Taenia Solium Cysticercosis

Taenia solium Cysticercosis
From Basic to Clinical Science
Taenia solium Cysticercosis

From Basic to Clinical Science
Edited by
Gagandeep Singh
Dayanand Medical College & Hospital Ludhiana
Punjab, India
and
Sudesh Prabhakar
Department of Neurology
Postgraduate Institute of Medical Education and Research
Chandigarh, India
CABI Publishing
CABI Publishing is a division of CAB International

CABI Publishing
CAB International
Wallingford
Oxon OX10 8DE
UK
Tel: +44 (0)1491 832111
Fax: +44 (0)1491 833508
E-mail: cabi@cabi.org
Web site: www.cabi-publishing.org
CABI Publishing
10 E 40th Street
Suite 3203
New York, NY 10016
USA
Tel: +1 212 481 7018
Fax: +1 212 686 7993
E-mail: cabi-nao@cabi.org
CAB International 2002. All rights reserved. No part of

this publication may be reproduced in any form or by any
means, electronically, mechanically, by photocopying,
recording or otherwise, without the prior permission of
the copyright owners.
A catalogue record for this book is available from the British Library,
London, UK.
Library of Congress Cataloging-in-Publication Data
Singh, G. (Gagandeep)
Taenia solium cysticercosis : from basic to clinical science / edited
by G. Singh and S. Prabhakar.
p. cm.
Includes bibliographical references and index.
ISBN 0-85199-628-0
1. Cysticercosis. 2. Taenia. I. Prabhakar, S. (Sudesh) II. Title.
RC136.7 .S545 2002
616.964--dc21
2002001332
ISBN 0 85199 628 0
Typeset in Palatino by Columns Design Ltd, Reading, UK

Printed and bound in the UK by Biddles Ltd, Guildford and Kings Lynn.
Contents
Contributors
ix
Preface
xiii
Abbreviations
xiv
SECTION I
TAENIA SOLIUM CYSTICERCOSIS: BASIC SCIENCE
1. Taenia solium: Basic Biology and Transmission

Zbigniew S. Pawlowski
2. Taenia solium Cysticercosis: New and Revisited Immunological Aspects

Ana Flisser, Dolores Correa and Carlton A.W. Evans
15
3. Molecular Determinants of HostParasite Interactions: Focus on Parasite

Jos L. Molinari and Patricia Tato
25
4. Animal Models of Taenia solium Cysticercosis: Role in Understanding

HostParasite Interactions
Astrid E. Cardona and Judy M. Teale
5. Mitochondrial DNA of Taenia solium: From Basic to Applied Science
Akira Ito, Minoru Nakao, Munehiro Okamoto, Yasuhito Sako and Hiroshi Yamasaki
6. Hereditary Factors in Neurocysticercosis with Emphasis on Single, Small,
Enhancing CT Lesions
Vasantha Padma, Satish Jain, Achal Srivastava, Manjari Tripathi and
Mahesh C. Maheshwari
SECTION II
35
47
57
EPIDEMIOLOGY
7. Taenia solium Cysticercosis: an Overview of Global Distribution and

Transmission
Peter M. Schantz
8. What Have We Learnt From Epidemiological Studies of Taenia solium
Cysticercosis in Peru?
Hector H. Garca, Robert H. Gilman, Armando E. Gonzalez, Manuela Verastegui,
Victor C.W. Tsang and The Cysticercosis Working Group in Peru
63
75
vi
Contents
9. Epidemiology of Taenia solium Taeniasis and Cysticercosis in Mexico

Elsa Sarti
10. Taenia solium Taeniasis and Cysticercosis in Central America
Jos Garcia-Noval, Ana L. Sanchez and James C. Allan
83
91
11. Neurocysticercosis in Brazil: Epidemiological Aspects

Svetlana Agapejev
101
12. Taenia solium Taeniasis and Cysticercosis in Asia

Gagandeep Singh, Sudesh Prabhakar, Akira Ito, Seung Yull Cho and Dong-Chuan Qiu
111
13. Taenia solium Cysticercosis in Africa

Michel Druet-Cabanac, Bienvenue Ramanankandrasana, Sylvie Bisser, Louis Dongmo,
Gilbert Avod, Lopold Nzisabira, Michel Dumas and Pierre-Marie Preux
129
14. Taenia solium Cysticercosis: the Special Case of the United States
Wayne X. Shandera, Peter M. Schantz and A. Clinton White Jr
139
15. Porcine Cysticercosis

Armando E. Gonzalez, Patricia P. Wilkins and Teresa Lopez
145
16. Taenia solium: A Historical Note

Noshir H. Wadia and Gagandeep Singh
157
SECTION III
TAENIA SOLIUM CYSTICERCOSIS: CLINICAL ASPECTS
17. Neurocysticercosis: an Overview of Clinical Presentations

Sudesh Prabhakar and Gagandeep Singh
169
18. Meningeal Cysticercosis

Oscar H. Del Brutto
177
19. Heavy Multilesional Cysticercotic Syndromes

Oscar H. Del Brutto, Hector H. Garca and Sudesh Prabhakar
189
20. Intraventricular Neurocysticercosis

Albert C. Cuetter and Russell J. Andrews
199
21. Neurocysticercosis and Epilepsy

Arturo Carpio and W. Allen Hauser
211
22. Cerebrovascular Manifestations of Neurocysticercosis

Fernando Barinagarrementeria and Carlos Cant
221
23. Taenia solium Cysticercosis: Uncommon Manifestations

Gagandeep Singh and Indermohan S. Sawhney
229
24. The Story Behind Solitary Cysticercus Granuloma

Vedantam Rajshekhar
241
25. Seizures Due to Solitary Cysticercus Granuloma

J.M.K. Murthy
251
26. Paediatric Neurocysticercosis

257
27. Psychiatric Manifestations of Neurocysticercosis

Orestes V. Forlenza
263
28. Taenia solium Cysticercosis: Ophthalmic Aspects

Atul Kumar and Namrata Sharma
269
Contents
29. Neurocysticercosis: Diagnosis and Treatment in Special Situations

Ravindra K. Garg and Alok M. Kar
SECTION IV
281
CYSTICERCOSIS: PATHOLOGY
30. The Pathology of Neurocysticercosis

Alfonso Escobar and Karen M. Weidenheim
31. Single Small Enhancing Computed Tomography Lesions
Pathological Correlates
Geeta Chacko
SECTION V
vii
289
307
NEUROCYSTICERCOSIS: INVESTIGATIONAL ASPECTS
32. Imaging and Spectroscopy of Neurocysticercosis

Deepshikha Sharda, Sanjeev Chawla and Rakesh K. Gupta
33. Taenia solium Cysticercosis: Immunodiagnosis of Neurocysticercosis
and Taeniasis
Patricia P. Wilkins, Marianna Wilson, James C. Allan and Victor C.W. Tsang
311
329
34. Antigen-based Immunoassays in the Diagnosis of Taenia solium Cysticercosis

Dolores Correa, Raquel Tapia-Romero, Antonio Meza-Lucas and Olga Mata-Ruiz
343
35. Polymerase Chain Reaction in the Diagnosis of Taenia solium Cysticercosis

Taru Meri and Seppo Meri
351
36. Immunodiagnosis in Solitary Cysticercus Granulomas

Anna Oomen
359
SECTION VI
TAENIASISCYSTICERCOSIS: THERAPY AND PREVENTION
37. Pharmacology of Anticysticercal Therapy

Helgi Jung and Dinora F. Gonzlez-Esquivel
363
38. Controversies in the Drug Treatment of Neurocysticercosis

Bhim S. Singhal and Rodrigo A. Salinas
375
39. Neurocysticercosis: Neurosurgical Perspective

Bhawani S. Sharma and P. Sarat Chandra
387
40. Endoscopic Management of Intraventricular Cysticercosis

Marvin Bergsneider and Jaime H. Nieto
399
41. Control of Taenia solium with Emphasis on Treatment of Taeniasis

James C. Allan, Philip S. Craig and Zbigniew S. Pawlowski
411
42. Taenia solium Vaccination: Present Status and Future Prospects

Carlton A.W. Evans
421
43. Control of Taenia solium with Porcine Chemotherapy

Armando E. Gonzalez
431
44. Use of a Simulation Model to Evaluate Control Programmes against Taenia

solium Cysticercosis
Armando E. Gonzalez, Robert H. Gilman, Hector H. Garca and Teresa Lopez
437
Index
449
Contributors
Svetlana Agapejev, Department of Neurology and Psychiatry, PO Box 540, School of

Medicine, UNESP, 18618-000 Botucatu, So Paulo, Brazil.
James C. Allan, Pfizer Global Research and Development Veterinary Medicine Clinical
Development, Pfizer Ltd, Sandwich, CT13 9NJ, UK.
Russell J. Andrews, Department of Neurology, Texas Tech University Health Sciences Center,
El Paso, Texas 79905, USA.
Gilbert Avod, School of Medicine, Cotonou, Benin.
Fernando Barinagarrementeria, Department of Neurology, Instituto Nacional de Ciencias
Medicas y Nutricion, Salvador Zubiran, Mxico City, Mxico.
Marvin Bergsneider, Division of Neurosurgery, University of California, Los Angeles,
HarborUCLA Medical Center, Los Angeles, California, USA.
Sylvie Bisser, Institut dEpidmiologie Neurologique et de Neurologie Tropicale, EA 3174
(Neuroparasitologie et Neuropidmiologie Tropicale) Facult de Mdecine, 2 rue du Dr
Marcland, 87025 Limoges, France.
Carlos Cant, Department of Neurology, Instituto Nacional de Neurologia y Neurocirgia
Manuel Velasco Suarez, Mxico City, Mxico.
Astrid E. Cardona, Department of Microbiology, The University of Texas Health Science
Center at San Antonio, San Antonio, Texas 78229, USA.
Arturo Carpio, Comprehensive Epilepsy Center, School of Medicine, University of Cuenca,
Ecuador, PO Box 0101-719, Cuenca, Ecuador.
Geeta Chacko, Division of Neuropathology, Department of Neurological Sciences, Christian
Medical College and Hospital, Vellore 632 004, Tamil Nadu, India.
P. Sarat Chandra, Department of Neurosurgery, CN Center, Room 720, All India Institute of
Medical Sciences, Ansari Nagar, New Delhi 110 029, India.
Sanjeev Chawla, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of
Medical Sciences, Rae Bareli Road, Lucknow 226 014, Uttar Pradesh, India.
Seung Yull Cho, Section of Molecular Parasitology, Department of Molecular Medicine,
Sungkyunkwan University College of Medicine, Sungkyunkwan, Korea.
Dolores Correa, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Epidemiologicos (INDRE), Secretaria de Salud, Mxico DF, Mxico.
Philip S. Craig, Department of Biological Sciences, School of Environment and Life Sciences,
University of Salford, Salford, M5 5W7, UK.
Albert C. Cuetter, Department of Neurology, Texas Tech University Health Sciences Center,
El Paso, Texas 79905, USA.
CAB International 2002. Taenia solium Cysticercosis
(eds G. Singh and S. Prabhakar)
ix
Contributors
Oscar H. Del Brutto, Department of Neurology, Luis Vernaza Hospital, Guayaquil, Ecuador.
Louis Dongmo, School of Medicine, Yaoude, Cameroon.
Michel Druet-Cabanac, Institut dEpidmiologie Neurologique et de Neurologie Tropicale,
EA 3174 (Neuroparasitologie et Neuropidmiologie Tropicale) Facult de Mdecine, 2 rue
du Dr Marcland, 87025 Limoges, France.
Michel Dumas, Institut dEpidmiologie Neurologique et de Neurologie Tropicale, EA 3174
(Neuroparasitologie et Neuropidmiologie Tropicale) Facult de Mdecine, 2 rue du Dr
Marcland, 87025 Limoges, France.
Alfonso Escobar, Instituto de Investigaciones, Biomedicas, National Autonomous University
of Mxico, Ciudad Universitaria 04510, Mxico DF, Mxico.
Carlton A.W. Evans, Imperial College, Department of Infectious Diseases, Hammersmith
Hospital, Du Cane Road, London W12 0NN, UK.
Ana Flisser, Departmento de Microbiologia y Parasitologia, Facultad de Medicina, National
Autonomous University of Mxico, Ciudad Universitaria, San Angel, Mxico 04510 DF,
Mxico.
Orestes V. Forlenza, Laboratory of Neuroscience (LIM-27), Department and Institute of
Psychiatry, Faculty of Medicine, University of So Paulo, So Paulo, Brazil.
Hector H. Garca, Departments of Transmissible Diseases, Microbiology, and Pathology,
Universidad Peruana Cayetano Heredia, Lima, Peru.
Jos Garcia-Noval, Centro de Investigaciones de las Ciencias de la Salud, Facultad de
Ciencias Medicas, Universidad de San Carlos, Zona 12, Guatemala City, Guatemala.
Ravindra K. Garg, Department of Neurology, King Georges Medical College, Lucknow,
226 003, Uttar Pradesh, India.
Robert H. Gilman, Department of International Health, Johns Hopkins School of Public
Health, Johns Hopkins University, 615 N Wolfe St, Room W 3501, Baltimore, Maryland
21205, USA.
Armando E. Gonzalez, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de
San Marcos, Lima, Peru.
Dinora F. Gonzlez-Esquivel, Laboratorio de Neuropsicofarmacologia, Instituto Nacional de
Neurologia y Neurocirugia, Mxico City, Mxico.
Rakesh K. Gupta, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of
Medical Sciences, Rae Bareli Road, Lucknow 226 014, Uttar Pradesh, India.
W. Allen Hauser, Department of Neurology and Public Health, College of Physicians and
Surgeons, Columbia University, GH Sergievsky Center, 630 West 168th Street, New York
10032, USA.
Akira Ito, Department of Parasitology, Asahikawa Medical College, Midorigaoka-Higashi
2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan.
Satish Jain, Department of Neurology, Neurosciences Center, All India Institute of Medical
Sciences, New Delhi, 110 029, India.
Helgi Jung, Laboratorio de Neuropsicofarmacologia, Instituto Nacional de Neurologia y
Neurocirugia, Mxico City, Mxico.
Alok M. Kar, Department of Neurology, King Georges Medical College, Lucknow, 226 003,
Uttar Pradesh, India.
Atul Kumar, Dr Rajendra Prasad Center for Ophthalmic Sciences, All India Institute of
Medical Sciences, Ansari Nagar, New Delhi 110 029, India.
Teresa Lopez, Laboratorio de Micribiologia y Parasitologia, Facultad de Medicina
Veterinaria, Universidad Nacional Mayor de San Macos, Cdra. 29 Av. Circunvalacion s/n
San Borja, Lima, Peru.
Mahesh C. Maheshwari, Department of Neurology, Neurosciences Center, All India Institute
of Medical Sciences, New Delhi, 110 029, India.
Olga Mata-Ruiz, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Epidemiologicos, Secretaria de Salud, Mxico DF, Mxico.
Contributors
xi
Seppo Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21

(Haartmaninkatu 3) 00014, University of Helsinki, Finland.
Taru Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21
(Haartmaninkatu 3) 00014, University of Helsinki, Finland.
Antonio Meza-Lucas, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Jos L. Molinari, Department of Molecular Genetics, Institute of Cellular Physiology, National
Autonomous University of Mxico, Mxico DF 04510, Apartado Postal 70242, Mxico.
J.M.K. Murthy, Department of Neurology, The Institute of Neurological Sciences, CARE
Hospital, Nampally, Hyderabad, 500 001, India.
Minoru Nakao, Department of Parasitology, Asahikawa Medical College, MidorigaokaHigashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan.
Jaime H. Nieto, Division of Neurosurgery, University of California, Los Angeles,
HarborUCLA Medical Center, Los Angeles, California, USA.
Lopold Nzisabira, School of Medicine, Bujumbura, Burundi.
Munehiro Okamoto, Department of Laboratory Animal Sciences, School of Veterinary
Medicine, Faculty of Agriculture, Tottori University, Koyamacho-Minami 4-101, Tottori
680-8553, Tottori, Japan.
Anna Oomen, Neurochemistry Laboratory, Department of Neurological Sciences, CMC
Hospital, Vellore 632 004, India.
Vasantha Padma, Department of Neurology, Neurosciences Center, All India Institute of
Medical Sciences, New Delhi, 110 029, India.
Zbigniew S. Pawlowski, Clinic of Parasitic and Tropical Diseases, ul., Przybyszewskiego 49,
60-355 Poznan, Poland.
Sudesh Prabhakar, Department of Neurology, Postgraduate Institute of Medical Education
and Research, Chandigarh, 161 001, India.
Pierre-Marie Preux, Institut dEpidmiologie Neurologique et de Neurologie Tropicale, EA
3174 (Neuroparasitologie et Neuropidmiologie Tropicale) Facult de Mdecine, 2 rue du
Dr Marcland, 87025 Limoges, France.
Dong-Chuan Qiu, Sichuan Institute of Parasitic Diseases, 10 University Road, Chengdu
610041, Sichuan Province, Peoples Republic of China.
Vedantam Rajshekhar, Department of Neurological Sciences, Christian Medical College and
Hospital, Vellore, 632 004, India.
Bienvenue Ramanankandrasana, Institut dEpidmiologie Neurologique et de Neurologie
Tropicale, EA 3174 (Neuroparasitologie et Neuropidmiologie Tropicale) Facult de
Mdecine, 2 rue du Dr Marcland, 87025 Limoges, France.
Yasuhito Sako, Department of Parasitology, Asahikawa Medical College, MidorigaokaHigashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan.
Rodrigo A. Salinas, Healthcare Programmes Division, Ministry of Health, Chile.
Ana L. Sanchez, Department of Microbiology, National Autonomous University of
Honduras, Tegucigalpa, Honduras.
Elsa Sarti, INDRE, Carpio no. 470, 3rd floor, Col. Sto. Toms, CP 04230, Mexico City, Mexico.
Indermohan S. Sawhney, Department of Neurology, Morriston Hospital, Morriston,
Swansea SA6 6NL, UK.
Peter M. Schantz, Division of Parasitic Diseases, National Center for Infectious Diseases
Centers for Disease Control and Prevention, Atlanta, Georgia 30341, USA.
Wayne X. Shandera, Department of Medicine, Sections of General Internal Medicine and
Infectious Diseases, Baylor College of Medicine and Ben Taub General Hospital, Houston,
Texas 77030, USA.
Deepshikka Sharda, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of
Medical Sciences, Rae Bareli Road, Lucknow, 226 014, Uttar Pradesh, India.
xii
Contributors
Bhawani S. Sharma, Department of Neurosurgery, CN Center, Room 720, All India Institute
of Medical Sciences, Ansari Nagar, New Delhi, 110 029, India.
Namrata Sharma, Dr Rajendra Prasad Center of Ophthalmic Sciences, All India Institute of
Medical Sciences, Ansari Nagar, New Delhi, 110 029, India.
Gagandeep Singh, Department of Neurology, Dayanand Medical College and Hospital,
Ludhiana, 141 001, Punjab, India.
Bhim S. Singhal, Department of Neurology, Bombay Hospital Institute of Medical Sciences,
12 Marine Lines, Mumbai, 400 0020, India.
Achal Srivastava, Department of Neurology, Neurosciences Center, All India Institute of
Raquel Tapia-Romero, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia
Patricia Tato, Department of Microbiology and Parasitology, Faculty of Medicine, National
Autonomous University of Mxico, Mxico DF 04510, Mxico.
Judy M. Teale, Department of Microbiology, The University of Texas Health Science Center at
San Antonio, San Antonio, Texas 78229, USA.
Manjari Tripathi, Department of Neurology, Neurosciences Center, All India Institute of
Victor C.W. Tsang, Division of Parasitic Diseases, National Center for Infectious Diseases,
Manuela Verastegui, Laboratorio de Parasitologia, Facultad de Ciencias, Universidad
Peruana Cayetano Heredia, Av. Honorio Delgado s/n Urbanizacion Ingeniera, San Martin
de Porres, Lima, Peru.
Noshir H. Wadia, Director of Neurology, Jaslok Hospital and Research Center, Mumbai,
India.
Karen M. Weidenheim, Division of Neuropathology, Montefiore Medical Center, AECOM,
YU111, East 210th Street, Bronx, New York 10467, USA.
A. Clinton White Jr, Infectious Disease Section, Department of Medicine, Baylor College of
Medicine, One Baylor Plaza, Houston, Texas 77030, USA.
Patricia P. Wilkins, Division of Parasitic Diseases, National Center for Infectious Diseases,
Marianna Wilson, Division of Parasitic Diseases, National Center for Infectious Diseases,
Hiroshi Yamasaki, Department of Parasitology, Asahikawa Medical College, MidorigaokaHigashi 2-1-1-1, Asahikawa, 078-8510, Hokkaido, Japan.
Preface
Neurocysticercosis and the macroparasite Taenia solium, which causes it, have been known
about for time immemorial. Through history, one can follow the development of concepts
regarding the aetiology, pathology, clinical science and treatment of the disorder. Recent
times have however been complicated by accumulating knowledge regarding molecular biology, immunology and genetics of the disorder. The relationship between the molecular laboratory and bedside clinical practice is becoming increasingly powerful. In these times of
molecular advances, a review of neurocysticercosis and T. solium that focuses on past accomplishments, current understanding and future hopes seems appropriate. A number of scientific antecedents mean that the goals of effective treatment and, more importantly, eradication
are foreseeable. This alone prompted the genesis of this textbook, which symbolizes the spirit
of unity between basic researchers, clinicians and field workers. Since the book involved a
large number of subspeciality areas including parasitology, immunology, biology, genetics,
epidemiology and public health, clinical neurology, radiology and veterinary medicine, it
was impossible for two authors alone to write such a volume. Therefore, we solicited the contribution of a number of experts, each with great depth of knowledge and experience in their
respective areas. The contributors to this book are its principal strength and we are indebted
to them for their time and effort spent not only in writing their respective chapters but also
for the years of painstaking work that led to the realization of knowledge through basic, clinical or field research. It is because of their involvement, that the book turns out what it was
meant to be, a one-stop shop for T. solium cysticercosis.
We express our appreciation of several associates among the contributors, who gave
invaluable suggestions while planning the book project and were also involved in stimulating discussions: James Allan, Peter Schantz, Ana Flisser, Patricia Wilkins, Hector Garca,
Akira Ito, Phillip Craig, Arturo Carpio, Carlton Evans and Svetlana Agapejev. Davinder
Singh and Arun Gupta provided excellent editorial assistance with the text and illustrations,
respectively. Finally, this book is a tribute to those millions afflicted by the disorder. They
have contributed in their own way to the understanding of the disorder. It is our fervent
hope that the recent accomplishments in scientific understanding brought out in this volume
will ultimately lead to the goal of complete global eradication of the parasite, T. solium.

xiii
Abbreviations
AED
AFB
AIDS
ALBSO
ATT
AUC
C1
CDC
cDNA
CECT
CI
Cmax
CNS
COI
COII
COIII
Con A
CSF
CT
CWG
DTH
EDTA
EEG
EITB
ELISA
ES
FLAIR
FMO
Gd
GIS
GPL
GST
HIV
HLA
HPLC-ELISA
hsps
antiepileptic drug
acid-fast bacilli
acquired immune-deficiency syndrome
albendazole sulphoxide
antitubercular treatment
area under the plasma concentrationtime curve
first cervical vertebra
Centers for Disease Control
complementary deoxyribonucleic acid
contrast enhanced CT
confidence interval
maximal concentration
central nervous system
cytochrome c oxidase subunit I
cytochrome c oxidase subunit II
cytochrome c oxidase subunit III
concanavalin A
cerebrospinal fluid
computed tomography
Cysticercosis Working Group
delayed type hypersensitivity
ethylenediamine tetra-acetic acid
electroencephalography
enzyme-linked immunoelectrotransfer blot
enzyme-linked immunosorbent assay
excretorysecretory
fluid attenuation inversion recovery
flavin-containing monoxygenase
gadolinium
global information system
glycoproteins
glutathione-S-transferase
human immunodeficiency virus
human leucocyte antigen
high pressure liquid chromatography-ELISA
heat shock proteins

xiv
Abbreviations
HU
ICH
ICP
IDEMSC
IEF
IFN
IgG
IgM
IHA
IL
ILAE
IMOA
IMSC
IP
IV
IVNC
LLGP
LrRNA
MAb
MF
MoAb
MRI
mtDNA
NADH
NADPH
NC
Nd:YAG
NOD-SCID
Pc
PCR
PD
PoAb
PRA
Rnase
RR
rRNA
SCG
SDS-PAGE
SrRNA
SSECTL
sTS
TCD
Th
TNF
tRNA
VPS
Hounsfield units
intracranial hypertension
intracranial pressure
intradural extramedullary spinal cysticercosis
immunoelectrophoresis
interferon
immunoglobulin G
immunoglobulin M
indirect haemagglutination assay
interleukin
International League Against Epilepsy
intramuscular oncosphere assay
intramedullary spinal cysticercosis
intraperitoneal
intravascular
intraventricular neurocysticercosis
lentil lectin-bound glycoproteins
large subunit rRNA
monoclonal antibody
metacestode factor
monoclonal antibody
magnetic resonance imaging
mitochondrial deoxyribonucleic acid
reduced nicotinamide-adenine dinucleotide
nicotinamide-adenine dinucleotide phosphate (reduced form)
neurocysticercosis
neodymium:yttrium alminium-garnet
non-obese diabetic-severe combined immunodeficiency
corrected P value
polymerase chain reaction
proton density
polyclonal antibody
participatory rural appraisal
ribonuclease
relative risk
ribosomal ribonucleic acid
solitary cysticercus granuloma
sodium dodecyl sulphate-polyacrylamide gel electrophoresis
small subunit rRNA
single small enhancing CT lesion
synthetic Taenia solium
transcranial doppler
T helper cell
tumour necrosis factor
transfer ribonucleic acid
ventriculoperitoneal shunt
xv
Taenia solium: Basic Biology and

Transmission
Zbigniew S. Pawlowski
No animal has been responsible for more hypotheses, discussions and errors than the tapeworm
Casimir Joseph Davaine, 18601
Introduction
Even today, the above statement by the
author of a French textbook of parasitology
deserves attention. While some of the earlier
controversies regarding the taxonomic status, life cycle and pathogenicity of Taenia
solium have been solved, several issues in
relation to basic biology, modalities of transmission and control remain unsettled. A
major reason for these persisting uncertainties has been that the study of Taeniidae is
neither a research nor a control priority.
Fifty years ago in UK, and in many countries today, taeniasis in humans was considered a trifle, and regarded as more suitable
for an examination question than for consideration as a potential threat of cysticercosis2.
Basic, experimental as well as field studies
upon T. solium infection are still few. The
control of human cysticercosis for a long
time was left to veterinary services alone.
The eradication of human cysticercosis in
Europe made it clear that certain economic
and social standards and community discipline and cooperation were necessary for
successful control of infection. Since socioeconomic improvement is a gradual and
slow process, long-term control programmes
would take time in several developing countries where cysticercosis is endemic.

Recently, schemes for short-term control
have been developed with an aim to bring
about immediate control of T. solium infection in developing countries (reviewed in
Chapters 4144). These methods require
multidisciplinary collaboration between
clinical, veterinary and public health services, and immunology and parasitology
disciplines as well as support at the community and national levels3. In order to understand the basis of the control strategies, it is
necessary to have sound knowledge of the
life cycle and mechanisms of transmission of
infection. This chapter reviews basic biology
of T. solium with emphasis on aspects related
to its transmission.
Taxonomic Status of T. solium

The origin of tapeworms still remains a
controversial issue4,5. According to actual
systematics, there are two major subclasses
of tapeworms: Cestodaria and Eucestoda.
Taenia solium belongs to the subclass,
Eucestoda, order, Cyclophyllidea and
family, Taeniidae5. The family, Taeniidae

Z.S. Pawlowski
comprises 11 genera of small to large sized

tapeworms. They have a holdfast organ
the scolex and an elongated-segmented
tape-like body. Each segment has intricately developed sexual organs but does
not have an alimentary canal. The genus
Taenia has about 20 species; important
among these are T. solium (pork tapeworm),
T. saginata (beef tapeworm), T. crassiceps
(rodent tapeworm), T. hydatigena (canine
tapeworm), T. ovis (canine tapeworm) and
T. pisiformis (canine tapeworm). Only a few
species among Taeniidae present potential
health hazards to humans: Taenia solium, T.
saginata, Echinococcus granulosus and E. multilocularis. In addition, there are anecdotal
reports of human infection with T. crassiceps, T. hydatigena and T. multiceps. Few
other zoonotic species, e.g. T. taeniaeformis,
T. ovis and T. hydatigena are good models
for laboratory and field studies; the latter
can hardly be performed with T. solium on
account of its high pathogenic risk potential. Therefore, studies of related species
constitute a useful source of information on
biology and transmission of T. solium.
Although the Standardized Nomenclature
of Animal Parasitic Diseases recommended
the use of the term taeniosis (T. solium taeniosis, T. saginata taeniosis), the term, taeniasis continues to be widely used6. The term,
cysticercosis denotes infection with the
metacestode stage (cysticercus) of Taenia. It
was as late as 1853 that cysticerci were
demonstrated to be a developmental stage
of T. solium and not a separate parasite
species as was previously held7. The terms,
cysticercus cellulosae and cysticercus
bovis were introduced in the 18th century;
these are of historic value only and should
never be used in a generic fashion. In medical literature, the expression cysticercosis
synonymously denotes T. solium metacestode infection unless otherwise specified,
e.g. bovine cysticercosis.
Differences between T. solium, T. saginata

and T. saginata asiatica
Several morphological abnormalities of
strobila or individual proglottides of T. sagi-
nata, and less frequently T. solium adult

tapeworms have been noted, often giving
rise to taxonomic confusion in the past. The
taxonomic revision of genus Taenia, published by Verster, recognizes only two
species of Taeniidae, namely, T. solium and
T. saginata as capable of parasitizing the
human gut8,9. The so called Asian Taenia,
first described in 1980s in Taiwan, was initially proposed to be a new species but is
now accepted to be a subspecies of T. saginata namely, T. saginata asiatica (see Chapter
5)10,11. The adult stage of T. solium needs to
be differentiated from other Taeniidae, particularly the closely related T. saginata (Table
1.1, Fig. 1.1). Differences between scolices of
T. solium and T. saginata were recognized as
early as in the 17th century7. T. solium scolices are armed with hooks, while T. saginata
scolices are not. This easily visible criterion
is now of little routine diagnostic value as
intact scolices can rarely be found after
treatment with modern anthelminthics (that
cause considerable damage to the worm). In
general, the adult T. solium is smaller and
more delicate than T. saginata. For nearly
150 years, gravid proglottides of T. solium
and T. saginata were differentiated by counting the number of lateral uterine branches.
In 1967, Verster questioned this criterion
and proposed three morphological characteristics for distinguishing T. solium from T.
saginata, namely the presence of an armed
rostellum, three-lobed ovary and the
absence of a vaginal sphincter (Table 1.1,
Fig. 1.1)8. These differences are rarely
observed in routine diagnostic parasitology practice as scolices and mature
proglottides are not commonly available
and counting ovarian lobes as well as finding the vaginal sphincter requires fixation
and staining of mature proglottides, which
is an arduous procedure.
Enzyme electrophoresis for the differentiation of Taeniidae was elaborated in the early
1970s; it has been replaced by DNA fingerprinting in the 1990s12,13. Specific DNA probes
for T. solium and T. saginata are now available13. Intraspecific DNA differences were
demonstrated between T. solium tapeworms
originating from various continents (reviewed
in Chapter 5)14. These molecular studies also
Muscle, viscera
710 46
No rostellum
Rugae
1.52.0
4
0.70.8
Absent
Absent
412
1214
c. 2000
8001200
Two lobes
Present
No
1832 (15)
Dichotomous
Single, spontaneously
0.61.0
4
0.40.5
Present
2232
1.58
710
7001000
375575
Three lobes
Absent
Yes
712 (16)
Dendritic
Mainly in groups, passively
Cattle, reindeer
T. saginata
Brain, skin, muscle

5.68.5 3.16.5
Rostellum and hooks
Wart-like formations
Pig, wild boar
Intermediate host
Metacestodes
Site
Size (mm)
Scolex
Bladder surface
Adult tapeworm
Scolex
Diameter (m)
Number of suckers
Diameter of suckers (mm)
Rostellum
Number of hooks
Proglottides
Length (mm)
Maximal breadth (mm)
Number of proglottides
Mature proglottides
Number of testes
Ovary
Vaginal sphincter
Cirrus pouch extending to excretory vessels
Gravid proglottides
Number of uterine branches
Branching pattern
Expulsion from host
T. solium
Characteristic
1621 (32)
Dichotomous
Single, spontaneously
868904
Two lobes
Present
No
c. 3.5
c. 9.5
2601016
0.8
4
0.240.29
Present
Absent
Liver (exclusively)
22
Rostellum, rudimentary hooklets (137)
Wart-like formations
Pig, cattle, goat, some wild mammals
T. saginata asiatica
Table 1.1. Morphological differences between T. solium, T. saginata and T. saginata asiatica (compiled from references 10, 18, 37 and 46).
Basic Biology and Transmission

3
Z.S. Pawlowski
0.5 mm
(a)
(b)
(c)
2 mm
(d)
(e)
(f)
(g)
5 mm
ut
(h)
(i)
(j)
Fig. 1.1. Diagrammatic representation of the comparative morphological features of adult T. solium (a, d,
f, h), T. saginata (b, g, i) and T. saginata asiatica (c, e, j) (adapted from references 8, 10, 47). Note that
tri-lobed ovary in the mature proglottid of T. solium (d), in comparison to two lobes in the mature
proglottid of T. saginata and T. saginata asiatica (e), the presence of the vaginal sphincter in the atrium
genitale of T. saginata (g). Note also the differences in the branching pattern of the uterus of T. solium
(h), T. saginata (i) and T. saginata asiatica (j) proglottides.
support speciation of T. saginata asiatica as a

subspecies of T. saginata15. Recently, a serologic assay, using T. solium excretorysecretory antigens that is 95% sensitive and 100%
specific, has been developed to identify T.
solium tapeworms carriers (reviewed in
Chapter 33)16. A rapid, highly sensitive and
specific dot blot assay has also been developed for detection of T. solium eggs, which
otherwise cannot be differentiated from T. saginata and some other taeniid eggs by morphological criteria alone17. The differentiation of
T. solium and T. saginata taeniasis is important
for clinical reasons and epidemiological purposes. However, in regions, where both are
endemic in animals, and when species-specific diagnosis in humans is not possible, any
case of taeniasis should be considered and
treated without delay as suspected T. solium
infection.
Stages in Development of T. solium

The life cycle of T. solium is divided into six
characteristic developmental stages (Fig. 1.2):
1. Preadult tapeworm: a stage between the
cysticercus, after it has successfully invaded
the definite host, and the mature tapeworm.
2. Adult tapeworm: a reproductive stage
capable of producing thousands of eggs.
3. Egg: a small embryo covered by an
embryophore, a stage responsible for dissemination to the external environment.
4. Oncosphere: a hexacanth larva which
migrates from the intestine to internal tissues
or organs within the intermediate host.
5. Postoncospheral form: an intermediate
stage between an oncosphere in the tissues
and a fully developed cysticercus.
6. Cysticercus: a bladder metacestode form
that parasitizes tissues of the intermediate
host, mainly pigs as well as humans.
Taenia solium Infection: Host

Characteristics
Preadult and adult tapeworm
Humans are the major natural final host of T.
solium, implying that man, the only natural
definite host, is the most important multiplier, reservoir and disseminator of the infection to pigs. However, experimental
infections with adult T. solium after ingestion
of cysticerci have been successfully established in lar gibbon (Hylobates lar), chacma
baboon (Papio ursinus) and golden hamster
(Mesocricetus auratus). T. solium metacestodes
are less specific than adult cestodes18. The
list of mammals in which cysticerci armed
with hooks have been found includes monkeys (Ateles, Cercopithecus, Macacus sp.), wild
boars, bush pigs, bush babies, camels, rabbits, hares, rock hyraxes, brown bears, dogs,
foxes, cats, polecats, coatis, rats and mice18.
In addition, experimental infection with T.
solium oncospheres has been successfully
established in immunosuppressed mice (see
Chapter 4)19. However, many of the
reported cysticerci differed in the size of
hooks and immunoelectrophoretic pattern
of T. solium cysticerci; not all armed cysticerci are those of T. solium18. Humans are
unique in that they can harbour both adult
and metacestode stages.
The ingestion of pork contaminated with

cysticerci by man is a prerequisite for this
stage. Upon reaching the human intestine
the cysticercus evaginates and loses its
bladder wall. The adult tapeworm grows
up from behind the scolex of the cysticercus. It takes approximately 2 months to
develop into a mature, reproductively competent, adult tapeworm that is capable of
producing eggs.
The adult tapeworm has a scolex, an elongated neck and a strobila4. The scolex is the
holdfast organ armed with four suckers and a
rostellum displaying 2232 characteristic
hooks4. The strobila consists of 7001000 segments proglottids and can be extremely long
(Fig. 1.3). It is made up of immature, mature
and gravid proglottids, which differ in size,
shape and stage of development with respect
to their internal reproductive organs and egg
content (Fig. 1.1). Proglottids located proximally are small, short and reproductively
immature. Mature proglottids are almost rectangular and have fully developed sexual
organs. The gravid segments, located towards
the very distal end of the strobila, are
Z.S. Pawlowski
Stages
Habitat
Number
Time
*Human taeniasis
HUMANS
**Human cysticercosis around a carrier

**Human cysticercosis: external / internal autoinfection
1. Preadult
tapeworm
Gut
One
2 months
2. Adult
tapeworm
Gut
One
In years
(Gravid
proglottids)
Several in a
week
ENVIRONMENT
3. Eggs
Soil, water,
dirt
300,000 per day
One year
Transmission of human cysticercosis

PIGS
4. Oncosphere
Gut / tissue
Oneseveral
2 days
5. Post-oncosphere
Muscle, brain,
other organs
Oneseveral
1012 weeks
6. Cysticercus
Muscle, brain,
other organs
Oneseveral
<1 year
Transmission of human taeniasis: meatborne
Fig. 1.2. Diagrammatic representation of the life cycle of T. solium.
elongated (20 5 mm) and each is packed

with a uterus full of eggs. The gravid proglottids detach from the strobila by apolysis
either individually or in groups of two to five,
and are passed in the faeces a few times in a
week20. Discharged proglottides remain active
and may show some movements.
The tapeworm is a protoandrous hermaphrodite4. Its reproductive system is
intricately developed. Within each mature
proglottid, a centrally located ovary, a
vitelline gland and uterus, surrounded by
numerous testes can be seen. The male
reproductive organs include numerous
testes; each connected to the sperm duct

(vas deferens) leading to the genital pore.
The female reproductive system comprises
of a vagina, also located within the genital
pore, a receptaculum seminis, an oviduct, a
trilobed ovary and a vitelline gland. Both
self- and cross-fertilization may occur.
Spermatozoa formed in the testes are conveyed through the sperm duct to the genital
pore and thereafter to the vagina to finally
reach the receptaculum seminis and the
oviduct. The ovary discharges eggs in to the
oviduct, where the latter are fertilized by
spermatozoa. The fertilized eggs acquire
Fig. 1.3. Picture depicting the entire length of the adult T. solium tapeworm. (Source: Ana Flisser,
National Autonomous University of Mxico, Mxico DF, Mxico.)
Z.S. Pawlowski
yolk cells from a vitelline gland in the

oviduct itself and are relocated into the
uterus, where they are stored. As the uterus
tube is closed without any opening to outside it develops several ramifications packed
with eggs, thus occupying most of the
gravid proglottid. Besides the reproductive
system, the adult tapeworm has four major
organ systems: tegument, nervous system,
osmoregulatory system and muscular system. It has no digestive canal4.
While the tapeworm lives in human small
intestine, its scolex is temporarily fixed in the
duodenum and the strobila is bent a few
times21. However, it frequently moves up
and down, in synchrony with the passage of
incoming food. It adapts to the rather hostile
intestinal environment, being mobile, anaerobic, and is able to withstand the varying pH
and digestive enzymes within the intestine.
The adult worm is believed to survive for a
few years; new proglottides constantly
replace those expelled. Studies performed by
Yoshino in the 1930s are of interest2226. He
himself swallowed three T. solium cysticerci
and noted passage of proglottides starting
from 2 months after infection and lasting for
2 years and 3 months26. A tapeworm that
dies naturally or after treatment is easily
digested and disappears quickly without
(a)
(b)
being noticed in the faeces. Usually, a single

T. solium tapeworm parasitizes the human
gut; however, multiple infections may occur.
Superinfection probably exists; it has been
documented in experimental T. saginata
infection27.
Taenia solium eggs

The eggs of T. solium are morphologically
indistinguishable from those of other Taenia
sp. (Fig. 1.4a). As with eggs of other
Taeniidae, the outer shell of T. solium eggs is
very delicate and is usually lost while leaving the uterus. What is found in the faeces is
an oncosphere covered by an embryophore,
characteristic for all Taenia. The embryophore
is globular in shape and measures 3143 m
in diameter28. It has a thick striated cover
and contains an oncosphere armed with six
typical embryonic hooklets (giving it the
name, hexacanth embryo), usually visible
through the embryophore cover. The
embryophore protects the oncosphere
against various unfavourable environmental
conditions but is easily broken in the gut of
the intermediate host where the substance
cementing the keratin-like prismatic elements of its cover is digested.
(b)
(a)
Fig. 1.4. Taenia solium eggs (a) and oncospheres (b). The eggs are 40 30 m in size and surrounded
by a shell; in the centre of figure (a) is a disintegrating egg, showing the process of hatching of an
oncosphere. The oncospheres can be seen surrounding a single egg in (b); their size is smaller (30 20
m) and they contain characteristic embryonic hooklets. (Source: Akivo Ito, Asahikawa Medical College,
Asahikawa, Japan.)
The T. solium tapeworm can shed up to

300,000 eggs daily29. Each apolysed proglottid has approximately 40,000 eggs. Most of
the eggs are discharged from a pore at the
anterior part of the proglottid, but some
remain in the uterus. Eggs that are shed into
faeces may serve as a source of external
autoinfection to people in close contact with
the carrier. However, most eggs are disseminated to the environment. The fate of T.
solium eggs in the environment has not been
adequately studied. In regions that lack sanitation, free-ranging pigs feed upon faecal
matter that is indiscriminately deposited by
people. This is a natural method to reduce
contamination of the environment but it
increases incidence of swine cysticercosis.
The high reproductive potential of the
adult T. solium tapeworm is counterbalanced
by an enormous egg loss in the external environment29. Factors influencing egg survival
and infectivity have been studied in other
members of the genus Taenia and have been
comprehensively reviewed elsewhere3034.
Egg survival is adversely affected by
extremes of temperature and desiccation.
Conversely, humidity and temperatures
between 10C and room temperature favour
egg survival29. A number of agents such as
wind and water, and some invertebrates and
birds are believed to aid in taeniid egg dispersal3035. However, egg dispersal may be of
less importance in the life cycle of T. solium
than in that of Echinococcus sp., where sheep
presumably get infected while grazing heavily contaminated pasturage31.
Oncosphere
The mature oncosphere is a globular larva,
30 m in diameter (Fig. 1.4b). Its body is
composed of a few hundred cells differentiated into muscle, excretory and nervous system; it also has six characteristic embryonic
hooklets and a pair of penetration glands
that are helpful in migration5.
Oncospheres, enclosed within embryophores while leaving the human gut, are in
various stages of development. A few oncospheres are not fully developed and will
mature in the environment (as in the case of
E. granulosus oncospheres). Others are

mature and readily infective to humans
and/or pigs. There are also few senile
oncospheres that are incapable of developing further; nevertheless, they serve as
immunizing factors while disintegrating in
the intermediate host31. It is held that luminal factors such as bile salts are involved in
the liberation and activation of mature
oncospheres in the gut. Within 2 hours of
liberation, oncospheres enter submucosal
blood and/or lymphatic vessels and migrate
to internal organs such as liver, lungs, muscles and brain. Why oncospheres have a
predilection for certain sites such as muscle,
brain and subcutaneous tissue is not clear.
Postoncospheral stage or cysticercus

The postoncospheral development of the
larva (also designated as metacestode) proceeds within the intermediate host. During
this stage, the parasite does not attain sexual
maturity. The metacestode of the genus
Taenia is known as cysticercus. The parasite
is located in a cavity lined by host epitheloid
cells originating from small vessels. The
oncosphere quickly change from a solid
larva into a bladder form filled with fluid
and having a group of cells that will differentiate further into an invaginated scolex. The
experiments performed by Yoshino, referred
to earlier, helped to clarify the sequence of
development of the metacestode2325. When
the freed oncosphere enters the intestinal
wall, it is less than 0.03 mm in size23. At
about 6 days, the metacestode is still solid
and measures 0.4 0.3 mm23. It has an outer
membranous wall comprising of pleomorphic
cells, while its inner contents are myxomatous. By 12 days, the metacestode is larger
and becomes cystic. Between 20 and 30 days,
a rudimentary scolex is discernable24. Hooks
appear by 40 days and the rostellum and
suckers are distinguishable by 4050 days25.
The metacestode reaches its fully grown size
of 5.68.5 mm 3.16.5 mm by 6070 days.
The cysticercus is an ovoid bladder stage.
It is filled with an opalescent fluid and contains an invaginated scolex. The bladder consists of outer and inner layers. The outer
10
Z.S. Pawlowski
layer has characteristic hair-like processes.

This layer not only plays a protective role
but also serves as a trophoblast that absorbs
nutrients
and
excretes
metabolites36.
Between the outer and inner layers there are
few muscle bundles, fine fibres, flame cells,
calcareous corpuscles, neural and duct systems and a group of non-differentiated oval
cells. Any change in osmotic pressure causes
the scolex to become everted. The survival
time of a cysticercus is limited to a few years.
The naturally degenerating cysticercus
becomes necrotic and eventually gets calcified, or forms a granuloma that finally transforms into a fibrotic scar.
The cysticercus is typically found in the
intermediate host, i.e. the pig. In humans, the
cysticercus constitutes a dead-end stage, i.e.
its life cycle cannot progress any further.
However, its development in pigs, known as
porcine cysticercosis, perpetuates the life
cycle of the parasite when man ingests contaminated pork with viable cysticerci.
Biological and Economic Cycles of T.

solium: Implications for Control
Biological cycle
The relatively simple natural biological cycle
of T. solium zoonosis consists of two hosts
and the environment. Man, the final host,
harbours the adult tapeworm, which produces several thousands of eggs daily for
years. The eggs are disseminated to the environment through faeces. The pig, which is
the intermediate host, ingests some of these
eggs; the latter develop into cysticerci. When
man consumes contaminated pork containing cysticerci, the latter develop into an adult
worm inhabiting the human intestine. This
completes the life cycle of the parasite (Fig.
1.2). However, man may also be infected by
T. solium eggs through internal and external
autoinfection. External autoinfection implies
faecaloral infection with T. solium eggs in an
individual with intestinal taeniasis. Neglect
of hygienic standards such as washing hands
after defecation and before consuming meals
are principal reasons for external autoinfection. External autoinfection is an established
route of self-infection. Internal autoinfection,

suggested by Leukart in 1856 and cited by
others, implies infection with eggs through
reverse peristalsis37. Internal autoinfection
appears theoretically improbable since eggs
are required to pass through a brief period of
peptic digestion that is necessary for disintegration of the embryophores before being
invasive to human tissue37. The possibility of
internal autoinfection cannot be totally disregarded however, and merits further study.
From 5 to 40% of adult T. solium carriers
have
been
reported
to
develop
cysticercosis38. In the case of infection with T.
saginata, it has been demonstrated that the
immediate environment of the infected individual is heavily contaminated39. This may
not be the case, however, with pork tapeworm infection, because unlike T. saginata,
the proglottides of T. solium do not pass out
actively through the anus. Nevertheless, the
high rates of cysticercosis in individuals with
intestinal taeniasis and their family members
and household contacts confirm that
faecaloral self- and cross-infection is common38. Similarly, there is the theoretical possibility of outbreak of cysticercosis around T.
solium carriers in schools, closed institutions
and public eating facilities, though this has
never been adequately confirmed.
Economic cycle
One can imagine that in addition to the biological cycle of T. solium described above, an
economic cycle exists in several developing
countries40,41. Several economic factors sustain the life cycle of T. solium in underdeveloped regions. Each rural household, in
certain developing countries, rears pigs in
small numbers; the latter constitute an
important source not only of meat but also of
immediate income. The production of freeranging animals needs minimal investment
and running costs for the rural poor. In
absence of sanitary infrastructure, people use
houseyards, open areas and fields for defecation and ablution. This allows free-ranging
pigs access to human faeces and perpetuates
transmission of parasite from man to pig.
Individual rural pork producers and unli-
censed pig dealers are not motivated to pass

pork through meat inspection because of
threat of condemnation. Furthermore, the
lack of fuel as well as the local culinary
habits facilitate the consumption of raw or
semi-cooked meat. These factors lead to the
transmission of the parasite from pig to man
in endemic areas42. The socio-ecological and
economic factors strongly influence the
transmission of T. solium infection and are
responsible for its concentration in certain
areas, making short-term control with taeniasis therapy possible (discussed in Chapter
41)43,44.
Implications for control

In 1993, the Task Force for Disease
Eradication (Centers for Disease Control,
Atlanta, USA) itemized four diseases that
were potentially eradicable in the future;
these included lymphatic filariasis, mumps,
rubella and T. solium taeniasis/cysticercosis45. Several characteristics of T. solium
infection make it suitable for eradication,
namely, adult tapeworm infection in
humans is the only source of infection for
intermediate hosts (pigs); the animal intermediate host population can be managed;
11
there is no significant wildlife reservoir and

finally a feasible intervention is available in
the form of mass chemotherapy of human
taeniasis with safe and effective drugs
(reviewed in Chapter 41).
Conclusions
Six major stages of development have been
recognized in the life cycle of T. solium. Man
is a major reservoir, multiplier of the parasite
and disseminator of infection to both himself
and to the pig. The pig does not play the
most important role in spreading human
cysticercosis, as was believed until not long
ago. The role of the external environment in
transmission of T. solium infection is incompletely understood. The control of taeniasis/cysticercosis depends much not only on
the biological life cycle but also on the economic cycle of T. solium. Several factors
including inadequacies in pig husbandry,
sanitary facilities, meat inspection, personal
hygiene and local feeding habits are
involved in the perpetuation of the life cycle
of T. solium in the developing world. Control
strategies should be able to deal with these
deficiencies in order to be effective in eradicating taeniasis/cysticercosis.
References
1. Davaine, C.J. (1860) Traite des Entozoaires et des Maladies Vermineuses de lHomme et des Animaux
Domestiques. JB Bailire et fils, Paris, France.
2. Asher, R. (1953) Troublesome tapeworms. Lancet i, 10191021.
3. Schantz, P.M., Cruz, M., Sarti, E., et al. (1993) Potential eradicability of taeniasis and cysticercosis.
Bulletin of the Pan American Health Organization 27, 397403.
4. Wardle, R.A., McLeod, J.A., Radinovsky, S. (1974) Advances in the Zoology of Tapeworms 19501970.
University of Minnesota Press, Minneapolis, pp. 1022.
5. Smyth, J.D. (1994) Introduction to Animal Parasitology, 3rd edn. Cambridge University Press,
Cambridge, pp. 277387.
6. Kassai, T., Cordero del Campillo, M., Euzeby, J., et al. (1988) Standardized nomenclature of animal
parasitic diseases (SNOAPAD). Veterinary Parasitology 29, 299326.
7. Grove, D.I. (1990) Taenia solium taeniasis and cysticercosis. In: A History of Human Helminthology.
CAB International, Wallingford, UK, pp. 355383.
8. Verster, A. (1967) Redescription of Taenia solium Linnaeus, 1758 and Taenia saginata Goeze, 1782.
Zeitschrift fuer Parasitenkunde 29, 313328.
9. Verster, A. (1969) A taxonomic revision of the genus Taenia Linnaeus, 1758. Journal of Veterinary
Research 36, 358.
10. Eom, K.S., Rim, H.J. (1993) Morphological descriptions of Taenia asiatica sp. Korean Journal of
Parasitology 31, 16.
12
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
Z.S. Pawlowski
Fan, P.C., Chung, W.C. (1998) Taenia saginata asiatica: Epidemiology, infection, and immunological
and molecular studies. Journal of Microbiology, Immunology and Infection 31, 8489.
La Riche, P.D., Sewell, M.M.H. (1978) Differentiation of taeniid cestodes by enzyme electrophoresis.
International Journal of Parasitology 8, 479483.
McManus, D.P. (1990) Characterization of taeniid cestodes by DNA analysis. Revue Scientifique et
Technique 9, 489510.
Rishi, A.K., McManus, D.P. (1988) Molecular cloning of Taenia solium genomic DNA and characterization of taeniid cestodes by DNA analysis. Parasitology 97, 161176.
Zarlenga, D.S., McManus, D.P., Fan, P.C., et al. (1991) Characterization and detection of a newly
described Asian taeniid using cloned ribosomal DNA fragments and sequence amplification by the
polymerase chain reaction. Experimental Parasitology 72, 174183.
Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of a serologic assay to detect
Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199204.
Chapman, A., Vallejo, V., Mossie, K.G., et al. (1995) Isolation and characterization of species-specific
DNA probes from Taenia solium and Taenia saginata and their use in an egg detection assay. Journal of
Clinical Microbiology 33, 12831288.
Pawlowski, Z.S. (1982) Taeniasis and cysticercosis. In: Steele, J.H. (ed.) Handbook Series. Zoonoses.
Section C: Parasitic Zoonoses. CRC Press, Boca Raton, Florida Vol. 1, part 2, pp. 313348.
Wang, I.C., Ma, Y.X., Guo, J.X., et al. (1999) Oncospheres of Taenia solium and Taenia saginata asiatica
develop into metacestodes in normal and immunosuppressed mice. Journal of Helminthology 73,
183186.
Pawlowski, Z.S. (1994) Taeniasis and cysticercosis. In: Hui, Y.H., Gorham, J.R., Murrel, K.D., et al.
(eds) Foodborne Disease Handbook. Diseases Caused by Viruses, Parasites and Fungi. Marcel Dekker, New
York, Vol. 2, pp. 199254.
Prevot, R., Hornbostel, H., Dorken, H. (1952) Lokalisations-studien bei Taenia saginata. Klinische
Wochenschrift 30, 7880.
Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part I. On the hatching of eggs of Taenia solium. Journal of Medical Association of Formosa 32, 139141 (English summary).
Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part II. On the
youngest form of cysticercus cellulosae and on the migratory course of the oncospheres of Taenia
solium within the intermediate host. Journal of Medical Association of Formosa 32, 155158 (English
summary).
Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part III. On the
development of cysticercus cellulosae within the definite intermediate host. Journal of Medical
Association of Formosa 32, 166169 (English summary).
Yoshino, K. (1933) Experimental studies on the formation of the scolex of Taenia solium. Journal of
Medical Association of Formosa 32, 169171 (English summary).
Yoshino, K. (1934) On the subjective symptoms caused by parasitism of Taenia solium and its development in man. Journal of Medical Association of Formosa 33, 183194 (English summary).
Hornbostel, H. (1959) Bandwurmprobleme in neuer Sicht. Ferdinand Enke Verlag, Stuttgart, Germany,
pp. 159.
Laclette, J.P., Ornelas, Y., Merchant, M.T., et al. (1982) Ultrastructure of the surrounding envelopes of
Taenia solium eggs. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of
Knowledge and Perspectives. Academic Press, New York, pp. 375387.
Lawson, J.R., Gemmell, M.A. (1983) Hydatidosis and cysticercosis: the dynamics of transmission.
In: Baker, J.R., Muller, R. (eds) Advances in Parasitology. Academic Press, London, Vol. 22,
pp. 262308.
Gemmell, M.A., Johnstone, P.D. (1976) Factors regulating tapeworm populations: dispersion of eggs
of Taenia hydatigena on pasture. Annals of Tropical Medicine and Parasitology 70, 431.
Gemmell, M, Lawson, J.R., Roberts, M.G. (1987) Population dynamics in echinococcosis and cysticercosis: evaluation of the biological parameters of Taenia hydatigena and T. ovis and comparison
with those of Echinococcus granulosus. Parasitology 94, 161180.
Gemmell, M.A., Lawson, J.R. (1989) The ovine cysticercosis as models for research into the epidemiology and control of the human and porcine cysticercosis Taenia solium. I. Epidemiological considerations. Acta Leidensia 57, 165172.
Gemmell, M.A., Johnstone, P.D., Boswell, C.C. (1978) Factors regulating tapeworm population dispersion patterns of Taenia hydatigena eggs on pasture. Research in Veterinary Science 24, 334338.
13
34. Gemmel, M.A., Lawson, J.R. (1982) Ovine cysticercosis: an epidemiological model for the cysticercosies II. Host immunity and regulation of the parasite population. In: Flisser, A., Willms, K.,
Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New
York, pp. 647660.
35. Lonc, E. (1980) The possible role of the soil fauna in the epizootiology of cysticercosis in cattle. I.
Earthworms, II. Dung beetles the biotic factor in a transmission of Taenia saginata eggs. Angewandte
Parasitologie 21, 133138, and 139144
36. Bon, E.R., Merchant, M.T., Gonzalez-del Pliego, M., et al. (1982) Ultrastructre of the bladder wall of
the metacestode of Taenia solium. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis:
Present State of Knowledge and Perspectives. Academic Press, New York, pp. 261280.
37. Goennert, R., Meister, G., Strufe, R., et al. (1967) Biologische Probleme bei Taenia solium. Journal of
Tropical Medicine and Parasitology 18, 7681.
38. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging, and immunoblots: the emergence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A.,
Hughes, J.M. (eds) Emerging Infections. ASM Press, Washington, DC, pp. 213242.
39. Pawlowski, Z., Schultz, M.G. (1972) Taeniasis and cysticercosis (Taenia saginata). Advances in
40. Pawlowski, Z. (1991) Control of Taenia solium taeniasis and cysticercosis by focus oriented
chemotherapy of taeniasis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 284286.
41. The Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of
Peru. Bulletin of the World Health Organization 71, 223228.
42. Pawlowski, Z.S. (1990) Perspectives on the control of Taenia solium. Parasitology Today 6, 371373.
43. Cruz, M., Davis, A., Dixon, H., et al. (1989) Operational studies on the control of Taenia solium taeniasis/cysticercosis in Ecuador. Bulletin of the World Health Organization 67, 401407.
44. Craig, P.S., Rogan, M.T., Allan, J.C. (1996) Detection, screening and community epidemiology of
taeniid cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis.
Advances in Parasitology 38, 169250.
45. Centers for Disease Control and Prevention (1993) Recommendations of the International Task Force
for Disease Eradication. Mortality and Morbidity Weekly Report 42, 127.
46. Fan, P.C. (1988) Taiwan Taenia and taeniasis. Parasitology Today 4, 8688.
47. Faust, E.C., Russell, P.F., Jung, R.C. (1974) Clinical Parasitology. Lea and Fibiger, Philadelphia, USA.
Taenia solium Cysticercosis: New and

Revisited Immunological Aspects
Ana Flisser, Dolores Correa and Carlton A.W. Evans
Introduction
It has taken almost 25 years to unravel and
understand some of the characteristics and
mechanisms of the immune response elicited
against Taenia solium cysticercus within the
human host. Some of these are presently quite
clear, for instance, the heterogeneity of the
humoral immune response, the existence of
immune evasive mechanisms and the fact
that the immune response can both protect
and harm the host, as demonstrated in several
studies performed in animals. Others are still
at the stage of requiring precise identification,
such as the type and interactions of the components of the cellular immune response,
with specific reference to cytokines that may
play important roles in different stages of the
hostparasite relationship. Four different
aspects of the immunology of human T.
solium cysticercosis are discussed in this chapter: (i) components and characteristics of the
immune response; (ii) evasion of the host
immune response by the parasites; (iii) neurocysticercosis (NC) and neoplasia; and (iv) protective immunity induced against T. solium.
Components and Characteristics of

the Immune Response to T. solium
Cysticercosis
The immunology of NC is particularly important because of its paradoxical relationship
with disease pathogenesis. Living cysticerci

may cause an asymptomatic infection
through active evasion and suppression of
immunity. Histological studies have shown
that both in humans and pigs, live, viable cysticerci have little or no surrounding inflammation. Cysticerci may persist in the human
host for long periods of time, often for years
without eliciting surrounding host inflammatory reaction. In contrast, the immune mediated inflammation around one or more
degenerating cysts may precipitate symptomatic disease. When the parasite begins to
involute, either naturally or after treatment
with anticysticercal drugs, a surrounding
granulomatous inflammatory response develops both in human and porcine infections.
Predominant components of this inflammatory response include plasma cells, lymphocytes, eosinophils and macrophages. The
latter engulf parasite remnants, eventually
leaving a gliotic scar with calcification.
Several correlative clinical, neuroimaging,
immunological and histopathological studies
have amply demonstrated that symptomatic
human cysticercosis corresponds to the presence of tissue inflammation around involuting cysticerci that are transiting between the
live, viable stage and the calcified stage15.
The host immunological response to cysticerci
is becoming more and more complicated as
more knowledge is accumulating. Broadly it
can be divided into humoral and cellular
components, outlined below.

15
16
A. Flisser et al.
Humoral immune response

The humoral immune response is better
understood than the cellular one. The fact
that humans respond immunologically to
antigens of T. solium cysticerci is well evident from the number of immunodiagnostic
assays that have been developed using different types of antigens6,7. Several
immunoglobulin (Ig) classes are produced
as specific antibodies against the parasite.
The most frequent is IgG, which can be
detected in serum, cerebrospinal fluid (CSF)
and saliva and suggests that infection is of
long duration815. An interesting aspect of
the humoral immune response is its compartmentalization; there is evidence for local
synthesis of specific IgG antibodies within
the brain and the presence of a given antibody class in one compartment (i.e. CSF or
serum) and its absence in the other compartments11,1621. Those cases where both CSF
and serum samples were obtained from the
same patient and were positive only in one,
suggest that the bloodbrain barrier is not
always damaged by the parasite. On the
other hand, seemingly there is a correlation
between the presence of antibodies and the
intensity of infection1. Enzyme-linked
immunoelectrotransfer blot (EITB) detected
only 28% of cases with a single cysticercus
compared with 94% of those with two or
more cysts. Furthermore, antibodies were
found in most cases that had live or involuting parasites, but only in few cases with calcified cysts, thereby suggesting that the
presence of antibodies is influenced by the
evolutionary stage of the parasite. Similarly,
in pigs, antibody responses were found to
be proportional to the intensity and duration of infection. In human cysticercosis, differences were also found between benign
and malignant cysticercosis, for instance,
cysticercotic encephalitis is very immunogenic6,9,16. Thus, the humoral immune
response in patients with NC is quite heterogeneous. Its heterogeneity is also evident
from the number of antigens recognized:
patients antibodies may react with one to
eight antigens in immunoelectrophoresis
and up to 30 antigens in EITB3,22,23.
Cellular immune response

Some of the earlier studies that evaluated
cellular immune responses in hospitalized
patients with NC under corticosteroid treatment reported low proliferation of peripheral blood mononuclear cells after
stimulation with mitogens and high proportions of CD8+ cells22,24. These initial studies
generated the belief that cellular responses
were impaired in NC. On the contrary, a
recent study that compared immune
responses in individuals with active,
untreated NC with paired controls, showed
that most patients responded adequately to
concanavalin A and to cysticercus antigens;
also, CD4+ and CD8+ counts were not significantly different from those of controls25.
Precise patterns and pathways of the cellular
responses in human NC are still under study
and until recently, no clear hypothesis was
available before demonstration of the
Th1/Th2 duality of the T-helper-cell
response (Fig. 2.1)26*. Precise molecular
mechanisms underlying Th1 and Th2
*T cells are of the following two types: helper (Th, CD3+/CD4+) and cytotoxic (CTL, CD3+/CD8+). The
former produce molecules that regulate the immune response, while the latter lyse histocompatible infected
or transformed cells (Fig. 2.1). The type of response elicited by Th cells depends on the subtype they transform
themselves to after antigen priming, i.e. Th1 or Th2. The two responses are becoming increasingly difficult to
understand as knowledge about them accumulates. Nevertheless, it can generally be said that Th1 cells
produce cytokines [including tumour necrosis factor- (TNF-) and interferon-gamma (IFN-)] that promote
inflammation, macrophage activation, and intracellular destruction of infectious agents; they also stimulate
proliferation of CD8+ cells. Thus, this response is primarily cellular. On the other hand, Th2 cells stimulate
most of the antibody responses, as well as granulocyte proliferation, differentiation and chemotaxis. The
major cytokines produced by the Th2 cells are interleukin-4 (IL-4), IL-5, IL-10 and IL-13. This type of response
is primarily humoral. Each response reciprocally down-regulates the other, for instance, IFN- stimulates the
Th1 response and inhibits Th2, while IL-4 promotes Th2 response and down-regulates Th1 response.
MHC class II
IL-4
Th0
CD4+
IL-12
MHC class I
Fig. 2.1. Diagrammatic overview of the Th1 and Th2 host immune responses.
Antigenpresenting
cell (APC)
Antigens
CTL
CD8+
Th2
CD4+
T helper
cells
Th1
CD4+
CD8+
Cytotoxic
cell
B cell
IL-4
IL-5
IL-6
IL-13
TNF-
IFN-
IL-15
Plasma cell
IgM
IgG
Antibodies
Macrophage
activation
IgE
IgA
New and Revisited Immunological Aspects

17
18
A. Flisser et al.
immune responses to natural and experimental cysticercosis are yet to be clarified.

Studies so far have addressed molecular
components in the CSF, serum and the granuloma itself. Increased levels of interleukin
(IL)-1 and IL-6 have been reported in CSF of
patients with inflammatory NC27. High levels of IL-6 in CSF of patients with subarachnoid NC have also been reported; this
possibly represents an acute phase response.
In addition, high levels of tumour necrosis
factor-alpha (TNF-alpha) have also been
noted in CSF of children with active NC28.
TNF-alpha was undetectable in controls and
children with inactive NC.
In asymptomatic humans, a single low
dose of the taeniacidal drug praziquantel,
given to treat intestinal parasites may cause
sufficient damage to latent asymptomatic
cysticerci that inflammation and seizures
result29. Similarly, full dose anticysticercal
therapy administered in heavy infections
has precipitated fatal cerebral inflammation30,31. An immunological study of NC
patients treated with praziquantel (without
major adverse effects) reported elevated soluble IL-2 in the CSF suggesting a Th1-type
immune response to therapy, in contrast
with the Th2-type immune response found
in animal models of viable cysticerci32. It
was therefore hypothesized that living cysticerci facilitate immune evasion by inducing a Th2-type immune response until the
death of the larval parasite allows a Th1mediated
inflammatory
response
to
develop. This model however, is not consistent with some of the other findings listed
above and it seems likely that the regulation
of immunity in T. solium cysticercosis is a
complex phenomenon.
Increased levels of eotaxin and IL-5, both
eosinophil-selective mediators, have been
found in the sera of patients with NC33.
These cytokines are involved in recruiting
eosinophils locally as well as systemically.
Interestingly, in the mouse model of
Angiostrongylus cantonensis infection, ablation of IL-5 activity with anti-IL-5 monoclonal antibody resulted in more severe
intracranial disease34. Furthermore, the presence of eosinophils as the first attack cells
was reported in porcine cysticercosis after
anticysticercal treatment and after vaccination35,36. This suggests that eosinophils may
play an important role in the degenerative
phase in this parasitic infection. Another
study showed that IL-2 was synthesized by
the peripheral blood cells of 58% of individuals with untreated, recently diagnosed NC,
while interferon- (IFN-), IL-4 and IL-10,
were only found in 11%, 10% and 14%,
respectively25. Interestingly, only IFN- was
increased in the group of patients as compared to controls.
The macroscopic disappearance of killed
cysticerci takes about 2 months, but the
immunological processes that occur within
the involuting granulomas are poorly understood. Very few immunohistochemical studies of the inflammatory response within
cysticercus granulomas located in the human
central nervous system have been performed,
mainly due to limited specimen tissue37,38.
Available reports suggest an intermixture of
Th1 and Th2 responses in human brain cysticercus granulomas. Observations made in
animals are of interest in understanding the
complex phenomena that occur in granulomas within the central nervous system.
Destruction of parasites in the natural intermediate host, the pig, is mediated by a granulomatous eosinophil-rich inflammation
(driven by the Th2 response), followed by
macrophage/lymphocyte-driven resolution
(involving the Th1 response)35. In apparent
discordance, a Th1 response prevails in
early granulomas, that is, when metacestodes are intact in a rodent model of cysticercosis (T. crassiceps in mice)39. In the same
model, late granulomas, wherein parasite
destruction is complete, exhibit a mixture of
Th1 and Th2 cytokines (IL-4). It would seem
then that if the first antibodycomplement
phenomenon does not destroy the oncosphere, the latter develops into a metacestode, giving rise to a hostparasite
relationship that, while in equilibrium, has a
more silent Th1-like pattern (i.e. IL-2), with
concomitant presence of antibodies mostly of
the IgG class. When this equilibrium is broken, a pro-inflammatory granulomatous
Th2-like process provokes parasite destruction. This would be followed by resolution of
the inflammatory reaction induced by Th1
cytokines (i.e. macrophages/lymphocytes).

The change from equilibrium to destruction has been demonstrated in cysticercal
granulomas in naturally infected pigs35,36.
Evasion of Host Immune Responses

by Parasites
One of the most interesting phenomena in
immunoparasitology is the evasion of host
immune responses by the parasite. As
alluded to earlier, cysticerci are capable of
surviving in the human host for several
years before their degeneration sets in. Live,
viable cysticerci are associated with little surrounding inflammation. This allows for the
maintenance of a hostparasite equilibrium
as a result of which the parasite is able to
survive in the host for long periods of time.
The mechanisms underlying this process are
complex and may involve the following4042.
Survival of parasites lodged in

immunologically privileged sites
After a brief period of migration, T. solium
oncospheres lodge in host tissues and transform into cysticerci. The site where they settle and the nature of their relationship to the
encapsulating host may contribute to sequestration of the parasites from immune attack.
The unequal distribution of cysticerci
throughout body tissues does not mirror
regional blood flow but may result from
selective invasion by the parasite or differential survival of larvae in immunologically
privileged sites43. For example, an experimental model of intraocular T. crassiceps cysticercosis, where the parasite is maintained
with ease in the anterior chamber of the eye,
has demonstrated that there is little inflammatory response to the parasite in that location44. Similarly, experimental chemotherapy
studies in pigs showed that parasites lodged
within the brain remained alive longer after
anticysticercal treatment than those located
in the muscles35. These studies indicate that
in naive hosts, cysticerci may develop or persist better in the eye and the brain, as compared to other tissues or organs.
19
Masking of cysticercal antigens by host

Igs
Cysts obtained from brain, eye and muscle of
patients with cysticercosis have demonstrable
IgG, IgM, IgA and IgE on their surface, while
specific antibodies of these classes, except for
IgG, have not been detected in the surrounding fluids45. Morphologically intact cysticerci
excised from pigs also present host Ig on their
surface46. These results suggest that living
parasites mask themselves with host Igs,
probably through Fc receptors on the surface
of the tegument, which could play a role in
the process of Ig endocytosis4750.
Concomitant immunity
Concomitant immunity refers to protection
conferred by already established parasites
against newly invading parasites of the same
species in a given host. Concomitant immunity may result from shifts in the expressed
antigens as parasites develop through their
life cycle. Hence, during initial infection, cysticerci may be able to counteract immune
effector mechanisms that kill less developed
forms. Experimental studies in the porcine
model of cysticercosis have shown that reinfection following a challenge with T. solium
eggs results in the partial destruction of established cysticerci rather than establishment of
additional tissue cysts51. This implies that
prior infection protects against new infection.
It may be surmised that this protective effect
results from shifts in the antigens expressed
by parasites through different stages of their
development in the host. Hence, fully developed cysticerci may express different antigens
that are able to withstand host immune
responses more effectively than developing
cysticerci. It is known that after 1 week of
infection, the surface of parasites, previously
covered
by
microvilli,
changes
to
microtriches52 and that surface antigens
change during development in Hymenolepis
nana53. Concomitant immunity may explain
the lack of overwhelming cysticercosis in
hyperendemic regions, since animals may
only be able to acquire cysticercosis for 1 or 2
weeks after primary exposure54.
20
A. Flisser et al.
Parasites may evade immune recognition by

synthesizing host-like antigenic determinants. Immunoglobulin G on the surface of
T. solium cysticerci does not show specificity
for antigens on the cysticercus55. The possibility that it is synthesized by the parasite
was tested in vitro by translation of parasitederived messenger-RNA55. Though not adequately proven, molecular mimicry, i.e.
synthesis of host-like antigens by the parasite, may be one the mechanisms involved in
immune evasion.
and in healthy controls69,70. Also, 17% of 43

patients with glioma but only 3% of 172 controls had NC65. Whether these chromosomal
alterations in lymphocytes or increased
cytokine synthesis are responsible for the
establishment of neoplasia is not clear. Even
though, as mentioned in the earlier sections
of this chapter, cysticerci do not seem to
induce a generalized immune suppression,
since patients produce antibodies, inflammatory reaction, and cytokines, have normal
white cell counts and generally good state of
health and their immune cells respond in
vitro to parasite antigens and mitogens.
Suppression or deviation of the host

responses
Protective Mechanisms against

T. solium Cysticercosis
The presence of anti-complementary activity

described long ago suggested that the classical and the alternative pathways of the complement cascade are inhibited by cysticerci56.
Paramyosin (previously known as antigen B)
was shown to bind and inhibit C1q, the first
component of the complement cascade57.
Since this antigen is being released by cysticerci and due to the fact that it is recognized by antibodies of most patients with
NC, it could have a dual role in immune evasion: inhibition of C1q and deviation of antibodies to host tissues7,11,57,58. There are
several reports of the presence of immunosuppressive factors in extracts prepared from
metacestodes of various Taenia species,
which inhibit proliferation of lymphocytes
against mitogens, or the synthesis of IL25964, that are reviewed by Molinari and Tato
in Chapter 3.
Since there are many Taenia species that

infect mammals, there are numerous studies
in rodents, ovine and bovines which demonstrate that it is possible to acquire protection
against cysticercosis by vaccination. In most
studies, crude antigens have been obtained
from oncospheres, cysticerci or tapeworms59,71. These studies have been relatively easy to perform since the different
stages of the parasite (cysticerci and tapeworms) can develop in animals. Various
degrees of protection have been reported,
living oncospheres and oncospheral antigens
being the most effective immunogens59,71.
Recombinant proteins and DNA vaccines
have yielded high degrees of immunity7278.
The reader is referred to a detailed discussion of this aspect in Chapter 42.
Molecular mimicry
Conclusions
NC and Neoplasia
A recent analysis of autopsy files suggested
that NC might be a risk factor for human
cancer, specifically of the lymphoid
tissues6568. Several data support this
hypothesis. Chromosome aberrations in
peripheral blood lymphocytes are more common in patients with NC and in cysticercotic
pigs as compared to those observed in the
same cases after anticysticercal treatment
It is known that antibodies and complement

are protective against T. solium oncospheres
(Fig. 2.2), but if the pace of the host immune
response is slow, then the parasites develop
mechanisms to evade the latter. As a result,
metacestodes establish and antibodies and
complement are no longer effective in
destroying them. Thus, a race between
development of protective immune mechanisms by the host and evasive mechanisms
21
Phase II. Viable cysticerci and concomitant IR.

