an attempt to offset the atrophic
process. The exact role of MRF4 in adult human muscle
remains unclear; however, it has been suggested that MRF4 is
involved in the maintenance of terminally differentiated cells
(39). Therefore, in the immediate postexercise period, MRF4 is
upregulated in concert with proteolytic genes as part of the
muscle remodeling process. Along these lines, it is possible
that the same mechanism that attenuated MuRF-1 and calpain-2 mRNA expression with feeding may have also blunted
MRF4 mRNA expression.
Perspectives and Significance
Aerobically trained skeletal muscle is characterized by a
high oxidative capacity and in some cases muscle fiber hypertrophy (12, 13, 19, 21). While the mechanisms of exerciseinduced mitochondrial biogenesis have been comprehensively
investigated, the alterations in muscle protein metabolism during recovery from aerobic type exercise have been less characterized. Results from this study demonstrate that aerobic
exercise performed with moderate duration and intensity significantly stimulates mixed-muscle protein FSR, even in the
fasted state. Although we did not specifically assess the FSR of
the various muscle protein fractions (i.e., myofibrillar, sarcoplasmic, mitochondrial), it is probable that the detectable
change in mixed muscle protein FSR was primarily due to
changes in mitochondrial protein FSR (50), although future
work is needed to verify this point. This finding extends
previous research reporting elevated protein FSR after lowintensity exercise (8, 44), to demonstrate that aerobic exercise
performed at moderate to high intensity, which significantly
reduces muscle glycogen levels, also stimulates mixed-muscle
protein FSR. Interestingly, feeding after exercise did not further stimulate protein FSR, which may be due to the timing of
postexercise FSR measurement or because the feeding effect
was minimal and/or transient in nature and was, therefore, not
detected. Postexercise feeding did attenuate the transcription of
proteolytic markers MuRF-1 and calpain-2, suggesting a potential role of feeding after aerobic exercise on muscle protein
breakdown. The association between mRNA expression of
these proteolytic factors and their protein content or function
was not directly assessed in the current study; therefore, the
role of feeding on postexercise protein degradation remains
speculative. A reduction of protein breakdown coupled with
similar or slightly elevated levels of protein FSR in the presence of feeding would potentially enhance muscle recovery by
creating a positive muscle-protein balance. Collectively, these
data provide molecular insights into the regulation of muscle
299 NOVEMBER 2010

www.ajpregu.org

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

protein metabolism and recovery by feeding in the hours


immediately following aerobic exercise.
ACKNOWLEDGMENTS
We are grateful to Bill Fink for technical assistance with muscle glycogen
analysis.
GRANTS
This research was supported by a grant from the Gatorade Sports Science
Institute (to M. Harber).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
REFERENCES
1. Bartoli M, Richard I. Calpains in muscle wasting. Int J Biochem Cell
Biol 37: 21152133, 2005.
2. Bergstrom J. Muscle electrolytes in man. Scand J Clin Lab Invest Suppl
68: 1110, 1962.
3. Biolo G, Maggi SP, Williams BD, Tipton KD, Wolfe RR. Increased
rates of muscle protein turnover and amino acid transport after resistance
exercise in humans. Am J Physiol Endocrinol Metab 268: E514 E520,
1995.
4. Bohe J, Low JF, Wolfe RR, Rennie MJ. Latency and duration of
stimulation of human muscle protein synthesis during continuous infusion
of amino acids. J Physiol 532: 575579, 2001.
5. Bolster DR, Pikosky MA, Gaine PC, Martin W, Wolfe RR, Tipton
KD, Maclean D, Maresh CM, Rodriguez NR. Dietary protein intake
impacts human skeletal muscle protein fractional synthetic rates after
endurance exercise. Am J Physiol Endocrinol Metab 289: E678 E683,
2005.
6. Burd NA, Dickinson JM, Lemoine JK, Carroll CC, Sullivan BE, Haus
JM, Jemiolo B, Trappe SW, Hughes GM, Sanders CE Jr, Trappe TA.
Effect of a cyclooxygenase-2 inhibitor on postexercise muscle protein
synthesis in humans. Am J Physiol Endocrinol Metab 298: E354 E361,
2010.
7. Calder AG, Anderson SE, Grant I, McNurlan MA, Garlick PJ. The
determination of low d5-phenylalanine enrichment (0.002 009 atom percent excess), after conversion to phenylethylamine, in relation to protein
turnover studies by gas chromatography/electron ionization mass spectrometry Rapid Commun Mass Spectrom 6: 421424, 1992.
8. Carraro F, Stuart CA, Hartl WH, Rosenblatt J, Wolfe RR. Effect of
exercise and recovery on muscle protein synthesis in human subjects. Am
J Physiol Endocrinol Metab 259: E470 E476, 1990.
9. Carroll CC, Fluckey JD, Williams RH, Sullivan DH, Trappe TA.
Human soleus and vastus lateralis muscle protein metabolism with an
amino acid infusion. Am J Physiol Endocrinol Metab 288: E479 E485,
2005.
10. Chen ZP, Stephens TJ, Murthy S, Canny BJ, Hargreaves M, Witters
LA, Kemp BE, McConell GK. Effect of exercise intensity on skeletal
muscle AMPK signaling in humans. Diabetes 52: 22052212, 2003.
11. Cochran AJ, Little JP, Tarnopolsky MA, Gibala MJ. Carbohydrate
feeding during recovery alters the skeletal muscle metabolic response to
repeated sessions of high-intensity interval exercise in humans. J Appl
Physiol 108: 628 636, 2010.
12. Coggan AR, Spina RJ, King DS, Rogers MA, Brown M, Nemeth PM,
Holloszy JO. Skeletal muscle adaptations to endurance training in 60- to
70-yr-old men and women. J Appl Physiol 72: 1780 1786, 1992.
13. Costill DL, Fink WJ, Pollock ML. Muscle fiber composition and enzyme
activities of elite distance runners. Med Sci Sports 8: 96 100, 1976.
14. Feasson L, Stockholm D, Freyssenet D, Richard I, Duguez S, Beckmann JS, Denis C. Molecular adaptations of neuromuscular diseaseassociated proteins in response to eccentric exercise in human skeletal
muscle. J Physiol 543: 297306, 2002.
15. Gelfand RA, Barrett EJ. Effect of physiologic hyperinsulinemia on
skeletal muscle protein synthesis and breakdown in man. J Clin Invest 80:
16, 1987.
16. Glickman MH, Ciechanover A. The ubiquitin-proteasome proteolytic
pathway: destruction for the sake of construction. Physiol Rev 82: 373
428, 2002.
AJP-Regul Integr Comp Physiol VOL

R1261

17. Glynn EL, Fry CS, Drummond MJ, Dreyer HC, Dhanani S, Volpi E,
Rasmussen BB. Muscle protein breakdown has a minor role in the protein
anabolic response to essential amino acid and carbohydrate intake following resistance exercise. Am J Physiol Regul Integr Comp Physiol 299:
R533R540, 2010.
18. Greenhaff PL, Karagounis LG, Peirce N, Simpson EJ, Hazell M,
Layfield R, Wackerhage H, Smith K, Atherton P, Selby A, Rennie MJ.
Disassociation between the effects of amino acids and insulin on signaling,
ubiquitin ligases, and protein turnover in human muscle. Am J Physiol
Endocrinol Metab 295: E595E604, 2008.
19. Harber M, Trappe S. Single muscle fiber contractile properties of young
competitive distance runners. J Appl Physiol 105: 629 636, 2008.
20. Harber MP, Crane JD, Dickinson JM, Jemiolo B, Raue U, Trappe TA,
Trappe SW. Protein synthesis and the expression of growth-related genes
are altered by running in human vastus lateralis and soleus muscles. Am J
Physiol Regul Integr Comp Physiol 296: R708 R714, 2009.
21. Harber MP, Konopka AR, Douglass MD, Minchev K, Kaminsky LA,
Trappe TA, Trappe S. Aerobic exercise training improves whole muscle
and single myofiber size and function in older women. Am J Physiol Regul
Integr Comp Physiol 297: R1452R1459, 2009.
22. Haus JM, Miller BF, Carroll CC, Weinheimer EM, Trappe TA. The
effect of strenuous aerobic exercise on skeletal muscle myofibrillar proteolysis in humans. Scand J Med Sci Sports 17: 260 266, 2007.
23. Hawke TJ, Garry DJ. Myogenic satellite cells: physiology to molecular
biology. J Appl Physiol 91: 534 551, 2001.
24. Howarth KR, Moreau NA, Phillips SM, Gibala MJ. Coingestion of
protein with carbohydrate during recovery from endurance exercise stimulates skeletal muscle protein synthesis in humans. J Appl Physiol 106:
1394 1402, 2009.
25. Jemiolo B, Trappe S. Single muscle fiber gene expression in human
skeletal muscle: validation of internal control with exercise. Biochem
Biophys Res Commun 320: 10431050, 2004.
26. Koohmaraie M. Effect of pH, temperature, and inhibitors on autolysis
and catalytic activity of bovine skeletal muscle mu-calpain. J Anim Sci 70:
30713080, 1992.
27. Kramer HF, Goodyear LJ. Exercise, MAPK, and NF-B signaling in
skeletal muscle. J Appl Physiol 103: 388 395, 2007.
28. Lehti M, Kivela R, Komi P, Komulainen J, Kainulainen H, Kyrolainen H. Effects of fatiguing jumping exercise on mRNA expression of
titin-complex proteins and calpains. J Appl Physiol 106: 1419 1424,
2009.
29. Levenhagen DK, Carr C, Carlson MG, Maron DJ, Borel MJ, Flakoll
PJ. Postexercise protein intake enhances whole-body and leg protein
accretion in humans. Med Sci Sports Exerc 34: 828 837, 2002.
30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta CT) method.
Methods 25: 402408, 2001.
31. Louard RJ, Fryburg DA, Gelfand RA, Barrett EJ. Insulin sensitivity of
protein and glucose metabolism in human forearm skeletal muscle. J Clin
Invest 90: 2348 2354, 1992.
32. Louis E, Raue U, Yang Y, Jemiolo B, Trappe S. Time course of
proteolytic, cytokine, and myostatin gene expression after acute exercise
in human skeletal muscle. J Appl Physiol 103: 1744 1751, 2007.
33. Miller BF, Olesen JL, Hansen M, Dossing S, Crameri RM, Welling
RJ, Langberg H, Flyvbjerg A, Kjaer M, Babraj JA, Smith K, Rennie
MJ. Coordinated collagen and muscle protein synthesis in human patella
tendon and quadriceps muscle after exercise. J Physiol 567: 10211033,
2005.
34. Moore DR, Robinson MJ, Fry JL, Tang JE, Glover EI, Wilkinson SB,
Prior T, Tarnopolsky MA, Phillips SM. Ingested protein dose response
of muscle and albumin protein synthesis after resistance exercise in young
men. Am J Clin Nutr 89: 161168, 2009.
35. Moore DR, Tang JE, Burd NA, Rerecich T, Tarnopolsky MA, Phillips
SM. Differential stimulation of myofibrillar and sarcoplasmic protein
synthesis with protein ingestion at rest and after resistance exercise. J
Physiol 587: 897904, 2009.
36. Nakashima K, Yakabe Y. AMPK activation stimulates myofibrillar
protein degradation and expression of atrophy-related ubiquitin ligases by
increasing FOXO transcription factors in C2C12 myotubes. Biosci Biotechnol Biochem 71: 1650 1656, 2007.
37. Passonneau JV, Lauderdale VR. A comparison of three methods of
glycogen measurement in tissues. Anal Biochem 60: 405412, 1974.
38. Patterson BW, Zhang XJ, Chen Y, Klein S, Wolfe RR. Measurement of
very low stable isotope enrichments by gas chromatography/mass spec299 NOVEMBER 2010

www.ajpregu.org

R1262

39.
40.

41.

42.

43.

44.

45.

46.

47.

FEEDING AND POSTEXERCISE MUSCLE PROTEIN METABOLISM

trometry: application to measurement of muscle protein synthesis. Metabolism 46: 943948, 1997.
Perry RL, Rudnick MA. Molecular mechanisms regulating myogenic
determination and differentiation. Front Biosci 5: D750 D767, 2000.
Phillips SM, Tipton KD, Aarsland A, Wolf SE, Wolfe RR. Mixed
muscle protein synthesis and breakdown after resistance exercise in
humans. Am J Physiol Endocrinol Metab 273: E99 E107, 1997.
Pikosky MA, Gaine PC, Martin WF, Grabarz KC, Ferrando AA,
Wolfe RR, Rodriguez NR. Aerobic exercise training increases skeletal
muscle protein turnover in healthy adults at rest. J Nutr 136: 379 383,
2006.
Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Myogenic gene
expression at rest and after a bout of resistance exercise in young (18 30
yr) and old (80 89 yr) women. J Appl Physiol 101: 5359, 2006.
Raue U, Slivka D, Jemiolo B, Hollon C, Trappe S. Proteolytic gene
expression differs at rest and after resistance exercise between young and
old women. J Gerontol A Biol Sci Med Sci 62: 14071412, 2007.
Sheffield-Moore M, Yeckel CW, Volpi E, Wolf SE, Morio B, Chinkes
DL, Paddon-Jones D, Wolfe RR. Postexercise protein metabolism in
older and younger men following moderate-intensity aerobic exercise. Am
J Physiol Endocrinol Metab 287: E513E522, 2004.
Short KR, Vittone JL, Bigelow ML, Proctor DN, Nair KS. Age and
aerobic exercise training effects on whole body and muscle protein
metabolism. Am J Physiol Endocrinol Metab 286: E92E101, 2004.
Spencer MJ, Lu B, Tidball JG. Calpain II expression is increased by
changes in mechanical loading of muscle in vivo. J Cell Biochem 64:
5566, 1997.
Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO,
Gonzalez M, Yancopoulos GD, Glass DJ. The IGF-1/PI3K/Akt pathway

AJP-Regul Integr Comp Physiol VOL

48.
49.

50.

51.
52.
53.

54.

55.

prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 14: 395403, 2004.
Tipton KD, Ferrando AA, Williams BD, Wolfe RR. Muscle protein
metabolism in female swimmers after a combination of resistance and
endurance exercise. J Appl Physiol 81: 2034 2038, 1996.
Tong JF, Yan X, Zhu MJ, Du M. AMP-activated protein kinase
enhances the expression of muscle-specific ubiquitin ligases despite its
activation of IGF-1/Akt signaling in C2C12 myotubes. J Cell Biochem
108: 458 468, 2009.
Wilkinson SB, Phillips SM, Atherton PJ, Patel R, Yarasheski KE,
Tarnopolsky MA, Rennie MJ. Differential effects of resistance and
endurance exercise in the fed state on signalling molecule phosphorylation
and protein synthesis in human muscle. J Physiol 586: 37013717, 2008.
Williamson DL, Raue U, Slivka DR, Trappe S. Resistance exercise,
skeletal muscle FOXO3A, and 85-year-old women. J Gerontol A Biol Sci
Med Sci 65: 335343, 2010.
Witt CC, Witt SH, Lerche S, Labeit D, Back W, Labeit S. Cooperative
control of striated muscle mass and metabolism by MuRF1 and MuRF2.
EMBO J 27: 350 360, 2008.
Witt SH, Granzier H, Witt CC, Labeit S. MURF-1 and MURF-2 target
a specific subset of myofibrillar proteins redundantly: towards understanding MURF-dependent muscle ubiquitination. J Mol Biol 350: 713722,
2005.
Wojtaszewski JF, MacDonald C, Nielsen JN, Hellsten Y, Hardie DG,
Kemp BE, Kiens B, Richter EA. Regulation of 5AMP-activated protein
kinase activity and substrate utilization in exercising human skeletal
muscle. Am J Physiol Endocrinol Metab 284: E813E822, 2003.
Yang Y, Creer A, Jemiolo B, Trappe S. Time course of myogenic and
metabolic gene expression in response to acute exercise in human skeletal
muscle. J Appl Physiol 98: 17451752, 2005.

299 NOVEMBER 2010

www.ajpregu.org

International Journal of Sport Nutrition and Exercise Metabolism, 2012, 22, 392-400
2012 Human Kinetics, Inc.

www.IJSNEM-Journal.com
CASE STUDies

Case Study: Nutrition and Training Periodization


in Three Elite Marathon Runners
Trent Stellingwerff
Laboratory-based studies demonstrate that fueling (carbohydrate; CHO) and fluid strategies can enhance
training adaptations and race-day performance in endurance athletes. Thus, the aim of this case study was
to characterize several periodized training and nutrition approaches leading to individualized race-day fluid
and fueling plans for 3 elite male marathoners. The athletes kept detailed training logs on training volume,
pace, and subjective ratings of perceived exertion (RPE) for each training session over 16 wk before race day.
Training impulse/load calculations (TRIMP; min RPE = load [arbitrary units; AU]) and 2 central nutritional
techniques were implemented: periodic low-CHO-availability training and individualized CHO- and fluidintake assessments. Athletes averaged ~13 training sessions per week for a total average training volume of
182 km/wk and peak volume of 231 km/wk. Weekly TRIMP peaked at 4,437 AU (Wk 9), with a low of 1,887
AU (Wk 16) and an average of 3,082 646 AU. Of the 606 total training sessions, ~74%, 11%, and 15% were
completed at an intensity in Zone 1 (very easy to somewhat hard), Zone 2 (at lactate threshold) and Zone 3
(very hard to maximal), respectively. There were 2.5 2.3 low-CHO-availability training bouts per week. On
race day athletes consumed 61 15 g CHO in 604 156 ml/hr (10.1% 0.3% CHO solution) in the following
format: ~15 g CHO in ~150 ml every ~15 min of racing. Their resultant marathon times were 2:11:23, 2:12:39
(both personal bests), and 2:16:17 (a marathon debut). Taken together, these periodized training and nutrition
approaches were successfully applied to elite marathoners in training and competition.
Keywords: TRIMP, carbohydrate and fluid, caffeine, endurance, performance
Since the legendary run of Pheidippides in the Battle
of Marathon (490 B.C.) no event has captured the human
imagination quite like the marathon, as evidenced by
the long interest in marathon-associated physiology and
performance (Proceedings of the 2006 World Congress,
2007). However, only a few published studies have
examined physiological, anthropometric, nutritional, or
training characteristics of truly world-class marathoners (Billat, Demarle, Slawinski, Paiva, & Koralsztein,
2001; Billat et al., 2003; Lucia et al., 2006; Onywera,
Kiplamai, Boit, & Pitsiladis, 2004). Traditionally, most
elite marathon training expertise is tackled anecdotally
through word of mouth and practical experience and not
systematically documented through validated methodologies in peer-reviewed scientific journals.
Scientific interest in the marathon, and what causes
fatigue and ultimately limits performance, continues to
be highly relevant as evidenced by the recent viewpoint
article by Joyner, Ruiz, and Lucia (2011) titled The
Two-Hour Marathon: Who and When? and the 38
unique published countercommentaries (Stellingwerff &
Jeukendrup, 2011). What has become clear is that there
are a myriad of potential physiological, psychological,
The author is with the Canadian Sports Center-Pacific, Victoria,
Canada.

392

environmental, and sociological determinants of marathon performance. One distinctive facet to the marathon
is that carbohydrate (CHO) metabolism, primarily muscle
glycogen, is the dominate fuel at exercise intensities
greater than 75% VO2max and can start to become limiting after ~90 min. So despite the fact that endurance
running played a significant role in the evolution of man
(Bramble & Lieberman, 2004), given the high exercise
intensities of marathon racing dictating a high muscle
glycogen use (>80% VO2max; OBrien, Viguie, Mazzeo,
& Brooks, 1993), it could be argued that humans are not
adapted to racing marathon distances at high exercise
intensities. Thus, perhaps underappreciated is the vital
role that fueling and hydration status plays on marathon
success, which is not necessarily a prerequisite for success over shorter distances (<90 min).
Contemporary scientific studies have started to examine the interactions that altered nutrition approaches may
have on endurance-training adaptations. For example, a
periodic lack of CHO availability may further enhance
training adaptations (Burke, 2010), the gastrointestinal
(GI) tract may also be adapted to handling increased fluid
and CHO, and an individualized approach to race-day
CHO type and fluid intake may contribute to optimal
competitive success (Jeukendrup, 2011). However,
there have been no studies published that characterize
these training and nutrition approaches in elite marathon

Optimization of Elite Marathon Preparation 393

runners. Therefore, the primary aim of the current case


study was to use field data to characterize several training and nutrition techniques, leading to an individualized
race-day fluid and fuel plan in a periodized approach with
three elite male marathon runners.

hard); Zone 2 = RPE of 57 (hard); and Zone 3 = RPE


of >7 (very hard to maximal). These three TRIMP RPE
training-zone breakpoints, corresponding to first ventilatory and second ventilatory threshold, respectively, have
previously been validated and shown not to differ from
TRIMP analysis using either heart rate or blood lactate
data (Seiler & Kjerland, 2006).

Interventions and Methods

Dietary Approaches

Background and Athletes

There were two main nutrition approaches, which were


periodized across three training mesocycles: general
preparation phase (Weeks 16), specific preparation
phase (Weeks 712), and competition taper phase (Weeks
1316), with the target marathon being at the end of
Week 16. Each dietary approach was described in writing
and verbally to each athlete and coach and individually
implemented and continuously monitored.

Each marathoner (Table 1) undertook an individualized 16-week training plan and competed in different
marathons at Week 16 but implemented the same nutrition approaches with the same physiology/nutrition
practitioner. Each athlete/coach has read, approved, and
provided written permission for this publication, which
conforms to the principle approval for case studies in the
International Journal of Sports Nutrition and Exercise
Metabolism by the ethics committee of the Australian
Institute of Sport.

Low -CHO-Availability Training. Athletes were

instructed to periodically undertake and develop their


ability to tolerate training with low CHO availability
(~15 times per week as individually tolerated, with
emphasis during the general preparation phase). This
was done either by limiting exogenous skeletal-muscle
CHO availability (by undertaking morning-fasted training) or by limiting endogenous skeletal-muscle CHO
availability (by undertaking reduced-muscle-glycogen
training). For periodic overnight-fasted training, athletes
were instructed to undertake aerobic training (at or below
lactate/ventilatory threshold) first thing on waking, with
just prerun water and/or coffee consumption. Conversely,
low-glycogen training featured doing two training sessions within a single day, but limiting dietary CHO
intake after the first training session so that the second
training session was undertaken with reduced muscle
glycogen stores. Immediately after this second training

Training Assessment
All athletes kept detailed training logs, including information on duration and volume (min and km), body weight
(BW), subjective training feedback (ratings of perceived
exertion; RPE), and weather conditions. All the data
collected were exclusively used to characterize training,
not to affect training decisions. Each training sessions
load was calculated by multiplying the training duration (minutes) by intensity (RPE scale of 110, easy to
maximal) into a single arbitrary unit (AU) called training
impulse (TRIMP), as previously validated and described
by Foster et al. (Foster, 1998; Foster et al., 2001). Session
RPE was further divided into three separate intensity
zones: Zone 1 = RPE of 04 (very easy to somewhat

Table 1 Anthropometric, Training, and Performance-History


Characteristics of the Three Marathon Runners
Marathoner
Parameter

M SD

Age

31

27

27

28.3 2.3

Body weight (kg)

61.5

68.0

68.0

65.8 3.8

Height (cm)

175

191

188

184.7 8.5

Body-mass index (kg/m2)

20.1

18.6

19.2

19.3 0.7

Resting morning heart rate

33

39

43

38 5

Years of elite training

10

9.0 1.0

Years with current coach

12

0.5

5.5 5.9

3,000-m track personal best

7:53.51

7:59.49

7:58.70

7:57 3

5,000-m track personal best

13:21.53

13:40.33

13:57.80

13:39 18

10,000-m track personal best

27:56.92

N/A

28:58.45

28:27 44

1/2-marathon road personal best

1:03:46

N/A

1:03:53

63:50 5

394Stellingwerff

bout, athletes consumed optimal CHO and protein to


maximize glycogen and protein synthesis. The few times
reduced-glycogen training was implemented, a demanding interval-based training session was undertaken in the
morning commencing with higher muscle glycogen to
ensure high training quality. This type of training would
also cause a large reduction in muscle glycogen, which
was maintained with low CHO intakes, before the second
daily training session (>4 hr), which was prolonged but
aerobic in nature (at or below lactate/ventilatory threshold). These low-CHO-availability training sessions are
not to be mistaken for a low-CHO diet. Instead, athletes
were instructed to merely alter the timing and availability
of CHO in their diet around specific training situations.
They were taught the amount and timing of CHO to
maximize postexercise glycogen synthesis, as well as
the dietary choices required to limit CHO availability
when required.
Individualized Targeted CHO Fueling and Hydration
During Training and Competition. Athletes were

taught to measure CHO- and fluid-intake rates, measure


sweat rate via BW changes, and record GI tolerance
during key training bouts (13 times per week with
emphasis during the specific preparation phase and
competition taper phase) in a worksheet (Table 2). They
were instructed to adjust fluid intake, aiming for ~23%
BW losses during training sessions. On runs >2 hr,
athletes were encouraged to consume at least ~3060 g
CHO/hr and ~400600 ml/hr, but then urged to further
increase intakes to maximize their individual upper tolerance. During the competition taper phase, athletes were
encouraged to consume fluids and CHO in every session
>75 min. Within 48 hr postrace, athletes reported their
race-day fluids, carbohydrate, and caffeine consumption
(Table 3). Since each marathoner was a recognized elite
athlete, each got to prepare his own fuel/fluid bottles,
which were placed at elite-athlete-only aid stations to
facilitate more accurate reporting. Unfortunately, due to
the complexities postrace for these elite marathoners (e.g.,
interviews, doping controls, etc.), pre- to postrace BW
tracking for the competitions resulted in either uncertain
data or was not possible.

Observations and Outcomes


Marathoner Characteristics
and Performance Outcomes
The characteristics of each marathoner at the time of
his race are outlined in Table 1, with data reported as M
SD. To date, these athletes have won a combined 12
Canadian Championships and competed in 16 global
championships (World or Olympic Games). Average
training weight was 67.3 3.3 kg, which decreased
2.2% for racing. Marathon times were 2:11:23 and
2:12:39 for Marathoners 1 and 3, respectively (previous
personal bests were 2:16:53 and 2:15:15, respectively).
Marathoner 2 debuted at 2:16:17.

Training Data
Training data are based on 606 training sessions over 12.6
2.1 training sessions per week per athlete, featuring
average weekly training volumes of 173.6 32.5, 213.3
41.2 and 159.6 27.0 km/week for Marathoners 1, 2, and
3, respectively (Figure 1). Each marathoner had his highest training volume during the specific preparation phase,
with highs of 228, 266, and 199 km/week, respectively.
Lowest weekly training volumes were on race week (114.5
14.1 km), with ~35% of that weeks running volume
coming on race day. Due to the highly subjective nature of
RPE TRIMP assessment, it can only be compared within
a given athlete (Figure 2; Marathoner 1). This athlete had
a weekly high TRIMP of 4,437 AU (Week 9) and low of
1,887 AU (Week 16), with a 16-week average of 3,082
646 AU. For all athletes combined, of the 606 total training sessions, 74.3% 3.5%, 11.0% 1.7%, and 14.7%
3.5% of the sessions were completed in Zone 1 (very
easy to somewhat hard), Zone 2 (hard), and Zone 3 (very
hard to maximal), respectively (Figure 3).

Periodized Dietary Approaches


During Marathon Preparation
Figure 4 provides an overview of the two nutrition techniques, which were periodized across each training phase.
On average, there were 2.5 2.3, 2.6 2.3, and 1.3 2.3
low-CHO-availability training bouts per week across the
general preparation phase, specific preparation phase, and
competition taper phase, respectively. There were 107
low-CHO-availability training sessions for all 3 marathoners, of which 11 were reduced-glycogen training and
96 were morning-fasted training. CHO-fueling practice
sessions increased during each phase, with an average of
19.0 6.1 CHO-fueling sessions throughout the 16 weeks,
with most during the specific preparation phase and the
competition taper phase. A wide range of individual sweat
rates was recorded by Marathoner 2 during training:
~7501,000 ml/hr (Table 2). This marathoner practiced
with a wide range of CHO- and fluid-consumption rates
and demonstrated great individual GI tolerance to fluid
and CHO intake during running (Table 2).

Race-Day Intakes
On average, athletes consumed 61 15 g CHO in 604
156 ml/hr of racing, resulting in a CHO solution of 10.1%
0.3% (Table 3). All marathoners used commercial products featuring CHO blends of maltodextrin (glucose) and
fructose in the form of sports drinks and CHO gels. On
average, marathoners consumed ~15 g CHO in ~150 ml
every ~15 min of racing. Two of the marathon runners
used caffeine (Table 3). They took ~60% of their total
caffeine dose 1 hr before the start as caffeine pills and
then consumed ~40% of their remaining dose throughout
the race via CHO gels containing caffeine, which resulted
in 3.7 1.4 mg caffeine per kg BW throughout the race.
Variability of caffeine intake between athletes was mostly
due to previous individual experience.

395

12-10

12-17

1-6

1-9

1-12

1-13

1-15

34

48

52

46

51

100

100

Humidity
(%)

68.7

69.4

68.9

69.1

68.9

69.0

69.5

Prerun
weight
(kg)

67.5

68.7

67.5

67.7

68.1

67.0

66.7

Postrun
weight
(kg)

0.375

0.000

0.100

0.300

0.000

0.100

0.350

Fluids
ingested
(L/hr)

2.00

1.30

1.75

2.25

1.13

2.00

2.50

Total run
time (hr)

1.7

1.0

2.0

2.0

1.2

2.9

4.0

% bodyweight
loss

14.8

32.8

SD

347

1,343

1,710

1,300

1,020

Total fluid
intake (ml)

155.6

604.3

773.4

572.4

467.2

Fluid ml/hr

0.3

10.1

10.0

9.8

10.4

% CHO
solution

147

158

184

290

Total CAFF
(mg)

38.0

0.0

20.0

35.0

0.0

26.0

48.0

10.0

0.0

10.0

10.0

0.0

26.0

13.7

% CHO
solution

2.4

2.5

0.0

2.7

4.7

CAFF/kg
body weight

CHO
ingested
(g/hr)
Comments

10

# of aid
stations

2.0

14.9

17.1

14.2

13.3

CHO/aid
station

21.9

147.6

171.0

144.4

127.5

Fluid/aid
station

Longer tempo workout, fueling went well.


Great workout.

Easy evening run, no fuelingjust sweat


testing.

Fueled during 4 10 min, stomach a bit off,


some discomfort.

Tried apple gel flavor, liked it. Great fueling


on the long run.

Easy evening run, no fuelingjust sweat


testing.

Only 2 gelsbottles on course were stolen


during session.

Stomach felt great, harder to drink when tired


and cold.

Note. Marathoner 1 race: Toronto, September 26, 2010; 12 C, 77% humidity. Marathoner 2 race: Houston, January 30, 2011; 17 C, 90% humidity. Marathoner 3 race: Sacramento, December 5, 2010;
10 C, 91% humidity.

77.3
60.8

171.0

135.2

Marathoner 3

56.4

48.8

CHO g/hr

106.5

128.0

Marathoner 1

Total CHO
intake (g)

Marathoner 2

Athlete

Table 3 Actual Race-Day Carbohydrate (CHO), Fluid, and Caffeine (CAFF) Intakes

0.788

0.538

0.857

0.756

0.708

1.050

1.260

Sweat
ratea
(L/hr)

rate calculated as [(prerun weight postrun weight) + ingested fluids (L)]/total run time (hr).

Date

aSweat

Temperature
(C)

Table 2 Individualized Sweat and Fluid and Carbohydrate (CHO) Intake for Marathoner 2

396Stellingwerff

Discussion
The aim of this case study was to characterize several
training and nutrition techniques, leading to an individualized race-day fluid and fuel plan. Although there are
many variables to consider in marathon performance,
together these unique periodized training and nutrition
techniques were successfully implemented with three
elite marathoners.

Training Load, Distribution,


and Tapering Analysis
There are few publications on training characteristics of
elite marathoners, and the athletes in the current study averaged ~13 hr/week or ~182 km/week of running (Figure 1),
which is comparable to the volume range reported in elite
French/Portuguese (Billat et al., 2001) and Kenyan runners
(Billat et al., 2003; Onywera et al., 2004). However, their
average volume and peak volume (231 km/week) are substantially higher than what was recorded by elite Spaniard
(129 km/week) or Eritrean runners (105 km/week; Lucia
et al., 2006). Training intensity also needs to be considered when assessing total training load. This case study
contains the first published RPE-based TRIMP scores for
an elite marathoner (Figure 2). Most contemporary training programs feature cycles of increasing load, followed
by consolidation and recovery weeks, which are captured
in the week-to-week TRIMP variability. Throughout the
first 12 weeks, there was an average TRIMP of 3,350
561 AU/wk, which is comparable to the ~4,000-AU/week
threshold that Foster (1998) identified as what is routinely
performed by elite endurance athletes.
A polarized pattern of training features ~7075%
of training performed below lactate threshold and >15%
well above that intensity (Fiskerstrand & Seiler, 2004).
This polarized training distribution has previously been
used by successful (e.g., Olympic and World medalists)

rowers, cross-country skiers, and track cyclists (Seiler


& Tonnessen, 2009). Despite each marathoner having an
individualized training program, with no training-plan
interventions, a polarized distribution resulted (Figure
3). The 3-week premarathon taper featured a 52% reduction in volume with no appreciable change in training
frequency (Figure 1). This taper is congruent with the
recommendations from a recent meta-analysis on the
effects of tapering on performance, which found the ideal
length of taper to be ~23 weeks, where training volume
was decreased 4160%, without any modification of
training intensity or frequency (Bosquet, Montpetit,
Arvisais, & Mujika, 2007). Thus, it appears that all three
athletes implemented a scientifically supported approach
to training volume, distribution, and tapering.

Altering Carbohydrate Availability


During Endurance Training
Conventional nutrition recommendations dictate that
endurance athletes endeavor to replenish muscle glycogen
stores postexercise to ensure that subsequent training
bouts are conducted in a glycogen-compensated state.
However, reports from professional cyclists and East African runners indicate that some of those athletes purposely
undertake some training in a glycogen-depleted/reduced
and/or fasted/water-only state, in an attempt to force
muscle adaptation (personal communication). In support
of this, recent scientific hypotheses have suggested that
periodically decreasing CHO availability may further
enhance endurance-training adaptations and possibly performance (for review, see Burke, 2010). Nevertheless, it
is difficult to extrapolate the results of laboratory training
studies to the real world, where athletes are looking for
only marginal improvements in performance over years
of training. Despite the fact that low-CHO-availability
training is both physiologically and psychologically
challenging, these scientific and anecdotal reports suggest

Figure 1 Comparison of weekly training volume over 16 weeks until the target marathon (race included).

Figure 2 Average weekly and daily training impulse (TRIMP) for Marathoner 1 throughout 16 weeks. AU = arbitrary units.

Figure 3 Average training-intensity distribution during the 16-week marathon-preparation period as assessed by training impulse
based on rating of perceived exertion.
397

398Stellingwerff

that maximally adapted athletes may need to periodically


undertake low-CHO-availability training to fully exploit
endurance-training responses. Accordingly, these interventions were individualized at different rates into each
marathoners training program, and each was encouraged
to increase the frequency, duration, and quality of these
sessions throughout the general preparation phase and
specific preparation phase as they better tolerated and
adapted. There was a purposeful decline in these training sessions during the competition taper phase (Figure
4). Low-CHO-availability training had a large degree of
individual variability according to personal acclimatization/tolerance, as Marathoner 2 conducted ~35% of his
training sessions with low CHO availability, compared
with ~10% of training sessions for Marathoners 1 and
3. Marathoner 2 already had a lot of experience in doing
fasted and low-glycogen training and thus was much
more willing to undertake these types of training sessions.
Furthermore, feedback from the athletes indicated that
morning-fasted training was physiologically much easier
to integrate than the more strenuous reduced-glycogen
training, as evidenced by the fact that only 10% of the
low-CHO training was reduced-glycogen training.

Individualizing CHO and Fluid Intake


During Training
Most studies demonstrate improved endurance performance when subjects consume CHO drinks compared
with water, with CHO delivery and oxidation being a
central mechanism (for review, see Jeukendrup, 2011).

Accordingly, a recent CHO dose-response study showed


a step-wise improvement in endurance performance in
combination with increased CHO oxidation, with 60 g
CHO/hr resulting in better performance than either 30
or 15 g CHO/hr (Smith et al., 2010). This suggests that
the more CHO that can be feasibly consumed, the better
the potential endurance-performance benefits. Recent
evidence suggests that high intake rates (>90 g/hr) of
glucose + fructose produce 2050% greater exogenous
CHO-oxidation rates, potentially decreased negative GI
side effects (Jeukendrup, 2011), and an 8% increase in
time-trial performance versus isocaloric glucose alone
(Currell & Jeukendrup, 2008). Accordingly, marathoners
used glucose + fructose mixtures at ~60 g/hr in an attempt
to minimize adverse GI issues and to enhance performance.
The most recent position stand on fluid intake (Sawka
et al., 2007) highlights the need for individualized recommendations according to sweat rates (Table 2). Marathoners experimented with a wide range of CHO- and
fluid-consumption rates to ascertain individual GI tolerance in varying training intensities, especially in weather
conditions that athletes were likely to face on race day.
This allowed for an individual intake profile of tolerance
for fluids and CHO to be made for each athlete. A recent
study examining CHO- and fluid-intake rates (Pfeiffer
et al., 2012) showed that 73% of marathon runners did
not reach the relatively low recommendation of 3060 g
CHO/hr during racing (Sawka et al., 2007). Thus, during
this CHO-fueling period (specific preparation phase and
competition taper phase; Figure 4), athletes were strongly
encouraged to slowly increase intakes in an attempt to

Figure 4 Frequency of nutrition approaches throughout the 16-week marathon preparation. CHO = carbohydrate.

Optimization of Elite Marathon Preparation 399

at least reach the threshold of ~60 g CHO/hr, with even


higher intakes if tolerated.
However, excessive consumption of fluids and CHO
during prolonged exercise can also result in adverse GI
problems, as we have previously shown through significant correlation between endurance athletes who have
a history of GI problems and subsequent measured GI
problems during competition (Pfeiffer et al., 2012). It
has been suggested that the GI tract can adapt and be
optimized to large fluid and CHO intakes (Jeukendrup,
2011), as GI comfort was shown to improve in just five
training bouts with fluid consumption (Lambert et al.,
2008). Furthermore, 1 month of endurance training
with 100 g CHO/hr increased steady-state exercise CHO
oxidation by 14%, which the authors hypothesized was
due to increased intestinal CHO transporters (Cox et al.,
2010). Therefore, in the last 4 weeks before our athletes
target marathons, there was a continual emphasis on CHO
fueling and fluid intake (Figure 4). This process of fluid
and CHO individualization, and gut adaptation, resulted
in each athlete finding his individual balance between
the ergogenic effect of maximal CHO and fluid intake on
race day and the potential ergolytic effect of GI distress.

Race-Day Nutrition and Hydration Intakes


A recent large (N = 221) CHO- and fluid-intake field
study showed a significant positive correlation between
higher CHO intake rates and faster finishing times in
Ironman and marathon races (Pfeiffer et al., 2012). Thus,
all our marathoners attempted to maximize their fueling and hydration plan that was individually optimized
from the many prerace nutrition/hydration-monitoring
sessions (Table 2) by consuming ~15 g CHO in ~150
ml of fluids every ~15 min during the race, along with
a total of ~3 mg caffeine/kg BW (Table 3). This fluid
intake of 604 156 ml/hr is very similar to the 550
34 ml/hr recently reported in elite marathon runners
(Beis, Wright-Whyte, Fudge, Noakes, & Pitsiladis,
2012). Haile Gebrselassie only ran 2:06:35 in his first
serious marathon, consuming only water. Conversely,
Gebrselassie consumed ~6070 g CHO/hr (personal
communication) in ~9001,000 ml/hr (Beis et al., 2012)
during his 2008 2:03:59 marathon world record. Worldclass marathon performance is influenced by incredible
genetics, physiological and psychological aptitude, and
dedication to handle enormous training loads in an intelligent program. However, a periodized and individualized
marathon nutrition and training approach can certainly
facilitate the quest for marathon success.
Acknowledgments
An enormous thank you goes to marathoners Reid Coolsaet,
Rob Watson, and Dylan Wykes and their coaches Dave ScottThomas and Richard Lee. Without their receptiveness to executing these interventions, and their open collaboration in allowing
their data to be showcased, this case-study publication would
never have come to fruition.

References
Beis, L.Y., Wright-Whyte, M., Fudge, B., Noakes, T., &
Pitsiladis, Y.P. (2012). Drinking behaviors of elite male
runners during marathon competition. Clinical Journal of
Sport Medicine, 22(3), 254261. PubMed doi:10.1097/
JSM.0b013e31824a55d7
Billat, V., Lepretre, P.M., Heugas, A.M., Laurence, M.H., Salim,
D., & Koralsztein, J.P. (2003). Training and bioenergetic
characteristics in elite male and female Kenyan runners.
Medicine and Science in Sports and Exercise, 35(2), 297
304. PubMed doi:10.1249/01.MSS.0000053556.59992.A9
Billat, V.L., Demarle, A., Slawinski, J., Paiva, M., & Koralsztein, J.P. (2001). Physical and training characteristics
of top-class marathon runners. Medicine and Science
in Sports and Exercise, 33(12), 20892097. PubMed
doi:10.1097/00005768-200112000-00018
Bosquet, L., Montpetit, J., Arvisais, D., & Mujika, I. (2007).
Effects of tapering on performance: A meta-analysis.
Medicine and Science in Sports and Exercise, 39(8),
13581365. PubMed doi:10.1249/mss.0b013e31806010e0
Bramble, D.M., & Lieberman, D.E. (2004). Endurance running
and the evolution of Homo. Nature, 432(7015), 345352.
PubMed doi:10.1038/nature03052
Burke, L.M. (2010). Fueling strategies to optimize performance:
Training high or training low? Scandinavian Journal
of Medicine & Science in Sports, 20(Suppl. 2), 4858.
PubMed
Cox, G.R., Clark, S.A., Cox, A.J., Halson, S.L., Hargreaves,
M., Hawley, J.A., . . . Burke, L.M. (2010). Daily training
with high carbohydrate availability increases exogenous
carbohydrate oxidation during endurance cycling. Journal of Applied Physiology, 109(1), 126134. PubMed
doi:10.1152/japplphysiol.00950.2009
Currell, K., & Jeukendrup, A.E. (2008). Superior endurance performance with ingestion of multiple transportable carbohydrates. Medicine and Science in Sports and Exercise, 40(2),
275281. PubMed doi:10.1249/mss.0b013e31815adf19
Fiskerstrand, A., & Seiler, K.S. (2004). Training and performance characteristics among Norwegian international
rowers 19702001. Scandinavian Journal of Medicine &
Science in Sports, 14(5), 303310. PubMed doi:10.1046/
j.1600-0838.2003.370.x
Foster, C. (1998). Monitoring training in athletes with reference to overtraining syndrome. Medicine and Science
in Sports and Exercise, 30(7), 11641168. PubMed
doi:10.1097/00005768-199807000-00023
Foster, C., Florhaug, J.A., Franklin, J., Gottschall, L., Hrovatin,
L.A., Parker, S., . . . Dodge, C. (2001). A new approach
to monitoring exercise training. Journal of Strength and
Conditioning Research, 15(1), 109115.
Jeukendrup, A.E. (2011). Nutrition for endurance sports:
Marathon, triathlon, and road cycling. Journal of Sports
Sciences, 29(Suppl. 1), D91S99. PubMed doi:10.1080/
02640414.2011.610348
Joyner, M.J., Ruiz, J.R., & Lucia, A. (2011). The twohour marathon: Who and when? Journal of Applied
Physiology, 110(1), 275277. PubMed doi:10.1152/
japplphysiol.00563.2010

400Stellingwerff

Lambert, G.P., Lang, J., Bull, A., Eckerson, J., Lanspa, S., &
OBrien, J. (2008). Fluid tolerance while running: Effect of
repeated trials. International Journal of Sports Medicine,
29(11), 878882. PubMed doi:10.1055/s-2008-1038620
Lucia, A., Esteve-Lanao, J., Olivan, J., Gomez-Gallego, F., San
Juan, A.F., Santiago, C., . . . Foster, C. (2006). Physiological
characteristics of the best Eritrean runnersExceptional
running economy. Applied Physiology, Nutrition, and
Metabolism, 31(5), 530540. PubMed doi:10.1139/h06-029
OBrien, M.J., Viguie, C.A., Mazzeo, R.S., & Brooks, G.A.
(1993). Carbohydrate dependence during marathon running. Medicine and Science in Sports and Exercise, 25(9),
10091017. PubMed
Onywera, V.O., Kiplamai, F.K., Boit, M.K., & Pitsiladis, Y.P.
(2004). Food and macronutrient intake of elite Kenyan
distance runners. International Journal of Sport Nutrition
and Exercise Metabolism, 14(6), 709719. PubMed
Pfeiffer, B., Stellingwerff, T., Hodgson, A.B., Randell, R., Pottgen, K., Res, P., & Jeukendrup, A.E. (2012). Nutritional
intake and gastrointestinal problems during competitive endurance events. Medicine and Science in Sports
and Exercise, 44(2), 344351. PubMed doi:10.1249/
MSS.0b013e31822dc809
Proceedings of the 2006 World Congress on the Science
and Medicine of the Marathon. (2007). Sports Medi-

cine (Auckland, N.Z.), 37(45), 279466. PubMed


doi:10.2165/00007256-200737040-00001
Sawka, M.N., Burke, L.M., Eichner, E.R., Maughan, R.J., Montain, S.J., & Stachenfeld, N.S. (2007). American College of
Sports Medicine position stand. Exercise and fluid replacement. Medicine and Science in Sports and Exercise, 39(2),
377390. PubMed doi:10.1249/mss.0b013e31802ca597
Seiler, K.S., & Kjerland, G.O. (2006). Quantifying training
intensity distribution in elite endurance athletes: Is there
evidence for an optimal distribution? Scandinavian
Journal of Medicine & Science in Sports, 16(1), 4956.
PubMed doi:10.1111/j.1600-0838.2004.00418.x
Seiler, K.S., & Tonnessen, E. (2009). Intervals, thresholds, and
long slow distance: The role of intensity and duration in
endurance training. Sportscience, 13, 3254.
Smith, J.W., Zachwieja, J.J., Peronnet, F., Passe, D.H., Massicotte, D., Lavoie, C., & Pascoe, D.D. (2010). Fuel selection and cycling endurance performance with ingestion of
[13C]glucose: Evidence for a carbohydrate dose response.
Journal of Applied Physiology, 108(6), 15201529.
PubMed doi:10.1152/japplphysiol.91394.2008
Stellingwerff, T., & Jeukendrup, A.E. (2011). Dont forget
the gutIt is an important athletic organ! Journal of
Applied Physiology, 110(1), 278. PubMed doi:10.1152/
japplphysiol.01259.2010

This article was downloaded by: [2.82.1.188]


On: 24 September 2014, At: 13:09
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
37-41 Mortimer Street, London W1T 3JH, UK

European Journal of Sport Science


Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/tejs20

Nutritional strategies to support concurrent training


ab

ab

Joaquin Perez-Schindler , D. Lee Hamilton , Daniel R. Moore , Keith Baar & Andrew Philp
a

School of Sport, Exercise and Rehabilitation Sciences, University of Birmingham,


Birmingham, UK
b

MRC-ARUK Centre for Musculoskeletal Ageing Research, University of Birmingham,


Birmingham, UK
c

School of Sport, University of Stirling, Stirling, UK

Faculty of Kinesiology and Physical Education, University of Toronto, Toronto, Canada

Department of Neurobiology, Physiology and Behavior, University of California-Davis,


Davis, CA, USA
Published online: 27 Aug 2014.

To cite this article: Joaquin Perez-Schindler, D. Lee Hamilton, Daniel R. Moore, Keith Baar & Andrew Philp (2014): Nutritional
strategies to support concurrent training, European Journal of Sport Science, DOI: 10.1080/17461391.2014.950345
To link to this article: http://dx.doi.org/10.1080/17461391.2014.950345

PLEASE SCROLL DOWN FOR ARTICLE


Taylor & Francis makes every effort to ensure the accuracy of all the information (the Content) contained
in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no
representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the
Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and
are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and
should be independently verified with primary sources of information. Taylor and Francis shall not be liable for
any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever
or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of
the Content.
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any
form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://
www.tandfonline.com/page/terms-and-conditions

European Journal of Sport Science, 2014


http://dx.doi.org/10.1080/17461391.2014.950345

REVIEW ARTICLE

Nutritional strategies to support concurrent training

JOAQUIN PEREZ-SCHINDLER1,2, D. LEE HAMILTON3, DANIEL R. MOORE4,


KEITH BAAR5, & ANDREW PHILP1,2
School of Sport, Exercise and Rehabilitation Sciences, University of Birmingham, Birmingham, UK, 2MRC-ARUK Centre
for Musculoskeletal Ageing Research, University of Birmingham, Birmingham, UK, 3School of Sport, University of Stirling,
Stirling, UK, 4Faculty of Kinesiology and Physical Education, University of Toronto, Toronto, Canada, 5Department of
Neurobiology, Physiology and Behavior, University of California-Davis, Davis, CA, USA

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Abstract
Concurrent training (the combination of endurance exercise to resistance training) is a common practice for athletes looking
to maximise strength and endurance. Over 20 years ago, it was first observed that performing endurance exercise after
resistance exercise could have detrimental effects on strength gains. At the cellular level, specific protein candidates have
been suggested to mediate this training interference; however, at present, the physiological reason(s) behind the concurrent
training effect remain largely unknown. Even less is known regarding the optimal nutritional strategies to support concurrent
training and whether unique nutritional approaches are needed to support endurance and resistance exercise during
concurrent training approaches. In this review, we will discuss the importance of protein supplementation for both
endurance and resistance training adaptation and highlight additional nutritional strategies that may support concurrent
training. Finally, we will attempt to synergise current understanding of the interaction between physiological responses and
nutritional approaches into practical recommendations for concurrent training.
Keywords: Concurrent training, training interference, nutrition, hypertrophy, AMPK, mTORC1

Introduction
Training interference was first conceptualised by
Robert C. Hickson (Hickson, 1980). Utilising highintensity cycling and running as the endurance
component of a concurrent training programme
(i.e. the combination of resistance and endurance
type exercise in the same training session), Hickson
demonstrated that endurance exercise blunted gains
in strength compared to strength training alone
(Hickson, 1980). This data demonstrated for the
first time that high-intensity endurance training was
capable of interfering with the adaptive response to
strength training (Figure 1). Despite numerous
experimental studies, the mechanisms underlying
training interference remain unclear (Fyfe, Bishop, &
Stepto, 2014; Hamilton & Philp, 2013). What is also
uncharacterised is the role of nutrition in the concurrent training response and whether nutritional
strategies might be an effective approach to offset the

strength declines reported by Hickson (1980) and


others (Ronnestad, Hansen, & Raastad, 2012). The
aim of this review is to (1) briefly highlight the
molecular processes thought to regulate skeletal
muscle adaptation to endurance, resistance and
concurrent exercise, (2) discuss nutritional strategies
to improve recovery from and/or adaptation to
endurance and resistance exercise in isolation, and
(3) attempt to formulate nutritional strategies that
might be suitable for supporting concurrent training.

Molecular regulation of endurance exercise


adaptations
Endurance exercise relies to a great extent on
skeletal muscle oxidative capacity, which in turn is
highly dependent on mitochondrial function and
blood supply (Egan & Zierath, 2013). Accordingly,
chronic endurance exercise training augments the

Correspondence: Andrew Philp, MRC-ARUK Centre for Musculoskeletal Ageing Research, School of Sport, Exercise and Rehabilitation
Sciences, University of Birmingham, Birmingham, Edgbaston B15 2TT, UK. E-mail: a.philp@bham.ac.uk
2014 European College of Sport Science

Downloaded by [2.82.1.188] at 13:09 24 September 2014

J. Perez-Schindler et al.

Figure 1. Concurrent training blocks strength gains during 10 weeks training. The addition of endurance training to resistance-training
programme blunts gains in strength compared to resistance training alone. Data is redrawn from Hickson (1980) with relative training
regimes detailed for resistance, concurrent and endurance training designs.

capacity for aerobic adenosine triphosphate (ATP)


synthesis by increasing the expression of genes
regulating biological processes like mitochondrial
biogenesis and angiogenesis (Egan & Zierath,
2013). Skeletal muscle metabolic and mechanical
stress induced by endurance exercise are thought to
modulate different signal pathways controlling the
transcriptional networks regulating these adaptations
(Egan & Zierath, 2013). It is well established that
following the initiation of contraction, there is a
rapid, transient flux of substrates, metabolites and
nucleotides within skeletal muscle, such as Ca2+,
adenosine monophosphate (AMP) and nicotinamide
adenine dinucleotide (NAD+) (Egan & Zierath,
2013). From an adaptation perspective, this is
extremely important, as many of these signalling
molecules have been identified as key activators of
signal transduction cascades, which ultimately
enhance the adaptive response. We will briefly
highlight these factors and the cascades they govern
in the context of endurance training adaptations.

Metabolic stress leads to skeletal muscle adaptation


Among the wide range of proteins regulated by
endurance exercise, AMP-activated protein kinase
(AMPK) is probably the most studied in the context
of skeletal muscle remodelling. The relevance of this
protein kinase relies on its capacity to sense both
metabolic stress and energy storage (Hardie, Ross, &
Hawley, 2012). Exercise activates skeletal muscle
AMPK in an intensity-dependent manner, with exercise at high intensities (thus higher ATP turnover)

resulting in higher AMPK activation (Wojtaszewski,


Nielsen, Hansen, Richter, & Kiens, 2000). Furthermore, energy restriction and glycogen depletion in
rodent and human skeletal muscle significantly
enhances AMPK activity both under basal conditions
and following acute exercise (Philp et al., 2013;
Wojtaszewski et al., 2003).
In the long-term, repeated activation of AMPK via
endurance exercise can enhance skeletal muscle
oxidative capacity through the modulation of different transcription factors and co-regulators (Egan &
Zierath, 2013); these include nuclear respiratory
factor 1, nuclear respiratory factor 2, mitochondrial
transcription factor A and the co-activator peroxisome proliferative activated receptor, gamma, coactivator 1 alpha (PGC-1), all of which are central
modulators of mitochondrial biogenesis (GarciaRoves, Osler, Holmstrom, & Zierath, 2008; Rockl
et al., 2007). The positive effects of AMPK on
mitochondrial function are PGC-1 dependent,
which can be phosphorylated and activated by
AMPK in vitro (Jager, Handschin, St-Pierre, &
Spiegelman, 2007), indicating dynamic interaction
between the two proteins. Another post-translational
modification controlling PGC-1 activity is its acetylation, with deacetylation of PGC-1 shown to
increase its transcriptional activity. PGC-1 acetylation levels are regulated by the acetyltransferase
GCN5 and the deacetylase sirtuin 1 (SIRT1),
respectively (Lerin et al., 2006; Rodgers et al.,
2005). This acetylation balance adds another way
by which skeletal muscle metabolism can be modulated by energy status, since SIRT1 activity is

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Nutritional strategies

Figure 2. Molecular signalling pathways involved in endurance and resistance-training adaptation. mTORC1 is activated in skeletal muscle
via three distinct mechanisms (1) Branch-chain amino acids (BCAA), (2) Mechanical loading (MECH) and (3) growth factor (GF)
stimulation. Through phosphorylation of downstream targets S6K1 and 4E-BP1, mTORC1 increases protein synthesis and ribosomal
biogenesis, which ultimately leads to hypertrophy. In contrast, endurance-training adaptation is initiated via the increased production of
AMP, Ca2+ and NAD+, which activate the sensing proteins AMPK, p38 MAPK and SIRT1. These proteins initiate a programme of
mitochondrial biogenesis through the activation of the transcriptional co-activator PGC-1, which in turn drives mitochondrial gene
transcription through a subset of transcription factors. The interference effect of endurance exercise has been suggested to occur through
AMPK mediated phosphorylation of TSC2 Ser1345 and Raptor Ser792 which both serve to blunt mechanical and nutritional activation of
mTORC1. P = phosphorylation, A = acetylation.

efficiently induced by an increase in cytosolic


[NAD+] and GCN5 activity thought to be regulated
by increased acetyl-CoA availability (Philp &
Schenk, 2013).
In addition to alterations in the metabolic environment, other signals induced by skeletal muscle contraction have also been shown to be an important
signal controlling exercise adaptation, with the p38
mitogen-activated protein kinase (MAPK) and calcium dependent (CaMKII) and cAMP (PKA-CREB)
signalling thought to play a key role (Egan & Zierath,
2013). However, how these proteins could affect
strength adaptations has yet to be demonstrated.

Molecular regulation of resistance exercisemediated skeletal muscle hypertrophy


In contrast to endurance exercise, adaptations to
chronic resistance exercise require the activation of
anabolic processes that ultimately promote increased
protein accretion, enhanced skeletal muscle crosssectional area (CSA) and maximal force (Egan &
Zierath, 2013). Skeletal muscle mechanical loading
mediates these adaptations mainly through an

increase in the rate of protein synthesis and ribosomal biogenesis (Moore, Robinson, et al., 2009;
Tipton, Ferrando, Phillips, Doyle, & Wolfe, 1999;
Witard et al., 2014).
Activation of the mechanistic target of rapamycin
(mTOR) complex 1 (mTORC1) seems to be a
mandatory step and a point of convergence of
pathways sensing both mechanical load and amino
acid levels (Philp, Hamilton, & Baar, 2011). Skeletal
muscle overload has been proposed to increase
mTORC1 activity by increasing cytosolic calcium
[Ca2+], phosphatidic acid and leucine, in addition to
the activation of focal adhesion kinase, extracellular
signal-regulated kinase and diacylglycerol kinase
(Miyazaki, McCarthy, Fedele, & Esser, 2011; Philp
et al., 2011; You et al., 2014). mTORC1 activation
by amino acids, on the other hand, involves the
activation of the Rag GTPases that mediate the
translocation of mTORC1 from the cytosol to the
lysosome surface (Shimobayashi & Hall, 2014).
Since the two mechanisms are distinct, administration of essential amino acids potentiates the positive
effects of resistance exercise on mTORC1 activity in
human skeletal muscle (Kakigi et al., 2014).

Downloaded by [2.82.1.188] at 13:09 24 September 2014

J. Perez-Schindler et al.

Following its activation, mTORC1 drives protein


synthesis via two main mechanisms (Figure 2): (1)
the direct phosphorylation of the eukaryotic translation initiation factor 4E (eIF4E)-binding protein 1
(4E-BP1) and (2) S6 kinase 1 (S6K1) (Shimobayashi & Hall, 2014). 4E-BP1 phosphorylation exerts an
inhibitory effect that releases eIF4E, thus promoting
the initiation of cap-dependent translation, whereas
phosphorylation of S6K1 increases its activity and
the regulation of its downstream targets controlling
translation, including S6 and eIF4B (Shimobayashi
& Hall, 2014). In accordance, the increase in protein
synthesis induced by resistance exercise in human
skeletal muscle has been shown to coincide with
higher levels of 4E-BP1 and S6K1 phosphorylation,
although reports have also identified that surrogate markers of mTORC1 activation might not
always correlate with the protein synthetic response
(Mitchell et al., 2013) or adaptation to chronic
resistance exercise training (Phillips et al., 2013).
Intracellular signalling regulated by concurrent
exercise in skeletal muscle
It has been proposed that AMPK-mediated suppression of mTORC1 is the principal mechanism by
which endurance exercise may blunt strength gains
following resistance exercise (Hamilton & Philp,
2013). In fact, while the growth stimulus provided
by resistance exercise inhibits the upstream
mTORC1 repressor TSC1-TSC2 complex, endurance exercise seems to promote the opposite effects
in an AMPK-dependent way (Figure 2). Practically,
however, although the molecular mechanism controlling anabolic (mTORC1) and catabolic (AMPK)
processes coincide with the concurrent effect
reported in humans, some studies have also reported
conflicting results, making the molecular events
underpinning concurrent training at present unclear.
For example, chronic concurrent exercise training
has been shown to induce similar effects on maximal
force and CSA as strength training, while V_ O2max
and exercise performance improved to a similar
extent as induced by interval training (de Souza
et al., 2013). Moderate intensity endurance exercise
does not seem to impair the effects of acute resistance exercise on mTORC1 and S6K phosphorylation (Apro, Wang, Ponten, Blomstrand, & Sahlin,
2013) or the hypertrophy response to short-term
single-leg resistance training (Lundberg, FernandezGonzalo, Gustafsson, & Tesch, 2013); however,
high-intensity interval exercise does blunt S6K1
phosphorylation (Coffey et al., 2009). Furthermore,
performing aerobic exercise prior to resistance exercise in a concurrent model has no detrimental effects
on anabolic signalling (Lundberg, FernandezGonzalo, Gustafsson, & Tesch, 2012) or adaptive

growth to chronic single-leg training (Lundberg


et al., 2013). In fact, contrary to the concept of
exercise interference during concurrent training,
concurrent exercise actually enhances myofibrillar
(Camera et al., 2014) or myofibrillar and mitochondrial protein fractional synthesis rates (Donges et al.,
2012) in the fed state to a greater extent than
resistance exercise alone. These data, therefore,
indicate that the physiological and acute molecular
responses to concurrent exercise are highly dependent
on training status, the order of the concurrent exercise
regime, the mode of exercise and the time course
studied (acute vs. chronic models). As such, contemporary studies still have not identified a unifying molecular mechanism accounting for Hicksons initial
observations. Given that training interference occurs
after 8 weeks of concurrent training (Hickson, 1980;
Ronnestad et al., 2012), chronic training protocols
combined with specific acute studies appear to represent
the most appropriate approach to delineate the molecular mechanisms mediating training interference in
human skeletal muscle (Fyfe et al., 2014; Hamilton &
Philp, 2013).

Nutritional approaches to improve resistance


and endurance performance implications for
concurrent training
Whilst the interference effect makes concurrent training technically challenging, it also adds additional
complexity when considering the nutritional requirements for a concurrent athlete. In general terms,
energy restriction in skeletal muscle appears to amplify
the endurance training signalling environment,
whereas a positive energy balance is optimal to
maximise the anabolic environment post-resistance
exercise (Hamilton & Philp, 2013). Detailed investigation of the nutritional requirements for concurrent
training has not been conducted, and so much of our
knowledge about nutritional strategies that may influence the concurrent training comes from isolated
studies examining the impact of nutritional interventions on endurance or resistance training alone. Based
on these studies, the following section will examine
nutritional strategies utilised in isolated endurance
or resistance exercise settings to highlight common
practices between modes that might be suitable for
consideration for the concurrent athlete. Additionally,
given the need to synthesise new muscle proteins (e.g.
force-generating myofibrillar and/or energy-producing
mitochondrial protein) in order to facilitate muscle
recovery and ultimately improve training adaptations
for the concurrent athlete, the following section will
focus heavily on the role dietary protein plays in the
remodelling of skeletal muscle.

Nutritional strategies

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Beneficial effects of protein supplementation for both


resistance and endurance exercise
Exercise in the fasted state increases both the
synthesis and breakdown (i.e. turnover) of muscle
protein with the algebraic difference between these
processes determining the net protein balance (i.e.
synthesis breakdown; Burd, Tang, Moore, &
Phillips, 2009). This enhanced protein turnover
functions to remodel skeletal muscle and ultimately
underpins its plasticity. It is well known that the
ingestion of essential amino acids enhances muscle
protein synthesis (MPS) and net protein balance
after exercise (Tipton et al., 1999). The stimulatory
effect of exogenous amino acids on MPS is uninfluenced by the co-ingestion of carbohydrate (Glynn
et al., 2010; Staples et al., 2011), demonstrating that
dietary protein is the primary nutritional factor
regulating skeletal muscle remodelling after exercise
and, in the case of resistance exercise, can enhance
training-induced muscle growth (Burd et al., 2009).
Recent studies have demonstrated that it is the
myofibrillar protein fraction that is primarily
responsive to exogenous amino acids after resistance
(Moore, Tang, et al., 2009), endurance (Breen et al.,
2011), and/or concurrent exercise (Camera et al.,
2014; Donges et al., 2012). While there appears to
be little effect of dietary protein on post-exercise
rates of mitochondrial protein synthesis (Moore,
Camera, Areta, & Hawley, 2014), this enhanced
myofibrillar protein remodelling could still reflect an
adaptive advantage for the athlete engaged in concurrent training. Moreover, during periods of chronic
energy restriction, such as would be encountered
during voluntary weight loss or inadvertent suboptimal
energy intake, protein ingestion is essential to enhance
post-exercise MPS (Areta et al., 2014) and the
maintenance of lean mass (Churchward-Venne,
Murphy, Longland, & Phillips, 2013; Mettler,
Mitchell, & Tipton, 2010). Therefore, dietary protein
should be viewed as a core component of the recovery
nutrition for the concurrent athlete (and especially
weight restricted athletes) through its ability to
enhance muscle protein remodelling.
MPS is enhanced after both resistance (Moore,
Robinson, et al., 2009) and endurance-based exercise (Levenhagen et al., 2002) with the ingestion of
as little as ~10 g of dietary protein. However, athletes
aiming to maximise recovery from each training bout
would benefit from greater post-exercise protein
ingestion, as demonstrated by recent ingested protein doseresponse studies (Moore, Robinson, et al.,
2009; Witard et al., 2014). Therefore, the optimal
protein ingestion (i.e. one that maximises MPS
yet minimises irreversible amino acid oxidation)
would be ~20 g (or the equivalent of ~0.25 g/kg)
of high-quality protein (such as whey protein).

Understanding of the specific protein requirements


to maximise MPS after endurance exercise are at a
relative infancy compared to resistance exercise
(Moore et al., 2014). Nevertheless, MPS is similarly
enhanced after endurance-based exercise with ~1620
g of dietary protein in both untrained and trained
athletes (Breen et al., 2011; Lunn et al., 2012),
suggesting post-exercise protein requirements for skeletal muscle remodelling are likely consistent across
training modalities (Moore et al., 2014). Therefore,
based on currently available literature, the optimal
protein ingestion would likely be similar after endurance exercise, meaning that concurrent athletes can
likely interchange dosing across the training regime.
In general, there are three occasions in which
athletes may ingest nutrients to facilitate their training and/or recovery: before, during and/or after
exercise. These clear distinctions between eating
occasions are not always evident for athletes who
train on consecutive days or, more importantly,
multiple times per day, as would be the case with
many concurrent athletes. Nevertheless, the following sections will discuss the relative importance of
these general opportunities for protein intake on the
ability to enhance skeletal muscle remodelling with
training.

Prior to exercise
Although early research suggested that pre-exercise
essential amino acid ingestion induced a greater
increase in muscle net protein balance with resistance
exercise (Tipton et al., 2001), subsequent studies have
failed to support these initial positive findings (Tipton
et al., 2007). The digestion and absorption of highquality dietary protein typically result in peak blood
amino acid concentrations occurring within 1 h after
ingestion and being sustained for up to 23 h,
although this depends on the protein type, energy
density and food matrix of the nutrition (Burke et al.,
2012). Nevertheless, post-exercise MPS after relatively
short duration training bouts (e.g. 1 h) has been
reported to be enhanced by pre-exercise protein/
amino acid ingestion (Tipton et al., 2007), possibly
through a priming of the muscle intracellular amino
acid pool for subsequent post-exercise muscle remodelling. However, MPS is generally depressed during
muscle contraction due to the shunting of cellular
energy away from non-essential energy-consuming
processes such as protein remodelling (Atherton &
Rennie, 2006), which ultimately lessens the importance of pre-exercise protein ingestion for the greater
muscle remodelling and adaptive process. Therefore,
athletes performing brief (e.g. 1 h) exercise bouts
would arguably obtain a greater benefit from a preexercise feeding strategy that would prioritise fuelling

J. Perez-Schindler et al.

a quality training session (e.g. adequate carbohydrate


and/or fluid ingestion), rather than promoting muscle
remodelling (e.g. protein ingestion).

