Characterization of Na/HCO3 cotransporter isoform NBC-3

HASSANE AMLAL,1 CHARLES E. BURNHAM,1 AND MANOOCHER SOLEIMANI1,2

of Nephrology, Department of Internal Medicine, University of Cincinnati,
and 2Veterans Affairs Medical Center, Cincinnati, Ohio 45267-0585

1Division

Amlal, Hassane, Charles E. Burnham, and Manoocher Soleimani. Characterization of Na/HCO3 cotransporter isoform NBC-3. Am. J. Physiol. 276 (Renal Physiol.
45): F903F913, 1999.Na-HCO3 cotransporters mediate
the transport of HCO3 into or out of the cell. Two Na-HCO3
cotransporters (NBC) have been identified previously, which
are referred to as NBC-1 and NBC-2. A cDNA library from
uninduced human NT-2 cells was screened with an NBC-2
cDNA probe. Several clones were identified and isolated.
Sequence analysis of these clones identified a partial coding
region (2 kb) of a novel NBC (called here NBC-3), which
showed 53% and 72% identity with NBC-1 and NBC-2,
respectively. Northern blot analysis revealed that NBC-3
encodes a 4.4-kb mRNA with a tissue distribution pattern
distinct from NBC-1 and NBC-2. NBC-3 is highly expressed
in brain and spinal column, with moderate levels in trachea,
thyroid, and kidney. In contrast with NBC-1, NBC-3 shows
low levels of expression in pancreas and kidney cortex. In the
kidney, NBC-3 expression is predominantly limited to the
medulla. Cultured mouse inner medullary collecting duct
(mIMCD-3) cells showed high levels of NBC-1 and low levels
of NBC-3 mRNA expression. Subjecting the mutagenized
mIMCD-3 cells to sublethal acid stress decreased the mRNA
expression of NBC-1 by 90% but increased the Nadependent HCO3 cotransport activity by 7-fold (as assayed
by DIDS-sensitive, Na-dependent, HCO3-mediated intracellular pH recovery). This increase was associated with 5.5fold enhancement of NBC-3 mRNA levels. NBC showed
significant affinity for Li in the mutant but not the parent
mIMCD-3 cells. On the basis of the widespread distribution of
NBC-3, we propose that this isoform is likely involved in cell
pH regulation by transporting HCO3 from blood to the cell.
We further propose that enhanced expression of NBC-3 in
severe acid stress could play an important role in cell survival
by mediating the influx of HCO3 into the cells.
kidney; acid-base; sodium-bicarbonate cotransporter; NBC-1;
inner medullary collecting duct cells

SODIUM-BICARBONATE COTRANSPORTERS (NBC) were first

described in the kidney proximal tubule (7, 8, 26, 31).
Subsequent studies have shown their presence extends
to numerous other tissues, including brain, liver, cornea, heart, and lung (12, 1618, 21, 23), suggesting
that NBC plays an important role in mediating HCO3
transport in both epithelial as well as nonepithelial
cells. In addition to reabsorption of HCO3 in proximal
tubule, NBC also plays an important role in cell pH
regulation in various tissues by transporting HCO3
from blood to the cell (7, 8, 12, 1618, 21, 23, 26, 31).
The expression of NBC in epithelial tissues is restricted
to the basolateral membrane (7, 8, 1618, 23, 26, 31).

Functional data suggest the presence of more than

one NBC isoform, as judged by direction and stoichiometry of the transporter. In kidney, NBC activity leads to
cell acidification, whereas in other tissues (liver and
heart) its function leads to cell alkalinization (7, 8, 12,
1618, 21, 23, 26, 31). Furthermore, NBC has a stoichiometry of 3 equivalents of HCO3 per Na ion in the
proximal tubule, but shows a stoichiometry of 2 HCO3
per Na in other tissues (16, 31, 32, 33, 36). The
stoichiometry of NBC plays an important role in determining the direction of the flux. In the kidney proximal
tubule, a stoichiometry of 3 HCO3 per 1 Na causes
membrane potential driven efflux against uphill chemical gradients for Na and HCO3 (32, 33, 36); whereas in
liver and heart, a stoichiometry of only 2 HCO3 per Na
leads to the inward movement of Na and HCO3 (12,
17, 18).
Recent cloning experiments have identified two NBC
isoforms, NBC-1 and NBC-2 (9, 20, 28). NBC-1, which
was cloned from human and amphibian kidney, mediates an electrogenic, Na-dependent HCO3 cotransport
that is inhibitable by DIDS (9, 28). Human NBC-1
encodes a 7.6-kb mRNA, whereas amphibian NBC-1
encodes a 4.2-kb mRNA (9, 28). Human NBC-1 shows
highest levels of expression in kidney and pancreas
with lower levels in brain (9). In the kidney, NBC-1 is
predominantly expressed in the proximal tubule (1, 10,
29) and shows adaptive mRNA regulation in rats
subjected to HCO3 loading (10), potassium deprivation
(4), or glucocorticoids (3). Pancreatic NBC-1 is a splice
variant of kidney NBC-1 and is expressed in both
acinar and ductal cells (2). A recent report indicated
cloning of a new NBC isoform, NBC-2, from a human
retina cDNA library (20). NBC-2 encodes an 8.5-kb
mRNA and shows highest expression in testis and
spleen and moderate levels of expression in intestine,
colon, and muscle (20). Functional properties of NBC-2
have not been described.
The purpose of the current experiments was to
identify other possible members of NBC family and
study their expression and regulation. Accordingly, a
human NT-2 cell cDNA library was screened with
NBC-2 cDNA. Positive clones were identified, isolated,
and sequenced. The results indicated a novel NBC
cDNA isoform, called here NBC-3. NBC-3 is highly
expressed in the central nervous system and shows
differential regulation vs. NBC-1 in cells subjected to
severe acid stress. NBC-3 is likely involved in cell pH
regulation by transporting HCO3 from blood to the cell.
EXPERIMENTAL PROCEDURES

The costs of publication of this article were defrayed in part by the

payment of page charges. The article must therefore be hereby
marked advertisement in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.