Immune evasion?
IR
Phase III.
Resolution.
Immunotherapy?
Phase I: Oncosphere and

developing immune
response (IR).
Vaccination?
0
0
10
15
20
Infection time
Fig. 2.2. Phases of cysticercosis in relation to immune response. The initial Phase I is characterized by
the development of immune mediated protective mechanisms in the host and the differentiation of the
oncosphere into a metacestode. Phase II is a period during which the parasite and the host coexist due
to the development of immune evasive mechanisms by the parasite. Finally, in Phase III, the
hostparasite equilibrium is broken and the parasite is destroyed by an immune reaction that sometimes
even damages the host. This final phase leads to resolution of the infection.
by the parasite occurs during the initial

period of infection. Subsequently, an equilibrated hostparasite relationship develops
that may last for long periods of time and
maintains concomitant immunity. The
immune response against T. solium cysticerci appears to have both Th1 and Th2
components, although their precise roles
remain controversial. Through not yet
understood mechanisms, the parasite is
killed primarily by eosinophils, which are
probably chemo-attracted to the site by

lymphoid cells. It is surmised that this specific response is mediated by Th2 cytokines.
Finally, an intense granulomatous type of
inflammatory reaction occurs that leads to
complete parasite destruction and resolution with fibrosis. This last mechanism is
probably of the Th1-type. Thus, it seems
that the Th1 and Th2 cytokines play different roles during various stages of the
hostparasite relationship.
References
1. Correa, D., Medina-Escutia, E. (1999) Hostparasite immune relationship in Taenia solium taeniosis
and cysticercosis. In: Garca, H.H., Martnez, S.M. (eds) Taenia solium Taeniasis/Cisticercosis, 2nd
edn. Editorial Universo, Lima, Per, pp. 1524.
2. de Aluja, A., Vargas, G. (1988) The histopathology of porcine cysticercosis. Veterinary Parasitology 28,
6577.
3. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed) Progress in Clinical
Parasitology. CRC Press, Boca Raton, Florida, pp. 77116.
4. Sciutto, E., Fragoso, G., Fleury, A., et al. (2000) Taenia solium disease in humans and pigs: an ancient
parasitosis disease rooted in developing countries and emerging as a major health problem of
global dimensions. Microbes and Infection 2, 18751890.
22
A. Flisser et al.
5. Willms, K., Sotelo, J. (2001) Cestodes. In: Gillespie, S., Pearson R.D. (eds) Principles and Practice of
Clinical Parasitology. John Wiley & Sons, New York, pp. 613633.
6. Flisser, A., Larralde, C. (1986) Cysticercosis. In: Walls, K.W., Schantz, P.M. (eds) Immunodiagnosis of
Parasitic Diseases. Academic Press, New York, pp. 109161.
7. Flisser, A., Woodhouse, E., Larralde, C. (1980) Human cysticercosis: antigens, antibodies and nonresponders. Clinical and Experimental Immunology 39, 2737.
8. Grogl, M., Estrada, J.J., MacDonald, G., et al. (1985) Antigenantibody analyses in neurocysticercosis. Journal of Parasitology 71, 433442.
9. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1986) Evaluation of enzyme-linked immunosorbent assay in
serological diagnosis of human neurocysticercosis using paired samples of serum and cerebrospinal
fluid. Korean Journal of Parasitology 24, 2541.
10. Corona, T., Pascoe, D., Gonzalez-Barranco, D., et al. (1986) Anticysticercus antibodies in serum and
cerebrospinal fluid in patients with cerebral cysticercosis. Journal of Neurology, Neurosurgery and
Psychiatry 49, 10441049.
11. Espinoza, B., Ruiz-Palacios, G., Tovar, A., et al. (1986) Characterization by enzyme linked
immunosorbent assay of the humoral immune response in patients with neurocysticercosis and its
application in immunodiagnosis. Journal of Clinical Microbiology 24, 536541.
12. Feldman, M., Plancarte, A., Sandoval, M., et al. (1990) Comparison of two assays (EIA and EITB) and
two samples (saliva and serum) for the diagnosis of neurocysticercosis. Transactions of the Royal
Society of Tropical Medicine and Hygiene 84, 559562.
13. Zini, D., Farrell, V.J.R., Wadee, A.A. (1990) The relationship of antibody levels to the clinical spectrum of human neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 53, 656661.
14. Short, J.A., Heiner, D.C., Hsiao, R.L., et al. (1991) Immunoglobulin E and G4 antibodies in cysticercosis. Journal of Clinical Microbiology 28, 16351639.
15. Spina-Franca, A., Livramento, J.A. (1982) Cerebrospinal fluid immunology in neurocysticercosis.
European Review of Medicine and Pharmacological Science 4, 385388.
16. Miller, B.L., Heiner, D., Golderg, M.A. (1983) The immunology of cerebral cysticercosis. Bulletin of
Clinical Neurosciences 48, 1823.
17. Pammenter, M.D., Rossouw, E.J., Epstein, S.R. (1987) Diagnosis of neurocysticercosis by enzymelinked immunosorbent assay. South African Medical Journal 71, 512514.
18. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1988) Intracranial synthesis of specific IgG antibody in cerebrospinal fluid of neurocysticercosis patients. Korean Journal of Parasitology 26, 1526.
19. Correa, D., Plancarte, A., Sandoval, M.A., et al. (1989) Immunodiagnosis of human and porcine cysticercosis. Detection of antibodies and parasite products. Acta Leidensia 57, 93100.
20. Estaol, B., Juarez, H., Irigoyen, M.C., et al. (1989) Humoral immune response in patients with cerebral parenchymal cysticercosis treated with praziquantel. Journal of Neurology, Neurosurgery and
21. Bueno, E.C., Vaz, A.J., Machado, L.R., et al. (2000) Total IgE detection in paired cerebrospinal fluid
and serum samples from patients with neurocysticercosis. Revista do Instituto de Medicina Tropical de
So Paulo (Sao Pulo) 42, 6770.
22. Flisser, A., Rivera, L., Trueba, J., et al. (1982) Immunology of human neurocysticercosis. In: Flisser,
A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives.
Academic Press, New York, pp. 549563.
23. Larralde, C., Montoya, R.M., Sciutto, E., et al. (1989) Deciphering western blots of tapeworm in antigens. Taenia solium, Echinococcus granulosus and Taenia crassiceps resolving with sera from neurocysticercosis and hydatid disease patients. American Journal of Tropical Medicine and Hygiene 40, 282290.
24. Correa, D., Tovar, A., Espinoza, B., et al. (1989) Cisticercosis humana: relacin inmunolgica
husped-parsito. In: Flisser, A., Malagon, F. (eds) Cisticercosis Humana y Porcina. Su Conocimiento e
Investigacion en Mexico. Limusa-Noriega, Mexico DF, Mexico, pp. 3143.
25. Medina-Escutia, E., Morales-Lpez, Z., Proao, J.V., et al. (2001) Cellular immune response and
Th1/Th2 cytokines in human neurocysticercosis: lack of immune suppression. Parasitology 87,
587590.
26. Mosmann, T.R., Coffman, R.L. (1989) Th1 and Th2 cells: different patterns of lymphokine secretion
lead to different functional properties. Annual Review of Immunology 7, 145173.
27. Ostrosky-Zeichner, L., Garca-Mendoza, E., Ros, C., et al. (1996) Humoral and cellular immune
response within the subarachnoid space of patients with neurocysticercosis. Archives of Medical
Research 27, 513517.
23
28. Aguilar-Robolledo, F., Cedillo-Rivera, R., Llaguno-Violante, P., et al. (2001) Interleukin levels in cerebrospinal fluid from children with neurocysticercosis. American Journal of Tropical Medicine and
Hygiene 64, 3540.
29. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticercosis after a single taeniacidal dose of praziquantel. Lancet 342, 748.
30. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: new observations, including CT
scan findings and experience with treatment by praziquantel. Brain 111, 597614.
31. Takayanagui, O.M., Chimelli, L.L. (1998) Disseminated muscular cysticercosis with myositis
induced by praziquantel therapy. American Journal of Tropical Medicine and Hygiene 59, 10021003.
32. Cruz-Revilla, C., Rosas, G., Fragoso, G., et al. (2000) Taenia crassiceps cysticercosis: protective effect
and immune response elicited by DNA immunization. Journal of Parasitology 86, 6774.
33. Evans, C.A.W., Garca, H.H., Hartnell, A., et al. (1998) Elevated concentration of eotaxin and interleukin-5 in human neurocysticercosis. Infections and Immunity 66, 45224525.
34. Sasaki, O., Suguya, H., Ishida, K., et al. (1993) Ablation of eosinophils with anti IL-5 antibody
enhances the survival of intracranial worms of Angiostrongylus cantonensis in the mouse. Parasite
Immunology 15, 349354.
35. Flisser, A., Gonzalez, D., Skhurovich, M., et al. (1990) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis. 1. Radiological, physiological and histopathological studies.
Parasitology Research 76, 263269.
36. Molinari, J.L., Meza, R., Suarez, B., et al. (1983) Taenia solium: immunity in hogs to the cysticercus.
Experimental Parasitology 55, 340357.
37. Restrepo, B., Llaguno, P., Sandoval, M.A., et al. (1998) Analysis of immune lesions in neurocysticercosis patients: central nervous system response to helminth appears Th1-like instead of Th2. Journal
of Neuroimmunology 89, 6472.
38. Restrepo, B.I., Alvarez, J.I., Castano, L.F., et al. (2001) Brain granulomas in neurocysticercosis are
associated with a Th1 and Th2 profile. Infections and Immunity 69, 45544560.
39. Robinson, P., Altamar, R., Lewis, D., et al. (1997) Granuloma cytokines in murine cysticercosis.
Infections and Immunity 65, 29252931.
40. Mitchell, G.F. (1982) Genetic variation in resistance of mice to Taenia taeniaeformis: analysis of hostprotective immunity and immune evasion. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds)
Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 575584.
41. Flisser, A. (1989) Taenia solium cysticercosis: some mechanisms of parasite survival in immunocompetent hosts. Acta Leidensia 57, 259263.
42. White, A.C. Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: hostparasite interaction and
the immune response. Clinical Immunology 66, 209230.
43. Barker, C.F., Billingham, R.E. (1977) Immunologically privileged sites. In: Kunkel, H.G., Dixon, F.J.
(eds) Advances in Immunology, Vol. 25. Academic Press, New York, pp. 154.
44. Crdenas, F., Plancarte, A., Quiroz, H., et al. (1989) Taenia crassiceps: experimental model of intraocular cysticercosis. Experimental Parasitology 69, 324329.
45. Correa, D., Dalma, D., Espinoza, B., et al. (1985) Heterogeneity of humoral immune components in
human cysticercosis. Journal of Parasitology 71, 535541.
46. Willms, K., Arcos, L. (1977) Taenia solium: host serum proteins on the cysticercus surface identified
by an ultrastructural immuno-enzyme technique. Experimental Parasitology 43, 396401.
47. Mandujano, A., Vela, M., Alcntara, P., et al. (1990) Presence of a receptor for the Fc fraction of IgG in
Taenia solium (Abstract). Bulletin de la Societie de la Socit Franaise Parasitologie 8 (Suppl. 1), 578.
48. Kalinna, B., MacManus, D.P. (1993) An IgG (Fc gamma)-binding protein of Taenia crassiceps
(Cestoda) exhibits sequence homology and antigenic similarity with schistosome paramyosin.
49. Hayunga, E.G., Sumner, M.P., Letonja, T. (1989) Evidence of selective incorporation of host
immunoglobulin by strobilocerci of Taenia taeniaeformis. Journal of Parasitology 75, 638642.
50. Ambrosio, J., Landa, A., Merchant, M.T., et al. (1994) Protein uptake by cysticerci of Taenia crassiceps.
Archives of Medical Research 25, 325330.
51. Herbert, I.V., Oberg, C. (1974) Cysticercosis in pigs due to infection with Taenia solium Linnaeus,
1758. In: Soulsby, E.J.L. (ed.) Parasitic Zoonosis. Academic Press, New York, pp. 199211.
52. Williams, J.F., Engelkirk, P.G., Lindsay, M.C. (1982) Mechanisms of immunity in rodent cysticercosis.
In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and
Perspectives. Academic Press, New York, pp. 621631.
53. Ito, A., Onitake, K. (1987) Changes in surface antigens of Hymenolepis nana during differentiation
and maturation in mice. Journal of Helminthology 61, 129136.
24
A. Flisser et al.
54. Gemmell, M.A. (1972) Hydatidosis and cysticercosis 4. Acquired resistance to Taenia hydatigena
under conditions of a strong infection pressure. Australian Veterinary Journal 48, 2628.
55. Willms, K., Arcos, L. (1997) Taenia solium cysticercosis: hostparasite interactions and the immune
response. Clinical Immunology 66, 209230.
56. Hammemberg, B., Williams, J.F. (1978) Physico-chemical characterization of complement-interacting
factors from Taenia taeniaeformis. Journal of Immunology 120, 10391045.
57. Laclette, J.P., Shoemaker, C., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of
58. Laclette, J.P., Merchant, M.T., Willms, K. (1987) Histological and ultrastructural localization of antigen B in the metacestode of Taenia solium. Journal of Parasitology 73, 121125.
59. Flisser, A., Prez-Montford, R., Larralde, C. (1979) The immunology of human and animal cysticercosis: a review. Bulletin of the World Health Organization 57, 839856.
60. Burger, C.J., Rikihisa, Y., Lin, Y.C. (1986) Taenia taeniaeformis inhibition of mitogen induced proliferation and interleukin-2 production in rat splenocytes by larval in vitro products. Experimental
61. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1990) Depressive effect of a Taenia solium cysticercus factor on cultured human lymphocytes stimulated with phytohemaglutinin. Annals of Tropical Medicine
and Parasitology 84, 205208.
62. Sciutto, E., Fragoso, G., Baca, M., et al. (1995) Depressed T cell proliferation associated with susceptibility to experimental infection with Taenia crassiceps infection. Infections and Immunology 63,
22772281.
63. Tato, P., Castro, A.M., Rodrguez, D., et al. (1995) Suppression of murine lymphocyte proliferation
induced by a small RNA purified from the Taenia solium metacestode. Parasitology Research 81,
181187.
64. Arechavaleta, F., Molinari, J.L., Tato, P. (1998) A Taenia solium metacestode factor non-specifically
inhibits cytokine production. Parasitology Research 84, 117122.
65. Del Brutto, O.H., Castillo, P.R., Mena, I.X., et al. (1997) Neurocysticercosis among patients with cerebral glioma. Archives of Neurology 54, 11251128.
66. Herrera, L.A., Benita-Bordes, A., Sotelo, J., et al. (1999) Possible relationship between neurocysticercosis and hematological malignancies. Archives of Medical Research 30, 154158.
67. Herrera, L.A., Ostrosky-Wegman, P. (2001) Do helminths play a role in carcinogenesis? Trends in
68. Herrera, L.A., Ramrez, T., Rodrguez, U., et al. (2000) Possible association between Taenia solium cysticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neurocysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 15.
69. Montero, R., Flisser, A., Madrazo, I., et al. (1994) Mutation at the HPRT locus in patients with neurocysticercosis treated with praziquantel. Mutation Research 305, 181188.
70. Flisser, A., Gonzlez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle
porcine Taenia solium cysticercosis. 2. Immunological and cytogenetic studies. Parasitology Research
76, 640642.
71. Lightowlers, M.W. (1994) Vaccination against animal parasites. Veterinary Parasitology 54, 177204.
72. Johnson, K.S., Harrison, G.B.L., Lightowlers, M.W., et al. (1989) Vaccination against ovine cysticercosis using a defined recombinant antigen. Nature 338, 585587.
73. Mitchel, G.F. (1990) Vaccines and vaccination strategies against helminths. In: Agabian, N., Cerami,
A. (eds) Parasites. Molecular Biology, Drug and Vaccine Design, Wiley-Liss Publications, New York,
pp. 349363.
74. Harrison, G.B.L., Heath, D.D., Dempster, R.P., et al. (1996) Identification and cDNA cloning of two
novel low molecular weight host-protective antigens from Taenia ovis oncospheres. International
Journal of Parasitology 26, 195204.
75. Lightowlers, M.W., Rolfe, R., Gaucci, C.G. (1996) Taenia saginata: vaccination against cysticercosis in
cattle with recombinant oncosphere antigens. Experimental Parasitology 84, 330338.
76. Rosas, G., Cruz-Revilla, G., Fragoso, G., et al. (1998) Taenia crassiceps cysticercosis: humoral immune
response and protection elicited by DNA immunization. Journal of Parasitology 84, 516523.
77. Plancarte, A., Flisser, A., Gaucci, C.G., Lightowlers, M.W. (1999) Vaccination against Taenia solium
cysticercosis in pigs using native and recombinant oncosphere antigens. International Journal for
78. Flisser, A., Lightowlers, M.W. (2000) Vaccination against Taenia solium cysticercosis. Memorias do
Instituto Oswaldo Cruz 96, 353356.
Molecular Determinants of
HostParasite Interactions: Focus on
Parasite
Jos L. Molinari and Patricia Tato
The relationship between helminths and their

hosts is complex and interesting. It is well
known that parasites elicit immunological
responses in their hosts. What is less well
known and appreciated, is that parasites
have evolved numerous ways of evading the
consequences
of
host
immunological
response. The net outcome is that parasites
frequently survive for long periods in fully
immunocompetent hosts. Host lymphocytes
and their cytokines play a crucial role in
determining the outcome of parasitic infection (reviewed in Chapter 2). In this chapter,
we review certain aspects of the hostparasite
interaction in Taenia solium cysticercosis with
special emphasis on parasite related factors.
been studied. An idea of the process can be

obtained from studies involving other
helminths. For instance, Hymenolepis nana
oncospheres make use of certain proteases in
addition to three pairs of hooks in order to
invade host tissues1. Similarly, serine protease activity and excretorysecretory peptidases have been isolated from penetration
glands of oncospheres of H. diminuta and T.
saginata, respectively2,3. It is held that these
enzymes participate in tissue invasion in
addition to performing nutritional functions.
Finally, T. solium egg infection induces
humoral immunological responses in human
hosts. This assumption is based on evidence
from in vitro studies, where serum from cysticercotic individuals destroys oncospheres in
presence of complement4.
Hostoncosphere interactions
Hostmetacestode interactions
Ingestion of food or water contaminated with

T. solium eggs is the most preliminary step in
the development of human cysticercosis.
Hatched and activated oncospheres penetrate
intestinal tissues, perforate small intestinal
blood vessels, and reach the bloodstream.
Here, they passively migrate and finally
lodge in target tissues and develop into
metacestodes. Specific mechanisms underlying T. solium oncosphere penetration have not
Host inflammatory response directed against

T. solium metacestodes is a major determinant
of clinical symptoms and signs of NC. There
is great variability in its onset, duration and
severity. The seminal study by Dixon and
Lipscomb has established that metacestodes
remain in host tissues in a viable, non-degenerate state for variable and prolonged periods
of time5. Eventually, usually after 45 years,
local and systemic immune responses against
Introduction

25
26
J.L. Molinari and P. Tato
metacestodes develop. As a result, metacestodes pass through a series of degenerativeevolutionary stages that are described in
detail in Chapters 30 and 32. Clinical symptoms and signs owe their appearance and
evolution to the host immune responses.
Furthermore, histological studies corroborate
the relationship between the evolutionary
stages of metacestodes and host immune
response. In both humans and pigs, live and
viable metacestodes are surrounded by only
discrete inflammatory reaction6,7. In comparison, studies on pigs pre-immunized with cysticercus antigens have revealed intense
granulomatous inflammation surrounding
the metacestodes8. These clinical, histological
and experimental observations have led several workers including ourselves, to postulate
that live T. solium metacestodes are able to
down-modulate host immune responses by
virtue of producing certain specific molecules. Several such molecules have been previously described911. Taenia metacestodes
modulate complement function by sulphated
polysaccharides that activate and consume
complement9. Among other molecules, taeniaestatin inhibits both classic and alternative
complement pathways and paramyosin
inhibits C1q activation10,11.
Metacestode Factor (MF)

Studies evaluating peripheral blood T cells
in naturally and experimentally infected cysticercotic pigs, have consistently revealed
diminution of CD4+ cell counts in proportion
to parasite loads12,13. We postulated that Tcell suppression in cysticercotic pigs might
be related to substances secreted by T. solium
metacestodes. Similarly, low molecular
weight isolates from Schistosoma mansoni and
Onchocerca gibsoni have previously been
reported to induce depression of (3H) thymidine uptake by lymphocytes stimulated with
Concanavalin-A (Con-A)14,15.
Isolation and preliminary characterization

A method to isolate substances of molecular
weight less than 3500 Dalton from super-
natants of live T. solium metacestodes was

designed. The isolate was tested at different
doses in human lymphocyte cultures, stimulated with phytohaemagglutinin and was
found to suppress (3H) thymidine uptake by
lymphocytes. The suppression was forestalled by pre-digestion with ribonuclease
(RNase), suggesting that the active molecule
may be a RNA fraction16. A suppression of
(3H) thymidine uptake has also been demonstrated in T lymphocytes from naturally
infected-cysticercotic pigs17.
The material that suppresses (3H) thymidine uptake was assigned the name,
metacestode factor (MF). We proceeded to
study its effects in vivo. Mice were inoculated
with MF (four doses of 100 g per mouse)
and challenged with one LD50 of Salmonella
typhimurium virulent bacilli18. Mice were
either treated with S. typhimurium antigen
alone or MF alone, or with S. typhimurium
antigens and MF in combination. A control
group consisted of mice inoculated with
saline solution. We observed that mice
treated with MF alone, or with both S.
typhimurium antigens and MF, died faster
and in greater number than control mice. In
contrast, all mice survived in the group that
was given S. typhimurium antigens alone.
When batches of MF were filtered
through a Bio-gel P-6 column, two peaks (F1
and F2) were obtained. Further, F1 and F2
were tested in proliferation assays19. While,
F1 induced a dose-dependent suppressive
effect, F2 induced an increase of the (3H)
thymidine uptake elicited by mitogen.
Thereafter, an attempt was made to characterize F1 by treating it with several inactivating factors such as RNase, proteases and
heat. After treatment, F1 was tested again in
proliferation assays. RNase-treated F1 lost its
suppressive effect. In contrast, trypsin and
papain augmented (3H) thymidine uptake
inhibition. Chymotrypsin or heat had no
effect. Finally, the effect of F1 was studied in
co-cultures of murine macrophages and lymphocytes. It was shown that macrophages
pre-incubated with F1 and subsequently cocultured with fresh lymphocytes did not
affect (3H) thymidine uptake. In contrast,
incorporation of (3H) thymidine by fresh
lymphocytes co-cultured with lymphocytes
Molecular Determinants of HostParasite Interactions
pre-incubated with F1 was inhibited. This

study provided specific evidence for the
probable existence of a RNA molecule, F1,
whose principal site of action was shown to
be the lymphocyte.
Effect on local inflammatory reactions

In vivo studies further examined the effects
of MF on the inflammatory reaction around
implanted metacestodes in mice20. Female
BALB/c syngeneic mice were divided into
four groups based upon the following
experimental protocol. One group of mice
was treated with 100 g of MF (one dose
every 96 h for 12 days). A second group
consisted of mice inoculated with metacestode antigens (100 g as a single dose)
alone, while a third group was constituted
by mice that were first inoculated with
metacestode antigens and then treated with
MF. In the fourth (control) group, mice were
inoculated with inert normal saline alone.
Subsequently, mice in all four groups were
implanted with live T. solium metacestodes
(six metacestodes/mouse), obtained from
cysticercotic pig meat under sterile conditions. Twelve days after the metacestode
implantation, the mice were killed.
Histopathological studies revealed that:
1. Metacestodes implanted in control mice
were completely destroyed and their remnants were surrounded by an intense inflammatory reaction predominantly made up of
neutrophils and eosinophils.
2. In metacestodes of mice that were treated
with MF alone, there were clearly identifiable and intact suckers, rostellum, tegument
and hooks. Few neutrophils, plasma cells,
lymphocytes and histiocytes were noted in
spiral canals; eosinophils were not observed.
3. Metacestodes implanted in mice immunized with metacestode antigens alone were
completely destroyed; their caseous remnants were intensely surrounded and infiltrated by neutrophils and eosinophils.
4. Finally, in mice immunized with
metacestode antigens and subsequently
treated with MF, there were clearly identifiable (albeit necrotic) rostellum, suckers,
27
parenchymal tissues and tegument; the

hooks were dispersed in necrotic tissue.
Moderate inflammatory reaction surrounded the metacestodes.
Local inflammatory responses were also
evaluated
using
scanning
electron
microscopy in the experimental protocol outlined above21. Samples from metacestodes
removed at 6 and 12 days post-implantation
were studied.
At 6 days post-implantation, it was
found that:
1. In control mice, metacestodes were disintegrated and covered by an intense inflammatory reaction (Fig. 3.1a).
2. Metacestodes removed from mice treated
with MF alone were intact and exhibited a
scarce inflammation on the bladder tegument (Fig. 3.1b).
3. An evaginated metacestode removed
from a mouse inoculated with metacestode
antigen alone displayed inflammatory reaction on its scolex. Inflammatory cells were
disseminated on the double crown of hooks,
suckers and the neck tegument; whereas the
bladder wall tegument was covered by a
dense net of fibrous material embedding
numerous inflammatory cells.
4. Metacestodes removed from mice immunized with metacestode antigens and subsequently treated with MF exhibited few
inflammatory cells on their bladder wall
teguments.
At 12 days post-implantation:
1. Metacestodes removed from control mice
were completely enmeshed in an intense
inflammatory reaction, with a dense collagen-like matrix embedding numerous
inflammatory cells and covering the whole
bladder wall tegument.
2. The inflammatory reaction surrounding
metacestodes removed from mice treated
with MF alone was more intense than that
observed on day 6. In one partially evaginated metacestode, the scolex was apparently
intact, with minimal amount of inflammatory
infiltrate in the folds of its neck. At higher
magnification ( 1500), the microtriches were
visibly intact with scarce inflammatory cells
and eosinophil like-granules.
28
Fig. 3.1a. Scanning electron micrograph of a Taenia solium metacestode removed from a control mouse
at day 6. (Reproduced with permission from reference 21.) (ST, subtegument; T, tegument.)
Fig. 3.1b. Scanning electron micrograph of a metacestode removed from a MF-treated mouse at day 6.
(Reproduced with permission from reference 21.)
3. Metacestodes from mice immunized with

metacestode antigens exhibited much
stronger inflammatory reactions on the
scolex tegument in comparison to day-6.
Copious inflammatory infiltrate was visible
surrounding the tegument of an evaginated
scolex (Fig. 3.2). Ruptures of different size
and depth were evident in the tegument and
sub-tegumental suckers. At higher magnification ( 1500), an intense accumulation of
different kinds of white cells, cell debris and

fibrinoid material was apparent.
4. In mice immunized with metacestode antigen and treated subsequently with MF, the
inflammatory reaction on the bladder wall
tegument was less extensive in comparison to
immunized (with metacestode antigens) or
control groups. Very few inflammatory cells,
cell debris and fibrous material were found
adherent to intact microtriches.
29
Fig. 3.2. Scanning electron micrograph of an evaginated scolex removed from an immunized mouse at day
12. An intense inflammatory reaction completely covers the scolex tegument. Note the large cell aggregates
and several ruptures of the sucker and rostellum teguments. (Reproduced with permission from reference 21.)
Effects on humoral and cellular immune

responses
Humoral and cellular immune responses to
inoculation with metacestode antigens, treatment with MF and metacestode implantation
were also studied in the experimental model
outlined above. Sera from mice immunized
with metacestode antigens and treated with
MF showed a significant decrease in antibody
titres compared with those of mice treated
with metacestode antigens alone. Metacestode
implantation further suppressed antibody
responses to metacestode antigens. Antibody
titres were least in sera of implanted mice
treated with MF alone (Fig. 3.3). A suppressive
effect of MF was also noted on cellular
immune functions. Splenic lymphocytes from
mice immunized with metacestode antigens
and treated with MF exhibited a significant
decrease in (3H) thymidine uptake in comparison with lymphocytes from mice inoculated
with metacestode antigens alone (Fig. 3.4)20.
were measured in culture supernatants in

order to study the effects of MF on cytokine
production22. When cultured with MF, cells
showed significantly decreased production
of interleukin 2 (IL-2), interferon- (IFN-),
and interleukin 4 (IL-4) as compared to mitogen alone. Exogenous recombinant IL-2 and
recombinant IL-4 largely restored proliferation responses (85% and 71% of control cells,
respectively). MF also inhibited the production of tumour necrosis factor-alpha (TNFalpha) by macrophages stimulated with
lipopolysaccharide and IFN-. The results of
the above study provide additional evidence
of an inhibitory effect of MF upon cytokine
production, regardless of the cell type or
cytokine (Fig. 3.5). It may be surmised that
impairment, specifically of IL-2 and IFN-
production may underlie modulatory influences of MF of the nature noted in experiments with metacestodes implanted in mice.
Metacestode Proteases
Effects on cytokines
Murine spleen cells were stimulated in vitro
with Con-A and cytokine concentrations
There is sufficient evidence for the existence

of several parasitic secretory proteases. The
latter are believed to be involved in invasion,
nutrition and immune evasion2325. White et
30
1.4
1.2
1.0
A (492)
0.8
0.6
0.4
0.2
0
0
100
200
300
400
500
600
700
800
900 1000
Dilutions
I
IFM
IF
C
IM
Fig. 3.3. Antibody titres determined by ELISA in sera from mice inoculated with Taenia solium
metacestode antigens (I), inoculated with metacestode antigens plus MF (IF), inoculated with
metacestode antigens and implanted with six metacestodes (IM), inoculated with metacestode antigens
plus MF and implanted with six metacestodes (IFM), and inoculated with saline (C). Data are expressed
as mean values SE for each treatment (n = 4) (P0.05 for I versus IF, IM or IFM). (Reproduced with
permission from reference 20.)
10,000
(3H) Thymidine uptake cpm
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
C
CM
IF
IM
IMF
MF
Fig. 3.4. Effect of Taenia solium metacestode antigens on the proliferation of murine splenic
lymphocytes from the following groups of mice: (C) control; (CM) implanted with six metacestodes; (I)
inoculated with metacestode antigens; (IF) inoculated with metacestode antigens plus MF; (F) inoculated
with MF; (IM) inoculated with metacestode antigens and implanted with six metacestodes; (IMF)
inoculated with metacestode antigens plus MF and implanted with six metacestodes; and (MF)
inoculated with MF and implanted with six metacestodes. Bars represent mean values SE for thymidine
uptake by cells stimulated with 1 g of metacestode antigens (P0.05 for I and IM versus IF, IMF, CM or
C). (Reproduced with permission from reference 20.)
(a)
(b)
25
IFN- concentration (ng ml1)
IL-2 concentration (U ml1)
150
100
50
C+
10
15
20
(c)
C+
10
20
C+
10
20
(d)
5
TNF- concentration (ng ml1)
50
IL-4 concentration (U ml1)
31
30
10
C+
10
20
MF (g)
MF (g)
Fig. 3.5. Effect of Taenia solium MF on the production of cytokines. IL-2, IFN- and IL-4 were measured in
supernatants of mouse spleen cells treated with 10 and 20 g of MF (measured as ribose) and stimulated
with Con-A. TNF-alpha was detected in supernatants of murine macrophage line (IC-21) treated with 10
and 20 g of MF and stimulated with lipopolysaccharide and recombinant IFN-. C are the cytokine
concentrations from cells incubated in RPMI medium; C+ are the cytokine values from cells stimulated with
Con-A or lipopolysaccharide/recombinant IFN-. (Reproduced with permission from reference 22.)
al., described cysteine, metallo- and serine

protease activities in acid extracts from
lyophilized T. solium metacestodes. The
authors reported IgG digestion by the extracts
in vitro26. We postulated that immunoglobulin
molecules behaved as target substrates and
molecular nutrients for T. solium proteases.
Supernatants of live metacestode cultures
were evaluated for protease activity on peptide substrates with T cell surface proteins27.
Substantial cysteine protease activity in addition to metallo- and serine protease activities
was found. Isolated human lymphocytes
from volunteers were co-cultured with live
T. solium metacestodes (96% viability) at

37C for 2 h. Cells were separated, washed
and stained with monoclonal antibodies, antiCD4 FITC (fluoresceinated) and anti-CD8 PE
(phycoerythrinated). Flow cytometric analysis
revealed significant decrease in CD4+ expression (Fig. 3.6). The cause and effect relationship between protease activity and decrease
in CD4 expression was demonstrated when
human lymphocytes were cultured with
metacestode excretorysecretory products in
presence of L-cysteine, a reducing substance.
Cells were washed and stained and analysed
by flow cytometry. Metacestode excretory
32
102 103
FL1-H
104
103
102
FL2-H
100
100
100
101
101
102
FL2-H
103
101
102
FL2-H
103
101
CD8
100
R1 : 5685
104
R1 : 2210
104
104
R1 : 8467
100
101
102 103
FL1-H
104
100
101
102 103
FL1-H
104
CD4
Fig. 3.6. Flow cytometry analysis of human T cells co-cultured with 100 Taenia solium metacestodes after
cells were separated and stained with monoclonal antibody fluoresceinated anti-human CD4 and
phycoerythrinated anti-human CD8. (a) Control cells in RPMI 1640 medium without metacestodes. (b)
Cells co-cultured for 2 hours with 100 metacestodes. (c) Cells co-cultured for 2 hours with 100
metacestodes and 100 g of rabbit antiserum to metacestode excretory-secretory products. Values are
expressed as gated percentages of CD8+and CD4+cells. (Reproduced with permission from reference 27.)
secretory products pre-incubated with E-64 (a

specific inhibitor of cysteine protease) served
as control material. A significant decrease in
CD4 expression, attributable to cysteine protease activity was again demonstrated.
Furthermore, treatment with E-64 resulted in
the reversion of the inhibitory effect on CD4
expression.
Conclusions
T. solium metacestodes exert a modulatory
influence on host immunological responses
through several molecular agents. MF, a
3500 Da RNA-like molecule is most significant in this regard. It inhibits humoral and
cellular immune responses as well as inflammatory reaction around implanted metacestodes in mice. It has also been shown to
inhibit cytokine, particularly IFN- and IL-2,

and to a lesser degree IL-4 production in vitro.
Live metacestodes also secrete cysteine, metallo- and serine proteases. Cysteine protease
activity significantly depletes CD4+ cells in
vitro. The elucidation of these molecules and
of their actions in experimental conditions
have provided insights into the mechanisms
by which T. solium metacestodes evade host
immunological attack and are able to survive
for long periods of time.
Acknowledgements
This work was supported by grants from
National Council of Science and Technology
(Mexico) 23672-M, and National Autonomous
University of Mexico. Authors thank Dr.
Rodolfo Paredes for photographic material.
References
1. Miyasato, T., Furukawa, T., Inoue, M., et al. (1977) Electron microscopic observations on the penetration of oncospheres of Hymenolepis nana into the intestine of the mouse. Acta Medica Kinki University
2, 118.
2. Moczon, T. (1996) A serine proteinase in the penetration glands of the hexacants of Hymenolepis
diminuta (Cestoda, Cyclophyllidea). Parasitology Research 82, 6771.
3. White, A.C. Jr, Baig, S., Robinson, P. (1996) Taenia saginata oncosphere excretory/secretory peptidases. Journal of Parasitology 82, 710.
33
4. Molinari, J.L., Tato, P., Lara, A.R., et al. (1993) Effects of serum from neurocysticercosis patients on
the structure and viability of Taenia solium oncospheres. Journal of Parasitology 79, 124127.
5. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis. An analysis and follow-up of 450 cases. Medical
Research Council Special Reports Series. Her Majestys Stationery Office, London, 299, 156.
6. Marquez, H. (1971) Cysticercosis. In: Marcial, R. (ed.) Pathology of Protozoal and Helminth Diseases.
Williams and Wilkins, Baltimore, Maryland, pp. 592617.
7. Hernandez, J.P.A., Marquez, M.H., Sastre, O.S. (1973) Cysticercosis of the central nervous system in
hogs. American Journal of Veterinary Research 34, 451453.
8. Molinari, J.L., Meza, R., Suarez, B., et al. (1983) Taenia solium: immunity in hogs to the cysticercus.
Experimental Parasitology 55, 340357.
9. Hammerberg, B., William, J.F. (1978) Interaction between Taenia taeniaeformis and the complement
system. Journal of Immunology 120, 10331038.
10. Suquet, C., Green, E.C., Leid, R.W. (1984) Isolation and partial characterization of a Taenia taeniaeformis metacestode proteinase inhibitor. International Journal of Parasitology 14, 165172.
11. Laclette, J.P., Shoemaker, C.B., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal
of Immunology 148, 124128.
12. Tato, P., Valles, Y., Rolon, R., et al. (1987) Effect of the immunization on immunodepressed hogs,
infected naturally by Cysticercus cellulosae. Revista LatinoAmericana de Microbiologia (Mxico) 29,
6771.
13. Molinari, J.L., Tato, P., Valles, Y. (1987) Immunodepression of T lymphocytes in hogs modulated by
Cysticercus cellulosae. Revista LatinoAmericana de Microbiologia (Mxico) 29, 293300.
14. Dessaint, J.P., Camus, D., Fisher, E., et al. (1977) Inhibition of lymphocyte proliferation by factor(s)
produced by Schistosoma mansoni. European Journal of Immunology 7, 624629.
15. Yin, F.D., Nowak, M., Copeman, B., et al. (1983) A low molecular weight immunosuppressive factor
produced by Onchocerca gibsoni. Veterinary Immunology and Parasitology 4, 445451.
16. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1990) Depressive effect of a Taenia solium cysticercus factor on cultured human lymphocytes stimulated with phytohemagglutinin. Annals of Tropical
Medicine and Parasitology 84, 205208.
17. Molinari, J.L., Soto, R., Tato, P., et al. (1993) Immunization against porcine cysticercosis in an
endemic area in Mexico: a field and laboratory study. American Journal of Tropical Medicine and
Hygiene 49, 502512.
18. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1989) Modulation effects on mice response to a
Salmonella typhimurium infection by a Taenia solium cysticerci product of low molecular weight.
Revista LatinoAmericana de Microbiologia (Mxico) 31, 327333.
19. Tato, P., Castro, A.M., Rodriguez, D., et al. (1995) Suppression of murine lymphocyte proliferation
induced by a small RNA purified from Taenia solium metacestodes. Parasitology Research 81, 181187.
20. Tato, P., White, A.C. Jr, Willms, K., et al. (1996) Immunosuppression and inhibition of inflammation
in mice induced by a small Taenia solium RNA-peptide to implanted T. solium metacestodes.
21. Molinari, J.L., Tato, P., Rodriguez, D., et al. (1998) Impairment of the inflammatory reaction on
implanted Taenia solium metacestodes in mice by a T. solium RNA-peptide: a scanning electron
microscopy study. Parasitology Research 84, 173180.
22. Arechavaleta, F., Molinari, J.L., Tato, P. (1998) A Taenia solium metacestode factor nonspecifically
inhibits cytokine production. Parasitology Research 84, 117122.
23. McKerrow, J.H., Jones, P., Sage, H., et al. (1985) Proteinases from invasive larvae of the trematode
parasite Schistosoma mansoni degrade connective tissue and basement membrane macromolecules.
Biochemical Journal 231, 4751.
24. Hotez, P.J., Trang, N.L., McKerrow, J.H., et al. (1985) Isolation and characterization of a proteolytic
enzyme from the adult Ancylostoma caninum. Journal of Biological Chemistry 260, 73437348.
25. Chappel, C.L., Dresden, M.H. (1986) Schistosoma mansoni: proteinase activity of hemoglobinase
from the digestive tracts of adult worms. Experimental Parasitology 61, 160167.
26. White, A.C. Jr, Molinari, J.L., Pillai, A.V., et al. (1992) Detection and preliminary characterization of
Taenia solium metacestode proteases. Journal of Parasitology 78, 281287.
27. Molinari, J.L., Mejia, H., Clinton, A.C. Jr, et al. (2000) Taenia solium: a cysteine protease secreted by
metacestodes depletes human CD4 lymphocytes in vitro. Experimental Parasitology 94, 133142.
Animal Models of Taenia solium

Cysticercosis: Role in Understanding
HostParasite Interactions
Astrid E. Cardona and Judy M. Teale
Introduction
An important outcome of initial clinical studies of neurocysticercosis (NC) was the realization that the brain is not only affected by the
presence of metacestodes, but more significantly by the inflammatory response and its
sequelae13. In the human central nervous system (CNS), host responses to Taenia solium
cysticerci range from complete absence, to
severe inflammatory reaction4. In most cases,
viable parasites have little surrounding
inflammation5, which correlates with an
asymptomatic stage of NC. In contrast, virtually all cases of symptomatic disease are characterized by prominent immunological
responses in host nervous tissue69. The
reader is referred to Chapter 2 for an
overview of host immune responses to cysticercosis. Besides the host immune response,
the location, stage, number and the
immunomodulatory effects of the metacestodes (reviewed in Chapter 3) also contribute
to disease outcome. However, the extent of
contribution of these factors and how such
factors influence each other is still not clear. It
is difficult to segregate and study each of the
factors individually in humans. Given the
large number of variables involved, the lack
of predictability of their interactions in
human hosts and complexity of the host
immune system at cellular and subcellular
levels, animal models are critical to furthering

our knowledge of the hostparasite relationship. Furthermore, animal models are useful
in the study of other factors associated with
disease acquisition, e.g. genetic factors both in
relation to the host (see Chapter 6)10,11and parasite and in the development of novel therapeutic agents and schemes (see Chapter 15).
The development of animal models to study
T. solium infection has been an arduous task.
The earliest experience with animal models
was studies exploring immunological mechanisms of resistance to larval cestodes in mice
and rats infected with Taenia taeniaeformis12,13.
These studies elucidated components of the
peripheral response to T. taeniaeformis and
found that antibodies and complement were
implicated in host defence mechanisms12,13.
Animal Models for Adult T. solium

Several mammals have been evaluated as
experimental models of adult T. solium. The
oral route of infection with T. solium cysticerci
obtained from infected pigs has been
employed in these models14. In young dogs,
tapeworms survived only for 8 days. Mice,
albino rats and guinea pigs were not susceptible to T. solium infection. Rhesus monkeys,
cats and rabbits did not prove to be useful
models14. In contrast, in gerbils and golden

35
36
A.E. Cardona and J.M. Teale
hamsters (Mesocricetus auratus), tapeworms

developed and exhibited greater sexual development, though mature and infectious oncospheres were not produced1416. Cysternal
infection with scolex and membranes from T.
solium cysticerci resulted in an intense granulomatous inflammatory response consisting of
lymphocytes in rabbits17. Interestingly, the
most successful hosts to date for adult T.
solium tapeworms are chinchillas (Chinchillidae family of rodents), in which larvae
develop into gravid proglottides, eventually
producing infective oncospheres. Infectivity of
eggs obtained from the chinchilla model was
demonstrated in pigs. Metacestodes were
found in pig skeletal muscle, 12 weeks after
oral infection with gravid proglottides recovered from chinchillas14.
Immunosuppressive
treatment
with
steroids (prednisolone and methyl prednisolone) facilitates the establishment and
development of adult T. solium and a related
cestode, T. crassiceps in experimental host
intestine14,18. The basis of the facilitatory
effect of steroid treatment presumably relates
to suppression of local mucosal inflammatory responses to worm attachment19. When
T cells were depleted in vivo in Mongolian
gerbils (Meriones unguiculatus) infected with
T. crassiceps ova, only destrobilated adult
worms were harvested in the faeces20. This
indicated that T cells in some way prevented
strobilar attachment to enteral mucosa. A
similar effect was observed in prednisolonetreated gerbils, arguably due to an effect of
prednisolone upon T cells20.
The development of an experimental
model that allows the recovery of T. solium
eggs is likely to have a significant impact
upon future research. Eggs will be available
for antigen cloning, analysis and purification.
Further application of the chinchilla model
will be valuable in the areas of vaccine design
and hostadult parasite interactions.
pigs are the natural intermediate host of the

helminth. Most researchers employing this
model so far have used naturally infected
pigs21,22, although experimentally induced
infections have also been studied (see also
Chapter 15)23. The number of T. solium eggs
required for inducing experimental infection
varied between 1000 and 380,00023. The
porcine model has provided information
related to progression of the parasitosis in
liver, muscles and lungs. In parallel to human
CNS infections, histological studies in this
model revealed the presence of immature,
mature, degenerate and calcified cysts in pig
liver and muscle22,24. As yet, a detailed analysis of the specific immunological elements
has not been described in the porcine model.
A major area of application of porcine
models has been the development of treatment strategies to control porcine cysticercosis with the ultimate goal of preventing
human infection. Two of the drugs that are
currently used for treatment of human cysticercosis, albendazole and praziquantel,
have been used in several different protocols
to determine their efficacy for treatment of
porcine cysticercosis21, 22, 25, 26. Another drug,
oxfendazole has been found effective in controlling swine cysticercosis (reviewed in
Chapter 43)27. These studies together with
the epidemiological studies are important for
the development of interventions to eradicate T. solium infection28,29. However, the
scarcity of infected pigs in non-endemic
areas, and the difficulty in obtaining T.
solium eggs have limited the widespread use
of the porcine model. Moreover, there are
difficulties in handling pigs, and a high cost
of support is involved. Therefore, other animal species have been used to develop
experimental models for cysticercosis using
related parasites.
Experimental intraocular cysticercosis
Animal Models for Cysticercosis

T. solium cysticercosis in pigs
Porcine cysticercosis is a successful experimental model for T. solium cysticercosis, as
The eye is an immunologically privileged

site. T. crassiceps metacestodes have also been
used in experimental models of intraocular/
intravitreous cysticercosis in rabbits30,31.
Living T. crassiceps cysticerci in the vitreous
cavity produced ocular lesions with an
Animal Models of T. solium Cysticercosis
intense inflammatory response in those rabbits that had been previously infected
through the intraperitoneal route or had
been inoculated with cysticercus antigen30,31.
A granulomatous response comprising
eosinophils and polymorphonuclear cells
was noted. Naive rabbits and steroid treated
rabbits did not exhibit inflammatory ocular
lesions30,31. These models are significant in
the understanding of immune reactions
specifically involved in the intraocular compartment as well as the treatment of ocular
cysticercosis.
T. crassiceps experimental cysticercosis

Two related cestode parasites, T. crassiceps
and Mesocestoides corti have been used extensively as animal models of cysticercosis.
Their metacestodes are infectious to mice,
and the larval stages of these parasites are
easily maintained in the peritoneal cavity of
infected mice32,33. Intraperitoneal injection of
either organism results in invasion of liver
and peritoneum. Intraperitoneal inoculation,
however, does not produce CNS lesions, a
major drawback of initial investigations with
these models. Recently, however, infection
with either organism was accomplished in
the brain, thereby facilitating the study of
infective mechanisms specific to the CNS34.
T. crassiceps has a canine definitive host
and a rodent intermediate host32,35. In natural infections, the larval form invades several tissues including the peritoneal cavity of
the rodent. In BALB/c mice, chronic infection with T. crassiceps induced host immunosuppression. Analysis of the temporal course
of the immune response in mice inoculated
intraperitoneally with T. crassiceps, revealed
a time dependent variation in the intensity of
Th1 and Th2 type responses (see Chapter 2
for an overview of the Th1 and Th2
responses)3638. In the early stages of infection when few or no parasites could be
recovered from the peritoneal cavity, mice
exhibited a strong Th1 type of immunological response characterized by high
interferon- (IFN-) production, IgG2a dominated antibody response and delayed type
hypersensitivity (DTH). Late in infection,
37
production of interleukin-2 (IL-2) and IFN-

decreased and DTH was depressed, while
IL-4, IL-10, IgG2b and IgG1 production was
up-regulated. These results suggest that
there is a shift from an initial parasite-restrictive, Th1-type based response to a later parasite-permissive, Th2 response. While the
early response suppresses infection by
metacestodes, the latter allows establishment
and growth of T. crassiceps metacestodes in
murine hosts36,38.
Analyses of the immunological response
around peritoneal granulomas formed 314
weeks after infection indicate that early
granulomas are predominantly associated
with a Th1-type response, whereas later
granulomas, in which parasite destruction is
complete, have a mixture of Th1- and Th2type responses39. These data suggest that
dying parasites can no longer modulate host
immunological responses. The Th1 granulomatous response is likely to be involved in
the pathogenesis of symptomatic human
infection in which active inflammation is a
major cause of disease. As the parasite is
destroyed, the response shifts to involve
greater Th2-type cytokine expression, perhaps as a means of down-regulating inflammation39. Interestingly, it was demonstrated
that subcutaneous inoculation with larvae
induces protection against subsequent
intraperitoneal challenge. Parasite destruction was associated with adherence of host
cells to the tegument of larvae. The crucial
effector population of host cells involved in
parasite death is not known40.
The T. crassiceps animal model has also
been used to investigate mechanisms of
immunological regulation that the parasite
can exhibit in the host. T. crassiceps larvae
release factors that are capable of down-regulating both proliferative responses of and
cytokine production by T cells41. These parasite factors were found to down-regulate
production of IFN- and IL-4 by mitogen
stimulated spleen cells41. This inhibitory
effect was caused by excretorysecretory
products from the larvae in the early stages
of infection. In contrast, excretorysecretory
products from larvae harvested late in
infection were not suppressive40. Future
studies will be critical to elucidate immuno-
38
logical mechanisms involved in larval

destruction by the host and immunomodulatory mechanisms by which the parasite
persists in the host.
A major outcome of the development of
the mouseT. crassiceps, hostparasite model
has been the recognition of several host factors that influence infection by metacestodes.
The sex specific behaviour of the cestode is
an outstanding example of one such host factor. In mouse models, T. crassiceps parasitize
female mice in preference to male mice in
large numbers following intraperitoneal
inoculation42. Gonadectomy was found to
increase parasite population in male mice
but had an opposite effect in female mice42,43.
Replacement with 17 -oestradiol favours
parasite proliferation in host mice, an effect
that is more prominent in male mice44. The
sex specific behaviours are not observed in
irradiated or neonatally thymectomized mice
suggesting that sex hormones interact with
the immune system in order to favour or
suppress infection43,45. It has been surmised
that oestrogens inhibit immune mechanisms
and are thereby permissive to T. crassiceps
proliferation in mice.
The sex-related differences in rate and
intensity of establishment described above
are evident in the early stages of T. crassiceps
infection in mice. In chronically parasitized
mice, the parasite establishes itself in large
numbers in male mice as well. The effect of
chronic T. crassiceps infection on sexual
behaviour and related morphological and
biochemical parameters is of interest.
Chronic infection results in inhibition of sexual responses in male mice, gonadal atrophy
in male mice and hypertrophy in female
mice and an overwhelming increase of
plasma oestradiol levels and corresponding
reduction in plasma testosterone levels in
male mice46,47. Likewise, an increase in the
expression of genes and enzymes associated
with oestrogen synthesis has been noted in
male mice48,49. Recently, it was demonstrated
that the parasite could utilize sex hormone
precursors from the host to synthesize sex
hormones required for its own development
and sustenance50.
Another example of host factors involved
in T. crassiceps infection is influence of the
human
leukocyte
antigen
system10,11.
Expression of the Qa-2, non-classic Class I
major histocompatibility complex antigen
was associated with resistance to T. crassiceps
infection in BALB/cAnN mice10. An understanding of such protective genetic factors is
likely to have an impact upon the development of genetically engineered animals,
which are inherently resistant to cysticercosis,
a novel strategy for its prevention and control.
Mesocestoides corti experimental

cysticercosis
Similar to T. crassiceps, intraperitoneal
injection of the larval stage of the metacestode parasite, M. corti results in chronic
infection in mice33,51,52. In nature, M. corti
ova are believed to be ingested by terrestrial arthropods. An intermediate host such
as the mouse or lizard then consumes the
arthropod, where upon the oncosphere
develops into the mature larva or metacestode53. Upon ingestion of the intermediate
host by a carnivorous mammal such as
dog, cat or skunk, a mature intestinal tapeworm develops releasing eggs and perpetuating the life cycle. M. corti infected mice
develop splenomegaly and hepatomegaly,
with encystment of the organism in the
liver33,51,52.
Animal Models for

Neurocysticercosis
To study the immunological response in the
brain during NC, we have developed a
mouse model using M. corti and T. crassiceps metacestodes. Due to lack of CNS
involvement in intraperitoneally infected
mice, intracranial inoculation of the
metacestodes was used to analyse immunological responses in CNS. This model has
allowed us to follow the kinetics of
immunological response in brain. With a
view to parallel human disease, metacestodes were injected intracranially, avoiding
penetration of brain parenchyma. Mice
were sacrificed at different time points after
infection34. The associated pathological and

immunological responses in the brain were
analysed using haematoxylin and eosin
staining (Fig. 4.1) and in situ immunohistochemistry of brain cryosections34.
39
M. corti metacestodes were found to be

highly invasive. They infiltrated ventricles,
subarachnoid spaces and brain parenchyma
within days (Fig. 4.2). Pathological studies
revealed presence of lesions with active
Fig. 4.1. Haematoxylin and eosin staining of a brain cryosection, 10 m in thickness. Mesocestoides
corti metacestode is present in parenchyma associated with small inflammatory infiltrate shown by the
long arrow. The short arrow demarcates a parasite in a lateral ventricle.
100
Percentage of parasites
80
P
60
EP
40
20
0
2 days
10
16
Time p.i (weeks)
Fig. 4.2. Distribution of Mesocestoides corti larvae in the brain of BALB/c mice. Haematoxylin and eosin
stained sections from infected mouse brains were analysed for the presence and location of larva.
Parasites were counted and classified as P (parenchymal) or EP (extraparenchymal, i.e. located in
ventricle, subarachnoid space or meninges). Each data point represents the average of three mice.
40
necrosis in brain parenchyma (Fig. 4.3). An

accumulation of inflammatory cells in the
ventricles and meninges was noted (Fig.
4.4). Massive accumulation of gamma/delta
T lymphocytes, macrophages, and to a
lesser extent, dendritic cells, NK cells, mast
cells and B cells was observed (Fig. 4.5). A
Th1 pathway of cytokine expression was
observed in the brain after M. corti infection
with high levels of IL-2, IL-12, IL-15 and
IFN- (Fig. 4.6). Importantly, Th2-related
cytokines (IL-10 and IL-13) were either
undetectable or found in very low levels
(IL-4). Interestingly, gamma/delta T lymphocytes were found in the CNS by 2 days
postinfection. These cells co-localized to
areas where Th1 cytokines were detected34.
The immunological response in the CNS in
mice infected with T. crassiceps was similar
with the exception that this organism was
larger and fewer organisms were able to

penetrate brain parenchyma.
In the mouse model, infection of CNS
appears to induce initially an innate type
of immunological response evidenced by
the presence of neutrophils, macrophages
and natural killer cells. By 3 days postinfection, an early-induced response develops with the added participation of large
numbers of gamma/delta T cells. By 7
days postinfection, an adaptive immunological response is evident with parasite
specific T and B cells.
The immunological response that develops in mouse brain has been evaluated in
both infected BALB/c and C57BL/6 mice.
Little difference was found in the type of the
cellular and cytokine response in the CNS in
these two strains of mice. This is of interest
since these two strains often differ dramatically in their response to infectious organisms such as Leishmania54,55.
(a)
(a)
(b)
(b)
Fig. 4.3. Haematoxylin and eosin staining reveal

the presence of areas of active necrosis. (a)
Hanks balanced salt solution inoculated mice do
not reveal pathology showing normal parenchymal
tissue. (b) The parasite (P) is associated with
active areas of necrosis lacking cellularity
(magnification: 150).
Fig. 4.4. Intense inflammatory response

associated with parasite (P) in ventricle (a) and
subarachnoid space (b) (magnification 150 in (a)
and 100 in (b)).
41
Number of
cells
0
2 days
5 days
1
Time p.i (weeks)
13

CD19
Fig. 4.5. Immunological response in the brain after Mesocestoides corti infection. Two mouse brains
obtained after intracranial inoculation with M. corti metacestodes were analysed by immunohistochemistry for the presence of various cell types. Cells in the extraparenchymal regions were
counted, and the score given represents: 1100 cells (1), 100300 cells (2), 300500 cells (3). The
results represent the average of two mice.
Number of
cells
3
2
1
0
2 days
5 days
13
Time p.i (weeks)

IL-12
IL-4
Fig. 4.6. Predominance of a Th1 pathway of cytokine response in the brain after Mesocestoides corti
infection. Results of immunohistochemical staining for IL-12 and IL-4 are shown. Cells were counted and
scores given as described in Fig. 4.5. The results represent the average of two mice.
Data from the mouse model are consistent

with previous reports of the cellular
immunological responses in human brain.
Macrophages, NK cells and pro-inflammatory cytokines predominate with little or no

detection of eosinophils, mast cells and IL-4
42
production8. Within the brain, host responses

to the parasite appears to be of Th1 inflammatory type in contrast to the Th2 response
which is a characteristic response to
helminths in peripheral extraneural tissue.
However, as disease progresses with granuloma formation, a mixed Th1 and Th2
response is likely.
The presence of gamma/delta T cells in
large numbers predicts their important role
in NC. In lymphoid tissues, gamma/delta T
cells represent a minor proportion of T cells
and their specific functions are uncertain56,57.
We hypothesized that gamma/delta T cells
play important immunoregulatory functions
by producing cytokines that modulate the
development of inflammatory response in
CNS. Further studies in the animal model
may improve our understanding of the role
of this T cell subset in the human disease.
The interactions between immunological
cells and resident brain cells in the mouse
model are of interest with specific reference to
T cells. A question that needs to be answered
is which antigens may be activating the
gamma/delta T cell response? Previous studies have indicated that M. corti secretes a number of molecules when propagated in vitro58,59.
Two of these molecules are temperatureinduced heat shock proteins (hsps) of the hsp70
and hsp60 families58. Since gamma/delta T
cells might be able to recognize whole proteins
in an antibody-like manner60,61, M. corti hsps
have a potential role in the development of an
inflammatory response in the CNS.
Furthermore, phospholipids have been found
to induce specific expansion of human
gamma/delta T cells6264. Future studies with
M. corti lipids may help define the mechanism
by which the parasite induces an inflammatory response in the brain.
Conclusions
Animal models contribute to the areas of
parasite biology and immunology and are
valuable for the recognition of new mechanisms involved in the hostparasite relationship during cestode infection. These models,
and the data obtained from human studies
will be critical for the understanding of the
progression of the disease in the human host.
The animal models hitherto described have
been instrumental in the understanding of
hostparasite interactions involved in NC.
References
1. Dixon, H., Lipscomb, F.M. (1991) Cysticercosis: an analysis and follow up of 450 cases. Medical
Research Council Special Report Series. Her Majestys Stationery Office, London, 299, pp. 158.
2. Wiederholt, W.C., Grisiola, J.S. (1982) Cysticercosis: an old scourge revisited. Archives of Neurology
39, 533535.
3. Shandera, W.X., White, A.C. Jr, Chen, J.C., et al. (1994) Neurocysticercosis in Houston, Texas: a report
of 112 cases. Medicine 73, 3752.
4. Ostrosky-Zeichner, P., Garcia-Mendoza, E., Rios, C., et al. (1996) Humoral and cellular immunological response within the subarachnoid space of patients with neurocysticercosis. Archives of Medical
5. White, A.C. Jr (2000) Neurocysticercosis: updates on epidemiology, pathogenesis, diagnosis, and
management. Annual Review of Medicine 51, 187206.
6. Cecilia, R. (1983) Clinical aspects, pathology and treatment of human cysticercosis. In: Flisser, A.,
Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic
Press, New York, pp. 179199.
7. Correa, D., Dalma, D., Espinoca, B. (1985) Heterogeneity of humoral immunological components in
human cysticercosis. Journal of Parasitology 71, 535541.
8. Restrepo, B.I., Llaguno, P., Sandoval, M.A., et al. (1998) Analysis of immunological lesions in neurocysticercosis patients: central nervous system response to helminth appears Th1-like instead of Th2.
Journal of Neuroimmunology 89, 6472.
9. Grewal, J.S., Kaur, S., Bhatti, G., et al. (2000) Cellular immunological responses in human neurocysticercosis. Parasitology Research 86, 500503.
43
10. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1996) Genetic control of susceptibility to Taenia crassiceps
cysticercosis. Parasitology 112, 119124.
11. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1998) Increased resistance to Taenia crassiceps murine cysticercosis in Qa-2 transgenic mice. Infection and Immunity 66, 760764.
12. Rickard, M., Williams, J. (1982) Hydatidosis/cysticercosis: immunological mechanisms and immunization against infection. Advances in Parasitology 21, 229296.
13. Lloyd, S. (1987) Cysticercosis. In: Soulsby, E.J.L. (ed.) Immunological Responses to Parasite Infections,
Vol. 2. CRC Press, Boca Raton, Florida, pp. 183212.
14. Maravilla, P., Avila, G., Cabrera, V., et al. (1998) Comparative development of Taenia solium experimental models. Journal of Parasitology 84, 882886.
15. Merchant, M.T., Aguilar, L., Avila, G., et al. (1998) Taenia solium: description of intestinal implantation sites in experimental hamster infections. Journal of Parasitology 84, 681985.
16. Allan, J.C., Garcia-Dominguez, Craig, P.S., et al. (1991) Sexual development of Taenia solium in hamsters. Annals of Tropical Medicine and Parasitology 85, 473477.
17. Garcia de Llano, C.A., Mateos, J.H., Rivas, A. (1989) Reaccin inflamatoria en la neurocisticercosis
estudio experimental en conejo. Archivos de Investigacion Medica (Mexico) 20, 6168.
18. Sato, H., Oku, Y., Rausch, R.L., et al. (1993) Establishment and survival of the strobilar stage of Taenia
crassiceps in hamsters, gerbils, and mice, with reference to different helminth isolates. Parasitology
19. Sato, H., Kamiya, H., Oku, Y., et al. (1994) Infection course of the strobilar stage of Taenia crassiceps in
golden hamsters, with reference to host responses. Parasitology Research 80, 99103.
20. Sato, H., Ihama, Y., Kamiya, H. (2000) Survival of destrobilated adults of Taenia crassiceps in T-celldepleted Mongolian gerbils. Parasitology Research 86, 284289.
21. Flisser, A., Gonzalez, D., Shkurovich, M., et al. (1990) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis. Parasitology Research 76, 263269.
22. Flisser, A., Gonzalez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle
porcine Taenia solium cysticercosis 2. Immunological and cytogenetics studies. Parasitology Research
76, 640642.
23. Fan, P.C., Chung, W.C., Lin, C.Y., et al. (1990) The pig as an intermediate host for Taiwan Taenia
infection. Journal of Helminthology 64, 223231.
24. Kaur, M., Joshi, K., Ganguly, R., et al. (1995) Evaluation of the efficacy of albendazol against the larvae of Taenia solium in experimentally infected pigs, and kinetics of the immunological response.
25. Torres, A., Plancarte, A., Villalobos, A.N.M., et al. (1992) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis 3. Effect of 1-day treatment. Parasitology Research 78, 161164.
26. Gonzales, A.E., Garca, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with
albendazol. American Journal of Tropical Medicine and Hygiene 53, 571574.
27. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1998) Timeresponse curve of oxfendazole in the treatment of swine cysticercosis. American Journal of Tropical Medicine and Hygiene 59, 832836.
28. Evans, C., Gonzales, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis:
implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56,
3337.
29. Gilman, R.H., Garca, H.H., Gonzales, A.E., et al. (1999) Short cuts to development: methods to control the transmission of cysticercosis in developing countries. In: Garca, H.H., Martinez, S.M. (eds)
Taenia solium Taeniosis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313326.
30. Cardenas, F., Plancarte, A., Quiroz, H., et al. (1989) Taenia crassiceps: experimental model of intraocular cysticercosis. Experimental Parasitology 69, 324.
31. Santos, A., Paczka, J.A., Jimenez-Sierra, J.M., et al. (1996) Experimental intravitreous cysticercosis.
Graefes Archives of Clinical and Experimental Ophthalmology 234, 515520.
32. Freeman, R.S. (1962) Studies on the biology of Taenia crassiceps. Canadian Journal of Zoology 40,
969971.
33. Mitchell, G.F., Machalonis, J.J., Smith, P.M., et al. (1977) Studies on immunological responses to larval cestodes in mice. Immunoglobulins associated with the larvae of Mesocestoides corti. Australian
Journal of Experimental Biology and Medical Science 55, 187211.
34. Cardona, A.E., Restrepo, B.I., Jaramillo, J.M., et al. (1999) Development of an animal model for neurocysticercosis: immunological response in the central nervous system is characterized by a predominance of gamma/delta T cells. Journal of Immunology 162, 9951002.
44
35. Smyth, J.D. (1994) Introduction to Animal Parasitology. Cambridge University Press, New York,
1189 pp.
36. Terrazas, L.I., Bojalil, R., Govezensky, T., et al. (1998) Shift from an early protective Th1-type
immunological response to a late permissive Th2-type response in murine cysticercosis (Taenia crassiceps). Journal of Parasitology 84, 7481.
37. Villa, O.F., Kuhn, R.E. (1996) Mice infected with the larvae of Taenia crassiceps exhibit a Th2-like
immunological response with concomitant anergy and downregulation of Th1-associated phenomena. Parasitology 112, 561570.
38. Toenjes, S.A., Spolski, R.J., Mooney, K.A., et al. (1999) The systemic immunological response of
BALB/c mice infected with larval Taenia crassiceps is a mixed Th1/Th2-type response. Parasitology
118, 623633.
39. Robinson, P., Atmar, R.L., Lewis, D.E., et al. (1997) Granuloma cytokines in murine cysticercosis.
Infection and Immunity 65, 29252931.
40. Mooney, K.A., Spolski, R.J., See, E.J., et al. (2000) Immunological destruction of larval Taenia crassiceps in mice. Infection and Immunity 68, 23932401.
41. Spolski, R.J., Corson, J., Thomas, P.G., et al. (2000) Parasite secreted products regulate the host
response to larval Taenia crassiceps. Parasite Immunity 22, 297305.
42. Garcia Tamayo, F., Terrazas Valdez, L.I. (1992) Immune response to parasitic infection in mice without seminal vesicles. Archives of Medical Research 23, 149150.
43. Huerta, L., Terrazas, L.I., Sciutto, E., et al. (1992) Immunological mediation of gonadal effects on experimental murine cysticercosis caused by Taenia crassiceps metacestodes. Journal of Parasitology 78, 471476.
44. Terrazas, L.I., Bojalil, R., Govezensky, T., et al. (1994) A role for 17-BETA-estradiol in immunoendocrine regulation of murine cysticercosis (Taenia crassiceps). Journal of Parasitology 80, 563568.
45. Bojalil, R., Terrazas, L.I., Govezensky, T., et al. (1993) Thymus-related cellular immune mechanisms
in sex-associated resistance to experimental murine cysticercosis (Taenia crassiceps). Journal of
46. Larralde, C., Morales, J., Terrazas, L.I., et al. (1995) Sex hormone changes induced by the parasite
lead to feminization of the male host in murine Taenia crassiceps cysticercosis. Journal of Steroid
Biochemistry and Molecular Biology 52, 575580.
47. Morales, J., Larralde, C., Arteaga, M., et al. (1996) Inhibition of sexual behaviour in male mice
infected with Taenia crassiceps cysticerci. Journal of Parasitology 82, 689693.
48. Morales-Montor, J., Rodriguez-Dorantes, M., Mendoza-Rodriguez, C.A., et al. (1998) Differential
expression of the estrogen-regulated proto-oncogenes c-fos, c-jun, and bc12 and of the tumorsuppressor p53 gene in the male mouse chronically infected with Taenia crassiceps cysticerci.
49. Morales-Montor, J., Rodriguez-Dorantes, M., Cerbon, M.A. (1999) Modified expression of steroid 5
alpha-reductase as well as aromatase, but not cholesterol side-chain cleavage enzyme, in the reproductive system of male mice during (Taenia crassiceps) cysticercosis. Parasitology Research 85, 393398.
50. Gomez, Y., Valdez, R.A., Larralde, C., et al. (2000) Sex steroids and parasitism: Taenia crassiceps cysticercus metabolizes exogenous androstenedione to testosterone in vitro. Journal of Steroid
Biochemistry and Molecular Biology 74, 143147.
51. Johnson, G.W., Nicholas, D., Metcalf, D., et al. (1979) Peritoneal cell population of mice infected with
Mesocestoides corti as a source of eosinophils. International Archives of Immunology 59, 315317.
52. Chapman, C.P., Knopf, P., Hicks, J., et al. (1979) IgG1 hypergammaglobulinemia in chronic parasitic
infections in mice: magnitude of the response in mice infected with various parasites. Australian
Journal of Experimental Biology and Medical Science 57, 369372.
53. Novak, M. (1972) Quantitative studies on the growth and multiplication of tetrathyridia of
Mesocestoides corti (Hoeppli, 1925) (Cestoda: Cyclophyllidia) in rodents. Canadian Journal of Zoology
50, 11891199.
54. Heinzel, F., Sadick, M., Holaday, B., et al. (1989) Reciprocal expression of interferon-gamma or interleukin 4 during the resolution or progression of murine leishmaniasis. Evidence for the expansion
of distinct helper T cell subsets. Journal of Experimental Medicine 169, 5972.
55. Heinzel, F., Sadick, M., Mutha, S., et al. (1991) Production of interferon-gamma, interleukin 2, interleukin 4, and interleukin 10 by CD4+ lymphocytes in vivo during healing and progressive murine
leishmaniasis. Proceedings of the National Academy of Sciences USA 88, 70117015.
56. Haas, W., Pereira, P., Tonegawa, S. (1993) Gamma/delta cells. Annual Review of Immunology 11,
637685.
45
57. Modlin, R.L., Pirmez, C., Horman, F.M., et al. (1989) Lymphocytes bearing antigen-specific
gamma/delta T cell receptors accumulate in human infectious disease lesions. Nature 339, 812.
58. Estes, D.M., Teale, J.M. (1991) Biochemical and functional analysis of extracellular stress proteins of
Mesocestoides corti. Journal of Immunology 147, 39263934.
59. Teale, J.M., Abraham, K.M. (1987) Regulation of antibody class expression. Immunology Today 138,
16991672.
60. Li, H., Lebedeva, M.I., Llera, A.S., et al. (1998) Structure of the Vdelta domain of the human
gamma/delta T-cell receptor. Nature 391, 502506.
61. Groh, V., Steinle, A., Bauer, S., et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gamma/delta T cells. Science 279, 17371739.
62. Morita, C., Beckman, E., Bukowski, J., et al. (1995) Direct presentation of nonpeptide prenyl
pyrophosphate antigens to human gamma/delta T cells. Immunity 3, 495507.
63. Tanaka, Y., Morita, C., Nieves, E., et al. (1995) Natural and synthetic non-peptide antigens recognized by human gamma/delta T cells. Nature 375, 155158.
64. Tanaka, Y., Sano, S., Nieves, E., et al. (1994) Nonpeptide ligands for human gamma/delta T cells.
Proceedings of the National Academy of Sciences USA 91, 81758179.
Mitochondrial DNA of Taenia solium:

From Basic to Applied Science
Akira Ito, Minoru Nakao, Munehiro Okamoto, Yasuhito Sako and

Hiroshi Yamasaki
Introduction
The mitochondrial genome has been
sequenced and its variations have been established in humans and several other animal and
plant species. Little is, however, known about
mitochondrial DNA (mtDNA) of the parasitic
flatworms, cestodes and trematodes14. While
the study of human mitochondrial genome has
led to the understanding of genetic basis of a
wide range of diseases, a similar study in flatworms has important bearing upon three different areas of knowledge. First, variations in
the mitochondrial genome of different
species have been utilized for deducing phylogenic relationships and studying evolutionary sequences among different members
of a phylum58. Secondly, the study of taeniid
mtDNA has been useful in speciation as well
as in elucidating similarities and differences
between individual species. A good example
has been the utilization of knowledge of
mtDNA structure in establishing the status of
a novel taeniid, Taenia saginata asiatica (see
below). Finally, it could also provide insights
into epidemiological aspects of pathogenicity
and zoogeography of individual flatworms.
Here, we review intra-species variations
in relation to geographical location and
molecular evolution of T. solium and their
implications for the understanding of its
pathogenicity and epidemiology.
Comparative Studies of mtDNA in

T. solium, T. saginata and T. saginata
asiatica
Figure 5.1 depicts the molecular phylogeny
of major cestodes. Taenia solium and T. saginata are well known cosmopolitan human
tapeworms. In addition, a third taeniid, the
Asian Taenia has been recognized lately.
There is a high prevalence of this taeniid
among aboriginal inhabitants of several
East and Southeast Asian countries, including Korea, Taiwan, China, Malaysia,
Thailand, Philippines and the Samosir
Island of North Sumatra, Indonesia913. The
Asian Taenia bears similarities to, and is different from both T. solium and T. saginata. It
resembles the latter in morphology.
However, a major distinguishing feature
from T. saginata on one hand and a similarity to T. solium on the other hand is its utilization of swine and not cattle as
intermediate hosts. However, it is not clear
whether humans can also serve as intermediate hosts to Asian Taenia. Indeed, if
human transmission were possible, cases of
neurocysticercosis (NC) would abound in
countries of East Asia. Fortunately, this is
not the case. Two major factors account for
the non-pathogenic nature of the Asian
Taenia. Firstly, its metacestodes are far
smaller in comparison to those of T. solium,

47
48
A. Ito et al.
E. multilocularis
1000
E. granulosus
LrRNA gene
(377387 bp)
T. hydatigena
T. solium
956
1000
T. saginata
T. asiatica
T. crassiceps
T. pisiformis
T. taeniaeformis
0.02
H. diminuta
669
986
H. nana
H. microstoma
M. corti
M. expansa
D. caninum
1000
D. latum
D. ditremum
F. hepatica
Fig. 5.1. A neighbour-joining phylogenic tree of 17 cestodes based on the sequences of partial LrRNA
genes. Bootstrap values more than 500 are shown in the tree. The trematode, Fasciola hepatica served
as an outgroup. The cestodes examined were Echinococcus multilocularis, E. granulosus, Taenia
hydatigena, T. solium, T. saginata, T. asiatica, T. crassiceps, T. pisiformis, T. taeniaeformis, Hymenolepis
diminuta, H. nana, H. microstoma, Mesocestoides corti, Moniezia expansa, Dipylidium caninum,
Diphyllobothrium latum and D. ditremum.
a factor that may affect its potential to produce neurological symptoms. However, we
have shown that larvae of the Asian Taenia
can develop to 10 mm or larger in diameter
in non-obese diabetic-severe combined
immunodeficiency (NOD-SCID) mice14.
Secondly, while T. solium is neuro- and myotropic, the Asian Taenia is hepato- and viscero-tropic. In other words, in swine and
possibly in humans, metacestodes of the latter are primarily found in the liver and viscera and not in the brain and muscles, as is
the case with T. solium.
Given the above background, controversy
exists with regard to speciation of Asian Taenia
(T. asiatica vs. variant of T. saginata (T. saginata

asiatica)),911 and also with reference to its
potential to cause human cysticercosis12,13.
Mitochondrial DNA analysis1518 and comparative studies of morphology and development
of metacestodes of each species in experimental animal models14,1923 have provided preliminary insights into differences in the biological
behaviour of the three human taeniids. Both
suggest that the Asian Taenia is highly homologous to T. saginata, and although there are biological differences between the two9,14, T.
asiatica should not be classified as a new
species but rather a subspecies of T. saginata,
i.e., T. saginata asiatica1618,23.
Mitochondrial DNA of T. solium
Taenia solium mtDNA

The structure of the mtDNA in T. solium and a
related cestode, Echinococcus multilocularis has
been recently established using polymerase
chain reaction-amplification and nucleotide
sequencing. Between the two species, there
are minor variations in the size of the mitochondrial genome (13,709 bp in the case of T.
solium and 13,738 bp for E. multilocularis) (M.
Nakao et al., Asahikawa, unpublished observations). The heavy chains of the mtDNA of
each have 12 genes encoding proteins, two
ribosomal RNA (rRNA) genes and 22 transfer
RNA (tRNA) genes (Fig. 5.2).
Gene order within mtDNA

Gene sequences constituting mitochondrial
genomes of various animal phyla are diagrammatically depicted in Fig. 5.3. From the
49
illustration, it is clear that the gene arrangement in the T. solium mitochondrion is

highly unique and differs from nematodes
as well as other animal phyla. In studies
performed on cestodes and trematodes, this
unique arrangement has been found to be
highly conserved24,35.
Initiating and stop codons

The earliest breakthrough in the study of
mtDNA of the phylum Platyhelminthes was
the determination of the sequence and codon
assignments of a 3.5 kb mtDNA segment of
the trematode, Fasciola hepatica2527,35. Bessho
et al.27 partially sequenced the cytochrome c
oxidase subunit I (COI) gene of mtDNA of
the planaria, Dugesia japonica and proposed a
unique genetic code for planarian mtDNA.
The codon assignments of trematode and
planarian are nearly similar except that the
Fig. 5.2. The mitochondrial genome of Taenia solium. Arrows indicate the direction of transcription
(COIIII: cytochrome c oxidase subunits IIII; ND16 and 4L: NADH dehydrogenase subunits 16 and
4L; ATP6: ATPase subunit 6; LrRNA and SrRNA: large and small subunit rRNAs). Genes for tRNAs are
indicated as abbreviated capital letters for amino acids. The gene arrangement of T. solium mtDNA is the
same as those of Echinococcus multilocularis and T. crassiceps mtDNAs.
50
A. Ito et al.
Vertebrata
Mus musculus
(16,295 bp)
Echinodermata
S. purpuratus
(15,650 bp)
Arthropoda
D. yakuba
(16,019 bp)
Nematoda
Caenorhabditis
elegans
(13,794 bp)
Platyhelminthes
Taenia solium
(13,709 bp)
Fig. 5.3. The arrangements of protein and rRNA genes among representative metazoan mitochondrial
genomes. The sites of tRNA genes are omitted from this figure. Arrows indicate the direction of transcription.
UAA codon specifies tyrosine in the latter.

