Romanian Archives: Microbiology Immunology

ROMANIAN ARCHIVES
OF
MICROBIOLOGY
AND
IMMUNOLOGY
Founded by
PROFESSOR ION CANTACUZINO
VOLUME 66 - Nos. 3-4

July - December 2007
Published quarterly
by
CANTACUZINO INSTITUTE BUCHAREST
TOTAL PUBLISHING HOUSE
ROMANIAN ARCHIVES OF MICROBIOLOGY AND IMMUNOLOGY
ROMANIAN ARCHIVES
Chief Editor: Dorel Lucian RADU

Editorial Assistant: Maria TEFNESCU
OF
MICROBIOLOGY
AND
IMMUNOLOGY
ISSN 1222-3891
Editorial Board: Cornelia CEIANU, Maria DAMIAN, Emilia LUPULESCU,

Cristiana MATACHE, Adrian ONU, Gabriela OPRIAN, Herv PELLOUX, Mircea
Ioan POPA, Aurora SLGEANU, Demetrios A. SPANDIDOS, Dan STERIU,
Codrua Romania USEIN
Editorial Staff: Felicia RAPILAT, Monica POEAN
INDEXED IN MEDLINE
TOTAL PUBLISHING HOUSE
Subscription orders:
Orders can be placed directly with the publisher:
Cantacuzino National Institute of Research-Development for Microbiology and Immunology
C.P. 1-525, Splaiul Independentei 103, 050096, Bucureti, Romania,
Fax: (40.21)318.44.14
E-mail: archives@cantacuzino.ro
www.roami.ro
54
CONTENTS
IMMUNOLOGY
BETA CELL ALLOTRANSPLANT IN DOUBLE TRANSGENIC MOUSE MODEL
57 PANCREATIC
OF TYPE 1 DIABETES MELLITUS
Melania Grosu, Crina Stvaru, D. Guu and D.L. Radu
MICROBIOLOGY
OF SERUM ANTIBODIES AGAINST HELICOBACTER PYLORI USING A CHROMATOGRAPHIC
62 DETECTION
IMMUNOASSAY IN OUTPATIENTS
Cecilia Bobo, Katalin Racz and Ileana Spnu
AND RESISTANCE MARKERS IN CLINICAL AND ENVIRONMENTAL AEROMONAS STRAINS

69 VIRULENCE
ISOLATED IN ROMANIA
Mariana Carmen Chifiriuc, Anca Michaela Israil, Cristina Larion, Ionela Alexandru and Georgeta Dobre
SURVEILLANCE OF SYPHILIS PATIENTS IN COLENTINA HOSPITAL (BUCHAREST, ROMANIA)

80 EPIDEMIOLOGICAL
Carmen Slvstru, Alina Ruinoiu, Alina Prvu, Magdalena Constantin, Mihaela Panduru,
Gabriela Loredana Popa and George-Sorin iplica
LABORATORY-BASED SURVEY OF CAMPYLOBACTER INFECTIONS IN PRAHOVA COUNTY

85 AMarilena
Sorokin, Codrua-Romania Usein, Mariana Irimia and Maria Damian
CONTROL OF PATHOGENIC FUNGI ISOLATED FROM WILD PLANTS IN TAIF GOVERNORATE,

90 FUNGAL
SAUDIA ARABIA
A.M. Abou-Zeid, A.D. Altalhi and R.I. Abd El-Fattah
37TH NATIONAL CONFERENCE OF IMMUNOLOGY, IAI, 19-21 SEPTEMBER, 2007

97 The
ABSTRACTS
INDEX
111 SUBJECT
AUTHOR INDEX
VOLUME 66
NOS. 3-4
JULY-DECEMBER 2007
55
INSTRUCTIONS TO AUTHORS
Aims and Scope
Romanian Archives of Microbiology and Immunoloy, an international journal dedicated to original research work, publishes papers focusing on various aspects of microbiology and immunology. Romanian
Archives of Microbiology and Immunology is indexed in MEDLINE.
The frequency of the Journal is currently four issues per year.
Categories of manuscripts
Full-length articles are full-length descriptions of original research
(up to 10 printed pages)
Reviews are comprehensive appraisals of research in a field of current
interest. All reviews are subject to the normal review process (up to
15 printed pages)
Rapid Communications are brief, definitive reports of highly significant and timely findings in the field (up to 5 printed pages)
Submission of manuscripts
Manuscripts and illustration should be submitted in electronic form
using the e-mail address of the Editorial Office:
archives@cantacuzino.ro
The preferred software is: MS Word or Adobe PDF for text and
Adobe Photoshop or Corel for images.
Editorial review and acceptance
All manuscripts are subject to editorial review by professional peer
reviewers (at least two). The Editor will decide if a paper is published
or not. The acceptance criteria for all manuscripts are based on the
quality and originality.
Ethical considerations
A paper describing any experimental work with humans should include a statement that the Ethics Committee of the institution in which
the work was done has approved it, and that the subjects gave
informed consent to the work.
Experiments with animals should be done in accordance with the
legal requirements of the relevant local or national authority. Procedures should be such that animals used in experiments do not suffer
unnecessarily. Papers should include details of the procedures and
anaesthetics used. The Editors will not accept papers where the ethical aspects are, in their opinion, open to doubt.
Preparation of manuscripts
Manuscripts should be submitted in English. American or British
spelling can be used provided that only one spelling style is consistently used throughout. Manuscripts must be typewritten on A4
format (210x297 mm), with double spacing, margins of 25 mm, on
one side only, consecutively numbered. Times New Roman font,
12-point size, is required.
Text headings
All headings in the text should be set over to the left hand margin,
and text should begin on the next line. Type first level (sectional)
headings all in capitals. Second level headings should be typed in
small (lower case) letters but with the first letter of each main word
a capital. For third level headings, only the first letter of the first word
should be a capital. Underline first and second level headings.
FIRST LEVEL TEXT HEADING
Second Level Text Heading
Third level text heading
Manuscripts should be divided into the following sections and
order: Title page, Abstract and key words, Introduction, Materials
and Methods, Results, Discussion, Acknowledgements, References,
Tables, Figure Legends and Figures.
1) Title page contain: title of the paper not longer than 80-100 characters, including spaces and punctuation; full names (including
forenames) of the authors and the name of their institute(s); the
author responsible for correspondence will be marked by an
asterisk, and his full address, telephone/fax numbers, and e-mail
address will be indicated.
2) Abstract must not exceed 250 words and must reflects the content of the study. Following the abstract, a list of 3-10 keywords
is essential for indexing purposes.
56
3) Introduction containing a description of the problem under

investigation and a brief survey of the existing literature on the
subject.
4) Material and Methods provide sufficient detail to allow the work
to be reproduced.
5) Results. Results should be clear and concise.
6) Discussion that enriches but does not repeat Section 3 or 5
7) Acknowledgements (if applicable) containing acknowledgement
of technical help and of financial material support.
8) Notes: e-mail adresses of all the authors.
9) References should be numbered consecutively in the order in
which they are first mentioned in the text. Identify references in
text, tables, and legends by Arabic numerals in square brackets
(e.g. [1], [2-6], etc.). Please note the following examples:
Journals:
Allain F, Vanpouille C, Carpentier M, Slomianny MC, Durieux S, Spik G.
Interaction with glycosaminoglycans is required for cyclophilin B to trigger
integrin-mediated adhesion of peripheral blood T lymphocytes to extracellular matrix. Proc Natl Acad Sci U S A 2002. 99: 2714-2719.
Books:
Theofilopoulos AN. Immune complexes in autoimmunity. In: Bona CA,
Siminovitch KA, Zanetti M, Theofilopoulos AN (Eds.) The Molecular
Pathology of Autoimmune Diseases. Harwood Academic Publishers,
Switzerland 1993, pp 229-244.
10) Tables with suitable captions at the top and numbered with
Arabic numerals should be collected at the end of the text on
separate sheets (one page per Table). Footnotes to tables should
be marked with a) b) c) etc and *, **, *** should be reserved
for pvalues. Each table must be understood independently of
the text. All tables must be cited in the text.
11) Figures (illustrations) Figures should be submitted on separate
pages at the end of the article (new page for each complete figure). They should be numbered in the order of their appearance
with Arabic numerals. Figures should be submitted as TIFF files
at a proper resolution as follows: Graphs at 800-1200 dpi; Photos
at 400-800 DPI; Color 300-400 DPI. Text in figures should be 810 point in size. Each figure must have a separate legend. The legends should not appear under the figures, but be gathered in a
separate section (Figure legends). Color figures can only be printed if the author is prepared to pay the cost incurred.
12) Figure legends should be supplied at the end of the manuscript,
double spaced, with relevant figure numbers, labeling symbol
and explanation.
Units of measurement, Symbols and abbreviations
Symbols for physical units should be those of the Systme Internationale (SI) Units.
Alternative or non-SI units may be used, but these must be defined
at their first occurrence in the text.
Nomenclature of Microorganisms
Binary names, consisting of a generic name and a specific epithet
(e.g., Escherichia coli), must be used for all microorganisms.
Genetic Nomenclature
To facilitate accurate communication, it is important that standard
genetic nomenclature be used whenever possible and that deviations or proposals for new naming systems be endorsed by an
appropriate authoritative body.
Proofs and reprints
Ten reprints of each article (free of charge) will be sent to the corresponding author.
Cover letter
Each manuscript submitted to the Romanian Archives of Microbiology and Immunoloy must be accompanied by a Cover letter including statement that:
- the materials represents an original work, has not been previously published, and that it has not been submitted simultaneously
for publication elsewhere.
- all authors of a manuscript concure with the submission and are
responsible for its content.
PANCREATIC BETA CELL ALLOTRANSPLANT IN DOUBLE

TRANSGENIC MOUSE MODEL OF TYPE 1 DIABETES MELLITUS
Melania Grosu1, Crina Stvaru1, D. Guu3 and D.L. Radu1
1
"Cantacuzino" National Institute of Research and Development for Microbiology

and Immunology, Bucharest, Romania; 2"N Paulescu" Institute, 2nd Clinic of Diabetes,
Nutrition and Metabolic Diseases, Bucharest, Romania
ABSTRACT
The purpose of this study was to evaluate the therapeutic response to intra-hepatic and intra-portal allotransplant with
pancreatic beta cells in double transgenic mice (dTg) with autoimmune diabetes. The results showed an improvement
in metabolic and somatic parameters and an increase in survival rate. Histopathology analysis revealed the presence
of transplanted islets and the absence of the inflammatory infiltrate 5 days after the procedure and an increase in insulinemia. In the absence of immunosuppressive drugs, rejection of the transplanted islet seems to appear after 10 weeks,
being marked by an increase in blood glucose level. A re-transplantation was performed in one mouse of each group
and the glycemia levels recorded after the second transplant were less successful.
Key words: type 1 diabetes, double transgenic mice, insulin therapy, transplantation
INTRODUCTION
Type 1 diabetes mellitus (T1DM) is one of the most
common autoimmune diseases with several million people around the globe already affected. T1DM is a multifactorial disease affecting predisposed individuals and
involving genetic susceptibilities, environmental triggers,
as well as an unbalanced immune response. The outcome
is the production of auto-antibodies as well as an expansion of auto-aggressive T-cells [1].
Insulin, the body's only blood glucose-lowering hormone, is exclusively produced by -cells from pancreatic
islets of Langerhans. Insulin therapy changed diabetes
from a rapidly fatal disease to a chronic disease associated with significant secondary complications, such as
renal failure, neuropathy, cardiovascular disease, and
retinopathy which subjects millions of patients to a daily
burden of disease management [2]. While insulin therapy
maintains glucose levels near the normal range and
reduces the risk of secondary complications, patients
often find such control difficult to achieve and suffer an
increased risk of hypoglycemia. Insulin replacement
remains the cornerstone treatment for T1DM. Islet transplantation has the potential to replace pancreatic
endocrine function in T1DM patients [3, 4]. The benefits
of enough islet transplantations are glucose control without insulin injections, prevention of potentially dangerous episodes of hypoglycemia and may also slow or prevent the progression of complications associated with
T1DM. Risks of islet transplantation include risks associated with the transplant process, side effects of immunosuppressive drugs taken by transplant recipients and
rejection of transplanted islets [5].
Various animal models have been extensively used

in diabetes research; most experiments have been carried
out on rodents. A remarkable number of therapies have
effectively treated T1DM in animal models, but only few
of them have been tested on humans [6, 7, 8, 9].
In the present study, using double transgenic mice
(dTg) which develop spontaneous insulin dependent diabetes mellitus by a known autoimmune mechanism, we
examined the therapeutic response of intra-hepatic and
intra-portal allotransplant with pancreatic beta cells.
Double transgenic mice (TCR-HA, Ins-HA) express T cell
receptors (TCR-HA) specific to the immunodominant
HA110-120 epitope of hemagglutinin (HA) of PR8
influenza virus, and the HA of the same virus is expressed
in pancreatic beta-cells under the control of insulin promoter (Ins-HA).
MATERIALS AND METHODS
Mice
Ins-HA transgenic mice express the hemagglutinin
(HA) of A/PR8/34 influenza virus in the pancreatic beta
cells under the rat insulin promoter. TCR-HA transgenic
mice express the T cell receptor specific to the immunodominant epitope HA 110-120 from the same virus in
association with I-Ed. By mating Ins-HA +/+ transgenic
mice with TCR-HA +/- transgenic mice, Ins-HA +/- TCRHA+/- dTg mice were obtained. The presence of transgenes in offspring was analyzed by PCR using primers for
TCR-HA (forward TAGGAGAAAGCAATGGAGAC, reverse
GTACCTGGTATAACACTCAG) and HA (forward GTCCTACATTGTAGAAACA, reverse GTGACTGGGTGTATATTCT) transgenes [10].
57
GROSU et al.
Fig.1 - Glycemia values in recipient dTg mice after intra-hepatic islet allotransplantation
In order to perform our experiments, 6-10 week old
dTg diabetic mice were divided into groups of 10 mice
for intra-hepatic allotransplant and 10 mice for intra-portal allotransplant. Untreated dTg mice groups and single
transgenic mice groups (Ins-HA+/-) of the same ages were
used as control. For pancreatic beta-cell donors 4 Balb/c
mice for each recipient mouse were used.
Pancreatic beta cell preparation and administration
Pancreas organs were harvested from Balb/c mice,
immediately immersed in Hank's Buffer Salt Solution
(HBSS) and crumbled. The cellular suspension was centrifuged at 2000 rpm at 4C for 10 minutes. The pellet underwent collagenase V (Sigma) digestion at 37C for 15
minutes. The digested material was washed two times by
centrifugation in HBSS. Obtained islets were purified by
Ficoll-Paque (Pharmacia Fine Chemicals) gradient density
separation at 2000 rpm for 20 minutes. Isolated islets
were recovered from the gradient interface, washed in
HBSS at 1500 rpm, 4C, for 10 minutes. The pellet was
suspended in HBSS. Cell viability was always greater than
98%, as determined by the eosin exclusion test. Finally,
cell suspension was again suspended in 0.2 mL inoculum/mouse, approximately 100 islets/mouse [4, 11, 12].
Pancreatic beta cell transplant was performed by
intra-hepatic and intra-portal methods. Intraperitoneal
Pentobarbital Sodium (Nembutal) 0.8%, 0.20 mL/20 g
body weight was injected in order to anesthetize the
recipient dTg mice. Intra-hepatic islet administration was
performed using a syringe equipped with a 27 G needle.

The volume used to inoculate a single mouse was equal
to 0.2 mL cell suspension. Intra-portal administration was
performed using a syringe equipped with a 29 G needle
and the cell suspension volume inoculated was identical
to the one used in the previous case. In both instances, the
suture of the peritoneum and skin was performed at separate points with surgical needle size 19 and surgical thread.
Diabetes monitoring
Blood glucose level was measured using a BASIC
PLUS micro-tester (Lifescan Inc., USA). Animals were
considered diabetic at blood glucose concentration levels
of over 200 mg/dL.
Plasmatic insulin concentration was measured by
ELISA method, using the manufacturer's protocol (DRG
Instruments GmbH, Germany). The anti-rat insulin antibody has 100% cross-reactivity with mouse insulin [13].
For dTg mice, the presence of glucose in urine was
identified with Medi-Test Combi 10 indicative strips
(Macherey-Nagel, Germany).
The body weight and survival rate of treated dTg
mice were monitored and compared to the control group.
Histopathological analysis
Liver specimens isolated from recipient dTg mice
were fixed in 10% formalin buffered solution embedded
in paraffin and sections were cut in stair wise 7 m-sec-
Fig. 2 Mouse blood glucose level monitored after the first and second intra-hepatic transplantation.
The bigger point marked the second pancreatic beta cells allotransplantation.
58
Pancreatic beta cell allotransplant in double transgenic mouse model of type 1 diabetes mellitus
Fig. 3 Glycemia values in recipient diabetic mice after intra-portal islet allotransplantation
tions. Sections staining was performed using haematoxylin-eosin and van Gieson stain.
RESULTS
Transplant experiment
The results of pancreatic beta cell intra-hepatic allotransplant in the diabetic mice group showed an average
decrease of 300 mg/dL in hyperglycemia over approximately 10 weeks (Fig. 1). During this period of time the
treated diabetic mice maintained a constant body weight.
After 10 weeks a gradual increase in plasmatic glucose
levels associated with decreased body weight was
observed.
One of the mice with intra-hepatic transplantation
was subjected in the 13th week (day 94) to the second
intra-hepatic transplant procedure and kept under observation. The second transplant was performed when an
increase in glycemia values were recorded. Glycemia values measured after intra-hepatic re-transplantation were
significantly higher compared to those measured following the first transplant. The intra-hepatic re-transplantated dTg mouse survived 29 weeks after the surgical procedures (Fig. 2).
The second protocol consisted of intra-portal pancreatic beta cell transplant in dTg mice. The plasmatic glucose monitored in this group of diabetic mice showed
decreased average values of around 200 mg/dL which is
the upper limit of the normal glycemia range in mice (Fig. 3).
They survived approximately 24 weeks after the procedure.
One of the mice with intra-portal transplant was subject to a second intra-portal transplant and kept under
observation for an 8 weeks (day 56). The glycemia values
monitored after re-transplantation were significantly higher
than those found after the first transplant (Fig. 4).
Insulinemia was measured in 5 intra-portal and 2
intra-hepatic transplanted diabetic mice before and on
day 5 after intervention in order to demonstrate the functionality of transplanted pancreatic beta cells. The results
showed an increase in plasmatic insulin levels in most cases but not always correlated with the reduction in glycemia (Table 1). The presence of beta pancreatic cells in
liver after transplantation was also demonstrated by histopathological analysis. Hepatic tissues from dTg mice collected 5 days after intra-hepatic or intra-portal transplant
were analyzed, indicating the presence of numerous
groups of cells with smaller dimensions, with homogenous nuclear chromatin and citoplasm localized along
the inoculation trajectory in the case of intra-hepatic
transplant and in the periphery of the hepatic lobule after
intra-portal transplant. Inflammatory infiltrate presence
was not observed. Furthermore, histological analysis showed the absence of apoptotic or necrotic transplanted
cells (Figs. 5 and 6).
We compared the survival rate of recipient mice
from both transplantation methods. The survival rate after
Fig. 4 Glucose plasmatic level of intra-portal re-transplanted diabetic mouse.

The bigger point marked the second intra-portal islets allotransplant.
59
GROSU et al.
Table 1. Glycemia and insulinemia values in intra-hepatic and intra-portal transplanted diabetic mice
intra-portal allotransplant in dTg mice and after intrahepatic allotransplant showed the benefits of this kind of
treatment in comparison with untreated dTg mice (Fig. 7).
DISCUSSION
Animal experimentation has a long history of pursuing
knowledge about human diabetes mellitus. These models
increased understanding of the role of immunological factors and the efficiency of different therapeutic approaches when trying to control hyperglycemia. Much of the
research on islet transplantation has relied on the use of
rodents and supported by the possibilities of a large number of experimental conditions. The advantages of using
the engineered T1DM mouse model is the reduced time
for disease development and the useful experimental
model for physiological as well as physiopathological
studies [13, 14].
In the present study, we evaluated two methods of
islet transplantation, by intra-hepatic and intra-portal
injection on a double transgenic mouse model of insulindependent diabetes mellitus.
Islet transplantation represents an alternative for normalization of main glucose metabolism parameters in
T1DM. The control of blood glucose levels without insu-
Fig. 5 Liver haematoxillin-eosin stain section

isolated from a recipient mouse
with intra-hepatic pancreatic beta cell transplantation
60
lin injection depends on sufficient islet transplantation.

Poor function of transplanted islet has been ascribed to
technical failure during isolation and purification, inability of islet to engraft, or the development of nonspecific
inflammatory responses which results in islet destruction
[15]. Both islet transplantation methods performed in the
present study showed a decrease in hyperglycemia with
an improvement after intra-portal transplantation reflected by decreased average values in monitored blood glucose levels and a prolonged survival rate in that group of
diabetic mice (Figs. 1, 3 and 7).
It is known that the quality of islets is one decisive
factor for successful islet transplantation [16] but it seems
that the liver islet transplantation method also has importance as shown by our results. The measurement of plasmatic insulin concentration 5 days after transplantation
revealed a significant increase in most of the cases, but it
was not accompanied by a decrease in hyperglycemia
which may be due to early detection performed after surgical intervention (Table 1). Hystopathology analysis of
the recipient liver section performed 5 days after transplantation showed the presence of transplanted beta pancreatic cells and the absence of the inflammatory infiltrate, demonstrating the success of islet transplantation
Fig. 6 Van Gieson stain of liver section

isolated from a recipient mouse with intra-portal
pancreatic beta cell transplantation
Fig. 7 Survival rate of diabetic mice with and without pancreatic beta cells transplantation
both intra-hepatic and intra-portal (Figs. 5 and 6). In the
absence of any immunosuppressive drugs, the blood glucose level was kept relatively under control for approximately 10 weeks. After this period the glycemia level
started increasing, probably as consequence of immune
system activation and rejection of transplanted islets.
When we performed the second islet transplantation
using these two methods, subsequent results showed a
less marked decrease in high blood glucose levels than
results obtained after the first transplantation, which point
to the rejection of re-transplanted islets (Figs. 2 and 4).
Our findings point to the importance of the transplantation method and the possibilities of using this murine insulin-dependent diabetes mellitus model to find
new approaches which will allow successful islet transplantation.
ACKNOWLEDGEMENTS
This work was supported by Ministry of Education
and Research grant PN 03260202
REFERENCES
1. Bresson D., von Herrath M., Moving towards efficient therapies in type 1 diabetes: To combine or not to combine?,
Autoimmun Rev., 6(5): 315-322, 2007
2. Clark O. G., Yochem L. R., Axelman J., Sheets P. T., Kaczorowski J. D., Shamblott J. M., Glucose responsive insulin
production from human embryonic germ cell derivatives,
Biochem Biophys Res Commun., 356(3): 587-593, 2007
3. Ren J., Jin P., Wang E., Liu E., Harlan D.M., Li X., Stroncek
D.F. - Pancreatic islet cell therapy for type I diabetes:
understanding the effects of glucose stimulation on islets in
order to produce better islets for transplantation, Journal of
Translational Medicine, 5:1, 2007
4. Yang T.Y., Oh H.S., Jeong I.K., Seo I.A., Oh Y.E., Kim J.S.,
Chung H.J., Min K.Y., Lee S.M., Lee K.M., Kim W.K., Do
S.Y., Choo W.S. - First human trial of pancreatic islet allotransplantation in Korea-focus on re-transplantation, Diabetes Research and Clinical Practice, 56: 107-113, 2002
5. Close N.C., Hering B.J., Eggerman T.L. - Results from the
inaugural year of the Collaborative Islet Transplant Registry, Transplant Proc., 37(2): 1305-8, 2005
6. Roep B.O., Atkinson M., von Herrath M. - Satisfacion (not)
guaranteed: re-evaluating the use of animal models of type
1 diabetes, Nature Reviews Immunology, 4, 989-997, 2004
7. Oldstone M.B.A., Nerenberg M., Southern P., Price J., Lewicki H. - Virus infection triggers insulin-dependent diabetes mellitus in a transgenic model: a role of anti-self (virus)
immune response, Cell., 65: 319-331, 1991
8. Ohashi P.S., Oehen S., Buerki K., Pircher H., Ohashi C.T.,
Odermatt B., Malissen B., Zinkernagel R.M., Hengartner
H. - Ablation of "tolerance" and induction of diabetes by
virus infection in viral antigen transgenic mice, Cell., 65:
305-317, 1991
9. Degermann S., Reilly C., Scott B., Ogata L., von Boehmer H.,
Lo D. - On the various manifestations of autoimmune diabetes in rodent animals, Eur. J Immunol., 24: 3155-3160,
1994
10. Radu D.L., Brumeanu T.D., McEvoy R.C., Bona C.A., Casares S. - Escape from self-tolerance leads to neonatal insulin-dependent diabetes mellitus, Autoimmunity, 30: 199207, 1999
11. Mendola J., Corominola H., Esmatjes E., Saenz A., Fernandez-Cruz L., Gomis R. - Effect of cyclosporine a treatment
in vitro on pancreatic islet allograft rejection, Transplantation Proceedings, 29(5): 2494-2497(4), 1997
12. Bonner-Weir S., Taneja M., Weir G.C., Tatarkiewicz K.,
Song K.H., Sharma A., O'Neil J. - In vitro cultivation of
human islets from expanded ductal tissue, Proc Natl Acad
Sci, 97: 7999-8004, 2000
13. Radu D.L., Georgescu A., Stavaru A., Carale A., Popov D.
- Double transgenic mice with type 1 diabetes mellitus
develop somatic, metabolic and vascular disorders, J. Cell.,
Mol., Med., 8(3): 349-358, 2004
14. Bot A., Casares S., Bot S., von Boehmer H., Bona C.A. Cellular mechanisms involved in protection against
influenza virus infection in transgenic mice expressing a
TCR specific for class-II hemagglutinin peptide in CD4+
and CD8+ T cells, J. Immunol., 160: 4500-4507, 1998
15. Gaber A.O., Fraga D., Kotb M., Lo A., Sabek O., Latif K.
- Human islet graft function in NOD-SCID mice predicts
clinical response in islet transplant recipients, Transplantation Proceedings, 36: 1108-1110, 2004
16. Migliavacca B., Nano R., Antonioli B., Marzorati S., Davalli A.M., Di Carlo V., Bertuzzi F. - Identification of in
vitro parameters predictive of graft function: a study in an
animal model of islet transplantation, Transplantation Proceedings, 36: 612-613, 2004
61
DETECTION OF SERUM ANTIBODIES AGAINST HELICOBACTER PYLORI

USING A CHROMATOGRAPHIC IMMUNOASSAY IN OUTPATIENTS
Cecilia Bobo1*, Katalin Racz2 and Ileana Spnu2
1*Iuliu-Haieganu
2The
University of Medicine and Pharmacy, Cluj-Napoca, Romania