Isolation of human NBC-3 cDNA. A cDNA library (prepared from uninduced, exponentially growing testicular teratocarcinoma neuroepithelial cells; Ntera-2/c1.D1, NT-2 cells,
cloned into the ZAP Express vector) was purchased from

0363-6127/99 $5.00 Copyright r 1999 the American Physiological Society

F903

F904

NBC-3 EXPRESSION AND REGULATION

Stratagene (La Jolla, CA) and screened at high stringency

using a 1.48-kb 32P-labeled cDNA probe prepared by PCR
amplification of an expressed sequence tag cDNA clone
(GenBank accession no. AA216661) encoding a part of human
NBC-2, purchased from the American Type Culture Collection. The primers GACGAGTCCATACGAGAG and CCATGATGACCACAAGCTGAC were used to amplify the NBC-2 probe
from the NBC-2 expressed sequence tag clone. Nylon membranes were used to lift plaques in duplicate from plates.
DNA was denatured by incubation of the membranes (57
min) in 0.5 N NaOH, 1.5 M NaCl. Then the membranes were
neutralized by soaking 5 min in 1 M Tris-Cl, pH 8, followed by
5 min in 1 M Tris-Cl, pH 8, 1.5 M NaCl. This was followed by a
rinse in 2 SSPE. After ultraviolet cross-linking, the membranes were dried. They were then soaked overnight with
gentle agitation in a 65C prehybridization solution containing 5 Denhardts BSA, 6 SSPE, 0.1% SDS, and 100 g/ml
carrier DNA. The following day, freshly labeled probe was
added, and the hybridization was continued until the next
morning. The membranes were then washed twice for 10 min
each in 2 SSPE 0.1% SDS at room temperature. A third
wash for 30 min at 65C in 1 SSPE 0.1% SDS was
followed by a brief rinse in 2 SSPE at room temperature
before exposure to film. Following plaque-purification and
conversion to plasmid form (pBK-CMV), DNA sequence analysis was performed on six clones at the University of Cincinnati DNA Core, using dye-termination technology. The largest insert (5.5 kb) contained part of the coding region of a
novel member of the Na-HCO3 cotransporter family, NBC-3.
A second clone contained a 2-kb insert that included the 58
end of the coding region of NBC-3. The other four clones
contained smaller inserts that were included in the two larger
clones (the 5.5-and the 2-kb clones). The cloned cDNA represents a partial sequence of a new NBC isoform (we refer to
this as NBC-3).1 A recent study reported the cloning of a
full-length cDNA that shows complete homology to our NBC-3
(24). However, no functional studies were performed to examine the identity of the cloned cDNA.
RNA isolation. RNA was extracted from rat kidney cortex
and medulla or cultured mIMCD-3 cells, using TriReagent
(Molecular Research, Cincinnati, OH) according to the manufacturers instructions. The extracted RNA was dissolved in
Formazol, quantitated spectrophotometrically, and stored at
80C.
Northern hybridization. Total RNA samples (30 g/lane)
were fractionated on 1.2% agarose-formaldehyde gels and
transferred to nylon membranes. RNA was covalently bound
to the nylon membranes by ultraviolet cross-linking (14). The
human multiple tissue blots containing 2 g of poly(A) RNA
(normalized for identical -actin expression in each lane)
were purchased from Clontech. Hybridization was performed
according to the method of Church and Gilbert (15). Briefly,
membranes were preprehybridized for 1 h in 0.1 SSPE
1% SDS solution at 65C. The membranes were then prehybridized for 13 h at 65C with 0.5 M sodium phosphate
buffer, pH 7.2, 7% SDS, 1% BSA, 1 mM EDTA, and 100 g/ml
1 While this manuscript was under review, two independent entries
into the GenBank (accession nos. AF069512 and AB018282) reported
sequences identical to our NBC-3 cDNA. An alignment of our cDNA
clone with these two other cDNAs showed perfect match. The 58 end
of our cDNA sequence shows perfect match to the AF069512 sequence. However, the AB018282 sequence contains an extended 58
coding region of 300 nucleotides that replaces the first 63 nucleotides of the two other cDNAs (the current NBC-3 sequence and the
AF069512 sequence) and likely represents an alternative splice
variant of NBC-3.

sonicated carrier DNA. Thereafter, the membranes were

hybridized overnight in the above solution with 32P-labeled
DNA probe for NBC-1, NBC-2, or NBC-3. The cDNA probes
were labeled with 32P-labeled deoxynucleotides using the
RadPrime DNA labeling kit (GIBCO-BRL). The membranes
were washed twice in 40 mM sodium phosphate buffer, pH
7.2, 5% SDS, 0.5% BSA, and 1 mM EDTA for 10 min at 65C,
washed four times in 40 mM sodium phosphate buffer, pH 7.2,
1% SDS, and 1 mM EDTA for 10 min at 65C, exposed to a
PhosphorImager screen at room temperature for 2472 h,
and read by a STORM PhosphorImager (Molecular Dynamics). Densitometric scanning of the blots was performed on
the PhosphorImager. For purpose of quantitation, blots from
mIMCD-3 cells or rat kidney were first probed with NBC-1,
NBC-2, or NBC-3 and then with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA. For NBC-1, the fulllength cDNA was used as a specific probe. For NBC-2, the
probe was generated by PCR amplification of an EST cDNA
fragment (GenBank accession no. AA216661) that encodes
nucleotides 82808 and is a part of human NBC-2. For
NBC-3, a 3-kb Sst I fragment from the 5.5-kb cDNA or a
700-bp fragment from the 2-kb cDNA was used as a probe.
The respective NBC probes recognize appropriate size mRNAs
on high-stringency Northern blots that were performed on
RNA isolated from normal or acid-stressed mIMCD-3 cells
(7.6-kb message for NBC-1 and 4.4-kb message for NBC-3).
A more specific 700-bp NBC-3 cDNA probe (corresponding to
nucleotides 9001600) also recognized the 4.4-kb message as
the only transcript in mIMCD-3 cells.
RT-PCR of NBC-2 on the RNA of mIMCD-3 cells. RNA (2
g) from control and acid-stressed cells was subjected to
RT-PCR using an oligo-dT reverse transcriptase primer and
mouse NBC-2-specific primers for the PCR. Amplification
across an intron-exon junction ensured selectivity for mRNA
vs. genomic DNA. The mouse-specific primers were 58-GACCGTATCAAGTTTGG and 58-CAAGCCAACTGAGTTCTCTC.
Cycling parameters were as follows: 30 cycles of 94C, 30 s;
57C, 1 min; 72C, 2 min.
Cell culture procedures. mIMCD-3 cells (which were developed from the inner medullary collecting duct cells of simian
virus transgenic mice and retain many characteristics of this
nephron segment, Ref. 27) were cultured in a 1:1 mixture of
Hams F-12 and DMEM (DMEM-F12) containing 2.5 mM
L-glutamine and 2.438 g/l sodium bicarbonate (GIBCO-BRL)
supplemented with 50 U/ml penicillin G, 50 g/ml streptomycin, and 10% fetal bovine serum. Cultured mIMCD-3 cells and
cells subjected to sublethal acid stress were incubated at 37C
in a humidified atmosphere of 5% CO2 in air. The medium was
replaced every other day.
Sublethal acid stress. Cells that were subjected to modified
acid-suicide selection (sublethal acid stress) were grown as
described (5, 30). We have referred to these cells in the past as
NHE2d or mutant cells based on the downregulation of
NHE-2 isoform in response to sublethal acid stress (5, 30).
Briefly, actively proliferative, subconfluent mIMCD-3 cells
were treated for 16 h with the mutagen ethylmethylsulfonic
acid (EMS) at 500 g/ml and then subjected to a modified
protocol of lethal acid stress (30). Following treatment with
EMS, mIMCD-3 cells were grown to confluence, trypsinized,
centrifuged at room temperature, and loaded with NH4 by
incubation for 10 min at 37C in an ammonium-containing
solution that consisted of 20 mM NH4Cl, 120 mM tetramethylammonium chloride (TMA-Cl), 5 mM KCl, 5 mM glucose,
and 5 mM HEPES-Tris, pH 7.40. The cells were then acid
loaded by incubation for 30 min in an NH4-free solution that
consisted of 125 mM TMA-Cl, 5 mM KCl, 5 mM glucose, and
20 mM HEPES-Tris, pH 5.5. Thereafter, cells were pelleted,