The codon sequences are unified into the
mitochondrial code of the entire phylum
Platyhelminthes, and its range is conceived to
cover all three classes: Turbellaria, Trematoda
and Cestoda. The genetic code is similar to
that of echinoderm mitochondria5; however
it differs from the universal code27. Our
group28 recently found that GUG is an initiating methionine codon and UAA is a terminating codon (Table 5.1).
tRNA and rRNA genes

Individual sizes of 22 tRNA genes identified
in the cestode mtDNA range from 58 to 73
nucleotides (nt). The variations in length are
mostly due to differences in stem and loop
sizes of the D and T arms (M. Nakao et al.,
Asahikawa, unpublished observations). The
nucleotide compositions of cestode and
nematode mtDNAs are similar. However,
the secondary structures of their tRNAs differ from each other. A majority of cestode
tRNAs (18 out of 22) can be folded into conventional four-arm cloverleaf structures,
whereas the remaining four [tRNASer(AGN),
tRNASer(UCN), tRNAArg and tRNACys] have
unorthodox structures wherein their D-arms
are unpaired and replaced by loops of 69

nt. This unorthodox structure, particularly
in tRNAArg and tRNACys, has not been found
in any other metazoan mitochondrion so
far28.
The cestode mtDNA contains genes for
large and small subunit rRNAs (LrRNA and
SrRNA) of mitochondrial ribosomes. The
putative LrRNA and SrRNA genes are 983
and 704 nt long, respectively (M. Nakao et
al., Asahikawa, unpublished observations).
The length of these genes are similar to those
of their nematode counterparts29 but are
shorter than those of other metazoan mitochondrial rRNAs, so far reported. It is speculated that the compactness of the cestode
rRNAs results from the pressure to minimize
the size of the mitochodrial genome.
Predicted secondary structures of cestode
LrRNA and SrRNA are more similar to those
of nematodes30 and trematodes2.
Polymorphism of T. solium: global

variations
A comparison of sequences of complete COI
genes in different isolates of T. solium from
Asia (China, India, Indonesia, Thailand),
Africa (Mozambique, Tanzania) and Latin
51
Table 5.1. The flatworm mitochondrial genetic code modified for cestodes.
TTT
TTC
TTA
TTG
Phe (F)
Phe (F)
Leu (L)
Leu (L)
TCT
TCC
TCA
TCG
Ser (S)
Ser (S)
Ser (S)
Ser (S)
TAT
TAC
TAA
TAG
Tyr (Y)
Tyr (Y)
Stop
Stop
TGT
TGC
TGA
TGG
Cys ( C )
Cys ( C )
Trp (W)
Trp (W)
CCT
CTC
CTA
CTG
Leu (L)
Leu (L)
Leu (L)
Leu (L)
CCT
CCC
CCA
CCG
Pro (P)
Pro (P)
Pro (P)
Pro (P)
CAT
CAC
CAA
CAG
His (H)
His (H)
Gln (Q)
Gln (Q)
CGT
CGC
CGA
CGG
Arg ( R )
Arg ( R )
Arg ( R )
Arg ( R)
ATT
ATC
ATA
ATG*
Ile (I)
Ile (I)
Ile (I)
Met (M)
ACT
ACC
ACA
ACG
Thr (T)
Thr (T)
Thr (T)
Thr (T)
AAT
AAC
AAA
AAG
Asn (N)
Asn (N)
Asn (N)
Lys (K)
AGT
AGC
AGA
AGG
Ser (S)
Ser (S)
Ser (S)
Ser (S)
GTT
GTC
GTA
GTG*
Val (V)
Val (V)
Val (V)
Val (V)
GCT
GCC
GCA
GCG
Ala (A)
Ala (A)
Ala (A)
Ala (A)
GAT
GAC
GAA
GAG
Asp (D)
Asp (D)
Glu (E)
Glu (E)
GGT
GGC
GGA
GGG
Gly (G)
Gly (G)
Gly (G)
Gly (G)
*Initiation codon.
America (Mexico, Ecuador and Peru) was

undertaken18,24. Based upon the sequencing
data, it was apparent that the Asian isolates
differed from the African and American isolates (Fig. 5.4)24. We surmised that the similarities between African and American
isolates could be related to a common ancestor or origin. Indeed, pigs were exported
from Europe (perhaps, Spain or Portugal) to
Africa and America from the 15th century
onwards. Therefore, it is conceivable that
African and American isolates of T. solium
were introduced by European colonization.
The hypothesized export phenomenon
draws a parallel to the recent export of T.
solium from Bali to Irian Jaya after the latter
came under Indonesian control in 196911,31,32.
The confirmation of the above hypothesis
requires an analysis of the mtDNA of T.
solium isolated from Europe and the demonstration of its similarity to American and
African strains24.
The demonstrated differences in the COI
gene sequences between Asian and
AmericanAfrican isolates may be surmised
to translate into different clinical implications. Indeed, there are differences in the
clinical spectrum of NC between Asia and
South America. For instance, parenchymal
NC and subcutaneous cysticercosis are
common while racemose cysticercosis is
rare in Asia. On the other hand, racemose

cysticercosis is comparatively more common in Central and South America.
Similarly, muscular cysticercosis leading to
pseudohypertrophy has almost exclusively
been reported from China and India and is
uncommon in Central and South America.
Furthermore, serological analysis of purified glycoproteins33 and the antigenic components of cyst fluid of T. solium cysticerci34
have
revealed
differences
in
the
immunoblot profile of isolates from
Ecuador and Mozambique on one hand
and Irian Jaya, Indonesia and China on the
other hand (Fig. 5.5; A. Ito et al.,
Asahikawa, unpublished data).
An increasing amount of travel, immigration and refugeeism in the world is likely to
dilute strict geographical predilections of
any supposed strains and their different clinical and serological expressions. This is likely
to interfere with the determination of a logical inference of phylogenic relationships
between substrains as well as the study of
epidemiology based on mitochondrial
genomics. This however does not prevent us
from forming a preliminary opinion that
there are indeed at least two different substrains of T. solium based on differences in
their mitochondrial genomes, biological and
clinical behaviour.
52
A. Ito et al.
Mexico
Peru
COI gene
(1620 bp)
Tanzania
981
0.01 Da
Mozambique
Ecuador
Thailand
1000
Taenia solium
India
China 2
China 1
1000
Irian Jaya
1000
Taenia saginata
Taenia asiatica
Echinococcus multilocularis
Fig. 5.4. A neighbour-joining phylogenetic tree of various isolates of Taenia solium. The tree was
constructed from complete nucleotide sequences of COI genes. Bootstrap values are shown in the tree
(group A: the African and Latin American isolates; group B: the Asian isolates).
Suggested Protocol for Collection of

Material for mtDNA Studies
While setting up a mitochondrial genomics
laboratory is an elaborate affair, the collection of biological material is relatively simple. Viable segments or eggs from taeniasic
individuals may be frozen or stored in
80100% ethanol in a capped tube at 4C for
mtDNA studies. Viable T. solium eggs may
also be prepared immediately from fresh
segments. At our laboratory, oncospheres
are hatched in vitro and inoculated into the
peritoneal cavity of NOD-SCID mice to
obtain well-developed cysticerci within a
few months14. Morphological, microscopic

and mtDNA studies are then performed
upon the larval stage with the intent of
obtaining epidemiological, species and
other biological data. Cysticerci resected
either from the brain or subcutaneous tissue of humans may also be used as a source
for mtDNA32.
Conclusions
Most recently, the Asahikawa group in
Japan has analysed the complete sequence
of mtDNA of T. solium. The mtDNA of T.
Fig. 5.5. Immunoblot figures of cysticercosis

patients from Latin America (Ecuador) reacting
with various cyst fluid of Taenia solium from
different continents. Lanes 14: Cyst fluid of T.
solium from pigs in Ecuador (lane 1), in Irian Jaya,
Indonesia (lane 2), in China (lane 3) and in
Mozambique (lane 4).
solium consists of 13,709 bp and 12 protein

genes, two rRNA genes and 22 tRNA genes
located exclusively on the heavy chain. It
uniquely uses GUG as an initiating methionine codon and UAA as a terminating codon.
The unique codon usages are shared by
53
other cestodes including E. multilocularis, E.

granulosus and T. crassiceps. These cestodes
have a unique gene order that is different
from other animals except trematodes.
MtDNA studies have established similarities
between the Asian Taenia and T. saginata.
Furthermore, sequencing of the complete
COI gene has revealed differences between
isolates of T. solium from Asia and those
from Africa and America18,24. The genetic
diversity may have important biological,
serological and clinical implications and it is
likely that the two geographical isolates
have different ancestral origins. More such
studies, from different geographical locations, particularly Europe, are required. The
African and American isolates are believed
to have arisen out of European colonization.
Mitochondrial DNA studies may be the key
to demonstrate a link between European
and AmericanAfrican substrains.
Acknowledgements
This study was supported in part by grants
from the Nissan Science Foundation and the
Uehara Memorial Foundation, by a Grant-inAid for International Scientific Research
(Joint
Research,
06044089,
07044243,
09044279) and by a Grant-in-Aid for Scientific
Research (A) 11694259, (B) 10557029,
12557024 to A. Ito and by a Grant-in-Aid for
Scientific Research (C) 70155670 to M. Nakao.
REFERENCES
1. Barker, S., Blair, D. (1996) Molecular phylogeny of Schistosoma species supports traditional groupings within the genus. Journal of Parasitology 82, 292298.
2. Blair, D., Le, T.H., Desprs, L., et al. (1999) Mitochondrial genes of Schistosoma mansoni. Parasitology
119, 303313.
3. McManus, D.P., Hope, M. (1993) Molecular variation in human schistosomes. Acta Tropica 53,
255276.
4. Kokaze, A., Miyadera, H., Kita, K., et al. (1997) Phylogenetic identification of Sparganum proliferum as
a pseudophyllidean cestode. Parasitology International 46, 271279.
5. Smith, M.J., Arndt, A., Gorski, S., et al. (1993) The phylogeny of echinoderm classes based on mitochondrial gene arrangements. Journal of Molecular Evolution 36, 545554.
6. Boore, J.L., Collins, M., Stanton, D., et al. (1995) Deducing the patterns of arthropod phylogeny from
mitochondrial DNA rearrangements. Nature 376, 163165.
7. Boore, J.L., Lavrov, D., Brown, W.M. (1998) Gene translocation links insects and crustaceans. Nature
392, 667668.
54
A. Ito et al.
8. Boore, J.L. (1999) Animal mitochondrial genomes. Nucleic Acids Research 27, 17671780.
9. Fan, P.C. (1988) Taiwan Taenia and taeniasis. Parasitology Today 4, 8688.
10. Eom, K.S., Rim, H.J. (1993) Morphologic descriptions of Taenia asiatica sp. North Korean Journal of
11. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/cysticercosis in Indonesia as
an emerging disease. Parasitology Today 13, 321323.
12. Ito, A. (1992) Cysticercosis in Asia-Pacific regions. Parasitology Today 8, 182183.
13. Galan-Puchardes, M.T., Fuentes, M.V. (1999) Human cysticercosis and larval tropism of Taenia asiatica. Parasitology Today 16, 174.
14. Ito, A., Nakaya, K., Sako, Y., et al. (2001) NOD-SCID mouse as an experimental animal model for
cysticercosis. Southeast Asian Journal of Tropical Medicine and Public Health 32 (Suppl.), 8589.
15. McManus, D.P. (1990) Characterization of taeniid cestodes by DNA analysis. Revue Scientifique et
Technique 9, 489510.
16. Bowles, J., McManus, D.P. (1994) Genetic characterization of the Asian Taenia, a newly described
taeniid cestode of humans. American Journal of Tropical Medicine and Hygiene 50, 3344.
17. Zarlenga, D.S., George, M. (1995) Taenia crassiceps: cloning and mapping of mitochondrial DNA and
its application to the phenetic analysis of a new species of Taenia from Southeast Asia. Experimental
18. Okamoto, M., Nakao, M., Sako, Y., et al. (2001) Molecular variation of Taenia solium in the world.
Southeast Asian Journal of Tropical Medicine and Public Health 32 (Suppl.), 9093.
19. Ito, A., Cheng, W.C., Chen, C.C., et al. (1997) Human Taenia eggs develop into cysticerci in SCID
mice. Parasitology 114, 8588.
20. Ito, A., Ito, M., Eom, K.S., et al. (1997) In vitro hatched oncospheres of Asian Taenia from Korea and
Taiwan develop into cysticerci in the peritoneal cavity of female scid (severe combined immunodeficiency) mice. International Journal for Parasitology 27, 631633.
21. Ito, A., Ma, L., Sato, Y. (1997) Cystic metacestodes of a rat-adapted Taenia taeniaeformis established in
the peritoneal cavity of scid and nude mice. International Journal for Parasitology 27, 903905.
22. Ito, A., Ito, M. (1999) Human Taenia in severe combined immunodeficiency (SCID) mice. Parasitology
Today 15, 6467.
23. Fan, P.C., et al. (1995) Morphological description of Taenia saginata asiatica (Cyclophyllidea:
Taeniidae) from man in Asia. Journal of Helminthology 69, 299303.
24. Nakao, M., Okamoto, M., Sako, Y., et al. (2002) A hypothesis for the distribution of two genotypes of
the pork tapeworm Taenia solium worldwide. Parasitology 126 (in press).
25. Garey, J.R., Wolstenholme, D.R. (1989) Platyhelminth mitochondrial DNA: evidence for early evolutionary origin of a tRNASerAGN that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons. Journal of Molecular Evolution 28, 374387.
26. Ohma, T., Osawa, S., Watanabe, K., et al. (1990) Evolution of the mitochondrial genetic code IV.
AAA as an asparagine codon in some animal mitochondria. Journal of Molecular Evolution 30,
329332.
27. Bessho, Y., Ohama, T., Osawa, S. (1992) Planarian mitochondria II. The unique genetic code as
deduced from cytochrome c oxidase subunit I gene sequences. Journal of Molecular Evolution 34,
331335.
28. Nakao, M., Sako, Y., Yokoyama, N., et al. (2000) Mitochondrial genetic code of cestodes. Molecular
Biochemistry and Parasitology 111, 415424.
29. Okimoto, R., Macfarlane, J.L., Clary, D.O., et al. (1992) The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. Genetics 130, 471498.
30. Okimoto, R., Macfarlane, J.L., Wolstenholme, D.R. (1994) The mitochondrial ribosomal RNA
genes of the nematodes Caenorhabditis elegans and Ascaris suum: consensus secondary-structure
models and conserved nucleotide sets for phylogenetic analysis. Journal of Molecular Evolution 39,
598613.
31. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging and immunoblots: the emergence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A.,
Hughes, J.M. (eds) Emerging Infections 2. ASM Press, Washington, DC, pp. 213242.
32. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures
and burns associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 199195.
Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 4650.
33.
55
Ito, A., Sako, Y., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins for
serodiagnosis of cycsticercosis in pigs naturally injected with Taenia solium. Journal of Helminthology
73, 363365.
34. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticercosis: simple method for
preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59,
291294.
35. Ito, A., Plancarte, A., Nakao, M., et al. (2002) Neurocysticercosis in Asia: serology/seroepidemiology
in humans and pigs. In: Craig, P., Pawlowski, Z. (eds) Cestode Zoonoses: Echinococcosis and
Cysticercosis an Emergent and Global Problem. IOS Press, Amsterdam, pp. 2531.
36. Le, T.H., Blair, D., Agatsuma, T., et al. (2002) Phylogenies inferred from mitochondrial gene orders
a cautionary tale from parasitic flatworms. Molecular Biology and Evolution 17, 11231125.
Hereditary Factors in
Neurocysticercosis with Emphasis on
Single, Small, Enhancing CT Lesions
Vasantha Padma, Satish Jain, Achal Srivastava, Manjari Tripathi
and Mahesh C. Maheshwari
Introduction
Most human disorders are a result of an
interaction between environmental and
genetic factors. In certain diseases, there is a
dominant genetic influence and environmental agencies exert a modulating influence. In
others, the primary cause is an environmental agent, most often a microbial, toxic or an
immune element, but in addition, there is a
small but definite genetic predisposition. A
number of infectious and inflammatory disorders fall into the latter category. Significant
in this context is the predisposition conferred
by the major histocompatibility complex,
also known as the human leucocyte antigen
(HLA) on chromosome 61. Different alleles
of the HLA genes either predispose or protect against specific disorders. Multiple sclerosis, systemic lupus erythematosus and
diabetes are examples of such disorders24.
Neurocysticercosis (NC) is a somatic form
of taeniasis that is acquired by ingestion of
Taenia solium eggs. Environmental factors
including poor personal hygiene, improper
sanitation and inadequate pig husbandry are
primary reasons for its occurrence. The role
of genetic factors in NC has not been sufficiently recognized. It might be interesting to
postulate the existence of genetic influence,
that predisposes certain populations to
acquire T. solium cysticercosis, and among
these, subpopulations to exhibit differences

in disease manifestations and behaviour. On
a different note, the study of genetic factors
may also unravel novel control strategies of
developing genetically engineered pigs that
are resistant to cysticercosis and can effectively check the humanenvironmentpig
human cycle.
The study of genetic influences in human
T. solium cysticercosis is at a preliminary
stage. In this review, we present some of our
data on HLA studies in single, small,
enhancing CT lesions (SSECTLs)5,6 and
review some of the published human7 and
experimental evidence8,9 of the influence of
the major histocompatibility complex in disease acquisition.
HLA Studies in SSECTL

Aetiology of SSECTL
Computed tomography (CT) often demonstrates SSECTLs or the so-called disappearing CT lesions in individuals with recent
seizures in several developing countries,
including India. These lesions are seen to be
associated with a benign form of seizure disorder. Rajshekhar has reviewed the events
that led to the recognition of the aetiological
agent for SSECTL. The reader is referred to

57
58
V. Padma et al.
Chapter 24 for a review of aetiological considerations. Current opinion links an overwhelming majority of the SSECTLs to T.
solium cysticercosis. This has been based
upon histological findings, which have been
summarized in this book by Chacko (see
Chapter 31). However, other aetiological
agents such as tuberculosis, brain abscesses
and miscellaneous inflammatory conditions
cannot be completely disregarded10.
HLA studies
We performed HLA studies in 63 Indian
probands with seizures and SSECTL, and
also studied the occurrence of seizure types
among their family members5. All probands
included in the study were clinically evaluated by one of the three authors (SJ, MCM,
and VP). Family pedigrees were drawn to
include all the first- and second-degree relatives of the probands. Information on
affected relatives was collected and, wherever possible, the affected relatives were
examined in the outpatient clinic. All
probands and affected relatives underwent
electroencephalographic evaluations. CT
scan was done when possible and indicated.
All 63 patients and 340 healthy controls were
serologically tested using complement mediated standard micro-lymphotoxicity test for
HLA-A, HLA-B and HLA-C antigens.
We found a positive family history of
seizures among 16 out of 63 (25%)
probands with SSECTL. Among affected
relatives, 13% had symptomatic generalized epilepsy. A SSECTL was noted in four
relatives (17%). The occurrence of different
epileptic syndromes among the relatives
prompted us to consider either a genetic
contribution in the aetiopathogenesis of
this syndrome or a hereditary susceptibility
to an environmental agent5.
Further, preliminary results of HLA class I
studies revealed that the frequencies of HLAA11 were decreased, whereas those of HLAB63 and HLA-B58 were increased in
probands, when compared with healthy controls (the values were not significant after
application of correction factor for P value).
Among HLA class II antigens (tested subse-
quently in 41 randomly selected probands),

HLA-DR B1*13 occurred in 29.3% of probands
in comparison to 9.7% in healthy controls (2 =
10.35; Pc = 0.036; relative risk (RR) = 3.83). In
addition, HLA-DR B1*09 was observed with
an increased frequency in probands (7.3 vs.
1.3%; 2 = 4.69; RR = 6). No other class II antigens deviated significantly from control5. The
HLA Class II genomic typing results in our
patients are statistically significant. These
associations may be surmised to be an indicator of susceptibility to an infection or infestation in Indian patients with seizures. From a
different viewpoint, our report adds to the list
of results associating different class I and class
II alleles with epileptic syndromes such as
juvenile myoclonic epilepsy, LennoxGastaut
syndrome and severe myoclonic epilepsy in
infants1117.
We hypothesized that the condition to
which we have been assigning different
names is actually an imaging phenotype.
This CT lesion represents a benign epileptic
syndrome that occurs predominantly in Asian
Indians. The results of our preliminary study
prompted us to investigate further, hereditary
factors in this syndrome. We reported clinical
features in 235 Indian probands with seizures
in association with SSECTL along with those
in their family members6. HLA class II antigen frequencies were further studied in 41
randomly selected probands.
A total of 235 individuals with SSECTL
were followed at the outpatient clinic of the
Neurology
Department,
Neurosciences
Center, All India Institute of Medical
Sciences, New Delhi. These patients represented the ethnic groups of North Indian
Hindus. Follow-up CT scan revealed complete or nearly complete (only a residual calcified dot) spontaneous resolution of the
lesion in all cases with no specific therapy.
Individuals in whom the CT lesion resolved
while they were taking antitubercular or
anticysticercal drugs, antibiotics and steroids
were excluded6. Family history of seizures
was considered positive when one or more
first- or second-degree relative had seizures.
Family pedigrees were similarly drawn for
probands having other neurological disease,
for instance, muscular dystrophy, to determine the occurrence of seizures in their fam-
Hereditary Factors in Neurocysticercosis
ily members. The affected relatives with

seizures in these families also were examined
in the same way as the affected relatives of
probands. The 41 patients (from a total 235)
included for HLA-DR typing were unrelated
and randomly selected. HLA-DR typing also
was performed on 154 healthy controls (from
the same ethnic groups living in the same
geographic region)18.
A history of seizures was documented
among first- and second-degree relatives of
50 (21%) probands. A first-degree relative
was affected in 35 and a second-degree relative in 15 probands. Thirty-eight (3%) of 1212
first-degree relatives and 28 (0.8%) of 3379
second-degree relatives were affected.
Therefore, the ratio of affected firstdegree : second-degree relatives was 4.3 : 1.
Localization-related epilepsies were more
common among first-degree relatives
(P0.05), whereas generalized epilepsies
were more often noted among second-degree
relatives (P0.01). Interestingly, seven of 35
first-degree relatives had seizures in association with SSECTL compared with only one
of 15 second-degree relatives. Other syndromes were almost equally distributed
among the relatives. Among affected firstdegree relatives, seven had localizationrelated epilepsy, while five had SSECTL.
Among 1587 first- and 3797 second-degree
relatives of 212 controls with neurological
diseases other than epilepsy, 20 first- and
four second-degree relatives had epilepsy.
Affected probands had a significantly higher
frequency or a positive family history in
comparison to controls6.
HLA-DR B1*13 was expressed in 29.3% of
probands in comparison to 97% in healthy
controls (2 = 10.35; RR = 3.83). On the other
hand, HLA-DR B1*09 was observed with an
increased frequency in probands (7.3 vs. 1.3%;
2 = 4.69; RR = 6). None of the other class II
antigens tested revealed any significant deviation in patients as compared to controls6.
Several previously published reports suggest a role of the HLA system in different
epileptic
syndromes11,13,14,19,20.
Juvenile
myoclonic epilepsy was shown to be linked
to the BF and HLA loci on human chromosome 6 in two population groups from the
United States and Germany, and HLA-DRW
59
13 in Arab patients14,19,20. Some genes predisposing to the susceptibility to seizures

may be located near the HLA locus. From
this viewpoint, seizures in association with
SSECTL in Asian Indians may represent a
genetically determined predisposition to a
unique benign epileptic syndrome with particular imaging characteristics.
HLA Studies in Human

Neurocysticercosis
From a contrasting point of view to that presented above, HLA associations have been
reported with other infective diseases such
as leprosy, tuberculosis and cysticercosis7,21,22. Del Brutto et al. reported significantly increased frequency of HLA-A28 and
decreased frequency of HLA-DQW2 in a
Mexican cohort with parenchymal NC7. The
authors surmised that HLA-A28 confers susceptibility to NC, while HLA-DQW2 accords
resistance. With a similar view, our results of
HLA studies in the Indian probands with
SSECTLs point to an increased susceptibility
to an infective agent such as cysticercosis. It
is also possible that affected relatives of
individuals with SSECTLs were exposed to
the common causative agent (through food
and water for cysticercosis). The high prevalence of seizures among first-degree relatives could also be reflection of an exposure
to a common environmental agent.
Experimental Evidence for a Genetic

Contribution
Fragoso et al. investigated the influence of nonclassic Class I MHC Qa-2 antigen expression
and acquisition of T. crassiceps cysticercosis in
mice8. The authors found that the
BALB/cAnN substrain of mice, which did not
express Qa-2 antigen was highly susceptible to
infection, while another substrain BALB/cJ,
which expressed Qa-2 was resistant to T. crassiceps cysticercosis. In further experiments, Qa-2
transgenic mice (C57BL/67/BALBcAnN) were
backcrossed to BALB/cAnN mice and then
infected with T. crassiceps9. A significantly
lower yield of cysticercus larvae was noted in
60
V. Padma et al.
the Qa-2 transgenic mice than in non-transgenic

mice. These studies have established a definite
relationship between Qa-2 antigen expression
and resistance to infection with T. crassiceps cysticercosis in mice. Furthermore, human Class I
MHC, HLA-G has been suggested to be functionally similar to murine Qa-2. The experimental data outlined above are significant for the
understanding of factors that lead to resistance
or susceptibility to cysticercosis.
Conclusions
Several HLA molecules have been demonstrated to confer susceptibility or resistance
to cysticercosis in humans with SSECTLs,
NC and in experimental models of a related
cysticercus. The identification of these
genetic factors offers the promise of developing strategies for inducing resistance to cysticercosis through genetic manipulation.
References
1. Robinson, J., Waller, M.J., Parham, P., et al. (2001) IMGT/HLA database a sequence database for
the human major histocompatibility complex. Nucleic Acids Research 29, 210213.
2. Ruiz, N., Giudecelli, V., Ginestoux, C., et al. (2000) IMGT, the international immunogenetics database. Nucleic Acids Research 28, 219221.
3. Nepom, G.T., Nepom, B.S. (1992) Prediction of susceptibility to rheumatoid arthritis by human
leukocyte antigen genotyping. Rheumatic Diseases Clinics of North America 18, 785794.
4. Subbah, I., Savola, K., Ebeling, T., et al. (2000) Genetic, autoimmune and clinical characteristics of
childhood- and adult-onset type 1 diabetes. Diabetes Care 23, 13261332.
5. Jain, S., Padma, M.V., Kanga, U., et al. (1997) Human leukocyte antigen studies in Indian probands
with seizures associated with single small enhancing computed tomography lesions and seizure
types in their family members. Journal of Epilepsy 10, 5561.
6. Jain, S., Padma, M.V., Kanga, U., et al. (1999) Family studies and human leukocyte antigen class II
typing in Indian probands with seizures in association with single small enhancing computed
tomography lesions. Epilepsia 40, 232238.
7. Del Brutto, O.H., Granados, G., Talamas, O., et al. (1991) Genetic pattern of the HLA system: HLA A, B,
C, DR, DQ antigens in Mexican patients with parenchymal brain cysticercosis. Human Biology 63, 8593.
8. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1996) Genetic control of susceptibility to Taenia crassiceps
cysticercosis. Parasitology 112, 119124.
9. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1998) Increased resistance to Taenia crassiceps murine cysticercosis in Qa-2 transgenic mice. Infection and Immunity 66, 760764.
10. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT ring lesions in epilepsy.
Neurology 44, 13441346.
11. Durner, M., Janz, D., Zingsem, J., et al. (1992) Possible association of juvenile myoclonic epilepsy
with HLA-DRw6. Epilepsia 33, 814816.
12. Arali, J.A. (1993) Immunological aspects of epilepsy. Brain Development 15, 4149.
13. van Engelen, B.G., de Waal, L.P., Weemeas, C.M., et al. (1994) Serologic HLA typing in cryptogenic
Lennox Gastaut syndrome. Epilepsy Research 17, 4347.
14. Obeid, T., el Rab, M.O., Daif, A.K., et al. (1994) Is HLA-DRw13 (W6) associated with juvenile
myoclonic epilepsy in Arab patients? Epilepsia 35, 319321.
15. Moen, T., Brodtkorb, E., Michler, R.P., et al. (1995) Juvenile myoclonic epilepsy and human leukocyte
antigens. Seizure 4, 119122.
16. Oguni, H., Uehara, T., Fzumi, T., et al. (1995) Immunogenetic study of patients with severe
myoclonic epilepsy in infants and its variant. Epilepsia 36 (Suppl. 3), S910.
17. Suastegui, R.A., De la Rosa, G., Fonzalez-Austiazaran, A., et al. (1995) HLA class II genetic markers
are involved in resistance/susceptibility for the expression of massive spasm. Epilepsia 36 (Suppl. 3),
S10.
18. Mehra, N.K., Verduijn, W., Taneja, V., et al. (1991) Analysis of HLA-DR2 associated polymorphism
by oligonucleotide hybridization in an Asian Indian population. Human Immunology 32, 246253.
19. Greenberg, D.A., Delgado-Escueta, A.V., Widlitz, H., et al. (1988) Juvenile myoclonic epilepsy may
be linked to the BF and HLA loci on human chromosome 6. American Journal of Medical Genetics
31, 185192.
Hereditary Factors in Neurocysticercosis
61
20. Liu, A.W., Delgado-Escueta, A.V., Serratose, J.M., et al. (1995) Juvenile myoclonic epilepsy locus in
chromosome 6p21.2p11: linkage to convulsions and electroencephalographic trait. American Journal
of Human Genetics 57, 368381.
21. Zerva, L., Ciznam, B., Mehra, N.K., et al. (1996) Arginine at positions 13 or 7071 in pocket 4 of
HLA-DRB1 alleles is associated with susceptibility to tuberculoid leprosy. Journal of Experimental
Medicine 183, 829836.
22. Rajalingam, R., Mehra, N.K., Jain, R.C., et al. (1996) Polymerase chain reaction-based sequence specific oligonucleotide hybridization analysis of HLA class II antigens in pulmonary tuberculosis: relevance to chemotherapy and disease severity. Journal of Infectious Diseases 173, 669676.
Taenia solium Cysticercosis: an

Overview of Global Distribution and
Transmission
Peter M. Schantz
Introduction
History
Taeniasis/cysticercosis caused by Taenia

solium, often referred to as the pork tapeworm, is a classical zoonosis, recognized
since antiquity, which, as a result of a variety of demographical, technological and
political factors, has emerged as an increasingly important disease in regions where it
has long been endemic, as well as in regions
into which it has been imported or introduced. The two-host life cycle of the tapeworm involves humans as definitive hosts
and swine as intermediate hosts. Infected
pigs are the source of human taeniasis, an
intestinal tapeworm infection acquired by
eating undercooked pork contaminated
with cysticerci, the larval stage of the cestode. Cysticercosis, however, is acquired by
ingesting Taenia eggs shed in the faeces of a
human tapeworm carrier and thus may
occur in humans who neither eat pork nor
share environments with pigs. Although
cysticerci may localize throughout the body,
most clinical manifestations result from
their presence in the central nervous system
(neurocysticercosis (NC)), where they can
cause seizures, hydrocephalus and other
neurological disorders1.
Prominently visible in both its intestinal and

tissue stages, the macroparasite T. solium has
been known since the earliest times.
Spontaneous elimination of individual tapeworm segments was alluded to by writers at
the beginnings of recorded history2. The
ancient Greeks made reference to measles
in pork, which were in fact larval cysticerci;
however, their significance was not understood. Aristotle compared their appearance
to hailstones; he and others regarded them
as worm-like animals. In the 16th century,
European pathologists associated the condition with disease in humans and described
cysticerci in the brains of epileptic persons.
By the mid-19th century a number of investigators had demonstrated the link between
cystic and strobilar (intestinal) forms of several species of Taenia by showing that cystic
forms metamorphosed into adult worms
when ingested by suitable hosts. This relationship for T. solium was confirmed in 1855
by Kchenmeister who administered cystinfected pork to a condemned criminal and
observed developing adult forms in the
mans intestine after his execution2. About
the same time, van Beneden in Belgium

63
64
P.M. Schantz
demonstrated that he could produce cysticerci in the muscles of pigs by feeding them
T. solium eggs obtained from tapeworm segments passed by infected humans. Further
studies confirmed that humans alone were
the definitive host of the worm and pigs
were the only significant intermediate host;
thus, the reasons for the well-recognized
paucity of infection in Moslems and Jews, for
whom Mosaic laws forbade the ingestion of
pork, could then be understood. Scattered
reports suggest that the infection was prevalent in pigs and in humans in various parts
of the world; however, highest rates of transmission most likely occurred in populations
with the poorest recorded medical documentation. During the first half of the 19th
century, approximately 2% of postmortem
examinations of humans conducted in
Berlin, Germany, revealed cysticercosis and
details of the clinical and pathologic characteristics of NC were extensively described in
German medical literature by the turn of the
20th century3. Although the infection has
been virtually eliminated from Germany and
most of the rest of Western Europe, similar

or higher prevalence rates have been documented recently in parts of Africa, Asia, and
Central and South America4. Improvements
in diagnosis (neuroimaging methods and
specific antibody detection) have revolutionized the antemortem recognition of this disease, thus improving our understanding of
the nature of the disease and its true prevalence while large-scale migration of populations in modern times have continued to
expand its distribution.
Geographic Distribution
Taenia solium infection is widely endemic in
rural areas of developing countries in
Central and South America, Asia and Africa
(Fig. 7.1). Published reports document the
occurrence of clinical NC in most of the
countries of the Americas (most notably
Mexico, Guatemala, El Salvador, Honduras,
Colombia, Ecuador, Peru, Bolivia and Brazil).
The infection was reported to be present in
Fig. 7.1. Approximate global geographic distribution of Taenia solium.
Global Distribution and Transmission
18 countries of South and Central America

whose combined populations represented
94% of the total 1980 population of the Latin
American countries5. Of the American countries, only Canada, the United States,
Argentina and Uruguay appear to be free of
transmission in the pighuman cycle; however, these latter countries are observing an
increase in imported and introduced infections related to immigration of persons from
neighbouring countries where T. solium
infection is endemic4. No information is
available concerning the occurrence, or
absence, of infection in Guyana, Suriname
and French Guiana.
In Asia, most available data are from
clinic-based populations and, consequently,
are biased in terms of the true geographic
origin and epidemiologic factors associated
with transmission. Transmission in much of
Asia is strongly influenced by prevailing cultural practices and socio-economic conditions. In India, for example, intestinal-stage
T. solium infections occur mainly in pork-eating populations, particularly in rural populations and lower socio-economic classes; 78%
of children of pig farmers were reported to
be passing taeniid eggs6,7. Vegetarian populations are presumably exposed to cysticercosis through direct and indirect contact
with Taenia carriers. The vast majority of
clinical cases reported in India are of the single-lesion variety with relatively mild symptoms and benign outcome; these are believed
to be associated with exposure to eggs in
contaminated foodstuffs or other indirect
exposure to tapeworm carriers8. Curiously,
the greatest number of cases of the rare, massive, disseminated form of the disease have
also been reported from India; the explanations for these extremes are unknown9. As
might be expected, there are no reports from
the strictly Moslem countries of Iran,
Pakistan, Afghanistan and Bangladesh.
Human NC is reported widely from China
and parts of Korea. It is known to occur also,
although few published data are available, in
the Southeastern Asian countries of
Myanmar, Cambodia, Laos, Vietnam and
parts of the Philippines. In Indonesia, T.
solium infection is endemic in parts of
numerous islands including Sumatra, Bali,
65
West Kalimantan, Sulawesi, Flores, East

Timor and Irian Jaya10,11. The cestode was
apparently introduced into Irian Jaya in
recent times when swine from Bali were
translocated to (former) West New Guinea12.
Improvements in socio-economic conditions
were associated with reduction or disappearance of the infection in Japan, Taiwan, Hong
Kong, Singapore, and Thailand, where, in
recent years, most cases diagnosed were
apparently imported.
In Africa, T. solium is transmitted throughout most of the continent with the exception
of the strictly Muslim areas of North and
sub-Saharan Africa. NC is an important
cause of neurological disability in regions of
Africa in which it has been studied; epilepsy
in several countries has been documented to
be caused by T. solium infection in 3051% of
cases13. In Africa, as in Asia, subcutaneous
localization of cysticerci, concomitant with
intracerebral infection, is common (30%);
this is in contrast to the infection in
American countries where subcutaneous
localization in patients with NC is relatively
rare4. Because of the limited development of
medical and sanitary infrastructure, the
impact of the disease may be underestimated
to a greater degree than in other regions. The
widespread absence of sanitary services,
especially adequate disposal of human
excrement, and the frequent practice of
allowing pigs to roam free, permits transmission of T. solium in most of the regions.
Controlled slaughter of swine is rarely practised and consequently cysticerci-infected
pork is generally consumed by humans who
either ignore or are ignorant of its significance14,15. In South Africa, Zimbabwe and
Madagascar where medical services are relatively sophisticated, NC has long been a subject of scientific reports1619; from other
regions, however, there are very limited data
because of the lack of diagnostic facilities.
NC is reportedly a common clinical entity in
many countries of West Africa (Senegal,
Benin, Ivory Coast, Togo, Ghana) and
Central Africa (Zaire, Cameroon, Burundi
and Rwanda)20. Few reports of NC in
humans in East Africa have been documented; however, a recent report of T. solium
cysticercosis in 13% of pigs slaughtered in
66
P.M. Schantz
three abattoirs in Tanzania suggests that the

cestode occurs in at least some regions21.
There is increasing recognition that the medical and economic costs of T. solium cysticercosis are greatly underestimated in countries
like Tanzania, Zambia, Zimbabwe and South
Africa and efforts are underway to document these costs and to organize effective
methods of prevention and control (A.L.
Willingham, Frederiksberg, Denmark and
R.C. Krecek, Onderstepoort, South Africa,
personal communication, 2000).
Historically, T. solium occurred widely in
European countries; indeed, many of the earliest recorded observations about the parasite
and its life cycle were reported by European
authors2. In the mid-19th century, it was
reported that cysticerci were observed in 2%
of autopsied human cadavers in Germany
and infections were commonly observed in
swine at slaughter2. The same was apparently
true in many countries of the continent.
Today, as a result of improvements in swine
husbandry, sanitation and hygiene, the infection has largely disappeared; however, locally
acquired infections are still occasionally
reported from Spain (Castilla, Extremadura
and Andalucia)22,23, northern Portugal24,
southern Italy25 and Poland (Z. Pawlowski
and A. Ramisz, Poznan, Poland, personal
communication, 1997), indicating persisting
foci of transmission in some regions.
Prevalence Data
Until recently, the only available quantitative
data on cysticercosis from any country were
clinic-based statistics on the frequency of NC
among hospital patients or autopsied cadavers. In Mexico, for example, NC has long
been considered to have an important impact
on health services expenditures. Through the
1980s, this diagnosis accounted for nearly 9%
of admissions in neurology and neurosurgical services and was the final diagnosis in
1125% of patients operated on for removal
of brain tumours1. NC was found in 2.83.6%
of all autopsies in Mexico City hospitals and
was reported as the cause of death in
0.61.5% of hospitalized patients. Similar statistics documenting the frequency of clinical
diagnoses of NC have been reported from

many other countries; however, such statistics are misleading because differences in
availability of medical services and lack of
comprehensive and consistent reporting in
most countries confound attempts to compare incidence and prevalence between countries and, within a country, between rural and
urban areas. For example, extensive documentation in the medical literature on the
occurrence of NC in Mexico over many years
might have suggested that the disease was
more prevalent there than in neighbouring
countries; however, recent surveys using
modern diagnostic techniques reveal that the
prevalences of T. solium infection in some
countries of the region exceed rates in Mexico
by considerable margins (Table 7.1). In all
countries, improved diagnostic technology,
new options for treatment, and greater
awareness of cysticercosis by the medical and
public health communities have resulted in
documentation of increased numbers of cases
diagnosed in traditional disease-endemic
areas as well as new disclosures of active
transmission from regions where the disease
was previously unrecognized or not
reported. Recent surveys and epidemiological studies, using state-of-the-art diagnostic
methods26, have begun to document the
occurrence of the infection and its impact on
affected populations. Table 7.1 compares
recent prevalence estimates for T. solium cysticercosis and taeniasis in humans and cysticercosis
in
pigs
in
surveys
of
community-based population samples in
Latin America in which comparable diagnostic methods were used2740. Prevalence varied
among communities; however, a consistent
relative pattern of prevalence ratios of the
different forms of infection has been
observed. Prevalences of intestinal stage
infection (taeniasis) are relatively low; however, rates of cysticercosis in humans and
pigs are usually related quantitatively to the
rates of taeniasis. People in affected communities are not usually aware that the parasitic
cysts they see in the meat of pigs is the cause
of seizures and other neurological disorders;
however, use of modern serological and
imaging diagnostic technology has identified
NC as the most important contributor to the
67
Table 7.1. Prevalence estimates of Taenia solium cysticercosis and taeniasis in humans and pigs in
Latin American communities.
Country
Community
Mexico
Angahuan
SeroPrevalence
prevalence
of
Prevalence
Sample
(EITB1)
taeniasis
in pigs
size
(%)
(%)
(%)
Reference
10.8
0.3e
4.0t
Sarti et al., 1992, 199428,27
1005
4.9
0.2e
6.5t
Sarti et al., 199229
1552
Mexico
Xoxocotla
Guatemala
Quesada
862
11.0
1.0c,e
4.0t
Allan et al.,199630,
Garcia Noval et al., 200131
Guatemala
El Jocote
955
20.0
2.8c,e
14.0t
Allan et al.,199630,
Garcia-Noval et al., 200131
n.d.
Military
recruits
urban
(363)
rural
(41)
15.0
Honduras
22.0
0.6e
n.d.
Sanchez et al.,
199832
Honduras
Agua
Caliente
68
536
34.0
1.5e
n.d.
Sanchez et al.,
199733
Honduras
Salama
County
480
17.0
2.5e
27.1t
Sanchez et al.,
199934 , Sakai
et al., 199835
Bolivia
rural
community
159
22.6
n.d.
38.9i
Tsang and Wilson,

199536
Ecuador
San Pablo
del Lago
118
10.4
n.d.
7.5t
Cruz et al., 199837
Peru
Lima
(urban)
250
n.d.
Tsang and Wilson,

199536
Peru
Maceda
371
8.0
0.3e
43.0i
Diaz et al., 199238

Garca et al., 199639
Peru
Churusapa
134
7.0
n.d.
49.0i
Peru
Haparquilla
108
13.0
n.d.
46.0i
Peru
Monterredonda
489
16.0
n.d.
13.0i
18.0
n.d.
6070i
24.0
8.6i
36.0i
Garca et al., 199639,

199940
Peru
Peru
Quilcas
Saylla
99
Notes:
1. EITB: enzyme-linked immunoelectrotransfer blot.
2. Prevalence of antibodies to cysticercosis measured in humans by EITB assay (Reference 26).
3. Prevalence of taeniasis measured by examination of faecal specimens for eggs e or coproantigensc or
both.
4. Prevalence of cysticercosis in pigs measured by visual examination and palpation of tongue t or
detection of antibodies by EITB assay i.
5. n.d.: not done.
high rates of epilepsy and migraine

headaches in many regions where T. solium
infection is endemic. For example, in community-based studies from Mexico, Guatemala,
Honduras, Ecuador and Peru, large proportions of persons with histories of seizures had
serological (2134%) or neurological imaging

(5470%) evidence of NC31,37,41. It is important to note that the seizure episodes in these
rural people had not previously been linked
to NC and it required this type of active diagnostic intervention to be able to demonstrate
68
P.M. Schantz
the impact of the disease on the health of

these communities.
Using data on seroprevalence and seizure
disorder rates from multiple populationbased community studies in Peru, Bern et al.
estimated that there were from 23,512 to
39,186 symptomatic cases of NC in Peru
alone42. Extrapolating from limited serological surveys in other countries of Latin
America, these authors calculated that 3050
million persons may have been exposed to T.
solium in Latin America alone and that there
were an estimated 400,000 infected persons
with symptomatic disease. In most countries
where T. solium infection is endemic, community-based prevalence data are not yet
available and there exist no realistic, databased estimates of the worldwide prevalence
of T. solium infection in humans, however,
the diagnostic technology now exists to
begin to amass such data. There is a need for
provision of diagnostic and therapeutic
resources at the community level to determine the prevalence of infection and rates of
associated morbidity.
Patterns of Transmission
Endemic transmission
Throughout its worldwide distribution, T.
solium is maintained by cyclic transmission
in swine and human hosts. More than 40
years ago, T. solium infection was called a
testimony to under-development43; that
characterization
remains
true
today.
Transmission of T. solium requires that pigs
have access to human faeces and that
humans ingest inadequately cooked meat of
pigs. Such conditions are common in rural
areas of many under-developed or unevenly
developed countries characterized by poor
hygiene, deficient sanitary facilities and
primitive swine husbandry practices that
allow pigs to run loose all or part of the time;
such communities have not yet directly benefited from the achievements in sanitation
and hygiene often referred to as the first
public health revolution. In certain situations where pigs are kept in enclosures or are
restrained, they may be fed human faeces
purposefully, e.g. pig-sty privies, thus also

leading to transmission of T. solium. Such
conditions may appear to be the endpoint of
social neglect but usually represent an effective adaptation to poverty and circumstance
whereby the pig is nourished adequately at
virtually no cost to the owner and, simultaneously, serves as a community scavenger or
sanitary police. Through coprophagy, pigs
readily become infected, often at high rates
and very intense levels. Recent surveys in
disease-endemic communities of Latin
America have revealed that infection rates in
pigs approach 550%2731,35,36,39,4446. In T.
solium-endemic areas, local populations,
including pig owners, are often unaware of
the threat to public health that this infection
in pigs represents and do not relate the
lesions in their animals to disease in humans.
Nevertheless, pig owners may routinely
check their live pigs for cysticercosis by
direct examination of the tongue. This concern is motivated by the knowledge that cysticerci-infected meat may be rejected at
slaughter (where visual meat inspection is
practised) or will bring a significantly
reduced price. Consequently, infected pigs
may be slaughtered and sold clandestinely
or consumed by the pig-owners family. In
villages of Central Peru, where infection
rates in pigs varied from 14% to 25%, virtually none of the infected pigs were processed
at the local slaughterhouse. Rather, pig owners and vendors purposefully bypassed formal slaughterhouses. The investigators
estimated that 23% of the total pork consumed in the community was derived from
pigs infected with cysticerci46. Studies in
Mexico, Guatemala and Peru have shown
that the principal factors associated with the
likelihood of infection in pigs include
increasing age and access to human faeces.
Confined pigs tend to be protected from
infection but only if confinement is habitual
and they are not deliberately fed faeces28,29,47.
Improved understanding of the epidemiology of T. solium transmission
requires a better understanding of the risk
factors for intestinal-stage infection and the
modes of dispersal of infective eggs by
human tapeworm carriers because taeniid
eggs in faeces or contamination of the
hands of infected humans are the direct

source of cysticercosis in both pigs and
humans. Surveys in disease-endemic communities in Mexico, Guatemala, Peru and
Honduras have shown rates of T. solium
taeniasis
varying
from
0.3%
to
6%27,29,30,35,38. Factors associated with taeniasis include age (rates of intestinal taeniid
infections tend to peak in middle adulthood; however, infections occur in all age
groups) and frequency of pork consumption11,29,30,38. In some populations, taeniid
infections are observed significantly more
frequently in women than in men29,30. The
presence of a tapeworm-infected individual
within a household is an important risk factor for exposure to T. solium cysticercosis
and this risk may be increased if the tapeworm carrier is an individual engaged in
food preparation and child care activities.
In Peruvian mountain villages, food handlers engaged in preparing and selling a
traditional pork dish (chicharrones) were
shown to harbour intestinal taeniid infections at a significantly higher rate than
other persons in the community39,40.
Serological screening of humans from these
villages documented levels of apparent
exposure to T. solium cysticercosis varying
from 5% to 24% (Table 7.1). Significantly
higher levels of seropositivity in humans
were associated with low levels of sanitary
infrastructure and personal hygiene, age
more than 20 years and personal histories
of taeniasis. Highest seropositivity rates
were found in persons with multiple factors39, suggesting that these apparent risk
factors and behaviours acted cumulatively.
In some communities, there was evidence
of clustering of seropositive persons in
households of persons with histories of or
current taeniasis28,29,30,37. In Guatemala, for
example, one-third of all seropositive persons were clustered within the same households30. These observations suggest a
focal pattern of transmission associated
with the presence of a tapeworm carrier.
There is a need for further studies in other
areas where T. solium is currently transmitted to be able to provide baseline epidemiological data and suggest strategies for
control.
69
Imported and introduced disease

Imported cases of T. solium taeniasis/cysticercosis are those acquired in a foreign country.
Onset of illness in NC typically occurs a year
or more after initial acquisition of the infection; therefore, among internationally mobile
persons exposed to infection, it is not uncommon that development of the disease occurs in
a country different from that in which the
infection was acquired (imported case).
Returning tourists or immigrants can also
import intestinal-stage T. solium infections into
the country; when the tapeworm carrier travels home or emigrates to a foreign country and
inadvertently transmits the infection to
another person, or to a pig, the infection has
been introduced to the host country. More
rarely, the infection can be introduced by international transport of infected pigs and subsequent consumption of their infected meat.10,12
Imported disease
A unique historical epidemic of imported
NC was that which occurred in British
troops stationed in India. In at least 450 cases
soldiers or their family members developed
symptoms 130 years (average: 5 years) following their deployment in India48.
Approximately a quarter of these patients
reported a history of taeniasis; however, little
other information was reported on their possible sources of infection. More recently,
imported cases of NC are diagnosed every
year in countries throughout the world in
immigrants or tourists returning from countries where T. solium infection is endemic.
This phenomenon is fed by the recent
increase in international movement as a
result of tourist and business travel and emigration (the World Tourist Organization currently estimates that at least 400 million
international border crossings occur each
year). In recent years, imported cases of NC
have been reported from Australia4951,
Norway52, Spain23, Argentina53, Denmark54
and the USA55. By virtue of the number of
immigrants entering the USA every year
from countries where T. solium infection
is endemic, more cases of imported NC
are diagnosed in that country every year
70
P.M. Schantz
than in all other non-endemic countries combined. The recently completed 2000 US
Census recorded 35.3 million persons of
Hispanic origin living in the USA representing an increase of 12.9 million in the past
decade56. Because immigration to the USA
from countries where T. solium infection is
endemic continues to rise, the numbers of
imported cases of NC as well as local transmission from imported tapeworm carriers
are likely to increase. Aspects of the impact
of this continuing wave of immigration into
the USA on the epidemiology of T. solium
infection are discussed in greater detail elsewhere in this volume (see Chapter 14)
Introduced disease
On rare occasions, T. solium has been introduced into a new area and spread epidemically. Such was the case in West Papua (Irian
Jaya) where the infection was introduced
through swine brought from Bali and given
to the local people (Ekari tribals) by the
Indonesian government as part of an effort to
induce them to accept Indonesian control.
Unfortunately, these gift pigs turned out to be
a Trojan horse, because the swine were
infected by cysticerci of T. solium and the
human population also became infected, with
disastrous consequences (see Chapter 12).
Local cultural customs and pig husbandry
practices facilitated the transmission and
rapid spread of the cestode. The first indication of the problem was noted in 1971 when
many of the people suffered seizures and
burns caused by NC12. As a result of extensive migrations of people with their pigs, the
infection has spread throughout the island,
possibly including Papua New Guinea, and
is now considered a serious emerging health
problem10,11. There are no other documented
instances of foreign introduction and continued transmission of T. solium via infected
pigs, however, imported cases of human taeniasis occasionally are linked epidemiologically to clusters of infected pigs in the United
States. Such outbreaks have been identified
by detection of infected swine during routine
inspection at slaughter and limited to the
exposed cohorts of pigs (Peter M. Schantz,
unpublished observations).
Conclusions
The only effective solution to the public
health problem of T. solium cysticercosis is
to prevent transmission of the zoonotic cestode in the thousands of rural communities
in Latin America, Africa and Asia where
conditions exist to permit the life cycle of T.
solium to be completed. Taenia solium infection is widely endemic in rural areas of
developing countries where political, socioeconomic and environmental conditions
permit the tapeworms life cycle in pigs
and humans to be completed. Active intervention for control of T. solium infection is
still at its infancy and there are many economic and social problems existing in most
disease-endemic areas that hinder implementation of these programmes.
Even though special studies reveal that
morbidity caused by NC can be severe in
disease-endemic populations, the nature of
the disease and the lack of locally available
diagnostic facilities often make NC an
essentially silent and unrecognized disease
of humans within many affected communities; these realities complicate attempts to
motivate and empower the community to
initiate measures to control the disease. Pig
owners, however, easily recognize the
infection in their animals and are aware
that cysticercosis reduces the market value
of infected pigs and the infection in this
valuable meat animal suggests a possible
focus for education and prevention measures. In contrast, people rarely understand
the relationship between cysticercosis in
pigs and taeniasis or cysticercosis in
humans and thus lack knowledge and
incentive to change behaviour that fosters
transmission. In many, if not most, communities where T. solium infection is endemic
there is an absence of piped water, sanitary
infrastructure, waste disposal, and other
basic services; consequently, to be effective
in the short-term, intervention measures
must be designed to circumvent these deficiencies to the extent possible (see Chapters
4144). Primary health care facilities are
also often lacking or inadequate. Since the
disease is generally related to poverty and
all its associated manifestations, strategies
to control the disease must consider costs

and locally available resources. Nevertheless, the many recent advances in diagnosis and treatment of the disease, and the
71
new knowledge of the impact of the

zoonotic disease on local health and the
economy, provide incentive and improved
means to undertake these tasks5759.
References
1. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. Progress in Clinical Parasitology 4,
77115.
2. Grove, D.I. (1990) Taenia solium taeniasis and cysticercosis. In: A History of Human Helminthology.
CAB International, Wallingford, UK, pp. 335383.
3. Henneberg, R. (1912) The animal parasites of the central nervous system. Handbook of Neurology
(German) 3, 642683.
4. Anonymous (1997) PAHO/WHO Informal Consultation on the Taeniasis/Cysticercosis Complex. Pan
American Organization Series HCT/AIEPI-5. Washington, DC, pp. 120.
5. Schenone, H.R., Ramirez, A., Rojas, F., et al. (1982) Epidemiology of human cysticercosis in Latin
America. In: Flisser, A., Willms, K., Laclette J.P., et al. (eds) Cysticercosis: Present State of Knowledge and
6. Banerjee, P.S., Bhatia, B.B., Pandit, B.A. (1994) Sarcocystis suihominis infection in human beings in
India. Journal of Veterinary Parasitology 8, 5758.
7. Singh, S., Singh, N.R., Pandav, C.S., et al. (1994) Toxoplasma gondii infection and its association with
iodine deficiency in a residential school in a tribal area of Maharashtra. Indian Journal of Medical
Research 99, 2731.
8. Thakur, L.C., Anand, K.S. (1991) Childhood neurocysticercosis in South India. Indian Journal of
Pediatrics 58, 815819.
9. Wadia, N.H., Desai, S., Bhatt, M.B. (1988) Disseminated cysticercosis. New observations including
CT scan findings and experience with treatment by praziquantel. Brain 11, 597614.
10. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/Cysticercosis in Indonesia as
11. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of epileptic seizures and burns
associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 199195. Transactions
of the Royal Society of Tropical Medicine and Hygiene 94, 4650.
12. Gadjusek, D.C. (1978) Introduction of Taenia solium into West New Guinea with a note on an epidemic of burns from cysticercus epilepsy in the Ekari people of the Wissel Lake area. Papua New
Guinea Medical Journal 21, 329342.
13. Preux, P.M., Avode, G., Bouteille, B.M., et al. (1996) Cysticercosis and neurocysticercosis in Africa:
current status. Neurological Infections and Epidemiology 1, 6368.
14. Graber, M., Chailloux, A. (1970) Existence in Chad of porcine cysticercosis caused by Cysticercus
cellulosae (Rudolphi). Revue d Elevage et de Medecine Veterinaire de Pays Tropicaux (Paris) 23, 4955.
15. Permin, A., Yelifari, L., Bloch, P., et al. (1999) Parasites in cross-bred pigs in the upper east region of
Ghana. Veterinary Parasitology 87, 6371.
16. Gelfand, M., Jeffrey, C. (1973) Cerebral cysticercosis in Rhodesia. Journal of Tropical Medicine and
Hygiene 76, 8789.
17. Mafojane, N.A. (1994) The neurocysticercosis project in Atteridgeville-Mamelodi townships. South
African Medical Journal 84, 208211.
18. Powell, S.J., MacLeod, I.N., Proctor, E.M., et al. (1966) Cysticercosis and epilepsy in Africans: a clinical and serological study. Annals of Tropical Medicine and Parasitology 60, 152158.
19. Sachs, L.V., Berkowitz, I. (1991) Cysticercosis in an urban black South African community: prevalence and risk factors. Tropical Gastroenterology 11, 3033.
20. Michel, P., Callies, P., Genin, C., et al. (1992) Cysticercosis in Madagascar: diagnostic and therapeutic
improvement. Dakar-Mdical (Dakar) 37, 191197.
21. Boa, M.E., Bogh, O.H., Kassuku, A.A., et al. (1995) The prevalence of Taenia solium metacestodes in
pigs in northern Tanzania. Journal of Helminthology 69, 113117.
22. Chinchilla, N., De Andres, D., Gimenez-Roldan, S. (1989) Neurocysticercosis in the urban area of
Madrid. Archivos de Neurobiology 52, 287294.
72
P.M. Schantz
23. Terraza, S., Pujol, T., Gascon, J., et al. (2001) Neurocysticercosis: an imported disease? Medicina
Clinica (Barcelona) 116, 261263.
24. Santos Meneses Monteiro, L.A. (1995) Neurocisticercose no norte de Portugal: Doctoral
Disssertation, Institute Ciencias Biomed A. Salazar (ISBN 972965910-9-DL No. 87526/95), 247 pp.
25. Saporiti, A., Brocchieri, A., Grignani, G. (1994) Neurocysticercosis as a cause of epilepsy. A case
report. Minerva Medica (Torino) 85, 403407.
26. Tsang, V.C.W., Boyer, A.E., Brand, J.A. (1989) An enzyme-linked immunotransfer blot assay and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious Diseases
159, 5059.
27. Sarti, E., Plancarte, A., Schantz, P.M., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society
of Tropical Medicine and Hygiene 88, 4952.
28. Sarti, E., Aguilera, J., Lopez, A., et al. (1992) Epidemiologic observations on porcine cysticercosis in a
rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195201.
29. Sarti, E., Flisser, A., Guiterrez, I.O., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis
and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical
Medicine and Hygiene 46, 677685.
30. Allan, J.C., Soto de Alfaro, H., Torres-Alvarez, R., et al. (1996) Epidemiology of intestinal taeniasis in
four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157165.
31. Garcia-Noval, J., Moreno, E., De Mata, F., et al. (2001) An epidemiological study of epilepsy and
epileptic seizures in two rural Guatemalan communities. Annals of Tropical Medicine and Parasitology
95, 167175.
32. Sanchez, A.L., Medina, M.T., Ljungstrom, I. (1998) Prevalence of taeniasis and cysticercosis in a population of urban residence in Honduras. Acta Tropica 69, 141149.
33. Sanchez, A.L., Gomez, O., Allebeck, P., et al. (1997) Epidemiological study of Taenia solium infections
in a rural village in Honduras. Annals of Tropical Medicine and Parasitology 91, 163171.
34. Sanchez, A.L., Lindback, J., Schantz, P.M., et al. (1999) A population-based case-control study on
Taenia solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247258.
35. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium cysticercosis in pigs in
a rural community of Honduras. Veterinary Parasitology 78, 233238.
36. Tsang, V.C.W., Wilson, M. (1995) Taenia solium: an under recognized but serious public health problem. Parasitology Today 11, 124126.
37. Cruz, M.E., Schantz, P.M., Cruz, I., et al. (1998) Epilepsy and neurocysticercosis in an Andean community. International Journal of Epidemiology 28, 799803.
38. Diaz, J.F., Carcamo, C., Castro, M., et al. (1992) Epidemiology of taeniasis and cysticercosis in a
Peruvian village. American Journal of Epidemiology 185, 875882.
39. Garca, H.H., Gilman, R.H., Gonzales, A.E., et al. (1996) Epidemiologia de la cysticercosis en el Peru.
In: Garca, H.H., Martinez, S.M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA,
Lima, Peru, pp. 313326.
40. Garca, H.H., Araoz, R., Gilman, R.H., et al. (1999) Increased prevalence of cysticercosis and taeniasis
among professional fried pork vendors and the general population of a village in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 59, 902905.
41. Schantz, P.M., Criales, J.L., Flisser, A., et al. (1994) Community-based epidemiological investigations
of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings
in two populations in Mexico. Clinical Infectious Diseases 18, 879885.
42. Bern, C., Garca, H.H., Evans, C., et al. (1999) Magnitude of the disease burden from neurocysticercosis in a developing country. Clinical Infectious Diseases 29, 12031209.
43. Canelas, H.M. (1962) Neurocisticercose: incidencia diagnostico y formas. Arquivos de Neuropsiquiatria
20, 115.
44. Allan, J.C., Fletes, C., Velasquez-Tohom, M., et al. (1997) Mass chemotherapy for intestinal Taenia
solium infection: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical
45. Garcia-Noval, J., Allan, J.C., Craig, P.S., et al. (1996) Epidemiology of Taenia solium taeniasis and cysticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene
55, 282289.
46. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of Peru.
Bulletin of the World Health Organization 71, 223228.
73
47. Diaz, J.F., Gallo, C., Garca, H.H., et al. (1992) Immunodiagnosis of human cysticercosis: a field comparison of an antibody enzyme-linked immunosorbent assay (ELISA), and an enzyme-linked
immunoelectrotransfer blot (EITB) assay in Peru. American Journal of Tropical Medicine and Hygiene
46, 610615.
48. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical
Research Special Report Series. Her Majestys Stationery Office, London, 229, 158.
49. Oman, K.M., Grayson, M.L., Kempster, P. (1994) Neurocysticercosis and new-onset seizures in short
term travelers to Bali. Medical Journal of Australia 161, 399.
50. Yong, J.L.C., Warren, B.A. (1994) Neurocysticercosis: a report of four cases. Pathology 26, 244249.
51. McDowell, D., Harper, C.G. (1990) Neurocysticercosis two Australian cases. Medical Journal of
Australia.152, 217218.
52. Dietrichs, E., Aanonsen, N.O., Bakke, S.J., et al. (1994) Tapeworms in the brain current problem in
Norway. The Journal of the Norwegian Medical Association 114, 30893092.
53. Villa, A.M., Monteverde, D.A., Rodriguez, W. (1993) Neurocisticercosis en un hospital de la ciudad
de Buenos Aires: estudio de once casos. Arquivos de Neuropsiquiatria 51, 333336.
54. Hansen, N.J.D., Christensen, T., Hagelskjaer, L.H. (1992) Neurocysticercosis: a short review and presentation of a Scandinavian case. Scandinavian Journal of Infectious Diseases 24, 255262.
55. Schantz, P.M., Wilkins, P.P., Tsang, V.C. (1998) Immigrants, imaging and immunoblots: the emergence of neurocysticercosis as a significant public health problem. Emerging Infections, Vol. 2. ASM
Press, Washington, DC, pp. 213242.
56. Guzman, B. (2001) The Hispanic population. Census 2000 brief. United States, Department of
Commerce, C2KBR/01-3, 8 pp. (www.census.gov)
57. Centers for Disease Control and Prevention (1993) Recommendations of the International Task Force
for Disease Eradication. Morbidity and Mortality Weekly Report 42 (No. RR-16), 127.
58. Gilman, R.H., Dunleavy, M., Evans, C.A.W., et al. (1996) Methods for the control of taeniasis-cysticercosis. In: Garca, H.H., Martinez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo
SA, Lima, Peru, pp. 327340.
59. Schantz, P.M., Cruz, M., Pawlowski, Z., et al. (1993) Potential eradicability of taeniasis and cysticercosis. Bulletin of Pan American Health Organization 27, 397403.
What Have We Learnt From

Epidemiological Studies of Taenia solium
Cysticercosis in Peru?
Hector H. Garca, Robert H. Gilman, Armando E. Gonzalez,
Manuela Verastegui, Victor C.W. Tsang, and The Cysticercosis
Working Group in Peru
Introduction
Taenia solium taeniasis/cysticercosis has been
known since antiquity (it is probable that suspicion as to its origins led some religions to
expressly forbid the consumption of pork), but
the epidemiology of human and porcine infection and disease has been poorly understood
until recently. The lack of an accurate screening
tool in the community setting was a barrier to
the understanding of the magnitude of infection burden. The design of the enzyme-linked
immunoelectrotransfer blot (EITB), the most
sensitive and specific serological assay so far
available, was a turning point in population
studies of cysticercosis. In Peru, South
America, the Cysticercosis Working Group
(CWG) was formed through the efforts of professionals of different disciplines (biologists,
biochemists, clinicians, epidemiologists and
others), institutions and countries. The group
performed a series of studies oriented to
describe the epidemiological characteristics of
taeniasis/cysticercosis for T. solium. This information is summarized in the present chapter.
Studies in General Population

Overview of seroprevalence studies in Peru
Peru, located in South America has 24 million inhabitants. The population is of mixed
ethnicity; most people are Catholic. The

country is divided into three clearly defined
zones by the Andean mountains: the arid
Coast, the Highlands and the tropical Jungle.
The geographic divisions served well as a
guide to define regional prevalence of T.
solium infection within Peru. Cysticercosis
was believed to be endemic in the
Highlands, and certain zones of the Coast
and Jungle.
The earliest surveys by the CWG were
carried out in communities that were
believed to be highly endemic for T. solium
cysticercosis13. In 1988, two Jungle communities, Maceda (population: 421; altitude: 500
m)1 and Churusapa (population: 275; altitude: 500 m) were sampled. Both were typically representative of the High Jungle
communities: each was located close to a
river, had an agriculture-based economy
and a tropical climate. The survey found
that houses were made of adobe, with dirt
floors. There was no electricity or water supply; water for consumption was obtained
from the river. Further, pigs and other
domestic animals were raised free (rarely
corralled) and had access to human
dwellings. Only a few houses had latrines.
Census, mapping, human stool sampling,
human and porcine blood sampling, and
porcine tongue examination were performed
after obtaining population consent. A total
of 25 soil samples (five in Maceda and 20 in

75
76
H.H. Garca et al.
Churusapa) and five water samples (each

after concentrating 250500 l of river water)
were obtained. The study determined that
the EITB-human seroprevalence was 8%
and porcine seroprevalence, 45% (Table 8.1).
The coproparasitological survey detected
Taenia eggs in about 1% of the human population. Most seropositive individuals were
neurologically asymptomatic. Taenia ova
were not found in any soil or water sample.
Subsequently, the CWG focused upon a
different geographical environment, the
Highlands. A survey was carried out in
Haparquilla (population: 371; altitude: 3400
m), a village in the southern Highlands,
close to Cusco, in 19903. The Highlands are
different from the jungle in that the
weather is much colder. Moreover, the survey found that pigs were mostly corralled
in the backyards. There were virtually no
latrines and villagers defecated in their
backyards. Electricity supply existed, however there was no facility of potable water.
Human seroprevalence in the Highland
community was found to be 13% and was
comparatively higher than in the jungle
communities. Porcine seroprevalence was
similarly high (Table 8.1)2. Two years later,
we performed a survey in Saylla, another
community in the Highlands, with the help
of the Mothers Club of the village, and

obtained similar findings3. In order to
obtain a thorough assessment of the
geographical prevalences within Peru, the
CWG studied an endemic community
(Monteredondo) in the Coastal zone (population: 1200; altitude: 300 m)4. An inspection
of this region noted that pigs were kept tied,
and human faeces were disposed in the
fields, but usually in fixed places. A total of
489 individuals were sampled and human
seroprevalence was estimated at 16%.
However, interestingly, seroprevalence in
pigs (13%) was considerably less than
human seroprevalence as well as prevalence
figures in porcine populations in other geographic locations (Table 8.1)4. The low
prevalence in pigs was somewhat unexpected. When the CWG attempted to
analyse the reasons behind the low rates of
porcine infection in this community, it found
that the Monteredondo community began to
grow rice, 3 years before the survey. This led
the villagers to tether pigs in order to protect
the rice crop. Therefore, at the time of the
survey, all pigs were less than 3 years of age
and were tethered; accordingly seropositvity
rates were low. Serological status in humans
remained high since it represented the
cumulative effects of exposure over a
Table 8.1. Characteristics of human and porcine populations and EITB based seroprevalence of Taenia
solium cysticercosis in Peru.
Jungle villages
Community
Population
sampled
Maceda
Highland villages
Coastal village
Churusapa
Haparquilla
Saylla
Monteredondo
371 (88%)*
134 (48%)*
108 (30%)*
99 (20%)*
489
General
population
General
population
General
population
Mothers Club
and relatives
General
population
Human
seroprevalence
Males
Females
8%
7%
9%
7%
6%
7%
13%
10%
15%
24%
41%
18%
16%
13%
20%
Stool disposal
Open field
Open field
Backyard
Backyard
Defined
Type of sample
Porcine
seroprevalence
43% (57/133)
49% (43/87)
46% (51/110)
36% (19/53)
13%
Pig raising
Free
Free
Free/corralled
Free/corralled
Tied
*Figures in parentheses represent the percentage of the total population of the village that was sampled.
Lessons from Epidemiological Studies in Peru
much longer period of time. Other community surveys have similarly described high
seroprevalence rates in endemic communities within Peru; 15 (13%) out of 112 individuals attending a health centre in
Pomabamba, Ancash, and 72 (21%) out of
334 in Vichaycocha, Central Highlands
were seropositive. Two large-scale surveys
in a population of 3000 in Quilcas
(Huancayo, Central Highlands) and 4500
in Andahuaylas (Apurimac, southern
Highlands) established seroprevalence rates
of 1215%. In addition, a recent survey in
Tumbes in the northern Coast, found 22% of
individuals sampled to be seropositive. The
above findings are representative of the
prevalence in T. solium endemic regions of
Peru. In non-endemic areas, the seroprevalence has been consistently found to be less
than 1% (1% in unselected urban groups in
Lima5 and a specialized sheep-raising cooperative farm in the Highlands6 and no
seropositive cases among the low-Jungle
communities in Iquitos and La Merced).
Longitudinal studies of seroprevalence

The high seroprevalence rates of T. solium
antibodies with EITB in disease-endemic
populations contrasts with the relatively
small number of symptomatic cases of NC
among seropositive individuals as well as a
large number of putatively inactive brain
lesions (mainly calcifications) in seronegative
controls. These findings have been borne out
in epidemiological studies of T. solium cysticercosis in Peru in common with data from
Mexico (see Chapter 9) and Central America
(see Chapter 10). The discrepancies have
often been a source of confusion. When longitudinal serological data from general population serosurveys in disease-endemic areas
were analysed, it was noted that about 40%
of initially seropositive individuals became
seronegative when resampled after one
year7. This phenomenon was first observed
between 1993 and 1994 in Monteredondo4,7.
Between two consecutive serosurveys, 1 year
apart, six (32%, 95%CI: 1152%) out of 19 initially seropositive individuals in the community reverted to seronegative. In a different
77
location (Quilcas, Central Highlands), 398

villagers were sampled in 1996; 140 were
found to seropositive while 258 were
seronegative. Three years later, in 1999, 69
out of the 140 that were initially seropositive
(50%; 95%CI: 4158%) were now seronegative.
These data demonstrated that many newly
infected (or exposed) individuals developed
only transient serologic antibody reactions.
These individuals may have been exposed to
T. solium, but did not eventually develop
viable infection, or they may have had cysticercosis that spontaneously resolved. This
could also explain the discrepant finding of
high background levels of putatively inactive, calcified brain lesions in seronegative
controls810; it may be surmised that these
currently seronegative individuals had transient seropositivity in association with active
or transitional cysticercosis that eventually
resolved with calcification.
From initial evaluation to intervention

The CWG also studied the feasibility of control of T. solium with combined mass human
and porcine chemotherapy in the Central
Highlands. The prevalence of porcine infection did decrease temporarily; however it
soon returned to the pre-intervention levels
(CWG, unpublished data). The reader is
referred to Chapters 41 and 43 for more comprehensive descriptions of these studies.
Geographic position system analysis demonstrated clustering of new infections in pigs
around the houses with Taenia carriers (see
Chapter 15). Moreover, the pattern of
appearance of new cases suggested that
immigration from other endemic areas was
the major contributor to control failure
(CWG, unpublished data).
Studies in Hospital-based Population

In order to determine the relationship
between EITB-based T. solium seropositive
status and neurological disease, 204 of 231
patients consecutively admitted to a neurology ward in Lima were studied5. Twentyone (12%) of 173 patients, who agreed to
78
H.H. Garca et al.
give blood samples were seropositive.