Downloaded by [2.82.1.188] at 13:09 24 September 2014

During exercise
Aerobic exercise is associated with an enhanced
oxidative disposal of amino acids (especially the
branched-chain amino acids) (Millward, Bowtell,
Pacy, & Rennie, 1994) that arise from the catabolism
of skeletal muscle protein, which ultimately results in
a negative muscle and whole body protein balance
during exercise (Howarth et al., 2010). For athletes
who perform relatively long (e.g. 1.5 h) bouts and/
or multiple endurance training sessions per day, the
inclusion of protein during their workout may help
limit the endogenous use of amino acids as a source
of fuel and improve whole body protein balance
during exercise (Beelen et al., 2011). It is presently
unclear, however, as to what extent protein intake
could improve muscle protein remodelling and/or net
protein balance during a bout of endurance exercise
(Beelen et al., 2011), given the general suppression of
anabolic pathways during periods of high ATP
demand (e.g. muscle contraction; Atherton & Rennie,
2006).
Resistance exercise differs from traditional constant load endurance exercise as it is typically
characterised by brief inter-set rest (i.e. recovery)
periods, which may represent an opportunity to
initiate skeletal muscle remodelling. In potential
support, protein ingestion during a relatively prolonged (i.e. ~2 h) resistance training bout has been
reported to support greater rates of MPS during
exercise than a protein-free carbohydrate control
(Beelen et al., 2008). Therefore, athletes who have
long resistance training sessions and/or who train
concurrently after their endurance exercise sessions
may benefit from the co-ingestion of dietary protein
during their training bouts.
Following exercise
Protein ingestion immediately after exercise unquestionably enhances MPS and net protein balance in
young adults after all forms of exercise (Burd et al.,
2009; Moore et al., 2014). Resistance exercise has
been shown to enhance the sensitivity of skeletal
muscle to dietary protein for up to 24 h, meaning
that protein consumed at any time within this
extended window of opportunity will contribute to
enhanced muscle remodelling and adaptation (Burd
et al., 2011). This may explain, in part, the recent
suggestion that the timing of protein intake around a
resistance exercise session (i.e. 2 h) plays a limited
role in the ability to augment training-induced gains in
muscle mass or strength primarily in novice athletes

(Schoenfeld, Aragon, & Krieger, 2013). However,


resistance-trained individuals may have a relatively
abbreviated window of opportunity, given that rates
of MPS are enhanced by protein ingestion 4 h, but not
28 h, after an acute bout of resistance exercise (Tang,
Perco, Moore, Wilkinson, & Phillips, 2008). Moreover, compared to immediately post-exercise, delaying
protein ingestion by as little as 3 h after constant load
aerobic exercise markedly blunts its anabolic effects as
demonstrated by a lack of stimulation of MPS
(Levenhagen et al., 2001). Therefore, it would be
prudent for athletes aiming to rapidly initiate muscle
remodelling and recovery to consume dietary protein
as soon as possible after an exercise bout, regardless of
training modality.
Aside from the immediate post-exercise feeding
period, the pattern of protein ingestion outside of
this early (i.e. < 3 h) recovery period can also impact
the extent of muscle protein remodelling. For
instance, the repeated ingestion of 20 g of protein
[i.e. an optimal amount for the stimulation of MPS
(Moore, Robinson, et al., 2009; Witard et al., 2014)]
every 3 h over 12 h supported greater rates of
myofibrillar protein synthesis and induced a more
positive whole-body protein balance after a bout of
resistance exercise than the identical amount (i.e.
80 g) of protein ingested as 10 g feedings every 1.5 h
or 40 g feedings every 6 h (Areta et al., 2013; Moore
et al., 2012). This demonstrates that the pattern, and
not merely the amount, of protein ingested can
influence the efficiency of post-exercise muscle
remodelling after resistance exercise. While such
prolonged recovery studies have not been performed
after endurance and/or concurrent exercise, it is
likely that a similar feeding pattern (both of protein
amount and frequency) would also support the
greatest rates of MPS after these training modalities,
given that 2025 g (0.250.30 g protein/kg/meal) of
protein has been established to saturate the protein
synthetic capacity of the muscle in multiple studies
at rest and after exercise (Moore, Robinson, et al.,
2009; Witard et al., 2014). Additionally, protein
consumed immediately prior to sleep has been
reported to sustain greater rates of MPS during the
overnight post-exercise recovery period (Res et al.,
2012), which may help athletes who, due to scheduling or personal preference, must train in the
evening but want to maximise their recovery. Therefore, athletes aiming to support the greatest rates of
muscle remodelling would benefit from targeting
protein consumption immediately after exercise and
every 34 h thereafter.
It should also be highlighted that beyond altering
anabolic processes, influencing protein accretion, protein ingestion can also play a role in glycogen synthesis
and by extension in skeletal muscle metabolic conditioning (Burke, Hawley, Wong, & Jeukendrup,

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Nutritional strategies
2011). Co-ingesting protein with suboptimal doses of
carbohydrate (<1.2 g.kg1 h1) elicits a glycogen resynthesis response comparable to higher carbohydrate
ingestion (Burke et al., 2011). As such, combined
protein and carbohydrate ingestion could be advantageous for a concurrent athlete looking to restore
glycogen levels quickly prior to a second exercise bout
or to avoid ingesting high amounts of carbohydrate. In
this respect, however, under some circumstances, it
may also be beneficial for the concurrent athlete to
delay glycogen re-synthesis, allowing endurance exercise to be performed in a glycogen-depleted state (see
review in this issue from Morton and Hawley).
However, the payoff for this strategy may be a greater
rate of muscle catabolism with low glycogen levels
(Howarth et al., 2010). It is, therefore, likely that
periodising protein and combined proteincarbohydrate ingestion in respect to the mode/intensity of
exercise during a concurrent training regime could
be the most practical approach. Clearly, this topic will
provide numerous avenues of experimentation for
concurrent-based research in the future.

General protein requirements


General protein recommendations highlight that
athletes require a greater daily protein intake than
their sedentary counterparts. Provided energy needs
are met, current recommendations suggest that
~1.21.7 g protein/kg/d is required to satisfy the
metabolic demands of this macro-nutrient for both
resistance and endurance-trained athletes (Phillips,
2012; Tarnopolsky, 2004), which is generally in line
with habitual dietary intakes of elite athletes (Burke
et al., 2003). As highlighted previously, balanced
daily protein ingestion supports greater rates of MPS
both at rest (Mamerow et al., 2014) and during
prolonged recovery from exercise (Areta et al.,
2013). If one were to accept that ~0.25 g/kg
maximises MPS (Moore, Robinson, et al., 2009)
and that the repeated ingestion every ~3 h would
sustain these elevated rates (Areta et al., 2013), then
a typical ~16 h waking period (i.e. ~5 meal occasions)
would result in a total protein intake of ~1.25 g/kg/d.
However, a greater protein intake (i.e. 40 g or ~0.50
g/kg) may be required prior to bedtime to offset
overnight catabolic losses (Res et al., 2012), which
when factored into this repeated feeding paradigm to
replace the final meal occasion would yield a total
protein intake of ~1.5 g/kg/d. This optimal feeding
pattern would result in a total protein intake that
would be in line with recommendations for all
athletes and would be generally consistent with the
habitual meal frequency and protein intake of most
elite athletes (Burke et al., 2003).

Are there other active ingredients that might support


concurrent training practice?
Omega 3 fish oil. Omega 3 fatty acids have a unique
ability to reorganise cell membrane structure and
effect intermediate signalling precursors with a range
of bioactivities including anti-inflammatory actions
(Maskrey, Megson, Rossi, & Whitfield, 2013).
Recently, Omega 3 supplementation (8 weeks/4 g/
day) has been shown to improve anabolic responsiveness in 16 older adult subjects (>65 years of age;
Smith et al., 2011). In response to simulated feeding
(hyperinsulinaemichyperaminoacidaemic clamp),
those subjects supplemented with fish oil increased
their MPS by ~60% above the pre-supplementation
value (Smith et al., 2011). The same response was
observed in a follow-up study by the same group
in nine young and middle-aged men and women
(2545 years old) indicating that the effect of Omega
3 supplementation is maintained in young and old
individuals. Furthermore, an Omega 3 supplementation (2 g/day fish oil) trial superimposed on a 90-day
resistance-training programme in 45 elderly women
resulted in greater training-induced strength gains in
the groups receiving fish oil (Rodacki et al., 2012).
These studies highlight that Omega 3 supplementation can have a substantial impact on the nutritional
response of MPS and also (in elderly subjects at
least) Omega 3 supplementation can enhance the
training effect achieved by a resistance-training
programme.
The impact of Omega 3 supplementation on
endurance adaptations is less defined. With specific
focus on skeletal muscle adaptation, Peoples and
McLennan have shown that male Wistar rats supplemented with n-3 PUFAs for 8 weeks display
greater fatigue resistance to electrical stimulation
(1 Hz, 612 V, 0.05 ms), improved recovery rates
between contraction bouts and a significantly higher
O2 efficiency index during the recovery period
(Peoples & McLennan, 2010). A possible explanation for the improvements reported by Peoples and
McLennan (2010) was recently provided by Herbst
et al. who demonstrated that 12-weeks of n-3
supplementation in humans improved adenosine
diphosphate (ADP) kinetics in human skeletal muscle mitochondria through alterations in membrane
structure and/or post-translational modification of
ATP synthase and adenine nucleotide translocator
isoforms (Herbst et al., 2014). However, to our
knowledge, no studies have found a beneficial effect
of fish oil/Omega 3 supplementation on endurance
exercise performance in trained individuals. Only
one study in sedentary subjects has reported
improvements in training-induced changes in
V_ O2max when supplemented with fish oil throughout
the training period (Brilla & Landerholm, 1990). So

J. Perez-Schindler et al.

from the endurance training perspective, there seems


to be a benefit of fish oil on V_ O2max only in
untrained subjects with a potential to reduce inflammation in response to an acute bout of endurance
exercise (Ernst, Saradeth, & Achhammer, 1991).
Irrespective of exercise mode, it would appear that in
order to gain a benefit, doses need to be high (>3 g
Omega 3 per day) with a minimum supplementation
period of 2 weeks to increase skeletal muscle Omega
3 content (McGlory et al., 2014). As a recommendation, it would seem wise for those on concurrent
training programmes to supplement at least 3 g/day
fish oil with the potential for the supplementation to
enhance the strength training responses.

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Modulators of nitric oxide (L-arginine, citrulline and


nitrates)
The signalling molecule nitric oxide (NO) represents
another nutritional target that might promote both
endurance and resistance adaptation. NO can be
synthetised from L-arginine and molecular O2
through a reaction catalysed by different NO
synthase (NOS) isoforms (endothelial, neuronal
and inducible; Stamler & Meissner, 2001). In addition, NO can be synthetised in a NOS-independent
manner through an alternative mechanism requiring nutritional nitrate (NO3; Jones, Vanhatalo, &
Bailey, 2013). Nitrate is especially enriched in greenleafed vegetables and is converted into nitrite
(NO2) by oral bacteria prior to its absorption,
where it can subsequently be converted to NO in
vivo (Jones et al., 2013). NO regulates a number of
biological processes determining skeletal muscle
metabolism and exercise performance, such as blood
flow, glucose/fatty acid oxidation, angiogenesis and
mitochondrial biogenesis (Stamler & Meissner, 2001).
Nitrate supplementation in the form of NaNO3
or NO3-rich beetroot juice has been reported to
improve metabolic efficiency, which is reflected in
lower oxygen consumption (VO2 ) during sub-maximal exercise when compared to a placebo (Bescs,
Sureda, Tur, & Pons, 2012; Jones et al., 2013).
Importantly, consistent with the effects on metabolic
efficiency, ~7 days of nitrate consumption has been
demonstrated to increase fatigue resistance by ~20%
(Bescs et al., 2012; Jones et al., 2013). Maximal
exercise performance, on the other hand, seems to
be less sensitive to nitrate supplementation, with
short-term nitrate supplementation inducing ~2%
improvement in peak power output (Bescs et al.,
2012; Jones et al., 2013). These short-term effects of
nutritional nitrate on metabolic efficiency are related
to a more efficient coupling between ATP utilisation
and skeletal muscle force generation (Bailey et al.,
2010), while mitochondrial function seems to be
also improved following long-term administration

(Vanhatalo et al., 2010). Administration of nitrate


for a longer period of time (15 days) increases maximal exercise performance and V_ O2max (Vanhatalo
et al., 2010); however, the mechanisms behind these
ergogenic effects remain to be elucidated. In addition, a different strategy to modulate NO levels
involves the consumption of the L-arginine precursor L-citrulline (Bescs et al., 2012). However,
even though some reports suggest that L-arginine
and L-citrulline supplementation can exert ergogenic effects, the efficiency of these nutrients remain
controversial and its effects appear to be NO-independent (Bescs et al., 2012). Collectively, these
data suggest that increasing NO levels might be a
potential strategy to potentiate the improvement in
endurance performance following concurrent exercise. However, the effects of nutritional supplements
increasing NO synthesis on skeletal muscle force
generation and adaptive growth need to be experimentally explored.
Creatine
The performance-enhancing effects of the biologically active compound creatine have been extensively
studied in both endurance and resistance settings
(Bemben & Lamont, 2005) due to the fact that the
main biological function of creatine is to rapidly
replenish high-energy phosphate stores (Bemben &
Lamont, 2005). During high-intensity and explosive
exercises, such as brief (~10 s) sprinting or weightlifting, are predominantly fuelled by phosphocreatine as this intracellular energy buffer provides an
immediate phosphate source for ADP re-phosphorylation (catalysed by the enzyme creatine kinase
(CK)) that ultimately leads to ATP re-synthesis.
Another function of creatine is pH buffering, since
hydrogen ions are utilised during the enzymatic
reaction catalysed by CK, suggesting that increased
levels of skeletal muscle phosphocreatine can also
delay fatigue by attenuating metabolic acidosis
(Bemben & Lamont, 2005).
Nutritional supplementation of this active compound in the form of creatine monohydrate efficiently increases phosphocreatine levels in skeletal
muscle tissue, implying that this nutritional supplement improves skeletal muscle energetics and function. Accordingly, creatine supplementation has
been extensively shown to induce a significant ~2%
improvement of high-intensity exercise performance,
representing an important ergogenic effect for elite
athletes competing in disciplines involving sprinting
and jumping (Tarnopolsky, 2010). In addition to the
beneficial effects in sprint-related sports, creatine
can also potentiate the effects of chronic resistance
exercise on skeletal muscle mass, potentially through
a greater work capacity and, subsequently, training

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Nutritional strategies

Figure 3. Integrating nutritional approaches relative to molecular signalling events in skeletal muscle. Exercise-mediated signalling
responses representing transcriptional (mRNA) and fractional protein synthesis rate (MITO Mitochondrial and MYO myobrillar) in
relation to generalised skeletal muscle energy status are depicted. To maximise adaptation, it would be advised to complete endurance
training with a low energy status. The most practical approach to achieve this would be to perform endurance exercise in the AM, following
an overnight fast. Protein ingestion can be performed during this period, whereas high CHO intake should be avoided during low intensity
long duration exercise bouts. Prior to resistance exercise, the nutritional focus would be to restore CHO/PRO availability so that the
individual enters the resistance exercise session in positive energy status. Typically, this can be achieved with a mixed meal prior to exercise,
supported with CHO/PRO ingestion. Post-resistance exercise, the nutritional goal is to maintain PRO availability during the adaptive
period, maintaining positive energy status and maximising the protein synthetic response. This can be achieved through a mixed meal and
pulse ingestion of PRO.

stimulus. Even though higher fat-free mass induced


by creatine ingestion is partially due to increased
intracellular water, when combined with resistance
exercise, this active compound induces positive
effects on skeletal muscle function (Bemben &
Lamont, 2005). Consistently, resistance exercise
training combined with creatine supplementation
induces greater improvements in skeletal muscle
strength compared to placebo (Bemben & Lamont,
2005). The main nutritional approach to induce
such ergogenic effects has traditionally involved an
initial loading period in which high doses (~20 g/day)
of creatine are consumed during a short period of
time (~5 days). Subsequently, a maintenance period
in which lower doses (~4 g/days) of creatine are
consumed is continued for a longer period of time
(~4 weeks). Alternatively, similar effects can be
obtained by consuming lower doses (~5 g/days) of
creatine during a long period of time (> 4 weeks)
without the necessity of a loading period.

Practical implications
The most practical approach to combine endurance
and resistance training within the same day is likely

an endurance session in the morning, followed by


resistance training in the afternoon (Figure 3). This
approach is advantageous as it allows the athlete to
conduct the endurance training bout in a fasted
state, to promote signalling adaptation associated
with metabolic and mechanical stress. For long
duration/moderate-intensity sessions, ingestion of
high amounts of carbohydrates (CHO) are likely
detrimental for many of the pro-adaptive signals
(Philp, Hargreaves, & Baar, 2012). In contrast,
protein ingestion during this phase could support
muscle remodelling and offset proteolysis during
exercise. Post-exercise, CHO replenishment should
be gradual and likely avoided in the immediate postexercise period (Figure 3).
In preparation for subsequent resistance exercise,
the concurrent athlete should attempt to gradually
increase skeletal muscle energy status so that resistance exercise is ultimately performed in an energyrich fed state. In this respect, a mixed meal and
CHO replenishment are advised, with post-exercise
protein intake of 0.25 g/kg of a leucine-rich food
required to maximise the anabolic effects of the
exercise bout and maintenance of the pro-hypertrophic effects thereafter. Further, gains may be

10

J. Perez-Schindler et al.

achieved by habitual supplementation of active


ingredients such as Omega 3 fish oils, NO precursors and creatine which may enhance the training
response and improve recovery in between successive exercise bouts.

Downloaded by [2.82.1.188] at 13:09 24 September 2014

References
Apro, W., Wang, L., Ponten, M., Blomstrand, E., & Sahlin, K.
(2013). Resistance exercise induced mTORC1 signaling is not
impaired by subsequent endurance exercise in human skeletal muscle. American Journal of Physiology Endocrinology and
Metabolism, 305(1), E22E32. doi:10.1152/ajpendo.00091.2013
Areta, J. L., Burke, L. M., Camera, D. M., West, D. W.,
Crawshay, S., Moore, D. R., Coffey, V. G. (2014, April).
Reduced resting skeletal muscle protein synthesis is rescued by
resistance exercise and protein ingestion following short-term
energy deficit. American Journal of Physiology Endocrinology
and Metabolism, 306(8), E989E997. doi:10.1152/ajpendo.
00590.2013
Areta, J. L., Burke, L. M., Ross, M. L., Camera, D. M., West, D.
W., Broad, E. M., Coffey, V. G. (2013). Timing and
distribution of protein ingestion during prolonged recovery
from resistance exercise alters myofibrillar protein synthesis.
The Journal of Physiology, 591(Pt 9), 23192331.
Atherton, P. J., & Rennie, M. J. (2006). Protein synthesis a low
priority for exercising muscle. The Journal of Physiology, 573
(Pt 2), 288289. doi:10.1113/jphysiol.2006.110247
Bailey, S. J., Fulford, J., Vanhatalo, A., Winyard, P. G., Blackwell, J.
R., DiMenna, F. J., Jones, A. M. (2010). Dietary nitrate
supplementation enhances muscle contractile efficiency during
knee-extensor exercise in humans. Journal of Applied Physiology,
109(1), 135148. doi:10.1152/japplphysiol.00046.2010
Beelen, M., Koopman, R., Gijsen, A. P., Vandereyt, H., Kies, A. K.,
Kuipers, H., van Loon, L. J. (2008). Protein coingestion
stimulates muscle protein synthesis during resistance-type exercise. American Journal of Physiology Endocrinology and Metabolism,
295(1), E70E77. doi:10.1152/ajpendo.00774.2007
Beelen, M., Zorenc, A., Pennings, B., Senden, J. M., Kuipers, H., &
van Loon, L. J. (2011). Impact of protein coingestion on muscle
protein synthesis during continuous endurance type exercise.
American Journal of Physiology Endocrinology and Metabolism,
300, E945E954.
Bemben, M. G., & Lamont, H. S. (2005). Creatine supplementation
and exercise performance: Recent findings. Sports Medicine, 35(2),
107125. doi:10.2165/00007256200535020-00002
Bescs, R., Sureda, A., Tur, J. A., & Pons, A. (2012). The effect of
nitric-oxide-related supplements on human performance. Sports
Medicine, 42(2), 99117. doi:10.2165/11596860-000000000-00000
Breen, L., Philp, A., Witard, O. C., Jackman, S. R., Selby, A.,
Smith, K., Tipton, K. D. (2011). The influence of
carbohydrate-protein co-ingestion following endurance exercise
on myofibrillar and mitochondrial protein synthesis. The
Journal of Physiology, 589(Pt 16), 40114025. doi:10.1113/
jphysiol.2011.211888
Brilla, L. R., & Landerholm, T. E. (1990). Effect of fish oil
supplementation and exercise on serum lipids and aerobic fitness.
The Journal of Sports Medicine and Physical Fitness, 30, 173180.
Burd, N. A., Tang, J. E., Moore, D. R., & Phillips, S. M. (2009).
Exercise training and protein metabolism: Influences of contraction, protein intake, and sex-based differences. Journal of
Applied Physiology, 106, 16921701. doi:10.1152/japplphysiol.91351.2008
Burd, N. A., West, D. W., Moore, D. R., Atherton, P. J., Staples,
A. W., Prior, T., Phillips, S. M. (2011). Enhanced amino acid
sensitivity of myofibrillar protein synthesis persists for up to 24 h

after resistance exercise in young men. The Journal of Nutrition,


141, 568573. doi:10.3945/jn.110.135038
Burke, L. M., Hawley, J. A., Wong, S. H., & Jeukendrup, A. E.
(2011). Carbohydrates for training and competition. Journal of
Sports Sciences, 29(Suppl. 1), S17S27. doi:10.1080/02640414.
2011.585473
Burke, L. M., Slater, G., Broad, E. M., Haukka, J., Modulon, S.,
& Hopkins, W. G. (2003). Eating patterns and meal frequency
of elite Australian athletes. International Journal of Sport Nutrition & Exercise Metabolism, 13, 521538.
Burke, L. M., Winter, J. A., Cameron-Smith, D., Enslen, M.,
Farnfield, M., & Decombaz, J. (2012). Effect of intake of
different dietary protein sources on plasma amino acid profiles
at rest and after exercise. International Journal of Sport Nutrition
& Exercise Metabolism, 22, 452462.
Camera, D. M., West, D. W., Phillips, S. M., Rerecich, T.,
Stellingwerff, T., Hawley, J. A., & Coffey, V. G. (2014).
Protein ingestion increases myofibrillar protein synthesis after
concurrent exercise. Medicine and Science in Sports and Exercise.
[Epub ahead of print].
Churchward-Venne, T. A., Murphy, C. H., Longland, T. M., &
Phillips, S. M. (2013). Role of protein and amino acids in
promoting lean mass accretion with resistance exercise and
attenuating lean mass loss during energy deficit in humans.
Amino Acids, 45, 231240. doi:10.1007/s00726-013-1506-0
Coffey, V. G., Jemiolo, B., Edge, J., Garnham, A. P., Trappe, S. W.,
& Hawley, J. A. (2009). Effect of consecutive repeated sprint
and resistance exercise bouts on acute adaptive responses in
human skeletal muscle. American Journal of Physiology Regulatory,
Integrative and Comparative Physiology, 297, R1441R1451.
de Souza, E. O., Tricoli, V., Roschel, H., Brum, P. C., Bacurau,
A. V., Ferreira, J. C., Ugrinowitsch, C. (2013). Molecular
adaptations to concurrent training. International Journal of
Sports Medicine, 34, 207213.
Donges, C. E., Burd, N. A., Duffield, R., Smith, G. C., West, D.
W., Short, M. J., Edge, J. A. (2012). Concurrent resistance
and aerobic exercise stimulates both myofibrillar and mitochondrial protein synthesis in sedentary middle-aged men. Journal
of Applied Physiology, 112, 19922001. doi:10.1152/japplphysiol.
00166.2012
Egan, B., & Zierath, J. R. (2013). Exercise metabolism and the
molecular regulation of skeletal muscle adaptation. Cell Metabolism, 17, 162184. doi:10.1016/j.cmet.2012.12.012
Ernst, E., Saradeth, T., & Achhammer, G. (1991). n-3 fatty acids
and acute-phase proteins. European Journal of Clinical Investigation, 21(1), 7782. doi:10.1111/j.1365-2362.1991.tb01362.x
Fyfe, J. J., Bishop, D. J., & Stepto, N. K. (2014). Interference
between concurrent resistance and endurance exercise: Molecular bases and the role of individual training variables. Sports
Medicine, 44, 743762. doi:10.1007/s40279-014-0162-1
Garcia-Roves, P. M., Osler, M. E., Holmstrom, M. H., & Zierath,
J. R. (2008). Gain-of-function R225Q mutation in AMPactivated protein kinase gamma3 subunit increases mitochondrial biogenesis in glycolytic skeletal muscle. The Journal of
Biological Chemistry, 283, 3572435734. doi:10.1074/jbc.
M805078200
Glynn, E. L., Fry, C. S., Drummond, M. J., Dreyer, H. C.,
Dhanani, S., Volpi, E., Rasmussen, B. B. (2010). Muscle
protein breakdown has a minor role in the protein anabolic
response to essential amino acid and carbohydrate intake
following resistance exercise. American Journal of Physiology
Regulatory, Integrative and Comparative Physiology, 299,
R533R540.
Hamilton, D. L., & Philp, A. (2013). Can AMPK mediated
suppression of mTORC1 explain the concurrent training effect?
Cellular and Molecular Exercise Physiology, 2(1), 18. doi:10.7457/
cmep.v2i1.e4

Downloaded by [2.82.1.188] at 13:09 24 September 2014

Nutritional strategies
Hardie, D. G., Ross, F. A., & Hawley, S. A. (2012). AMPK: A
nutrient and energy sensor that maintains energy homeostasis.
Nature Reviews Molecular Cell Biology, 13, 251262.
Herbst, E. A., Paglialunga, S., Gerling, C., Whitfield, J., Mukai, K.,
Chabowski, A., Holloway, G. P. (2014). Omega-3 supplementation alters mitochondrial membrane composition and respiration kinetics in human skeletal muscle. The Journal of
Physiology, 592(Pt 6), 13411352. doi:10.1113/jphysiol.2013.
267336
Hickson, R. C. (1980). Interference of strength development by
simultaneously training for strength and endurance. European
Journal of Applied Physiology and Occupational Physiology, 45,
255263.
Howarth, K. R., Phillips, S. M., MacDonald, M. J., Richards, D.,
Moreau, N. A., & Gibala, M. J. (2010). Effect of glycogen
availability on human skeletal muscle protein turnover during
exercise and recovery. Journal of Applied Physiology, 109, 431
438. doi:10.1152/japplphysiol.00108.2009
Jager, S., Handschin, C., St-Pierre, J., & Spiegelman, B. M.
(2007). AMP-activated protein kinase (AMPK) action in
skeletal muscle via direct phosphorylation of PGC-1alpha.
Proceedings of the National Academy of Sciences of the United
States of America, 104, 1201712022.
Jones, A. M., Vanhatalo, A., & Bailey, S. J. (2013). Influence of
dietary nitrate supplementation on exercise tolerance and performance. Nestl Nutrition Institute Workshop Series, 75, 2740.
Kakigi, R., Yoshihara, T., Ozaki, H., Ogura, Y., IchinosekiSekine, N., Kobayashi, H., & Naito, H. (2014, April). Whey
protein intake after resistance exercise activates mTOR signaling in a dose-dependent manner in human skeletal muscle.
European Journal of Applied Physiology, 114(4), 735742.
doi:10.1007/s00421-013-2812-7.
Lerin, C., Rodgers, J. T., Kalume, D. E., Kim, S. H., Pandey, A.,
& Puigserver, P. (2006). GCN5 acetyltransferase complex
controls glucose metabolism through transcriptional repression
of PGC-1alpha. Cell Metabolism, 3, 429438. doi:10.1016/j.
cmet.2006.04.013
Levenhagen, D. K., Carr, C., Carlson, M. G., Maron, D. J.,
Borel, M. J., & Flakoll, P. J. (2002). Postexercise protein intake
enhances whole-body and leg protein accretion in humans.
Medicine and Science in Sports and Exercise, 34, 828837.
Levenhagen, D. K., Gresham, J. D., Carlson, M. G., Maron, D. J.,
Borel, M. J., & Flakoll, P. J. (2001). Postexercise nutrient intake
timing in humans is critical to recovery of leg glucose and protein
homeostasis. American Journal of Physiology Endocrinology and
Metabolism, 280, E982E993.
Lundberg, T. R., Fernandez-Gonzalo, R., Gustafsson, T., &
Tesch, P. A. (2012). Aerobic exercise alters skeletal muscle
molecular responses to resistance exercise. Medicine and Science
in Sports and Exercise, 44, 16801688.
Lundberg, T. R., Fernandez-Gonzalo, R., Gustafsson, T., &
Tesch, P. A. (2013). Aerobic exercise does not compromise
muscle hypertrophy response to short-term resistance training.
Journal of Applied Physiology, 114(1), 8189. doi:10.1152/
japplphysiol.01013.2012
Lunn, W. R., Pasiakos, S. M., Colletto, M. R., Karfonta, K. E.,
Carbone, J. W., Anderson, J. M., & Rodriguez, N. R. (2012).
Chocolate milk and endurance exercise recovery: Protein
balance, glycogen, and performance. Medicine and Science in
Sports and Exercise, 44, 682691.
Mamerow, M. M., Mettler, J. A., English, K. L., Casperson, S. L.,
Arentson-Lantz, E., Sheffield-Moore, M., Paddon-Jones, D.
(2014, June). Dietary Protein Distribution Positively Influences
24-h Muscle Protein Synthesis in Healthy Adults. The Journal of
Nutrition, 144(6), 876880. doi:10.3945/jn.113.185280
Maskrey, B. H., Megson, I. L., Rossi, A. G., & Whitfield, P. D.
(2013). Emerging importance of omega-3 fatty acids in the

11

innate immune response: Molecular mechanisms and lipidomic


strategies for their analysis. Molecular Nutrition & Food
Research, 57, 13901400.
McGlory, C., Galloway, S. D. R., Lee Hamilton, D., McClintock,
C., Breen, L., Dick, J. R., Tipton, K. D. (2014, June).
Temporal changes in human skeletal muscle and blood lipid
composition with fish oil supplementation. Prostaglandins, Leukotrienes and Essential Fatty Acids, 90(60), 199206. doi:10.1016/j.
plefa.2014.03.001
Mettler, S., Mitchell, N., & Tipton, K. D. (2010). Increased protein
intake reduces lean body mass loss during weight loss in athletes.
Medicine and Science in Sports and Exercise, 42, 326337.
Millward, D. J., Bowtell, J. L., Pacy, P., & Rennie, M. J. (1994).
Physical activity, protein metabolism and protein requirements.
The Proceedings of the Nutrition Society, 53, 223240.
Mitchell, C. J., Churchward-Venne, T. A., Bellamy, L., Parise,
G., Baker, S. K., & Phillips, S. M. (2013). Muscular and
systemic correlates of resistance training-induced muscle
hypertrophy. PLoS One, 8, e78636.
Miyazaki, M., McCarthy, J. J., Fedele, M. J., & Esser, K. A.
(2011). Early activation of mTORC1 signalling in response to
mechanical overload is independent of phosphoinositide
3-kinase/Akt signalling. The Journal of Physiology, 589(Pt 7),
18311846.
Moore, D. R., Areta, J., Coffey, V. G., Stellingwerff, T., Phillips,
S. M., Burke, L. M., Hawley, J. A. (2012). Daytime pattern
of post-exercise protein intake affects whole-body protein
turnover in resistance-trained males. Nutrition and Metabolism,
9(1), 91.
Moore, D. R., Camera, D. M., Areta, J. L., & Hawley, J. A.
(2014, May). Beyond muscle hypertrophy: Why dietary protein
is important for endurance athletes. Applied Physiology, Nutrition, and Metabolism, 7, 111.
Moore, D. R., Robinson, M. J., Fry, J. L., Tang, J. E., Glover, E.
I., Wilkinson, S. B., Phillips, S. M. (2009). Ingested protein
dose response of muscle and albumin protein synthesis after
resistance exercise in young men. The American Journal of
Clinical Nutrition, 89, 161168.
Moore, D. R., Tang, J. E., Burd, N. A., Rerecich, T., Tarnopolsky, M. A., & Phillips, S. M. (2009). Differential stimulation
of myofibrillar and sarcoplasmic protein synthesis with protein
ingestion at rest and after resistance exercise. The Journal of
Physiology, 587(Pt 4), 897904.
Peoples, G. E., & McLennan, P. L. (2010). Dietary fish oil
reduces skeletal muscle oxygen consumption, provides fatigue
resistance and improves contractile recovery in the rat in vivo
hindlimb. The British Journal of Nutrition, 104, 17711779.
Phillips, B. E., Williams, J. P., Gustafsson, T., Bouchard, C.,
Rankinen, T., Knudsen, S., Atherton, P. J. (2013).
Molecular networks of human muscle adaptation to exercise
and age. PLoS Genetics, 9, e1003389.
Phillips, S. M. (2012). Dietary protein requirements and adaptive
advantages in athletes. The British Journal of Nutrition, 108
(Suppl. 2), S158S167.
Philp, A., Hamilton, D. L., & Baar, K. (2011). Signals mediating
skeletal muscle remodeling by resistance exercise: PI3-kinase
independent activation of mTORC1. Journal of Applied Physiology, 110, 561568.
Philp, A., Hargreaves, M., & Baar, K. (2012). More than a store:
Regulatory roles for glycogen in skeletal muscle adaptation to
exercise. American Journal of Physiology Endocrinology and
Metabolism, 302, E1343E1351.
Philp, A., MacKenzie, M. G., Belew, M. Y., Towler, M. C.,
Corstorphine, A., Papalamprou, A., Baar, K. (2013).
Glycogen content regulates peroxisome proliferator activated
receptor- partial differential (PPAR- partial differential) activity
in rat skeletal muscle. PLoS One, 8, e77200.

Downloaded by [2.82.1.188] at 13:09 24 September 2014

12

J. Perez-Schindler et al.

Philp, A., & Schenk, S. (2013). Unraveling the complexities of


SIRT1-mediated mitochondrial regulation in skeletal muscle.
Exercise and Sport Sciences Reviews, 41, 174181.
Res, P. T., Groen, B., Pennings, B., Beelen, M., Wallis, G. A.,
Gijsen, A. P., Van Loon, L. J. (2012). Protein ingestion
before sleep improves postexercise overnight recovery. Medicine
and Science in Sports and Exercise, 44, 15601569.
Rockl, K. S., Hirshman, M. F., Brandauer, J., Fujii, N., Witters,
L. A., & Goodyear, L. J. (2007). Skeletal muscle adaptation to
exercise training: AMP-activated protein kinase mediates muscle fiber type shift. Diabetes, 56, 20622069.
Rodacki, C. L., Rodacki, A. L., Pereira, G., Naliwaiko, K., Coelho,
I., Pequito, D., Fernandez, L. C. (2012). Fish-oil supplementation enhances the effects of strength training in elderly
women. The American Journal of Clinical Nutrition, 95, 428436.
Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman,
B. M., & Puigserver, P. (2005). Nutrient control of glucose
homeostasis through a complex of PGC-1alpha and SIRT1.
Nature, 434(7029), 113118.
Ronnestad, B. R., Hansen, E. A., & Raastad, T. (2012). High
volume of endurance training impairs adaptations to 12 weeks
of strength training in well-trained endurance athletes. European Journal of Applied Physiology, 112, 14571466.
Schoenfeld, B. J., Aragon, A. A., & Krieger, J. W. (2013). The
effect of protein timing on muscle strength and hypertrophy: A
meta-analysis. Journal of the International Society of Sports
Nutrition, 10(1), 53.
Shimobayashi, M., & Hall, M. N. (2014). Making new contacts:
The mTOR network in metabolism and signalling crosstalk.
Nature Reviews Molecular Cell Biology, 15, 155162.
Smith, G. I., Atherton, P., Reeds, D. N., Mohammed, B. S.,
Rankin, D., Rennie, M. J., & Mittendorfer, B. (2011). Dietary
omega-3 fatty acid supplementation increases the rate of muscle
protein synthesis in older adults: A randomized controlled trial.
The American Journal of Clinical Nutrition, 93, 402412.
Stamler, J. S., & Meissner, G. (2001). Physiology of nitric oxide in
skeletal muscle. Physiological Reviews, 81, 209237.
Staples, A. W., Burd, N. A., West, D. W., Currie, K. D.,
Atherton, P. J., Moore, D. R., Phillips, S. M. (2011).
Carbohydrate does not augment exercise-induced protein
accretion versus protein alone. Medicine and Science in Sports
and Exercise, 43, 11541161.
Tang, J. E., Perco, J. G., Moore, D. R., Wilkinson, S. B., &
Phillips, S. M. (2008). Resistance training alters the response
of fed state mixed muscle protein synthesis in young men.
American Journal of Physiology Regulatory, Integrative and
Comparative Physiology, 294, R172R178.

Tarnopolsky, M. (2004). Protein requirements for endurance


athletes. Nutrition, 20, 662668. doi:10.1016/j.nut.2004.04.008
Tarnopolsky, M. A. (2010). Caffeine and creatine use in sport.
Annals of Nutrition & Metabolism, 57(Suppl. 2), 18. doi:10.1159/
000322696
Tipton, K. D., Elliott, T. A., Cree, M. G., Aarsland, A. A.,
Sanford, A. P., & Wolfe, R. R. (2007). Stimulation of net
muscle protein synthesis by whey protein ingestion before and
after exercise. American Journal of Physiology Endocrinology and
Metabolism, 292(1), E71E76.
Tipton, K. D., Ferrando, A. A., Phillips, S. M., Doyle, D., Jr., &
Wolfe, R. R. (1999). Postexercise net protein synthesis in
human muscle from orally administered amino acids. American
Journal of Physiology, 276(4 Pt 1), E628E634.
Tipton, K. D., Rasmussen, B. B., Miller, S. L., Wolf, S. E.,
Owens-Stovall, S. K., Petrini, B. E., & Wolfe, R. R. (2001).
Timing of amino acid-carbohydrate ingestion alters anabolic
response of muscle to resistance exercise. American Journal
of Physiology Endocrinology and Metabolism, 281, E197
E206.
Vanhatalo, A., Bailey, S. J., Blackwell, J. R., DiMenna, F. J., Pavey,
T. G., Wilkerson, D. P., Jones, A. M. (2010). Acute
and chronic effects of dietary nitrate supplementation on blood
pressure and the physiological responses to moderate-intensity and
incremental exercise. American Journal of Physiology Regulatory,
Integrative and Comparative Physiology, 299, R1121R1131.
Witard, O. C., Jackman, S. R., Breen, L., Smith, K., Selby, A., &
Tipton, K. D. (2014). Myofibrillar muscle protein synthesis
rates subsequent to a meal in response to increasing doses of
whey protein at rest and after resistance exercise. The American
Journal of Clinical Nutrition, 99(1), 8695.
Wojtaszewski, J. F., MacDonald, C., Nielsen, J. N., Hellsten,
Y., Hardie, D. G., Kemp, B. E., Richter, E. A. (2003).
Regulation of 5'AMP-activated protein kinase activity and
substrate utilization in exercising human skeletal muscle.
American Journal of Physiology Endocrinology and Metabolism, 284, E813E822.
Wojtaszewski, J. F., Nielsen, P., Hansen, B. F., Richter, E. A., &
Kiens, B. (2000). Isoform-specific and exercise intensity-dependent activation of 5'-AMP-activated protein kinase in human
skeletal muscle. The Journal of Physiology, 528(Pt 1), 221226.
You, J. S., Lincoln, H. C., Kim, C. R., Frey, J. W., Goodman, C.
A., Zhong, X. P., Hornberger, T. A. (2014). The role of
diacylglycerol kinase zeta and phosphatidic acid in the mechanical
activation of mammalian target of rapamycin (mTOR) signaling
and skeletal muscle hypertrophy. Journal of Biological Chemistry,
289, 15511563. doi:10.1074/jbc.M113.531392

The perfect pedal stroke


There are 3 parts to a peddle stroke
A) Downward stroke: this is where most
of your power is created.
B) Back stroke this is the section most
of us forget and is the start of the dead
point in the peddle action
. C) Up stroke to actively lift the leg so
no negative force can be created.
Aim to have 2 parts at work and one at
rest, as the old push and pull does not
allow at any time the muscle to find rest
and this is critical in endurance sports.

Most of a cyclist's power should come from the gluteus maximus and quadriceps muscles
during the downstroke. These muscles combine to extend the upper leg at the hip and the
lower leg at the knee. Other accessory muscles should be involved, but should not fatigue
greatly and certainly should never be a limiting factor in cycling performance.
The way the hamstring muscles attach creates one difficulty for cyclists. Since the
hamstring crosses both the hip and the knee joints, it has two major functions: hip
extension and knee flexion. During all 360 degrees of the pedal-stroke, a cyclist
undergoes either hip extension or knee flexion ... so the hamstring muscles potentially
contract throughout the entire pedal-stroke without a moment to recover. No wonder they
fatigue for so many riders.
Each muscle involved in the pedal-stroke must have periods of relaxation during which
they recover from the powerful contractions they have just been required to produce. The
key is learning when the hamstrings are required to produce power in an efficient stroke
and when they should be relaxed and then learning to pedal that way.

Back Stroke

Power production during this phase of


the pedal stroke is critical for effective
climbing. Each pedal stroke reaches a
crisis moment when one pedal is at 12
o'clock and the other is at 6 o'clock. Since
neither leg is engaged in a downstroke,
creating a little bit of power in this 'dead
spot' carries momentum through to the
next downstroke.
The backstroke is one area of the pedal
stroke where the hamstring muscles
should be very active, because only knee
flexion provides power in this range.
Relaxation during another range of the
pedal stroke in (upstroke) prevents
fatigue and enables powerful backstroke
contractions without over-using the
hamstrings.

U p

s t r o k e

The first key is keeping your


concentration on lifting the knee and not
the heel or the foot. If a cyclist thinks of
lifting the heel or pedal or foot, he is
likely to use knee flexion to accomplish
the movement. If he thinks of lifting his
knee powerfully, the foot and pedal will
follow without contractions to bend the
knee.
The second key is thinking of the
upstroke as a diagonally upward /
forward movement, instead of an upward
and backward movement. Again, this
places the emphasis on the hip-flexor
muscles, which should be contracting,
instead of the hamstrings, which should
be relaxing. When your pedal reaches the
seven o'clock position, think of driving
the knee up toward the handlebar

Down Ward Stroke

the power application begins early, at 12


o'clock, and is directed downward
diagonally toward 4 o'clock. This
activates the quadriceps optimally and
lengthens the overlap between the peak
torque production of knee extension and
hip extension. The quadriceps and gluteus
maximus are the primary power
producers and the hamstrings contract
moderately.

THE BULDING DRILL for cycling


This is to be done in the start at slow cadence on slightly heavy gear to learn drill
Back ward stroke 30ses (then Add) hamstrings
Up ward Stroke 30sec (then add) Hip flexors
Downward Stroke 30 sec Quads& Gluts
TOTAL 1.30MIN + rest 30 sec (Drill time 2 mins)
Drill time 2 mins
Repeat 3times
Do this at start , Middle and finish of ride
Aim to build time ,higher cadence and lighter gear

Genes & Nutrition Vol. 1, No. 2, pp. 95-106, 2006


ISSN 1555-8932 print, Copyright 2006 by New Century Health Publishers, LLC
www.newcenturyhealthpublishers.com
All rights of reproduction in any form reserved

POLYUNSATURATED FATTY ACIDS: FROM DIET TO BINDING


TO PPARS AND OTHER NUCLEAR RECEPTORS
A. Bordoni, M. Di Nunzio, F. Danesi and P.L. Biagi
Centro Ricerche sulla Nutrizione - Department of Biochemistry G. Moruzzi,
University of Bologna Via Irnerio, 48 - 40126 Bologna, Italy
[Received April 7, 2006; Accepted June 21, 2006]

ABSTRA
CT
ABSTRACT
CT:: Dietary polyunsaturated fatty acids (PUFAs)
function not only by altering membrane lipid composition, cellular
metabolism, signal transduction, but possess also effects on gene
expression by regulating the activity/abundance of different nuclear
transcription factors: peroxisome proliferator activated receptors,
retinoid X receptors, liver X receptors, hepatic nuclear factors-4a,
and sterol regulatory binding proteins 1 and 2. PUFAs regulate
the expression of genes in various tissues, including the liver, heart,
adipose tissue, and brain, playing a major role in carbohydrate,
fatty acid, triglyceride, and cholesterol metabolism. Before binding
to transcription factors, PUFAs must be absorbed in the intestine
and delivered to cells, and then they must enter the cell and the
nucleus. PUFA concentration within the cell depends on many
different factors, and regulate their possibility to act as
transcription modulators. The aim of this review is to summarize
recent knowledge about PUFAs destiny from diet to nuclear factors
binding, examining the different variables which can modulate
their interaction with nuclear factors themselves and therefore
their effect on gene expression.
KEY WORDS
WORDS: Gene Expression, Nuclear Receptors,
Nutrigenomic, Polyunsaturated Fatty Acids
______________________________________________________________________________
Abbreviation used: AA, Arachidonic Acid; ACS, AcylCoA
Synthase; A-FABP,Adipose Fatty Acid-Binding Protein; ALA, Linolenic Acid; CBP, CREB Binding Protein; CE,Cholesterol
Ester; COX, Ciclooxygenase; CYP, Cytochrome P450; DHA,
Docosahexaenoic Acid; EPA, Eicosapentaenoic Acid; FA,Fatty
Acid; FAAR, Fatty Acid-Activated Receptor; FABPpm, Plasma
Membrane Fatty Acid-Binding Protein; FACoA, Fatty Acyl-CoA;
FAT, Fatty Acid Translocase; FATP, Fatty Acid Transport Protein;
H-FABP, Heart Fatty Acid-Binding Protein; HNF-4a, Hepatic
Nuclear Factors-4a; I-FABP, Intestinal FattyAcid-Binding Protein;
LA, Linoleic Acid; LCFA, Long Chain Fatty Acid; L-FABP,Liver
Fatty Acid-Binding Protein; LPX, Lipooxygenase; LXR, Liver X

Receptor; LXRE, LXR Responsive Element; MAP


kinase,Mitogen-Activated Protein kinase; NCoR, Nuclear
Receptor Corepressor; NEFA, Non-Esterified Fatty Acid; ORF,
Open Reading Frame; PBP, PPAR Binding Protein; PL,
Phospholipid; PLA2, Phospholipase A2; PPAR,Peroxisome
Proliferator Activated Receptor; PPRE,PPAR Response Element;
PUFA, Polyunsaturated Fatty Acid; RA,Retinoic Acid; RAR,
Retinoic Acid Receptor; RXR, Retinoid X Receptor; SL,
Sphingolipid; SM,Sphingomyelin; SMRT, Silencing Mediator
for Retinoid- and Thyroid-Hormone Receptor; SRC-1, Steroid
Receptor Coactivator-1; SRE, Sterol Responsive Element; SREBP,
Sterol Regulatory Binding Protein; TAG, Triacylglycerol
Corresponding Author: Dr. Alessandra Bordoni, Centro Ricerche
sulla Nutrizione, Department of Biochemistry G. Moruzzi Via
Irnerio, 48, 40126 Bologna, Italy; Fax: +39 051 2091235;
E-mail: alessandra.bordoni@unibo.it
INTRODUCTION
Although since long ago nutrition has clearly had a predominant
role in health management, the mechanisms by which certain
nutrients are essential for optimal health and for the prevention of
human diseases have been elucidated only recently, and in some
cases not completely. At the beginning of the 20th century two
fatty acids (FAs), linoleic (C18:2n-6, LA) and -linolenic (C18:3n3, ALA), were recognized as essential, and later on the positive
effects of their elongated and desaturated derivatives, n-6 and n-3
polyunsaturated fatty acids (PUFAs), appeared clear. Prior to the
90s, it was commonly believed that PUFAs exerted their effects
through changes at the level of membrane phospholipids (PLs) or
through the production of signalling molecules such as eicosanoids.
Only in 1992 Gottlicher et al. (Gottlicher et al., 1992) established
the existence of nuclear receptors capable for binding FAs and thus
affecting gene transcription.
Since the initial description of peroxisome-proliferator activated
receptors (PPARs), a number of other transcription factors have

96 Polyunsaturated fatty acids


been identified as targets for regulation by FAs or their
metabolites, including retinoid X receptor (RXR), hepatic
nuclear factor 4 (HNF-4), liver X receptor and
(LXR and ), and sterol regulatory element binding
protein-1c (SREBP-1c) (Clarke, 2004; Sampath and
Ntambi, 2004).
While examining the effects of FAs on gene
transcription, it is seldom considered that, before exerting
their nuclear effects, they must be absorbed in the
intestine and delivered to cells; then they must enter the
cell and the nucleus, where they bind to nuclear factors
as non-esterified fatty acids (NEFAs) or as acylCoAs. So,
to understand the effect of FAs on gene transcription, it
is important to consider what happens not only inside
but also outside the nucleus.

Figure 1. From diet to nucleus.


Plasma non-esterified fatty acids (NEFAs) derived from chilomicrons and VLDLs or
mobilized from storage depots enter the cells via passive diffusion or transporters.
Inside the cells, NEFAs are converted by acylCoA synthases to fatty acylCoAs
(FACoAs), which are substrates for -oxidation, desaturation/elongation and
assimilation into complex lipids, i.e. cholesterol esters (CEs), triacylglycerols (TAGs),
phospholipids (PLs) and sphingolipids (SLs). Both NEFAs and FACoAs regulate the
activity/abundance of transcription factors. NEFAs released from PLs by phospholipase
A2 (PLA2) are substrates for ciclooxygenase (COX), lipooxigenase (LPX) and
cytochrome P450 (CYP). The resulting oxidized lipids can affect the activity of
transcription factors.

FR
OM DIET TO THE NUCLEUS
FROM
Since dietary components interact first with the
gastrointestinal tract, the mechanisms which regulate
the bioavailability (degree or rate at which a substance
is absorbed or become available at the site of
physiological activity) of a nutritional molecule is
fundamental to understand its bioactive role throughout
the body. The gastrointestinal tract is a very complex
organ, and many factors such as pH, motility, different
microbial community, diet composition may influence
the bioavailability of a substance (Schneeman, 2002).
Although in physiological conditions lipids possess a
good bioavailability, their absorption is influenced by
so many factors that the plasma concentration of specific
FAs after the consumption of a meal is not easily predictable.
The quantitatively most important lipid component in the
human diet is triacylglycerol (TAG), which may amount to 100 g
per day or more. The fatty acyl groups in dietary TAGs may vary in
chain length from C2 to C24 and from saturated fatty acids to
unsaturated fatty acids with up to six double bonds. The structure
and fatty acid composition of TAGs affect their absorption and the
distribution of the fatty acids in the body following digestion and
absorption (Mu and Porsgaard, 2005). Furthermore, little is known
about the influence of genetic polymorphisms on nutrient
absorption, but an association between plasmatic NEFAs and
polymorphism of intestinal fatty acid binding proteins (I-FABPs)
has been suggested (Pratley et al., 2000).
Long chain fatty acids (LCFAs) are bound by I-FABPs, which
transport them in the cytoplasm of columnary absorptive epithelial
cells of the small intestine (Darimont et al., 2000). LCFAs absorption
is influenced by a polymorphism at codon 54 of the I-FABP gene
(Ala54Thr). These polymorphism results in a change from alanine
to threonine, and is associated with a higher affinity of I-FABP in
LCFA binding (Baier et al., 1995); Pima Indians homozygous for
the Thr54 allele have higher plasmatic concentration of NEFAs
after the consumption of a high fat meal (Pratley et al., 2000). This
finding indicates that polymorphism in genes encoding for intestinal
transporters may modulate bioavailability of dietary components,
and bioavailability, in its turn, may modulate the effects of nutrients.

Once absorbed, FAs are reassembled in lipoprotein complexes


and delivered to cells (figure 1). FAs esterified in chilomicron
TAGs mainly come from dietary lipids, while those esterified
in VLDL-TAGs derive from both diet and endogenous
biosynthesis. In all cases, TAGs are hydrolysed by the action of
lipoprotein lipase and NEFAs enter the cells, as well as
circulating albumin-bound NEFAs mobilized from storage
depots. While controversy still exists regarding the contribution
of passive diffusion versus protein-mediated FA transport, both
processes are now widely accepted. FAs cross the membrane by
a purely diffusive process, without the requirement of protein
mediators; different studies have suggested that diffusion is
rapid enough to account for all FA transport (Pownall and
Hamilton, 2003). On the other hand, many investigators
believe that FA transport is mediated by specific membrane
proteins via FA transporters.
Among these proteins are particularly: i. plasma membrane
fatty acid-binding protein (FABPpm), an approximately 43
kDa protein located peripherally on the plasma membrane
(Koonen et al., 2005); ii. fatty acid translocase (FAT)/CD36,
an 88 kDa integral membrane glycoprotein, with two predicted
transmembrane domains, which is identical to glycoprotein IV
or CD36 of human blood platelets and leucocytes (Koonen et
al., 2005); iii. fatty acid transport proteins 1-6 (FATP1-FATP6),
which are differently expressed in different tissues (Kalant and

Polyunsaturated fatty acids 97


Cianflone, 2004). There are several recent reports on the
(C20:4 n-6, AA) or docosapentaenoic acid (C22:5n-3), is a
regulation of proteins involved in FA transport, but how cells
poor substrate for diacylglycerol acyltransferase, the terminal
and tissues may regulate FA transporters under normal
step in TAG biosynthesis (Madsen et al., 1999; Berge et al.,
physiological conditions and in stress and disease is only
1999), and CoA thioesters of 20 and 22-carbon PUFAs are
beginning to be elucidated (Mashek and Coleman, 2006). Not
poor substrates for acylcholesterol acyltransferase I (Seo et al.,
surprisingly, factors activated by lipids or analogues often lead
2001). Furthermore, PUFAs 22 carbons require prior
to modulation of FA transporters. These modes of regulation
peroxisomal -oxidation to shorten the FA before entry into
include transcriptional regulation through substrate-mediated
the mitochondrial -oxidation spiral, this causing a delay in
stimulation such as PPAR activation or translocation from
their oxidation (Sprecher, 2000). Taken all together these
intracellular to plasma membrane compartments in the case of
situations may lead to a rise in the intracellular NEFA or acylCoA
FAT/CD36 (Cameron-Smith et al., 2003) and FATP1 (Stahl,
levels of specific 20- and 22-carbon PUFAs (both n-6 and n2004).
3). The intracellular concentration of NEFAs and acylCoA
Beyond the proteins that control FA entry into the cell, there
thioesters is low (< 10M), as most of them are protein bound
are intracellular proteins that regulate partitioning to different
(Jump, 2002a). FABPs are abundant cytosolic binding proteins
metabolic fates, such as TAG synthesis for storage, PL synthesis,
having molecular masses of 14-15 kDa, characterised by their
oxidation for energy, intracellular signalling, and protein
high affinity for hydrophobic molecules and their tertiary
acylation. These proteins include the acylCoA synthases (ACSs)
structures (Glatz et al., 2002). At present, nine types of FABs
and multiple small cytosolic proteins collectively termed fatty
are known and each of them has an overlapping but somewhat
acid binding proteins (FABPs) (Hanhoff et al., 2002; Glatz et
different substrate specificity, and each is encoded by a specific
al., 2003).
gene under cell type regulation of transcription (for a review,
Once in cells, NEFAs are rapidly converted to fatty acylCoA
see Chmurzyska, 2006). Liver-FABP (L-FABP) is mainly
thioesters by ACS (figure 1). At least six ACS have been
expressed in the liver and intestine, intestine-FABP (I-FABP)
described, ACS-1 through ACS-5 and very long chain ACS
in the intestine, heart-FABP (H-FABP) in the heart, muscle,
(Coleman et al., 2000; Jump, 2002b); each isoform can activate
brown adipose tissue, prostate and placental trophoblast, and
a wide range of FAs, although some are most active toward
adipose-FABP (A-FABP) in white adipose tissue. L-FABP, Ispecific FA (i.e. ACS-4 is most active with 20:4n6, 20:5n-3
FABP and H-FABP mRNAs are induced by PPAR agonists,
and 22:6n-3) (Jump, 2002a). Recent studies suggest that certain
while A-FABP is induced by PPAR agonists (Tontonoz et al.,
ACS may channel acylCoA thioesters to specific metabolic
1994). Unbound NEFAs and acylCoA binds to affect the
compartments, for example ACS-1 and ACS-4 are linked to
activity of specific transcription factors; among them, PPARs
TAG synthesis (Lewin et al., 2001; Mashek and Coleman,
are considered those mainly involved in direct PUFA regulation
2006).
of gene expression.
The conversion of NEFAs
Table 1. N
atural ligands of PP
ARs
Natural
PPARs
to acylCoA by ACS is a ratedetermining step for
LIGAND
KD
REFERENCE
entering of FAs into 2-3 nM
Hostetler et al., 2005
oxidation, elongation/ Palmitic acid, stearic acid
Linoleic
acid

5
nM
Lin et al., 1999
desaturation or assimilation
Linolenic
acid

8
nM
Lin et al., 1999
into complex lipids such as
Arachidonic
acid
15-20
nM
Lin
et al., 1999
TAGs, cholesterol esters, or
Eicosapentaenoic
acid
n.d.
PLs. Sequestering into
Docosahexaenoic acid
n.d.
synthetic pathways such as
AcylCoA
1-4 nM
Hostetler et al., 2005
lipid synthesis is also
PGA1 PGA2, PGB3, PGD3,PGE3,
influenced by enzymes that
PGF1, PGF2, PGF3, PGI3
> 1000 M
Ferry et al., 2001
funnel or pull FAs into
PGA3
180
Ferry et al., 2001
these pathways.
PGB1, PGB2, PGD1, PGD2, PGE1, PGE2,
A delay in assimilation of PGF , PGG , PGE , PGJ
< 100
Ferry et al., 2001
2
2
20 and 22-carbon PUFAs PGH2, PGH 2
<
10
Ferry et al., 2001
1
2
into neutral lipids is due to 15-deoxy-
12,14
-prostaglandin J2
325 nM - 2.5 M
Nosjean and Boutin, 2002
the fact that CoA thioesters Leukotriene B
submicromolar range
Devchand et al., 1996
4
of 20 and 22-carbon PUFAs
are poor substrates for many
PPAR ligands may be classified in synthetic ligands, such as peroxisome proliferators, hypolipidemic, anti-inflammatory
reactions; as examples, and insulin-sensitizing compounds, and in natural ligands. The main natural PPAR ligands are reported in the table,
eicosapentaenoic acid (C20:5 together with their Kd value, when determined. n.d. = not determined.
n-3, EPA) but not arachidonic

98 Polyunsaturated fatty acids


Figure 2. Structure and splice variants of the PPARs.
A. The three PPAR isoforms share a similar modular structure with functionally
distinct domains which is typical to members of the nuclear receptor superfamily.
The N-terminal A/B domain mediates ligand-independent transcriptional
activation (AF-1); the C domain contains the DNA-binding domain
comprehensive of a two zinc-finger motif; the D domain is a hinge region; the
E domain is the ligand binding domain, which contains the ligand-dependent
transactivation function called (AF-2) and also offers the main surfaces for
dimerization as well as for interaction with regulatory proteins called cofactors.
B. Each PPAR family member is transcribed from a specific gene. Alternative
splicing and the use of different promoters give rise to different splice variants.
In humans, in addition to the full length mRNA for PPAR, a splice variant
lacking the hinge region (playing a role in receptor dimerization) and the entire
ligand binding domain has been identified. The four splice variants for PPAR
give rise to one primary translation product. PPAR1, 3, and 4 yield the same
protein product, PPAR1 including the untranslated exons A1 and A2, PPAR3
containing the untranslated exon A2, and PPAR4 containing only exon 1-6,
which are common to all PPAR subtypes. PPAR2 contains the translated
exon B1, so in humans the protein encoded by PPAR2 has an additional 28
amino acids in the N-terminus.

INSIDE
THE
PE
RO
NUCLEUS:
P
ER
O XISOMEOLIFERA
TOR A
CTIV
ATED RECEPT
ORS (PP
ARs)
PROLIFERA
OLIFERAT
ACTIV
CTIVA
RECEPTORS
(PPARs)
PR
In 1990 PPARs were identified as transcription factors
(Issemann and Green, 1990), and in 1992 Gottilicher et al.
(Gottilicher et al., 1992) demonstrated that linoleic and
arachidonic acid potently activate them. The three PPAR
family members, PPAR (NR1C1), PPAR [NUC-1, fatty acidactivated receptor (FAAR), , NR1C2], and PPAR (NR1C3),
have a canonical nuclear receptor organization (figure 2A).
The N-terminal A/B domain does not seem to be structured and
harbors a weak ligand-independent transactivation function
referred to as AF-1; the C domain contains the DNA-binding
domain comprehensive of a two zinc-finger motif that is
characteristic of the nuclear receptor superfamily; the D domain

is a hinge region. The E domain is the ligand binding domain


and comprises 12 helices and 4 sheets that fold to create
a large hydrophobic cavity where ligands are buried. The E
domain contains a ligand-dependent transactivation function
called AF-2 and also offers the main surfaces for dimerization
as well as for interaction with regulatory proteins called
cofactors.
Each PPAR family member is transcribed from a specific
gene. Alternative splicing and the use of different promoters
give rise to different splice variants (figure 2B); in humans, in
addition to the full length mRNA for PPAR, a splice variant
lacking the hinge region and the entire ligand binding domain,
possibly interfering with PPAR and other nuclear receptors
activity by competing for coactivators, has been identified
(Gervois et al., 1999). The splice variants for PPAR give rise
to one primary translation product (Larsen et al., 2002).

Structural studies of the PPAR- gene and mRNA


transcript support the existence of multiple PPAR- isoforms.
The open reading frame (ORF) of the PPAR- gene consists
of exons 1 to 6. Exons 2 and 3 encode the DNA binding
domain, while exons 5 and 6 encode the ligand-binding
domain. The 52 -terminal region of the transcript is the most
variable and is the determinant of the PPAR- isoform. Until
recently, three exons had been identified in the 52 -terminal
region in many species including rhesus monkey and human.
They are referred to as exon A1, exon A2 and exon B. They
are alternatively spliced with exons 16 of the ORF to
generate three well established isoforms of PPAR- as shown
in figure 2B. PPAR-1 consists of untranslated exon A1 and
A2 spliced together with exons 16; the mRNA for PPAR-2
consists of translated exon B and exons 16, so in humans
the protein encoded by PPAR2 has an additional 28 amino
acids in the N-terminus. A third isoform, PPAR-3, identified
in humans, consists of only untranslated exon A2 in its 52 terminal region and exons 16; PPAR4 contains only exon
1-6, which are common to all PPAR subtypes.
Recently, Chen et al. (2006) identified two novel exons
in PPAR- cDNA from monkey macrophages, which have
been called exon C and exon D. Both of these exons combine
with either exons A1A2 or with exon B to form novel PPAR is o forms.
PPAR is expressed at relatively high levels in liver, small
intestine, kidney, heart, and brown adipose tissue, and it is an
important player in regulating FA transport and oxidation, cell
proliferation, inflammatory crosstalk. PPAR is ubiquitously
expressed and it is involved in development, lipid metabolism,
proliferation of epidermal cells, myelination of nerves, wound
healing (Tan et al., 2003), adaptive responses to exercise in skeletal
muscle (Grimaldi, 2005). PPAR plays a role in glucose
homeostasis, lipid metabolism, cell cycle, inflammation, and
carcinogenesis, and is an adipocyte differentiation factor (for a
review, see Feige et al., 2006). The expression of the various PPAR
isoforms shows tissue specificity. PPAR1 is the most widely
expressed, PPAR2 is localized primarily in adipocytes, PPAR3 is

Polyunsaturated fatty acids 99


found in adipocytes, colonic epithelium, and macrophages, while
the distribution of PPAR4 is unclear (Sundvold and Lien, 2001;
Ferre, 2004).
Among the multitude of agents that activate the PPARs, many
have nutritional origin; for this reason it has been suggested that
PPARs mediate dietary regulation of gene expression. Some
specificity exist between ligands and the PPAR subtypes; structural
and amino acid differences in the binding pocket of the PPAR
isoforms contribute to selectivity for ligand binding (Xu et al.,
2001a). PPAR ligands may be classified in synthetic ligands,
such as peroxisome proliferators, hypolipidemic, antiinflammatory and insulin-sensitizing compounds, and in natural
ligands, such as medium- and long-chain fatty acids and
eicosanoids (table 1). LCFAs, particularly PUFAs, preferentially
activate PPAR (Hostetler et al., 2005), but are also capable of
activating PPAR and PPAR (Desvergne and Wahli, 1999).
Among LCFAs, 18 and 20-carbon FAs are likely preferred
ligands for PPAR activation (Jump, 2002a). Therefore activation
of PPARs by 22-carbon FAs will likely require prior retroconversion
to a 20- carbon PUFA, a process that requires peroxisomal oxidation. PPAR binds 18:1n-9 and 20:5n-3 with nearly equal
affinity (Xu et al., 1999a); notwithstanding, 20:5n-3 but not
18:1n-9 activates PPAR in primary rat hepatocytes. The simplest
explanation is that the intracellular NEFA pool available to activate
PPAR is subjected to metabolic regulation; since 20:5n-3CoA
has been reported to be a poor substrate for TAG synthesis, the
decrease in EPA assimilation into neutral lipids might elevate its
intracellular concentration to a level sufficient to activate PPAR.
Although LCFAs are thought to be putative endogenous
PPAR ligands, most radioligand binding studies demonstrated
that PPAR binds unsaturated LCFAs with only weak affinities
(Kd values in the micromolar range) and saturated LCFAs (lauric
and palmitic acids) are bound even less well (Forman et al., 1999).
These radioligand-based affinities for LCFAs are several orders of
magnitude weaker than PPAR affinity for synthetic xenobiotics.
Since nucleoplasmic LCFA concentrations are in the range of
3968 nM (Huang et al., 2004), based on radioligand binding
assays it would appear unlikely that LCFAs are physiologically
significant endogenous ligands for PPAR. Otherwise, PPAR
binding pockets are 3-4 times larger than those of other nuclear
receptors, being therefore large enough to allow different FAs to
bind in multiple conformations (Blanquart et al., 2003). Flexible
PUFAs are probably physiologically relevant ligands of PPARs
even if they display lower affinity and activity compared to other
compounds, and PPARs may function as lipid sensors and
recognize a number of different metabolites rather than a single
high-affinity hormone (Egea et al., 2002). Very recently, using
direct fluorescence binding and fluorescence displacement assays,
Hoesteler et al. (2005) have provided significant evidence
indicating that PPAR exhibits high affinity (15-20 nM Kd
values) for unsaturated (but not saturated) LCFAs. It is unclear
whether only unsaturated LCFAs represent physiologically
significant endogenous PPAR ligands.
Nowadays, increasing data indicate that also LCFA metabolites
such as LCFA-CoAs may represent active endogenous high affinity

PPAR ligands (Hostetler et al., 2005). The observation of PPAR


high affinity for LCFA-CoAs and unsaturated LCFAs is in
agreement with the structure of the ligand-binding pocket of this
protein, which consists of 13 -helices and four small -strands,
with the binding pocket forming a Y-shaped cavity of 1400
3 (Xu et al., 1999a). This volume appears sufficient to
accommodate LCFAs as well as LCFA-CoAs, which have typical
volumes of <430 3 and <700 3, respectively (Egea et al., 2002).
The overall structure of the ligand-binding domain region of
each PPAR subtype is very similar, with specific amino acid changes
determining ligand specificity between the subtypes (Blanquart
et al., 2003), suggesting that each PPAR subtype may interact
with acyl-CoAs.
Figure 3. PPAR binding to target genes.
PPARs exert their effect on gene transcription by dimerization with
the 9, cis-retinoic acid receptors (RXRs). The heterodimer binds to
a short sequence of DNA, the PPAR response element (PPRE) present
in the promoter region of target genes. Many endogenous (table 1)
and exogenous PPAR ligands are known; RXR is activated by 9, cisretinoic acid, DHA and probably other polyunsaturated fatty acids.
Different co activators and co repressors are supposed to play a role
in PPAR regulation of target genes.