NBC-3 EXPRESSION AND REGULATION

Table 1. Composition of experimental solutions

Solutions
A

NaCl
KCl
LiCl
TMA-Cl
115
KHCO3
25
K2HPO4
0.8
KH2PO4
0.2
CaCl2
1
Ca gluconate
MgCl2
1
Mg gluconate
HEPES
10
NH4Cl
NMG gluconate

115
25

115
115

95
25
0.8
0.2
1

25
0.8
0.2
1

115

10
20

10

25
0.8
0.2
1

25
0.8
0.2
1

10

10

10

0.8
0.2
1

25
0.8
0.2
1
1
10
115

All concentrations are in mM. Solutions A, B, C, E, F, and G were

bubbled with 5% CO2-95% O2 ; solution D was gassed with 100% O2 .
pH was adjusted to 7.40 with Tris. TMA, tetramethylammonium;
NMG, N-methyl-D-glucamine.

washed, and incubated for 120 min at 37C in a solution with

a very low concentration of Na (5 mM NaCl) that, in
addition, consisted of 120 mM choline chloride, 5 mM KCl, 5
mM glucose, and 20 mM of MES at pH 6.0. The cells were
then centrifuged, recovered, and seeded to culture-grade
plastic dishes in DMEM-F12 medium (pH 7.40) for 10 days.

F905

Cells were subjected while in suspension to two more rounds

of acid stress, with each selection event separated from its
predecessor by 10 days. The cells were subcultured and
passaged at very high dilutions (1:1,000) to isolate individual
colonies. A number of individual colonies were isolated with
cloning cylinder, then collected and subcultured. One strain
(NHE2d) was studied in details for NHE isoform expression
(30), H-ATPase activity (5), and the current studies. In
addition to the parent cells, three individual colonies from
cells not subjected to acid stress were obtained (using trypsinization and passage at very high dilution followed by isolation
with cloning cylinder). These strains showed a pattern of
NBC expression very similar to the uncloned parent cell line.
These results suggest that overexpression of NBC-3 and
suppression of NBC-1 in stressed cells could represent true
adaptive regulation of these transporters by acid stress.
Equally plausible, however, is the possibility that the differential regulation of NBC-1 and NBC-3 could be due to a
combination of EMS-induced mutagenesis and acid-suicide.
Intracellular pH measurement. Changes in intracellular
pH (pHi ) were monitored using the acetoxymethyl ester of the
pH-sensitive fluorescent dye 28,78-bis(2-carboxyethyl)-5(6)carboxyfluorescein (BCECF-AM) as described (6, 34, 35).
mIMCD-3 cells and cells that were recovered from sublethal
acid stress were grown to confluence on coverslips and
incubated in the presence of 5 M BCECF in a Na-free
solution that consisted of 115 mM TMA-Cl and 25 mM
KHCO3, pH 7.4 (solution A, Table 1). pHi was measured in a
thermostatically controlled holding chamber (37C) in a Delta

Fig. 1. Nucleotide sequence of the human Na-HCO3 cotransporter NBC-3 cDNA (see RESULTS ). Stars indicate the
ends of the 700-bp probe used for Northern hybridizations. Sequence has been assigned GenBank accession no.
AF107099.

F906

NBC-3 EXPRESSION AND REGULATION

Scan dual-excitation spectrofluorometer (PTI, South Brunswick, NJ). The monolayer was then perfused with the appropriate solutions (Table 1). The fluorescence ratio at excitation
wavelengths of 500 and 450 nm was utilized to determine pHi
values in the experimental groups by comparison to the
calibration curve that was generated by KCl/nigericin technique. The fluorescence emission was recorded at 525 nm.
The Na-HCO3 cotransporter activity was determined as the
initial rate of the DIDS-sensitive, Na-dependent pHi recovery (dpHi/dt, pH/min) in a HCO3-containing solution (Table 1,
solution C) following an acid load induced by NH3/NH4
loading (Table 1, solution B) and withdrawal (Table 1, solution A). The experiments were performed in the presence of 1
mM amiloride to block the Na/H exchanger activity. Glucose was deleted from the solutions to minimize the contribution of H-ATPase to pHi recovery from acidosis (5). The
initial rate of pHi recovery (dpHi/dt, pH/min) following intracellular acidosis was calculated by fitting to a linear equation
the first 30 s of the time course of pHi recovery. Correlation
coefficients for these linear fits averaged 0.98 0.01. The
representative and bar graph experiments were compiled
from data from a single acid-stressed clonal line.
Materials. DMEM-F12 medium was purchased from Life
Technologies. BCECF was from Molecular Probes. Amiloride,
DIDS, nigericin, and other chemicals were purchased from
Sigma Chemical. 32P was purchased from New England