There was however, discordance between
clinical and serological diagnoses: over half
of the patients clinically diagnosed as having cysticercosis were seronegative. On the
other hand, ten seropositive patients had
diagnoses other than cysticercosis. One of
them had intestinal Taenia infection and
another previously had surgery for cerebral
cysticercosis (antecedent was not recorded
in the current clinical chart). Three seropositive subjects were diagnosed to have NC by
computed tomography (CT) scan (showing
multiple cysts) upon follow-up, one had a
lesion diagnosed on CT as expansive temporal lesion, and another patient had
hydrocephalus5.
Another serological survey was performed upon patients visiting a private
radiology centre for brain CT scan10.
Seroprevalence was 8% in this population.
Again, there were discrepancies between
radiological diagnoses and seropositive status. Moreover, when the scans were interpreted by a second neuroradiologist
(masked to the original interpretation), only
one of ten scans was confirmed as having
active NC, and five of 14 were not recognized as having NC. At the Instituto de
Ciencias Neurolgicas, Lima, 498 neurological outpatients were examined by EITB11.
Of patients with seizures, 12% were
seropositive, compared with 3% of those
with
other
neurological
symptoms.
Seroprevalence increased to 20% if patients
had late-onset epilepsy or were born outside Lima, and to 29% if they had both risk
factors.
The relationship between serological status and seizures was also evaluated in the
community setting during a survey in
Monteredondo12. Of 52 individuals who were
evaluated, 49 had neurological symptoms.
Fourteen (34%) of 41 epileptic individuals
were found to be seropositive, in comparison
to one (12.5%) of eight with headache and/or
dizziness. Of the 14 seropositive epileptic
individuals, 13 agreed to undergo CT. Seven
of these 13 scans revealed evidence of NC:
single cyst (2), multiple cysts (1), two calcifications (2), and multiple calcifications (2). In
a different community in Huaraz, five (35%)
seropositive cases were found among 16 individuals with history of seizures13. Eight of
them (four seropositive and four seronegative) agreed to undergo complete neurological and CT examination at a reference centre.
All four seropositive individuals had evidence of NC upon CT: single enhancing
lesion (1), multiple live cysts and calcifications (1) and multiple calcifications (2). The
four seronegative individuals had normal
cerebral CT scans. Age of onset of seizures
was 17 or older in seven of the eight patients
(excepting one seropositive case).
When results of consecutive EITB-based
serological studies at a serological laboratory of a large hospital were evaluated, the
overall proportion of positive cases was 18%
in serum samples and 28% in CSF samples14.
Factors potentially associated with seropositivity were analysed using logistic regression techniques. Four factors were
significantly associated with a positive test:
to be born outside Lima, to have raised
pigs, age older than 20, and a history of taeniasis. We have also studied the time to disappearance of antibodies in a series of 50
patients with NC treated with albendazole15,16. Only three of the 14 cured patients
became seronegative at one year after successful treatment. In most patients, who had
strong baseline serology (displaying all
seven reactive bands on EITB), the reactive
bands persisted at the end of 1 year of follow-up. Interestingly, an increase in the
number of bands was observed around the
second week of therapy in patients with
viable cysts.
A careful coproparasitological evaluation
of a prospective series of patients with NC
identified intestinal taeniasis in 15%. This
prevalence was higher than expected. A
direct correlation between the number of
cysticerci and the presence of intestinal T.
solium was noted, suggesting that heavy
infections were commonly the result of
autoinfection17. Furthermore, we have confirmed elsewhere that the frequency of adult
T. solium infection is high among patients
with massive cysticercus infection18.
When imaging features in seropositive
individuals were analysed it was found that
individuals with transitional (enhancing)
lesions were younger in comparison to those

with active (viable) cysts; at older ages both
active (viable) cysts and calcified lesions
were frequent. This suggested that some
infections (probably those with lesser numbers of parasites) were controlled by the host
immune response resulting in early death of
parasites, whereas others persisted for long
periods. Patients with hydrocephalus were
older than those with viable cysts, enhancing
lesions, or calcifications alone (CWG, unpublished data).
Porcine Cysticercosis
Porcine cysticercosis has been reviewed by
Gonzalez et al. (Chapter 15). Certain features
that are specifically relevant to the understanding of the epidemiology of T. solium cysticercosis in Peru are discussed here. Before
1990, the veterinary team of the CWG evaluated the sensitivity and specificity of tongue
palpation vis--vis EITB serology, in a controlled design. When evaluated against
necropsy, tongue palpation was over 70%
sensitive and highly specific, whereas EITB
detected all necropsy-positive pigs19. The veterinary team also studied and identified the
pig marketing circuits in Peru. They noted
that official marketing and slaughtering facilities were completely circumvented by peasants particularly in the Central Highlands.
Slaughtering was performed under clandestine conditions; infested carcasses thus
obtained were later introduced into the formal market. A significant proportion of commercialized pork was infected in the
Highlands. Infected pork was sold at cheaper
prices and often mixed and disguised with
clean meat in order to facilitate its sale to
public eating facilities20. Other major accomplishments of the veterinary team of the
CWG include the establishment of the feasibility of using sentinel pigs as an indicator of
the burden of infection in a given area21,
demonstration of the passive transplacental
transfer of immunity and seropositivity22, the
use of drugs such as albendazole and
oxfendazole for treatment in control measures2327 and of intramuscular inoculation in
an experimental model of porcine cysticerco-
79
sis28. The reader is referred to Chapter 15 for

a comprehensive review of these studies.
Conclusions
After more than a decade of studies by the
CWG, several concepts have emerged while
others have been clarified. The most significant of these is that taeniasis/cysticercosis is
extremely common in Peru. The magnitude
of transmission may be as high as 25% of
humans infected at a given time in hyperendemic villages, and may easily be over 10%
in many endemic zones. While seroprevalence rates are high, neurologically symptomatic individuals constitute the tip of the
iceberg. Also, a proportion of asymptomatic
individuals has imaging abnormalities suggestive of NC79; these are mainly seronegative individuals with residual, inactive
calcified brain lesions. On a converse note, it
is also common to encounter asymptomatic
seropositive individuals in community studies. As for many other infectious diseases,
seropositivity in asymptomatic individuals is
generally interpreted as a marker of current
subclinical or past infection.
A common pitfall in the interpretation of
serological data is to compare different kinds
of populations. A 10% prevalence in neurological patients at a large urban medical facility (where the overall seroprevalence is likely
to be below 10%) cannot be equated to a 10%
prevalence in the general population of an
endemic community (where surveying
epileptic patients may reveal seroprevalence
rates of 3035%). Another pitfall is to assume
that, since the majority of seropositive individuals in endemic communities are asymptomatic, seropositivity has no relationship
with neurological symptoms. Some authors
have questioned the role of NC in the aetiology of seizure disorders. However, studies by
the CWG in Peru have demonstrated that
seroprevalence rates in neurological patients
are consistently much higher than in comparable general populations. This increases further when specific subgroups, for instance,
those with late onset seizures are examined.
Another important outcome of the work done
by the CWG is the realization of the intimate
80
H.H. Garca et al.
relationship between domestic pig raising,

taeniasis and human cysticercosis. Porcine
seroprevalence reflects recent infection and
porcine serosurveys are the fastest and least
expensive method to document levels of
ongoing transmission. Pigs are infected early
in life29 and are usually slaughtered by the
age of 1 year. In a survey in an urban commercial pig slaughterhouse, no animals had
cysticercosis. Usually porcine seroprevalence
is twice that of human seroprevalence.
However, Monterendondo was an exception.
Thus human seroprevalence reflects cumulative effect of past exposure, while porcine
seroprevalence is an indicator of recent trends
in infection burden in a given community.
The CWG is now in the concluding phase

of a randomized study designed to evaluate
the clinical benefits of anticysticercal therapy
for NC, along with radiological (CT/MRI)
and immunological (clinical significance of
individual antibodies, antigen detection30,31,
cytokine pathways32) studies in the natural
and post-treatment evolution of human NC.
Acknowledgements
Support from grants FD-R-001107 from the
Food and Drug Administration, and U19A145431 from NIAID/NIH (USA) is
acknowledged.
References
1. Diaz, F., Garca, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in a
2. Garca, H.H., Araoz, R., Gilman, R.H., et al. (1998) Increased risk for cysticercosis and taeniasis
3. Garca, H.H., Gilman, R.H., Gonzalez, A.E., et al. (1999) Human and porcine T. solium infection in a
village in the Highlands of Cusco, Peru. Acta Tropica 73, 3136.
4. Gilman, R.H., Garca, H.H., Gonzalez, A.E., et al. (1999) Shortcuts to development: methods to control the transmission of cysticercosis in developing countries. In: Garca, H.H., Martnez, S.M. (eds)
Taenia solium Taeniasis/Cysticercosis, 2nd edn. Editorial Universo SA, Lima, Peru, pp. 313326.
5. Garca, H.H., Martinez, M., Gilman, R.H., et al. (1991) Diagnosis of cysticercosis in endemic regions.
Lancet 338, 549551.
6. Moro, P.L., Guevara, A., Verastegui, M., et al. (1994) Distribution of hydatidosis and cysticercosis in
different Peruvian populations as demonstrated by an enzyme-linked immunoelectrotransfer blot
(EITB) assay. American Journal of Tropical Medicine and Hygiene 51, 851855.
7. Garca, H.H., Gonzalez, A.E., Gilman, R.H., et al. (2001) Transient antibody response in Taenia solium
infection in field conditions: a major contributor to high seroprevalence. American Journal of Tropical
Medicine and Hygiene (in press).
8. Cruz, M.E., Schantz, P.M., Cruz, I., et al. (1999) Epilepsy and neurocysticercosis in an Andean community. International Journal of Epidemiology 28, 799803.
9. Sanchez, A.L., Lindback, J., Schantz, P.M., et al. (1999) A population-based, case-control study of
Taenia solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247258.
10. Garca, H.H., Herrera, G., Gilman, R.H., et al. (1994) Discrepancies between cerebral computed
tomography and western blot in the diagnosis of neurocysticercosis. American Journal of Tropical
11. Garca, H.H., Gilman, R., Martinez, M., et al. (1993) Cysticercosis as a major cause of epilepsy in
Peru. Lancet 341, 197200.
12. Garca, H.H., Gilman, R.H., Tsang, V.C.W., et al. (1997) Clinical significance of neurocysticercosis in
endemic villages. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 176178.
13. Garca, H.H., Talley, A., Gilman, R.H., et al. (1999) Epilepsy and neurocysticercosis in a village in
Huaraz, Per. Clinical Neurology and Neurosurgery 101, 225228.
14. Garca, H.H., Gilman, R.H., Tovar, M., et al. (1995) Factors associated with T. solium cysticercosis.
Analysis on 946 Peruvian neurologic patients. American Journal of Tropical Medicine and Hygiene 52,
147150.
81
15. Garca, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a
prospective double blind trial comparing 7 vs. 14 days of treatment. Neurology 48, 14211427.
16. Garca, H.H., Gilman, R.H., Catacora, M., et al. (1997) Serological evolution of neurocysticercosis
patients after antiparasitic therapy. Journal of Infectious Diseases 175, 486489.
17. Gilman, R.H., Del Brutto, O.H., Garca, H.H., et al. (2000) Prevalence of taeniasis among neurocysticercosis patients is related to the severity of cerebral infection. Neurology 55, 1062.
18. Garca, H.H., Del Brutto, O.H. and The Cysticercosis Working Group in Per (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 15821584.
19. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays,
necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American
Journal of Tropical Medicine and Hygiene 43, 194199.
20. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the sierra of Peru.
21. Gonzalez, A.E., Gilman, R.H., Garca, H.H., et al. (1994) Use of sentinel pigs to monitor environmental Taenia solium contamination. American Journal of Tropical Medicine and Hygiene 51, 847850.
22. Gonzalez, A.E., Verastegui, M., Noh, J.C., et al. (1999) Persistence of passively transferred antibodies
in porcine Taenia solium cysticercosis. Veterinary Parasitology 86, 113118.
23. Gonzalez, A.E., Garca, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with
albendazole. American Journal of Tropical Medicine and Hygiene 53, 571574.
24. Gonzalez, A.E., Garca, H.H., Gilman, R.H., et al. (1996) Effective, single dose treatment of porcine
cysticercosis with oxfendazole. American Journal of Tropical Medicine and Hygiene 54, 391394.
25. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1997) Treatment of swine cysticercosis with oxfendazole: a dose-response trial. Veterinary Record 141, 420422.
27. Verastegui, M., Gonzalez, A.E., Gilman, R.H., et al. (2000) Experimental infection model for Taenia
solium cysticercosis in swine. Veterinary Parasitology 94, 3344.
28. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Cysticercotic pigs treated with oxfendazole are
protected from further infection. American Journal of Tropical Medicine and Hygiene 65, 1518.
29. Diaz, F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia
solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA) an antigen-ELISA and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American Journal
30. Garca, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1998) Application of a specific antigen detection ELISA to the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical
31. Garca, H.H., Parkhouse, R.M.E., Gilman, R.H., et al. (2000) Serum antigen detection in the diagnosis, treatment, and follow-up of neurocysticercotic patients. Transactions of the Royal Society of Tropical
32. Evans, C.A.W., Garca, H.H., Hartnell, A., et al. (1998) Elevated concentrations of eotaxin and interleukin-5 in human neurocysticercosis. Infection and Immunity 66, 45224525.
Epidemiology of Taenia solium

Taeniasis and Cysticercosis in Mexico
Elsa Sarti
Introduction
Taenia solium taeniasis and cysticercosis are
important public health problems in several
developing countries of Latin America,
Africa and Asia. Mexico has one of the highest frequencies of disease in the Americas14.
It also has a long history, spanning over
three decades, of the development of surveillance, preventive and control strategies
with specific reference to T. solium cysticercosis. These and several other aspects of epidemiology
of
human
and
porcine
cysticercosis and human taeniasis in Mexico
are reviewed in this chapter.
Mexico is the third largest country in
Latin America (after Brazil and Argentina),
with an area of 1,972,550 square kilometres.
It has a population of almost 100 million,
35% of which live under marginal conditions. Ethnically, most (60%) Mexicans are of
Mestizo origin. The official literacy rate was
88% in 1990. Health care personnel and facilities are generally concentrated in urban
areas; care in rural areas consists of understaffed clinics operated mostly by medical
graduates. Leading causes of death are infections, including parasitic diseases, and respiratory and circulatory failure. Spanish is the
official language, spoken by nearly all.
However, knowledge of English is increasing
rapidly, especially among business people,
the middle class, returned emigrants and the

young. The annual population growth rate is
1.96%. The nation underwent a rapid change
in the last few decades of the 20th century
and Mexicans are viewed as urban, opening
to democracy and market-oriented.
Human Intestinal Taeniasis

The reported prevalence of intestinal T.
solium infection in Mexico is between 0.2%
and 3.4%2,3,59. This amounts to nearly 1.5
million potential transmitters of Taenia eggs,
capable of producing new cases of neurocysticercosis (NC). An average of 13,000
cases of Taenia sp. infection were reported
every year during the last 5 years by the
National
Epidemiological
Surveillance
System, giving an incidence of 3.8 per
100,000 inhabitants (Fig. 9.1)7,10. Official statistics reveal highest frequency in individuals under 14 years of age with no statistical
difference by gender7,10. In comparison, several epidemiological surveys have established peak levels between 16 and 45 years
of age (economically productive life) with
predominance in women2,59,11. These discrepancies reflect differences in taeniasis
case definitions and methodologies adopted
by the two sources of data. While surveillance systems consider only patients

83
11.49 13.1 (1 state)
5.75 11.48 (3 states)
2.88 5.74 (13 states)
0.19 2.87 (15 states)
*Incidence rate by 100,000 inhabitants

in Mexico (average 3.0)
Fig. 9.1. State-wise and age-wise incidence of Taenia sp. infection in Mxico, 19942000 (Source: National epidemiological surveillance system)10.
Older than 65 years
4564
Less than 1 year old

1 4
5 14
1524
2544
25
43
*Incidence rates by group of age

(100,000 inhabitants)
84
E. Sarti
Epidemiology of Taeniasis and Cysticercosis in Mexico
requesting assistance in local health units,

planned epidemiological studies obtain
data from house-to-house surveys. The latter, apparently, are more representative of
the community burden.
Human Cysticercosis
Initially, considerable information on human
cysticercosis was derived from cases seen in
neurological services of hospitals and
necropsy series of general hospitals in
Mexico. The frequency of NC from hospital
facilities in Mexico appeared to be as high as
8.6 per 100 patients1,3,12. Cysticercosis was
detected in 413% of large hospital-based
autopsy series1,2,13. Neurocysticercosis was
listed as the cause of death in 4080% of
autopsy protocols that reported cysticercal
infestation. Official sources from Mexican
surveillance currently estimate an average
of 500 new cases every year, giving a nationwide incidence of 0.6 per 100,000. These projections underestimate the incidence and
prevalence of human cysticercosis in
Mexico, since a number of cases in rural
areas, where facilities for contemporary
diagnosis (like computed tomography, magnetic resonance imaging and serology) do
not exist, are not registered. Nevertheless,
official registers do give us a general idea
about the geographical and demographic
predilections of human cysticercosis in
Mexico (Fig. 9.2).
The seroprevalence of cysticercosis using
immunoelectrophoresis (IEF) and indirect
haemagglutination (IHA) was 13% of the
population studied. With newer techniques
such as the ELISA and EITB (enzyme-linked
immunoelectrotransfer blot, better known as
blot), the prevalence has been estimated at
around 10%59,14,15. Seroprevalence rates are
highest between 15 and 45 years of age and
in women.
Swine Cysticercosis
The reported average prevalence of cysticercosis in swine, from official registered
slaughterhouses in Mexico is 0.2%3,16. This
85
figure is at best, an underestimate. It is common to find a large number of informal

slaughterhouses without veterinary inspection, in addition to the registered ones in
the country. No information on the status of
porcine infection in these unauthorized
facilities is available. Swine in registered
slaughterhouses represent only 40% of the
total swine slaughtered3,16. Besides, infected
pigs are unlikely to be brought to abattoirs
for slaughter. Undernotification may also
occur on account of lack of trained personnel in slaughter facilities and of standardized screening practices among meat
vendors. In addition to slaughterhousebased data, information has been collected
from sampling domestic and free-ranging
pigs in Mexico. Tongue inspection and palpation and EITB have been used as methods
of evaluation in such studies. The prevalence of porcine cysticercosis was found to
vary between 1.4 and 4.0% using tongue
inspection or palpation and from 4.1% to
7.0% with EITB6,9,1617,18. Seroprevalence
rates increased with age and peaked at 11
months.
An Overview of Epidemiological
Studies from Mexico
The study of the taeniasiscysticercosis
complex in Mexico has progressed through
logical and sequential steps. It began with
investigations into disease frequency at
necropsy and later, in clinical series at neurological and neurosurgical services.
Studies then progressed towards the search
of an adequate, reliable, and convenient
diagnostic and screening test, available for
use, both in hospital facilities and the community. In the 1970s, epidemiological studies were directed towards the study of
prevalence of T. solium. In the 1980s,
research looked into risk factors for transmission. Simultaneously, standardization of
methods for the diagnosis of taeniasis and
cysticercosis, for instance the use of EITB
and sound statistical techniques, was
undertaken. Finally in the 1990s, intervention studies began examining strategies for
control of taeniasiscysticercosis.
0 0.19 (4 states)
0.20 0.63 (14 states)
0.64 2.52 (9 states)
2.53 3.94 (5 states)
*Incidence rate by 100,000 inhabitants

in Mexico (average 0.5)
Fig. 9.2. State-wise and age-wise incidence of neurocysticercosis in Mxico, 19942000 (Source: National epidemiological surveillance system)10.
0
Less than 1 year old
1 4
5 14
15 24
25 44
45 64
Older than 65 years
12
*Incidence rates by group of age

(100,000 inhabitants)
86
E. Sarti
Step 1 (Estimation of disease prevalence)

A national survey with urban representation was carried out in 197419. Blood samples of 18,417 individuals were examined
for anticysticercus antibodies by IEF; 1% of
the population was found to be positive.
Earlier, a survey in Oaxaca in 1971 revealed
a seropositivity of 3.3% by IHA20. In several
communities of Chiapas, seroprevalence by
IEF ranged between 0.4% and 7.6%21. Some
of the early epidemiological investigations
were criticized for not having used rigorous
epidemiological methods. Nevertheless, a
general idea of disease frequency could be
drawn. In 1992, a second nationwide seroepidemiological survey was conducted
using a systematic approach. From 66,754
blood samples analysed by IHA, anticysticercus antibodies were detected in 1.2%22.
The highest prevalences were noted in West
and Southeast Mexico.
Our studies using EITB vis--vis ELISA
for screening established an association of
EITB positivity (but not ELISA positivity)
with late-onset convulsions6,14,23. Neuroimaging abnormalities compatible with NC
were significantly more common in individuals with late-onset convulsions. This led us
to infer a risk factor association between cysticercosis and late-onset convulsions and
established the superiority of EITB over
ELISA as a tool for community screening. It
was also found that immunological tests
detect exposure to the parasite besides the
infection and active disease. Therefore, in the
1990s, EITB was employed for further
human sero-surveys.
Coproparasitological examinations of faeces with Ritchie, Katz and Faust techniques
and faecal antigen assays have been used for
screening
of
intestinal
taeniasis24,25.
However, both techniques yielded poor
results. Incidentally, a simple inquiry about
having passed proglottides was found to be
a fairly reliable indicator of intestinal taeniasis. This inquiry is simpler and more effective than sophisticated, expensive and timeconsuming faecal tests. Therefore, therapeutic taeniacidal intervention on the basis of
this inquiry alone is recommended.
87
The prevalence of intestinal taeniasis

using standard coproparasitological evaluations was 0.20.4%5,6,8,9,14,17,23,2629. EITB
based seroprevalence of human cysticercosis
varied between 4.9% and 10.9%5,6,8,9,14,17,23,26
29. The prevalence of porcine cysticercosis
based on tongue inspection and palpation
was 1.4% to 23.8% and using EITB was
around 4%6,9,16,18.
Step 2 (Determination of risk factors)

In the 1980s, a number of epidemiological
and statistical investigations focused on
determination of magnitude of disease and
risk factors. The first such study was undertaken in El Stano, a small community of
150 inhabitants in 19845. An association
between ELISA seropositivity and tapeworm
carriage, symptoms compatible with cysticercosis (generalized convulsions), swine
cysticercosis, and presence of latrines in
homes was observed in this study5. Clusters
of infection in the El Stano study, suggested that the source of transmission of
infection lay within the household (living
closely with the tapeworm carrier) rather
than the environment. Subsequent studies
from Mexico and Central America using
EITB and structured questionnaires have
confirmed the observations6,9,26,27,30,31. In
these studies, cardinal risk factors for human
taeniasis included: (i) history of having
passed proglottides in stools; and (ii) consumption of uncooked or infected pork. Risk
practices that were associated with human
cysticercosis included: (i) drinking unboiled
water; and (ii) not washing hands before eating food and after defecation. On the other
hand, rates of swine cysticercosis were determined by numbers of free-ranging pigs with
access to human faeces. The above mentioned human and porcine behaviours facilitate the humanenvironmentpighuman
cycle. Modifications of these behaviours were
considered as potential strategies for control
of the taeniasiscysticercosis complex.
Transmission, other than the human
environmentpighuman cycle has been
suggested, for instance, through flies and by
ingestion of fruits and vegetables contami-
88
E. Sarti
nated by Taenia eggs32. These modalities of

transmission have not been confirmed by
studies in Mexico6,17,33.
Step 3 (Developing interventions for

control)
An evaluation of the efficacy of mass taeniacidal treatment was carried out during
1990, in a community in Sinaloa26.
Praziquantel treatment was administered to
the population of approximately 2000 inhabitants. Before treatment, 1.3% of the individuals had taeniasis and only one out of the 72
pigs examined had cysticercosis. Treatment
lead to complete eradication of intestinal taeniasis but data on porcine cysticercosis was
inadequate. By comparison, another study in
1987 provided insights into the role of health
education, and demonstrated that health
promotion could be a short-term alternative26,27. A promotional campaign emphasizing upon the need to construct latrines in
every home and the hazards of open-air
defecation was conducted in schools. The
study demonstrated that the campaign created awareness about the parasite; unfortunately, mass taeniacidal treatment of
members of this community was not successful as the prevalence of porcine cysticercosis
had doubled 1 year after intervention. It
must be mentioned that this study was not
oriented to community intervention, but to
the identification of the risk factors.
We have evaluated two alternative strategies for control of T. solium in the last decade:
(i) mass taeniacidal drug administration; and
(ii) health education28,29,34. Both measures
were applied to three rural communities of
Mexico with similar social, economical and
cultural characteristics. Community A
received mass praziquantel treatment (5 mg
kg1), community B received health education and community C received both mass
praziquantel treatment and health education.
Demographic, epidemiological, clinical, sanitary and sociological data from 98% of the
inhabitants were obtained. Evaluations were
performed 6 and 42 months after intervention. Prevalence and incidence rates of taeni-
asis were measured by the frequency of

Taenia coproantigens and Taenia eggs in faeces. Swine cysticercosis was measured by
palpating tongue and the presence of serum
antibodies. Changes in knowledge, attitudes
and practices in the communities were evaluated by questionnaires prepared ex professo
as well as by direct observation by interviewers. Praziquantel treatment reduced
rates of taeniasis by 66%. However, treatment alone, had no impact on swine cysticercosis. A 6677% decrease in swine
cysticercosis was observed in communities
where health education was provided (B
and C). Evaluation of long-term outcome
(42 months after the intervention) revealed a
reduction of 48% of taeniasis in community
B. This underscored the importance of
health education in the effective control of
taeniasiscysticercosis. Health education
had a twofold effect. Improved sanitary
practices and curtailing free-ranging pigs
led to a decrease in the frequency of
porcine cysticercosis and ultimately human
taeniasis. Secondly, awareness of the utility
of taeniacidal treatment and its use prevented human and porcine cysticercosis.
Results of our studies suggested that health
educational programmes are effective for T.
solium control.
Mexican Surveillance to Monitor and

Control TaeniasisCysticercosis
Mexico has a Unique Information System for
Epidemiological Surveillance (SUIVE) generating information on community healthrelated risk factors, treatment and control at
all operative levels. Information on several
diseases subject to epidemiological surveillance, including taeniasis and cysticercosis is
collected in a specifically prepared format by
some 17,000 primary health care units and is
transmitted to State and Federal health
authorities for analysis at a national level.
Health care personnel manning the primary
health care units are imparted continuing
education regarding simple and effective
screening and treatment of taeniasis and cysticercosis. It is recommended that all individuals presenting to these centres for health
check-ups and treatment for any ailment

should be screened for taeniasiscysticercosis. As mentioned earlier, a simple inquiry
about the passage of proglottides suffices as
a screening tool. Both cases that are identified as positive by screening and their families should be offered taeniacidal treatment.
Conclusions
The prevalence of human taeniasis in Mexico
varies between 0.2% and 0.4%, while that of
human cysticercosis is 4.910.9% and that of
89
swine cysticercosis may be as high as 23.8%.

Risk behaviours for taeniasis include freeranging pigs with access to human faeces
and poor personal hygiene. Human cysticercosis, on the other hand, is clustered around
intestinal adult T. solium carriers. Currently
intervention trials focusing on the modification of these risks are underway. The impact
of health education and improving sanitary
infrastructure is considered important.
Finally strategies employing the above interventions both individually as well as in combination, must be evaluated in order to
develop a unified national control policy.
REFERENCES
1. Sarti, E., Gutirrez, I. (1986) La teniasis y cisticercosis en Mxico (Revisin Bibliogrfica). Salud
Pbica de Mxico 28, 556563.
2. Sarti, E. (1997) La teniosis y cisticercosis en Mxico. Salud Pblica de Mxico 39, 225231.
3. Organizacin Panamericana de la Salud (1994) Epidemiologa y control de la teniosis y cisticercosis en
Amrica Latina. OPS/OMS, Washington, DC.
4. Schantz, P., Cruz, M., Sarti, E., et al. (1993) Potential erradicability of taeniasis and cysticercosis.
5. Sarti, E., Schantz, P., Lara, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. American Journal of Tropical Medicine and Hygiene 39, 194198.
6. Sarti, E., Schantz, P., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniosis
7. Correa, M.D., Flisser, A., Sarti, E. (1994) Teniasis y cisticercosis. In: Valdespino-Gomez, J.L. (ed.)
Enfermedades Tropicales. Secretara de Salud, Mxico, DF, Mexico, pp. 335345.
8. Daz, S., Candil, R., Uribe, M., et al. (1990) Serology as an indicator of Taenia solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene
84, 563566.
9. Sarti, E., Schantz, P., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniosis and cysticercosis in a rural village of Michoacan State, Mexico. Transactions of the Royal Society of
Tropical Medicine and Hygiene 68, 4952.
10. Secretara de Salud (2000) Boletn Semanal de Epidemiologa, 19942000. Direccin General de
Epidemiologa, Mxico DF, Mexico.
11. Schantz, P., Sarti, E. (1989) Diagnostic methods and epidemiologic surveillance of Taenia solium
infection. Acta Leidensia 57, 153163.
12. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticercosis as the main cause of
late onset epilepsy in Mexico. Archives of Internal Medicine 150, 325327.
13. Rabiela, M.T., Rivas, A., Rodriguez, I.J. (1979) Consideraciones anatomopatolgicas de la cisticercosis cerebral como causa de muerte. Patologa (Mxico) 17, 119124.
14. Schantz, P., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations of
cysticercosis due to Taenia solium. Comparison of serological screening tests and clinical findings in
two populations in Mexico. Clinical Infectious Diseases 18, 879885.
15. Flisser, A., Correa, D., Plancarte, A., et al. (1990) New approaches for the diagnosis of Taenia solium
taeniasis/cysticercosis. Annals of Human and Comparative Parasitology 65, 9598.
16. Aluja, A.S. (1982) Frequency of porcine cysticercosis in Mexico. In: Flisser, A., Willms, K., Laclette, J.,
et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York,
pp. 4750.
90
E. Sarti
17. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations in a rural community of
Michoacan State, Mexico. Veterinary Parasitology 41, 195201.
18. Aluja, A., Villalobos, N., Plancarte, A., et al. (1996) Experimental Taenia solium cysticercosis in pigs.
Characteristics of the infection and antibody response. Veterinary Parasitology 61, 4958.
19. Woodhouse, E., Flisser, A., Larralde, C. (1982) Seroepidemiology of human cysticercosis in Mexico.
In: Flisser, A., Willms, K., Laclette, J., et al. (eds) Cysticercosis: Present State of Knowledge and
20. Goldsmith, R.S., Kagan, I.G., Reyes-Gonzlez, M.A., et al. (1971) Estudios serepidemiolgicos realizados en Oaxaca, Mexico. I. Encuesta de anticuerpos parasitarios mediante la prueba de
hemaglutinacin indirecta. Boletin de la Oficina Sanitaria Panamericana (Washington DC) 71, 500.
21. Flisser, A., Bulnes, I., Daz, M.L., et al. (1976) Estudio seroepidemiolgico de la cisticercosis humana
en poblaciones predominantemente indgenas y rurales del estado de Chiapas. Archives of Internal
Medicine (Mxico) 7, 107113.
22. Larralde, C., Padilla, A., Hernndez, M., et al. (1992) Seroepidemiology of cysticercosis in Mexico.
Salud Pblica de Mxico 34, 197210.
23. Schantz, P., Sarti, E., Plancarte, A., et al. (1991) Clinical, radiological and epidemiological correlation
of ELISA and immunoblot assays for Taenia solium cysticercosis in 2 populations. Mexico. American
24. Alan, J.C., Avila, G., Garcia-Noval, J., et al. (1990) Immunodiagnosis of taeniasis by coproantigen
detection. Parasitology 101, 473477.
25. Daz, S., Candil, R., Suate, P., et al. (1991) Epidemiologic study and control of Taenia solium infections
with praziquantel in a rural village of Mexico. American Journal of Tropical Medicine and Hygiene 45,
522531.
26. Keilbach, N., Aluja, S., Sarti, E. (1989) A program to control taeniosis and cysticercosis (Taenia
solium). Experiences in a Mexican village. Acta Leidensia 57, 181189.
27. Rodriguez Canul, R., Fraser, A., Allan, J.C., et al. (2000) Epidemiological study of Taenia solium taeniasis/cysticercosis in a rural village in Yucatan state, Mexico. Annals of Tropical Medicine and
28. Sarti, E., Flisser, A., Schantz, P.M., et al. (1997) Development and evaluation of health education
intervention against Taenia solium in a rural community in Mexico. American Journal of Tropical
29. Sarti, E., Schantz, P., Avila, G., et al. (2000) Mass treatment against human taeniosis for the control of
cysticercosis. A population based intervention study. Transactions of the Royal Society of Tropical
30. Garca, H.H., Gilman, R., Tovar, M., et al. (1995) Factors associated with Taenia solium cysticercosis:
analysis of nine hundred forty-six Peruvian neurologic patients. American Journal of Tropical Medicine
and Hygiene 52, 145148.
31. Lawson, J.R., Gemmel, M.A. (1983) Hydatidosis and cysticercosis: the dynamics of transmission.
Advances in Parasitology 22, 261308.
32. Spindola Feliz, N., Rojas Wastanino, G., de Haro, Arteaga, L., et al. (1996) Parasite search in strawberries from Irapuato, Guanajuato and Zamora, Michoacn (Mxico). Archives of Medical Research 27,
229231.
33. Sarti, E., Bronfman, M., Schantz, P., et al. (1993) Estructuracin de un proyecto epidemiolgico para el control de la Taenia solium. Comparacin del uso de quimioterapia masiva contra la teniasis y de la imparticin
de educacin para la salud, como mtodo de intervencin de mayor utilidad. Conmemoracin Jubileo.
Instituto de Investigaciones Biomdicas. UNAM. Mxico DF, Mxico 2, pp. 413415.
34. Sarti, E. (1989) Epidemiologa de la teniasis y cisticercosis. In: Flisser, A., Malagn, F. (eds)
Cisticercosis Humana y Porcina, su Conocimiento e Investigacin en Mxico. Limus Noriega, Mxico DF,
Mxico, pp. 233242.
10
Taenia solium Taeniasis and

Cysticercosis in Central America
Jos Garcia-Noval, Ana L. Sanchez and James C. Allan
Introduction
The Central American region, lying between
Mexico and Colombia consists of seven
countries: Belize, Guatemala, Honduras, El
Salvador, Nicaragua, Costa Rica and Panama
(Fig. 10.1). The region occupies approximately 524,000 km2 and had a population of
approximately 36 million in 1999. Slightly
less than one-third of this population lives in
Guatemala. Over half the population is rural
and the United Nations classified 46% as living in extreme poverty in 1994. In 1999, rates
of access to health services varied from 46%
(Honduras) to 96% (Costa Rica)1. The region
is ethnically diverse: two-thirds of the population being of mixed race, 49% of the
Guatemalan population being classified as
indigenous American, up to 9% of the population of Nicaragua being Afro-Caribbean
and 87% of the population of Costa Rica
being of European origin. The region has an
estimated population of 3 million pigs.
Taenia solium has been recognized in
Central America for over a century2.
Neurocysticercosis (NC) was reported in
Guatemala and Honduras in 1940 and 1956,
respectively, and periodically thereafter over
the next quarter-century38. The first
Panamanian report of NC was made in 1984,
though T. solium was known to be endemic
in Panama for decades prior to this912.
The presence of the parasite within the

region also has an impact further afield. Data
from both Guatemala and Honduras indicate
that a significant number of individuals from
rural communities, where T. solium is highly
prevalent, travel either to Guatemala City or
Tegucigalpa for work13,14. Furthermore,
migration also occurs to the United States,
such that in one study, 9.7% of a rural population, 100 km from Guatemala City were
travelling on a regular basis to Guatemala
City or the United States for work13. There
have been numerous reports of cysticercosis
either in Central American immigrants or in
visitors to Central America made in the
United States, Europe and Japan1519.
Recently, the employment of domestic help
from Latin America and in particular Central
America has been implicated in an outbreak
of cysticercosis in the United States20,21.
Taeniasis
From 1951 to 1960, a mean prevalence of
1.13% of T. solium taeniasis was detected in
the 157,085 faecal samples examined in the
Institute of Tropical Diseases Rodolfo
Robles, Guatemala City10. Of these cases,
83% were aged between 18 and 45 years old
and 42% came from rural areas near
Guatemala City. From 1983 to 1989, data

91
92
J. Garcia-Noval et al.
N
Belmopan
Belize
Caribbean Sea
Guatemala
Honduras
Guatemala City
Tegucigalpa
San
Salvador
El Salvador
Nicaragua
Managua
Pacific Ocean
Costa Rica
San
Jose
Panama City
200 km
Panama
Fig. 10.1. Map of Central America showing countries and capital cities.
from health centres in Honduras indicated a

mean prevalence of 0.47% of intestinal taeniasis in 365,400 faecal samples22. The
Honduran data also brought out significant
regional variation in prevalence with rates
between 0.06% and 1%. From 1978 to 1987, a
survey by the Ministry of Health, Costa Rica
recorded a relatively low rate of intestinal
taeniasis, with a mean prevalence of 0.05% in
1,176,332 faecal samples examined23. Recent
data on rates of taeniasis from rural Central
America are available from Honduras and
Guatemala13,22,2426. Rates of up to 6.2%, with
an average prevalence of 2% of intestinal taeniasis have been recorded by microscopy in
Honduran communities22,25,26. Rates of
approximately 1% have been detected by
microscopy in Guatemala13,24,27. These data
appear to indicate that, in comparison to
countries in Latin America, rates in these two
countries are high. For instance, average
prevalence in Mexico is typically below
0.5%2833. Interestingly, a study carried out in
the United States indicated a prevalence of
4.4% of intestinal taeniasis in Central
American migrant workers to North
Carolina but none in migrants from Mexico

or Haiti34. Data from field studies in rural
areas of Honduras and Guatemala have indicated that T. solium is responsible for
75100% of all Taenia species worms identified to the species level22,2426. This contrasts
with hospital data from large urban centres
where typically no diagnosis to the species
level is carried out10,22.
There are clear patterns in the distribution
of cases of taeniasis within the population of
the region. Rates have been demonstrated to
vary considerably between, closely situated,
communities. For instance, in one study of
four similarly sized rural communities, all
within 5 km of each other, prevalence rates
of taeniasis varied between 1% and 5.7%,
with statistically significant differences in
prevalence between the communities13. The
variations may be linked to socio-economic
factors such as sanitation, pig husbandry
techniques and rates of pork consumption.
Furthermore, within individual communities
the inter-household distribution of intestinal
taeniasis has been shown to be clustered13,24,25. In the same Guatemalan study,
Taeniasis and Cysticercosis in Central America
rates of taeniasis in household members of

indicator cases of the taeniasis were shown
to be nearly double that of the general rate of
taeniasis in the population (4.7% vs. 2.7%)13.
This is consistent with the clustered pattern
of intestinal taeniasis reported elsewhere in
Latin America28,30,31. Data from both hospitals and rural communities within the region
suggest that the highest rates of intestinal
taeniasis are in individuals in their late teens
to early forties (Fig. 10.2)10,13. Some data suggest that females may be at higher risk than
males13,22. Similar sex-biased distributions of
intestinal taeniasis have been reported in
Ecuador and in Latin American immigrants
to the United States35,36. Once again the reasons for this are unknown.
Human Cysticercosis,
Neurocysticercosis and Seizures
From 1952 to 1961, in a study of hospital
records from El Salvador and Guatemala, 118
cases of cysticercosis were detected by
autopsy, of which 71 were shown to involve
cysts in the brain10. In 1967, a retrospective
93
study of 10,600 Costa Rican autopsy reports

showed 24 cases of NC (0.23%)37. All the cases
were aged above 7 years and the number of
the cysts was overdispersed, with 11 of the 24
autopsies (41.6%) disclosing only one cyst, a
median of two cysts per person and a maximum of 17 cysts (Fig. 10.3)37. Retrospective
review indicated that 11 cases (45.8%) had
apparently been neurologically asymptomatic,
intracranial hypertension had been diagnosed
in 7 cases (29.1%), convulsive crisis in three
cases (12.5%) and motor deficit in two cases
(8.3%). One case was not classified37. More
recent hospital data from Costa Rica demonstrates the continued presence of low levels of
human cysticercosis in that country23.
When computed tomography (CT) scanning was introduced to Guatemala in 1980,
the number of cases of NC diagnosed
increased greatly, resulting in the finding
that NC accounted for at least 8% of all
admissions to neurological wards in
Guatemala City38. Similarly, the introduction
of CT and ELISA to Honduras in the middle
of the 1980s led to a fivefold increase in the
number of diagnoses of NC made in
University Hospital, Tegucigalpa22.
5.0
4.5
Percentage prevalence
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0
04
59
1019
2029
30 39
40 49
50 59
60 80
Age cohort (years)

Fig. 10.2. Age prevalence of intestinal taeniasis from a study of four rural communities in Guatemala13.
A total of 92 cases were diagnosed from a sample size of 3399 individuals (2.7% prevalence). Of the
cases 56 were Taenia solium, one case was T. saginata and in 35 cases it was not possible to determine
the species present.
94
12
Number of individuals
10
0
1
10 11 12 13 14 15 16 17
Number of cysticerci
Fig. 10.3. Distribution of intracerebral Taenia solium cysticerci detected in a retrospective study of
autopsy results carried out in Costa Rica37.
Seroepidemiology of human
cysticercosis in Central America
Studies with the glycoprotein antigen based
(EITB) have provided important insights into
the burden of cysticercosis in Central
America39. For instance, seroprevalence rates
were 10% and 17%, respectively, in two rural
communities in Guatemala, whilst seroprevalence rates were 17%, 22% and 34%,
respectively, in three different rural populations and 15% in an urban population from
Tegucigalpa in Honduras14,2426,40. These
rates would suggest that infection rates in
Guatemala and Honduras are higher than
those routinely reported from the remainder
of Latin America such as Mexico, Peru,
Colombia or Bolivia, where rates are generally below 10%31,32,4145. Indeed, a recent
assessment of data from Peru suggested a
mean seroprevalence of between 6% and
10% there, although seroprevalence rates of
up to 35% have been reported43,46.
Studies within Central America have indicated, in common with data from other
regions, that infection with intestinal taeniasis
or sharing a house with an intestinal taeniasis

carrier are significant risk factors for cysticercosis24. In the Honduran study, several socioeconomic factors were associated with
seropositivity including lack of potable water,
lack of a sanitary toilet, raising pigs and an
earthen floor in the home14. In Guatemala
females have been shown to be at higher risk
of being seropositive (15% seropositive
females vs. 11% seropositive males, odds ratio
= 1.45, P0.016)24. Whether this reflects
greater exposure to infective eggs in the home
environment, or is a reflection of the higher
rates of intestinal taeniasis seen in females,
reported above, is unknown. This sex-specific
difference has, however, not been generally
reported elsewhere, even within the region,
and so may represent a local phenomenon14,26.
Epidemiology of seizure disorders in

Central America
Prevalence rates of seizure disorders are high
among rural communities throughout the
region24,26,47,48. The lowest rate reported to
date has been in one Guatemalan study that
neuroimaging studies than apparently neurologically normal controls (47% vs. 24%, P
0.007) (Fig. 10.4)24. In Honduras, one
study in a rural community found 41% of 90
epileptics having lesions compatible with
NC40. A second Honduran community study
found a 17.6% rate of intracranial lesions
suggestive of NC in persons with a normal
neurological examination26. Finally, an evaluation of family contacts of an indicator case
of cerebral cysticercosis at an urban
Panamanian hospital resulted in the detection of three of six other family members as
EITB positive and two of six (including one
of the three seropositives) as having calcified
lesions indicative of NC by CT (Fig. 10.4)52.
In the clinical setting, a study in
Honduran neurological patients indicated
that 84% of individuals with seizures and
69% of those with neurological problems
other than seizures had lesions suggestive of
NC (Fig. 10.4)53. Furthermore, recent data
from Honduras indicate that the two major
causes of seizures in that country were
neonatal hypoxia, as a result of lack of medical attention during delivery, and NC (Ada
Zelaya, National University of Honduras,
personal communication). Finally, there is
evidence from a Honduran study to suggest
indicated a prevalence of 5.8 cases of active

epilepsy per 100048. Combined rates of active
and inactive epilepsy in rural Honduras have
been recorded at 22.7 per 100049. High rates
of active epilepsy have been detected in other
studies. For instance, prevalence rates of 29
per 1000 in rural Honduras26 and 18 per 1000
in rural Guatemala50 have been detected.
Furthermore, the estimated prevalence in a
rural population of Guaymi Indians, living
on the Caribbean coast near Costa Rica, was
up to 57 per 1000, much higher than the rate
of active epilepsy in the lower social class
population of Panama City (22 per 1000)51.
Neurocysticercosis and seizure disorder:

imaging studies
Central American studies carried out in
urban centres, rural populations and among
neurological patients have all established
that cysticercosis is a major cause of morbidity due to seizure disorders throughout the
region2426,40,50,51. Data from two rural
Guatemalan communities revealed that individuals with history of seizures had a significantly greater chance of exhibiting abnormal
intracranial lesions suggestive of NC upon
Neurological
status
Village population
(Guatemala)
Neurological patients
(Honduras)
Trace back to family

(Panama)
95
Number of
individuals
Punctate
calcification
Active/mixed
lesions
Any
abnormality
Seizures
76
31 (41%)
9 (12%)
36 (47%)
No seizures
51
10 (20%)
3 (6%)
12 (24%)
Seizures
31
20 (65%)
6 (19%)
26 (84%)
No seizures
29
12 (41%)
8 (28%)
20 (69%)
Seizures
1 (100%)
No seizures
2 (33%)
Fig. 10.4. Correlation between history of seizures and neuroimaging abnormalities detected by CT scan
in different populations in Central America: rural village population24; neurological patients52 and trace
back to family members of an individual in whom NC was diagnosed51.
96
that headache may also be linked to NC53.

This link has previously been reported from
a rural population in Ecuador and may bear
further investigation54.
In both field epidemiological studies and
studies of neurological patients the most common type of abnormal intracerebral lesions
seen by CT scanning have been punctate calcifications (Fig. 10.4)24,26,50,53. Furthermore,
studies from the region have indicated that,
besides imposing a burden of neurological
disease, that, conversely, significant numbers
of apparently neurologically normal individuals have abnormal intracranial lesion suggestive of NC14,2426,50,52. This has led to the
suggestion that the majority of cases may, in
fact, be asymptomatic as has been suggested
in other endemic regions24,26,54,55.
Human cysticercosis and seizure

disorder: serological observations
Serological testing, particularly using the EITB
has been useful in detecting areas of transmission, identifying risk factors associated with
infection and producing data that allow comparison both within the region and between
Central America and other endemic areas39. In
the hospital-based setting, clear associations
have been shown between T. solium specific
serological status and seizure disorder. This
sometimes represents the only recently available data from some countries. For instance, in
an ongoing study in Nicaragua, 14.7% of 88
epileptic patients and 2.94% of 102 controls
from Leon had antibodies detected by EITB
(P0.05, odds ratio = 4.25) (Felix Espinoza,
National
Autonomous
University
of
Nicaragua, personal communication).
Epidemiological studies in the region, and
particularly those carried out in endemic
communities, have, however, not generally
shown an association between either epilepsy
or abnormal CT images suggestive of cysticercosis and serological status in this
test14,2426. This contrasts with studies in other
areas41,42,46. These interregional variations
may be related to the study design. There
may, however, be some differences caused by
the underlying prevalence and intensity and
location of cystic infections. For instance in

Central America there appears to be a relatively high frequency of single active lesions
and calcified lesions detected by CT scan in
rural populations (see Figs 10.3 and 10.4). It
is known that the EITB, though essentially
100% specific for T. solium, is less sensitive in
infections involving single cysts and in individuals with calcified lesions56. Furthermore,
the high rates of NC in apparently asymptomatic individuals in Central America and the
frequency of extraneural infection may further explain the apparent lack of association
between serological status and epilepsy in
rural Central America. Some studies carried
out within the region have, however, demonstrated association between epilepsy and
serological status in rural populations.
Indeed Panamanian data, collected before the
introduction of the glycoprotein-based EITB
using an ELISA, demonstrated that significantly more active epileptics were seropositive for cysticercosis than age- and sexmatched controls in a population of Guaymi
Indians (44% vs. 6%, relative risk = 14)51.
For many years there has been an understanding that porcine cysticercosis imposes a
significant economic burden on Central
American pork producers10,57,58. In a study
carried out across the whole region, except
Belize, from 1959 to 1961, it was reported that
68% of all the hogs condemned for any reason
in the six main abattoirs serving the capital
cities of Guatemala City, San Salvador,
Tegucigalpa, Managua, San Jos and Panama
City, were condemned because of cysticercosis10. This represented 2.13% of all the pigs
slaughtered over this period in these abattoirs. This situation does not appear to have
improved: Honduran figures indicate that,
from 1981 to 1986, an average of 4.8% of all
pigs slaughtered at the main abattoir serving
Tegucigalpa were condemned due to cysticercosis22. Furthermore, in 1994 and 1995 respectively, in the same abattoir, 2.8% and 3% of
pigs slaughtered were condemned due to cysticercosis (Alexis Mendoza, PROMDECA,
personal communication).
The failure of the meat inspection process

to control this parasite can be seen in data
from the mid 1960s, where 6% and 6.5%
respectively, of 99 pork sausages and 107
chorizo (Spanish type) sausages purchased
from a range of randomly selected establishments in Guatemala City were found to harbour cysticerci57. More recent studies from
Guatemala revealed that 4% and 14%, respectively, of pigs in two rural communities had
cysts present in their tongues ante mortem24. In
these respective communities, 22% and 55%
of families raised pigs and 77% and 83% of
those families that raised pigs allowed them
to roam freely in the village. At least 75% of
families stated that their main source of pork
was pigs killed either at home or in the village
with no official meat inspection. In one village
27% of families were aware of having purchased pork containing cysts while in the
other community, 6% were aware of this24.
Further studies in Guatemala have indicated
seroprevalences of antibodies to T. solium antigens using the glycoprotein-based EITB59 of
40% and 64% in pigs from two communities60.
Data from Honduras indicate that 27.1% of
pigs in one community were seropositive in
this test and that pigs may be infected soon
after birth, although recent data on the passive transfer of antibodies from infected sows
to piglets complicates the interpretation of the
serological data61,62.
97
Conclusions: Prospects for Control

The prospects for control of T. solium within
Central America remain poor. None of the
countries has a formal comprehensive control system and abattoir meat inspection is
ineffective due to slaughter of significant
numbers of pigs outside the formal, regulated, system. Further to this, for much of the
region, there is a lack, or indeed complete
absence of epidemiological data. Without
such data to assess the magnitude of the
problem, control programmes cannot be
either properly planned or implemented.
Within the region, one study, carried out in
Guatemala, has indicated that mass
chemotherapy with niclosamide significantly
reduced prevalence of intestinal taeniasis and
seroprevalence of cysticercosis in pigs 10
months later60. Whether such an approach is
economically or logistically feasible is, in the
current economic climate of much of the
region, questionable. If regional governments
were to identify T. solium as a problem that
needed attention, this might improve the situation. The authors are unaware of any initiatives on this parasite backed by any of the
regional governments. Similarly, there
appears to have been relatively little work
undertaken on this parasite by the local scientific, veterinary or public health communities.
References
1. Pan American Health Organization. (1999) Health Situation in the Americas. Basic Indicators. Special
Programme for Health Analysis, PAHO, Washington, DC.
2. Herrera, C.T. (1894) Frequent Endemics and Infections in Guatemala. Thesis, Faculty of Medicine,
University of San Carlos, Guatemala.
3. Aguilar, F.J. (1989) Natural history of cysticercosis. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds)
Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 1115.
4. Aguilar, F.J., Vizcaino, C. (1954) Cysticercosis in Guatemala. Revista del Collegio Medico (Guatemala) 5,
9298.
5. Alvarez Rubio, O.A., Nazar, H.N. (1989) Neurocysticercosis in the Hospital Escuela. Revista Medica
Hondurea 57, 246260.
6. Cueva, J.A. (1956) Cysticercosis in Honduras. Revista Medica Hondurea 24, 101111.
7. Duron, R.A. (1967) Human cysticercosis in Honduras. A statistical review. Revista Medica Hondurea
35, 126131.
8. Hernandez-Gonzalez, L.A., Arrredondo-Mendoza, F., Prado-Castro, J.A. (1990) Racimedullar neurocysticercosis in Guatemala. Description of the floating cystic lesion sign. Revista Mexicana
Radiologica 44, 165169.
9. Acuna, E.R., Velasco Aparicio, G., Guzman Aranda, G. (1988) Neurocysticercosis in Panama. Revista
Medica Panama de 13, 916.
98
10. Acha, P.N., Aguilar, F.J. (1964) Studies on cysticercosis in Central America and Panama. American
11. Garrick, D. (1967) Current status of brucellosis, tuberculosis, rabies and cysticercosis in Central
America and Panama. Bulletin of the Pan American Health Organization 63, 142150.
12. Paz, J.R. (1973) Present status of cysticercosis in Panama. Boletin Chileno de Parasitologia 28, 100102.
13. Allan J.C., Velasquez Tohom, M., Garcia Noval, J., et al. (1996) Epidemiology of intestinal taeniasis in
four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157165.
14. Sanchez, A.L., Medina, M.T., Ljungstrm, I. (1998) Prevalence of taeniasis and cysticercosis in a population of urban residence in Honduras. Acta Tropica 69, 141149.
15. Shimizu, Y., Kagawa, S., Onuma, T. (1986) Cerebral cysticercosis report of an operated case. No
Shinkei Geka 14, 209213.
16. Ciesielski, S., Seed, J.R., Estrada, J., et al. (1993) The seroprevalence of cysticercosis, malaria, and
Trypanosoma cruzi among North Carolina migrant farmworkers. Public Health Reports 108, 736741.
17. Steinmetz, R.L., Masket, S., Sidikaro, Y. (1989) The successful removal of a subretinal cysticercus by
pars plana vitrectomy. Retina 9, 276280.
18. Chatel, G., Gulletta, M., Scolari, C., et al. (1999) Neurocysticercosis in an Italian traveller to Latin
America. American Journal of Tropical Medicine and Hygiene 60, 255256.
19. Prosser, P.R., Wilson, C.B., Forsham, P.H. (1978) Intrasellar cysticercosis presenting as a pituitary
tumor: successful transsphenoidal cystectomy with preservation of pituitary function. American
20. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692695.
21. Moore, A.C., Lutwick, L.I., Schantz, P.M., et al. (1995) Seroprevalence of cysticercosis in an Orthodox
Jewish community. American Journal of Tropical Medicine and Hygiene 53, 439442.
22. Kaminsky, R.G. (1991) Taeniasiscysticercosis in Honduras. Transactions of the Royal Society of Tropical
23. Arroyo, R. (1989) Taeniasis/cysticercosis in Costa Rica. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds)
Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 7579.
24. Garcia-Noval, J., Allan, J.C., Fletes, C., et al. (1996) Epidemiology of Taenia solium taeniasis and cysticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene
55, 282289.
25. Sanchez, A.L., Gomez, O., Allebeck, P., et al. (1997) Epidemiological study of Taenia solium infections
in a rural village in Honduras. Annals of Tropical Medicine and Parasitology 91, 163171.
26. Sanchez, A.L., Lindbck, J., Schantz, P.M., et al. (1999) A population-based case-control study for T.
solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247258.
27. Allan, J.C., Velasquez Tohom, M., Torres Alvarez, R., et al. (1996) Field trial of diagnosis of Taenia
solium taeniasis by coproantigen enzyme linked immunosorbent assay. American Journal of Tropical
28. Diaz Camacho, S.P., Candil Ruiz, A., Suate Peraza, V., et al. (1991) Epidemiologic study and control
of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical
29. Diaz Camacho, S., Candil Ruiz, A., Uribe Beltran, M., et al. (1990) Serology as an indicator of Taenia
solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of
30. Sarti-Gutierrez, E.J., Schantz, P.M., Lara-Aguilera, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. Tropical Medicine and Parasitology 39, 194198.
31. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical
32. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society
33. Rodriguez-Canul, R., Fraser, A., Allan, J.C., et al. (1999) Epidemiological study of Taenia solium taeniasis/cysticercosis in a rural village of Yucatan, Mexico. Annals of Tropical Medicine and Parasitology
93, 5767.
34. Ciesielski, S., Seed, J.R., Ortiz, J.C., et al. (1991) Intestinal parasites among North Carolina migrant
farmworkers. American Journal of Public Health 82, 12581262.
99
36. Richards, F.O. Jr, Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County.
Journal of the American Medical Association 254, 34443448.
37. Piza, J., Fernandez, A., Soto, M., et al. (1967) Cerebral cysticercosis. a clinicoanatomical study of 24
cases in Costa Rica. Acta Medica Costaricense 10, 517.
38. Arredondo, F. (1989) Computerised tomography in the diagnosis of neurocysticercosis. In: Aguilar,
F.J., Masselli, R., Samayao, A. (eds) Cisticercosis. Asociacion Guatemalteca de Parasitologia y
Medicina Tropical, Guatemala, pp. 5155.
39. Tsang, V., Brand, A.J., Boyer, A.E. (1989) An enzyme imunoelectrotransfer blot assay and glycoprotein
antigens for diagnosing human Taenia solium cysticercosis. Journal of Infectious Diseases 159, 5059.
40. Snchez, A.L., Duron, R., Osorio, J.R., et al. (1998) Evaluation of the enzyme-linked immunoelectrotransfer blot (EITB) assay in epileptic patients from a rural community in Honduras. In: Proceedings
of the International Congress of Parasitology, ICOPA IX. Italy, pp. 185189.
41. Diaz, J.F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia
solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA), an antigen-ELISA, and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. The
Cysticercosis Working Group in Peru (CWG). American Journal of Tropical Medicine and Hygiene 46,
610615.
42. Moro, P.L., Guevara, A., Verastegui, M., et al. (1997) Distribution of hydatidosis and cysticercosis in
different Peruvian populations as demonstrated by an enzyme-linked immunoelectrotransfer blot
(EITB) assay. The Cysticercosis Working Group in Peru (CWG). American Journal of Tropical Medicine
44. Palacio, L.G., Jimenez, I., Garca, H.H., et al. (1998) Neurocysticercosis in persons with epilepsy in
Medellin, Colombia. The Neuroepidemiological Research Group of Antioquia. Epilepsia 39,
13341339.
45. Jafri, H.S., Torrico, F., Noh, J.C., et al. (1998) Application of the enzyme-linked immunoelectrotransfer blot to filter paper blood spots to estimate seroprevalence of cysticercosis in Bolivia. American
46. Garca, H.H., Talley, A., Gilman, R.H., et al. (1999) Epilepsy and neurocysticercosis in a village in
Huaraz, Peru. Clinical Neurology and Neurosurgery 101, 225228.
47. Gracia, F.J., Bayard, V., Triana, E., et al. (1988) Prevalence of neurologic diseases in Belisario Porras
municipality, District of San Miguelito, Panama, 1986. Revista Medica de Panama 13, 4045.
48. Mendizabal, J.E., Salguero, L.F. (1996) Prevalence of epilepsy in a rural community of Guatemala.
Epilepsia 37, 373376.
49. Duron, R., Osorio, J.R., Martinez, L., et al. (1997) Epilepsy in Salama, Honduras: first phase of an epidemiological study. Revista Hondurea de Neurociencias 1, 918.
50. Garcia-Noval, J., Moreno, E., de Mata, F., et al. (2001) An epidemiological study of epilepsy and
epileptic seizures in two rural Guatemalan communities. Annals of Tropical Medicine and Parasitology
95, 167175.
51. Gracia, F., de Lao, S.L., Castillo, L., et al. (1990) Epidemiology of epilepsy in Guaymi Indians from
Bocas del Toro Province, Republic of Panama. Epilepsia 31, 718723.
52. Gracia, F., Chavarria, R., Archbold, C., et al. (1990) Neurocysticercosis in Panama: preliminary epidemiologic study in the Azuero region. American Journal of Tropical Medicine and Hygiene 42, 6769.
53. Sanchez, A.L., Ljungstrm, I., Medina, M.T. (1999) Diagnosis of human neurocysticercosis in an
endemic area: a clinical study in Honduras. Parasitology International 48, 8189.
54. Cruz, I., Cruz, M.E., Teran, W., et al. (1994) Human subcutaneous Taenia solium cysticercosis in an
Andean population with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 51,
405407.
55. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigations
56. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme
linked immunotransfer blot (EITB) in patients with neurocysticercosis. Journal of Infectious Diseases
164, 107109.
100
57. Zapatel, J., Ubieto, A., Martinez, M. (1965) Cysticerci in processed meat in Guatemala. American
58. Schenone, H. (1973) Some considerations on the occurrence of cysticercosis in swine in Latin
America. Boletin Chileno de Parasitologia 28, 106107.
60. Allan, J.C., Velasquez-Tohom, M., Fletes, C., et al. (1997) Mass chemotherapy for intestinal Taenia
solium taeniasis: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical
61. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium in pigs in a rural community of Honduras. Veterinary Parasitology 78, 233238.
in porcine Taenia solium cysticercosis. Cysticercosis Working Group in Peru. Veterinary Parasitology
86, 113118.
11
Neurocysticercosis in Brazil:
Epidemiological Aspects
Svetlana Agapejev
Introduction
Human and swine cysticercosis is a disease
caused by the metacestode larval form (cysticercus cellulosae) of the parasite, Taenia
solium. Factors contributing to the endemic
nature of taeniasiscysticercosis are many.
Improper disposal of faeces from infected
individuals in the absence of sanitary infrastructure, the existence of latrines and vegetable gardens and/or orchards in the
vicinity of pig pens especially when irrigated
with contaminated water or fertilized with
human faeces, allow the swine access to
human faeces. Rearing infected swine,
manipulation of contaminated meat through
unofficial markets, aberrant inspection at
slaughterhouses and butchers shops and
consumption of raw or poorly cooked pork
are risk factors for acquiring human taeniasis. Finally, deficient health education and
awareness, precarious personal hygiene such
as ingestion of unwashed food and handling
of food with dirty and contaminated hands,
and possibly the use of water from rivers,
streams or lakes, directly for consumption
are risk factors for human cysticercosis.
Several of these risk factors prevail in Brazil
giving it one of the highest prevalences of
taeniasiscysticercosis in the world (Fig. 11.1).
A review of Brazilian literature on neurocysticercosis (NC) from 1907 to 2000 reveals
a sizeable collection of papers describing the

many aspects of the disorder. A major contribution of Brazilian work has been the generation of autopsy (Table 11.1)122 and clinical
(Table 11.2)2352 data. In comparison, seroepidemiologic studies are few but nevertheless
available (Table 11.3)5359. This chapter is
based on reports selected from an extensive
review of papers from accessible Brazilian
literature and from more than 25 years of
personal observations60. Together, the
autopsy, clinical and epidemiological information reflect the epidemiological characteristics of T. solium cysticercosis in Brazil.
Geographical Prevalences
Brazil: geography, people and habits
Brazil is the fifth largest country in the world
and the largest in South America. It has an
area of 8512 million km2 and a population of
172,535 million. Most Brazilians are Catholic
Christians. Food habits differ regionally and
with economic conditions within Brazil.
Meat is an important dietary item, although
beef is eaten more frequently than pork.
However, sausages made of pork are often
consumed raw or undercooked. It is traditional practice in North and Northeast Brazil
to eat meat after salting it and then drying it

101
102
S. Agapejev
Fig. 11.1. Some endemic factors for the maintenance of taeniasis/cysticercosis complex: (a) Rubbish
near a sign (arrow) saying No rubbish disposal . (b) Lake water used for drinking and hygiene for
humans (arrows) and swine (foreground). (c) Vegetable garden irrigated with contaminated water from
the river (arrow). (d) Contaminated pork at a clandestine slaughterhouse.
in the hot sun. In South and Southeast Brazil,

pork is roasted or fried. Brazil is a rapidly
developing country, making great strides in
industrialization. Piped water supply exists
in three-quarters and sewer or septic
cesspool facilities in one-half of the homes.
The Brazilian Association of Pig Producers
has 12 million pigs registered in South Brazil,
9 million in Northeast Brazil, 7 million in
Southeast Brazil and 6 million in CentralWest Brazil. This, however, is not a true estimate of the porcine population, since a large
number of pigs are raised in backyards or are
free ranging. Official data from government
sources revealed that the prevalence of swine
cysticercosis for the period 195291 was
0.036.9%, through several regions in Brazil.
However, epidemiological surveys estimate
that the actual prevalence may be as high as
1328% in certain regions within Brazil.
Geographic prevalence of NC within

Brazil
While NC is endemic throughout most of
Brazil, definite information about the
endemic nature of the disease is available
from several states (shown in Fig. 11.2). Other
states have non-confirmed occurrence of NC.
These projections are mostly derived from
hospital-based reports and these may not
reflect the true prevalence of disease. For
instance, Northeast Brazil is an economically
underprivileged area and one would expect
large number of cases to be reported from
this region. However, this might not be the
case as a large proportion of cases may be
undiagnosed on account of the lack of investigative facilities like computed tomography
(CT). Similarly, it appears from the review of
literature that more severe cases like intracra-
Neurocysticercosis in Brazil
103
Fig. 11.2. Frequency of human neurocysticercosis in the Brazilian states.

(RS: Rio Grande do Sul; SC: Santa Catarina; PR: Paran; MS: Mato Grosso do Sul; SP: So Paulo;
MT: Mato Grosso; MG: Minas Gerais; RJ: Rio de Janeiro; ES: Esprito Santo; TO: Tocantins;
FD: Federal District; GO: Gois; BA: Bahia; SE: Sergipe; AL: Alagoas; PI: Piau; PE: Pernambuco;
PB: Paraba; AC: Acre; AM: Amazonas; PA: Par; MA: Maranho; CE: Cear; RN: Rio Grande do Norte;
RR: Roraima; AP: Amap.)
nial hypertension and racemose cysticercosis

are frequently seen in hospital services in
Southern and Southeast Brazil in comparison
to North and Northeast Brazil, where most of
the hospital-based reports are those of milder
varieties of NC. These differences may
merely reflect different referral patterns,
access to medical care and of expertise in the
treatment of more difficult cases in South and
Southeast Brazil. Therefore geographical differences in clinical presentations may be
more apparent than real (Figs 11.2 and 11.3).
From a review of published autopsy and
clinical service-based data from 1907 to 2000
and 1915 to 2000, respectively, an average of
600 autopsy diagnoses of NC and 500 clinicoradiological diagnoses of NC were made every
year60. Similarly, data available from general
hospitals in Brazil indicate that NC was

responsible for about two admissions every
month there. These data are at best an underestimate especially since the reporting of
taeniasiscysticercosis is not obligatory in
Brazil.
Epidemiological Characteristics
Inferred from Autopsy
Autopsy is an important tool to confirm clinical diagnosis and estimate disease frequency. Unfortunately, however, resort to
autopsy is infrequent in Brazil, primarily
owing to factors such as excessive trust in
laboratory diagnoses, difficulty in obtaining
family authorization, lack of systematic
104
S. Agapejev
(a)
North-Northeast
Central-West
South-Southeast
12.9%
Viable cysts
26%
1.6%
5.2%
4.6%
67%
2.0%
4.0%
1.8%
1.5%
0.4%
Autopsy
Clinical series
Seroepidemiology
North-Northeast
(b)
77%
South-Southeast
57%
50% 48%
47%
28%
10%
5%
Epilepsy
Intracranial
hypertension
Psychiatric
disturbance
Headache
Fig. 11.3. Brazilian regional differences in the frequency of neurocysticercosis: (a) and clinical
manifestations (b) expressed by the average of the reported incidences.
requirement of obligatory autopsy even in

university hospitals, and a high frequency of
domiciliary deaths. Since autopsy is difficult
to perform in many areas, many cases of disease go unnoticed. There is a lack of uniform
protocol for organ examination at autopsy
services. Furthermore, slices are usually
made at more than 1 cm at autopsy; and as a
result, a small pathological lesion may escape
detection leading to an underestimation of
disease frequency. Survey of necropsy at
Legal Medicine institutes and in the popula-
tion may provide a more realistic estimate of

the prevalence of NC since ocular globes,
skeletal muscles and spinal cord with the
nerve roots are analysed in addition to the
brain. Nevertheless, NC ranked 19 among
pathological diagnoses at autopsy in a general hospital in the city of So Paulo15.
The frequency of detection of NC at
autopsy in different series in Brazil from
1915 onwards is shown in Table 11.1. A range
of frequency from 0.12% to 9.0%, giving an
average of 1.5% has been reported122,60.
105
Table 11.1. Neurocysticercosis in Brazil frequency based on autopsy studies.

Author (publication year)
Almeida1 (1915)
Trtiakoff and Silva2 (1924)
Galvo3 (1928)
Povoa4 (1934)
Salles5 (1934)
Pinheiro and Mello6 (1941)
Pupo et al.7 (1945/1946)
Montenegro8 (1946)
Hellmeister and Faria9 (1973)
Guidugli-Neto and Matosinho-Frana10 (1977)
Queiroz and Martinez11 (1979)
Gobbi et al.12 (1980)
Almeida and Lima13 (1988)
Tavares et al.14 (1988)
Almeida et al.15 (1989)
Vianna et al.16 (1991)
Tavares17 (1994)
Agapejev18 (1995)
Costa-Cruz et al.19 (1995)
Chimelli et al.20 (1998)
Lino et al.21 (1999)
Montemr-Netto et al.22 (2000)
State*
Frequency
(%)
Total number
of cases
SP
SP
SP
SP
SP
SP
SP
SP
SP
SP
BA
MG
CE
MG
SP
FD
SP
MG
MG
SP
MG
PR
0.71
3.6
1.6
1.03
0.12
0.43
1.5
2.5
1.78
0.86
0.30
1.60
0.45
9.0
1.5
1.6
1.85
0.77
1.22
1.5
3.3
3.1
1,822
250
997
1,073
4,000
465
1,000
312
1,013
3,587
4,000
2,306
1,773
1,160
200
1,520
3,681
20,741
2,862
2,522
1,596
901
Note: The data refer to frequency of neurocysticercosis and not to cysticercosis in general.
*Federal State of Brazil in which the study was conducted (see Fig. 11.2).
Number of studied cases from which those with neurocysticercosis were selected.
Studies in general hospitals.
Studies conducted on psychiatric patients.
Numbers reported depend primarily upon

the autopsy protocol adopted, the repute of
the medical facility in treatment of disease
and possibly on the geographical location
within Brazil. For instance, high rates of
detection of NC have been noted in autopsy
series reported from Southeast Brazil
(0.19.0%) in comparison with Northeast
Brazil (0.300.45%). Dichotomy also exists in
the relative proportions of viable, asymptomatic and symptomatic cysticercosis. In a
large series from the state of Bahia in North
Brazil, 67% of examined parasites were
viable and there was a high proportion of
asymptomatic NC11. The latter refers to those
autopsies in which the individuals had no
symptoms related to NC during life and
autopsy revealed incidental cysts. In comparison, data from our centre in Southeast
Brazil revealed viable cysticerci in 26% of the
autopsies18.
Autopsy data from Brazil also indicate

that NC is the primary cause of death in
1634% of those cases in which it was
detected122,60. The final cause of death was
found to be intracranial hypertension in
4769% of these cases18,20. Even in autopsies
performed in those who had neurological
symptoms during life, NC may be an incidental finding in about 26%18. While
parenchymal calcifications and viable cysts
are the most common incidental findings,
autopsy could occasionally reveal asymptomatic intraventricular or cisternal cysticercosis. NC may also be diagnosed at autopsy in
those patients who die as a result of other
infectious and parasitic diseases such as pulmonary tuberculosis, paracoccidiomycosis,
Chagas disease and AIDS18,20. Co-infection
probably reflects poor socio-economic and
health-related conditions that predispose to
both infections.
106
S. Agapejev
Prior to the 1980s, when CT was not available, a diagnosis of NC was often made only
after death during necropsy. For instance, a
definite ante-mortem diagnosis of NC was
made on the basis of cerebrospinal fluid examination in only 3.6% of cases in whom autopsy
revealed NC. With the advent of CT, this figure
rose to 5063%, demonstrating the dramatic
impact of CT upon the diagnosis of NC15,18,43.
Epidemiological Characteristics
Inferred from Hospital-based Studies
Several large clinical series of patients with
NC have been reported from Brazil (Table
11.2). The frequency of NC, the demographic
profile and clinical manifestations depend
upon the source of the series. For instance, in
four general hospitals in So Paulo state, two
Table 11.2. Neurocysticercosis in Brazil frequency in clinical series.

State*
Lange|23 (1940)
Pupo et al.|7 (1945/1946)
Brotto24 (1947)
Spina-Frana25 (1956)
Canelas26 (1962)
Silva et al.27 (1965)
Camargo-Lima28 (1966)
Mega and Lison |29 (1967)
Bencio** (1970)
Reis31 (1970)
Manreza32 (1982)
Takayanagui and Jardim33 (1983)
Machado et al.34 (1988)
Chequer and Vieira35 (1990)
Clemente and Werneck36 (1990)
Spina-Frana et al.|39 (1993)
Agapejev18 (1995)
SP
SP
SP
SP
SP
PE
SP
SP
PE
SP
SP
SP
SP
ES
RJ
FD
SP
SP
Ferreira et al.40 (1994)

Tavares***17 (1994)
Azambuja et al.|41 (1995)
Camargo|42 (1995)
Gonalves-Colho and Colho|43 (1996)
Freitas and Palermo44 (1996)
Takayanagui et al.45 (1996)
Andrade46 (1997)
Forlenza et al.***40 (1997)
Narata et al.|48 (1998)
FD
MG
RS
PR
PB
PA
SP
BA
SP
PR
Agapejev49 (1999)
Pfuetzenreiter and vila-Pires50 (1999)
Gomes et al.|51 (2000)
Silva et al.|52 (2000)
SP
SC
BA
RS
Frequency
(%)
Total number
of cases
0.31
0.36
2.98
3.39
0.06
3.08
0.03
1.15
1.76
7.5
0.19
12.9
1.13
0.3
6.1
12.2
13.4
4.8
1.02
9.2
3.3
5.0
1.27
Note: The data refer to frequency of neurocysticercosis and not to cysticercosis in general.
*Federal State of Brazil in which the study was conducted (see Fig. 11.2).
Number of studied cases from which those with neurocysticercosis were selected.
Studies in general hospitals.
Studies limited to paediatric cases.
***Studies conducted on psychiatric patients.
**Cited by Schenone et al.30.
|
Studies based upon complementary tests (e.g. CT, CSF, etc.).
4,200
10
12,361
2,273
4,900
4,600
355
2,500
9,077
500
126,968
45
100
520
135,000
132,480
3,225
10
188
1,088
51,694
4,011
12
262
157
38
2,554
973
299
57
200
6,300
in the capital city and two outside the capital, NC was responsible for 0.10.2% and
0.32.5% of hospital admissions, respectively60. In comparison, this disorder was
responsible for up to 13% of admissions to
neurology and neurosurgery services.
Headaches and seizures are the most
commonly reported symptoms; headaches
are more frequent in women, while seizures
are more common in men. Seizures occur
more frequently in series collected from outpatient departments in Brazil.
In available hospital-based reports of
series of patients with NC from Brazil,
patients are mostly of rural origin (3079%).
However, urban origin becomes more frequent when more severe clinical presentations of NC in children and adults are
considered6062. Skin colour does not seem to
be a selection factor since its frequency was
proportional to the studied populations, with
no significant statistical difference18,46. In the
majority of published studies, the most
affected age group is 1160 years, with a frequency of 2267% between 21 and 40 years60.
In general, there is a predominance of males
(5180%) in most series20,22,46,51,60,61. However,
severe manifestations are more commonly
reported among females47,48,50,60,63.
The period of hospitalization for patients
with NC ranges from 1 to 254 days. Most
patients require hospitalization for about a
week18,34. Nearly one half of the patients
require multiple admissions (up to nine, in
Brazilian literature)18,34,35. The mortality rate in
several of the general hospital based series in
Brazil is low (approximately 0.3%). However,
among patients with NC, the mortality rate is
4.825.9%18,25,26,33,34,37. NC is responsible for
0.63.6% of hospital deaths due to neurological disorders in Brazil. When studies from
neurosurgical departments are evaluated, the
mortality may be as high as 60%64.
107
quency of 26% in radiological investigations20,22,45,60. Several studies have addressed

the frequency of diagnosis of NC among
patients referred to CT scan units38,41,43,48,52,61.
While these numbers give us an idea of the frequency of NC in comparison to other neurological disorders, they cannot be extrapolated to
establish prevalence of the disease in the community. In addition, the frequency may depend
upon whether the CT unit is that of a general
hospital or a specialized neurological facility. In
most of such published series from Brazil, a
diagnosis of NC was made in 12% of the CT
examinations38,41,43,48,52,61. More meaningful is
the fact that the commonest CT abnormality in
these reports has been either single or multiple
parenchymal calcifications38,41,43,48,52,61.
Compulsory Notification
The study of frequency and manifestations of
NC seen in a single hospital does not reflect
actual disease prevalence and patterns, since
they are largely dependent on the pattern of
referral to that hospital. Compulsory notification is a more accurate estimate of disease
frequency and patterns45. Compulsory notification in Ribeiro Preto, So Paulo, established
a prevalence of 54/100,000 inhabitants45. While
compulsory notification is useful in estimating
the prevalence of clinically overt NC, it would
not be able to detect the large number of
asymptomatic cases known to exist.
Community-based Serological
Studies
The seroepidemiology of human cysticercosis has not been systematically studied with
the help of contemporary methods of evaluation. Some of the earlier studies have been
based upon indirect haemagglutination and
ELISA (reviewed in Table 11.3)5259.
Epidemiological Data Inferred from

Imaging Facilities
Conclusions
While asymptomatic forms of NC (cases with
no neurological manifestations during life) are
often diagnosed at autopsy, they can also be
detected as an incidental finding with a fre-
A plethora of clinical, hospital-based and

autopsy reports of human cysticercosis are
available from Brazil. These reports suggest
108
S. Agapejev
Table 11.3. Neurocysticercosis in Brazil seroepidemiological studies.