PPARs exert their effect on gene transcription by dimerization


with the 9, cis-retinoic acid receptors (RXRs) (figure 3) (Feige et
al., 2005). The heterodimer binds to a short sequence of DNA,
the PPAR response element (PPRE) present in the promoter region
of target genes, which is a DR1 sequence (direct repeat of the
sequence AGGTCA, separated by one nucleotide) (Desvergne
and Wahli, 1999). If the nucleotide between the two hexamers is
an adenine, the binding affinity of the PPAR/RXR heterodimer is
greatly enhanced. Also the presence of an AA/TCT sequence 5'
of the PPRE increases affinity, since these DNA features result in
a polarity to the bound heterodimer, PPAR binding to the

100 Polyunsaturated fatty acids


upstream hexamer while RXR interacting with the lower, 3'
hexamer (Desvergne and Wahli, 1999).
RXRs bind the 9-cis isomer of retinoic acid (RA) only, while
other nuclear receptors, retinoic acid receptors (RARs), bind both
9-cis and all-trans isomers (Shulman and Mangelsdor, 2005). RA
derives from dietary vitamin A (retinol), which can be converted
into retinal in cells. Retinal is the precursor of all-trans RA, which
can be enzimatically isomerised to 9-cis RA. The regulation of this
enzymatic step controls the 9-cis/all-trans ratio within the cell,
regulating RAR and RXR pathways (Parker, 1996).
Although RXRs can be active as homodimers, the RXR
heterodimers are the physiological relevant molecular species, and
since RXR is the obligate partner with several other nuclear
receptors, among which PPARs, it is a key receptor in many
pathways. Another peculiarity of RXR is its propensity to form
autorepressed homotetramer in the absence of ligands (Egea et
al., 2001).
RXR is also able to bind FAs, and docosahexaenoic acid (DHA)
has been shown to activate it (de Urquiza et al., 2000; Crawford
et al., 2003). DHA deficiency in rat and humans results in
abnormalities similar to those observed in RXR knock-out mice.
The ability of RXR to bind FAs underlines its potential
involvement in lipid homeostasis through complex feedback
mechanisms in association with other nuclear receptors such as
PPARs (Egea et al., 2002). Other PUFAs closely related to DHA,
i.e. EPA or arachidonic acid, can activate RXR but with lower
efficiency, while other FAs such as erucic acid (C20:1) fail to do it
(Egea et al., 2002).
The conformational change that occurs upon ligand binding
to PPARs also facilitates the recruitment of coactivators: steroid
receptor coactivator-1 (SRC-1), CREB binding protein/p300
(CBP), RIP140, ARA70, members of the DRIP/TRAP family of
coactivators, PPAR interacting protein, PPARcoactivator-1, and
PPAR binding protein (PBP). Similar to other steroid hormone
receptors, there are also corepressors that associate with the PPARs:
nuclear receptor corepressor (NCoR) and silencing mediator for
retinoid- and thyroid-hormone receptors (SMRT), that dissociate
from the receptor upon ligand binding (for a review, see Feige et
al., 2006).
The activity of PPARs can be modified also by phosphorylation,
nitration, ubiquitylation and sumoylation. The impact of
phosphorylation on the activity of PPARs depends on the residue
being phosphorylated, and the kinase cascade that has been
activated (Gelman et al., 2005); nitration of tyrosine residues in
PPAR inhibits the translocation from the cytosol to the nucleus
(Shibuya et al., 2002). Ligand binding to PPAR induces
ubiquitilation (Hauser et al., 2000), and therefore receptor
degradation, while ligand binding to PPAR stabilizes the receptor
by decreasing its rate of ubiquitilation (Blanquart et al., 2002).
Ligand binding also regulates sumoylation of PPAR, which
occurs on different lysine residue in a ligand-dependent or ligandsindependent manner and exerts different effects (Ohshima et al.,
2004). Ligands are therefore influencing PPAR activity in a very
complex manner.
Although the identification of a PPRE in the promoter region
is sometimes considered sufficient for considering a gene as a

PPAR-target gene, these stereotypic analyses is not sufficient to


explain tissue-specific PPAR action. The basal expression of several
genes is dominantly regulated in a tissue-specific manner, and not
induced by a PPAR ligand alone even if that tissue abundantly
expresses PPARs (Sato et al., 2002). This tissue specific PPAR
action can be explained by two possibilities: i. the responsive gene
is generally and dominantly repressed and PPAR/RXR alone
cannot activate transcription without a tissue specific enhancing
factor; ii. the gene is basically activated by PPAR/RXR alone but
cells express a repressor.
PUFAs binding to PPAR results in rapid upregulation of
genes involved in lipid oxidation; in the meanwhile, PUFAs
downregulate lipogenic genes, such as FA synthase. This
downregulation is not mediated by PPAR, since it has been
shown also in PPAR null mice, indicating that some effects of
PUFAs are not mediated by PPAR (Sampath and Ntambi,
2004). PPARs can mediate indirect repressive effects termed
transrepression by inhibiting the activity of key transcription
factors. Transrepression may occur either by inhibiting the binding
of transcription factors to DNA through direct protein-protein
interaction (tethering) or by sequestrating cofactors necessary to
their activity (squelching). Anyway, ligand binding is fundamental
for PPAR repressive effects (Feige et al., 2006). Although the
above mentioned mechanisms could explain a PPAR mediated
repressive effects of PUFAs on gene expression, other transcription
factors have been identified as possible mediators for PUFA-related
downregulation of different genes.
INSIDE THE NUCLEUS: PUF
As AND O
THER
PUFAs
OT
NUCLEAR RECEPTORS
Liver X receptors (LXR
and LXR
(LXR
LXR
)
LXR is found mainly in liver, kidneys, intestine, adipose tissue
and adrenal glands, while LXR is more ubiquitariously expressed.
Both LXRs bind oxysterols and directly regulate the expression of
genes involved in hepatic bile acid synthesis. LXRs have also been
shown to regulate genes involved in lipid metabolism such as
lipoprotein lipase, fatty acid synthase, acetylCoA carboxylase and
stearoylCoA desaturase 1. Furthermore, LXR indirectly regulate
the expression of lipogenic genes through the regulation of
SREBP-1c gene transcription (Zelcer and Tontonoz, 2006). LXR
functions by heterodimerizing with RXR and binding DR-4
repeats termed LXR response elements (LXREs). FAs work in
different ways to antagonize the effects of LXRs in promoting
lipid synthesis and storage:
i. unsaturated FAs antagonize oxysterol binding to LXR
and inhibit LXR activation (Ou et al., 2001); the hierarchy
for this effect is 20:4n-6>18:2n-6>18:1n-9. Saturated FAs
have no effects.
ii. FAs inhibit binding of the LXR/RXR heterodimers
to the LXRE (Yoshikawa et al., 2002).
iii. PPAR and PPAR that are activated by PUFAs have
been shown to directly bind LXRs and antagonize their
lipogenic effects probably by a competition between PPAR
and LXR for the RXR partner (Yoshikawa et al., 2003).
PPAR activators induce transcription of the LXR, but

Polyunsaturated fatty acids 101


not LXR, gene through cis-regulatory elements in the LXR
promoter. Thus PUFAs may potentially induce LXR levels
in cells, while inhibiting LXR binding of oxysterols.
iv. binding of PUFAs to LXRs results in the inability of
LXR to induce transcription of SREBP 1c, causing a
consequent decrease in lipogenesis (Sampath and Ntambi,
2005).
Hepatic nuclear factor-4
(HNF-4
)
factor-4
(HNF-4
HNF-4 is a member of the hepatocyte nuclear factor family
that includes six different isoforms (Hayhurst et al., 2001). It
binds to DR1 elements as a homodimer and seems to be
indispensable to hepatocyte differentiation and hepatic functions
such as cholesterol and lipoprotein secretion. It is expressed mainly
in liver, kidney, intestine, and pancreas and is capable of activating
target genes even in the absence of ligand (Hayhurst et al., 2001).
A wide array of hepatic genes is controlled either directly or
indirectly by HNF-4. These include the genes encoding
apolipoproteins CII, CIII, AII, AIV, enzymes involved in iron and
carbohydrates
metabolism
(L-piruvate
kinase,
phosphoenolpyruvate carboxykinase), cytochrome P450,
monooxygenases and bile acid synthesis (Hayhurst et al., 2001).
Fatty acylCoA thioesters at physiological concentrations can
modulate the activity of HNF-4 by directly binding to its ligandbinding domain. The effect of this binding seems to be dependent
on factor such as chain length and degree of unsaturation of the
FA. While binding of saturated FAs (14:0CoA or 16:0CoA)
activate HNF-4, binding of 18:3n-3CoA, 20:5n-3CoA or
22:6n-3CoA results in repression of HNF-4 (Sampath and
Ntambi, 2004; Sampath and Ntambi 2005).
Sterol regulatory element binding protein (SREBP)
SREBP are helix-loop helix transcription factors involved in
the transcription of genes related to cholesterol and lipid synthesis.
Three SREBP have been described; SREBP 1a and 1c are
transcribed from the same gene locus, but they differ for the Ntermini, SREBP1c being the predominant subtype expressed in
rodents and humans; a separate gene encodes SREBP 2. SREBP
1 has emerged as a regulator of FA and TAG synthesis, while
SREBP 2 regulates cholesterol synthesis (Osborne, 2000).
SREBPs are translated as large precursors tethered to the
endoplasmic reticulum where SREBP is bound at the C-terminal
end to SREBP cleavage activating protein. When cellular
cholesterol levels are high, Insig proteins bind and trap SREBP
cleavage-activating protein, retaining it in the endoplasmic
reticulum and preventing it from escorting SREBPs from
endoplasmic reticulum to the site of proteolytic activation in the
Golgi complex (Yabe et al., 2003).
With sterol depletion, both SREBP and SREBP-cleavage activating
protein move to the Golgi where proteases (site 1 protease and
site 2 protease) cleave the protein to release a mature transcriptional
form (nSREBP) that travels to the nucleus to bind to sterol
regulatory elements in promoters of specific genes (Jump, 2002a).
SREBPs act on genes containing sequences called sterol
responsive elements (SREs) in their promoter regions (Sampath

and Ntambi, 2004). SREBP-1c binds SREs in promoters of many


genes involved in de-novo lipogenesis and TAG synthesis,
including ATP-citrate lyase, acetylCoA- carboxylase, fatty acid
synthase, stearoylCoA desaturase 1, glycerol phosphate acyl
transferase; SREBP-2 upregulate genes involved in cholesterol
synthesis.
Rats fed fat-free diets supplemented with n-3 and n-6 PUFAs
showed decreased nuclear levels and expression of SRE-containing
target genes (Xu et al., 1999b). SREBP may not bind FAs or
cholesterol, instead, their effect on gene expression is determined
by regulating the nuclear abundance of nSREBPs. Elevated
intracellular cholesterol downregulates the site 1 protease,
effectively reducing the formation of nSREBPs. Thus, cholesterol
is a feed back regulator controlling SREBP nuclear level (Jump,
2002a). Cholesterol is not equally distributed in cells; most
cholesterol is found in the plasma membrane, often associated
with sphingomyelin (SM) (Worgall et al., 2002). SM typically
contains saturated acyl chains and together with cholesterol it is
found associated with lipid rafts. Treatment of cells with
unsaturated FAs stimulates sphingomyelinase releasing ceramide
as well as redistributing cholesterol from the plasma membrane to
the endoplasmic reticulum. These events suppress proteolytic
processing of the precursor of SREBP and result in a decline in
nSREBP levels and SREBP-mediated gene expression. This
mechanism does not affect mRNA encoding any SREBPs.
PUFAs reduce the nuclear content of SREBP-1c via a two
phases mechanism. The first phase is rapid (<60 min) and consists
in the above mentioned inhibition of the proteolytic release process
(Hannah et al., 2001); the second one involves an adaptative
(about 48 hours) reduction in the hepatic content of SREBP-1
mRNA that is subsequently followed by a reduction in the amount
of precursor SREBP-1 protein (Xu et al., 2001b). Unsaturated
FAs selectively suppress hepatic levels of the mRNA encoding
SREBP-1 (both 1a and 1c), but not SREBP-2 (Mater et al.,
1999; Yahagi et al., 1999); the hierarchy for FA regulation of
mRNASREBP-1c is 20:5n-3 = 20:4n-6 > 18:2n-6 > 18:1n-9. This
effect may be attributed to inhibition of transcription of the
SREBP-1 gene as well as enhanced turnover of the mRNA
encoding SREBP-1; PUFAs reduce the half-life of SREBP-1c
mRNA from 11 hours to <5hours (Xu et al., 2001b). Recently,
Botolin et al. (2006) have demonstrated that 22:6n-3 accelerates
the degradation of nSREBP-1 by a 26S proteosome-dependent
pathway while having little impact on microsomal SREBP-1 or
nSREBP-2.
CONCLUSION
It is well documented that dietary fat regulates gene expression
by controlling the activity/abundance of key transcription factors.
PUFAs regulation of gene expression also accomplishes with
modulation of mRNA processing, mRNA decay and stimulation
of post translational protein modifications.
Moreover, there are alternative routes for PUFA regulation of
transcription factor function, either through generation of
alternative ligands or activation of kinase signalling cascade. For
example, incorporation of PUFAs into membrane PLs affects

102 Polyunsaturated fatty acids


membrane fluidity and cholesterol content and impacts the
generation of signalling molecules. Enrichment of PUFAs in
membrane components associated with lipid rafts (both the PL
and acylated protein components) has a significant impact on Gprotein related receptors, Src kinase, mitogen-activated protein
kinases (MAP kinases) and Ca2+ signalling. Mitogen-activated
protein kinases phosphorylation of PPARs, SREBPs and HNF4 affect their activity. Elevation of PUFAs into membrane PLs
also affects membrane cholesterol levels. Increased PUFA in PLs
displaces cholesterol to the cytoplasm where it can affect
microsomal processing of SREBP.
PUFAs also affect the synthesis of bioactive lipids generated by
cyclooxygenases (COXs) 1 and 2, and 5, 12 and 15lipooxygenases (LPXs). Both COX and LPXs products bind and
affect the activity of PPARS, particularly PPAR. Among PUFAs,
EPA is not only a poor substrate for cyclooxygenases and
lipooxygenases, in contrast to 20:4n-6, but in addition eicosanoids
originating from it display weak activity as PPAR activators.
Independent of their mechanisms of action, an underlying
assumption regarding fatty acid effects on gene expression is that
they are absorbed and transported and that they enter the cells.
Since many variables regulate intestinal absorption, transport and
cellular uptake, FA cytosolic concentration may significantly differ
among subjects and tissues. Furthermore, FA intracellular
metabolism regulates FA uptake. In turn, metabolism requires
intracellular transport and FA activation, which appears as a key
step linking uptake and metabolism. FA activation, binding to
cytosolic proteins and intracellular metabolism appear to be a
driving force in regulating acylCoA and NEFA concentration
inside the cell. How this regulation occur it is not known, but
since it could be different in different cells and for different FAs,
it could partially explain why different FAs do not have the same
final effect in all tissues.
The nuclear actions of PUFAs is established in liver cells (Jump
et al., 2005), in pancreas (Manco et al., 2004), immune system
(Calder, 2003), brain (Uauy and Calderon, 2003), adipose tissue
(Al-Hasani and Joost, 2005) and heart (Vanden Heuvel, 2004),
and the possibility of counteracting human diseases by dietary
FAs, particularly n-3 PUFAs, has been largely investigated,
although their therapeutic effects are still unclear (De Caterina et
al., 2006; Engler and Engler, 2006; Hooper et al., 2006;
Lombardo and Chicco, 2006; Grynberg, 2005; Mills et al., 2005;
Rodriguez-Cruz et al., 2005; Sekiya et al., 2003). It is important
to remember that the effects of PUFAs are due to changes in
membrane FA composition and subsequent alterations in
hormonal signalling, as well as to their direct, membrane
independent influence on molecular events that govern gene
expression. Ongoing researches and those completed thus far has
indeed established PUFAs as universal regulators of cellular
metabolism and increased our understanding on the role that
dietary fats play at cellular and nuclear levels. Studies on the
molecular mechanism by which n-3 and n-6 PUFAs function
could pave the way to finding novel targets for pharmacological
treatment of various chronic diseases.
In this complex scenario, it is fundamental to underline that
PUFA effects largely depend on PUFA cellular concentration;

up-to-date the dietary amount of n-6 and n-3 PUFAs and the
best n-6 to n-3 ratio required for optimum metabolic benefit are
unknown.
Future research should explore the real effectiveness of PUFAs
in the prevention/counteraction of human diseases, designing
studies that closely represent physiological conditions and taking
into account all variables that could influence PUFA concentration
within the different cells. Such researches will provide valuable
insights into understanding the complexity of PUFA effects, and
will be useful to educators and policy makers in setting
recommendations for reaching optimal health through good
nutrition.
REFERENCES
Al-Hasani, H. and Joost, H.G. (2005) Nutrition-/diet-induced
changes in gene expression in white adipose tissue. Best Practice &
Research. Clinical Endocrinology & Metabolism 19, 589-603.
Baier, L.J., Sacchettini, J.C., Knowler, W.C., Eads, J., Paolisso, G.,
Tataranni, P.A., Mochizuki, H., Bennett, P.H., Bogardus, C. and
Prochazka, M. (1995) An amino acid substitution in the human
intestinal fatty acid binding protein is associated with increased
fatty acid binding, increased fat oxidation, and insulin resistance.
The Journal of Clinical Investigation 95, 1281-1287.
Berge, R.K., Madsen, L., Vaagenes, H., Tronstad, K.J., Gottlicher,
M. and Rustan, A.C. (1999) In contrast with docosahexaenoic
acid, eicosapentaenoic acid and hypolipidaemic derivatives
decrease hepatic synthesis and secretion of triacylglycerol by
decreased diacylglycerol acyltransferase activity and stimulation
of fatty acid oxidation. The Biochemical Journal 343, 191-197.
Blanquart, C., Barbier, O., Fruchart, J.C., Staels, B. and Glineur,
C. (2002) Peroxisome proliferator-activated receptor alpha
(PPARalpha ) turnover by the ubiquitin-proteasome system
controls the ligand-induced expression level of its target genes.
The Journal of Biological Chemistry 277, 37254-37259.
Blanquart, C., Barbier, O., Fruchart, J.C., Staels, B. and Glineur,
C. (2003) Peroxisome proliferator-activated receptors: regulation
of transcriptional activities and roles in inflammation. The Journal
of Steroid Biochemistry and Molecular Biology 85, 267-273.
Botolin, D., Wang, Y., Christian, B. and Jump, D.B. (2006)
Docosahexaneoic acid (22:6,n-3) regulates rat hepatocyte SREBP1 nuclear abundance by Erk- and 26S proteasome-dependent
pathways. Journal of Lipid Research 47, 181-192.
Calder, P.C. (2003) N-3 polyunsaturated fatty acids and
inflammation: from molecular biology to the clinic. Lipids 38,
343-352.
Cameron-Smith, D., Burke, L.M., Angus, D.J., Tunstall, R.J.,
Cox, G.R., Bonen, A., Hawley, J.A. and Hargreaves, M. (2003) A
short-term, high-fat diet up-regulates lipid metabolism and gene

Polyunsaturated fatty acids 103


expression in human skeletal muscle. The American Journal of
Clinical Nutrition 77, 313-318.
Chen, Y., Jimenez, A.R. and Medh, J.D. (2006) Identification and
regulation of novel PPAR-gamma splice variants in human THP-1
macrophages. Biochimica et Biophysica Acta 1759, 32-43.
Chmurzynska, A. (2006) The multigene family of fatty acidbinding proteins (FABPs): function, structure and
polymorphism. Journal of Applied Genetics 47, 39-48.
Clarke, S.D. (2004) The multi-dimensional regulation of gene
expression by fatty acids: polyunsaturated fats as nutrient sensors.
Current Opinion in Lipidology 15, 13-18.
Coleman, R.A., Lewin, T.M. and Muoio, D.M. (2000)
Physiological and nutritional regulation of enzymes of
triacylglycerol synthesis. Annual Review of Nutrition 20, 77-103.
Crawford, M.A., Golfetto, I., Ghebremeskel, K., Min, Y.,
Moodley, T., Poston, L., Phylactos, A., Cunnane, S. and Schmidt,
W. (2003) The potential role for arachidonic and docosahexaenoic
acids in protection against some central nervous system injuries in
preterm infants. Lipids 38, 303-315.
Darimont, C., Gradoux, N., Persohn, E., Cumin, F. and De Pover,
A. (2000) Effects of intestinal fatty acid-binding protein
overexpression on fatty acid metabolism in Caco-2 cells. Journal
of Lipid Research 41, 84-92.
De Caterina, R., Zampolli, A., Del Turco, S., Madonna, R. and
Massaro, M. (2006) Nutritional mechanisms that influence
cardiovascular disease. The American Journal of Clinical Nutrition
83, 421S-426S.
de Urquiza, A.M., Liu, S., Sjoberg, M., Zetterstrom, R.H.,
Griffiths, W., Sjovall, J. and Perlmann, T. (2000) Docosahexaenoic
acid, a ligand for the retinoid X receptor in mouse brain. Science
290, 2140-2144.
Desvergne, B. and Wahli, W. (1999) Peroxisome proliferatoractivated receptors: nuclear control of metabolism. Endocrine
Reviews 20, 649-688.
Devchand, P.R., Keller, H., Peters, J.M., Vazquez, M., Gonzalez,
F.J. and Wahli, W. (1996) The PPARalpha-leukotriene B4
pathway to inflammation control. Nature 384, 39-43.

Engler, M.M. and Engler, M.B. (2006) Omega-3 fatty acids: role
in cardiovascular health and disease. The Journal of Cardiovascular
Nursing 21, 17-24.
Feige, J.N., Gelman, L., Michalik, L., Desvergne, B. and Wahli,
W. (2006) From molecular action to physiological outputs:
peroxisome proliferator-activated receptors are nuclear receptors
at the crossroads of key cellular functions. Progress in Lipid Research
45, 120-159.
Feige, J.N., Gelman, L., Tudor, C., Engelborghs, Y., Wahli, W.
and Desvergne, B. (2005) Fluorescence imaging reveals the nuclear
behavior of peroxisome proliferator-activated receptor/retinoid X
receptor heterodimers in the absence and presence of ligand. The
Journal of Biological Chemistry 280, 17880-17890.
Ferre, P. (2004) The biology of peroxisome proliferator-activated
receptors: relationship with lipid metabolism and insulin
sensitivity. Diabetes 53, S43-S50.
Ferry, G., Bruneau, V., Beauverger, P., Goussard, M., Rodriguez,
M., Lamamy, V., Dromaint, S., Canet, E., Galizzi, J.P. and Boutin,
J.A. (2001) Binding of prostaglandins to human PPARgamma:
tool assessment and new natural ligands. European journal of
pharmacology 417, 77-89.
Forman, B.M., Chen, J. and Evans, R.M. (1997) Hypolipidemic
drugs, polyunsaturated fatty acids, and eicosanoids are ligands
for peroxisome proliferator-activated receptors alpha and delta.
Proceedings of the National Academy of Sciences of the United States
of America 94, 4312-4317.
Gelman, L., Michalik, L., Desvergne, B. and Wahli, W. (2005)
Kinase signaling cascades that modulate peroxisome proliferatoractivated receptors. Current Opinion in Cell Biology 17, 216-222.
Gervois, P., Torra, I.P., Chinetti, G., Grotzinger, T., Dubois, G.,
Fruchart, J.C., Fruchart-Najib, J., Leitersdorf, E. and Staels, B.
(1999) A truncated human peroxisome proliferator-activated
receptor alpha splice variant with dominant negative activity.
Molecular Endocrinology 13, 1535-1549.
Glatz, J.F., Luiken, J.J., van Bilsen, M. and van der Vusse, G.J.
(2002) Cellular lipid binding proteins as facilitators and regulators
of lipid metabolism. Molecular and Cellular Biochemistry 239, 3-7.

Egea, P.F., Mitschler, A. and Moras, D. (2002) Molecular


recognition of agonist ligands by RXRs. Molecular Endocrinology
16, 987-997.

Glatz, J.F., Schaap, F.G., Binas, B., Bonen, A., van der Vusse, G.J.
and Luiken, J.J. (2003) Cytoplasmic fatty acid-binding protein
facilitates fatty acid utilization by skeletal muscle. Acta Physiologica
Scandinavica 178, 367-371.

Egea, P.F., Rochel, N., Birck, C., Vachette, P., Timmins, P.A. and
Moras, D. (2001) Effects of ligand binding on the association
properties and conformation in solution of retinoic acid receptors
RXR and RAR. Journal of Molecular Biology 307, 557-576.

Gottlicher, M., Widmark, E., Li, Q. and Gustafsson, J.A. (1992)


Fatty acids activate a chimera of the clofibric acid-activated receptor
and the glucocorticoid receptor. Proceedings of the National Academy
of Sciences of the United States of America 89, 4653-4657.

104 Polyunsaturated fatty acids


Grimaldi, P.A. (2005) Regulatory role of peroxisome proliferatoractivated receptor delta (PPAR delta) in muscle metabolism. A
new target for metabolic syndrome treatment? Biochimie 87, 5-8.

Jump, D.B., Botolin, D., Wang, Y., Xu, J., Christian, B. and
Demeure, O. (2005) Fatty acid regulation of hepatic gene
transcription. The Journal of Nutrition 135, 2503-2506.

Grynberg, A. (2005) Hypertension prevention: from nutrients


to (fortified) foods to dietary patterns. Focus on fatty acids. Journal
of Human Hypertension 19, S25-S33.

Kalant, D. and Cianflone, K. (2004) Regulation of fatty acid


transport. Current Opinion in Lipidology 15, 309-314.

Hanhoff, T., Lucke, C. and Spener, F. (2002) Insights into binding


of fatty acids by fatty acid binding proteins. Molecular and Cellular
Biochemistry 239, 45-54.

Koonen, D.P., Glatz, J.F., Bonen, A. and Luiken, J.J. (2005)


Long-chain fatty acid uptake and FAT/CD36 translocation in
heart and skeletal muscle. Biochimica et Biophysica Acta 1736,
163-180.

Hannah, V.C., Ou, J., Luong, A., Goldstein, J.L. and Brown,
M.S. (2001) Unsaturated fatty acids down-regulate srebp
isoforms 1a and 1c by two mechanisms in HEK-293 cells. The
Journal of Biological Chemistry 276, 4365-4372.
Hauser, S., Adelmant, G., Sarraf, P., Wright, H.M., Mueller, E.,
and Spiegelman, B.M. (2000) Degradation of the peroxisome
proliferator-activated receptor gamma is linked to liganddependent activation. The Journal of Biological Chemistry 275,
18527-18533.
Hayhurst, G.P., Lee, Y.H., Lambert, G., Ward, J.M. and Gonzalez,
F.J. (2001) Hepatocyte nuclear factor 4alpha (nuclear receptor
2A1) is essential for maintenance of hepatic gene expression and
lipid homeostasis. Molecular and cellular biology 21, 1393-1403.
Hooper, L., Thompson, R.L., Harrison, R.A., Summerbell, C.D.,
Ness, A.R., Moore, H.J., Worthington, H.V., Durrington, P.N.,
Higgins, J.P., Capps, N.E., Riemersma, R.A., Ebrahim, S.B. and
Davey Smith, G. (2006) Risks and benefits of omega 3 fats for
mortality, cardiovascular disease, and cancer: systematic review.
BMJ 332, 752-760.
Hostetler, H.A., Petrescu, A.D., Kier, A.B. and Schroeder, F. (2005)
Peroxisome proliferator-activated receptor alpha interacts with
high affinity and is conformationally responsive to endogenous
ligands. The Journal of Biological Chemistry 280, 18667-18682.
Huang, H., Starodub, O., McIntosh, A., Atshaves, B.P.,
Woldegiorgis, G., Kier, A.B. and Schroeder, F. (2004) Liver fatty
acid-binding protein colocalizes with peroxisome proliferator
activated receptor alpha and enhances ligand distribution to nuclei
of living cells. Biochemistry 43, 2484-2500.
Issemann, I. and Green, S. (1990) Activation of a member of the
steroid hormone receptor superfamily by peroxisome proliferators.
Nature 347, 645-650.
Jump, D.B. (2002a) Dietary polyunsaturated fatty acids and
regulation of gene transcription. Current Opinion in Lipidology
13, 155-164.
Jump, D.B. (2002b) The biochemistry of n-3 polyunsaturated
fatty acids. The Journal of Biological Chemistry 277, 8755-8758.

Larsen, L.K., Amri, E.Z., Mandrup, S., Pacot, C. and Kristiansen,


K. (2002) Genomic organization of the mouse peroxisome
proliferator-activated receptor beta/delta gene: alternative promoter
usage and splicing yield transcripts exhibiting differential
translational efficiency. The Biochemical Journal 366, 767-775.
Lewin, T.M., Kim, J.H., Granger, D.A., Vance, J.E. and Coleman,
R.A. (2001) Acyl-CoA synthetase isoforms 1, 4, and 5 are present
in different subcellular membranes in rat liver and can be inhibited
independently. The Journal of Biological Chemistry 276,
24674-24679.
Lin, Q., Ruuska, S.E., Shaw, N.S., Dong, D. and Noy, N. (1999)
Ligand selectivity of the peroxisome proliferator-activated receptor
alpha. Biochemistry 38, 185-190.
Lombardo, Y.B. and Chicco A.G. (2006) Effects of dietary
polyunsaturated n-3 fatty acids on dyslipidemia and insulin
resistance in rodents and humans. A review. The Journal of
Nutritional Biochemistry 17, 1-13.
Madsen, L., Rustan, A.C., Vaagenes, H., Berge, K., Dyroy, E. and
Berge, R.K. (1999) Eicosapentaenoic and docosahexaenoic acid
affect mitochondrial and peroxisomal fatty acid oxidation in
relation to substrate preference. Lipids 34, 951-963.
Manco, M., Calvani, M. and Mingrone, G. (2004) Effects of
dietary fatty acids on insulin sensitivity and secretion. Diabetes,
Obesity & Metabolism 6, 402-413.
Mashek, D.G. and Coleman, R.A. (2006) Cellular fatty acid
uptake: the contribution of metabolism. Current Opinion in
Lipidology 17, 274-278.
Mater, M.K., Thelen, A.P., Pan, D.A. and Jump, D.B. (1999) Sterol
response element-binding protein 1c (SREBP1c) is involved in the
polyunsaturated fatty acid suppression of hepatic S14 gene
transcription. The Journal of Biological Chemistry 274, 32725-32732.
Mills, S.C., Windsor, A.C. and Knight, S.C. (2005) The potential
interactions between polyunsaturated fatty acids and colonic
inflammatory processes. Clinical and Experimental Immunology
142, 216-228.

Polyunsaturated fatty acids 105


Mu, H. and Porsgaard, T. (2005) The metabolism of structured
triacylglycerols. Progress in Lipid Research 44, 430-448.
Nosjean, O. and Boutin, J.A. (2002) Natural ligands of
PPARgamma: are prostaglandin J(2) derivatives really playing the
part? Cellular Signalling 14, 573-583.
Ohshima, T., Koga, H. and Shimotohno, K. (2004) Transcriptional
activity of peroxisome proliferator-activated receptor gamma is
modulated by SUMO-1 modification. The Journal of Biological
Chemistry 279, 29551-29557.
Osborne, T.F. (2000) Sterol regulatory element-binding proteins
(SREBPs): key regulators of nutritional homeostasis and insulin
action. The Journal of Biological Chemistry 275, 32379-32382.

Sekiya, M., Yahagi, N., Matsuzaka, T., Najima, Y., Nakakuki, M.,
Nagai, R., Ishibashi, S., Osuga, J., Yamada, N. and Shimano, H.
(2003) Polyunsaturated fatty acids ameliorate hepatic steatosis in
obese mice by SREBP-1 suppression. Hepatology 38, 1529-1539.
Seo, T., Oelkers, P.M., Giattina, M.R., Worgall, T.S., Sturley, S.L.
and Deckelbaum, R.J. (2001) Differential modulation of ACAT1
and ACAT2 transcription and activity by long chain free fatty
acids in cultured cells. Biochemistry 40, 4756-4762.
Shibuya, A., Wada, K., Nakajima, A., Saeki, M., Katayama, K.,
Mayumi, T., Kadowaki, T., Niwa, H. and Kamisaki, Y. (2002)
Nitration of PPARgamma inhibits ligand-dependent translocation
into the nucleus in a macrophage-like cell line, RAW 264. FEBS
Letters 525, 43-47.

Ou, J., Tu, H., Shan, B., Luk, A., DeBose-Boyd, R.A., Bashmakov,
Y., Goldstein, J.L. and Brown, M.S. (2001) Unsaturated fatty
acids inhibit transcription of the sterol regulatory element-binding
protein-1c (SREBP-1c) gene by antagonizing ligand-dependent
activation of the LXR. Proceedings of the National Academy of
Sciences of the United States of America 98, 6027-6032.

Shulman, A.I. and Mangelsdorf, D.J. (2005) Retinoid x receptor


heterodimers in the metabolic syndrome. The New England
Journal of Medicine 353, 604-615.

Parker, R.S. (1996) Absorption, metabolism, and transport of


carotenoids. The FASEB Journal 10: 542-551.

Stahl, A. (2004) A current review of fatty acid transport proteins


(SLC27). Pflgers Archiv: European Journal of Physiology 447,
722-727.

Pownall, H.J. and Hamilton, J.A. (2003) Energy translocation


across cell membranes and membrane models. Acta Physiologica
Scandinavica 178, 357-365.
Pratley, R.E., Baier, L., Pan, D.A., Salbe, A.D., Storlien, L.,
Ravussin, E. and Bogardus, C. (2000) Effects of an Ala54Thr
polymorphism in the intestinal fatty acid-binding protein on
responses to dietary fat in humans. Journal of Lipid Research 41,
2002-2008.
Rodriguez-Cruz, M., Tovar, A.R., del Prado, M. and Torres, N.
(2005) Molecular mechanisms of action and health benefits of
polyunsaturated fatty acids. Revista de Investigacin Clnica;
Organo del Hospital de Enfermedades de la Nutricin 57, 457-472.
Sampath, H. and Ntambi, J.M. (2004) Polyunsaturated fatty acid
regulation of gene expression. Nutrition Reviews 62, 333-339.
Sampath, H. and Ntambi, J.M. (2005) Polyunsaturated fatty
acid regulation of genes of lipid metabolism. Annual Review of
Nutrition 25, 317-340.
Sato, O., Kuriki, C., Fukui, Y. and Motojima, K. (2002) Dual
promoter structure of mouse and human fatty acid translocase/
CD36 genes and unique transcriptional activation by peroxisome
proliferator-activated receptor alpha and gamma ligands. The
Journal of Biological Chemistry 277, 15703-15711.
Schneeman, B.O. (2002) Gastrointestinal physiology and
functions. The British Journal of Nutrition 88, S159-S163.

Sprecher, H. (2000) Metabolism of highly unsaturated n-3 and


n-6 fatty acids. Biochimica et Biophysica Acta 1486, 219-231.

Sundvold, H. and Lien, S. (2001) Identification of a novel


peroxisome proliferator-activated receptor (PPAR) gamma
promoter in man and transactivation by the nuclear receptor
RORalpha1. Biochemical and Biophysical Research Communications
287, 383-390.
Tan, N.S., Michalik, L., Desvergne, B. and Wahli, W. (2003)
Peroxisome proliferator-activated receptor (PPAR)-beta as a target
for wound healing drugs: what is possible? American Journal of
Clinical Dermatology 4, 523-530.
Tontonoz, P., Graves, R.A., Budavari, A.I., Erdjument-Bromage,
H., Lui, M., Hu, E., Tempst, P. and Spiegelman, B.M. (1994)
Adipocyte-specific transcription factor ARF6 is a heterodimeric
complex of two nuclear hormone receptors, PPAR gamma and
RXR alpha. Nucleic Acids Research 22, 5628-5634.
Uauy, R. and Calderon, F. (2003) Long-chain polyunsaturated
fatty acids in visual and neural development: cellular and molecular
mechanisms. Forum of nutrition 56, 71-73.
Vanden Heuvel, J.P. (2004) Diet, fatty acids, and regulation of
genes important for heart disease. Current Atherosclerosis Reports
6, 432-440.
Worgall, T.S., Johnson, R.A., Seo, T., Gierens, H. and Deckelbaum,
R.J. (2002) Unsaturated fatty acid-mediated decreases in sterol
regulatory element-mediated gene transcription are linked to

106 Polyunsaturated fatty acids


cellular sphingolipid metabolism. The Journal of Biological
Chemistry 277, 3878-3885.
Xu, H.E., Lambert, M.H., Montana, V.G., Parks, D.J., Blanchard,
S.G., Brown, P.J., Sternbach, D.D., Lehmann, J.M., Wisely, G.B.,
Willson, T.M., Kliewer, S.A. and Milburn, M.V. (1999a)
Molecular recognition of fatty acids by peroxisome proliferatoractivated receptors. Molecular Cell 3, 397-403.
Xu, H.E., Lambert, M.H., Montana, V.G., Plunket, K.D., Moore,
L.B., Collins, J.L., Oplinger, J.A., Kliewer, S.A., Gampe, R.T. Jr,
McKee, D.D., Moore, J.T. and Willson, T.M. (2001a) Structural
determinants of ligand binding selectivity between the peroxisome
proliferator-activated receptors. Proceedings of the National Academy
of Sciences of the United States of America 98, 13919-13924.
Xu, J., Nakamura, M.T., Cho, H.P. and Clarke, S.D. (1999b)
Sterol regulatory element binding protein-1 expression is
suppressed by dietary polyunsaturated fatty acids. A mechanism
for the coordinate suppression of lipogenic genes by
polyunsaturated fats. The Journal of Biological Chemistry 274,
23577-23583.
Xu, J., Teran-Garcia, M., Park, J.H., Nakamura, M.T. and Clarke,
S.D. (2001b) Polyunsaturated fatty acids suppress hepatic sterol
regulatory element-binding protein-1 expression by accelerating
transcript decay. The Journal of Biological Chemistry 276, 9800-9807.
Yabe, D., Komuro, R., Liang, G., Goldstein, J.L. and Brown,
M.S. (2003) Liver-specific mRNA for Insig-2 down-regulated
by insulin: implications for fatty acid synthesis. Proceedings of the
National Academy of Sciences of the United States of America 100,
3155-3160.
Yahagi, N., Shimano, H., Hasty, A.H., Amemiya-Kudo, M.,
Okazaki, H., Tamura, Y., Iizuka, Y., Shionoiri, F., Ohashi, K.,
Osuga, J., Harada, K., Gotoda, T., Nagai, R., Ishibashi, S. and
Yamada, N. (1999) A crucial role of sterol regulatory elementbinding protein-1 in the regulation of lipogenic gene expression
by polyunsaturated fatty acids. The Journal of Biological Chemistry
274, 35840-35844.
Yoshikawa, T., Ide, T., Shimano, H., Yahagi, N., Amemiya-Kudo,
M., Matsuzaka, T., Yatoh, S., Kitamine, T., Okazaki, H., Tamura,
Y., Sekiya, M., Takahashi, A., Hasty, A.H., Sato, R., Sone, H.,
Osuga, J., Ishibashi, S. and Yamada, N. (2003) Cross-talk between
peroxisome proliferator-activated receptor (PPAR) alpha and liver
X receptor (LXR) in nutritional regulation of fatty acid metabolism.
I. PPARs suppress sterol regulatory element binding protein-1c
promoter through inhibition of LXR signaling. Molecular
Endocrinology 17, 1240-1254.
Yoshikawa, T., Shimano, H., Yahagi, N., Ide, T., Amemiya-Kudo,
M., Matsuzaka, T., Nakakuki, M., Tomita, S., Okazaki, H., Tamura,
Y., Iizuka, Y., Ohashi, K., Takahashi, A., Sone, H., Osuga, Ji J.,
Gotoda, T., Ishibashi, S. and Yamada, N. (2002) Polyunsaturated

fatty acids suppress sterol regulatory element-binding protein 1c


promoter activity by inhibition of liver X receptor (LXR) binding
to LXR response elements. The Journal of Biological Chemistry
277, 1705-1711.
Zelcer, N. and Tontonoz, P. (2006) Liver X receptors as integrators
of metabolic and inflammatory signaling. The Journal of Clinical
Investigation 116, 607-614.

Porcine peroxisome proliferator-activated receptor mediates the lipolytic effects of


dietary fish oil to reduce body fat deposition
Y. H. Yu, P. H. Wang, W. T. K. Cheng, H. J. Mersmann, S. C. Wu and S. T. Ding
J ANIM SCI 2010, 88:2009-2018.
doi: 10.2527/jas.2009-2597 originally published online February 26, 2010

The online version of this article, along with updated information and services, is located on
the World Wide Web at:
http://www.journalofanimalscience.org/content/88/6/2009

www.asas.org

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

Porcine peroxisome proliferator-activated receptor mediates


the lipolytic effects of dietary fish oil to reduce body fat deposition1
Y. H. Yu,* P. H. Wang,* W. T. K. Cheng, H. J. Mersmann,*2 S. C. Wu,*3
and S. T. Ding*3
*Department of Animal Science and Technology/Institute of Biotechnology, National Taiwan University,
Taipei 106, Taiwan; and Department of Animal Science and Biotechnology,
Tunghai University, Taichung 407, Taiwan

ABSTRACT: Peroxisome proliferator-activated receptor promotes fatty acid catabolism and energy
expenditure in skeletal muscle and adipose tissues. A
ligand for PPAR is required to activate PPAR function. Polyunsaturated fatty acids are potential ligands
for PPAR activation. The current experiment was designed to determine the potential for PUFA, particularly from dietary fish oil, to activate porcine PPAR
in vivo. Transgenic mice were generated to overexpress
porcine PPAR in the adipose tissue. Mice were fed a
high-saturated fat (13% beef tallow), or high-unsaturated fat (13% fish oil) diet, or a diet containing 4 mg/
kg of a PPAR ligand (L165041) for 4 mo. Compared
with beef tallow feeding, fish oil feeding reduced fat

mass and decreased (P < 0.05) plasma triacylglycerol


and FFA concentrations in the transgenic mice. Adipose tissue expression of genes involved in adipogenesis
(i.e., lipoprotein lipase and adipocyte fatty acid-binding
protein) was decreased in transgenic mice fed fish oil or
the PPAR ligand. In the same mice, expression of the
lipolytic gene, hormone-sensitive lipase was increased
(P < 0.05). Fish oil feeding also stimulated expression
of genes participating in fatty acid oxidation in the
liver of transgenic mice compared with wild-type mice.
Overall, these results indicate that PUFA may serve as
natural and effective regulators of lipid catabolism in
vivo and many of these effects may be generated from
activation of PPAR.

Key words: adipose tissue, fish oil, lipid metabolism, peroxisome proliferator-activated receptor ,
pig, polyunsaturated fatty acid
2010 American Society of Animal Science. All rights reserved.

INTRODUCTION
Peroxisome proliferator-activated receptor is broadly expressed in several tissues (Amri et al., 1995). Peroxisome proliferator-activated receptor plays a multifunctional role in lipid metabolism; namely, it increases
lipolysis in adipose tissues (Wang et al., 2003) and fatty
acid oxidation in the skeletal muscle (Kramer et al.,
2007).
For activation of PPAR, a ligand is needed for binding to the ligand-binding domain. Several synthetic
compounds, such as benzafibrate and L165041, have
high binding affinity for PPAR (Krey et al., 1997; Willson et al., 2000). Fatty acids and fatty acid derivatives

The project was funded in part by National Science Council in


Taiwan, Republic of China, and National Taiwan University.
2
Visiting professor at National Taiwan University.
3
Corresponding authors: sding@ntu.edu.tw and scw01@ntu.edu.
tw
Received October 21, 2009.
Accepted February 17, 2010.

J. Anim. Sci. 2010. 88:20092018


doi:10.2527/jas.2009-2597

have been proposed to be possible endogenous ligands


for PPAR (Krey et al., 1997). Arachidonate metabolites, prostacyclins, are capable of activating PPAR
(Lim et al., 1999). Polyunsaturated fatty acids, such
as eicosapentaenoic acid (EPA) and docosahexaenoic
acid (DHA), activate PPAR (Yu et al., 1995). These
results indicate that PUFA and PUFA metabolites are
able to regulate PPAR activity. It has been demonstrated that PUFA regulates hepatic lipid metabolism
through activation of PPAR (Clarke and Jump, 1996)
and increases insulin sensitivity by a PPAR-dependent
pathway (Neschen et al., 2006). It is unclear whether
PUFA has a role in interacting with PPAR in adipose
tissues to regulate lipid metabolism.
There is no in vivo evidence demonstrating the interaction of dietary PUFA with porcine PPAR. Using
stably transformed cells, we demonstrated that porcine
PPAR and PPAR regulate lipid metabolism (Yu et
al., 2006, 2008b) and that DHA or its metabolites are
able to activate porcine PPAR (Yu et al., 2008a). In
the current study, we generated transgenic mice with
adipose tissue-specific expression of porcine PPAR to

2009
Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

2010

Yu et al.

Figure 1. Generation of transgenic mice. A: Schematic of the transgene. Porcine peroxisome proliferator-activated receptor was regulated
by adipocyte fatty acid-binding protein (aP2) promoter/enhancer. B: Southern blot analysis of aP2 promoter/enhancer-PPAR transgenic mice
(PPAR TG). For detection of transgene insertion, tail genomic DNA from wild-type mice (WT) and PPAR transgenic mice were digested with
KpnI and separated on agarose gel. After enzyme digestion, the transgene generated 1.4 kb of PPAR fragment. The blots were hybridized with
a porcine PPAR cDNA probe. C: Western blot analysis of PPAR transgenic mice. For confirmation of protein production in PPAR transgenic
mice, total proteins from the adipose tissue were separated, blotted, and hybridized with a PPAR antibody. -Actin was an indicator of equivalent protein loading. The detection of the transgene and the protein was performed in 3 individual mice, all yielding the same result.

study the function of PPAR and the role of PUFA as


ligands for PPAR.

MATERIALS AND METHODS


The animal protocol was approved by the Animal
Care and Use Committee of the National Taiwan University.

Generation of Transgenic Mice


To obtain the adipose tissue-specific expression of
porcine PPAR, porcine PPAR cDNA was placed
downstream of the mouse 5.4-kb adipocyte fatty acid-binding protein (aP2) promoter/enhancer and upstream of SV40 polyadenylation sequences (Figure 1A).
It has been demonstrated that this promoter sequence
is functional and regulated by adipocyte-specific
transcription factors (Ross et al., 1990). The porcine
PPAR sequence with SV40 polyadenylation sequences was successfully cloned in previous studies (Yu et
al., 2008b). Transgenic mice were generated by microinjection of the transgene into pronuclei of fertilized

FVB/NJ mouse embryos. Founder genomic DNA was


extracted and the presence of PPAR was confirmed
by PCR and Southern blot techniques. Southern blots
were prepared following a standard protocol (Southern,
1975). Adipose tissue PPAR protein from transgenic
mice was also identified by standard Western blot with
modifications by Ding et al. (2002). The anti-PPAR
polyclonal antibody (sc-1986, Santa Cruz Biotechnology Inc., Santa Cruz, CA) was used to determine the
expression of transgene. Positive transgenic progeny
were backcrossed with FVB/NJ mouse to generate homogenous transgenic mice. Transgenic mice from the
F3 generation were used in this study.

Animal Experiments
In the diet study, wild-type (FVB/NJ) and PPAR
transgenic mice were age- (7 to 8 wk old) and sexmatched. Both sexes of mice were used because there
was no reported sex difference in PPAR function in
mammals. Wild-type mice and transgenic mice were
each divided into 4 diet groups. Because animal death
is expected in a long-term feeding experiments, more

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

Porcine peroxisome proliferator-activated receptor

than enough animals were assigned to each treatment


(between 10 and 14 in each group). Mice were provided
feed for ad libitum consumption. The first group was
fed a standard diet that contained, on a caloric basis,
58% carbohydrate, 13.5% fat, and 28.5% protein (LabDiet 5001, LabDiet, Richmond, IN). The second group
was fed the standard diet containing L165041 at a concentration of 4 mg/kg (Cayman Chemicals, Ann Arbor,
MI); on a caloric basis, it contained 58% carbohydrate,
13.5% fat, and 28.5% protein (Bioserv, Frenchtown,
NJ). The dose of L165041 was chosen because similar
treatments were demonstrated to be effective by others
(Oliver et al., 2001; Shan et al., 2008). The third group
was fed a high-fish oil (mainly from tuna) diet; on a
caloric basis, it contained 36% carbohydrate, 35.5%
fat, and 28.5% protein (Bioserv, Frenchtown, NJ). The
fourth group was fed a high-beef tallow diet; on a caloric basis, it contained 36% carbohydrate, 35.5% fat, and
28.5% protein (Bioserv, Frenchtown, NJ). Mice were
fed the experimental diets for 4 mo. Feed intake was
determined monthly. At the end of dietary treatments,
mice were weighed and killed by cervical dislocation after anesthesia using tribromoethanol, (0.4 mg/g of BW,
intraperitoneal; Sigma, St. Louis, MO). Fat pads (male:
epididymal fat pads; female: ovarian fat pads) were isolated immediately and weighed. The liver (right lobe)
and white adipose tissue were fixed for histochemical
staining or frozen in liquid nitrogen for RNA extraction.

2011

Carlsbad, CA). Reverse transcription was performed


with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems Inc., Foster City, CA).
Real-time PCR was performed to quantify the mRNA
concentration of each gene using the LightCycler 480
Instrument II (Roche Diagnostics, Indianapolis, IN)
and the RealQ-PCR Master Mix Kit (Ampliqon, Herlev, Denmark). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA concentration was also
determined and served as the internal control. The
sequence of primers for quantitative reverse transcription-PCR is listed in Table 1. The mRNA expression
of each gene was normalized to its GAPDH mRNA.
Threshold cycle (Ct) values were obtained and relative gene expression was calculated using the formula
(1/2)Ct target genes Ct GAPDH (Schmittgen et al., 2000) as
described by Chen et al. (2008).

Statistical Analysis
The treatment effects were analyzed using an ANOVA procedure to determine the main effects of PPAR
and diets. Statistical analysis of results was performed
by a 2 4 factorial arrangement of treatments (mice
background and diet treatments); Duncans new multiple range test was used to evaluate differences among
means (SAS Inst. Inc., Cary, NC). A significant difference indicates that P-value is not greater than 0.05.

RESULTS

Biochemical Assays
A blood sample of 0.3 mL was obtained from the tail
of each mouse at the end of dietary treatments. Blood
plasma was isolated by centrifuging blood samples
treated with EDTA as an anticoagulant at 2,000 g
for 20 min at 4C and used to colorimetrically measure
glucose (K606-100, kits from BioVision Inc., Mountain
View, CA), triacyglycerol (K622-100, kits from BioVision Inc.), and FFA (K612-100, kits from BioVision
Inc.). Plasma adiponectin (ADN) was measured using
a mouse ELISA kit (B-Bridge International Inc., Mountain View, CA).

Histochemistry
Tissues were fixed in 10% formalin and embedded in
paraffin. Sections (4 m thick) were cut and stained
with hematoxylin/eosin staining. For Oil Red O staining, tissues were embedded in optimal cutting temperature medium and cryosectioned following a standard
protocol with modifications by Wang et al. (2006).
Frozen sections were subjected to standard Oil Red O
staining (Koopman et al., 2001).

Quantitative Real-Time PCR


Tissue RNA of 3 mice randomly selected from each
treatment was extracted using TRIzol (Invitrogen,

Expression of Porcine PPAR


in Transgenic Mice
Successful integration of the transgene was confirmed
by Southern blot (Figure 1B). Endogenous PPAR protein expression was decreased in wild-type mice (Figure 1C), whereas the transgenic mice carrying porcine
PPAR had increased PPAR protein expression in the
adipose tissue (Figure 1C).

The Effect of Dietary Fatty Acids


on the Phenotype of Transgenic Mice
Dietary treatments affected feed intake (P < 0.01),
BW (P < 0.01), and fat pad weights (P < 0.01, Figure 2). The mouse genetic backgrounds (wild-type vs.
transgenic) had no effect on feed intake (P > 0.05) but
had an effect on BW (P < 0.01) and fat pad weights
(P < 0.01). In wild type and transgenic mice, mice fed
the PPAR ligand, L165041, or either of the high-fat
diets had reduced (P < 0.05) feed intake (Figure 2A).
The terminal BW was decreased (P < 0.05) in fish
oil-fed mice of either genotype and in transgenic mice
fed the PPAR ligand (Figure 2B). Fat pad weight was
dramatically decreased (P < 0.05) in fish oil-fed mice of
either genotype; the decrease was greater in transgenic
mice (Figure 2C). Beef tallow feeding increased (P <
0.05) fat pad weight in wild type, but not in transgenic

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

2012

Yu et al.

Figure 2. Physiological variables in mice fed different diets. A: Feed intake measured monthly in individually housed wild-type mice and adipocyte fatty acid-binding protein promoter/enhancer-PPAR transgenic mice (PPAR transgenic mice). Values from each group are the means
SE (n = 6). B: Body weights of wild-type and PPAR transgenic mice. Values from each group are the means SE (n = 7 to 14). C: Weight of
gonadal fat pads of wild-type and PPAR transgenic mice. Values from each group are the means SE (n = 7 to 14). aeMeans without a common letter differ, P 0.05.

mice, whereas feeding the PPAR ligand decreased (P


< 0.05) fat pad weight in transgenic, but not in wildtype mice.
Both diet treatment and genetic background had effects on plasma triacylglycerol and plasma FFA. Fish
oil feeding reduced (P < 0.05) plasma triacylglycerol,
particularly in the PPAR transgenic mice (Figure 3A).
Feeding of the PPAR-ligand, L165041 also decreased
(P < 0.05) plasma triacylglycerol in transgenic mice,

but the effect was less than with fish oil feeding (Figure
3A). Transgenic mice had less (P < 0.05) plasma FFA
concentration than wild-type mice when fed each of
the diets (Figure 3B). In both genotypes, feeding the
PPAR ligand reduced (P < 0.05) the FFA concentration and feeding fish oil decreased the concentration to
an even greater extent. Dietary beef tallow increased
(P < 0.05) the FFA concentration in wild-type mice.
Genetic backgrounds had an effect on plasma glucose

Table 1. Sequences for quantitative real-time PCR


Gene1

Primer2

LPL
(BC003305)
aP2
(NM 024406)
ADN
(NM 009605)
SREBP-1c
(NM 011480)
UCP-3
(BC139430)
HSL
(BC021642)
ACO
(BC054727)
CPT-1
(BC046383)
MCAD
(BC013498)
LCAD
(BC027412)
ACC
(AY451393)
GAPDH
(NM 007393)

S 5-AGGACCCCTGAAGACAC-3
A 5-GGCACCCAACTCTCATA-3
S 5-CCGCAGACGACAGGA-3
A 5-CTCATGCCCTTTCATAAACT-3
S 5-GATGGCAGAGATGGCACTCC-3
A 5-CTTGCCAGTGCTGCCGTCAT-3
S 5-GGACCACGGAGCCATGG-3
A 5-GGAAGTCACTGTCTTGGTTGTTGA-3
S 5-ACTCCAGCGTCGCCATCAGGATTCT-3
A 5-TAAACAGGTGAG ACTCCAGCAACTT-3
S 5-CCTCATGGCTCAACTCC-3
A 5-GGTTCTTGACTATGGGTGA-3
S 5-GCCCAACTGTGACTTCCATT-3
A 5-GGCATGTAACCCGTAGCACT-3
S 5-GCACTGCAGCTCGCACATTACAA-3
A 5-CTCAGACAGTACCTCCTTCAGGAAA-3
S 5-GATCGCAATGGGTGCTTTTGATAGAA-3
A 5-AGCTGATTGGCAATGTCTCCAGCAAA-3
S 5-GTAGCTTATGAATGTGTGCAACTC-3
A 5-GTCTTGCGATCAGCTCTTTCATTA-3
S 5-TGACAGACTGATCGAGAGAAAG-3
A 5-TGGAGAGCCCCACACACA-3
S 5-CAAGGTCATCCATGACAACTTTG-3
A 5-GGCCATCCACAGTCTTCTGG-3

Annealed
temperature, C
58
58
58
58
58
60
58
60
58
58
60
60

1
GenBank accession number is indicated parenthetically. LPL = lipoprotein lipase; aP2 = adipocyte fatty
acid-binding protein; ADN = adiponectin; SREBP-1c = sterol regulatory element-binding protein 1c; UCP-3
= uncoupling protein 3; HSL = hormone-sensitive lipase; ACO = acyl-CoA oxidase; CPT-1 = carnitine palmitoyltransferase 1; MCAD = medium-chain acyl-CoA dehydrogenase; LCAD = long-chain acyl-CoA dehydrogenase; ACC = acetyl coenzyme A carboxylase; GAPDH = glyceraldehyde-3-phosphate dehydrogenase.
2
S = sense; A = antisense.

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

Porcine peroxisome proliferator-activated receptor

2013

Figure 3. Plasma metabolites in mice fed different diets. A: Plasma triacylglycerol concentrations of wild-type mice and adipocyte fatty acidbinding protein promoter/enhancer-PPAR transgenic mice (PPAR transgenic mice). B: Plasma FFA concentrations of wild-type and PPAR
transgenic mice. C: Blood glucose concentrations of wild-type and PPAR transgenic mice. D: Plasma adiponectin concentrations of wild-type and
PPAR transgenic mice. Values from each group are the means SE (n = 3). agMeans without a common letter differ, P 0.05.

concentration (P < 0.01). Dietary treatments had no


effect on plasma glucose concentration (P > 0.05).
Dietary fish oil treatments significantly increased the
plasma ADN concentration (P < 0.01). The transgene
did not affect the ADN secretion (P > 0.05). Plasma
glucose concentration of PPAR transgenic mice generally was less (P < 0.05) than wild-type mice across all
dietary treatments (Figure 3C). Glucose concentration
was increased (P < 0.05) in beef tallow-fed wild-type
mice. Plasma ADN concentrations were increased (P
< 0.05) by the fish oil treatment in both genotypes
(Figure 3D).
Compared with wild-type mice, PPAR transgenic
mice fed L165041 had a smaller adipocyte size (Figure
4). Fish oil feeding markedly decreased adipocyte size
in wild-type mice, and size was further decreased in
transgenic mice. Increased adipocyte size was observed
wild-type mice fed a beef tallow diet (Figure 4); transgenic mice had smaller adipocytes than wild-type mice

when fed beef tallow. There was no lipid droplet accumulation in hepatocytes from wild-type mice or PPAR
transgenic mice fed the standard or L165041 diets (Figure 5). Feeding wild type or transgenic mice a fish oil
diet slightly increased hepatic lipid droplet accumulation (Figure 5). A severe fatty liver was observed in
wild-type mice fed beef tallow. Transgenic mice fed beef
tallow had considerable hepatic fat deposition, but it
was much less than that in wild-type mice.

Adipocyte-Specific PPAR Overexpression


Regulated the Expression of Genes Involved
in Lipid Metabolism
Feeding the PPAR ligand L165041 decreased (P <
0.05) lipoprotein lipase (LPL), aP2, and sterol regulatory element-binding protein 1c (SREBP-1c) mRNA
concentrations (Figure 6A, 6B, and 6D) in transgenic
mice. The fish oil-fed transgenic mice also had less (P

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

2014

Yu et al.

Figure 4. Histology of adipose tissue sections from wild-type (WT) mice and transgenic mice. Adipose tissue from reproductive fat pad were
sectioned and stained with hematoxylin/eosin. Histology of adipose tissue from WT mice and adipocyte fatty acid-binding protein promoter/
enhancer-PPAR transgenic mice (PPAR transgenic mice) when fed a standard diet or diets containing L165041, fish oil, or beef tallow. Bars
indicate a length of 100 m. Data represent 3 mice per group with 1 representative result shown in the figure. Color version available in the online
PDF.

< 0.05) expression of adipogenic genes including LPL,


aP2, ADN, and SREBP-1c (Figure 6A to 6D). In contrast, fish oil feeding increased (P < 0.05) LPL and
aP2 mRNA concentrations in wild-type mice (Figure
6A and B). Beef tallow feeding increased (P < 0.05)
LPL, aP2, and SREBP-1c mRNA concentrations in
both genotypes (Figure 6A, 6B, and 6D). The mRNA
concentration for uncoupling protein 3 (UCP-3) was
increased (P < 0.05) in both genotypes by feeding the
PPAR ligand and in transgenic mice fed fish oil (Figure 6E). The fish oil-fed PPAR transgenic mice also
had a greater (P < 0.05) mRNA concentration of hormone-sensitive lipase (HSL) when compared with the
wild-type mice (Figure 6F). The interaction of the 2
major factors on the expression of LPL, aP2, SREBP1c, ADN, UCP-3, and HSL mRNA was significant (P
< 0.05), indicating that the regulation of these genes by
PPAR transgene depended on the dietary treatments.
In mice fed each diet, the liver -oxidation genes, including acyl-CoA oxidase (ACO), carnitine palmitoyltransferase 1 (CPT-1), and long-chain acyl-CoA dehy-

drogenase (LCAD) generally were greater (P < 0.05)


in transgenic compared with wild-type mice (Figure
7A, 7B, and 7D). Feeding the PPAR ligand, L165041
increased (P < 0.05) the CPT-1 expression in transgenic mice (Figure 7B). Dietary fish oil increased (P <
0.05) the mRNA concentration of ACO and mediumchain acyl-CoA dehydrogenase (MCAD) in wild-type
mice (Figure 7A and 7C) and of ACO, CPT-1, MCAD,
and LCAD in transgenic mice (Figure 7A through 7D).
Feeding beef tallow increased (P < 0.05) the mRNA
concentrations for ACO and CPT-1 in transgenic mice
(Figure 7A and 7B). The mRNA for the hepatic lipogenic transcription factor, SREBP-1c, was decreased
(P < 0.05) by fish oil feeding in both genotypes and
was increased in wild-type mice when fed beef tallow
(Figure 7E). The mRNA for the lipogenic gene, acetylCoA carboxylase, was increased (P < 0.05) by fish oil
feeding and more so by beef tallow feeding in both
genotypes (Figure 7F). Dietary treatments and genetic backgrounds interacted to affect ACO and CPT-1
mRNA expression (P < 0.05), indicating that the effect

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

Porcine peroxisome proliferator-activated receptor

2015

Figure 5. Histology and Oil Red O staining of the liver sections from wild-type mice and transgenic mice. Liver was cryosectioned and stained
with Oil Red O. A: Hematoxylin/eosin staining and Oil Red O staining of the liver from wild-type mice when fed standard diet, L165041, fish oil,
and beef tallow. B: Hematoxylin/eosin staining and Oil Red O staining of the liver from adipocyte fatty acid-binding protein promoter/enhancerPPAR transgenic mice (PPAR transgenic mice) when fed standard diet, L165041, fish oil, and beef tallow. Bars indicate a length of 100 m.
Data represent 3 mice per group with 1 representative result shown in the figure. Color version available in the online PDF.

of PPAR transgene on the expression of these genes


also depends on which diet was fed.

DISCUSSION
Dietary fish oil, especially EPA and DHA, inhibits
hepatic lipogenesis by suppression of SREBP-1c expression and promotes hepatic fatty acid oxidation by activation of PPAR (Clarke and Jump, 1996; Kim et al.,
1999). Experiments using PPAR knockout mice (Dallongeville et al., 2001) indicate that PPAR is required
for dietary fish oil to induce hepatic genes involved in
-oxidation. These results demonstrate that fish oil
regulates hepatic lipid metabolism mainly through activation of PPAR. However, fish oil not only affects
lipid metabolism in the liver, it also regulates lipid metabolism in several peripheral tissues, especially in the
adipose tissues (Nakatani et al., 2003).
In the current studies, fish oil feeding significantly
reduced BW and fat mass compared with dietary beef
tallow treatment in wild-type mice. These results are
consistent with previous studies (Belzung et al., 1993;
Couet et al., 1997; Nakatani et al., 2003). When fed
any of the diets, a remarkable reduction of fat mass and
adipocyte size was found in our transgenic mice with
adipose tissue specific expression of PPAR. In these
transgenic mice, fish oil feeding decreased the adipose

tissue expression of the lipogenic genes, LPL, aP2, and


SREBP-1c and increased the expression of UCP-3 and
the lipolytic gene, HSL. Feeding the PPAR ligand,
L165041 had a similar, but lesser effect than dietary
fish oil on these same genes. These results indicate that
fish oil treatment increased the function of the overexpressed adipose tissue PPAR. It has been demonstrated that addition of a PPAR synthetic ligand, such
as GW501516 and L165041, stimulates -oxidation in
fully differentiated adipocytes and that ectopic expression of an activated form of PPAR in fully differentiated adipocytes promotes glycerol release (Wang et al.,
2003).
Fatty acids are proposed to be possible endogenous
ligands for PPAR based on experiments using transactivation assays or ligand-binding assays (Yu et al.,
1995; Forman et al., 1997; Krey et al., 1997). These
studies indicate that PUFA are better activators than
SFA. Similar to the effects of a PPAR synthetic ligand
to reduce fat deposition (Wang et al., 2004), PUFA
reduce fat mass by increasing the expression of genes
involved in -oxidation and energy dissipation in the
adipose tissue; these genes are regulated by PPAR
(Hun et al., 1999; Holst et al., 2003; Nakatani et al.,
2003). Our findings indicate that PUFA from dietary
fish oil elevated genes involved in energy dissipation
and decreased lipogenic genes in adipose tissue. The

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

2016

Yu et al.

Figure 6. Expression of lipid metabolism genes in the adipose tissue. Total RNA of adipose tissues from wild-type mice and adipocyte fatty
acid-binding protein promoter/enhancer-PPAR transgenic mice (PPAR transgenic mice) were isolated at the end of dietary treatments. The
mRNA concentrations were measured by quantitative reverse transcription-PCR. The expression of adipogenic and lipogenic marker genes [lipoprotein lipase (LPL), adipocyte fatty acid-binding protein (aP2), adiponectin (ADN), sterol regulatory element-binding protein 1c (SREBP-1c),
uncoupling protein 3 (UCP-3), and hormone-sensitive lipase (HSL)] were determined and normalized to the mRNA for glyceraldehyde-3-phosphate
dehydrogenase. The bars indicate the means SE for cells from independent replicates (n = 3). aeMeans without a common letter differ, P
0.05.

data indicate that PPAR mediated these effects of


fish oil because the effects were so much greater in the
transgenic mice overexpressing PPAR in adipose tissue. The critical difference between previous studies
and ours was that we found the effects of fish oil on the
adipose tissue to be equal to or greater than feeding
transgenic mice a PPAR synthetic ligand. Our results
imply that PUFA or PUFA metabolites are ligands for
PPAR activation and activated PPAR regulates adipose tissue downstream genes to reduce lipogenic gene
expression and increase energy dissipation and lipolysis. The overall result was a reduction in body fat.
Dietary fish oil or DHA is able to reduce plasma
triacylglycerol (Liu et al., 2005) and FFA in a dose-dependent fashion (Neschen et al., 2006). Adipose tissuetargeted expression of a constitutively active form of
mouse PPAR significantly decreases plasma triacylglycerol and FFA (Wang et al., 2003). Other studies
indicate that dietary fish oil reduces plasma triacylglycerol through activation of hepatic PPAR target genes
controlling fatty acid oxidation (Wong et al., 1984;
Clarke and Jump, 1996). In the current study, fish
oil feeding reduced plasma triacylglycerol and FFA in
wild-type mice and further decreased plasma triacylglycerol and FFA in the PPAR transgenic mice. Similar

to the observations on gene expressions in the adipose


tissue of fish oil-fed PPAR transgenic mice, the large
improvement in the blood lipid profile was dependent
on dietary fish oil plus the overexpressed adipose tissue
PPAR.
Dietary fish oil increases the expression of hepatic
-oxidation genes including ACO and CPT-1 (Clarke
and Jump, 1996; Nakatani et al., 2003). In the current
study, we also demonstrated that hepatic -oxidation
genes were stimulated by dietary fish oil in the wildtype mice. In the fish oil-fed PPAR transgenic mice,
the -oxidation genes including ACO, CPT-1, and
LCAD were further upregulated. Therefore, PPAR not
only regulates gene expression in adipose tissue, but it
also is directly or indirectly involved in -oxidation in
the liver. Wang et al. (2003) indicated that activated
PPAR in the adipose tissue reduces lipid deposition
in the liver when mice are fed with a high-fat diet.
Expression of PPAR is increased after starvation and
exercise and functions to increase fatty acid mobilization and oxidation (Holst et al., 2003). We hypothesize
that overexpression of PPAR in the adipose tissue increases whole body lipid catabolism. In support of this
speculation, we provide evidence that the fish-oil fed
PPAR transgenic mice display an increase in expres-

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

Porcine peroxisome proliferator-activated receptor

2017

Figure 7. Expression of lipid metabolism genes in the liver. Total RNA from livers of wild-type mice and adipocyte fatty acid-binding protein
promoter/enhancer-PPAR transgenic mice (PPAR transgenic mice) were isolated at the end of dietary treatments. The mRNA concentrations
were measured by quantitative reverse transcription-PCR. The expression of -oxidation genes and lipogenic genes [acyl-CoA oxidase (ACO),
carnitine palmitoyltransferase 1 (CPT-1), medium-chain acyl-CoA dehydrogenase (MCAD), long-chain acyl-CoA dehydrogenase (LCAD), sterol regulatory element-binding protein 1c (SREBP-1c), and acetyl-CoA carboxylase (ACC)] were determined and normalized to the mRNA for
glyceraldehyde-3-phosphate dehydrogenase. The bars indicate the means SE for cells from independent replicates (n = 3). aeMeans without a
common letter differ, P 0.05.

sion of genes participating in energy dissipation and


lipolysis in the adipose tissue coupled with a remarkable reduction of fat mass. The FFA released from lipolysis may be immediately transported to the liver
due to decreased circulating FFA, as observed. Finally,
transported FFA are readily oxidized by induced hepatic -oxidation genes (ACO, CPT-1, and LCAD). In
addition to our observations, previous studies partially
support our supposition; fish oil increases lipolysis, reduces plasma FFA, and increases hepatic -oxidation
(Clarke and Jump, 1996; Bizeau et al., 2000; Neschen
et al., 2006) and PPAR promotes fatty acid transport
and oxidation (Wang et al., 2003).
In conclusion, we demonstrated that fish oil feeding
inhibits adipocyte development and stimulates fatty
acid utilization in PPAR transgenic mice. This transgenic model provided evidence to demonstrate that
PUFA, especially EPA and DHA, regulated lipid metabolism through activation of PPAR to reduce body
fat deposition by decreasing lipogenic gene expression
and increasing lipolysis and fatty acid oxidation gene
expression. These findings indicate that PUFA may
serve as effective regulators of lipid catabolism in vivo,
and part of the effect is generated through the activation of PPAR. Therefore, the findings are also valuable for animal production; specifically, the incorpora-

tion of some PUFA in the diet may improve the body


composition of pigs.

LITERATURE CITED
Amri, E., F. Bonino, G. Ailhaud, N. A. Abumrad, and P. A. Grimaldi. 1995. Cloning of a protein that mediates transcriptional effects of fatty acids in preadipocytes. J. Biol. Chem. 270:2367
2371.
Belzung, F., T. Raclot, and R. Groscolas. 1993. Fish oil n-3 fatty
acids selectively limit the hypertrophy of abdominal fat depots
in growing rats fed high-fat diets. Am. J. Physiol. 246:R1111
R1118.
Bizeau, M. E., J. M. Solano, and J. R. Hazel. 2000. Menhaden oil
feeding increases lipolysis without changing plasma membrane
order in isolated rat adipocytes. Nutr. Res. 20:16331644.
Chen, C. H., P. H. Wang, B. H. Liu, H. H. Hsu, H. J. Mersmann, and
S. T. Ding. 2008. Serum amyloid A protein regulates the expression of porcine genes related to lipid metabolism. J. Nutr.
138:674679.
Clarke, S. D., and D. B. Jump. 1996. Polyunsaturated fatty acid
regulation of hepatic gene transcription. J. Nutr. 126:1105S
1109S.
Couet, C., J. Delarue, P. Ritz, J. Antoine, and F. Lamisse. 1997. Effect of dietary fish oil on body fat mass and basal fat oxidation
in healthy adults. Int. J. Obes. 21:637643.
Dallongeville, J., E. Baug, A. Tailleux, J. M. Peters, F. J. Gonzalez,
J. C. Fruchart, and B. Staels. 2001. Peroxisome proliferatoractivated receptor alpha is not rate-limiting for the lipoproteinlowering action of fish oil. J. Biol. Chem. 276:46344639.

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

2018

Yu et al.