Nuclear (Boston, MA). The GIBCO-BRL RadPrime DNA

labeling kit was purchased from Life Technologies.
Statistics. Results are means SE. Statistical significance
between experimental groups was assessed by Students
t-test or by one-way analysis of variance. P 0.05 was
considered significant.
RESULTS

Partial sequence of NBC-3 cDNA. Figure 1 shows the

partial nucleotide sequence (encompassing 2 kb) and
conceptual translation of NBC-3. The sequence shows
an in-frame stop codon prior to the initial methionine
codon indicating that the clone contains the 58 end of an
NBC-3 cDNA coding region. The remainder of the
5.5-kb sequence (not shown) did not correlate with any
known gene and is likely to be the second half of a cDNA
double insert. A separate 2-kb NBC-3 cDNA clone was
identified that spans the entire coding region of the
5.5-kb cDNA and contains the 58 end of NBC-3 cDNA
clone. The absence of a cDNA region encoding the terminal transmembrane regions common to other members of this gene family suggests that the 38 end of the
message is missing from both of the cDNA clones (see
Footnote 1). An analysis of the amino acid translation of

Fig. 2. Alignment of human NBC-3, NBC-2, and NBC-1. An analysis of the deduced amino acid translation of
NBC-3 shows 72% identity with NBC-2 and 53% identity with NBC-1. Black boxes indicate areas of identical amino
acids in all 3 isoforms. Uppercase letters indicate conserved domains among the NBC isoforms. Lowercase letters
indicate areas of divergence.

NBC-3 EXPRESSION AND REGULATION

F907

Fig. 3. A and B: tissue distribution of human NBC-3 mRNA. C: NBC-3 mRNA expression in cortex and medulla of
rat kidney; phosphorImager hybridization signal from NBC-3 of four cortices and medullas are shown. D:
NBC-3/GAPDH mRNA ratio in cortex vs. medulla.

the open-reading frame shows 72% and 53% identity

with NBC-2 and NBC-1, respectively, as shown in Fig. 2.
Northern blots. Two human multiple tissue Northern
blots (Clontech) were probed with a 32P-labeled NBC-3
cDNA. Figure 3A shows that a 4.4-kb mRNA in human
brain hybridized strongly with the probe, indicating a
high level of NBC-3 expression in the central nervous
system. A moderate band was detected in kidney and
skeletal muscle. The expression of NBC-3 was very faint in
the pancreas. In addition to the 4.4-kb band, two other
transcripts at 9 and 3 kb were also detected in the
brain. Figure 3B shows strong expression of the 4.4-kb
mRNA in human spinal column followed by adrenal
gland and lymphoid tissue. A moderate band was
detected in thyroid and trachea. Similar to the brain,
two other transcripts at 9 and 3 kb were also detected in
the spinal column and adrenal gland. Figure 3C examines
the expression of NBC-3 in rat kidney cortex and
medulla. As indicated, NBC-3 mRNA is predominantly
expressed in the medulla, with NBC-3-to-GAPDH
mRNA ratio being 2.8 0.3-fold higher in the medulla
vs. cortex (Fig. 3D) (n 4 for each group, P 0.04).
Effect of acid stress on the expression of NBC isoforms
in mIMCD-3 cells. The expression and regulation of
NBC isoforms in the kidney inner medulla was next

examined. Normal cultured mIMCD-3 cells were subjected to sublethal acid stress and examined. The
Northern blot in Fig. 4A indicates high levels of NBC-1
mRNA expression in control (parent) mIMCD-3. Figure
4A further indicates that cells subjected to acid stress
showed significant reduction in NBC-1 mRNA expression. Figure 4B demonstrates that NBC-1 mRNA levels
were decreased by 90% in acid-stressed cells (n 4
for acid stress; n 5 for control cells; P 0.001).
To correlate the expression of NBC-1 with its function, control mIMCD-3 cells were grown to confluence
on coverslips, loaded with BCECF, and monitored for
pHi recovery from intracellular acidosis. In the presence of amiloride (to block Na/H exchange), switching to a Na- and HCO3-containing solution resulted in
rapid pHi recovery in mIMCD-3 cells (Fig. 5A). This
recovery was absolutely HCO3 dependent, as shown by
the lack of a significant pHi recovery in the absence of
HCO3 (Fig. 5B). Indeed, pHi recovery from acidosis in
the absence of HCO3 was 0.011 0.002 pH/min (n 4),
a value not significantly different from zero. The Nadependent HCO3 cotransport was completely abolished
in the presence of 300 M DIDS (Fig. 5A). The results,
summarized in Fig. 5C, indicate that the rate of Na-

F908

NBC-3 EXPRESSION AND REGULATION

Fig. 4. A: NBC-1 Northern hybridizations in control and acidstressed inner medullary collecting duct mIMCD-3 cells. NBC-1
mRNA levels were suppressed by 90% in cells subjected to sublethal
acid stress. Top: NBC-1 Northern hybridization. Bottom: GAPDH
Northern hybridization. B: NBC-1/GAPDH mRNA ratio. TMA, tetramethylammonium.

dependent HCO3-mediated pHi recovery was 0.076

0.005 pH/min (n 7) and decreased to 0.012 0.002
pH/min in the presence of 300 M DIDS (n 5).
In the next series of experiments, NBC activity in
cells subjected to acid stress was assayed in a manner
similar to Fig. 5. Figure 6A shows representative pHi
tracings from both parent and stressed cells and demonstrates that the Na-dependent HCO3-mediated pHi
recovery from intracellular acidosis was significantly
increased in stressed cells compared with the parent
cells (dpHi/dt was 0.610 0.038 pH/min in stressed
cells, n 7; and 0.085 0.005 pH/min in control cells,
n 6, P 0.0001). The pHi recovery from acidosis was
nearly completely inhibited by 300 M DIDS (Fig. 6, B
and C), consistent with the presence of NBC activity in
stressed cells (The rate of pHi recovery was 0.676
0.051 pH/min, and decreased to 0.027 0.005 pH/min
in the presence of 300 M DIDS, n 5 for each group,
Fig. 6C). The minimal pHi recovery from acidosis in the
presence of DIDS likely represents a contribution by
H-ATPase, as it was also evident in the absence of