Clinic Center for Diagnosis and Treatment, Cluj-Napoca, Romania
ABSTRACT
Objectives: The presence of the antibodies against Helicobacter pylori was tested in 163 subjects (children and adults) in the outpatient department, in the years 2005 and 2006.
Methods: Of the 163 investigated patients 108 (66.3%) were females and 55 (33.7%) were males. The
antibodies against Helicobacter pylori were determined by "One Step Helicobacter pylori Test Device
(Serum/Plasma)" (ACON Laboratories, Inc.), a rapid, high quality chromatographic immunoassay using
human antibodies against IgG immobilized and particles covered with Helicobacter pylori antigen, in
contact with the serum of the tested subjects.
Results: Of the 163 investigated subjects, 60 (36.8%) presented a positive test suggesting the passage
through the infection with Helicobacter pylori. The positive tests were found in adults, 1 case was a boy
of 12 years and 5 cases were teenagers between 16 and 18 years. The incidence of the antibodies increased
with age. Only 40% of the patients with positive test had a clinical diagnosis of gastritis or gastro-duodenal
ulcer, the remaining patients presenting symptoms of chronic hepatitis, cholecystitis or urticaria.
Conclusions: Antibody assay is considered by many authors as a simple, noninvasive, rapid method,
applicable in the diagnosis of Helicobacter pylori infection. Other authors asserted that the performance
of these assays is less satisfactory and the results should be confirmed by other tests, such as ureea breath
test. High levels of antibodies against Helicobacter spp. were encountered in liver and biliary chronic
diseases, suggesting a possible role of these bacteria in the development of hepatitis or cholecystitis.
Key words: Helicobacter pylori, serum IgG, chromatographic immunoassay
INTRODUCTION
At least 50% of the world's population is infected
with Helicobacter pylori, but only 10-20% of them
develop gastric or duodenal diseases, MALT lymphoma or gastric cancer (1). More than 90% of the
patients with duodenal ulcer, over 70% of the patients
with gastric ulcer and over 80% of those with gastric
cancer are infected with Helicobacter pylori (2). The
clinical course is determined by the influence of certain
environmental factors (geographic area, economic-social status), of certain host factors (age, nationality), as
well as bacterial virulence factors (1). The infections
with Helicobacter pylori carrying the gene CagA (cytotoxin-associated gene A) are usually associated with
deep histologic changes, with atrophy of the gastric
mucosa or even with gastric cancer (3). Man represents
the main pool of bacteria and their transmission takes
place from one person to another by oral or fecal-oral

route. Helicobacter pylori DNA was detected in the
saliva, dental plaque, vomiting fluid, gastric juice,
feces. Iatrogenic transmission is also possible through
the endoscope (4).
Considering these facts the authors tested the presence of the infection with Helicobacter pylori in subjects examined in the outpatient unit with the clinical
diagnosis of gastric or duodenal ulcer, acute or chronic
gastritis, acute dyspepsia, other digestive diseases or
diseases with other localizations.
The antibodies against Helicobacter pylori were
detected by One Step HP Test Device (ACON Laboratories, Inc.), a rapid qualitative chromatographic
immunoassay using immobilized antibodies against
*Corresponding author: Cecilia Bobo - Strada Moldoveanu nr 10/7, cod 400608, Cluj-Napoca; e-mail: ceciliabobos@yahoo.com
62
Detection of serum antibodies against helicobacter pylori using a chromatographic immunoassay in outpatients
Fig. 1 - Positive and negative serologic tests carried out in outpatients
human IgG and particles covered with Helicobacter

pylori antigen, put in contact with the serum of the
tested patients.
The test was applied in the outpatient unit in 163
subjects.
RESULTS
Of the 163 testings carried out in the outpatient
unit between 2005 and 2006, 60 cases (36.8%) were
positive presenting antibodies against Helicobacter
pylori, and 103 cases (63.2%) were negative (Fig. 1).
The tested subjects aged 7-17 years (28 subjects:
17.2%) and 18-79 years (135 subjects: 82.8%) (Fig. 2).
Of the tested patients, 108 patients (66.3%) were
females and of these 37 (34.2%) had positive serologic
tests, and 55 (33.7%) were males and of these 23
(41.8%) had positive serologic tests. Sex distribution
related to positive serologic tests is shown in Fig. 3.
The positive serologic tests were found in 54 (90%)
adults and in 6 (10%) children (one child aged 12
years and 5 teenagers aged 16-18 years), the incidence
of the antibodies increasing with age. The age distribution of the positive serologic tests is shown in Fig.4.
Only 40% of the subjects presenting a positive test
had a clinical diagnosis of gastritis or gastro-duodenal
ulcer, the remaining patients presenting symptoms of
chronic hepatitis, cholecystitis, urticaria or other diseases. The clinical diagnosis for positive serologic
patients is shown in Fig. 5. Age distribution related to
clinical diagnosis in positive serologic tests is revealed
in Fig. 6.
In a patient aged 49 years with the diagnosis of
chronic hepatitis, besides the antibodies against Helicobacter pylori, antibodies against HBc were also detected in the serum using the immunoenzymatic method: AxSYM CORETM (Abbott AxSYM System).
DISCUSSION
As is can be seen in Fig.1, 36.8% of the tested subjects presented antibodies against Helicobacter pylori,
a low percentage as compared with that reported by
other authors in patients with dyspeptic phenomena
Fig. 2 - Age distribution of the tested subjects
63
BOBO et al.
Fig. 3 - Sex distribution related to positive serologic tests
(5,6,7,8). It should be considered that in the present

investigation only about 40% of the tested subjects
presenetd the clinical diagnosis of gastritis, gastroduodenal ulcer or dyspepsia, the remaining patients presenting other digestive symptoms or symptoms of a different nature (Fig. 5).
Fig. 2 shows that most tested subjects (108 subjects: 66.3%) were females. Of these, 37 (34.2%) had
antibodies against Helicobacter pylori, while 23 out of
55 male subjects (41.8%) were found with a positive
diagnosis (Fig. 3). The data published in the literature
do not seem to reveal significant differences in the
infection with Helicobacter pylori between the two
sexes (9), however, Karima et al. (2006) (10) noted that
in Saudi Arabia the peptic ulcer caused by Helicobacter
pylori is more frequent in females (70%) than in males
(58%), it showing prevalence in the young patients.
The age distribution of the positive cases (Fig. 4)
showed the predominance of the infection in the adult
patients, especially in the subjects aged 30 to 50 years.
Only 6 of the 28 patients under the age of 18 years
(21.4%) had antibodies against Helicobacter pylori,

while 54 of the 135 adult patients (40%) were seropositive (Fig. 5).
In the world, the infection with Helicobacter pylori
in children varies between 10% and 80%, it depending on the socio-economic status, on the number of
the family members, the presence of the infection in
one of the family members, hygienic habits etc. Childhood represents an important period for the transmission of the infection in the undeveloped countries,
where up to 70% of the children can be infected soon
after their birth, the infection being rare in the children
in the developed countries (4). In an investigation carried out by Sinha et al. (2002) (11) in a population living in primitive living conditions in the North
America, it was found that Helicobacter pylori infection
was acquired at the age of 6 weeks, and in the second
year of life 67% of the children presented Helicobacter
pylory antigens in the feces.
Yamashita et al. (2001) (9) found 29% of the children aged 15 to 19 years with antibodies against Heli-
Fig. 4 - Age distribution of the positive serologic tests
64
Fig. 5 - Clinical diagnosis in positive serologic tests
cobacter pylori, a percentage considered by the authors higher than that found in the developed countries (5-15%), but lower as compared with the children
in the undeveloped countries (30-60%), and no sex
differences were found in the incidence of the infection in the tested subjects.
Sykora et al. (2002) (12) investigating the Czech
children with chronic gastritis found 41.6% of children
infected with Helicobacter pylori, these presenting a
higher incidence of some extradigestive symptoms
(urticaria, iron deficiency anemia) as compared with
those with gastritis of a different origin. In contrast with
the above mentioned data, Horneman (1997) (13) did
not find antibodies against Helicobacter pylori in children under the age of 4 years in Germany, but in the
children of higher age the seropositivity increased with
the age.
No specific symptoms have been described for the
infection with Helicobacter pylori in children, this
being manifest particularly in the form of gastritis, the
peptic ulcer being rare in children under the age of 10
years. Gastritis with Helicobacter pylori can be a cause
of the recurrent abdominal pain in children (14).
An analysis of the clinical diagnosis in the subjects
with positive serologic tests revealed that in 40% of
the patients with gastritis and gastroduodenal ulcer
antibodies against Helicobacter pylori were found, this
percentage being lower than that reported in the literature (2, 15). In opinion of many authors, the simultaneous application of some invasive and non-invasive
diagnosis techniques increases the chance of making a
positive diagnosis (6, 16).
A ratio of 13.3% of the seropositive patients presented liver-biliary diseases. Some findings were
reported in the literature according to which the high
level of the antibodies against the enteric strains of
Helicobacter pylori can be detected in chronic hepati-
tis or in biliary diseases, suggesting a possible role

played by these bacteria in such cases (17).
In 8.3% of the seropositive cases the diagnosis was
that of urticaria, atopic dermatitis or acne rosacea.
Some authors found high titers of IgG against
Helicobacter pylori in 41-75% of the patients with
chronic urticaria, suspecting the intervention of
Helicobacter pylori in these cases and in there opinion
the therapeutic possibilities can thus be extended
(18,19,20,21). It is recommended to test the patients
with chronic urticaria, pruritus cutaneus, prurigo
chronica multiformis, eczema, for the presence of
Helicobacter pylori, too, the eradication of the infection being useful in those with positive tests (22).
In 38.2% of the seropositive cases, the clinical
diagnosis was that of vascular or blood diseases or of
diseases of a different nature. Kowalski (2001) (23) suggested a relationship between the coronary diseases
and Helicobacter pylori. The presence of bacterial
DNA in the athreosclerotic plaques support the
hypothesis that Helicobacter pylori infection, particularly with CagA positive strains, could influence the
evolution of atherosclerosis.
In what follows several aspects concerning the
value of the serologic tests in the diagnosis of the diseases caused by Helicobacter pylori will be present.
The detection of the antibodies against the various
antigens of Helicobacter pylori was made by ELISA
type tests using chromatographic immunoassay or
immunoblot test. Some authors consider that the serologic tests are simple, rapid and convenient tests for
the diagnosis of the infection with Helicobacter pylori
(24,25) while others assert that the performances of
these tests are less satisfactory and that the results
should be confirmed by other tests (26).
The chromatographic immunoassay and immunoblot
test are recommended as a screening method in chil-
65
BOBO et al.
Fig. 6 - Age distribution related to clinical diagnosis in positive serologic tests
dren, their sensitivity and specificity being considered

satisfactory (25,27,28). Elistur et al. (1997) (29) recommended chromatographic immunoassay only in symptomatic children, its value being limited in the asymptomatic children. In adults and elderly, chromatographic immunoassay for the detection of serum IgG,
although rapid and sensitive, shows a moderate specificity, limiting its use in the population, but it is useful
for the exclusion of infection with Helicobacter pylori
in symptomatic patients (30,31,32). The reduced specificity of the serologic tests determined some authors
to use them only in the initial assessment of dyspepsia,
they helping in the selection of the patients for
endoscopy (33,34).
66
An association was noted between the presence of

serum IgG against some antigens of Helicobacter
pylori and the diagnosis of gastric cancer, the seropositivity amounting to 69-94% (34,35,36).
In patients with gastric polyps a rise of the level of
serum IgG to 88% of the investigated patients was
detected, with titers reaching 1/1060 (37).
The serologic tests can determine falsely positive
results due to the presence of some cross-reactive antigens between Helicobacter pylori, Campilobacter
jejuni, Pseudomonas aeruginosa, Haemophilus influenzae (38), or falsely negative results in the case of the
infections detected in initial stages, before the sero-
conversion. A single noninvasive test in the population

is rather a falsely positive result and most of the transient infections with Helicobacter pylori are diagnosed
based on the falsely positive tests (8). Confirmation by
other methods such as the respiratory test with labelled
urea or the detection of Helicobacter pylori antigens in
the feces would be necessary. In some patients, serum
IgA against Helicobacter pylori are present, but IgG are
not detected, which could underestimate the infection
with Helicobacter pylori when only IgG is tested (39).
The combined use of serum IgG and IgA would provide more useful information than their separate assay
(40).
Despite the existing limitations, Mitchell et al. (2001)
(41) considered that the presence of serum IgG against
Helicobacter pylori can represent a marker for the
presence of duodenal ulcer and of a strong inflammatory reaction, and Hahn et al. (2000) (42) recommended the serologic tests as a substitute of the histologic
examination.
CONCLUSIONS
1) Of the 163 tested subjects, 108 (66.3%) were females and 55 (33.7%) were males.
2) A percentage of 36.8% of the tested subjects presented antibodies against Helicobacter pylori.
3) 34.2% of the 108 tested females and 41.8% of the
55 tested males had anticorps against Helicobacter
pylori.
4) The positive serologic tests were presented in 90%
of the adults and in 10% of the tested children.
5) Antibodies against Helicobacter pylori were also
found in subjects with chronic liver and biliary diseases (13.3%), also in patients with chronic urticaria
(8.3%), suggesting a possible role of the bacterium
in the evolution of these cases.
6) The value of the serologic tests in the diagnosis of
the infections with Helicobacter pylori is discussed.
REFEERENCES
1. Hocker M, Hohenberger P. Helicobacter pylori virulence
factors - one part of a big picture. Lancet 2003.
362(9391):1231-1233.
2. Aleksic S. Helicobacter pylori - clinical manifestations,
diagnosis and therapy. Glas Srp Akad Nauka [Med] 2005.
(48):41-54.
3. Con SA, Valerin AL, Takeuchi H, Con-Wong R, Con-Chin
VG, Con-Chin GR et al. Helicobacter pylori CagA status
associated with gastric cancer incidence rate variability in
Costa Rican regions. J Gastroenterol. 2006. 41(7):632-637.
4. Brown LM. Helicobacter pylori: epidemiology and routes
of transmission. Epidemiol Rev. 2000. 22(2):283-297.
5. Ho AS, Young TH, Shyu RY, Yeh C, Tseng HH, Lee SC et al.
The accuracy of the rapid urease test and 13C-urea breath
test in the diagnosis of Helicobacter pylori infection.
Zhonghua Yi Xue Za Zhi (Taipei) 1996. 58(6):400-406.
6. Ogata SK, Kawakami E, Patricio FR, Pedroso MZ, Santos
AM. Evaluation of invasive and non-invasive methods for
the diagnosis of Helicobacter pylori infection in symptomatic children and adolescents. Sao Paulo Med J. 2001.
119(2):67-71.
7. Garcia-Diaz E, Castro-Fernandez M, Romero-Gomez M,
Vargas-Romero J. The effectiveness of (IgG-ELISA) serology
as an alternative diagnostic method for detecting Helicobacter pylori infection in patients with gastro-intestinal
bleeding due to gastro-duodenal ulcer. Rev Esp Enferm Dig.
2002. 94(12):725-736.
8. Locatelli A, Catapani WR, Gomes CR Jr, Silva CB,
Waisberg J. Detection of anti-Helicobacter pylori antibodies in serum and duodenal fluid in peptic gastroduodenal
disease. World J Gastroenterol. 2004. 10(20):2997-3000.
9. Yamashita Y, Fujisawa T, Kimura A, Kato H. Epidemiology
of Helicobacter pylori infection in children: a serologic
study of the Kyushu region in Japan. Pediatr Int. 2001.
43(1):4-7.
10. Karima TM, Bukhari SZ, Ghais MA, Fatani MI, Hussain
WM. Prevalence of Helicobacter pylori infection in patients
with peptic ulcer diseases. Saudi Med J. 2006. 27(5):621-626.
11. Sinha SK, Martin B, Sarget M, McConnell JP, Bernstein
CN. Age at acquisition of Helicobacter pylori in a pediatric
Canadian First Nations population. Helicobacter 2002.
7(2):76-85.
12. Sykora J, Varvarovska J, Kuntscherova J, Stozicky F,
Vincent P, Martin de Lasalle E et al. Symptomatology and
specific characteristics of chronic gastritis caused by
Helicobacter pylori infection in children in the Czech population - epidemiologic, clinical, endoscopic and histomorphologic study. Cas Lek Cesk. 2002. 141(19):615-621.
13. Hornemann F, Nilius M, Malfertheiner P, Bartmann P.
Seroprevalence of Helicobacter pylori in German infants
and children. Helicobacter 1997. 2(4):176-179.
14. Chong SK, Lou Q, Asnicar MA, Zimmerman SE, Croffie
JM, Lee CH et al. Helicobacter pylori infection in recurrent
abdominal pain in childhood: comparison of diagnostic
tests and therapy. Pediatrics 1995. 96(2 Pt 1):211-215.
15. Sefer M, Moroti Helicobacter pylori (H.p.) n etiologia
ulcerului peptic (gastric i duodenal). Bacteriologia, Virusologia, Parazitologia, Epidemiologia, nr. 4, 1993, 87-106.
16. Frenck RW Jr, Fathy HM, Sherif M, Mohran Z, El Mohammedy H, Francis W et al. Sensitivity and specificity of
67
BOBO et al.
various tests for the diagnosis of Helicobacter pylori in
Egyptian children. Pediatrics 2006. 118(4):e1195-1202.
17. Vorobjova T, Nilsson I, Terjajev S, Granholm M, Lyyra M,
Porkka T et al. Serum antibodies to enterohepatic Helicobacter spp. in patients with chronic liver diseases and in
a population with high prevalence of H. pylori infection.
Dig Liver Dis. 2006. 38(3):171-176.
18. Hizal M., Tuzun B., Wolf R., Tuzun Y. The relationship
between Helicobacter pylori IgG antibodies and autologous serum test in chronic urticaria. Int J Dermatol. 2000.
39(6):443-445.
19. Cuevas Acuna MT, Lopez Garcia AI, Paz Martinez D,
Galindo Garcia JA, Papaqui Tapia S, Garza Yado Mde L et
al. Frequency of Helicobacter pylori infection in patients
with chronic urticaria of Puebla University Hospital. Rev
Alerg Mex. 2006. 53(5):174-178.
20. Galadari IH, Sheriff MO. The role of Helicobacter pylori
in urticaria and atopic dermatitis. Skinmed. 2006.
5(4):172-176.
21. Valsecchi R, Pigatto P. Chronic urticaria and Helicobacter
pylori. Acta Derm Venereol. 1998. 78(6):440-442.
22. Shiotani A, Okada K, Yanaoka K, Itoh H, Nishioka S,
Sakurane M et al. Beneficial effect of Helicobacter pylori
eradication in dermatologic diseases. Helicobacter 2001.
6(1):60-65.
23. Kowalski M. Helicobacter pylori (H. pylori) infection in
coronary artery disease: influence of H. pylori eradication
on coronary artery lumen after percutaneous transluminal
coronary angioplasty. The detection of H. pylori specific
DNA in lumen atherosclerotic plaque. J Physiol Pharmacol.
2001. 52(1 Suppl):3-31.
24. Hung CT, Leung WK, Chan FK, Sung JJ. Comparison of
two new rapid serology tests for diagnosis of Helicobacter
pylori infection in Chinese patients. Dig Liver Dis. 2002.
34(2):111-115.
25. Pelerito A, Oleastro M, Lopes AI, Ramalho P, Cabral J,
Monteiro L. Evaluation of rapid test Assure Helicobacter
pylori for diagnosis of H. pylori in pediatric population. J
Microbiol Methods. 2006. 66(2):331-335.
26. Koivusalo AI, Pakarinen MP, Kolho KL. Is GastroPanel
serum assay useful in the diagnosis of Helicobacter pylori
infection and associated gastritis in children? Diagn
Microbiol Infect Dis. 2006.
27. Treepongkaruna S., Nopchinda S., Taweewongsounton
A., Atisook K., Pienvichit P., Vithayasai N. et al. A Rapid
Serologic Test and Immunoblotting for the Detection of
Helicobacter pylori Infection in Children. J Trop Pediatr.
2006. 52(4):267-271.
28. Ogunc D, Artan R, Ongut G, Gelen T, Colak D, Donmez L
et al. Evaluation of a Western blot technique (Helicoblot
2.1) for the diagnosis of Helicobacter pylori infection in
children. Pathology. 2003. 35(2):157-160.
29. Elitsur Y, Neace C, Triest WE. Comparison between a rapid
office-based and ELISA serologic test in screening for Helicobacter pylori in children. Helicobacter. 1997. 2(4):180-184.
30. Sharma TK, Young EL, Miller S, Cutler AF. Evaluation of a
rapid, new method for detecting serum IgG antibodies to
Helicobacter pylori. Clin Chem. 1997. 43(5):832-836.
31. Anderson JC, Cheng E, Roeske M, Marchildon P, Peacock
J, Shaw RD. Detection of serum antibodies to Helicobacter
pylori by an immunochromatographic method. Am J
Gastroenterol. 1997. 92(7):1135-1139.
68
32. Shirin H, Bruck R, Kenet G, Krepel Z, Wardi Y, Reif S et

al. Evaluation of a new immunochromatographic test for
Helicobacter pylori IgG antibodies in elderly symptomatic
patients. J Gastroenterol. 1999. 34(1):7-10.
33. Fraser AG, Ali MR, McCullough S, Yeates NJ, Haystead A.
Diagnostic tests for Helicobacter pylori--can they help
select patients for endoscopy? N Z Med J. 1996.
109(1018):95-98.
34. Whiting JL, Hallissey MT, Fielding JW, Dunn J. Screening
for gastric cancer by Helicobacter pylori serology: a retrospective study. Br J Surg. 1998. 85(3):408-411.
35. Schumann C, Triantafilou K, Rasche FM, Moricke A, Vogt
K, Triantafilou M et al. Serum antibody positivity for distinct Helicobacter pylori antigens in benign and malignant
gastroduodenal disease. Int J Med Microbiol. 2006. 296(45):223-228.
36. Limburg P, Qiao Y, Mark S, Wang G, Perez-Perez G,
Blaser M et al. Helicobacter pylori seropositivity and subsite-specific gastric cancer risks in Linxian, China. J Natl
Cancer Inst. 2001. 93(3):226-233.
37. Lazebnik LB, Tsaregorodtseva TM, Serova TI, Klishina
MV, Dubtsova EA, Gubina AV et al. Anti-Helicobacter
pylori antibodies in cases of stomach polyps. Eksp Klin
Gastroenterol. 2005. (5):39-42, 124.
38. Johansen HK, Norgaard A, Andersen LP, Jensen P, Nielsen
H, Hoiby N. Cross-reactive antigens shared by Pseudomonas aeruginosa, Helicobacter pylori, Campylobacter jejuni,
and Haemophilus influenzae may cause false-positive
titers of antibody to H. pylori. Clin Diagn Lab Immunol.
1995. 2(2):149-155.
39. Urita Y, Hike K, Torii N, Kikuchi Y, Kurakata H, Kanda E
et al. Comparison of serum IgA and IgG antibodies for
detecting Helicobacter pylori infection. Intern Med. 2004.
43(7):548-552.
40. Martin-de-Argila C, Boixeda D, Canton R, Valdezate S,
Mir N, De Rafael L et al. Usefulness of the combined IgG
and IgA antibody determinations for serodiagnosis of
Helicobacter pylori infection. Eur J Gastroenterol Hepatol.
1997. 9(12):1191-1196.
41. Mitchell HM, Mascord K, Hazell SL, Daskalopoulos G.
Association between the IgG subclass response, inflammation and disease status in Helicobacter pylori infection.
Scand J Gastroenterol. 2001. 36(2):149-155.
42. Hahn M, Fennerty MB, Corless CL, Magaret N, Lieberman DA, Faigel DO. Noninvasive tests as a substitute for
histology in the diagnosis of Helicobacter pylori infection.
Gastrointest Endosc. 2000. 52(1):20-26.
VIRULENCE AND RESISTANCE MARKERS IN CLINICAL AND

ENVIRONMENTAL AEROMONAS STRAINS ISOLATED IN ROMANIA
Mariana Carmen Chifiriuc, Anca Michaela Israil, Cristina Larion, Ionela Alexandru and Georgeta Dobre*
Affiliation: Cantacuzino Institute; *Public Health District Fetesti
ABSTRACT
The virulence and resistance (R) features of 37 Aeromonas strains from diarrheal cases and 150 from the aquatic
environment (isolated during cold and warm season) were tested at different incubation temperatures (4oC, 28oC
and 37oC). When incubated at 4oC temperature, the Aeromonas strains isolated during the cold season expressed
the highest number of virulence factors by comparison with the strains isolated during warm season and from
diarrhoeal cases, the virulence spectrum increasing simultaneously with the incubation temperature (i.e. 28oC
and 37oC) for all strains. Mucinase was the unique virulence factor constantly present in all three categories of
strains at all three incubation temperatures. The aquatic as well as clinical strains exhibited similar R levels to
ampicillin and colistin, while for the other tested antibiotics, the aquatic strains generally proved higher R levels
than clinical strains, excepting cephtazidime. Plasmids of molecular weights ranging between 1904 -21226 bp,
were isolated in 36,5 % of Aeromonas strains, some of them being correlated with specific R patterns. The large
virulence spectrum correlated with high R in Aeromonas strains isolated from the aquatic medium is pleading
for the significant role of these bacteria in the pathogenic potential of the natural reservoir possibly implicated in human pathology.
Key words: Aeromonas, virulence factors, resistance markers, temperature dependence
INTRODUCTION
Aeromonads are common psychrophilic and
mesophilic microorganisms present in mud, soil (12),
freshwater and estuarine environment (4), but also
occasionally implicated in poikilothermic (reptile,
frogs, fish) and homeothermic animal infections. These
bacteria can also contaminate food (meat, milk products, fish, brackish) preserved at 4oC, drinking water
systems (9, 51) and hospital dialysis supplies. The persistence of Aeromonads (A. hydrophila, A. caviae, A.
veronii) in biofilms within water distribution systems
(26, 47) as well as their multiple resistance (R), when
isolated from these utilities were for a long time underestimated, although these aspects are signifying an
important risk for the public health (7, 8, 10).
As opportunistic pathogens these strains were cited
over the last decades as involved in human enteric (40)
and extra-intestinal infections. In enteric infections,
Aeromonas strains are implicated in isolated cases, as
well as in outbreaks of cholera- and Shigella-like enterocolitis (of food and water origin) (3, 19, 29, 35),
whereas in extra-intestinal infections there are implicated in localized as cutaneous (fasciitis as nosocomi-
al infection) (21), ocular (orbital cellulitis, keratitis

associated with contact lens) (22, 44), joint, bones, respiratory, hepatic, urinary tract infections, meningitis
(as consequence of the use of medicinal leech therapy)
(42) as well as in systemic infections as bacteremia (35)
and septicemia with exitus by endotoxic shock phenomena. Among the patients were included immunocompromised as well as normal persons belonging to
special professional groups as fishers, subjects practicing aquatic sports (surfing, diving, swimming) or aspiration pneumonia in post resuscitated drown cases
(41) etc.
The Aeromonas species frequently implicated in
the human (6) and animal pathology are: A. veronii, A.
caviae (especially in extra-intestinal infections) and A.
hydrophila.
At present the phenotypic diagnosis of Aeromonas
species is still very difficult. The biochemical identification needs at least five days and sometimes 136 tests
are not yet sufficient for a clear taxonomic differentiation among Aeromonas species (2, 15, 34). Difficulties
of Aeromonas identification were also described with
special reference to VITEK and API 20E systems, which
*Corresponding author: carmen_balotescu@yahoo.com
69
CHIFIRIUC et al.
frequently misidentified Aeromonas strains as: V.