Ding, S. T., W. L. Bacon, and M. S. Lilburn. 2002. The development of an immunoblotting assay for the quantification of liver
fatty acid-binding protein during embryonic and early posthatch development of turkeys (Meleagridis gallopavo). Poult.
Sci. 81:10571064.
Forman, B. M., J. Chen, and R. M. Evans. 1997. Hypolipidemic
drugs, polyunsaturated fatty acids, and eicosanoids are ligands
for peroxisome proliferator-activated receptors and . Proc.
Natl. Acad. Sci. USA 94:43124317.
Holst, D., S. Luquet, V. Nogueira, K. Kristiansen, X. Leverve, and
P. A. Grimaldi. 2003. Nutritional regulation and role of peroxisome proliferator-activated receptor in fatty acid catabolism
in skeletal muscle. Biochim. Biophys. Acta 1633:4350.
Hun, C. S., K. Hasegawa, T. Kawabata, M. Kato, T. Shimokawa,
and Y. Kagawa. 1999. Increased uncoupling protein2 mRNA in
white adipose tissue, and decrease in leptin, visceral fat, blood
glucose, and cholesterol in KK-Ay mice fed with eicosapentaenoic and docosahexaenoic acids in addition to linolenic acid.
Biochem. Biophys. Res. Commun. 259:8590.
Kim, H., M. Takahashi, and O. Ezaki. 1999. Fish oil feeding decreases mature sterol regulatory element-binding protein 1 (SREBP1c) by down-regulation of SREBP-1c mRNA in mouse liver. J.
Biol. Chem. 274:2589225898.
Koopman, R., G. Schaart, and M. K. C. Hesselink. 2001. Optimisation of oil red O staining permits combination with immunofluorescence and automated quantification of lipids. Histochem.
Cell Biol. 116:6368.
Kramer, D. K., L. Al-Khalili, B. Guigas, Y. Leng, P. M. GarciaRoves, and A. Krook. 2007. Role of AMP kinase and PPAR
in the regulation of lipid and glucose metabolism in human
skeletal muscle. J. Biol. Chem. 282:1931319320.
Krey, G., O. Braissant, F. LHorset, E. Kalkhoven, M. Perroud, M.
G. Parker, and W. Wahli. 1997. Fatty acids, eicosanoids, and
hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor
ligand assay. Mol. Endocrinol. 11:779791.
Lim, H., R. A. Gupta, W. Ma, B. C. Paria, D. E. Moller, J. D. Morrow, R. N. DuBois, J. M. Trzaskos, and S. K. Dey. 1999. Cyclooxygenase-2-derived prostacyclin mediates embryo implantation
in the mouse via PPAR. Genes Dev. 13:15611574.
Liu, B. H., C. F. Kuo, Y. C. Wang, and S. T. Ding. 2005. Effect
of docosahexaenoic acid and arachidonic acid on the expression of adipocyte determination and differentiation-dependent
factor 1 in differentiating porcine adipocytes. J. Anim. Sci.
83:15161525.
Nakatani, T., H. J. Kim, Y. Kaburagi, K. Yasuda, and O. Ezaki.
2003. A low fish oil inhibits SREBP1 proteolytic cascade,
while a high-fish-oil feeding decreases SREBP1 mRNA in mice
liver: Relationship to anti-obesity. J. Lipid Res. 44:369379.
Neschen, S., K. Morino, J. C. Rossbacher, R. L. Pongratz, G. W.
Cline, S. Sono, M. Gillum, and G. I. Shulman. 2006. Fish oil
regulates adiponectin secretion by a peroxisome proliferatoractivated receptor--dependent mechanism in mice. Diabetes
55:924928.
Oliver, W. R. Jr., J. L. Shenk, M. R. Snaith, C. S. Russell, K. D.
Plunket, N. L. Bodkin, M. C. Lewis, D. A. Winegar, M. L.
Sznaidman, M. H. Lambert, H. E. Xu, D. D. Sternbach, S.

A. Kliewer, B. C. Hansen, and T. M. Willson. 2001. A selective peroxisome proliferator-activated receptor delta agonist
promotes reverse cholesterol transport. Proc. Natl. Acad. Sci.
USA 98:53065311.
Ross, S. R., R. A. Graves, A. Greenstein, K. A. Platt, H. L. Shyu, B.
Mellovitz, and B. M. Spiegelman. 1990. A fat-specific enhancer
is the primary determinant of gene expression for adipocyte P2
in vivo. Proc. Natl. Acad. Sci. USA 87:95909594.
Schmittgen, T. D., B. A. Zakrajsek, A. G. Mills, V. Gorn, M. J.
Singer, and M. W. Reed. 2000. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: Comparison of endpoint and real-time methods. Anal. Biochem.
285:194204.
Shan, W., P. S. Palkar, I. A. Murray, E. I. McDevitt, M. J. Kennett,
B. H. Kang, H. C. Isom, G. H. Perdew, F. J. Gonzalez, and J.
M. Peters. 2008. Ligand activation of peroxisome proliferatoractivated receptor beta/delta (PPARbeta/delta) attenuates
carbon tetrachloride hepatotoxicity by downregulating proinflammatory gene expression. Toxicol. Sci. 105:418428.
Southern, E. M. 1975. Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J. Mol. Biol.
98:503517.
Wang, J. W., Y. N. Jiang, C. W. Chen, C. Y. Huang, M. C. Huang,
P. Y. Huang, W. T. K. Cheng, C. K. J. Shen, and Y. T. Ju.
2006. Proliferin enhances microvilli formation and cell growth
of neuroblastoma cells. Neurosci. Res. 56:8090.
Wang, Y., C. Lee, S. Tiep, R. T. Yu, J. Ham, H. Kang, and R. M.
Evans. 2003. Peroxisome proliferator-activated receptor activates fat metabolism to prevent obesity. Cell 113:159170.
Wang, Y., C. Zhang, R. T. Yu, H. K. Cho, M. C. Nelson, C. R. Bayuga-Ocampo, J. Ham, H. Kang, and R. M. Evans. 2004. Regulation of muscle fiber type and running endurance by PPAR.
PLoS Biol. 2:e294.
Willson, T. M., P. J. Brown, D. D. Sternbach, and B. R. Henke.
2000. The PPARs: From orphan receptors to drug discovery. J.
Med. Chem. 43:527550.
Wong, S. H., P. J. Nestel, R. P. Trimble, G. B. Storer, R. J. Illman,
and D. L. Topping. 1984. The adaptive effects of dietary fish
and safflower oil on lipid and lipoprotein metabolism in perfused rat liver. Biochim. Biophys. Acta 792:103109.
Yu, K., W. Bayona, C. B. Kallen, H. P. Harding, C. P. Ravera,
G. McMahon, M. Brown, and M. A. Lazar. 1995. Differential
activation of peroxisome proliferator-activated receptors by eicosanoids. J. Biol. Chem. 270:2397523983.
Yu, Y. H., E. C. Lin, S. C. Wu, W. T. K. Cheng, H. J. Mersmann,
P. H. Wang, and S. T. Ding. 2008a. Docosahexaenoic acid regulates adipogenesis genes in myoblasts via porcine peroxisome
proliferator-activated receptor . J. Anim. Sci. 86:33853392.
Yu, Y. H., B. H. Liu, H. J. Mersmann, and S. T. Ding. 2006. Porcine peroxisome proliferator-activated receptor induces transdifferentiation of myocytes into adipocytes. J. Anim. Sci.
84:26552665.
Yu, Y. H., S. C. Wu, W. T. K. Cheng, H. J. Mersmann, and S.
T. Ding. 2008b. Ectopic expression of porcine peroxisome proliferator-activated receptor regulates adipogenesis in mouse
myoblasts. J. Anim. Sci. 86:6472.

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

References

This article cites 33 articles, 19 of which you can access for free at:
http://www.journalofanimalscience.org/content/88/6/2009#BIBL

Citations

This article has been cited by 1 HighWire-hosted articles:


http://www.journalofanimalscience.org/content/88/6/2009#otherarticles

Downloaded from www.journalofanimalscience.org by guest on September 13, 2014

Articles in PresS. Am J Physiol Endocrinol Metab (June 10, 2003). 10.1152/ajpendo.00216.2003

Prevention of Glycogen Supercompensation Prolongs the Increase in Muscle GLUT4 After


Exercise

Pablo M. Garcia Roves, Dong-Ho Han, Zheng Song, Terry E. Jones, Kathleen A. Hucker and
John O. Holloszy

Department of Internal Medicine, Washington University School of Medicine, St. Louis, Missouri
63110

Running Title: Posttranscriptional regulation of GLUT4 expression

Please send correspondence to:


John O. Holloszy, MD
Washington University School of Medicine
Applied Physiology, Campus Box 8113
4566 Scott Avenue
St. Lou is, MO 63110
Phone: 314-362-3506
Fax: 314-362-7657
E-Mail: jhollosz@im.wustl.edu

Copyright (c) 2003 by the American Physiological Society.

ABSTRACT
Exercise induces an increase in GLUT4 in skeletal muscle with a proportional increase in
glucose transport capacity. This adaptation results in enhanced glycogen accumulation, i.e.
supercompensation, in response to carbohydrate feeding after glycogen depleting exercise.
The increase in GLUT4 reverses within 40h after exercise in carbohydrate fed rats.

The

purpose of this study was to determine if prevention of skeletal muscle glycogen


supercompensation after exercise results in maintenance of the increases in GLUT4 and the
capacity for glycogen supercompensation. Rats were exercised by means of three daily bouts
of swimming. GLUT4 mRNA was increased ~3-fold and GLUT4 protein was increased ~2-fold
18h in epitrochlearis muscle after exercise. These increases in GLUT4 mRNA and protein
reversed completely within 42h after exercise in rats fed a high carbohydrate diet. In contrast,
the increases in GLUT4 protein, insulin-stimulated glucose transport and increased capacity for
glycogen supercompensation persisted unchanged for 66h, in rats fed a carbohydrate-free diet
that prevented glycogen supercompensation after exercise. GLUT4 mRNA was still elevated at
42h, but had returned to baseline by 66h, after exercise in rats fed the carbohydrate-free diet.
Glycogen-depleted rats fed carbohydrate 66h after exercise underwent muscle glycogen
supercompensation with concomitant reversal of the increase in GLUT4.

These findings

provide evidence that prevention of glycogen supercompensation after exercise results in


persistence of exercise-induced increases in GLUT4 protein and enhanced capacity for
glycogen supercompensation.

Keywords: carbohydrate feeding; insulin responsiveness; muscle glucose transport

INTRODUCTION
Exercise training induces an increase in the GLUT4 isoform of the glucose transporter in
skeletal muscle (11, 13, 14, 40). Insulin- and contraction-stimulated glucose transport increase
in proportion to the increase in GLUT4 (29, 40), resulting in marked potentiation of the rate and
magnitude of muscle glycogen accumulation, above the normal fed level, in response to
carbohydrate feeding after exercise (15, 34). This post-exercise glycogen supercompensation
phenomenon is self-limiting, because the rapid influx of glucose into muscle causes inhibition of
insulin- and contraction-stimulated glucose transport, via the glucose toxicity type of insulin
resistance (20, 25, 27-30, 42). Another factor involved in the rapid reversal of the exercise
training-induced increase in muscle glucose transport capacity is the return of GLUT4 protein
content to the pretraining level within 40h after exercise in carbohydrate fed animals (26).
Previous studies have provided evidence suggesting that prevention of glycogen
supercompensation, by not feeding carbohydrate after exercise, results in persistence of an
increase in insulin-stimulated glucose transport (5, 9, 46). This raises the possibility that, after
glycogen-depleting exercise, muscle cells maintain the adaptations that make possible faster
and greater glycogen accumulation until glycogen accumulation actually occurs.

Exercise

induces an increase in muscle insulin sensitivity (12, 41). It is not clear from available data
whether the persistent increase in insulin action in the carbohydrate-depleted state after
exercise is due to a persistent increase in insulin sensitivity (5) or also involves enhanced insulin
responsiveness mediated by maintenance of the increase in GLUT4.

In this context, the

present study was undertaken to determine whether persistent increases in GLUT4 and insulin
responsiveness are involved in a mechanism that enables trained, glycogen-depleted muscles
to maintain their capacity for enhanced glycogen accumulation.

MATERIALS AND METHODS


Materials. 2-[1,2-3H]-Deoxy-D-glucose (2-DG) was obtained from American Radiolabeled
Chemicals (St. Louis, MO), and mannitol, D-[1-14C] was obtained from NEN Life Science
Products (Boston, MA). Purified porcine insulin (Iletin II) was purchased from Eli Lilly.

polyclonal antibody specific for the GLUT-4 glucose transporter was the generous gift of Dr.
Mike Mueckler (Washington University, St. Louis). Horseradish peroxidase-conjugated donkey
anti-rabbit IgG was purchased from Jackson ImmunoResearch Laboratories (West Grove, PA).
A mouse anti-human cytochrome oxidase subunit I (COXI) monoclonal antibody was purchased
from Molecular Probes (Eugene, OR, USA). Reagents for enhanced chemiluminescence were
obtained from Amersham (Arlington Heights, IL). All other reagents were obtained from Sigma
Chemical (St. Louis, MO).
Animal care. This research was approved by the Animal Studies Committee of
Washington University School of Medicine. Male Wistar rats (body wt 165-185 g) were obtained
from Charles Rivers Laboratories, housed in individual cages and fed a diet of Purina rodent
laboratory chow and water ad libitum. Animals were randomly assigned to either an exercise
group or a sedentary control group. Rats in the exercise group were accustomed to swimming
for 10 min/day for 2 days. They were then exercised on 3 successive days using a swimming
protocol, described previously (34, 40) that involves two 3-h-long swimming sessions separated
by a 45-min-long rest period during which the rats are kept warm and given food and water.
After completion of the swimming on the 3rd day, food was withheld from one group of exercised
animals, and the remaining exercised animals were fed either chow or lard ad libitum. The
exercised, fasted rats and groups of exercised, high carbohydrate diet and sedentary animals
were sacrificed 18h after the last exercise bout. Groups of chow-fed (high carbohydrate diet)
and lard-fed (carbohydrate free diet) rats were sacrificed 42h post exercise. Additional groups
of carbohydrate free diet rats were studied either 66h after exercise or 18h after being switched
from a lard to a chow diet 66h after the last bout of exercise. The animals were anesthetized

with an intraperitoneal injection of pentobarbital sodium (5 mg/100 g body wt), and the
epitrochlearis and triceps muscles were dissected out.
Muscle incubations. Epitrochlearis muscles were incubated with shaking for 60 min at
30C in 2 ml of oxygenated Krebs-Henseleit buffer (KHB) in Erlenmeyer flasks gassed
continuously with 95% O2-5% CO2. The epitrochlearis is a small, thin muscle of the forelimb that,
in rats of the size used in this study, is suitable for measurement of sugar transport in vitro (21,
45).

The KHB was supplemented with 8 mM glucose, 32 mM mannitol, and 0.1%

radioimmunoassay-grade BSA, in the presence or absence of 2 mU/ml purified porcine insulin.


This concentration of insulin maximally activates glucose transport in this muscle preparation
(43). To remove glucose, muscles were then washed for 10 min at 30C, in KHB containing
40 mM mannitol, 0.1% BSA, plus insulin if it was present in the previous incubation, and used
for measurement of glucose transport activity.
Measurement of glucose transport activity. Glucose transport activity was measured by
using the glucose analog 2-DG as described previously (16, 45). After the wash, epitrochlearis
muscles were incubated at 30C for 20 min in 1.0 ml KHB containing 4 mM [1,2-3H]-2-DG
(1.5 Ci/ml), 36 mM [14C]mannitol (0.2 Ci/ml), 0.1% BSA, and insulin if present in previous
incubations. Extracellular space and intracellular 2-DG concentration were determined as
previously described (45).
Analytical methods. Glycogen was measured in perchloric acid extracts of the
epitrochlearis muscle using the amyloglucosidase method (38). Plasma glucose concentrations
were determined using the glucose oxidase method, with a Beckman Glucose Analyzer II
(Beckman Instrument, Fullerton, CA). Plasma insulin was measured by radioimmunoassay.
Serum free fatty acid concentration was measured using a kit (Wako, NEFA C ACS-ACOD
Method).
Western Blot Analysis. Epitrochlearis muscle GLUT-4 content was determined by Western
blotting as described previously (18) using a rabbit polyclonal antibody directed against the

COOH terminus of GLUT-4, followed by horseradish peroxidase-conjugated anti-rabbit


immunoglobulin G. Antibody-bound transporter protein was visualized using enhanced
chemiluminescence. For evaluation of COX1 protein content, triceps muscle was homogenized
in a buffer containing 20 mM HEPES, 1 mM EDTA, and 250 mM sucrose, pH 7.4. Protein
content was measured using bicinchoninic acid (Pierce). Aliquots of homogenate were
solubilized in Laemmli sample buffer and subjected to SDS-polyacrylamide gel electrophoresis.
Proteins were transferred to polyvinylidene difluoride membranes. Membranes were blocked in
PBS containing 5% nonfat dry milk. Blots were probed with a monoclonal antibody against
COXI. Blots were then incubated with anti-mouse immunoglobulin G conjugated to horseradish
peroxidase. Antibody bound protein was detected by ECL.

Competitive RT-PCR. The GLUT4 RNA competitors used in our assays were generated
using the streamlined PCR-based approach described by Moller and Edvinsson (32, 33), which
uses commercially available kits for most steps of the procedure. In the first round of PCR, a
fragment representing the native GLUT4 mRNA was generated by conventional RT-PCR,
purified on a gel and eluted using an extraction kit (Quianx II). The purified first round product
was subjected to a second round of PCR, using a hybrid forward primer, that results in a
product in which the forward and reverse primer sites are ~100 bp closer to each other, i.e. a
~100 bp deletion. The forward and reverse primers and the hybrid forward competitor primers
used in this study are listed below. The competitor fragment was cloned into a PGEM-T Easy
vector containing T7 promoters. After linearization of the plasmid and Klenow treatment, sensecompetitor RNA was transcribed in vitro using a Riboprobe kit (Promega), and the resulting
RNA copies were purified from the plasmid template by DNAse 1 digestion. The identity of the
RNA and extent of the deletion were verified by sequencing.
GLUT4 D84345

Forward

5GTGTGGTCAATACCGTCTTCACG3

Reverse

5CCATTTTGCCCCTCAGTCATTC3

Competitor Forward 5GTGTGGTCAATACCGTCTTCACGATCTTGATGACGGTGGCTCTGC3


Total RNA was isolated from ~20 mg of triceps muscle by the method of Chomczynski and
Sacchi (6) and suspended in DEPC-treated H2O containing 0.1 mM EDTA.

For RNA

quantization by competitive RT-PCR, RT reactions were performed with a constant amount of


tissue mRNA and different amounts of the competitor mRNA. Once optimal initial concentrations
of tissue mRNA and competitor mRNA were established final RT-PCR was performed. The RT
involves the use of the Reverse Transcription System (Promega). Aliquots of each RT reaction
were added to a PCR Master Mix (Promega) mixture containing Taq DNA Polymerase, dNTPs,
MgCl2, reaction buffers at optimal concentrations for efficient amplification of DNA templates by
PCR and 10 pmol of both sense and antisense primers. The reaction medium was subjected to
PCR amplification. After warming the lid at 105C and 120 s at 94C, the PCR mixtures were
subjected to 35 cycles of PCR amplification with a cycle profile, including denaturation for 60 s
at 94C, hybridization for 60 s at 56.5C, and elongation for 60 s at 72C.
The PCR products were separated by electrophoresis on 2% agarose, stained with
ethidium bromide, photographed and analyzed by densitometry.

The ratio of sample to

competitor band densities was then calculated.


Statistics. Values are expressed as means SE. Statistically significant differences
were determined using ANOVA. When ANOVA showed significant differences, the StudentNewman-Keuls post hoc test was performed to discern statistical by significant differences.

RESULTS
Muscle GLUT4 protein. As in previous studies (26, 29, 30, 40) the exercise induced a
~2-fold increase in GLUT4 protein in epitrochlearis muscles (Fig. 1). In keeping with previous
results (26), this adaptive increase in GLUT4 protein reversed completely within 42h after
cessation of exercise in the high carbohydrate diet fed animals (Fig. 1).

In contrast, the

increase in GLUT4 protein was still present 66h after exercise in muscles of rats fed the
carbohydrate-free diet after exercise. The increase in GLUT4 reversed completely within 18h
after rats that were fed the carbohydrate free diet for 66h after exercise were switched to the
high carbohydrate diet (Fig. 1).
Glucose transport activity. The increase in glucose transport activity in response to a
maximal insulin stimulus was ~2-fold higher in epitrochlearis muscles of the exercised rats 18h
after the last bout of exercise than in muscles of sedentary, fasted animals (Fig. 2). This
enhancement of insulin-stimulated glucose transport activity had reversed completely 42h after
exercise in muscles of rats fed the high carbohydrate diet. These findings confirm the results of
previous studies (26, 29, 30). In contrast, the ~2-fold greater increase in glucose transport
activity in response to insulin was still present 66h following exercise in epitrochlearis muscles
of rats fed the carbohydrate-free diet (Fig. 2). The persistence of the increases in GLUT4
protein and insulin-stimulated 2DG transport were closely correlated (Fig. 2).
Muscle glycogen concentration. Epitrochlearis muscle glycogen concentration in rats
fed the high carbohydrate diet for 18h after exercise was increased ~2-fold above that found in
the high carbohydrate diet fed sedentary control animals (Fig. 3). This increase in muscle
glycogen persisted unchanged 42h after exercise.

The post-exercise increase in muscle

glycogen was prevented by feeding the rats the carbohydrate-free diet for 42 or 66h after
exercise. One of the hypotheses that we were testing in this study was that the exerciseinduced increase in the ability of muscle to accumulate glycogen persists until the glycogen
supercompensation actually occurs. This hypothesis appears to be correct, as the increase in

epitrochlearis muscle glycogen was as great in rats maintained in the glycogen-depleted state
for 66h and then fed the high carbohydrate diet as in muscles of rats fed the high carbohydrate
diet for 18h immediately after exercise (Fig. 3). This increase in glycogen was associated with a
decrease in GLUT4 protein back to the control, sedentary level (Fig. 1).
GLUT4 mRNA. The increase in muscle GLUT4 protein induced by exercise is preceded,
and probably mediated, by an increase in GLUT4 mRNA (40). In the present study, GLUT4
mRNA was increased ~3-fold 18h after exercise. This increase in GLUT4 mRNA reversed
completely between 18h and 42h after exercise in the high carbohydrate diet rats (Fig. 4).
GLUT4 mRNA concentration decreased less rapidly in the carbohydrate free diet group and was
still elevated 42h post exercise in the animals fed the carbohydrate free diet. However, between
42h and 66h after exercise, GLUT4 mRNA returned to the baseline, control level despite
prevention of glycogen supercompensation by the carbohydrate free diet.
Cytochrome oxidase subunit I. The exercise program used in this study also induces
increases in the expression of mitochondrial proteins (2).

COXI, which was used as a

mitochondrial marker protein, was increased 18h after last exercise bout (Fig. 5). There was no
reversal of the increase in COXI protein in muscles of rats fed carbohydrate for 42h beginning
shortly after the exercise or for 18h beginning 66h post exercise. This is in contrast to the rapid
reversal of the increase in GLUT4 in response to carbohydrate feeding and muscle glycogen
supercompensation.

DISCUSSION
Exercise has three major effects on muscle glucose uptake (22). The first is an insulin
independent stimulation of glucose transport (23, 44) mediated by translocation of GLUT4 to the
cell surface (8). The second is an increase in insulin sensitivity that develops in the immediate
post exercise period as the acute stimulation of glucose transport wears off (12, 41). The third
is an adaptive increase in GLUT4 (11, 13, 40), with a proportional increase in insulin
responsiveness (22, 40), that occurs after a prolonged bout of exercise. This adaptive increase
in GLUT4 results in markedly enhanced muscle glycogen accumulation in response to
carbohydrate feeding after glycogen depleting exercise (15, 34).

The increase in GLUT4

expression reverses rapidly after the increase in muscle glycogen occurs (26). The results of
previous studies have suggested that prevention of glycogen supercompensation following
glycogen depleting exercise results in persistence of an exercise-induced increase in insulin
action on muscle glucose transport (5, 9, 46)
In this context, we tested the hypothesis that muscles maintain their capacity for
increased glycogen accumulation after exercise for as long as glycogen supercompensation is
prevented after glycogen depleting exercise. Our findings show that this hypothesis is correct.
They provide evidence that maintenance of the capacity for glycogen supercompensation is
mediated by persistence of the adaptive increase in GLUT4. As in our previous study (26), the
exercise-induced increase in muscle GLUT4 expression reversed completely within 42h after
exercise in rats fed a high carbohydrate diet that resulted in glycogen supercompensation. In
contrast, the increases in GLUT4, insulin responsiveness, and increased capacity for glycogen
accumulation persisted unchanged for 66h, the longest period studied, in muscles of rats fed a
carbohydrate-free diet that prevented glycogen supercompensation after exercise. Feeding the
glycogen depleted rats carbohydrate 66h after exercise resulted in muscle glycogen
supercompensation similar in magnitude to that observed in the animals fed chow immediately
after exercise. Concomitantly, muscle GLUT4 protein concentration returned to the baseline,

10

control level, providing evidence that rapid glucose influx and/or glycogen accumulation are
involved in mediating reversal of the exercise-induced increase in GLUT4.
Research interest in the exercise-induced increase in muscle GLUT4 is currently
focused on the role that this adaptation can play in ameliorating insulin resistance associated
with type 2 diabetes and obesity. However, it seems improbable that countering of insulin
resistance is the biological function that led to the evolutionary selection of this adaptive
response, as obesity and diabetes are extremely rare under natural conditions, i.e. in wild
animals.

On the other hand, muscle glycogen is necessary for strenuous exercise, and

depletion of glycogen stores results in fatigue that makes vigorous exercise impossible (1, 3, 7).
Therefore, rapid muscle glycogen repletion can be essential for survival in a fight or flight
situation that requires prolonged, vigorous exercise.

The major factor limiting glycogen

accumulation in muscle appears to be the rate of glucose uptake (10, 17, 39, 40). Muscle
glucose uptake is limited by both the availability of a high carbohydrate diet and muscle glucose
transport activity. The rate of glucose transport into muscle is limited by glucose transport
capacity, which is normally proportional to muscle GLUT4 content (19, 31, 40).
In this context, the rapid increase in GLUT4 expression induced by exercise could
provide a survival advantage during prolonged flight or fight situations by making possible faster
and greater glycogen repletion between exercise bouts or during intervals of less intense
exercise.

The rapid reversal of the exercise-induced increase in GLUT4 in response to

carbohydrate feeding and glycogen supercompensation could serve to prevent glycogen


accumulation to the point that it causes muscle stiffness and impaired function. The present
results show that additional adaptations are present in glycogen depleted muscles that prevent
this rapid decrease in GLUT4 protein and, thus, keep the muscles poised for rapid glycogen
supercompensation until carbohydrate becomes available.

11

The increase in GLUT4 expression is a component of an adaptive response to


endurance exercise that also involves an increase in mitochondrial biogenesis (2). The signals
responsible for this adaptive response appear to be the increases in cytosolic Ca2+, leading to
activation of Ca2+-calmodulin dependent protein kinases, and the decrease in high energy
phosphates, leading to activation of AMP kinase, during contractile activity (24, 35-37, 47).
Following cessation of exercise, the time course of the reversal of the adaptive increase in
mitochondrial proteins appears to be determined by the half-lives of the proteins which, for
respiratory chain and citrate cycle enzymes, appears to be ~8 days (4). Thus, the adaptive
increase in mitochondrial enzymes is gradually lost over a period of about one month after
cessation of training in rats fed a chow diet (4). In the present study, switching rats from a
carbohydrate-free to a high carbohydrate diet that resulted in glycogen supercompensation 66h
after exercise had no effect on COXI protein level in muscle.

In contrast, in rats fed

carbohydrate, the increase in GLUT4 protein reverses completely within 40h (26).

The

decrease in muscle GLUT4 protein in glycogen depleted rats fed carbohydrate 66h after
exercise was even more rapid, occurring within 18h. Two possible explanations for this rapid
reversal may be that the GLUT4 protein normally has a short half-life, and that rapid glucose
influx and glycogen synthesis may be associated with the specific activation of GLUT4
proteolysis.
Our finding in the present study that no decrease in GLUT4 protein occurred over a 66
hr period after exercise in glycogen depleted muscles could, theoretically, be due to either a
persistent increase in GLUT4 protein synthesis or an inhibition of GLUT4 proteolysis. Our
results suggest that both of these processes may have played a role. Muscle GLUT4 mRNA
content had returned to the baseline control value 42h after exercise in the high carbohydrate
diet fed rats. However, in the animals fed a carbohydrate free diet the persistent decrease in
muscle glycogen was associated with maintenance of an increase in GLUT4 mRNA that was
still evident 42h after exercise. Thus, the persistent increase in GLUT4 mRNA could have

12

played a role in the maintenance of an exercise-induced increase in GLUT4 protein synthesis.


However, an increase in GLUT4 protein content of the glycogen-depleted muscle was still
present 66h after exercise, by which time GLUT4 mRNA had returned to the sedentary control
level.

This is in contrast to the decline in both GLUT4 mRNA and GLUT4 protein to the

sedentary control levels between 18h and 42h after exercise in the carbohydrate fed rats. It,
therefore, seems possible that inhibition of GLUT4 proteolysis also played a role in the
persistent increase in GLUT4 protein in the glycogen-depleted muscles.
In the high carbohydrate diet fed animals, GLUT4 protein was still elevated 18h after the
onset of muscle glycogen repletion, while in the rats maintained in the glycogen depleted state,
muscle GLUT4 protein content fell to the sedentary control level within 18h after the start of
glycogen repletion. This difference may be explained by the finding that GLUT4 mRNA was
elevated during glycogen repletion starting immediately after exercise, whereas GLUT4 mRNA
had fallen to the sedentary control level at the time glycogen repletion was initiated in the rats
maintained for 66h in the glycogen depleted state.
In conclusion, the results of this study provide evidence that prevention of glycogen
supercompensation after exercise results in persistence of the increased capacity for muscle
glycogen accumulation after exercise for at least three days. The mechanism responsible for
this phenomenon appears to be a prolongation of the exercise-induced increase in muscle
GLUT4 protein.

13

ACKNOWLEDGEMENTS
This research was supported by National Institutes of Health Grants DK18986 and
AG000425. Zheng Song and Terry E. Jones were supported by National Institute on Aging
Institutional National Research Service Award AG00078. Pablo M. Garcia-Roves was initially
supported by an American Diabetes Association Mentor-Based Postdoctoral Fellowship, and
subsequently by a Plan Regional I+D+I of Principado of Asturias Postdoctoral Fellowship.
We thank Victoria Reckamp for expert assistance with preparation of this manuscript.

14

REFERENCES
1. Ahlborg, B., J. Bergstrm, L. G. Ekelund, and E. Hultman. Muscle glycogen and muscle
electrolytes during prolonged physical exercise. Acta Physiol.Scand. 70:129-142, 1967.

2. Baar, K., A. R. Wende, T. E. Jones, M. Marison, L. A. Nolte, M. Chen, D. P. Kelly, and J. O.


Holloszy. Adaptations of skeletal muscle to exercise: Rapid increase in the transcriptional
coactivator PGC-1. FASEB J. 16:1879-1886, 2002.

3. Bergstrm, J., L. Hermansen, E. Hultman, and B. Saltin. Diet, muscle glycogen and physical
performance. Acta Physiol.Scand. 71:140-150, 1967.

4. Booth, F. W. and J. O. Holloszy. Cytochrome c turnover in rat skeletal muscles. J.Biol.Chem.


252:416-419, 1977.

5. Cartee, G. D., D. A. Young, M. D. Sleeper, J. Zierath, H. Wallberg-Henriksson, and J. O.


Holloszy. Prolonged increase in insulin-stimulated glucose transport in muscle after exercise.
Am.J.Physiol. 256:E494-E499, 1989.

6. Chomczynski, P. and N. Sacchi. Single-step method of RNA isolation by acid guanidinium


thiocyanate-phenol-chloroform extraction. Anal.Biochem. 162:156-159, 1987.

7. Conlee, R. K. Muscle glycogen and exercise endurance: a twenty-year perspective. Exerc.Sport


Sci.Rev. 15:1-28, 1987.

8. Douen, A. G., T. Ramlal, S. Rastogi, P. J. Bilan, G. D. Cartee, M. Vranic, J. O. Holloszy, and


A. Klip. Exercise induces recruitment of the "insulin-responsive glucose transporter". J.Biol.Chem.
265:13427-13430, 1990.

15

9. Fell, R. D., S. E. Terblanche, J. L. Ivy, J. C. Young, and J. O. Holloszy. Effects of muscle


glycogen content on glucose uptake by muscle following exercise. J.Appl.Physiol. 52:434-437,

1982.
10. Fisher, J. S., L. A. Nolte, K. Kawanaka, D.-H. Han, T. E. Jones, and J. O. Holloszy. Glucose
transport rate and glycogen synthase activity both limit skeletal muscle glycogen accumulation.
Am.J.Physiol:Endocrinol.Metab. 282:E1214-E1221, 2002.

11. Friedman, J. E., W. M. Sherman, M. J. Reed, C. W. Elton, and G. L. Dohm. Exercise-training


increases glucose transporter protein GLUT4 in skeletal muscle of obese Zucker (fa/fa) rats. FEBS
Lett. 268:13-16, 1990.

12. Garetto, L. P., E. A. Richter, M. N. Goodman, and N. B. Ruderman. Enhanced muscle glucose
metabolism after exercise in the rat: the two phases. Am.J.Physiol. 246:E471-E475, 1984.

13. Goodyear, L. J., M. F. Hirshman, P. M. Valyou, and E. S. Horton. Glucose transporter number,
function, and subcellular distribution in rat skeletal muscle after exercise training. Diabetes
41:1091-1099, 1992.

14. Goodyear, L. J. and B. B. Kahn. Exercise, glucose transport and insulin sensitivity.
Ann.Rev.Med. 49:235-261, 1998.

15. Greiwe, J. S., R. C. Hickner, P. A. Hansen, S. B. Racette, M. M. Chen, and J. O. Holloszy.


Effects of endurance exercise training on muscle glycogen accumulation in humans. J.Appl.Physiol.
87:222-226, 1999.

16. Hansen, P. A., E. A. Gulve, and J. O. Holloszy. Suitability of 2-deoxyglucose for in vitro
measurement of glucose transport activity in skeletal muscle. J.Appl.Physiol. 76:979-985, 1994.

16

17. Hansen, P. A., B. A. Marshall, M. Chen, J. O. Holloszy, and M. Mueckler. Transgenic


overexpression of hexokinase II in skeletal muscle does not increase glucose disposal in wild-type
or Glut1-overexpressing mice. J.Biol.Chem. 275:22381-22386, 2000.

18. Hansen, P. A., T. J. McCarthy, E. N. Pasia, R. J. Spina, and E. A. Gulve. Effects of ovariectomy
and exercise training on muscle GLUT-4 content and glucose metabolism in rats. J.Appl.Physiol.
80:1605-1611, 1996.

19. Henriksen, E. J., R. E. Bourey, K. J. Rodnick, L. Koranyi, M. A. Permutt, and J. O. Holloszy.


Glucose transporter protein content and glucose transport capacity in rat skeletal muscles.
Am.J.Physiol. 259:E593-E598, 1990.

20. Henriksen, E. J. and A. E. Halseth. Early alterations in soleus GLUT-4, glucose transport, and
glycogen in voluntary running rats. J.Appl.Physiol. 76:1862-1867, 1994.

21. Henriksen, E. J. and J. O. Holloszy. Effect of diffusion distance on measurement of rat skeletal
muscle glucose transport in vitro. Acta Physiol.Scand. 143:381-386, 1991.

22. Holloszy, J. O. A forty-year memoir of research on the regulation of glucose transport into muscle.
Am.J.Physiol. 284:E453-E467, 2003.

23. Holloszy, J. O. and H. T. Narahara. Studies of tissue permeability. X. Changes in permeability to


3-methylglucose associated with contraction of isolated frog muscles. J.Biol.Chem. 240:3493-

3500, 1965.
24. Holmes, B. F., E. J. Kurth-Kraczek, and W. W. Winder. Chronic activation of 5'-AMP-activated
protein kinase increases GLUT-4, hexokinase, and glycogen in muscle. J.Appl.Physiol. 87:1990-

1995, 1999.

17

25. Host, H. H., P. A. Hansen, L. A. Nolte, M. M. Chen, and J. O. Holloszy. Glycogen


supercompensation masks the effect of a training-induced increase in GLUT4 on muscle glucose
transport. J.Appl.Physiol. 85:133-138, 1998.

26. Host, H. H., P. A. Hansen, L. A. Nolte, M. M. Chen, and J. O. Holloszy. Rapid reversal of
adaptive increases in muscle GLUT4 and glucose transport capacity after training cessation.
J.Appl.Physiol. 84:798-802, 1998.

27. Jensen, J., R. Aslesen, J. L. Ivy, and O. Brors. Role of glycogen concentration and epinephrine
on glucose uptake in rat epitrochlearis muscle. Am.J.Physiol. 272:E649-E655, 1997.

28. Kawanaka, K., D.-H. Han, J. Gao, L. A. Nolte, and J. O. Holloszy. Development of glucoseinduced insulin resistance in muscle requires protein synthesis. J.Biol.Chem. 276:20101-20107,

2001.
29. Kawanaka, K., D.-H. Han, L. A. Nolte, P. A. Hansen, A. Nakatani, and J. O. Holloszy.
Decreased insulin-stimulated GLUT4 translocation in glycogen supercompensated muscles of
exercised rats. Am.J.Physiol. 276:E907-E912, 1999.

30. Kawanaka, K., L. A. Nolte, D.-H. Han, P. A. Hansen, and J. O. Holloszy. Mechanisms
underlying impaired GLUT-4 translocation in glycogen-supercompensated muscles of exercised
rats. Am.J.Physiol. 279:E1311-E1318, 2000.

31. Kern, M., J. A. Wells, J. M. Stephens, C. W. Elton, J. E. Friedman, E. B. Tapscott, P. H.


Pekala, and G. L. Dohm. Insulin responsiveness in skeletal muscle is determined by glucose
transporter (GLUT 4) protein level. Biochem.J. 270:397-440, 1990.

32. Mller, S., M. Adner, and L. Edvinsson. Increased levels of endothelin ETB receptor mRNA in
human omental arteries after organ culture: quantification by competitive reverse transcriptionpolymerase chain reaction. Clin.Exper.Pharm.Physiol. 25:788-794, 1998.

18

33. Mller, S. and L. Edvinsson. A strategy for the generation of RNA competitors in competitive RTPCR. Technical Tips Online 1:T01604-T01606, 1999.

34. Nakatani, A., D.-H. Han, P. A. Hansen, L. A. Nolte, H. H. Host, R. C. Hickner, and J. O.
Holloszy. Effect of endurance exercise training on muscle glycogen supercompensation in rats.
J.Appl.Physiol. 82:711-715, 1997.

35. Ojuka, E. O., T. E. Jones, D.-H. Han, M. Chen, and J. O. Holloszy. Raising Ca2+ in L6 myotubes
mimics effects of exercise on mitochondrial biogenesis in muscle. FASEB J. 17:675-681, 2003.

36. Ojuka, E. O., T. E. Jones, L. A. Nolte, M. Chen, B. R. Wamhoff, M. Sturek, and J. O. Holloszy.
Regulation of GLUT4 biogenesis in muscle: Evidence for involvement of AMPK and Ca2+.
Am.J.Physiol. 282:E1008-E1013, 2002.

37. Ojuka, E. O., L. A. Nolte, and J. O. Holloszy. Increased expression of GLUT-4 and hexokinase in
rat epitrochlearis muscles exposed to AICAR in vitro. J.Appl.Physiol. 88:1072-1075, 2000.

38. Passonneau, J. V. and V. R. Lauderdale. A comparison of three methods of glycogen


measurements in tissue. Anal.Biochem. 60:405-412, 1974.

39. Ren, J.-M., B. A. Marshall, E. A. Gulve, J. Gao, D. W. Johnson, J. O. Holloszy, and M.


Mueckler. Evidence from transgenic mice that glucose transport is rate-limiting for glycogen
deposition and glycolysis in skeletal muscle. J.Biol.Chem. 268:16113-16115, 1993.

40. Ren, J.-M., C. F. Semenkovich, E. A. Gulve, J. Gao, and J. O. Holloszy. Exercise induces rapid
increases in GLUT4 expression, glucose transport capacity, and insulin-stimulated glycogen
storage in muscle. J.Biol.Chem. 269:14396-14401, 1994.

41. Richter, E. A., L. P. Garetto, M. N. Goodman, and N. B. Ruderman. Muscle glucose metabolism
following exercise in the rat. Increased sensitivity to insulin. J.Clin.Invest. 69:785-793, 1982.

19

42. Richter, E. A., S. A. Hansen, and B. F. Hansen. Mechanisms limiting glycogen storage in muscle
during prolonged insulin stimulation. Am.J.Physiol. 255:E621-E628, 1988.

43. Wallberg-Henriksson, H., S. H. Constable, D. A. Young, and J. O. Holloszy. Glucose transport


into rat skeletal muscle: Interaction between exercise and insulin. J.Appl.Physiol. 65:909-913,

1988.
44. Wallberg-Henriksson, H. and J. O. Holloszy. Activation of glucose transport in diabetic muscle:
Responses to contraction and insulin. Am.J.Physiol. 249:C233-C237, 1985.

45. Young, D. A., J. J. Uhl, G. D. Cartee, and J. O. Holloszy. Activation of glucose transport in
muscle by prolonged exposure to insulin:

Effects of glucose and insulin concentration.

J.Biol.Chem. 261:16049-16053, 1986.

46. Young, J. C., S. M. Garthwaite, J. E. Bryan, L.-J. Cartier, and J. O. Holloszy. Carbohydratefeeding speeds reversal of enhanced glucose uptake in muscle after exercise. Am.J.Physiol.
245:R684-R688, 1983.

47. Zheng, D., P. S. MacLean, S. C. Pohnert, J. B. Knight, A. L. Olson, W. W. Winder, and G. L.


Dohm.

Regulation

of

muscle

GLUT-4

J.Appl.Physiol. 91:1073-1083, 2001.

transcription

by

AMP-activated

protein

kinase.

20

FIGURE LEGENDS
Figure 1.

Effects of 3 daily bouts of exercise followed by a high carbohydrate diet or a

carbohydrate-free diet on epitrochlearis muscle GLUT4 protein content. Rats were exercised by
means of swimming on 3 consecutive days. Following the last bout of exercise, groups of rats
were either fasted, fed a high carbohydrate or fed a carbohydrate-free (lard) diet for the times
indicated. One group was switched to a high carbohydrate diet after eating the carbohydrate
free diet for 66h.

Epitrochlearis muscle GLUT4 content was determined by Western blot

analysis. Values are means SE for 6 to 10 muscles per group. *P<0.05 versus Sedentary, Hi
Carb 42h, and Carb Free 66h + Hi Carb 18h.

Figure 2. Insulin-induced increase in glucose transport activity parallels GLUT4 content in


epitrochlearis muscles. Rats were exercised on 3 consecutive days followed by either fasting, a
high carbohydrate diet or a carbohydrate-free diet for the times indicated.

Epitrochlearis

muscles were incubated with or without 2 mU/ml insulin for 60 min followed by measurement of
2DG transport as described in Materials and Methods. Epitrochlearis muscle GLUT4 protein
content was evaluated by Western blot analysis. Values are means SE for 8 to 12 muscles
per group. *P<0.05 versus Sedentary and Hi Carb 42h groups.

Figure 3. Muscle glycogen concentrations. Epitrochlearis muscle glycogen concentrations


were measured in the same groups, described in the legend for Figure 1., in which muscle
GLUT4 content was determined.

Values are means SE for 8 to 10 muscles per group.

*P<0.05 versus Sedentary, Fasted 18h, Carb Free 42h and Carb Free 66h P<0.05 versus
Fasted 18h, Carb Free 42h and Carb Free 66h.

21

Figure 4.

Epitrochlearis muscle GLUT4 mRNA.

GLUT4 mRNA was measured, in

epitrochlearis muscles of the groups of rats described in Figure 1, using competitive RT-PCR as
described under Materials and Methods. Values are means SE for 5 to 7 muscles. *P<0.05
versus Sedentary, Hi Carb 42h, Carb Free 66h, and Carb Free 66h + Hi Carb 18h.

Figure 5. Cytochrome oxidase subunit I protein (COXI). Rats were exercised on 3 consecutive
days. COXI protein content of epitrochlearis muscles was determined by Western blot analysis
in muscles of the Sedentary, Fasted 18h, Hi Carb 42h, Carb Free 42h and Carb Free 66h + Hi
Carb 18h groups. Values are means SE for 4 to 6 muscles per group. *P<0.05 vs. all other
groups.

0.0

Exercise
Carb Free 66h
+ Hi Carb 18h

Carb Free 66h

CarbFree 42h

Hi Carb 42h

Hi Carb 18h

2.5

Fasted 18h

Sedentary

GLUT4 protein (arbitrary units)

22

FIGURE 1

2.0

1.5

1.0

0.5

*
*
2.0

2.5

2.0
1.5

1.5
1.0

1.0

0.5
0.5

Exercise
0.0

GLUT4 protein (arbitrary units)

0.0

Carb Free 66h

2-Deoxyglucose transport

Hi Carb 42h

3.0
GLUT4 protein

Fasted 18h

3.5

Sedentary

Epitrochlearis Muscle 2-DG Transport


(mol * ml-1 * 20min-1)

23

FIGURE 2

*
2.5

Exercise

Carb Free 66h


+ Hi Carb 18h

Carb Free 66h

Carb Free 42h

Hi Carb 42h

Hi Carb 18h

Fasted 18h

Sedentary

Muscle glycogen (mol/g)

24

FIGURE 3

100
*

80

60

40

20

Exercise

Carb Free 66h


+ Hi Carb 18h

Carb Free 66h

Carb Free 42h

Hi Carb 42h

Hi Carb 18h

Fasted 18h

Sedentary

GLUT4 mRNA (arbitrary units)

25

FIGURE 4

*
*

0.0

Exercise
Carb Free 66h
+ Hi Carb 18h

Carb Free 42h

Hi Carb 42h

Fasted 18h

Sedentary

COX subunit I protein (arbitrary units)

26

FIGURE 5

2.0

1.5
*

1.0

0.5

1785

J Physiol 590.8 (2012) pp 17851786

JOURNAL CLUB

Protein ingestion after


endurance exercise: the
evolving needs of the
mitochondria?
Daniel R. Moore1
and Trent Stellingwerff 2
1
Physical Performance and Mobility Group,
Department of Nutrition and Health, Nestle
Research Centre, Vers-chez-les-Blanc,
Switzerland
2
Canadian Sport Centre Pacific, Pacific
Institute for Sport Excellence, Victoria,
British Columbia, Canada

The Journal of Physiology

Email: mooredr@mcmaster.ca

Humans have evolved with incredible


biological capacity to adapt to their
environment, with nutrients and exercise
being two of the most robust stimuli.
Considerable progress has been made
in elucidating the relevant transcriptional
and molecular networks and their subsequent phenotypic endpoints responsible
for driving these adaptations. However,
we are only beginning to understand the
importance of nutrition in optimizing these
exercise adaptations. The importance of
carbohydrates and fats for optimal aerobic
exercise recovery has received the bulk of
research attention. Conversely, we arguably
know relatively little insofar as the role
dietary protein plays in enhancing the
recovery from and/or adaptation to endurance exercise.
Therefore, it was with great interest
that we read the recent paper published
in The Journal of Physiology by Breen
and colleagues (Breen et al. 2011) who
investigated the impact that dietary protein
ingestion has on fraction-specific muscle
protein synthesis after endurance exercise.
In their paper, trained subjects acutely
performed 90 min of exercise at 77%
V O2 max , which is an exercise stimulus
that chronically would be associated
with training-induced adaptations such as
mitochondrial biogenesis and enhanced
aerobic capacity. In a cross-over design,
subjects ingested carbohydrate beverages
immediately and 30 min after exercise
with one trial including a total of
20 g of whey protein, which is a dose
that maximally stimulates muscle protein
synthesis post-resistance exercise in average

80 kg young men. Myofibrillar and


mitochondrial protein synthesis were then
measured by a primed, constant infusion
of ring-[13 C6 ]phenylalanine. The authors
demonstrated that the co-ingestion of
protein with carbohydrate enhanced the
synthesis of the myofibrillar, but not the
mitochondrial, protein fraction up to 4 h
after exercise. In addition, alteration in
the phosphorylation status, and presumably
activity, of some intracellular signalling
molecules involved in mRNA translation
(i.e. mTOR, p70S6K and eEF2) previously
linked to muscle growth pathways generally
supported the observed changes in myofibrillar protein synthesis. Although basal
protein synthetic rates were not measured
and hence exercise effects could not be
fully delineated, the authors speculated
that the lack of enhanced mitochondrial
protein synthesis with protein ingestion may
have been related to the endurance-trained
nature of the subjects and/or the relatively
abbreviated 4 h post-exercise recovery
time period over which the study was
performed (Breen et al. 2011). Nevertheless,
these results are consistent with another
recent report demonstrating a similar
myofibrillar-only fraction-specific synthetic
response with dietary protein ingestion after
high-intensity sprint exercise (Coffey et al.
2011). However, these post-exercise results
are in apparent contrast to observations
at rest, whereby exogenous amino acids
have been shown to robustly stimulate
the synthesis both of myofibrillar and
mitochondrial protein fractions (Bohe et al.
2003). This discrepancy begs the question
as to why there is an apparent difference
in nutrient sensitivity between rested and
exercised skeletal muscles.
Given the vital requirement for ATP for
all cellular processes, it is of paramount
importance that energy production, and
hence mitochondrial function, is prioritized
to maintain cell viability. Aerobic exercise
represents a stimulus that results in a
marked disturbance to cellular energy
homeostasis and would elicit adaptations,
such as mitochondrial biogenesis, aimed
to lessen future disturbances by optimizing
ATP production. In this manner, it is
tempting to speculate that skeletal muscle
may have evolved mechanisms that would
somehow target and channel intracellular
amino acids towards this essential physio-

logical process of mitochondrial protein


synthesis to enhance the remodelling of
this vital organelle. Thus, the availability of
intracellular amino acids may be prioritized
towards mitochondrial protein synthesis
in the acute recovery period to maintain
maximal synthetic rates even in the fasted
state (Breen et al. 2011; Coffey et al. 2011).
In contrast, it is generally accepted that
myofibrillar protein is the major labile pool
and, in addition to its role in converting
chemical energy into mechanical work, acts
as the sole storage reservoir for body amino
acids. As such, this protein fraction is
essentially at the disposal of the nutrient
environment as it is catabolised during
periods of reduced amino acid supply
(i.e. fasted state) and resynthesized during
periods of abundance (i.e. with protein
feeding). Therefore, despite its synthesis
being stimulated after aerobic exercise, myofibrillar protein synthesis (and probably
net balance of this protein fraction) is not
maximized until a source of exogenous
amino acids is provided regardless of
prior contractile activity (Bohe et al.
2003; Breen et al. 2011; Coffey et al.
2011).
Given that protein ingestion did not
further augment mitochondrial protein
synthesis over a protein-free control (Breen
et al. 2011; Coffey et al. 2011), it begs the
question of whether there is any role for
post-exercise protein in enhancing recovery
from and/or adaptation to endurance
exercise. At the outset, the enhanced myofibrillar protein synthesis with moderate
dietary protein ingestion is consistent
with the repair or remodelling of the
contractile protein apparatus, which would
undoubtedly be beneficial for recovery.
Whether this post-exercise enhancement of
myofibrillar protein synthesis could result
in training-induced increases in muscle
power, which in turn could enhance aerobic
performance, is unclear due to the absence
of longer-term training studies featuring
protein synthetic measures. Nevertheless,
some evolutionary biologists have theorized
that humans evolved to run as a means to
procure meat through persistence hunting,
in which prey are essentially run to (heat)
exhaustion prior to the kill. From the
perspective of enhancing aerobic capacity
per se, proponents of this theory may
argue that natural selection may have


C 2012 The Authors. The Journal of Physiology 
C 2012 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

DOI: 10.1113/jphysiol.2011.224188

1786

Journal Club

favoured larger protein intakes that would


have occurred after a successful hunt as a
means to fully drive aerobic adaptations.
In this scenario, an abundant or, in the
context of the saturation of protein synthetic
capacity, excessive protein intake could have
indicated that ample amino acid substrates
were available to not only repair all protein
fractions (i.e. both mitochondrial and myofibrillar) but also drive further adaptive
responses that could have provided a
competitive advantage. Potentially in partial
support of this theory is the observation
in trained athletes that higher protein
intakes (64 g) during the immediate 2 h
acute recovery period after 2.5 h of cycling
initiate a transcriptional profile up to 48 h
later that favours the expression of genes
involved in type I myofibril remodelling
and enhanced cellular energy pathways (e.g.
peroxisome proliferator-activated receptor
gamma family expression) (Rowlands et al.
2011). This effect was observed despite
equivalent energy intake and otherwise
identical daily diets, suggesting a direct
effect of the post-exercise dietary amino
acid ingestion. In addition, rodent models
have demonstrated a role for the branched
chain amino acids, the human equivalent of
10 g per day, in enhancing mitochondrial
biogenesis through sirtuin-1 expression
with the functional significance evident in
an enhanced aerobic capacity (DAntona
et al. 2010). Admittedly, the translation of
these results to humans with whole foods
(e.g. complete proteins) in conjunction with
exercise is currently unclear. Nevertheless,
outside of a measurable effect on
mitochondrial protein synthesis, it is
possible that post-endurance exercise
protein intake, and perhaps relatively
greater amounts than what has been studied
previously (Breen et al. 2011; Coffey et al.
2011), may have subtle yet meaningful
effects on the facilitation and support of
cellular adaptations that could ultimately
translate into mitochondrial biogenesis and
enhanced aerobic performance.

So what could be the next steps? As Breen


and colleagues suggest in their paper, it is
possible that the synergies between exercise
and protein ingestion for mitochondrial
protein synthesis lie outside the acute
4 h recovery window (Breen et al. 2011).
In this respect, as the aerobic stimulus
begins to wane in the hours to days
post-exercise a more rested mitochondrial
turnover rate is observed. Given that
exogenous amino acids stimulate resting
mitochondrial protein synthesis (Bohe et al.
2003), it is possible that protein ingestion
later (i.e. >4 h) in recovery enhances the
synthesis of this protein fraction (over
and above what would normally occur in
unexercised muscle) and helps sustain the
elevated post-exercise protein synthesis; this
could be akin to what is observed within the
myofibrillar protein fraction after resistance
exercise (Burd et al. 2011) and, compared
to a rested or a fasted exercised muscle,
could translate into a greater 2448 h
mitochondrial protein synthesis and net
protein accretion. Nevertheless, what is clear
is that more studies need to investigate
the synthetic response of specific muscle
protein sub-fractions both at basal levels
and with combined exercise and nutrition
interventions given the divergent responses
that can occur between protein fractions
(Breen et al. 2011; Burd et al. 2011; Coffey
et al. 2011), some of which may not be
detected with mixed muscle homogenates
due to the confounding influences of protein
pool size and turnover rate. Moreover,
the further development and refinement of
methods that quantify proteome synthesis,
for example 2D gel electrophoresis with
tandem mass spectrometry, should greatly
enhance our understanding of the specific
and synergistic effects of exercise and
nutrition on the turnover of individual
muscle proteins. This acute protein
fraction-specific information could provide
a guiding snapshot to help elucidate
the potential phenotypic adaptations
that might occur with more prolonged

J Physiol 590.8

interventions. Additionally, marrying up


these protein-specific synthetic data with
information from other molecular and
transcriptomic technologies could provide
further insights into the subtle or overt
regulation of the acute training phenotype.
However, this mechanistic knowledge must
ultimately be leveraged into longer-term
studies with functional outcomes to validate
the predictive ability of these acute models.
Ultimately, it is clear that many questions
remain in the quest to evolve our knowledge
of what the mitochondria really need to
optimally adapt to aerobic exercise stimuli.
References
Bohe J, Low A, Wolfe RR & Rennie MJ (2003).
Human muscle protein synthesis is modulated
by extracellular, not intramuscular amino acid
availability: a doseresponse study. J Physiol
552, 315324.
Breen L, Philp A, Witard OC, Jackman SR, Selby
A, Smith K et al. (2011). The influence of
carbohydrateprotein co-ingestion following
endurance exercise on myofibrillar and
mitochondrial protein synthesis. J Physiol 589,
40114025.
Burd NA, West DW, Moore DR, Atherton PJ,
Staples AW, Prior T et al. (2011). Enhanced
amino acid sensitivity of myofibrillar protein
synthesis persists for up to 24 h after resistance
exercise in young men. J Nutr 141, 568573.
Coffey VG, Moore DR, Burd NA, Rerecich T,
Stellingwerff T, Garnham AP et al. (2011).
Nutrient provision increases signalling and
protein synthesis in human skeletal muscle
after repeated sprints. Eur J Appl Physiol 111,
14731483.
DAntona G, Ragni M, Cardile A, Tedesco L,
Dossena M, Bruttini F et al. (2010).
Branched-chain amino acid supplementation
promotes survival and supports cardiac and
skeletal muscle mitochondrial biogenesis in
middle-aged mice. Cell Metab 12, 362372.
Rowlands DS, Thomson JS, Timmons BW,
Raymond F, Fuerholz A, Mansourian R et al.
(2011). Transcriptome and translational
signaling following endurance exercise in
trained skeletal muscle: impact of dietary
protein. Physiol Genomics 43, 10041020.


C 2012 The Authors. The Journal of Physiology 
C 2012 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

4011

J Physiol 589.16 (2011) pp 40114025

The influence of carbohydrateprotein co-ingestion


following endurance exercise on myofibrillar and
mitochondrial protein synthesis
Leigh Breen1,5 , Andrew Philp2 , Oliver C. Witard1,4 , Sarah R. Jackman1 , Anna Selby3 , Ken Smith3 ,
Keith Baar2 and Kevin D. Tipton1,4
1

School of Sport and Exercise Sciences, University of Birmingham, Birmingham, UK


Functional Molecular Biology Lab, Neurobiology, Physiology and Behavior, University of California, Davis, CA, USA
3
School of Graduate Entry Medicine & Health, University of Nottingham, Derby, UK
4
Department of Sports Studies, University of Stirling, Stirling, UK
5
Department of Kinesiology, McMaster University, Ontario, Canada

The Journal of Physiology

Non-technical summary A single bout of exercise stimulates the production of new muscle
proteins. Furthermore, ingesting protein in close proximity to exercise enhances the metabolic
response. Long-term exercise training promotes muscle adaptation, and the mode of exercise
performed determines the type of proteins that are made. To date, the types of proteins that are
made when protein is ingested after endurance exercise are not known. We report that when
well-trained male cyclists ingest protein with a carbohydrate drink after a high-intensity ride,
production of proteins responsible for muscle contraction is increased. Proteins responsible for
aerobic energy production are not responsive to protein feeding. Furthermore, specific signals
within the muscle that control protein synthesis are responsive to protein ingestion, providing
a potential mechanism to underpin our primary findings. These results suggest that protein
feeding after intense endurance exercise may be important in maintaining the structural quality
and power generating capacity of the muscle.
Abstract The aim of the present study was to determine mitochondrial and myofibrillar
muscle protein synthesis (MPS) when carbohydrate (CHO) or carbohydrate plus protein (C+P)
beverages were ingested following prolonged cycling exercise. The intracellular mechanisms
thought to regulate MPS were also investigated. In a single-blind, cross-over study, 10 trained
cyclists (age 29 6 years, V O2 max 66.5 5.1 ml kg1 min1 ) completed two trials in a randomized
order. Subjects cycled for 90 min at 77 1% V O2 max before ingesting a CHO (25 g of carbohydrate)
or C+P (25 g carbohydrate + 10 g whey protein) beverage immediately and 30 min post-exercise.
A primed constant infusion of L-[ring-13 C6 ]phenylalanine began 1.5 h prior to exercise and
continued until 4 h post-exercise. Muscle biopsy samples were obtained to determine myofibrillar and mitochondrial MPS and the phosphorylation of intracellular signalling proteins.
Arterialized blood samples were obtained throughout the protocol. Plasma amino acid and urea
concentrations increased following ingestion of C+P only. Serum insulin concentration increased
more for C+P than CHO. Myofibrillar MPS was 35% greater for C+P compared with CHO
(0.087 0.007 and 0.057 0.006% h1 , respectively; P = 0.025). Mitochondrial MPS rates were
similar for C+P and CHO (0.082 0.011 and 0.086 0.018% h1 , respectively). mTORSer2448
phosphorylation was greater for C+P compared with CHO at 4 h post-exercise (P < 0.05).
p70S6KThr389 phosphorylation increased at 4 h post-exercise for C+P (P < 0.05), whilst eEF2Thr56
phosphorylation increased by 40% at 4 h post-exercise for CHO only (P < 0.01). The present study demonstrates that the ingestion of protein in addition to carbohydrate stimulates an


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

DOI: 10.1113/jphysiol.2011.211888

4012

L. Breen and others

J Physiol 589.16

increase in myofibrillar, but not mitochondrial, MPS following prolonged cycling. These data
indicate that the increase in myofibrillar MPS for C+P could, potentially, be mediated through
p70S6K, downstream of mTOR, which in turn may suppress the rise in eEF2 on translation
elongation.
(Received 6 May 2011; accepted after revision 25 June 2011; first published online 11 July 2011)
Corresponding author L. Breen: McMaster University, Department of Kinesiology, 1280 Main Street West, Hamilton,
ON, L8P 2P9, Canada. Email: breenl@mcmaster.ca
Abbreviations AMPK, AMP-activated protein kinase; CHO, carbohydrate-only; C+P, carbohydrate plus protein;
4E-BP1, eukaryotic initiation factor 4E binding protein 1; EE, endurance exercise; eEF2, eukaryotic elongation factor
2; MPS, muscle protein synthesis; mTOR, mammalian target of rapamycin; p38 MAPK, p38 mitogen-activated protein
kinase; p70S6K, 70 kDa S6 protein kinase; PRAS40, proline-rich Akt substrate 40 kDa; RE, resistance exercise.

Introduction
Endurance (EE) and resistance exercise (RE) training
regimens result in divergent phenotypic adaptations.
Whereas RE promotes muscle hypertrophy and an increase
in contractile force output (Jones & Rutherford, 1987;
Hartman et al. 2007), EE training is characterized by an
expansion of oxidative capacity, brought about through
an increase in the size and density of mitochondria and
accumulation of myosin heavy chain I (Holloszy, 1967;
Harber et al. 2002; Tarnopolsky et al. 2007). At the
metabolic level, the adaptation to exercise is determined
by summing the acute transcriptional (Pilegaard et al.
2000; Hildebrandt et al. 2003) and translational responses
(Wilkinson et al. 2008) to each exercise stimulus and
the subsequent increase in synthesis of muscle proteins
(Mahoney et al. 2005; Hawley et al. 2006; Tipton,
2008). Recently, Wilkinson and colleagues (2008) showed
the response of myofibrillar and mitochondrial muscle
protein synthesis (MPS) were dependent on the type of
exercise performed. Furthermore, the interaction of RE
and protein nutrition varies between different protein
fractions (Moore et al. 2009). Thus, it is important to
examine the response of different protein fractions in
order to determine whether a particular nutritional intervention elicits the desired effect following varied types of
exercise.
Whereas the response of mixed MPS to different types of
exercise has been investigated (Tipton et al. 1996; Phillips
et al. 1997; Harber et al. 2010), there is less information on
the response of various proteins to exercise and nutrition.
It is widely recognized that ingesting protein potentiates
the anabolic effect of RE (Tang et al. 2007), seemingly
due to the essential amino acid content (Tipton et al.
1999). Recently, Moore et al. (2009) showed that myofibrillar and sarcoplasmic proteins respond in a similar
manner to protein feeding; however, rates of synthesis of
only myofibrillar proteins were further increased when
RE was combined with protein ingestion. Similarly, myofibrillar, but not mitochondrial protein synthesis increased
in response to nutrient, including protein, ingestion

following repeated sprints (Coffey et al. 2010). To date,


no study has investigated the interactive effect of EE and
protein ingestion on different muscle protein fractions.
There are many studies demonstrating the response of
MPS to protein ingestion following RE (Phillips et al.
1997; Moore et al. 2009; Burd et al. 2010) but very few
studies have sought to determine the effect of protein
ingestion on MPS following EE. Levenhagen et al. (2002)
reported that adding protein to a carbohydrate treatment
increased post-EE leg and whole-body protein synthesis.
This increase in synthesis was associated with increased net
muscle protein balance. However, it was unclear whether
the benefits observed were due to the protein per se,
or an increase in total energy intake. To address this
possibility, Howarth and colleagues (2009) showed that
the addition of protein to carbohydrate increased mixed
MPS compared with CHO treatments matched for total
energy and carbohydrate content. Thus, it seems clear
that the rate of mixed MPS responds to protein ingestion
following EE, as well as RE. However, none of these
studies (Levenhagen et al. 2002; Howarth et al. 2009)
attempted to determine the specific protein fractions that
contribute to changes in mixed MPS in response to protein
ingestion or the mechanisms accounting for the response.
Recent evidence from Coffey et al. (2010) suggests that
nutrient provision prior to a high-intensity, repeat-sprint
bout of cycling increases the rate of myofibrillar MPS
in the post-exercise period. However, this finding may
have been influenced by the unique overload stimulus of
repeated sprint exercise, characterized by a greater rate of
force production and large disturbances to ion homeostasis (Coffey et al. 2009). Thus, our primary aim was
to investigate the impact of ingesting protein in addition
to carbohydrate on the response of myofibrillar and
mitochondrial protein synthesis rates following prolonged
EE.
Acute changes in transcription and translation that
occur following exercise regulate skeletal muscle protein
turnover through a number of intracellular signalling
proteins. The mammalian target of rapamycin (mTOR)
is a key regulator of translational control, integrating

C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

J Physiol 589.16

Carbohydrateprotein consumption for endurance athletes

environmental signals from nutrients and exercise to


control cell growth (Fingar et al. 2004). The activation of
mTOR signalling leads to the phosphorylation of downstream targets involved in mRNA translation initiation and
elongation (Bolster et al. 2003), e.g. p70 ribosomal protein
S6 kinase-1 (p70S6K). In concert with an increase in
mitochondrial MPS following EE, Wilkinson et al. (2008)
showed an increase in the phosphorylation of signalling
proteins in the mTORp70S6K pathway. Furthermore,
human (Ivy et al. 2008) and rat studies (Morrison et al.
2008) indicate that post-EE C+P ingestion increases the
phosphorylation of intermediates in the mTORp70S6K
pathway. To date, no study has characterized the response
of signalling proteins to changes in myofibrillar and
mitochondrial MPS following post-EE protein ingestion.
Hence, the secondary aim of the study was to elucidate
the potential intracellular signalling mechanisms (in
the mTORp70S6K pathway) regulating the response of
myofibrillar and mitochondrial MPS following post-EE
protein ingestion.

Methods
Participants

Ten well-trained, male cyclists were recruited from local


cycling clubs through advertisements. Their mean (SD)
age was 29 6 years, body mass was 77.2 6.5 kg,
maximal oxygen uptake was 66.5 5.1 ml kg1 min1 and
maximal power output was 383 25 W. Only cyclists who
undertook two or more training sessions per week of
15 h duration were eligible to participate. Participants
had 7.5 3.0 years of competitive cycling experience.
All tests were completed within a 4 week period with
both treatment trials separated by 1421 days, with the
exception of one participant who completed the second
trial 32 days after the first. The purpose and methodology
of the study were clearly explained to the participants.
All participants gave their informed consent prior to
taking part in the study and were deemed healthy based
on their response to a general health questionnaire. The
experimental protocol was approved by the Black Country
Research Ethics Committee (Rec No: 08/H1202/130). The
study conformed to the standards set by the Declaration
of Helsinki.

Study design

4013

Recovery Powder, GlaxoSmithKline, Brentford, UK).


During each trial participants performed a 90 min high
intensity, steady-state cycle before consuming CHO or
C+P immediately and 30 min following the exercise bout.
Mitochondrial and myofibrillar MPS were measured by
combining isotopic tracer infusion and muscle biopsy
techniques. Participants returned to the laboratory for the
second blinded trial 1421 days after the first trial, thereby
serving as their own control. Trial order was randomized
in a counter-balanced fashion.
Preliminary testing
Body mass. Body mass was determined to the nearest
0.1 kg. Each participant was weighed in their cycling
clothing without shoes on. Measurement of body mass was
repeated prior to each of the two testing visits to ensure
body mass remained constant throughout the study.
Maximal cycling test. Maximum oxygen uptake (V O2 max )
and maximal power output (W max ) were determined
using an incremental cycle test-to-exhaustion on an
electrically braked cycle ergometer (Lode Excalibur Sport
v. 2.0, Groningen, Netherlands). The test consisted of
a 3 min warm-up cycling at a self-selected cadence at
95 W followed by an increase of 35 W every 3 min until
volitional exhaustion. Breath-by-breath measurements
were taken throughout exercise using an OxyCon
Pro automated gas analysis system (Jaeger, Wurzburg,
Germany). The gas analysers were calibrated using a
4.99% CO2 15.01% O2 gas mixture (BOC Gases, Surrey,
UK) and the volume transducer was calibrated with a
3 litre calibration syringe. Heart rate (HR) was measured
continuously via telemetry using a HR monitor (Polar
S625X; Polar Electro Oy, Kempele, Finland). V O2 was
considered maximal if two of the four following conditions
were met: (1) a plateau in V O2 with further increasing
workloads (an increase of <2 ml min1 kg1 ); (2) a HR
within 10 beats min1 of the age predicted maximum
(220 bpm age); (3) a respiratory exchange ratio (RER)
of >1.05; and (4) a rate of perceived exertion (RPE)
greater than 17. The seat position, handlebar height and
orientation used during baseline testing were recorded
and replicated on subsequent visits to the laboratory.
All exercise bouts were conducted in thermo-neutral
conditions (21 C, 40% relative humidity).
Dietary analysis and control. Participants diet was

Participants reported to the laboratory on three


separate occasions. During the first visit maximal
aerobic fitness was determined. Approximately 2 weeks
later participants performed the first blinded trial
in which they consumed a carbohydrate (CHO) or
carbohydrateprotein beverage (C+P; Lucozade Sport

standardized for 48 h prior to each treatment. During


the preliminary testing phase, participants completed a
3 day food diary, representative of their average week
(2 weekdays and 1 weekend day). A questionnaire of
food preferences was also completed by participants.
Using an on-line diet planner (Weight Loss Resources,


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

4014

L. Breen and others

recorded over 2530 min, 5560 min and 8590 min of


the exercise bout (as described above). If participants
indicated during exercise that the workload was too
difficult and they were unlikely to complete the full
80 min, workload was lowered in 5% decrements to no
less than 65% W max . Air conditioning and a fan were
used when requested by participants. The exact settings
of the air conditioning/fan and the time of any change in
workload were recorded and replicated during the second
trial. Throughout each trial, participants were allowed to
drink water ad libitum. The amount of water consumed
throughout the course of the each trial was found to be
similar (1556 249 ml for CHO and 1674 233 ml for
C+P).