HCO3 in the media. Depleting the intracellular Cl by

incubating the cells in Cl-free media (only Cl-free
solutions were used for the duration of experiments,
solution G, Table 1) did not reduce the rate of Nadependent HCO3 cotransport into acid-loaded cells
(Fig. 6D), indicating that the enhanced activity is not
due to the Na-dependent Cl/HCO3 exchanger [The
rate of pHi recovery from acidosis was 0.630 0.023
pH/min in Cl-free solution (n 4), a value not
different from pHi recovery in Cl-containing media].
HCO3 dependence of pHi recovery from cell acidosis in
stressed cells was confirmed by the lack of a significant
recovery from acidosis in the absence of HCO3 in the
media (Fig. 6E). pHi recovery from acidosis in the
absence of HCO3 was only 0.01 0.002 pH/min (n 4).
The above experiments indicate that sublethal acid
stress decreases the mRNA expression of NBC-1 but
increases the Na-dependent HCO3 cotransport activity. This clearly raises the possibility that enhanced
NBC activity in acid-stressed cells is due to another
NBC isoform. Figure 7A is a Northern blot analysis and
indicates that NBC-3 mRNA expression was enhanced
significantly in cells subjected to acid stress, with
mRNA levels increasing by 5.5 0.8-fold (Fig. 7B;
P 0.01 vs. control cells, n 4 for each group).2
Northern hybridization did not detect NBC-2 mRNA
expression in either control cells or cells subjected to
acid stress (data not shown). An attempt was then
made to examine the expression of NBC-2 in IMCD
cells by RT-PCR according to EXPERIMENTAL PROCEDURES
(Fig. 7C). Lanes 1 and 2 in Fig. 7C are control mIMCD-3
cells, with and without reverse transcriptase, respectively. Lanes 3 and 4 are acid-stressed cells, with and
without reverse transcriptase, respectively. Lane M is a
1-kb DNA molecular mass ladder (Life Technologies).
As demonstrated, the mouse-specific primers amplified
a single 279-bp product in both cell lines but failed to
amplify a 1,018-bp genomic sequence (Fig. 7C). These
results are consistent with the mRNA expression of
NBC-2 in mIMCD-3 cells. Coupled with the fact that
NBC-2 mRNA expression was not detected by Northern

2 To determine the presence of a mouse homolog of human NBC-3

in the mIMCD-3 cells, an RT-PCR experiment was designed to detect,
amplify, and sequence such a homolog. Accordingly, cDNA was
prepared from mIMCD-cell total RNA (1 g) using SuperScript
reverse transcriptase (Life Technologies) and an oligo-dT primer
according to standard procedures. The following PCR primers were
designed (based on the known human sequence) to amplify a 601-bp
product (upper, 58-GCTATTTGGGGGCTTGGTG-38; lower, 58-CTGGAGGGTGTGATTGTTTGG-38). Under moderate stringency conditions, several amplification products were detected by gel electrophoresis, and one band of 600-bp was excised from the gel, reamplified,
and sequenced, using the amplification primers as sequencing primers. Clear sequence electropherograms were obtained, indicating the
amplification of a pure product. The nucleotide sequence of the PCR
product was 87% identical to the human NBC-3 sequence. The mouse
amino acid sequence was 94% identical to the human sequence.
Taken together with the Northern blot analysis described in this
article, this demonstrates that mIMCD-3 cells express NBC-3.

NBC-3 EXPRESSION AND REGULATION

F909

Fig. 5. NBC activity in control mIMCD-3 cells. A:

representative tracings demonstrating Na-dependent HCO3-mediated intracellular pH (pHi ) recovery
in presence or absence of DIDS. Cells were acid loaded
by NH4 withdrawal and monitored for pHi recovery in
presence of 115 mM Na and 25 mM HCO3 at pH 7.4.
Amiloride, 1 mM, was present to block Na/H exchange. DIDS concentration was 300 M. B: in absence of HCO3, pHi recovery from acidosis was minimal. C: summary of separate experiments showing
DIDS sensitivity of Na-dependent HCO3-mediated
pHi recovery from cell acidosis (n 7 for no DIDS; n
5 for DIDS).

hybridization, we conclude that NBC-2 mRNA levels

are very low in control and acid-stressed cells.
Functional characterization of NBC-1 and NBC-3.
The above experiments demonstrate high levels of
expression of NBC-1 and NBC-3 along with a DIDSsensitive Na-dependent HCO3 cotransport activity in
control and acid-stressed cells, respectively. Given very
low mRNA levels for NBC-2 and NBC-3, these data
suggest that NBC activity in control mIMCD-3 cells is
likely mediated via NBC-1. The very low levels of
NBC-1 and NBC-2 mRNA in acid-stressed cells strongly
suggest that most of the NBC activity in these cells is
mediated via NBC-3. To characterize the NBC activity
in control mIMCD-3 and stressed cells further, the
interaction of Li with NBC in both cell lines was
studied. As shown in Fig. 8A, control mIMCD-3 cells
showed little pHi recovery from intracellular acidosis in
the presence of Li (Table 1, solution E). Switching
from the Li-containing solution to the Na-containing
solution (Table 1, solution C) caused a rapid rise in pHi
recovery (Fig. 8A). As indicated and summarized in Fig.
8B, the rate of HCO3-dependent pHi recovery from
acidosis was very low in the presence of Li (0.008
0.002 pH/min, n 5) but was significantly high in the
presence of Na (0.09 0.009 pH/min, n 5). These
results indicate that NBC activity in control mIMCD-3

cells (likely mediated via NBC-1) has low affinity

for Li.3
The interaction of NBC with Li in acid-stressed cells
was next tested. As shown in Fig. 9A, exposing the cells
to a Li-containing solution (Table 1, solution E) caused
significant recovery from intracellular acidosis. As indicated and summarized in Fig. 9B, the rate of
HCO3-dependent pHi recovery from acidosis was
0.327 0.025 pH/min in the presence of Li (n 7) and
0.618 0.033 in the presence of Na (n 7; P
0.0001). The Li-dependent HCO3 cotransport was
completely inhibited in the presence of 300 M DIDS
(Figs. 9C, representative pHi tracings). Figure 9D is the
summary of the results and indicates that the rate of
Li-dependent HCO3-mediated pHi recovery from cell
acidosis was 0.327 0.0025 pH/min (n 7) and
decreased to 0.011 0.003 pH/min in the presence of
300 M DIDS (n 5). These results indicate that Li
3 In several experiments, Li caused a weak HCO-dependent pH
i
3
recovery in control mIMCD-3 cells when the nadir pHi was reduced to

5.8 (by longer incubation in the NH4 containing solution). The

Li-dependent pHi recovery reached a plateau at pHi 6.2. This
suggests that the interaction of NBC-1 with Li in mIMCD-3 cells is
likely dependent on the pHi; At pHi 6.2 or higher, NBC-1 does not
mediate Li-dependent HCO3 cotransport.