damsela, V. fluvialis or V. cholerae strains, this last
aspect triggering unnecessary special epidemiological
measures (1, 43). Considering these aspects, a clearcut differentiation of all species by using only chemotaxonomic markers has not been yet possible. By help
of molecular biology methods (RFLP of PCR-amplified
16S rRNA genes), 13 genomospecies were identified,
out of which only 9 taxa were recovered from clinical
material, but evident discrepancies still remain
between these genomospecies and species defined by
phenotypic analysis (2, 11, 25).
Aeromonas strains are known to-day as producers
of virulence factors (5, 16, 20, 38) and among the few
microorganisms synthesizing carbapenemases.
The purpose of the present work was to study by
comparison the virulence and resistance markers in
Aeromonas strains isolated in our country, from different sources of the aquatic environment versus clinical
cases (clinical diarrhea in infants, children, adults).
Bacterial strains and cultivation. 390 samples (350
from the aquatic medium and 40 from diarrhea cases)
were collected. Out of the 350 samples from the
aquatic medium (301 isolated during the cold season
and 49 during the hot season), 228 were from fluvial
water, 44 from plants, 35 from frogs, 23 from shellfish,
20 from fish intestinal content.
i. Environmental samples
For estuarine water: specimens (with debris, mud
or silt) of 10 ml water were collected in sterile containers and added to 90 ml alkaline peptone water (i.e.
dil. 10-1); two additional tenfold dilutions were made
in alkaline peptone water at 35-37 oC for 18 hours and
thereafter the cultures were plated on MacConkey,
Bile Salt Agar (BSA), Thiosulfate-Citrate-Bile salts-Sucrose agar (TCBS) and Havelaar media. After 18 hours
incubation at 37 oC, the isolated colonies on BSA
medium were tested for oxidase reaction and submitted to biochemical identification. On TCBS medium
there were evidenced the sucrose-fermentative (Vibrio
cholerae) and non-fermentative (Vibrio parahaemolyticus) colonies. The suspicious colonies were further
cultivated on triple sugar agar and gelatine agar with
0% and 1% NaCl. On Havelaar medium (supplemented with ampicillin) the Aeromonas colonies were recognized by the presence of their yellow color (ampicillin resistant colonies).
For clear water: samples of 100 ml water were collected in sterile container and filtered through 0.45 um
Milipore membrane filter; thereafter the filter was
placed in 100 ml alkaline peptone water in a flask and
70
after 6 hours incubation at 35-37 oC, the filter was plated

to MacConkey, BSA, TCBS and Havelaar media. The
plates were incubated 18 hours at 37oC and the same
above-mentioned criteria of identification were used.
The environmental samples (plankton, oysters, fish
intestinal content) were kept refrigerated until prepared for testing. Aseptically, samples of 25 g were weight,
cut in very small pieces, put into sterile blenders of
500 ml and 225 ml alkaline peptone water were poured on it (dilution 10-1); thereafter serial dilution of 10-2
and 10-3 were also prepared. After incubation 18 hours
at 35-37oC, two small loops from the surface and topmost portion of the alkaline peptone water cultures
were streaked on TCBS, BSA and MacConkey media
The colonies isolated on TCBS medium were fished
and streaked on gelatin agar with 0 % and 1% NaCl
respectively, in the purpose to isolate nonhalophilic
and halophilic vibrios species. The isolated colonies
were used for biochemical identification.
ii. Clinical samples
40 strains isolated from diarrhea cases (26 from
adults, 5 from children and 9 from infants) were sent
for identification to National Reference Center for Vibrio
by 2 hospital laboratories of the country. These strains
were plated on BSA and after 18 hours of incubation at
37 oC, the isolated colonies were tested for oxidase
reaction and submitted to biochemical identifications.
iii. Strains identification. The biochemical identification was carried out by 33 conventional tests: TSI
(triple sugar agar), oxidase, motility, growth at 37 oC,
D-glucose fermentation (with/or without gas production assessed by Durham tube), ornithine-decarboxylase, lysine-dcarboxylase, arginine-dehydrolase, lactose, sucrose, mannitol, mannose, maltose, arabinose,
dulcitol, adonitol, inositol, sorbitol, trehalose, xylose,
raffinose, Na citrate Simmons, nitrate reduction, indole
production, methyl red and Voges Proskauer (on Clark
medium) reactions, phenylalanine-desaminase, growth
at different NaCl concentrations (i.e. 6%, 7,5%, 10%,
12%), sensitivity to O/129 vibriostatic agent (2,4diamino-6,7-diisopropylpteridine) 400 mg/disk (prepared in house).
iv. Control reference strains: Vibrio cholerae O1
classical biotype, serotype Inaba 35 A, Staphylococcus
aureus ATTC25923, -Escherichia coli ATCC 29935.
Detection of virulence factors
37 Aeromonas strains isolated from diarrhea cases
and 150 strains from aquatic environment (101 isolated during cold and 49 during warm season) were tested for the presence of 14 cell-associated and soluble
Virulence and resistance markers in clinical and environmental Aeromonas strains isolated in Romania
virulence factors. The adherence to biotic substrate

was assessed by the Cravioto adapted method (24). In
this purpose, 1 ml bacterial suspensions prepared from
broth cultures of 24 hours were inoculated on a 80%
confluent monolayer of HEp-2 cells. After 2 hours incubation at 37 oC, the bacterial suspensions were discarded and the cell cultures were washed and stained
by Giemsa method. The adherence was microscopically examined and registered from qualitative (different adherence patterns) and semiquantitative (+,
++, +++, ++++) points of view. Three different
patterns of adherence were registered: localized (cluster formation), diffuse (individual bacterial cells adhered to Hep-2 cells) and aggregative (bacterial cells
stratified in brick-like layers adhered both on cellular
and inert substrata), The adherence capacity to abiotic surface (slime test) and the soluble virulence factors, i.e. the production of pore forming-toxins
(CAMP-like factor, sheep red blood cells haemolysin,
Kanagawa enterotoxin, lipase and lecithinase), DN-ase,
proteases (caseinase and gelatinase), glucidases
(mucinase, amylase and aesculin hydrolysis) were tested by methods (17, 28) already mentioned by the
authors (31).
Study of resistance markers by:
i. Phenotypic methods
a. disk diffusion method
The susceptibility of the same 187 Aeromonas
strains (150 wild strains from environmental sources
and 37 from diarrhea cases) to 19 antimicrobial agents
was determined according to CLSI (23). The Mueller
Hinton (MH) agar was previously controlled by using
E.coli ATTC 29935 reference strain in Petri dishes in a
constant layer of 4 mm thickness. Each new lot of
Aeromonas strains was simultaneously tested by comparison with the reference strain to ascertain the validity of results. The results were interpreted by using
CLSI 2005 standard tables for E. coli. The following
(commercial) Oxoid disks were used: amoxicillin
(AMX) (25mg), amoxicillin/clavulanic acid (AMC) (20
mg), ceftazidime (CAZ) (30 mg), cefoxitin (FOX) (30 mg)
imipenem (IMP) (10 mg), chloramphenicol (CHL) (30
mg), tetracycline (TCY) (30 mg), nalidixic acid (NAL) (30
mg), norfloxacin (NOR) (10 mg), ciprofloxacin (CIP) (5
mg), bactrim (TMP/SMX) (1,25/23,75 mg), gentamicin
(CN) (10 mg), streptomycin (STR) (10 mg), kanamycin
(K) (30 mg), amikacin (AK) (30 mg), colistine (CT) (10
mg), furazolidone (FRZ) (50 mg), nitrofurantoin (NF)
(300 mg). For the first 20 strains, each strain was tested
on MH medium in three different plates, each plate
being incubated at a certain temperature (i.e. 4oC, 28oC
and 37oC respectively) and the results compared.
The remaining Aeromonas strains were tested in
one single replica incubated at the classical temperature of 37oC.

b. double diffusion method
It was used for investigation of b-lactamases screening by synergism/antagonism aspects between AMX,
AMC, CAZ disks placed at 20 mm distance, carbapenemases (IMP), porin deficiency (FOX) and efflux mechanism (CHL, TCY, NOR) (32-33). The reading of results could detect the ESBL-phenotype (occurrence of
synergism between the AMC disk and AMX and CAZ
respectively) as well as the inducible b-lactamases revealed by the occurrence of an antagonism between
the AMC and CAZ disks on one side and inducible carbapenemases revealed by antagonism between CAZ
and IMP, on the other side.
c. minimal inhibitory concentration MIC assay by
broth microdilution method
The MIC was performed on 47 Aeromonas strains
selected from aquatic and clinical sources. Binary dilution scales from 1024 g/mL to 1g/mL of 5 antimicrobial substances (ampicillin, streptomycin, ciprofloxacin, nalidixic acid and furazolidone) were performed in microvolumes of 200 l trypticase soy broth
(Mrieux) distributed in 96 well microplates to which
50 l of bacterial suspension of 0.5 MacFarland density were added. After 24 hours incubation at 37C, the
MIC were noticed as the last well with clear medium
without visible bacterial growth. All data (diameters of
growth inhibition areas and the corresponding MICs)
were processed by help of an electronic WHONET
program (version 5.2) in the purpose to obtain specific
break-points for each tested antibiotic versus Aeromonas strains.
ii. Isolation of plasmid DNA
The isolation and purification of plasmid DNA was
performed by QUANTUM Pre-Pasmidial Miniprep kit
(BIORAD) and the presence of DNA evidenced by horizontal electrophoresis (using 0.5 % agarose gel in TBE
buffer, stained with ethydium bromide and photographed under UV transmission). The molecular weights
were appreciated using lambda phage (restricted with
Eco RI and Hind III) with 9 DNA fragments (21.226 kb,
5.148 kb, 4.973 kb, 4.268 kb, 3.530 kb, 2.027 kb,
1.904 kb, 1.584 kb, 1.375 kb) (SIGMA) and the E. coli
V517 reference strain (carrying eight plasmids of
molecular weight of: 54 kb, 7.4 kb, 5.6 kb, 5.1 kb, 4.4.
kb, 3.0 kb, 2.7 kb and 2.1 kb) (37).
RESULTS
i. Strain identification
Out of 350 samples collected from the aquatic
medium, 300 strains were isolated out of which 291
71
CHIFIRIUC et al.
(97%) oxidase positive and 9 (3%) oxidase-negative.

Among the oxidase positive strains, 181 (60%) were
identified as Aeromonas: i.e 91 (30, 33%) A. hydrophila, 31 (10, 33%) A. veronii, 21 (7 %) A. caviae, 7
(2,33%), A. proteoliytica and 31 (10,33 %) Aeromonas
sp. that could not be identified with certitude at
species level by routine biochemical tests, so that
these last number of Aeromonas strains have been
excluded from further studies. Considering other oxidase -positive strains, 30 (10%) were vibrios, i.e.: 29
(9.77%) V. fischerii and 1(0, 33%) V. fluvialis, 4
(1.33%) Plesiomonas and 36 (11,88 %) Alcaligenes,
10 (3.33%) Pseudomonadaceae, i.e.: 4 (1.32%)
Cryseomonas luteola, 3 (0.99%) Pseudomonas aeruginosa, 1 (0.33%) Brewundimonas, 1 (0.33%) Burkholderia and 1 (0.33%) Pantoea. Among the 9 (3%) oxidase-negative strains, 6 (1.98%) were Proteus, 2
(0.66%) Providencia and 1 (0.33%) Vibrio metschnikovii strains.
Out of 40 strains of diarrhoeal cases there were isolated 37(92, 5 %) Aeromonas strains (23 adults, 5 children and 9 infants): 21 (52,5 %) A. hydrophila, 11 (27, 5 %),
A. caviae, 4 (10%), A. veronii and 1 (2,5%) A. sobria.
ii. Virulence factors

Adherence on biotic surface
The ability to colonize the cellular substrate was
100 % in Aeromonas strains isolated in infants, followed by the strains isolated in adults (65%) and
aquatic medium (55%). The both diffuse and aggregative adherence patterns were present in strains isolated
from infants, aggregative adherence was predominant
in clinical strains from adults and the localized adherence predominated in environmental strains.
The slime factor was constantly present in all 3 categories of strains, i.e. at incubation temperature of
28 oC and 37 oC for the environmental strains and only
at 37 oC for clinical strains. Out of the 11 soluble enzymatic factors, 9 proved to be present in Aeromonas
strains, dependent upon the incubation temperature
(i.e. 4 oC, 28 oC and 37oC) and the source of isolation,
namely: aquatic cold season 4 / 9 / 9, aquatic warm season: 3 / 7 / 10 and clinical strains: 1 / 8 / 8 (Fig. 1). In the
strains isolated from the aquatic environment during
the cold season, there were constantly present 4 virulence factors: mucinase, caseinase, lipase, esculinase.
The strains isolated in diarrheal cases exhibited less
Table 1 - Distribution and prevalence of R markers in Aeromonas strains isolated from different sources
72
Fig. 1. Expression levels of virulence factors at different incubation temperatures

in Aeromonas strains isolated from clinical and environmental sources
73
CHIFIRIUC et al.
ability of adaptation at 4 oC temperature but exhibited

8 virulence factors active at 28 oC and 37 oC. Mucinase
was the unique virulence factor constantly present in
the strains isolated in aquatic medium as well as in
clinical strains. Amylase reaction exhibited a non-significant incidence. CAMP-factor was completely absent
in all 3 categories of strains. Arabinose was constantly
present in Aeromonas strains isolated in clinical cases
(98%) when compared with only 43% positivity in the
strains isolated from the environment (Fig. 1).
iii. Aspects of resistance
Phenotypic determinations
a. Disk diffusimetric method and double diffusion
method
Comparative studies of R patterns of 150 Aeromonas strains isolated in environmental (aquatic) medium
and 37 in diarrhoeal disease indicated the following
aspects: the bacterial cultures did not grow at the incubation temperature of 4 0C in the presence of antibiotic disks. The aspects of R were identical for both temperature of plates incubation i.e. 28 oC and 37 oC. The
highest incidence of R was evidenced in Aeromonas
strains isolated in the aquatic medium by comparison
with the strains isolated in clinical cases and namely to
8 antimicrobial substances: ampicillin (constitutive
resistance by inhibitor sensitive b-lactamase production) (27,36 ), cefoxitin, bactrim, nitrofurantoin, streptomycin, amikacin, chloramphenicol, kanamycin
(table 1). The Aeromonas strains isolated in clinical
cases exhibited a higher incidence of R only towards 2
antimicrobial substances, i.e: ceftazidime and nalidixic
acid (table no. 1). All tested strains, irrespective to their
origin exhibited similar levels of R for ampicillin and

colistin (table 1).
b. Determination of the break-points to 5 antimicrobial substances for Aeromonas strains
By the simultaneous assay of growth inhibition
areas and minimal inhibitory concentrations of 47
Aeromonas strains (originating in clinical cases and
aquatic sources) to ampicillin, streptomycin, ciprofloxacin, nalidixic acid and furazolidone table, it was possible by help of the WHONET 5.2 system analysis
program to determine the well delimited break-points
for streptomycin, ciprofloxacin and nalidixic acid (Fig.
2-4). Concerning furazolidone, the results indicated a
direct passage from sensitivity to resistance aspects
without an intermediary bacterial population (in accordance with the bacteriostatic action of this substance)
(Fig. 5). With special reference to ampicillin, it was not
possible at all to achieve any precise limit among the
three clinical categories (resistant, intermediate and
sensitive) of strains as given by WHONET system data
(Fig. 6).
iv. Genetic studies
Plasmid DNA isolation performed on 35 strains (14
from aquatic and 21 from acute diarrhea cases)
revealed a great diversity of the extra-chromosomal
genetic material, demonstrated by the presence of
plasmid DNA in 15 strains (7 from aquatic and 8 from
acute diarrhea cases) (table 3 ). The isolated plasmids
(1 to 3 / strain) exhibited molecular weights ranging
from 1, 904 kb to 21, 226 kb. In spite of the fact that
an evident relationship between the presence of a certain phenotypic R marker and the presence of a certain
plasmid profile could not be established, however it
Table 2 - Comparative results between the antibiotic break points for Aeromonas and standard CLSI
antibiotic break points for Enterobacteriaceae strains
74
Table 3 - Correlation between the presence of DNA plasmids and the presence of different R phenotypic markers
must be mentioned that all three strains carrying two

plasmids exhibited the same R pattern, i.e. resistance
to AMP, AMX, S, CT, K, AK, TMP/SMX, suggesting that
at least one of these two plasmids could carry R genes
for the respective antibiotics.
DISCUSSION
The present study demonstrated the predominance
of oxidase-positive microbiota (97%) in the aquatic
medium, in Danube area (Borcea branch) along the
Fig. 2. Susceptibility concordance data

between diameter zones (X axis)
and MICs (Y axis) for streptomycin (STR)
Fig. 3. Susceptibility concordance data between disk

diffusion diameter zones (X axis) and MICs (Y axis)
for ciprofloxacin (CIP)

between disk diffusion diameter zones (X axis)
and MICs (Y axis) for nalidixic acid (NAL)

and MICs (Y axis) for furazolidone (FRZ)
75
CHIFIRIUC et al.

and MICs (Y axis) for amoxicillin (AMX)
year, out of which Aeromonas exhibited the highest

incidence (60%), followed by Vibrio (10%) strains.
The Aeromonas strains from clinical cases were
isolated in three different areas of the country: i.e. 14
(14 Aeromonas hydrophila) strains in the first geographical area, during 2003, 14 (10 A. caviae, 3 A.
hydrophila and 1 A. sobria) strains in the second area
during 2005-2006 and 9 (4 A. hydrophila, 4 A.veronii
and 1 A. caviae) strains (in a pediatric hospital) in the
third area, during 2006; all the strains were isolated
from individual cases (infants, children, adults) hospitalized for fever, diarrhea and abdominal pains.
It must be mentioned that the differentiation
between Aeromonas and Vibrio strains by help of the
sensitivity aspect to O/129 vibriostatic agent was possible only by help of disks impregnated with 400 mg/disks
(instead of the standard concentration of 150 mg/disk,
which could not evidence any difference); this test performed on Mueller Hinton yielded negative results for
Aeromonas, but positive (growth inhibition zone of 15
mm diameter or larger) for Vibrio strains (34).
No evident correlation could be established between a certain Aeromonas sp. and a special aquatic
habitat, all species being ubiquitary in the aquatic
water, plants, shellfish, frogs and fish enteric content.
Our results demonstrated that the Aeromonas
aquatic strains isolated even in the cold season (in
stress conditions) preserved their rapid cultivability on
culture media, as well as the activity of certain virulence factors, aspects pleading for the permanent existence of a natural reservoir of pathogenic potential in
the aquatic environment.
76
The adherence on biotic and abiotic (slime test)

surfaces is pleading for the ability of the respective
strains to colonize gut mucosa (in case of strains isolated in clinical cases) and other biotic (brackish, shellfish, fish) and abiotic (aquatic plants) surfaces in the
environment. When considering the strains isolated
from diarrhea cases, the infants appeared as a risk
group (as in case of Escherichia coli strains) exhibiting
the highest incidence (100%) of diffuse and aggregative adherence, by comparison with the adults strains
where only the aggregative adherence was present,
with a lower level of 65%. The presence of adherence
capacity to HeLa cells in the aquatic strains (55%) is
suggesting the potential of the respective strains to initiate an infectious process when transferred from the
external medium to the animal/human host.
The expression of virulence factors increasing
simultaneously with the incubation temperature (4oC 28oC -37oC) in our experiments is suggesting the occurrence of a similar phenomenon in the natural environment during the hot season.
At 4 0C, the environmental strains isolated during
the cold season exhibited the highest number of active
virulence factors (mucinase 83%, lipase 83%, caseinase 55% and aesculinase 55%), followed by environmental strains isolated during the warm season (mucinase 99%, lipase 67% and DN-ase 67%), whereas the
clinical strains exhibited only mucinase (70%). The
presence of virulence factors active at 4 oC in Aeromonas environmental and clinical strains were also
reported by Haque's (30), suggesting their implication
in microbial surviving in stress conditions.
Mucinase proved to be the most constant active virulence factor at all 3 temperatures of incubation, in all
3 categories of strains.
It is known that mucinases may enhance bacterial
adhesion to the host cells and therefore favor the host
colonization, by degrading the mucins as well as the
IgA and lactoferrin, contributing to disruption of the
defense mucosal barriers. Besides their implication in
the pathogenesis of Aeromonas strains, mucinases (as
degrading enzymes) could also contribute to the persistence and surviving of microorganisms in the external medium even in non-favorable conditions (embedded in the mucous gels on the surface of brackish,
shellfish etc).
Concerning the presence of aesculinase and
caseinase as virulence factors there were evidenced
high positivity levels in all three categories of strains at
28 oC and 37 oC and even at 4 oC for the strains isolated in cold season.
The aesculine positivity test must be interpreted as
a virulence factor in Aeromonas strains isolated in clinical cases and very active at 37 oC temperature, signi-
fying the presence of growth and virulence ability of

these strains. The presence of aesculinase means that
the respective Aeromonas are able to produce aesculetol (by aesculine hydrolysis) acting as iron-chelating agent (14) from the external environment contributing to the control of virulence expression.
The significant expression level of aesculinase in
strains isolated in cold season, even at 4 oC is pleading
for the role of this factor in the bacterial resistance to
stress conditions.
Lipase was present in both categories of strains isolated in aquatic medium, at all 3 incubation temperatures, this aspect suggesting the implication of this
enzyme in the resistance and surviving of Aeromonas
strains in the external medium, even in extreme thermal conditions.
Lecithinase was present in all 3 categories of strains,
the highest expression level being noticed in clinical
strains incubated at 37oC, suggesting the implication
of this enzyme in host invasion.
Our results revealed that all 3 categories of strains
exhibited significant levels of Kanagawa enterotoxin,
when incubated at 28oC and 37oC, suggesting that environmental Aeromonas strains harbor cytotoxins, aspect
giving rise to public health risks associated with consumption of these aquatic microbionts (39). Similar aspects were also reported by Ullmann et. al, 2005 (50).
Our results demonstrated a higher incidence of
heamolysins in environmental than in clinical strains,
whereas the literature is citing a higher incidence in
clinical strains (Chacon et al., 2003) (18). These contradictory results are probably related to the geographical distribution of strains with different virulence patterns (46, 52).
D-arabinose degradation exhibited 98% positivity
in the clinical strains and 43 % in the environmental
strains by comparison with Haque's results reporting
positivity of 100% in diarrhea strains and 0% in the
environmental strains. The constant positivity of D-arabinose degradation in Aeromonas clinical strains
demonstrates the utility of this biochemical test as a
virulence marker for Aeromonas strains.
The presence of high number of virulence factors in
environmental strains is pleading for the existence in
the external medium of a virulence reservoir with risk
for the human health. Similar aspects were reported by
Burke et al, 1984 (13), who mentioned that: although
the distribution of several characteristics differs in clinical and environmental strains, many strains found in
water have properties identical with those of the clinical isolates, aspects that suggest such strains may be
potential enteric pathogens.
The association of low temperature with antibiotics
proved to have a synergic inhibitory effect on the sur-
vival and cultivability of the strains, as demonstrated

by the growth absence of Aeromonas strains on
Mueller Hinton in the presence of antibiotic disks,
when incubated at 4 oC, whereas at 28 and 37 oC, the
growth of Aeromonas strains was evident even in the
presence of antibiotics.
The R level was higher in the strains isolated from
the aquatic medium than in clinical cases, these results
coming into concordance with similar aspects previously reported by our studies (31) for V. cholerae
strains. These aspects are pleading for the important
role of the aquatic ecological system in the preservation of resistance genes in the external medium as
described also by other authors (48).
Although there was not noticed any relationship
between a specific R spectrum and a certain Aeromonas sp., however the clinical strains exhibited different
R patterns related to the geographical areas of the
country, as well as to the year of isolation, as follows:
in the first area, during 2003, the Aeromonas strains
exhibited 100% resistance to cephtazidime and 84%
to colistin, in the second area, during 2005-2006 , the
highest incidence of R was noted for the constitutive
resistance AMP/AMX 70%, and AMP/AMX-R AMC-R
63%, as well as for kanamycin 49%, STR 77%, colistin
100% and bactrim 56%, whereas in the third area,
during 2006, the highest incidence was noticed for
streptomycin 100% and colistin 100%. For the third
area, in the strains isolated in infants only, this higher
R level could have been acquired from the hospital
strains.
With special reference to ampicillin resistance of
Aeromonas strains, the resistance levels varied from
59% (in clinical strains) to 86,97% (in aquatic strains),
by comparison with literature data related to different
geographical area, i.e. 54.3 % ampicilin resistance in
Aeromonas strains isolated in South Africa, (Pavlov,
2004) (45 ), 91% in strains isolated in Spain and 100%
in Lebanon (Tokajan, 2004) (49).
Considering the ampicillin break-points for
Aeromonas strains, it was not possible to establish the
clinical categories of R, I and S (the strains exhibiting a
very heterogenic distribution), this aspect indicating a
great genetic variability in the bacterial population.
These results suggest that amoxicillin/ampicillin must
be eliminated from the antibiotics list recommended to
be tested and used for Aeromonas infections.
The results based on the analysis of R patterns, as
well as on the plasmid isolation indicated the presence
of both constitutive and plasmidial R aspects in
Aeromonas strains.
The clinical and aquatic strains proved to carry 1-3
plasmids, the most of them with high molecular
weight; 8,5% strains exhibited 2 plasmids and a con-
77
CHIFIRIUC et al.
stant resistance to AMP/AMX, S,CT,K, AK, TMP /SMX,

whereas 28% with 1 plasmid exhibited constant resistance to AMP/AMX, S, CT, K, NA, suggesting the possible plasmid origin of AMP/AMX resistance.
Extensive resistance surveillance programs for
Aeromonas strains are compulsory required to guide
the antimicrobial therapy, taking into account that
these bacteria are not routinely tested and there are not
yet specific standards available, the antibiotic susceptibility results being interpreted by help of the Enterobacteriaceae standard values, which are not always
offering the best correlations, as demonstrated by our
results (Table 2).
In conclusion, the presence of a large spectrum of
virulence factors and high levels of resistance in
Aeromonas strains isolated from the aquatic medium
of Danube Delta is pleading for the important role of
these strains as constituents of the natural pathogenic
reservoir with possible implications in human pathology. The presence of some virulence factors active even
at 4oC, is pleading for the ability of Aeromonas strains
to adapt to the permanent changing of the environmental parameters and to survive in stress conditions.
ACKNOWLEDGEMENTS
The present work was performed by help of a
research VIASAN grant (2004-2006) awarded by the
Romanian Ministry of Research and Education.
SELECTIVE REFERENCES
1. Abbott, S.L., L. S. Seli, M. Catino, Jr, M. A. Hartley and M.
Janda.1998. Misidentification of Unusual Aeromonas
Species as members of the genus Vibrio: a Continuing
Problem. J. Clin. Microbiol. 36: 1103-1104.
2. Abbott S.L., W.K. Cheung, and J.M. Janda. 2003. The
genus Aeromonas: biochemical characteristics, atypical
reactions and phenotypic identification schemes. J. Clin.
Microbiol. 41:2348-57.
3. Albert M. J., M. Ansaruzzaman , A. Kaisar Talukder, K.
Ashok Chopra, Inger Kuhn, Motiur Rahman, A.S.G.
Faruque , M. Sirajul Islam , R. Bradley Sack and Mollby.
2000. Prevalence of Enterotoxin Genes in Aeromonas spp.
Isolated from Children with Diarrhea, Healthy controls
and the Environment. J. Clin. Microbiol. 38: 3785-3790.
4. Aguilera-Arreopla M.G., C. Hernandez-Rodriguez, G.
Zuniga, M.J. Figuerras and G. Castro-Escarpulli. 2005.
Aeromonas hydrophila clinical and environmental ecotypes as revealed by genetic diversity and virulence genes.
FEMS Microbiol. Lett. 5: 231-240.
5. Allan B.J. and M.W. Stevenson. 1981. Extracellular virulence factors of Aeromonas hydrophila in fish infections .
Canad. J. Microbiol. 27: 114-1122
78
6. Altweg M., and H. K. Geiss.1989. Aeromonas as human