Peterborough, UK), each of the 3 days was logged and


energy and macronutrient intake was estimated. In our
study cohort the average total daily energy intake was
2787 164 kcal (5.3 0.4 g (kg BM)1 carbohydrate;
1.2 0.1 g (kg BM)1 fat; 1.5 0.2 g (kg BM)1 protein).
The food parcels given to each participant matched their
habitual energy and macronutrient intake. Participants
were instructed to refrain from caffeine and alcohol and
to consume only the food provided for them over the
2 days prior to arriving for each trial. Participants also were
asked to consume their final meal no later than 22.00 h to
ensure a 10 h fast prior to measuring myofibrillar and
mitochondrial protein synthesis rate. An identical 2 day
food parcel was provided to each participant prior to the
second trial.
Physical activity control. Participants were instructed to

Muscle biopsy and blood sampling. Using a 5 mm


Bergstrom biopsy needle, two muscle biopsies
(100150 mg of muscle tissue per biopsy) were
obtained from the same leg during each trial. The order
of biopsied leg was randomized and counterbalanced for
each trial. Prior to the exercise bout (15 min) under
local anaesthetic (1% lidocaine), the lateral portion of one
thigh was prepared for the extraction of a needle biopsy
sample from the vastus lateralis muscle. Biopsy incisions
were made prior to exercise to allow the sample to be
obtained as quickly as possible after exercise (5 1 min
post-exercise). Immediately after the post-exercise muscle
biopsy was obtained, participants were asked to consume
one of two treatment beverages described below. Four
hours after consuming the treatment beverage, the
second muscle biopsy was obtained (Fig. 1). The second
biopsy was taken 2 cm proximal to the first biopsy.
Biopsy samples were quickly rinsed in saline, blotted
and divided into two to three aliquots, before being
frozen in liquid nitrogen and stored at 80 C until later
analysis. Arterialized blood samples from a heated wrist
vein were collected at rest, immediately post-exercise
and every 15 min following beverage consumption for
2 h. Thereafter, blood samples were obtained at regular
intervals for the remainder of the infusion. Blood was
collected in ethylenediaminetetraacetic-containing,
lithium heparin-containing and serum separator tubes
and spun at 1,500 g for 15 min at 4 C. Aliquots of plasma
and serum were the frozen at 80 C for subsequent
analysis.

maintain their normal training volume and intensity


throughout the course of the study but to refrain from
training for 48 h prior to each treatment trial. To monitor
physical activity between trials, participants were asked to
record all training 7 days prior to each trial. No differences
were noted in training volume in the 7 days prior to each
trial.
Experimental trial protocol

Each participant was instructed to arrive at the Human


Performance Laboratory at 06.30 h after an overnight
fast, where standard measures of height and weight were
taken. A cannula was placed into the forearm vein of
one arm and a wrist vein of the other. The forearm
cannula was used to infuse a stable isotopic tracer whilst
the hand vein was heated for frequent arterialized blood
sampling (Abumarad et al. 1981). After a resting blood
sample had been obtained, participants then received a
primed constant infusion of L-[ring-13 C6 ] phenylalanine
(prime: 2 mol kg1 ; infusion: 0.05 mol kg1 min1 ;
Cambridge Isotope Laboratories, Andover, MA, USA) to
determine MPS (described below). Approximately 90 min
after the start of the infusion, having rested in a supine
position, participants were asked to complete a 90 min
cycling exercise bout on a Lode Cycle Ergometer at a
self-selected cadence 60 revolutions per minute (rpm).
The exercise bout consisted of a warm-up cycle at 50%
W max (189 4 W) for 10 min and then 80 min, initially
at 75% W max (283 6 W). V O2 , RER, HR and RPE were
Primed-continuous L-[ring-

6]

J Physiol 589.16

phenylalanine infusion

Exercise

Time (min) -180


Blood

Biopsy
Beverage

-120

-60

60

* * ******

120

180

240

*
Figure 1. Schematic diagram of the experimental
protocol

C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

J Physiol 589.16

Carbohydrateprotein consumption for endurance athletes

Treatment beverages. Immediately after the first muscle

biopsy sample was obtained, subjects ingested either


25.2 g of carbohydrate (CHO) or 25.4 g of carbohydrate
plus 10.2 g of whey protein isolate (C+P) dissolved in
250 ml of cold water (11 < 1 min post-exercise). A
second identical beverage was consumed 30 min after the
first beverage was finished. This dose regime provided
a total carbohydrate and protein intake of 50.8 g and
20.4 g, respectively, in C+P and a total carbohydrate
intake of 50.4 g in CHO. Participants were encouraged
to consume the beverages within 2 min. Both CHO
and C+P treatment beverages were matched for flavour
(orange and passion fruit) and appearance. Beverages
were administered to participants in a single-blinded
manner, the order of which was randomized. Eight out
of the 10 participants correctly identified the order of the
treatments. The amino acid content of the whey protein
was (as percentage content, w:w): Ala, 5.2; Arg, 2.2; Asp,
11.4; Cys, 2.3; Gln, 18.8; Gly, 1.5; His, 1.8; Ile, 6.7; Leu, 11;
Lys, 10; Met, 2.3; Phe, 3.1; Pro, 5.7; Ser, 4.8; Thr, 7; Trp,
1.5; Tyr, 2.7; and Val, 6.1. A small amount of L-[ring-13 C6 ]
phenylalanine tracer was added to the C+P drink (6%
of phenylalanine content) in order to minimize changes
in blood phenylalanine enrichment after drink ingestion.
The need to add isotopic tracer to the C+P beverage
dictated that the investigators were not blinded to the
treatment beverage order.

Analyses
Blood analyses. Plasma glucose, lactate and urea
concentrations were analysed using an ILAB automated
analyser (Instrumentation Laboratory, Warrington,
UK). Serum insulin concentrations were analysed
using a commercially available ELISA kit (IBL
International, Hamburg, Germany), following the
manufacturers instructions. L-[ring-13 C6 ]Phenylalanine
tracer-to-tracee (t/T) enrichment was determined
by gas chromatography, mass spectrometry (GCMS)
(model 5973; Hewlett Packard, Palo Alto, CA, USA).
Upon thawing, plasma samples were combined with
diluted acetic acid and purified on cation-exchange
columns (Dowex 50W-X8-200, Sigma-Aldrich, Poole,
UK). The amino acids were then converted to their
N -tert - butyldimethyl - silyl -N - methyltrifluoracetamide
(MTBSTFA) derivative. Plasma 13 C6 phenylalanine
enrichment was determined by ion monitoring at
masses 234/240. Appropriate corrections were made
for overlapping spectra contributing to the t/T ratio.
Phenylalanine, leucine and threonine concentrations
were determined using an internal standard method
(Tipton et al. 1999, 2001), based on the known volume
of blood and internal standard added. The internal standards used were U-[13 C9 15 N]phenylalanine

4015

(50 mol l1 ), U-[13 C6 ]leucine (120 mol l1 ) and


U-[13 C9 15 N]threonine (182 mol l1 ) added in a
ratio of 100 l ml1 of blood. Leucine, threonine and
phenylalanine concentrations were determined by
monitoring at ions 302/308, 404/409 and 336/346,
respectively.
Muscle tissue analyses. Muscle samples were analysed for

enrichment of L-[ring-13 C6 ] phenylalanine in the intracellular pool and bound myofibrillar and mitochondrial
protein fractions. Intracellular amino acids were liberated
from 20 mg of muscle. The tissue was powdered under
liquid nitrogen using a mortar and pestle and 500 l of
0.2 M perchloric acid (PCA) was added. The mixture was
centrifuged at 10,000 g for 10 min. The pH of the supernatant was then adjusted to 57 with 2 M KOH and 0.2 M
PCA and treated with 20 l of urease for removal of
urea. The free amino acids from the intracellular pool
were purified on cation-exchange columns (described
above). Intracellular amino acids were converted to their
MTBSTFA derivative and 13 C6 phenylalanine enrichment
determined by monitoring at ions 234/240 (as described
above) using GCMS.
Mitochondrial and myofibrillar protein isolation was
achieved using a protocol adapted from Wilkinson et al.
(2008). Approximately 70100 mg of muscle tissue was
homogenized in a 2 ml Eppendorf tube with a Teflon
pestle in 10 l mg1 of ice-cold homogenizing buffer
(0.1 mM KCl, 50 mM Tris, 5 mM MgCl, 1 mM EDTA,
10 mM -glycerophosphate, 50 mM NaF, 1.5% BSA, pH
7.5). The homogenate was spun at 1000 g for 10 min
at 4 C. The supernatant was transferred to another
Eppendorf tube and spun at 10,000 g for 10 min at
4 C to pellet the sarcoplasmic mitochondria (SMs).
The supernatant was then removed and discarded. The
pellet that remained from the original 1,000 g spin was
washed twice with homogenization buffer. A glass Dounce
homogenizer and tight fitting glass pestle were used
to forcefully homogenize the pellet in homogenization
buffer to liberate intermyofibrillar mitochondria (IMs).
The resulting mixture of myofibrillar proteins (MYO)
and IMs was spun at 1,000 g for 10 min at 4 C to pellet
out the MYO. The supernatant was removed and spun
at 10,000 g for 10 min at 4 C to pellet the IMs. The
MYO, SM and IM pellets were washed twice with homogenizing buffer containing no BSA. The MYO fraction
was separated from any collagen by dissolving in 0.3 M
NaCl, removing the supernatant and precipitating the
proteins with 1 M PCA. All samples were washed once with
95% ethanol. In order to determine 13 C6 phenylalanine
enrichment in the mitochondrial protein fraction, IM
and SM fractions were combined as per Wilkinson et al.
(2008). Mitochondrial and myofibrillar fractions were
then hydrolysed overnight at 110 C in 0.1 M HCl/Dowex


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

4016

L. Breen and others

50W-X8-200 (Sigma-Aldrich) and the constituent


amino acids purified on cation-exchange columns
(Dowex 50W-X8-200, Sigma-Aldrich). The amino acids
were then converted to their N -acetyl-n-propyl ester
derivative. Phenylalanine labelling was determined
by gas-chromatography-combustion-isotope ratio mass
spectrometry (GC-C-IRMS, Delta-plus XL, Thermofinnigan, Hemel Hempstead, UK) by monitoring at ions
44/45 for labelled and unlabelled CO2 . Unfortunately,
during processing two mitochondrial fraction samples
were lost, therefore these data represent an n = 8.
Western blots. The remaining muscle tissue (2540 mg)

was powdered on dry ice under liquid nitrogen using


a mortar and pestle. Approximately 20 mg of powdered
muscle was homegenized in 10 l of lysis buffer per
mg of powdered muscle (50 mM Tris pH 7.5; 250 mM
sucrose; 1 mM EDTA; 1 mM EGTA; 1% Triton X-100;
1 mM NaVO4 ; 50 mM NaF; 0.50% PIC), using a hand-held
homogenizer (PRO200, UK). Samples were shaken at
4 C for 30 min (12,000 rpm), centrifuged for 5 min
at 6000 g and the supernatant removed for protein
determination. Protein concentration was determined
using the DC protein assay (Bio-Rad, Hertfordshire, UK).
Equal aliquots of protein were boiled in Laemmli sample
buffer (250 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol;
0.01% bromophenol blue; 5% -mercaptoethanol) and
separated on SDS polyacrylamide gels (1012.5%) for 1 h
at 58 mA. Following electrophoresis proteins were transferred to a Protran nitrocellulose membrane (Whatman,
Dassel, Germany) at 100 V for 1 h. The membranes
were incubated overnight at 4 C with the appropriate
primary antibody. The primary antibodies used were
AMPKThr172 (cat. no. 15-115, Millipore, Billerica, MA,
USA), mTORSer2448 (2976, Cell Signaling Technology, Inc.,
Danvers, MA, USA), S6KThr389 (Cell Signaling 9234),
AktThr308 (Cell Signaling 4056), 4E-BP1Thr37 (SC6025,
Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA),
eEF2Thr56 (Cell Signaling 2332), PRAS40Thr246 (Cell
Signaling 2610) and p38 MAPKThr180 (Cell Signaling
9212). The following morning the membrane was rinsed
in wash buffer (Tris Buffered Saline with 0.1% Tween-20)
three times for 5 min. The membrane was then incubated
for 1 h at room temperature within wash buffer containing
the appropriate secondary antibody, either horseradish
peroxidase (HRP)-linked anti-mouse IgG (7072, New
England Biolabs, Inc., Ipswich, MA, USA; 1:1000) or
anti-rabbit IgG (New England Biolabs 7074; 1:1000).
The membrane was then cleared in wash buffer three
times for 5 min. Antibody binding was detected using
enhanced chemiluminescence (Millipore). Imaging and
band quantification were carried out using a Chemi
Genius Bioimaging Gel Doc System (Syngene, Cambridge,
UK). Intracellular signalling targets were determined with

J Physiol 589.16

n = 8 for CHO and C+P trials. Protein phosphorylation


was expressed relative to the total protein.
Calculations

The fractional synthetic rate (FSR) of mitochondrial and


myofibrillar proteins were calculated using the standard
precursorproduct method:
FSR (%h1 ) = E b /E p 1/t 100

(1)

Where E b is the change in bound 13 C6 phenylalanine


enrichment between two biopsy samples, E p is the precursor enrichment and t is the time between muscle
biopsies.
The true precursor enrichment would be the labelled
phenylalanine-tRNA (Baumann et al. 1994). However,
measurement of this enrichment requires large amounts
of tissue, which cannot typically be obtained from
human volunteers. Thus, the intracellular (IC) free
phenylalanine enrichment is commonly used in studies
(Tipton et al. 1999; Howarth et al. 2009; Moore et al.
2009), primarily because it often is considered to be the
best available correlate of muscle tRNA (Ljungqvist et al.
1997). Unfortunately, due to technical difficulties, the IC
enrichment was available for only five participants. Thus,
we chose to use the plasma precursor to estimate the IC
enrichment. A comparison of arterialized plasma and IC
enrichments from the samples available (n = 5) revealed
the IC enrichment to be 70 2% of the plasma (range
6777%). Furthermore, a comprehensive examination of
studies (e.g. Koopman et al. 2006; Beelen et al. 2008; Tang
et al. 2009) in which phenylalanine tracers were used to
determine fed-state FSR revealed the IC phenylalanine
enrichment to be 70% of the plasma enrichment. We
chose to use the IC enrichment estimated from the plasma
enrichment as the precursor for ease of comparison of the
results to other previously published studies (e.g. Tipton
et al. 1996; Howarth et al. 2009). However, FSRs also were
calculated with the unadjusted plasma precursor.
Statistics

A within-subject repeated measures design was utilized


for the current study. Exercise variables, blood analytes
and Western blot data were analysed using a two-way
ANOVA with repeated measures (treatment time) to
determine differences between each treatment beverage
across time. When a significant main effect or interaction
was identified, data were subsequently analysed using a
Bonferroni post hoc test. Myofibrillar and mitochondrial
FSR data were analysed using one-factor (treatment)
repeated measures ANOVA. All statistical tests were
analysed using statistical package for social sciences
(SPSS) v. 18.0 (Chicago, IL, USA). Significance for all

C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

Carbohydrateprotein consumption for endurance athletes

J Physiol 589.16

4017

Table 1. Exercise variables


CHO
Ex time (min)
HR (bpm)
Cadence (rpm)
V O2 (ml kg1 min1 )
%V O2 max
RER
RPE

2530
172
84
53.2
80
0.89
16

5
5
2.0
3
0.01
1

5560
172
79
50.7
77
0.87
17

3
5
2.0
2
0.02
1

C+P
8590
172
80
50.9
76
0.87
17

1
3
2.0
5
0.02
1

2530
174
84
52.6
79
0.91
16

4
4
1.9
2
0.01
1

5560
172
80
50.5
76
0.87
17

1
3
1.9
2
0.02
1

8590
171
79
50.9
77
0.87
18

2
5
2.6
3
0.01
1

Values are the average recording over each 5 min phase and are presented as mean SEM. Significant difference at 2530 min
compared with other time phases (P < 0.05).

analyses was set at P < 0.05. All values are presented as


means standard error of the mean (SEM).
Results
Exercise variables

There was no between-trial difference in heart rate,


cadence, V O2 and RER measured at 2530, 5560
and 8590 min of the steady state cycle (Table 1).
Average HR over the 90 min cycle was 172 3 and
172 4 bpm for CHO and C+P, respectively. Average
V O2 over 90 min (51.3 1.6 ml kg1 min1 for CHO
and 51.6 1.2 ml kg1 min1 for C+P) and RER over
90 min (0.88 0.01 for CHO and C+P) were not different
between treatments. Metabolic data indicated participants
were cycling at 77 1% of V O2 during CHO and C+P
trials. Average RPE over 90 min was similar for CHO and
C+P (16 4 for CHO and C+P).
Blood analytes

Fasted blood glucose was 5.1 0.3 mmol l1 and


5.3 0.3 mmol l1 for CHO and C+P, respectively
and remained similar immediately post-exercise.
Approximately 30 min after consuming the first treatment
beverage, plasma glucose concentration increased by
32% and 20% for CHO and C+P, respectively, with
no significant difference between treatments. Plasma
glucose concentration returned to basal values by 1.5 h
post-exercise for CHO and C+P and was constant
for the remainder of the trial. Fasted serum insulin
concentration was 6.0 0.8 and 5.5 0.5 U ml1 for
CHO and C+P, respectively (Fig. 2A). Following drink
ingestion, serum insulin concentration increased for
both CHO and C+P, peaking at 30 min post-exercise
(P < 0.001). Serum insulin increased to a greater extent
for C+P (285 32%) compared with CHO (60 8%;
P < 0.001). Serum insulin returned to basal values by
1.5 h post-exercise for CHO and C+P and remained
constant until the end of the trial. Following exercise,

plasma lactate concentration increased by 150 16% and


175 19% compared with resting values for CHO and
C+P, respectively (P < 0.001), with no difference between
treatments. Lactate concentration returned to basal values
by 3 h post-exercise for CHO and C+P. Resting plasma
urea concentration was similar for CHO and C+P and
was stable immediately post-exercise (Fig. 2B). Following
ingestion of C+P, plasma urea concentration increased
by 20 2% compared with resting values and remained
elevated at 4 h post-exercise (P < 0.05). Plasma urea
concentration remained unchanged for CHO compared
with resting values. From 15 min to 4 h post-exercise,
plasma urea concentration for C+P was significantly
greater than CHO (P < 0.05).
Plasma amino acid concentrations

Prior to and immediately post-exercise, plasma amino acid


concentrations of phenylalanine, leucine and threonine
were similar for CHO and C+P (Fig. 3). Following
ingestion of C+P, plasma concentrations of phenylalanine,
leucine and threonine increased by 37, 130 and 58%,
respectively (P < 0.001) and peaked at 1 h post-exercise
(30 min after the second drink was ingested), after
which, amino acid concentrations returned to basal
levels such that there were no differences between
CHO and C+P at 4 h post-exercise. Following CHO
ingestion, plasma phenylalanine, leucine and threonine
concentrations were reduced at 30 min compared with
immediate post-exercise values (P < 0.05). Phenylalanine
and threonine concentrations remained lower for the
remainder of the infusion. In contrast, plasma leucine
concentration returned to pre-exercise values by 150 min
post-exercise.
Plasma and intracellular 13 C6 phenylalanine
enrichment

Plasma 13 C6 phenylalanine enrichment increased from


immediately pre- to post-exercise (P < 0.05) but was


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

4018

L. Breen and others

stable across the time of tracer incorporation, immediately


post-exercise to 4 h post-exercise for CHO and C+P
(7.20 0.03% t/T for both; Fig. 4). These data
demonstrate that the additional tracer added to the C+P
treatment beverage did not appear in the circulation
more rapidly than the amino acids from the protein
and that all measurements were made at isotopic
equilibrium. Intracellular 13 C6 phenylalanine enrichment
for an available sub-set of participants (n = 5) was stable
across the time of tracer incorporation for CHO and C+P
(4.8 0.5 and 4.5 0.7% t/T, respectively; P > 0.05).
However, due to the small sub-set of available intracellular samples (n = 5) our calculations revealed intracellular phenylalanine enrichments for eight participants
would have been required to achieve sufficient statistical
power (0.8). Based on a close correlation between
available intracellular (n = 5) and plasma enrichments

A
Serum insulin concentration (U/mL)

40

C+P
CHO

J Physiol 589.16

(r = 0.63), the mean predicted intracellular enrichment


for the complete study cohort (n = 10) was 5.0 0.1
and 5.1 0.2% t/T for C+P and CHO, respectively.
Trial order did not influence the tracer enrichment in
plasma (7.0 0.3 and 7.4 0.2% t/T for trials 1 and
2, respectively; P = 0.2) or in the available intracellular
samples (4.5 0.4 and 4.8 0.3% t/T for trials 1 and 2,
respectively; P = 0.2).

Post-exercise protein phosphorylation

Immediately post-exercise, mTORSer2448 phosphorylation


was similar for CHO and C+P. At 4 h post-exercise
mTOR phosphorylation tended to increase for C+P
(P = 0.1), whereas mTOR phosphorylation tended to
decrease for CHO (P = 0.08). A group effect at 4 h

35
30

c
25

20
15

a
10
5

a
a

a
a

b
Exercise

a
a

0
-90

-60

-30

30

60

90

120

150

180

210

240

Time (min)

B
7

Plasma urea concentration (mmol/L)

CHO
C+P

*
b

b b

a
5

a a

a a

3
Exercise

0
-90

-60

-30

30

60

90

Time (min)

120

150

180

210

240

Figure 2. Serum insulin (A) and plasma urea (B)


concentrations in CHO and C+P trials
Means within each trial with different subscripts are
significantly different from each other (P < 0.05).
Significant difference between CHO and C+P at each
respective time point. Values are means SEM; n = 10.


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

J Physiol 589.16

Carbohydrateprotein consumption for endurance athletes

4019

Plasma phenylalanine concentration (mol/L)

100

c c c

CHO
C+P

90

bc
b
b

80

b
70

a
a
c

a
60

ab

ab

c
ac

a
b

50

ab

40
Exercise

0
-180

-120

-60

60

120

180

240

Time (min)

B
Plasma leucine concentration (mol/L)
(

350

CHO
C+P

300

b
250

200

ab
b

a
a

150

ab

ab

a
100

b b b
c c c

50

bc c

Exercise

0
-180

-120

-60

60

120

180

240

Time (min)

C
Plasma threonine concentration (mol/L)

Figure 3. Plasma concentrations of


phenylalanine (A), leucine (B) and threonine
(C)
Means within each trial with different subscripts
are significantly different from each other
(P < 0.05). Significant difference between CHO
and C+P (P < 0.05). Values are means SEM;
n = 10.

350
CHO
C+P

300

b
b

b b

250
200

a
a

a a

150

ab

100

ab

ab

b b b b b b

50
Exercise

0
-180

-120

-60

60
Time (min)


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

120

180

240

4020

L. Breen and others

post-exercise revealed mTOR phosphorylation was greater


for C+P compared with CHO (P = 0.02; Fig. 5A).
However, there was no group by time interaction
for mTOR phosphorylation. Immediately post-exercise,
eEF2Thr56 phosphorylation was similar for CHO and C+P.
At 4 h post-exercise phosphorylation increased 1.4-fold
for CHO compared with immediately post-exercise
(P = 0.02). Furthermore, eEF2 phosphorylation for CHO
was greater than C+P at 4 h post-exercise (P = 0.04;
Fig. 5B). Immediately post-exercise, p38 MAPKThr180
phosphorylation was similar for CHO and C+P. At
4 h post-exercise p38 MAPK phosphorylation was
unchanged for CHO and C+P (Table 2). Immediately
post-exercise, p70S6KThr389 phosphorylation was similar
for CHO and C+P. A time effect revealed p70S6K
phosphorylation was increased at 4 h for C+P compared
with immediately post-exercise (P = 0.05); however,
p70S6K phosphorylation was not significantly different
from CHO at 4 h (Fig. 5C). Immediately post-exercise,
4E-BP1Thr37 phosphorylation was similar for CHO and
C+P. At 4 h post-exercise 4E-BP1 phosphorylation
showed a tendency to increase for CHO and C+P
(P = 0.09) with no difference between treatments (Table
2). There was no difference in the phosphorylation
of AMPKThr172 , AktThr308 and PRAS40Ser246 immediately
post-exercise between CHO and C+P. Furthermore,
the phosphorylation of AMPK, Akt and PRAS40
remained unchanged from immediately post-exercise at
4 h post-exercise for CHO and C+P (Table 2).

Mitochondrial and myofibrillar FSR

Mitochondrial protein synthesis rates were similar for


CHO and C+P (95% confidence interval (CI): 0.060.12
and 0.060.10% h1 , respectively; Fig. 6). Myofibrillar

protein synthesis rates were 35% higher for C+P


compared with CHO (CI: 0.070.11 and 0.050.07% h1 ,
respectively; P = 0.025). Rates of mitochondrial and
myofibrillar protein synthesis were 30.2 0.9% lower
when the unadjusted plasma precursor was used in the
calculation of FSR for C+P and CHO (0.061 0.005 and
0.040 0.004% h1 , for myofibrillar FSR, respectively).
The difference in myofibrillar FSR between groups
remained significant with the unadjusted precursor
(P = 0.03).
Discussion
This is the first study to investigate the response of various
muscle protein fractions to protein ingestion after endurance exercise. The present study findings expand on
those of previous investigations (Levenhagen et al. 2002;
Howarth et al. 2009) to show that the addition of protein
to carbohydrate (C+P) ingestion following 90 min of
intense cycling by well-trained individuals stimulates an
increase in rates of myofibrillar muscle protein synthesis
(MPS) compared with carbohydrate alone (CHO). Interestingly, C+P did not increase mitochondrial MPS rates
compared with CHO. The mechanism facilitating the
adaptive response of myofibrillar MPS could potentially
be due to enhanced mRNA translation as evidenced by
differences (albeit marginal) in the phosphorylation of cell
signalling intermediates with C+P compared with CHO.
The response of myofibrillar MPS to hyperaminoacidaemia with protein ingestion is not unique
to post-exercise recovery from EE. Following RE, Holm
et al. (2010) recently demonstrated that myofibrillar
MPS increased in response to protein ingestion. No
measurement of mitochondrial protein synthesis was
made in that study. Additionally, an amino acid infusion

CHO
C+P

9
8
7

13

Plasma L-[ring- C6] phenylalanine


enrichment (% t/T)

10

J Physiol 589.16

6
5
4

Exercise

0
-90

-60

-30

30

60

90

120

150

Time post-exercise (min)

180

210

240

Figure 4. Enrichment of 13 C6
phenylalanine in plasma
% t/T: percentage of tracer-to-tracee ratio.
Values are means SEM; n = 10.


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

Carbohydrateprotein consumption for endurance athletes

J Physiol 589.16

increased myofibrillar MPS in resting muscle (Bohe


et al. 2001, 2003). In addition, Moore et al. (2009)
demonstrated that protein ingestion increased myofibrillar MPS at rest and after RE. Finally, increased myoC+P
CHO
0h 4h 0h
4h

mTOR2448

p - mTOR Ser2448 (Arbitrary units)

mTOR
2.0
1.8

0h Post-ex
4h Post-ex

1.6
1.4
1.2
1.0
0.8
0.0

C+P

CHO

C+P
0h

4h

CHO
0h

4h

eEF256

p - eEF2 Thr56 (Arbitrary units)

eEF2
1.2
1.0

0h Post-ex
4h Post-ex

0.8
0.6
0.4
0.2
0.0

C+P
C+P
0h 4h

CHO
CHO
0h 4h

S6K1389

C
p - p70 S6K Thr389 (Arbitrary units)

S6K1
1.6
1.4

0h Post-ex
4h Post-ex *

1.2
1.0
0.8
0.6
0.0

C+P

CHO

Figure 5. Post-exercise protein phosphorylation of


mTORSer2448 (A), eEF2Thr56 (B) and p70S6KThr389 (C)
Significant time effect for protein phosphorylation at 4 h compared
with 0 h post-exercise (P < 0.05). Significant group effect for
protein phosphorylation at 4 h post-exercise between CHO and C+P
(P < 0.05). Values are means SEM; n = 8.

4021

fibrillar protein synthesis was noted with protein ingestion


following repeated sprints (Coffey et al. 2010). Taken
together with our results, it seems clear that myofibrillar
protein synthesis rates are particularly sensitive to hyperaminoacidaemia from ingested protein.
Mitochondrial protein synthesis rates are increased by
EE with little response of myofibrillar proteins (Wilkinson
et al. 2008). Thus, it may seem logical that others
(Levenhagen et al. 2002; Howarth et al. 2009) have
assumed that an increase in mixed MPS reported with
post-EE protein ingestion would be due, primarily, to
mitochondrial proteins. However, this notion is not
supported by our data or others (Coffey et al. 2010).
Instead, it seems that the increase in mixed muscle
protein synthesis with protein ingestion immediately
following EE (Levenhagen et al. 2002; Howarth et al.
2009) is attributed more aptly to the increase in the myofibrillar protein synthesis rates. However, a contribution
of mitochondrial synthesis to the mixed muscle protein
response cannot be completely dismissed. Whereas we
studied mitochondrial protein synthesis in well-trained
cyclists, previous investigations demonstrated increased
mixed muscle protein synthesis in untrained subjects
(Levenhagen et al. 2002; Howarth et al. 2009). It has been
shown previously (Wilkinson et al. 2008) that training
reduces the response of mitochondrial protein synthesis
rates to exercise. Thus, it is possible that the exercise bout
maximized the acute response in these well-trained cyclists
causing a ceiling effect of mitochondrial MPS. Therefore,
although mitochondrial synthesis rates do not respond
to protein ingestion in our trained subjects, it is possible
that the increase in mixed muscle protein synthesis rates
reported previously (Levenhagen et al. 2002; Howarth et al.
2009) may have included a mitochondrial component.
Accordingly, whereas our data provide more information
regarding the impact of protein nutrition on the acute
stimulation of mitochondrial protein synthesis, clearly
there is much more to be learned.
The reason for this lack of response of mitochondrial
MPS to protein ingestion, in our hands, is not clear.
Moore et al. (2009) demonstrated that the synthesis
of the sarcoplasmic protein pool, composed mostly of
mitochondrial proteins, was increased by 70% with
protein ingestion, both at rest and following RE. Thus,
these results suggest that rates of mitochondrial MPS
increase in response to protein ingestion after RE. A
response of mitochondrial protein synthesis to protein
ingestion following RE, but not EE, seems somewhat
counterintuitive, particularly given that mitochondrial
protein synthesis responds to elevated amino acid levels at
rest (Bohe et al. 2001, 2003).
Despite the evident responsiveness of mitochondrial
protein synthesis rates to protein ingestion in other
situations (Bohe et al. 2001, 2003; Moore et al. 2009),
we and others (Coffey et al. 2010) were not able to


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

4022

L. Breen and others

J Physiol 589.16

Table 2. Post-exercise protein phosphorylation


Treatment
Time post-exercise (h)
AMPKThr172
AktThr308
4E-BP1Thr37
eEF2Thr56
mTORSer2448
P38 MAPKThr180
p70S6KThr389
PRAS40Ser246

CHO
0
1.40
0.80
1.71
0.65
1.53
0.65
1.13
0.83

CHO
4

0.04
0.02
0.07
0.11
0.21
0.07
0.06
0.12

1.36
0.73
1.77
0.91
1.40
0.62
1.20
0.80

C+P
0

0.06
0.02
0.09
0.11
0.07
0.10
0.04
0.13

1.45
0.74
1.66
0.71
1.49
0.61
1.17
0.70

C+P
4

0.06
0.03
0.08
0.08
0.12
0.14
0.03
0.08

1.33
0.77
1.77
0.75
1.58
0.64
1.32
0.72

0.05
0.05
0.07
0.07
0.13
0.08
0.06
0.06

CHO
Fold-change 04
0.95
0.92
1.03
1.40
0.91
1.15
1.06
0.97

0.03
0.04
0.02
0.11
0.09
0.21
0.04
0.08

C+P
Fold-change 04
0.89
1.04
1.04
1.05
1.05
1.28
1.13
1.03

0.08
0.04
0.02
0.12
0.05
0.08
0.05
0.08

Values are means SEM protein phosphorylation at 0 and 4 h post-exercise (arbitrary units) and fold-change over 4 h post-exercise.
Protein phosphorylation is expressed as a ratio of phospho to total protein. Significant increase in phosphorylation at 4 h compared
with 0 h post-exercise (P < 0.05). Significant difference between CHO and C+P at 4 h post-exercise (P < 0.05); n = 8.

detect an increase in response to protein following intense


cycling. However, we cannot dismiss the possibility that
the magnitude and/or duration of the response may
have been smaller than that which is detectable with
our current methods. In line with our data, a recent
study by Coffey et al. (2010) showed that when a mixed
macronutrient meal was ingested prior to a short bout of
high-intensity, repeat-sprint cycling, myofibrillar proteins
were preferentially synthesized in the post-exercise period,
with no effect on mitochondrial proteins. The precise
mechanism to explain the apparent synthesis of only myofibrillar proteins after nutrient ingestion in combination
with exercise should be investigated further.
Finally, it is possible that the lack of response may
be related to the temporal pattern of the response of
mitochondrial proteins to the exercise. This supposition
is supported by recent preliminary data suggesting that
mitochondrial protein synthesis is much greater at 24 h
than 6 h post-exercise (Burd, Phillips et al. personal
communication). Further support comes from evidence
that transcription of mitochondrial protein mRNA does
not produce elevated mRNA levels for several hours

CHO
C+P

Muscle protein FSR (%h-1)

0.12
0.10

0.08
0.06
0.04
0.02
0.00

Myofibrillar

Mitochondrial

Figure 6. Myofibrillar (n = 10) and mitochondrial (n = 8)


fractional synthetic rate
Significant difference between CHO and C+P (P < 0.05). Values are
means SEM.

after exercise at least for some proteins (Yang et al.


2005). Therefore, the stimulation of mitochondrial MPS
detected 24 h after exercise (Burd, Phillips et al. personal
communication) may be due primarily to translation of
the new mRNA. Thus, the stimulation of mitochondrial
protein synthesis may manifest itself far later than when
we made our measurements. However, it should be noted
that the 24 h response was following RE and, to our
knowledge, there are no data investigating the temporal
pattern of mitochondrial protein synthesis following EE.
Nevertheless, the acute increase in mixed muscle protein
synthesis following post-EE protein ingestion noted in
previous studies (Levenhagen et al. 2002; Howarth et al.
2009) may not be explained by an acute increase in
mitochondrial FSR.
Since training adaptations result, ultimately, from
the summation of the acute responses to exercise and
nutrition (Hawley et al. 2006), protein consumption may
potentiate this response. It is unclear from our results
what impact protein ingestion following cycling may
have on training adaptations. Increased myofibrillar MPS
is normally associated with increased muscle mass and
strength in the context of resistance training (Tipton, 2008;
Burd et al. 2009). Thus, our data could be interpreted
to suggest that protein ingestion following EE would
lead to increased muscle mass (and overall body weight)
with training, potentially decreasing the power-to-mass
ratio. Alternatively, it is possible that muscle hypertrophy may increase power output, thus offsetting the
increase in overall body weight. In support of this notion,
Hickson et al. (1980) showed that gains in thigh mass
after strength training, extended short-term endurance
capacity. Alternatively, EE training increases myosin heavy
chain I content, a key protein in type I fibres leading
to more fatigue resistant fibres (Harber et al. 2004;
Kohn et al. 2007). Thus, increased rates of myofibrillar
protein synthesis with protein intake after EE may be a
contributing factor to potentiate the adaptive response to
EE training. Additionally, elevated rates of myofibrillar

C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

J Physiol 589.16

Carbohydrateprotein consumption for endurance athletes

protein synthesis may simply reflect increased turnover


due to increased degradation of myofibrillar proteins.
Moderate intensity EE has been shown to stimulate muscle
protein breakdown during (Blomstrand & Saltin, 1999;
Van Hall et al. 1999) and immediately following exercise
(Sheffield-Moore et al. 2004); this is thought to be due,
at least in part, to increased breakdown of myofibrillar
proteins (Carraro et al. 1990). Therefore, the increase in
myofibrillar synthesis may be contributing to repair and
remodelling of proteins damaged during the bout. Thus,
enhanced myofibrillar protein synthesis with post-exercise
ingestion of protein may impact training adaptations
by one or more of several mechanisms. Clearly, these
mechanisms require more study.
The increase in myofibrillar MPS with post-EE protein
ingestion coincided with significant, albeit relatively
modest, alterations in the phosphorylation of factors
previously associated with increased mRNA translation
(Fingar et al. 2004). These findings were surprising
given that we were only able to determine signalling
phosphorylation at 0 and 4 h post-exercise and the
phosphorylation of signalling intermediates with anabolic
stimuli is relatively transient (Atherton et al. 2010;
Camera et al. 2010). EE is known to activate proteins
that regulate translation initiation (Mascher et al. 2007;
Wilkinson et al. 2008; Camera et al. 2010) (i.e. mTOR) and
elongation (Mascher et al. 2007) (i.e. eEF2) following EE.
In addition, ingestion of protein increases rates of MPS
via mTOR-p70S6K-mediated mechanism (Fujita et al.
2007). Previously, Ivy et al. (2008) demonstrated that
mTOR and rpS6 phosphorylation was greater when C+P
is ingested after EE as compared with a non-energetic
placebo. However, due to the study design, it was unclear
whether the effect of C+P was due to greater amino
acid availability, elevated plasma insulin or a combination
of the two. In contrast, an earlier experiment, in which
rats were fed immediately after an exhaustive swim
(Morrison et al. 2008) showed that the phosphorylation of
translational proteins was sustained with C+P ingestion
(Morrison et al. 2008). In line with these data, our
results show that protein ingestion after EE modified the
translational signalling response in the mTOR-p70S6K
pathway and, potentially, contributed towards prolonging
the effect of EE on protein synthesis. We also show
that eEF2 phosphorylation increased by 40% at 4 h
post-EE in the CHO group, whereas there was no change
with protein co-ingestion. Reduced phosphorylation of
eEF2, due to eEF2 kinase inhibition, results in a more
efficient translocation of the ribosome along the mRNA,
thereby contributing to faster elongation and greater
MPS (Carlberg et al. 1990). Our findings are further
supported by prior human (Fujita et al. 2007) and
cell culture (Wang et al. 2001) studies showing that
mTOR regulation of p70S6K is inversely related to
eEF2 phosphorylation. Together with an increase in

4023

initiation due to prolonged mTOR phosphorylation, the


suppression of eEF2 phosphorylation (and improved
elongation) may have contributed to the rise in myofibrillar MPS for C+P. Finally, we acknowledge that from
our findings it is unclear whether alterations in translational signalling with C+P are causative, or merely
associative with the increase in myofibrillar MPS.
In conclusion, we have shown that when protein
is co-ingested with carbohydrates after cycling exercise
myofibrillar, but not mitochondrial, protein synthesis is
increased. It is possible that frequent post-endurance
exercise protein ingestion may promote muscle hypertrophy over time. Thus, the implications of larger,
more powerful muscles for cyclists should be carefully
considered prior to making nutritional recommendations.
On the other hand, increased myofibrillar MPS may
enhance the synthesis of proteins associated with fatigue
resistance or may serve to counteract a fasted-state rise in
myofibrillar protein breakdown during and immediately
following endurance exercise. Thus, the maintenance
and structural integrity of contractile proteins may be
enhanced. Thus, we posit that post-endurance exercise
protein nutrition could have important implications
for the adaptive response to endurance exercise and,
potentially, the recovery of muscle function. Finally, the
synthetic response of different protein fractions to endurance exercise and protein ingestion may be dependent
on the individual training status, intensity and duration
of the exercise bout, as well as the timing and quantity of
post-EE nutrient strategies. Future studies should seek to
address these issues in greater depth.
References
Abumarad N, Rabin ND & Diamond MP (1981). Use of a
heated superficial hand vein as an alternative site for the
measurement of amino acid concentrations and for the study
of glucose and alanine kinetics in man. Metabolism 30,
936941.
Atherton PJ, Etheridge T, Watt PW, Wilkinson D, Selby A,
Rankin D, Smith K & Rennie MJ (2010). Muscle full effect
after oral protein: time-dependent concordance and
discordance between human muscle protein synthesis and
mTORC1 signaling. Am J Clin Nutr 92, 10801088.
Baumann PQ, Stirewalt WS, ORourke BD, Howard D & Nair
KS (1994). Precursor pools of protein synthesis: a stable
isotope study in a swine model. Am J Physiol Endocrinol
Metab 267, E203E209.
Beelen M, Tieland M, Gijsen AP, Vandereyt H, Kies AK,
Kuipers H, Saris WH, Koopman R & van Loon LJ (2008).
Coingestion of carbohydrate and protein hydrolysate
stimulates muscle protein synthesis during exercise in young
men, with no further increase during subsequent overnight
recovery. J Nutr 138, 21982204.
Blomstrand E & Saltin B (1999). Effect of muscle glycogen on
glucose, lactate and amino acid metabolism during exercise
and recovery in human subjects. J Physiol 514, 293302.


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

4024

L. Breen and others

Bohe J, Low A, Wolfe RR & Rennie MJ (2003). Human muscle


protein synthesis is modulated by extracellular, not
intramuscular amino acid availability: a doseresponse
study. J Physiol 552, 315324.
Bohe J, Low JF, Wolfe RR & Rennie MJ (2001). Latency and
duration of stimulation of human muscle protein synthesis
during continuous infusion of amino acids. J Physiol 532,
575579.
Bolster DR, Kubica N, Crozier SJ, Williamson DL, Farrell PA,
Kimball SR & Jefferson LS (2003). Immediate response of
mammalian target of rapamycin (mTOR)-mediated
signalling following acute resistance exercise in rat skeletal
muscle. J Physiol 553, 213220.
Burd NA, Holwerda AM, Selby KC, West DW, Staples AW, Cain
NE, Cashaback JG, Potvin JR, Baker SK & Phillips SM
(2010). Resistance exercise volume affects myofibrillar
protein synthesis and anabolic signalling molecule
phosphorylation in young men. J Physiol 588,
31193130.
Burd NA, Tang JE, Moore DR & Phillips SM (2009). Exercise
training and protein metabolism: influences of contraction,
protein intake, and sex-based differences. J Appl Physiol 106,
16921701.
Camera DM, Edge J, Short MJ, Hawley JA & Coffey VG (2010).
Early time-course of Akt phosphorylation following
endurance and resistance exercise. Med Sci Sports Exerc 42,
18431852.
Carlberg U, Nilsson A & Nygard O (1990). Functional
properties of phosphorylated elongation factor 2. Eur J
Biochem 191, 639645.
Carraro F, Stuart CA, Hartl WH, Rosenblatt J & Wolfe RR
(1990). Effect of exercise and recovery on muscle protein
synthesis in human subjects. Am J Physiol Endocrinol Metab
259, E470476.
Coffey VG, Moore DR, Burd NA, Rerecich T, Stellingwerff T,
Garnham AP, Phillips SM & Hawley JA (2010). Nutrient
provision increases signalling and protein synthesis in
human skeletal muscle after repeated sprints. Eur J Appl
Physiol 111, 14731483.
Coffey VG, Pilegaard H, Garnham AP, OBrien BJ & Hawley JA
(2009). Consecutive bouts of diverse contractile activity alter
acute responses in human skeletal muscle. J Appl Physiol 106,
11871197.
Fingar DC, Richardson CJ, Tee AR, Cheatham L, Tsou C &
Blenis J (2004). mTOR controls cell cycle progression
through its cell growth effectors S6K1 and
4E-BP1/eukaryotic translation initiation factor 4E. Mol Cell
Biol 24, 200216.
Fujita S, Dreyer HC, Drummond MJ, Glynn EL, Cadenas JG,
Yoshizawa F, Volpi E & Rasmussen BB (2007). Nutrient
signalling in the regulation of human muscle protein
synthesis. J Physiol 582, 813823.
Harber M, Gallagher PM, Trautman J & Trappe SW (2002).
Myosin heavy chain composition of single muscle fibers in
male distance runners. Int J Sports Med 23, 484488.
Harber MP, Gallagher PM, Creer AR, Minchev KM & Trappe
SW (2004). Single muscle fiber contractile properties during
a competitive season in male runners. Am J Physiol Regul
Integr Comp Physiol 287, R11241131.

J Physiol 589.16

Harber MP, Konopka AR, Jemiolo B, Trappe SW, Trappe TA &


Reidy PT (2010). Muscle protein synthesis and gene
expression during recovery from aerobic exercise in the
fasted and fed states. Am J Physiol Regul Integr Comp Physiol
299, R1254R1262.
Hartman JW, Tang JE, Wilkinson SB, Tarnopolsky MA,
Lawrence RL, Fullerton AV & Phillips SM (2007).
Consumption of fat-free fluid milk after resistance exercise
promotes greater lean mass accretion than does
consumption of soy or carbohydrate in young, novice, male
weightlifters. Am J Clin Nutr 86, 373381.
Hawley JA, Tipton KD & Millard-Stafford ML (2006).
Promoting training adaptations through nutritional
interventions. J Sports Sci 24, 709721.
Hickson RC, Rosenkoetter MA & Brown MA (1980). Strength
training effects aerobic power and short term endurance.
Med Sci Sports 12, 336339.
Hildebrandt AL, Pilegaard H & Neufer PD (2003). Differential
transcriptional activation of select metabolic genes in
response to variations in exercise intensity and duration. Am
J Physiol Endocrinol Metab 285, E1021E1027.
Holloszy JO (1967). Biochemical adaptations in muscle. Effects
of exercise on mitochondrial oxygen uptake and respiratory
enzyme activity in skeletal muscle. J Biol Chem 242,
22782282.
Holm L, van Hall G, Rose AJ, Miller BF, Doessing S, Richter EA
& Kjaer M (2010). Contraction intensity and feeding affect
collagen and myofibrillar protein synthesis rates differently
in human skeletal muscle. Am J Physiol Endocrinol Metab
298, E257269.
Howarth KR, Moreau NA, Phillips SM & Gibala MJ (2009).
Coingestion of protein with carbohydrate during recovery
from endurance exercise stimulates skeletal muscle protein
synthesis in humans. J Appl Physiol 106, 13941402.
Ivy JL, Ding Z, Hwang H, Cialdella-Kam LC & Morrison PJ
(2008). Post exercise carbohydrate-protein supplementation:
phosphorylation of muscle proteins involved in glycogen
synthesis and protein translation. Amino Acids 35,
8997.
Jones DA & Rutherford OM (1987). Human muscle strength
training: the effects of three different regimens and the
nature of the resultant changes. J Physiol 391,
111.
Kohn TA, Essen-Gustavsson B & Myburgh KH (2007). Exercise
pattern influences skeletal muscle hybrid fibers of runners
and nonrunners. Med Sci Sports Exerc 39, 19771984.
Koopman R, Verdijk L, Manders RJ, Gijsen AP, Gorselink M,
Pijpers E, Wagenmakers AJ & van Loon LJ (2006).
Co-ingestion of protein and leucine stimulates muscle
protein synthesis rates to the same extent in young and
elderly lean men. Am J Clin Nutr 84, 623632.
Levenhagen DK, Carr C, Carlson MG, Maron DJ, Borel MJ &
Flakoll PJ (2002). Postexercise protein intake enhances
whole-body and leg protein accretion in humans. Med Sci
Sports Exerc 34, 828837.
Ljungqvist O, Persson M, Ford GC & Nair KS (1997).
Functional heterogeneity of leucine pools in human skeletal
muscle. Am J Physiol Endocrinol Metab 273,
E564E570.


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

J Physiol 589.16

Carbohydrateprotein consumption for endurance athletes

Mahoney DJ, Parise G, Melov S, Safdar A & Tarnopolsky MA


(2005). Analysis of global mRNA expression in human
skeletal muscle during recovery from endurance exercise.
FASEB J 19, 14981500.
Mascher H, Andersson H, Nilsson PA, Ekblom B & Blomstrand
E (2007). Changes in signalling pathways regulating protein
synthesis in human muscle in the recovery period after
endurance exercise. Acta Physiol (Oxf) 191, 6775.
Moore DR, Tang JE, Burd NA, Rerecich T, Tarnopolsky MA &
Phillips SM (2009). Differential stimulation of myofibrillar
and sarcoplasmic protein synthesis with protein ingestion at
rest and after resistance exercise. J Physiol 587, 897904.
Morrison PJ, Hara D, Ding Z & Ivy JL (2008). Adding protein
to a carbohydrate supplement provided after endurance
exercise enhances 4E-BP1 and RPS6 signaling in skeletal
muscle. J Appl Physiol 104, 10291036.
Phillips SM, Tipton KD, Aarsland A, Wolf SE & Wolfe RR
(1997). Mixed muscle protein synthesis and breakdown after
resistance exercise in humans. Am J Physiol Endocrinol Metab
273, E99107.
Pilegaard H, Ordway GA, Saltin B & Neufer PD (2000).
Transcriptional regulation of gene expression in human
skeletal muscle during recovery from exercise. Am J Physiol
Endocrinol Metab 279, E806814.
Sheffield-Moore M, Yeckel CW, Volpi E, Wolf SE, Morio B,
Chinkes DL, Paddon-Jones D & Wolfe RR (2004).
Postexercise protein metabolism in older and younger men
following moderate-intensity aerobic exercise. Am J Physiol
Endocrinol Metab 287, E513522.
Tang JE, Manolakos JJ, Kujbida GW, Lysecki PJ, Moore DR &
Phillips SM (2007). Minimal whey protein with
carbohydrate stimulates muscle protein synthesis following
resistance exercise in trained young men. Appl Physiol Nutr
Metab 32, 11321138.
Tang JE, Moore DR, Kujbida GW, Tarnopolsky MA & Phillips
SM (2009). Ingestion of whey hydrolysate, casein, or soy
protein isolate: effects on mixed muscle protein synthesis at
rest and following resistance exercise in young men. J Appl
Physiol 107, 987992.
Tarnopolsky MA, Rennie CD, Robertshaw HA,
Fedak-Tarnopolsky SN, Devries MC & Hamadeh MJ (2007).
Influence of endurance exercise training and sex on
intramyocellular lipid and mitochondrial ultrastructure,
substrate use, and mitochondrial enzyme activity. Am J
Physiol Regul Integr Comp Physiol 292, R12711278.
Tipton KD (2008). Protein for adaptations to exercise training.
Eur J Sport Sci 8, 107118.
Tipton KD, Ferrando AA, Phillips SM, Doyle D Jr & Wolfe RR
(1999). Postexercise net protein synthesis in human muscle
from orally administered amino acids. Am J Physiol
Endocrinol Metab 276, E628634.
Tipton KD, Ferrando AA, Williams BD & Wolfe RR (1996).
Muscle protein metabolism in female swimmers after a
combination of resistance and endurance exercise. J Appl
Physiol 81, 20342038.

4025

Tipton KD, Rasmussen BB, Miller SL, Wolf SE, Owens-Stovall


SK, Petrini BE & Wolfe RR (2001). Timing of amino
acid-carbohydrate ingestion alters anabolic response of
muscle to resistance exercise. Am J Physiol Endocrinol Metab
281, E197206.
Van Hall G, Saltin B & Wagenmakers AJ (1999). Muscle protein
degradation and amino acid metabolism during prolonged
knee-extensor exercise in humans. Clin Sci (Lond) 97,
557567.
Wang X, Li W, Williams M, Terada N, Alessi DR & Proud CG
(2001). Regulation of elongation factor 2 kinase by
p90(RSK1) and p70 S6 kinase. EMBO J 20,
43704379.
Wilkinson SB, Phillips SM, Atherton PJ, Patel R, Yarasheski KE,
Tarnopolsky MA & Rennie MJ (2008). Differential effects of
resistance and endurance exercise in the fed state on
signalling molecule phosphorylation and protein synthesis
in human muscle. J Physiol 586, 37013717.
Yang Y, Creer A, Jemiolo B & Trappe S (2005). Time course of
myogenic and metabolic gene expression in response to
acute exercise in human skeletal muscle. J Appl Physiol 98,
17451752.

Author contributions
Data collection for the entire study was conducted at the School
of Sport and Exercise Sciences, University of Birmingham. All
analytical experiments were conducted at the School of Sport
and Exercise Sciences at the University of Birmingham, the
School of Graduate Entry Medicine & Health at the University of
Nottingham and the Functional Molecular Biology Laboratory
at he University of California, Davis. L.B., O.C.W., S.R.J.,
K.B. and K.D.T. contributed to the conception and design
of the experiment. L.B., A.P., O.C.W., S.R.J., K.B. and K.D.T.
contributed to the collection of the data. L.B., A.P., O.C.W.,
S.R.J., A.S., K.S., K.B. and K.D.T. contributed to the analysis and
interpretation of the data. L.B., A.P., O.C.W., S.R.J., K.S., K.B.
and K.D.T. contributed to drafting or revising the content of
the manuscript. All authors approved the final version of the
manuscript for publication. The authors declare no conflicts of
interest.

Acknowledgements
We would like to thank Daniel Moore, Debbie Rankin and
Robert Bagabo for cooperation during method development
and data analyses and Ms Lorna Webb for assistance during data
collection. We would also like to extend our appreciation to the
participants for their time and effort. This study was funded by
a research grant from GlaxoSmithKline Nutritional Healthcare,
Brentford, UK to K.D.T.


C 2011 The Authors. Journal compilation 
C 2011 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on August 30, 2014

ISSN 1414-431X
Volume 45 (10) 875-994 October 2012

BIOMEDICAL SCIENCES

www.bjournal.com.br

Braz J Med Biol Res, October 2012, Volume 45(10) 875-890


doi: 10.1590/S0100-879X2012007500096

Protein turnover, amino acid requirements and recommendations for


athletes and active populations
J.R. Poortmans, A. Carpentier, L.O. Pereira-Lancha and A. Lancha Jr.

The Brazilian Journal of Medical and Biological Research is partially financed by

Institutional Sponsors

Campus
Ribeiro Preto

Explore High - Performance MS


Orbitrap Technology
In Proteomics & Metabolomics
Faculdade de Medicina
de Ribeiro Preto
analiticaweb.com.br

S C I E N T I F I C

All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License

Brazilian Journal of Medical and Biological Research (2012) 45: 875-890


ISSN 1414-431X
Review

Protein turnover, amino acid requirements


and recommendations for athletes and
active populations
J.R. Poortmans1, A. Carpentier1, L.O. Pereira-Lancha2 and A. Lancha Jr.3
1Laboratory

for Biometry and Sport Nutrition, Faculty of Motor Sciences,


Free University of Brussels, Brussels, Belgium
2Departamento de Nutrio, Instituto Vita, So Paulo, SP, Brasil
3Laboratrio de Nutrio Aplicada Atividade Motora, Escola de Educao Fsica e Esporte,
Universidade de So Paulo, So Paulo, SP, Brasil

Abstract
Skeletal muscle is the major deposit of protein molecules. As for any cell or tissue, total muscle protein reflects a dynamic turnover
between net protein synthesis and degradation. Noninvasive and invasive techniques have been applied to determine amino
acid catabolism and muscle protein building at rest, during exercise and during the recovery period after a single experiment or
training sessions. Stable isotopic tracers (13C-lysine, 15N-glycine, 2H5-phenylalanine) and arteriovenous differences have been
used in studies of skeletal muscle and collagen tissues under resting and exercise conditions. There are different fractional
synthesis rates in skeletal muscle and tendon tissues, but there is no major difference between collagen and myofibrillar protein
synthesis. Strenuous exercise provokes increased proteolysis and decreased protein synthesis, the opposite occurring during
the recovery period. Individuals who exercise respond differently when resistance and endurance types of contractions are
compared. Endurance exercise induces a greater oxidative capacity (enzymes) compared to resistance exercise, which induces
fiber hypertrophy (myofibrils). Nitrogen balance (difference between protein intake and protein degradation) for athletes is usually balanced when the intake of protein reaches 1.2 gkg-1day-1 compared to 0.8 gkg-1day-1 in resting individuals. Muscular
activities promote a cascade of signals leading to the stimulation of eukaryotic initiation of myofibrillar protein synthesis. As
suggested in several publications, a bolus of 15-20 g protein (from skimmed milk or whey proteins) and carbohydrate ( 30 g
maltodextrine) drinks is needed immediately after stopping exercise to stimulate muscle protein and tendon collagen turnover
within 1 h.
Key words: Protein metabolism; Synthesis; Supplementation; Essential amino acids

General view of protein metabolism


In human beings, the body protein mass provides architectural support, enzymes to catalyze metabolic reactions,
signaling intermediates within and between cell tissues, and fuel
to support survival under extreme situations. Skeletal muscles
are the major deposit of protein molecules (about 40% of body
weight in young males with a 20-22 body mass index), and
nearly 60% of total body protein in humans. Other organs or
tissues contain protein, such as the liver, which synthesizes
plasma proteins (including albumin, which represents nearly
50% of liver proteins), immune cells (mainly leukocytes), digestive enzymes, bone, and dermal collagen (1). For any cell or
tissue, protein balance reflects the net protein synthesis and
protein degradation that differ significantly among tissues and

organs and between cell compartments.


As there is no protein storage pool, the human body faces
a delicate and dynamic balance that maintains homeostasis
in the presence of environmental challenges. Under resting
conditions, steady-state measurements of fuel turnover in
postabsorptive humans show a unique situation where,
as compared to carbohydrates and triglycerides, proteins
have the fastest turnover rate and the lowest oxidation rate
(Figure 1) (2).

Catabolic reactions and oxidation


The liver and, to a lesser extent, the kidney are the

Correspondence: A. Lancha Jr., R. Prof. Melo Moraes, 65, 05508-900 So Paulo, SP, Brasil. Fax: +55-11-3826-4908.
E-mail: lanchajr@hotmail.com
Received February 21, 2012. Accepted May 25, 2012. Available online June 8, 2012. Published September 3, 2012.
www.bjournal.com.br

Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

876

Figure 1. Rates of daily turnover and relative fuel oxidation in resting adults. FFA = Free fatty acids. Adapted
from Ref. 1.

principal sites of amino acid metabolism in humans. When


mammals are ingesting excess protein, amounts of amino
acids larger than needed for synthesis of proteins and other
nitrogen compounds cannot be stored or excreted and
the surplus is oxidized or converted to carbohydrate and
lipid. During amino acid degradation, the -amino group is
removed and the resulting carbon skeleton is converted
into a major metabolic intermediate. Most of the carbon
skeleton from amino acids is metabolized into pyruvate,
acetyl-CoA or one of the intermediates of the tricarboxylic
acid cycle (3).
The loss of the -amino group occurs by oxidative
deamination (using the enzyme glutamate dehydrogenase)
and transdeamination (using several aminotransferases
and glutamate dehydrogenase). Most of the amino acids
can be converted to their respective oxoacids by reactions
with aminotransferases (also called transaminases). All but
two (lysine and threonine) amino acids appear to be able to
be transaminated although it is not always clear how large
a part these reactions play in the normal degradation of
amino acids in the liver.
The reactions catalyzed by the aminotransferases
(using pyridoxal phosphate-vitamin B6 as a prosthetic
group) and by glutamate dehydrogenase (using NAD+ or
NADP+ as oxidizing agents) are close to equilibrium so that
2-oxoacids are provided, the overall process can be readily
Braz J Med Biol Res 45(10) 2012

reversed and amino acids can be synthesized as well as


degraded. The near-equilibrium transdeamination system
provides an easy mechanism whereby the concentrations
of both amino acids and 2-oxoacids are maintained fairly
constant despite variations in the magnitude and direction
of the metabolic flux through this system. The metabolism
of amino acids, in addition to adenosine, generates most
of the ammonia. Meanwhile, most tissues release nitrogen
mainly as alanine or glutamine in order to buffer the toxicity
of ammonia. The first reaction uses aminotransferase from
glutamate to pyruvate, and the second reaction transfers
the ammonia itself to glutamate and is catalyzed by glutamine synthetase.
Although a large proportion of the ammonia does not
arise from catabolism in the liver, the urea cycle occurs
exclusively in hepatic tissue and requires four molecules of
energy-rich phosphate for the synthesis of one molecule
of urea. In the human being, as much as 90% of urinary
nitrogen is in the form of urea.
The urea cycle appears to be regulated by non-equilibrium reactions, with the first reaction being the flux-generating
step. The synthesis of fumarate by the urea cycle is important
because it links the urea cycle and the tricarboxylic acid
cycle. In this respect, fumarate leading to oxaloacetate can
be converted to glucose by a gluconeogenesis pathway.
Many cells are capable of concentrating amino acids
www.bjournal.com.br

Protein requirements and exercise training

from the extracellular environment, but prior to intracellular metabolism, amino acids must be transported across
the cell membrane. This transport is mediated by specific
amino acid transporters, proteins that recognize, bind and
transport these amino acids from the extracellular medium
into the cell, or vice versa.
The skeletal muscles, the intestines and the liver are
particularly important for the disposal of excess amino
acids. Much of the nitrogen is channeled into only a few
compounds for transport between the tissues (mainly alanine and glutamine). Free amino acid deposition in muscle
often accounts for as much as 80% of the total amount in
the whole body. In contrast, plasma contains a very small
proportion of the total amino acid pool, ranging from 0.2 to
6% for individual amino acids.
The muscle free amino acid pool in a normal male
weighing 70 kg has been calculated to be about 86.5 g
excluding taurine and 121.5 g including taurine (3). The
latter compound is synthesized from cysteine, and taurine
is excreted as such or in the form of taurocholate or related
bile salts. In mammalian muscle tissues, taurine acts as a
membrane stabilizer and a modulator of the Ca2+ storage
capacity of the sarcoplasmic reticulum. Of the total pool
of human skeletal muscle free amino acids, the eight essential amino acids (EAA) represent only 8.4%, whereas
glutamine, glutamate, and alanine constitute nearly 79%.
Among the amino acids, the branched-chain amino acids
(leucine, isoleucine, and valine) are of particular interest as
60% of the total distribution of specific enzymes necessary
for their oxidation (-keto acid dehydrogenases) in humans
is located in skeletal muscle. These amino acids, unlike
most of the others, are taken up by the striated muscles
after a meal and partially oxidized in those tissues. In the
postabsorptive period of starvation, the human leg muscle
essentially releases alanine and glutamine (60% of the
total release).
Amino acid oxidation in muscle leads to an appreciable
amount of ATP generation. Assuming a common composition for the amino acids in muscle, the total balance of
amino acid degradation is: 1 mol amino acids + 5 mol O2
0.70 mol urea + 4.11 mol CO2 + 0.34 mol SO42- +
22.19 mol ATP. This equation also states that about 0.4
mol equivalent of glucose can be formed in the liver, or
72 g from the 110 g of mixed amino acids. The complete
oxidation of leucine, isoleucine and valine yields 43, 42,
and 32 mol ATP, respectively, per amino acid molecule.
However, the P/O ratio is only 2.4 compared to 2.8 for fats
and 3.1 for glycogen; thus, amino acids are not a good fuel
for maximum power production.
At present, it is rather difficult to precisely estimate the
energy balance from the daily supply of amino acids in
muscle tissue, especially in humans. However, ~90% of
the nitrogen derived from the branched-chain amino acids
(BCAA) is released as glutamine and only ~10% as alanine.
Jungas et al. (4) calculated the net ATP and acid-base
www.bjournal.com.br

877

balances associated with amino acid oxidation in skeletal


muscle and concluded that, under resting conditions, the
overall ATP balance amounts to ~4.5 mol excess ATP per
day, or about 50% of the total oxidation from amino acids
in muscle, small intestine, kidney and liver tissues taken
together. Again, this emphasizes the importance of muscle
mass in the energy balance of the whole organism. The
net effect of the oxidation of amino acids to glucose in
the liver is to make nearly two-thirds of the total energy
available from the oxidation of amino acids accessible to
peripheral tissues.

Methodology for protein turnover studies


Our scientific heritage in the study of protein metabolism started with Black (1756) and Rutherford (1772) who
observed the release of CO2 and NH3 in animal tissues,
respectively. Since then, the metabolic changes produced
by an intake of protein have been widely studied. Currently,
methodological approaches are based on the dilution of an
isotope tracer and its application to the calculation of the synthesis and turnover of whole-body and tissue proteins.
Mammalian organisms use a considerable amount of
energy in the basal or standard state when no net work
is being done and all free energy is dissipated. Proteins,
polymers of amino acids, are continuously degraded (catabolism) and renewed (anabolism) through numerous and
complex metabolic processes. Standard metabolic rate may
be defined as the steady-state rate of heat production by
the whole organism under standard conditions (awake
and resting).
Direct measurement of protein synthesis can provide
relevant information regarding the metabolic state of individual tissues. Direct incorporation methods using tracer
molecules have been used to measure the synthesis of
specific proteins. The principal method is to provide a known
amount of a labeled compound (tracer) to be mixed with the
endogenous pool of amino acids that is to be incorporated
into protein over time. Several techniques, both noninvasive
and invasive, have been used to analyze human protein
synthesis and breakdown during and after exercise.
Noninvasive techniques
2H O administration. Labeled water is administered
2
orally to the subjects (about 5 mL/kg body weight) (5).
The di-deutero-labeled water is rapidly dissociated to yield
mono-isotopically labeled water (2HHO), and the equilibrium
of 2H-labeled water with various amino acids leads to the
generation of singly labeled compounds. The uniqueness
of using 2H2O is that, unlike amino acids, which must gain
entry into the cells via transporters, 2H-labeling occurs
intracellularly (Figure 2) (5).
A few studies of the effects of feeding and exercise on
muscle protein synthesis (MPS) have been conducted in
mice, rats and human males (5).
Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

878

Figure 2. Precursor-product labeling methods to determine tissue protein synthesis. Adapted from Ref. 5.