State*
Ueda et al.53 (1984)

Arruda et al.55 (1990)
Vaz et al.56 (1990)
Silva-Vergara57 (1995)
Lonardoni et al.58 (1996)
Biondi et al. (1998)
Pires et al.59 (2000)
SP
FD
PR
SP
MG
PR
AL
MA
Total number
of cases
Frequency
(%)
824
1122
1168
821
1080
2180
736
756
0.87
5.2
0.68
2.30
1.94
3.2
1.9
6.22
Note: The data refer to incidence of positive reactions for cysticercosis in serum.
* Federal State of Brazil in which the study was conducted (see Fig. 11.2).
Number of studied cases from which those with cysticercosis were selected.
Biondi, G.F., Nunes, C.M., Cruz, J.M.C., et al., 1998 unpublished observations.
that human cysticercosis is an important

public health problem there; however, they
do not provide a true estimate of the disease
prevalence. Compulsory notification of the
disease is a useful method that has been
evaluated on a preliminary basis in Brazil. It

needs to be applied on a wider basis in order
to determine areas of high prevalence. Once
this is done, control measures may be preferentially applied to these areas.
References
1. Almeida, W. (1915) [Contribution of autopsy to clinical study of cerebral cysticercosis.] Archivos
Brasileiros de Psychiatria, Neurologia e Medicina Legal 11, 229264.
2. Trtiakoff, C., Silva, A.C.P. (1924) [Contribution to the study of cerebral cysticercosis and in details
the farther toxic brain lesions in this infection.] Memorias do Hospcio de Juquery 1, 3766.
3. Galvo, S.T. (1928) [Incidence and Prophylaxis of Cysticercosis and Hydatidosis in So Paulo.]
Thesis, University of So Paulo, Brazil.
4. Povoa, H. (1932) [Cerebral cysticercosis.] Folha Mdica 13, 241246.
5. Salles, J.M.M. (1934) [Cerebral Cysticercosis.] Thesis, University of So Paulo, Brazil.
6. Pinheiro, J., Mello, A.R. (1941) [Considerations about cerebral cysticercosis.] Archivos Brasileiros de
Medicina 31, 192212.
7. Pupo, P.P., Cardoso, W., Reis, J.B., et al. (1945/1946) [On brain cysticercosis. Its clinic, pathology,
radiology and cerebrospinal fluid syndrome.] Arquivos de Assistncia aos Psicopatas do Estado de So
Paulo 10/11, 3123.
8. Montenegro, J. (1946) [Blindness caused by brain cysticercosis.] Revista Paulista de Medicina 29,
348356.
9. Hellmeister, C.R., Faria, J.L. (1973) [Neurocysticercosis. Necropsy details.] Revista da Associao
Mdica Brasileira 19, 281282.
10. Guidugli-Neto, J., Matosinho-Frana, L.C. (1977) [Neurocysticercosis: necroscopic study.] Revista
Mdica do IAMSPE 8, 6567.
11. Queiroz, A.C., Martinez, A.M.B. (1979) [The involvement of the central nervous system in cysticercosis.] Arquivos de Neuropsiquiatria 37, 3441.
12. Gobbi, H., Adad, S.J., Neves, R.R., et al. (1980) [Occurrence of cysticercosis (Cysticercus cellulosae) in
necropsied patients in Uberaba MG, Brazil.] Revista de Patologia Tropical 9, 5159.
13. Almeida, Y.M., Lima, J.H.C. (1988) [Neurocysticercosis in the state of Cear: necropsy findings.]
Revista da Sociedade Brasileira de Medicina Tropical 11 (Suppl.), 97.
14. Taveras, A.R., Valadares-Neto, D., Pittella, L.E.M. (1988) [Frequency of neurocysticercosis at the
Hospital of Clinics of the Federal University of Minas Gerais confirmed by neuropathologic examination.] Arquivos de Neuropsiquiatria 46 (Suppl.), 75.
109
15. Almeida, M.C., Couto, L.A.A.M., Silva, L.H.F., et al. (1989) [Correlation between anatomo-clinical
diagnosis and retrospective assessment of clinical diagnosis in post mortem.] Revista de Sade Pblica
(So Paulo) 23, 285291.
16. Vianna, L.G., Macedo, V., Costa, J.M. (1991) Musculocutaneous and visceral cysticercosis: a rare disease? Revista do Instituto de Medicina Tropical de So Paulo 33, 129136.
17. Taveras, A.R. (1994) [Neuropsychiatric Aspects in Human Neurocysticercosis.] Thesis, Federal
University of So Paulo, Brazil.
18. Agapejev, S. (1995) Incidence of Neurocysticercosis at the University Hospital, Faculty of Medicine,
State University of So Paulo. (Abstract). Thesis. University of So Paulo, Brazil. Arquivos de
Neuropsiquiatria 53, 170171.
19. Costa-Cruz, J.M., Rocha, A., Silva, A.M., et al. (1995) [Occurrence of cysticercosis in autopsies performed in Uberlndia, Minas Gerais, Brazil.] Arquivos de Neuropsiquiatria 53, 227232.
20. Chimelli, L., Lovalho, A.F., Takayanagui, O.M. (1998) [Neurocysticercosis: contribution of autopsies
to consolidation of the compulsory notification in Ribeiro Preto SP, Brazil.] Arquivos de
21. Lino, R.S., Reis, M.A., Teixeira, V.P.A. (1999) [Occurrence of encephalic and cardiac cysticercosis
(Cysticercus cellulosae) in necropsy.] Revista de Sade Pblica (So Paulo) 33, 495498.
22. Montemr-Netto, M.R., Gasparetto, E.L., Faoro, L.N., et al. (2000) [Neurocysticercosis: a clinical and
pathological study of 27 necropsied cases.] Arquivos de Neuropsiquiatria 58, 883889.
23. Lange, O. (1940) [Cerebrospinal fluid syndrome in encephalic and meningeal cysticercosis.] Revista
de Neurologia e Psiquiatria de So Paulo 6, 3548.
24. Brotto, W. (1947) [Neurologic aspects of cysticercosis.] Arquivos de Neuropsiquiatria 5, 258294.
25. Spina-Frana, A. (1956) [Central nervous system cysticercosis. Considerations about 50 cases.]
Revista Paulista de Medicina 48, 5970.
26. Canelas, H.M. (1962) [Neurocysticercosis: incidence, diagnosis and clinical pictures.] Arquivos de
27. Silva, W.F., Ataide, L., Chiappetta, J. (1965) [Neurocysticercosis: a proposal of 3 cases.] Neurobiologia
28, 5158.
28. Camargo-Lima, J.G. (1966) [Brain Cysticercosis. Clinical Aspects.] Thesis. Federal University of So
Paulo, Brazil.
29. Mega, D., Lison, M.P. (1967) [Hypoglycorachie et cysticercose crbro-mninge.] Schweizerisch
Archiv fr Neurologie, Neurochirurgie und Psychiatrie 100, 425430.
30. Schenone, H., Ramirez, R., Rojas, A. (1973) [Epidemiological aspects of neurocysticercosis in Latin
America.] Boletin Chileno de Parasitologia 28, 6172.
31. Reis, J.B. (1970) [Incidence of Neurocysticercosis at the Department of Neurology and Neurosurgery
of the So Paulo School of Medicine During the Period of 19391969.] Thesis. Federal University of
So Paulo, Brazil.
32. Manreza, M.L.G. (1982) [Neurocysticercosis in childhood: clinical aspects and diagnosis.] Revista do
Hospital das Clnicas da Faculdade de Medicina de So Paulo 37, 206211.
33. Takayanagui, O.M., Jardim, E. (1983) [Clinical aspects of neurocysticercosis: study of 500 cases.]
Arquivos de Neuropsiquiatria 41, 5063.
34. Machado, A.B.B., Pialarissi, C.S.M., Vaz, A.J. (1988) [Human cysticercosis in a general hospital in S.
Paulo, Brazil.] Revista de Sade Pblica (So Paulo) 22, 240244.
35. Chequer, R.S., Vieira, V.L.F. (1990) [Neurocysticercosis in the state of Esprito Santo, Brazil: evaluation of 45 cases.] Arquivos de Neuropsiquiatria 48, 431440.
36. Clemente, H.A.M., Werneck, A.L.S. (1990) [Neurocysticercosis: incidence in the Rio de Janeiro State.]
37. Vianna, L.G., Macedo, V., Mello, P., et al. (1990) [Clinical and laboratory study of neurocysticercosis
in Braslia.] Revista do Brasileira de Neurologia 26, 3540.
38. Bruck, I., Antoniuk, A.S., Wittig, E., et al. (1991) [Neurocysticercosis in childhood I. Clinical and laboratory diagnosis.] Arquivos de Neuropsiquiatria 49, 4346.
39. Spina-Frana, A., Livramento, J.A., Machado, L.R. (1993) Cysticercosis of the central nervous system
and cerebrospinal fluid. Immunodiagnosis of 1573 patients in 63 years (19291992). Arquivos de
40. Ferreira, M.S., Costa-Cruz, J.M., Nishioka, S.A., et al. (1994) Neurocysticercosis in Brazilian children:
report of 10 cases. Tropical Medicine and Parasitology 45, 4950.
41. Azambuja, N.D., Ambrs, S., Vanzin, J., et al. (1995) [Neurocysticercosis calcifications in computed tomography: a report of the Department of Radiology of HSVP.] Revista do Hospital So Vicente de Paula 7, 1419.
110
S. Agapejev
42. Camargo, N.J. (1995) Epidemiological situation of taeniasis/cysticercosis in the state of Paran
(Southern part of Brazil) and strategie for its control. PAHO/AMRO WHO Informal Consultation.
43. Gonalves-Colho, T.D., Colho, M.D.G. (1996) Neurocysticercosis in Paraba, Northeast Brazil an
endemic area? Arquivos de Neuropsiquiatria 54, 565570.
44. Freitas, J., Palermo, E.N. (1996) [Taeniasiscysticercosis complex in Northern Brazil.] Brazilian
Journal of Veterinary Research and Animal Science 33, 270275.
45. Takayanagui, O.M., Castro e Silva, A.A.M.C., Santiago, R.C., et al. (1996) [Compulsory notification of
cysticercosis in Ribeiro Preto SP.] Arquivos de Neuropsiquiatria 54, 557564.
46. Andrade, A.S. (1997) [Neurocysticercosis: Clinical, Epidemiological and Diagnostic Aspects
Prospective Study of 157 Patients in Northeastern Region Bahia, Brazil.] Thesis. Federal University
of Rio de Janeiro, Brazil.
47. Forlenza, O.V., Guerra-Vieira, A.H., Nbrega, J.P.S., et al. (1997) Psychiatric manifestations of neurocysticercosis: a study of 38 patients from a neurology clinic in Brazil. Journal of Neurology,
Neurosurgery and Psychiatry 62, 612616.
48. Narata, A.P., Arruda, W.O., Uemura, E., et al. (1998) [Neurocysticercosis: a CT-scan study in a series
of neurological patients.] Arquivos de Neuropsiquiatria 56, 245249.
49. Agapejev, S. (1999) Standardization of tomographic indexes of the fourth ventricle and its characteristics in patients with neurocysticercosis (Abstract). Thesis. University of the State of So Paulo,
Brazil. Arquivos de Neuropsiquiatria 57, 147148.
50. Pfuetzenreiter, M.R., vila-Pires, F.D. (1999) [Clinical manifestations in patients with computerized
tomography diagnosis of neurocysticercosis.] Arquivos de Neuropsiquiatria 57, 653658.
51. Gomes, J., Veiga, M., Correa, D., et al. (2000) Cysticercosis in epileptic patients of Mulungo do Morro
Northeastern Brazil. Arquivos de Neuropsiquiatria 58, 621624.
52. Silva, J.E., Diefenthaler, A.P., Palma, J.K. (2000) Frequency of suspected cases of neurocysticercosis
detected by computed skull tomography in Santa Maria, RS Brazil. Revista do Instituto de Medicina
Tropical de So Paulo 42, 5758.
53. Ueda, M., Nakamura, P.M., Waldman, E.A., et al. (1984) [Frequency of anti-Cysticercus cellulosae
antibodies in a population with risk of cysticercosis in a considered normal population segment in
regions of the state of So Paulo, Brazil.] Revista do Instituto Adolfo Lutz 44, 2528.
54. Vianna, L.G., Macedo, V., Costa, J.M., et al. (1996) [Seroepidemiologic study of human cysticercosis
in Braslia, Distrito Federal.] Revista da Sociedade Brasileira de Medicina Tropical 19, 149153.
55. Arruda, W.O., Camargo, N.J., Coelho, R.C. (1990) Neurocysticercosis. An epidemiological survey in
two small rural communities. Arquivos de Neuropsiquiatria 48, 419424.
56. Vaz, A.J., Hanashiro, A.S.G., Chieffi, P.P., et al. (1990) [Frequency of patients with anti-Cysticercus
cellulosae antibodies in 5 municipalities of the state of So Paulo.] Revista da Sociedade Brasileira de
Medicina Tropical 23, 9799.
57. Silva-Vergara, M.L., Aluizio, P., Vieira, C.O., et al. (1995) [Epidemiological aspects of cysticercosis
due to Taenia solium in the endemic area of Lagamar, MG.] Revista da Sociedade Brasileira de Medicina
Tropical 28, 345349.
58. Lonardoni, M.C.V., Bertolini, D.A., Silveira, T.G.V., et al. (1996) Frequency of anti-Cysticercus cellulosae antibodies in individuals from five counties in the southern region of Brazil. Revista de Sade
pblica (So Paulo) 30, 273279.
59. Pires, M.A.S., Barbosa, S.P.F., Gonalves-Pires, M.R.F., et al. (2000) Frequency of IgG anti-cysticercus
cellulosae antibodies in a human population of the So Luiz Island MA, between March and June.
Annals of the XIII Sao Paulo State Journal of Parasitology, p. 35.
60. Agapejev, S. (1996) Epidemiology of neurocysticercosis in Brazil. Revista do Instituto de Medicina
Tropical de So Paulo 38, 207216.
61. Trevisol-Bittencourt, P.C., Silva, N.C., Figueredo, R. (1998) [Prevalence of neurocysticercosis among
epileptic in-patients in the west of Santa Catarina southern Brazil.] Arquivos de Neuropsiquiatria 56,
5358.
62. Morales, N.M.O., Agapejev, S., Morales, R.R., et al. (2000) Clinical aspects of neurocysticercosis in
children. Pediatric Neurology 22, 287291.
63. Dantas, F.L.R., Fagundes-Pereira, W.J., Souza, C.T., et al. (1999) [Intramedular cysticercosis: Case
report.] Arquivos de Neuropsiquiatria 57, 301305.
64 Colli, B.O., Martelli, N., Assirati, J.A. Jr, et al. (1994) Cysticercosis of the central nervous system. I.
Surgical treatment of cerebral cysticercosis. A 23 years experience in the Hospital das Clnicas of
Ribeiro Preto Medical School. Arquivos de Neuropsiquiatria 52, 166186.
12
Taenia solium Taeniasis and

Cysticercosis in Asia
Gagandeep Singh, Sudesh Prabhakar, Akira Ito, Seung Yull Cho

and Dong-Chuan Qiu
Introduction
Indonesia
Taenia solium infections remain widely

prevalent throughout Asia, Africa and
South and Central America. A large number of community-based, epidemiological
surveys carried out in several Latin
American countries, provide accurate information on the burden of T. solium taeniasis
and cysticercosis in these countries (see
Chapters 810). In this regard, a series of
investigations in Peru stands apart in terms
of their completeness and accuracy of portrayal of the status of disease there (see
Chapter 8). In contrast, precise epidemiological proportions of T. solium infection
have not been defined adequately in most
Asian countries. All we know is that the
disease does exist in several countries like
Indonesia, China, India and Nepal. More
accurate data are, however, lacking.
Information regarding taeniasiscysticercosis is now available from Indonesia1. In the
present review, several researchers review
available knowledge about the situation of
T. solium cysticercosis in their countries,
with particular emphasis upon Indonesia,
India, Korea, China and Japan.
Geography, people, customs and food

habits
Indonesia comprises 17,000 islands, of which
6000 are inhabited2. The islands are situated
on the archipelago between the Indian and
Pacific Oceans, straddling the equator.
Important islands include Java, Sumatra,
Borneo, Bali and Irian Jaya (now called West
Papua Guinea). The last mentioned comprises
the western half of New Guinea, the other
eastern half of which is a separate country,
namely Papua New Guinea (formerly East
Irian Jaya) (Fig. 12.1). Indonesia has a landed
area of 1.8 million km2 and a population of 21
million. About 88% of the population is
Moslem, the remaining 12% consists of
Christians, Hindus and Buddhists2. Certain
islands have a majority of non-Moslem communities, for instance of Christians in Irian
Jaya and Hindus in Bali. Some 80% of the
people live in the countryside.
Reliance upon traditional sanitary practices and inadequate cooking of infested
pork are principal reasons for the high
prevalence of T. solium taeniasis and cys-

111
112
G. Singh et al.
Philippines
Pacific Ocean
Malaysia
Irian Jaya
Borneo
Sumatra
Papua New
Guinea
South
Sulawesi
Flores
Java
Indian Ocean
Bali
Timor
Australia
Traditionally endemic areas
500
km
INDONESIA
Areas rendered highly endemic

after introduced disease
Areas threatened to become
endemic
Fig. 12.1. Geographical representation of Taenia solium endemic regions in Indonesia.
ticercosis in Indonesia. For instance, the

tribal inhabitants of Bali use the dwellings of
their domestic animals, called teba, for
ablution3. In Irian Jaya, an undeveloped
tribal habitat with complete lack of sanitary
understructure, people defecate in their
house-yards and gardens and allow freeranging pigs to clear the excrement at nighttime. As if to complete the human
pighuman cycle, the Balinese traditional
festival dish, lavar is made from minced
raw pork, mixed with coconut and spices4.
In Irian Jaya, male tribals frequently feast
upon pork that is inadequately cooked with
cassava in earthen ovens during tribal ceremonies5. Women are permitted to consume
the dish only after childbirth.
Human and porcine cysticercosis are
infrequent in the Moslem dominated regions
of Indonesia1. However, they constitute
major health and economic problems in Irian
Jaya, Bali, Timor, Flores, Samosir Island of
North Sumatra, Lampung in South Sumatra,
West Kalimantan and Sulawesi (Fig. 12.1)1,6,7.
In these islands, the estimated prevalence
varies between 2% in Bali and 48% in Irian
Jaya, the latter being one of the highest
reported figures in the world1,6,7.
Intestinal taeniasis
Intestinal taeniasis is common in Bali,
Sumatra and Samosir Island, but beef Taenia
sp. and Asian Taenia sp. are believed to be
more common than pork Taenia sp.5,811.
Recent data is available from a study by
Sutisna and co-workers12. They reported three
instances of Taenia sp. infection among 415
faecal samples surveyed in Bali; at a species
level, one was T. solium, while the other two
were T. saginata. The occurrence of T. solium
taeniasis in Irian Jaya has been recognized
only lately. Indeed several of the surveys of
intestinal parasitism, which were undertaken
in the 1950s and 1960s, indicated a complete
absence of T. solium infection in this region.
Thus, in at least two separate communitybased coproparasitic surveys, van der Hoeven
and Rijpstra13 (1957), and Kelly and Vines14
(1966), could not find a single case of T. solium
infection in Central Irian Jaya and neighbouring Papua New Guinea. The earliest report of
human intestinal T. solium infection in the
Wissel Lakes area of Irian Jaya was probably
made in 197315. Several workers have recently
examined the prevalence of intestinal T.
solium infection in Irian Jaya. Margono and
Taeniasis and Cysticercosis in Asia
co-workers6,7,16, and other workers17,18, have

reviewed these studies and found that the
reported prevalence varied from 8% to 51%.
The prevalence of intestinal taeniasis in other
islands has not been studied in a comprehensive manner, but rates in excess of 5% of the
faecal samples examined have been noted in
North Sumatra and Timur16,19,20.
Porcine cysticercosis
High levels of porcine infection have been
noted throughout Indonesia, particularly
Bali and Irian Jaya. More accurate data to
indicate the prevalence of porcine cysticercosis is recently available from Irian Jaya17.
Approximately 24% of pigs examined in
Jayawijaya, Irian Jaya were noted to be heavily infected and 74% (50 of 71 examined)
demonstrated serological evidence of exposure to T. solium17.
The spread of a zoonotic disorder through
transport of animals across geographical
boundaries is typically exemplified by the
story behind the occurrence of T. solium cysticercosis in Irian Jaya. Porcine cysticercosis
was not known to occur in Irian Jaya prior to
the 1970s. A mass transport of cysticercotic
pigs was undertaken from Bali to Irian Jaya
in the early 1970s and the taeniasiscysticercosis epidemic in Irian Jaya followed.
Dog cysticercosis
The consumption of canine meat and brain is
customary among tribals of Irian Jaya. It
might be interesting to speculate that the dog
may also be involved in the transmission
cycle of T. solium. In this context, parallel may
be drawn from evidence of T. saginata taeniasis arising from consumption of undercooked
reindeer brain in the former USSR21. Indeed,
some recent studies using serological markers
suitable for humans and swine have demonstrated serological evidence of exposure (to T.
solium) among dogs in Indonesia22,23.
Moreover, T. solium cysticerci have also been
recovered from seropositive dogs (Ito et al.,
Jakarta, Indonesia, unpublished data).
113
Human cysticercosis
In 1983, Coker-Vann and co-workers,
reported an estimated prevalence of 21% of
anticysticercus antibodies in sera based
upon ELISA among inhabitants of Bali24. In
other regions, such as Samosir and Nias, the
prevalence of seropositivity was lower, in
the range of 34%24. More recent data have
revealed the continued presence, in low to
moderate levels, of anticysticercus seropositive status in Bali. Thus, Theis et al.
reported an immunoblot-based seropositivity to be 13%25. Serological prevalence was
highest in the age group 2130 years, with
no preference for any gender. In comparison
to the high prevalence found by Theis et
al.25, Sutisna and co-workers12 determined
a seropositive status in only 1.65% of a population surveyed in Bali. All seropositive
cases were from one district only, suggesting regional variations with regard to the
seroprevalence of cysticercosis on the island
of Bali.
While human cysticercosis has been
known in Bali since at least the 1920s9,2628,
its occurrence in Irian Jaya is a recent phenomenon1. Tumada and Margono were the
first to report T. solium cysticercosis in 12
patients in the Wissel Lakes area of Central
Irian Jaya in 197315. Several other authors
followed with reports of widespread infection among Ekari tribals of this region2932.
In 1978, Subianto et al. reported an
unprecedented increase in hospital admissions due to high-degree burns between
1973 and 1976 in Central Irian Jaya31.
Burns were believed to be caused by nocturnal seizures in tribals who slept by community fires during winter nights. Seizures
were recorded in 63%, subcutaneous nodules were found in 33% and intestinal T.
solium infection was demonstrated in 16%
of 157 individuals, who were hospitalized
with burns31.
To build up on the story of the epidemic,
while cysticercosis was recognized in
Central Irian Jaya in the 1970s it was then
unheard of in West Irian Jaya or the neighbouring Papua New Guinea. However,
there is recent evidence of the spread of the
epidemic to East and South Irian Jaya.
114
G. Singh et al.
Wandra et al. reported 120 burn casualties

and new onset seizures in 293 individuals
among a community of 15,000 in Jayawijaya
district in East Irian Jaya33. Histopathological examination of subcutaneous
cysts removed from a number of affected
individuals confirmed the diagnosis of cysticercosis. Over the years, cross-border
migration between Indonesian Irian Jaya
and Papua New Guinea has given rise to
concerns about the disease getting established in Papua New Guinea34. In fact, in
1990, Fritzsche et al. detected a serologically
confirmed cases of cysticercosis among
Irianese refugees in Papua New Guinea35.
More recently, however, a survey found 3%
of the population of Papua New Guinea to
be seropositive and among them, local
inhabitants were also positive18.
Philippines
The estimated prevalence of T. solium taeniasis in Philippines is about 2%36. In one survey of over 200,000 stool examinations in
Manila and elsewhere within the country, the
prevalence of T. solium infection was 0.02%37.
The estimated prevalence of porcine cysticercosis is 0.16%38. A Medline search indicated
several reports of isolated cases and series of
NC originating from Philippines39,40.
Hong Kong and Singapore

Published reports indicate the occurrence of
both indigenous and imported cases in Hong
Kong, now part of China41,42. Local or indigenous cases result from consumption of pork
imported from the Chinese mainland42. With
specific reference to exotic cases, Heap
reported that a diagnosis of cysticercosis was
quite common in Nepalese Gurkha recruits in
the Territorial Army43. The Gurkhas presumably acquired infection while in Nepal. CokerVann et al. surveyed three different ethnic
communities using an anticysticercus ELISA
and determined an overall prevalence of 8%24.
Rates were highest among individuals of
Chinese origin (13%) in comparison to those of
Indian (5%) or Malay (3%) origin24. While
Singapore is a developed country, it is at-risk

for T. solium cysticercosis, given the high volume of travel to and from this country.
Vietnam, Cambodia and Laos

Studies in the post-Vietnam war period
focused on morbidity patterns among war
veterans and refugees. Among various illnesses, a high rate of helminthiasis was
described in war veterans and refugees by
several authors4447. Several case reports
from medical facilities affirmed the occurrence of T. solium cysticercosis in good numbers in Vietnam4850. In 36 children
convalescing from a flu-like illness in
Vietnam, 3% of the serum samples were
positive for anticysticercus antibodies,
when tested in an ELISA in 1972197324.
Contemporary data is now available;
Brandt et al. reported reported a seropositivity of 5.7% among inhabitants of North
Vietnam51, while reliable estimates of
seropositivity are around 8% in Hanoi and
10% in Cambodia and Laos (Carlo Urbani,
Hanoi, Vietnam, personal communication).
Thailand
According to Vejjajiva, T. solium infestation
is uncommon in Thailand52. However,
reports of sporadic case and series have
been made from several hospitals located
throughout Thailand5357. These indicate
that low levels of infection do exist in this
country. A recent report from a provincial
general hospital in Surin, in Northeast
Thailand, alluded to the frequent occurrence
of solitary cysticercus granulomas57. There, a
solitary cysticercus granuloma was identified in 110 (11%) of 972 patients with a
seizure disorder over a 3-year period.
Myanmar
One of the earliest Asian reports of cysticercosis was made from Myanmar
(Burma) (1912)58. However, a review of literature, including a Medline search did not
reveal a single recently published report of

the disorder originating from Myanmar.
Surely, this must be because of lack of
awareness rather than the lack of occurrence of T. solium infections. Coker Vann et
al. performed a serological study in a local
population using an ELISA format and
found anticysticercus antibodies in 6% of
the samples surveyed24.
Malaysia and Bangladesh

Malaysians are mostly Moslems and hence
do not consume pork. Accordingly T. solium
cysticercosis is recognized only infrequently
in this country (Zim Abdul Rashid, Kuala
Lumpur, Malaysia, personal communication). Similarly, Islam is the official and most
widely endorsed religion in Bangladesh.
Hence, indigenous cases of T. solium taeniasis and cysticercosis do not occur
(Muzuharal Mannan, Dhaka Neurological
Foundation, personal communication).
115
India
Geography, people, customs and food
habits
India is located in subtropical South Asia.
With a population of over one billion, it is the
second most populated nation in the world.
About 80% of the population is Hindu, 14% is
Moslem and the remaining 6%, of several religions. The average literacy rate is 52%. About
80% of the people live in villages2. A good
majority of the population in India is vegetarian59. Animal proteins account for about 20%
of protein intake in India, in comparison with
58% in developed countries60. An unimaginable disparity exists in the geography, ethnicity, religion, food and personal habits, level of
education and standards of living within the
country. The above listed factors have direct
bearing on the frequency of T. solium infection
and, consequently, there is significant variation in the frequency of T. solium cysticercosis
throughout the country (Fig. 12.2).
Jammu and Kashmir

New Delhi
Uttar Pradesh
Bihar
Assam
Calcutta
Kerala
Areas believed to be endemic

Areas where transmission possibly exists
Areas with no or very few local cases
Fig. 12.2. Geographical representation of regions within India, from where Taenia solium taeniasis and
cysticercosis have been reported in considerable numbers.
116
G. Singh et al.
The estimated pig population in India is 15.4
million59. The density of pigs in the plains of
North India (states of Uttar Pradesh, Bihar,
Haryana and Punjab) is high and is
estimated at 1018 km2 61. Here, the pig
industry largely consists of domestic pig
rearers who follow the scavenging system,
where pigs are allowed to free range in the
morning and are enclosed in unhygienic
pens at night61. Data collected from abattoirs
from several locations in Uttar Pradesh in
the northern plains revealed cysticercal
infestation in the muscles of 812% of the
slaughtered pigs62. Another survey of
slaughterhouses in Calcutta in eastern India
revealed cysticercus cellulosae infestation in
7% of the slaughtered pigs63.
Human taeniasis
Public health and hospital records of British
soldiers posted in India in the early part of the
19th century were extremely useful for calculation of the incidence of T. solium taeniasis64.
At that time, it was customary to admit individuals with diagnosed taeniasis to hospital
on account of the complexity and toxicity of
its treatment. Thus, between 1928 and 1932, a
total of 774 British soldiers were admitted to
hospital because of taeniasis. All of them were
assumed to have acquired the infection while
in India, because T. solium infection did not
exist in Britain at that time. Therefore, all
cases were presumed to be new and not existing cases. During this period, approximately
58,000 British troops were stationed in India.
This gave a calculated incidence of at least
1.3%. Infection was most commonly reported
from the United Provinces (presently, Uttar
Pradesh) (Fig. 12.2)64.
More recent data has indicated the persistence of T. solium infestation in significant
proportions in the areas mentioned above as
well a variation in the prevalence throughout
the country. A stool survey of 1074 outpatients and inpatients in a hospital in Calcutta
revealed Taenia sp. infestation in 12 (1.11%)63.
When identified to a species level, T. solium
could be identified in only a single instance.
Another hospital-based evaluation of nearly

250,000 faecal samples in Northwest India
revealed a prevalence of T. solium of
0.52%65. When faecal samples were examined in a community-based survey in Uttar
Pradesh, a prevalence of 2% was
determined62. A survey of 2559 faecal samples in Sikkim in East India indicated a
prevalence of 3.9%66. Prevalence was highest
among Lepkhas, Tibetians and Bhotiyas and
was comparatively less among Hindus and
Nepalese66. Taenia solium taeniasis is less of a
problem in South India67,68and in the northern state of Kashmir69. Community based
surveys in Tamil Nadu67and the Andaman
and Nicobar Islands68 have revealed a high
prevalence of geohelminthiasis but no cases
of Taenia sp. infection. On the other hand, in
Kashmir, where the population is predominantly Moslem, high prevalence of T. saginata infestation was found but no cases of T.
solium were encountered in one survey69.
Human cysticercosis
There is virtually no population-based data
that gives information about the community
burden, risk behaviours and geographical
predilections of T. solium cysticercosis in
India. Medical facility-based data is however
available in the form of large series of
patients with neurocysticercosis (NC). Health
care providers all over the country with the
exception of a few states such as Kerala70 in
the extreme Southeast and Kashmir (Sushil
Razdan, Jammu, India, personal communication) in the extreme north (Fig. 12.2), do see
large number of patients with NC. Thus,
when pre-computed-tomography (CT) era
hospital records of a large referral hospital in
Madras, South India were analysed, NC
accounted for 0.005% of all neurological
admissions71. At a tertiary care neurological
referral service in the capital, New Delhi, NC
constituted 2.5% of all intracranial spaceoccupying lesions72. In another tertiary hospital in Northwestern India, a survey of over
6000 consecutive autopsy protocols revealed
cerebral cysticercosis in 48 (0.75%)65.
Intensive evaluations of an unselected series
of epileptics at a tertiary-care neurological
facility in Banglore, South India, in the period

when CT and magnetic resonance imaging
(MRI) were not accessible, revealed a diagnosis of cerebral cysticercosis in 2%73. With the
availability of CT and MRI, the proportion of
seizures due to cerebral cysticercosis rose.
Thus Murthy and Ravi, from Hyderabad in
South India, diagnosed cerebral cysticercosis
in 220 (8.7%) of an unselected group of 2537
consecutive patients with seizure disorder74.
Similarly, Sawhney et al. noted cerebral cysticercosis in 49 (31%) of 158 patients among a
series of 407 patients with seizure disorder in
whom a CT scan was done75. In both series,
solitary cerebral cysticercus granulomas predominated.
Within the country, NC appears to be
more prevalent in the northern region
including the states of Bihar, Uttar Pradesh
through Punjab. Other states also have a fair
proportion of disease with the possible
exception of Kerala, where low levels of disease reflect efficient sanitation, pig husbandry and a superior socio-economic and
educational status and in Kashmir with its
predominant Moslem population, where the
consumption of pork is forbidden.
Experience with contemporary tools of
epidemiogical evaluation such as the
(EITB) is limited76. An EITB-based sero-survey of household family contacts of children
with solitary cysticercus granulomas found
anticysticercus antibodies in 27% of the family contacts. These figures are high because
they are from a population that is at risk of
exposure, possibly due to consumption of
common food items and similar socio-economic and sanitary conditions as with index
cases with solitary cysticercus granuloma.
Nepal
A systematic evaluation of the dimensions of
the problems related to T. solium cysticercosis
has not been undertaken in this Himalyan
nation with an area of 140,000 km2 and a
population of 24 million. The disorder has
been recognized as a major health hazard in
the country only lately as is evident from
few recent reports from major referral hospi-
117
tals77,78. Amatya and Kimula collected 62

cases of cysticercus skin mucosal and breast
nodules out of a total of 23,402 biopsies over
a 5-year period at the Patan Hospital in the
capital city of Kathmandu77. Cases were
drawn from all over the country, though the
majority were from the capital city itself.
Most patients were less than 30 years of age.
Data from neurological facilities indicate
that NC is the commonest cause of symptomatic seizures in Nepal79. Both solitary and
multiple forms of cerebral cysticercosis are
seen, though the former predominates.
Sri Lanka
According to Senanayake (Peradinya, Sri
Lanka, personal communication), NC,
including the solitary cysticercus granuloma,
which occurs very commonly in several
neighbouring countries, does not occur
locally in Sri Lanka.
China
China has an area of 9.5 million km2 and a
population of 1.2 billion. The country is
divided by the river Yangtze into two: the
warm tropical south and the cold and dry
north. About 70% of the population is rural.
There is a substantial portion of the population that is Buddhist, Taoist or Moslem,
important because these communities do not
consume pork. China also has the largest pig
population in the world. The Food and
Agricultural Organization estimated in 1997
that there were 4.6 billion pigs in China59.
Despite this, levels of pork consumption do
not approach those noted in the Western
Hemisphere. Nevertheless, the conditions do
exist in China that may perpetuate the
pighumanenvironment cycle. Surveys in
Yunnan Province indicated that significant
numbers of the Pumi and Bai minorities ate
raw meat80,81. Surveys in rural portions of the
Shandong Province revealed that pigs were
rarely corralled, human defecation was indiscriminate and awareness of the means to recognize infected pork was lacking82,83.
118
G. Singh et al.
Neurocysticercosis has been reported

from hospitals all over China. Yingkun et al.
collected a series of 158 cases between 1956
and 1974 at a large hospital in Beijing84. Most
clinic-based data is however not published
or is published in Chinese scientific literature, to which the rest of the worlds scientific community has poor access.
Adult T. solium infection is distributed broadly
throughout China. Confirmed cases have been
noted in at least 28 provinces. Neimeng,
Henan, Shandong, Hebei and Anhui are considered hyperendemic, while other provinces
like Guangxi, Guizhou, Yunnan, Sichuan and
Tibet have moderate prevalence of intestinal
infection85. The National Investigation of
Human Parasitic Diseases estimated an average prevalence of 0.112%; however, in certain
regions, local prevalence rates were as high as
0.666.0%86. The investigation estimated that
there were approximately 1.26 million persons
with adult T. solium in the entire country.
Several regional surveys have indicated varying levels of infection in different provinces
within China. For instance, between 1975 and
1987, a coproparasitological evaluation of over
34,000,000 individuals in Henan Province
revealed T. solium taeniasis in 0.55%87.
Investigations in other regions have yielded
similar results: Shandong 0.8%88; Jinan,
Taian and Laiwu City 0.1%89; Yunnan
6.93%; Dali City (Louyi village of Eryuan
county) 19.5%; Jilin (Yanji City) 0.11%;
Liaoning (Shengyang and Dalian cities)
0.005%80; Sichuan (Xide county) 4.0%90 and
Fujian (Xianyou county) 0.13%91.
Human cysticercosis
The earliest report of confirmed human cysticercosis from China was made in 193092. The
National Investigation of Human Parasitic
Diseases revealed that T. solium cysticercosis
was reported from 671 counties in 29
provinces within China93. Five zones of high
endemicity have been described: (i) Northeast
provinces; (ii) North China (including Hebei,
Neimeng and Shanxi), (iii) Northwest China

(including Ganxu, Ningxia and Qinghai); (iv)
a fourth zone comprising of Shandong,
Henan, Anhui and Hubei; and (v) finally, a
fifth zone comprising of Guangdong, Guangxi,
Hainan, Yunnan and Sichuan (Fig. 12.3).
Sporadic cases have also been reported from
the provinces of Jiangshu, Shanghai, Zhejiang,
Fujian, Taiwan, Guizhou, Xinjiang and Tibet.
Most epidemiological studies have
focused on the prevailing situation in
Shandong Province82,83,89. Here, 38 clinical
cases were detected among 35,512 patients
examined in 2000, giving a frequency of
0.2%89. In this province, a seroprevalence
(with a specific IgG4 antibody) of 2.2% was
noted89. In another study using the indirect
fluorescent antibody assay, a seroprevalence
of 3.2% was found83. Seropositivity rates
increased with age and were highest in persons over 60 years of age. Other factors that
were significantly associated with seropositivity were indiscriminate defecation, inability to identify diseased pork and raising pigs.
Outside the Shandong Province seropositivity rates are reportedly low94: Haerbin city of
Helongjiang Province 4.3%95; Liaoning
Province 0.02%96; Henan Province
0.11.2%97,98 and Sichuan 0.8%97. Higher
seroprevalence rates have however been
noted in the Pumi nation area of Yunnan
Province (11.2%)81 and Guangxi (9.5%)99.
Korea
During the past three decades, Taenia infection has decreased steadily in Korea. In a
series of national surveys for intestinal
helminth infections, undertaken every 5
years, the egg positive rates of Taenia species
were 1.9% in 1971, 0.7% in 1976, 1.1% in
1981, 0.3% in 1986, 0.06% in 1992 and 0.002%
in 1997, respectively, when one random
sample of 1000 people was examined by
stool microscopy100. In interpreting these
data, low sensitivity of stool microscopy for
detecting Taenia infection should be considered. However, the decreasing trend has well
been depicted in the consecutive surveys.
Fig. 12.3. Geographical representation of Taenia solium endemic regions in China.
Zone 5
Zone 4
Zone 3
Zone 2
Zone 1
Non-endemic area
300
300
600
Miles

119
120
G. Singh et al.
ally before the 1990s. The egg positive rate

has always been the highest in Cheju
Province, although the infections were
found throughout the country (Fig. 12.4).
Except for a few academic surveys, mass
chemotherapeutic control has not been
undertaken in Korea against intestinal Taenia
infections. Instead, taeniafuges such as
bithionol (marketed since 1964), niclosamide
(since 1976) and praziquantel (since 1981)
were allowed to be available to the public,
and infected individuals can purchase the
drug without prescription.
By examining morphology of Taenia

expelled after chemotherapy, the proportion
of T. solium was found in the wide range of
4.136.7%101 among the Taenia egg passers.
As of 1997, the least number of infected people with two species of Taenia was about
9000, which were mostly aged people older
than 60 years, living in rural Korea. From
them, nationwide number of T. solium infection could be estimated as being in the range
of 4003200 out of 46 million people in
Korea. The present intestinal infections are
regarded as persisting ones contracted actu-
Pyongyang
Seoul
Not surveyed
< 2.5%
2.54.9%
Pusan
5.07.4%
> 7.5%
Cheju
Fig. 12.4. Geographic map of Korea depicting major geographical foci of Taenia solium taeniasis and cysticercosis.
Porcine infections with T. solium metacestodes had been as high as 7.4% in Cheju
Province where pigs had been reared in pigpens in each household102. Swine infection
rates also decreased steadily throughout the
1970s to 0.40.5%. After 1986, no more swine
infections were found when the Governor of
Cheju Province banned the use of pigpens.
However, the principal reason of disappearance of measly pork in the Korean market
was the modernization of the pig breeding
industry. In 1980, about half of the pigs came
to market from farm households. However,
industrialized pig breeding, which started in
the 1960s by instigation of an Irish Catholic
Mission, has dominated the market since the
mid-1980s. It is believed that the transmission cycle from pig to human infection of
T. solium ceased in 1985.
Human cysticercosis
The earliest report of human cysticercosis in
Korea was made in 1937. Thereafter, sporadic case reports continued. Since the 1960s
when the industrialization drive began and
farmers migrated to industrial areas, the
demand for animal proteins increased.
During the same period, modernized pig
breeding also began, but most pigs originated from farmhouses. Therefore in addition to sporadic cases of cysticercosis from
rural areas, urban cases of subcutaneous
cysticercosis, orbital and intraocular cysticercosis (which represented recent transmission and active infections) were
frequently reported in literature in the
1970s103. One such report described that out
of 657 patients with benign and malignant
skin tumours, observed in Seoul during
19601972, 114 (24.3%) were caused by T.
solium cysticercosis104. Out of 174,770 biopsy
specimens submitted to the surgical pathology department of a University hospital in
Seoul during 19681987, 580 cases (0.33%)
were diagnosed as parasitic diseases. Of
them, 216 (37.2%) were due to cysticercosis105. Cases of NC were also reported during the 1970s.
121
In the 1980s, innovative progress was

achieved in diagnosis and patient management of NC including brain imaging by
CT/MRI106, chemotherapeutics such as praziquantel107, and antibody test by ELISA108.
As a result of the progress, it was found that
at least 12.6% of 206 adult-onset epilepsy
patients in 19821985 were diagnosed as due
to cysticercosis109. An epidemiological study
for anti-T. solium metacestode antibodies was
also undertaken. The antibody positive rate
was 3.1% in epilepsy patients while that in
normal population was 1.8%110. Since 1984, a
multi-antigen screening system has been set
up for specific antibodies to three helminth
parasites. During 7 years from 1990 to 1997,
a total of 10,802 neurological patients with
abnormal brain images were examined for
the antibody levels. Of them, 1580 (14.6%)
were positive for anti-T. solium antibodies in
either serum or cerebrospinal fluid or both111.
After experiencing epidemic cysticercosis
in the early industrialization period, the situation of T. solium cysticercosis in Korea has
improved nowadays because of progress in
sanitation and pig husbandry. Innovative
diagnostics and chemotherapeutics, together
with improved patient care, have lessened
the social burden caused by the disease.
However, even if the transmission cycle of
intestinal T. solium infection is stopped, morbidity and mortality due to NC will continue
for decades because of the long-term nature
of this larval disease.
Japan
Masuda et al. reviewed available published
and unpublished information on 345 cases
of T. solium cysticercosis reported in
Japan112. Subsequently, Nishiyama and
Araki added more cases to their review, giving a total of 389 cases from 1908 till 1999.
Of these 325 were Japanese; 168 were from
the Okinawa Island, where an endemic
focus existed before the Second World War.
Among others, there were 20 Chinese, 22
Koreans, one Indian and 21 of whom no
record of nationality was available112,113. In
most of the cases reviewed, there was no
evidence to suggest adult Taenia infection;
122
G. Singh et al.
presumably these cases acquired infection

either during overseas travel or through persons of foreign origin in Japan. Over the last
few years, between five and ten cases were
detected every year in Japan114117. At the
Asahikawa Medical College, most cases
were in workers who visit endemic countries115,117,118. However, two cases reported
by Masuda et al. and Ohnishi et al. are of
interest since both had no history of overseas travel and apparently acquired the disease locally in Japan112,116. This raises the
possibility of an outbreak of cysticercosis
such as the one reported in New York in an
orthodox Jewish community that never travelled abroad but nevertheless acquired cysticercosis through household food handlers
from endemic countries119,120.
West Asia (including Pakistan,

Afganistan, Iran, Iraq and the Arabian
Peninsula)
Most of West Asia is almost exclusively
Moslem. Human and porcine cysticercosis
does not occur in these locations, though,
given the high rate of travel to Arabia, the
diagnostic possibility may be considered in
foreigners who present with appropriate
clinical features121.
Conclusions
Asia is a colossal mix of contrasting geographies, cultures, religions and economies.
Understandably, therefore, remarkable variations are observed in the prevalence of T.
solium-taeniasis and cysticercosis in the continent. There are developed countries with
high standards of sanitation such as Japan
and Singapore, where T. solium infection is
virtually non-existent, apart from an occasional imported case in overseas travellers or
immigrants. There are also a number of
Moslem countries in West Asia, but also others such as Malaysia, where the consumption
of pork is forbidden on religious grounds.
Here again, though for a different reason, T.
solium infection does not occur. There are
also few rapidly developing economies such
as Korea, Thailand and Taiwan, where T.
solium infection was a major health problem
in the past, but its impact is now on the
decline. In contrast, there are a number of
developing countries such as Indonesia,
China, India and Nepal, where a significant
burden of disease is believed to exist. Finally,
there are a number of countries such as
Vietnam, Cambodia, Myanmar and Bhutan
for which no current information is available
about the status of T. solium infection but levels of infection can be imagined to be high.
References
1. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/cysticercosis in Indonesia as
2. www.geographic.org. India, Nepal, Korea, Indonesia and China.
3. Depary, A.A., Kosman, M.L. (1991) Taeniasis in Indonesia with special reference to Samosir Island,
North Sumatra. Southeast Asian Journal of Tropical Medicine and Public Health 22, 239241.
4. Simanjuntak, G.M., Margono, S.S., Sachlan, R., et al. (1977) An investigation on taeniasis and cysticercosis in Bali. Southeast Asian Journal of Tropical Medicine and Public Health 8, 494497.
5. Sutisna, P. (1977) Human parasitic infections in Bali: a review. Bulletin Penelit Kesehat 17, 276283.
6. Margono, S.S., Ito, A., Suroso, T. (2000) The problem of taeniasis and cysticercosis in Irian Jaya
(Papua), Indonesia. Proceedings of the Sixth Asian-Pacific Congress for Parasitic Zoonoses, pp. 5564.
7. Margono, S.S., Subahar, R., Hamid, A., et al. (2000) Cysticercosis in Indonesia: epidemiological
aspects. Southeast Asian Journal of Tropical Medicine and Public Health 2 (Suppl.), 79-84.
8. Fan, P.C., Chung, W.C., Soh, C.T., et al. (1992) Eating habits of East Asian people and transmission of
taeniasis. Acta Tropica 50, 305315.
9. Cross, J.H., Clarke, M.D., Cole, W.C., et al. (1976) Parasitological survey in northern Sumatra,
Indonesia. Journal of Tropical Medicine and Hygiene 79, 123131.
10. Cross, J.H. (1987) Current status of some parasitic zoonoses in Asia and suggested studies on the
application of new technologies. Proceedings of the First Sino-American Symposium on Biotechnology of
Parasitic Diseases, pp. 15.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
123
Kosin, E., Depary, A., Djohansjah, A. (1972) Taeniasis di pulau Samosir. Majalah Fakultas
Kedokteran, Universitas Sumatera Utara, Medan, 3, 511.
Sutisna, I.P., Fraser, A., Nengah Kapti, L., et al. (1999) Community prevalence study of taeniasis and
cysticercosis in Bali, Indonesia. Tropical Medicine and International Health 4, 288294.
van der Hoeven, J.A., Rijpstra, A.C. (1957) Intestinal parasites in the Central Mountains District of
Netherlands, New Guinea: an important focus of Balanitidium coli. Tropical and Geographical Medicine
9, 225228.
Kelly, A., Vines, A.P. (1966) Highland region survey of intestinal parasites. Medical Journal of
Australia 2, 635640.
Tumada, L.R., Margono, S.S. (1973) Cysticercosis in the area of the Wissel Lakes, West Irian.
Southeast Asian Journal of Tropical Medicine and Public Health 4, 371376.
Margono, S.S. (1997) Report for the Eighth Annual Meeting of the Indonesian Organization for
Parasitology. In: Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997)
Taeniasis/Cysticercosis in Indonesia as an emerging disease. Parasitology Today 13, 321322.
Subahar, R., Hamid, A., Purba, W., et al. (2001) Taenia solium infection in Irian Jaya (West Papua),
Indonesia: a pilot serological survey of human and porcine cysticercosis in Jayawijaya District.
Wandra, T., Subahar, R., Margono, S.S., et al. (2001) Sero-epidemiology of neurocysticercosis in Irian
Jaya (West Papua), Indonesia in 19961997 and Papua New Guinea in 1997. Acta Tropica (in press).
Kusharyono, C., Sukartinah, S. (1991) The current status of food-borne parasitic zoonoses in
Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 22, 810.
Suweta, G.P. (1991) The situation of cysticercosis and taeniasis in animals/man in Bali. Southeast
Asian Journal of Tropical Medicine and Public Health 22, 236238.
Blazek, K., Kirichek, V.S., Schramlova, J. (1986) Cysticercus bovis infection in the reindeer.
Proceedings
of
the
Second
International
Symposium
on
Taeniasis/Cysticercosis
and
Echinococcosis/Hydatidosis, pp. 121127.
Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticerosis: simple method for preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59, 291294.
Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins
for serodiagnosis of cysticercosis in pigs naturally infected with Taenia solium. Journal of
Helminthology 73, 363365.
Coker-Vann, M.R., Subianto, D.B., Brown, P., et al. (1981) ELISA antibodies to cysticerci of Taenia
solium in human populations in New Guinea, Oceania and Southeast Asia. Southeast Asian Journal of
Tropical Medicine and Public Health 12, 499505.
Theis, J.H., Goldsmith, R.S., Flisser, A., et al. (1994) Detection by immunoblot assay of antibodies to
Taenia solium cysticerci in sera from residents of rural communities and from epileptic patients in
Bali, Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 3, 464468.
Hausman, R., Yoe, T.L., Fossen, A. (1950) Een geval van cysticercose met enkele aantekeningen over
taeniasis in Indinesia [A case of cysticercosis with some notes on taeniasis in Indonesia]. Documenta
Nederland Indonesia Morbidity Report 2, 59.
Hadidjaja, P., Rukmono, B., Sjamsudhajat, et al. (1971) Another case of cysticercosis in Djakarta.
Journal of Indonesian Medical Association 21, 461465.
Joe, L.K., Gupito, C., Handojo, K. (1955) A case of cysticercosis in Indonesia. Documenta Nederland
Indonesia Morbidity Report 2, 134136.
Muller, R., Lillywhite, J., Bending, J.J., et al. (1987) Human cysticercosis and intestinal parasitism
amongst the Ekari people of Irian Jaya. Journal of Tropical Medicine and Hygiene 90, 291296.
Gajdusek, D.C. (1978) Introduction of Taenia solium into West New Guinea with a note on an epidemic of burns from cysticercus epilepsy in the Ekari people of the Wissel Lakes area. Papua New
Guinea Medical Journal 21, 329342.
Subianto, D.B., Tumada, L.R., Margono, S.S. (1978) Burns and epileptic fits associated with cysticercosis in mountain people of Irian Jaya. Tropical Geographic Medicine 30, 275278.
Desowitz, R.S., Margono, S.S., Sutjahyo, et al. (1977) Observations on the application of counterimmunoelectrophoresis for the seroepidemiology of human cysticercosis. Southeast Asian Journal of
Tropical Medicine and Public Health 8, 303307.
Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures
124
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
G. Singh et al.
McManus, D.P. (1995) Improved diagnosis as an aid to better surveillance of Taenia solium cysticercosis,
a potential public health threat to Papua New Guinea. Papua New Guinea Medical Journal 38, 287294.
Fritzsche, M., Gottstein, B., Wigglesworth, M.C., et al. (1990) Serological survey of human cysticercosis in Irianese refugee camps in Papua New Guinea. Acta Tropica 47, 6977.
Cross, J.H. (1988) Biotechnology research on cestodes in the Philippines, Malaysia and Indonesia.
Hinz, E. (1984) Human Helminthiases in the Philippines. The Epidemiology and Geomedical Situation.
Springer-Verlag, Berlin, pp. 166170, 266268.
Arambulo, P.V., Cabrera, B.D., Tongson, M.S. (1976) Studies on the zoonotic cycle of Taenia saginata
taeniasis and cysticercosis in the Philippines. International Journal of Zoonoses 3, 77104.
Quimosing, E.M., Conde, J., Cross, J.H. (1984) Subcutaneous and cerebral cysticercosis treated with
praziquantel. Southeast Asian Journal of Tropical Medicine and Public Health 15, 201205.
Jarin, P. Cysticercosis presenting as a tongue mass. UP-PGH ENT Journal. http://www.cm.upm.edu.
ph/dept/ent/journal 2.html
Ko, R.C. (1991) Current status of food-borne parasitic zoonoses in Hong Kong. Southeast Asian
Journal of Tropical Medicine and Public Health 22, 4247.
Woo, E., Yu, Y.L., Huang, C.Y. (1988) Cerebral infarct precipitated by praziquantel in neurocysticercosis a cautionary note. Tropical Geographic Medicine 40, 143146.
Heap, B.J. (1990) Cerebral cysticercosis as a common cause of epilepsy in Gurkhas in Hong Kong.
Journal of Royal Army Medical Corps 136, 146149.
Colwell, E.J., Welsh, J.D., Boone, S.C., et al. (1971) Intestinal parasitism in residents of the Mekong
delta of Vietnam. Southeast Asian Journal of Tropical Medicine and Public Health 2, 2528.
Berke, R., Wagshol, L.E., Sullivan, G. (1972) Incidence of intestinal parasites in Vietnam veterans.
Eosinophilia a guide to diagnosis. American Journal of Gastroenterology 57, 6367.
Picher, O., Aspock, H. (1980) Frequency and significance of parasitic infections in refugees from
Vietnam. Wiener Medizinische Wochenschrift 130, 190193.
King, P.A., Duthie, S.J., Ma, H.K. (1990) Intestinal helminths in pregnant Vietnamese refugees.
Transactions of the Royal Society for Tropical Medicine and Hygiene 84, 723.
Pham, H.T., Van Knapen, F. (1989) Preliminary report of praziquantel treatment of cysticercosis
patients in Vietnam. Acta Leiden 57, 229233.
Pascoe, M., Saines, N., Lyall, I., et al. (1987) Cerebral cysticercosis: a case report with particular reference
to recent advances in diagnosis and treatment. Australian and New Zealand Journal of Medicine 17, 5557.
Perry, H.D., Font, R.L. (1978) Cysticercosis of the eyelid. Archives of Ophthalmology 96, 12551257.
Brandt, L. (2000) Taenia solium cysticercosis in Northern Vietnam. Third Seminar on Food-borne
Parasitic Diseases; Food, Water and Parasitic Zoonoses in the 21st Century, Bangkok, Thailand, 95pp.
Vejajiva, A. (1977) Neurology in Thailand. In: Spillane, J.D. (ed.) Tropical Neurology. Oxford
University Press, Oxford, UK, pp. 335352.
Vanijanouta, S., Bunnag, D., Riganti, M. (1991) The treatment of neurocysticersosis with praziquantel. Southeast Asian Journal of Tropical Medicine and Public Health 22, 275278.
Morakote, N., Nawacharoen, W., Sukonthasun, K., et al. (1992) Comparison of cysticercus extract,
cyst fluid and Taenia saginata extract for use in ELISA for serodiagnosis of neurocysticercosis.
Chotmongkol, V., Silarugs, S. (1992) Transient paralytic attacks with cerebral cysticercosis. Southeast
Asian Journal of Tropical Medicine and Public Health 23, 165166.
Bhoopat, W., Poungarin, N., Issaragrisil, R., et al. (1989) CT diagnosis of cerebral cysticercosis.
Journal of Medical Association of Thailand 72, 673681.
Yodnopaklow, P., Mahuntussanapong, A. (2000) Single small enhancing CT lesions in Thai patients
with acute symptomatic seizures: a clinico-radiological study. Tropical Medicine and International
Health 5, 250255.
Krishnaswami, C.S. (1912) Case of Cysticercus cellulosae. Indian Medical Gazette 47, 4344.
Anonymous. FAO Production Yearbook, 199798. Food and Agriculture Organization of the United
Nations, Rome, Italy 1998.
Griggs, D. (1993) International variations in food consumption. Geography 3, 251266.
Sastry, N.S.R. (1995) Livestock Sector of India: Regional Aspects. International Book Distributing Co.,
Lucknow, India.
Pathak, K.N., Gaur, S.N. (1989) Prevalence and economic implications of Taenia solium taeniasis and
cysticercosis in Uttar Pradesh state of India. Acta Leiden 57, 197200.
125
63. Ratnam, S., Khanna, P.N., Bandyopadhyay, A.K. (1983) Incidence of taeniasis in man. Indian Journal
of Public Health 27, 7074.
Research Council Special Report Series 299, 158.
65. Mahajan, R.C. (1982) Geographical distribution of human cysticercosis. In: Flisser, A., Willms, K.,
Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New
York, pp. 3946.
66. Mitra, S., Patwari, A. (1998) Intestinal taeniasis in Sikkim. Journal of the Association of Physicians of
India 45, 124126.
67. Kang, G., Mary, S., Mathew, D., et al. (1998) Prevalence of intestinal parasites in rural southern
Indians. Tropical Medicine and International Health 3, 7075.
68. Sugunan, A.P., Murhekar, M.V., Sehgal, S.C. (1996) Intestinal parasitic infection among different
population groups of Andaman and Nicobar Islands. Journal of Communicable Diseases 28, 253259.
69. Patwari, A., Aneja, S., Singh, G., et al. (1980) A study of taeniasis in children. Indian Pediatrics 17,
515517.
70. Kuruvilla, A., Pandian, J.D., Nair, M.D., et al. (2001) Neurocysticercosis: a clinico-radiological
appraisal from Kerala state, South India. Singapore Medical Journal 42, 297303.
71. Ramamurthi, B., Balasubramaniam, V. (1970) Experience with cerebral cysticercosis. Neurology India
18, 8991.
72. Wani, M.A., Banerjee, A.K., Tandon, P.N., et al. (1981) Neurocysticercosis some uncommon presentations. Neurology India 29, 5863.
73. Mani, A., Ramesh, C.K., Ahuja, G.K., et al. (1974) Cysticercosis presenting as epilepsy. Neurology
India 22, 30.
74. Murthy, J.M.K., Ravi, Y. (1995) The syndromic classification of the International League Against
Epilepsy: a hospital based study from South India. In: Chopra, J.S., Sawhney, I.M.S. (eds) Progress in
Neurology. BI Churchill Livingstone, New Delhi, India, pp. 5367.
75. Sawhney, I.M.S., Lekhra, O.P., Chopra, J.S. (1995) Evaluation of epilepsy management and future
guidelines for a developing country. In: Chopra, J.S., Sawhney, I.M.S. (eds) Progress in Neurology. BI
Churchill Livingstone, New Delhi, India, pp. 2837.
76. Singh, G., Ram, S., Kaushal, V., et al. (2000) Risk of seizures and neurocysticercosis in household
family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176,
131135.
77. Amatya, B.M., Kimula, Y. (1999) Cysticercosis in Nepal: a histopathologic study of sixty-two cases.
American Journal of Surgical Pathology 23, 12761279.
78. Shrestha, S.P., Henning, A., Pradhan, D., et al. (1999) Subconjunctival and intraocular cysticercosis in
Nepal. Tropical Doctor 29, 251253.
79. Rajbhandari, K.C. (2000) Clinical profile of epilepsy with neurocysticercosis in Nepal. In: Proceedings
of the Third Congress of Asian Oceanian Epilepsy Organization, New Delhi, pp. 18.
80. Fang, W., Lian, Z.Q., Fang, C., et al. (1996) The investigation of infection actuality and epidemic factors of Taenia solium taeniasis/cysticercosis in Bai minority of Dali, Yunnan. Journal of Practical
Parasitic Diseases 4, 62.
81. Wang, H.Z., Zhang, H.M., Zhang, L.L., et al. (1997) The seroepidemiological survey of cysticercosis
in Pumi minority focusing region of Yunnan Province. The Chinese Journal of Prevention and Care of
Parasitic Diseases 10, 306.
82. Cao, W., van der Ploeg, C.P., Xu, J., et al. (1997) Risk factors for human cysticercosis morbidity: a
population-based case control study. Epidemiology and Infections 119, 231235.
83. Cao, W., van der Ploeg, C.P., Gao, C.L., et al. (1996) Seroprevalence and risk factors of human cysticercosis in a community of Shandong, China. Southeast Asian Journal of Tropical Medicine and Public
Health 27, 279285.
84. Yingkun, F., Shan, O., Xiuzhen, Z., et al. (1979) Clinicoelectroencephalographic studies of cerebral
cysticercosis, 158 cases. Chinese Medical Journal 92, 770786.
85. Li, W., Ma, Y. (1995) The epidemiological status of Taenia solium taeniasis in China. Henan Preventive
Medicine Journal 6, 4445.
86. Wang, Z. (1991) The Address to the Meeting of National Antiparasitic Diseases. Guilin, pp.14.
87. Ma, Y.X. (1991) The status and countermeasure of prevention and cure of echinococcosis and cysticercosis in China. The Chinese Journal of Prevention and Care of Parasitic Diseases (Suppl.) 4, 5052.
126
G. Singh et al.
88. Liu, X., Deng, X.L., Zhao, Z.P., et al. (2000) The epidemiological survey of Taenia solium
taeniasis/cysticercosis in the center of Shangdong Province. The Chinese Journal of Prevention and
Care of Parasitic Diseases 13, 3436.
89. Zhou, K.X. (1998) The epidemiology and prevention of Taenia solium taeniasis/cysticercosis in
China. The Chinese Journal of Prevention and Care of Parasitic Diseases 11, 344345.
90. Zhou, G.X., Zhang, G.H., Wang, S.Y., et al. (1993) The epidemiological survey of Taenia solium taeniasis/cysticercosis in Xide County of Sichuan. Journal of Practical Parasitic Diseases 1, 2527.
91. Xu, X.R., Yin, H.Z., Chen, B.J., et al. (1998) The prevention and cure of Taenia solium taeniasis/cysticercosis in Xianyou County. The Haixia Journal of Preventive Medicine 4, 5354.
92. Zhao, W.X. (1983) The Human Parasitology, 1st edn. Peoples Sanitation Publishing Co., Beijing,
China, pp. 492509.
93. Xu, L.Q., Jiang, Z.X., Zhou, C.H., et al. (1999) The investigation of cysticercosiss distribution in
China. The Chinese Journal of Prevention and Care of Parasitic Diseases 12, 3032.
94. Li, X.C., Sun, D.P., Hu, B.Y., et al. The epidemiological survey of Taenia solium taeniasis/cysticercosis
and the study of corresponding countermeasure in Gunzhou City. The Chinese Journal of Prevention
and Care of Parasitic Diseases 12, 150.
95. Ji, K.B., Tong, S.F., Liu, Y.L., et al. (1996) The seroepidemiological survey of cysticercosis in Ha Erbin
City. The Chinese Journal of Prevention and Care of Parasitic Diseases 9, 313.
96. Li, F.H., Xu, J.T., Sun, T., et al. (1998) The epidemiological investigation of human Taenia solium taeniasis/cysticercosis in Liaoning Province. The Chinese Public Health Journal 14, 227228.
97. Li, Y., Mo, Q.X., Wang, H., et al. (1997) The investigation of epidemic situation and epidemic factors
of Taenia solium taeniasis/cysticercosis in Xiayi county. The Henan Journal of Preventive Medicine 8,
910.
98. Wang, Z.Q., Ma, Y.X., Cui, J., et al. (1999) The seroepidemiological survey of human Taenia solium
taeniasis/cysticercosis in Weishi County of Henan Province. The Chinese Journal of Prevention and
Care of Parasitic Diseases 12, 236237.
99. Mai, F.Z., Xie, Z.Y., Lu, X.G., et al. (1999) The seroepidemiological survey of Taenia solium
taeniasis/cysticercosis in the minority focusing region of Guangxi. The Guangxi Journal of Preventive
Medicine 5, 121.
100. Ministry of Health and Welfare, Korea Association of Health (1997) Prevalence of Intestinal Parasitic
Infections in Korea: the Sixth Report, pp. 1287.
101. Rim, H.J., Song, K.W., Joo, K.H., et al. (1980) An epidemiological note on the taeniasis in Korea.
Korean Journal of Parasitology 18, 235240.
102. Han, H.R. (1969) A survey on Cysticercus cellulosae infection in swine of Cheju-Do. Korean Journal of
Public Health 6, 2328.
103. Lee, K.T., Kim, C.H., Park, C.T., et al. (1966) Cysticercosis and taeniasis in Chollapukdo Province.
Korean Journal of Parasitology 4, 3945.
104. Cho, B.K., Houh, W., Shim, S.I., et al. (1973) A study on 657 skin tumors. Korean Journal of
Dermatology 11, 38.
105. Chi, J.G., Sung, R.H., Cho, S.Y. (1988) Tissue parasitic diseases in Korea. Journal of Korean Medical
Science 3, 5162.
106. Chang, K.H., Kim, W.S., Cho, S.Y., et al. (1988) Comparative evaluation of brain CT and ELISA in the
diagnosis of neurocysticercosis. American Journal of Neuroradiology 9, 125130.
107. Rim, H.J., Lee, J.S., Joo, K.H., et al. (1982) Therapeutic trial of praziquantel (Embay 8440; Biltricide)
on the dermal and cerebral human cysticercosis. Korean Journal of Parsitology 20, 169190.
108. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1986) Evaluation of enzyme-linked immunosorbent assay in
serological diagnosis of human neurocysticercosis using paired samples of serum and cerebrospinal
fluid. Korean Journal of Parasitology 24, 2541.
109. Han, S.H., Myung, H.J. (1986) A clinical study on epileptic seizures of late onset. Journal of Korean
Neurological Association 4, 218226.
110. Kong, Y., Cho, S.Y., Cho, M.S., et al. (1993) Seroepidemiological observation of Taenia solium cysticercosis in epileptic patients in Korea. Journal of Korean Medical Science 8, 145152.
111. Cho, S.Y., Kong, Y., Kang, S.Y., et al. (1997) Multi-antigen screening for antibodies to three
helminthes parasites in neurologic patients in Korea. Proceedings of the Third Korea-Japan
Parasitologists Seminar, pp. 3941.
112. Masuda, H., Niida, M., Nakamura, N., et al. (1980) Cysticercosis in Japan: one case after 30 years of
infection with reference of 345 reported cases. Showa Medical College Journal 40, 669688.
127
113. Nishiyama, T., Araki, T. (1999) Cysticercosis: clinical and epidemiological aspects. Progress in Medical
Parasitology in Japan, 7, 263274.
114. Miyake, H., Takahashi, K., Tsuji, M., et al. (1993) A surgical case of solitary cerebral cysticercosis. No
115. Ohsaki, Y., Matsumoto, A., Miyamoto, K., et al. (1999) Neurocysticercosis without detectable specific
antibody. Internal Medicine 38, 6770.
116. Ohnishi, K., Murata, M., Nakane, M., et al. (1993) Cerebral cysticercosis. Internal Medicine 32,
569573.
117. Ito, A., Nakao, M., Itoh, Y., et al. (1999) Neurocysticercosis case with a single cyst in the brain showing a dramatic drop in specific antibody titers within 1 year after curative resection. Parasitology
International 48, 9599.
118. Ito, A., Nako, M., Sako, Y., et al. (2000) Neurocysticercosis and echinococcosis in Asia: recent
advances in the establishment of highly reliable differential serodiagnosis for international collaboration. Southeast Asian Journal of Tropical Medicine and Public Health 31 (Suppl. 1), 1620.
119. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an orthodox Jewish community in New York City. New England Journal of Medicine 327, 692695.
120. European Commission (2000) Opinion of the Scientific Committee on Veterinary Measures Relating to
Public Health of the Control of Taeniasis/Cysticercosis in Man and Animals. pp. 31.
121. Kak, V.K., Al-Joshi, A.A., Daftary, S.G., et al. (1994) Cerebral cysticercosis presenting as a ring
enhancing lesion with partial seizures (A case report with review of literature). Baharin Medical
Bulletin 16, 2628.
13
Taenia solium Cysticercosis in Africa
Michel Druet-Cabanac, Bienvenue Ramanankandrasana, Sylvie

Bisser, Louis Dongmo, Gilbert Avod, Lopold Nzisabira, Michel
Dumas and Pierre-Marie Preux
Introduction
Taenia solium cysticercosis exists in Africa but
published reports are scarce. Its spread is not
well understood, owing to the lack of welldeveloped medical infrastructure, and of
trained medical staff and diagnostic facilities. Several sub-Saharan African countries
have high rates of cysticercosis, because of
indiscriminate pork consumption, poor sanitary conditions, free-roaming pigs around
residential areas, and lack of veterinary control at slaughter facilities. Even in South
Africa, where sanitary and medical facilities
are better developed, the disease is well recognized, with a high prevalence having been
reported. In West Africa, similar high rates
have been reported in countries where epidemiological studies have been carried out.
This chapter, based on a previous review1,
gives an account of available data concerning T. solium cysticercosis in Africa.
Geography, people and their habits and

environment
Africa covers more than 30 million km2 of
area and, after Asia, it is the second largest
continent. It is divided into two parts by the
equator. One-third of the continent is desert.
The Sahara, the largest desert in the world,
covers almost one-quarter of Africa. Twothirds of the continent has a tropical or subtropical climate. Africa has nearly 600 million
inhabitants. Its rate of population growth is
the highest in the world, but actually it is
sparsely populated, the average population
density being around 20 inhabitants per km2.
Differences in language, religion, ethnic origin and culture are enormous but comparable to other continents. Regarding religious
status, Africa can be divided in two parts: the
Moslem dominated northern part and animist and Christian dominated sub-Saharan
region. Owing to religious beliefs, pork is not
consumed in Moslem dominated regions of
Africa, resulting in a low prevalence of cysticercosis in these areas. We have chosen to
include Madagascar, an island off the African
coast, in this review because of the similarities of the environmental conditions between
this country and the African continent.
The overall socio-economic standard of the
population in Africa is low, the illiteracy rate
is high, and cultural backgrounds are difficult
to modify. There is a dearth of robust sanitary
and medical understructure and trained medical personnel. Access to improved sanitary
facilities and training of qualified medical
staff is dependent upon socio-economic standards of the society. The latter in turn are negatively influenced by the number of diseases
existing in the African continent, resulting in

129
130
M. Druet-Cabanac et al.
an important loss of productivity. This forms

a vicious cycle that is very difficult to break.
In most rural areas, meat inspection is
improper or absent. Even in localities where
slaughterhouses exist, illegal channels of meat
marketing exist. Moreover, slaughterhouses
do not exist in villages and people butcher
their own animals, offering the meat for sale.
Free-ranging pigs with access to human faeces abound. Too many inhabitants in remote
areas of the continent ignore the danger of
eating meat infected with cysticerci. Different
gastronomic customs and beliefs concerning
meat consumption also play an important
role in transmission of T. solium cysticercosis.
In a few ethnic groups, pork infested with
cysticercosis is believed to have a better taste
than healthy meat. Raw or insufficiently
cooked pork meat is consumed to ensure
virility in certain other communities. In some
tribes of South Africa, tapeworm proglottides are a component of the muti administered by native herbalists to expel intestinal
worms2.
In Africa, maybe more than anywhere
else, environment and disease are closely
related. As with other communicable diseases, the geographic, demographic and cultural characteristics of the region influence
the epidemiology of cysticercosis. For
instance, T. solium egg survival in the external environment is influenced by temperature and humidity. The tropical climate of
Africa favours egg survival. In addition, ova
can be transported over many kilometres by
streams and rivers, and mechanically over
long distances by birds. Some insects may
also transmit the disease. The use of irrigation water contaminated by animal wastes
contributes to transmission of cysticercosis.
Finally, a high rate of transmission is noted
in specific familial environments.
Human Cysticercosis
Hospital-based case reports and series
In most African countries, neurologists are
few and general practitioners are not aware
of cysticercosis. Access to modern neuroimaging techniques and serological diagno-
sis is limited. The clinical presentation of neurocysticercosis (NC) is extremely variable and
the diagnosis is easy to miss. It is interesting
that diagnosis of the first case of NC in a
country often follows the completion of training of the first neurologist in that country.
The first autopsy report of human cysticercosis in Africa was made from
Madagascar in 1910 by Andrianjafy3.
Bettencourt in 1911, reported cysticerci in an
Angolan individual who died of trypanosomiasis. In 1938, Gallais reported NC in an
epileptic individual from Benin4.
Review of international literature indicates
that T. solium cysticercosis has been reported
from many African countries. Cases have been
reported from Senegal57, Benin8, Ivory
Coast911, Togo12, Ghana13, Burkina Faso1 and
Nigeria14 in West Africa, Democratic Republic
of Congo (ex-Zaire)1517, Cameroon18, Burundi19,
Kenya20, Rwanda2123, Tanzania1 and Uganda1
in Central and East Africa, and Zimbabwe2426,
South Africa2735 and Madagascar36 in southern
Africa.
Human cysticercosis was found in 7% of
300 autopsies carried out at Butare,
Rwanda23. Gelfand reported cysticercosis in
0.45% of 2148 autopsies conducted in
Zimbabwe24. Proctor, identified 71 cases of
taeniasis in an autopsy survey of 7597 cases,
most of them also had cysticercosis25.
In Togo, 38 (1.45%) of 2604 consecutive
patients presenting for neurological consultation to the outpatient department of a teaching
hospital, were found to have cysticercosis12.
Mason et al. observed that 12% of 630 hospitalized patients were seropositive for anticysticercus antibodies with an ELISA26. Sacks and
Berkowitz noted a seropositivity rate of 7.4%
among hospitalized adult patients in
Johannesburg with an ELISA test35. In
Madagascar, Michel et al., using ELISA and
(EITB) reported a seroprevalence rate of 36%
among 1132 neurologic patients36.
Human NC and seizure disorder
A review of published studies from Africa
reveals that seizures are the most frequent
presenting manifestation of NC in common
with data available from other continents.
T. solium Cysticercosis in Africa
Powell et al. noted seizures in 58% of 48

patients with proven cysticercosis from
Zimbabwe37. In Madagascar, seizures were
the presenting symptom in 57% of 241
patients with NC38. A total of 33 (87%) of 38
patients with NC presented with seizures in
Togo12. Shasha et al. analysed 141 cases of
cysticercosis from South Africa and reported
seizures with or without other neurological
syndromes in 95 (67.4%) of them39. In a paediatric cohort of 61 cases of cerebral cysticercosis from South Africa, seizures were
recorded in 43%30.
131
Several studies from South and Central

America indicate that NC is the most common cause of adult-onset seizures4042.
Studies from Africa have produced conflicting viewpoints on the association between
NC and seizures (Tables 13.1 and
13.2)2,12,34,37,4350. Dumas et al. demonstrated
evidence of cysticercosis in 26 of 88 individuals with seizure disorder identified during
a population-based survey in Togo48. The
diagnosis of cysticercosis was based upon
presence of one of the following findings:
positive serology by ELISA; presence of
Table 13.1. Prevalence of cysticercosis among epileptic patients in sub-Saharan Africa.

Number of
epileptic patients
Prevalence
(%)
45
98
103
93
200
2
37
46
47
34
48
12
49
200
180
70
106
578
88
305
170
40.8
11.7
18.3
12.8
5.5
15.5
34.4
30.0
50.9
28.0
29.5
10.8
13.5
Country
Year
Reference
Burundi
1992
1997
2000
1962
43
44
1965
1966
1987
1987
1991
1989
1995
2000
Cameroon
South Africa
Togo
Diagnostic
method *
S, R, N
S
S
S
R
S, R
S, R, N
CT
CT
CT
S, R, N
S, R, N, CT
S
*S: serology; R: calcifications on standard radiographs; N: subcutaneous cysticercus nodules;

CT: computerized tomography cerebral scan.
Louis Dongmo, Yaounde, Cameroon unpublished data.
Table 13.2. Seroprevalence of cysticercosis in casecontrol and transversal studies in sub-Saharan Africa.
Country
Year
Reference
Benin
Burundi
2000
1997
2000
2000
1999
2000
2000
*
44
Cameroon
Central African Republic
Kenya
Togo
50
*
49
Number
of epileptic
patients
Prevalence
in epileptics
(%)
Number of
controls
Prevalence
in controls
(%)
65
103
61
93
187
98
115
1.5
11.7
26.0
18.3
4.0
5.0
13.5
130
72
87
81
374
124
1343
1.5
2.8
24.0
14.8
2.4
2.4
3.8
*Pierre-Marie Preux, Limoges, France, unpublished data.

Nsengiyumva, Burundi, unpublished data.
Louis Dongmo, Yaounde, Cameroon, unpublished data.
132
calcifications characteristic of cysticercosis

on standard radiographs; proof of cysticerci
in subcutaneous nodules by histology. Using
the same criteria, evidence of cysticercosis
was found in 40 of 98 individuals with
seizures in Burundi43. Of these, 25 patients
had a positive cerebrospinal fluid (CSF)
serology. In a hospital-based study from
Madagascar, Michel et al. reported 36%
seropositivity for cysticercosis among 1132
consecutive hospitalized patients with neurological complaints38. Laurence and Levi
also emphasized the aetiological role of cysticercosis in epilepsy in Zimbabwe, Malawi
and Zambia51. However, in several other
case-control studies, no difference was
found between the seroprevalence rates in
individuals with seizures and controls
(Table 13.2). More studies with contemporary methods of case finding such as the
EITB are needed in order to determine if
these differences are real or only due to
methodological discrepancies1, 41.
Human NC and other neurological
presentations
Other presentations including intracranial
hypertension (ICH), psychiatric symptoms
and focal neurological deficits have been
reported from Africa. ICH was a presenting
symptom in 24% of 61 children with cerebral
cysticercosis in South Africa30. In this report,
headache and meningoencephalitis were
noted in 28% and 13%, respectively.
Meningoencephalitis was reported in two
patients from Togo12. Some patients having
NC present with multiple signs and symptoms. Avod et al. reported a patient from
Benin with diffuse cysticercosis, who presented with seizures, ICH, confusion, myositis and subcutaneous cysticercus nodules8.
Spinal cord involvement or ocular cysticercosis has been rarely reported from Africa.
Michel et al. reported ocular cysticercosis in
3% of 266 patients with cysticercosis36.
Subcutaneous cysticercosis
The finding of subcutaneous nodules in individuals with seizures may be taken as presumptive evidence of T. solium cysticercosis.
However, subcutaneous cysticerci need to be

differentiated from onchocerciasis nodules in
certain parts of Africa, where the latter is
endemic. For example, cysticerci were found
in 12 cases (22.7%), while onchocerci were
found in 36 cases (67.9%) out of 53 biopsies
of subcutaneous nodules in Togo48. The
study further showed that clinical examination had excellent positive predictive value
for onchocerciasis (100%) in comparison
with cysticercosis (45.8%). Among the 12
individuals with subcutaneous cysticerci, a
diagnosis of NC could not be confirmed in
five. Interestingly, the study revealed that
there were three epileptics among the 36
cases with histologically proven onchocercal
subcutaneous nodules; two of them had
intracranial calcifications typical of NC. This
raises the possibility of co-infection in areas
that are endemic for both disorders.
Community-based data on T. solium

cysticercosis
While there are several reports of NC in hospitalized patients from Africa, very few community-based studies have been undertaken.
When available, studies are often subject to
bias because of lack of random sampling or
other appropriate epidemiological methods.
This may explain the high variability of
prevalence rates among different regions
within Africa. Nevertheless, preliminary
data has emerged to show that most
sub-Saharan countries have a high prevalence of T. solium cysticercosis (Table
13.3)2,14,36,4850,5257.
West Africa
A population-based survey evaluated the
prevalence of cysticercosis and epilepsy in
the Kozah region of northern Togo in
198748,58. The study included 5264 randomly
selected subjects above 15 years of age. In
this population, the prevalence rate for
epilepsy was 16.7 per 1000 (95%CI: 12.321.2
per 1000). The overall prevalence of cysticercosis was 2.4%. Serological studies were
undertaken in part of this sample (i.e.
among epileptic subjects, their relatives and
133
Table 13.3. Prevalence of human cysticercosis in sub-Saharan Africa and Madagascar.