pathogen. CRC Critical Reviews in Microbiology .16: 253286 .
7. Ashbolt N. J. 2004. Microbial contamination of drinking
water and disease outcomes in developing regions.
Toxicology. 198: 229-238.
8. Aulicino F.A., and F. Pastoni. 2004. Microorganisms surviving in drinking water systems and related problems.
Ann.Ig. 16: 265-72.
9. Bomo A.M., M.V. Storey, and N.J. Ashbolt. 2004.
Detection, integration and persistance of aeromonads in
water distribution pipe biofilms. J. Water Health. 2: 83-96.
10. Bondi M., P. Messi , E. Guerrieri, and F. Bitonte. 2000.
Virulence profiles and other biological characters in water
isolated Aeromonas hydrophila. New. Microbiol. 23: 347356.
11. Borrell N., Acinas S. G., M. J. Figueras and A. J. MartinezMurcia.1997. Identification of Aeromonas Clinical isolates
by restriction Fragment Length Polymorphism of PCRAmplified 16S rRNA Genes. J. Clin. Microbiol. 35: 16711674.
12. Brandi G., M. Situ, F.F. Schiavano, L. Salvaggio, and A.
Albano.1996. Survival of Aeromonas hydrophila, Aeromonas caviae and Aeromonas sobria in soil. J.Appl.Bacteriol.
81: 439-444
13. Burke V., J. Robinson, M. Cooper, J. Beaman, K. Patridge,
D. Paterson and M. Gracey. 1984. Biotyping and virulence
factors in clinical and environmental isolates of Aeromonas
species. Appl.Environ. Microbiol. 47:1146-1149.
14. Byers B.R., P.E. Liles, P.E. Byerrs and J.E.L. Atceneaux
1986. A new siderophore in Aeromonas hydrophila; Possible relationship to virulence. Advanced Research Workshop on Iron, Siderophores and Plant Dsiseases Wye, Kent
(U.K). 117: 227-232.
15. Carnahan A.M., S.Behram and S. W. E. Joseph. 1991.
Aerokey II; a flexible key for identifying clinical Aeromonas
species. J. Clin.Microbiol. 29: 2843-2849.
16. Cashill M.M. 1990. Virulence factors in motile Aeromonas
species. J.Appl. Microbiol. 69: 1-16.
17. Centre de l'Enseignement de l'Institut Pasteur de Paris.
2000. Milieux de culture et techniques. Cours de Bacteriologie Medicale.
18. Chacon M.R., M.J. Figueras, G.Castro-Escarpulli, L. Soler
and J. Guarro 2003. Distribution of virulence genes in
clinical and environmental isolates of Aeromonas spp.
Antoine van Loewenhoeck 84:269-278.
19. Chaudhury A., G. Nath, B. N. Shukla and S. C. Sanyal.
1996. Biochemical characterization, enteropathogenicity and
antimicrobial resistance plasmids of clinical and environmental Aeromonas isolates. J. Med. Microbiol. 44: 434-437
20. Chean M. R., M. K. Figueras, G. Castro-Escarpulli, L. Soler
and J. Guerro 2003. Distribution of virulence genes in clinical and environmental isolates of Aeromonas spp. Antonie
van Leeuwnehoek. 84: 269-278.
21. Cheng N.C., S. Y. Horng, S.C. CHANG and TANG Y.B.
2004. Nosocomial infection of Aeromonas hydrophila presenting as necrotizing fasciitis. J.Formos.Med.Assoc.103:
53-57.
22. Chou S. Y., C. C. Tsai, S. C. Kau, H.C. KAU and W.M. HSU.
2004. Aeromonas hydrophila orbital cellulitis in a patient with
myelodysplastic syndrome. J. Clin. Med.Asoc. 67: 51-53.
23. CLSI. 2006. M2-A9-Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard-Ninth
Edition
24. Cravioto A., R.J. Gross, S.M. Scotland and B. Rowe. 1979.
An adhesive factor found in strains of Escherichia coli belonging to the traditional infantile enteropathogenic serotypes. Curr Microbiol 3: 95-99
25. Figueras M.J., L. Soler, M.R. Chacon, J. Guarro, and A.J.
Martinez-Murcia. 2000. Extended method for discrimination of Aeromonas spp.by 16S rDNA RFLP analysis.
Internat.J.Syst.Evol. Microbiol. 50: 2069-2073.
26. Figueras M. J., A. Suarez-Franquet, M. R. Chacon, L.
Soler, M. Navarro, C. Alejandre, B. Grasa, A. J. MartinezMurcia, and J. Guarro. 2005. First record of the rare
species Aeromonas culicicola from drinking water supply.
Appl. Environ. Microbiol. 71: 538-541.
27. Fosse T., C. Giraud-Morin, and I. Madinier. 2003.
Phenotypes of beta-lactam resistance in the genus
Aeromonas. Pathol. Biol.(Paris). 51: 290-296.
28. Garcia Moreno M.L., and M. Landgraf. 1998. Virulence
factors and pathogenicity of Vibrio vulnificus strains isolated from seafood. J. Appl. Microbiol. 84:747-751.
29. Gracey M., V. Burke, and J. Robinson. 1982. Aeromonas
-associated gastroenteritis Lancet. ii: 1304-1306.
30. Haque Q. M., A. Sugiyama, Y. Iwade ,Y. Midorikawa,
H.Yoshimura, U. Kawasar, T. Shimada, and T.Yamauchi.
1996. Characterization of Aeromonas hydrophila: a comparative study of strains isolated from diarrhoeal faeces and
the environment. Southeast Asian J. Trop. Med. Publ. Hlth.
27: 132-138.
31. Israil A., C. Balotescu, N. Bucurenci, N. Nacescu, Cl Cedru,
C. Popa, and C. Ciufecu. 2003. Factors associated with virulence and survival in environmental and clinical isolates of
Vibrio cholerae 01 and non 01 in Romania. Rom. Arch.
Microbiol. Immunol. 62: 155-177
32. Jarlier V., M.H. Nicolas, G. Fournier, A. Philippon. 1988.
Extended broad-spectrum beta-lactamases conferring transferable resistance to newer beta-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Reviews of Infectious Diseases. 10 (4): 867-878.
33. Jarlier V., M.H. Nicolas, A. Philippon, A.M. Giroir, J. Grosset. 1989. In-vitro activity of FCE 22101 and other betalactam antibiotics against Enterobacteriaceae resistant to
third generation cephalosporins. Journal of Antimicrobial
Chemotherapy. 1989, 24 (2):165-172.
34. Lenette E. H., A. Balows, W. Haussler Jr., and J.P. Truant.
1980. Manual of Clinical Microbiology 3rd Ed. ASM
Washington D.C., 220-225.
35. Llopis F., I. Grau, F.Tubau, M. Cisnal, and R. Pattares.
2004. Epidemiological and clinical characteristics of bacteremia caused by Aeromonas spp. as compared with Escherichia coli and Pseudomonas aeruginosa. Scand
J.Infect.Dis. 36: 335-341.
36. Lupiola Gomez P.A., Z. Gonzales-Lama, M.T. TejedorJunco M., M. Gonzales-Martin and J.L. Martin-Barrasa.
2003. Group 1 beta-lactamases of Aeromonas caviae and
their resistance to beta-lactam antibiotics. Can. J. Microbiol. 49: 207-215.
37. Macrina F.L., D.J. Kopecko, K.R. Jones, D.J. Ayers, S.M.
McCowen 1978. A multiple plasmid-containing Escherichia coli strain: convenient source of size reference plasmid molecules. Plasmid. 1 (3): 417-420
38. Maluping R.P., C.R. Lavilla-Pitogo, A. De Paola, J.M.

Janda, and K.Krovacek. 2004. Occurrence, characterization and detection of potential virulence determinants of
emerging aquatic bacterial pathogens from the Philippines
and Thailand. New. Microbiol. 27: 381-389
39. Mateos D., J. Anguita, G. Naharro and C. Paniagua.
1993. Influence of growth temperature on the production
of extracellular virulence factors and pathogenicity of environmental and human strains of Aeromonas hydrophila.
J.Appl.Bacteriol. 74:11-118.
40. Megraud F. 1986. Incidence and virulence of Aeromonas
species in faecies of children with diarrhea. Eur. J. Clin.
Microbiol. 5:311-316.
41. Mukopadhyay C., Bhargava A., and A. Ayyagari. 2003.
Aeromonas hydrophila and aspiration pneumonia; a
diverse presentation. Yousei Med. J. 44: 1087-1090.
(Abstract).
42. Ouderkirk J.P., D. Bekhor, G.S. Turett, and R. Murali.
2004. Aeromonas meningitis complicating medicinal leech
therapy. 38: 36-37.
43. Park T.S., S.H. Oh, E.Y. Lee, T.K. Lee, K.H. Park, M.J.
Figueras, and C.L.Cheng. 2003. Misidentification of
Aeromonas veronii biovar sobria as Vibrio algynolyticus by
the Vitek system. Lett. Appl. Microbiol. 37:349-353.
44. Pinna A., L.A. Sechi, S. Zanetti, D.Usai, and F.Carta.
2004. Aeromonas caviae keratitis associated with contact
lens wear. Ophtalmology 111: 348-351.
45. Pavlov D., De Wet C. M., Grabow W.O., and Ehlers M.M.
2004. Potentialy pathogenic features of heterotrophic plate
count bacteria isolated from treated and untreated drinking
water. Int. J. Food. Microbiol. 1: 275-287.
46. Santour M., P. Mary, N.E. Chihib, and J.P. Hornez. 2003.
The effects of temperature activity and pH on the growth of
Aeromonas hydrophila and its subsequent survival in
microcosm water. J.Appl.Microbiol. 95:807-813.
47. Sen K., and M. Rodgers. 2004. Distribution of six virulence factors in Aeromonas species isolated from US drinking water utilities: a PCR identification. J. Appl. Microbiol.
97:1077-1086.
48. Severo N.A., D. Kallifidas, K. Smalla, J.D. Van Elsar, J. M.
Colard, A. D. Karagouni, and E. M. H. Wellington. 2002.
Occurrence and reservoir of antibiotic resistance genes in
the environment. Reviews Med. Microbiol. 13:15-27.
49. Tokajian S. and F. Hashwa. 2004. Phenotypic and genotypic identification of Aeromonas spp. isolated from a chlorinated intermittent water distribution system in Lebanon.
J.Water Health. 2 : 115-122.
50. Ullmann D., G. Krause, D. Knabner, H. Weber and L.
Beutin. 2005. Isolation and characterization of potentially
human pathogenic, cytotoxin-producing Aeromonas strains
from retailed seafood in Berlin, Germany. J.Vet.Med. B.
Infect. Dis.Vet. Public Health.: 82-87.
51. United States Environmental Protection Agency National
Exposure Research Laboratory. 2001: Occurrence of CCLRelated Pathogens in Source of Drinking Waters
52. Vivekanandhan G., Savithamani K. and P. Lakshmanaperumalsamy. 2003. Influence of ph, salt concentration
and temperature on the growth of Aeromonas hydrophila.
J. Environ. Biol.24: 373-379.
79
EPIDEMIOLOGICAL SURVEILLANCE OF SYPHILIS PATIENTS

IN COLENTINA HOSPITAL (BUCHAREST, ROMANIA)
Carmen Slvstru1,2, Alina Ruinoiu1, Alina Prvu1, Magdalena Constantin1,2, Mihaela Panduru1,
Gabriela Loredana Popa2,3 and G.S. iplica1,2
1
Second Clinic of Dermatology, Colentina Hospital Bucharest, 2Carol Davila University of Medicine and Pharmacy,
3Parasitology Clinic, Colentina Hospital Bucharest
ABSTRACT
Syphilis remains a global health problem with an estimated 12 million people infected each year. In Romania a
decrease in the syphilis prevalence can be observed. From 2002 (12,702 cases) and 2003 (9,698 cases) until 2006
(5,657 syphilis cases) the reduction can be explained through the intensified efforts of the Ministry of Pubic Health to
fight STI. The decrease is probably not related to an improvement of the general health status and not a consequence
of some epidemiological prevention and control measures but probably was done by the reorientation of the patients
to the general practitioners and to the private practice medical offices and to the lack of reporting of the cases.
In Colentina Hospital a similar abrupt decrease of new cases was registered from 2004 (259 cases) to 2006 (110 cases).
General problems related to syphilis cases recorded at Colentina Hospital included the patient presentation for consultation in the advanced stages of the disease, the socio-economic and educational factors, proxenetism and the sexual aggression of minors.
There is a need in strengthening of the public health component in the control and surveillance of HIV/AIDS and STI. This
may need changes in the legal framework to improve reporting and to target vulnerable groups in prevention activities.
Laboratory capacity needs to be increased in order to be able to properly diagnose STI and improve the control and
patient management. The reporting needs to be improved and simplified as for reporting protocol, reporting forms,
case definitions to be taken into account in the renewed STI surveillance.
Key words: Syphilis, Epidemiological survey
INTRODUCTION
Syphilis, a sexual transmitted infection (STI), causes
significant complications if untreated and facilitates the
transmission of HIV. Many women and men with syphilis
do not have symptoms, or have minimal symptoms and
do not realize that something is wrong. They may visit a
clinic for other reasons or not at all. Yet, identifying and
treating such patients prevent the development of complications for the individual patient and help reduce transmission in the community. [1, 2] In this era of evidencebased public health, the uses of data to inform, evaluate,
and modify interventions and other activities are critical
to best prevent syphilis. Surveillance data are a basic prerequisite for decision-making and for monitoring, evaluating and improving policies and services. Lack of such
data management systems may be a significant obstacle
for developing appropriate strategies and policies, and for
introducing efficient interventions for STI prevention,
treatment and control [1-3]. The World Health Organization (WHO) estimates that there are 12 million new
cases of infectious syphilis world-wide each year, the
majority of these occurring in South and Southeast Asia

(5.8 million) and sub-Saharan Africa (3.5 million). [4, 5]
Surveillance data in the WHO European Region are
scarce and inconsistent. Some countries do not report
even the basic surveillance data, while others report with
significant delays. The numbers of cases in Western
Europe are low. For example, in England, where there is
a good notification system, it is fairly certain that syphilis
has declined very substantially since the peak after the
Second World War (when 27,761 cases were recorded)
(see Table 1). [3] Cases of infectious syphilis did show an
increase in the 1960s and 1970s and began to fall in the
late 1980s and early 1990s. Most European countries,
particularly Scandinavian ones, have shown a similar
decline. Incidence rates for syphilis are now below 5 per
100 000 in nearly all western European countries. With
the existing data WHO estimated a decrease in syphilis
ratio in the areas with the highest incidence, meaning Est
Europe and Asia, but it is not certified that it is a real fact
or just some modifications in health services and also in
registration form for patients. [6-10] In the United States
*Correspondence: Clinica II Dermatologie, Spitalul Clinic Colentina, Soseaua Stefan cel Mare nr. 19-21, sector 2, Bucuresti, Romania.
Telefon 0040-318052587. E-mail romsocderm@yahoo.com
80
Epidemiological surveillance of syphilis patients in Colentina Hospital (Bucharest, Romania)
of America, according to the Center of Prevention and

Control of Sexual Transmitted Disease, the incidence
ratio for primary and secondary syphilis had begun to
decrease showing for the 90's and the year 2000 the
lower level ever registered. This situation is changing as
in the last six years as USA is experiencing an increase in
the morbidity due to Treponema pallidum infections. Between 2004 and 2005 the national ratio for syphilis increased with 11%, from 2,7 to 3 cases in 100.000 people.
Also USA is confronting with a high incidence of STI in
homosexual partners. Congenital syphilis ratio is in continuing decrease, which reflects a good influence of prenatal screening programs in USA and in Europe. [1, 3, 5]
In Romania data regarding STI are collected by dermato-venereologists and general practitioners. The
reports are grouped by districts through the supervising
physicians and the local epidemiologic service and are
transmitted to the Ministry of Public Health. Syphilis data
should be interpreted with caution. Case report data are
likely to underestimate the true burden of disease in
Romania, because of underreporting of diagnosed cases,
infected persons not accessing health care and persons
who are otherwise not screened. [11]
This article includes an overview of syphilis morbidity in Romania and details obtained from the analysis of
cases reported by Colentina Clinical Hospital. [12, 13]
MATERIAL AND METHODS
In Romania at the Ministry of Public Health, in a specialized Health Department's Statistic Center, are being
centralized the new cases of syphilis. These cases are epidemiologically investigated and declared on the bases of
an official coded form. At the end of every month and at
the end of every year the Center of Medical Statistics
processes the information's received from the networks
using the declaration forms. The epidemiologic service
reports monthly, trimestrialy, semestrialy and annually
the statistic situation in order to assess the morbidity
through syphilis at a national level. [11, 12]
RESULTS
In 2003 it was noticed a sudden decrease in the
number of the new cases of syphilis nation-wide (9,698
cases) after the peak registered in 2002 (12,702 cases).
Then from 2003 to 2006 it was observed a slight, linear,
decrease in the number of new cases, which is a positive
aspect considering the socio-economic problems that this
disease implicates. Thus, in 2006 there were reported 5,657
syphilis new cases. It is still preserved the predominance
of syphilis cases from the urban areas (3,244 cases) compared with the rural ones (2,413 cases). [11]
As far as Colentina Hospital is concerned it shows an
abrupt decrease of new cases from 2004 to 2006. This
decrease is probably not related to an improvement of the
general health status and a consequence of prevention
and control epidemiological measures but it could be
influenced by the reorientation of the patients to the general practitioners and to the private practice offices. Also,
comparing the number of the contact syphilis identified
(110 cases) with the ones declared (235 cases) (figure 1)
we can easily find out that more than a half of contact
syphilis are not identified and treated. That finding
explains our suspicion about the reality of statistical data
(figure 1, figure 2). It was noticed as an interesting information, that the sex ratio was modified and there are now
reported more women than males. In the last decade the
incidence of syphilis was greater in men but in 2004 the
situation has been reversed, so that in 2006, 57% of the
cases of syphilis were identified in women (figure 3). This
could have an explanation in the following known factors: prostitution, sexual tourism, unemployment and
financial independence of women. Regarding the marital
status we can conclude that the incidence of syphilis is
higher in those who live in concubinage (36%) compared
to 25% - married patients- and 22% -unmarried patients.
The distribution of the clinical aspects of syphilis
showed a certain feature for Romania:
- The number of cases with negative serology continued
to decrease;
Table 1 - Estimated prevalence and incidence of STI by region (5)
81
SLVSTRU et al.
- The patients are seeking for medical intervention in the

advanced stages of the disease, only, so the number of
cases addressing spontaneously to the doctor is lower
then the cases discovered through active methods;
- The serologic tests are still the most important methods
for screening;
- The incidence of the recent latent form of syphilis is
growing; from these cases a high percentage being
seroresistant.
In the Colentina Clinical Hospital in 2006 there
were registered 12 cases of primary syphilis, 18 cases of
secondary syphilis, 78 of recent latent form syphilis and
the rest presented the late latent form (figure 4). The distribution considering the age groups in Colentina Hospital
showed and gave the following information (figure 5):
- The highest incidence was between 25- 45 years old, an
interval expected to be so, because of the active sexual
period;
- The socio-economic and educational factors, the proxenetism, the sexual aggressing of minors determined the
growth of morbidity through syphilis at young ages;
- A high incidence was observed in patients over 55
years;
- The estimation for congenital syphilis at national level
couldn't be done because the cases are registered in the
neo-natology network; that there are both recommendations and forms for the registration of the cases, but
reports are not completed and is not possible to do the
statistical inference, ar national level.
The distribution according to the employment status
shows a higher incidence in patients without occupation,
aggravated by the increasing rate of unemployment; the
professions most incriminated were security-guard, driver, temporary workers etc.
The person who registered patients in Colentina
Hospital has performed a field investigation. This field
work brought in 2006 about 130 cases of syphilis. The
figure is 50% less than in 2005, when there were two
people working for obtaining these epidemiologic information. So, there is a clear need to have more personal
involved in such activity (figure 6).
DISCUSSIONS
The national strategy on HIV prevention and control
includes a section to strengthen and improve STI care and
treatment. STI are still considered to be a major public
health problem. A national strategy for prevention and
control of STD was issued in 2004. In the same year a
ministerial order was published including the diagnostic
and treatment guide of STIs management. Guidelines were
prepared by the national commission of dermato-venerology specialists.
Treatment and care is freely accessible through any
physician who refers a suspect STI case to the dermato-
82
venerology specialist for further investigation. Testing and

treatment are free for pregnant women; otherwise it is
covered by Health Insurance House. The dermato-venerology specialist communicates the case to the family
doctor (treatment) and reports monthly to the epidemiologist at the district Public Health Authority (PHA). At PHA
the contact tracing for syphilis (compulsory; with signed
list of sexual contacts) is done.
STI control is beneficial to the individual patient but
also at populational level: STI increase the risk for HIV
transmission. In addition, undetected STI and subsequent
long-term consequences of untreated STI in women and
congenital STI may cause the burden of disease and burden on health system. Therefore, STI care and surveillance need to be strengthened.
STI surveillance needs major improvements before
reliable data can be provided. STI reporting is incomplete
as self-treatment is prevalent, and cases are not diagnosed
properly and underreported. Reports of congenital
syphilis seem to be incomplete.
Laboratory capacity for STI is good in our hospital
but is poor and needs immediate improvement in other
facilities. Special training is needed and additional regional reference labs for STI (including Quality assurance
management) are needed to ensure national coverage.
The prophylaxis and control of syphilis depend on
the creation of an accessible network of diagnosis and
treatment, the identification and treatment of syphilis
patients and their contacts. The follow-up of patients is
very important because in this way it can be verified the
response to the treatment. Also, the promotion of educational measures represents a major instrument of prevention and early discovery of syphilis cases. So, we mention
the advantages of a safe sexual conduct, the individual
protection measures, and the importance of an early presentation to the doctor at the first signs of disease.
The sources were declared in 38% of cases but only
42% of them get to be discovered and treated. The known
contacts of infected patients in number of 235 were identified in 48% of cases. [13] From all cases with syphilis
only 38, 5% were identified by spontaneous presentation. This is a clear evidence of the low degree of sanitary
education in this category of patients. [11, 12]
The Ministry of Public Health reported 40 cases of
congenital syphilis in newborn (who were correctly treated)
and also there were 50,000 pregnant women registered
in 2006 for testing syphilis serology and 2,000 of them
has been discovered positive and has been treated. [11]
Benzathine benzyl penicillin G (BBP) has been used
for several decades both in early syphilis (one 2.4 million
unit intramuscular injection) and in late syphilis (three
weekly doses) with a high rate of success. BBP remains
very active after many years of use, is easy to administer,
there are no problem with compliance, and has a very
Epidemiological surveillance of syphilis patients in Colentina Hospital (Bucharest, Romania)
Figure 1. Statistic data in Colentina Hospital - syphilis

contacts in 2005 and 2006
Figure 2. Incidence in syphlis

in Colentina Hospital 2002-2006
Figure 3. Statistic data in Colentina Hospital sex distribution 2006
Figure 4. Statistic data in Colentina Hospital serology in patients 2006
Figure 5. Syphilis in Colentina

Hospital 2006 - years ratio
Figure 6. Statistic data in Colentina Hospital epidemiologic search of sources in 2005 and 2006
low cost. Severe anaphylaxis is rare (1/100.000 doses)

and desensitization is possible in patients with a history
of penicillin allergy. Oral beta-lactamine antibiotics and
third generation cephalosporin's compare unfavorably to
BBP in terms of costs, compliance, and administration.
Azithromycin also has been studied for unique administration (2g single oral dose) but The International Union
against Sexually Transmitted Infections (IUSTI) and the

U.S. Center for Disease Control and Prevention (CDC) did
not recommended it because of the exponential appearance of resistance to macrolides (up to 90% of other bacteria in some settings). So, penicillin remains the best
treatment in syphilis with the hope that penicillin resistance will not appear soon. [14, 15]
83
SLVSTRU et al.
CONCLUSIONS
BIBLIOGRAPHY
Basic epidemiological data on sexually transmitted

infections (STI) is routinely collected in Colentina Clinical
Hospital in Epidemiologic Center the main focus being
on syphilis cases. There is an urgent need for more comprehensive, detailed and timely data collection, analysis
and distribution.
There is a need in strengthening of the public health
component in the control and surveillance of HIV/AIDS
and STI. This may need changes in the legal framework to
improve reporting and to target vulnerable groups in prevention activities.
Even there is not the main role of our hospital and
clinic, it is to underline the need to integrate antenatal
care, PMTCT and prevention of congenital syphilis, to
improve the coverage of antenatal care, to reduce percentage of pregnant women not attending antenatal care
in first and third trimester, to strengthen the screening programs for pregnant women (reducing the percentage of
non-tested pregnant women for HIV and syphilis) and to
evaluate the screening programmes for HIV and syphilis.
Laboratory capacity needs to be increased in order
to be able to properly diagnose STI and improve the control and patient management. The reporting needs to be
improved and simplified as for reporting protocol, reporting forms, case definitions to be taken into account in the
renewed STI surveillance.
The analyse of cases with syphilis that have been
hospitalized in Colentina Hospital in 2006 compared with
2005 showed an abrupt decrease that doesn't seem to
have a real correspondent (numerous patients have not
been declared). It is needed to sustain the epidemiologic
activity and to maintain a good relation between sanitary
personal and the public health system leaded by the Public Health Authority within the Romanian Ministry of
Public Health.
1. Department of Health and Human Services - Center

for Disease Control and Prevention, USA, Syphilis Surveillance Project Annual Report 2006; www.cdc.gov
2. World Health Organization, WHO Regional Office for
Europe, Ten things to know about health in the ten
new
European
Union
members,
2004,
www.euro.who.int/mediacentre/pr/2004/20040514_1
3. Department of Health and Human Services - Center
for Disease Control and Prevention, USA, Recommendations for Public Health Surveillance of Syphilis in
the United States; 2006, www.cdc.gov
4. World Health Organization, Sexually transmitted and
other reproductive tract infections, 2005
5. World Health Organization, The Global elimination of
congenital syphilis: rationale and strategy for action, 2006
6. World Health Organization, WHO Regional Office for
Europe, Integrated Approach to the Prevention and
Treatment of Sexually Transmitted Infections, 1999
7. Adler MW, 2000, Epidemiology of sexually transmitted infections and human immunodeficiency virus in
Europe, Journal of the European Academy of Dermatology & Venereology, 5, 370-377
8. Fleming DT, Wasserheit JN, 1999, From epidemiological synergy to public health policy and practice; the
contribution of other sexually transmitted diseases to
sexual transmission of HIV infection, Sex. Transm.
Infect., 75, 3-17
9. Davis R, Mortimer F, Harman K, 2006, Syphilis: no
longer a historical disease, Clinical & Experimental
Dermatology, 6, 835-836
10. Meheus A, 1993, Epidmiologie des maladies sexuellement trans-missibles en Europe, Acta Urol. Belg., Univ.
Anvers dep. pidmiologie sant communautaire, 1-2,
61-69
11. Epidemiology Committee of Romanian Health Minister, Programs, subprograms and health interventions
financed by the state, administrate by the Health Minister, objectives and afferent activities, physics indicators of efficiency and results, 2006
12. Epidemiologic Centre in Colentina Clinical Hospital Data file 2002-2006 (unpublished data)
13. Diaconu JD, Benea V, 1999, Aspecte ale morbidiii n
bolile majore prin transmitere sexual n 1998 n
comparaie cu 1996, 1997, n Romania, Dermato-venerologia, XL, 78-82
14. Guide for Diagnostic and Treatment of Sexual Transmitted Diseases recommended by the Health Ministry in 2004, 2004
15. Catchpole MA, 1996, The role of epidemiology and
surveillance systems in the control of sexually transmitted diseases, Communicable Disease Surveillance
Centre, London, UK, Genitourin. Med., 72, 321-9
84
A LABORATORY-BASED SURVEY
OF CAMPYLOBACTER INFECTIONS IN PRAHOVA COUNTY
Marilena Sorokin1, Codrua-Romania Usein2, Mariana Irimia1 and Maria Damian2
1
Laboratory of Microbiology, Public Health Authority, Prahova, Romania