Whole-body nitrogen balance. For many years the


whole-body nitrogen balance (NBal) has been the easiest
and fastest way to estimate the amount of protein intake
needed to cover the daily requirement of protein in a resting
human subject. The NBal was a simple equation: nitrogen
content of food intake (expressed as mg N from proteins)
- total nitrogen excretion (urine, feces, sweat). For practical reasons, the latter part of the equation was restricted
to urine N, with some correction from the two other origins.
Thus, NBal = 0 means an accurate daily protein intake.
Moreover, specifically the estimation of an adjusted intake
was obtained by comparison of the NBal values with the
daily intake of protein expressed as dry g/kg body weight.
The Institute of Medicine (USA) proposes a daily intake
of 0.8 g/kg to cover the total protein metabolism in resting
adults (6).
Despite the fact that urinary nitrogen is a validated
biomarker for dietary protein intake, there are several
uncertainties such as the validity of dietary assessments,
underreporting behaviors, measurement errors, and incomplete 24-h urine collection (7). Usually, several days (a
whole week of 7 continuous days) of recording intake and
at least two 24-h urine collections are needed to minimize
these biases. Completion of 24-h urine collection may
be validated with para-aminobenzoic acid (PABA), which
is actively absorbed and excreted in urine. The method
consists of three 80-mg tablets of PABA taken with meals.
Braz J Med Biol Res 45(10) 2012

Urine collections that contains 85% PABA can be classified as satisfactory. Additionally, this NBal method is rather
inexpensive compared to isotopic methods.
Invasive isotopic tracer methods to quantify protein
turnover
Radioactive (3H, 14C, 18N, and 11O) and stable isotopes
(2H, 13C, 15N, and 18O) have been used to study metabolism
in biological circumstances. The advantages and disadvantages of the use of stable isotopes as biological tracers were
analyzed by Halliday and Rennie (7). The major advantage
of the use of stable isotopes is the lack of ionizing radiation, being therefore safer and less toxic for humans. Their
disadvantages are the low range of measurement of stable
isotopes (less than 1%) as compared to stable elements, and
the high costs of chemical compounds and instrumentation.
These investigators noted that the enrichment of muscle
protein with [1-13C]-leucine using both isotope ratio and gas
chromatograph/mass spectrometer techniques permitted
the measurement of MPS during a total investigation time
of about 7 h. Whole-body steady-state tracer techniques
assume a simple two-pool model for protein metabolism
in which amino acids are either free or protein bound. But
there are more invasive methods that involve arteriovenous
catheterizations. Moreover, a recent publication by Smith
et al. (8) reviewed different tracer methods to evaluate human muscle protein turnover and the authors concluded
www.bjournal.com.br

Protein requirements and exercise training

that the variability of the reported values is due in part to


1) differences in experimental design (choice of tracer)
and 2) considerable within-subject variability. The lack of
consensus reflects the fact that measurement of human
protein metabolism in vivo has inherently difficult problems
to solve (inaccessible compartments, metabolically different
compartments).
Measurements of whole-body protein turnover from
the dilution of tracer amino acids in plasma. Stable isotopic tracers are administered as a priming dose and then
continuous intravenous infusion: 15N-glycine, 13C-lysine,
2H -phenylalanine. Nowadays, the 15N-glycine method
5
has been gradually replaced with 13C-lysine and 2H5phenylalanine. Isotopic enrichment at isotopic steady state
is analyzed from a few blood samples (see Ref. 9). Over
the years, 13C-lysine has become the reference method as
a tracer, and the isotopic enrichment of its transamination
product, -ketoisocaproic acid, is used as an estimate of
the intracellular isotopic dilution of the leucine pool.
Approaches to the measurements of tissue protein
synthesis using arteriovenous differences. Stable isotopically labeled tracers have been used to evaluate MPS.
This specific technique needs arteriovenous differences
and muscle biopsy samples. The low isotope enrichments of 13C-lysine and 2H5-phenylalanine perfusions are
measured by a combination of gas chromatography and
mass spectrometry giving access to MPS and balance
(10). However, as observed in human muscle tissues,
the metabolic fate and the fractional synthesis rate (FSR)
depend on the choice of the amino acid tracers (1,11). At
present, it is possible to evaluate the distinct muscle fractions
(myofibrillar, sarcoplasmic, mitochondrial) using different
separation techniques such as gel electrophoresis and
cation-exchange chromatography (1,12). A new technique
based on [5,5,5-2H3]-leucine perfusion and SDS-PAGE
separation is able to identify muscle fiber myosin heavy
chain, and therefore to distinguish slow- and fast-twitch
muscle fibers (13).
Jaleel et al. (14) reported a methodology based on
13C -phenylalanine labeling and two-dimensional gel elec6
trophoresis to measure synthesis rates of human multiple
muscle mitochondrial proteins. The in vivo synthesis rate of
individual skeletal muscle mitochondrial proteins in humans
was also measured after SDS-PAGE of anion exchange
HPLC extracts (15). Stable isotope techniques did study
the incorporation of labeled amino acids (13C-proline, 15Nproline) into tendon and ligament to study the kinetics of
human collagen (16,17).
Some more recent techniques for the measurement of
tissue turnover have been used in humans to precisely identify specific muscle protein modifications during exercise,
such as the mRNA activity of different contractile proteins.
However, due to post-translational adaptations, it is difficult
to quantitatively assume that the modified mRNA expression
is true valuable evidence of specific protein synthesis.
www.bjournal.com.br

879

Protein turnover in resting individuals


General view
The term turnover covers both the synthesis and breakdown of protein. In a steady-state condition, the energy cost
of protein synthesis will account for approximately 10% of
the basal oxygen uptake (18). Total protein synthesis in
adult human subjects is about 3.0 gkg-1day-1 while protein
turnover is about 5.7 gkg-1day-1 (18). Protein degradation
in human skeletal muscles estimated from the release of
tyrosine in the presence of insulin and amino acids is approximately 34 nmolh-1g wet weight-1. This degradation
rate corresponds to a half-life of approximately 20 days.
The optimal intakes of whole protein in the human diet
have been a matter of debate for many years (see Ref. 6).
The NBal data for healthy adult men and women increased
from 0.60 g/kg per 24 h in 1979 to 0.80 g/kg per 24 h in
2003. However, the recommended intake of protein is
higher for young children (1.2 g/kg at 1 year) and slowly
decreases for young adults (18 years). The energy cost of
protein turnover in healthy elderly humans (60-75 years) is
comparable to that of a young population, and correlates
with fat-free mass (18,19).
Vegetarians restrict their diet to plant food and may be
at risk of not getting adequate amounts of some indispensable amino acids (lysine, methionine, cysteine, threonine)
because the amount of protein in plant foods compared to
animal foods is inadequate. Moreover, plant proteins are
generally less digestible than animal proteins. Nevertheless,
available evidence does not support the recommendation
of a separate protein requirement for vegetarians who
consume complementary mixtures of plant protein (6).
We shall now focus our interest mainly on skeletal
muscle and collagen (tendon) tissues, which appear to be
quantitatively most important for physically active people.
Skeletal muscle tissues
Skeletal muscle tissue contains a few thousand specific
proteins, which could be classified as myofibrillar, sarcoplasmic and mitochondrial fractions. The myofibrillar proteins are
different molecules such as myosin heavy and light chains,
actin, tropomyosin, troponins (T, I, and C), titin, elastin, etc.
Sarcoplasmic proteins (which represent about 20-30%
of total muscle proteins) consist of glycolytic enzymes,
proteins of the sarcoplasmic reticulum (calsequestine,
calcium-ATPase, and others). Mitochondrial proteins in
muscle tissue consist of enzymes of the tricarboxylic acid
cycle, -oxidation, and mitochondrial respiratory chain. The
rate of myosin synthesis is lower than that of other muscle
fractions (Table 1).
Thus, it appears that the FSR of actin is more or
less 2-fold that of the myosin heavy chain. The precise
mechanism of this specificity remains unknown. The overall control of the size of human skeletal muscle mass has
been elegantly reviewed by Rennie et al. (20). Eventually,
Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

880

Boh et al. (21) concluded that the rates of synthesis


of all classes of muscle proteins (mixed, myofibrillar,
sarcoplasmic, mitochondrial) are acutely regulated by
the blood essential amino acid concentration over their
normal diurnal range, but become saturated at high concentrations (21). Thus, the stimulation of protein synthesis
depends on the concentration of extracellular rather than
intramuscular EAA.
Collagen tissues
Extracellular matrix located in tendon tissue ensures a
functional link between the skeletal muscle mass and the
bone. The extracellular matrix molecules consist of a variety
of glycoproteins most of which consist of proteoglycans
and collagen fibrils, the latter being predominant (60-85%)
(see Ref. 22). The fundamental building blocks of collagen
fibrils consist of three polypeptide -chains that compose a
triple helical structure. Collagen is 35% glycine, 21% proline
and hydroxyproline, and 11% alanine. This unusual amino
acid content is imposed by structural constraints unique to
collagen molecules.
Collagen is the most abundant single protein in most
vertebrates (humans included), constituting up to nearly
one third of the total protein mass. Collagen molecules
are not synthesized in muscle tissue but are synthesized
in fibroblasts, which are scattered within the tissue. Given
the importance of collagen to skeletal muscle function, the
knowledge of its quantitative synthesis rate was either ignored or estimated to be very slow. Over the last few years,
some studies have revealed that FSR of patellar tendon
collagen amounted to a mean value of 1.08% per day in
resting men, and nearly 30% less in women (23). When
comparing the FSR of collagen and myofibrillar proteins in
humans, there is no major difference as previously assumed,
but muscle collagen is not at all responsive to feeding (24).
Meanwhile, collagen synthesis is similar in muscle after
eccentric and concentric exercise (25).
Growth hormone (GH) and recombinant human GH
have no effect on human muscle size or MPS (26) but do
have a positive effect on strengthening the collagen matrix
in musculotendinous tissue (27).

Protein metabolism in exercising individuals


In 1974, Goldberg et al. (28) showed that the rate of
protein degradation depends upon the level of muscular
activity. Rennie et al. (29) provided further evidence that
severe physical exercise by adult humans is accompanied
by an increase in the rate of whole protein breakdown and
a decrease in the rate of synthesis. More information about
the development of data may be obtained from a review
(30). The measurement of 3-methylhistidine (3-MeHis)
in urine has been recognized as a useful, indirect, noninvasive technique to assess muscle protein breakdown
(MPB). The major site of endogenous 3-MeHis is the actin
Braz J Med Biol Res 45(10) 2012

Table 1. Protein fractional synthesis rates (FSR) in human


skeletal muscle (fasted state).
Muscle fractions
Myosin heavy chain
Actin
Sarcoplasm
Mitochondria

FSR (% per day)


0.90 0.08
1.80 0.19
1.29 0.20
1.94 0.10

Data are reported as means SD. Adapted from Ref. 1.

of all muscle fibers and the myosin of white muscle fibers


(see Ref. 30 for details). However, Rennie and Millward
(31) believe that urinary 3-MeHis is not a valid index of
skeletal muscle production of 3-MeHis. This is why researchers now use isotopic techniques to evaluate protein
turnover in human beings and to distinguish the effects
of resistance from endurance exercise and training in
skeletal muscle fibers (23,32-34) and tendons (17,23,35).
As stated by Kumar et al. (32), exercise is characterized
as either endurance/aerobic or resistance types. The
main operative distinction results in a phenotypic shift
towards a population of fibers with greater oxidative
capacity with endurance exercise, whereas repeated
resistance exercise induces fiber hypertrophy. However,
during exercise itself, both types of exercise depress MPS
with unchanged MPB.
Effect of resistance exercise
There are a few review publications related to the regulation of human MPS and MPB during and after resistance
exercise (32,36). We will have to differentiate the results
obtained in the fasted (postabsorptive condition) or fed state,
during or after exercise, for MPS or MPB, using different
modes of amino acids or protein supplementation.
The data in Table 2 clearly demonstrate that short-term
intense resistance exercises induce a greater increase in
the amount of mixed skeletal muscle protein at the end of
exercise. The differences between the reports may be the
result of methodological differences (see Invasive isotopic
tracer methods to quantify protein turnover) but, generally
speaking, the best results seem to be linked to the total
work output (80-90% of maximal contraction). Resistance
exercise seems to be more relevant regarding myofibrillar
proteins than sarcoplasmic protein synthesis (37). Moreover,
it appears that the increases in MPS persist up to 4 h after
the end of exercise. On the contrary, resistance exercise
does not seem to have a major effect on MPB.
The effect of feeding a mixed protein meal under resting conditions doubles MPS. Several publications have
reported the results of resistance exercise on human MPS
and breakdown (see Table 3).
Protein feeding has been applied after the end of exwww.bjournal.com.br

Protein requirements and exercise training

ercise. Under most, if not all conditions,


MPS has been enhanced by ingestion
of amino acids. The increase in MPS
is observed in mixed muscle, myofibrillar and sarcoplasmic fractions. The
enhanced amount of muscle proteins
depends on the quantity of the ingested
amino acids, the relative proportion
of EAA being either supplemented as
free EAA or as a major portion of whey
proteins (about 50% EAA). It appears
that MPS is increased when the amino
acids are ingested immediately after the
end of the exercise session (38). Rapid
aminoacidemia during the post-exercise
period enhances MPS and the anabolic
signals leading to the increase in muscle
protein mass. Moreover, it seems that a
bolus dose of 25 g is more efficient than a
series of small pulsed drinks (10 x 2.5 g)
(39). Both myofibrillar and sarcoplasmic
proteins may remain stimulated up to
3-5 h post-exercise (38-40) or even up
to 24 h in young men when the intensity
of exercise is high (41).

881

Table 2. Effect of resistance exercise on total muscle protein synthesis (MPS) and
muscle protein breakdown (MPB) under untrained conditions in a fasted state.
Exercise protocol

FSR (%/h)
FBR (%/h)
Post-Ex/Pre-Ex ratio Post-Ex/Pre-Ex ratio

Mixed muscle proteins


4 x 6-12 rep. 80% max
5 x 10 rep. 100% max
8 x 8 rep. 80% max
8 rep. 120% max
6 x 8 rep. 80% max
8 x 10 rep. 75% max
10 x 10 rep. 80% max
4 x 10 rep. 80% max
5 rep. 90% max
Myofibrillar proteins
5 rep. 90% max
Sarcoplasmic proteins
5 rep. 90% max

Reference

+49%*
+136%*
+140%*
+122%*
+30%*
+36%*
+50%*
+135%*
+350%*

+36%*
+40%*
NS
-

105
106
107
108
109
110
111
112
37

+330%*

37

+170%*

37

MPS and MPB are reported as their fractional synthetic rate (FSR) and fractional
breakdown rate (FBR), respectively. rep. = repetitions; max = % max power output;
Pre-Ex = pre-exercise; Post-Ex = post-exercise; (-) = not measured. *P < 0.05 compared to pre-exercise test. NS = no significant difference between pre- and post-exercise (P > 0.05).

Table 3. Effects of resistance exercise on human muscle protein synthesis (MPS) and muscle protein breakdown
(MPB) in the fed state.
Exercise protocol

Feeding protocol

FSR (%/h)
Post-Ex/Pre-Ex ratio

FBR (%/h)
Reference
Post-Ex/Pre-Ex ratio

Mixed muscle proteins


5 x 10 rep. 100% max
10 x 8 rep. 80% max
4 x 10 rep. 80% max
10 x 10 rep. 70% max
4 x 10 rep. 100% max
Myofibrillar proteins

10 g AA (iv)
6 g EAA (oral)
10 g whey + CHO (oral)
Leu EAA + CHO (oral)
40 g egg proteins (oral)

+121%*
+340%*
+130%*
+167%*
+90%*

NS
NS
-

113
114
98
84
43

5 x 10 rep. 80% max


20 x 10 rep. 75% max
stepping ex (+25% bw)
5 x 10 rep. 100% max
8 x 10 rep. 100% max
10 x 8 rep. 80% max
Sarcoplasmic proteins

1 g protein/kg (oral)
6 g protein/h (oral)
45 g EAA + CHO
25 g whey (oral)
25 g whey (oral)
0.3 g/kg LM whey

+83%*
+188%*
+221%*
+229%*
+193%*
+90%*

NS
-

43
115
116
40
39
38

20 x 10 rep. 75% max


5 x 10 rep. 100% max

6 g protein/h (oral)
25 g whey (oral)

+300%*
+104%*

115
40

MPS and MPB are reported as their fractional synthesis rate (FSR) and fractional breakdown rate (FBR), respectively.
Pre-Ex = pre-exercise; Post-Ex = post-exercise; max = % max power output; AA = amino acids; EAA = essential
amino acids; CHO = carbohydrate; LM = lean mass; (-) = not measured. *P < 0. 05 (post-exercise compared to preexercise). NS = no significant difference between pre- and post-exercise.
www.bjournal.com.br

Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

882

Effect of endurance exercise


Again, it is necessary to differentiate between the effect
of aerobic exercise under fasting or fed conditions. Table 4
summarizes the published data.
Endurance-type exercise seems to have less impact on
skeletal MPS compared to resistance exercise. This may
be due, at least in part, to post-exercise proteolysis of nonmyofibrillar proteins. Indeed, prolonged aerobic exercise (>1
h) induces a higher release of nitrogen both in blood and
urine (30). Apparently, MPS increases after the end of the
event and not during prolonged exercise (42).
Effect of exercise training on muscle protein
synthesis and breakdown in humans
According to Kumar et al. (32), it appears that chronic
resistance exercise increases mean muscle fiber crosssectional area and provokes muscle hypertrophy. Several
investigators have reported an enhanced basal rate of MPS
but it seems difficult to have a precise idea about these
changes due to the lack of information on the time course
of the last bout of exercise sessions during the training
schedule. However, an accurate report before and after 10
weeks of training indicated an increase in the basal synthesis of myofibrillar proteins under resistance exercise, while
endurance training enhanced basal mitochondrial protein

synthesis (43). Furthermore Meredith et al. (44) investigated


the effect of different regimes of protein intake (0.6, 0.9,
1.2 gkg-1day-1) during endurance training in men and
observed that the mean recorded NBal was equilibrated
for 0.94 gkg-1day-1. Nevertheless, 11 of the 12 subjects
had a positive balance of >1.2 gkg-1day-1.
Sex differences in muscle protein metabolism under
exercise conditions
The literature does not provide significant information
about a smaller muscle mass in women compared to men,
unless anabolic hormonal injections (such as testosterone)
are administered (45,46). Vingren et al. (47) speculated
about the differential effects of several hormones, such as
gonadotrophin-releasing hormone and adrenocorticotropic
hormone, which could explain the sex difference in muscle
mass. They concluded that testosterone plays only a minor
role in explaining the difference of muscle mass between
women and men. Moreover, Kumar et al. (32) did not report
differences in the basal or post-exercise rates of MPS or
MPB between young men and young women. In addition,
using two variable protein intakes, Pannemans et al. (48)
observed identical nitrogen balance and whole-body protein
turnover in young men and women. However, postmenopausal women have about 20-30% higher basal rates of

Table 4. Effect of endurance-type exercise on human muscle protein synthesis (MPS) and muscle protein breakdown
(MPB) in the fasted and fed states.
Exercise protocol
Fasted state
Mixed muscle proteins
Swimming 1.5 h
Swimming 2.7 h
Running 45 min, 45% max
Cycling 1 h, 70% VO2max
Fed state
Mixed muscle proteins
Cycling 2 h
Cycling 2 h, 55% Wmax
Cycling 3 h, 55% Wmax

Myofibrillar proteins
Cycling 45 min, 75% max
Leg ex. 1 h, 67% max

Food protocol

10 g protein/h + CHO
0.2 g proteinkg-1h-1
78 g protein + 234 g CHO

1.1 g protein/kg
1.4 BMR, 15% protein

FSR (%/h)
FBR (%/h)
Post-Ex/Pre-Ex ratio Post-Ex/Pre-Ex ratio

Reference

+42%*
+82%*
+80%*
+22%*

NS
-

109
109
117
54

+48%*
+84%*
+51%*

118
91
42

NS
+25%*

43
23

MPS and MPB are reported as their fractional synthesis rate (FSR) and fractional breakdown rate (FBR), respectively.
Pre-Ex = pre-exercise; Post-Ex = post-exercise; % max = % max power output; CHO = carbohydrate; BMR = basal metabolic rate; Wmax = maximal power; (-) = not determined. *P < 0.05 between pre- and post-exercise. NS = no significant
difference between pre- and post-exercise.

Braz J Med Biol Res 45(10) 2012

www.bjournal.com.br

Protein requirements and exercise training

MPS than men (49). Thus, there is still a need for further
investigation of the differential mechanisms.
Aging and muscle protein metabolism during
exercise
There is some controversy regarding the rates of basal
MPS in the elderly, with some investigators reporting reduced basal MPS rates compared to young men while others show that aging has no major effect on the basal rate
of MPS in healthy men (see Ref. 32). However, resistance
exercise training and appropriate nutrition can stimulate
MPS, although with a 30% lower response in older men than
in young men (50). Additionally, Haub et al. (51) observed
that resistance-trained older men (65 5 years) were able
to increase their muscle strength and size when total protein
intake was adequate (from 1.03 to 1.17 gkg-1day-1). There
is almost no data about the evolution of MPB in response
to exercise in elderly subjects. Nevertheless, it seems valuable and important to stimulate physical activity, with both
resistance and endurance intervals, to adequately reduce
the effect of aging on muscle metabolism.
Mechanisms leading to the regulation of muscle
protein synthesis
MPS and degradation are regulated by hormonal and
nutritional factors (2,20), which act on the sarcolemma
receptors and sarcoplasmic effectors that promote the
activation of translational initiation of protein synthesis.
Hormonal implications. Basically, four main hormones
appear to be the major effectors acting on body protein
metabolism: insulin, insulin-like growth factor-1 (IGF-1), testosterone, and GH. It is commonly reported that resistance
exercise of moderate to high intensity and volume induces
the blood release of IGF-1, testosterone and GH. However,
as mentioned previously, the exact role of testosterone in
resistance training programs is still hard to identify (47).
But an elegant report by West et al. (52) reveals that even
if transient resistance exercise induces increases in these
anabolic hormones, they do not enhance post-exercise
MPS. More recently, Phillips (53) estimated that anabolic
hormone intervention in the adaptation of MPS after resistance exercise is more likely to be chasing a hormonal
ghost. Thus, other local intramuscular mechanisms appear to monitor the acute effect of the MPS response after
resistance exercise.
Regulatory mechanisms of skeletal muscle protein turnover during exercise. Mechanical deformation of skeletal
muscle fibers induced by muscle contraction stimulates
several signals included in the sarcoplasm (2,32,33,43,5457). Among the regulators acting on gene expression are
amino acids, AMP-activated protein kinase (AMPK) (58),
mitogen-activated protein kinase (MAPK) (37), the mammalian target of rapamycin complex 1 (mTORC1) (59,60),
and the ribosomal S6 protein kinase 1 (S6K1) (61).
The EAA, mainly leucine (37,62,63) and glutamine (64),
www.bjournal.com.br

883

the most abundant muscle amino acid, act on several kinases to stimulate the initiation of protein synthesis translation.
A prominent signaling pathway that controls the regulatory
process of protein synthesis involves the phosphorylation
state of several regulatory proteins (AMPK, mTORC1, S6K1,
MAPK) leading to increased myofibrillar protein synthesis
after resistance exercise training and regulatory oxidative
enzymes during endurance training.
A simplified schematic diagram is proposed in Figure
3A and B. Acute changes in protein synthesis are primarily
regulated at the level of mRNA translation via translational
efficiency (37,65) (Figure 3A). However, over the last few
years, several publications have revealed that noncoding
RNAs, called microRNAs (miRNAs), control the development, function and adaptation of skeletal muscle (66)
through a post-transcriptional mechanism involving inhibition of translation and/or degradation of mRNA transcripts.
Several studies show that exercise is capable of modulating
miRNA levels, which play a central role in skeletal muscle
plasticity (see Ref. 67).
The miRNAs are defined as 21-30 small single-stranded
noncoding RNAs produced from hairpin-shaped precursors.
From a microRNA gene, a primary-miRNA (pri-miRNA) is
initially transcribed by RNA polymerase II in the nucleus
as long primary transcripts of several kilobases. Then, an
RNA II endonuclease cleaves the pri-miRNA into a 60-70
nucleotide (pre-miRNAs). An exportin-5-GTP transports
the pre-miRNA from the nucleus to the sarcoplasm where
it is cut by an RNA III enzyme into a 22 nucleotide mature
miRNA. Skeletal and cardiac muscles are highly enriched
in several miRNAs, named myomiR (miR). miR-206 is a
unique member of the myomiR family in that it is specifically
expressed in skeletal muscle. Kim et al. (68) suggested
that miRNA-206 negatively regulates DNA polymerase
translation, thereby inhibiting DNA synthesis. Thus, these
myomiR could block the formation of skeletal muscle mass.
Moreover, it is postulated that miR-206 has an important role
in regulating the expression of genes involved in satellite
cell specification during fiber type transitions in muscle.
A few reports on miRNA have been published recently
on the effect of endurance exercise training in human
subjects. Keller et al. (69) observed that endurance training
down-regulates several miRNAs targeting DNA sequences
involved in muscle differentiation (69). Additionally, Nielsen
et al. (70) reported that several myomiRs are down-regulated
between the end of the training period and two weeks of
cessation. Linear correlations were observed between peak
exercise levels of some blood circulating miR and VO2max
(71). Conversely, bed rest of only 7 days abolishes the
gene responses involved in exercise adaptation, such as
regulatory oxidative enzymes (72). However, there seems
to be higher and lower responders to microRNA expression
in skeletal muscle, which may explain that some subjects
are less prone to react to resistance training than others
(73). Finally, an important question remains: what is reguBraz J Med Biol Res 45(10) 2012

884

J.R. Poortmans et al.

lating myomiR transcription? The adaptation mechanism


remains unknown!
After stimulation by muscular activities (mechanical
stress, hormones, amino acids), there is a cascade of signals
starting with protein kinase B, MAPK (54) (Figure 3B). The
post-exercise feeding condition increases the phosphorylation of different signals leading to the simulation of eukaryotic initiation of myofibrillar proteins. These acute effects
contribute to positive changes in the 24-h muscle protein
balance and quantitatively predict phenotypic adaptations
with exercise training. However, what controls the upstream
transcriptional changes remains to be defined.

Practical feeding recommendations for


regular exercise practice
The information given here is directed at athletes or
regular exercising individuals who should ingest adequate
amounts of protein to maintain or increase their skeletal
muscle mass status. A joint position of the American College of Sports Medicine, the American Dietetic Association
and the Dietitians of Canada recommended protein intakes
for endurance- and strength-trained athletes from approximately 1.2 to 1.7 g/kg per day (74). However, the scientific
literature reveals a wide variety of practical conducts, which
promote the adaptation of muscle mass through specific
food applications: how much, with or without carbohydrates,
what type of protein, how, when? We shall try to separate
the wheat from the chaff.

Figure 3. Simplified schematic diagram of skeletal muscle protein


synthesis following exercise. A, The microRNA (miRNA) synthesis
pathway (see text). B, The metabolic cascade from protein kinase B
(PKB), mitogen-activated protein kinase (MAPK) to protein synthesis
(see text).
Braz J Med Biol Res 45(10) 2012

How much protein is needed?


There is mounting evidence that the timing of ingestion
and the protein source during recovery influence the extent
of muscle hypertrophy. Minor differences in muscle protein
turnover appear to exist between young men and women.
An adequate protein balance is the result of an equation
between the quantity of protein ingested per day and the
amount of protein utilized under exercise conditions. As
detailed previously, one could estimate this balance using
the N intake by food and the N release in waste (mainly
in urine). The NBal has been utilized for a long time (see
Ref. 30), even though this is not considered to be the most
accurate method. However, it represents an indirect method
to evaluate the daily balance between protein intake using
a daily food questionnaire and nitrogen release from protein
degradation (mainly muscle mass) by urine collection. Table
5 gives an example of NBal recorded in young athletes (75,
Poortmans JR, unpublished data).
Figure 4 shows the scattered distribution of NBal among
young orienteering athletes and bodybuilders engaged in
regular training. It appears that, under exercise conditions,
the general adult population can easily equilibrate its NBal
with a mean daily intake of 1.25 g protein/24 h. In one study
on young gymnasts, using both NBal and the 15N-glycine
technique, we were able to observe a positive net protein
www.bjournal.com.br

Protein requirements and exercise training

885

Table 5. Nitrogen balance (NBal) of athletes recorded using a food questionnaire (over
balance (+ 0.61 g protein/24 h) with
a 7-day survey) and urine nitrogen determination (mean of two 24-h collections over the
a mean protein intake of over 1.39 g
week).
protein/24 h during a training season
(76). Additional investigations on
Athletes (N)
Gender Age (years) NBal (mean SEM) NBal > than 0*
whole-body protein turnover (77) and
(g protein/24 h)
(g protein/24 h)
skeletal muscle fractional synthetic
rates in trained endurance humans
Running (5)
M
19-23
1.46 0.07
1.22
(78) suggest that a protein intake of
Rowing (10)
M
15-20
1.28 0.07
1.15
1.2 g/24 h (or 10-12% of total energy)
Cycling (12)
M
17-21
1.59 0.09
1.37
should achieve a positive NBal. A
Swimming (27)
M, F
11-18
1.52 0.14
1.50
recent survey by Slater and Phillips
Gymnastics (13)
F
8-11
1.61 0.36
1.39
(79) reported a protein intake that
Gymnastics (9)
F
15-16
1.12 0.18
0.85
ranged from 1.1 to 3.3 g/24 h among
Basketball (14)
M
19-39
1.74 0.13
1.18
adult male strength and power athletes
Aerobic (16)
F
19-33
1.23 0.05
1.17
during their training. However, as menOrienteering (15)
M
22-34
1.35 0.12
1.30
tioned above, there is no evidence that
Bodybuilding (19)
M
25-36
1.94 0.13
1.30
even these strength athletes absorb
more than 1.25 g protein/24 h.
Mean food protein intake (g/kg body weight) per 24 h were compared to total protein
How much protein is safe? A daily
excretion (g/kg body weight) per 24 h to evaluate total nitrogen balance. The needed
intake of 8-12% protein seems to be
minimal protein intake per day was evaluated in each athlete group when NBal was equal
adequate and well balanced over the
to zero. *Positive NBal for all subjects investigated. Source: unpublished data from J.R.
Poortmans. M = male; F = female.
entire life span (80). But would excess
protein and amino acid intake have
detrimental effects on the human organism? Already in
1981, Waterlow and Jackson (18) stated that excess dietary
protein is immediately oxidized. Probably most nephrologists
and internal medicine practitioners should be concerned
about excess protein intake. Consumption of high-protein
diets by humans may have relevance to the occurrence of
osteoporosis and hypercalciuria. We evaluated the consequences of excess protein intake on glomerular filtration rate
(creatinine clearance), glomerular membrane permeability
(albumin urine excretion) and calcium metabolism (calcium
urine excretion rate) (75). Protein intake below a mean of 2.8
g protein/24 h does not impair renal function in well-trained
athletes, as indicated by measures of renal function. But
all excess protein intake results in a waste of money and a
higher nitrogen excess (essentially urea) in the organism.
Protein supplementation under exercise conditions should
be addressed to stimulate net MPS, and more specifically,
the optimal proportion of EAA (81,82).

With or without carbohydrate?


It has been reported that hyperinsulinemia stimulates
MPS rates (83-85) and inhibits protein breakdown (86),
leading to protein accretion. A post-exercise feeding strategy
that provides 1.2 g carbohydratekg-1h-1 seemed to improve
muscle fractional synthetic rate (85), but another study
concluded that carbohydrate does not augment exerciseinduced protein accretion versus protein alone (87). The
current literature remains equivocal in terms of post-exercise
protein accretion, with or without carbohydrate addition. A
recent predominant argument has been proposed to reach
a conclusive statement (88). In summary, this statement
means that athletes involved in regular training could add
www.bjournal.com.br

Figure 4. Distribution of nitrogen balance (NBal) among basketball


players (filled dots) and orienteering runners (open dots over 1-week
survey. The zero line indicates an equal balance between nitrogen
intake (by protein nutrition) and nitrogen excretion (by metabolic oxidations) over 24 h. Reproduced from Ref. 75, with permission.

some carbohydrate to their protein supplement since they


have to keep a balanced diet both to replenish their glycogen
store and to stimulate their muscle protein accretion.
What type of protein?
Animal or plant protein, all 20 amino acids, EAA, and
Braz J Med Biol Res 45(10) 2012

886

single leucine have been supplemented under resting


conditions and mainly after exercise. Under resting conditions, Boirie et al. (89) demonstrated that dietary amino
acid absorption is faster with whey protein than with casein,
but there were no differential metabolic effects on skeletal
muscle breakdown and synthesis when comparing feeding with casein or soy protein (90). As mentioned earlier,
supplementation during exercise does not act on protein
synthesis (91). But there is a total consensus that feeding
during the recovery period from exercise induces muscle
protein accretion. Let us remember, once more, that skeletal
muscle represents about 40% of total mass and that nearly
80% of the three BCAA (leucine, isoleucine and valine) are
located in muscle mass.
Quite reasonably, skimmed milk supplementation ( 18
g protein) has been proposed to athletes after resistance
exercise (92-95). These publications showed greater lean
mass accretion and functional performance induced by
skimmed milk beverages. Whey proteins, or whey components, have been proposed as they contain nearly 50%
of the EAA and about 26% of the BCAA. Moreover, whey
proteins are obtained from skimmed milk after precipitation
of casein, the latter being less digestible by humans. Different research teams used whey proteins to supplement
athletes after resistance exercise to foster MPS (38,40,9698). All these publications but one (38) concluded that an
oral bolus of whey protein (10-48 g, or 0.3 g/kg lean body
mass) taken immediately after resistance exercise stimulates MPS, and more specifically the myofibrillar protein
fraction up to at least 6 h post-exercise (40). There is a
general consensus indicating that whey protein increases
and prolongs the mTORC1 signaling response. In fact,
whey protein and its high leucine component stimulate
the reversible phosphorylation of mTORC1 and 70-kDA
ribosomal S6K1, thereby up-regulating the control mRNA
binding to the 40S ribosomal subunit.
Why choose whey protein over other protein solutions
(whole milk, EAA, soy, wheat, beef)? When compared to
casein or whole milk, whey is more rapidly absorbed by the
intestinal tract. Moreover, following resistance exercise,
MPS is greater with whey protein than with casein or soy
proteins. Already in 2003, Boh et al. (21) demonstrated
that human MPS is modulated by the extracellular (blood
concentration) availability of EAA, and several publications have confirmed this observation following resistance
exercise (39,84,99). However, these EAA beverages (with
or without leucine enrichment) are more costly than whey
protein products. Eventually, whey may also improve immune function and have gastrointestinal health benefits for
physically active people.
And what about wheat protein from cereals, or beef
proteins? Wheat contains moderate amounts of protein
(8-12%) mainly composed of storage proteins (gluten, 8085% of total wheat protein), with a deficiency of EAA (lysine,
threonine). Moreover, wheat protein has a lower postprandial
Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

nitrogen retention compared to animal protein. Haub et al.


(51) analyzed the effect of beef protein versus soy protein
sources on resistance-trained older men (65 5 years) and
concluded that muscle strength and size were not influenced
by a predominant source of protein with adequate total
protein intake (a mean of 1.1 g protein/24 h).
Would exercise be implicated in collagen MPS modifications? A study by Holm et al. (100) showed no effect of
feeding (17% milk protein) on resting muscle collagen FSR
(100). In addition, they realized that feeding after exercise
also had no effect on intramuscular collagen synthesis.
This suggests that the connective tissue collagen is differently regulated compared to the contractile structure in
response to nutrients.

Concluding remarks and proposals


In 2001, Rennie (101) suggested that muscle is
acutely sensitive to amino acids, that exercise probably increases the anabolic effects of amino acids by a
separate pathway, and that for this reason, it is unlikely
that accustomed physical exercise increases protein
requirements. This view was repeated in 2009 stating
that although not yet proven, it seems likely to us that
any high-quality protein source, such as beef, egg, or
soy, will be as good as milk for muscle protein accretion
(32). Moreover, the Institute of Medicine of the National
Academies in its Dietary Reference Intakes concluded
that no additional dietary protein is suggested for healthy
adults undertaking resistance or endurance exercise (6).
The numerous publications cited in the previous sections
might be evidence contradicting these two proposals.
Thus, let us be more convincing!
Indeed, the FAO/WHO estimates of adult protein
requirements using nitrogen balance have evolved from
0.60 gkg-1day-1 in 1973 to 0.75 in 1985, and the 2005
requirements from the Institute of Medicine reached a value
of 0.80 gkg-1day-1. However, those recommendations are
focused on individuals with moderate- or medium-intensity
physical activity. The many observations and suggestions
from different research teams insist on a well-balanced
diet for athletes that meets energy demands with varied
sources of high-quality protein (102). The daily amount of
protein should represent between 12 and 15% of the total
energy requirement. As shown above, timing of ingestion,
co-ingestion of nutriments and the type of protein may all
influence protein accretion (103). Thus, a reasonably higher
protein intake may be appropriate for some athletes (104) but
we are convinced that an appropriate diet survey should be
applied for several days, together with nitrogen-balance assays, to evaluate the real need for protein intake. It appears
that a mean protein intake of 1.25 gkg-1day-1 is sufficient to
compensate for the enhanced muscle protein degradation
during prolonged exercise sessions (resistance and endurance types). As suggested by several publications, a bolus
www.bjournal.com.br

Protein requirements and exercise training

of 15-20 g protein drink may be needed immediately after


stopping exercise to stimulate muscle protein and tendon
collagen turnover. Let us also keep in mind that any excess
protein intake is useless.

887

Acknowledgments
We are highly indebted to Jessica Bates (FSM) for her
careful reading and English correction of our manuscript.

References
1. Guillet C, Boirie Y, Walrand S. An integrative approach to in
vivo protein synthesis measurement: from whole tissue to
specific proteins. Curr Opin Clin Nutr Metab Care 2004; 7:
531-538.
2. Liu Z, Barrett EJ. Human protein metabolism: its measurement and regulation. Am J Physiol Endocrinol Metab 2002;
283: E1105-E1112.
3. Bergstrom J, Furst P, Hultman E. Free amino acids in muscle
tissue and plasma during exercise in man. Clin Physiol 1985;
5: 155-160.
4. Jungas RL, Halperin ML, Brosnan JT. Quantitative analysis
of amino acid oxidation and related gluconeogenesis in
humans. Physiol Rev 1992; 72: 419-448.
5. Gasier HG, Fluckey JD, Previs SF. The application of 2H2O
to measure skeletal muscle protein synthesis. Nutr Metab
2010; 7: 31-38.
6. Institute of Medicine of the National Academies. Dietary
reference intakes for energy, carbohydrate, fiber, fat, cholesterol, protein, and amino acids. Washington: The National
Academies Press; 2005.
7. Halliday D, Rennie MJ. The use of stable isotopes for diagnosis and clinical research. Clin Sci 1982; 63: 485-496.
8. Smith GI, Patterson BW, Mittendorfer B. Human muscle
protein turnover - why is it so variable? J Appl Physiol 2011;
110: 480-491.
9. Darmaun D. Mthodes dtudes du mtabolisme des acides
amins in vivo chez lhomme: approches cintiques par les
isotopes stables. Nutr Clin Mtabol 1994; 8: 81-91.
10. Katsanos CS, Chinkes DL, Sheffield-Moore M, Aarsland A,
Kobayashi H, Wolfe RR. Method for the determination of the
arteriovenous muscle protein balance during non-steadystate blood and muscle amino acid concentrations. Am J
Physiol Endocrinol Metab 2005; 289: E1064-E1070.
11. Smith GI, Villareal DT, Mittendorfer B. Measurement of human mixed muscle protein fractional synthesis rate depends
on the choice of amino acid tracer. Am J Physiol Endocrinol
Metab 2007; 293: E666-E671.
12. Burd NA, West DW, Rerecich T, Prior T, Baker SK, Phillips
SM. Validation of a single biopsy approach and bolus protein
feeding to determine myofibrillar protein synthesis in stable
isotope tracer studies in humans. Nutr Metab 2011; 8: 1523.
13. Dickinson JM, Lee JD, Sullivan BE, Harber MP, Trappe SW,
Trappe TA. A new method to study in vivo protein synthesis
in slow- and fast-twitch muscle fibers and initial measurements in humans. J Appl Physiol 2010; 108: 1410-1416.
14. Jaleel A, Nehra V, Persson XM, Boirie Y, Bigelow M, Nair KS.
In vivo measurement of synthesis rate of multiple plasma
proteins in humans. Am J Physiol Endocrinol Metab 2006;
291: E190-E197.
15. Jaleel A, Short KR, Asmann YW, Klaus KA, Morse DM, Ford
GC, et al. In vivo measurement of synthesis rate of individual

www.bjournal.com.br

16.

17.

18.
19.
20.
21.

22.
23.

24.
25.

26.
27.

28.

29.

skeletal muscle mitochondrial proteins. Am J Physiol Endocrinol Metab 2008; 295: E1255-E1268.
Babraj JA, Cuthbertson DJ, Smith K, Langberg H, Miller B,
Krogsgaard MR, et al. Collagen synthesis in human musculoskeletal tissues and skin. Am J Physiol Endocrinol Metab
2005; 289: E864-E869.
Kjaer M, Langberg H, Heinemeier K, Bayer ML, Hansen M,
Holm L, et al. From mechanical loading to collagen synthesis, structural changes and function in human tendon. Scand
J Med Sci Sports 2009; 19: 500-510.
Waterlow JC, Jackson AA. Nutrition and protein turnover in
man. Br Med Bull 1981; 37: 5-10.
Boirie Y, Beaufrere B, Ritz P. Energetic cost of protein
turnover in healthy elderly humans. Int J Obes Relat Metab
Disord 2001; 25: 601-605.
Rennie MJ, Wackerhage H, Spangenburg EE, Booth FW.
Control of the size of the human muscle mass. Annu Rev
Physiol 2004; 66: 799-828.
Boh J, Low A, Wolfe RR, Rennie MJ. Human muscle protein
synthesis is modulated by extracellular, not intramuscular
amino acid availability: a dose-response study. J Physiol
2003; 552: 315-324.
Kjaer M. Role of extracellular matrix in adaptation of tendon
and skeletal muscle to mechanical loading. Physiol Rev
2004; 84: 649-698.
Miller BF, Olesen JL, Hansen M, Dossing S, Crameri RM,
Welling RJ, et al. Coordinated collagen and muscle protein
synthesis in human patella tendon and quadriceps muscle
after exercise. J Physiol 2005; 567: 1021-1033.
Wackerhage H, Rennie MJ. How nutrition and exercise
maintain the human musculoskeletal mass. J Anat 2006;
208: 451-458.
Moore DR, Phillips SM, Babraj JA, Smith K, Rennie MJ.
Myofibrillar and collagen protein synthesis in human skeletal
muscle in young men after maximal shortening and lengthening contractions. Am J Physiol Endocrinol Metab 2005;
288: E1153-E1159.
Rennie MJ. Claims for the anabolic effects of growth hormone: a case of the emperors new clothes? Br J Sports
Med 2003; 37: 100-105.
Doessing S, Heinemeier KM, Holm L, Mackey AL, Schjerling
P, Rennie M, et al. Growth hormone stimulates the collagen
synthesis in human tendon and skeletal muscle without affecting myofibrillar protein synthesis. J Physiol 2010; 588:
341-351.
Goldberg AL, Jablecki C, Li JB. Trophic functions of the neuron. 3. Mechanisms of neurotrophic interactions. Effects of
use and disuse on amino acid transport and protein turnover
in muscle. Ann N Y Acad Sci 1974; 228: 190-201.
Rennie MJ, Edwards RH, Davies CT, Krywawych S, Halliday D, Waterlow JC, et al. Protein and amino acid turnover
during and after exercise. Biochem Soc Trans 1980; 8: 499-

Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

888

501.
30. Poortmans JR. Principles of exercise biochemistry. 3rd edn.
Basel: Karger; 2004.
31. Rennie MJ, Millward DJ. 3-Methylhistidine excretion and the
urinary 3-methylhistidine/creatinine ratio are poor indicators
of skeletal muscle protein breakdown. Clin Sci 1983; 65:
217-225.
32. Kumar V, Atherton P, Smith K, Rennie MJ. Human muscle
protein synthesis and breakdown during and after exercise.
J Appl Physiol 2009; 106: 2026-2039.
33. Phillips SM. Physiologic and molecular bases of muscle
hypertrophy and atrophy: impact of resistance exercise on
human skeletal muscle (protein and exercise dose effects).
Appl Physiol Nutr Metab 2009; 34: 403-410.
34. Tang JE, Phillips SM. Maximizing muscle protein anabolism:
the role of protein quality. Curr Opin Clin Nutr Metab Care
2009; 12: 66-71.
35. Magnusson SP, Narici MV, Maganaris CN, Kjaer M. Human
tendon behaviour and adaptation, in vivo. J Physiol 2008;
586: 71-81.
36. Tipton KD, Wolfe RR. Exercise-induced changes in protein
metabolism. Acta Physiol Scand 1998; 162: 377-387.
37. Burd NA, West DW, Staples AW, Atherton PJ, Baker JM,
Moore DR, et al. Low-load high volume resistance exercise
stimulates muscle protein synthesis more than high-load low
volume resistance exercise in young men. PLoS One 2010;
5: e12033.
38. Reitelseder S, Agergaard J, Doessing S, Helmark IC, Lund
P, Kristensen NB, et al. Whey and casein labeled with
L-[1-13C]leucine and muscle protein synthesis: effect of
resistance exercise and protein ingestion. Am J Physiol
Endocrinol Metab 2011; 300: E231-E242.
39. West DW, Burd NA, Coffey VG, Baker SK, Burke LM, Hawley
JA, et al. Rapid aminoacidemia enhances myofibrillar protein
synthesis and anabolic intramuscular signaling responses
after resistance exercise. Am J Clin Nutr 2011; 94: 795803.
40. Moore DR, Tang JE, Burd NA, Rerecich T, Tarnopolsky MA,
Phillips SM. Differential stimulation of myofibrillar and sarcoplasmic protein synthesis with protein ingestion at rest and
after resistance exercise. J Physiol 2009; 587: 897-904.
41. Burd NA, West DW, Moore DR, Atherton PJ, Staples AW,
Prior T, et al. Enhanced amino acid sensitivity of myofibrillar protein synthesis persists for up to 24 h after resistance
exercise in young men. J Nutr 2011; 141: 568-573.
42. Hulston CJ, Wolsk E, Grondahl TS, Yfanti C, van Hall G.
Protein intake does not increase vastus lateralis muscle
protein synthesis during cycling. Med Sci Sports Exerc 2011;
43: 1635-1642.
43. Moore DR, Robinson MJ, Fry JL, Tang JE, Glover EI, Wilkinson SB, et al. Ingested protein dose response of muscle and
albumin protein synthesis after resistance exercise in young
men. Am J Clin Nutr 2009; 89: 161-168.
44. Meredith CN, Zackin MJ, Frontera WR, Evans WJ. Dietary
protein requirements and body protein metabolism in endurance-trained men. J Appl Physiol 1989; 66: 2850-2856.
45. Tarnopolsky M. Protein requirements for endurance athletes.
Nutrition 2004; 20: 662-668.
46. Tipton KD. Gender differences in protein metabolism. Curr
Opin Clin Nutr Metab Care 2001; 4: 493-498.
47. Vingren JL, Kraemer WJ, Ratamess NA, Anderson JM,
Volek JS, Maresh CM. Testosterone physiology in resistance
Braz J Med Biol Res 45(10) 2012

48.
49.

50.

51.

52.

53.
54.

55.

56.
57.

58.
59.
60.
61.
62.
63.

64.

exercise and training: the up-stream regulatory elements.


Sports Med 2010; 40: 1037-1053.
Pannemans DL, Halliday D, Westerterp KR, Kester AD. Effect of variable protein intake on whole-body protein turnover
in young men and women. Am J Clin Nutr 1995; 61: 69-74.
Henderson GC, Dhatariya K, Ford GC, Klaus KA, Basu R,
Rizza RA, et al. Higher muscle protein synthesis in women
than men across the lifespan, and failure of androgen administration to amend age-related decrements. FASEB J 2009;
23: 631-641.
Kumar V, Selby A, Rankin D, Patel R, Atherton P, Hildebrandt
W, et al. Age-related differences in the dose-response relationship of muscle protein synthesis to resistance exercise
in young and old men. J Physiol 2009; 587: 211-217.
Haub MD, Wells AM, Tarnopolsky MA, Campbell WW. Effect
of protein source on resistive-training-induced changes in
body composition and muscle size in older men. Am J Clin
Nutr 2002; 76: 511-517.
West DW, Kujbida GW, Moore DR, Atherton P, Burd NA,
Padzik JP, et al. Resistance exercise-induced increases in
putative anabolic hormones do not enhance muscle protein
synthesis or intracellular signalling in young men. J Physiol
2009; 587: 5239-5247.
Phillips SM. Strength and hypertrophy with resistance training: chasing a hormonal ghost. Eur J Appl Physiol 2012; 112:
1981-1983.
Mascher H, Ekblom B, Rooyackers O, Blomstrand E.
Enhanced rates of muscle protein synthesis and elevated
mTOR signalling following endurance exercise in human
subjects. Acta Physiol 2011; 202: 175-184.
Moore DR, Atherton PJ, Rennie MJ, Tarnopolsky MA, Phillips SM. Resistance exercise enhances mTOR and MAPK
signalling in human muscle over that seen at rest after bolus
protein ingestion. Acta Physiol 2011; 201: 365-372.
Rose AJ, Richter EA. Regulatory mechanisms of skeletal
muscle protein turnover during exercise. J Appl Physiol
2009; 106: 1702-1711.
Spiering BA, Kraemer WJ, Anderson JM, Armstrong LE,
Nindl BC, Volek JS, et al. Resistance exercise biology:
manipulation of resistance exercise programme variables
determines the responses of cellular and molecular signalling pathways. Sports Med 2008; 38: 527-540.
Hardie DG, Sakamoto K. AMPK: a key sensor of fuel and
energy status in skeletal muscle. Physiology 2006; 21: 4860.
Kimball SR, Jefferson LS. Control of translation initiation
through integration of signals generated by hormones, nutrients, and exercise. J Biol Chem 2010; 285: 29027-29032.
Rivas DA, Lessard SJ, Coffey VG. mTOR function in skeletal
muscle: a focal point for overnutrition and exercise. Appl
Physiol Nutr Metab 2009; 34: 807-816.
Foster KG, Fingar DC. Mammalian target of rapamycin
(mTOR): conducting the cellular signaling symphony. J Biol
Chem 2010; 285: 14071-14077.
Kimball SR, Jefferson LS. Amino acids as regulators of gene
expression. Nutr Metab 2004; 1: 3.
Apro W, Blomstrand E. Influence of supplementation with
branched-chain amino acids in combination with resistance
exercise on p70S6 kinase phosphorylation in resting and
exercising human skeletal muscle. Acta Physiol 2010; 200:
237-248.
Brasse-Lagnel C, Lavoinne A, Husson A. Control of mammawww.bjournal.com.br

Protein requirements and exercise training

65.
66.
67.
68.
69.

70.

71.

72.

73.

74.
75.
76.
77.

78.

79.
80.
81.
82.

lian gene expression by amino acids, especially glutamine.


FEBS J 2009; 276: 1826-1844.
McCarthy JJ. The MyomiR network in skeletal muscle plasticity. Exerc Sport Sci Rev 2011; 39: 150-154.
Guller I, Russell AP. MicroRNAs in skeletal muscle: their
role and regulation in development, disease and function. J
Physiol 2010; 588: 4075-4087.
Izzotti A. Genomic biomarkers and clinical outcomes of
physical activity. Ann N Y Acad Sci 2011; 1229: 103-114.
Kim HK, Lee YS, Sivaprasad U, Malhotra A, Dutta A. Musclespecific microRNA miR-206 promotes muscle differentiation.
J Cell Biol 2006; 174: 677-687.
Keller P, Vollaard NB, Gustafsson T, Gallagher IJ, Sundberg
CJ, Rankinen T, et al. A transcriptional map of the impact of
endurance exercise training on skeletal muscle phenotype.
J Appl Physiol 2011; 110: 46-59.
Nielsen S, Scheele C, Yfanti C, Akerstrom T, Nielsen AR,
Pedersen BK, et al. Muscle specific microRNAs are regulated by endurance exercise in human skeletal muscle. J
Physiol 2010; 588: 4029-4037.
Baggish AL, Hale A, Weiner RB, Lewis GD, Systrom D,
Wang F, et al. Dynamic regulation of circulating microRNA
during acute exhaustive exercise and sustained aerobic
exercise training. J Physiol 2011; 589: 3983-3994.
Ringholm S, Bienso RS, Kiilerich K, Guadalupe-Grau A,
Aachmann-Andersen NJ, Saltin B, et al. Bed rest reduces
metabolic protein content and abolishes exercise-induced
mRNA responses in human skeletal muscle. Am J Physiol
Endocrinol Metab 2011; 301: E649-E658.
Davidsen PK, Gallagher IJ, Hartman JW, Tarnopolsky MA,
Dela F, Helge JW, et al. High responders to resistance exercise training demonstrate differential regulation of skeletal
muscle microRNA expression. J Appl Physiol 2011; 110:
309-317.
American College of Sports Medicine ADAaCD. Nutrition
and athletic performance. Med Sci Sports Exerc 2009; 709731.
Poortmans JR, Dellalieux O. Do regular high protein diets
have potential health risks on kidney function in athletes? Int
J Sport Nutr Exerc Metab 2000; 10: 28-38.
Boisseau N, Persaud C, Jackson AA, Poortmans JR. Training does not affect protein turnover in pre- and early pubertal
female gymnasts. Eur J Appl Physiol 2005; 94: 262-267.
Gaine PC, Pikosky MA, Martin WF, Bolster DR, Maresh CM,
Rodriguez NR. Level of dietary protein impacts whole body
protein turnover in trained males at rest. Metabolism 2006;
55: 501-507.
Bolster DR, Pikosky MA, Gaine PC, Martin W, Wolfe RR,
Tipton KD, et al. Dietary protein intake impacts human skeletal muscle protein fractional synthetic rates after endurance
exercise. Am J Physiol Endocrinol Metab 2005; 289: E678E683.
Slater G, Phillips SM. Nutrition guidelines for strength sports:
sprinting, weightlifting, throwing events, and bodybuilding. J
Sports Sci 2011; 29 (Suppl 1): S67-S77.
Agostoni C, Scaglioni S, Ghisleni D, Verduci E, Giovannini
M, Riva E. How much protein is safe? Int J Obes 2005; 29
(Suppl 2): S8-S13.
Millward DJ. An adaptive metabolic demand model for
protein and amino acid requirements. Br J Nutr 2003; 90:
249-260.
Wolfe RR. Protein supplements and exercise. Am J Clin Nutr

www.bjournal.com.br

889

2000; 72: 551S-557S.


83. Fujita S, Rasmussen BB, Cadenas JG, Grady JJ, Volpi E.
Effect of insulin on human skeletal muscle protein synthesis
is modulated by insulin-induced changes in muscle blood
flow and amino acid availability. Am J Physiol Endocrinol
Metab 2006; 291: E745-E754.
84. Dreyer HC, Drummond MJ, Pennings B, Fujita S, Glynn EL,
Chinkes DL, et al. Leucine-enriched essential amino acid
and carbohydrate ingestion following resistance exercise
enhances mTOR signaling and protein synthesis in human
muscle. Am J Physiol Endocrinol Metab 2008; 294: E392E400.
85. Howarth KR, Moreau NA, Phillips SM, Gibala MJ. Coingestion of protein with carbohydrate during recovery from endurance exercise stimulates skeletal muscle protein synthesis
in humans. J Appl Physiol 2009; 106: 1394-1402.
86. Miller SL, Tipton KD, Chinkes DL, Wolf SE, Wolfe RR. Independent and combined effects of amino acids and glucose
after resistance exercise. Med Sci Sports Exerc 2003; 35:
449-455.
87. Staples AW, Burd NA, West DW, Currie KD, Atherton PJ,
Moore DR, et al. Carbohydrate does not augment exerciseinduced protein accretion versus protein alone. Med Sci
Sports Exerc 2011; 43: 1154-1161.
88. Betts JA, Stevenson E. Should protein be included in CHObased sports supplements? Med Sci Sports Exerc 2011; 43:
1244-1250.
89. Boirie Y, Dangin M, Gachon P, Vasson MP, Maubois JL,
Beaufrere B. Slow and fast dietary proteins differently modulate postprandial protein accretion. Proc Natl Acad Sci U S
A 1997; 94: 14930-14935.
90. Luiking YC, Engelen MP, Soeters PB, Boirie Y, Deutz NE.
Differential metabolic effects of casein and soy protein meals
on skeletal muscle in healthy volunteers. Clin Nutr 2011; 30:
65-72.
91. Beelen M, Zorenc A, Pennings B, Senden JM, Kuipers H,
van Loon LJ. Impact of protein coingestion on muscle protein
synthesis during continuous endurance type exercise. Am J
Physiol Endocrinol Metab 2011; 300: E945-E954.
92. Hartman JW, Tang JE, Wilkinson SB, Tarnopolsky MA, Lawrence RL, Fullerton AV, et al. Consumption of fat-free fluid
milk after resistance exercise promotes greater lean mass
accretion than does consumption of soy or carbohydrate in
young, novice, male weightlifters. Am J Clin Nutr 2007; 86:
373-381.
93. Josse AR, Tang JE, Tarnopolsky MA, Phillips SM. Body
composition and strength changes in women with milk and
resistance exercise. Med Sci Sports Exerc 2010; 42: 11221130.
94. Kukuljan S, Nowson CA, Sanders K, Daly RM. Effects of
resistance exercise and fortified milk on skeletal muscle
mass, muscle size, and functional performance in middleaged and older men: an 18-mo randomized controlled trial.
J Appl Physiol 2009; 107: 1864-1873.
95. Wilkinson SB, Tarnopolsky MA, MacDonald MJ, MacDonald
JR, Armstrong D, Phillips SM. Consumption of fluid skim milk
promotes greater muscle protein accretion after resistance
exercise than does consumption of an isonitrogenous and
isoenergetic soy-protein beverage. Am J Clin Nutr 2007; 85:
1031-1040.
96. Atherton PJ, Etheridge T, Watt PW, Wilkinson D, Selby A,
Rankin D, et al. Muscle full effect after oral protein: timeBraz J Med Biol Res 45(10) 2012

890

dependent concordance and discordance between human


muscle protein synthesis and mTORC1 signaling. Am J Clin
Nutr 2010; 92: 1080-1088.
97. Hulmi JJ, Kovanen V, Selanne H, Kraemer WJ, Hakkinen K,
Mero AA. Acute and long-term effects of resistance exercise
with or without protein ingestion on muscle hypertrophy and
gene expression. Amino Acids 2009; 37: 297-308.
98. Tang JE, Manolakos JJ, Kujbida GW, Lysecki PJ, Moore DR,
Phillips SM. Minimal whey protein with carbohydrate stimulates muscle protein synthesis following resistance exercise
in trained young men. Appl Physiol Nutr Metab 2007; 32:
1132-1138.
99. Fujita S, Dreyer HC, Drummond MJ, Glynn EL, Cadenas
JG, Yoshizawa F, et al. Nutrient signalling in the regulation
of human muscle protein synthesis. J Physiol 2007; 582:
813-823.
100. Holm L, van Hall G, Rose AJ, Miller BF, Doessing S, Richter
EA, et al. Contraction intensity and feeding affect collagen
and myofibrillar protein synthesis rates differently in human
skeletal muscle. Am J Physiol Endocrinol Metab 2010; 298:
E257-E269.
101. Rennie MJ. Control of muscle protein synthesis as a result
of contractile activity and amino acid availability: implications
for protein requirements. Int J Sport Nutr Exerc Metab 2001;
11 (Suppl): S170-S176.
102. Tipton KD, Witard OC. Protein requirements and recommendations for athletes: relevance of ivory tower arguments
for practical recommendations. Clin Sports Med 2007; 26:
17-36.
103. Tipton KD, Ferrando AA. Improving muscle mass: response
of muscle metabolism to exercise, nutrition and anabolic
agents. Essays Biochem 2008; 44: 85-98.
104. Tipton KD. Efficacy and consequences of very-high-protein
diets for athletes and exercisers. Proc Nutr Soc 2011; 70:
205-214.
105. Chesley A, MacDougall JD, Tarnopolsky MA, Atkinson SA,
Smith K. Changes in human muscle protein synthesis after
resistance exercise. J Appl Physiol 1992; 73: 1383-1388.
106. Biolo G, Maggi SP, Williams BD, Tipton KD, Wolfe RR.
Increased rates of muscle protein turnover and amino acid
transport after resistance exercise in humans. Am J Physiol
1995; 268: E514-E520.
107. Phillips SM, Tipton KD, Aarsland A, Wolf SE, Wolfe RR.
Mixed muscle protein synthesis and breakdown after resistance exercise in humans. Am J Physiol 1997; 273: E99107.

Braz J Med Biol Res 45(10) 2012

J.R. Poortmans et al.

108. Phillips SM, Tipton KD, Ferrando AA, Wolfe RR. Resistance
training reduces the acute exercise-induced increase in
muscle protein turnover. Am J Physiol 1999; 276: E118E124.
109. Tipton KD, Ferrando AA, Williams BD, Wolfe RR. Muscle
protein metabolism in female swimmers after a combination
of resistance and endurance exercise. J Appl Physiol 1996;
81: 2034-2038.
110. Durham WJ, Miller SL, Yeckel CW, Chinkes DL, Tipton KD,
Rasmussen BB, et al. Leg glucose and protein metabolism
during an acute bout of resistance exercise in humans. J
Appl Physiol 2004; 97: 1379-1386.
111. Dreyer HC, Fujita S, Cadenas JG, Chinkes DL, Volpi E, Rasmussen BB. Resistance exercise increases AMPK activity
and reduces 4E-BP1 phosphorylation and protein synthesis
in human skeletal muscle. J Physiol 2006; 576: 613-624.
112. Kim PL, Staron RS, Phillips SM. Fasted-state skeletal
muscle protein synthesis after resistance exercise is altered
with training. J Physiol 2005; 568: 283-290.
113. Biolo G, Tipton KD, Klein S, Wolfe RR. An abundant supply
of amino acids enhances the metabolic effect of exercise on
muscle protein. Am J Physiol 1997; 273: E122-E129.
114. Rasmussen BB, Tipton KD, Miller SL, Wolf SE, Wolfe RR.
An oral essential amino acid-carbohydrate supplement enhances muscle protein anabolism after resistance exercise.
J Appl Physiol 2000; 88: 386-392.
115. Louis M, Poortmans JR, Francaux M, Berre J, Boisseau N,
Brassine E, et al. No effect of creatine supplementation on
human myofibrillar and sarcoplasmic protein synthesis after
resistance exercise. Am J Physiol Endocrinol Metab 2003;
285: E1089-E1094.
116. Cuthbertson DJ, Babraj J, Smith K, Wilkes E, Fedele MJ,
Esser K, et al. Anabolic signaling and protein synthesis in
human skeletal muscle after dynamic shortening or lengthening exercise. Am J Physiol Endocrinol Metab 2006; 290:
E731-E738.
117. Sheffield-Moore M, Yeckel CW, Volpi E, Wolf SE, Morio
B, Chinkes DL, et al. Postexercise protein metabolism in
older and younger men following moderate-intensity aerobic
exercise. Am J Physiol Endocrinol Metab 2004; 287: E513E522.
118. Beelen M, Tieland M, Gijsen AP, Vandereyt H, Kies AK,
Kuipers H, et al. Coingestion of carbohydrate and protein
hydrolysate stimulates muscle protein synthesis during
exercise in young men, with no further increase during subsequent overnight recovery. J Nutr 2008; 138: 2198-2204.

www.bjournal.com.br

Reduced mitochondrial biogenesis activation during exercise after short-term training


N.K. Stepto,1,2 G. Wadley,3 B. Benziane,4 A.V. Chibalin,4 B.J. Canny5 and G.K. McConell,1 1Institute of Sport
Exercise and Active Living, Victoria University, Melbourne, VIC 8001, Australia, 2School of Sport and Exercise
Science , Victoria University, Melbourne, VIC 8001, Australia, 3School of Exercise and Nutrition Sciences,
Deakin University, Burwood, VIC 3152, Australia, 4Department of Physiology and Pharmacology, Karolinska
Institutet, Stockholm, Sweden, and 5Department of Physiology, Monash University, Clayton, VIC 3800,
Australia.
Mitochondrial biogenesis and function are important for energy production in cells and tissues. Aberrant
mitochondrial function, specifically reduced volume not function, has been implicated as a cause or at least a
contributor to lifestyle diseases including insulin resistance, obesity and diabetes. It is also well established that
mitochondrial function and biogenesis is promoted by physical activity and exercise. In this study we
investigated whether mitochondrial biogenesis was maintained in response to acute exercise after 10d of
intensive cycle training despite the reduction of AMPK activity. Nine untrained, healthy participants (mean
SEM; 23 5 years of age, BMI: 24.9 1 kg.m2 VO2peak 44.1 7.2 ml.kg1.min1) provided written informed
consent. These participants performed a 60 min bout of cycling exercise at 164 9 W (70% pre-training
VO2peak), muscle biopsies were taken from the vastus lateralis muscle under local anesthesia at rest,
immediately and 3h after exercise. Within 7 days the participants then underwent 10d of intensified cycle
training including 4 days of high-intensity interval training. Three days after the final training session
participants repeated the pre-training exercise trial with biopsies at the same absolute work load (164 W).
Protein and mRNA were extracted from muscle for analysis by immunoblotting or RT QPCR respectively.
AMPK Thr172 phosphorylation increased by 15 fold and 4 fold during exercise before and after training
respectively (p<0.05). PGC1- gene expression was increased by 11 and 4 fold (p<0.001; Figure A) 3 h after
the exercise bout before and after training.

PGC1a/cDNA (AU)

16

P<0.001

14

P<0.001

12

P<0.001

10
8
6
4
2

Po
st

24

0
Po
st

Pr
e

Pr
e

24

PGC1a/GAPDH (AU)

B 0.6
0.4
P<0.05

0.2

0
24

Po
st

60
Po
st

Po
st

0
24
Pr
e

60
Pr
e

Pr
e

0.0

PGC1- protein expression increased 1.5 fold (p<0.05; Figure B) in response to exercise pre-training with no
further increases occurring after the post-training exercise bout. COXIV gene expression was increased by
training only (1.6 fold; p<0.0001). On the other hand COXIV protein expression increased (1.5 fold; p<0.05)
but demonstrated a 20% reduction (p<0.01) in response to acute exercise before and after training. The nuclear
co-repressor RIP140 and COXI protein expression was influenced by acute exercise only. Specifically, protein
expression of RIP140 increased by 5.5 fold (p<0.01) and COXI decreased 2 fold (p<0.01) in response to
acute exercise before and after training. These data demonstrate that short-term intensified training promotes
gene and protein expression for mitochondrial biogenesis, and that acute exercise after training at the same
absolute intensity results in reduced gene expression responses.

Proceedings of the Australian Physiological Society

http://www.aups.org.au/Proceedings/41/7P

Am J Physiol Endocrinol Metab 287: E25E31, 2004.


First published February 3, 2004; 10.1152/ajpendo.00557.2003.