Country
Year
Reference
Benin
1996
1998
1998
2000
1987
2002
2000
1999
1993
1965
1987
52
53
54
1991
1989
2000
57
48
49
Burundi
Cameroon
Central African Republic

Madagascar
South Africa
Togo
55
14
50
36
2
56
Population
studied *
Prevalence
(% )
Sample
size
Diagnostic
method
GP
GP
GP
GP
GP
GP
GP
GP
GP
GP
SC: Transkei
SC: KwaZulu
SC
GP
GP
3.5
3.9
1.5
24.0
2.4
0.8
16.7
2.4
18.0
8.5
0.23
2.49
5.5
2.4
3.8
319
1443
2625
87
764
4128
174
374
1408
2124
736
677
1352
5264
1343
S
S
S
S
S
S
S
S
S
S
S
S
S
S, R, N
S
*GP: general population; SC: school children.

serology; R: calcifications on standard radiographs; N: subcutaneous cysticercus nodules.
Nsengiyumva, Burundi, unpublished data.
Louis Dongmo, Yaounde, Cameroon, unpublished data.
S:
neighbours). In this subsample, seroprevalence was 8.4% (95%CI: 6.510.7%), and the
difference in prevalence between epileptic
individuals and others was statistically significant (P0.001). Another survey in the
Tone region of Togo, found 170 individuals
with seizure disorder among 9155 examined, giving a prevalence of 18.6 per 100049.
The seroprevalence of cysticercosis was significantly higher (P106) in subjects with
seizure disorder (135 per 1000) than in a
control group consisting of 1343 randomly
selected individuals (38 per 1000). Using
similar methods and case definitions, a survey of 1443 subjects older than 5 years in the
Savalou region of Benin, in 1993, indicated a
prevalence rate of seizure disorder of 15.2
per 1000 (95%CI: 9.823.4 per 1000).
Prevalence rates were comparable to those
found in Togo52,54. The seroprevalence rate
for cysticercosis was 3.9% (95%CI: 3.05.1%).
No statistically significant difference was
found between seropositivity rates among
individuals with and without seizures. Two
other studies were carried out in Benin by
the same team. A serological study for cysticercosis on a representative sample of 319
subjects in Vekky, a lake-side village situated near Cotonou in the Atlantique

province of Benin, found 11 (3.5%) positive
cases (95%CI: 1.86.3%)52. Houinato et al.
evaluated 2625 sera using ELISA and
immunoblot collected from six regions
within Benin by cluster sampling54. The
sera, therefore, constituted a representative
sample of the national population. A total
of 35 (1.3%) subjects were seropositive for
cysticercosis (95%CI: 0.91.9%). Two regions,
Atacora (3.3%) and Atlantique (3.0%) had
higher seroprevalence rates than the
national average. The Moslem dominated
regions of Borgou (0.3%), Oum (0.8%)
had low seroprevalence rates. The prevalence rate was higher in men (1.9%; 95%CI:
1.22.7%) than in women (0.8%; 95%CI:
0.41.5%) (P0.05). Benin can then be considered as a country with medium endemicity for cysticercosis with several foci of
hyper-endemicity53,59.
East Africa
In Kazanya, northern Burundi, 25% of individuals with seizure disorder were assigned
134
a diagnosis of NC based on the finding of

anticysticercus antibodies in CSF in a community-based survey43. To our knowledge,
this is the only population-based study from
East Africa.
Southern Africa
A serological survey using complement fixation and precipitin reactions found an
overall prevalence rate of 8.5% of cysticercosis among a rural black population in
South Africa2. In an ELISA based serosurvey, 22 of 736 school children from Transkei
were found to be serologically positive
while only eight of 677 KwaZulu children
were positive56. These results, when corrected for the sensitivity and specificity of
ELISA, indicate a prevalence rate for cysticercosis of 2.49% in Transkeian school
children and 0.23% in the KwaZulu. The
differences in prevalence between the two
regions are in keeping with the meat-eating
habits of the two communities. While
KwaZulu is primarily a cattle and meatproducing area, the Transkei region has a
large number of free-roaming pigs in addition to cattle. An earlier study in 1966
revealed that the frequency of porcine cysticercosis detected in slaughterhouses in
the Transkei area was nearly seven times
higher than in those close to the KwaZulu
area60. Another ELISA based serosurvey,
carried out on school children in Transkei
in 1991, determined an overall seroprevalence rate of 5.5%57. The rates were similar
for regions with different climatic conditions. An interesting revelation that
emerged from this study was the lower
seroprevalence rate in undernourished children (3.3%) in comparison with those with
good nutritional status (7.3%). The authors
attributed this discrepancy to an impaired
antibody response associated with proteinenergy malnutrition.
In Madagascar, 91 of 34,137 persons with
neurological symptoms were found to
have NC61. When 1408 sera from healthy
individuals
from
six
provinces
of
Madagascar were evaluated by the anticysticercus ELISA/EITB, a high seroprevalence
rate of 18% was obtained36,38.
Only few studies have examined the burden
of porcine cysticercosis in Africa. In
Burundi, the prevalence was found to be
around 20%56. In northern Togo, 17% of pigs
were reported to be infected58. In South
Africa, prevalence of porcine cysticercosis
was 4% in 198445. Similar data are also available from other African countries14,62.
Veterinary meat inspection is an important
method of prevention. Unfortunately, in
most parts of Africa, only a very small percentage of pig carcasses undergo veterinary
meat inspection. We believe that the situation in Africa is similar to that reported in
Peru, where about 65% of the pork consumed is obtained through informal channels, in order to avoid financial losses from
the condemnation of infected pigs63. One
way to circumvent these problems would be
to establish an official market for infected
meat. The meat brought there, at a somewhat lower price, could then be processed
using methods that would kill all cysts.
The production of free-roaming pigs,
which feed on domestic wastes and faecal
matter, with minimal feeding and maintenance costs is a considerable source of
income for small farmers. None of the peasants who raised pigs in Vekky (Benin) practised indoor husbandry52. Similarly, in
Savalou (Benin), 92.6% of the pigs are produced using free-range methods53. In western Cameroon, pigs are raised in household
pens but humans frequently defecate inside
these pens64.
Intestinal Taeniasis
Data on intestinal taeniasis in Africa is
extremely limited. Furthermore, there are
discrepancies between the low prevalence of
intestinal taeniasis and the high prevalence
of cysticercosis in the same area. For
instance, Dumas et al. found T. solium eggs
and proglottides in one case out of 1163
stool examinations and eggs alone in eight
(0.5%) out of 1157 faecal samples48. Only one
of these eight cases was seropositive
(ELISA) for cysticercosis. Newell et al.
established a prevalence of taeniasis (both T.

solium and T. saginata) of 0.16% in 1992,
0.25% in 1993 and 0.25% in 1994 among
school children in Rumonge, Burundi44. The
highest reported prevalence was reported
from South Africa, where a survey found
10% prevalence of adult Taenia infection.
Conclusions
While human and porcine cysticercosis have
been recognized as major health and economic problems in Latin America and also in
few developed countries, their impact upon
health and economy in Africa has not been
adequately appreciated. Preliminary epidemiological data indicate that sub-Saharan
Africa may be a major focus of disease.
135
Besides, cysticercosis has also been recognized in West Africa and southern Africa.
Studies from Benin and Togo have succeeded
in increasing the awareness of local political,
administrative and public health authorities
concerning cysticercosis and NC. In Benin,
information on sanitation has been disseminated through a published handbook. More
work of this nature on a collaborative basis
involving countries within Africa and
beyond are clearly required to assess and
contain the situation in Africa.
Acknowledgements
We would like to thank the Conseil Rgional
du Limousin for their financial help and Dr
Bernard Bouteille for technical assistance.
References
1. Preux, P.M., Melaku, Z., Druet-Cabanac, M., et al. (1996) Cysticercosis and neurocysticercosis in
Africa: current status. Neurological Infections and Epidemiology 1, 6368.
2. Heinz, H.J., MacNab, G.M. (1965) Cysticercosis in the Bantu of Southern Africa. South African Journal
of Medical Sciences 30, 1931.
3. Andrianjafy, A. (1910) Cysticercose humaine. S S Mad 2, 5360.
4. Gallais, P. (1938) Deux cas de cysticercose crbrale avec manifestations pileptiques. Bulletin de la
Socit de Pathologie Exotique 31, 915919.
5. Collomb, H., Lariviere, M., Philippe, Y. (1961) Cysticercose crbrale (premier cas au Sngal).
Bulletin de la Socit de Mdicine dAfrican Noire 6, 695700.
6. Dumas, M., NDiaye, I.P., Daumens, J.P., et al. (1976) Cysticercose crbrale (deux nouveaux cas
sngalais). Bulletin de la Socit de Mdicine dAfrican Noire 21, 203211.
7. Collomb, H., Larivire, M., Phillipe, Y., et al. (1964) Foyer de cysticercose de la Basse Casamance
(Sngal). Bulletin et Mmoires de la Facult Mixte de Mdecine et de Pharmacie de Dakar, Sngal 12, 148155.
8. Avod, D.G., Bouteille, B., Avimadj, M., et al. (1994) Epilepsie, hypertension intracrnienne, syndrome confusionnel et cysticercose cutane, propos dun cas observ en milieu hospitalier au
Bnin. Bulletin de la Socit de Pathologie Exotique 87, 186188.
9. Heroin, P., Loubire, R., Doucet, J., et al. (1972) Un cas de cysticercose sous-cutane en Cte dIvoire.
Revue Mdicale Cte dIvoire 8, 26.
10. Giordano, C., Vedrenne, H., Dago-Ekribi, A., et al. (1976) Cysticercose crbrale forme confusionnelle avec aspects priodiques lEEG, tude anatomo-clinique. Mdicine dAfrique Noire 23, 43 51.
11. Bullock, A. (1980) La cysticercose crbrale. A Propos dune Observation Clinique, Electrique et
Anatomique. Medical thesis, Abidjan, Ivory Coast, 75 pp.
12. Grunitzky, E.K., Balogou, A.K., MBella, M., et al. (1995) La cysticercose chez des malades neurologiques en milieu hospitalier Lom, Togo. Annales de Mdecine Interne 146, 419422.
13. Odamtten, S.E., Laing, W.N. (1967) Cysticercosis of the brain. Ghana Medical 6, 97105.
14. Geerts, S., Zoli, A., Wallingham, L., et al. (2002) Taenia solium cysticercosis in Africa: an under-recognised problem. In: Craig, P.S., Pawlowski, Z.S. (eds) Tapeworm Zoonoses: an Emergent and Global
Problem. IOS Press, Amsterdam, pp. 1323.
15. Fain, A., Duren, P., Fels, P. (1956) Cysticercose gnralise et plasmocytose mdullaire (mylome)
associs chez une femme de race Muhutu. Annales de la Socit de Belge Mdecine Tropicale 36,
239246.
136
16. Denisoff, N., Haenecour, F. (1958) Nouveau cas de cysticercose gnralise dans lEst Congolais.
Annales de la Socit de Belge de Mdecine Tropicale 38, 529530.
17. Lelo, T., Malenga, M., Ndoma, K., et al. (1992) La cysticercose crbrale Kinshasa, propos de deux
observations. African Journal of Neurological Sciences 11, 3637.
18. Marty, P., Herzog, U., Marty-Jaussan, et al. (1985) 2 cas de cysticercose observs au Cameroun.
Mdecine Tropicale 45, 8386.
19. Aubry, P., Ndayiragije, A., Kamamfu, G., et al. (1990) A propos de 2 cas de cysticercose au Burundi.
Bulletin de la Socit de Pathologie Exotique 83, 288289.
20. Ruberti, R.F., Mwingi, S.M.G., Dekker, N., et al. (1985) Epilepsy in the Kenyan Africans. African
Journal of Neurological Sciences 4, 13.
21. Kestelyn, P., Taelman, H. (1985) Effect of praziquantel in intraocular cysticercosis: a case report.
British Journal of Ophthalmology 69, 788790.
22. Gascon, J., Corachan, M., Ramirez, J. (1989) A propos de 5 cas de cysticercose au Rwanda. Mdecine
Tropicale 49, 7780.
23. Vanderick, F.X., Moboryingabo, P. (1972) La cysticercose humaine au Rwanda. Annales de la Socit
de Belge de Mdecine Tropicale 52, 153155.
24. Gelfand, M. (1948) Cysticercosis of the brain in the Africans of Rhodesia. East African Medical Journal
25, 110112.
25. Proctor, N.S.T. (1963) Problems associated with tapeworm infestation of the central nervous system.
In: van Bogaert, L., Kafer, J.P., Poch, G.F. (eds) Tropical Neurology. Lopez Libreros Editores, Buenos
Aires, Argentina, pp. 140.
26. Mason, P., Houston, S., Gwanzura, L. (1992) Neurocysticercosis: experience with diagnosis by ELISA
serology and computerized tomography in Zimbabwe. Central African Journal of Medicine 38, 149 154.
27. Becker, B.J.P., Jacobson, S. (1951) Infestation of the human brain with Coenurus cerebralis. Lancet 29,
12021204.
28. De Villiers, P.D. (1953) Cerebral cysticercosis: an aspect of the diagnosis. South African Medical
Journal 27, 10971098.
29. Gelfand, M., Jeffrey, C. (1973) Cerebral cysticercosis in Rhodesia. Journal of Tropical Medicine and
Hygiene 76, 8789.
30. Thomson, A.J., De Villiers, J.C., Moosa, A., et al. (1984) Cerebral cysticercosis in children in South
Africa. Annals of Tropical Paediatrics 4, 6777.
31. Tuch, P.S., Saffer, D. (1984) Cerebral cysticercosis: a case report and review of literature. South
African Medical Journal 65, 211216.
32. Joubert, J., Joubert, M.J., Lombaard, C.M. (1985) Neurocysticercosis a comprehensive approach to
medical treatment. South African Medical Journal 68, 1114.
33. Zini, D., Farrell, V.J.R., Wadee, A.A. (1990) The relationship of antibody levels to the clinical spectrum of human neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 53, 656661.
34. Van As, A.D., Joubert, J. (1991) Neurocysticercosis in 578 black epileptic patients. South African
Medical Journal 80, 327328.
35. Sacks, L.V., Berkowitz, I. (1990) Cysticercosis in urban black South African community: prevalence
and risk factors. Tropical Gastroenterology 11, 3033.
36. Michel, P., Callies, P., Raharison, H., et al. (1993) Epidmiologie de la cysticercose Madagascar.
Bulletin de la Socit de Pathologie Exotique 86, 6267.
37. Powell, S.J., Proctor, E.M., Wilmot, A.J., et al. (1966) Cysticercosis and epilepsy in Africans: a clinical
and serological study. Annals of Tropical Medicine and Parasitology 60, 152158.
38. Michel, P., Callies, P., Raharison, H., et al. (1992) La cysticercose Madagascar: mise au point diagnostique et thrapeutique. Dakar Mdical 37, 191197.
39. Shasha, W., Van Dellen, J., Cakata, E. (1986) Cysticercosis: an analysis of 141 cases in South Africa.
South African Journal of Epidemiology and Infection 1, 9497.
40. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticerosis as the main cause of
late-onset epilepsy in Mexico. Archives of Internal Medicine 150, 325327.
41. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a critical review. Epilepsia 39,
10251040.
42. Pal, D.K., Carpio, A., Sander, J.W.A.S. (2000) Neurocysticercosis and epilepsy in developing countries. Journal of Neurology, Neurosurgery and Psychiatry 68, 137143.
43. Nzisabira, L., Nsengiyumva, G., Bouteille, B., et al. (1992) La cysticercose dans la province de
Kayanza (Burundi). Bulletin de la Socit de Pathologie Exotique 85, 374377.
137
44. Newell, E., Vyungimana, F., Geerts, S., et al. (1997) Prevalence of cysticercosis in epileptics and members of their families in Burundi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91,
389391.
45. Bird, A.V., Heinz, H.J., Klintworth, G. (1962) Convulsive disorders in Bantu mine workers. Epilepsia
3, 175187.
46. Naidoo, D.V., Pammenter, M.D., Moosa, A., et al. (1987) Seventy black epileptics: cysticercosis, computed tomography, and electroencephalography. South African Medical Journal 72, 837 838.
47. Campbell, G.D., Farrell, V.J.R. (1987) Brain scans, epilepsy and cerebral cysticercosis. South African
Medical Journal 72, 885886.
48. Dumas, M., Grunitzky, E.K., Deniau, M., et al. (1989) Epidemiological study of neurocysticercosis in
Northern Togo (West Africa). Acta Leidensia 57, 191196.
49. Balogou, A.K., Grunitzky, E.K., Beketi, K.A., et al. (2000) Cysticercose et pilepsie au nord du Togo
dans le Tone. Revue Neurologique (Paris) 156, 270273.
50. Druet-Cabanac, M., Preux, P.M., Bouteille, B., et al. (1999) Onchocerciasis and epilepsy: a matched
case-control study in Central African Republic. American Journal of Epidemiology 149, 565570.
51. Laurence, F., Levi, S. (1990) Epilepsia in Rhodesia, Zambia and Malawi. African Journal of Medical
Science 1, 291303.
52. Adjid, C.C., Bouteille, B., Josse, R., et al. (1996) Sroprvalence de la cysticercose dans la commune
lacustre de Vekky, dpartement de lAtlantique (Bnin). Bulletin de la Socit de Pathologie Exotique 89,
2429.
53. Avod, D.G., Bouteille, B., Houngbe, F., et al. (1998) Epilepsy, cysticercosis and neurocysticercosis in
Benin. European Neurology 39, 6061.
54. Houinato, D., Ramanankandrasana, B., Adjid, C.C., et al. (1998) Seroprevalence of cysticercosis in
Benin. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 621624.
55. Zoli, A., Geerts, S., Vervoort, T. (1987) An important focus of porcine and human cysticercosis in
West Cameroon. In: Geerts, S., Kumar, V., Brandt, J. (eds) Helminth Zoonoses. Martinus Nijhoff
Publishers, Dordrecht, pp. 8591.
56. Pammenter, M.D., Rossouw, E.J., Dingle, C.E. (1987) Serological detection of cysticercosis in two
rural areas of South Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene 81,
242244.
57. Shasha, W., Pammenter, M.D. (1991) Sero-epidemiological studies of cysticercosis in school children
from two rural areas of Transkei, South Africa. Annals of Tropical Medicine and Parasitology 85,
349355.
58. Dumas, M., Grunitzky, K., Belo, M., et al. (1990) Cysticercose et neurocysticercose: Enqute pidmiologique dans le nord du Togo. Bulletin de la Socit de Pathologie Exotique 83, 263274.
59. Avode, D.G., Capo-Chichi, O.B., Gandaho, P., et al. (1996) Epilepsie provoque par la cysticercose. A
propos dune enqute sociologique et culturelle ralise Savalou au Bnin. Bulletin de la Socit de
Pathologie Exotique 89, 4547.
60. Verster, A. (1966) Cysticercosis, hydatidosis and coenurosis in the republic of South Africa. Journal of
South African Veterinary Medical Association 37, 3745.
61. Andriamiandra, A., Cros, J., Dodin, A., et al. (1969) La cysticercose Madagascar. Bulletin de la
Socit de Pathologie Exotique 62, 894900.
62. Geerts, S. (1993) The taeniosiscysticercosis complex in Africa. Bulletin Sances de lAcadmie des
Sciences dOutre-Mer 38, 245264.
63. Cysticercosis Working Group in Peru. (1993) The marketing of cysticercotic pigs in the Sierra of
64. Marty, P., Mary, C., Pagliardini, G., et al. (1986) Courte enqute sur la cysticercose et le taeniosis
Taenia solium dans un village de louest Cameroun. Mdecine Tropicale 46, 181183.
14
Taenia solium Cysticercosis: the

Special Case of the United States
Wayne X. Shandera, Peter M. Schantz and A. Clinton White Jr.
Introduction
Neurocysticercosis (NC) is commonly considered a disease of the developing world.
Nonetheless, NC is also diagnosed in the
developed world. By virtue of the number of
immigrants entering the United States of
America (USA) every year from countries
where Taenia solium infection is endemic,
more cases of imported NC are diagnosed in
the USA every year than in all other developed countries combined. While NC cases in
the USA occur primarily among immigrants
from the developing world, a few cases arise
autochthonously. In this chapter we discuss
the epidemiology of NC in the developed
world by focusing on the USA.
Early American Reports

The earliest studies on NC were from
Europe. These include descriptions of Taenia
morphology, clarification of the animal hosts
differences between T. solium (originally classified by Linnaeus) and T. saginata (classified
by the German scientist, Johann Goeze in the
18th century) and the detailed elucidation of
the Taenia life cycle by the 19th-century
German scientist Karl Leuckart1. Many of the
clinical manifestations were defined by
British investigators studying clinical disease
acquired largely in India. Key insights

included the observation of the protracted
interval between acquisition of disease and
onset of symptoms. For example, of over 450
British citizens who acquired infection primarily in India, clinical disease did not present until several years (average: 5 years,
range 130 years) later in their homeland2.
In the USA, T. solium cysticercosis has
always been predominantly an imported disease. Even in the early 19th century, when
thousands of swine roamed streets in New
York City and other communities, cysticercosis was rarely described in the USA.
Occasional cases were reported in the late
19th century and early 20th century, but most
patients were German and Eastern European
immigrants who were infected before immigration. A review published in 1899, for
example, describes only eight cases including
the first case, a German woman reported
from New York in 18573. Few cases were
reported in the first half of the 20th century4.
Two larger case series were published in the
1950s. The first described two new cases from
Louisiana as well as a literature review of 40
additional American cases5. Overall, 31%
showed ocular disease, and only 49%
parenchymal brain disease, suggesting that
neurological manifestations were often overlooked. Only three (7%) of the cases had
clearly acquired their infection in the USA.

139
140
W.X. Shandera et al.
Another American series of cysticercosis

cases diagnosed in the USA involved two
intraventricular cases and one parenchymal
case6. The three patients were from Portugal,
Guatemala (the intraventricular cases) and
Angola (the parenchymal case). Subsequent
articles broadened the clinical spectrum of
disease, and showed that surgical intervention improved the outcome of selected
cases79. Thus, the number of cases described
before the 1970s was limited, perhaps due to
limitations of diagnostic tests. In addition, the
spectrum of disease was skewed towards
cases that were obvious (e.g. patients with
parasites visible in the eye) or more severe
(e.g. intraventricular disease).
T. solium Infections: 1970 Onwards

The spurt in T. solium cases in the 1970s
In the late 1970s, computed tomography (CT)
scanning became widely available in the USA.
The result was that parasites in the central nervous system could be identified without invasive testing. At about the same time, the
number of immigrants from endemic areas
began to increase. Between 1960 and the 1990s,
the proportion of the US population born in
foreign countries doubled. Furthermore, there
was a shift in the country of origin for US
immigrants. Prior to the 1970s, most immigrants to the USA were of Canadian or
European origin. Changes in immigration policy led to the influx of large numbers of immigrants from Latin America and Asia. The
recently completed 2000 US Census recorded
35.3 million persons of Hispanic origin living
in the USA, representing an increase of 12.9
million in the past decade10. US immigrants of
Mexican origin now number over 20 million.
There was also increased travel to endemic
areas with an estimated 200 million persons
crossing the USMexico border every year.
Increased immigration plus widespread
availability of non-invasive neuroimaging
tests resulted in a dramatic increase in recognition of NC. This was initially noted in
California. For example, review of hospital
records from four large medical centres in
Los Angeles for the period 19731983
revealed 447 cases diagnosed with NC11. The

number of cases, however, only began to
increase during the last few years of the
1970s. There was a fourfold increase in the
number of cases diagnosed between l977 and
l981, which was far greater than the increase
in the number of immigrants. The major factor associated with the increased number of
cases was the introduction and widespread
utilization of CT scans. This technology so
enhanced the clinicians ability to identify
and define the nature of intracerebral lesions
that its introduction overshadowed any other
factors. The vast majority of the patients
reported during this period were Hispanic.
Most were presumably from Mexico. Even in
this early report, however, 12 of the cases
(3%) had no history of travel to diseaseendemic areas outside of the USA11. Thus, their
infections were presumably acquired locally.
As the number of immigrants increased
and the geographic range of Hispanic immigration broadened, so did the extent of NC.
By the 1990s, we estimated that 1000 NC cases
were diagnosed in the USA each year12. With
the continued increase in immigration from,
and travel to endemic areas, the number of
cases is probably higher now. In support of
this is the continuing increase in the number
of cases in Los Angeles13. While cases were
initially noted in southern California, large
cases series have subsequently been reported
from Colorado, Texas, Chicago and New
York12,1417. Interestingly, these case series are
reported from cities with large immigrant
populations, especially those from Mexico
and Central America. However, up to 42% of
the patients were persons born in the
USA15,16. Reported sources of possible exposure in these persons included travel to
Mexico or Central America (50%) or visitors
in the home from Latin America (20%).
To document the extent of disease, an
ongoing multi-state surveillance project of 11
university-affiliated hospital emergency
departments was begun in the late 1990s18.
NC was documented as the apparent cause
of approximately 2% of cases of seizures.
Most cases were seen in the southwestern
states. Patients with no travel history and in
whom infections may have been locally
acquired represented 8% of identified cases.
T. solium Cysticercosis in the USA
Risk factors for T. solium infection in USA

To further characterize the epidemiology of
NC, we interviewed NC cases diagnosed in
Houston19. Of 35 immigrants questioned,
83% were from families that raised pigs, 43%
had a history of taeniasis, and 54% had a
family history of taeniasis. The median
period from immigration to diagnosis was 28
months for the 13 patients who had not left
the USA after immigration. Thus, NC cases
were concentrated in immigrants from villages in known endemic regions. Travel
between the endemic villages and cities in
the USA was surprisingly frequent19,20.
In the late 1980s, NC was made a
reportable disease in southern California.
Surveillance was started in 1988 and within 3
years the county health system in Los
Angeles was notified of 138 cases21. The
number of cases was significantly fewer than
would be predicted from hospital surveys,
suggesting significant underreporting. As
might be expected the case rates were over
2.5 times higher in the Hispanic than in the
non-Hispanic communities. In addition,
many of the non-Hispanic patients were
Asian immigrants.
With the increase in numbers of cases,
there was also a shift in the spectrum of disease. Most cases diagnosed after the widespread use of neuroimaging studies were
due to parenchymal cysticerci. Previously, it
was widely assumed that NC carried a grave
prognosis and that patients would do poorly
unless treated with anticysticercal drugs.
Based on uncontrolled studies, praziquantel
and subsequently albendazole became
widely used. During the early 1980s, neither
of these drugs was widely available in the
USA. Several investigators in California followed the natural history of patients treated
with only symptomatic therapy22,23. US
investigators reported that most patients
with NC presented with seizures and usually
a single enhancing lesion on CT scans. These
patients did very well with only symptomatic therapy. By contrast, ocular, ventricular and meningeal disease (which comprised
most of the reported cases before the CT era)
were only a small minority of cases. Thus,
the poor prognosis reported in older series
141
may have been due to ascertainment bias,

with only more severe or obvious cases
being diagnosed.
Locally acquired infections

Locally acquired infections have also occasionally been noted. Pigs sold and consumed
in the USA however, are infrequently infected
with cysticercosis and among over 80 million
swine slaughtered annually, fewer than 10
pigs show evidence of infection1. Thus, local
acquisition of T. solium adult tapeworms (taeniasis) is unlikely to be a significant problem.
By contrast, local acquisition of NC has been
noted. Twelve US-born patients with NC
who had not left the USA were identified in
the hospital-based survey from Los
Angeles21. Similarly, locally acquired cases
were also identified in patients from
Massachusetts and North Carolina24. A small
series of patients with no travel outside of the
USA was also reported from Chicago16.
Direct or circumstantial evidence commonly
links these cases to direct or indirect exposure
to immigrants from Latin America, who presumably are (or were previously) carriers of
adult-stage T. solium. This was most dramatically shown in a cluster of cases in four unrelated families of an Orthodox Jewish
community in New York City25. The clue to
the epidemiological puzzle in these cases was
the employment of live-in housekeepers in
all of the exposed households. These female
employees had recently emigrated from Latin
American countries where T. solium is
endemic and were considered the most likely
sources of infection for the infected members
of these households. Examination of six
housekeepers currently or previously
employed in the four case households
revealed an active Taenia sp. infection in one
and a positive serological test result in
another. Employment of immigrants as
domestic workers was very common in this
community; a random telephone survey
determined that 94% of the approximately
7000 households in the community employed
housekeepers, almost all of whom had
recently emigrated from rural areas of
Mexico or countries of Central America.
142
W.X. Shandera et al.
Each household employed an average of

three such women per year.
To further evaluate the extent of this
problem, a serosurvey was conducted in the
same community which sought to identify
exposures and practices associated with
acquisition of infection. Anticysticercus antibodies were detected by enyme-linked
immunoelectrotransfer blot (EITB) in 23
(1.3%) of 1789 persons from 612 families26.
All 23 seropositive persons were asymptomatic, and no intracerebral lesions were
found in the 21 seropositive persons who
underwent brain imaging. Seropositivity
was significantly associated (P 0.05) with
female sex, employment of domestic workers for child care duties, and with employment of persons from Central America. This
cluster of patients within a community in
New York that never ate pork and enjoyed
modern hygienic facilities underscored the
importance of faecaloral hygiene in the
transmission cycle. The prevalence of these
risk factors among the US population in general is unknown.
The prevalence of taeniasis among
immigrant employees in surveyed households is unknown and may be difficult to
determine. Most employees live in the
households; many are undocumented
aliens; access to the population is limited,
and confidentiality of test results is difficult
to ensure. A stool examination survey of
migrant workers in North Carolina found
taeniasis in Central American workers
(4.4%), but none in those from Haiti or

Mexico27. Thus, widespread employment of
domestic workers from disease-endemic
regions and high employee turnover may
contribute to exposure risk. It is unclear,
however, whether local transmission is in
fact rare or merely under-recognized. In
Los Angeles, Sorvillo et al. attempted to
identify tapeworms among contacts of NC
patients21. They identified carriers in 1.1%
of the household contacts of their patients.
Among the subgroup of NC patients that
were not from and had not travelled to
endemic areas, 22% had tapeworm carriers
among household contacts.
Conclusions
Overall, NC is a growing public health problem in the USA. Initial recognition resulted
from improved imaging studies and has
included more cases of mild disease (e.g. single parenchymal cysticerci) than in most
series from developing countries. NC in the
USA is primarily a disease of immigrants
infected abroad. Thus, as immigration and
travel from Latin America and Asia increase,
so the number of cases. In addition, small
numbers of cases of locally acquired infections are recognized. While the number of
such cases is small, the risk factors associated
with locally acquired infection need better
definition and the magnitude of this problem
requires further study.
References
1. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging, and immunoblots: the emergence of neurocysticercosis as a major public health problem. In: Scheld, W.M., Craig, W.A.,
Hughes, J.M. (eds) Emerging Infections 2. ASM Press, Washington, DC, pp. 213242.
Research Council Special Report Series. Her Majestys Stationery Office, London, pp. 158.
3. Diamond, I.B. (1899) Cysticercosis of brain and spinal cord. Journal of the American Medical
Association 32, 13651369.
4. Dandy, W.E. (1950) Animal parasites invading the central nervous system: cysticercosis cellulosae.
In: Lewis Practice of Surgery, Vol. 12. W. F. Prior Co, Hagertown, USA, pp. 377382.
5. Campagna, M., Swartzwelder, C. (1954) Human cysticercosis in the United States. Journal of
Parasitology 40 (Suppl.), 46.
6. White, J.S., Sweet, W.H., Richardson, E.P. (1957) Cysticercosis cerebri. New England Journal of
Medicine 256, 479486.
T. solium Cysticercosis in the USA
143
7. Orihel, T.C., Gonzalez, F., Beaver, P.C. (1970) Coenurus from the neck of a Texas woman. American
8. Simms, N.M., Maxwell, R.E., Christenson, P.C., et al. (1969) Internal hydrocephalus secondary to
cysticercosis cerebri: treatment with a ventriculoatrial shunt. Journal of Neurosurgery 30, 305309.
9. Carmalt, J.E., Theis, J., Goldstein, E. (1975) Spinal cysticercosis. Western Journal of Medicine 123,
311314.
10. Guzman, B. (2001) The Hispanic population. Census 2000 Brief. US Department of Commerce, 8 pp.
11. Richards, F.O., Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles county. Journal
of American Medical Association 254, 34443448.
12. Shandera, W.X., White, A.C. Jr, Chen, J., et al. (1994) Cysticercosis in Houston, Texas: a report of 112
cases. Medicine 73, 3752.
13. Zee, C.S., Go, J.L., Kim, P.E., et al. (2000) Imaging of neurocysticercosis. Neuroimaging Clinics of North
America 10, 391407.
14. Earnest, M.P., Reller, L.B., Filley, C.M., et al. (1987) Neurocysticercosis in the United States: 35 cases
and a review. Reviews in Infectious Diseases 9, 961979.
15. Rosenfeld, E.A., Byrd, S.E., Shulman, S.T. (1996) Neurocysticercosis among children in Chicago.
Clinical Infectious Diseases 23, 262268.
16. Stamos, J.K., Rowley, A.H., Hahn, Y.S., et al. (1996) Neurocysticercosis: report of unusual paediatric
cases. Pediatrics 98, 974977.
17. Buitrago, M., Edwards, B., Rosner, F. (1995) Neurocysticercosis: report of fifteen cases. Mount Sinai
Journal of Medicine 62, 439444.
18. Ong, S., Moran, G.J., Talan, D.A., et al. (1998) Radiographically-imaged seizures and neurocysticercosis. Program and abstracts of the International Conference on Emerging Infectious Diseases, Atlanta,
Georgia (abstract 28.4).
19. de la Garza, Y., Graviss, E., Shandera, W., et al. (1998) Epidemiology of neurocysticercosis in
Houston, Texas. International Conference on Emerging Infectious Diseases, Atlanta, Georgia (abstract).
20. Allan, J.C., Velasquez-Tohom, M., Garcia-Noval, J., et al. (1996) Epidemiology of intestinal taeniasis
in four, rural, Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157165.
21. Sorvillo, F.J., Waterman, S.H., Richards, F.O., et al. (1992) Cysticercosis surveillance: locally acquired
and travel-related infection and detection of intestinal tapeworm carriers in Los Angeles. American
22. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis
and treatment. Pediatrics 82, 7682.
23. Kramer, L.D., Locke, G.E., Byrd, S.E. (1989) Cerebral cysticercosis: documentation of natural history
with CT. Radiology 171, 459462.
24. Centers for Disease Control and Prevention (1992) Locally acquired neurocysticercosis North
Carolina, Massachusetts, and South Carolina, 19891991. Morbidity and Mortality Weekly Report 41,
14.
25. Schantz, P.M., Moore, A.C., Muoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692695.
27. Ciesielski, S.D., Seed, J.R., Ortiz, J.C., et al. (1992) Intestinal parasites among North Carolina migrant
farmworkers. American Journal of Public Health 82, 12581262.
15
Armando E. Gonzalez, Patricia P. Wilkins and Teresa Lopez
Introduction
Porcine cysticercosis visibly affects the quality of pork and results in widespread economic losses in areas where Taenia solium is
endemic. The rates of porcine infection are
variable, but in highly endemic regions, over
20% to 42% of pigs may be infected1. Figures
obtained from slaughterhouse inspection
generally provide lower levels of infection
because obviously infected pigs are not
brought to the abattoir for slaughter2.
Diagnostics
Infection by T. solium in pigs can be detected
by one of three methods: necropsy, palpation
or visualization of cysts in the tongue, and
immunological assays to demonstrate either
antibodies or circulating antigen. The first is
not practically useful, as most infected pigs
are killed in a clandestine manner2. Tongue
examination, although specific, is only moderately sensitive, requires highly trained personnel, is time-consuming and involves the
risk of being bitten3,4. Immunological assays
appear to be best suited for field surveys.
Pigs can be bled rapidly from the anterior
vena cava, a task that requires less training,
and involves less danger than examination
of the tongue3.
Before development of the enzymelinked immunoelectrotransfer blot (EITB),

serological diagnosis of porcine cysticercosis
was hampered by the lack of a reliable test
to establish previous exposure to T. solium
eggs. The EITB, which utilizes purified glycoprotein antigens, is highly specific and
more sensitive than either ELISA or tongue
examination for the detection of T. solium
infection in pigs3,5.
Other serological methods have also been
developed for the surveillance, control and
prevention of porcine cysticercosis (reviewed
in Chapters 33 and 34). Glycoproteins purified from T. solium cysts by isoelectric focusing6, as also four polypeptides found in the
soluble fraction prepared from T. solium
cysts7, were shown to react with sera from
pigs with confirmed cysticercosis in ELISA
and immunoblot formats. Four antigen
preparations from T. solium and T. crassiceps
were evaluated for the diagnosis of porcine
cysticercosis810. These studies found that
antigens from T. crassiceps cyst fluid were
superior to crude extracts prepared from T.
solium. Also, an ELISA that used
excretorysecretory antigens, prepared from
in vitro cultured T. solium cysticerci, was
shown to be highly sensitive and specific11.
The presence of T. solium specific antibodies does not always correlate with the detection of parasites at necropsy; often, positive

145
146
A.E. Gonzalez et al.
serological results are obtained and subsequent necropsy results are negative. DSouza
and Hafeez described that 33.33% of freeranging pigs, in which parasites could not be
detected at meat inspection, were positive
using ELISA11. This problem affects any antibody-based diagnostic test, including the
highly sensitive and specific EITB assay.
Sciutto et al. reported that antigen and antibody detection assays showed lower sensitivity and specificity when used in pigs that
were reared in rural environments versus
those raised on commercial farms12. These
data demonstrate that it is not uncommon to
detect specific antibody responses in pigs
from endemic areas, especially if pigs are
free ranging. A positive serological result in
the face of a negative necropsy could occur
from either prior effective treatment, past
infection that has cleared, or exposure to T.
solium, among other explanations.
In the past, when investigators used the
EITB to diagnose porcine cysticercosis, the
problem of passively transferred maternal
antibodies was recognized as a potential
source of bias13. The presence of passive antibodies hampers the use of cohort studies for
porcine cysticercosis because in highly
endemic villages most piglets must be
excluded due to the presence of maternal
antibodies, which cannot be differentiated
from acquired antibodies. Investigators
addressed this issue by sampling only pigs
that were older than 3 months. Later, the
presence of maternal anticysticercal antibodies was noted in sentinel pigs that were older
than 3 months14. Seropositive results that did
not correlate with age were also reported by
others, suggesting that maternally transferred antibodies may confound results

obtained by using serological methods15,16.
Subsequently, it was demonstrated that passive humoral immunity persists in piglets
born to seropositive sows up to 35 weeks
postpartum4. Infection-specific antibody patterns in the piglets are indistinguishable from
maternally transferred antibody reactions. In
contrast, new reaction bands produced by the
piglet alone most certainly represent a new
antigenic stimulus, and therefore are presumed to be the result of new infection14.
Although the presence of antibodies in
necropsy-negative pigs may, in some ways,
limit the use of EITB, the number of bands in
the infected animals suggests that diagnostic
patterns do not happen at random and that
these results may be related to the final infection outcome (A.E. Gonzalez, unpublished
data).
A study was designed to answer some of
these questions to enable a better understanding of the EITB results. A total of 482 pigs were
sampled from an endemic area in Huancayo,
in the Peruvian Central Highlands. A total of
279 pigs were found to be EITB positive. The
prevalence of seropositive pigs in the area was
therefore calculated to be 53.5962.41%
(95%CI). A subset of 84 from the 279 EITB-positive pigs were bought and necropsied. The
number of EITB bands and necropsy results
were registered by age and have been tabulated (Table 15.1). The information (Table 15.1)
was used to develop a stochastic model in a
spreadsheet (Excel 2000) format using simulation software @risk (Palisade). The probability
function of having a necropsy-positive result
Table 15.1. Distribution of necropsy-positive animals by EITB reaction and age.

Age
Number of
EITB bands
diagnosed
12
3
4+
Total
8 months
8 months
Positive
Negative
Positive
Negative
7
5
2
14
13
7
1
21
3
20
3
26
15
7
1
23
EITB: enzyme-linked immunoelectrotransfer blot.
given a band and age combination was simulated using distributions. The original 279
positive pigs were also organized by age and
number of bands (Table 15.2). The confidence
limits for the number of expected positive pigs
for each group were simulated using binomial
distributions that considered the number of
positive pigs observed in each group and the
probability previously calculated. The distributions above described were then used to
simulate the number of necropsy-positive pigs
in each stratum in 500 interactions. The simulation results showed that the mean prevalence of EITB seropositivity was 28% (90%CI:
2233%) (Fig. 15.1).
Antigen detection assays (reviewed in
Chapter 34) have also been evaluated in pigs.
Monoclonal antibodies (MAbs) produced
against T. saginata excretorysecretory products were unable to detect lightly infected
animals17. Brandt et al. developed an assay
using two MAbs that recognized antigenic
components of T. saginata18. Although the
sensitivity of the test varied from one animal
Table 15.2. Frequency of positive pigs by age.

Bands
8 months
8 months
78
39
15
47
75
25
12
3
4+
147
to another, the minimum number of living

cysticerci that could be detected was 88.
Animals harbouring only dead cysticerci
gave negative reactions and cross-reactions
were observed with sera infected by other
taeniids. The test was also able to detect circulating antigen in sheep and pigs, infected
with T. ovis and T. solium respectively, and in
serum samples of confirmed cases of human
cysticercosis18. Another MAb, the HP10, generated against a repetitive epitope present on
the surface and in excretorysecretory antigens of T. saginata cysticerci was selected for
its ability to detect circulating antigen in a
double antibody sandwich ELISA19. The
assay was evaluated in a randomized study
using control, positive, negative and heterologous infection sera (A.E. Gonzalez, unpublished data). Sensitivity and specificity
values were calculated using sera (that
served as control) from 40 necropsy-positive
pigs with varying infection burdens and 40
necropsy-negative pigs from non-endemic
areas. Cross-reactions were evaluated using
sera from pigs infected with Cysticercus
tenuicollis, hydatid cysts and liver flukes.
Sensitivity was 83% (95%CI: 7194%) with a
specificity of 88% (95%CI: 7798%). After
grouping positive sera according to infection
burden, it was found that 10 of 15 (67%) sera
from mild infections, 10 of 12 from moderate
infections (83%) and 13 of 13 from heavy
infections gave positive results. Also, 24 of 27
Distribution for prevalence/H27
16
Mean = 0.2790083
14
12
10
8
6
4
2
0
0.18
0.23
0.28
0.33
90%
5%
0.23
0.38
5%
0.33
Fig. 15.1. Simulated prevalence of Taenia solium cysticercosis in swine.
148
sera from pigs infected with C. tenuicollis

reacted in the antigen detection ELISA.
Cross-reactions with hydatid, liver fluke and
mixed infections (C. tenuicollis and either
hydatid or liver fluke) occurred with 1 of 13
(8%), 0 of 4 (0%) and 25 of 28 (89%) samples,
respectively. Although this antigen detection
assay may be potentially used to monitor
treatment and experimental infections, the
use of the test is limited to those areas with a
low prevalence of T. hydatigena infections
(A.E. Gonzalez, unpublished data).
Epidemiology
Field epidemiology
The prevalence and risk factors for T. solium
infection in pigs were studied in a rural population in Michoacan State, Mexico2022.
Visual inspection of the tongues of 216 pigs
revealed cysticerci in 14 (6.5%). The prevalence was slightly but not significantly higher
in male (10 of 105) than female pigs (4 of 110).
The most important risk factors for infection
in pigs were access to human faeces, the presence of an indoor latrine, and indiscriminate
disposal of human faeces around the pig
owners household21,22. Similarly, the seroepidemiology of human and porcine cysticercosis using an EITB assay was studied in a
Peruvian jungle community23. Sera and
stools were collected from nearly all villagers.
Those positive for tapeworm eggs or who
were serologically positive were treated.
Thirty (8%) of the 371 inhabitants were
seropositive. After niclosamide therapy, four
Taenia sp. worms were identified in the EITB
positive group compared with one in the controls (P=0.06). Pigs were found to be frequently infected; 32% had positive tongue
examination and 43% were positive by EITB.
Interestingly, the main risk factor for porcine
cysticercosis was the presence of a latrine in
the house, corroborating the previous report
from Mexico. Of the households 71% had at
least one EITB positive pig. Two years later,
a serological survey of pigs less than 1 year
old was able to demonstrate that over 40%
of the pigs remained serologically positive23.
These results strongly suggest that high lev-
els of environmental contamination by T.

solium eggs persisted in the village. Whether
this represented eggs that had survived in
the soil, or were disseminated by new or
previously untreated human infection cannot be determined.
As in Latin America, porcine cysticercosis
caused by T. solium is a widespread infection
in Africa in those areas where free-ranging
pigs wander about in the villages, and are
raised in the traditional way. The reported
prevalences in Zaire ranged from 10% to
30%24. The overall prevalence of porcine cysticercosis found in three slaughterhouses in
Tanzania was 13%25. The prevalence of T.
solium cysticercosis in slaughter pigs was
studied in the Nsukka area of Enugu State,
Nigeria26. Infection status was diagnosed by
ante-mortem examination of the tongue and
detailed post-mortem examination of the carcasses using standard meat-inspection procedures. Over 20% (483 of 2358) of the pigs
were found to be positive26.
An appraisal of the environmental

contamination by T. solium
Direct appraisal
A field study performed in Peru showed
that it was not possible to demonstrate environmental contamination by Taenia eggs
using standard techniques23. Five samples of
river water obtained at different points were
pumped through a 0.1 m nylon filter.
Water quantity varied between 200 and 400 l
depending on the amount of sediment present in the water. In addition, five soil samples were taken near the edge of stool pits or
latrines and examined for the presence of
Taenia sp. eggs using sedimentation techniques. None were positive for Taenia eggs23.
Likewise, in a study carried out in a rural
community in Mexico, 400 soil samples and
600 flies were examined for the presence of
Taenia sp. eggs, all with negative results27.
Direct detection of eggs in the environment
is extremely difficult because Taenia sp. eggs
are scarce and large amounts of soil must be
processed and examined microscopically to
find a single egg28.
Sentinel pigs
Most cysticercosis intervention programmes
use human antiparasitic treatment, stool
examination and human serodiagnosis to
determine disease prevalence, but these methods are generally expensive, slow and difficult to comply with, partly because of cultural
problems associated with obtaining human
blood and stool samples29,30. Indicators of success of therapy in village treatment schemes
have been difficult to measure. Documentation of significant changes in an ideal
indicator would best be accomplished by one
which requires a small number of subjects,
permits sampling at least once a year, is culturally acceptable and feasible to perform in
rural communities. The prevalence of neurological symptoms in the human population
has been claimed to change in a few years
after an intervention programme31. However,
there are too many unknown parameters
behind this: What proportion of infected
humans will have brain cysts?; What proportion of these will ever be symptomatic?; What
proportion of old infections will become
apparent years after? Similarly, nothing is yet
known about clinical significance and the rate
of change in the serological status of infected
humans in field conditions. Detection of
human taeniasis is difficult because of its low
prevalence and the poor sensitivity of available assays. Testing pigs for infection by serology fulfils the requirements for consideration
as an ideal indicator of the presence of T.
solium as a whole, both among different hosts,
and in the environment. Since pigs become
infected only by ingesting eggs from human
faeces, pig infection rates must, therefore,
reflect the relative quantity of T. solium eggs in
the environment. Obtaining blood samples
from pigs is acceptable to villagers, and is easily performed; thus, serodiagnosis in pigs
may be a valid and practical way to monitor
the potential for cysticercosis infection and
can be used to evaluate the efficacy of control
programmes. Monitoring T. solium transmission by evaluating the porcine population is
more sensitive than sampling human populations, because porcine prevalence is usually
double that of human prevalence. Infection
occurs over a much smaller period of time (a
149
pigs life span rarely exceeds 1 year, whilst

human life span is 60 years on average).
Furthermore, the pig is constantly sampling
its environment and thus is a very sensitive
indicator of the prevalence of the parasite.
Changes in the percentage of infected pigs
mirror changes in the intensity of environmental contamination. Pigs are generally sold
at less than 1 year of age, therefore, there is a
regular supply of new, susceptible animals
available for study32. Disease acquisition can
easily be determined, since each year there is
a new population of pigs.
Twelve 2-month-old piglets from Lima,
Peru (a non-endemic area for T. solium cysticercosis) were tested by serum EITB for T.
solium antibodies and relocated to Maceda, an
endemic area13. All native 2-month-old piglets
in Maceda (n=157) were also tested by EITB at
the same time. The 12 non-native pigs and 28
surviving native pigs were re-tested at 9
months of age. The dams of 115 of the native
piglets were also tested, and these piglets were
evaluated at 5 and 9 months of age. In piglets
from infected (EITB-positive) sows, reactions
to bands that were different from those of the
mother were presumed to indicate new infection. Of the 12 non-native pigs, four (33%) had
acquired antibody to EITB bands after 9
months, but these bands were rather faint. Of
28 native pigs, 18 (64%) acquired new infection by 9 months of age; 56% (nine of 16) of the
initially negative pigs showed antibody bands
and 75% (nine of 12) of the initially positive
native pigs showed new antibody bands.
Results indicated a trend for higher infection
rates (though not statistically significant) in
native pigs. Three years before this experiment, mass niclosamide chemotherapy had
been given to 93% of the seropositive humans
in the village of Maceda. At that time, 43% (67
of 153) of all pigs were EITB positive13. The
results showed that environmental contamination with T. solium eggs was persisting at the
time of the second study and that niclosamide,
as applied, did not break the cycle of infection and transmission. Furthermore, as pig
populations were renewed yearly, EITB positivity rates in piglets less than 1 year old permitted assessment of interventions and
intensity of environmental contamination by
T. solium with time2.
150
The feasibility of using sentinel pigs as a

surveillance tool in intervention programmes, as well as an alternative to experimental infection, was further assessed in two
trials32. In the first, 51 sentinel pigs were
exposed to T. solium eggs from February to
April 1996 (Casacancha) and April to June
1996 (Rangra). In the second trial, a total of
38 sentinel pigs were relocated and exposed
in Casacancha during April to June 1997.
Basically, the sentinel pig model consists of
relocating a group of susceptible pigs from a
cysticercosis-free area into an endemic
region. After 3 months of exposure, pigs are
transported to a cysticercosis free area, kept
for an additional 3-month period to allow for
cysts to achieve full growth, and then killed.
The infection status is determined by serological examination and detailed necropsy32.
The experiments were successful in
Casacancha, where over two-thirds of sentinel pigs were recovered at both opportunities, but not in Rangra, where only one-third
of animals were recovered. The low recovery
percentage in Rangra prompted the cancellation of this village in the second experiment.
The overall attack rate for the first trial was
50% (12/24). Ten out of the 12 EITB-positive
pigs had cysts or cyst scars at necropsy.
Apparently, the infection rate was higher in
Rangra (7 of 10) than in Casacancha (5 of 14)
in the first trial, but the numbers involved
were small and hence not statistically significant. The overall attack rate in the second
trial was 55% (16 of 29). Again, almost all the
EITB-positive pigs yielded necropsy-positive
results (15 of 16). The application of the sentinel pig model demonstrated a high level of
environmental contamination in the study
area in both trials. Currently used monitoring tools (slaughterhouse inspection, search
for Taenia eggs in the environment, estimation of porcine cysticercosis by tongue examination or serology, estimation of the
prevalence of human taeniasis by stool
examination, of human neurocysticercosis
(NC) by clinical screening, or of human cysticercosis by serology) would not have permitted this demonstration. In Peru, as in
other developing countries, pigs do not
always go through slaughterhouse inspection. Even if available, villagers would not be
willing either to pay for the service, or

expose their animals to the risk of confiscation2. Evaluation of environmental contamination by direct detection of T. solium eggs in
the soil has proved inefficient every time it
has been tried. Taenia sp. eggs are rarely
found in soil or water, or even in sewage-irrigated vegetables13,29,30. Tongue examination
of pigs will only detect a subset of heavily
infected animals, and miss out on infections
outside the tongue3. More importantly,
tongue examination is familiar to villagers,
and the decision to bring their pigs for
inspection may be biased towards bringing
only healthy pigs if they have fear of confiscation, or only those pigs more at risk if they
feel they can use the service to screen their
animals2. Serological determination of
porcine prevalence is somewhat similar to
the sentinel pig model, but has the disadvantage of dealing with a population with a fast
turn-over and long-lived passive anticysticercal antibodies4.
Socio-economic aspects
Economic losses resulting from food-borne
parasitic zoonoses are difficult to assess.
Estimation of the global economic impact of
these diseases is handicapped by inadequate
information on the prevalence and public
health importance of parasitic zoonoses for
most countries. However, the economic
losses due to porcine cysticercosis have been
estimated for some countries; in these
instances the costs are significant33. In
Mexico, for example, porcine cysticercosis is
responsible for a loss of more than one-half
of the national investment in swine production whereas for all Latin America, porcine
cysticercosis accounts for an economic loss
of US$164 million34. Besides, T. solium not
only causes severe economic losses to the
pig industry but also causes a severe
zoonotic disease35.
Peasants practise pig rearing for shortterm savings. Furthermore, they optimize
the profit of rearing pigs by keeping investment to a minimum. This attitude towards
pig rearing explains why pigs range freely to
obtain a variety of foods, including human
faeces36. The driving force behind peasants

practices and attitudes to T. solium is the economic benefit in the short- and mid-term
periods. People will require an economic
incentive for changing their pig-rearing practices. Control strategies that fail to recognize
the economic significance of pig keeping are
unlikely to be successful in controlling T.
solium. An interesting observation in a rural
community in coastal Peru illustrates this
point36. Factors responsible for the reduction
in the prevalence of porcine cysticercosis in
this community over a 2-year period were
studied. The decrease was found to be linked
to the practice of corralling or tethering of
pigs, which was enforced to protect the
recently introduced rice crop from being
ruined by free-ranging pigs (see Chapter 8).
Rice cropping was not only more profitable,
but also provided by-products to feed the
corralled pigs. Therefore, the community
agreed to corral their animals. Porcine cysticercosis then decreased because tethering
and corralling indirectly prevented the animals from accessing human faeces.
Use of geographic information systems

(GIS) to elucidate transmission of porcine
cysticercosis
The survival and dispersal in T. solium eggs
is believed to be similar to those of T. hydatigena and T. ovis37. It has been demonstrated
that although most of the eggs of the latter
parasites remain within about 180 m of the
site of deposition, some disperse rapidly in
all directions by means of agents of egg dispersal, such as birds, wind, rainfall, arthropods, earthworms, the feet of other animals
and blowflies38,39. However, T. solium eggs
may not require dispersion of eggs to infect
intermediate hosts. Pigs actively seek and
readily ingest human faeces, thus favouring
clusters of cases around tapeworm
carriers37. A GIS database was used to investigate the presence of clusters in T. solium
cysticercosis and examine the relationship
between adult tapeworm carriers and intermediate hosts (A.E. Gonzalez, unpublished
data). The GIS has been used for spatial
analysis of vector habitats and infections
151
and consequent risk assessment in other

tropical disorders such as malaria, onchocerciasis and schistosomiasis4042. Global positioning satellite technology was used to
determine the exact position of every household in a village with sub-metre accuracy40.
After processing, global positioning satellite
files were directly exported to a GIS database for analysis, showing that clusters of
incident cases are related to tapeworm carriers (Fig. 15.2). Although T. solium cysticercosis
clusters
have
been
previously
demonstrated using prevalence data, the
clusters were not as clearly defined as when
incident cases were studied using the GIS
technique. Furthermore, the map made evident that not all tapeworms contaminate the
environment. It became clear that careful
observation of infection within longitudinal
studies provided the most useful information on transmission dynamics.
The marketing of cysticercotic pigs in the

Sierra of Peru
In Peru, consumption of pork supplied from
regulated slaughterhouses is primarily
restricted to the large cities on the coast.
Approximately 65% of the pork consumed
in the country is obtained through informal
channels that are not inspected or supervised. The pathways via which pigs are sold
were studied in Huancayo (population:
500,000; altitude: 3215 m), a major commercial and agricultural city, 560 km west of
Lima, in the Peruvian Sierra (Central
Highlands), where cysticercosis is endemic.
Official purchase, slaughter and market
records were reviewed in addition to direct
surveys and participant observation carried
out at two informal meat markets in
198819892. Based on estimates by the
National Statistics Office, 1988, there were
35,000 pigs in Huancayo. Of this number,
25,000 were butchered every year (c. 1220
tonnes of meat per annum). Officially, none
of the inspected and condemned meat in
Huancayo was reported to be cysticercotic.
The two official abattoirs butchered only 18
pigs in 1988 and none in 1989. The meat sold
in the official market was graded for its
152
Incident pigs
one
two
Taenia
one
two
House
Road
River
Main square
Other buildings
Ruins
Llacta
100 0
100 200 300 400 500 600 700 800 900
Fig. 15.2. GIS map of a village endemic for Taenia solium cysticercosis depicting location of tapeworms
and incident pigs.
quality and inspected for cysticercosis. No

restrictions were placed on the sale of the
meat, based on where or how the carcass
was obtained. Infected meat was not sold in
the official market. At four visits to the market for the purpose of direct observation,
220 pig carcasses were inspected and only
two were found to be infected. These carcasses were then returned to their owner.
Observations were then carried out at two
local live pig markets in the area surrounding Huancayo. Official pig inspections were
never observed in over ten separate visits to
each fair. Instead, tongue examinations were
routinely performed by local peasants in an
attempt to establish the value of the pigs.
Infected pigs were often bought by buyers

because of their low price. Buyers mentioned that they also examined the pigs
tongues for scars; sellers would apparently
excise cysts from the tongue in order to
increase the market value of the pigs. Based
on findings of the tongue examinations performed by buyers, approximately 15% of the
pigs sold in the live market were considered
to be infected.
A total of 52 pigs were inspected at six
informal slaughterhouses. Examination of the
heads and carcasses of these pigs indicated
that seven (14%) had cysticercotic cysts in the
muscles or brain. Interviews with the informal butcher revealed that infected meat was
sold either to another city or for use in fried

pork (chicharrones). Infected meat was sold
only to selected individuals known to the
seller. Two processed meat sellers were interviewed, both admitted to selling infected
meat; small quantities of infected meat were
mixed with non-infected meat, and the mixture was then roasted or fried in fat.
Intramuscular Oncosphere Assay

(IMOA): a Novel Experimental
Infection Model to Evaluate
Chemotherapeutic Agents
Previously, experimental models for taeniid
tapeworms have employed oral challenge of
hosts, other than the natural intermediate
hosts (e.g. sheep for T. saginata, SCID mice for
Asian Taenia and T. solium, and rodents for T.
solium) (reviewed in Chapter 4)4346. Methods
other than oral egg challenge, for instance,
intramuscular injection of T. saginata oncospheres and subcutaneous T. solium and Asian
Taenia oncosphere injection in SCID mice
have also been tried. Currently, the evaluation of porcine cysticercosis model vaccines is
limited to pigs infected through the oral route
because no other experimental model exists.
However, infecting pigs with eggs or proglottides requires very large numbers of infective
eggs and results in unpredictable numbers of
cysts. No more than 21 cysts were found in
any of the pigs when infected with three
gravid proglottides in one experiment47. In
another Mexican study, oral challenge with
105 eggs eventually produced from four to
212 cysts per pig48. The poor yield may be
due to variations in intestinal transit times,
which might affect the dissolution of the
eggshell. Furthermore, obtaining T. solium
with gravid proglottides is not easy since
standard therapy with niclosamide or praziquantel often destroys the proglottid. In addition, each experiment requires the use of
25,000100,000 eggs to obtain reasonable
infection. The large number of eggs required
for each animal restricts studies to a small
number of animals. These limitations of the
oral model have prevented its widespread
use in vaccine and therapeutic trials.
153
A novel method for infecting pigs with T.

solium using an intramuscular inoculum of
oncospheres was investigated in a series of
five experiments in 18 animals49. The first
experiment evaluated three routes of infection: intraperitoneal (IP; n=4), intravenous
(IV; n=2) and intraduodenal infection (n=1)
with either 6000 or 15,000 oncospheres.
Successful infections were obtained following IP and IV inoculation. All cysts in IP
inoculated pigs were viable, whilst cysts
were either viable or degenerated in IV inoculated pigs. After one IP inoculation, a welldefined cluster of 35 cysts was found in the
abdominal muscle. It became apparent that
the injection of oncospheres was accidentally
made into the muscle rather than into the
peritoneal cavity. The results prompted four
consecutive experiments devoted to standardize inoculation site, time to necropsy,
and inoculation dose via the intramuscular
route and to evaluate the feasibility of oncosphere activation in the intramuscular model.
Histopathologically, the cysts that developed
in the IMOA were no different from those
seen with natural infection.
The IMOA model is simple to perform,
requires a minimal number of oncospheres,
permits multiple infections per animal, and
decreases the variability in the numbers of
cysts recovered, inherent to oral infection
models. The direct injection technique is simple and reproducible. It produces relatively
constant levels of infection with the same
inoculum in different pigs. Also the number
of cysts produced is relatively large so that
differential effects can be easily observed. In
contrast, an intestinal model permits only
one inoculum per test pig and produces
marked variation in the number of animals
infected and in cyst numbers. Thus, the
IMOA may be a valuable tool to evaluate
therapeutic agents or potential vaccines for
porcine cysticercosis.
Immunity to T. solium was investigated
using the IMOA model in a series of experiments (M. Verastegui, A.E. Gonzalez, R.H.
Gilman et al., unpublished observations).
Three naturally infected pigs were treated
with oxfendazole and then inoculated with
oncospheres using the intramuscular route
3 months after treatment. None of the
154
treated pigs developed cysts after intramuscular inoculation, while the three uninfected, untreated, control pigs developed
intramuscular cysts following inoculation,
confirming that successful treatment with
oxfendazole provided immunity against
further challenge. In a second experiment,
two pigs were injected with oncospheres
once a week, at different sites. No new cysts
developed after the second injection in
these pigs. In a third study, two groups of
three pigs each were immunized with crude
T. solium oncosphere and metacestode antigens, respectively, and subsequently inoculated intramuscularly with oncospheres.
Immunization with crude oncosphere antigens induced 100% protection, whilst
metacestode antigens provided partial protection to oncosphere challenge since animals immunized with this antigen produced
some, albeit degenerated, cysts. These
results are similar to other studies where
immunization with metacestode extracts did
not appear to provide complete protection
against cysticercosis (see Chapter 3).
Conclusions
The study of the epidemiology of porcine
cysticercosis has now provided important
insights in to the burden and control of T.
solium infection. Three methods are available
for the determination of the prevalence of
cysticercosis in pigs: tongue inspection and

palpation, meat inspection in abattoirs and
serum EITB. The last of these has been found
to be most sensitive, specific, safe and economical. The prevalence of porcine cysticercosis in a population at any given time has
been shown to be a sensitive indicator of the
current levels of T. solium in that population.
The sentinel pig model has been found to be
particularly useful in this regard. Briefly, it
involves translocation of pigs from a cysticercosis-free zone to an endemic zone for 3
months and then back to the former for
another 3 months. Porcine infection rates are
determined at the end of 6 months; they
indicate levels of T. solium infection in the
endemic community.
Porcine cysticercosis not only poses
health hazards to humans but is a major
cause for economic loss to pork-producing
farmers since the price of infested pork is
considerably less than that of healthy pork.
Therefore, control of porcine cysticercosis
accrues not only health-related but also
financial benefits. The viewpoint that only
those control measures that provide economic benefits are likely to be successfully
implemented is presented. However, for the
present, most cysticercotic pigs bypass official meat inspection channels in developing
countries; this is a major cause for concern
to all involved in initiatives to control T.
solium infection through strategies targeting
the pig.
References
1. Garca, H.H., Gilman, R.H., Gonzalez, A.E., et al. (1999) Epidemiology of Taenia solium infection in
Peru. In: Garca, H.H., Martinez, S.M. (eds) Taenia solium Taeniasis/Cysticercosis. Editorial Universo,
Lima, Peru, pp. 297306.
Bulletin of World Health Organization 71, 223228.
in porcine Taenia solium cysticercosis. American Journal of Tropical Medicine and Hygiene 86, 113118.
5. Tsang, V.C.W., Brand, J., Boyer, E., et al. (1989) Enzyme-linked immunoelectrotransfer blot assay and
glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious
Diseases 159, 5059.
6. Pathak, K.M., Allan, J.C., Ersfeld, K., et al. (1994) A western blot and ELISA assay for the diagnosis of
Taenia solium infection in pigs. Veterinary Parasitology 53, 209217.
155
7. Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins
8. Nunes, C.M., Biondi, G.F., Heinemann, M.B., et al. (2000) Comparative evaluation of an indirect
ELISA test for the diagnosis of swine cysticercosis employing antigen from Taenia solium and Taenia
crassiceps metacestode. Veterinary Parasitology 93, 135140.
9. Pinto, P.S., Vaz, A.J., Germano, P.M., et al. (2000) ELISA test for the diagnosis of cysticercosis antigens of Taenia solium and Taenia crassiceps. Revista do Instituto de Medicina Tropical (So Paulo) 42,
7179.
10. Pinto, P.S., Vaz, A.J., Germano, P.M., et al. (2000) Performance of an ELISA test for swine cysticercosis antigens of Taenia solium and Taenia crassiceps. Veterinary Parasitology 88, 127130.
11. DSouza, P.E., Hafeez, M. (1999) Detection of Taenia solium cysticercosis in pigs by ELISA with an
excretory-secretory antigen. Veterinary Research Communications 23, 293298.
12. Sciutto, E., Aluja, A., Fragoso, G., et al. (1995) Immunization of pigs against Taenia solium cysticercosis: factors related to effective protection. Veterinary Parasitology 60, 5367.
14. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium cysticercosis in pigs in
a rural community of Honduras. Veterinary Parasitology 14, 233238.
15. Sciutto, E., Martinez, J.J., Villalobos, N.M., et al. (1998) Limitations of current diagnostic procedures
for the diagnosis of Taenia solium cysticercosis in rural pigs. Veterinary Parasitology 79, 299313.
16. Geerts, S., Kumar, V., Mortelmans, J. (1981) Sheep as an experimental model of Taenia saginata cysticercosis. Tropical Animal and Health Production 13, 3740.
17. Harrison, L.J.S., Parkhouse, R.M.E. (1985) Antigens in taeniid cestodes in protection, diagnosis and
escape. Current Topics in Microbiology and Immunology 120, 159172.
18. Brandt, J.R., Geerts, S., De Deken, R. (1992) A monoclonal antibody-based ELISA for the detection of
circulating excretory-secretory antigens in Taenia saginata cysticercosis. International Journal of
19. Harrison, L.J.S., Joshua, G.W., Wright, S.H., et al. (1989) Specific detection of circulating/secreted
glycoprotein of viable cysticerci in Taenia saginata cysticercosis. Parasite Immunology 120, 159172.
20. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations on porcine cysticercosis in
a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195201.
21. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan State, Mexico. Transactions of the Royal Society
22. Sarti, E., Schantz, P., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis
24. Chartier, C., Mutesi, U., Ndakala, N.O. (1990) Helminths of domestic pork in Ituri, Upper Zaire.
Annales de la Societe Belge de Medicine Tropicale (Brussels) 70, 213225.
25. Bao, M.E., Bogh, H.O., Kasuku, A.A., et al. (1995) The prevalence of Taenia solium metacestodes in
pigs in northern Tanzania. Journal of Helminthology 69, 270.
26. Onah, D.N., Chiejina, S.N. (1995) Taenia solium cysticercosis and human taeniasis in the Nsukka area
of Enugu State, Nigeria. Annals of Tropical Medicine and Parasitology 89, 399407.
27. Keilbach, N.M., De Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis-cysticercosis (Taenia
solium): experiences in a Mexican village. Acta Leiden 57, 181189.
30. Sarti, E., Schantz, P.M., Avila, G., et al. (2000) Mass treatment against human taeniasis for the control
of cysticercosis: a population-based intervention study. Transactions of the Royal Society of Tropical
31. Fernandez, M., Gutierrez, A. (1986) Como son las Comunidades de la Zona Intermedia del Valle del
Montaro, La Gardenia. Serie Comunidades, Lima, Peru, 50 pp.
156
32. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Sentinel pigs to monitor Taenia solium transmission in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 65, 3132.
33. Murrel, K.D. (1991) Economic losses resulting from food-borne parasitic zoonosis. Southeast Asian
34. Acevedo-Hernandez, A. (1982) Economic impact of porcine cysticercosis. In: Flisser, A., Willms, K.,
Laclette, P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New
York, pp. 6368.
35. Gonzalez, A.E. (1977) Evaluation of a Control Programme for Taenia solium Cysticercosis Targeting
Human and Porcine Health. PhD thesis. University of Reading, Reading, UK.
36. Gilman, R.H., Garca, H.H., Gonzalez, A.E., et al. (1999) Short cuts to development: methods to control the transmission of cysticercosis in developing countries. In: Garca, H.H., Martinez, S.M. (eds)
Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313326.
37. Gemmel, M.A. (1999) Current knowledge of the epidemiology of the family Taeniidae: operational
research needs in planning control of Taenia solium. In: Garca, H.H., Martinez, S.M. (eds) Taenia
solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 219244.
38. Lawson, J.R., Gemmell, M.A. (1985) The potential role of blowflies in the transmission of taeniid
tapeworm eggs. Parasitology 91, 129143.
39. Lawson, J.R., Gemmell, M.A. (1990) Transmission of taeniid tapeworm eggs via blowflies to intermediate hosts. Parasitology 100, 143146.
40. Hightower, A.W., Klein, R.E. (1995) Building a geographic information system (GIS) public health
infrastructure for research and control of tropical diseases. Emerging Infectious Diseases 4, 156157.
41. Malone, J.B., Huh, O.K., Fehler, D.P., et al. (1994) Temperature data from satellite imagery and the
distribution of schistosomiasis in Egypt. American Journal of Tropical Medicine and Hygiene 50,
714722.
42. Richards, F.O. (1993) Use of geographic information systems in control programs for onchocerciasis
in Guatemala. Bulletin of the Pan American Health Organization 27, 5255.
43. Gemmell, M., Matyas, Z., Pawlowsky, Z., et al. (1983) Guidelines for Surveillance and Control of
Taeniasis/Cysticercosis. VPH/83.49. World Health Organization, Geneva, Switzerland, pp. 1207.
44. Froyd, G., Round, M.C. (1960) The artificial infection of adult cattle with Cysticercus bovis. Research in
Veterinary Science 1, 275282.
45. Ito, A., Ito, M., Eom, K.S., et al. (1997) In vitro hatched oncospheres of Asian Taenia from Korea and
Taiwan develop into cysticerci in the peritoneal cavity of female scid (severe combined immunodeficiency) mice. International Journal of Parasitology 27, 631633.
46. Ito, A., Chung, W.C., Chen, C.C., et al. (1997) Human Taenia eggs develop into cysticerci in scid mice.
47. Pathak, K.M., Gaur, S.N. (1990) Immunization of pigs with culture antigens of Taenia solium.
Veterinary Parasitology 34, 353356.
48. Nascimento, E., Costa, J.O., Guimaraes, M.P., et al. (1995) Effective immune protection of pigs
against cysticercosis. Veterinary Immunology and Immunopathology 45, 127137.
49. Verastegui, M., Gonzalez, A., Gilman, R.H., et al. (2000) Experimental infection model for Taenia
solium cysticercosis in swine. Veterinary Parasitology 20, 3344.
16
Taenia solium: a Historical Note

Noshir H. Wadia and Gagandeep Singh
The farther backwards you look, the farther forwards you can see.
Winston Churchill
Introduction
The amazing incongruities and controversies
of Taenia solium cysticercosis make sense once
we understand the origins of the knowledge
regarding the disorder and the parasite. The
authors of this chapter have attempted to
trace early knowledge about the pathogen, T.
solium and its biological behaviour that then
led to realization of the malady it caused and
its treatment. The essay consists of random
notes and is not intended to be a comprehensive and complete review of the history of T.
solium cysticercosis.
Early Historical Impressions

Among the earliest references to tapeworms
are the works of ancient Egyptians that date
back to almost 2000 BC. Evidence that the
Egyptians were aware of the existence of
tapeworms is available from the study of the
Ebers papyrus, a written documentary of
the Egyptian perception of maladies of a
non-surgical nature and their medical as
well as mystical treatment1. Indeed, there
are several references to the existence of
worms, including perhaps, schistosomes
and tapeworms and their treatment.