National Institute of Research-Development for Microbiology and Immunology Cantacuzino, Bucharest, Romania
ABSTRACT
In developing countries, as well as in many western countries, members of the genus Campylobacter are
recognized as one of the most common cause of acute bacterial enteritis. Campylobacter jejuni and
Campylobacter coli isolation rates have been shown to be equal to, and sometimes higher than those of
other enteric pathogens. The Microbiology Laboratory of the local Public Health Authority in Prahova
County conducted a one and a half-year laboratory-based survey of Campylobacter infections in patients
suffering from gastrointestinal symptoms. From a total of 3284 stool samples screened, the culture-positive ones confirmed the bacterial etiology for 551 diarrhea cases. Campylobacter was found in 345 specimens, being the most frequently isolated enteropathogen. C. jejuni outnumbered C. coli species (239 vs.
106 isolates). Salmonella isolates were the second local cause of diarrhea. The highest isolation rate of
Campylobacter was found in children 5 years of age (262 strains). The prevalence of campylobacteriosis declined with age. The isolation rate of Campylobacter (10,5%), the unimodal age-specific distribution of cases, as well as the identification of polymicrobial infections among the screened population
were epidemiological aspects resembling reports on campylobacteriosis in developing countries. The susceptibility of Campylobacter isolates to various antimicrobial agents, including macrolides and fluoroquinolones was also assessed. Among the screened isolates, Erythromycin retained a good activity, while
an increased ciprofloxacin resistance was observed. The information gathered through this local study
sustains the importance of Campylobacter in the etiology of autochthonous infectious diarrhea. A development of a national surveillance program regarding the most important foodborne pathogens would be
beneficial for improving prevention and controlling measures.
Key words: Campylobacter, bacterial gastroenteritis, antibiotic susceptibility
INTRODUCTION
Campylobacter was recognized as a human
pathogen in 1970s [1,2]. Campylobacteriosis is the
collective designation of the infections caused by the
members of Campylobacter genus, zoonotic diseases
reported all over the world. The only form of campylobacteriosis of major public health importance is the
gastroenteritis caused by Campylobacter jejuni and
Campylobacter coli. C. jejuni, which exceeds in
prevalence all the other Campylobacter species, have
been found in virtually every country where investigations have been carried out, causing a clinical spectrum of Campylobacter enteritis that ranges from mild,
self-limiting watery diarrhea, to severe inflammatory
bloody diarrhea with abdominal pain and fever. The
clinical complications of Campylobacter infection
include toxic megacolon, hemolytic uremic syndrome,
Reiter's syndrome, and Guillain Barr syndrome, the
most common cause of acute neuromuscular paralysis
in the industrialized world [3].
The Foodborne Diseases Active Surveillance

Network (FoodNet) of CDC's Emerging Infections
Program collects data from 10 U.S. states regarding
diseases caused by enteric pathogens transmitted commonly through food. In 2005, from 16,614 laboratoryconfirmed cases of infections in FoodNet surveillance
areas, 5,655 were cases of campylobacteriosis [4].
In the United Kingdom (UK), laboratory reports of
Campylobacter spp. infections have revealed in 1999
more than 60,000 cases. However, their true population burden was considered much higher [5]. For every
laboratory-confirmed case reported to the national surveillance in England, an additional eight cases might
have been unrecognized. This estimate suggests that in
1999, approximately half a million people in the UK
became ill with Campylobacter enteritis.
Taking into account that several reports have indicated that clinical isolation of campylobacters in some
developed is equal to, and sometimes higher than
those of other enteric pathogens, such as Salmonella
spp. and Shigella spp., during year 2001 a European
85
SOROKIN et al.
study on Campylobacter surveillance and diagnosis

was conducted in 18 countries. Its results indicated that
a basic infrastructure for wide European Campylobacter
surveillance [6]. However, the surveillance of these
organisms does not have the same availability and support in developed and developing countries, which
may significantly influence the data regarding their
true public health impact. Romanian data regarding
campylobacteriosis are scarce and there is not an institutionalized surveillance system. With Romania being
included among the EU members, the harmonization
of the various national healthcare strategies with the
global healthcare politics is mandatory.
The aim of this study was to obtain information
regarding the real incidence of Campylobacter infections among the autochthonous population, thus trying
to fill the gaps in knowledge about the epidemiology
of campylobacteriosis in Romania. A first survey was
set up in Prahova district, being conducted by the Microbiology Laboratory of the local Public Health Authority from January 2005 through July 2006. The results of the microbiological investigation are presented,
thus providing evidence for its public health importance, and eventually considering the needs for national surveillance programs.
Fecal specimens
A total of 3284 stool samples from adults and children with gastrointestinal symptoms were analyzed
between 4th of January 2005 and 30th of June 2006
(Tabel 1). All the diarrhea cases were considered of domestic origin and the fecal samples were submitted to
the public health laboratory from Hospital of Infectious
Diseases, Pediatric Hospital Pediatric Polyclinic, and
general practitioners.
Isolation procedure
Cultivation was usually carried out within a day
after the sample had been taken and transported in
Cary Blair medium. All fecal specimens were cultivated for thermophilic campylobacters (C. jejuni and C.
coli), Salmonella spp., Shigella spp., Yersinia enterocolitica, and Enteropathogenic E. coli (EPEC). The
presence of campylobacters was evaluated by using
antibiotic-containing selective media Campylosel
blood agar (BioMerieux) and Karmali agar (Oxoid).
Plates were incubated for 48 hours at 42 C in a
microaerophilic atmosphere produced by a gas-generating system suitable for Campylobacter.
Identification
The adopted approach for the identification of C.
jejuni and C. coli was based on classical phenotypic
characteristics, including: colony morphology, Gram
stain morphology, oxidase and catalase reactions, sus86
ceptibility to Cephalothin, and hippurate hydrolysis. In

addition, a commercially available identification system for Campylobacter (API Biomerieux) was used for
some isolates.
Antimicrobial susceptibility
In vitro susceptibility testing was performed using
agar diffusion method, on Mueller-Hinton agar supplemented with 5% sheep blood, with Oxoid antibiotic
discs. The plates were incubated in microaerophilic
atmosphere at 37 oC. All the isolates were tested for
their susceptibility to ampicillin, ampicillin/clavulanic
acid, cephazolin, cephalothin, cephotaxime, erythromycin, tetracycline, chloramphenicol, nalidixic acid,
and ciprofloxacin. The interpretative criteria used were
those of the Antibiogram Committee of the French
Society of Microbiology.
RESULTS AND DISCUSSION
The incidence of human campylobacteriosis has
markedly increased in many countries in the last decade, revealing that Campylobacter species C. jejuni
and C. coli have become the most important causative
agents of acute diarrhea in the industrialized world.
Campylobacter is a zoonotic agent, which may cause
sporadic infections or common source outbreaks. It is
a predominant human food borne pathogen [7,8],
which can be overlooked during routine laboratory
diagnosis due to its fastidious growth characteristics,
requiring reduced oxygen levels, and optimal growth
temperatures of 42 C [9]. The development in Campylobacter isolation techniques resulted in its enhanced
detection, thus improving the diagnosis of human infectious diarrhea. Epidemiological studies have provided important information on the sources of human
infections, but there are still epidemiological aspects of
this pathology that remain to be fully clarified.
During one year and a half, the Microbiology Laboratory of the Public Health Authority from Prahova
analyzed 3284 stool samples from 1592 women and
1692 men with gastrointestinal symptoms and confirmed 551 cases of bacterial diarrhea (Table 2). The
recovery of Campylobacters from over half (60.8%) of
the positive stool cultures revealed its high prevalence
among the enteric pathogens. Campylobacter isolates
were present in 10.5% (345 subjects) of the analyzed
local population with diarrhea symptoms. Sixteen patients had polymicrobial infections. These epidemiological features are similar to those registered in
developing countries [10].
Taking into account the comparable number of
men and women included in the study, the analysis by
sex showed no significant difference between the prevalence of campylobacterios is among males and females (193 males vs. 152 females).
A laboratory-based survey of Campylobacter infections in Prahova County

Tabel 1. Epidemiological information regarding the origin of the tested stool isolates recorded by the laboratory
Table 2. Enteric pathogens identified in stools of diarrheic subjects
Tabel 3. Distribution of Campylobacter infections according to the patient's age
On the contrary, Campylobacter-associated diarrhea was significantly associated with urban cases: 227
urban patients vs. 118 rural cases. We cannot explain
this observation by a better medical addressability of
individuals living in the city, and thus the over sampling of this population because in this study, from the
total of 3284 patients with clinical symptoms of diarrhea subjected to the microbiological diagnosis, 1877
subjects formed the urban lot, and the rural lot consisted of 1407 subjects. Maybe, our results reflect the
impact of different food consumption practices [11],
with the tendency to consume more undercooked
chicken meat among the urban population, thus a
higher risk of contamination with Campylobacter.
Analysis by age showed that Campylobacter was
encountered in patients of all ages, ranging from a few
months to more than 80 years (Table 3). The rate of the

infection significantly declined with age. The highest
isolation rate was found in children 5 years of age
(262 strains), with almost half of the isolates (127 strains)
originating in infants less than 1 year of age. The unimodal age distribution of the infection found in our
study is characteristic to developing countries [10]. It
was reported that in these countries Campylobacter is
the most commonly isolated bacterial pathogen from
2-year-old children with diarrhea, poor hygiene and
sanitation and the close proximity to animals contributing to the acquisition of any enteric pathogen,
including Campylobacter. We cannot speculate on our
findings regarding the high prevalence of Campylobacter-induced diarrhea among young children, but we
must point out that, within this laboratory surveillance,
87
SOROKIN et al.
Tabel 4. C. jejuni and C. coli resistance to antimicrobial agents
more than half of the sampled children (1075 cases)

were hospitalized. This fact may suggest the severity of
their symptoms, but may also be partly due to the
greater attention given by both parents and medical
stuff to small children presenting with diarrhea, a disease that easily may lead to dehydration. When
recording the age of all patients submitting faecal specimens, higher sampling rates for infants <5 years of
age were seen (1884 stool samples). This fact could
account for the greater number of children included in
this study, that might have contributed to the higher
isolation rate of Campylobacter in children compared
to adults (806 sampled adults). The symptomatic infections observed among the studied population are in
concordance with the clinical aspects characteristic for
developed countries, whereas in developing countries,
where the Campylobacter infections are hyperendemic, asymptomatic infections commonly occur in both
children and adults.
The hippurate hydrolysis test differentiated almost
70% of the Campylobacter isolates as C. jejuni (239
strains), and the rest as C. coli (106 strains). The found
distribution of Campylobacter species is similar to
observations in most developed countries, where the
isolation rate of C. jejuni exceeds that of C. coli.
From the epidemiological point of view, the majority of patients with Campylobacter-caused diarrhea
(328 subjects) were sporadic cases. Only 17 strains
were documented as originating from three household
outbreaks. This is not surprising, knowing that most
Campylobacter infections are sporadic, which makes
the search for the source of infection difficult.
However, in time, case-control studies have provided
important information on the sources of human infections [12,13]. Western European countries have identified poultry (especially the consumption of undercooked chicken) as a risk factor for sporadic infections.
Additional identified risk factors included contact with
pet animals, contaminated drinking water, milk, swimming in recreational waters, occupational exposure to
88
animals, traveling [14]. Unfortunately, in our study the

laboratory confirmation of the disease was not accompanied by a thorough epidemiological investigation,
thus the sources of the infections and the routes of
transmission were not reported.
Much has been written in recent years about
increasing problem of clinically important bacteria that
have developed resistance to a wide range of antibacterial agents [15]. Several reports have dealt with the
susceptibility of C. jejuni and C. coli to antimicrobial
agents, even though most often, Campylobacter
species cause a self-limiting diarrhea illness, and
patients do not usually require antimicrobial treatment. Antibiotics may be prescribed for patients with
severe and prolonged gastroenteritis, suspected septicemia, or other invasive manifestations, as well as for
patients who have a severe underlying illness. Drugs
of choice typically include a fluoroquinolone for early
empirical treatment in adults, and a macrolide for
treatment after the microbiological diagnosis has been
established.
In recent years, fluoroquinolone and macrolide
resistance has emerged, and many countries have
reported an increasing isolation rate of Campylobacter
resistant strains. This study also aimed to determine the
antimicrobial resistance of C. jejuni and C. coli isolates
(Table 4). Our results are in general agreement with
other reports. While chloramphenicol was active on
all Campylobacter tested strains, cefazolin was completely inactive on them. The great majority of isolates
were susceptible to amoxicillin/ clavulanic acid, and
cephotaxim. Susceptibility to ampicillin, and tetracycline was seen in more than half of the isolates, but
these antibiotics were less active than the previous
ones. As for the susceptibility to erythromycin, this
was seen in the majority of C. jejuni and C. coli isolates, with a slight increase among the former species.
The erythromycin good activity against Campylobacter
in our study is in concordance with the optimistic
observation resulting from other investigations that
A laboratory-based survey of Campylobacter infections in Prahova County
macrolide resistance in general, and C. jejuni in particular, has so far remained relatively uncommon [16].
On the contrary, more than half of the both C. jejuni and C. coli isolates were resistant to nalidixic acid.
A worrying rate of microbial resistance was also
observed for fluoroquinolone ciprofloxacin. Within
this study, only 51% of C. jejuni were susceptible to
the fluoroquinolone, and the drug was active on less
than half (47%) of tested C. coli isolates. The reason for
this tendency is not well known. A possible explanation could be the increasing use of fluoroquinolone in
both humans and animals. It is of interest that in our
study 75% of the Campylobacter strains were isolated
from children < 5 years of age, and quinolone are not
recommended for use in the pediatric population.
Unfortunately, there is no official information regarding the use of quinolones in food animals in Romania.
A remarkable increase in the prevalence of
Campylobacter fluoroquinolone resistant human
strains was noted in other previous European studies.
Spain, for example, seems to be deeply touched by
this epidemiological aspect of infection [17]. High
rates of ciprofloxacin resistance of Campylobacter
were also seen in Germany, which made the status of
ciprofloxacin as a first-choice drug in the treatment
questionable [18].
Active laboratory-confirmed disease surveillance
and epidemiological studies are needed to identify the
risk factors and evaluate prevention and control measures aimed at reducing the burden of autochthonous
diarrhea illness in general, and Campylobacter diarrhea in particular. A very important step towards this
goal might be a national health care strategy that
includes a program regarding the prevalence of various foodborne pathogens among our population. The
gathered information might also be very important for
our integration into the European infectious diseases
surveillance system.
ACKNOWLEDGEMENTS
The authors are deeply grateful for the highly competent guidance of Dr. Stefan Lucinescu, who made
this local study possible, and gave a personal example
of professionalism and commitment.
REFERENCES
1. Dekeyser P., Gossuin-Detrain M., Butzler J.P., Sternon J.
Acute enteritis due to related vibrios: first positive stool cultures. J. Infect. Dis. 125: 390-392, 1972.
2. Butzler J.P., Dekeyser P., Detrain M., Dehaen F. Related
vibrio in stools. J. Pediatr. 82: 493-495, 1973.
3. Nachamkin I., Allos B.M., Ho T. Campylobacter Species
and Guillain-Barr. Syndrome. Clin. Microbiol. Rev. 11:
555-567, 1998.
4. Centers for Disease Control and Prevention. Preliminary
FoodNet Data on the Incidence of Infection with Pathogens
Transmitted Commonly Through Food in 10 States, United
States, 2005. MMWR 55: 392-395, 2006.
5. Wheeler JG, Sethi D, Cowden JM, Wall PG, Rodrigues LC,
Tompkins DS, et al. Study of infectious intestinal disease in
England: rates in the community, presenting to general
practice, and reported to national surveillance. BMJ 318:
1046-50, 1999.
6. Takkinen J., Ammon A., Robstad T., Breuer T and the Campylobacter Working Group. European Survey on Campylobacter surveillance and diagnosis 2001. Eurosurveillance 8: 207-213, 2003.
7. Altekruse S.F., Stern N.J., Fields P.I., Swerdlow D.
Campylobacter jejuni - An emerging foodborne pathogen.
Emerg Infect Dis 5:28-35, 1999.
8. Tam C.C., O'Brien S.J., Adak G.K., Meakins S.M., Frost J.A.
Campylobacter coli - an important foodborne pathogen. J
Infect 47:28-32, 2003.
9. McClurg K.R., McClurg R.B., Mooore J.E., Dooley J.S.G.
Efficient isolation of campylobacters from stools: what are
we missing? J. Clin. Pathol. 55: 239-240, 2002.
10. Coker A.O., Isokpehi R.D., Thomas B.N., Amisu K.O., Obi
C.L. Human campylobacteriosis in developing countries.
Emerg. Infect. Dis 8: 237-243, 2002.
11. Allos B.M. Campylobacter jejuni infections: update on emerging issues and trends. Clin. Infect. Dis. 32: 1201-1206, 2001.
12. Harris NV, Weiss NS, Nolan CM. The role of poultry and
meats in the etiology of Campylobacter jejuni/coli enteritis.
Am. J. Public Health 76: 407-10, 1986.
13. Gillespie I.A., O'Brien S.J. , Frost J.A., Adak G.K., Horby
P.,Swan A.V., Painter M.J., Keith R. Neal K.R. and the
Campylobacter Sentinel Surveillance Scheme Collaborators. A Case-Case Comparison of Campylobacter coli and
Campylobacter jejuni Infection: A Tool for Generating
Hypotheses. Emerg. Infect. Dis. 8: 937-942, 2002.
14. Butzler J.P. Campylobacter, from obscurity to celebrity.
Clin. Microbiol. Infect. 10: 868-876, 2004.
15. Engberg, J., Aarestrup F.M., Taylor D.E., P. Gerner-Smidt P.,
Nachamkin I. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: resistance mechanisms and
trends in human isolates. Emerg. Infect. Dis. 7:24-34, 2001.
16. Engberg J. Contributions to the epidemiology of Campylobacter infections. Danish Med. Bull. 53: 361-389, 2006.
17. Sanchez R., Fernandez-Baca V., Diaz M.D., Munoz P.,
Rodriguez-Creixems M., Bouza E. Evolution of susceptibilities of Campylobacter spp. to quinolones and macrolides.
Antimicrob. Agents Chemother. 38: 1879-1882, 1994.
18. Jutta Wagner J., Jabbusch,M., Martin Eisenblatter M., Hahn
H.,Wendt C., Ralf Ignatius R. Susceptibilities of Campylobacter jejuni Isolates from Germany to Ciprofloxacin, Moxifloxacin, Erythromycin, Clindamycin, and Tetracycline.
Antimicrob. Agents Chemoter. 47: 2358-2361, 2003.
89
FUNGAL CONTROL OF PATHOGENIC FUNGI ISOLATED

FROM WILD PLANTS IN TAIF GOVERNORATE, SAUDIA ARABIA
Abou-Zeid A.M.*, Altalhi, A. D. and Abd El-Fattah, R.I
Biology department, Faculty of Science, Taif University, Saudi Arabia. P.B. (888)
ABSTRACT
Twenty two plants were collected from Taif Governorate and identified as: Euphorbia glomerifera,
Juniperus procera, Launaea mucronata, Capparis dcidua, Punica granatum, Opuntia ficus, Prunus persica, Eucalyptus globulus, Medicago sativa, Artemisia monosperma, Trichodesma calathiforme, Artemisia
judaica, Foeniculum vulgare, Phagnalon sinaicum, Rumex dentatus, Asphodelus aestives, Pulicaria
crispa, Launae sonchoides, Forsskaolea tenacissima, Arnebia hispidissima, Avena spp and Aerva lanata.
Pathogenic fungi were isolated from some of these plants and identified as Alternaria alternate,
Ulocladium botrytis, Cladosporium spp, Cephalosporium spp, Penicillium chrysogenum, Fusarium oxysporum and Humicola grisea. Four antagonistic isolates were tested, 2 from Gliocladium fungus and 2
from Trichoderma fungus. We found that all the four antagonistic isolates (G. deliquescens , G. virens, T.
viride and T. hamatum) significantly inhibited the radial growth of the pathogenic fungi tested, with different ratios. The results indicated that the antibiotics produced by the antagonists were more effective
than the fungus itself and differ with different fungi. Coating plant stems with antagonists or with antagonist extracts reduce the severity of the disease but not prevent it in all tested pathogens.
Key words: Pathogen, antagonist, antibiotic
INTRODUCTION
Plant diseases play a direct role in the destruction
of natural resources in agriculture. In particular, pathogens cause important losses, fungi being the most
aggressive. Chemical compounds have been used to
control plant diseases (chemical control), but abuse in
their employment has favored the development of
pathogens resistant to fungicides (Tjamos et al. 1992).
By contrast, the use of microorganisms that antagonize
plant pathogens (biological control) is risk-free when it
results in enhancement of resident antagonists (Monte,
2001). Biological control of fungal plant pathogens
appears as an attractive and realistic approach, and
numerous microorganisms have been identified as biocontrol agents. A considerable role in limiting the populations of these pathogenic fungi inhabiting the
aboveground parts of plants is played by antagonistic
microorganisms. Such properties are first of all exposed by the fungi Trichoderma and Gliocladium ( Aluko
& Hering 1970; Well et al. 1972; Howell 1982;
Lifshitz et al. 1986; Chet 1987; Lumsden et al. 1992;
Zhang et al. 1996; Elad & Kapat 1999; Yedidia et al.
1999; Gupta et al. 1999; Harman, 2000; Ahmed et al.
2000; Hag and Khan 2000; Kredics et al. (2000);
*Corresponding author: E-mail: abouzeid_alaa@hotmail.com
90
Sharon et al. 2001; McQuilken et al. 2001; Roco &

Perez 2001; Patkowska 2003; Bartmanska & Dmochowska- Gladysz 2006; El-Katatny et al. 2006; Massart
& Jijakli 2007 and Sempere & Santamarina 2007).
Surveying and monitoring of some wild plants in
Al Taif area. Wild plants were collected from different
regions of Taif Governorate, and identified according
to Tackholm (1974); Boulos, and El-Hadidi, (1994)
and Boulos (2002).
Isolation and Identification of pathogenic fungi
from Taif plants
Pieces of plants that showed symptoms of the disease were submerged in 5% sodium hypochloride for
five minutes. After this treatment, they were extensively washed with sterile distilled water and placed on
Petri dishes containing potato-dextrose-agar (PDA,
Difco) amended with streptomycin sulphate (30
mg/liter) and rose bengal (3.3 ml of 1% (w/v)) to eliminate bacterial contamination and incubated at 25oC
for 72 hrs. according to Ismail and Aly (1997); Montealergre et al. (2003) and Abou-Zeid et al. 2004. The
Fungal control of pathogenic fungi isolated from wild plants in Taif Governorate, Saudia Arabia
isolated fungal strains were purified and identified,

according to Ellis (1976); Booth (1977); Alexopouls &
Mims (1979); Domsch, et al. (1980), Pitt (1988); Burgess et al. (1988) and Klich & Pitt (1988).
Antagonistic microorganisms
Tested fungal bioagents included 2 isolates belonging to Trichoderma spp. (T. viride and T. hamatum)
and 2 isolates belonging to Gliocladium spp. (G. virens
and G. deliquescens).
In vitro evaluation of the antagonistic potential of
the fungal bioagents tested:
Antagonistic reaction between the causal pathogens and the bioagents were studied in vitro. One agar
disc (4mm-diam.) with the active mycelium of the
bioagents was taken from advancing mat zone of a 3days-old culture grew on PDA medium and transferred
to one side of a Petri plate. The other side was inoculated with active mycelium plug taken from the outer
margin of a 3-days-old culture of the causal pathogens
( El-Kafrawy et al. 2002). This experiment was conducted in 3 replicates per each bioagent and plates
were incubated at 25+3 oC for 5 days. Plates containing only pathogen were used as a control. Inhibition
percentages of the pathogen were calculated just after
overlapping of the two tested fungi according to the
following equation:
Inhibition % = P-C/C
Since:
P= Mean diameter of the pathogen growth on the
nearby site of the fungus disk which faces the bioagente candidate.
C= Mean diameter growth of the pathogen control.
Production of diffusible antibiotics
PDA plates, covered with a cellophane membrane,
were inoculated in the center with 100 uL of a bioantagonistic fungal and bacterial suspension. After incubation for 72 hrs at 22 oC, the membrane with the
grown organism was removed, and the plate was inoculated in the middle with a 10-mm disk of a pure culture of the pathogen. Plate were further incubated at
22 oC for 48 hrs and the growth of the pathogen was
measured. Control were run as above replacing the
antagonisms by sterile distilled water (Montealegre et
al. 2003).
Control of pathogen by coating plant stems with
antagonists
The basal portions of plant stems were coated with
antagonists and the cuttings planted in sands infected
with the pathogen. Control was run as above replacing
the antagonisms by sterile distilled water and the percent of inhibition was calculated (Wu et al. 1986).
Control of pathogen by antagonist extracts