Regulation of metabolic genes in human skeletal muscle


by short-term exercise and diet manipulation
Melissa J. Arkinstall,1 Rebecca J. Tunstall,2 David Cameron-Smith,2 and John A. Hawley1
1

Exercise Metabolism Group, School of Medical Sciences, RMIT University, Bundoora, Victoria 3083;
and 2School of Health Sciences, Deakin University, Burwood, Victoria 3125, Australia
Submitted 8 December 2003; accepted in final form 30 January 2004

Arkinstall, Melissa J., Rebecca J. Tunstall, David CameronSmith, and John A. Hawley. Regulation of metabolic genes in
human skeletal muscle by short-term exercise and diet manipulation.
Am J Physiol Endocrinol Metab 287: E25E31, 2004. First published
February 3, 2004; 10.1152/ajpendo.00557.2003.Changes in dietary
macronutrient intake alter muscle and blood substrate availability and
are important for regulating gene expression. However, few studies
have examined the effects of diet manipulation on gene expression in
human skeletal muscle. The aim of this study was to quantify the
extent to which altering substrate availability impacts on subsequent
mRNA abundance of a subset of carbohydrate (CHO)- and fat-related
genes. Seven subjects consumed either a low- (LOW; 0.7 g/kg body
mass CHO) or high- (HIGH; 10 g/kg body mass CHO) CHO diet for
48 h after performing an exhaustive exercise bout to deplete muscle
glycogen stores. After intervention, resting muscle and blood samples
were taken. Muscle was analyzed for the gene abundances of GLUT4,
glycogenin, pyruvate dehydrogenase kinase-4 (PDK-4), fatty acid
translocase (FAT/CD36), carnitine palmitoyltransferase I (CPT I),
hormone-sensitive lipase (HSL), -hydroxyacyl-CoA dehydrogenase
(-HAD), and uncoupling binding protein-3 (UCP3), and blood samples for glucose, insulin, and free fatty acid (FFA) concentrations.
Glycogen-depleting exercise and HIGH-CHO resulted in a 300%
increase in muscle glycogen content (P 0.001) relative to the
LOW-CHO condition. FFA concentrations were twofold higher after
LOW- vs. HIGH-CHO (P 0.05). The exercise-diet manipulation
exerted a significant effect on transcription of all carbohydrate-related
genes, with an increase in GLUT4 and glycogenin mRNA abundance
and a reduction in PDK-4 transcription after HIGH-CHO (all P
0.05). FAT/CD36 (P 0.05) and UCP3 (P 0.01) gene transcriptions were increased following LOW-CHO. We conclude that 1) there
was a rapid capacity for a short-term exercise and diet intervention to
exert coordinated changes in the mRNA transcription of metabolic
related genes, and 2) genes involved in glucose regulation are increased following a high-carbohydrate diet.
messenger ribonucleic acid; exercise-diet gene interaction
SKELETAL MUSCLE REPRESENTS the largest component of fat-free
mass (FFM) in humans and is the major site of insulinstimulated glucose disposal (10). At rest, glucose availability
exerts the dominant influence on the mix of oxidized fuels in
healthy individuals (33). However, within 10 12 h of fasting,
fatty acid (FA) oxidation accounts for 80% of resting energy
requirements (9). Manipulation of dietary macronutrient content is associated with marked changes in substrate stores,
metabolic flux, and subsequent fuel oxidation (5, 8, 17, 32).
Changes in dietary intake alter the concentration of bloodborne nutrients and hormones and, via substrate availability,
regulate the short-term macronutrient oxidative and storage

Address for reprint requests and other correspondence: J. A. Hawley, School


of Medical Sciences, RMIT University, PO Box 71, Bundoora, Victoria 3083,
Australia (E-mail: john.hawley@rmit.edu.au).
http://www.ajpendo.org

profile of skeletal muscle. Perturbations in muscle and blood


substrates alter the uptake and flux of these fuel-specific
intermediates within related metabolic pathways. This immediate response serves to redirect enzymatic processes involved
in substrate metabolism and the subsequent concentration of
particular proteins critical for metabolic pathway function.
Altering substrate availability impacts not only resting energy
metabolism but also regulatory processes underlying gene
expression (25, 27). To bring about such modifications, a
number of highly coordinated processes occur, including
gene transcription, RNA transport from the nucleus, protein
synthesis and, in some cases, posttranslational modification
of the protein. However, the initiation of gene transcription
is strongly related to changes in dietary intake and composition (20).
To date, there have been few investigations to determine the
responsiveness and coordination of changes in mRNA abundances following alterations in diet. A previous study from our
laboratory supports a role for a short-term (5-day) low-carbohydrate, high-fat diet to upregulate lipid-related genes in skeletal muscle (6). Accordingly, one might predict that this
relationship is reciprocal, with high carbohydrate eliciting
greater levels of mRNA abundance of carbohydrate-related
genes and a suppression of lipid-related genes. However, the
coordinated control of the specific mRNA levels involved in
key regulatory steps in the oxidative and storage pathways for
carbohydrate and fat in response to dietary alterations in human
skeletal muscle is yet to be investigated. Accordingly, the aim
of the present study was to quantify the extent to which altering
muscle and blood substrate availability impacts on the subsequent transcription of metabolic genes. We hypothesized that
high carbohydrate availability (i.e., exhaustive glycogen-depleting exercise followed by a high-carbohydrate diet) would
increase transcription of carbohydrate-related genes while simultaneously decreasing the transcription of genes underlying
lipid metabolism.
METHODS

Subjects and Experimental Design


Seven male subjects who were moderately trained in cycling
exercise participated as subjects in this study, which was approved by
the Human Research Ethics Committee of RMIT University. The
experimental design required subjects to perform two exercise-diet
interventions [low-carbohydrate (LOW-CHO) vs. high-carbohydrate
(HIGH-CHO)] in a random order, separated by 7 days. The subjects
O2 peak) were 33 5 yr,
age, body mass (BM), and peak O2 uptake (V
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked advertisement
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

0193-1849/04 $5.00 Copyright 2004 the American Physiological Society

E25

E26

EXERCISE-DIETARY REGULATION OF METABOLIC GENES

80.3 9.5 kg, and 4.64 0.62 l/min, respectively (values are
means SE). As muscle and blood samples were taken, all procedures and risks were carefully explained to each subject before their
written consent was obtained.
Preliminary Testing
All subjects performed an incremental test to volitional fatigue (i.e.,
maximal test) on a Lode cycle ergometer (Groningen, The Netherlands) under standard laboratory conditions (2122C, 40 50% rela O2 peak. The maximal test has
tive humidity) for the determination of V
been described in detail previously (16). The results of the maximal
test were used to determine the work rates to be employed in the
exercise-depletion protocol.
Exercise Depletion Protocol and Dietary Intervention
Immediately before each dietary intervention, muscle glycogen
content was depleted by means of exhaustive cycle exercise. The
exercise-depletion protocol has been described in detail previously
(36). Briefly, subjects reported to the laboratory and after a 5-min
O2 peak, followed
warm-up, commenced cycling for 2 min at 95% V
O2 peak. This highimmediately by 2 min of cycling at 55% V
intensity, low-intensity regimen was maintained until subjects were
O2 peak. At this time,
unable to complete 2 min of exercise at 95% of V
O2 peak
the power output was lowered to 85, 75, and finally 65% of V
while the same work-to-rest interval was maintained. Exercise was
terminated when subjects could not complete 2 min of cycling at 65%
O2 peak.
of V
During the 48-h period immediately following the exercise-depletion protocol, subjects consumed either a LOW-CHO (0.7 g/kg BM of
CHO, 4.4 g/kg BM of fat, 4 g/kg BM of protein) or HIGH-CHO (10
g/kg BM of CHO, 1 g/kg BM of fat, 1.9 g/kg BM of protein)
isoenergetic (235 kJ/kg BM) diet. All meals and snacks were
provided to subjects to maximize dietary compliance. The morning
after completion of a 48-h dietary intervention, subjects reported to
the laboratory between 0700 and 0800 in a 10- to 12-h overnightfasted state. A resting venous blood sample (10 ml) was collected via
venipuncture into the antecubital space of one arm. Local anesthesia
[23 ml of 1% xylocaine (Lignocaine)] was then administered to the
skin, subcutaneous tissue, and fascia of the vastus lateralis muscle in
preparation for a resting-muscle biopsy. Muscle (100 150 mg) was
removed using a UCH biopsy needle (Popper, NY), with suction
applied, and immediately frozen in liquid nitrogen. Samples were
stored at 80C until subsequent analysis.
Analytical Procedures
Blood substrates and hormone concentrations. Five milliliters of
whole blood were placed into a tube containing fluoride EDTA,
mixed, and spun in a centrifuge at 4,000 rpm for 8 min at 0C. The
plasma was later analyzed in duplicate for glucose concentration by
means of an automated glucose/lactate analyzer (YSI 2300 STAT
PLUS; Yellow Springs Instruments, Yellow Springs, OH). Four
milliliters of whole blood were placed into a tube containing lithium
heparin, mixed, and spun in a centrifuge (as above). The plasma was
stored at 80C for later analysis (in duplicate) of plasma insulin
concentration by radioimmunoassay (Phadeseph, Insulin RIA; Pharmacia & Upjohn Diagnostics, Uppsala, Sweden). Blood (3 ml) for the
determination of plasma free fatty acid (FFA) concentration was
placed in tubes containing ethylene glycol-bis(-aminoethyl ether)N,N,N,N-tetraacetic acid and reduced glutathione and spun in a
centrifuge at 0C for 15 min at 4,000 rpm. The supernatant was then
stored at 80C until analysis. Plasma FFA concentration was measured by an enzymatic colorimetric method (NEFA C code 279
75409; Wako, Tokyo, Japan).
Muscle analyses. A small piece of frozen muscle (10 20 mg) was
removed under liquid nitrogen for the quantification of mRNA. At the
AJP-Endocrinol Metab VOL

same time, an additional portion of frozen muscle (10 20 mg) was


chipped, freeze-dried, and dissected of all visible blood, connective
tissue, and fat, and powdered for subsequent determination of muscle
glycogen concentration in duplicate as glucose residues after hydrolysis in 2 M HCl at 100C for 2 h (22).
Total RNA isolation and reverse transcription. Total RNA from
10 mg of wet muscle was isolated using FastRNA Kit-Green (BIO
101, Vista, CA) protocol and reagents. Total RNA concentration was
determined spectrophotometrically at 260 nm. First-strand cDNA was
generated from 0.5 g of RNA by use of AMV RT (Promega,
Madison, WI) as described previously (37). The cDNA was stored at
20C for subsequent analysis.
mRNA quantification. A real-time polymerase chain reaction (PCR)
mix of 0.5 SYBR green PCR master mix (Applied Biosystems,
Foster City, CA), forward and reverse primers (3 M), and 12 ng of
cDNA was run for 40 cycles of PCR in a volume of 20 l. Because
SYBR green indiscriminately binds to double-stranded DNA and
other products such as primer dimers, the samples were subjected to
a heat dissociation protocol after the final cycle of PCR to ensure that
only one product was detected. Heat dissociation of oligonucleotides
detects differences in melting temperature and produces a single
dissociation peak for each nucleotide within a 2C difference in
melting temperature (29).
Real-time RT-PCR analysis. Primers were designed using Primer
Express software package version 1.0 (Applied Biosystems) from
gene sequences obtained from GenBank. A BLAST (1) search for
each primer confirmed homologous binding to the desired mRNA of
human skeletal muscle. Primer sequences are shown in Table 1.
Quantification of mRNA expression was performed in duplicate by
real-time RT-PCR using the ABI PRISM 5700 sequence detection
system (Applied Biosystems) as described previously (11). Fluorescent emission data were captured and mRNA levels quantitated using
the critical threshold value. To compensate for variations in input
RNA amounts and efficiency of reverse transcription, -actin mRNA
was quantitated, and results were normalized to these values as
described previously (35). Each gene was analyzed with the incorporation of a negative control template.
Statistical Analysis
Differences between dietary treatments for skeletal muscle glycogen content and resting blood substrate levels (plasma glucose, insulin, and FFA concentrations) were analyzed using paired-sample
t-tests. The mRNA data for each dietary intervention were expressed
in arbitrary units after normalization relative to -actin and analyzed
using paired-sample t-tests and effect size statistics. Statistical significance for these measures was established at the level of P 0.05.
Lacking any information on the smallest substantial changes in gene
transcription, we converted the observed differences in mRNA abundance (arbitrary units) between dietary treatments to Cohen effect
sizes by calculating the mean difference between groups divided by
the average of the groups standard deviation. We then interpreted the
magnitude of the effect size by using conventional threshold values of
0.2 as the smallest effect, 0.5 as a moderate effect, and 0.8 as a large
effect size (7). All values are expressed as means SE.
RESULTS

Resting Muscle Glycogen, Plasma Glucose, Insulin,


and FFA Concentrations
Figure 1 displays the effects of short-term exercise and diet
manipulation on resting muscle glycogen content. As expected,
consumption of a HIGH-CHO diet after glycogen-depleting
exercise resulted in significantly higher (300%) muscle glycogen content compared with concentrations observed following a LOW-CHO diet (570 103 vs. 171 40 mmol glucosyl

287 JULY 2004

www.ajpendo.org

E27

EXERCISE-DIETARY REGULATION OF METABOLIC GENES

Table 1. Gene primer sequences


Gene

GenBank Accession No.

-Actin

X00351

GLUT4

NM_001042

Glycogenin

AH00714

PDK-4

NM_002612

FAT/CD36

L06850

CPT I

Y08683

HSL

L11706

-HAD

NM_000182

UCP3

XM_055241

Sequence

Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:

5-GAC
5-TGA
5-CCA
5-CGC
5-CTA
5-CCT
5-CCC
5-GCA
5-AGT
5-CTG
5-GAG
5-GTG
5-ACC
5-TGG
5-TGG
5-TGG
5-CGT
5-CGG

AGG
TCC
ACA
AGA
TGG
CTT
GAG
TTT
CAC
CAA
GCC
GAC
TGC
CTC
CTT
AGC
GGT
TGA

ATG
ACA
GAT
GAA
CAC
GAT
AGG
TCT
TGC
TAC
TCA
TCG
GCA
GAG
CCC
CGG
GAT
TTC

CAG
TCT
AGG
CAC
AGC
GTT
TGG
GAA
GAC
CTG
ATG
CTG
CAA
AAG
GCC
TCC
GTT
CCG

AAG
GCT
CTC
AGC
CGT
GTC
AGC
CCA
ATG
GCT
ACC
GTA
TGA
AAG
TTG
ACT
CGT
TAA

GAG ATT ACT-3


GGA AGG T-3
CGA AGA-3
AAG GA-3
TTG TAT C-3
AAA GGA ATC T-3
ATT T-3
AAG TCC AGT A-3
ATT AAT GGT-3
TTT CTC A-3
AGA ATG-3
CAG GAA-3
CAC A-3
GCT ATG-3
TC-3
ATC TTC-3
AAC CTA TG-3
CAT CTG-3

PDK-4, pyruvate dehydrogenase kinase-4; FAT/CD36, fatty acid translocase; CPT I, carnitine palmitoyltransferase I; HSL, hormone-sensitive lipase; -HAD,
-hydroxyacyl-CoA dehydrogenase; UCP3, uncoupling binding protein-3.

units/kg dry mass, P 0.001). Table 2 displays resting


concentrations of plasma glucose, insulin, and FFA following
the exercise-diet interventions. Plasma glucose (4.9 0.3 vs.
4.6 0.4 mmol/l) and insulin concentrations (5.9 1.6 vs.
4.9 1.5 U/ml) were similar after both LOW- and HIGHCHO conditions, respectively. However, plasma FFA levels
were approximately twofold higher after the LOW- compared
with the HIGH-CHO trial (0.43 0.17 vs. 0.24 0.10
mmol/l, P 0.01).
Gene Transcription
The overall effect of short-term exercise-diet manipulation
on mRNA abundance of metabolic genes: GLUT4, glycogenin,
pyruvate dehydrogenase kinase (PDK-4), fatty acid translocase
(FAT/CD36), carnitine palmitoyltransferase I (CPT I), hormone-sensitive lipase (HSL), -hydroxyacyl-CoA dehydrogenase (-HAD), and uncoupling binding protein-3 (UCP3) is
displayed in Table 3, whereas the fold changes in mRNA
abundance for these genes are displayed in Figs. 2 and 3.

The exercise-diet manipulation exerted a large effect (0.8


units; Table 3) on the transcription of all carbohydrate-related
genes, with an increase in GLUT4 (P 0.05) and glycogenin
(P 0.05) mRNA abundance and a reduction in PDK-4 (P
0.05) transcription after HIGH-CHO. This corresponded to a
2.5- and 1.6-fold increase in mRNA abundance for GLUT4
and glycogenin, respectively, and a 0.3-fold reduction in
PDK-4 mRNA, following the HIGH-CHO compared with the
LOW-CHO condition (Fig. 2).
The results of altering dietary carbohydrate availability after
glycogen-depleting exercise on the transcriptional regulation of
specific lipid-based genes (FAT/CD36, CPT I, HSL, -HAD,
and UCP3) ranged from small (0.2 0.5) to large (0.8) effect
sizes (Table 3). The largest effects of the short-term exercisediet manipulation on mRNA abundance were observed for
FAT/CD36 (1.4). A significant increase in the gene transcription of both FAT/CD36 (P 0.05) and UCP3 (P 0.01) was
observed following the LOW-CHO condition, which corresponded to a fold change of 3.0 and 1.8, respectively (Fig. 3).
DISCUSSION

Several experimental models have been used to alter substrate availability and examine the effects of these perturbations on genes underlying fuel utilization. Periods of fasting
lasting up to 72 h have been employed to investigate the
responses of genes aligned with fat-regulatory processes (25,
27, 34). Although this approach markedly influences circulatTable 2. Effect of short-term exercise-diet intervention on
resting plasma glucose, insulin, and FFA concentrations
Dietary Carbohydrate

Fig. 1. Effect of short-term exercise-diet manipulation on resting muscle


glycogen content. LOW-CHO and HIGH-CHO, low- and high-carbohydrate
diets, respectively. Values are expressed as means SE; n 7. ***P 0.001.
AJP-Endocrinol Metab VOL

Concentrations

Low

High

Glucose, mmol/l
Insulin, U/ml
FFA, mmol/l

4.60.4
4.91.5
0.430.17

4.90.3
5.91.6
0.240.10*

All values expressed as means SE; n 7. FFA, free fatty acid. *P 0.05.

287 JULY 2004

www.ajpendo.org

E28

EXERCISE-DIETARY REGULATION OF METABOLIC GENES

Table 3. Effect of short-term exercise-diet manipulation on


mRNA abundance of metabolically related genes

To the best of our knowledge, this is the first study to


measure GLUT4 mRNA in humans in response to shortterm exercise and dietary manipulation, although GLUT4
gene expression (21) and protein content (28) have previously been reported to increase immediately after a single
bout of moderate-intensity exercise. After glycogen-depleting exercise and 2 days of a diet high in carbohydrate,
resting muscle glycogen content was elevated 300% above
concentrations following a low-carbohydrate diet, with

Dietary Carbohydrate
Low
Gene

GLUT4
Glycogenin
PDK-4
FAT/CD36
CPT I
HSL
-HAD
UCP3

High
mRNA

0.0090.003
0.8190.164
0.0680.025
0.3670.051
0.1510.023
0.0230.014
1.670.248
0.2140.045

0.0230.006
1.3490.167
0.0210.007
0.1960.044
0.1370.028
0.0090.004
1.2680.242
0.1370.042

Effect
Size

Effect
Magnitude

1.2
1.5
1.1
1.4
0.2
0.6
0.6
0.7

Large
Large
Large
Large
Small
Moderate
Moderate
Moderate

All values expressed as means SE are arbitrary units; n 7.

ing metabolites (i.e., increases FFA and glucagon while decreasing glucose and insulin concentrations), muscle substrate
availability remains largely unaffected. On the other hand,
exercise has often been employed as a means to reduce endogenous fuel stores (i.e., muscle glycogen) to determine the level
of activation of metabolic genes that encode for various regulatory proteins in the immediate (1 4 h) postexercise recovery
period (21, 26, 35). Interpretations of the results from this latter
model are somewhat complicated because contraction per se
has an independent effect on gene transcription (for review see
Ref. 14).
In the present study, we used an exercise protocol that
initially reduced endogenous glycogen stores and then fed
rested subjects either a low- or high-carbohydrate diet for 2
days to manipulate subsequent muscle and blood substrate
availability. Our first major finding was that short-term (48-h)
alteration of dietary carbohydrate intake after glycogen-depleting exercise resulted in marked alterations in the expression of
metabolic genes within human skeletal muscle. This finding
demonstrates the rapid capacity of whole body substrate availability to modify the abundances of genes necessary to adapt
and maintain the oxidative and storage profile to accommodate
the changed nutrient supply. The second novel finding was that
a subset of carbohydrate-related genes demonstrated greater
responsiveness to short-term exercise and diet manipulation
than a subset of lipid genes: all three carbohydrate-related
genes under investigation (GLUT4, glycogenin, and PDK-4)
exhibited large alterations in their mRNA abundances as a
consequence of altered whole body substrate availability.
Although mRNA abundance is a strong determinant of
protein synthesis, this relationship is neither simple nor linear
(13). The half-lives of many mRNAs are relatively short
compared with their target proteins, with transcription gene
activation sometimes occurring before sustained and measurable increases in protein (15). Although we acknowledge that
the extent to which a protein might be modified in response to
an adaptive stimulus cannot be predicted from an increase in
mRNA, we (6) and others (25) have previously reported that
increased abundance of genes encoding for substrate metabolism is accompanied by a concomitant increase in the cellular
content of the transcribed protein. More to the point, the dietary
intervention employed in the present investigation lasted for 2
days, with subsequent changes in mRNA likely to represent
new steady-state levels rather than a transient activation of
gene transcription (23).
AJP-Endocrinol Metab VOL

Fig. 2. Effect of short-term exercise-diet manipulation on skeletal muscle


mRNA abundance of GLUT4 (A), glycogenin (B), and pyruvate dehydrogenase kinase-4 (PDK-4; C) expressed as fold change relative to HIGH-CHO
trial. Values expressed as means SE; n 7. *P 0.05.

287 JULY 2004

www.ajpendo.org

EXERCISE-DIETARY REGULATION OF METABOLIC GENES

GLUT4 mRNA abundance also substantially higher than


values measured after the low-carbohydrate diet. A similar
trend was observed for glycogenin, the primer for glycogen
synthesis in muscle and liver and a potential determinant of

maximum glycogen storage capacity (24). The coordinated


increase in GLUT4 and glycogenin mRNA abundance might
be expected to enhance protein expression and thus facilitate
muscle glycogen storage.

Fig. 3. Effect of short-term exercise-diet manipulation on skeletal muscle mRNA abundance of fatty acid translocase (FAT/CD36;
A), carnitine palmitoyltransferase I (CPT I; B), hormone-sensitive lipase (HSL; C), -hydroxyacyl-CoA dehydrogenase (-HAD;
D), and uncoupling binding protein-3 (UCP3; E) expressed as fold change relative to HIGH-CHO trial. Values expressed as
means SE; n 7. *P 0.05, **P 0.01.
AJP-Endocrinol Metab VOL

E29

287 JULY 2004

www.ajpendo.org

E30

EXERCISE-DIETARY REGULATION OF METABOLIC GENES

Induction of PDK-4 is a primary means by which glucose


oxidation is suppressed in skeletal muscle during periods of
low carbohydrate availability, largely as a means to conserve
limited glucose stores. The transcriptional activation of PDK-4
has previously been determined after 3 days of a low-carbohydrate, high-fat diet (25) and also after prolonged fasting (27).
In agreement with Peters (25), we show that substrate availability had a large effect on PDK-4 mRNA. In the present
study, intake of a diet low in carbohydrate induced a threefold
increase in PDK-4 compared with the high-carbohydrate diet.
Peters reported a significant increase in both PDK-4 mRNA
and protein after 1 day of a low-carbohydrate diet. In that
study, the induction of mRNA correlated with a decrease in the
resting respiratory exchange ratio, indicating a shift to greater
fat metabolism (25). Interestingly, neither PDK-4 mRNA nor
protein was increased further after an additional 2 days of a
low-carbohydrate diet despite progressive increases in plasma
FFA levels (25). Although muscle glycogen was not determined in that investigation (25), little variation in content
would be expected, as muscle glycogen levels can be maintained for at least 3 days in subjects who do not participate in
vigorous exercise (12).
In the present study, the intake of a low-carbohydrate diet
following glycogen-depleting exercise was also associated
with a twofold elevation in FFA concentrations. Accordingly,
we are unable to ascertain whether muscle energy stores per se
and/or the prevailing concentrations of circulating metabolites
exerted the predominant effect on PDK-4 transcription. However, Pilegaard et al. (26) have previously reported that the
transcriptional activation of PDK-4 in response to a bout of
exercise is enhanced in skeletal muscle when starting muscle
glycogen content is low. Taken collectively, these observations
suggest that the transient transcriptional activation of PDK-4
may be coordinately linked to signaling mechanisms that are
sensitive to muscle glycogen content and/or FFA availability.
Although the subset of glucoregulatory genes determined in
the present study responded in a coordinated manner to
changes in whole body carbohydrate availability, the fat genes
under investigation were selectively altered in response to
exercise-dietary intervention. Several genes specific to lipid
metabolism were chosen for investigation as indexes of putative fatty acid transport/uptake (FAT/CD36), mitochondrial
fatty acid transporters (CPT I), and substrate-level oxidative
enzymes (-HAD and HSL). Whereas 2 days of a low-carbohydrate diet after glycogen-depleting exercise induced only
small to moderate effects on CPT I, HSL, and -HAD mRNA,
the transcription of FAT/CD36 and UCP3 was significantly
increased after this intervention. We have previously reported
that 5 days of a low-carbohydrate, high-fat diet failed to
increase the abundance of CPT I and plasma membrane fatty
acid-binding protein mRNA expression, while markedly increasing FAT/CD36 mRNA and protein (6). However, in that
study, well-trained athletes maintained a vigorous exercise
program while consuming the diet: the subjects high fitness
levels and intense training are likely to have influenced the
extent and degree of gene expression observed (6). FAT/CD36
is present in tissues with a high FA demand and turnover (3),
and although its contribution to skeletal muscle FA uptake is
not well characterized, it does appear to have a role as a
regulator of intracellular FA uptake during periods of increased
supply and/or demand (2).
AJP-Endocrinol Metab VOL

UCP3 is a member of a family of mitochondrial carrier


proteins with a number of hypothetical roles, including contributing to the uncoupling of respiration (4), FA export from
the mitochondrial matrix (19), or reactive oxygen species
regulation (31). Previous studies have reported an induction of
UCP3 mRNA in response to fasting (27, 34) and high-fat
feeding (18, 30). The results from the present study confirm
and extend previously observed diet-induced alterations in
UCP3 gene expression (30) to show that UCP3 mRNA levels
are moderately elevated (twofold) within 48 h of switching to
a low-carbohydrate diet.
In conclusion, this is the first study to quantify the extent to
which short-term exercise and diet manipulation impact the
subsequent transcription of a subset of both carbohydrate- and
fat-related metabolic genes. We found a rapid capacity for
alterations in dietary macronutrient content to modulate
changes in the expression of mRNA following a bout of
glycogen-depleting exercise. However, substrate availability
only exerted large and uniform effects on a subset of glucoregulatory genes (GLUT4, glycogenin, and PDK-4). The
transcription of genes encoding for lipid transport and oxidation in skeletal muscle varied, with only FAT/CD36 and UCP3
exhibiting significant increases in mRNA abundance in the
face of low-carbohydrate availability.
ACKNOWLEDGMENTS
We thank Prof. Mark Hargreaves for critical analysis of this manuscript and
Prof. Louise M. Burke for time and expertise in constructing the diets used in
this study. We also extend our sincere appreciation to Prof. Will G. Hopkins
for a significant contribution to the statistical analyses reported in this paper.
GRANTS
This study was supported by a research grant from GlaxoSmithKline
Nutrition (UK) to J. A. Hawley, and Deakin University Priority Area funding
to D. Cameron-Smith.
REFERENCES
1. Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ. Basic
local alignment search tool. J Mol Biol 215: 403 410, 1990.
2. Bonen A, Dyck DJ, Ibrahimi A, and Abumrad NA. Muscle contractile
activity increases fatty acid metabolism and transport and FAT/CD36.
Am J Physiol Endocrinol Metab 276: E642E649, 1999.
3. Bonen A, Dyck DJ, and Luiken JJ. Skeletal muscle fatty acid transport
and transporters. Adv Exp Med Biol 441: 193205, 1998.
4. Boss O, Hagen T, and Lowell BB. Uncoupling proteins 2 and 3: potential
regulators of mitochondrial energy metabolism. Diabetes 49: 143156,
2000.
5. Burke LM, Angus DJ, Cox GR, Cummings NK, Febbraio MA,
Gawthorn K, Hawley JA, Minehan M, Martin DT, and Hargreaves
M. Effect of fat adaptation and carbohydrate restoration on metabolism
and performance during prolonged cycling. J Appl Physiol 89: 24132421,
2000.
6. Cameron-Smith D, Burke LM, Angus D, Tunstall RJ, Cox GR, Bonen
A, Hawley JA, and Hargreaves M. A short-term, high-fat diet upregulates lipid metabolism and gene expression in human skeletal muscle.
Am J Clin Nutr 77: 313318, 2003.
7. Cohen J. Statistical Power Analysis for the Behavioral Sciences. NJ:
Lawrence Erlbaum, 1988.
8. Coyle EF, Jeukendrup AE, Wagenmakers AJM, and Saris WHM.
Fatty acid oxidation is directly regulated by carbohydrate metabolism
during exercise. Am J Physiol Endocrinol Metab 273: E268 E275, 1997.
9. Dagenais GR, Tancredi RG, and Zierler KL. Free fatty acid oxidation
by forearm muscle at rest and evidence for an intramuscular lipid pool in
the human forearm. J Clin Invest 58: 421 431, 1976.
10. DeFronzo RA, Jacot E, Jequier E, Maeder E, Wahren J, and Felber
JP. The effect of insulin on the disposal of intravenous glucose: results

287 JULY 2004

www.ajpendo.org

EXERCISE-DIETARY REGULATION OF METABOLIC GENES

11.

12.
13.
14.
15.
16.
17.

18.

19.
20.
21.
22.
23.
24.
25.

from indirect calorimetry and hepatic and femoral venous catheterization.


Diabetes 30: 1000 1007, 1980.
Gerber HP, Condorelli F, Park J, and Ferrara N. Differential transcriptional regulation of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-1/KDR, is up-regulated by hypoxia. J Biol
Chem 272: 23659 23667, 1997.
Goforth HWJ, Arnall DA, Bennett BL, and Law PG. Persistance of
supercompensated muscle glycogen in trained subjects after carbohydrate
loading. J Appl Physiol 82: 342347, 1997.
Gygi SP, Rochon Y, Franza BR, and Aebersold R. Correlation between
protein and mRNA abundance in yeast. Mol Cell Biol 19: 17201730, 1999.
Hargreaves M and Cameron-Smith D. Exercise, diet, and skeletal
muscle gene expression. Med Sci Sports Exerc 34: 15051508, 2002.
Hargrove JL, Hulsey MG, and Beale EG. The kinetics of mammalian
gene expression. Bioessays 13: 667 674, 1991.
Hawley JA and Noakes TD. Peak power output predicts maximal oxygen
uptake and performance time in trained cyclists. Eur J Appl Physiol 65:
79 83, 1992.
Helge JW, Watt PW, Richter EA, Rennie MJ, and Kiens B. Fat
utilization during exercise: adaptation to a fat-rich diet increases utilization
of plasma fatty acids and very low density lipoprotein-triacylglycerol in
humans. J Physiol 537: 1009 1020, 2001.
Hesselink MKC, Greenhaff PL, Constantin-Teodosiu D, Hultman E,
Saris WHM, Nieuwlaat R, Schaart G, Kornips E, and Schrauwen P.
Increased uncoupling protein 3 content does not affect mitochondrial function
in human skeletal muscle in vivo. J Clin Invest 111: 479 486, 2003.
Himms-Hagen J and Harper ME. Physiological role of UCP3 may be
export of fatty acids from mitochondria when fatty acid oxidation predominates: an hypothesis. Exp Biol Med 226: 78 84, 2001.
Jump DB and Clarke SD. Regulation of gene expression by dietary fat.
Annu Rev Nutr 19: 6390, 1999.
Kraniou Y, Cameron-Smith D, Misso M, Collier GR, and Hargreaves
M. Effects of exercise on GLUT-4 and glycogenin gene expression in
human skeletal muscle. J Appl Physiol 88: 794 796, 2000.
Lowry OH and Passonneau JV. A Flexible System of Enzymatic Analysis. New York: Academic, 1972.
MacLean PS, Zheng D, and Dohm GL. Muscle glucose transporter
(GLUT4) gene expression during exercise. Exerc Sport Sci Rev 28:
148 152, 2000.
Mu J and Roach PJ. Characterization of human glycogenin-2, a self
glycosylating initiator of liver glycogen metabolism. J Biol Chem 273:
34850 34856, 1998.
Peters SJ. Human skeletal muscle PDH kinase activity and isoform
expression during a 3-day high-fat/low-carbohydrate diet. Am J Physiol
Endocrinol Metab 281: E1151E1158, 2001.

AJP-Endocrinol Metab VOL

E31

26. Pilegaard H, Keller C, Steensberg A, Helge JW, Pedersen BK, Saltin


B, and Neufer PD. Influence of pre-exercise muscle glycogen content on
exercise-induced transcriptional regulation of metabolic genes. J Physiol
541: 261271, 2002.
27. Pilegaard H, Saltin B, and Neufer PD. Effect of short-term fasting and
refeeding on transcriptional regulation of metabolic genes in human
skeletal muscle. Diabetes 52: 657 662, 2003.
28. Ren JM, Semenkovich CF, Gulve EA, Gao J, and Holloszy JO.
Exercise induces rapid increases in GLUT-4 expression, glucose transport
activity, and insulin stimulated glycogen storage in muscle. J Biol Chem
269: 14396 14401, 1994.
29. Ririe K, Rasmussen R, and Wittwer C. Product differentiation by
analysis of DNA melting curves during the polymerase chain reaction.
Anal Biochem 245: 154 160, 1997.
30. Schrauwen P, Hoppeler H, Billeter R, Bakker AH, and Pendergast
DR. Fiber type dependent upregulation of human skeletal muscle UCP2
and UCP3 mRNA expression by high-fat diet. Int J Obes Relat Metab
Disord 25: 449 456, 2001.
31. Schrauwen P, Saris WH, and Hesselink MK. An alternative function for
human uncoupling protein 3: protection of mitochondria against accumulation of nonesterified fatty acids inside the mitochondrial matrix. FASEB
J 15: 24972502, 2001.
32. Schrauwen P, Wagenmakers AJM, van Marken Lichtenbelt WD,
Saris WHM, and Westerterp KR. Increase in fat oxidation on a high-fat
diet is accompanied by an increase in triglyceride-derived fatty acid
oxidation. Diabetes 49: 640 646, 2000.
33. Sidossis LS and Wolfe RR. Glucose and insulin-induced inhibition of
fatty acid oxidation: the glucose-fatty acid cycle reversed. Am J Physiol
Endocrinol Metab 270: E733E738, 1996.
34. Tunstall RJ, Mehan KA, Hargreaves M, Spriet LL, and CameronSmith D. Fasting activates the gene expression of UCP3 independent of
genes necessary for lipid transport and oxidation in skeletal muscle.
Biochem Biophys Res Commun 294: 301308, 2002.
35. Tunstall RJ, Mehan KA, Wadley GD, Collier GR, Bonen A, Hargreaves M, and Cameron-Smith D. Exercise training increases lipid
metabolism gene expression in human skeletal muscle. Am J Physiol
Endocrinol Metab 283: E66 E72, 2002.
36. Van Loon LJC. The Effects of Exercise and Nutrition on Muscle Fuel
Selection. Maastricht, The Netherlands: Universitaire Pers Maastricht,
2001, p. 185.
37. Wadley GD, Tunstall RJ, Sanigorski A, Collier GR, Hargreaves M,
and Cameron-Smith D. Differential effects of exercise on insulinsignaling gene expression in human skeletal muscle. J Appl Physiol 90:
436 440, 2001.

287 JULY 2004

www.ajpendo.org

Skeletal muscle adaptation: training twice every


second day vs. training once daily

Anne K. Hansen, Christian P. Fischer, Peter Plomgaard, Jesper Lvind Andersen,


Bengt Saltin and Bente Klarlund Pedersen
J Appl Physiol 98:93-99, 2005. First published 10 September 2004; doi:10.1152/japplphysiol.00163.2004
You might find this additional info useful...
This article cites 51 articles, 21 of which can be accessed free at:
/content/98/1/93.full.html#ref-list-1
This article has been cited by 26 other HighWire hosted articles, the first 5 are:
Optimizing Intramuscular Adaptations to Aerobic Exercise: Effects of Carbohydrate
Restriction and Protein Supplementation on Mitochondrial Biogenesis
Lee M. Margolis and Stefan M. Pasiakos
Adv Nutr, November , 2013; 4 (6): 657-664.
[Abstract] [Full Text] [PDF]

Low muscle glycogen concentration does not suppress the anabolic response to resistance
exercise
Donny M. Camera, Daniel W. D. West, Nicholas A. Burd, Stuart M. Phillips, Andrew P.
Garnham, John A. Hawley and Vernon G. Coffey
J Appl Physiol, July 15, 2012; 113 (2): 206-214.
[Abstract] [Full Text] [PDF]
More than a store: regulatory roles for glycogen in skeletal muscle adaptation to exercise
Andrew Philp, Mark Hargreaves and Keith Baar
Am J Physiol Endocrinol Metab, June 1, 2012; 302 (11): E1343-E1351.
[Abstract] [Full Text] [PDF]
High-fat diet overrules the effects of training on fiber-specific intramyocellular lipid
utilization during exercise
Karen Van Proeyen, Karolina Szlufcik, Henri Nielens, Louise Deldicque, Raf Van Dyck,
Monique Ramaekers and Peter Hespel
J Appl Physiol, July , 2011; 111 (1): 108-116.
[Abstract] [Full Text] [PDF]
Updated information and services including high resolution figures, can be found at:
/content/98/1/93.full.html
Additional material and information about Journal of Applied Physiology can be found at:
http://www.the-aps.org/publications/jappl

This information is current as of September 20, 2014.

Journal of Applied Physiology publishes original papers that deal with diverse areas of research in applied physiology, especially
those papers emphasizing adaptive and integrative mechanisms. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright 2005 by the American Physiological Society.
ISSN: 0363-6143, ESSN: 1522-1563. Visit our website at http://www.the-aps.org/.

Downloaded from on September 20, 2014

Reduced carbohydrate availability enhances exercise-induced p53 signaling in human


skeletal muscle: implications for mitochondrial biogenesis
Jonathan D. Bartlett, Jari Louhelainen, Zafar Iqbal, Andrew J. Cochran, Martin J. Gibala,
Warren Gregson, Graeme L. Close, Barry Drust and James P. Morton
Am J Physiol Regul Integr Comp Physiol, March 15, 2013; 304 (6): R450-R458.
[Abstract] [Full Text] [PDF]

J Appl Physiol 98: 9399, 2005.


First published September 10, 2004; doi:10.1152/japplphysiol.00163.2004.

Skeletal muscle adaptation: training twice every second day


vs. training once daily
Anne K. Hansen, Christian P. Fischer, Peter Plomgaard,
Jesper Lvind Andersen, Bengt Saltin, and Bente Klarlund Pedersen
Department of Infectious Diseases and The Copenhagen Muscle Research Centre,
Rigshospitalet, University of Copenhagen, Copenhagen, Denmark
Submitted 13 February 2004; accepted in final form 7 September 2004

has been a key research


area within exercise physiology for many years. When relating
to the effect on performance, e.g., running time in a marathon
race, it is clear that carbohydrate loading the days before to
rebuild muscle glycogen as well as carbohydrate intake during
the race enhance performance (28, 31, 37). In analogy, a
common belief is that carbohydrate intake during training at
high amounts will allow the athlete to train harder and longer
and thus achieve a superior training response. However, this
argument does not consider the unsolved longstanding question
of whether it is a lack or a surplus of a substrate that triggers
the training adaptation (14).
In endurance exercise, adaptation includes systemic changes
O2 max). Adaptasuch as improved maximal oxygen uptake (V
tion also includes prolonged time until exhaustion at a given
workload, which is linked to maximal aerobic power but may

also be linked to local factors within the muscle (46). The


multitude of adaptations that occur with training that allow for
greater performance also includes an increased number of
capillaries (2, 3), an increased density of mitochondria with the
activity of enzymes such as 3-hydroxyacyl-CoA dehydrogenase (HAD) and citrate synthase (CS) being elevated, an
increased concentration of transport proteins, greater glycogen
concentration (24, 27, 30, 46), and a relative increase in the
occurrence of type IIA fibers at the expense of type IIX fibers
(2, 3). As a result, the ability to metabolize fat is enhanced (24).
When a more molecular view on training adaptation is taken,
it is obvious that adaptation is a consequence of accumulation
of specific proteins. The gene expression that allows for these
changes in protein concentration is pivotal to the training
adaptation. Recent studies have demonstrated that exercise
induces transcription of several genes (43). Furthermore, it has
been demonstrated that muscle glycogen is a determining
factor for the transcription of some genes. Exercising when
muscle glycogen concentration was low resulted in a greater
transcriptional activation of interleukin-6 (32), pyruvate dehydrogenase kinase 4 (23, 42), hexokinase (42), and heat shock
protein 72 (22) compared with when muscle glycogen concentration was high or normal at the start of exercise. The role of
glycogen could be explained by the fact that several transcription factors include glycogen-binding domains. When muscle
glycogen is low, these factors are released and become free to
associate with different targeting proteins (4, 18, 44, 48, 49).
Helge and Kiens (29) studied the role of substrate availability on muscle enzyme activity and found that HAD increased
with training after adaptation to a fat-rich diet but not a
carbohydrate-rich diet. Transcriptional activities of HAD and
CS are only markedly influenced by acute muscle contractions
(43). However, it is possible that the accumulation of mRNA
for these genes peaks late in the recovery from the exercise and
that a low muscle glycogen level may enhance the transcription
of these genes.
On this molecular background, we have formulated the
overall hypothesis that training on a low muscle glycogen level
will improve training adaptation (21). In the present study, we
specifically tested the hypothesis that training at a low muscle
glycogen content would enhance levels of HAD and CS.
Moreover, performance defined as time until exhaustion at a
given power output would be more pronounced by training
twice every second day compared with training once daily.

Address for reprint requests and other correspondence: B. K. Pedersen,


Dept. of Infectious Diseases M7641, and The Copenhagen Muscle Research
Centre, Rigshospitalet, Blegdamsvej 9, DK-2100 Copenhagen, Denmark
(E-mail: bkp@rh.dk).

The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked advertisement
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

substrate availablity; 3-hydroxyacyl-CoA dehydrogenase; citrate synthase

THE ROLE OF SUBSTRATE AVAILABILITY

http://www. jap.org

8750-7587/05 $8.00 Copyright 2005 the American Physiological Society

93

Downloaded from on September 20, 2014

Hansen, Anne K., Christian P. Fischer, Peter Plomgaard, Jesper Lvind Andersen, Bengt Saltin, and Bente Klarlund Pedersen. Skeletal muscle adaptation: training twice every second day vs.
training once daily. J Appl Physiol 98: 9399, 2005. First published
September 10, 2004; doi:10.1152/japplphysiol.00163.2004.Low
muscle glycogen content has been demonstrated to enhance transcription of a number of genes involved in training adaptation. These
results made us speculate that training at a low muscle glycogen
content would enhance training adaptation. We therefore performed a
study in which seven healthy untrained men performed knee extensor
exercise with one leg trained in a low-glycogen (Low) protocol and
the other leg trained at a high-glycogen (High) protocol. Both legs
were trained equally regarding workload and training amount. On day
1, both legs (Low and High) were trained for 1 h followed by 2 h of
rest at a fasting state, after which one leg (Low) was trained for an
additional 1 h. On day 2, only one leg (High) trained for 1 h. Days 1
and 2 were repeated for 10 wk. As an effect of training, the increase
in maximal workload was identical for the two legs. However, time
until exhaustion at 90% was markedly more increased in the Low leg
compared with the High leg. Resting muscle glycogen and the activity
of the mitochondrial enzyme 3-hydroxyacyl-CoA dehydrogenase increased with training, but only significantly so in Low, whereas citrate
synthase activity increased in both Low and High. There was a more
pronounced increase in citrate synthase activity when Low was
compared with High. In conclusion, the present study suggests that
training twice every second day may be superior to daily training.

94

MUSCLE GLYCOGEN: TRAIN LOW, COMPETE HIGH

We therefore designed a protocol of two different training


regimens in which the cycling of muscle glycogen differed.
Critical would be to have direct comparison between legs on
the same individual, where one leg has trained markedly more
with low glycogen than the other. This can be accomplished by
having one leg train twice every second day, whereas the other
only trains once daily.
When a subject exercises, muscle glycogen declines and is
slowly restored over the following 24 h if carbohydrate intake
is normal (14, 26, 34). Therefore, when two exercise sessions
of 1 h is separated by 2 h, the second bout of exercise is
undertaken with low muscle glycogen at its start, whereas
muscle glycogen is restored before each exercise bout when the
exercise is separated by 24 h.
MATERIALS AND METHODS

Fig. 1. Schematic overview showing the design of the study. Before onset of the training period, the maximal power output (Pmax) and the time to exhaustion
(Texh) at 90% of Pmax were determined for each leg on separate occasions. At least 48 h after the last performance test, a blood sample as well as a muscle biopsy
from the vastus laterialis (gray arrows) were obtained during rest after an overnight fast. After the first set of performance tests, the participants trained both legs
for 10 wk, followed by a second posttraining set of performance tests similar to those performed before training. The training consisted of a 14-day cycle repeated
5 times. During one 14-day period (box at top), one leg (Low) was trained for 5 days by the subjects performing 2 bouts of dynamic knee extensor exercise,
each bout lasting 1 h and separated by a 2-h break. Meanwhile, the other leg (High) was trained every day for 5 days/wk by the subjects performing 1 bout of
dynamic knee extensor exercise for 1 h. Numbers in the box at top denote the number of the day during the 14-day training cycle. The workload was initially
set to 75% of the pretraining Pmax, and increased by 510% every 14-days, depending on the progress of each participant. Of note, the workload for each leg
was equal during the training sessions; thus the total work for each leg during the training period was equal. F, One 1-hour training bout; E, contralateral resting leg.
J Appl Physiol VOL

98 JANUARY 2005

www.jap.org

Downloaded from on September 20, 2014

Seven healthy untrained young men were recruited with a mean age
of 26 yr (range 24 29 yr), a mean weight of 86.7 kg (range 53129
kg), mean height of 180.1 cm (range 171189 cm). The subjects were
exposed to a highly demanding and intensive training program lasting
10 wk with one- and/or two-legged knee extensor exercise (Fig. 1).
The study was opposed by the local Ethical Committee of Copenhagen and Frederiksburg Communities and was performed in accordance with the Declaration of Helsinki. The two legs were trained
after different schedules. By randomization, all subjects trained one
leg twice every second day [low-glycogen training (Low)], whereas
the other leg was trained once daily [high-glycogen training (High)].
Each bout of exercise lasted 1 h. On day 1, both legs trained
simultaneously for 1 h at 75% of maximal power output (Pmax),
followed by 2 h of recovery. Thereafter, the Low leg trained for 1 h
at 75% of Pmax.On day 2, the High leg trained alone for 1 h at 75%
of Pmax. This 2-day training cycle was repeated for 10 wk. Every
week, subjects trained 5 days and then rested 2 days. The training
sessions were performed in the morning after an overnight fast, the
first exercise bout being undertaken between 6:00 and 9:00 AM. The
subjects were fasting until the training session was finished. Water
intake was ad libitum. The workload of the 10-wk training was
initially 75% of Pmax before the training started. Workload was
increased individually by 510% depending on the progress of each
individual. The workload was identical for the two legs. Before and
after the 10 wk of training, a Pmax test was obtained for each leg
separately using the same cycle ergometer-knee extensor exercise
apparatus (Monark, Varberg, Sweden). Thereafter, a 90% Pmax endurance test was performed for each leg.
O2 max test on each leg
In the first trial, the subjects performed a V
to determine the individual knee Pmax. Both legs were tested on the

same day with at least 30 min of rest in between. The test began with
a 10-min warm-up at 20 W followed by a stepwise increase of 10 W
in workload every 2 min. Subjects worked until exhaustion.
Diet. The subjects consumed a mixed Western diet throughout the
study (16 MJ per day, 70% carbohydrate, 15% protein, 15% fat).
Subjects were asked to adhere to the diet and to refrain from strenuous
exercise other than that included in the training protocol.
Muscle biopsies. Muscle biopsy samples were obtained before and
after 10 wk of training from the vastus lateralis muscle of both legs.
The volunteers were told to abstain from any strenuous exercise 48 h
before these biopsies. In addition, muscle biopsies were obtained in
relation to training sessions (before, immediately after the first bout of
exercise, after 2 h of rest, and immediately after the second bout of
exercise). Muscle biopsies were analyzed for glycogen by using
enzymatic analyses with fluorometric detection (19). In addition,
biopsies were analyzed for CS and HAD activity (20).
Hormones. Glucose and lactate were measured by use of an
automated analyzer (Cobas Fara, Roche, Basel, Switzerland). Plasma
insulin (Insulin RIA 100, Amersham Pharmacia Biotech, Uppsala,
Sweden), glucagon (Linco Research, St. Charles, MO), and cortisol
(Diagnostic Products, Los Angeles, CA) were determined by RIA, and
plasma epinephrine and norepinephrine were determined by HPLC
(9, 47).
Fiber types and capillaries. Serial sections (10 m) of the muscle
biopsy samples were cut in a cryostat at 20C, and routine ATPase
histochemistry analysis performed after preincubation at pH 4.37,
4.60, and 10.30 (10). Five different fiber types were defined: types I,
I/IIA, IIA, IIAX, and IIX. The terms IIAX and IIX have been
used instead of IIAB and IIB, to match the predominant
nomenclature used for the human myosin heavy chain (MHC)
isoforms (1). Fibers determined to be type II fibers, but showing an
intermediate staining with pH 4.60 preincubation, were categorized
as type IIAX fibers. These fibers covered a wide range from fibers
with only a light staining (i.e., fibers with predominately MHC IIA
expression) to fibers with a much darker staining (i.e., fibers with
predominantly MHC IIX expression). In some individuals, the
number of the minor fiber types (I/IIA, IIAX, and IIX) were so
small that a reliable statistical comparison of changes in fiber-type
size was impossible. Therefore, calculations of fiber-type size were
performed for three major categories of fiber types (type I, type
IIA, and type IIAX). Staining of capillaries was performed by
using the double-staining method (45).
The serial sections of the various ATPase and capillary stainings
were visualized and analyzed for fiber-type percent, fiber-type area
percent, fiber size, and capillary density expressed as capillaries per
fiber and as capillaries per millimeter squared by using a TEMA
image analyzing system (Scanbeam, Hadsund, Denmark) as used

95

MUSCLE GLYCOGEN: TRAIN LOW, COMPETE HIGH

Table 1. Maximal power output and time until exhaustion at


90% of maximal power output before and after 10 wk of
training and total work before and after 10 wk of training
Pretraining

Posttraining

Parameter

Low

High

Low

High

Pmax, W
Texh, min
Total work, kJ

747
5.00.7
225

776
5.61.2
257

1077*
19.72.4*
11414*

1066
11.91.3
698

Values are means SE. Low, leg trained with low muscle glycogen
protocol; High, leg trained with high muscle glycogen protocol; Pmax, maximal
power output; Texh, time until exhaustion; total work, Pmax Texh. *Significant
difference (P 0.05) from pretraining in Low. Significant difference (P
0.05) from pretraining, in High. Significant difference (P 0.05) between
Low and High..

previously by our laboratory (45). We examined an average of 105


16 fibers in each biopsy.
RESULTS

DISCUSSION

The main findings of the present study were that 1) that time
until exhaustion, 2) resting muscle glycogen concentration, and
3) CS activity were enhanced by training twice every second
day when compared with training once daily. The protocol
allowed us to compare the work performed in the prolonged
time trial with each leg at the same absolute as well as exercise
intensity. Using a study design where the two legs were trained
at different protocols further allowed us to distinguish possible
systemic and local effects. Thus systemic concentrations of, for
example, hormones and glucose were equal for the two legs,
and the study design therefore only measured possible local
differences as a consequence of different training schedules.
The present study was based on an overall hypothesis, which
can be expressed as follows: Muscle glycogen: train low,
compete high. This hypothesis refers to the fact that, whereas
numerous studies have demonstrated that low muscle glycogen

Table 2. Hormone and lactate levels


Both Legs

Insulin
Glucagon
Norepinephrine
Epinephrine
Cortisol
Lactate

Low

High

Pretraining

Posttraining

Pretraining

Posttraining

Pretraining

Posttraining

47.212.76
90.115.61
2.10.25
0.30.07
16.32.46
1.10.37

19.563.37*
137.4824.23*
5.790.82*
0.740.16*
14.304.17
3.280.66

28.298.60
74.338.37
2.210.19
0.280.05
15.484.07
1.130.13

17.867.81*
129.5217.99*
4.650.35*
0.890.18*
11.091.60
3.110.70

35.547.98
75.688.69
2.110.26
0.300.07
16.203.51
1.380.11

21.173.36*
109.5517.09*
3.370.36
0.660.14
12.532.00
2.080.34

Values are means SE. No significant differences were observed between pretraining values for Low and High legs. *Difference between pretraining and
posttraining; P 0.05. Difference between Low and High legs posttraining value, P 0.05.
J Appl Physiol VOL

98 JANUARY 2005

www.jap.org

Downloaded from on September 20, 2014

Pmax and time until exhaustion. In response to 10 wk of


training, Pmax increased significantly, being the same in the two
legs (Table 1). The endurance at 90% of this new Pmax was
markedly increased for both legs, but time until exhaustion was
twice as long for Low compared with High. In accordance, the
actual work performed by Low was also markedly larger
compared with High.
Hormones and lactate in relation to a training session.
Plasma insulin, glucagon, norepinephrine, epinephrine, cortisol, and lactate were measured before and after 1 h of knee
extensor exercise with both legs, which corresponded to the
first exercise at that particular day; before and after knee
extensor exercise for 1 h with the Low leg, which was performed 2 h after the exercise with both legs; as well as before
and after 1 h of exercise with the High leg, which corresponded
to the first bout of exercise on the following day. During both
exercises with two legs as well as one leg, plasma insulin
decreased, whereas plasma glucaogon, norepinephrine, and
epinephrine increased (Table 2). These changes occurred to the
same extent when exercise was performed with two legs and
when exercise was performed with the Low leg. The hormonal
responses to exercise with the Low leg were in general more
pronounced compared with exercise performed with the High
leg. The difference in responses between the Low and High
legs was significant for norepinephrine and epinephrine.
Plasma cortisol did not change in response to exercise.

Muscle glycogen. Muscle glycogen content was measured at


rest before, after 5 wk, and after 10 wk of training (Fig. 2A).
Training induced a marked increase in muscle glycogen. This
effect was, however, only significant for Low. Muscle glycogen was also measured in relation to two training sessions.
Muscle glycogen declined during the first bout of exercise.
Because the subjects were not allowed to eat in the recovery
period of the first bout of exercise, the second bout of exercise
undertaken by Low was initiated at a low muscle glycogen
level. Therefore, every second time the Low leg trained, it was
with a markedly low muscle glycogen level, whereas the High
leg initiated each training session with a high muscle glycogen
content (Fig. 2B).
Mitochondrial enzymes The activities of the mitochondrial
enzymes HAD and CS were measured in muscle biopsies
obtained at rest before and after 5 and 10 wk of training (Fig.
3). HAD activity increased with training, but only significantly
so in Low, whereas CS activity increased in both Low and
High. When the relative change from pretraining to after 10 wk
of training was estimated, there was a significantly more
pronounced increase in CS activity when Low was compared
with High.
Muscle fibers and capillaries. Percent number and percent
area of type IIX fibers decreased significantly in High, but
there was no difference between the two legs postexercise
(Table 3). There were no significant effects of training and no
difference between Low and High with regard to distribution of
fiber types or size or with regard to capillaries.

96

MUSCLE GLYCOGEN: TRAIN LOW, COMPETE HIGH

transcription rate of a number of genes involved in training


adaptation (22, 32, 42).
In the present study, the two legs were trained according to
different protocols: one leg performed one training session

Downloaded from on September 20, 2014

Fig. 2. A: resting muscle glycogen concentration before (pre), halfway through


the training period (mid), and at the end (post) of the training period. Values are
geometric means SE. Difference from pretraining level, P 0.05. B: muscle
glycogen content at rest, after one bout of two-legged training (Post 1st bout), and
after the subsequent bout of one-legged training (Post 2nd bout; with the Low leg).
The biopsies obtained after the 1st and 2nd bouts are from the Low leg only.
Values are geometric means SE. Difference from pretraining level, P 0.05.

content is a limiting factor with regard to performance (6, 15,


28, 31, 36), this may not be valid when it comes to training
adaptation. In fact, data have accumulated showing that low
muscle glycogen content enhances the transcription and the
Fig. 3. A: resting muscle citrate synthase (CS) activity pretraining, midtraining, and posttraining. Values are means SE. Difference from pretraining
level in Low, P 0.05. Difference from pretraining level in High P 0.05.
B: resting muscle 3-hydroxyacyl-CoA dehydrogenase (HAD) activity pretraining, midtraining, and posttraining. Values are means SE. Difference from
pretraining level in Low, P 0.05. Difference from pretraining level in High,
P 0.05. C: change in resting muscle CS and HAD activity from pretraining
to posttraining. Values are means SE. $Difference between Low and High,
P 0.05.
J Appl Physiol VOL

98 JANUARY 2005

www.jap.org

MUSCLE GLYCOGEN: TRAIN LOW, COMPETE HIGH

Table 3. Muscle fiber and capillary characteristics


pretraining and posttraining
Pretraining
Low

High

Low

High

67.05.1
0.20.1
25.03.4
5.02.1
2.41.3

62.76.7
0.10.1
27.24.2
6.52.0
3.21.1

64.75.7
0.80.4
26.34.9
7.53.8
0.40.3

61.85.1
0.20.1
35.25.9
2.31.0
0.30.3*

65.25.0
0.20.1
28.84.3
3.91.5
1.70.9

58.86.3
0.00.0
31.84.9
6.31.8
2.80.9

63.76.3
0.80.4
27.95.3
6.83.3
0.50.3

61.86.6
0.20.1
35.27.2
2.31.1
0.20.2*

4,963843
5,394926

5,061893
5,867676

5.60.6

5.50.6

6.00.3

6.50.4

5.30.7
55516

5.70.5
55237

5.70.4
59827

6.10.5
61033

5,216659 5,564781
5,319550 5,464558

Values are means SE. *Difference from pretraining, P 0.05.

daily, whereas the other leg performed two training sessions


separated by only 2 h every second day. The latter training
schedule resulted in a marked decrease in muscle glycogen
content after the first bout of exercise. Therefore, when the
second bout of exercise was performed within the same day, it
was undertaken with very low muscle glycogen content. Thus
we succeeded in developing a protocol that allowed us to
compare training at a low muscle glycogen with training at a
high muscle glycogen content. The finding that the catecholamine response to exercise performed at low muscle glycogen
was higher than at exercise performed at high muscle glycogen
concentration demonstrates that a higher stress response was
elicited when the muscle glycogen was low.
In the present study, resting muscle glycogen content increased with training in accordance to numerous previous
studies (25). However, the increase in muscle glycogen was
only significant for Low. This indicates that training at the Low
protocol may be a more efficient training mode with respect to
enhancing muscle glycogen stores. It has long been known that
glycogen synthase (GS) activity is closely coupled to the
muscle glycogen content in both rodent (16, 17) and human
skeletal muscle (7), both in the resting state and after muscle
contraction (16, 38, 51). The rate-limiting conversion of UDPglucose to glycogen is catalyzed by GS, which in skeletal
muscle is known to be bound to glycogen particles (5, 35) and
myofibrils (33, 50). Rat studies have demonstrated that contraction-induced increase in GS activity is strongly dependent
on muscle glycogen (38). Exercise regulation of GS is characterized by great complexity (39). GS is a substrate of kinases
and phosphatases acting on several phosphorylation sites of
GS, and exercise seems to activate both stimulatory and inhibitory regulators of GS, including activation of 5-AMP-activated protein kinase (11, 13, 40). The mechanisms responsible
for inhibition and especially activation are poorly understood.
It may be proposed that the GS activity during exercise may
J Appl Physiol VOL

depend on the relative strength of opposing signals. Glycogen


breakdown may be considered the major stimulatory signal.
The finding that training on the Low and High protocols
influence glycogen metabolism differently talks in favor of the
idea that glycogen breakdown and low muscle glycogen are
important stimulatory GS signals, which result in a total
increase in muscle glycogen concentration.
The effect on resting muscle glycogen does, however, not
explain the difference in time until exhaustion because this
test was carried out on a relatively high intensity, which did not
allow the volunteers to exercise for more than a maximum of
25 min. Therefore, muscle glycogen content was not a limiting
factor.
The study did not aim to measure peak muscle oxygen
consumption, and therefore we did not consider measuring the
rate-limiting enzyme -keto acid glutamate dehydrogenase (8).
Rather, we focused on citrate synthase as a more general
marker of the tricarboxylic acid cycle flux and HAD as the
most-used marker enzyme for the -oxidation.
The activity of the mitochondrial enzymes HAD and CS
increased with training in both Low and High. However,
regarding CS activity, this increase was more pronounced in
the leg that was trained in the low muscle glycogen protocol.
Transcriptional activities of HAD and CS are only markedly
influenced by acute muscle contractions (43).
However, the possibility exists that the mRNA for these
genes peak late in the recovery phase. The effect of low muscle
glycogen on HAD and CS gene activation has not been studied.
The finding that the low muscle glycogen protocol induced a
more pronounced enhancement of CS activity may represent
one mechanism explaining the enhanced endurance time in the
low muscle glycogen-trained leg.
We were unable to identify any major effects of training on
muscle fiber types, fiber size, or capillaries, although there was
the expected decrease in the amount of type 2X fibers in the
High leg, with a corresponding tendency in the Low leg.
Similarly, there was a clear, but not significant, tendency of an
increased capillary density in both legs. This lack of significant
adaptations in fiber types and capillary density is most likely
due to the major limitation of the present study: the training
protocol was demanding to such an extent that the cost limited
us to carry through only seven subjects. An n value of seven is
sufficient to study parameters with little variation, but can be a
major limitation in relation to adaptations in fiber types and
capillarization.
The present study should be viewed as one among hopefully
many studies to be conducted in the coming decade, investigating the effect of muscle glycogen content on training adaptation using molecular biological methods as well as exercise
physiological parameters. Coaches and athletes should be careful not to draw practical consequences of the present study with
regard to training regimens. In the real world, training on a
high muscle glycogen content may allow the athlete to train for
longer periods and thereby obtain better results. In addition,
training schedules that allow muscle glycogen to decrease to
low values may increase the risk for the so-called overtraining
syndrome (41).
In summary, in a human experimental laboratory setting,
training twice every second day was superior to training once
daily. The present study therefore suggests that perhaps some
adaptations to physical activity may require a cycling of

98 JANUARY 2005

www.jap.org

Downloaded from on September 20, 2014

Percent number
Type I
Type I/IIA
Type IIA
Type IIAX
Type IIX
Percent area
Type I
Type I/IIA
Type IIA
Type IIAX
Type IIX
Fiber size
Type I
Type II
Capillaries
Capillaries/type I
fiber
Capillaries/type II
fiber
Capillaries/mm2

Posttraining

97

98

MUSCLE GLYCOGEN: TRAIN LOW, COMPETE HIGH

muscle glycogen stores as recently suggested by Chakravarthy


and Booth (12).
ACKNOWLEDGMENTS
We thank the subjects for participation. Ruth Rousing and Hanne Villumsen
are acknowledged for excellent technical assistance.
GRANTS
The study was also supported by grants from The Danish National Research
Foundation (no. 504-14), the Novo Nordisk Foundation, Lundbeckfonden,
Rigshospitalet, Member of H:S-Copenhagen Hospital. Civil Engineer Frode V.
Nyegaard og Hustrus Fond, Danfoss, Augustinus Fonden, Team Danmark, and
Kulturministeriets Udvalg for Idrtsforskning.
REFERENCES

J Appl Physiol VOL

98 JANUARY 2005

www.jap.org

Downloaded from on September 20, 2014

1. Andersen JL and Aagaard P. Myosin heavy chain IIX overshoot in


human skeletal muscle. Muscle Nerve 23: 10951104, 2000.
2. Andersen P and Henriksson J. Capillary supply of the quadriceps
femoris muscle of man: adaptive response to exercise. J Physiol 270:
677 690, 1977.
3. Andersen P and Henriksson J. Training induced changes in the subgroups of human type II skeletal muscle fibres. Acta Physiol Scand 99:
123125, 1977.
4. Armstrong CG, Browne GJ, Cohen P, and Cohen PT. PPP1R6, a novel
member of the family of glycogen-targetting subunits of protein phosphatase 1. FEBS Lett 418: 210 214, 1997.
5. Bergamini C, Buc H, and Morange M. Purification of muscle glycogen
particles by glycerol-gradient centrifugation. FEBS Lett 81: 166 172,
1977.
6. Bergstrom J, Hermansen L, Hultman E, and Saltin B. Diet, muscle
glycogen and physical performance. Acta Physiol Scand 71: 140 150,
1967.
7. Bergstrom J, Hultman E, and Roch-Norlund AE. Muscle glycogen
synthetase in normal subjects. Basal values, effect of glycogen depletion
by exercise and of a carbohydrate-rich diet following exercise. Scand
J Clin Lab Invest 29: 231236, 1972.
8. Blomstrand E, Radegran G, and Saltin B. Maximum rate of oxygen
uptake by human skeletal muscle in relation to maximal activities of
enzymes in the Krebs cycle. J Physiol 501: 455 460, 1997.
9. Blomstrand E and Saltin B. Effect of muscle glycogen on glucose,
lactate and amino acid metabolism during exercise and recovery in human
subjects. J Physiol 514: 293302, 1999.
10. Brooke MH and Kaiser KK. Muscle fiber types: how many and what
kind? Arch Neurol 23: 369 379, 1970.
11. Carling D and Hardie DG. The substrate and sequence specificity of the
AMP-activated protein kinase. Phosphorylation of glycogen synthase and
phosphorylase kinase. Biochim Biophys Acta 1012: 81 86, 1989.
12. Chakravarthy MV and Booth FW. Eating, exercise, and thrifty
genotypes: connecting the dots toward an evolutionary understanding of
modern chronic diseases. J Appl Physiol 96: 310, 2004.
13. Chen Z, Heierhorst J, Mann RJ, Mitchelhill KI, Michell BJ, Witters
LA, Lynch GS, Kemp BE, and Stapleton D. Expression of the AMPactivated protein kinase 1 and 2 subunits in skeletal muscle. FEBS Lett
460: 343348, 1999.
14. Coyle EF. Physical activity as a metabolic stressor. Am J Clin Nutr 72:
512S520S, 2000.
15. Coyle EF, Coggan AR, Hopper MK, and Walters TJ. Determinants of
endurance in well-trained cyclists. J Appl Physiol 64: 26222630, 1988.
16. Danforth WH. Glycogen synthase activity in skeletal muscle. Interconversion of two forms and control of glycogen synthesis. J Biol Chem
240:588 93.: 588 593, 1965.
17. Danforth WH and Harvey P. Glycogen synthetase and control of
glycogen synthesis in muscle. Biochem Biophys Res Commun 16: 466
471, 1964.
18. Doherty MJ, Moorhead G, Morrice N, Cohen P, and Cohen PT.
Amino acid sequence and expression of the hepatic glycogen-binding
(GL)-subunit of protein phosphatase-1. FEBS Lett 375: 294 298, 1995.
19. Essen B and Henriksson J. Glycogen content of individual muscle fibres
in man. Acta Physiol Scand 90: 645 647, 1974.
20. Essen-Gustavsson B and Henriksson J. Enzyme levels in pools of
microdissected human muscle fibres of identified type. Adaptive response
to exercise. Acta Physiol Scand 120: 505515, 1984.

21. Febbraio MA, Steensberg A, Keller C, Starkie RL, Krustrup P, Ott P,


Secher NH, and Pedersen BK. Glucose ingestion attenuates interleukin-6
release from contracting skeletal muscle in humans. J Physiol 549:
607 612, 2003.
22. Febbraio MA, Steensberg A, Walsh R, Koukoulas I, van Hall G, Saltin
B, and Pedersen BK. Reduced glycogen availability is associated with an
elevation in HSP72 in contracting human skeletal muscle. J Physiol 538:
911917, 2002.
23. Furuyama T, Kitayama K, Yamashita H, and Mori N. Forkhead
transcription factor FOXO1 (FKHR)-dependent induction of PDK4 gene
expression in skeletal muscle during energy deprivation. Biochem J 375:
365371, 2003.
24. Gollnick PD and Saltin B. Significance of skeletal muscle oxidative
enzyme enhancement with endurance training. Clin Physiol 2: 112, 1982.
25. Hargreaves M. Interactions between muscle glycogen and blood glucose
during exercise. Exerc Sport Sci Rev 25: 2139, 1997.
26. Hargreaves M. Skeletal muscle metabolism during exercise in humans.
Clin Exp Pharmacol Physiol 27: 225228, 2000.
27. Hawley JA. Adaptations of skeletal muscle to prolonged, intense endurance training. Clin Exp Pharmacol Physiol 29: 218 222, 2002.
28. Hawley JA, Palmer GS, and Noakes TD. Effects of 3 days of carbohydrate supplementation on muscle glycogen content and utilisation during
a 1-h cycling performance. Eur J Appl Physiol Occup Physiol 75: 407
412, 1997.
29. Helge JW and Kiens B. Muscle enzyme activity in humans: role of
substrate availability and training. Am J Physiol Regul Integr Comp
Physiol 272: R1620 R1624, 1997.
30. Holloszy JO and Booth FW. Biochemical adaptations to endurance
exercise in muscle. Annu Rev Physiol 38: 273291, 1976.
31. Karlsson J and Saltin B. Diet, muscle glycogen and endurance performance. J Appl Physiol 31: 203206, 1971.
32. Keller C, Steensberg A, Pilegaard H, Osada T, Saltin B, Pedersen BK,
and Neufer PD. Transcriptional activation of the IL-6 gene in human
contracting skeletal muscle: influence of muscle glycogen content. FASEB
J 15: 2748 2750, 2001.
33. Lane RD, Hegazy MG, and Reimann EM. Subcellular localization of
glycogen synthase with monoclonal antibodies. Biochem Int 18: 961970,
1989.
34. Maehlum S and Hermansen L. Muscle glycogen concentration during
recovery after prolonged severe exercise in fasting subjects. Scand J Clin
Lab Invest 38: 557560, 1978.
35. Meyer F, Heilmeyer LM Jr, Haschke RH, and Fischer EH. Control of
phosphorylase activity in a muscle glycogen particle. I. Isolation and
characterization of the protein-glycogen complex. J Biol Chem 245:
6642 6648, 1970.
36. Mitchell JB, Costill DL, Houmard JA, Flynn MG, Fink WJ, and Beltz
JD. Influence of carbohydrate ingestion on counterregulatory hormones
during prolonged exercise. Int J Sports Med 11: 3336, 1990.
37. Mitchell JB, Pizza FX, Paquet BJ, Davis BJ, Forrest MB, and Braun
WA. Influence of carbohydrate status on immune responses before and
after endurance exercise. J Appl Physiol 84: 19171925, 1998.
38. Nielsen JN, Derave W, Kristiansen S, Ralston E, Ploug T, and Richter
EA. Glycogen synthase localization and activity in rat skeletal muscle is
strongly dependent on glycogen content. J Physiol 531: 757769, 2001.
39. Nielsen JN and Richter EA. Regulation of glycogen synthase in skeletal
muscle during exercise. Acta Physiol Scand 178: 309 319, 2003.
40. Nielsen JN, Wojtaszewski JF, Haller RG, Hardie DG, Kemp BE,
Richter EA, and Vissing J. Role of 5AMP-activated protein kinase in
glycogen synthase activity and glucose utilization: insights from patients
with McArdles disease. J Physiol 541: 979 989, 2002.
41. Petibois C, Cazorla G, Poortmans JR, and Deleris G. Biochemical
aspects of overtraining in endurance sports: the metabolism alteration
process syndrome. Sports Med 33: 8394, 2003.
42. Pilegaard H, Keller C, Steensberg A, Helge JW, Pedersen BK, Saltin
B, and Neufer PD. Influence of pre-exercise muscle glycogen content on
exercise-induced transcriptional regulation of metabolic genes. J Physiol
541: 261271, 2002.
43. Pilegaard H, Saltin B, and Neufer PD. Exercise induces transient
transcriptional activation of the PGC-1 gene in human skeletal muscle.
J Physiol 546: 851 858, 2003.
44. Printen JA, Brady MJ, and Saltiel AR. PTG, a protein phosphatase
1-binding protein with a role in glycogen metabolism. Science 275:
14751478, 1997.

MUSCLE GLYCOGEN: TRAIN LOW, COMPETE HIGH


45. Qu Z, Andersen JL, and Zhou S. Visualisation of capillaries in human
skeletal muscle. Histochem Cell Biol 107: 169 174, 1997.
46. Saltin B and Rowell LB. Functional adaptations to physical activity and
inactivity. Fed Proc 39: 1506 1513, 1980.
47. Steensberg A, van Hall G, Keller C, Osada T, Schjerling P, Pedersen
BK, Saltin B, and Febbraio MA. Muscle glycogen content and glucose
uptake during exercise in humans: influence of prior exercise and dietary
manipulation. J Physiol 541: 273281, 2002.
48. Stralfors P, Hiraga A, and Cohen P. The protein phosphatases involved
in cellular regulation. Purification and characterisation of the glycogen-

99

bound form of protein phosphatase-1 from rabbit skeletal muscle. Eur


J Biochem 149: 295303, 1985.
49. Tang PM, Bondor JA, Swiderek KM, and DePaoli-Roach AA. Molecular cloning and expression of the regulatory (RG1) subunit of the glycogenassociated protein phosphatase. J Biol Chem 266: 1578215789, 1991.
50. Villa ME, Locci CT, and Bergamini E. Adrenaline and glycogen synthase
activity in fast and slow muscles of rat. FEBS Lett 111: 361364, 1980.
51. Zachwieja JJ, Costill DL, Pascoe DD, Robergs RA, and Fink WJ.
Influence of muscle glycogen depletion on the rate of resynthesis. Med Sci
Sports Exerc 23: 44 48, 1991.

Downloaded from on September 20, 2014

J Appl Physiol VOL

98 JANUARY 2005

www.jap.org

Am J Physiol Cell Physiol 305: C323C333, 2013.


First published May 22, 2013; doi:10.1152/ajpcell.00393.2012.