However, Flisser believes that the tapeworms were of the beef Taenia sp. because
the Egyptians never ate pork2.
Infestation of pork with bladderworms
were known to ancient Greeks as well, as is
apparent from mention of measled pork in
the History of Animals written by Aristotle
(384322 BC)3. However, the Greeks did not
appreciate the helminthic origin of measled
pork. A reference to cysticercosis was perhaps made by Aristophanes in his comedy,
The Knights, in the 5th century BC. In the
play, a slave mentioned examining another
persons tongue in the same way as one
would examine a pigs tongue to see if he
was measled. Further down in history,
Pliny (AD 2579) was perhaps the first to use
the term, Taenia2. Arabian physicians
around AD 1000 classified parasitic heminths
into longworms, tapeworms, roundworms
and smallworms2,4. It is believed that their
concept of tapeworm was actually one of a
chain of worms, each represented by what
we
now
know
to
be
individual
proglottides2. They named these individual
worms as cucurbitini, a name derived
from their resemblance to cucumber seed
but also significant because cucumber seeds

157
158
N.H. Wadia and G. Singh
constituted a herbal remedy for intestinal

taeniasis. References to intestinal parasitism
also appear in the Chinese Yellow
Emperors Canon of Medicine written in 200
BC5. More specifically, Chao alluded to Taenia
in his Etiology and Symptoms of Diseases in AD
6106. The ancient Indian treatise on medicine, the Charaka Samhita also mentions
worms and specifically flatworms, which
are broad, white and tape-like. At one place,
it states that worms (in general) can cause
maladies of the head, where they may be
observed. However, seizures are not mentioned as a symptom of this malady and
there is no reference to pork or meat as a
causative agent in the chapter on epilepsy. It
is thus conjectural if cysticercosis existed in
ancient India.
Beginnings of the Modern

Understanding of the Biology of
T. solium
The classification of tapeworms
Records of modern attempts at understanding the biology, life cycle, morphology and
nomenclature of tapeworms date to AD 1600.
(a)
(b)
For a detailed account of the developments

in classification and nomenclature of tapeworms, the reader is referred to Mnnig
(1950)7. The unravelling of the structure of
the tapeworms is credited to several workers
including Edward Tyson (AD 16501708),
Karl Asmund Rudolphi (AD 17711832) (Fig.
16.1a) and P.J. van Beneden. Carl Linnaeus
(AD 17071778) (Fig. 16.1b) described the
taxonomy of tapeworms, assigning the
genus Taenia for all types of tapeworms in
his work Systema Naturae810. In 1782, Goeze
published Versuch einer Naturgeschichte de
Eingeweidewurmer hierischer Korper and classified tapeworms on the basis of Linnaeuss
nomenclature11. He also put forward the
theory that tapeworms could be inherited.
Rudolph Leuckart (AD 18221898) (Fig. 16.1c)
made notable contributions to the study of
science of tapeworms. Significant among
them were the recognition of facts that T. saginata occurred only in cattle and T. solium in
the pig12. He and Rudolph Virchow were
instrumental in the realization of meat
inspection laws in Germany in the latter part
of the 18th century. He also published a
series of Wandtafeln (wall charts) depicting
the morphology of tapeworms among several other animal species (Fig. 16.2).
(c)
Fig. 16.1. (a) Karl Asmund Rudolphi (17711832). (Source: Parasitology 1921, Vol. 13, Cambridge
University Press, Cambridge, UK. Reproduced with permission.)
(b) Carl Linnaeus (17071778).
(c) Rudolph Leuckart (18221898). (Source: Marine Biological Laboratories. Reproduced with permission.)
T. solium: a Historical Note
159
Fig. 16.2. Wall chart (Wandtafeln) of Rudolph Leuckart, depicting flatworms. (Source: Marine Biological
laboratories. Reproduced with permission.)
The link between adult and larval forms of

tapeworms
The earliest description of cysticercosis was
by Paranolus in 1550, who described vesicles
in the corpus callosum13. Rumler detected
cysts in the dura mater of an epileptic in
158814. None of the early workers recognized

the link between adult tapeworms and cysticercosis. In fact, Goeze segregated tapeworms into two different classes, T. visceralis
(cystic forms) and T. intestinalis (worm-like
forms) based upon whether they were cystic
or worm-like in morphology11. Thus, while
160
he appreciated the proximity of relationship

between cystic tapeworms and adult tapeworms, he did not sense the fact that they
were different stages of the same helminth.
Zeder (AD 1800) was probably the first to use
the term, Cysticercus (cystis: bladder; cercos: tail (Greek)), for the larva of T. hydatigena,
the dog tapeworm. Again, he believed that
the Cysticercus was a distinct genus15.
Much of the credit for establishing a link
between adult tapeworms and Blasenwrmer
or bladderworms goes to Freidrich
Kchenmeister, a German gynaecologist16,17.
Around 1850, he performed a series of experiments first on dogs and then on imprisoned
human convicts. In his preliminary experiments, he fed bladderworms from rabbits to
dogs and demonstrated the subsequent development of the adult tapeworm, T. pisiformis in
dog intestine. Subsequently, he extended his
experimental design to humans awaiting execution in a German prison, whom he fed with
bladderworms from infested pigs. Upon
autopsy after execution of the death sentence,
he detected the presence of developing and
adult tapeworms in the intestines.
Kchenmeisters work was criticized
from several quarters on account of the
ethics of the nature of his experiments and
the validity of his conclusions. For instance,
von Siebold maintained that cysticerci were
tapeworms with hydropically degenerate
bodies, which developed in an abnormal
host4. He however agreed that bladderworms in pigs develop from tapeworm eggs
and were not foreign bodies, as was the prevailing view at that time18,19. Grove describes
the crossfire on the issue of ethics of
Kchenmeisters work in detail20.
Early clinical impressions

In the latter part of the 18th through to the
early part of the 19th century, there were sporadic descriptions of T. solium cysticercosis.
Virchow described racemose cysticercosis in
his paper entitled Traubenhydatiden der
weichen Hirnaut in 186021 (Figs 16.3a, b).
Griesenger, a German psychiatrist, wrote an
account in 1862 of neurocysticercosis (NC)
with emphasis on the seizure disorder. In
1902, Volovatz published an account of 414

patients with cysticercosis. Vosgein described
clinical features in 807 affected individuals
comprising mostly French soldiers who had
lived overseas in his thesis, Le Cysticercus cellulosae chez lhomme et chez les animmaux22.
According to Brumpt, the distribution of cysticerci in the human body in Vosgeins series
was as follows: ocular 46%; central nervous
system 40%; skin 6%; and muscle 3%23.
Later, Henneberg in 1912, described clinical
features and evolved a classification based
upon strictly compartmentalized clinical features, including generalized (actually referred
to as essential) epilepsy, focal epilepsy, neuropsychiatric presentations, intraventricular
cysticercosis, meningeal cysticercosis, spinal
cysticercosis and asymptomatic cysticercosis.
Taenia solium: the British Military

Connection
In the 1930s, interest in the study of human
cysticercosis was aroused by several British
military doctors at the Queen Alexandria
Military Hospital, Millbank, London, including Colonel (later Lieutenant General)
William Porter MacArthur (18841964) and
Colonel (later Brigadier) Henry Byran Frost
Dixon (18911962)2431. At that time, Queen
Alexandria Hospital was a specialist military
facility dealing with infirmity of civilian
nature in army personnel and their families.
Trauma was therefore not a priority here,
and a variety of non-war related ailments
including epilepsy were observed here.
MacArthur first noticed a high rate of
seizures due to cerebral cysticercosis among
soldiers returning after military placements
in India. He thus wrote24: About 100 soldiers
are yearly discharged from the army for
epilepsy; during 1933 twenty cases of cysticercosis were identified at Millbank.
MacArthur published his landmark paper,
Cysticercosis as seen in the British army,
with special reference to the production of
epilepsy in 193425. Sir Hamilton Fairleys
remarks on the title of the paper were explicatory27: The title may suggest that this disease is peculiar to Army, but MacArthurs
experience was limited to the Army.
(b)
Fig. 16.3. (a) Cover of the journal that contains Rudolph Virchows landmark article Traubenhydatiden der weichen Hirnaut, believed to be the first description of racemose
cysticercosis. (Source: Clendening Library of the History of Medicine, Kansas University Medical Center, USA. Reproduced with permission.) (b) Diagrammatic description of the
pathology of racemose cysticercosis by Virchow. (Source: Clendening Library of the History of Medicine, Kansas University Medical Center, USA. Reproduced with permission.)
(a)

161
162
Indeed, an overwhelming majority of

cases of cerebral cysticercosis were drawn
from the Army and included personnel
who were deputed to India, implying that
cysticercosis was acquired from exposure
to T. solium through food during their stay
in India. Even at that time, T. solium infestation was extremely rare in native Britons.
One redeeming aspect of cerebral cysticercosis was that British military provisions
enabled soldiers discharged from duty on
account of seizures with a diagnosis of cysticercosis to a disability pension. In this
regard, the following impressions of
MacArthur are noteworthy25:
Although the diagnosis benefits the man
himself but little, the presence of cysticerci
gives him material gain when it has been
caused by service abroad, it gives him great
mental ease when he can be reassured that
there is no chance of epilepsy appearing in his
children and when mental deterioration
necessitates his certification as insane it carries
to his relatives no slur of familial lunacy.
Insights into the transmission of

T. solium
Mackies comments on MacArthurs presentation on cysticercosis in British troops stationed in India reflect his perceptive views
on the transmission of disease from pig to
man. He stated:
The clinical histories of the cases referred to
seemed to show that most of the patients were
infected in India and, granted that this appears
to be probable, one would like to know more
about the methods of transmission from the
pig to man. Pig meat in any form is a very
unusual article of diet in India Very low caste
Hindus and outcasts and some jungle tribes eat
pig flesh but even then it is generally wild pig
and not domestic animal. The most likely
source of infection for the rank and file is the
cheap eating houses in the bazaars run by
Eurasian or low caste Hindus, where locally
killed pig meat may occasionally be served.
The soldiers referred to by Colonel MacArthur
must obviously be infected either from the
adult T. solium, which they themselves were
harbouring or from someone in close contact
with them or concerned in the preparation of
their food. The presumption is, then, that the
ova were being passed by native servants

employed in the barracks; but as I have said
before, I do not think that even this class of
Indian will eat the flesh of the village pig.
Mackies views were confirmed by several subsequent observations by Dixon and

his colleagues who noted that the disorder
occurred exclusively in corporals and privates, many of whom were cooks and that
the officers were mostly spared. He went on
to advise that the incidence of T. solium infection should be ascertained in Indians, especially the barrackss servants, through the
records of hospitals and laboratories around
military establishments; unfortunately this
does not seem to have been done.
The remarkable British papers have been
quoted somewhat extensively as they reflect
indirectly on the status of the infection in
India then and have much relevance to the
conditions prevailing even today. Though
cysticercosis was documented in large numbers among the British military, reports in
Indian natives were few in comparison, perhaps reflecting different eating habits of the
two. Nevertheless, it is quite evident that
cysticercosis must have been prevalent in
India in the 19th century. Since there is no
earlier record, it remains conjectural as to
when it first appeared. Was it brought by the
pork-eating European conquerors, when
they arrived in the 15th to 17th centuries,
when cysticercosis was known to be prevalent in Europe? Or did traders and travellers
introduce it across the Chinese borders?
After all, predominant vegetarianism and a
taboo against eating pork and rearing pigs,
especially during Mogul rule, was the prevailing practice in India.
Cysticercosis: the clinical disorder
It is said that in the early days of
MacArthurs investigations, it was difficult
to convince the medical profession that
such a condition as cysticercosis ever
existed, but subsequently the pendulum
swung to overdiagnosis. Scores of reports of
cerebral cysticercosis were made around
this time (Fig. 16.4)2431. In one such report,
Dixon remarked28: These two cases illus-
163
Unless evidence of cysticercosis is

systematically sought for, the diagnosis may be
missed, as the subcutaneous nodules which are
suggestive of the disease may be absent of
examination, only to come out in crops at a
later date, remaining for a varying period of
time and then disappearing, and radiological
evidence may not be convincing for some years
as calcification does not usually take place until
some four or five years after infestation.
Every case suspected of cysticercosis should
be re-examined at six-monthly or yearly
intervals for the presence of subcutaneous
nodules and calcification of the soft parts.
Fig. 16.4. Cover of the landmark publication,

Cysticercosis: An analysis and follow-up of 450
cases by H.B.F. Dixon and F.M. Lipscomb published
in 196131. (Source: Wellcome Library for the History
of Medicine, London. Reproduced with permission.)
trate how necessary it is to view with suspicion all alleged idiopathic epilepsy occurring in soldiers, aged 24 to 26, who
suddenly develop fits in the later years of
their service overseas.
The clinical studies carried out at
Millbank were significant in that they clarified several important aspects of the clinical behaviour of the disorder. The
following observations of Dixon and
Smithers exemplify several of such outstanding observations30:
The observations of the British workers

had an impact upon the understanding of
the pathogenesis of the disease. For instance,
MacArthur wondered why new subcutaneous cysts appeared over so many years,
even when the source of infection was no
more present. He showed that the so-called
new cysts were all tense and contained dead
larva and propounded that living cysts were
flaccid and not easily palpable, but with
impending death they became turgid and
tense. In fact, they were not new but old.
He also extrapolated that allied changes
must be affecting the cerebral parasites,
explaining the long delay in the onset of neurological symptoms after the first subcutaneous nodule could be palpated. It was
believed that living cysticerci caused little
nervous disturbance unless lodged in large
numbers in some responsive centre. Indeed,
MacArthur maintained that the varied clinical presentation could be explained on the
basis of the location of the cysticerci. It was
realized that cysticercosis could remain
asymptomatic for prolonged periods of time.
The recognition of the incubation period, i.e.
the period of time that elapsed between
infection with the larval stage of T. solium
and the onset of symptoms of cysticercosis,
was also a derivation from these initial studies3032. The time of initial infection could be
confidently estimated from study of records
of military placements in India, upon an
assumption that T. solium infection was
acquired in India alone, especially since the
T. solium did not occur in Britain. The incubation period so inferred varied between a
few months and 20 years. This was a signifi-
164
cant finding because in several of the subsequent series of cysticercosis that followed
these initial studies and were published from
endemic areas of Brazil and Mexico, it was
not possible to determine the incubation
period, because in endemic regions exposure
could have occurred at any time33,34. Finally,
the fact that symptoms of cerebral cysticercosis were related to degeneration of larvae
was also appreciated:
These parasites cause little disturbance in the
early stages, and the patient may live for years
with numerous cysts in both cerebral
hemispheres. After their death, however, the
parasites may cause symptoms partly by their
toxic effects and partly by their increase in size.
(Dixon and Smithers, 193430)
Early studies, particularly by MacArthur,

pictured a uniformly dismal prognosis of the
disorder, with virtually every case ending up
in lunacy and leading to death2426. Dixon
and Hargreaves disagreed with MacArthurs
view and remarked31:
Our observations have not borne out the view
of MacArthur, who believed that the general
tendency was one of retrogression, as
evidenced by signs of mental deterioration
which might be so marked so as to necessitate
institutional segregation.
When MacArthur reviewed Dixon and

Hargreavess paper in the Tropical Diseases
Bulletin he countered35:
In my experience, relapse has followed
symptom free intervals which had lasted for
10, 13, and 20 years. I believe that when a long
remission occurs, one can but wait and hope
for the best, while cautiously remembering the
scriptural injunction, Judge none blessed
before his death.
The reason why early workers inferred a

discouraging outcome can now be related to
the lack of availability of contemporary methods of diagnosis. The diagnosis of cysticercosis was based upon histology from excised
subcutaneous cysts or radiology depicting
soft tissue calcification/s. Obviously, only the
most severe forms were diagnosed by these
archaic tools. On the other hand, benign
oligolesional forms like those due to a solitary
or few cysts that would be easily picked up
on computed tomography (CT) or magnetic
resonance imaging (MRI) in the present

day era, would have been missed. We
now know that solitary or few cysts36 are
far more common than multilesionaldisseminated cysticercosis37; the former
carry a good prognosis in comparison to
heavy, multiple cysticercosis.
Serodiagnosis of T. solium cysticercosis

Weinberg in 1909 was the first to use the
complement fixation test on the serum of
cysticercotic pigs38. In 1910, Robin and
Fiessenger first performed the test upon
humans. Other notable contributions so far
to the serological diagnosis of cysticercosis
have been those of Rothfeld39, Biagi and
Tay40, and Neito41. Studies at this stage were
not optimistic about the role of serological
studies in the clinical context, though Neito
reported excellent results of his lengthy and
remarkable set-up with the complement fixation tests in the spinal fluid41.
Serological confusion compounded clinical confusion with neurosyphilis, an important disorder in the early part of the 19th
century. In an account of one such confusion,
Castellani described the occurrence of subcutaneous nodules, a positive Wassermans
reaction in the serum and response to antisyphilitic treatment in three persons under
the name, luetic pseudo-cysticercosis41,42.
Radiology
According to Grove, the earliest roentgenological description of dead cysticerci was by
Roth in 192620,43. Broughton-Alcock and
Weinbren described muscle calcification
picked up incidentally on a radiograph of a
gunshot wound44. They compared radiological appearances of calcification due to dead
cysticerci with those of Trichenella spiralis in a
radiograph of a post-mortem specimen of
muscle obtained from Sir Arthur Keith. They
found that calcifications of Taenia solium were
larger than those of Trichenella spiralis. Major
contributions on the radiology also came
from Morrison45 and Brailsford46,47. It was
recognized that cerebral calcification was
less common and appeared later than muscle

calcification and if the soft tissue radiographs did not reveal calcifications, skull
roentgenograms rarely contributed to the
diagnosis. Brailsford was eloquent in his
opinion on the role and limitations of
roentgenography47:
Radiography permits of the diagnosis of
cysticercosis when the parasites have
degenerated and calcified but affords no help
in the earlier years of infestation. Actually it
is rare to obtain radiographic evidence of
cysticerci in the brain in patients with
symptoms of central nervous system disease.
In the later years, when symptoms have as a
rule ceased, radiography for other reasons may
reveal the calcified parasites.
In 1945, Arana and Asenjo published a

landmark paper on the ventriculographic
diagnosis of posterior fossa cysticercosis
from
Santiago,
Chile48.
Incidentally,
MacArthur expressed surprise over the
authors observations and commented49:
It looks, therefore, as if the commoner types
which would bring the above more into their
proper proportions may not be coming to
light. Perhaps the explanation is that only
patients supposed to be suffering from a
cerebral tumour were sent to the institute
for investigation.
The Search for an Effective Treatment

The history of the search for effective treatment for taeniasis and cysticercosis is as old
as the recognition of tapeworms and cysticerci. The oldest remedies were the herbal
remedies used, for instance, by the ancient
Egyptians and Chinese. One can find mention of the use of herbs such as Acacia nilotica
and Aloe vera for treatment of worms in the
Egyptian papyri1. Similarly, a fungus,
Raigan (Omphalia lapidescens), that grows on
bamboo, has been used by the Chinese as an
anthelminthic for nearly 2000 years50.
One of the early remedies for the tapeworm was an extract of the male fern,
Dryopteris filix-mas, the active medicament of
which was filix mas51. Other important remedies included the ground seeds of Cucurbita
moschata (pumpkin) and Areca catecho (semen
165
aracae)6,52. Other remedies used in the early

part of the last century included betel nut
boiled in water, tetrachloroethylene, thymol,
carbon tetrachloride and hexylresorcinol5157.
Thus Allan in 191255 and Carman in 193156
reported the use of thymol and carbon tetrachloride respectively. In the 1930s through
1950s, filix mas and carbon tetrachloride were
most often used for the treatment of tapeworms. With both remedies, prior starvation
and subsequent purgation was advocated.
For 2 days before the administration of filicis
liquidum, the individual was fed upon a liquid diet consisting of orange juice and dextrose. Following the active drug, a saline
purgative was administered. Castor oil was
specifically contraindicated as it dissolved the
filix mas and led to intoxication. The stools
obtained following the purge were sieved and
examined against a black background to identify the head of the tapeworm. The identification of the head of the tapeworm was taken to
be an indicator of successful taeniacidal therapy. If the head was not passed, treatment
was repeated and, if still unsuccessful, a duodenal tube was passed and the drugs were
infused directly through the tube. However, it
was soon recognized that these chemicals
were associated with severe toxicity, primarily
renal and hepatic.
In the 1940s and 1950s, attention focused
on the use of atarabine as a taeniacidal
agent5759. Though anecdotally this drug
proved to be effective, its major limitations
were the side effects of severe vomiting and
encephalopathy. Vomiting was prevented by
the concomitant administration of largactil
or by intraduodenal administration of atarabine. Delirium was treated by the concomitant administration of phenobarbitone
(phenobarbital).
While in the early part of the 19th century
several efforts were made to develop an
effective taeniafuge, similar drives for the
development of anticysticercal agents were
not evident. In fact, in a discussion on
MacArthurs paper25, Sir Hamilton Fairley
pointed out that according to Colonel
MacArthurs description, the cysticerci
should be kept alive as long as possible; specific drug therapy was contraindicated27.
Similarly Dixon and Smithers stated29:
166
There is no known treatment for the established

disease, in fact the administration of such
substances as Tartar emetic have in some cases
produced an exacerbation of symptoms or a
fresh crop of palpable nodules, presumably by
causing the death of more parasites.
to us that the only surgical operation justified is decompression in order to save sight.
Thus the fact that specific chemotherapy

of larvae could cause exacerbation of symptoms and the mechanisms thereof were recognized very early. Other agents such as
neoarsphenamine and bismuth (both antisyphilitic treatments), atarabine, quinine,
antimony tartrate, chloroquine, sulfasalazine
and streptomycin were tried with no good
results. Radiation therapy was also tried but
results were not satisfactory5. Henneberg
advocated repeated lumbar punctures in
selected patients with intracranial hypertension as a palliative measure60. Another palliative measure comprised of the use of
bromides and luminal for control of seizures.
The earliest attempt at surgical treatment
was by Krausse in 190161. MacArthur clearly
advocated against resorting to surgery in
view of the widespread distribution of larvae2426. In a series of 99 patients reported
by Dixon and Hargreaves, 14 were
operated31. Indications for surgery included,
the lack of diagnosis, as a relief measure for
control of intracranial hypertension and control of seizures. They concluded: It appears
In about 1969, a United States General

remarked that it was time to close the book
on infectious diseases. His remark was at
best a gross underestimate. Taenia solium
cysticercosis is a classical example of a reemerging disease that the United States has
to cope with, as a result of increasing immigration, travel and general globalization.
This is one aspect of the global epidemiology of T. solium. The other, which is perhaps less well appreciated, is the presumed
but precisely unknown large number of
people affected by the disorder in several
developing countries. For these countries,
their governments and authorities, history
professes that T. solium, which was once
widely prevalent in Europe, was eradicated
solely by developing sanitary infrastructure
and enforcing meat hygiene. Perhaps, the
best thing that they can learn from history
is that the only way to surely eradicate
cysticercosis is by improving sanitation,
meat inspection, human behaviours and
attitudes and most importantly by socioeconomic development.
Conclusions
References
1. Ebers Papyrus. http://www.crystalinks.com/egyptmedicine.html
2. Flisser, A. Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed.) Progress in Clinical
3. Thompson, D.W. History of Animals by Aristotle. http://www.classics.mit.edu/Aristotle/
historyanim.html
4. Wardle, R.A., McLeod, J.A. (1952) The Zoology of Tapeworms. University of Minnesota Press,
Minneapolis, pp. 4591, 155172.
cysticercosis: 158 cases. Chinese Medical Journal 92, 770786.
6. Hoeppli, R., Chiang, I.H. (1940) Selections from old Chinese medical literature on various subjects
of helminthological interest. Chinese Medical Journal 57, 373380.
7. Mnnig, H.O. (1950) Veterinary Helminthology and Entomology. The Diseases of Domesticated Animals
Caused by Helminth and Arthropod Parasites, 3rd edn. Tindall and Cox, London, 11 pp.
8. Linnaeus, C. (1735) Systema Naturae sive segna tria Naturae Systematice Proposita per Classes, Ordines,
Genera et Species. Uppsala, Sweden.
9. Linnaeus, C. (1758) Systemae Naturae per regni tria Naturae, Secundum Classes, Ordines, Genera, Species
Characteribus, Differentis, Synonymis, Locis. Tomus 1, Edition decima. Reformata, Stockholm, Sweden.
167
10. Linnaeus, C. (1761) Fauna Svecia Sistens Animalia Sveciae Regni: Mamalia, Avesm Amphibia, Pisces,
Insecta, Vermes. Distributa per Classes and Ordines, Genera and Species, cum Differenttis Specierum,
Synonymis Auctorum, Nomiininibus Incolarum, Locis Natulium, Descrptionibus Insectorum. Edition
altera, auctoris, Stockholm, Sweden.
11. Goeze, J.A.E. (1782) Versuch einer Naturgeschichte der Eingeweidewrmer thierischer Krper. PA Pape,
Blankenburg, Germany, pp. 471. Cited in Ref. 20.
12. Leuckart, R. (1856) Die Blasenbandwrmer und ihre Entwickelng. Giessen, Germany, pp. 162. Cited in
Ref. 20.
13. Panarolus, D. (1652) Iatrologismorum, seu Medicinalium Observationum Pentecostae Quinque. F Moneta,
Romae, pp. 445. Cited in Ref. 2.
14. Rumler, J.U. (1558) Secto, a me, in capite, pustulae supra duram meningen apparuerunt, erosa ipsa
et cerebro per foramina eminente pluribus in locis. Observationes Medicae. Cited in Ref. 20.
15. Zeder, J.G. (1803) Anleitung zur Naturgeschichte der Eingeweidewrmer. Bamberg, Germany, pp. 432.
Cited in Ref. 20.
16. Kchenmeister, F. (1855) Offenes Sendschreiben an die k.k. Gesellschaft der Aertze zu Wein.
Experimenteller Nachweis, dass Cysticercus cellulosae innerhalb des menschlinchen Darmkanales
sich in Taenia solium umwandelt. Wiener medizinische Wochenschrift 5, 14. Translated in: Kean, B.H.,
Mott, J.E., Russell, A.J. (eds) Tropical Medicine and Parasitology Classic Investigations. Cornell
University Press, Ithaca, New York, 1978, pp. 677.
17. Kchenmeister, F. (1855) Die in und an dem Krper des lebenden Menschen vorkommenden
Parasiten. In: Ein Lehr- und Handbuch der Diagnose and Behandlung der thierischen und pflanzichen
Parasiten des Menschen. BG Teubner, Leipzig, p. 486. Translated in: Lankester, E. (1857) On Animal
and Vegetable Parasites of the Human Body, Vol. 1, Animal Parasites Belonging to the Group Entozoa. The
Sydenham Society, London, 1857, pp. 452.
18. von Siebold, C.T. (1835) Helminthologische Beitrge. Archiv fr Naturgeschichte 1, 4583.
19. von Siebold, C.T. (1836) Ueber die Spermatozoen der Crustacean, Insecten, Gasteropoden und
einiger anderer wirbellosen Thiere. Archiv fr Anatomie und Physiologie (Muller) 1353.
20. Grove, D.I. (1990) A History of Human Helminthology. CAB International, Wallingford, UK,
pp. 355383.
21. Virchow, R. (1860) Helmintologischen Notizen 5. Traubenhydatiden der weichen Hirnhaut. Virchows
Archiv fr Pathologische Anatomie un Physiologie und fr Klinische Medizin 16, 528535.
22. Vosgien, W. (1911) Le Cysticercus cellulosae Chez lhomme et Ches les Animaux. Thse de la Faculte
de Medecine, Paris.
23. Brumpt, E. (1936) Precis de Paristologie, 5th edn. Paris, France.
24. MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of
25. MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343357.
26. MacArthur, W.P. (1935) Cysticercosis of the brain. British Medical Journal ii, 1229.
27. Fairley, H. (1934) Tropical Diseases Bulletin 31, 784785.
28. Dixon, H.B.F. (1933) Two cases of cysticercosis (Taenia solium). Journal of Royal Army Medical Corps 61,
126128.
29. Dixon, H.B.F., Smithers, D.W. (1935) Cysticercosis (Taenia solium). Journal of Royal Army Medical Corps
64, 227234, 300306, 375380.
30. Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one
cases. Quarterly Journal of Medicine 3, 603616.
31. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further ten years clinical
study covering 284 cases. Quarterly Journal of Medicine 13, 107121.
32. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow up of 450 cases. Medical
Research Council Special Report Series No. 299. Her Majestys Stationery Office, London, pp. 158.
33. Machado, A.B.B., Pialarissi, C.S.M., Vaz, A.J. (1988) Human cysticercosis in a general hospital in S.
Paulo, Brazil. Revista de Sade Pblica (So Paulo) 22, 240244.
34. Takayanagui, O.M., Jardim, E. (1983) Clinical aspects of neurocysticercosis: Study of 500 cases.
35. MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 907908.
and treatment. Paediatrics 82, 7682.
168
37. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: New observations, including CT
scan findings and experience with treatment with praziquantel. Brain 111, 597614.
38. Weinberg, G. (1909) Recherches des anticorps specifiques dans la distomatose et la cysticercose.
Comptes Rendus Hebdomadaires des Seances et Memoires de la Societe de Biologie (France) 66, 219221.
39. Rothfeld, J. (1935) ber die Prcipitationsreaktion bei Hirncysticerkose. Deutsche Zeitschrift
Nervenheilk 137, 93102.
40. Biagi, F.F., Tay, J. (1958) A precipitin reaction for diagnosis of cysticercosis. American Journal of
41. Nieto, D. (1956) Cysticercosis of the nervous system. Diagnosis by means of the spinal fluid complement test. Neurology 6, 725738.
42. Castellani, A. (1938) Brief notes on cysticercosis and luetic pseudo-cysticercosis. Journal of Tropical
43. Roth, E.J. (1926) Man as the intermediate host of the Taenia solium. British Medical Journal ii, 470471.
44. Broughton-Alcock, W., Weinbren, M. (1930) Generalised infection of muscles with Cysticercosis cellulosae; measurement of cysts and comparison with those of Trichinella spiralis. Proceedings of the Royal
Society of Medicine 24, 222224.
45. Morrison, W.K. (1934) Cysticercosis in twin brothers aged 13 years with a radiological study of calcified cysticercus in twelve cases. British Medical Journal i, 1314.
46. Brailsford, J.F. (1941) Cysticercus cellulosae its radiographic detection in the musculature and central nervous system. British Journal of Radiology 14, 7993.
47. Brailsford, J.F. (1942) Unrecognized cysticercosis. Lancet i, 127128.
48. Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa.
Journal of Neurosurgery 2, 181190.
49. MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 908909.
50. Ryo, S. (1937) A new anthelminthic Raigan in taeniasis. Journal of Oriental Medicine 26, 799845.
51. Sandground, J.H. (1938) Newer drugs for the treatment of tapeworm infestations. Some results
obtained with carbon tetrachloride, tetrachlorethylene and hexylresorcinol. New England Journal of
Medicine 218, 298304.
52. Liu, H.L. (1936) Betel nut as a useful taeniafuge. Chinese Medical Journal 50, 1273.
53. Ogle, J.W. (1863) Observations of the treatment of Taenia, especially by the use of oil of male fern.
British Medical Journal i, 264266.
54. Pankhurst, R. (1969) The traditional taenicides of Ethiopia. Journal of the History of Medicine 24,
323334.
55. Allan, W. (1912) Thymol for Taenia saginata. Journal of American Medical Association 59, 197.
56. Carman, J.A. (1931) A note on the clinical aspect of the treatment of taeniasis with carbon tetrachloride. Transactions of the Royal Society of Tropical Medicine and Hygiene 25, 187190.
57. Schnelewa, A.A. (1931) Anwendng de Dodenal sonde bei Austreibung von Bandwrmen. Revue
Microbiologie Epidemiologie et Parasitologie 10, 297303.
58. Mazzotti, L., Trevino, A. (1953) Ensayo de tratamiento con Dietilcarbamazina (Hetrazan) en tres
casos de cistecercosis humana. Revista do Instituto Salubridad y Enfermedades Tropicale Mxico 13,
209211.
59. Mazzotti, L., Torroella, J. (1955) Resultados negatives de Hetrazan en des casos humans de cesticercosis ocular. Revista do Instituto Salubridad y Enfermedades Tropicale Mxico 15, 217219.
60. Henneberg, R. (1936) Die tierschen Parasiten des Zentralnervensystem. In: Bumke und Foersters
Handbuch der Neurlogie. Vierzehuten Band. Springer-Verlag, Berlin, Germany, pp. 286322.
61. Olive, J.I., Angulo-Rivero, P. (1962) Cysticercosis of the nervous system. Panel discussion. A.
Introduction and general aspects. Journal of Neurosurgery 19, 632634.
17
Neurocysticercosis: an Overview of
Clinical Presentations
Introduction
History and Physical Examination
The manifestations of neurocysticercosis

(NC) are a puzzling concern to clinicians in
endemic and non-endemic countries alike.
No symptom or sign is specific for the disorder. Furthermore, a plethora of clinical
presentations (reviewed in Chapters 1829)
have been described, giving NC the appropriate title of the modern-day successor of
syphilis, the master imitator of all diseases.
In non-endemic regions, which are experiencing a reemergence of the disorder, the
lack of awareness of NC often leads to
delay in diagnosis and resort to unnecessary invasive, potentially harmful and
time-consuming tests such a stereotactic
biopsy and so forth1. Contrariwise, in
endemic areas, clinicians often pronounce a
diagnosis of NC only to realize an alternative diagnosis much later2,3. In this view, it
is obviously important to classify the disorder, put down diagnostic criteria and familiarize clinicians with salient clinical
manifestations. Accordingly, an overview
of available and practised systems of staging, classification and diagnosis are discussed in the clinical context in this
chapter; more detailed reviews of individual clinical presentations follow in the subsequent chapters.
The symptoms and signs of NC are nonspecific. Parenchymal NC commonly presents with seizures and headaches. Seizures
may be single, clustered or recurrent. They
are either focal with or without secondary
generalization or may be generalized at the
onset. Headaches may be transientmigraineous, continuous-tension type or
more uncommonly, severe portending
intracranial hypertension. Other less common features include focal neurological
deficits (usually brief, though rarely persuasive), a variety of psychiatric manifestations
and dementia. In patients with extraparenchymal NC, the most common pathological determinant of clinical symptoms and
signs is hydrocephalus4,5. These patients present with headaches, which may or may not
be associated with nausea and vomiting and
visual disturbances resulting from papilloedema and secondary optic atrophy. In
addition, they may develop features of
meningismus, stroke-like presentations or
cranial nerve palsies.
General physical examination is usually
normal, though subcutaneous nodules may
be felt or seen (Fig. 17.1) and ocular examination may disclose ophthalmic cysticercosis
(Fig. 17.2) (reviewed in Chapter 28). The sub-

169
170
S. Prabhakar and G. Singh
Fig. 17.1. Lingual and subcutaneous cysticerci.
Fig. 17.2. Ocular cysticercosis.
cutaneous nodules represent cysticerci in

underlying muscles. The nodules are the size
of a pea and are painless. They often go
unnoticed by the patient but when recognized they may be a cause of concern to
him/her, requiring several assurances from
the physician. The skin over the nodules is
movable. Nodules are usually detected by
palpation alone over the trunk and limbs,
but may be visible over the tongue, face and

neck, where the skin is thin (Fig. 17.1).
Indeed, the detection of subcutaneous nodules was hitherto considered to be an important aspect of diagnosis of Taenia solium
cysticercosis. In a large series of 450 patients
reported by Dixon and Lipscomb, 54% had
nodules6. Subcutaneous nodules are now
becoming rare in view of the rapidity with
which a diagnosis of NC is made with the
help of computed tomography (CT) and
magnetic resonance imaging (MRI).
In most cases, neurological examination is
normal. Focal neurological deficits if present
are subtle and evanescent. In a subset of
patients with a large parenchymal burden of
disease or extraparenchymal NC7,8, the presenting signs may be those due to intracranial
hypertension
and/or
dementia
(reviewed in Chapter 19). These patients
commonly have papilloedema, impairment
in cognitive protocols and somnolence or
varying levels of consciousness.
A definite, probable and possible diagnosis of NC can be made on the basis of clinical, radiological and epidemiological criteria,
tabulated in Box 17.1. These criteria were
proposed by Del Brutto et al., in 19969, and
revised in 200110.
An Overview of Clinical Presentations
171
Box 17.1. Diagnostic criteria for neurocysticercosis (NC). (Adapted from references 9 and 10.)
Absolute criteria
1. Histological demonstration of cysticerci from either a central or peripheral source.
2. Direct visualization of ophthalmologic cysticerci.
3. Demonstration of a cyst containing a scolex upon neuroimaging study.
Major criteria
1. Evidence of lesions suggestive of NC on neuroimaging studies without demonstration of a
scolex (MRI or CT showing cystic lesions, ring-enhancing lesions, parenchymal brain
calcifications, hydrocephalus, and abnormal enhancement of the leptomeninges. Myelograms
showing multiple filling defects in the column of contrast material).
2. Serum anti-cysticercal antibodies demonstrated by immunoblot, or spinal fluid
anticysticercal antibodies demonstrated by immunoblot or ELISA.
3. Characteristic cigar-shaped calcifications demonstrated by soft-tissue radiographs of the
thigh and calf.
Minor criteria
1. Subcutaneous nodules suggestive of cysticerci (without histological confirmation).
2. Punctate intracerebral or soft-tissue calcifications on plain radiographs.
3. Clinical manifestations suggestive of NC (seizures, focal neurological deficits, symptoms of
increased intracranial pressure, dementia).
4. Disappearance of intracranial lesions after treatment with anticysticercal drugs.
Epidemiologic criteria
1. Residence in a cysticercosis endemic area.
2. Frequent travel to cysticercosis endemic areas.
3. Household contact with an individual infected with Taenia solium.
Based on the above diagnostic criteria, the following diagnostic categories were proposed:
A. Definite NC (one of the following)
One absolute criterion
Two major criteria
One major, two minor and one epidemiologic criterion
B. Probable NC (one of the following)
One major and two minor criteria
One major, one minor and one epidemiologic criterion
Three minor and one epidemiologic criterion
C. Possible NC (one of the following)
One major criteria
Two minor criteria
One minor and one epidemiologic criterion
Overview of Disease Staging and

Classification
The lack of pathognomic clinical features
despite the large number of clinical presentations of human T. solium cysticercosis was
recognized very early by medical scientists.
This led to attempts at systematic classification of disease. Thus, Kchenmeister recognized the presence of cysticercosis in
meningeal, cortical and ventricular loca-
tions11. This was one of the earliest versions

of more contemporary classifications. A
major objective of classification is to guide
management approaches and obtain prognostic information. Since in the early part of
the 20th century, surgery was the only established method of treatment, initial classification systems were made in order to
determine the need and nature of surgical
approach. Several orderly classifications
were given and perhaps that of Stepien and
172
Table 17.1. Surgically oriented classification of neurocysticercosis. (Source: reference 12.)

Group
Clinical characteristics
Surgical implication
Space occupying intracranial tumour-like behaviour

producing focal neurological manifestations (focal
seizures, hemiparesis, visual pathway deficits, cranial
neuropathy/ies, cerebellar symptoms and signs) and
ultimately raised intracranial pressure (in case of third/
fourth ventricular cysticercosis: posterior fossa mass
and obstructive hydrocephalus)
Diffuse cerebral syndrome due to numerous cysticerci
leading to cerebral oedema, intracranial hypertension
(leading to vision loss), organic brain syndrome
Basal meningeal or ventricular cysticerci giving rise to
hydrocephalus (and intracranial hypertension), rarely
focal signs and mental disturbances
Exeresis often indicated
II
III
Chorobski is most well known (Table 17.1)12.

The classification worked well in those
times, effectively dictating the surgical
approach in the absence of modern tools of
diagnosis like CT, MRI and enzymelinked immunoelectrotransfer blot (EITB).
Understandably, it has been replaced by classification/s that incorporate contemporary
diagnostic and therapeutic options13,14.
Classifying NC according to the anatomic
compartment of involvement is advantageous
to clinicians, radiologists and pathologists
(Table 17.2). It separates clinical concomitants
into those of parenchymal NC (presenting with
seizures, space-occupying effects and intracranial hypertension), subarachnoid NC (presenting with meningitis, space-occupying effects
and hydrocephalus) and ventricular NC (manifesting as acute hydrocephalus, meningitis or
rarely space-occupying lesions). A classification system that is oriented purely anatomically however, does not take into account the
evolutionary stage of NC, which also influences clinical presentation. In 1985, Sotelo et al.
proposed the classification of NC into active
and inactive disease (Table 17.3)15. The classification derives from pathological-radiological
staging of NC, which have been described elsewhere in the book (Chapters 30 and 32) in 753
cases. Both viable, live (non-inflamed)
parenchymal
cysts
and
degenerating
parenchymal cysts represented the active form.
Extraparenchymal presentations of active
meningitis or arachnoiditis were likewise
Exeresis rarely useful but may be

undertaken in life-threatening
conditions
Cerebrospinal fluid diversion
procedure
included in active disease presentations.

Parenchymal calcifications and hydrocephalus
secondary to meningeal fibrosis were classified
into inactive forms. Thus, symptoms of active
forms of NC included seizures (most commonly), acute or subacute hydrocephalus (less
Table 17.2. Anatomical classification of neurocysticercosis (NC).

1
2
Parenchymal NC
Extraparenchymal NC
Venticular
Subarachnoid
Mixed
Table 17.3. Classification of neurocysticercosis

into active and inactive forms. (Reproduced with
Active forms of NC
Arachnoiditis
Hydrocephalus secondary to meningeal
inflammation
Parenchymal cysts
Brain infarction secondary to vasculitis
Mass effect due to large cyst or cyst clumps
Intraventricular cysts
Spinal cysts
Inactive forms of NC
Parenchymal calcifications
Hydrocephalus secondary to meningeal fibrosis
common) due to meningeal inflammation,

arachnoiditis, obstruction by intraventricular
cysts, meningitis and stroke (not uncommon)
and mass effect due to space-occupying lesions
(rare) and myelopathy (rare). Clinical presentations of inactive NC included seizures due to
parenchymal calcified NC and chronic hydrocephalus. The purpose of this classification was
to differentiate between those cases that
required definitive medical (anticysticercal
treatment and/or steroids) or surgical management versus those that required only symptomatic medical (antiseizure medications) or
surgical (ventriculoperitoneal shunt) management. This classification is perhaps the most
widely used in the present day. Carpio et al.
classified NC into active, transitional and inactive forms16. This classification is an appropriate staging system based upon clinical and
imaging characteristics and has therapeutic
implications as well. Active NC forms, which
refer to live, viable parenchymal or extraparenchymal cysts, rarely produce symptoms
apart from the rare instance of mass effect.
Symptomatic NC is incident upon the transitional forms, where degenerating parenchymal
cysts produce acute symptomatic seizures.
Likewise degenerating subarachnoid cysts produce meningitis, arachnoiditis and hydrocephalus and ventricular cysts lead to acute
hydrocephalus. Inactive disease again is exemplified by single or multiple parenchymal calcification/s and/or hydrocephalus secondary to
meningeal fibrosis.
Natural course of disease

It must be remembered that no compartmentalization is strict, and good proportions of
patients
simultaneously
have
several
anatomical or evolutionary attributes. Thus,
it is not uncommon to find a patient with
multiple active, involuting and calcified
parenchymal cysts in addition to the presence
of cysticercotic hydrocephalus due to chronic
arachnoiditis. Likewise, another patient may
be having seizures due to transitional forms
of NC that ultimately resolve with calcifications. A few years later, this patient may
again experience seizures due to a fresh crop
of parenchymal cysticerci that have begun
173
involuting. Thus this patient may pass

through several stages of NC: active (asymptomatic) initially, transitional, inactive and
then again, transitional.
The usual course of illness in most
patients, particularly those with one or few
parenchymal cysts, is benign and self-limiting. These patients have few seizures, often
clustered, that remit rapidly. It is not uncommon to find some parenchymal cysts undergoing involution/degeneration at about the
same time rather than one after another
upon CT. The simultaneous involution is
surmised to result from an antigenic stimulation following degeneration of one cyst that
induces an immune response against the
other cysts as well. This often is the reason
for the short, self-limiting course of NC
rather than a protracted course. In contrast,
clinical syndromes associated with multiple
inflamed parenchymal cysticercosis, often
synonymously called cysticercotic encephalitis and profuse, non-inflamed cysticercosis,
also called disseminated cysticercosis
(reviewed in Chapter 19), or even few cysts
in the intraventricular (discussed in Chapter
20) or subarachnoid (discussed in Chapter
18) locations, often have a foreboding course.
Temporal and Geographical Trends in

Clinical Presentation
Temporal trends
Some of the earliest descriptions of NC in
literature portrayed a uniformly dismal
prognosis17,18. This was not borne out by
several subsequent studies, which suggested
that the prognosis was not as bad as previously felt19,20. More recent experience suggests the existence of benign self-limiting or
oligolesional disease in large numbers2023.
This does not indicate a shift in the clinical
spectrum of disease from more severe to
benign forms but merely reflects early diagnosis and the recognition of benign, oligolesional NC with modern modalities of
neuroimaging such as CT and MRI. For
instance, the average time period between
the first neurological symptom and establishment of a diagnosis of cysticercosis was
174
8.2 years with a range of 152 years before

19626. This time period has been reduced to
days or months in most developing countries and most certainly to hours or days in
developed countries. In another example,
the traditional viewpoint prevailed in India
that regarded NC as a disorder with multiple parenchymal cysts. With the advent of
CT in the early 1980s, a solitary ring-enhancing lesion that resolved spontaneously in
36 months was noted upon CT. It took clinical neurologists nearly a decade to understand and accept that these single
self-limiting forms were of cysticercal aetiology. In this regard, therefore, CT and later
MRI have made the most dramatic impact
on our understanding of the disorder.
Geographical trends
Several authors have considered geographical differences in clinical presentation
before. In fact, as early as 1938, MacArthur
was surprised to note the occurrence
of subarachnoid cysticercosis diagnosed
by ventriculography in South America,
although he had not encountered any such
form in his vast experience with the disorder in India21,22. His comments continue to
fuel speculations that parenchymal NC is
more common in India and other South and
Southeast Asian countries, while subarachnoidventricular forms are more common
in Latin America. These differences are perhaps more imaginary than real. Actually,
the spectrum of clinical presentations is
likely to vary with the volume of patients
seen and the referral pattern linked to the
repute of the medical facility in terms of
treating the disorder either medically or
surgically (H.H. Garca, Lima, personal
communication). Thus, a series of patients
compiled from a general hospital may have
seizures as the dominant manifestation,
while a series from a tertiary care neurosurgical facility may have a predominance of
subarachnoid and ventricular forms. It
appears therefore, that available published
clinical series cannot be strictly compared.
Nevertheless, the issue of geographical
variations in clinical presentation needs to
be resolved by careful prospective collection of data from similar facilities that are
matched for therapeutic expertise and reputation, referral pattern and patient volume. Some of the important published
series of NC in persons of Latin American
origin are summarized in Table 17.4. These
have been compared with a series collected
in a large tertiary care public hospital facility in India. The presence of NC was established by imaging, surgical pathology and
autopsy in this series. Indeed, comparison
of these series does not reveal differences in
clinical presentation.
Conclusions
A spectrum of clinical manifestations from
asymptomatic larval infestation to severe
presentations with life-threatening intracranial hypertension, irrecoverable cognitive
deterioration and altered sensorium
impending upon death has been noted in
NC. Most patients, however, lie between
these two extremes with occasional
seizures and/or headaches. Clinical manifestations vary according to the anatomical
site of lesion/s and the evolutionary stage
of the cysticercus. By the former approach,
NC is classified into parenchymal and
extraparenchymal. Parenchymal disease
results from infection within the brain
parenchyma, most commonly at the corticalsubcortical interface. Extraparenchymal
NC implies involvement of the cranial and
spinal subarachnoid space and the ventricles. Commonly, the clinician encounters
patients with combined disease or disease
which changes from one compartment to
the other. The classification of NC into
active (and transitional) and inactive forms
is particularly advantageous and has
important therapeutic implications. It is
conceivable that with the unfolding of
novel immune mechanisms that underlie
clinical presentations and application of
immune therapies against molecular
domains, a classification based upon molecular immunology may ultimately replace
existing clinical, pathological and radiological classifications.
175
Table 17.4. Clinical syndromes (not necessarily the presenting ones) of neurocysticercosis in various
published series in the 1980s, about the time when computed tomography was becoming available.
Reference
23
15*
24
25
26
Authors
McCormick et al.
Sotelo et al.
Scharff
Collection period
Location
19701980
Los Angeles,
CA, USA
127
1183
na
68 (53.5%)
59 (46.5%)
19771981
Mexico City,
Mexico
753
576
32
(50.8%)
(49.2%)
Grisiola and
Wiederholt
19721981
San Diego,
CA, USA
17
758
na
10 (58.8%)
7 (41.2%)
19811986
Los Angeles,
CA, USA
238
282
35
139 (58.4%)
99 (41.6%)
Veerendra
Kumar
19741980
Bangalore,
India
81
165
na
70 (55.1%)
(52.4%)
6 (35.3%)
134 (56.3%)
37 (45.7%)
48 (37.8%)
13 (10.2%)
54 (42.5%)
15 (11.8%)
na
0 (0%)
na
na
(43.4%)
(15.8%)
(29.5%)
(2.3%)
(7.4%)
(1.4%)
na
na
11 (64.7%)
na
14 (82.4%)
3 (17.6%)
na
1 (5.9%)
na
na
51 (21.4%)
5 (2.1%)
13 (5.5%)
10 (4.2%)
8 (3.4%)
1 (0.4%)
na
na
31 (38.3%)
6 (7.4%)
11 (13.6%)
1 (1.2%)
3 (3.7%)
2 (2.5%)
2 (2.5%)
4 (4.9%)
Number of patients
Age (range) in years
Age (mean) in years
Males
Females
Clinical syndrome
Seizures
Intracranial
hypertension
Dementia
Meningio-encephalitis
Stroke
Psychiatric presentation
Spinal cysticercosis
Muscular cysticercosis
Ocular cysticercosis
*Only percentages available.

criteria for diagnosis of meningitis were variable (including the presence of meningeal signs and
cerebrospinal fluid pleocytosis).
Does not imply a primary psychiatric presentation.
The
References
1.
Miyake, H., Takahashi, K., Tsuji, M., et al. (1993) A surgical case of solitary cerebral cysticercosis. No
2. Matson, D.O., Rouah, E., Lee, R.T., et al. (1988) Acanthamoeba meningoencephalitis masquerading
as neurocysticercosis. Pediatric Infectious Diseases Journal 7, 121124.
3. Walus, M.A., Young, E.J. (1990) Concomitant neurocysticercosis and brucellosis. American Journal of
Clinical Pathology 94, 790792.
4. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal NC: report of five cases and
review of management. Clinical Infectious Diseases 15, 799811.
5. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis.
Pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786793.
Research Council Special Report. Series No. 299. Her Majestys Stationery Office, London, pp. 158.
7. Wadia, N.H., Desai, S.B., Bhatt, M.B. (1988) Disseminated cysticercosis new observations including
8. Garcia, H.H., Del Brutto, O.H. (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 15821584.
9. Del Brutto, O.H., Wadia, N.H., Dumas, M., et al. (1996) Proposal of diagnostic criteria for human
cysticercosis and NC. Journal of the Neurological Sciences 142, 16.
10. Del Brutto, O.H., Rajshekhar, V., White, A.C., Jr, et al. (2001) Proposed diagnostic criteria for neurocysticerosis. Neurology 57, 177183.
176
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Kchenmeister, F. (1855) Die in und an dem Krper des lebenden Menschen vorkommenden
Parasiten. Ein Lehr- und Handbuch der Diagnose and Behandlung der thierischen und pflanzichen Parasiten
des Menschen. BG Teubner, Leipzig, pp. 486. Translated by E. Lankester (1857). In: On Animal and
Vegetable Parasites of the Human Body. Vol. 1. Animal Parasites Belonging to the Group Entozoa. The
Sydenham Society, London, pp. 452.
Stepie, L., Chorbski, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of
Neurology and Psychiatry (Chicago) 61, 499527.
Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I.
Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquiatria 52, 166186.
Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central
nervous system. Neurosurgery Quarterly 5, 3454.
Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and
inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442445.
Carpio, A., Placencia, M., Santilln, F., et al. (1994) A proposal for classification of neurocysticercosis.
Canadian Journal of Neurological Sciences 21, 4347.
MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of
MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343357.
Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one
Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further ten years clinical
study covering 284 cases. Quarterly Journal of Medicine 13, 107121.
MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 908909.
Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa.
McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of
Neurology 39, 534539.
Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540544.
Scharff, D. (1988) Neurocysticercosis. Two hundred thirty-eight cases from a California hospital.
Archives of Neurology 45, 777780.
Veerendra Kumar, M. (1986) Clinico-pathological Study of Neurocysticercosis. Thesis. University of
Bangalore, Bangalore, India.
18
Meningeal Cysticercosis
Oscar H. Del Brutto
Introduction
The meningeal form of cysticercosis was
probably first described in 1860 by Virchow,
who found membranous structures at the
base of the brain at necropsy of an individual
who died of a chronic neurological disorder1.
Virchow, however, did not recognize the correct nature of those membranes which he
called racemose hydatids (Traubenhydatiden).
In 1882, Zenker demonstrated cysticercal scolices within such membranes and coined the
term cysticercus racemosus (quoted by
Henneberg)2. According to Zenkers original
description based on the pathological study
of 15 cases this parasite was a variant of cysticercus cellulosae, which developed into an
abnormal shape and size. Only a few
authors35 described meningeal cysticerci subsequently, until Bickerstaff and co-workers6,7,
described their pathological and clinical manifestations in detail, in their classical papers
The racemose form of cerebral cysticercosis
and Cysticercosis of the posterior fossa.
It has been common practice to describe
cysticerci located in the brain parenchyma
or within cortical sulci between two cerebral convolutions as cysticercus cellulosae
and those cysticerci located within the
basal cisterns as cysticercus racemosus811.
However, this terminology may be misleading and indicate that these are unre-
lated conditions from different Taenia sp.12.

Actually, the term cysticercus cellulosae
was initially used to describe an unique
parasitic infection at a time when it was not
known that cysticerci merely represent the
larval stage of Taenia solium13. Therefore,
neither of the terms, cysticercus cellulosae
and cysticercus racemosus are scientifically acceptable. Flisser proposed the terms
cellulose form of T. solium cysticercosis
and racemose form of T. solium cysticercosis in order to differentiate between the
two conditions14.
Pathology
Taenia solium cysticercus is a vesicle that
consists of two main parts: the vesicular
wall and an invaginated scolex. The vesicular wall is a membranous structure with festooned appearance made up of an outer
eosinophilic layer called the cuticular mantle, a middle cellular layer with pseudoepithelial structure, and an inner layer formed
by circular muscle and reticular fibres15. It
may be considered equivalent to the tegument across which the parasite obtains
metabolites and nutrition through absorption and diffusion16. Inside the vesicle, there
is an invaginated scolex, structurally similar
to that of the adult T. solium, including its

177
178
O.H. Del Brutto
head armed with suckers and hooks, an

elongated neck, and a rudimentary body. A
scolex may not be identified in all cysticercus vesicles. These latter forms consist of
several membranes attached to each other,
usually located within basal cisterns17,18.
Histological studies have shown that these
structures represent proliferation of parasitic membranes after degeneration of the
scolex. Their histochemical composition is
unique, because of the presence of acid
mucosubstances and hydrophilic lipids in
large amounts19.
Rabiela et al. described the morphological characteristics of cellulose and racemose
forms of the cysticercus, providing evidence that they arise from a single Taenia
sp.20,21. The authors also described another
form of cysticercus that conserves the
scolex but has two or more small bladders
sprouting from the main vesicle. This is an
intermediate form of cysticercus, representing an initial stage in the transformation from cellulose to racemose form.
Mechanisms responsible for this transformation are incompletely understood. It is
believed that vesicles grow and their scolices disappear as the result of hydropic
degeneration, caused by the continuous
adsorption of cerebrospinal fluid (CSF)18.
Macroscopic appearances of meningeal
(subarachnoid) cysticerci vary according to
their location. Cysticerci located at the cortical surface of the brain usually have a scolex
and are of the cellulose form (Fig. 18.1). This
is the most common location of intracranial
cysticerci in pathological series15,17. The
cysts rarely measure greater than 10 mm
because pressure of the brain parenchyma
prevents further growth of vesicles. In contrast, cysticerci located within basal cisterns
often attain sizes of about 50 mm since their
growth is not limited by brain parenchyma.
Giant cysts usually lack a scolex. They are
commonly located within the Sylvian fissures, cerebellopontine angles, perimesencephalic and prepontine cisterns, and
optochiasmatic region.
Upon involution, meningeal cysticerci
elicit severe inflammatory reaction in the
subarachnoid space with formation of
dense exudates composed of collagen fibres,
lymphocytes, multinucleated giant cells,
eosinophils and hyalinized parasitic
membranes, leading to thickening of
leptomeninges (Fig. 18.2). Meningeal
inflammation may be disseminated, inducing neural and vascular damage distant
from the sites where parasites lodge.
Indeed, leptomeningitis may extend from
the optochiasmatic region to the foramen
magnum15,18. The optic chiasm is frequently
trapped by this dense exudate, leading to
visual field defects22. Cranial nerves arising
Fig. 18.1. Small subarachnoid cysticercus located in the depths of cortical sulci. (Reproduced with
179
Fig. 18.2. Cysticercotic arachnoiditis causing abnormal thickening of leptomeninges around the brainstem.
from the ventral aspect of the brainstem

may also be encased, giving rise to cranial
nerve palsies23. The foramina of Luschka
and Magendie may also be occluded by
thickened leptomeninges and parasitic
membranes with subsequent development
of obstructive hydrocephalus24. The subarachnoid inflammatory reaction elicited by
meningeal cysticerci may also involve
intracranial vessels. Walls of small penetrating arteries arising from the circle of Willis
are invaded by inflammatory cells, leading
to endarteritis, adventitial thickening,
medial fibrosis and endothelial hyperplasia
(Fig. 18.3). The hyperplasia reduces or
occludes the lumen of the vessels, leading
on to cerebral infarction25. Major intracranial arteries may also be occluded by
atheroma-like luminal deposits resulting
from disruption of the endothelium; this
vascular involvement may cause large cerebral infarcts in the territory of the anterior
or middle cerebral arteries2628. Adherence
of the cysticercus to a subarachnoid blood
vessel may weaken the vessel wall, resulting in the formation of a mycotic
aneurysm29. Finally, meningeal cysticerci
may also be located at the spinal subarachnoid space30,31. These are the result of
migration of cysts from the intracranial subarachnoid space. It is also possible that cys-
ticerci enter the spinal subarachnoid space

by retrograde flow through epidural vertebral veins32. Cysticerci located in the spinal
subarachnoid space cause spinal leptomeningitis with resulting inflammatory or
demyelinating changes in ventral and dorsal roots or peripheral nerves.
Clinical Manifestations
The clinical pleomorphism of meningeal cysticercosis is related to individual variations
in number, size and location of parasites, as
well as the severity of the subarachnoid
inflammatory reaction33,34. While a typical
syndrome of meningeal cysticercosis cannot
be defined, focal neurological deficits,
meningitis and intracranial hypertension in
varying combinations are the most common
presenting features3335.
Focal neurological deficits

As previously noted, cysticercotic arachnoiditis causes entrapment of cranial
nerves arising from brainstem. The oculomotor nerves, which run a long course
along the basal meninges from their origin
until their entrance into the cavernous
180
O.H. Del Brutto
Fig. 18.3. Microscopic section of an occluded leptomeningeal blood vessel affected by cysticercotic
endarteritis. A dense collagen capsule and parasitic membranes surround the vessel. (Reproduced with
sinuses, are particularly susceptible in this

regard. Clinical manifestations include
diplopia due to extraocular muscle paralysis, and blurred vision due to pupillary
abnormalities36. Encasement of the optic
nerves and/or optic chiasm by suprasellar
exudates leads to decreased visual acuity
and visual field defects37,38. Large cyst/s in
the cerebellopontine angle cistern present
with a syndrome characterized by various
combinations of sensorineural hearing loss,
vertigo, facial palsy, facial numbness and
pain, that may be accompanied by signs of
long-tract dysfunction, motor weakness
and cerebellar ataxia39. Likewise, clumps of
cysts inside the Sylvian fissure may cause
contralateral motor weakness and sensory
deficits and language disturbances40. Most
manifestations described above have a
subacute onset and progressive course,
often mimicking brain tumours3340. Strokelike presentations occur in 3% of the
patients with subarachnoid cysticercosis41.
Ischaemic cerebrovascular complications
include lacunar as well as large cerebral
infarcts5,42. Lacunar infarcts occur as the
result of inflammatory occlusion of small
perforating arteries secondary to arach-
noiditis associated with subarachnoid cysts

in the suprasellar cisterns. These infarcts
are located in the posterior limb of the
internal capsule or corona radiata, and produce syndromes such as pure motor hemiparesis and ataxic hemiparesis, that are
clinically indistinguishable from those
caused by hypertension43,44. Lacunar
infarcts may also be located in the midbrain
and thalamus, particularly when the paramedian thalamopeduncular branches of the
mesencephalic artery are involved by the
process of angiitis; in these cases, clinical
manifestations include impaired vertical
gaze, pupillary abnormalities, somnolence,
paraparesis, and urinary incontinence25.
Large cerebral infarcts are caused by
occlusion of the internal carotid artery, or
the anterior or middle cerebral arteries2628,4547. Patients present with severe
focal neurological deficits secondary to an
infarct involving the basal ganglia and/or
cerebral cortex. Finally, there are anecdotal
reports of patients with subarachnoid
haemorrhage due to rupture of mycotic
aneurysms of the basilar artery related to
large subarachnoid cysticerci attached to
the artery29.
Meningitis
Cysticercotic meningitis is most often subacute to chronic.34 It presents with cranial
nerve dysfunction or symptoms and signs of
increased intracranial pressure. Fever is
rarely noted. It is generally believed that
meningeal cysticerci do not cause acute
meningitis33. However, a recent report
described an acute meningeal syndrome
attributable
to
cysticercosis
in
27
individuals48. Fever was noted in 74% and
neck stiffness in 44% of the patients. The
report suggests that cysticercosis should be
included in the differential diagnosis acute
meningitis, particularly in endemic regions48.
Intracranial hypertension
Meningeal cysticercosis may cause intracranial
hypertension by two main mechanisms. The
most common is development of hydrocephalus due to inflammatory occlusion of the
foramina of Luschka and Magendie, with
blockage of CSF transit from the fourth ventricle to the subarachnoid space24. This severe or
even fatal complication of meningeal cysticercosis presents with a subacute syndrome of
intracranial hypertension (headache, vomiting,
papilloedema)49. It may be accompanied by
symptoms and signs of cranial nerve dysfunction and cerebral infarcts due to the hitherto
outlined mechanisms18. Intracranial hypertension may also be incidental to growing clumps
of cysts in locations such as Sylvian fissures,
anterior interhemispheric fissure, or cerebellopontine angle cisterns39,40. In the latter event,
focal neurological deficits precede development of symptoms and signs of intracranial
hypertension by several weeks to months.
Seizures
While seizures are common manifestations of
parenchymal brain cysticercosis, they may also
occur in meningeal cysticercosis. Subarachnoid
cysticerci located at the cortical surface of the
brain, between two cerebral convolutions,
induce seizures by irritation of the subjacent
cerebral cortex50. There is a lack of literature
181
specifically addressing characteristics of

seizure disorder associated with cortical subarachnoid cysticerci, but it may be assumed
that the latter give rise to partial seizures with
or without secondary generalization as a result
of focal irritative mechanisms.
Myelopathy and radiculopathy

Subarachnoid cysticerci of the spinal canal
usually cause a non-specific clinical picture
characterized by a combination of radicular
pain and motor deficits of subacute onset
and progressive course51,52. Cervical leptomeningeal cysts may cause a compressive
myelopathy with signs of upper motor neuron damage in the lower limbs (spastic paraparesis with bilateral Babinskis signs)
associated with atrophy and fasciculations of
hand muscles53. In contrast, leptomeningeal
cauda equina cysts present with flaccid paraparesis and arreflexia in the lower limbs54.
The reader is referred to Chapter 23 for a
detailed discussion on spinal cysticercosis.
Diagnostic Evaluation
Given the clinical pleomorphism of
meningeal cysticercosis, a definitive diagnosis on clinical grounds alone is difficult.
Complementary investigations are required
to differentiate this condition from other
tumours and infections with similar clinical
manifestations. Diagnostic work-up includes
neuroimaging,
lumbar
puncture
and
immunological tests34.
Neuroimaging studies
Hydrocephalus, involving lateral, third and
fourth ventricles, is the most common neuroimaging finding in meningeal cysticercosis55. Fibrous arachnoiditis can be seen as
areas of abnormal enhancement of the leptomeninges at the base of the brain on computed tomography (CT) and magnetic
resonance imaging (MRI) (Fig. 18.4). In addition, single or multiple subarachnoid and
parenchymal brain cysts or calcifications may
182
O.H. Del Brutto
be noted, a finding that facilitates the diagnosis of neurocysticercosis (NC). Small subarachnoid cysts over the convexity of the
cerebral hemispheres were considered rare in
initial CT studies of NC56,57. However, the
development of new generation CT equipment and MRI led to the recognition of such
lesions58,59. It is unusual for large cysts to
develop over the convexity of cerebral hemispheres, although isolated cases have been
reported40. These cysts are spherical rather
than multilobulated and in some cases, a
large hyperdense nodule corresponding to the
scolex may be seen. Large cysts usually have
a multilobulated appearance, displace neighbouring structures, and behave as space-occupying lesions in the Sylvian fissure,
cerebellopontine angle and the ambiens and
prepontine cisterns (Fig. 18.5)39,60.
Ischaemic cerebrovascular complications
are well visualized with CT and MRI42.
Findings are, however, non-specific since the
appearance of NC-related cerebral infarcts is
similar to those due to other causes. The
accompanying presence of subarachnoid cystic lesions or abnormal enhancement of basal
leptomeninges may establish a diagnosis of
meningeal cysticercosis in some instances43,44.
However, other conditions with similar presentation, including fungal, tuberculous and
carcinomatous meningitis should be considered in the differential diagnosis. Angiographic findings in cysticercotic angiitis
include segmental narrowing of the middle
cerebral artery, occlusion of the anterior or
middle cerebral arteries or even the internal
carotid artery, and mycotic aneurysms2629,44,46.
The exact prevalence of angiographic abnormalities in NC is unknown. However, a recent
report suggests that angiographically documented arteritis is relatively common in
meningeal cysticercosis, including cases
without clinical or neuroimaging evidence of
cerebral infarction61.
CT and MRI are often non-contributory in
the diagnosis of spinal meningeal cysticercosis. Myelography may be useful in such situations and may demonstrate multiple filling
defects in the column of contrast material corresponding to the cysts. These cysts may be
freely mobile within the spinal subarachnoid
space and may change their position during
myelographic examination according to
movements of the patient on the exploration
table. This finding is of diagnostic
significance30,54,62.
Fig. 18.4. Contrast-enhanced MRI of a patient

with severe cysticercotic arachnoiditis showing
abnormal enhancement of basal leptomeninges.
Fig. 18.5. MRI showing a giant cysticercus in the

Sylvian fissure. Note the multilobulate appearance
of the lesion and the displacement of the midline.
183
Table 18.1. Differences between larval cellulose and racemose forms of Taenia solium.
Characteristics
Metacestode form
Racemose form
Shape
Scolex
Diameter
Location
Multilobulated
Absent
2077 mm
Basal subarachnoid space
Number
Cerebrospinal fluid manifestation
Clinical manifestation
Round
Present
120 mm
Parenchymal, convexity
subarachnoid space
12000
Normal/abnormal
Seizures, headaches
Prognosis
Relatively benign
CSF analysis
Abnormalities in the cytochemical composition of CSF have been reported in up to 80%
of patients with meningeal cysticercosis34,41.
The most common finding is moderate
mononuclear pleocytosis, with cell counts
rarely exceeding 300 mm3. However, as
many as 5000 cells mm3 (with predominance of neutrophils) may be observed in
some instances48. Eosinophils are increased
in almost 60% of cases with pleocytosis.
However, this finding is not diagnostic and
may be seen in other infectious and noninfectious diseases. CSF glucose levels are
usually within the normal range despite
active meningeal disease. Indeed, normal
CSF glucose levels are useful in excluding a
diagnosis of tuberculous meningitis, where
low CSF glucose levels are usual. However,
hypoglycorrhagia (< 40 mg dl1) has been
reported in 1218% of NC patients9,41. Very
low glucose levels (< 10 mg dl1) have been
associated with poor prognosis63. Elevated
protein levels in the CSF are common in
patients with pleocytosis. Proteins are moderately raised, usually 50300 mg dl1,
although protein levels as high as 1600 mg
dl1 have been reported63.
Immunological tests
An immunological diagnosis of meningeal
cysticercosis has the inherent problems of
unsatisfactory sensitivity and specificity.
False-negative results are related to immune
13
Mostly abnormal
Intracranial hypertension, cranial
nerve palsies
Severe
tolerance to the parasite without antibody

production, and false-positive results are due
to previous contact with the adult T. solium
or to cross-reactivity with other helminths34.
The complement fixation test is positive in
more than 80% of patients with meningeal
cysticercosis who have inflammatory
changes in the CSF but only in 22% of those
who have a normal CSF analysis41. More
than 30% of patients with meningeal cysticercosis may have a false-negative result
and a similar percentage of individuals may
have false-positive results with ELISA in the
serum64. In contrast, ELISA measuring anticysticercal antibodies in CSF is more accurate (87% sensitivity and 95% specificity)65.
The enzyme-linked immunoelectrotransfer
blot (EITB) assay is considered highly reliable for the diagnosis of meningeal cysticercosis (94% to 98% sensitive and 100%
specific)66. One of the drawbacks of this
assay is that it may be positive in individuals with taeniasis. Therefore, EITB results
must be interpreted in context of the clinical
manifestations, neuroimaging findings and
the habitat of the patient. A positive EITB in
serum is of questionable diagnostic value in
individuals with neurological disease in
endemic areas, while is highly diagnostic in
those areas where cysticercosis is rare34. The
development of monoclonal antibody-based
ELISA to detect presence of cysticercal antigens in CSF may improve diagnostic accuracy
for
meningeal
cysticercosis67.
According to a recent report, the sensitivity
of the test is 86% and its specificity is
100%68.
184
O.H. Del Brutto
Treatment and Outcome

A common therapeutic scheme cannot be put
forward for the management of meningeal
cysticercosis on account of its variable clinical, pathological and radiological behaviour69,70. Therapy includes combinations of
symptomatic drugs, specific anticysticercal
drugs, surgical resection of lesions and
placement of ventricular shunts35. Medical
treatment of small convexity-subarachnoid
cysts is similar to that of parenchymal brain
cysts, with the difference that albendazole
(15 mg kg1 day1 for 8 days) is the preferred
drug since it penetrates the subarachnoid
space better than praziquantel71.
There is controversy on the management of
giant subarachnoid cysts. Some authors recommend surgical resection of these lesions40.
However, medical therapy is equally effective
yet less aggressive69. There are several reports
of clinical and neuroimaging improvement
with albendazole (Fig. 18.6)7274. The inflammatory reaction that follows albendazoleinduced cyst degeneration may lead to
occlusive endarteritis resulting in cerebral
infarction due to the proximity of subarach-
noid cysts to intracranial blood vessels47.

Dexamethasone administration is useful in the
prevention and management of this complication72. It is recommended that dexamethasone
administration should precede the institution
of anticysticercal therapy by a few days.
Furthermore, it may be used for several days
after completion of anticysticercal therapy.
There is anecdotal evidence of the benefit of
neuroprotective drugs, such as nimodipine, in
the prevention of cerebral infarction during
anticysticercal drug administration to individuals with subarachnoid cysticerci75.
The mainstay of management of hydrocephalus due to cysticercotic arachnoiditis is
the placement of a ventricular shunt
device70. The condition runs a protracted
course and carries a poor prognosis owing
to a high frequency of shunt dysfunction35.
A long-term follow-up study demonstrated
50% mortality rate within the first 2 years of
ventricular shunting. The mortality correlated with the number of surgical interventions to revise the shunt76. Shunt
dysfunction manifests with headache, vomiting and progressive deterioration of the
neurological status. Prompt recognition is
Fig. 18.6. CT before (a) and 3 months after (b) albendazole therapy of a patient with a subarachnoid
cysticercus in the interhemispheric fissure. Note resolution of lesion as the result of therapy.
important to avoid further neurological

damage. The continued administration of
prednisone in doses of 50 mg three times a
week for up to 2 years can reduce the risk
of shunt dysfunction from 60% to 13%77.
Sotelo recently designed a new shunt
device that functions at a constant flow
without a valvular mechanism78. This prevents the entry of spinal CSF into the ventricular system towards the inlet of the
shunt device. The inversion of CSF transit
is one of the most common causes of shunt
dysfunction as it allows the entry of subarachnoid inflammatory cells and parasitic
debris into the ventricular system79. A
recent study reported good shunt function
at a mean of 9 months in 96% of patients
with hydrocephalus due to cysticercotic
arachnoiditis80. Another study compared
the effectiveness of this new shunt with
that of a conventional Pudenz-type shunt81.
One year after follow-up, the Pudenz-type
shunt had to be withdrawn or surgically
revised in 45% of the patients. This compared with the requirement of shunt revision in 30% of those with the new shunt
implant. The main cause of shunt dysfunction in Pudenz-type shunt is shunt occlusion. This complication is rare with the new
185
shunt. A drawback of the new shunt device

was insufficient drainage of CSF, a problem
that may be resolved by increasing the
cross-sectional internal area of the peritoneal end of the catheter.
Conclusions
Meningeal cysticercosis involves the basal
CSF cisterns or the convexity CSF spaces.
The pathological appearance is one of
grape-like multilobulated vesicles, without
a scolex, occupying much of the volume of
the basal cistern or of small cystic structures with a scolex over the cerebral convexity.
Focal
neurological
deficits,
meningitis and intracranial hypertension
are the most common presenting clinical
features. In addition, convexity meningeal
cysticerci may present with seizures.
Imaging studies reveal a constellation of
findings in varying combination: cysts,
infarcts and hydrocephalus. Treatment
includes surgical and medical options. A
judicious choice between the use of the
anticysticercal drug, albendazole for small
cysts, and surgery for large cysts and
hydrocephalus needs to be made.
References
1. Virchow, R. (1860) Helmintologischen Notizen 5. Traubenhydatiden der weichen Hirnhaut. Virchows
Archiv fr Pathologische Anatomie un Physiologie und fr Klinische Medizin 16, 528535.
2. Henneberg, R. (1912) Die tierischen Parasiten des Zentralnervensystems. I. Des Cysticercus cellulosae. In: Lewandowsky, M. (ed.) Handbuch der Neurologie, Vol. III, Spezielle Neurologie II. Verlag von
Julius Springer, Berlin, pp. 643709.
3. Moniz, E., Loff, R., Pacheco, L. (1932) Sur le diagnostic de la cysticercose crbrale. A propos de
deux cas. LEncphale 27, 4253.
4. Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa.
5. Escobar, A. (1952) Cisticercosis cerebral. Con el estudio de 20 casos. Archivos Mexicanos Neurologia y
Psiquiatria 1, 149167.
6. Bickerstaff, E.R., Cloake, P.C.P., Hughes, B., et al. (1952) The racemose form of cerebral cysticercosis.
Brain 75, 118.
7. Bickerstaff, E.R., Small, J.M., Woolf, A.L. (1956) Cysticercosis of the posterior fossa. Brain 79,
622634.
8. Loo, L., Braude, A. (1982) Cerebral cysticercosis in San Diego. A report of 23 cases and a review of
the literature. Medicine 61, 341359.
186
O.H. Del Brutto
9. McCormick, G.F. (1985) Cysticercosis Review of 230 patients. Bulletin of Clinical Neurosciences 50,
76101.
10. Rodacki, M.A., Detoni, X.A., Teixeira, W.R., et al. (1989) CT features of cellulosae and racemosus
neurocysticercosis. Journal of Computer Assisted Tomography 13, 10131016.
11. Suh, D.C., Chang, K.H., Han, M.H., et al. (1989) Unusual MR manifestations of neurocysticercosis.
Neuroradiology 31, 396402.
12. Biagi, F.F., Briceo, C.E., Martnez, B. (1961) Diferencias entre Cysticercus cellulosae y Cysticercus racemosus. Revista de Biologia Tropical (Mxico) 9, 141151.
13. Grove, D.I. (1990) A History of Human Helminthology. CAB International, Wallingford, UK, pp.
355383.
14. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed.) Progress in Clinical
15. Pittella, J.E.H. (1997) Neurocysticercosis. Brain Pathology 7, 681693.
16. Lumsden, R.D., Voge, M., Sogandares-Bernal, F. (1982) The metacestode tegument: fine structure,
development, topochemistry, and interactions with the host. In: Flisser, A., Willms, K., Laclete, J.P.,
et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp.
307361.
17. Escobar, A., Nieto, D. (1972) Parasitic diseases. In: Minckler, J. (ed.) Pathology of the Nervous System,
Vol. 3. McGraw-Hill, New York, pp. 25032521.
18. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodriguez-Carbajal, J.,
Taveras, J.M. (eds.) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield,
Illinois, pp. 2754.
19. Valkounova, J., Zdarska, Z., Slais, J. (1992) Histochemistry of the racemose form of Cysticercus cellulosae. Folia Parasitoligica (Praha) 39, 207226.
20. Rabiela, M.T., Rivas, A., Castillo, S., et al. (1985) Pruebas morfolgicas de que C. cellulosae y C. racemosus son larvas de Taenia solium. Archives of Investigative Medicine (Mxico) 16, 8386.
21. Rabiela, M.T., Rivas, A., Flisser, A. (1989) Morphological types of Taenia solium cysticerci. Parasitology
Today 5, 357359.
22. Del Brutto, O.H., Guevara, J., Sotelo, J. (1988) Intrasellar cysticercosis. Journal of Neurosurgery 69,
5860.
23. Revuelta, R., Juambelz, P., Balderrama, J., et al. (1995) Contralateral trigeminal neuralgia. A new clinical manifestation of neurocysticercosis: case report. Neurosurgery 37, 138140.
24. Estaol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis:
implications for therapy. Neurosurgery 13, 119123.
25. Del Brutto, O.H. (1992) Cysticercosis and cerebrovascular disease: a review. Journal of Neurology,
26. Monteiro, L., Almeida-Pinto, J., Leite, I., et al. (1994) Cerebral cysticercus arteritis: five angiographic
cases. Cerebrovascular Disease 4, 125133.
27. Rodriguez-Carbajal, J., Del Brutto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral
artery due to cysticercotic angiitis. Stroke 20, 10951099.
28. terPenning, B., Litchmanm, C.D., Heier, L. (1992) Bilateral middle cerebral artery occlusions in neurocysticercosis. Stroke 23, 280283.
29. Soto-Hernndez, J.L., Gomez-Llata, S., Rojas-Echeverri, L.A., et al. (1996) Subarachnoid haemorrhage secondary to a ruptured inflammatory aneurysm: a possible manifestation of neurocysticercosis: case report. Neurosurgery 38, 197200.
30. Kim, K.S., Weinberg, P.E. (1985) Spinal cysticercosis. Surgical Neurology 24, 8082.
31. De Souza-Queiroz, L., Filho, A.P., Callegaro, D., et al. (1975) Intramedullary cysticercosis: case
report, literature review and comments on pathogenesis. Journal of the Neurological Sciences 26, 6170.
32. Sperlescu, A., Balbo, R.J., Rossitti, S.L. (1989) Breve comentrio sobre a patogenia da cisticercose
espinhal. Arquivos de Neuropsiquiatria 47, 105109.
33. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Review of Infectious Diseases 10,
10751087.
34. Del Brutto, O.H., Sotelo, J., Romn, G.C. (1998) Neurocysticercosis: a Clinical Handbook. Swets &
Zeitlingler, Lisse, the Netherlands.
35. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal neurocysticercosis: report of
five cases and review of management. Clinical Infectious Disease 15, 799811.
187
36. Keane, J.R. (1982) Neuro-ophthalmologic signs and symptoms of cysticercosis. Archives of
Ophthalmology 100, 14451448.
37. Keane, J.R. (1993) Cysticercosis: unusual neuro-ophthalmologic signs. Journal of Clinical Neuro-ophthalmology 13, 194199.
38. Santoyo, H., Corona, R., Sotelo, J. (1991) Total recovery of visual function after treatment for cerebral
cysticercosis. New England Journal of Medicine 324, 11371139.
39. Celis, M.A., Mourier, K.L., Polivka, M., et al. (1992) Cysticercose cisternale de lngle ponto-cerebellaux. Observatin dun cas oper et revue de la literature. Neurochirurgie 38, 108112.
40. Ramina, R., Hunhevicz, S.C. (1986) Cerebral cysticercosis presenting as mass lesions. Surgical
Neurology 25, 8993.
41. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and
inactive forms. Archives of Internal Medicine 145, 442445.
42. Cant, C., Barinagarrementeria, F. (1996) Cerebrovascular complications of neurocysticercosis.
Clinical and neuroimaging spectrum. Archives of Neurology 53, 233239.
43. Barinagarrementeria, F., Del Brutto, O.H. (1988) Neurocysticercosis and pure motor hemiparesis.
Stroke 19, 11561158.
44. Barinagarrementeria, F., Del Brutto, O.H. (1989) Lacunar syndrome due to neurocysticercosis.
45. McCormick, G.F., Giannotta, S., Zee, C.S., et al. (1983) Carotid occlusion in cysticercosis. Neurology
33, 10781080.
46. Levy, A.S., Lillehei, K.O., Rubinstein, D., et al. (1995) Subarachnoid neurocysticercosis with occlusion of the major intracranial arteries: case report. Neurosurgery 36, 183188.
47. Bang, O.Y., Heo, J.H., Choi, S.A., et al. (1997) Large cerebral infarction during praziquantel therapy
in neurocysticercosis. Stroke 28, 211213.
48. Bonametti, A.M., Baldy, J.L.S., Bortoliero, A.L., et al. (1994) Neurocisticercose com quadro clnico inicial de meningite aguda. Revista do Instituto de Medicina Tropical de So Paulo 36, 2732.
49. Keane, J.R. (1984) Death from cysticercosis. Seven patients with unrecognized obstructive hydrocephalus. Western Journal of Medicine (San Fransisco) 140, 787789.
50. Del Brutto, O.H., Santibaez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389392.
51. Carydakis, C., Baulac, M., Laplane, D., et al. (1984) Cysticercose spinale pure. Note sur le liquide
cphalorachidien. Revue Neurologique (Paris) 140, 590593.
52. Malzacher, V.D., Bogumil-Schott, E., Neu, I.S. (1994) Intraspinale manifestation der zystizerkose
Cysticercus racemosus. Nervenarzt 65, 563567.
53. Kahn, P. (1972) Cysticercosis of the central nervous system with amyotrophic lateral sclerosis: case
report and review of the literature. Journal of Neurology, Neurosurgery and Psychiatry 35, 8187.
54. Hyman, A.D., Gary, C.E., Lanzieri, C., et al. (1986) Tapeworm cysts of the cauda equina. AJNR
American Journal of Neuroradiology 7, 977.
55. Rodriguez-Carbajal, J., Arredondo-Estrada, H., Vzquez-Snchez, H. (1990) La neuroradiologa de
la neurocisticercosis humana. Revista Mexicana de Radiologia 44, 157164.
56. Carbajal, J.R., Palacios, E., Azar-Kia, B., et al. (1977) Radiology of cysticercosis of the central nervous
system including computed tomography. Radiology 125, 127131.
57. Bentson, J.R., Wilson, G.H., Helmer, E., et al. (1977) Computed tomography in intracranial cysticercosis. Journal of Computer Assisted Tomography 1, 464471.
58. Suss, R.A., Maravilla, K.R., Thompson, J. (1986) MR imaging of intracranial cysticercosis: comparison with CT and anatomopathologic features. AJNR American Journal of Neuroradiology 7, 235242.
59. Martinez, H.R., Rangel-Guerra, R., Elizondo, G., et al. (1989) MR imaging in neurocysticercosis: a
study of 56 cases. AJNR American Journal of Neuroradiology 10, 10111019.
60. Berman, J.D., Beaver, P.C., Cheever, A.W., et al. (1981) Cysticercus of 60-milliliter volume in human
brain. American Journal of Tropical Medicine and Hygiene 30, 616619.
61. Barinagarrementeria, F., Cantu, C. (1996) Cysticercotic arteritis: frequency in subarachnoid cysticercosis. Neurology 46, A240 (Abstract).
62. Hernndez-Gonzalez, L.A., Arredondo-Mendoza, F., Prado-Castro, J.A. (1990) Neurocisticercosis
raquimedular en Guatemala. Descripcin del signo de lesin qustica flotante. Revista Mexicana de
Radiologia 44, 165169.
63. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri. review of 127 cases. Archives of
188
O.H. Del Brutto
64. Ramos-Kuri, M., Montoya, R.M., Padilla, A., et al. (1992) Immunodiagnosis of neurocysticercosis.
Disappointing performance of serology (enzyme-linked immunosorbent assay) in an unbiased sample of neurological patients. Archives of Neurology 49, 633636.
65. Rosas, N., Sotelo, J., Nieto, D. (1986) ELISA in the diagnosis of neurocysticercosis. Archives of
66. Richards, F., Jr, Schantz, P.M. (1991) Laboratory diagnosis of cysticercosis. Clinical Laboratory
Medicine 11, 10111028.
67. Wang, C.Y., Zhang, H.H., Ge, L.Y. (1992) A Mab-based ELISA for detecting circulating antigen in
CSF of patients with neurocysticercosis. Hybridoma 11, 825827.
68. Garcia, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1998) A specific antigen-detection ELISA for
the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and
Hygiene 92, 411414.
69. Del Brutto, O.H., Sotelo, J., Romn, G.C. (1993) Therapy for neurocysticercosis: a reappraisal.
70. White, A.C., Jr (2000) Neurocysticercosis. Current Treatment of Infectious Diseases 2, 7887.
71. Jung, H., Hurtado, M., Sanchez, M., et al. (1990) Plasma and CSF levels of albendazole and praziquantel in patients with neurocysticercosis. Clinical Neuropharmacology 13, 559564.
72. Del Brutto, O.H., Sotelo, J., Aguirre, R., et al. (1992) Albendazole therapy for giant subarachnoid cysticerci. Archives of Neurology 49, 535538.
73. Del Brutto, O.H. (1997) Albendazole therapy for subarachnoid cysticerci: clinical and neuroimaging
analysis of 17 patients. Journal of Neurology, Neurosurgery and Psychiatry 62, 659661.
74. Castellanos, F., Montes, I., Porras, L.F., et al. (2000) Quistes subaracnoideos gigantes por neurocisticercosis: a propsito de dos casos observados en un rea rural de Extremadura. Revue Neurologique
(Paris) 30, 433435.
75. Del Brutto, O.H. (1997) Clues to prevent cerebrovascular hazards of cysticidal drug therapy. Stroke
28, 1088.
76. Sotelo, J., Marin, C. (1987) Hydrocephalus secondary to cysticercotic arachnoiditis. A long-term follow-up review of 92 cases. Journal of Neurosurgery 66, 686689.
77. Roman, R.A.S., Soto-Hernndez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal
shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of
Neurosurgery 84, 629633.
78. Sotelo, J. (1993) A new ventriculoperitoneal shunt for treatment of hydrocephalus. Experimental
results. RBM European Journal of Biomedical Technology 15, 257262.
79. Rubalcava, M.A., Sotelo, J. (1995) Differences between ventricular and lumbar cerebrospinal fluid in
hydrocephalus secondary to cysticercosis. Neurosurgery 37, 668672.
80. Sotelo, J., Rubalcava, M.A., Gomez-Llata, S. (1995) A new shunt for hydrocephalus that relies on
CSF production rather than on ventricular pressure: initial clinical experiences. Surgical Neurology
43, 324332.
81. Sotelo, J. (1996) Update: the new ventriculoperitoneal shunt at the Institute of Neurology of Mexico.
Surgical Neurology 46, 1920.
19
Heavy Multilesional Cysticercotic

Syndromes
Oscar H. Del Brutto, Hector H. Garca and Sudesh Prabhakar
Introduction
Most individuals with neurocysticercosis
(NC) have one or a few cysts in the brain, constituting what is appreciated as the benign
end of the clinical spectrum of the disorder13.
However, among the wide spectrum of infection and clinical manifestations of human
Taenia solium cysticercosis, a small subset of
individuals harbour massive infections and
develop clinical manifestations related to it14.
Clinical presentations vary even within this
subset. We will review separately the more
defined presentations of heavy infections in
human cysticercosis, according to Table 19.1.
Cysticercotic Encephalitis
Characteristics
This syndrome of intracranial hypertension
associated with multiple parenchymal cys-
ticerci of homogeneously small size (Fig.