Plant cuttings were treated with extracts of the various antagonists before planting in sand beds infected
with pathogen. Control was run as above replacing the
antagonisms by sterile distilled water, and the percent
of inhibition was calculated (Jone et al. 1987).
RESULTS AND DISCUSSION
Many plants were collected and identified from
Taif Governorate and listed in Tables (1).
A general description of the vegetation of the
western Saudi Arabia has been given by VeseyFitzgeraid (1957) and recognized a number of vegetational and ecological types including littoral marshes,
coastal desert plain, coastal foothills, mountain ranges
and wadies. Batanouny (1979); Fayed & Zayad (1989);
Mahmoud & El-Tom (1985) and Montealegre et al.
(2000) described the vegetation of the Makkah-Taif
roads and recognized a number of vegetational and
ecological types mostly organized in zones. Referring
to the western provinces (Saudi Arabia) flora, Batanouny and Baeshin (1978 and 1982) gave lists of 135
species belonging to 108 genera and 43 families of
angiosperms along Jeddah-Makkah road.
The collected plants revealed that the presence of
Euphorbia glomerifera, Juniperus procera, Launaea
mucronata, Capparis dcidua, Punica granatum, Opuntia ficus, Prunus persica, Eucalyptus globules, Medicago sativa Artemisia judaica in Shaffa area. At South
road the following plants were collected Trichodesma
calathiforme, Artemisia judaica, Foeniculum vulgare,
Phagnalon sinaicum, Rumex dentatus, Asphodelus aestives, Pulicaria crispa, Launae sonchoides, Forsskaolea
tenacissima, Arnebia hispidissima, Avena spp, Aerva
lanata
Abd El-Fattah and Ali (2005) recoded twenty-three
vegetation groups in Taif area, seven groups dominated by Aerva lanata, Pergularia tomentosa, Arnebia hispidissima, Salsola spinescens, Capparis decidua,
Aizoon canariense and Blepharis ciliaris in the sand
plains, Calotropis procera, Dipterygium gluacum,
Bassia muricata, Haloxylon scoparium, Aerva gavanica, Anthemis melompodina and Coccinea grandis in
the valleys, Halothammus bottae, Anvillea gracinii,
Euryops arabicus, Dianthis strictus and Ecobolium
gymnostachyum in the slopes, and Capparis sinaica,
Maerua oblongifolia, Salsola kali and Centaurea
schimperi in the plateaus. The distribution of species
composition of each in specific ecologically defined
habitats would substantiate the fact that such community types are useful as indicators for their habitat characters (El-Shourbagy et al. 1987), even under adverse
conditions of disturbance agencies encountered in
91
ABOU-ZEID et al.
these habitats. In sand plains Pergularia tomentosa is

widespread, it dominates in cluster III and recorded in
four other communities of these habitats. Mossallam
and BaZaid (2000) showed that P. tomentosa is widespread in Taif and latex of its stem and leaves is irritant
to the skin and eyes and can cause inflammation and
pain, and if ingested can cause stomach cramps and
diarrhea. In medicine it is used as expectorant and
purgative.
However, some of the species have wide ecological and sociological ranges of distribution. These are
Aerva lanata, Salsola spinescens and Haloxylon scoparium. Where Calotropis procera, Dipterygium glaucum, Aerva juvanica, Anthemis melompodina and
Coccinea grandis are moderately distributed (Abd ElFattah and Ali 2005). In contrast, other species are confined to certain plant communities: Ehretia obtusifolia
associated with C. grandis community in valleys habitat and Dianthis strictus associated with C. schimperi
in plateaus habitat.
Pathogens:
Pathogenic fungi were identified as:
Alternaria alternate, the cause of spot disease.
Ulocladium botrytis, the cause of rot disease.
Cladosporium spp, the cause of leaf mold (leaf spot).
Cephalosporium spp, the cause of leaf strip (late wilt).
Penicillium chrysogenum, the cause of wilt disease.
Fusarium oxysporum, the cause of wilt disease.
Humicola grisea, the cause of wilt disease.
Frequency of pathogenic fungi:
From the results we can concluded that A. alternate
fungus was recorded in 5 plants (Prunus persica, Euphorbia glomerifera, Avena spp, Forsskaolea tenacissima and Launae sonchoides), so it is the most frequent
fungus. U. botrytis and A. alternate fungi were infected Forsskaolea tenacissima plant, while Prunus persica plant was infected by A. alternate and F. oxysporum fungi, while all the other tested plants were infected by one pathogenic fungus only.
Antagonistic effect of Gliocladium deliquescens
and Gliocladium virens against different pathogens:
The antagonistic potential of G. deliquescens and
G. virens against different pathogens was measured by
dual culture method using PDA medium. Data presented in Table (2 ) and Figures (1 & 2) show that G.
deliquescens and G. virens significantly inhibited the
radial growth of all pathogens tested, when compared
with the control. The antagonistic fungus sometimes
grew over mycelium of the pathogens. The maximum
inhibition for the G. deliquescens radial growth was
reported with Penicillium chrysogenum isolated from
92
Capparis dcidua which resulted in inhibition of

63.33%, followed by Ulocladium botrytis isolated from
Forsskaolea tenacissima with 62.12% inhibition. The
lowest inhibition percent of 29.75 was recorded by
Cephalosporium spp isolated from Launae sonchoides
(Table 2 and Figure 1).
The maximum inhibition for the G. virens radial
growth was reported with Penicillium chrysogenum
isolated from Capparis dcidua which resulted in inhibition of 65.6%, followed by Cephalosporium spp isolated from Pulicaria crispa with 59.44% inhibition.
The lowest inhibition percent of 16.67 was recorded
by Humicola grisa isolated from Artemisia monosperma
(Table 2 and Figure 2).
We can concluded that the inhibition effects of the
two Gliocladium strains were similar excepts for Humicola grisa isolated from Artemisia monosperma,
where the inhibition percent was 44.58 for G. deliquescens and 16.67 for G. virens respectively. Also the
Cephalosporium spp was inhibited with 29.75% by G.
deliquescens and with 59.44 % by G. virens (Table 2).
On the other hand the highest inhibition percent was
recorded with P. chrysogenum by the two Gliocladium strains.
Antagonistic effect of Trichoderma viride and Trichoderma hamatum against different pathogens:
The antagonistic potential of T. viride and T. hamatum against different pathogens was measured by dual
culture method using PDA medium. Data presented in
Table (3) and Figures (3 &4) show that T. viride and T.
hamatum significantly inhibited also the radial growth
of all pathogens tested, when compared with the control. The antagonistic fungus sometimes grew over
mycelium of the pathogens. The maximum inhibition
for the T. viride radial growth was reported with Alternaria alternata isolated from Forsskaolea tenacissima
which resulted in inhibition of 62.7%, followed by
Cephalosporium spp isolated from Launae sonchoides
with 60% inhibition. The lowest inhibition percent of
7.41 was recorded by Cladosporium spp isolated from
Pulicaria crispa followed by Humicola grisa isolated
from Artemisia monosperma with
inhibition percent of 16.67.
The maximum inhibition for the T. hamatum radial
growth was reported with Alternaria alternata isolated
from Euphorbia glomerifera which resulted in inhibition of 67.24%, followed by Ulocladium botrytis isolated from Forsskaolea tenacissima with 62.24% inhibition. The lowest inhibition percent of 22.08 was
recorded by Humicola grisa isolated from Artemisia
monosperma.
So we can concluded that the highest differences
between the two strains of Trichoderma, (Table 3)
were reported with Cladosporium spp where the inhibition percent was 7.41 by T. viride and 31.71% by T.
hamatum respectively. Also Fusarium oxysporum was
inhibited with 25.7% by T. viride and with 53.87 % by
T. hamatum. On the other hand the highest inhibition
percent was reported with A. alternate, and the lowest
percent was found in H. grisa by the two Trichoderma
strains.
With respect to the effects of antibiotics produced
by Gliocladium spp, as shown in Table (4) the G. deliquescens antibiotics were completely inhibited all
pathogens growth except for Cephalosporium spp
where the growth was inhibited only by 46.91%.
While the effects of G. virens antibiotics were more
weaker than that of G. deliquescens. F. oxysporum was
inhibited by 48.15 % and P. chrysogenum by 49.44%,
then the three A. alternate strains from 82.69 - 86.32
inhibition percent.
The antibiotics produced by T. viride were completely inhibited all the pathogens growth (Table 5).
The T. hamatum antibiotics also inhibited the pathogens growth except for Cephalosporium spp where
only 40.45% of growth was inhibited and 60% inhibition was detected with Cladosporium spp. So we can
concluded that the effect of antibiotics produced by
the antagonists were more effective than the fungus
itself and differ with different fungi. Also the antibiotics
produced by Trichoderma spp. were more effective
than that of Gliocladium spp.
Control of pathogen by coating plant stems with
antagonists or with antagonist extracts
We found that coating plant stems with antagonists
or with antagonist extracts reduce the severity of the
disease but not prevent it in all tested pathogens.
The antagonistic activity of Trichoderma spp and
Gliocladium spp. could be related to their ability to act
as biocontrol against fungal phytopathogens either
indirectly, by competing for nutrients and space, modifying the environmental conditions, or promoting
plant growth and plant defensive mechanisms and
antibiosis, or directly, by mechanisms such as mycoparasitism. These indirect and direct mechanisms may
act coordinately and their importance in the biocontrol
process depends on the strain, the antagonized fungus,
the crop plant, and the environmental conditions,
including nutrient availability, pH, temperature, and
iron concentration (Bell et al. 1982 and Bentez et al.
2004). Most Trichoderma strains produce volatile and
non-volatile toxic metabolites that impede colonization by antagonized microorganisms; among these
metabolites, the production of harzianic acid, alamethicins, tricholin, peptaibols, antibiotics, 6-penthyl- pyrone, massoilactone, viridin, gliovirin, glisoprenins,
heptelidic acid and others have been described (Vey et

al. 2001). Strains of T. virens are able to produce gliovirin and used to protect cotton seedlings from Phytium ultimum (Chet et al. 1997 and Howell, 1998).
Also, our results agree with those reported by Mishra
& Mukhopadhyay (1997) ; Larkin & Farvel (1998) and
El-Kafrawy et al. (2002), they stated that Trichoderma
spp. and Gliocladium spp. controlled Fusarium oxysporum f. sp. Cucumerinum.
Jaworski et al. (1999) isolated a mixture of polypeptides, named trichovirins (TV) from the culture broth of
the mold Trichoderma viride NRRL 5243. Also Krause
et al. (2005) isolated polypeptide antibiotic suzukacillin (SZ) from the culture broth of the mold Trichoderma viride, strain 63 C-I. The microheterogeneous
alamethicin F30 (ALM F30) was isolated from the fermentation of Trichoderma viride strain NRRL 3199
(Psurek et al. 2005).
Peptaibols, the products of non-ribosomal peptide
synthetases (NRPS), are linear peptide antibiotics produced by Trichoderma and other fungal genera (Ada et
al. 2007). Trichoderma virens strain Gv29-8, a wellknown biocontrol agent and inducer of plant defence
responses, produces three lengths of peptaibols, 11,
14 and 18 residues long, with several isoforms of each.
Metabolites released from Trichoderma viride, T.
polysporum, T. hamatum and T. aureoviride were tested
in culture medium against Ceratocystis paradoxa,
which causes black seed rot in oil palm sprouted
seeds. The Trichoderma metabolites had similar fungistatic effects on the growth of C. paradoxa except
those from T. aureoviride. The inhibition varied depending on the Trichoderma species producing the metabolites; from 2.0% to 64% in volatile, 0.0% to 74%
in non-volatile and 0.0% to 81% from direct-diffusible
metabolites (Eziashi et al. 2006). This finding supported also our results.
Roco and Perez (2001) reported that the presence
of Trichoderma harzianum decreased endo-PGase
secreation of A. alternate by about 50% leading to its
growth inhibition. Expression of the chitinase Chit42
from T. harzianum in tobacco and potato plants resulted in transgenic lines highly tolerant or completely
resistant to the foliar pathogens A. alternate, A. solani
and Botrytis cinerea and to the soil-borne pathogen
Rhizoctonia solani (Howell, 2003). Also Sempere and
Santamarina (2007) confirmed this and our results and
stated that T. harzianum inhibited A. alternate at all
testing temperatures and water activities tested.
Also our results agreed with that of McQuilken et
al. (2001). They stated that hyphal interactions between the antagonist Gliocladium catenulatum and the
plant pathogenic fungi, Pythium ultimum and Rhizoctonia solani, were investigated in dual culture by scan-
93
ABOU-ZEID et al.
ning electron microscopy, Gliocladium catenulatum

hyphae grew along and sometimes coiled loosely around
those of the pathogens. Appressorium-like structures
were produced by the antagonist which aided in holding and penetrating the hosts,s hyphae leading to
growth inhibition.
In a laboratory experiment, inoculating Douglas-fir
seedlings with G. virens (10% w/w) prior to inoculation with Fusarium increased survival time when compared to concurrent inoculations of fungi (Dumroese
et al. 1996). Highley et al. (1996) reported that Gliocladium virens has shown good antagonism against
decay fungi in agar medium and in wood blocks.
Gliotoxin produced by G . virens is associated with
biocontrol of some plant diseases. Decay was reduced
in blocks treated with the culture filtrates but was not
completely stopped and this supported also our
results. Four new antibiotics, TMC-171A (2), B (3), C
(4) and TMC-154 (5) have been isolated from the fermentation of fungal strains Gliocladium sp. TC 1304
and TC 1282, respectively (Koh et al. 1999). These
compounds showed moderate cytotoxicity to various
tumor cell lines.
Our results were supported also with that of Stinson
et al. (2003), they found that Gliocladium sp. fungus
produces a mixture of volatile organic compounds
(VOC's) lethal to plant pathogenic fungi Pythium ultimum and Verticillum dahliae, while other pathogens
were only inhibited by its volatiles.
The results of this study indicated that the tested
Gliocladium and Trichoderma sp. significantly inhibited the growth and reduced the severity of the disease
of the pathogenic fungi with different ratios.
FINANCIAL SUPPORT
This paper was financed by Taif University, Ministry of Higher Education. Saudi Arabia. Project number (1-428-52).
94
REFERENCES
Abd El-Fattah R.I. and Ali, A.A. (2005). Vegetation-Environment relations in Taif, Saudi Arabia. International
Journal of Botany 1 (2): 206-211.
Abou-Zeid, A.M., Mahmoud, Y.A.G. and Talhi, A.E. (2004).
Effect of gaucho insecticide on the efficacy of fungicides
used to control root-rot and damping off- diseases in cotton
seedlings in Egyptian Journal of Microbiology 9: 1-10.
Ada, V., Aric, W., Yariv, B., Ilan, C. and Charles, K. (2007).
The 18mer peptaibols from Trichoderma virens elicit plant
defence responses. Molecular Plant Pathology 8 (6): 737746(10).
Ahmed, A.S., Sanchez, C. and Candela, E.M. (2000). Evaluation of induction of systemic resistance in pepper plants
(Capsicum annuum) of Phytophthora capsici using Trichoderma harzianum and its relation with capsidiol accumulation. Europian Journal of Plant Pathology. 106: 9, 817-824.
Alexopouls, C.J. and Mims, C.W. (1979). Introductory
Mycology. John Wiley and Sons, New York.
Aluko, M.O. and Hering, T.F. (1970). The mechanism associated with the antagonistic relationship between Corticium
solani and Gliocladium virens. Transaction Britch
Mycological Society 55:173-179.
Bartmanska, A. and Dmochowska- Gladysz, J. (2006).
Transformation of steroid by Trichoderma hamatum.
Enzyme and Microbial Technology. 40: 6, 1615-1621.
Batanouny, K.H. (1979). Vegetation along Jeddah-Makkah
road: Pattern and process as affected by human impact.
Journal Arid Environment 2: 21-30.
Batanouny, K.H. and Baeshin, N.A. (1978). Studies on the
flora of Arabia I, the Jeddah-Makkah Road, Saudi Arabia.
Taeckholmia, 9: 67-81.
Batanouny, K.H. and Baeshin, N.A. (1982). Studies on the
flora of Arabia II. The Medina-Badr Road. Saudi Arabia.
Bullitin Faculity of Science Kingdom of Abdulaziz
University 6: 7-29.
Bell, D.K., Wells, H.D. and Markham, C.R. (1982). In vitro
antagonism of Trichoderma spp. against six fungal plant
pathogens. Phytopathology. 72: 379-382.
Bentez, T., Rincn, A.M., Carmen Limn, M.C. and Codn,
A.C. (2004). Biocontrol mechanisms of Trichoderma strains.
International Journal of Microbiology 7(4): 249-260.
Booth, C. (1977). Laboratory guide to the identification of the
Fusarium species. Commonwealth Mycological Institute.
Surrey, England. 58 PP.
Boulos, L. (2002). Flora of Egypt: Volume Three (VerbinaceaeCompositae). Al-Hadara Publishing, Cairo, Egypt, pp. 373.
Boulos, L. and El-Hadidi, N.M. (1994). The Weed Flora of
Egypt. American University in Cairo Press, Cairo, pp. 361.
Burgess, L.W., Lidell, C.M. and Summerell, B.A. (1988). Laboratory manual for Fusarium reseach. Fusarium Reseach
Laboratory, Department of Plant Pathology and Agriculture
Entomology, The University of Sydney.
Chet, I. (1987). Trichoderma-Application, mode of action, and
potential as a biocontrol agent of soil borne pathogenic
fungi. Pages 137-160 in: Innovative Approaches to Plant
Disease Control. I. Chet, ed. John Wiley & Sons, New York.
Chet, I., Inbar, J. and Hadar, I. (1997). Fungal antagonists and
mycoparasites. In: Wicklow DT, Sderstrm B (eds) The
Mycota IV: Environmental and microbial relationships.
Springer-Verlag, Berlin, pp 165-184.
Domsch, K., Gams, W. and Anderson, T. (1980). Compendium of Soil Fungi. Acad. Press, London, pp: 889.
Dumroese, R.K., James, R.L. and Wenny, D.L. (1996).
Gliocladium virens in an alginate prill ineffective as a biological control of Fusarium root disease in container-grown
Douglas-fir. New Forests. 12, (2): 113-124.
Elad, Y., and Kapat, A. (1999). The role of Trichoderma harzianum protease in the biocontrol of Botrytis cinerea.
Eurbian Journa of Plant Pathology 105:177-189.
El-Hady, A.F. (1990). Ecology and phytochemical studies on
Centaurea scoparia (Sieb) plant. Ph. D. Thesis , Faculty of
Science, Zagazig University, Egypt.
El-Kafrawy, A.A., Moustafa-Mahmoud, S.M. and Ismaiel, A.A.
(2002). Biological control of Fusarium wilt disease on
Cucumber, in protected cultivation. The First Conf. Of The
General Agric. Pesticide Lab. 376-384. 3-5 Sep. CarioEgypt.
El-Katatny, M.H., Abdelzaher, H.M.A. and Shoulkamy, M.A.
(2006). Antagonistic actions of Pythium oligandrum and Trichoderma harzianum against phytopathogenic fungi (Fusarium oxysporum and Pythium ultimum var. ultimum). Archives of Phytopathology and Plant Pathology. 39: 4, 289-301.
El-Shourbagy, M.N.; Baeshin, N.A.; Sahhar, K.F. and AlZahrani, H.S. (1987). Studies on the ecology of the western
provinces of Saudi Arabia. II- Vegetation and soil wadiQudaid-Wadi Sitarah Ecosystem. Researches Science
K.A.U., 5-17.
Ellis, M.B. (1976). More dematiaceous hyphomycetes. Kew,
U.K.: International Mycological Institute.
Eziashi, E.I., Uma, N.U., Adekunle, A.A. and Airede, C.E.
(2006). Effect of metabolites produced by Trichoderma
species against Ceratocystis paradoxa in culture medium.
African Journal of Biotechnology 5 (9): 703-706.
Fayed, A. and Zayed, K. (1989). Vegetation along Makkah-Taif
Road (Saudi Arabia). Arab Gulf Journal. Scientific Research
7 (3): 97-117.
Gupta, V.P., Tewari, S.K., Govindaiah and Bajpai, A.K.
(1999). Ultrastructure of mycoparasitism of Trichoderma,
Gliocladium and Laetisaria Species on Botryodiplodia
theobromae. Journal Phytopathology. 147: 1, 19-24.
Hag, I. and Khan, S.M. (2000). Antagonistic reaction of ten
fungal isolates from roor rot affected cotton plants. Pakistan
Journal of Phytopathology. 12: 2, 109-111.
Harman, G. E. (2000). Myths and dogmas of biocontrol:
Changes in perceptions derived from research on Trichoderma harzianum T-22. Plant Diseases. 84: 377-393.
Highley, T.L., Madison, W.I., Anantha Padmanabha, H.S. and
Howell, C.R. (1996). Antagonistic Properties of Gliocladium virens Against Wood Attacking Fungi. The International Researth Group On Wood Preservation. Section 1
Biology. The 27th Annual Meeting. Guadaloupe, French
West Indies, 19-24 May.
Howell, C.R. (1982), Effect of Gliocladium virens on Pythium
ultimum, Rhizoctonia solani, and damping-off of cotton
seedlings. Phytopathology. 72: 496-498.
Howell, C.R. (1998). The role of antibiosis in biocontrol. In:
Harman GE, Kubicek CP (eds) Trichoderma & Gliocladium,
vol. 2. Taylor & Francis, Padstow, pp 173-184.
Howell, C.R. (2003). Mechanisms employed by Trichoderma
species in the biological control of plant diseases: the history and evolution of current concepts. Plant Diseases. 87:
4-10.
Ismail, A.A. and Aly, A.A. (1997). Sensitivity of some isolates

of Rhizoctonia solani isolated from cotton seedlings to the
insecticide Gaucho in combination with seed-dressing fungicide used for controlling seedling disease. J. Agriculture
Science. Mansoura University. 22 (12): 4511-4523.
Jaworski, A., Kirschbaum, J. and Brckner, H. (1999). Structures of trichovirins II, peptaibol antibiotics from the mold
Trichoderma viride NRRL 5243. Journaj Peptide Science. 5
(8): 341 - 351.
Jone, R.W. and Pettit, R.E. (1987). Variation in sensitivity
among anastomosis groups of Rhizoctonia solani to the
antibiotic gliotoxin. Pant disease. 71: 34-36.
Klich, M.A. and Pitt, J.I. (1988). A laboratory guide to common Aspergillus species and their teleomorphs. CSIRO Division of Food Processing, North Ryde, NSW, Australia, 116 pp.
Koh, no, J., Asai, Y., Nishio, M., Sakurai, M., Kawano, K., Hiramatsu, H., Kameda, N., Kishi, N., Okuda, T. and Komatsubara, S. (1999): TMC-171A,B,C and TMC-154, novel
polyketide antibiotics produced by Gliocladium sp. TC
1304 and TC 1282. J-Antibiot-(Tokyo). 52(12): 1114-1123.
Krause, C.; Kirschbaum , J.; Jung , G. and Hans Brckner, H.
(2005): Sequence diversity of the peptaibol antibiotic
suzukacillin-A from the mold Trichoderma viride. J.
Peptide Science. 12(5): 321 - 327.
Kredics, L.D., Doczi, I., Antol, Z. and Manczinger, L. (2000).
Effect of heavy metals on growth and extracellular enzyme
activities of mycoparasitics Trichoderma strains. Biulletin
of Environmental Contamination and Toxicology. 66 (2):
249-252.
Larkin, R.P. and Farvel, D.R. (1998). Efficacy of various fungal
and bacterial bio-control organisms for control of Fusarium
wilt of some vegetables. Plant Diseases. 82: 1022-1028.
Lifshitz, R., Windham, M.T. and Baker, R. (1986): Mechanism
of biological control of preemergence damping-off of pea
by seed treatment with Trichoderma spp. Phytopathology.
76: 720-725.
Lumsden, R.D., Locke, J.C., Adkins, S.T., Walter, J.F. and
Ridout, C.J. (1992): Isolation and localization of the antibiotic gliotoxin produced by Gliocladium virens from alginate prill in soil and soilless media. Phytopathology. 82:
230-235.
Mahmoud, A. and El-Tom, M. (1985): Ecological relationships
of some vegetation units in the Jeddah-Makkah region,
Saudi Arabia. Arab Gulf. Journal Scientific Research. 3 (2):
607-622.
Massart, S. and Jijakli, H.M. (2007): Use of molecular techniques to elucidate the mechanisms of action of fungal biocontrol agents: A review. Journal of Microbiological
Methods. 69 (2): 229-241.
McQuilken, M.P., Gemmell, J. and Lahdenpera, M.L. (2001).
Gliocladium catenulatum as a potential biological control
agent of damping off in bedding off in bedding plants.
Journal of Phytopathology. 149 (3/4): 171-178.
Mishra, P.K. and Mukhopadhyay, A.N. (1997). Bio-control of
corm and root rot disease in gladiolus by corm treatment
with Gliocladium virens. International Conference, Indian
Phytopathology Society, New Delhi, India.
Monte, E. (2001). Understanding Trichoderma: between
biotechnology and microbial ecology. International Microbiology. 4:1-4.
Montealegre, J.R., Reyes, R., Perez, L.M., Herrera, R., Silva,
P. and Mossallam, H.A. and BaZaid, S.A. (2000). An illus-
95
ABOU-ZEID et al.
trated guide to the wild plants of Taif, King of Saudi Arabia
Umm Al Qura Univ. Saudi Arabia.
Montealegre, J.R., Reyes, R., Perez, L.M., Herrera, R., Silva,
P. and Besoain, X. (2003). Selection of bioantagonistic bacteria to be used in biological control of Rhizoctonia solani
in tomato. Environmental Biotechnology. 6(2): 1-8.
Mossallam, H.A. and BaZaid, S.A. (2000). An Illustrated
Guide to the Wild Plants of Taif. Kingdom of Saudi Arabia.
Publication Committee For Tourism Activation-Taif, Saudi
Arabia.
Patkowska, E. (2003). The effect of phyllosphere microorganisms on the healthiness of aboveground parts of soybean
(Glycie max (L.) Merrill). Hortorum Cultus. 2(1): 65-71.
Pitt, J.I. (1988). A laboratory Guide to Common Penicillium
Species, 2nd edn. CSIRO Division of Food Processing,
North Ryde, NSW, Australia.
Psurek A., Neus, C., Degenkolb, T., Brckner, H.,
Balaguer, E., Imhof, D. and Scriba, G.K.E (2005).
Detection of new amino acid sequences of alamethicins
F30 by nonaqueous capillary electrophoresis-mass spectrometry. Journal Peptide Science. 12 (4): 279 - 290.
Roco, A. and Perez, L.M. (2001). In Vitro biocontrol analysis
of Trichoderma harzianum on Alternaria alternate in the
presence of growth regulators. Plant Biotechnology. 4 (2):
68-73.
Sempere, F. and Santamarina, M. (2007). In Vitro biocontrol
analysis of Alternaria alternate (Fr.) Keissler under different
environmental conditions. Mycopathologia. 163 (3): 183-190.
Sharon, E., Bar-Eyal, M., Chet, I., Herra-Estrella, A., Kleifeld,
O. and Spiegel, Y. (2001). Biological control of the rootknot nematode Meloidogyne javanica by Trichoderma
harzianum. Phytopathology 91: 687- 693.
Stinson, M., Ezra, D., Hess, W.M., Sears J. and Strobel, G.
(2003). An endophytic Gliocladium sp. of Eucryphia cordifolia producing selective volatile antimicrobial compounds. Plant Science. 165 (4): 913-922(10).
Tckholm, V. (1974). Student's Flora of Egypt. Cairo
University Press. Cairo, Egypt, pp. 888.
Tjamos, E.C., Papavizas, G.C. and Cook, R.J. (eds) (1992).
Biological control of plant diseases. Progress and challenges for the future. Plenum Press, New York.
Vesey-Fitzgerald, D.F. (1957). The vegetation of the Red Sea
coast north of Jedda. Saudi Arabia. J. Ecol., 45: 547-562.
Vey, A., Hoagland, R.E. and Butt, T.M. (2001). Toxic metabolites of fungal biocontrol agents. In: Butt TM, Jackson C,
Magan N (eds) Fungi as biocontrol agents: Progress, problems and potential. CAB International, Bristol, pp 311-346.
Wells, H.D., Bell, D.K. and Jaworski, C.A. (1972). Efficacy of
Trichoderma harzianum as a biocontrol for Sclerotium rolfsii. Phytopathology. 62: 442-447.
Wu, W.S., Liu, S.D., Chang, Y.C. and Tschen, J.S.-M. (1986):
Hyperparasitic relationships between antagonists and
Rhizoctonia solani. Plant Proction Bulletin. 28: 91-100.
Yedidia, I., Benhamou, N. and Chet, I. (1999). Induction of
defense responses in cucumber plants (Cucumis sativus L.)
by the biocontrol agent Trichoderma harzianum. Appllied
Environmental Microbiology 65: 1061-1070.
Zhang, J., Howell, C.R. and Starr, J.L. (1996). Suppression of
Fusarium colonization of cotton roots and Fusarium wilt by
seed treatments with Gliocladium virens and Bacillus subtilis. Biocontrol Science Technology 6: 175-187.
96
THE 37TH NATIONAL CONFERENCE OF IMMUNOLOGY

19-21 SEPTEMBER, 2007
ABSTRACTS
METHODS AND TECHNIQUES FOR EVALUATING

VACCINATION EFFICIENCY IN INFLUENZA PROPHYLAXIS
D. L. Radu
N.I.R.D.M.I. Cantacuzino
The constant, permanent and small modifications of influenza virus type A antigenic composition are known as antigenic drift. The tendency of viruses to suffer frequent and permanent antigenic modifications has led to the constant
global monitoring of influenza and to annual adjustments of influenza vaccine composition. Another worrying characteristic of influenza viruses A is that in case of a co-infection they may modify/reassort one or several segments of the
genome. The reassorting process, the antigenic shift, results in a different subtype of parental viral strains if at least one
of the two genes coding for surface glycoproteins (hemagglutinin and neuraminidase) is modified. The antigenic shift
has generated pandemics with many lethal cases. For their occurrence, the new subtype must contain genes of the
influenza viruses that can make it easily transmissible from one person to another, for a long period of time. We are
currently confrunted with a number of changes in the way that these influenza viruses react at the host level. The role
of the immune system in the protection against influenza viruses is described and the methods and techniques that can
be used in evaluating the efficiency of vaccination in influenza prophylaxis are presented. The latest phylogenetic investigations of H5N1 virus, the main research directions and the actions taken for a better protection against highly pathogenic viruses.
97
THE 37TH NATIONAL CONFERENCE OF IMMUNOLOGY (19-21 SEPTEMBER 2007)
EXPERIMENTAL INFLUENZA A/PR8/34 INFECTION