Distinct and additive effects of sodium bicarbonate and continuous mild heat
stress on fiber type shift via calcineurin/NFAT pathway in human skeletal
myoblasts
Tetsuo Yamaguchi, Maiko Omori, Nobuho Tanaka, and Naoshi Fukui
Clinical Research Center, National Hospital Organization Sagamihara Hospital, Minami-ku, Sagamihara City, Kanagawa, Japan
Submitted 6 December 2012; accepted in final form 15 May 2013

Yamaguchi T, Omori M, Tanaka N, Fukui N. Distinct and


additive effects of sodium bicarbonate and continuous mild heat stress
on fiber type shift via calcineurin/NFAT pathway in human skeletal
myoblasts. Am J Physiol Cell Physiol 305: C323C333, 2013. First
published May 22, 2013; doi:10.1152/ajpcell.00393.2012.Ingestion
of sodium bicarbonate (NaHCO3) is known to enhance athletic performance, probably via increased extracellular buffering capacity. At present, little is known about the direct effects of NaHCO3 on myogenesis,
especially in vitro. Here, we examined the effects of NaHCO3 and the
combined effects of NaHCO3 and continuous mild heat stress (CMHS) at
39C on the differentiation of human skeletal muscle myoblasts
(HSMMs). Levels of myosin heavy chain (MyHC) type I mRNA increased with increasing NaHCO3 concentrations; in contrast, those of
MyHC IIx decreased. The NaHCO3-induced fast-to-slow shift was additively enhanced by CMHS. Likewise, intracellular calcium levels and
expression of three factors, nuclear factor of activated T cells c2
(NFATc2), NFATc4, and peroxisome-proliferator-activated receptor-
coactivator-1, were upregulated with increasing NaHCO3 concentrations; moreover, these effects of NaHCO3 were additively enhanced by
CMHS. Overexpression experiments and small interfering RNAmediated knockdown experiments confirmed that NFATc2 and NFATc4
were involved in MyHC I regulation. The present study provided evidence that NaHCO3 and CMHS distinctly and additively induced a
fast-to-slow fiber type shift through changes in intracellular calcium
levels and the modulation of calcium signaling.
myosin heavy chain; calcium signaling; peroxisome proliferatoractivated receptor- coactivator-1; sodium bicarbonate; mild heat
stress

predominantly of three muscle fiber types that are commonly distinguished by their myosin
heavy chain (MyHC) isoforms. In human adults, there are three
major MyHC isoforms, MyHC I and two subtypes of MyHC II
(IIa and IIx; Ref. 8). The mitochondrial content and oxidative
capacity are highest in the slow oxidative type I, lower in the
fast oxidative-glycolytic type IIa, and lowest in the fast glycolytic type IIx fibers. Previous studies have shown that a
fast-to-slow shift in MyHC isoform expression can be induced
under several conditions, including increased neuromuscular
activity, mechanical loading, and hypothyroidism; moreover,
reduced neuromuscular activity, mechanical unloading, and
hyperthyroidism are known to cause a slow-to-fast shift (30).
Several signaling pathways regulate shifts in skeletal muscle
fiber type. A fast-to-slow fiber type shift includes pathways
that involve Ras/ERK (33), calcineurin (Cn; Ref. 25), and
CaMK IV (36). In contrast, p38 MAPK reportedly regulates

HUMAN SKELETAL MUSCLE CONSISTS

Address for reprint requests and other correspondence: T. Yamaguchi,


Clinical Research Center, National Hospital Organization Sagamihara Hospital, Kanagawa, 252-0392, Japan (e-mail: tetsuo-yama@abeam.ocn.ne.jp).
http://www.ajpcell.org

the activity of the MyHC IIx promoter in C2C12 mouse


myoblasts and primary rabbit skeletal myotubes (23). As the
main contractile element of muscle fibers, MyHC isoforms are
frequently used as markers of fiber type, but they are not the
only molecules that determine the muscle phenotype. MyHC is
responsible for muscle contraction, and the sarcoplasmic/endoplasmic reticulum Ca2 ATPase (SERCA) isoforms are
responsible for relaxation (1). SERCA isoforms are normally
expressed in coordination with the corresponding MyHC isoforms in the fibers of skeletal muscle. The isoform SERCA1 is
expressed exclusively in fast skeletal muscle of adults, while
the SERCA2a isoform is expressed in slow skeletal muscle of
adults (1).
Cn is a protein phosphatase that is activated by Ca2calmodulin, and it dephosphorylates nuclear factor of activated
T cells (NFAT) transcription factors. The dephosphorylation of
NFAT proteins causes their translocation from the cytoplasm
to the nucleus, where they bind to enhancer elements of
specific genes leading to transcriptional activation (9). Among
these, four distinct genes encoding closely related NFAT
proteins (NFATc1-c4) have been identified. Knockout of
NFATc1 is embryonically lethal due to defects in cardiogenesis (3), whereas knockout of either NFATc2 or NFATc3
results in muscle atrophy (12, 16). The upregulation of MyHC
I gene expression is thought to involve NFATc1 during the
fast-to-slow fiber type shifts in rodent skeletal muscle cells
(33). Mice with targeted NFATc4 disruption exhibit no known
phenotype (7). Thus the four NFAT isoforms probably have
distinctive roles in fiber type determination within skeletal
muscle.
Peroxisome proliferator-activated receptor- coactivator
(PGC)-1 is a key modulator of the mitochondrial network and
one of the factors that regulate muscle fiber type determination
(19). It interacts with nuclear respiratory factor-1 (NRF-1),
which increases the expression of mitochondrial transcription
factor A (mtTFA) and several nuclear genes that encode
respiratory chain components and mtTFA induces the expression of mitochondrial genes that encode subunits of the electron transport chain complex, such as -ATP synthase, cytochrome c, and cytochrome c oxidase I (COX I; Ref. 6). The
transgenic expression of PGC-1 in fast-twitch glycolytic
muscles promotes mitochondrial biogenesis and oxidative metabolism and induces type IIb muscle fibers to shift towards a
more oxidative phenotype (19). Exercise induces PGC-1 gene
expression in human and rodent skeletal muscles (5, 31).
Regular exercise stimulates mitochondrial biogenesis and
increases muscle oxidative capacity (11, 34). Supplementation
with NaHCO3 enhances athletic performance (10, 22, 28, 32)
and improves mitochondrial mass and respiration in the rat

0363-6143/13 Copyright 2013 the American Physiological Society

C323

C324

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

soleus muscle (2). Because athletic performance is closely


associated with the balance of muscle fiber types and mitochondrial function, we hypothesized that fiber type switching is
affected by NaHCO3 supplementation via specific NFAT isoforms. We previously reported that continuous mild heat stress
(CMHS) imposed by incubation at 39C induces a fast-to-slow
fiber type shift in mammalian myoblasts (38). Therefore, the
present study aimed to determine whether NaHCO3 supplementation and CMHS have additive or synergistic effects on
fast-to-slow fiber type shifts. We also determined the effects of
NaHCO3 supplementation and CMHS on the expression of
molecules associated with mitochondria.
MATERIALS AND METHODS

Cell culture. We used commercially available human skeletal


muscle myoblasts (HSMMs) of normal human quadriceps muscle
obtained from five Caucasian males, 16, 22, 24, 25, and 26 yr of age
(CC-2580; Lonza, Walkersville, MD). HSMMs were cultured in
culture dishes using the SkGM-2 BulletKit according to the manufacturers protocol (CC-3245; Lonza). The differentiation medium (DM)
was DMEM/F-12 (GIBCO, Grand Island, NY) with 2% horse serum,
15 mM HEPES buffer, and 0.25 g/ml fungizone. Media were
changed every other day.
NaHCO3 supplementation and heat stress exposure. HSMMs were
seeded in growth medium and incubated at 37C until they reached
60 70% confluency. The medium was then changed to DM to induce
myotube formation. To determine the effect of varying concentrations
of NaHCO3, the DM was supplemented with 11, 22, 33, or 44 mM
NaHCO3 (GIBCO). To determine the effects of CMHS, the cells were
cultured at 37 or 39C in water-jacketed incubators with humidified
air mixed with 5% CO2. During the experiments, the culture temperature was monitored continuously using a thermometer with a precision of 0.1C.
RNA interference. FlexiTube small interfering RNAs (siRNAs) for
NFATc1 (Hs_NFATC1_7 and Hs_NFATC1_8), NFATc2 (Hs_NFATC2_2
and Hs_NFATC2_5), NFATc3 (Hs_NFATC3_3 and Hs_NFATC3_5), and
NFATc4 (Hs_NFATC4_4 and Hs_NFATC4_7) were purchased from
Qiagen (Hilden, Germany). Allstars Negative Control siRNA (Qiagen) was used as a negative control. HSMMs at 50% confluence on
48-well plates were transfected with 5 pmol of NFATC siRNA using
Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the
manufacturers instructions. For each targeted gene we selected two
sequences with high silencing efficiency. All experiments were performed with both sequences. After transfection, the medium was
changed to DM containing 14 mM NaHCO3 at 37C, which is the
standard concentration in DM according to the manufacturers protocol for HSMMs. Cells were harvested after 72 h.
Overexpression experiments. Transient transfections of expression
vectors were performed using Lipofectamine 2000 according to the
manufacturers instructions. A total of 2.5 104 cells/well was
transfected with 0.5 g of HaloTag control vector, or HaloTag
expression vector carrying NFATc2 (pFN21AB0454, FHC11780) or
NFATc4 (pFN21AB0442, FHC03802) (Promega, Madison, WI) on a
24-well plate. Lipofectamine 2000 was used at an amount of 1.0
l/well. After transfection, the medium was changed to DM containing 14 mM NaHCO3. Cells were harvested after 72 h.
pH measurement. All pH measurements were performed using an
Accumet AR10 pH meter (Fisher Scientific, Pittsburgh, PA) in an
incubator (5% CO2) at 37C.
Western blot analysis. Western blot was carried out with the following primary antibodies: PGC-1 (1:1,000, ST1202; Calbiochem,
San Diego, CA), MyHC I (1:4,000, clone NOQ7.5.4D; Sigma-Aldrich, St. Louis, MO), MyHC II (1:500, clone MY-32; SigmaAldrich), and -actin (1:1,000, clone AC-15; Sigma-Aldrich). Cells
were washed twice with PBS and then lysed with 2 Laemmli sample

buffer. Protein concentrations were quantified using the BCA protein


assay kit (Thermo Fisher Scientific, Rockford, IL) with BSA as the
standard. Aliquots containing 10 g of total protein were separated
using 8 12% SDS-PAGE and electrophoretically transferred to a
nitrocellulose membrane (Bio-Rad, Hercules, CA). The membrane
was then blocked using Tris-buffered saline with 0.05% Tween 20
(TBST) containing 3% skim milk for 1 h and incubated with an
appropriately diluted primary antibody in TBST at 4C overnight.
After incubation, membranes were washed three times in TBST and
incubated for 1 h with a horseradish peroxidase-labeled secondary
antibody (1:5,000, sc-2030 or sc-2031; Santa Cruz Biotechnology,
Santa Cruz, CA). The immunoreactive bands were visualized on
X-ray films (Fuji Photo Film, Tokyo, Japan) using an Immobilon
Western Detection Reagent (Millipore, Billerica, MA).
Quantitative real-time RT-PCR analysis. Total RNA from HSMMs
was isolated using the PureLink RNA Mini kit (Invitrogen). After
DNase treatment, cDNAs were obtained by reverse transcription of 2
g of total RNA (Sensiscript RT kit; Qiagen). Quantitative real-time
RT-PCR (qPCR) was performed using the SYBR Premix Ex Taq
(Perfect Real Time) Premix (TaKaRa Bio, Otsu, Japan) or the LightCycler FastStart DNA Master SYBR Green I kit (Roche, Mannheim,
Germany) in a fluorescent temperature cycler (LightCycler; Roche).
Primer sequences were obtained from previous publications (6, 15, 35,
38) (Table 1). The qPCR protocol included initial denaturation at
95C for 10 min (LightCycler FastStart) or 10 s (SYBR Premix),
followed by 40 50 PCR cycles of 95C for 5 s and 60C for 20 s
(SYBR Premix), or 95C for 10 s, 60C for 10 s, and 72C for 12 s
(LightCycler FastStart). SYBR green fluorescence emissions were
determined after each cycle, and the amount of cDNA was quantified

Table 1. Sequences of the specific primers used in the


quantitative RT-PCR analyses
Genes

MyHC I
MyHC IIx
MyHC IIa
PGC-1
MCIP1
COX I
NRF1
-Actin
Serca 1
Serca 2A
mtTFA
NFATc1
NFATc2
NFATc3
NFATc4

RT-PCR Primer Sequence 5= 3=

Forward: ACAAGCTGCAGCTAAAGGTC
Reverse: TCAAGATGTGGCAAAGCTAC
Forward: AAGAGCAGGGAGGTTCACAC
Reverse: TTATCTCCAAAAGTCATAAGTACA
Forward: AAGGATACCCAGATCCACC
Reverse: CTCAGCATTACGCTTTTGC
Forward: TGTGCTGCTCTGGTTGGTG
Reverse: GCTGAGTGTTGGCTGGTGC
Forward: GCTCCCTGATTGCCTGTGT
Reverse: GGGTCGCATCTTCCACTTG
Forward: TCATAATCGGAGGCTTTGGC
Reverse: GGTTATGGCAGGGGGTTTTA
Forward: TTACTCTGCTGTGGCTGATGG
Reverse: CCTCTGATGCTTGCGTCGTCT
Forward: ACTCTTCCAGCCTTCCTTC
Reverse: ATCTCCTTCTGCATCCTGTC
Forward: GGCAATCGGGGGCTATGTG
Reverse: ATCCTCAGCGTACAGGAACCA
Forward: ACACCAAATAAACCAAGCAG
Reverse: TTTTAGACTTGTGGGAGGGT
Forward: CCGAGGTGGTTTTCATCTGT
Reverse: GCTGAACGAGGTCTTTTTGG
Forward: GCCGCAGCACCCCTACCAGT
Reverse: TTCTTCCTCCCGATGTCCGTCTCT
Forward: AGAAACTCGGCTCCAGAATCC
Reverse: TGGTTGCCCTCATGTTGTTTTT
Forward: ACCCTTTACCTGGAGCAAAC
Reverse: CTTGCAGTAGCGACTGTCTT
Forward: ACACAGCCCTATCTTCAGGA
Reverse: ATCTTGCCTGTGATACGGTG

MyHC, myosin heavy chain; PGC-1, peroxisome proliferator-activated


receptor- coactivator-1; MCIP1, myocyte-enriched calcineurin-interacting
protein 1; COXI, cytochrome c oxidase I; NRF-1, nuclear respiratory factor-1;
Serca, sarcoplasmic/endoplasmic reticulum Ca2 ATPase; mtTFA, mitochondrial transcription factor A; NFAT, nuclear factor of activated T cells.

AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

C325

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

on an Olympus BX51 microscope and were recorded with a digital


camera (DP70; Olympus, Tokyo, Japan).
Measurement of fusion index. The fusion index was defined as the
ratio of the number of DAPI stained nuclei in myotubes with three or
more nuclei to the total number of DAPI stained nuclei in each field.
This percentage was determined by counting 1,000 nuclei per dish on
3 independent cultures for each condition.
Intracellular calcium level measurements. HSMMs were loaded
with fura-2 AM (5 M, F-1225; Invitrogen) in modified Hanks
solution for 45 min at 37C. They were then washed three times with
modified Hanks solution, incubated in that solution for 20 min at
37C, and kept in modified Hanks solution during analysis. The cells
were viewed on an inverted fluorescence microscope (IX71; Olympus) equipped with an on-stage incubation chamber (INUG2-ONICS;
Tokai Hit, Shizuoka, Japan) that kept the cells at either 37C or 39C
under a 5% CO2 atmosphere. The excitation wavelengths of fura-2
AM are 340 and 380 nm, while the emission wavelength is 510 nm.
An intensified CCD camera (ORCA-R2; Hamamatsu Photonics, Shizuoka, Japan) was used for imaging. Image intensities were recorded
every second to give a ratio of emitted intensities at excitation
wavelengths of 340 and 380 nm, F340/F380. Intracellular calcium
level ([Ca2]i) was determined from the F340/F380 ratio. For each
experiment, the fluorescence signals of 10 cells were averaged for
analysis.
Statistical analysis. The effect of temperature on peak/baseline
[Ca2]i was determined using an unpaired Students t-test. The fusion
index and the effects of a single incubation with NaHCO3, siRNA, or
NFATc isoform overexpression on MyHC expression were deter-

using the LightCycler software version 3.5 (Roche). All PCR analyses
were performed in triplicate. The housekeeping gene -actin was used
as a control template for normalizing relative change of each mRNA
in qPCR. The normalized expression level was compared with the
control sample.
Fluorescent staining. For immunofluorescent staining, cells were
incubated in culture dishes containing collagen type I-coated cover
glasses (25 mm type; Iwaki, Tokyo, Japan). At appropriate times, the
cells were washed with warm PBS at 37C and fixed by incubation at
room temperature in FME (4% formaldehyde, 2 mM MgCl2, and 5
mM EGTA in PBS) for 10 min. Cells were washed three times with
PBS and permeabilized with FME containing 0.3% Triton X-100 for
10 min at room temperature. The cells were then washed three times
with PBS and incubated in PBS containing 1% BSA, 0.02% sodium
azide, and an appropriately diluted primary antibody for MyHC (type
I, clone NOQ7.5.4D; type II, clone MY-32), NFATc1-c4 (1:100; c1,
7A6, sc-7294; c2, G1-D10, sc-7295; c3, F-1, sc-8405; c4, H-74,
sc-13036; Santa Cruz Biotechnology) or COX I (1:200, OxPhos
Complex IV Subunit I, clone 1D6E1A8; Invitrogen) at 4C overnight.
The cells were washed three times with PBS, and then reacted for 1
h with fluorescence-conjugated secondary antibody Alexa fluor 488 or
555 (1:500; A11029 or A21424; Invitrogen). To stain functioning
mitochondria in living cells, we used MitoTracker Red CMXRos
(PA-3017; Lonza) according to the manufacturers protocol; this stain
yields a fluorescent signal the intensity of which is dependent on
mitochondrial membrane potential (29). The cover glasses were then
rinsed with PBS and mounted with DAPI (VectorShield, H-1500;
Vector Laboratories, Burlingame, CA). All photographs were viewed

Relative expresion

MyHC IIa

MyHC I
5
4

**

2
1
0

1.5

1.0

1.0

0.5

0.5

0.0

11

22

33

MyHC IIx

1.5

44

11

22

33

* **

0.0

44

11

22

33

44

NaHCO3 (mM)

PH

B
9.0

9.0

8.5

8.5

8.0

8.0

7.5

7.5

7.0

7.0

11

22 33 44

NaHCO3 (mM)

MyHC I
MyHC II
-actin
0

NaOH (mM)
(+NaHCO3 11 mM)

NaOH (mM)
(+NaHCO3 11 mM)

Fig. 1. Effects of sodium bicarbonate (NaHCO3) concentration on myosin heavy chain (MyHC) isoform expression in human skeletal muscle myoblasts
(HSMMs). A: relative expression of MyHC I, MyHC IIa, and MyHC IIx mRNA in HSMMs cultured in differentiation medium (DM) containing 11, 22, 33, or
44 mM NaHCO3 at 37C for 5 days. Expression levels of MyHC isoforms mRNA were determined by quantitative (q)PCR. Results are normalized to -actin
expression. Each column represents means SE of 4 independent experiments per treatment. Statistical analyses involved one-way ANOVA and Dunnetts post
hoc test. *P 0.05 and **P 0.01 refer to comparisons to cells cultured with 11 mM NaHCO3. B: pH of DM containing indicated concentrations of NaHCO3
(left) and pH of DM containing 11 mM NaHCO3 and indicated concentrations of NaOH (right). Results are means SE of 3 independent experiments.
C: Western blot analysis of indicated protein in HSMMs cultured for 7 days in DM containing 11 mM NaHCO3 and indicated concentrations of NaOH using
a specific antibody for MyHC I (clone NOQ7.5.4D) or MyHC II (clone MY32). -Actin was used as a loading control.
AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

C326

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

A
Relative expression

MyHC I

MyHC IIx

MyHC IIa
##

##

**

5
4

1.5
1.5

33

1.0
1.0

22

0.5
0.5

11

1
0

0.0
0.0

00

NaHCO3 (mM) 11 22 33

11 22 33

37C

39C

11 22 33

37C

39C

37C (33 mM)

11 22 33

11 22 33

37C

39C

39C (33 mM)

Relative expression

MyHC II

MyHC I

37C (11 mM)

11 22 33

SERCA1
1.5

Fusion index (%)

2.5
2.5
2.0
2.0

1.0

1.5
1.5
1.0
1.0

0.5

##

0.5
0.5
0.0

NaHCO3 (mM)

SERCA2a

0.0
0.0

11 22 33

11 22 33

37C

39C

11 22 33

11 22 33

37C

39C

37C (11 mM)

**

40
30
20

**

37C (33 mM)


39C (33 mM)

10
0

24 h

48 h

Fig. 2. Effects of continuous mild heat stress (CMHS) on NaHCO3-induced fiber type shift and cell fusion in HSMM cultures. A: relative expression of MyHC
I, MyHC IIa, or MyHC IIx mRNA in HSMMs cultured in DM for 5 days under indicated conditions. Expression of respective MyHC isoforms mRNA was
determined by qPCR. Results were normalized to -actin expression. Each column shows the means SE of 5 independent experiments per treatment. Statistical
analyses involved two-way ANOVA and Bonferroni post hoc test. **P 0.01 refers to comparisons to cells cultured with 11 mM NaHCO3 at respective
temperatures; ##P 0.01, main effect of temperature (37 vs. 39C). B: HSMMs were cultured for 7 days in DM under indicated conditions, and the presence
of MyHC I or MyHC II was visualized by immunofluorescent staining (scale bar 100 m). C: relative expression of sarcoplasmic/endoplasmic reticulum Ca2
ATPase 1 (SERCA1) and SERCA2a mRNA in HSMMs cultured in DM for 5 days under indicated conditions. Expression levels were determined by qPCR and
normalized to -actin expression. Each column shows the means SE of 5 independent experiments per treatment. Statistical analyses involved two-way
ANOVA and Bonferroni post hoc test. *P 0.05 refers to comparisons to cells cultured with 11 mM NaHCO3 at respective temperatures; ##P 0.01, main
effect of temperature (37 vs. 39C). D: HSMMs were cultured for 24 or 48 h in DM under indicated conditions. The fusion index of each culture was examined.
Each column shows the means SE of 3 independent experiments per treatment. Statistical analyses involved one-way ANOVA and Dunnetts post hoc test
at the respective times. *P 0.05 and **P 0.01 refer to comparisons to cells cultured with 11 mM NaHCO3 at 37C at the respective times.
AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

C327

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

mined using a one-way ANOVA followed by Dunnetts test. The


effects of both NaHCO3 and CMHS on gene expression were analyzed using a two-way ANOVA followed by Bonferronis post hoc
test. Statistical significance was set at P 0.05 (GraphPad Prism
Statistical Software version 5; GraphPad Software, San Diego, CA).
RESULTS

NaHCO3 alters expression levels of MyHC isoforms in


HSMMs. To investigate the direct effects of NaHCO3 on the
expression of MyHC isoforms in HSMMs, we incubated HSMMs

at 37C in DM supplemented with 11, 22, 33, or 44 mM


NaHCO3. Expression of MyHC I or MyHC II isoforms was
analyzed by qPCR after 5 days of differentiation. Levels of
MyHC I mRNA were significantly higher in the cells cultured
with 33 or 44 mM NaHCO3 than in the control cells cultured in
DM containing 11 mM NaHCO3; in contrast, levels of MyHC IIx
mRNA were significantly lower in the cells cultured with 33 or 44
mM NaHCO3 than in the control cells. Expression levels of
MyHC IIa were not significantly affected by differences in
NaHCO3 concentrations (Fig. 1A).

Relative expression

NRF-1
##

2.0

1.5

**

1.0
0.5
0.0

NaHCO3 (mM)

11 22 33 11 22 33
37C

6
4
2
0

11 22 33

39C

PGC-1
-actin
NaHCO3 (mM) 11 22 33 11 22 33
37C

NaHCO3 (mM)

39C

39C

mtTFA

COX I
##

4
3

**

NaHCO3 (mM)

##

11 22 33

11 22 33

11 22 33

11 22 33

37C

39C

37C

39C

37C (33 mM)

39C (33 mM)

Mitotracker

COX I

37C (11 mM)

11 22 33

37C
Relative expression

Relative expression

PGC-1

Fig. 3. Effects of CMHS and/or changes in NaHCO3 concentration on the expression of peroxisome proliferator-activated receptor-gamma coactivator (PGC)-1
and PGC-1 targets. A: HSMMs were cultured in DM for 5 days under indicated conditions. Expression of PGC-1 mRNA was determined by qPCR and
normalized to -actin expression (top). Cell lysates were prepared from cells cultured in DM for 7 days, and Western blot analysis was performed using a specific
antibody for PGC-1. -Actin was used as a loading control (bottom). B: relative expression of nuclear respiratory factor-1 (NRF-1), mitochondrial transcription
factor A (mtTFA), and cytochrome c oxidase I (COX I) mRNAs in HSMMs cultured in DM under indicated conditions for 5 days. Expression levels were
determined by qPCR and normalized to -actin cDNA levels. Each column represents means SE of 5 independent experiments per treatment. Statistical
analyses involve two-way ANOVA and Bonferroni post hoc test. *P 0.05 and **P 0.01 refer to comparisons to cells cultured with 11 mM NaHCO3 at
respective temperatures; ##P 0.01, main effect of temperature (37 vs. 39C). C: HSMMs were cultured for 7 days in DM under indicated conditions, and the
presence of COX I protein was visualized by immunofluorescence staining using a monoclonal antibody against OxPhos Complex IV Subunit I (clone 1D6E1A8).
Mitochondrial membrane potential of live cells was assessed via MitoTracker Red CMXRos staining (400 nM). Representative fluorescent images are shown
(scale bar 100 m).
AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

C328

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

We next studied the effects of differences in extracellular pH


on shifts in MyHC isoforms. The pH of the DM containing 11
mM NaHCO3 was 7.4 and that of DM with 44 mM NaHCO3
was 8.1. To regulate the pH within that range without using
NaHCO3, we added NaOH or sodium citrate at varying concentrations to DM that contained 11 mM NaHCO3 (Fig. 1B).
Differentiation of HSMMs was induced for 7 days, and the
protein levels of MyHC I and MyHC II were determined by
Western blot analysis. In this experiment, the MyHC I protein
levels were modestly affected by changes in NaOH concentration, while those of MyHC II decreased only when the cells
were cultured in media containing 8 mM NaOH (Fig. 1C).
Similarly, sodium citrate had no significant effects on MyHC
switching (data not shown).
CMHS enhances NaHCO3-induced changes in MyHC isoform expression and in the fusion process in HSMMs. To test
whether the NaHCO3-induced fast-to-slow shift of MyHC
isoforms was enhanced by CMHS, we incubated the cells in
DM supplemented with 11, 22, or 33 mM NaHCO3 at 37C or
39C. We examined the expression of each MyHC isoform at
the mRNA level. The levels of MyHC I mRNA were significantly higher at 33 mM NaHCO3 at 39C (33 mM/39C) than
at 11 mM/39C, while those of MyHC IIx were unaffected by
CMHS or an increase in the NaHCO3 concentration (Fig. 2A).

Changes in levels of MyHC I and IIa were the main effect of


CMHS. For fluorescent immunostaining, HSMMs were incubated in DM for 7 days at 11 mM/37C, 33 mM/37C, or 33
mM/39C. Representative images are shown in Fig. 2B. For
myotubes expressing MyHC I, the strongest in staining was
evident when cells were cultured at 33 mM/39C; the next
strongest staining was observed in myotubes cultured at 33
mM/37C, and the weakest staining was in myotubes at 11
mM/37C. In contrast, different culture conditions had little
effect on the staining intensity of the myotubes expressing
MyHC II.
To further examine the changes in gene expression in myotubes, we assessed the mRNA levels of SERCA1 and SERCA2a
in HSMM-derived myotubes after 5 days of differentiation. Levels of SERCA2a mRNA were significantly higher in myotubes
that had differentiated at 33 mM/37C than in those that had
differentiated at 11 mM/37C; in contrast, SERCA1 expression
was unaffected by the increase in NaHCO3 concentration or by
CMHS (Fig. 2C). Differences in SERCA2a expression were the
main effect of CMHS.
To investigate the effects of NaHCO3 and heat stress on the
fusion of HSMMs in cultures, we incubated the cells for 24 or 48
h in DM at 11 mM/37C, 33 mM/37C, or 33 mM/39C and
measured the fusion index of HSMM cultures. The fusion index

MCIP1
Relative expression

A
Ratio (F340/F380)

1.3
1.2

1.5

1.1
1.0

37C

0.9

39C

1.4
1.2
1.1

0.7

1.0

10

20

30

40

**

1.3

0.8
0

Peak/Baseline

37C

50

39C

##

4
3
2

*
*

1
0

NaHCO3 (mM)

11 22 33

11 22 33

37C

39C

Time (s)

C
MyHC I
MyHC II
PGC-1
-actin
0 0.25 0.5 ( M)
Cyclosporin A

0 0.5 1.0 ( M)
FK506

Fig. 4. Effects of NaHCO3 and/or CMHS alter intracellular calcium level ([Ca2]i) and calcium signaling. A: HSMMs were loaded with fura-2 AM and incubated
at 37C (solid line) or 39C (dotted line). NaHCO3 was added to the media at a concentration of 11 mM, and the change in [Ca2]i after the addition of NaHCO3
was studied by fluorescent microscopy. Changes in [Ca2]i are displayed as F340/F380. Arrow indicates the timing of NaHCO3 addition (left). Peak-to-baseline
ratio of fluorescence intensity was obtained for the cells maintained at 37C and 39C (right). Values are means SE of 10 cells imaged simultaneously.
**P 0.01 refers to comparisons to cells cultured at 37C and was calculated via unpaired Students t-test. B: relative expression of myocyte-enriched
calcineurin-interacting protein 1 (MCIP1) mRNAs in HSMMs cultured in DM under indicated conditions for 5 days. Levels of MCIP1 mRNA were determined
by qPCR and normalized to -actin expression. Results are means SE of 5 independent experiments per treatment. Statistical analyses involved two-way
ANOVA and Bonferroni post hoc test. *P 0.05 refers to comparisons to cells cultured with 11 mM NaHCO3 at respective temperatures; ##P 0.01, main
effect of temperature (37 vs. 39C). C: HSMMs were cultured in DM containing 33 mM NaHCO3 at 39C with or without the calcineurin inhibitors cyclosporine
A (0.25 and 0.5 M) or FK506 (0.5 and 1.0 M). After 7 days of culture, HSMMs were harvested, and the protein preparations were subjected to Western blot
analysis with antibodies against MyHC I, MyHC II, or PGC-1. -Actin was used as a loading control.
AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

at 11 mM/37C or at 11 mM/39C, respectively. Differences in


PGC-1 mRNA expression were the main effect of CMHS.
Levels of PGC-1 protein were higher at higher NaHCO3
concentrations, and this trend was more obvious in the cells
cultured at 39C than in those cultured at 37C (Fig. 3A).
Levels of COX I mRNA were significantly higher in the cells
cultured at 33 mM/39C than in the cells cultured at 11
mM/39C. Levels of mtTFA mRNA or COX I mRNA were
higher in cells cultured at 39C than in those cultured at 37C,

was highest at 33 mM/39C, next highest at 33 mM/37C, and


lowest at 11 mM/37C at both 24 h and 48 h (Fig. 2D).
NaHCO3 and CMHS alter the expression of mitochondriarelated genes in HSMMs. To address whether NaHCO3 and
CMHS affect the expression of mitochondria-related genes, we
examined the expression of PGC-1 and of three downstream
targets of PGC-1-NRF-1, mtTFA, and COX I. Levels of
PGC-1 transcripts were significantly higher in the cells cultured at 33 mM/37C or at 33 mM/39C than in cells cultured

NFATc1
Relative expression

NFATc2
##

1.5

4
3

1.0

0.5

11 22 33 11 22 33
37C

39C

Relative expression

NFATc3

11 22 33

37C

39C

NFATc4

1.0

2
0.5

0.0

11 22 33

11 22 33

11 22 33

37C

39C

37C

37C (11 mM)

37C (33 mM)

11 22 33
39C

39C (33 mM)

Fig. 5. Effects of CMHS and/or changes in NaHCO3


concentration on the expression of nuclear factor of activated T cells (NFAT) isoforms. A: HSMMs were cultured
in DM for 5 days under indicated conditions, and the cells
were harvested. Levels mRNAs encoding NFAT isoforms
in HSMMs were determined by qPCR and normalized to
-actin expression. Each column represents means SE
of 5 independent experiments per treatment. Statistical
analyses involved two-way ANOVA and Bonferroni post
hoc test. *P 0.05 refers to comparisons to cells cultured
with 11 mM NaHCO3 at respective temperatures; #P
0.05 and ##P 0.01, main effect of temperature (37 vs.
39C). B: HSMMs were cultured for 7 days in DM under
indicated conditions. NFAT isoforms were visualized by
immunofluorescence with the use of specific antibodies
(scale bar 50 m).

NFATc4

NFATc3

NFATc2

NFATc1

11 22 33

1.5

NaHCO3 (mM)

0.0

NaHCO3 (mM)

C329

AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

C330

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

after 7 days of differentiation. Both COX I staining and


MitoTracker Red CMXRos staining were most intense in the
cells cultured at 33 mM/39C; staining was next most intense
in cells cultured at 33 mM/37C and least intense in cells
cultured at 11 mM/37C.
NaHCO3 and CMHS alter calcium signaling in HSMMs. We
next examined whether NaHCO3 and CMHS affected [Ca2]i

but levels of NRF-1 mRNA tended to increase only with


increasing NaHCO3 concentrations (Fig. 3B). To further examine the levels of COX I protein and the mitochondrial
membrane potential, HSMMs were maintained in DM under
conditions of 11 mM/37C, 33 mM/37C, or 33 mM/39C and
then stained with the anti-COX I antibody or MitoTracker Red
CMXRos. Figure 3C shows representative images of HSMMs

siRNA
Control

siRNA
Control

Control

NFATc1

NFATc1

NFATc4

NFATc2

NFATc2

NFATc3

NFATc3

NFATc4

NFATc4

1.0

1.0

0.5

0.5

0.0

0.0

0.5
0.0

1.5

NFATc3

2.0

Control

0.5

NFATc2

0.0

NFATc4

1.0
0.5

2.0

C4

MyHC IIx

1.5

0.0

C2

NFATc4

1.0

2.0

0.5

Halo

MyHC IIa

1.5

2.5

1.0

Relative expression

Relative expression

1.0

Relative expression

1.5

NFATc2

10

MyHC I

1.5

1.5

NFATc2
20
Arbitrary unit

NFATc1

NFATc2

0.0

NFATc4

2.5
2.0
1.5

1.0
0.5
0.0

1.5
1.0
0.5
0.0

C
siRNA
NFATc1

NFATc2

NFATc3

MyHC II

MyHC I

Control

AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

NFATc4

MyHC I
MyHC II

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

in HSMMs. In this experiment, we added NaHCO3 to the


media and studied the changes in [Ca2]i. Supplementation
with NaHCO3 (11 mM) resulted in an immediate increase in
[Ca2]i, which was more obvious in cells cultured at 39C than
in those cultured at 37C (Fig. 4A, left). Next, we determined
the difference between peak [Ca2]i and baseline [Ca2]i. Peak
[Ca2]i was divided by baseline [Ca2]i, and the change in
[Ca2]i was expressed as a percentage increase over baseline.
The peak/baseline [Ca2]i at 39C (1.25 0.01) was significantly greater than that at 37C (1.07 0.02; Fig. 4A, right).
To examine the role of Cn in the fiber type shift and PGC-1
expression, we compared Cn activity in HSMMs cultured
under the different culture conditions. We examined the expression of myocyte-enriched calcineurin-interacting protein 1
(MCIP1) mRNA to estimate Cn activity (6, 39). The expression of MCIP1 mRNA was significantly higher in the cells
cultured at 33 mM/37C or 33 mM/39C than in the cells
cultured at 11 mM/37C or 11 mM/39C, respectively (Fig.
4B). Differences in MCIP1 mRNA expression were the main
effect of CMHS. To further examine the role of Cn, we treated
the cells with each of two specific Cn inhibitors, cyclosporine
A (Calbiochem) or FK506 (Cayman Chemical, Ann Arbor,
MI). HSMMs were incubated in DM containing either 0.25
0.5 M cyclosporine A or 0.51.0 M FK506 for 7 days.
These Cn inhibitors attenuated the levels of MyHC I and
PGC-1 proteins but not of MyHC II protein (Fig. 4C).
Roles of NFAT isoforms in fiber type determination. To
investigate the combined effect of NaHCO3 and CMHS on the
expression of NFAT isoforms, we assessed the expression of
NFAT mRNAs in HSMMs cultured under several different
conditions. Figure 5A shows that all four NFAT isoforms were
expressed at substantial levels in HSMMs. At either 37 or
39C, the levels of NFATc2 and of NFATc4 mRNA were
significantly higher in the cells cultured with 33 mM NaHCO3
than in control cells cultured with 11 mM NaHCO3. Changes
in levels of NFATc2 and NFATc4 were the main effect of
CMHS. In contrast, levels of NFATc1 and NFATc3 mRNA did
not differ significantly among the cells cultured under different
conditions. To confirm these findings at the protein level, we
conducted immunofluorescent staining of the cells. For this,
HSMMs were incubated for 7 days in DM at 11 mM/37C, 33
mM/37C, or 33 mM/39C. The cells were stained with antibodies against individual NFAT isoforms for analysis of immunofluorescence. Of the three culture conditions, the fluorescence intensities of NFATc2 and NFATc4 were the most
intense in the cells cultured at 33 mM/39C and next most

C331

intense in those cultured at 33 mM/37C. Fluorescence was


least intense in the cells cultured at 11 mM/37C (Fig. 5B). In
contrast, the fluorescence intensities of NFATc1 or of NFATc3
differed only modestly among cell cultures under these three
conditions.
To elucidate the roles of individual NFAT isoforms as
potential regulators of MyHC isoforms in HSMMs, we treated
the cells with siRNA to knockdown the levels of individual
NFAT isoforms and examined the expression of MyHC isoforms. The specificity and efficiency of knockdown of each
NFAT isoform was confirmed by qPCR (Fig. 6A). NFATc2
siRNAs or NFATc4 siRNAs reduced the mRNA levels of
MyHC I but not those of MyHC IIx or MyHC IIa. siRNAmediated knockdown of NFATc1 or NFATc3 did not alter the
mRNA levels of any of the MyHC isoforms (Fig. 6B). Figure
6C shows representative immunostaining for individual
NFATc isoforms of HSMMs after 72 h of transfection with
siRNA. MyHC I staining intensity was obviously reduced by
knockdown of NFATc2 or NFATc4 but only marginally by
knockdown of NFATc1 or NFATc3. The knockdown of any
NFAT isoform did not significantly affect the MyHC II signal.
To further investigate the role of NFATc2 and NFATc4 in
MyHC isoforms regulation in HSMMs, we examined the
effects of NFATc2 or NFATc4 overexpression on MyHC
isoform expression in HSMMs (Fig. 6, D and E). Western blot
analysis showed that the levels of MyHC I protein were
significantly higher in cells that overexpressed NFATc2 or
NFATc4 than in cells that did not. Moreover, the levels of
MyHC II protein did not differ between cells regardless of
whether they overexpressed NFATc2 or NFATc4.
DISCUSSION

Athletic performance often improves after ingesting NaHCO3


(10, 22, 28, 32). Changes in the expression of MyHC and
SERCA isoforms indicated that NaHCO3 supplementation
dose dependently induced fast-to-slow fiber type shifts in
HSMMs, which supports our hypothesis. The NaHCO3induced shift in myofiber type was enhanced by CMHS. This
effect was additive, because the effects of NaHCO3 and CMHS
did not significantly interact in any analysis (data not shown).
We previously reported that CMHS can induce a fast-to-slow
shift in fiber type (38). The present study shows that increased
NaHCO3 concentrations also induce a fast-to-slow shift in
MyHC isoform expression in HSMMs.

Fig. 6. Involvement of NFAT isoforms in the expression of MyHC isoforms. A and B: HSMMs were transfected with control small interfering RNA (siRNA)
or siRNAs targeting NFATc1-c4, and cultured in DM containing 14 mM NaHCO3 for 72 h. The effects of RNA interference were confirmed by qPCR (A).
Changes in expression of MyHC I, MyHC IIa, or MyHC IIx that were cause by the suppression of NFATc expression were analyzed by qPCR. mRNA levels
were normalized to -actin expression, and the results are presented as relative ratios; cells treated with control siRNA were used as the references for calculating
the relative ratios. Each column represents means SE of 5 independent experiments per treatment. Statistical analyses involved one-way ANOVA and
Dunnetts post hoc test. *P 0.05 refers to comparisons to cells given control siRNA (B). C: HSMMs were transfected with control siRNA or siRNAs targeting
NFATc1-c4, and cultured in the above-described media for 72 h. The presence of MyHC I or MyHC II was studied by immunofluorescence staining using specific
antibodies (scale bar 100 m). D and E: HSMMs were transfected with an empty control vector or an expression vector carrying NFATc2 or NFATc4, and
cultured in DM containing 14 mM NaHCO3. After 72 h, RNA was extracted from cells, and mRNA levels of NFATc2 or NFATc4 were analyzed by qPCR for
confirmation of overexpression. Results of qPCR analysis are presented as relative ratios to -actin expression (D). Other cells were harvested at the same time
and subjected to Western blot analysis to detect MyHC I or MyHC II. Protein levels were normalized to -actin levels, and the results are presented as relative
ratios; cells carrying control vector were used as the reference when calculating the relative ratios (E). Each column represents means SE of 5 independent
experiments per treatment. Statistical analyses involved one-way ANOVA and Dunnetts post hoc test. *P 0.05 refers to comparisons to cells carrying control
vector.
AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

C332

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

Calcium signaling is involved in the determination of muscle


fiber type. Kubis et al. (18) reported that a modest but sustained
rise in [Ca2]i caused by low concentrations of Ca2 ionophore A-23187 induced a fast-to-slow fiber type shift in rabbit
primary skeletal muscle cells, and Cn has been implicated in a
fast-to-slow fiber type shift (25, 33). The expression of MCIP1
is rapidly and robustly regulated by Cn and thus is recognized
as a highly accurate marker of Cn activity (6, 39). Here, we
showed that [Ca2]i and MCIP1 expression was increased by
NaHCO3 supplementation and that these increases were augmented by CMHS. Furthermore, Cn inhibitors caused a slowto-fast shift in MyHC expression. These results are consistent
with the notion that changes in calcium signaling are a pivotal
mechanism behind the fast-to-slow fiber type shift caused by
NaHCO3 supplementation or CMHS.
Each of the four NFAT isoforms plays a distinctive role in
the development of skeletal muscle in rodents. NFATc3 activity is critical for the generation of primary myofibers (16),
whereas NFATc2 regulates skeletal muscle growth (12).
NFATc2-null and NFATc3-null mice have an essentially normal composition of muscle fiber types (12, 16). Somatic gene
transfer into adult skeletal muscle of a constitutively active
form of NFATc1 enhances the promoter activity of MyHC I
and inhibits that of MyHC IIb. Conversely, the expression of
MyHC IIa and MyHC IIx is inhibited by siRNAs that target
NFATc2, c3, or c4, whereas the fast-glycolytic MyHC-IIb is
only inhibited by siRNAs that target NFATc4 (33). Together,
these findings indicate that NFATc2, c3, and c4 are all transcriptionally active in rat fast-type skeletal muscles. Consistent
with these findings in vivo, increased [Ca2]i in mouse skeletal
myoblasts induces the recruitment of p300 to NFATc1, which
increases NFATc1 transcriptional activity and enhances MyHC
I expression (23). Here, we confirmed that all four NFATc
isoforms were expressed at substantial levels in these primary
cultures of human skeletal muscle. We then found that changes
in NFATc2 and NFATc4 levels were involved in the regulation
of MyHC I in HSMMs. Although NFATc1 is a regulator of
MyHC I gene expression during the fast-to-slow fiber type shift
in rodent skeletal muscle cells (33), the results of our RNA
interference experiment indicated that NFATc1 is not involved
in the fast-to-slow shift in HSMMs. The activities of NFAT
proteins are regulated not only by expression levels but also by
their subcellular localization and phosphorylation. Thus further
studies are required to clarify the details of the involvement of
NFAT proteins in the regulation of MyHC isoforms in HSMMs.
Mitochondrial function depends on the coordinated expression of the mitochondrial and nuclear genomes. PGC-1 and
the transcription factors NRF-1 and mtTFA that are downstream of PGC-1 play important roles in the coordinated
expression of these two genomes. These three proteins are
therefore considered to be key regulators of mitochondrial
biogenesis (5, 6). Our results showed that NaHCO3 supplementation increased PGC-1 mRNA and protein levels and
increased the mitochondrial membrane potential. Moreover,
NaHCO3-induced changes were augmented by CMHS. Several
pathways have been implicated in the signaling that acts
upstream of PGC-1 transcription, such as the Cn and CaMK,
p38 MAPK, Sirtuin 1, and AMP-activated protein kinase
pathways (5, 26). In addition, endurance exercise readily induces PGC-1 expression in skeletal muscle in humans (31).
Here, we showed that Cn inhibitors attenuated PGC-1 protein

levels. However, the protein levels of PGC-1 and staining for


mitochondrial membrane potential were essentially unaltered
by the siRNA-mediated knockdown of individual NFAT isoforms (data not shown), implying that Cn, but not NFAT, is
involved in mitochondrial biogenesis and function in human
skeletal muscle.
The present study found that NaHCO3 enhanced and CMHS
additively enhanced MCIP1 expression and HSMM fusion. The
activation of Cn is linked to the induction of myogenic differentiation that leads to myoblast fusion via myogenin and myocyte
enhancer factor-2 (17). We previously reported that CMHS enhances myogenin expression and HSMMs fusion, leading to a
fast-to-slow shift in fiber type (38). Myogenin is implicated in the
fast-to-slow fiber-type shift (4, 14) and in a shift of enzyme
activity from glycolytic to oxidative metabolism in the skeletal
muscles of transgenic mice (14). NaHCO3 might affect a fast-toslow fiber-type shift and the expression of molecules associated
with mitochondria, leading the differentiation rate of HSMMs
through a pathway involving Cn and myogenin.
Accumulating evidence suggests that NaHCO3 ingestion
improves performance during single bouts of anaerobic exercise, repeated short-duration sprints, single-effort prolonged
sprints, and prolonged, intermittent exercise at high intensity
(10, 22, 28, 32). McNaughton and Thompson (21) described
differences in performance during short-duration, high-intensity cycling between acute and chronic NaHCO3 loading in
humans. Chronic NaHCO3 ingestion for 6 days allowed participants to perform more work (21) and 0.3 g of NaHCO3 per
kg of body weight are the apparent accepted dose (32). Thus
the dose and duration of NaHCO3 ingestion might be important
factors when attempting to improve athletic performance. We
showed that NaHCO3 supplementation dose dependently enhanced the expression of mitochondrial-related genes and the
mitochondrial membrane potential in HSMMs. Bishop et al.
(2) reported that oral NaHCO3 administration before each bout
of exercise for 5 wk resulted in improved mitochondrial mass
and mitochondrial respiration in the rat soleus muscle. Our
findings are consistent with these results. We showed that
changes in mitochondrial-related genes and mitochondrial
membrane potential do not depend on changes in extracellular
pH caused by NaOH or sodium citrate (data not shown). Our
findings indicated that NaHCO3 affects myocyte differentiation
via a mechanism other than changes in pH. Therefore, enhanced performance of prolonged exercise after NaHCO3 ingestion might be associated with changes in mitochondrial
mass and function following NaHCO3 ingestion. Ingestion of
NaHCO3 is thought to enhance performance by increasing
extracellular buffering capacity via reducing H accumulation
(2, 32). We speculate that reducing H accumulation following
NaHCO3 ingestion might lead to short-term improvements in
exercise performance. However, additional studies are needed
to clarify the mechanism that links NaHCO3 to improvements
in athletic performance.
Mitochondrial dysfunction is implicated in many age-related
diseases, such as sarcopenia, insulin resistance and type 2 diabetes
(13, 20, 37). Regular exercise elicits a rapid increase in oxidative
enzyme activities, mitochondrial density, and mitochondrial respiration (11, 34). Prolonged bouts of exercise induce PGC-1
gene expression in human skeletal muscle (31), and exercise
conditioning enhances this induction. Muscle temperatures range
from 36 to 39.5C during aerobic exercise such as soccer and

AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

NaHCO3 AND MILD HEAT STRESS INDUCE A FIBER TYPE SHIFT

cycling (24, 27); therefore, a mild increase in muscle temperature


may enhance mitochondria-related gene expression. We showed
here that NaHCO3 and CMHS additively induce a fast-to-slow
fiber type shift and the expression of mitochondrial-related genes.
Thus the present findings might help to establish novel therapeutic
strategies to prevent metabolic diseases through improving mitochondrial function.
GRANTS
This study was supported in part by the Yamaha Motor Foundation for
Sports and by the Japan Orthopaedic and Traumatology Foundation.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
AUTHOR CONTRIBUTIONS
Author contributions: T.Y. conception and design of research; T.Y., M.O.,
and N.T. performed experiments; T.Y. analyzed data; T.Y. interpreted results
of experiments; T.Y. prepared figures; T.Y. and N.F. drafted manuscript; T.Y.
and N.F. edited and revised manuscript; T.Y. approved final version of
manuscript.
REFERENCES
1. Berchtold MW, Brinkmeier H, Muntener M. Calcium ion in skeletal
muscle: its crucial role for muscle function, plasticity, and disease. Physiol
Rev 80: 12151265, 2000.
2. Bishop DJ, Thomas C, Moore-Morris T, Tonkonogi M, Sahlin K,
Mercier J. Sodium bicarbonate ingestion prior to training improves
mitochondrial adaptations in rats. Am J Physiol Endocrinol Metab 299:
E225E233, 2010.
3. de la Pompa JL, Timmerman LA, Takimoto H, Yoshida H, Elia AJ,
Samper E, Potter J, Wakeham A, Marengere L, Langille BL,
Crabtree GR, Mak TW. Role of the NF-ATc transcription factor in
morphogenesis of cardiac valves and septum. Nature 392: 182186, 1998.
4. Ekmark M, Gronevik E, Schjerling P, Gundersen K. Myogenin induces higher oxidative capacity in pre-existing mouse muscle fibres after
somatic DNA transfer. J Physiol 548: 259 269, 2003.
5. Finck BN, Kelly DP. PGC-1 coactivators: inducible regulators of energy
metabolism in health and disease. J Clin Invest 116: 615622, 2006.
6. Garnier A, Fortin D, Zoll J, NGuessan B, Mettauer B, Lampert E,
Veksler V, Ventura-Clapier R. Coordinated changes in mitochondrial
function and biogenesis in healthy and diseased human skeletal muscle.
FASEB J 19: 4352, 2005.
7. Graef IA, Chen F, Chen L, Kuo A, Crabtree GR. Signals transduced by
Ca(2)/calcineurin and NFATc3/c4 pattern the developing vasculature.
Cell 105: 863875, 2001.
8. Hilber K, Galler S, Gohlsch B, Pette D. Kinetic properties of myosin
heavy chain isoforms in single fibers from human skeletal muscle. FEBS
Lett 455: 267270, 1999.
9. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by
calcium, calcineurin, and NFAT. Genes Dev 17: 22052232, 2003.
10. Hollidge-Horvat MG, Parolin ML, Wong D, Jones NL, Heigenhauser
GJ. Effect of induced metabolic alkalosis on human skeletal muscle
metabolism during exercise. Am J Physiol Endocrinol Metab 278: E316
E329, 2000.
11. Hood DA. Invited Review: contractile activity-induced mitochondrial
biogenesis in skeletal muscle. J Appl Physiol 90: 11371157, 2001.
12. Horsley V, Friday BB, Matteson S, Kegley KM, Gephart J, Pavlath
GK. Regulation of the growth of multinucleated muscle cells by an
NFATC2-dependent pathway. J Cell Biol 153: 329 338, 2001.
13. Huang JH, Hood DA. Age-associated mitochondrial dysfunction in
skeletal muscle: contributing factors and suggestions for long-term interventions. IUBMB Life 61: 201214, 2009.
14. Hughes SM, Chi MM, Lowry OH, Gundersen K. Myogenin induces a
shift of enzyme activity from glycolytic to oxidative metabolism in
muscles of transgenic mice. J Cell Biol 145: 633642, 1999.
15. Jinquan T, Quan S, Jacobi HH, Reimert CM, Millner A, Hansen JB,
Thygesen C, Ryder LP, Madsen HO, Malling HJ, Poulsen LK. Cutting
edge: expression of the NF of activated T cells in eosinophils: regulation
by IL-4 and IL-5. J Immunol 163: 2124, 1999.

C333

16. Kegley KM, Gephart J, Warren GL, Pavlath GK. Altered primary
myogenesis in NFATC3(/) mice leads to decreased muscle size in the
adult. Dev Biol 232: 115126, 2001.
17. Konig S, Beguet A, Bader CR, Bernheim L. The calcineurin pathway
links hyperpolarization (Kir2.1)-induced Ca2 signals to human myoblast
differentiation and fusion. Development 133: 31073114, 2006.
18. Kubis HP, Haller EA, Wetzel P, Gros G. Adult fast myosin pattern and
Ca2-induced slow myosin pattern in primary skeletal muscle culture.
Proc Natl Acad Sci USA 94: 42054210, 1997.
19. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF,
Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R,
Spiegelman BM. Transcriptional co-activator PGC-1 alpha drives the
formation of slow-twitch muscle fibres. Nature 418: 797801, 2002.
20. Lowell BB, Shulman GI. Mitochondrial dysfunction and type 2 diabetes.
Science 307: 384 387, 2005.
21. McNaughton L, Thompson D. Acute versus chronic sodium bicarbonate
ingestion and anaerobic work and power output. J Sports Med Phys
Fitness 41: 456 462, 2001.
22. McNaughton LR. Sodium bicarbonate ingestion and its effects on anaerobic exercise of various durations. J Sport Sci 10: 425435, 1992.
23. Meissner JD, Freund R, Krone D, Umeda PK, Chang KC, Gros G,
Scheibe RJ. Extracellular signal-regulated kinase 1/2-mediated phosphorylation of p300 enhances myosin heavy chain I/beta gene expression via
acetylation of nuclear factor of activated T cells c1. Nucleic Acids Res 39:
59075925, 2011.
24. Mohr M, Krustrup P, Nybo L, Nielsen JJ, Bangsbo J. Muscle temperature and sprint performance during soccer matches beneficial effect of
re-warm-up at half-time. Scand J Med Sci Sport 14: 156 162, 2004.
25. Naya FJ, Mercer B, Shelton J, Richardson JA, Williams RS, Olson
EN. Stimulation of slow skeletal muscle fiber gene expression by calcineurin in vivo. J Biol Chem 275: 45454548, 2000.
26. Nemoto S, Fergusson MM, Finkel T. SIRT1 functionally interacts with
the metabolic regulator and transcriptional coactivator PGC-1. J Biol
Chem 280: 16456 16460, 2005.
27. Parkin JM, Carey MF, Zhao S, Febbraio MA. Effect of ambient
temperature on human skeletal muscle metabolism during fatiguing submaximal exercise. J Appl Physiol 86: 902908, 1999.
28. Parry-Billings M, MacLaren DP. The effect of sodium bicarbonate and
sodium citrate ingestion on anaerobic power during intermittent exercise.
Eur J Appl Physiol Occup Physiol 55: 524 529, 1986.
29. Pendergrass W, Wolf N, Poot M. Efficacy of MitoTracker Green and
CMXrosamine to measure changes in mitochondrial membrane potentials
in living cells and tissues. Cytometry A 61: 162169, 2004.
30. Pette D, Staron RS. Myosin isoforms, muscle fiber types, and transitions.
Microsc Res Tech 50: 500 509, 2000.
31. Pilegaard H, Saltin B, Neufer PD. Exercise induces transient transcriptional activation of the PGC-1alpha gene in human skeletal muscle. J
Physiol 546: 851858, 2003.
32. Requena B, Zabala M, Padial P, Feriche B. Sodium bicarbonate and
sodium citrate: ergogenic aids? J Strength Cond Res 19: 213224, 2005.
33. Schiaffino S. Fibre types in skeletal muscle: a personal account. Acta
Physiol (Oxf) 199: 451463, 2010.
34. Turner DL, Hoppeler H, Claassen H, Vock P, Kayser B, Schena F,
Ferretti G. Effects of endurance training on oxidative capacity and
structural composition of human arm and leg muscles. Acta Physiol Scand
161: 459 464, 1997.
35. Vega A, Chacon P, Monteseirin J, El Bekay R, Alba G, Martin-Nieto
J, Sobrino F. Expression of the transcription factor NFAT2 in human
neutrophils: IgE-dependent, Ca2- and calcineurin-mediated NFAT2 activation. J Cell Sci 120: 2328 2337, 2007.
36. Wu H, Kanatous SB, Thurmond FA, Gallardo T, Isotani E, BasselDuby R, Williams RS. Regulation of mitochondrial biogenesis in skeletal
muscle by CaMK. Science 296: 349 352, 2002.
37. Yamaguchi T, Arai H, Katayama N, Ishikawa T, Kikumoto K, Atomi
Y. Age-related increase of insoluble, phosphorylated small heat shock
proteins in human skeletal muscle. J Gerontol A Biol Sci Med Sci 62:
481489, 2007.
38. Yamaguchi T, Suzuki T, Arai H, Tanabe S, Atomi Y. Continuous mild
heat stress induces differentiation of mammalian myoblasts, shifting fiber
type from fast to slow. Am J Physiol Cell Physiol 298: C140 C148, 2010.
39. Yang J, Rothermel B, Vega RB, Frey N, McKinsey TA, Olson EN,
Bassel-Duby R, Williams RS. Independent signals control expression of
the calcineurin inhibitory proteins MCIP1 and MCIP2 in striated muscles.
Circ Res 87: E6168, 2000.

AJP-Cell Physiol doi:10.1152/ajpcell.00393.2012 www.ajpcell.org

593
The Journal of Experimental Biology 212, 593-597
Published by The Company of Biologists 2009
doi:10.1242/jeb.015024

Commentary
The physiology of long-distance migration: extending the limits of endurance
metabolism
Jean-Michel Weber
Department of Biology, University of Ottawa, Ontario, Canada
e-mail: jmweber@uottawa.ca

Accepted 15 December 2008


Summary
Long-distance migrants have evolved specific adaptations that make their athletic records possible. Unique mechanisms
explaining their amazing capacity for endurance exercise have now been uncovered, particularly with respect to energy storage,
mobilization, transport and utilization. Birds are champions of migration because flying offers a key compromise: it allows more
rapid movement than swimming, but has a lower cost of transport than running. High efficiency for muscle contraction, pointed
wings, low wingloading, travelling in V-formations, storing fuel as energy-dense lipids and atrophy of non-essential organs are
some of their strategies to decrease the cost of transport. The ability to process lipids rapidly also emerges as a crucial
component of the migrant phenotype. High lipid fluxes are made possible by lipoprotein shuttles and fatty acid binding proteins
(FABPs) that accelerate lipid transport and by upgrading the metabolic machinery for lipolysis and lipid oxidation. Preparation for
long flights can include natural doping on n-3 polyunsaturated fatty acids (n-3 PUFAs) from unique invertebrate diets. Muscle
performance is improved by restructuring membrane phospholipids and by activating key genes of lipid metabolism through
peroxisome proliferator-activated receptors (PPARs). The physiological secret to long migrations does not depend on a single
magic adaptation but on the integration of multiple adjustments in morphology, biomechanics, behavior, nutrition and
metabolism. Research on the physiology of migrants improves the fundamental knowledge of exercise biology, but it also has
important implications for wildlife conservation, treating obesity and improving the performance of human athletes.
Key words: natural doping, lipid metabolism, lipoprotein, membrane phospholipid, endurance exercise, cost of transport, animal energetics.

Introduction

The endurance capacity of long-distance migrants has fascinated


biologists for centuries, but recent work probing the physiological
mechanisms that underlie their athletic performance has further
strengthened this interest. Electronic tracking can now document
animal migrations by exact monitoring of global position, travel
speed and distance. Using satellite technology, scientists have
characterized the migration patterns of aquatic species such as the
white shark (Carcharodon carcharias, L.) and bluefin tuna
(Thunnus thynnus, L.) that criss-cross major oceans annually
(Block et al., 2005; Bonfil et al., 2005). Modern tracking has
allowed the shattering of former migration records by
demonstrating yearly roundtrips of more than 64,000 km in some
marine birds (Shaffer et al., 2006). Amazingly, these outstanding
physical achievements are overshadowed by the discovery of
single non-stop flights exceeding 11,000 km, authenticated in the
bar-tailed godwit (Limosa lapponica, L.), a wading bird that
migrates between Alaska and New Zealand without refueling
(Gill et al., 2005; Griggs, 2007). Physiologists are left with the
exciting task to unravel the mechanisms that make these exploits
possible. Are traditional concepts of exercise physiology simply
stretched to suit the extreme needs of migrants, or do these
athletes rely on original adaptations? Here, I focus on the fuel
metabolism of endurance exercise because exceptional capacities
for energy storage, mobilization, transport and utilization are
absolutely essential for migration. Specialized neuro-sensory
systems involved in orientation and navigation also play
important roles in energy economy, but they have been

extensively reviewed elsewhere and will not be addressed here


(Alerstam, 2006; Lohmann et al., 2008).
Energetics of long migrations

The complex compromises migrants must make to use seasonally


available food resources and breeding sites are strongly influenced
by the cost of transport, or the energy spent to move a unit body
mass by a unit distance. If the evolution of migratory behaviour had
been orchestrated exclusively by locomotion energetics, large
swimming animals would beat all records because the massspecific cost of transport decreases with body size and it is much
lower for swimming than for other modes of locomotion (~3- and
10-fold lower than for flying and running, respectively) (see
Table 1). This simple argument explains why the longest migrations
of land mammals barely reach a few thousand kilometers and
can only be performed by large species such as wildebeest
(Connochaetes taurinus, Liechtenstein) and caribou (Rangifer
tarandus, L.). However, it fails to clarify why the most extreme
migrations are achieved by birds rather than fish, a somewhat
perplexing observation, unlikely to be challenged even when the
monitoring of aquatic environments becomes more accessible.
Soaring, rather than flapping flight, can significantly reduce the
energy gap between flying and swimming, but this strategy is
restricted to large birds and cannot explain the high incidence of
long migrations among small avian species. Theoretical analyses
suggest that birds outcompete fish because flying is a useful
compromise between running (with prohibitive cost of transport)
and swimming (with low maximal speed) (Alexander, 1998).

THE JOURNAL OF EXPERIMENTAL BIOLOGY

594

J.-M. Weber

Table 1. Allometric equations for mass-specific cost of transport in


animals using different modes of locomotion
Locomotory mode
Swimming
Flying
Running

Cost of transport
0.38

1.1(body mass)
3.6(body mass)0.31
10.7(body mass)0.32

Cost of transport is the energy needed to move 1 unit body mass by 1 unit
distance. The equations provided are from Alexander (Alexander, 2003)
for cost of transport expressed in J kg1 m1 and body mass in kg. For
same-size animals, note that the difference in cost of transport between
modes of locomotion is almost entirely accounted for by large differences
in the constants (1.1 vs 3.6 vs 10.7) because the exponents are very
similar.

Successful migrations depend on the economic management of


time as well as energy, and high speed is one of the main
advantages that flying provides. Travelling long distances slowly
offers no benefit if it does not leave enough time for essential
activities such as feeding and reproduction.
Minimizing the cost of transport

Migrants have evolved multiple strategies to decrease their cost of


transport. The locomotory muscles of some species appear to
generate force with unusually high efficiency, and this
physiological trait might be unique to long-distance migrants
(Klaassen et al., 2000; Kvist et al., 2001). However, this
observation stems from the lower than expected whole-organism
metabolic rate during flight, and the exact nature of this
hypothetical muscle adaptation has never been characterized. To
save energy, migrant birds also rely on morphological features such
as pointed wings and low wingloading (Bowlin and Wikelski,
2008), as well as biomechanically advantageous behaviors such as
travelling in V-formations (Weimerskirch et al., 2001). Animal
migrants further decrease the cost of transport by minimizing body
mass. They do so by selecting lipids to store energy for muscle
work and temporarily atrophy non-essential organs. Pre-migration
lipid reserves can reach 50% of total body mass (Blem, 1990). The
existence of extremely rapid and ample fluctuations in lipid stores
makes migratory birds a fascinating model for obesity research.
Understanding the regulation of such drastic and reversible changes
in fat reserves is bound to bring important insights to this field of
human medicine. These lipids provide the highest ATP yield per
gram of fuel because they are stored with virtually no free water
and are more chemically reduced than other substrates (Weber and
Haman, 2004). For land migrants risking dehydration, lipids offer
the additional advantage of generating more metabolic water upon
oxidation than proteins or carbohydrates. It has also been
established that 515% of the energy used by migrating birds
comes from the oxidation of proteins. The reasons why they
increase the cost of transport by making significant use of this
heavier fuel are unclear. Among the proposed hypotheses (see
McWilliams et al., 2004), the most convincing are: first, the use of
amino acids in anaplerotic pathways, where amino acid metabolites
generated by protein breakdown replenish stocks of citric acid cycle
intermediates to ensure that lipid catabolism can proceed and,
second, downsizing of the flight muscle engine when heavy fuel
loads are progressively reduced throughout the migration (Jenni
and Jenni-Eiermann, 1998). Finally, birds are known to atrophy
their digestive organs before take-off to decrease the maintenance
and transport costs of tissues that are not essential for locomotion
(McWilliams and Karasov, 2004).

A record capacity to process lipids: a requirement for long


migrations

The metabolic rate that birds maintain during migration is 10 to 15


times higher than in the resting state, or about twice the maximal
oxygen consumption (mass-specific VO2,max) of similarly sized
mammals (Butler and Woakes, 1990). Most of the energy is
provided to working muscles from extra-muscular adipose reserves,
and it is estimated that migrant birds can mobilize, transport and
oxidize lipids at more than 10 times the maximal rates ever
recorded in mammals (McWilliams et al., 2004). Even though this
amazing ability to process lipids is a clear functional requirement
of migration, no direct measurement of fat metabolism has been
performed in a flying bird, and little information is available on the
actual adaptations that support these high fluxes.
Lipid mobilization

Lipid oxidation provides more than two-thirds of the energy


migrant birds consume during shivering or running (Vaillancourt
et al., 2005). Even at rest and under normothermic conditions, the
ruff (Philomachus pugnax, L.), a wading bird, reveals its
extraordinary capacity to mobilize lipids by maintaining a higher
lipolytic rate than any other animal measured to date. These first in
vivo measurements of lipid kinetics in migratory birds demonstrate
that, in the resting state, they hydrolyse triacylglycerol at the
astonishing rate of 5560 moles of glycerol kg1 min1
(Vaillancourt and Weber, 2007). These baseline values are 23
times higher than in similarly sized mammals (resting or after
prolonged submaximal exercise), and it is also quite clear that ruff
and other sandpipers have to stimulate lipolysis even further to be
able to support flight. Yet, quantifying the effects of flying on avian
lipid fluxes remains a challenge for the future. Valuable in vitro
information has been obtained on preferential selection of particular
fatty acids from adipocytes (Price et al., 2008). Birds mobilize
shorter and unsaturated fatty acids more rapidly, whereas longchain and more saturated ones take longer to become available for
oxidation. This selection pattern has also been observed in
mammals and appears to apply generally among animals.
The capacity for lipolysis has not been determined in longdistance migratory fish such as salmon. However, these endurance
swimmers are probably also able to mobilize fatty acids rapidly if
the high lipolytic rates measured in their sedentary trout relatives
are taken as an indication (Bernard et al., 1999; Magnoni et al.,
2008b). We have proposed that all ectotherms could have this high
capacity to provide fatty acids of different chain length and
saturation level, thereby allowing them rapid homeoviscous
adaptation when body temperature fluctuates. However, more
research is needed to determine whether the need to fuel endurance
swimming or to restructure membrane phospholipids is the main
determinant of lipolytic capacity in migrant fish.
Lipid transport

The classic mammalian strategy of providing lipids to muscles as


albumin-bound nonesterified fatty acids does not suit the needs of
long-distance migrants. Instead, they rely on circulating
lipoproteins to reach the high rates of energy supply necessary for
migration because the energy carrying capacity is much higher for
lipoproteins than for fatty acids. This alternative way to fuel
working muscles appears to have evolved in animals as
phylogenetically distant as fish, birds and insects. In fish, evidence
for the use of lipoproteins as an energy shuttle is strongest for
salmonids because they show particularly high plasma lipoprotein
levels that account for over 90% of total circulating lipids. More

THE JOURNAL OF EXPERIMENTAL BIOLOGY

Physiology of long-distance migration


importantly, the lipoproteins of sockeye salmon (Oncorhynchus
nerka, Walbaum) vary dramatically over the course of migration
and in a manner consistent with their utilization as a fuel (Magnoni
et al., 2006). The use of this important energy source has also been
confirmed by the recent demonstration that endurance swimming
activates lipoprotein lipase in red muscle (Magnoni and Weber,
2007) and that lipoprotein turnover rate is higher in trout
(Oncorhynchus mykiss, Walbaum) than in any endotherm
(Magnoni et al., 2008a). The presence of a lipoprotein shuttle to
supply muscles had also been proposed several years ago for
migrant birds (Jenni-Eiermann and Jenni, 1992), and this idea is
supported by more recent work on the western sandpiper (Calidris
mauri, Cabanis). The lipoproteins of this species undergo major
fluctuations during migration along the Pacific coast of North and
Central