F910

NBC-3 EXPRESSION AND REGULATION

Fig. 6. NBC activity in mIMCD-3 cells

subjected to sublethal acid stress. A:
representative tracings demonstrating
Na-dependent HCO3-mediated pHi
recovery in acid-stressed and control
cells. Cells were acid loaded by NH4
withdrawal and monitored for pHi recovery in presence of 115 mM Na and
25 mM HCO3 at pH 7.4. Amiloride, 1
mM, was present to block Na/H exchange. B: representative tracings
demonstrating DIDS sensitivity of Nadependent HCO3-mediated pHi recovery in acid-stressed cells. DIDS concentration was 300 M. C: summary of 5
separate experiments showing DIDS
sensitivity of Na-dependent HCO3mediated pHi recovery from cell acidosis. D: representative tracings demonstrating lack of effect of Cl-free media
on Na-dependent HCO3-mediated
pHi recovery from acidosis. E: representative tracings demonstrating that in
absence of HCO3, pHi recovery from
acidosis was minimal.

can substitute for Na on NBC in acid-stressed cells,

with Li showing less ability to mediate HCO3 cotransport. The NBC in control or acid-stimulated cells
showed no affinity for K (data not shown).
DISCUSSION

The NBC-3 cDNA clone was identified by screening a

NT-2 cell cDNA library with NBC-2 cDNA. Figure 1
shows the partial nucleotide sequence of NBC-3. Figure
2 shows significant homology with both NBC-1 and
NBC-2. Tissue distribution studies of NBC-3 (Fig. 3)
show a pattern of expression distinct from either NBC-1
and NBC-2. Unlike NBC-1 and NBC-2, NBC-3 is highly

expressed in brain and spinal column. Contrary to

NBC-1, NBC-3 shows low level of expression in pancreas and kidney cortex. NBC-3 and NBC-1 are expressed in cells from renal inner medulla and show
differential expression in EMS-mutagenized mIMCD-3
cells subjected to sublethal acid stress; NBC-1 is suppressed, whereas NBC-3 is enhanced. NBC-3 and NBC-1
show different affinities for Li; NBC-3 likely mediates
Li-dependent HCO3 cotransport, whereas NBC-1 does
not.
NBC-3 shows highest expression in brain and spinal
cord, suggesting that this isoform may be the dominant
Na-dependent HCO3 cotransporter in human astro-

NBC-3 EXPRESSION AND REGULATION

Fig. 7. A: NBC-3 Northern hybridizations in control and acid-stressed

mIMCD-3 cells. NBC-3 mRNA expression shows 5.5-fold upregulation
in cells subjected to sublethal acid stress. Top: NBC-3 Northern hybridization. Bottom: GAPDH Northern hybridization. B: NBC-3 mRNA/
GAPDH mRNA ratio in control and acid-stressed mIMCD-3 cells. C:
RT-PCR of control and acid-stressed mIMCD-3 cell RNA using primers
specific for NBC-2. Ethidium bromide staining of agarose gel demonstrates a PCR product of expected size for mouse NBC-2 (see RESULTS ).
Lane M, 1-kb DNA molecular mass ladder (Life Technologies).

F911

cytes (16). This is in contrast to NBC-1 and NBC-2,

which show either low expression or no expression,
respectively, in brain (9, 20). In rat and in contrast to
human, NBC-1 shows high level of expression in brain
(10), indicating species differences with regard to the
tissue distribution of NBC isoforms.
NBC-1 expression in the rat kidney is limited to the
cortex (1, 10, 29), whereas in the mouse kidney, it is
expressed in both cortex and medulla (11), consistent
with functional studies. NBC-1 mRNA expression, although absent in rat medullary thick ascending limb
and IMCD cells under baseline condition (10), shows
heavy induction in potassium depletion (4), indicating
that this cotransporter may mediate enhanced HCO3
reabsorption in these two nephron segments in certain
pathophysiological states. NBC-3 expression in the
rat kidney is predominantly observed in the medulla
(Fig. 3, C and D), a finding distinct from NBC-1 (1, 10,
29).
Functional studies in cultured IMCD cells have
localized the Na-dependent HCO3 cotransporter to
the basolateral membrane (19), confirming earlier
studies in proximal tubule and other epithelial cells (7,
8, 1618, 26, 30). It is therefore logical to conclude that
both NBC-1 and NBC-3 are expressed on the basolateral membrane of mIMCD-3 cells. Based on the clonal
origin of mIMCD-3 cells, we suggest that both these
isoforms are present on the basolateral membrane of
the same cells rather than different cells. A definitive
answer, however, should come from immunocytochemistry studies utilizing specific antibodies.
NBC-1, which is predominantly expressed in the
kidney proximal tubule cells, functions in an outwardly
directed mode under physiological conditions, resulting
in transvectorial transport of HCO3 from lumen to the
blood. Given the important role of IMCD in HCO3
reabsorption, it is likely that in mIMCD-3 cells, NBC-1
is functioning in an efflux mode, resulting in the exit of
HCO3 across the basolateral membrane under physiological conditions. Induction of NBC-3 in cells that
survive the sublethal acid stress (more than 99% of the
EMS-mutagenized mIMCD-3 cells subjected to acid
stress died; Refs. 5 and 30) suggests that this isoform
likely functions in the influx mode under this condition,
leading to increased cell pH in severe acidosis. The
expression and activity of NHE-1 and H-ATPase, two
known acid extruders, are also increased in acidstressed cells (5, 30). This likely defends the cells
against severe acidosis by transporting acid out of the
cells.
Enhancement of Na-dependent HCO3 influx has
also been observed in fibroblasts subjected to proton
suicide (13, 22). In PS120 cells, which are NHEdeficient fibroblast cells (25), Na-dependent Cl/
HCO3 exchange is enhanced compared with PS127
cells, which overexpress NHE-1 (13, 22). As a result of
overexpression of this Na-dependent HCO3 influx
pathway, PS120 cells survive acidic pH in the presence
but not the absence of HCO3 in the media (13, 22).
Taken together, these results, along with the results in