IN CONVENTIONAL AND TRANSGENIC MICE
Melania Grosu, Crina Stavaru, Anna Gruber, Adina Daniela Iancu, Maria Elena Mihai,
Claudiu Edward Sbarcea, Emilia Lupulescu, Viorel Alexandrescu, Dorel Lucian Radu
NIRDMI "Cantacuzino", Bucharest, Romania
INTRODUCTION
The aim of study was the experimental influenza A/PR8/34 infection in conventional and transgenic mice with different infection response.
Four different mice strains, Balb/c, Ins-HA, TCR-HA and double transgenic (dTg), were infected with A/PR8/34 virus.
TCR-HA+/- are Balb/c mice and their T lymphocytes express T cell receptor (TCR) specific for the immunodominant
hemagglutinin (HA) epitope of PR8 influenza virus. Double transgenic mice are obtainined by mating TCR-HA +/with Ins-HA +/+ mice. Ins-HA mice express HA of the same virus in pancreatic -cells under the control of rat insulin
promoter. A/PR8/34 infection was demonstrated by BinaxNow Influenza A&B rapid test and by identification of the
virus in pulmonary triturate, pulmonary and nasal lavage by MDCK test.
Immunophenotyping of lymphocytes sets and subsets, monitoring of body weight and survival rate were done.
RESULTS
The virus identification in biological products showed differences between the mice strains. Excepting dTg mice, in
all experimental mice strains a significant decrease of body weight was recorded.
The survival rate was 100% in TCR-HA and dTg mice, and was 0% in Balb/c mice which died on the 7th day of the
experiment, and 0% in Ins-HA which died on the 14th day of the experiment. Interstrains variations were registered on
lymphocytes immunophenotyping 48 hours after infection.
CONCLUSION
This protocol of influenza virus infection in different strains of mice offers the possibility to study the complex
immune mechanisms which occur in this disease.
SEPARATION AND IDENTIFICATION OF ACTIVE COMPONENTS

IN BACTERIAL EXTRACT CANTASTIM
Aurora Salageanu1, Olaf Nauen2, Luigi Silvestro2, Catalin Tucureanu1, Lucian Lerescu1,
Raluca Boghean1, Roxana Pispiris1, Mihaela Gheorghe1 and Adrian Onu1
1
N.I.R.D.M.I. Cantacuzino",
2PharmaServ
International, Bucaharest, Romania
CANTASTIM (CS) is a purified extract of Pseudomonas aeruginosa with immunomodulatory properties, which contains a mixture of components isolated from bacterial wall. To identify the active components, the total extract has been
separated into fractions by HPLC, using a C18 column as stationary phase and a gradient of water- methanol-chloroform as mobile phase, at a flow rate of 50 ml/min. Fractions of volume 50 ml each were collected and dried using a
Savant Speedvac vacuum centrifuge for further analysis. Identification of lipid components was performed by thin layer
chromatography on silica gel plates using a mixture of chloroform-methanol-water (65:25:4, vol/vol). The capacity of
the fractions to induce the production of cytokines has been tested by stimulation of PMA differentiated human monocyte-like cell line THP-1. The measurement of cytokine levels in cell culture supernatants has been performed using
ELISA (TNF alfa) and xMAP-Multiplex techniques. The results allowed the identification of the biologically active fractions. Further studies are aimed at identifying the components of the active fractions (aminoacids, lipids, glucides).
98
Abstracts
THE STUDY OF IMMUNE RESPONSE IN EXPERIMENTAL

MODEL OF INFLUENZA VIRUS INFECTION
Adina Daniela Iancu, Melania Grosu, Crina Stavaru, Anna Gruber, Maria Elena Mihai,
Claudiu Edward Sbarcea, Emilia Lupulescu, Viorel Alexandrescu, Dorel Lucian Radu
NIRDMI Cantacuzino
INTRODUCTION
The studies on experimental models of infections induced by influenza viruses allows in vivo evaluation of different mechanisms that characterize virus-host interaction. The preliminary results aim the study of immune response in
A/PR8/34 influenza virus infection in Balb/c mice.
6-8 weeks Balb/c mice were infected with A/PR8/34 influenza virus from allantoic fluid with 109.5 EID50 mL-1,
from NIRDMI Cantacuzino. The surveillance of infection was made during the entire survival period by measuring the
following parameters: survival period, body weight, immunoglobulin serum concentration, sets and subsets of lymphocytes. The accomplish of A/PR8/34 infection was demonstrated using BinaxNow rapid test and MDCK identification
from pulmonary triturate and nasal lavage. Antigen specific blastic transformation was performed on lymphocytes isolated from spleen and mediastinal ganglia from Balb/c mice infected with a non-lethal dose.
RESULTS
Virus identification was performed in all harvested biological products. The monitoring of somatic and immunological parameters showed: a decrease in body weight, the increasing subsets of IgG2a, IgG1 in infected mice, the
increasing of splenic B lymphocytes compared to control. Specific antigen response (PR8) of B lymphocytes isolated
from Balb/c mice that had the infection show significantly more increased values of the stimulation coefficient in the
case of those isolated from mediastinal ganglia compared to the splenic ones. The demise occurred in all Balb/c mice
in the 6th-7th day postinfection.
CONCLUSION
The use of experimental models of influenza viruses infection allows the study of immunopathogenic mechanisms
in this disease.
ORAC (OXYGEN RADICAL ABSORBANCE CAPACITY) - ACCURATE

FLUORIMETRIC METHOD FOR MEASURING THE ANTIOXIDANT
CAPACITY OF NATURAL OR SYNTHETIC PRODUCTS
Andreea-Roxana Lupu1, Lidia Cremer1, Ana Calugaru1, Natalia-Simona Barzu1,
Maria-Mihaela Badulescu1, G. Ionescu1, G. Szegli1, F. Kerek2
1
NIRDMI Cantacuzino, Bucharest, Romania; 2Max Plank Institut fr Biochemie, Mnchen, Germany
Compounds with antioxidant capacity are able to scavenge the oxygen and nitric radicals excessively produced in
some pathologic and degenerative diseases. Antioxidant properties of foods, nutritional supplements, cosmetics, purified compounds, blood, tissues, can be quantified by fluorimetric methods such as: ORAC (Oxygen Radical Absorbance
Capacity), NORAC (Nitric Oxide Radical Absorbance Capacity), HORAC (Hydroxyl Radical Absorbance Capacity) and
SORAC (Superoxide Radical Absorbance Capacity).
Significant applications of the above mentioned tests are the following:
- content control of antioxidant substances in foods (vegetables, fruits, meat, juices), nutritional supplements, vegetal
extracts etc;
- measuring the antioxidant capacity for drugs and any therapeutic product;
- clinical evaluation of ageing;
- basic research.
Our study focused on ORAC fluorimetric method for hydrophylic samples; we used Thermo Fluoroskan FL and the
data were processed by a dedicated software (Ascent).
In order to validate this method, we varied some parameters (temperature, incubation time, standard dilutions etc)
for finding the adequate measuring conditions and for obtaining reproducible results. We have tested a large amount
of natural extracts and we proved that some of them possess strong antioxidant capacity.
Extended method uncertainty was calculated by using an in-house reference Natural SOD - a commercial nutritional supplement with known antioxidant properties - produced by NIRDMI Cantacuzino.
99
PARAMETERS OPTIMIZATION FOR PHOTODYNAMIC THERAPY

OF ORAL DYSPLASIC KERATINOCYTES WITH 5-AMINOLEVULINIC ACID
Carolina Constantin1, Monica Neagu1, Gina Manda1, Ionela Neagoe1, Daniel Boda2, Teodor Savopol2
1
NIRD Victor Babes, Bucharest, e-mail: imunoc@vbabes.ro; 2University of Medicine and Pharmacy Carol Davila
The aim of the present study is to establish the optimal parameters for loading 5-aminolevulinic acid (5-ALA), the
precursor of protoporphyrin IX, in different cell lines: keratinocytes and immune origin cells.
Cells
DOK - human Caucasian dysplastic oral keratinocyte.
Jurkat E6.1- human leukaemic T cell lymphoblast.
Human normal peripheral mononuclear cells were isolated by standard gradient centrifugation from venous blood.
Cell viability - assessed as LDH release test (The CytoTox 96 Non-Radioactive Cytotoxicity Assay, Promega).
Cell proliferation - investigated with MTS reduction test (The CellTiter 96 AQueous One Solution Cell Proliferation
Assay, Promega) which measures the intracellular oxidases of metabolically active cells.
RESULTS
25nM-100 M concentration range of 5-ALA were studied. The viability and proliferation tests performed on DOK
cells suggest that 1-2 M is the optimum loading concentration for this type of cell line. Incubation with 1 M 5-ALA and
fluorescence microscopy analysis shows that as soon as 2h of loading, a low proportion of DOK cells exhibit protoporphyrin IX synthesis. After 24h of incubation, 80% of cell population has detectable synthesis of protoporphyrin IX.
Higher than 0.09 M concentrations of 5-ALA induces an increased LDH releases in Jurkat cells and a diminution of their
proliferative capacity, this cell line being more sensitive than the studied keratinocytes. The primary culture of human
mononuclear cells exhibit the same behavior like Jurkat cells in the presence of 5-ALA.
CONCLUSIONS
5-ALA induces different pattern of response depending on the studied cell line. Non-adherent cells are more sensitive to 5-ALA compared to adherent cells.
COMPUTERIZED PLETHYSMOMETRY - PERFORMANT METHOD

FOR MEASURING THE INFLAMMATORY OEDEMA
INDUCED BY CARRAGEENAN INJECTION IN MOUSE PAW
E. Vlase, C. Coman, G. Szegli, Andreea-Roxana Lupu, Lidia Cremer, Natalia Simona Barzu,
Maria-Mihaela Badulescu, Ana Calugaru, G.Ionescu
NIRDMI Cantacuzino, Bucharest, Romania
Oedema represents one of the characteristic clinical signs of local inflammation (tumor), besides congestion (rubor),
increasing of local temperature (calor) and pain (dolor), ascertaining functio laesa (reduced mobility of the affected
member). Taking into account that the volume of the affected member is in proportion to the inflammatory process
intensity, the oedema measurement is very important for inflammatory processes monitoring and also for clarifying in
vivo related cellular mechanisms and identifying anti-inflammatory products.
In our research we follow the assessment through computerized plethysmometry of the inflammatory oedema
induced with Carrageenan (experimental model for acute inflammation) or with Complete Freund Adjuvant (experimental model for chronic inflammation) in order to quantify the inflammatory process and to identify products with
anti-inflammatory activity.
The computerized plethysmometry used in experimental studies allows:
- accuracy and sensitivity of the measurements;
- keeping a high number of records in the internal memory.
With this modern method we already demonstrated, as a first part of our studies, the influence of a certified nonsteroidal anti-inflammatory drug (Indomethacin) on mouse paw oedema, after Carrageenean paw inoculation.
The results obtained demonstrated that when Indomethacin is applied by gavage one hour before Carrageenan, the
anti-inflammatory product is able to reduce the induced oedema; these experimental results are reproducible and in
accordance with the literature data, an encouraging fact to use this protocol for the method validation in order to test
anti-inflammatory products.
100
Abstracts
COMPUTATIONAL SOLUTIONS FOR COLLECTING

AND ANALYZING IMMUNOLOGIC AND BIOMOLECULAR DATA;
IMMUNOGENOMIC INTEGRATION
R. Huic, C. Ursaciuc
Victor Babe National Institute, Immunology Department, Bucharest
Morbidity and mortality indices in Romania are among the highest in Europe, largely due to immunologic, genetic
and epigenetic factors.
By separately analyzing immunologic and molecular parameters one cannot get adequate answers regarding the
complex mechanisms governing the functioning of the immune system against pathogens and tumors, hence the need
for a holistic, integrative approach- immunogenomics.
Lacking a standardized informatics system for streamlining correlations between genomic make-up, humoral status
and various diseases, the alternative remains to create local, open systems which would have to be developed and
adapted according to European guidelines regarding data collection and the management of coding identifiers, events,
adverse effects/reactions.
Here we present two informatics solutions for data collection, storage, analysis and delivery on request, currently
used by researchers from the Immunodiagnostic Group of Immunopathology Laboratory and the Bank for Tumor Cells
and Nucleic Acids (BTCNA). By introducing these solutions using new platforms and/or new software we aim to reach
a balance between requirements of robustness, security and data protection on the one hand and compliance and ease
of operation by non-technical staff members on the other.
We present the current status of these databases' progress, along with solutions and areas of improvement drawn
from the daily use in the research activity or medical services. Aspects concerning better compatibility with similar systems are considered, as well as integration into complete immunogenomic information solutions.
STUDY THE ONCO-PROTEINS EXPRESSION IN LARYNGEAL CANCER:

AS POTENTIAL INDICATORS FROM PROGNOSTIC EVALUATION
Georgiana Matei1, Bostan Marinela1, Ligia Gabriela Ghetea2, Ana Maria Niculescu2, Rozalia Motocc,
Valeria Liliana Jianu3, Madalina Lucia Marcu3, Lorelei Irina Brasoveanu1
1
Center of Immunology, Institute of Virology Stefan S. Nicolau, Bucharest, Romania;

Bucharest University, Institute of Genetics, Romania; 3Sf. Constantin & Elena Hospital, Romania
The stage and differentiation grades of tumor are the prognostic indicators had also been established in laryngeal
cancer, but the unforeseeable clinical evolution needs evaluation of adjacent pathological parameters. In order to analyze the some onco-proteins expression, in our study we used histological method, immunohistochemical staining
(IHC) and indirect immunofluorescence method (IIF).
We examined the patients with laryngeal cancer according to the following criteria: no history of previous malignancies, primary squamous cell carcinoma of the larynx, no previous radiotherapy or chemotherapy, and complete surgical excision of the primary tumor. The nontumoral epithelial laryngeal tissues prelevated from these patients were
used as the control.
The histological analysis of the slides shows the aggressivity of this type of cancer, thus, in 80% of the cases there
were lymphatic ganglions with metastasis of squamous carcinoma, and in 30% of the patients there were malign neoplasic infiltrations of keratinized squamous carcinoma, well differentiated in the fibro-adipose and in the striated muscular tissues. Likewise, it is to be noticed that in over 90% of the studied cases the resection limit appears to be invaded by tumor cells. The immunohistochemical analysis and the IIF show that the retinoblastoma (Rb) protein expression
was detected in only 50% of the investigated tumors, recording a very heterogeneous proportion between 5-25% of
the positive cells.
The p21 protein distribution in the tumor cells nucleus was between 10% and 25%, while the immunohistochemical data show the presence of Cyc D3 in over 50% of the analysed samples. These data suggest that the expression
level of the investigated proteins could be one of the prognostic factors in larynx cancer and could allow the discovery
of new therapeutic targets.
101
SERUM MARKERS OF ANGIOGENESIS

IN PATIENTS WITH PITUITARY ADENOMA
Cristiana Tanase1, Elena Raducan1, Eleonora Codorean1, L. Albulescu1, Daniela Popescu1,
Maria Linda Cruceru2, Irina Ogrezeanu3
1
Victor Babes National Institute of Pathology, Bucharest, Romania; 2Carol Davila University of Medicine,
Bucharest, Romania; 3D. Bagdasar" Hospital, Neurosurgery Dept., Bucharest, Romania
INTRODUCTION
Angiogenesis is a dynamic process, essential for embryogenesis, morphogenesis, tumorigenesis and other biological processes, being the most important factor for growth and proliferation of tumors. Angiogenic growth factors: vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) ensure vascularisation of the growing
tumor tissue.
AIM
The aim of our study was to analyze the relationship between VEGF and bFGF serum levels in patients with pituitary adenomas and tumor behavior. The study also evaluated the potential of serum levels of the two growth factors as
diagnostic markers.
MATERIAL AND METHOD
Serum levels for VEGF and bFGF were determined in 20 patients with pituitary adenoma and 10 healthy subjects,
using ELISA (R&D Systems - Quantikine) and xMAP array (Luminex).
RESULTS
Mean values of VEGF serum levels in pituitary adenoma patients was 199.77 pg/ml, versus 95.45 pg/ml (healthy
subjects) (p<0.05). There is also a difference between mean values of VEGF in invasive 213.10 pg/ml and non-invasive 159.77 pg/ml adenomas. In serum from patients with pituitary adenoma, mean values of bFGF was 6.25 pg/ml in
patients, versus 4.64 pg/ml (healthy subjects) (p<0.05). The mean of bFGF serum level was 6.95 pg/ml in invasive adenomas compared with 4.95 pg/ml in non-invasive adenomas. These results were sustained by xMAP Array technology
for VEGF level.
CONCLUSIONS
A direct correlation was observed between VEGF and bFGF expression in pituitary adenomas - serum level of two
growth factors and tumor behavior.
PERIOPERATIVE IMMUNOLOGICAL CHANGES

IN PATIENTS WITH COLORECTAL CANCER
Lucian Lerescu1, Stefan Neagu2, Catalin Tucureanu1, Gabriel Gangura2,
Mihai Panescu2, Raluca Boghean1, Gheorghe Iana2 and Aurora Salageanu1
1
National Institute for Research and Development in Microbiology and Immunology Cantacuzino,
2
University Hospital Bucharest, Romania
Immunity plays an important role for the prognostic and natural history of the cancers, including colorectal cancer.
Previous studies showed that the presence of the tumor in the body determines changes of immune response and an
immunosuppresion induced by the tumor and/or by the antitumoral therapy. To investigate the changes in immune
mediators profile induced by tumor resection, we assessed the serum levels of cytokines (IL-1, IL-2, IL-4, IL-6, IL-8, IL10, IFNgamma, TNFalpha, GM-CSF, IL-17, TGFbeta) and chemokines (MCP-1, MIP-1alpha, RANTES, CXCL5) in colon
cancer patients before, during and after surgery. We have also tested the culture supernatants of peripheral blood
mononuclear cells (PBMC) derived from the patients before and after surgery. We have used a novel multianalyte XMap
profiling technology (Luminex) that allows simultaneous measurement of multiple parameters in small volumes of samples. Preliminary results indicated that surgery did influence the immune mediators and revealed a notable interindividual variation. During surgery, an increase in serum concentration of IL-6 and IL-10 in the serum was noticed. Serum
levels of MCP-1 and MIP-1alpha decreased after operation (statistically significant in the case of MCP-1) whereas the
concentration of CXCL5 increased as compared to preoperative level. Preliminary results suggest that both tumor and
surgical act may influence immune mediators network. Further studies are aimed at establishing correlations between
these perioperative immunological profile and disease progression.
102
Abstracts
PRELIMINARY DATA REGARDING COMBINATED TREATMENT

WITH VINBLASTINE, RAPAMYCIN AND VEGETABLES EXTRACTS
ON ENDOTHELIAL CELL LINE
Ana Clugru1, Lidia Cremer1, Natalia Simona Brzu1, Andreea Roxana Lupu1,
Maria Mihaela Bdulescu1, G. Szegli1, F. Kerek2
1
N.I.R.D.M.I. "Cantacuzino", Bucharest, Romania; 22Max Plank Institut fr Biochemie, Mnchen, Germany
Angiogenesis, the biological process by which new capillaries are formed from pre-existing vessels, is a tightly controlled and complex process involving several factors with both stimulating and inhibiting steps. In solid tumor growth,
a specific clinical turning point is the transition from the avascular to the vascular phase. Once avascular an intrinsic
vascular network develops, a tumor may grow indefinitely. Tumor angiogenesis depends mainly on the release by neoplastic cells of growth factors specific for endothelial cells (ECs), able to stimulate growth of the host blood vessels.
Our study was performed on EAhy 926 endothelial cell line maintained in logarithmic growth at 370C and 5% CO2
in Eagle modified medium supplemented with 10% fetal bovine serum (Sigma Chemical), 50IU/mL sodium penicillin G,
50 g/mL streptomycin sulphate, and 2mM l-glutamine. Inhibition of endothelial growth cells by Vinblastine, Rapamycin
and VOB vegetables fractions were tested. Preliminary data shown that Vinblastine and Rapamycin has synergistic effect
on growth of the endothelial cell line EAhy 926. A synergistic apoptotic effect was observed in cells treated with
Vinblastine and Rapamycin in combination. The effect of Vinblastine was modulated by VOB vegetables fractions.
PHOTODYNAMIC THERAPY - ASSOCIATED IMMUNE RESPONSE

IN MELANOMA ANIMAL MODEL
M. Neagu1, G. Manda1, C. Constantin1, G. Savi1, I. Savi1, I. Neagoe1, M. Nechifor2, R. Ion3
Victor Babes National Institute, Bucharest, Romania; 2University of Bucharest, Bucharest, Romania;
3
ICECHIM National Institute for Chemical and Petrochemical Research, Bucharest, Romania.
ABSTRACT
Despite the extensive research done in the photodynamic therapy (PDT) field, the immune mechanisms triggered
by PDT are still a matter of debate. The purpose of our study was to elucidate the collateral immunological effects
induced by photodynamic therapy in B16 melanoma bearing mice. For the loading of melanoma cells, 5,10,15,20tetra(1-naphthyl)porphyrin (TNP) and 5,10,15,20-tetra(4-sulfonatophenyl)porphyrin (TSPP) were used as photosensitizers in a prior established non-toxic concentrations. The cell suspensions were irradiated at a = 632.8 nm, He-Ne laser
(30 mW, 25 oC), total irradiation time=30 min., in O2 saturated solution. C57 Black female mice were used as animal
model. In order to identify the protein quantity and the molecular weights of components released by cells subjected
to PDT, cell supernatants were electrophoretically analyzed in Experion microfluidic system (BioRad). Mice were subcutaneously immunized with the mentioned serum - free supernatants using 75g protein/mouse, and subsequently
challenged with B16 melanoma cells in day 21. Mice proved an increase in the antibody level starting the first week
after inoculation.
Our results have shown that the proteic profiles of supernatant obtained from cells subjected to TSPP-PDT and TNP-PDT
were different and characteristic for the photosensitizer type. The molecular weight of the proteins shed by untreated B16
melanoma cells matched the proteic profile of the supernatants obtained from TSPP-PDT cells but not from the TNPPDT ones. Animal survival and metastasis levels in immunized mice were clearly improved as compared with animal
groups subjected to in vivo PDT classical treatment.
Study financed by the National Research Grants CEEX 107-108/2006.
103
NOVEL PYRIMIDINE-BASED NUCLEOSIDE ANALOGS

IN RELATION WITH IMMUNE TUMOR CELLS
Ionela Neagoe1, Monica Neagu1, Carolina Constantin1, Constantin Tanase2, Gina Manda1
1
"Victor Babes" National Institute of Pathology, Bucharest;

National Institute of Chemical-Pharmaceutical Research, Bucharest
The study aims to characterize in vitro the toxicological profile and the anti-neoplastic activity of several novel
nucleoside analogs, at the level of immune tumor cells.
We studied novel nucleoside analogs in which the sugar moiety was modified by replacing the furane ring with a
functionalized oxabicyclo [3.3.0]ocatne fragment, and uracil (U-34), 5-iodo-uracil (IU-34) and thymine (T-34) were used
as bases. We investigated the in vitro effects of these compounds on human neoplastic cell lines with immune characteristics (Jurkat - lymphoblastic T cell leukemia, and U937 - hystiocytic lymphoma with monocyte characteristics). We
assessed the following cellular parameters: membrane integrity (LDH release method), cell viability (tetrazolium salt
reduction test) and multiplication (cell cycle, uridine and thymidine uptake, cell progenitors).
Our experimental data show that IU-34 interferes with the metabolism of neoplastic mononuclear cells, as it alters
cell viability, the uptake of uridine and, to a lesser extent, of thymidine. We detected the reduction of cells in the S
phase of cell cycle and the multiplication arrest of tumor cells at the 4th and 5th generation. Unlike IU-34, the effect
of U-34 is highly differentiated according to cell type regarding the action on cell viability. Thus, whilst Jurkat lymphoblsts respond to U-34, U937 tumor cells are not sensitive. U-34 and IU-34 alter uridine and thymidine uptake by
tumor cells, even at low, non-cytotoxic concentrations. T-34 does not alter the viability of tumor cells; at high doses it
limits moderately thymidine incorporation by Jurkat cells, but stimulates in this respect U937 cells.
Concluding, the investigated novel nucleoside analogs interfere with the metabolism of neoplastic T lymphocytes
and U937 monocytes. The expansion of these tumor cells seems to have distinct requirements for nucleotides or cells
express different levels/types of nucleoside receptors.
THE ROLE OF INFLAMMATORY MEDIATORS IN ACTIVATION PROCESS

OF THE MAP KINASES IMPLICATED IN THE CYTOTOXIC FUNCTION
DEVELOPED BY NEUTROPHILS IN RHEUMATOID ARTHRITIS
Marinela Bostan1, Mirela Hirt1, Dan Hotnog1, Georgiana Matei1, Cecilia Galatiuc1,
Stefania Marineata2, Lorelei Irina Brasoveanu1
Center of Immunology, Bucharest, Romania; 2Medical Center Vademecum Bucharest, Romania
Polymorphonuclear leucocytes (PMNs) are involved in the pathogenesis of several autoimmune diseases such as
rheumatoid arthritis (RA). During the inflammatory response activation of PMNs might be modulated by various mediators present at the site of inflammation (TNF-alpha, IL-8, IL-6). Once activated, PMNs exert a wide variety of biological functions like chemotaxis, degranulation, oxidative function which participate in the inflammatory response or
immune regulatory mechanisms. The aim of the present project focused to clarify the role of various inflammatory mediators (TNFalpha, IL-8, IL-6) in activating MAPK enzymes (ERK1/2 si p38 MAPK) which play an important role in development cytotoxic functions of PMNs. The oxidative function developed by PMNs was detected by using an amplified
chemiluminescence assay and degranulation process (release of enzymes: -glucuronidase and lactoferrin) by ELISA.
The experiments were performed using the PMNs cells isolated from peripheral blood or synovial fluid obtained
from RA patients. Thus, before the treatment with inflammatory mediators the cells were incubated in the presence or
absence of the specific MAPK inhibitors (SB203580 or PD098059). Our data show that activation of p38 MAPK might
mediate the oxidative function and the degranulation process developed by RA-PMNs stimulated with inflammatory
mediators. The ERK1/2 activation process were not implicated in development of the exocytosis of primary and secondary granules, but they modulated the oxidative function of the RA-PMNs stimulated with TNFalpha, IL-8, IL-6.
Our results indicate that the activation of p38 MAPK and in part of ERK significantly contributes to destructive
processes in RA. Furthermore, establishing the activation level of MAPK might offer additional information about cytotoxic function developed by PMNs in RA.
104
Abstracts
SERUM C1-INHIBITOR AND C4 VALUES