F912

NBC-3 EXPRESSION AND REGULATION

Fig. 8. Interaction of lithium (Li ) with

the NBC in control mIMCD-3 cells. A:
cells were acidified and then exposed to
a Li-containing solution (solution E,
Table 1). HCO3 was present during the
entire duration of the experiment.
Amiloride, 1 mM, was present to block
Li/H exchange. B: cells showed little
HCO3-mediated pHi recovery from intracellular acidosis in presence of Li
compared with Na (n 5 for each
group).

Figs. 6 and 7, strongly suggest that induction of NBC-3

likely prevents severe intracellular acidosis by transporting HCO3 into mIMCD-3 cells subjected to modified acid-suicide selection.
In basolateral membrane vesicles isolated from rabbit kidney cortex, NBC shows considerable affinity for
Li; however, its affinity was fivefold lower than for
Na (33). It is worth mentioning that, although mouse
NBC-1 shows no affinity for Li (Fig. 8), human NBC-1
interacts with Li (6)3. Given the high degree of cDNA

Fig. 9. Interaction of lithium (Li ) with

the NBC in cells subjected to sublethal
acid stress. A: cells were acidified and
then exposed to a Li-containing solution (Table 1, solution E). HCO3 was
present during the entire duration of
the experiment. Amiloride, 1 mM, was
present to block Li/H exchange. B:
rate of HCO3-mediated pHi recovery in
presence of Li or Na. C and D: representative tracings and summary of
separate experiments indicating presence of Li-dependent HCO3-mediated
pHi recovery from cell acidosis DIDS
(n 7 for no DIDS; n 5 for DIDS).

homology between mammalian NBC-1 isoforms (human and rat; see Refs. 9, 10, 28, 29), comparison of
mouse and human NBC-1 cDNAs could yield possible
clues regarding the Li-binding site(s) of NBC-1.
In conclusion, a novel Na-HCO3 cotransporter
(NBC-3) has been cloned. Its partial cDNA sequence
shows both the homology and the divergence from
NBC-1, NBC-2, and AEs, indicating that NBC-3 is a
new member of the superfamily of bicarbonate transporters to which both anion exchangers and Na-HCO3

NBC-3 EXPRESSION AND REGULATION

cotransporters belong. NBC-3 shows distinct patterns

of tissue expression and shows differential expression
compared with NBC-1 in response to sublethal acid
stress. On the basis of relatively widespread distribution of NBC-3 and its induction in acid stress, we
propose that NBC-3 is likely involved in cell pH regulation by mediating the influx of HCO3 into the cells.
These studies were supported by National Institute of Diabetes
and Digestive and Kidney Diseases Grants RO1-DK-46789, RO1-DK52821, and RO1-DK-54430 and by a grant from Dialysis Clinic
Incorporated (to M. Soleimani).
Address for reprint requests and other correspondence: M. Soleimani,
Univ. of Cincinnati Medical Center, 231 Bethesda Ave, MSB 5502,
Cincinnati, OH 45267-0585 (E-mail: Manoocher.Soleimani@ uc.edu).
Received 10 September 1998; accepted in final form 12 March 1999.
REFERENCES
1. Abdulazade, N., I. Lee, D. Newman, J. Hwang, A. Pushkin,
and I. Kurtz. Axial heterogeneity of sodium-bicarbonate cotransporter expression in the rabbit proximal tubule. Am. J. Physiol.
274 (Renal Physiol. 43): F628F633, 1998.
2. Abdulazade, N., I. Lee, D. Newman, J. Hwang, K. Boorer, A.
Pushkin, and I. Kurtz. Molecular cloning, chromosomal localisation, tissue distribution, and functional expression of the
human pancreatic sodium bicarbonate cotransporter. J. Biol.
Chem. 273: 1768917695, 1998.
3. Ali, R., H. Amlal, C. Burnham, and M. Soleimani. The effect
of glucocorticoids on the expression and activity of the basolateral Na-HCO3 cotransporter (NBC-1) in renal proximal tubule
(PT). J. Am. Soc. Nephrol. In press.
4. Amlal, H., C. E. Burnham, and M. Soleimani. Potassium
deprivation (KD) upregulates the expression of the basolateral
Na:HCO3 cotransporter (NBC-1) in rat renal nephron segments. J. Am. Soc. Nephrol. In press.
5. Amlal, H., Z. Wang, and M. Soleimani. Functional upregulation of H-ATPase by lethal acid stress in cultured inner
medullary collecting duct cells. Am. J. Physiol. 273 (Cell Physiol.
42): C1194C1205, 1997.
6. Amlal, H., Z. Wang, C. E. Burnham, and M. Soleimani.
Functional characterization of a cloned human kidney Na:
HCO3 cotransporter. J. Biol. Chem. 273: 1681016815, 1998.
7. Aronson, P. S., M. Soleimani, and S. M. Grassl. Properties of the
renal Na-HCO3 cotransporter. Semin. Nephrol. 11: 2836, 1991.
8. Boron, W. F., and E. L. Boulpaep. The electrogenic Na/HCO3
cotransporter. Kidney Int. 36: 392402, 1989.
9. Burnham, C. E., H. Amlal, Z. Wang, G. E. Shull, and M.
Soleimani. Cloning and functional expression of a human kidney
Na:HCO3 cotransporter. J. Biol. Chem. 272: 1911119114, 1997.
10. Burnham, C. E., M. Flagella, Z. Wang, H. Amlal, G. H. Shull,
and M. Soleimani. Cloning, renal distribution, and regulation
of the rat Na-HCO3 cotransporter. Am. J. Physiol. 274 (Renal
Physiol. 43): F1119F1126, 1998.
11. Burnham, C. E., Z. Wang, H. Amlal, and M. Soleimani. Tissue
distribution and regulation of Na-HCO3 cotransporter mRNA in
rat and mouse kidney (Abstract). J. Am. Soc. Nephrol. 8: 3, 1997.
12. Camilion, H. M. C., B. V. Alvarez, N. G. Perez, and N. E.
Cingolini. Role of an electrogenic Na/HCO3 cotransport in
determining myocardial pHi after an increase in heart rate. Circ.
Res. 79: 698704, 1996.
13. Cassel, D., O. Scharf, M. Rotman, F. J. Cragoe, and M. Katz.
Characterization of Na-linked and Na-independent Cl/HCO3
exchange systems in Chinese hamster lung fibroblast. J. Biol.
Chem. 263: 61226127, 1988.
14. Chomczynski, P., and N. Sacchi. Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal. Biochem. 162: 156159, 1987.
15. Church, G. M., and W. Gilbert. Genomic sequencing. Proc.
Natl. Acad. Sci. USA 81: 19911995, 1984.
16. Deitmer, J. W. Electrogenic sodium-dependent bicarbonate secretion by glial cells of the leech central nervous system. J. Gen.
Physiol. 98: 637655, 1991.

F913

17. Fitz, J. C., M. Persico, and B. F. Scharschmidt. Electrophysiological evidence for Na-coupled bicarbonate transport in cultured rat hepatocyte. Am. J. Physiol. 256 (Gastrointest. Liver
Physiol. 19): G491G500, 1989.
18. Gleeson, D., N. D. Smith, and J. L. Boyer. Bicarbonate
dependent and independent intracellular pH regulatory mechanisms in rat hepatocyte. J. Clin. Invest. 84: 312321, 1989.
19. Hart, D., and E. P. Nord. Polarized distribution of Na/H and
Na/HCO3 cotransport in primary cultures of renal inner medullary collecting duct cells. J. Biol. Chem. 266: 23742382, 1991.
20. Ishibashi, K., S. Sasaki, and F. Marumo. Molecular cloning of
a new sodium bicarbonate cotransporter cDNA from human
retina. Biochem. Biophys. Res. Commun. 246: 5350538, 1998.
21. Lagadic-Gossmann, D., K. J. Buckler, and R. D. VaughnJones. Role of HCO3 in pH recovery from intracellular acidosis
in the guinea-pig ventricular myocyte. J. Physiol. (Lond.) 458:
361384, 1992.
22. LAllemain, G., S. Paris, and J. Pouyssegur. Role of a
Na-dependent Cl/HCO3 exchange in regulation of intracellular
pH in fibroblasts. J. Biol. Chem. 260: 48774883, 1985.
23. Lubman, R. L., D. C. Chao, and E. D. Granadall. Basolateral
localization of Na-HCO3 cotransporter in alveolar epithelial
cells. Respir. Physiol. 100: 1524, 1995.
24. Nagase, T., K. Ishikawa, M. Suyama, R. Kikuno, N. Miyajima, A. Tanaka, H. Kotani, N. Nomura, and O. Ohara.
Prediction of the coding sequences of unidentified human genes.
The complete sequence of 100 new cDNA clones from brain. DNA
Res. 5: 277286, 1998.
25. Pouyssegur, J., C. Sardet, A. Franchi, G. LAllemain, and S.
Paris. A specific mutation abolishing Na/H exchange activity
in hamster fibroblasts precludes growth at neutral and acidic pH.
Proc. Natl. Acad. Sci. USA 81: 48334837, 1984.
26. Preisig, P. A., and R. J. Alpern. Basolateral membrane H-OHHCO3 transport in the proximal tubule. Am. J. Physiol. 256
(Renal Fluid Electrolyte Physiol. 25): F751F756, 1989.
27. Rauchman, M. I., N. K. Sanjay, E. Delpire, and S. R.
Gullans. An osmotically tolerant inner medullary collecting duct
cell line from SV40 transgenic mouse. Am. J. Physiol. 265 (Renal
Fluid Electrolyte Physiol. 34): F416F424, 1993.
28. Romero, M. F., M. A. Hediger, E. L. Boulpaep, and W. F.
Boron. Expression cloning and characterization of a renal
electrogenic Na:HCO3 cotransporter. Nature 387: 409413, 1997.
29. Romero, M. F., P. Fong, U. V. Berger, M. A. Hediger, and
W. F. Boron. Cloning and functional expression of rNBC, an
electrogenic Na-HCO3 cotransporter. Am. J. Physiol. 274 (Renal Physiol. 43): F425F432, 1998.
30. Singh, G., J. A. McAteer, and M. Soleimani. The Effect of
lethal acid stress on Na/H exchanger isoforms in cultured
inner medullary collecting duct cells: deletion of NHE-2 and over
expression of NHE-1. Biochim. Biophys. Acta 1239: 7480, 1995.
31. Soleimani, M., G. Bizal, Y. Hattabaugh, P. S. Aronson, and J.
Bergman. In: Molecular and Cellular Mechanisms of H Transport,
edited by B. H. Hirst. Berlin: Springer-Verlag, 1994, p. 309318.
32. Soleimani, M., S. M. Grassl, and P. S. Aronson. Stoichiometry
of the Na-HCO3 co-transporter in basolateral membrane
vesicles isolated from rabbit renal cortex. J. Clin. Invest. 79:
12761280, 1987.
33. Soleimani, M., and P. S. Aronson. Ionic mechanism of NaHCO3 cotransport in rabbit renal basolateral membrane vesicles.
J. Biol. Chem. 264: 1830218308, 1989.
34. Soleimani, M., G. Singh, G. L. Bizal, R. S. Gullans, and J. A.
McAteer. Na/H exchanger isoforms NHE-2 and NHE-1 in
inner medullary collecting duct cells: expression, functional
localization, and differential regulation. J. Biol. Chem. 269:
2797327978, 1994.
35. Soleimani, M., G. Singh, G. H. Dominguez, and R. L.
Howard. Long-term high osmolality activates Na/H exchange
and protein kinase C in aortic smooth muscle cells. Circ. Res. 76:
530535, 1995.
36. Yoshitomi, K., B. C. Burckhardt, and E. Fromter. Rheogenic
sodium-bicarbonate co-transport in the peritubular cell membrane of
rat renal proximal tubule. Pflugers Arch. 405: 360366, 1985.