IN ANGIOEDEMA
C. Ursaciuc, Mihaela Surcel, R. Huic, Maria Dobre, D. Ciotaru, Doina Barac
Victor Babe National Institute, Immunology Dept., Bucharest
Serum C1-inhibitor (C1inh) and C4 was determined by nephelometry in 307 angioedema (AE) patients: 62 primary
(including hereditary) AE (PAE), 67 allergy AE (AAE) and 178 secondary AE (SAE). C1inh and C4 were measured respectively in 97 and 257 patients.
The results revealed low C1inh and C4 only in respectively 22% and 18% patients. The decreased values prevailed
in PAE for both parameters (24% patients for C1inh and 27% for C4), whereas AAE registered mainly low C4 in 13%
patients. From low C1inh values, 57% were PAE and 14% AAE, while from low C4 values 21% were PAE and 19% AAE.
This study revealed the presence of a relatively few low C1inh values outside AE crisis. It is also possible that a significant number of patients have functional C1inh troubles, belonging to PAE type II, these circumstances indicating C4
testing as a diagnosis support.
VARIATION OF CELLULAR
IMMUNOLOGICAL PARAMETERS VALUES IN DIFFERENT AGE GROUPS
FROM ROMANIAN ADULT POPULATION
Mihaela Surcel1, Maria Dobre1, R. Huica1, D. Ciotaru1, C. Ursaciuc1, Ioana Culea2,
Doina Barac1, Adriana Munteanu1, Ioana Prvu1, Silvia Sorca1, Mariana Caralicea1
1
Victor Babe National Institute, Immunology Department, Bucharest; 2National Institute of Haematology, Bucharest
The establishment of a reference values system regarding the immune parameters for Romanian population represents
a major goal for laboratory and clinics immunologists. This reference system creates the premises for the dynamics and
immune status evaluation and also could setting up the framework for normal or immunopathological conditions.
The cellular immune status was investigated by immunophenotyping which quantifies and functionally analyses the
leukocytes from peripheral blood. The quantitative evaluation of cellular immune response consists in determination
of population and subpopulation cells percentage from peripheral blood, based on certain membrane specific markers.
Thus, on the topic of membrane markers, the following populations and subpopulations of peripheral cells are distinguished: CD3+ total T lymphocytes, CD3+CD4+ T helper lymphocytes (Th), CD3+CD8+ cytotoxic/supressors T
lymphocytes (Ts), CD19+ B lymphocytes, CD16+CD56+ NK cells. The functional evaluation has consisted in the
establishing and analyses of Th/Ts cells subpopulations ratio.
All determinations were performed on EDTA peripheral blood isolated from healthy volunteers belonging to the
subsequent age groups: 16 - 30 years (115 subjects) and 31 - 50 years (220 subjects).
The obtained average values were as follows: T cells 727; Th 466; Ts 257; B cells 207; NK cells 85;
Th/Ts 1,950,58 for 16 - 30 years group and T cells 808; Th 497; Ts 258; B cells 176; NK cells 106; Th/Ts
2,140,80 for 31 - 50 years group.
By recording these obtained results in a normal value immunological register and its application in medical practice, an improvement of laboratory determinations precision will be achieved.
105
VARIATION OF HUMORAL IMMUNOLOGICAL PARAMETERS VALUES

IN RELATION WITH AGE IN ROMANIAN ADULT POPULATION
Maria Dobre1, Mihaela Surcel1, C. Ursaciuc1, D. Ciotaru1, Doina Barac1, Ioana Culea2,
Radu Huic1, Adriana Munteanu1, Ioana Prvu1, Silvia Sorca1, Mariana Caralicea1
Victor Babe" National Institute, Immunology Department, Bucharest; 2National Institute of Haematology, Bucharest
Nowadays, the evaluation of the immunological results is based on comparison of values obtained in national laboratories with reference values systems from specialty literature. But these values systems could be different from those
of healthy people from Romania and data interpretation for resident patients might be the subject for an error coefficient generated by ignoring the evaluation limits for immune status in our country.
In order to obtain the normal values for humoral immunological parameters in Romania, the following factors were
determined: immunoglobulins (IgG, IgA, IgM - values in g/L and IgE - values in KUI/L), circulating immune complexes
(CIC - values in g Eq/mL), serum complement components (C3 and C4 - values in g/L).
All the determinations were performed on serum from healthy volunteers belonging to the following major groups:
16 - 30 years group (115 subjects) and 31 - 50 years group (220 subjects). The investigation techniques comprise some
modern methods used in the majority of research centres in the world: (Nephelometry and ELFA).
The obtained average values were as follows: IgG 11,62 3,44; IgA 2,120,9; IgM 1,170,53; IgE 199,41288,94;
C3 1,04 0,27; C4 0,260,08; CIC 4,648,43 for 16 - 30 years group and IgG 13,314,08; IgA 3,052,27; IgM
1,350,67; IgE 242,11288,4; C3 1,270,32; C4 0,320,14; CIC 4,668,13 for 31 - 50 years group.
Our results regarding the establishment of the reference values for the studied parameters will clearly improve the
medical act by adapting the output results to our country population characteristics.
FLOWCYTOMETRIC DETERMINATION OF SOME FUNCTIONAL

PARAMETERS OF HUMAN PERIPHERAL BLOOD LYMPHOCYTES
Ceciclia Galatiuc, Mirela Hirt, Marinela Bostan
Center of Immunology, Virology Institute Stefan S. Nicolau, Bucharest, Romania
Besides the major objective of establishing a National Register of confidence values, with wide diagnostic and therapy monitoring applications, our involvement in the general effort of evaluation of immunologic parameters in adult
Romanian population determined also the selection and standardization of immunologic tests applicable in fundamental research and for diagnostic purposes. Previously we comunicated results demonstrating the possibility of substituting radioactive tests [reclaming the existence of specially equipped areas and qualified personnel, polluting and
producing residums hard to eliminate], by simpliest cytometry or cytofluorometry techniques.
This work demonstrates [on 50 healthy donors (34 F/16 M) with ages between 30-51 years], the possibility to use
an exclusive cytofluorometric minimal fenotypic and functional battery of tests. By initially labeling of peripheral blood
lymphocytes isolated by B yum's technique of density gradient centrifugation with fluorescent linkers (PKH26 or
PKH67) followed by short or long term cultivation, FacScan analysis and estabilishing proliferative indices by the means
of CellCensus Plus program we obtained, regardless to the nature of stimulator used, results comparable to those from
classical radioisotopic determinations, and supplemental information regarding the offspring of stimulated cells and the
cell cycle of individual subpopulations. More than that, different linker labelled effector and target cells in a 4 hr cytotoxicity test alowed conjugate formation evaluation, the percent of target killing for a large E:T raports. A comparison
of results obtained by classical Cr51 release tests by Cytotox96 Non-Radioactive Cytotoxicity Assay and cytofluorometry was made.
106
Abstracts
DETECTING SYPHILIS IN BLOOD DONORS

BY IMMUNOLOGICAL INVESTIGATIONS
Lucica Rosu1, Sevastiana Bran2, Ovidiu Zlatian1, Alexandra Rosu1, M.E. Frumosu1
1
University of Medicine and Pharmacy, Craiova, Faculty of Medicine, Department of Microbiology-Immunology;

2
Regional Center for Blood Conservation and Transfusion, Craiova, Romania
INTRODUCTION
Syphilis (lues) is an infectious disease sexually transmitted in the most cases, nowadays with an increasing incidence
especially in young persons, with an unpredictable evolution. The sanitary legislation imposes the mandatory serological testing of blood donors for assuring the transfusion security. Our study proposes to investigate the incidence of
syphilis in donors from the Oltenia area in the last 7 years.
MATERIAL AND METHOD
The investigations were performed on a lot of 15.637 persons with ages between 15-64 years, presented for blood
donation at Regional Center for Blood Conservation and Transfusion (CRCTS) Craiova, Romania, in the period
1.01.2000-31.12.2006. The donors underwent some immunological investigations for detecting and confirmation of lues
(VDRL, RPR-C, TPHA, ELISA).
RESULTS
The data collected were interpreted by years of study and associated with sex and age group of the patients. The
results show an incidence of 2,31 % of lues among donors, with a decrease along the years; the morbidity is greater in
men (67 %), in persons aged between 25 and 34 years (37,40 %) and between 35-44 years (31,58 %).
CONCLUSIONS
Donation of blood for therapeutic purposes is a humanitarian and voluntary gesture. Because it can carry infectious
agents, as Treponema pallidum, it is mandatory to perform the immunological tests for detecting and exclusion from
donation of lues seropositive persons for assuring the transfusion security.
THE ROLE OF IMMUNOLOGICAL INVESTIGATIONS

IN DETECTING PERSONS INFECTED WITH HEPATITIS VIRUSES
Lucica Rosu, B.M. Bran, O. Zlatian, M.E. Frumosu, Alexandra Rosu, Andreea Ilie
University of Medicine and Pharmacy, Craiova, Romania, Faculty of Medicine, Department of Microbiology-Immunology
OBJECTIVES
Blood represents an important source of transmission for some infectious agents, including hepatitis viruses. Our study
analyses the morbidity by B and C hepatitis viruses infection of blood donors from the Oltenia area in the last 7 years.
MATERIAL AND METHOD
We have investigated a group of 15,637 persons aged between 15-64 years, who presented for blood donation to
Regional Center for Blood Transfusion and Preservation (CRCTS) Craiova, Romania, in the period 1.01.2000-31.12.2006.
We investigated the presence in the peripheral blood of HBs antigen and anti-HCV antibodies using ELISA method.
RESULTS
We observed a high incidence of morbidity by B and C hepatitis of 6,27 %. The HBs antigen was detected in 5,13
% from the tested donors, with a frequency of 77 % in men. The morbidity was increased in persons with age between
35-44 years (33,04 %) and 24-34 years (28,93 %). We observed a progressive decrease of the HVB morbidity in donors
from 12,25 % in the year 2000 to 4,17 % in the year 2006. The global incidence of morbidity by HCV infection in blood
donors was 1,14 %, with variable evolution along the years, from 1,30 % in the year 2000 to 2,13 % in 2001 and a slow
decrease towards 1,30 % in 2006, without a significant difference between the sexes. The anti-HCV antibodies were
detected in 39,89 % of persons aged between 35-44 years and 32,02 % in 45-54 years age group.
CONCLUSIONS
This study offers information about morbidity by B and C viral hepatitis in blood donors, apparently healthy persons
but with transfusion risk. These investigations help to detect persons infected with hepatitis viruses, establishing the therapy and prophylaxis.
107
PNEUMOCOCCAL SENSIBILITY TO PENICILLIN MEASURED

BY FLOW-CYTOMETRY
Crina Stavaru, Marina Pana, Maria Ghita, Vasilica Ungureanu, Melania Grosu,
Adina Daniela Iancu, Dorel Lucian Radu
NIRDMI Cantacuzino
INTRODUCTION
Streptococcus pneumoniae (S. pneumoniae) represents a major cause of pneumonia, otitis, septicemia and meningitis. The aim of this study was to evaluate the penicillin resistance of different S. pneumonia strains by flow-cytometry
compared with the known established methods.
MATERIAL AND METHODS
The following pneumocccal strains were tested: S. pneumoniae R6, S. pneumoniae ATCC49619, and 3 patient isolated resistance strains with different penicillin minimal inhibitory concentration (MIC). Initially, the bacterial strains
were analyzed by standard agar dilution method. Afterwards the 24 hour pneumococcal strain cultures were treated for
8 hrs with penicillin at standard MIC, then stained with propidium iodide.
RESULTS
Flow-cytometry preliminary results showed the bactericidal effect of penicillin after 8 hrs incubation with antibiotic compared with the established methods which provide those results after 48 hours.
CONCLUSION
This alternative method of bacterial antibiotic sensibility testing may be a useful tool for clinical practice.
THEORETICAL CONSIDERATIONS REGARDING

ACTIVATORY AND/OR INHIBITORY SIGNAL HIERARCHY
IN NATURAL CYTOTOXIC FUNCTION REGULATION
Cecilia Galatiuc
Center of Immunology, Stefan S. Nicolau Institute of Virology, Bucharest, Romania
Previously we demonstrated negative regulation of natural cytotoxic function of NK cells, mediated by immunoglobulin (Ig) molecules of IgG, IgA and IgM classes, after interaction with complementary Fc receptors (FcR). Binding specificity, dose/effect curves, the kinetic ligand and receptor shedding, and the intracellular signal transduction were analyzed.
A model of Fc R and/or antigen receptor signal hierarchy was imposed by the coexistence on NK cell membrane of
two types of Fc receptors Fc RIIIA and Fc RIIc). Both these Fc Rs interact with the same molecule [i.e. monomeric
cytophilic IgG (IgGm)]. We tried to explain they induced divergent intracellular signalling, [i.e. suppressory for physiological ligand (mIgG), or activatory for pharmacological ligand (3G8)]. We discuss these apparently insurmountable
problems in the light of accumulating literature about some particular cases which are not in agreement with the standard model of natural immunity regulation through receptors signalling through receptor thyrosine based activatory
motifs (ITAM).
The flexibility of ITAM based signaling mechanisms allowing a close and differential regulation of activatory and
inhibitory signals allows the reinterpretation of presented data, and opens new ways for therapeutical manipulation of
natural cytotoxicity.
108
Abstracts
FUNCTIONAL MODIFICATION AFTER THE TREATMENT

OF NK CELLS WITH SYNTHETIC PEPTIDES AND IGG FRAGMENTS
M. Hirt, C. Galatiuc, M. Bostan, G. Matei, L. I. Brasoveanu
Center of Immunology, Stefan S. Nicolau Institute of Virology, Bucharest, Romania
Interactions of human NK cells, via FcgRIIIA on the NK cells surface with ligands by immunoglobulinic type, can have
an inhibitory effect on the cytotoxic activity of these cells. The occupation of the Fc?RIIIA receptors, initiated the intracellular signaling cascade, followed by the affectation of cytotoxic function of NK cells. This adjustment of cytotoxic function of NK cells by IgG, takes place after interaction between FcgRIIIA and specific situs present in the IgG molecules.
The studies which demonstrated the localization and the characterization of the responsible situs for cytophilic
property, were investigated using fragments resulted through enzymatic digestion of IgG molecules or a number of the
synthetic peptides with aminoacids sequences presented in constant region of IgG molecules.
A consequence of the Fc?RIIIA interactions with specific ligands (mIgG or her fragments), is the starting of an early
process of phosphorylation and the activation of three protein tyrosine kinase (Lck, Lyn and Syk).
Because the activation of these kinases takes place following by the treatment of NK cells only with Fc fragment, is a
proof that the responsible situs for cytophilic property is localized in this domain. These results are supported by the information obtained by following the use of the Y75 synthetic peptides, with Tyr407-Arg416 sequences, which is the only
capable to jam on the binding of the IgG molecule with Fc?RIIIA and to unleash the activation of LCK tyrosine kinase.
To characterize and to localize the binding of situs on the IgG more exactly, even to identify the aminoacids with
an important role in the making of this situs, were used more synthetic peptides with sequences from different reactive
parts of Fc fragment of IgG.
IMMUNOLOGICAL PROPERTIES OF PROBIOTICS:

PROTECTION AGAINST EXPERIMENTAL BACTERIAL INFECTION AND
INDUCTION OF CYTOKINE SECRETION
Catalin Tucureanu1, Diana Pelinescu2, Lucian Lerescu1, Tatiana Vassu Dimov2,
Raluca Boghean1 and Aurora Salageanu1
1
National Institute for Research and Development in Microbiology and Immunology Cantacuzino,
2
MICROGEN Group, Faculty of Biology , University of Bucharest, Romania
Probiotics beneficially affect the host in different manners, among which stimulation of the immune system is of
major importance. The aim of the present study was to assess the immunological properties of certain strains of probiotics using in vitro and in vivo models. The protective role of several Lactobacillus strains was determined against an
experimental murine intestinal infection with Salmonella enteritidis serovar Typhimurium. BALB/c mice received viable
lactic bacteria by gavage (intragastrical intubation). After 72 h, mice were challenged by the same route of administration with a lethal dose of S. typhimurium (NCTC 3718). Survival was monitored for 16 days. Results indicate that mice
receiving Lactobacillus plantarum CMGB 3, Lactobacillus acidophilus CMGB 16 and Lactobacillus paracasei CMGB
15 had a statistically significant higher survival rate than control mice (p<0.001). The highest protection was noticed
for L. paracasei. By contrast, Enterococcus faecium CMGB 8 strain was pathogenic to mice. Cytokine induction in
human cell cultures (PBMC) stimulated with heat inactivated lactic bacteria was assessed by Multiplex immunoassay.
All the tested strains (including Enterococcus faecium) induced cytokine secretion; L. paracasei was the most potent
inducer of IFN-gamma while determining the lowest level of IL-10. Our results demonstrate the need for validation of
in vitro results by appropriate in vivo models.
109
NEURO-IMMUNE INTERFERENCES
IN HEROIN ADDICTS
Gina Manda1, Monica Neagu1, Carolina Constantin1, Ionela Neagoe1, Daniela Baconi2, Cristina Hudita3
Victor Babes National Institute of Pathology, Bucharest; 2University of Medicine and Pharmacy Carol Davila,
Bucharest; 3Centre of Evaluation and Treatment for Youth Sfantul Stelian, Bucharest
The study aims to evaluate the immune status in a group of heroin addicts volunteering for substitution therapy with
methadone.
For 21 patients we assessed in peripheral blood the following parameters: the mononuclear cells counts, the lymphocytes subsets , the activation potential of T and B lymphocytes, the soluble form of the T lymphocytes activation
marker CD25, the pattern of pro- and anti-inflammatory serum cytokines, the respiratory burst developed ex vivo by
granulocytes.
Our results indicate a normal distribution of the T and B lymphocytes populations, but we detected low levels of
peripheral NK cells, partially compensated by high proportions of B lymphocytes. The activation potential of T and B
lymphocytes proved to be within normal range. We point out the increased levels of the soluble form of CD25, which
were surprisingly negatively correlated with the activation potential of B lymhocytes. High counts of peripheral monocytes were recorded. Some of the investigated patients presented high levels of IL-12 in serum, which were negatively
correlated with the monocytes counts. Peripheral granulocytes respond normally when stimulated with E. coli, but
developed a decreased respiratory burst when challenged via PKC. Additionally, we detected low serum levels of IL-8,
which is a cytokine with chemotactic activity for neutrophils.
Our data reveal disturbances of the immune response in heroin addicts, especially at the level of the innate immune
component. Correlations with the health status, the psychiatric profile of heroin addicts and with the serum level of
heroin may provide additional information regarding neuro-immune interferences.
110
SUBJECT INDEX
IMMUNOLOGY
Bacterial product CANTASTIM derived from Pseudomonas aeruginosa induces migration and maturation of dendritic cells / Iuliana Cara, Ctlin ucureanu, Lucian Lerescu and Aurora Slgeanu
Systemic inflammatory markers in patients with aortic sclerosis

Mihaela Rugina, Iuliana Caras, Ruxandra Jurcut, Ciprian Jurcut, Francisca Serbanescu,
Aurora Salageanu and Eduard Apetrei
10
Adjuvant properties of bacterial product CANTASTIM

Iuliana Francisca Anghelache, Iuliana Caras and Aurora Salageanu
17
Melania Grosu, Crina Stavaru, D. Gutu and D.L. Radu
57
MICROBIOLOGY
Characterization of guanylate kinase from gram positive and gram negative microorganisms;
preliminary results / Ana-Maria Ruxandra Eftimie, Florina Toma, Adriana-Zoe Costache
and Nadia Bucurenci
22
Control of blood-transmitted infections in dentistry / Eugenia Aurora Negut, Monica Balteanu,

G. Ionescu, A. Bancescu, A. Iliescu and N. Skaug
26
First Detection of Human Metapneumovirus in Children with Respiratory Infections

in Romania" / Cristina Tecu, D. Orasanu, Aurora Sima, Maria Elena Mihai, V. Alexandrescu,
D. Matei and Narcisa Samoila
37
Virulence Characteristics of Escherichia coli Isolates From Children with Urinary Tract Infections /
Caliopsia Florea, Codruta-Romanita Usein, Maria Condei and Maria Damian
41
The maintaining of the Active Laboratory-based surveillance of the acute flaccid paralysis (AFP)
cases in Romania in the framework of the Strategic Plan of the Global Polio Eradication Initiative /
Anda Baicus, Ana Persu, Mariana Combiescu and A. Aubert-Combiescu
44
Detection of Serum Antibodies against Helicobacter Pylori using a Chromatographic Immunoassay

in Outpatients / Cecilia Bobo , Katalin Racz and Ileana Spnu
62
Virulence and resistance markers in clinical and environmental Aeromonas strains isolated
in Romania / Mariana Carmen Chifiriuc, Anca Michaela Israil, Cristina Larion,
Ionela Alexandru and Georgeta Dobre
69
111
Epidemiological surveillance of syphilis patients in Colentina Hospital (Bucharest, Romania) /

Carmen Slvstru, Alina Ruinoiu, Alina Prvu, Magdalena Constantin, Mihaela Panduru,
Gabriela Loredana Popa and George-Sorin iplica
80
A laboratory-based survey of Campylobacter infections in Prahova County /

Marilena Sorokin, Codruta-Romanita Usein, Mariana Irimia and Maria Damian
85
Fungal Control of Pathogenic Fungi Isolated From Wild Plants in Taif Governorate, Saudia Arabia /
Abou-Zeid A.M., Altalhi, A. D. and Abd El-Fattah, R.I
90
The 37TH NATIONAL CONFERENCE OF IMMUNOLOGY, IAI, 19-21 SEPTEMBER, 2007

ABSTRACTS
97
SUBJECT INDEX
111
AUTHOR INDEX
113
112
AUTHOR INDEX
A
ABD EL-FATTAH R.I.
ABOU-ZEID A.M.
ALEXANDRESCU V.
ALEXANDRU IONELA
ALTALHI A.D.
ANGHELACHE IULIANA FRANCISCA
APETREI E.
L
90
90
37
69
90
17
10
B
BICU ANDA
BLTEANU MONICA
BNCESCU A.
BOBO CECILIA
BUCURENCI NADIA
44
26
26
26
22
C
CARA IULIANA
CHIFIRIUC MARIANA CARMEN
COMBIESCU MARIANA
COMBIESCU-AUBERT A.
CONDEI MARIA
CONSTANTIN MAGDALENA
COSTACHE ADRIANA-ZOE
5, 10, 17
69
44
44
41
80
22
LARION CRISTINA
LERESCU L.
69
5
M
MATEI D.
MIHAI MARIA ELENA
37
37
N
NEGUT EUGENIA AURORA
26
O
ORANU D.
37
P
PANDURU MIHAELA
PRVU ALINA
PERSU ANA
POPA LOREDANA GABRIELA
80
80
44
80
R
RACZ KATALIN
RADU D.L.
RUGIN MIHAELA
RUINOIU ALINA
62
57
10
10
D
DAMIAN MARIA
DOBRE GEORGETA
41, 85
69
E
EFTIMIE RUXANDRA ANA MARIA
22
F
41
FLOREA CALIOPSIA
G
GROSU MELANIA
GUTU D.
S
SAMOIL NARCISA
SLGEANU AURORA
SLVSTRU CARMEN
SIMA AURORA
ERBNESCU FRANCISCA
SKAUG N.
SOROKIN MARILENA
SPNU ILEANA
STVARU CRINA
57
57
I
26
26
ILIESCU A.
IONESCU G.
IRIMIA MARIANA 85
ISRAIL ANCA MICHAELA
69
37
5,10,17
80
37
10
26
85
62
57
T,
TOMA FLORINA
ECU CRISTINA
IPLIC G.S.
UCUREANU C.
U
USEIN CODRUA-ROMANIA
82
37
80
5
41,85
J
JURCU RUXANDRA
JURCU C.
10
10
113
114

Romanian Archives: Microbiology Immunology

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Romanian Archives: Microbiology Immunology

Uploaded by

Copyright:

Available Formats

ROMANIAN ARCHIVES

VOLUME 66 - Nos. 3-4

ROMANIAN ARCHIVES OF MICROBIOLOGY AND IMMUNOLOGY

Chief Editor: Dorel Lucian RADU

Editorial Board: Cornelia CEIANU, Maria DAMIAN, Emilia LUPULESCU,

TOTAL PUBLISHING HOUSE

ROMANIAN ARCHIVES OF MICROBIOLOGY AND IMMUNOLOGY

AND RESISTANCE MARKERS IN CLINICAL AND ENVIRONMENTAL AEROMONAS STRAINS

SURVEILLANCE OF SYPHILIS PATIENTS IN COLENTINA HOSPITAL (BUCHAREST, ROMANIA)

LABORATORY-BASED SURVEY OF CAMPYLOBACTER INFECTIONS IN PRAHOVA COUNTY

CONTROL OF PATHOGENIC FUNGI ISOLATED FROM WILD PLANTS IN TAIF GOVERNORATE,

37TH NATIONAL CONFERENCE OF IMMUNOLOGY, IAI, 19-21 SEPTEMBER, 2007

ROMANIAN ARCHIVES OF MICROBIOLOGY AND IMMUNOLOGY

3) Introduction containing a description of the problem under

PANCREATIC BETA CELL ALLOTRANSPLANT IN DOUBLE

"Cantacuzino" National Institute of Research and Development for Microbiology

Various animal models have been extensively used

performed using a syringe equipped with a 27 G needle.

Fig. 4 Glucose plasmatic level of intra-portal re-transplanted diabetic mouse.

Fig. 5 Liver haematoxillin-eosin stain section

lin injection depends on sufficient islet transplantation.

Fig. 6 Van Gieson stain of liver section

DETECTION OF SERUM ANTIBODIES AGAINST HELICOBACTER PYLORI

University of Medicine and Pharmacy, Cluj-Napoca, Romania

place from one person to another by oral or fecal-oral

Fig. 1 - Positive and negative serologic tests carried out in outpatients

human IgG and particles covered with Helicobacter

Fig. 2 - Age distribution of the tested subjects

Fig. 3 - Sex distribution related to positive serologic tests

(5,6,7,8). It should be considered that in the present

(21.4%) had antibodies against Helicobacter pylori,

Fig. 4 - Age distribution of the positive serologic tests

Fig. 5 - Clinical diagnosis in positive serologic tests

tis or in biliary diseases, suggesting a possible role

Fig. 6 - Age distribution related to clinical diagnosis in positive serologic tests

dren, their sensitivity and specificity being considered

An association was noted between the presence of

conversion. A single noninvasive test in the population

32. Shirin H, Bruck R, Kenet G, Krepel Z, Wardi Y, Reif S et

VIRULENCE AND RESISTANCE MARKERS IN CLINICAL AND

al infection) (21), ocular (orbital cellulitis, keratitis

*Corresponding author: carmen_balotescu@yahoo.com

frequently misidentified Aeromonas strains as: V.

after 6 hours incubation at 35-37 oC, the filter was plated

virulence factors. The adherence to biotic substrate

one single replica incubated at the classical temperature of 37oC.

(97%) oxidase positive and 9 (3%) oxidase-negative.

ii. Virulence factors

Fig. 1. Expression levels of virulence factors at different incubation temperatures

ability of adaptation at 4 oC temperature but exhibited

origin exhibited similar levels of R for ampicillin and

must be mentioned that all three strains carrying two

Fig. 2. Susceptibility concordance data

Fig. 3. Susceptibility concordance data between disk

Fig. 4. Susceptibility concordance data

Fig. 5. Susceptibility concordance data

Fig. 6. Susceptibility concordance data

year, out of which Aeromonas exhibited the highest

The adherence on biotic and abiotic (slime test)

ROMANIAN ARCHIVES OF MICROBIOLOGY AND IMMUNOLOGY

fying the presence of growth and virulence ability of

vival and cultivability of the strains, as demonstrated

stant resistance to AMP/AMX, S,CT,K, AK, TMP /SMX,