19.1) was first described by Stepien and
Chorobsky, in 19495, and was re-visited after
the introduction of computed tomography
(CT) scanning by Rangel et al. in 19876. Its
clinical manifestations are related to severe
intracranial hypertension due to the inflammatory reaction around several dying cysticerci. There probably is a booster effect
caused by the simultaneous degeneration of
many parasites at the same time. Some
authors have attributed this syndrome to the
phase of brain invasion by the embryos.
Although the latter theory cannot be discarded, it does not account for the long duration of symptoms (several months) in most
cases reported6. Moreover, the development
of cystic parasite vesicles has been shown to
take only a few weeks in experimental infection in pigs. The severity of the clinical picture will depend on the number of the
parasites and the degree of inflammation
and can be severe enough to be fatal.
Table 19.1. Principal neurocysticercosis (NC) syndromes characterized by heavy infestations.

Syndrome
Localization
Characteristics
Cysticercotic encephalitis
Brain parenchyma
Heavy non-encephalitic NC
Brain parenchyma
Disseminated cysticercosis
Anywhere in the body
Severe inflammation with intracranial hypertension

Massive brain infection with minimal
inflammatory response
Involvement of several organs

189
190
O.H. Del Brutto et al.
between white and grey matter. Upon contrast-enhanced CT, multiple small ring/disc
lesions are noted. In the past, several
authors have described CT appearances of
diffuse brain oedema without any identifiable cystic lesions, giving rise to a consideration of benign intracranial hypertension9,10.
This was often seen with older generation
CT scans; however, with more contemporary CT infrastructure and magnetic resonance imaging (MRI), the cysticercal
aetiology cannot be missed.
Therapy and outcome
Fig. 19.1. Post-gadolinum T1 weighted coronal

MRI demonstrating cysticercotic encephalitis.
Clinical manifestations
Cysticercotic encephalitis seems to occur
more frequently in females and at younger
ages, and has also been described in series of
paediatric NC7,8. Seven of the eight patients
in the series described by Rangel et al. were
females, 1027 years of age6. Symptoms were
noted for a maximum of 18 months (mean: 6
months) before diagnosis. Presenting symptoms include headaches that intensify
rapidly prior to diagnosis and seizures6.
Among the clinical signs, those due to
intracranial hypertension including papilloedema often leading on to secondary optic
atrophy, false localizing third and sixth cranial nerve palsies, deep tendon hyperreflexia
and Babinskis responses are noteworthy6.
The mainstay of medical treatment is the use

of corticosteroids to control the inflammatory reaction11. Dexamethasone has been
reported to achieve this successfully,
although required doses may be as high as
32 mg day1. Furosemide, glycerol and
osmotic agents are useful adjuncts. On occasion, resort to decompressive craniotomy or
craniectomy may be undertaken in order to
control intracranial hypertension that threatens vision or life. The use of anticysticercal
agents, either albendazole or praziquantel, is
contraindicated since they may lead to more
degeneration of parasites and worsen the
intracranial hypertension. A number of
affected individuals for whom follow-up is
available required readmission for management of intracranial hypertension6,7. At
times, the latter may prove fatal. Other
important sequelae of cysticercotic encephalitis include loss of vision and neuropsychiatric impairment.
Heavy Non-encephalitic NC
Characteristics
Imaging
Computed tomography discloses multiple
or confluent hypodense areas representing
intense brain oedema6,9. The presence and
severity of the oedema can be appreciated
from the effacement of sulci, reduced ventricular size and loss of differentiation
Two of the authors (OHD and HHG) have

recently described a different syndrome with
multiple cerebral parenchymal cysticerci of
homogeneously small size (Fig. 19.2). This
condition called heavy non-encephalitic NC
differs from cysticercotic encephalitis in that
no inflammatory reaction can be seen around
the cysts, i.e. all parasites are viable and,
Heavy Multilesional Cysticercotic Syndromes
191
our series at the time of diagnosis of NC12.

Whether the presence of an intestinal tapeworm, besides being a close source of infection, relates to the mild symptomatic
expression of this syndrome has not been
determined12,13.
Imaging features
Several hundred non-enhancing homogeneously sized, viable cysts are noted
throughout the brain parenchyma upon CT
and MRI (Fig. 19.2). A scolex is demonstrable
in the majority of the cysts.
Therapy
Fig. 19.2. T1 weighted axial MRI showing heavy

non-encephalitic neurocysticercosis.
therefore, do not enhance with contrast upon

CT/MRI12. It also differs from disseminated
cysticercosis, described in the following section, by comparatively fewer parasitic numbers and absence of overwhelming
involvement of the muscle and subcutaneous tissue. As a rough rule, there are a few
hundred live parasites in heavy nonencephalitic NC, while the number in disseminated cysticercosis is in thousands.
There is no clear predominance of this syndrome by sex and the condition seems to
occur more frequently during the third or
fourth decades of life. Its clinical manifestations are mild. Patients present with
seizures, and subtle neuropsychological
abnormalities. Features of intracranial
hypertension are absent or mild in most
patients. Involvement of other parts of the
body is frequent but not predominant.
Interestingly, intestinal tapeworms were
detected in up to 90% of the individuals in
Adequate control of seizures with

antiepileptic drugs (AEDs) is mandatory, as
in other varieties of NC with seizures. Since
it is expected that most cysts will leave
residual calcifications and thus predispose
to seizure relapse in the future, the use of
AED/s will probably be required for the
life of the patients. Available options in
specific therapy include the use of anticysticercal drugs or inactive observation
allowing the parasites to go through natural involution and then control inflammation with long-term corticosteroid therapy.
The use of anticysticercal drugs in heavy
non-encephalitic cysticercosis has been
demonstrated to be effective in destroying
the cysts but may lead to severe side effects
at the time of death of the cysts. Often,
more than one course of anticysticercal
therapy is required12,14. Observational clinical and pharmacological data suggest that
the action of albendazole is less abrupt than
that of praziquantel; therefore we suggest
the former at first election. In this case,
simultaneous use of corticosteroids (dexamethasone, 0.1 mg kg1 day1 and increasing doses according to the clinical
condition) is mandatory. If anticysticercal
drugs are not used, then serial imaging
evaluations should be performed at least
once every year, and the use of depot corticosteroids is suggested to avoid sequelae of
parasite involution.
192
Disseminated Cysticercosis
Characteristics
The term, disseminated cysticercosis was
coined by Priest in 1926 to refer to the presence of a plethora of cysticerci in multiple
locations in the same patient15. The locations include the subcutaneous tissue, muscles, eye, brain and heart1517. Sporadic
descriptions of this condition have
appeared mainly in literature published
from India and China14,1833. The number of
reported cases since then have been few by
all standards and apart from a few exceptions have emanated from India. We studied clinical and laboratory features in 18
cases that have been reported in the English
literature14,1930,33.
Two important phenomena contribute to
the unique symptom complex of disseminated cysticercosis. One is the sheer number
of live cysticerci. The second is the absence
of a host inflammatory response to cysticerci.
Factors responsible for the massive cyst load
and the absence of an inflammatory response
are not known. Unlike the recent description
of the association between heavy nonencephalitic parenchymal cysticercosis and
intestinal taeniasis, none of the reports of
disseminated cysticercosis mention an association with intestinal taeniais based on faecal evaluations or recent or remote history of
intestinal taeniasis12. A good number of
reported subjects ate pork, but the condition
has been reported in vegetarians as well,
suggesting that it was not necessary to harbour adult worms in order to develop massive dissemination25,26.
nodules and muscle pains were the first

symptoms14,15,2022,29,33. Muscular pseudohypertrophy followed these initial symptoms
by a few weeks to 1 year. The onset of muscular pseudohypertrophy is often marked by
a transient febrile illness and skin
rash14,22,25,29. Two patients reported by Wadia
et al., developed skin rash after the administration of praziquantel14. Muscle pain and
tightness are important symptoms but may
not be forthcoming in certain patients
because of associated cognitive impairment.
Disseminated cysticercosis typically presents
in young age (mean SD of reviewed cases:
22 10 years; range: 945 years). Among
reported cases, males were twice as commonly affected as females.
Muscular pseudohypertrophy (Fig. 19.3)
was the presenting complaint in eight
reported cases19,21,24,27,29. In the remaining
reports, seizures, dementia, subcutaneous
Fig. 19.3. Muscular pseudohypertrophy due to

disseminated cysticercosis. (Reproduced with
Muscular pseudohypertrophy is noticeable in the calves, thighs, arms, glutei,

trapezius, nuchal muscles and masseters.
Usually, there is smooth enlargement of
muscles, but a few authors have described
nodularity20,22. Pseudohypertrophy often
assumes Herculean proportions. MacRoberts
description of a man who went to hospital
because of gross alteration in his physical
appearance, which had come to resemble
that of a professional wrestler to the amusement of his friend and dismay of his household is apt in this regard23. Cysticercal
muscular pseudohypertrophy is easily distinguished from other more common causes
of pseudohypertrophy like Duchennes and
Beckers muscular dystrophy by the short
history, age of onset and associated central
nervous system symptoms. Muscles may
rarely be tender on palpation though commonly there is no tenderness2023. Muscular
weakness is mild and never profound. In
certain cases, it may not be possible to detect
and quantify weakness on account of
impaired cognitive status14. Jolly and Pallis
stressed the absence of muscular weakness
in their patients, all of whom had significant
dementia21. Rao et al. described a patient
with muscular pseudohypertrophy with no
detectable weakness or central nervous
system involvement25. Deep tendon reflexes
may be absent, normal or even brisk22,25,28.
It is worthwhile to stress here that muscular involvement, though common, is
rarely symptomatic (except in pseudohypertrophic myopathy) in cysticercosis. In the
past, muscular involvement was detected
when plain radiographs were performed
either for diagnostic purposes or because of
unrelated medical conditions3437. In a wellknown series of 450 British soldiers returning from India, over 70% were diagnosed as
having muscle calcifications sometime during their follow-up38. This can not be interpreted as a usual frequency, however, since
many of these cases were diagnosed by this
finding and thus there was a strong selection
bias in the series3437.
The obviously more noticeable clinical
manifestations of disseminated cysticercosis
arise from cerebral and ocular involvement,
and subcutaneous cysticerci that are easily
193
identified at physical examination when

present. A helpful tool is to ask the patient
about noticing the nodules. It should be
noted here that subcutaneous cysticerci are
more frequently reported in Asia than in
Latin America despite similar endemicity of
disease38. Subcutaneous cysticercosis is
invariably associated with muscle involvement. Ocular cysts may be noted by careful
examination14,15,20,21. Dementia and behavioural disturbances have been reported in
approximately 50% of the reviewed
cases14,2022,29. Strangely, despite the massive
infestation of the brain, focal neurological
deficits and intracranial hypertension are
rare22,29.
Laboratory investigations
Soft-tissue calcifications are lacking in the
majority of cases but a few authors have
reported diminutive spotty calcifications in
limb radiographs of individuals with disseminated cysticercosis. Most reports have
not alluded to the status of muscle enzymes
in this condition. Wadia et al. categorically
described normal serum creatine kinase levels in two of their patients with pseudohypertrophy14. Electromyographic sampling of
muscle was unremarkable in two cases and
showed features of an inflammatory
myopathy in one case described by the
authors. Eosinophilia is an important supporting feature in the laboratory diagnosis
of this condition. CT of the brain has been
performed in only the most recently
reported cases14. A unifying feature is the
presence of a plethora of live, not calcified
cysts throughout the cerebral parenchyma
(Fig. 19.4a). Wadia et al. analysed the CT
appearance of muscle infested by cysticerci
and described profuse infestation by large
numbers giving rise to a honeycomb
appearance (Fig. 19.4b)14. Cysts in the muscle were larger than those in the brain and
scolices were more difficult to identify.
Cysticercal invasion of the muscle has
been demonstrated histologically in all
reported patients except one. Cysts are alive,
330 mm in size, and have scolices without
calcification. Jolly and Pallis stressed the
194
Therapy and outcome
Fig. 19.4. CT scan of the brain (a) and muscle (b)

of a patient with disseminated cysticercosis.
(Source: Noshir H. Wadia, Mumbai, India.)
observation of tense cysts, implying early

degeneration
during
involution
of
cysticerci21. Microscopically, all features of
cysticercus cellulosae can be identified,
including calcareal corpuscles and the
canalicular system. The cysts are surrounded by an inflammatory infiltrate of
round cells. Inflammatory as well as necrotic
changes in the muscle have been exceptionally noted25,29. More typically, the muscle is
histologically normal.
The majority of published reports do not

describe follow-up. A limited follow-up of
one case described by McGill revealed persisting pseudohypertrophy for at least 19
months22. It would be interesting to speculate that the radiological picture of multiple
profuse soft-tissue calcifications is a sequel to
cysticercal infestation in muscular pseudohypertrophy. However, no case of cysticercal
muscular pseudohypertrophy has been followed up to the point of calcification. A more
realistic description of overall outcome is
death due the effects of cysticercal infestation at other sites, particularly the brain14.
One of the patients reported by Wadia et al.
died of status epilepticus within 5 months of
presentation. Another died after the institution of praziquantel therapy and a third had
a sudden death 2 months after presentation.
The cause of death in the third patient is not
clear, but it may be interesting to speculate
an anaphylactic reaction due to massive
release of cysticercal antigens from degenerating cysts as the cause of death.
Wadia et al. treated their patients with disseminated cysticercosis with praziquantel
and noted an adverse prognosis. Muscle
girth initially increased with praziquantel
treatment but ultimately resolved in two
patients. The third patient died very soon
after the institution of anticysticercal therapy.
In contrast with the adverse results of praziquantel administration noted by Wadia et al.
several Chinese authors have reported
improved outcome with treatment31,32.
It is imperative that orbital cysticercosis
(ocular or extraocular cysts) should be carefully searched for in all cases of disseminated
cysticercosis. The reason for this is that
cyst/s in these locations may damage visual
function if treated inadvertently. Up till now,
the treatment of choice for ocular cysticercosis has been surgical excision with vitrectomy, although there are recent reports of
using albendazole along with local corticosteroid injections (see Chapter 28). Targeting
NC is the next therapeutic priority; these
patients should be approached as described
above for non-encephalitic NC. The use of
symptomatic treatment including AEDs; an
individualized decision on the use of anticysticercal drugs; adequate supportive measures when using them; maintenance of
imaging surveillance; and long-term corticosteroid therapy if anticysticercal agents are
not prescribed, are all important aspects of
the treatment plan. Subcutaneous and muscular cysticercosis do not require specific
therapy unless mass effects due to cyst
clumps occur. In these cases, either surgical
excision or anticysticercal therapy is effective
(again, after first ruling out the possibility of
ocular or cerebral cysticercosis).
Comment
Evidence from animal studies (Gonzalez et
al., unpublished data, 2001) and data on softtissue roentgenograms from older series of
cysticercosis suggest that almost all human
cases of NC are disseminated to an extent.
This dissemination, however, does not cause
discernible manifestations because infection
is controlled by the host immunity in sites
other than the brain39. If this is the case, the
heavy infections described hitherto imply
that either the hosts immune system is illprepared to counteract tissue infection, or
that the infecting parasite load was large
enough to overcome the hosts ability to
destroy cysts. Although the diagnosis of cysticercosis in these cases will easily fulfil the
recommended criteria for NC40, identification
of specific syndromes is necessary for sound
and appropriate therapy. Since only a few
reports of each syndrome are available, some
degree of overlap between them does occur.
In any case, one or more of these syndromes
can be clearly identified when a patient presents with massive infection. All these forms
195
result from either a massive load of T. solium

eggs, or a continued source of infection, and
the degree of inflammation, closely correlated
to the clinical expression, is probably dependent on the previous exposure of the host
immune system to T. solium antigens41,42.
Conclusions
Three major clinical syndromes with heavy,
multilesional
cysticercosis
have
been
described. The first, cysticercotic encephalitis,
is characterized by a profuse inflammatory
response to several degenerating cysticerci in
the cerebral parenchyma, giving rise to cerebral oedema and intracranial hypertension.
In the second condition, known as heavy nonencephalitic NC, there are hundreds of live,
active and viable cysts throughout the brain
parenchyma with no surrounding oedema.
The condition, which is not catastrophic like
cysticercotic encephalitis, manifests with
intracranial hypertension and neuropsychiatric features. The third form, i.e. disseminated cysticercosis, implies the existence of
cysticerci, again live, in still larger numbers,
probably thousands, throughout the brain,
muscles, skin and eyes. The latter presents
with muscular pseudohypertrophy in addition to dementia and other neuropsychiatric
disturbances. The clinical behaviour and
imaging characteristics of the three syndromes differ; however, a uniting feature is
the proclivity of anticysticercal therapy to
cause serious, often life-threatening adverse
effects due to massive inflammatory oedema
and intracranial hypertension that may follow death of the cysticerci. Therefore,
extreme caution is to be exercised if resort to
anticysticercal therapy is sought.
References
1. Del Brutto, O.H., Sotelo, J., Romn, G.C. (1997) Neurocysticercosis. A Clinical Handbook. Swets and
Zeiliger, Lisse, the Netherlands, pp. 207.
2. Garca, H.H., Martinez, S.M. (1999) Taenia solium Taeniasis/Cysticercosis, 2nd edn. Editorial
Universo, Lima, Peru, pp. 346.
3. Garcia, H.H., Del Brutto, O.H. (2000) T. solium taeniasis/cysticercosis. Infectious Diseases Clinics of
North America 14, 97120.
196
5. Stepien, L., Chorobsky, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of
6. Rangel, R., Torres, B., Del Brutto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young
females. American Journal of Tropical Medicine and Hygiene 36, 387392.
7. Del Brutto, O.H., Garcia, E., Talamas, O., et al. (1988) Sex-related severity of inflammation in
parenchymal brain cysticercosis. Archives of Internal Medicine 148, 544547.
8. Lopez-Hernandez, A., Garayzar, C. (1982) Analysis of 89 cases of infantile cerebral cysticercosis. In:
Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives.
9. Sharma, K., Gupta, R.K. (1993) Scan negative neurocysticercosis. Pediatric Neurosurgery 19, 206208.
10. Agapejev, S., Yela, D.A., Gomes, A.E. (1998) Edema cerebral crnico na neurocisticercose. Arquivios
de Neuropsiquiatria 56, 569576.
11. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticerosis: a reappraisal. Clinical
Infectious Diseases 17, 730735.
12. Garca, H.H., Del Brutto, O.H., and The Cysticercosis Working Group in Per (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 15821584.
13. Gilman, R.H., Del Brutto, O.H., Garca, H.H., et al. (2000) Prevalence of taeniosis among neurocysticercosis patients is related to the severity of cerebral infection. Neurology 55, 1062.
14. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations, including CT
scan findings and experience with treatment with praziquantel. Brain 111, 597614.
15. Priest, R. (1926) A case of extensive somatic dissemination of Cysticercus cellulosae in man. British
Medical Journal ii, 471472.
16. Cheung, Y.Y., Steinbaum, S., Yuh, W.T., et al. (1987) MR findings in extracranial cysticercosis. Journal
of Computed Assisted Tomography 11, 179181.
17. Mandal, D.K., Banerjee, S., Ghosh, A., et al. (1989) Neurocysticercosis with rare presentations. Journal
of the Indian Medical Association 87, 142144.
18. Krishnaswami, C.S. (1912) Case of Cysticercus cellulosae. Indian Medical Gazette 47, 4344.
19. Armbrust-Figueiredo, J., Speciali, J.G., Lison, M.P. (1970) Forma myopatica da cysticercose. Arquivos
de Neuropsiquitria 28, 385390.
20. Jacob, J.C., Mathew, N.T. (1968) Pseudohypertrophic myopathy in cysticercosis. Neurology 18,
767771.
21. Jolly, S.S., Pallis, C. (1971) Muscular pseudohypertrophy due to cysticercosis. Journal of Neurological
Sciences 12, 155162.
22. McGill, R.J. (1948) Cysticercosis resembling myopathy. Lancet ii, 728730.
23. MacRobert, G.R. (1944) Somatic taeniasis (Solium cysticercosis). Indian Medical Gazette 79, 399400.
24. Prakash, C., Kumar, A. (1965) Cysticercosis with taeniasis in a vegetarian. Journal of Tropical Medicine
25. Rao, C.M., Sattar, S.A., Gopal, P.S., et al. (1972) Cysticercosis resembling myopathy: report of a case.
Indian Journal of Medical Sciences 26, 841843.
26. Salgaokar, S.V., Watcha, M.F. (1974) Muscular hypertrophy in cysticercosis: a case report. Journal of
Postgraduate Medicine, Bombay, India 20, 148152.
27. Sawhney, B.B., Chopra, J.S., Banerji, A.K., et al. (1976) Pseudohypertrophic myopathy in cysticercosis. Neurology 26, 270272.
28. Singh, A., Jolly, S.S. (1957) Cysticercosis: case report. Indian Journal of Medical Sciences 11, 98101.
29. Vigg, B., Rai, V. (1975) Muscular involvement in cysticercosis with pseudohypertrophy of muscles.
Journal of the Association of Physicians of India 23, 593595.
30. Vijayan, G.P., Venkatraman, S., Suri, M.L., et al. (1977) Neurological and related manifestation of cysticercosis. Tropical and Geographical Medicine 29, 271278.
31. Zhu, D., Xu, W. (1983) Effect of biltricide on cysticercosis cellulosae with muscular psuedohypertrophy: a report of three cases. Chi Sheng Chung Hsueh Yu Chi Sheng Chung Ping Tsa Chih 1,
185186.
32. Xu, Z., Chen, W., Zong, H., et al. (1985) Praziquantel in treatment of cysticercosis cellulosae. Report
of 200 cases. Chinese Medical Journal 98, 489494.
33. Takayanagui, O.M., Chimelli, L. (1998) Disseminated muscular cysticercosis with myositis induced
by praziquantel therapy. American Journal of Tropical Medicine and Hygiene 59, 10021003.
34. Cruz, I., Cruz, M.E., Teran, W., et al. (1994) Human subcutaneous Taenia solium cysticercosis, in an
Andean population with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 51, 405407.
197
35. McArthur, W.P. (1934) Cysticercosis as seen in the British army with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343363.
36. Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one
37. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium): a further ten years clinical
study, covering 284 cases. Quarterly Journal of Medicine 13, 107121.
Research Council Special Report. Series No. 299. Her Majestys Stationery Office, London, pp. 158.
39. Garcia, H.H., Gonzalez, A.E., Gilman, R.H., et al. (2001) Transient antibody response in Taenia solium
infection in field conditions: a major contributor to high seroprevalence. American Journal of Tropical
40. Del Brutto, O.H., Rajshekhar, V., White, A.C., et al. (2001) Proposed diagnostic criteria for neurocysticercosis. Neurology 57, 177183.
41. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Protection of pigs with cysticercosis from further
infections after treatment with oxfendazole. American Journal of Tropical Medicine and Hygiene 65,
1518.
42. Evans, C.A.W., Gonzalez, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis:
Implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56,
3337.
20
Intraventricular Neurocysticercosis
Albert C. Cuetter and Russell J. Andrews
Introduction
Intraventricular neurocysticercosis (IVNC)
is the presence of tapeworm cysts inside
the cerebral ventricular system. IVNC commonly results in intraventricular obstruction, increased intracranial pressure (ICP),
meningoencephalitis
and
ventriculitis.
IVNC is a serious condition with an
obscure natural history, and in many cases,
a poor prognosis.
About 30% of patients with NC have
intraventricular cysts1,2. In the ventricular
system cysts are firmly encapsulated, either
float freely throughout the cerebrospinal
fluid (CSF) pathways, or are attached to the
ependyma, anywhere in the ventricles but
with predilection for the occipital horn of
the lateral ventricle and the fourth
ventricle3. Intraventricular cysts can be single or multiple. Many patients with cysts in
the lateral ventricles have multiple
parenchymal and subarachnoid cysts2,4.
Therefore, most of the patients with intraventricular cysts suffer from seizures before
they develop hydrocephalic symptoms4.
The larvae prefer to lodge in the well-irrigated parenchyma, and the ventricles are
used as a lodging site when the
parenchyma is filled. However, a cyst in the
fourth ventricle tends to be a solitary mass,
without
accompanying
parenchymal
cysts5,6. Approximately 30% of all patients

with NC develop hydrocephalus due to CSF
flow obstruction by the cysts either inside
the ventricles or in the subarachnoid space7.
Clinical Features
The classification of Carpio et al., of neurocysticercosis (NC) into active (vesicular,
viable), inflammatory (involutional, transitional, colloidal), and inactive lesions is
descriptive
and
convenient8.
Intraventricular cysts have a more aggressive
behaviour than parenchymal cysts. The
symptoms in parenchymal cysticercosis
largely result from the host inflammatory
response to the dead or dying larva with
irritation and oedema of the brain and the
occurrence of epileptic seizures. However,
intraventricular cysts may become symptomatic at the time of implantation due to
obstruction of the CSF flow, with consequent hydrocephalus and symptoms, signs,
and consequences of increased ICP. As the
process of involution begins, the inflammatory reaction around a dead or dying cyst
produces ependymitis, scarring, obstruction
and ventriculitis.
The secondary symptomatology of coexisting parenchymal involutional cysts may
lead to discovery of asymptomatic intraven-

199
200
A.C. Cuetter and R.J. Andrews
tricular cysts with or without hydrocephalus.

Thus, there are patients presenting with
seizures due to parenchymal involutional
cysts who also have asymptomatic intraventricular cysts (Fig. 20.1).
Symptoms mainly due to obstruction of

the CSF flow
Intraventricular cysts may totally obstruct
the CSF flow. This obstruction can be abrupt
or gradual. Cysts moving freely within the
ventricular system may lodge in one of the
vital communication passages of the ventricular system with intermittent or permanent
blockade of CSF flow4.
Abrupt obstruction
Abrupt obstruction of the ventricular system
results in acute hydrocephalus with symptoms and signs such as headache, diplopia,
dizziness, vomiting, restlessness, drowsiness, respiratory changes, bradycardia, ele-
vation of arterial blood pressure, seizures,

and alteration of consciousness. Abrupt
intermittent obstruction of the intraventricular CSF flow by the cyst produces abnormalities lasting hours to days. Sudden changes of
head position may change the location of the
cyst and trigger or alleviate the headaches4,9.
Also, sudden change of head position may
produce fleeting loss of strength or muscle
tone9. These drop attacks may be due to
associated sudden bilateral ischaemic
changes in brainstem. Abrupt permanent
obstruction leads to acute hydrocephalus
with stupor, coma, and death from brain herniation4,912. Obstruction may occur in the
foramen of Monro, third ventricle, aqueduct
of Sylvius, or fourth ventricle11. Any
obstructing cyst located in the ventricles
results in a non-communicating hydrocephalus that requires prompt therapeutic
intervention to prevent brain herniation.
In the fourth ventricle, direct compression
of the brainstem and midcerebellar structures
produces, in addition to symptoms of
increased ICP, focal deficits due to local mass
Fig. 20.1. Axial T1-weighted post-contrast MRI shows multiple parenchymal cysts and an intraventricular
cyst in the occipital horn of the right lateral ventricle. This 32-year-old man presented with seizures. The
hydrocephalus had not yet produced symptoms.
effects, such as gait ataxia, dysmetria and

diplopia13,14. In children, this clinical presentation may suggest the presence of a midline
cerebellar tumour. A superior aqueductal
syndrome is seen in patients with blockade of
the aqueduct of Sylvius. These patients have
paralysis of vertical gaze as well as other
symptoms and signs of increased ICP15.
Chronic obstruction
Most cases present with insidious, gradual
onset of increased ICP4. The obstruction of
the CSF circulation may be due to the presence of a large cyst in the ventricular cavities, particularly in the fourth ventricle.
Symptoms include headaches, nausea, vomiting, somnolence, memory and behavioral
changes, and gait disturbance for several
months before presentation4,5,9,12. The neurological examination may reveal decreased
alertness, papilloedema, and focal motor
neurological deficits, including corticospinal
tract signs and frontal lobe motor apraxia.
The latter is due to extensive bilateral lesions
of long motor tracts originating from the
frontal lobes by the enlarging lateral ventricles. Also, ventricular expansion is maximal
in the frontal horns with consequent impairment of frontal lobe functions. If not treated,
these patients can decompensate and deteriorate abruptly9.
Symptoms due to both obstruction of

CSF flow and inflammation
Most people who die from chronic complications belong to this category. When the larva
in the cyst dies, the involutional process and
inflammation turn an asymptomatic intraventricular cyst into a symptomatic one. The involutional cyst liberates antigenic substances that
generate an inflammatory reaction throughout
the ventricular system, and a severe localized
reaction of granular ependymitis that fixes the
cyst capsule to the ventricular wall with
strong adhesions and fibrosis that may produce irreversible blockade of the CSF circulation. The fourth ventricle is frequently
affected. The result is progressive hydrocephalus, increased ICP, and poor response to
201
medical and surgical treatment1,16. Fixed cysts

are not susceptible to surgical removal without damage to brain tissue1,7.
Patients present with a picture of
increased ICP, meningoencephalitis (fever,
alteration of consciousness and nuchal rigidity), focal neurological deficit and inflammatory reaction in the CSF7,17. A final clinical
stage includes mental deterioration, blindness, quadriparesis, and ataxia, despite
appropriate treatment17. There are many
complications contributing to clinical deterioration, including cerebral and brainstem
infarcts due to angiitis, hypothalamic dysfunction, infections, repeated shunt failure,
and progression of the disease with arachnoiditis, ependymitis, ventriculitis and irreversible tissue damage.
Inflammatory cysts in the fourth ventricle
pose a difficult problem because there is
associated widespread granular ependymitis
and ventriculitis. This leads to ventricular
enlargement that may persist even after a
ventriculoperitoneal shunt (VPS) is placed
for the relief of the hydrocephalus7.
Although there may be single or multiple
involutional cysts in the fourth ventricle, in
many cases there are no cysts detected by
neuroimaging or found during surgery.
Communicating hydrocephalus from

basilar arachnoiditis and leptomeningeal
scarring
This type of basilar meningeal cysticercosis
is discussed in Chapter 18.
Radiological and Laboratory Diagnosis

The criteria for the diagnosis of IVNC are
based on clinical presentation, magnetic resonance imaging (MRI) evidence of cystic
lesions containing the scolex, and histological demonstration of the parasite from the
brain lesions or from the CSF. Since the clinical presentation of IVNC is by no means specific, it is important to review the clinical
history, laboratory findings and imaging
studies to arrive at a correct diagnosis.
202
Computed tomography (CT)

Small cysts that do not deform the ventricles
are not visualized upon CT because: (i) they
have the same density as the CSF; (ii) the
wall of the cyst, and the scolex are not
visible18,19; and (iii) the cyst does not show
contrast enhancement20. In the absence of
hydrocephalus, a large intraventricular cyst
may be visualized on CT scan if it deforms
the ventricle and the cyst mass is outlined by
the normal ventricular cavity. A cyst deforming or enlarging the fourth ventricle is well
visualized on CT. If the cyst is in the inflammatory stage, there may be oedema of the
adjacent tissues. A CT scan may also show
calcified inactive parenchymal lesions. The
finding of cysts in different stages of evolution, including calcifications, and the presence of hydrocephalus on CT, even if the
obstructing cysts are not visualized, helps in
the diagnosis.
ment with surrounding oedema similar to

inflammatory parenchymal cysts (Fig.
20.2b)19. Differentiation of such a ring-like
enhancing lesion from neoplastic processes
or other inflammatory processes may be difficult based on imaging findings only19.
Obstructing cysts and consequent hydrocephalus are well demonstrated on MRI.
Sometimes, there is hydrocephalus and
other MRI findings of NC, but no cysts are
seen in the ventricles. In some of these cases
the enlargement of the ventricles may be a
result of ependymitis, scarring, or
meningeal involvement. A cyst in the third
ventricle or the foramen of Monro gives rise
to enlargement of the lateral ventricles,
sometimes unilateral only. Cysts in the
fourth ventricle produce significant hydrocephalus and usually are not accompanied
by parenchymal cysts19.
Immunodiagnosis
Magnetic resonance imaging (MRI)
MRI readily visualizes intraventricular cysts
in about 80% of the cases21. On T1-weighted
imaging and fluid attenuation inversion
recovery (FLAIR) imaging (Fig. 20.2c), a
viable, active intraventricular cyst appears as
a spherical lesion of 1020 mm in diameter,
often with the scolex visualized as a mural
nodule that has the hyperintensity of fat tissue. Evidence of cystic lesions containing the
scolex is one of the absolute criteria for diagnosis22. The cyst wall is a thin hyperintensity
outlined between the darkness of the cyst
content and the ventricular CSF. On T2weighted imaging, the inside of the cyst is
isointense with the surrounding tissues, and
the scolex is hyperintense.
Ring-like or nodular enhancement has
been correlated with the presence of granular ependymitis that accompanies inflammatory, involutional cysts. T1-weighted imaging
without gadolinium shows the inflammatory
features of an involutional cyst: (i) hyperintense cyst wall; (ii) hyperintense scolex; and
(iii) oedema around the cyst (Fig. 20.2ac).
On T1-weighted images with gadolinium,
inflammatory cysts have a ring-like enhance-
Over 80% of patients with intraventricular

inflammatory lesions have positive enzymelinked immunoelectrotransfer blot (EITB) in
serum and CSF. Antibodies are detectable as
frequently in serum as in CSF, regardless of
the number or apparent condition of the
cysts23. Recent data shows that ELISA in
serum does not perform well with this disease and has a high rate of both false-positive and false-negative results24. A negative
result does not exclude NC; a positive result
is not specific for NC, especially in groups
with high exposure.
CSF examination
Lumbar puncture is contraindicated in
patients with increased ICP. In these cases
the CSF may be obtained through a ventriculostomy. CSF abnormalities are directly proportional to the degree of local inflammation
and ventriculitis. The CSF examination may
show no cells, and normal protein and glucose in about half the number of cases9. The
other half of patients have a moderate
degree of mixed pleocytosis, increased protein and hypoglycorrhagia. There is both
203
(a)
(b)
(c)
Fig. 20.2. (a) Sagittal T1-weighted MRI shows a large inflammatory (involutional, transitional) cyst in the
fourth ventricle. The mural nodule is visible. There is oedema of adjacent brain tissue. (b) Axial T1-weighted
post-contrast MRI shows an inflammatory cyst in the fourth ventricle with a ring-like enhancement. There is
oedema of adjacent brain tissue. (c) An axial fluid attenuation inversion recovery (FLAIR) MRI shows an
inflammatory cyst in the fourth ventricle, oedema in the surrounding brain tissue, and the mural nodule.
polymorphonuclear and lymphomononuclear pleocytosis, but the latter predominates4,9,12,25. Eosinophilia occurs in
about 20% of patients with pleocytosis12.
Glucose is reduced in about 6%; protein is
elevated up to a maximum of 420 mg dl1 12.
Differential Diagnosis
Histological demonstration of the miniature
parasite from surgically resected tissue is an
important diagnostic criterion22. The tissue
may be the surgical specimen from cysts
204
removed, or the intraventricular content

obtained through ventriculostomy. The differential diagnosis of IVNC includes toxoplasmosis, fungal and bacterial meningitis,
hydrocephalic
sequelae
of
tubercular
meningitis, echinococcosis, intraventricular
neoplasms6,13,26 and non-infectious granulomatous chronic meningitis. Toxoplasmosis
may present with enlarged ventricles due to
ependymitis and aqueductal stenosis18. On
neuroimaging, bacterial and coccidioidal
ependymitis with ventriculitis produces
hydrocephalus and associated enhancement
of the ependymal walls of lateral ventricles.
However, the clinical picture is different, and
there are no cysts, or other signs of NC.
Granulomatous tubercular meningitis may
present with hydrocephalus, but there is
involvement of the meninges at the base of
the skull on post-gadolinium MRI27,28. On
MRI, the multiloculated parietal cystic structure of echinococcosis may overlap the ventricular silhouette resembling IVNC. A third
ventricular cysticercus may mimic a colloid
cyst. Fourth ventricle cysts simulate neoplasms such as cystic medulloblastoma, astrocytoma or ependymoma, with obstruction of
the ventricular flow, neuroimaging cystic
changes of a tumoural mass, and oedema of
adjacent brain tissues (Figs 20.2ac). However,
tumours enhance with gadolinium, have
much more oedema in the adjacent tissues,
and show extension up and down in the ventricle and laterally into prepontine cisterns.
Finally, non-infectious conditions such as sarcoidosis and meningeal carcinomatosis may
produce chronic hydrocephalus due to leptomeningitis and pachymeningitis18.
Treatment
The treatment of IVNC is symptom specific.
The choice of treatment from available therapeutic modalities shown below depends on
the condition of the patient at the time of
presentation, location of cyst, and evolutional stage of the cyst:
emergent temporary ventriculostomy;
VPS procedure;
surgical or endoscopic extirpation of
obstructing cysts;
use of anticysticercal drugs (albendazole,

praziquantel);
use of corticosteroids.
Acute hydrocephalus; viable cyst

According to current standards, acute hydrocephalus requires ventriculostomy followed
by surgical or endoscopic extirpation of
viable cyst/s obstructing the CSF flow, particularly those in the fourth ventricle1,6,9,11,19,29,30. After initial placement of a
ventriculostomy catheter, a definitive procedure to extirpate the cyst/s is highly advisable. The choice between open surgical
removal and endoscopic removal depends
upon the operators experience. The reader
is referred to Chapter 40 for a detailed discussion on the merits and demerits of each
procedure, as well as technical details of the
endoscopic approach.
Acute hydocephalus; inflamed cyst

When there is neuroimaging evidence of
ependymitis, VPS without surgical attempts
to remove the cyst is preferable because involutional inflammatory cysts are fixed to the
ventricular wall with strong adhesions and
thickening, and cannot easily be removed
without damaging brain tissue1,7,11,31. Even if
the cyst is removed, there is a likelihood that
VPS may still be necessary6,11.
Unfortunately, in most cases, a differentiation between a viable and an inflammatory
intraventricular cyst cannot be made. Several
clinical points are helpful. A viable cyst does
not have clinical symptoms and signs of
meningitis, and has no or only discrete
inflammatory reaction on CSF that has been
obtained by ventriculostomy. Conversely, an
involutional inflammatory cyst shows symptoms and signs of meningitis, focal neurological deficit and inflammatory response on CSF
examination7. On T1-weighted MRI, an
inflammatory cyst has a hyperintense wall,
and there is oedema of adjacent brain tissue
(Fig. 20.2a). On T1-weighted post-gadolinium
imaging, there is a ring-like enhancement in
the wall of the inflammatory cyst (Fig. 20.2b).
It is recommended that patients with

acute hydrocephalus due to intraventricular
inflammatory cysts be treated with emergent
temporary ventriculostomy, followed by a
permanent VPS procedure11,32,33. The use of
dexamethasone in therapeutic declining dose
therapy may afford some benefit to these
patients if it relieves the inflammatory stage
and brain oedema4,5,25,34.
205
cysts, or by high CSF protein37. In some

instances, a lack of improvement after a shunting procedure is explained by mass effect due
to an enlarging cyst or inadequate decompression, and in the latter situation, a revision of
the shunt is required12,35. Recurrent shunt
obstruction by cyst material is another reason
for excision of intraventricular cysts5.
Anticysticercal drugs
Chronic hydrocephalus; viable cysts
Patients with chronic hydrocephalus and
increased ICP usually require a permanent
VPS35. Open surgical or endoscopic removal
of the viable cysts should be done if they are
large, if they obstruct the CSF flow, if they
complicate shunting, if they cause a mass
effect despite shunting, and if the diagnosis
is uncertain35. Viable cysts in the fourth ventricle should be extirpated because by their
mass effect, these cysts may cause herniation
even after VPS9. A transcortical approach is
used for removal of cysts from lateral ventricles; a transcallosal approach for cysts in the
third ventricle; and a midline suboccipital
direct approach for cysts in the fourth ventricle1,11,32. Bergsneider and Nieto (see Chapter
40) discuss the option of direct endoscopic
removal of cyst/s without resort to VPS.
The surgeon must consider the possibility of
cyst migration between the time of diagnosis and
craniotomy36. Migration of the targeted cyst must
be ruled out by a neuroimaging procedure done
immediately before surgery19,33. In cases of multiple cysts and multiple obstructions with loculated hydrocephalus, there may be a need for
multiple shunt procedures, each draining a separate compartment31. Patients with intraventricular cysts without hydrocephalus, or with only
slight dilatation of the ventricles, require close
supervision in case shunting becomes necessary.
Chronic hydrocephalus; inflamed cyst

VPS remains the mainstay of therapy of
inflamed IVNC. However, shunts are prone to
complications in these patients. The most
common cause of dysfunction of VPS is
obstruction either by gelatinous material from
Some investigators have advocated the use

of anticysticercal drugs in conjunction with
VPS5,12 to decrease shunt failures and
destroy viable cysts. The use of praziquantel,
an isoquinoline with broad anthelmintic
activity, in IVNC is controversial, since earlier studies have associated such therapy
with a poor outcome38. Both failures2,17,3840,
and successes5,41,42, with praziquantel have
been observed in the treatment of intraventricular cysts. The recommended dose is 50
mg kg1 day1 for 14 days with concomitant
use of dexamethasone.
There are several reports describing the
successful treatment of intraventricular cysts
with albendazole (Fig. 20.3a,b)2,4345. In some
series, intraventricular cysts disappeared
within 3 months after this approach2,4345.
Albendazole is used at a dose of 15 mg kg1
day1 for 15 days. The daily dose is divided
into three administrations, and dexamethasone is given concomitantly. Two courses of
medication are given 1 month apart.
Intermittent long-term steroid therapy may
reduce shunt malfunction46.
The favourable response to treatment of
IVNC with either praziquantel or albendazole is by no means definite and may be a
reflection of the natural history of the condition. When the larva in the cyst dies as a
result of anticysticercal therapy, there is an
inflammatory reaction similar to the one seen
with the natural death of the larva47,48. The
local reaction with scarring and granulomatous ependymitis may lead to an irreversible
blockade of CSF flow due to a permanent tissue damage. In addition, resolution with
anticysticercal drugs may take a long period
of time, usually in months. During this
period, the patient is at risk of developing
206
(a)
(b)
Fig. 20.3. (a) T1-weighted MRI shows an intraventricular cyst in the frontal horn of the right lateral
ventricle. (b) Same patient as in (a), 12 months later. There was a resolution of the cyst.
complications such as ependymitis and acute

ventricular obstruction. For this reason, some
authors question the effectiveness of anticysticercal therapy in IVNC, even suggesting
that the treatment with anticysticercal agents
is associated with an increase in frequency of
long-term sequelae49. Therefore, the use of

anticysticercal therapy in IVNC continues to
be debated50. Collaborative clinical trials are
needed to evaluate specific medical treatment
of IVNC and to develop a better understanding of the clinical course49.
Prognosis
IVNC is potentially lethal. Early studies
showed that the mortality of acute hydrocephalus is 13%33. However, many patients
who have surgical removal of the intraventricular cysts and VPS to relieve hydrocephalus, improve with resolution of the
hydrocephalus26. The prognosis for patients
with IVNC of the fourth ventricle is not
good. The mass effect of a cyst in the poste-
207
rior fossa is less well tolerated than at other

sites. Significant morbidity is associated with
fourth ventricular cysts even after VPS12.
Cysts in the fourth ventricle usually present
in the inflammatory state with oedema and
adhesion to the adjacent tissue (Fig. 20.2c), at
which time the resection of the entire lesion
is difficult. Hydrocephalus returns in some
patients with IVNC, even after cysts have
disappeared (Fig. 20.4ac)2,14,20. Although a
reinfection can be the cause of this relapse, in
(a)
(b)
(c)
Fig. 20.4. (a) CT scan of a 46-year-old man shows intraventricular and parenchymal active cysts. (b) CT
scan, 11 months later shows resolution of the cyst. (c) One year later the patient presented with
increased intracranial pressure. CT scan showed non-communicating hydrocephalus.
208
some cases, the most likely reason is the

obstruction of the CSF pathways by chronic
adhesions and thickening left by involutional cysts. This emphasizes the need for
aggressive initial treatment in these patients.
Conclusions
IVNC is a serious and disabling condition
with obscure peculiarities in its natural history, grave complications, and a high rate of
poor outcomes. Active, viable intraventricular
cysts produce no reaction from the host, but
can mechanically interfere with CSF flow,
leading to complex clinical syndromes mainly
because of obstructive hydrocephalus. These
cysts can migrate freely in the ventricular system, giving rise to acute intermittent or permanent symptoms from hydrocephalus and
increased ICP. When the larva dies, there
occurs a local granulomatous ependymitis and
generalized ventriculitis with hydrocephalus,
increased ICP and meningoencephalitis.

Neuroimaging is the most important tool for
the diagnosis of IVNC. The finding of cysts in
different stages of evolution helps in the diagnosis. The treatment of IVNC is symptom
specific. Surgical treatment of acute hydrocephalus consists of ventriculostomy followed
by permanent VPS. Dexamethasone alleviates
the increased ICP, cerebral oedema and
inflammation. In chronic hydrocephalus and
intraventricular cysts, the selection of treatment modalities such as VPS, surgical removal
of the cysts, and anticysticercal therapy is a
subject that challenges the common sense,
experience, and judgement of the treating
physician. There are reports of successes and
failures with the use of anticysticercal medication. The use of anticysticercal medications to
hasten the involution of intraventricular viable
cysts may trigger an inflammatory response
similar to the one seen with the natural death
of the parasite, with consequent increased frequency of long-term sequelae.
References
1. Madrazo, I., Garcia-Renteria, J.A., Sandoval, M., et al. (1983) Intraventricular cysticercosis.
2. Cuetter, A.C., Garcia-Bobadilla, J., Guerra, L.G., et al. (1997) Neurocysticercosis: focus on intraventricular disease. Clinical Infectious Diseases 24, 157164.
3. Botero, D. (1989) Cysticercosis. In: Goldsmith, R., Heyneman, D. (eds) Tropical Medicine and
Parasitology. Appleton & Lange, Norwalk, Connecticut, pp. 498.
4. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis: pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786793.
5. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal neurocysticercosis: report of
five cases and review of management. Clinical Infectious Diseases 15, 799811.
6. Couldwell, W.T., Chandrasoma, P., Apuzzo, M.L.J., et al. (1995) Third ventricular cysticercal cyst
mimicking a colloid cyst: case report. Neurosurgery 37, 12001203.
7. Salazar, A., Sotelo, J., Martinez, H., et al. (1983) Differential diagnosis between ventriculitis and
fourth ventricle cyst in neurocysticercosis. Journal of Neurosurgery 59, 660663.
8. Carpio, A., Placencia, M., Santilln, F., et al. (1994) A proposal for classification of neurocysticercosis.
Canadian Journal of Neurological Sciences 21, 4347.
9. McCormick, G.F. (1985) Cysticercosis: review of 230 patients. Bulletin of Clinical Neuroscience 50,
76101.
10. Estaol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis:
11. Apuzzo, M.L.J., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraventricular cysticercosis: an analysis of 45 cases. Journal of Neurosurgery 60, 400407.
12. Shandera, W.X., White, A.C., Jr, Chen. J.C., et al. (1994) Cysticercosis in Houston, Texas: a report of
112 cases. Medicine 73, 3752.
13. de Morais-Rego, S.F., Latuf, N.L. (1978) Cisticercose do quarto ventrculo simulando neoplasia da
fossa posterior cintillografia cerebral. Relato de um caso. Arquivos de Neuropsiquiatria 36, 371374.
209
14. Colli, B.O., Pereira, C.U., Assirati, J.A. (1993) Isolated fourth ventricle in neurocysticercosis: pathophysiology, diagnosis, and treatment. Surgical Neurology 39, 305310.
15. Stern, W.E. (1981) Neurosurgical considerations in cysticercosis of the central nervous system.
16. Rabiela, M.Y., Rivas-Hernandez, A., Rodriguez Ibarra, J. (1979) Consideraciones anatomopatolgicas sobre cisticercosis cerebral como causa de muerte. Patologa 17, 119136.
17. Joubert, J. (1990) Cysticercal meningitis: a pernicious form of neurocysticercosis which responds
poorly to praziquantel. South African Medical Journal 77, 528530.
18. Kanamalla, U.S., Ibarra, R.A., Jinkins, J.R. (2000) Imaging of cranial meningitis and ventriculitis.
Neuroimaging Clinics of North America 325, 309331.
19. Zee, C.S., Go, J.L., Kim, P.E., et al. (2000) Imaging of neurocysticercosis. Neuroimaging Clinics of North
America 325, 391407.
20. Hanlon, K.A., Vern, B.A., Tan, W.S., et al. (1988) MRI in intraventricular neurocysticercosis: a case
report. Infection 16, 242244.
21. Chang, K.H., Lee, J.H., Han, M.H., et al. (1991) The role of contrast-enhanced MR imaging in the
diagnosis of neurocysticercosis. AJNR American Journal of Neuroradiology 12, 509512.
cysticercosis and neurocysticercosis. Journal of the Neurological Sciences 142, 16.
23. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzymelinked immunoelectrotransfer blot in patients with neurocysticercosis. Journal of Infectious Diseases
164, 10071009.
24. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigation
25. Bonametti, A.M., Baldy, J.L., Bortoliero, A.L., et al. (1994) Neurocisticercose com quadro clnico inicial de meningite aguda. Revista do Instituto de Medicina Tropical de So Paulo (So Paulo) 36, 2732.
26. Zee, C.S., Segal, H.D., Destian, S., et al. (1993) MRI of intraventricular cysticersosis: surgical implications. Journal of Computer Assisted Tomography 17, 932939.
27. Shah, G.V. (2000) Central nervous system tuberculosis: imaging manifestations. Neuroimaging Clinics
of North America 325, 355374.
28. Bekonakli, E., Cayli, S., Turgut, M., et al. (1998) Primary giant granulomatous basal meningitis: an
unusual presentation of tuberculosis. Childs Nervous System 14, 7981.
29. Bello Martinez, E., de Grgolas Hernndez-Mora, M., Albisua Sanchez, J., et al. (1997)
Neurocisticercosis en un hospital terciario. Nuevos avances en el diagnstico y tratamiento. Revista
Clinicia Espanola 197, 604610.
30. Sotelo, J. (1997) Treatment of brain cysticercosis. Surgical Neurology 48, 110112.
31. Amar, A.P., Ghosh, S., Apuzzo, M.L.J. (2000) Treatment of central nervous system infections.
32. Couldwell, W.T., Apuzzo, M.L.J. (1989) Management of cysticercosis cerebri. Contemporary
33. Zee, C.S., Segall, H.D., Apuzzo, M.L.J., et al. (1984) Intraventricular cysticercal cysts: further neuroradiologic observations and neurosurgical implications. AJNR American Journal of Neuroradiology 5,
727730.
34. Rogel-Ortiz, F., Vera-Pedro, M. (1997) Meningitis cisticercosa. Gaceta Medica de Mexico (Mexico) 133,
301305.
35. Colli, B.O., Martelli, N., Assirati, J.A., Jr, et al. (1986) Results of surgical treatment of neurocysticercosis in 69 cases. Journal of Neurosurgery 65, 309315.
36. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticercosis: a reappraisal.
37. Sandoval, M., Madrazo, I., Garcia-Renteria, J.A., et al. (1990) Obstruction of the ventricular catheter
of a CSF shunt system due to the own cyst of Taenia solium. Archives of Investigative Medicine (Mxico)
21, 9598.
38. Vasconcelos, D., Cruz-Segura, H., Mateos-Gomez, H., et al. (1987) Selective indications for the use of
praziquantel in the treatment of brain cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry
50, 383388.
39. Duplessis, E., Dorwling-Carter, D., Vidaillet, M., et al. (1988) Neurocysticercose intraventriculaire. A
propos de trois observations. Neurochirurgie 34, 275279.
210
40. Monteiro, L., Almeida-Pinto, J., Stocker, A., et al. (1993) Active neurocysticercosis, parenchymal and
extraparenchymal: a study of 38 patients. Journal of Neurology 241, 1521.
41. Allcut, D.A., Coulthard, A. (1991) Neurocysticercosis: regression of a fourth ventricular cyst with
praziquantel. Journal of Neurology, Neurosurgery and Psychiatry 54, 461462.
42. Proano, J.V., Madrazo, I., Garcia, L., et al. (1997) Albendazole and praziquantel treatment in neurocysticercosis of the fourth ventricle. Journal of Neurosurgery 87, 2933.
43. Sotelo, J., Penagos, P., Escobedo, F., et al. (1988) Short course of albendazole therapy for neurocysticercosis. Archives of Neurology 45, 11301133.
44. Del Brutto, O.H., Sotelo, J. (1990) Albendazole therapy for subarachnoid and ventricular cysticercosis. Journal of Neurosurgery 72, 816817.
45. Villarreal, H.J., Rangel-Guerra, R., Martinez, H.R., et al. (1990) Cisticercosis parenquimatosa y ventricular tratada con albendazole. Archivos del Instituto Nacional de Neurologa y Neurociruga de Mxico
5, 207208.
46. Suastegui Roman, R.A., Soto-Hernandez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal
of Neurosurgery 84, 629633.
47. Spina-Franca, A., Nobrega, J.P.S. (1980) Neurocysticercose e praziquantel. Revista Paulista de
Medicina 95, 3436.
48. Garcia, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a
prospective double-blind trial comparing 7 versus 14 days of treatment. Neurology 48, 14211427.
49. Carpio, A., Santillan, F., Leon, P., et al. (1995) Is the course of neurocysticercosis modified by treatment with anthelminthic agents? Archives of Internal Medicine 155, 19821988.
50. Salinas, R., Counsell, C., Prasad, K., et al. (1999) Treating neurocysticercosis medically: a systematic
review of randomized, controlled trials. Tropical Medicine and International Health 4, 713718.
21
Neurocysticercosis and Epilepsy

Arturo Carpio and W. Allen Hauser
Introduction
The natural history of neurocysticercosis
(NC) and its clinical course are poorly understood. Presumably, a high percentage of the
population harbouring NC remains asymptomatic. Among symptomatic patients, clinical
manifestations of NC vary, depending on
the number and localization of the cyst(s),
as well as the host immune response to the
parasite15. Acute symptomatic seizures
are the most common clinical manifestation
of NC in those patients in whom the parasite(s) are located in brain parenchyma68.
Based on prospective studies, the traditional view that NC is the principal cause of
epilepsy in developing countries can be
questioned9,10. Similarly, the view that
epilepsy attributable to NC generally has an
unfavourable course and prognosis, contrasts with recent reports showing an
overall favourable prognosis in terms of
seizure control and seizure remission2,3,1113.
Although some authors have suggested that
anticysticercal treatment is associated with
reduced seizure recurrence10,11 there are no
hard data to support this from controlled
clinical trials. The controversial issues of
treatment approach and the relationship
between NC and epilepsy are reviewed in
this chapter.
Epidemiology of Epilepsy and

Cysticercosis
The incidence of epilepsy in developing
countries is twice that in developed countries14,15. Three-quarters of the 50 million
people with epilepsy live in economically
disadvantaged countries of the world. Most
of those with epilepsy in these countries
are untreated16,17.
Taeniasiscysticercosis is endemic in Latin
America, India and China, and possibly also
in sub-Saharan Africa17. Poor hygiene and living conditions, allowing pigs access to human
faeces, put people at risk of developing taeniasiscysticercosis. A recent epidemiological
study has shown that household contacts of
patients with NC had a threefold higher risk
of positive serology for cysticercosis, in comparison to the general population18. While
these findings are still consistent with a common environmental source of infection with
Taenia solium eggs, they also suggest a potential role for direct human-to-human contamination. Migrant workers into the USA and
other developed countries have also imported
T. solium infections5,19.
Immunoserological assays, such as
(EITB) or ELISA, detect antibodies against
T. solium cysticercosis1,2,20. Epidemiological

211
212
A. Carpio and W.A. Hauser
surveys for human cysticercosis, using

EITB, report a seroprevalence from 8% to
12% in some regions of Latin America2024.
These assays are useful for identification of
individuals who have had systemic contact
with the parasite at some time.
Seropositivity, however, does not necessarily mean an active systemic infection or central nervous system involvement at any
time. Most seropositive individuals in the
populations surveyed were asymptomatic.
Some studies21,23,24 but not all22 have
reported an association between seizures
and seropositivity. Although a higher proportion of patients with epilepsy have been
shown to be EITB positive when compared
with those without epilepsy, the proportion
of seropositivity in epileptic patients is similar to that reported in the general population in these same areas. There is also a
discrepancy between EITB positivity and
computed tomography (CT) findings: more
than 50% of those diagnosed as having NC
by CT were seronegative22,23. This is especially true in patients with only single or
calcified lesions.
Seizures and epilepsy as main clinical

manifestations of NC
It is widely accepted that seizures are the
most common symptom of NC, occurring in
7090% of patients2,3,5,6,8,12. There is no consistency in the reported distribution of
seizure types in patients with NC. Some
authors report a higher frequency of partial
seizures9,14, others conclude that generalized
seizures are more common7,8. It seems that
either generalized seizures or partial seizures
with secondary generalization are most commonly reported, while complex partial
seizures are less frequent.
Some authors use the term seizures
indiscriminately for epilepsy, and vice
versa10,11. All people with epilepsy experience seizures, but not all individuals with
seizures have epilepsy25. This distinction is
not only semantic; it is important from the
clinical and epidemiological standpoint.
According to the definitions suggested by
the International League Against Epilepsys
(ILAEs) Commission on Epidemiology and

Prognosis26, provoked or acute symptomatic seizures are seizures which occur in
close temporal association with an acute
brain lesion (infection, stroke, cranial
trauma, etc.); such seizures are often isolated epileptic events associated with acute
conditions, but may recur if the acute condition recurs. Unprovoked seizures (epilepsy,
if seizures recur) may occur subsequent to a
well-demonstrated antecedent condition,
known to substantially increase the risk of
epileptic seizures. Symptomatic unprovoked seizures are categorized into two
major subgroups: (i) remote symptomatic
unprovoked seizures that follow conditions
resulting in a static encephalopathy, such as
infection, cerebral trauma, or cerebrovascular disease, generally presumed to be the
result of this non-progressive (static) lesion;
and (ii) progressive symptomatic seizures
occurring in association with progressive
neurological disorder (brain trauma, degenerative brain disease).
Seizures associated with NC may be categorized as either acute symptomatic or as
remote symptomatic seizures. Individuals
with cysticerci in the transitional form27 or
degenerative phase develop acute symptomatic seizures due to the acute inflammatory
response of the brain; on the other hand, a
patient with seizures who has active, viable
cysts and/or inactive, non-inflamed calcified
parasites may be categorized as having
unprovoked seizures. NC has an unpredictable clinical course, which makes it difficult to categorize all cases into the proposed
classification of the ILAE Commission. For
instance, a patient with chronic recurrent
seizures, whose imaging studies show several non-inflamed parenchymal calcifications, should be categorized as having
remote symptomatic unprovoked seizures.
The same patient, some years later, can
develop hydrocephalus associated with
intraventricular cysts or experience a recurrence of parenchymal transitional cysts. This
case should be considered to have multiple
episodes of NC now resulting in acute symptomatic seizures. The seizure disorder
should not be categorized as progressive
symptomatic unprovoked seizures (epilepsy)
owing to a progressive neurological

disorder2. Neurologists from developing
countries frequently see patients in whom
the first seizure occurred many years before
consultation, and when the second seizure
occurs at the time of consultation, the imaging study shows one or more calcifications
and one cyst in the transitional form with
perilesional oedema. We can assume that
when the first seizure occurred, the patient
had cysts in a transitional form, which eventually became calcified, and currently the
patient has new acute seizures27. According
to the ILAE Commission we should categorize these patients as having isolated epileptic events associated with a recurrent acute
condition (transitional form)26. Ultimately, in
patients with NC, what matters most is to
differentiate between provoked or acute
symptomatic seizures and recurrent unprovoked seizures (epilepsy). This differentiation is very important, because of its
implications concerning treatment and prognosis, as will be discussed below.
Presumably, the inclusion of people with
only acute symptomatic seizures as cases of
epilepsy is one of the reasons for the high
proportion of epilepsy in some studies.
Is NC the most frequent aetiology of

epilepsy in developing countries?
It is extremely difficult to compare results of
studies of epilepsy due to NC. These studies
are few, and are frequently targeted at all
seizures, instead of epilepsy alone. Almost
all the studies are prevalent case-series,
which are not useful for identifying the
cause of seizures. There are broad differences
in the definition (if any) of NC, as well as
failure to define criteria for diagnosis of
either seizures or epilepsy. There is no information on the latency between the first acute
symptomatic seizure and the first unprovoked seizure, or regarding the age of the
patient at the time of onset of seizures in
relation to the age of the patient at the time
of diagnosis of NC. Studies of highly
selected patients with epilepsy (or seizures?)
in neurological services of hospital settings
from some Latin American countries report
213
NC as the main cause of epilepsy, accounting

for 3050% of patients1,9. The proportion of
epilepsy cases associated with cysticercosis
using an immunoserological test as a diagnostic tool is considerably lower than the
proportion of NC using CT. Only 12% of
epileptic patients attending an outpatient
clinic in Peru had serological evidence of T.
solium as shown by the EITB test21.
New information now available from
developing countries shows that the proportion of idiopathic (6070%) to symptomatic
epilepsy (3040%) is similar to that reported
in studies from developed countries4,14.
Among the symptomatic group, infection
and parasitic diseases, particularly NC, perinatal brain damage, and head trauma are the
most frequent disorders reported as a cause
of epilepsy1,6,21,28,29. In studies from India, in
which acute symptomatic seizures were
excluded, only 5.3% and 11% of patients
with epilepsy had NC30,31. In a recent
prospective cohort study, among patients
with newly diagnosed epilepsy seen at the
five main hospitals in the three major cities
of Ecuador, the ratio of idiopathic/cryptogenic (63%) to symptomatic epilepsy (37%)
was also similar to the studies from developed countries32. Perinatal brain damage
(9%), NC (8.3%), central nervous system
infections (4.2%), stroke (4.8%) and head
trauma (4.2%) were the most frequent disorders reported as causes of epilepsy (Fig.
21.1). Although NC is one of the most frequent antecedents among the symptomatic
group, this disease is not the main cause of
epilepsy, as has been previously suggested.
Relationship Between NC and

Epilepsy
There are clinical inconsistencies in the link
between epilepsy and NC. Parasite location
may be remote from the apparent epileptogenic region33. There is also no correlation
between the NC burden of lesions and the
severity of the epilepsy. Patients with severe
refractory seizures may have only one calcified lesion; on the other hand, there are
patients with multiple cysts or calcifications
but no seizures. NC and epilepsy are com-
214
9.60%
3.50%
Cysticercosis
0.90%
5.70%
Others
Tumours
Stroke
5.20%
61.70%
3.90%
Infections
Head trauma
Perinatal insult
9.60%
Idiopathic
Fig. 21.1. Aetiology of epilepsy in Ecuador. (Source: reference 32.)
mon diseases in most developing countries.

Because of their high prevalence, a causal as
well as fortuitous relationship between the
two conditions might exist3,3436.
Seizures may occur at any evolutionary
stage of the parasite. Acute seizures are more
frequent with the transitional form owing to
the inflammatory reaction in the vicinity of
cortically or subcortically located cysts. In
the active form, seizures have been attributed to mechanical compression by cysticercal cysts2,27. We can theorize that risk of
seizure recurrence (i.e. epilepsy) probably
occurs in the inactive or calcified form of
NC37. This possibility has been attributed to
residual perilesional gliosis that results in
chronic epileptogenic foci38. This theory,
however, requires further confirmatory studies. Some authors have suggested that mild
inflammation, visible on contrast-enhanced
MRI or CT, may persist in the calcified stage
of NC, and may be associated with an
increased risk of recurrent seizures39,40.
These authors theorize that the perilesional
oedema surrounding calcified lesions due to
NC is a persistent host-inflammatory
response provoked by antigens released
from the calcified lesions. However, in
patients with multiple calcifications, it is not
clear why only some of the calcified lesions
would induce inflammation.
Electroencephalography (EEG) has been
found to be abnormal in 3050% of patients
with seizures due to NC. It is assumed that
EEG findings have poor correlation with

symptoms and CT lesions in patients with
NC5,4143. A positive correlation between CT
lesions and localizing or lateralizing EEG
abnormalities has been reported for only
1530% of patients. Similarly, the correlation
between seizure type and EEG abnormalities
ranges from around 7% to 20%43.
Discrepancies between clinical localization
based on seizure semiology and location of
the lesion on neuroimaging is not uncommon in patients with NC. Nevertheless,
some authors suggest that this reflects the
spread of seizure discharges37,42. In patients
with occipital-lobe epilepsy, an occipitotemporal spread was demonstrated in those
patients who had automatisms typical of
temporal-lobe seizures, and suprasylvian
spread was demonstrated in those patients
who presented tonic or clonic motor manifestations44. A non-causal relationship
between epilepsy and cysticercosis in some
cases might explain these apparent discrepancies37. Studies correlating epileptic foci
and intracranial calcifications suggest that
calcifications themselves were not the origin
of the epileptogenic lesion in at least 50% of
the cases36. Some authors tried to correlate
EEG with the cyst viability41. They found
interictal EEG abnormalities in 28% of
patients with any form of NC, but no EEG
abnormalities in patients with inactive NC.
These authors suggested that perilesional
gliosis might be insufficient to cause scalp
EEG abnormality in the inactive form of NC.

Further prospective cohort studies, properly
designed to study ictal and interictal EEG
abnormalities in patients with seizures, correlated with the different evolutionary stages
of the parasite, may clarify the relationship
between NC and epilepsy.
The coexistence of hippocampal atrophy
and extrahippocampal pathological abnormalities, such as cortical dysgenesis and gliosis, referred as dual pathology, has been
reported in 530% of patients with medically
refractory partial seizures33,45. Dual pathology implies that both lesions somehow interact with each other and contribute to
epileptogenesis through mechanisms still
poorly understood. Some authors have also
attributed hippocampal sclerosis to NC3,35.
Patients with calcifications due to NC and
mesial temporal lobe epilepsy (hippocampal
sclerosis)
became
seizure-free
after
anteromesial temporal lobectomy, without
resection of the cysticercotic lesion, suggesting the two phenomena are independent34.
The possibility of dual pathology related to
NC needs further clarification in prospective
cohort studies.
Considering that epileptogenicity of cysticercotic lesions is probably low for residual
calcifications, one should consider the
chance association between the two conditions34,35. Unequivocal evidence of causal
relationship between NC and epilepsy could
be deduced from correlation between clinical, EEG, and imaging data. This evidence
should be demonstrated in patients with single or multiple NC lesions shown by imaging studies, in whom video-EEG monitoring
displays ictal and interictal abnormalities
correlated with type of seizures. The association could be confirmed and the level of risk
determined through appropriate epidemiological studies.
Effect of Anticysticercal Treatment on

Epilepsy
Despite the first reports regarding treatment
for NC with anticysticercal drugs such as
praziquantel and albendazole being published more than 15 years ago2, to date there
215
are no controlled clinical trials to establish

specific indications, definitive doses, and
duration of treatment2. A critical review of
the literature suggests that the studies upon
which these assumptions are based are
flawed in terms of patient selection, assignment to treatment, and selection and measurement of outcome variables. Many
authors have appropriately criticized publications on this topic and have concluded that
no adequate studies of efficacy have been
reported (see Chapter 38)5,17,46,47. Other
authors have warned that this therapy might
be harmful in some patients, particularly
when cysts are in the subarachnoidal location, because these drugs might lead to the
development of arachnoiditis, arteritis and
hydrocephalus48,49.
A randomized clinical trial of treatment of
patients with newly identified active NC
used oral prednisolone alone, praziquantel
with prednisolone, or albendazole with
prednisolone49. At 6 months and at 1 year
after treatment there were no differences in
the three treatment groups in terms of the
proportion of cases free of cysts, or the relative reduction in number of cysts. At 2 years,
there was no difference in the proportion of
cases free of seizures over the entire followup period. Based on these results, it appears
that treatment with anticysticercal drugs
does not modify the prognosis of seizures in
patients with NC. This study addressed
questions about to what extent and in which
patients, treatment with either praziquantel
or albendazole is indicated. The improvement attributed to anticysticercal drugs in
previous studies may be related to the lack
of appropriate controls and is likely to be a
reflection of the natural history of the condition. Placebo-controlled trials for NC treatment that are under way should clarify these
uncertainties. It has been suggested that
seizure control in patients with NC is
improved and that the chance of remaining
seizure-free after the withdrawal of
antiepileptic drug (AED) is greater after a
course of anticysticercal drugs when compared with seizure control in those in whom
the disease is left untreated10,11. However,
these studies do not distinguish between
acute symptomatic seizures, chronic recur-
216
rent seizures that antedate the infection and

patients with newly diagnosed recurrent
unprovoked seizures. These distinctions are
crucial in order to interpret results of such
interventions.
Prognosis of First Seizure due to NC

There are inconsistent data on the risk of further seizures in patients with first seizure due
to NC. In most studies, the sample size has
been small, assessment has been carried out
retrospectively, and optimal analytical methods have not been used. Some authors report
that NC patients with acute symptomatic
seizures have a good prognosis in terms of
remission of seizures3,7,12,13; others report that
most patients have a high risk of seizure
recurrence, and suggest that prognosis
improves after anticysticercal treatment10,11.
In a prospective cohort study, patients with
a first seizure and evidence of an active or
transitional form of NC were enrolled and followed up for up to 5 years to identify the risk
of subsequent seizures49,50. Additional analysis
was performed after stratification by treatment of the acute condition: symptomatic
treatment alone using AED(s) and prednisolone (33 patients), or symptomatic treat-
ment plus the anticysticercal drug, albendazole, 15 mg kg1 day1, for 8 days (44
patients). Thirty patients (39%) experienced
seizure recurrence; however, when using
KaplanMeier survival analysis, 60% of cases
experienced a seizure recurrence in the 5-year
period following a first acute symptomatic
seizure. Half of these recurrences occurred in
the first year. The estimated recurrence was
20% at 6 months, 29% at 12 months, 35% at 24
months, and 60% at 48 months. This high
recurrence is in part related to recurrence of
acute symptomatic seizures. Among a large
array of variables that were assessed as potential risk factors for recurrence, only persistence
of abnormalities on follow-up CT scan was
predictive of seizure recurrence. Recurrence
risk ranged from 22% in patients in whom
cysts disappeared, to 78% in patients showing
no change in number of cysts. There were no
significant differences in the KaplanMeier
curves of recurrence when treatment groups
were compared (Fig. 21.2). It appears that anticysticercal treatment did not modify the risk
of seizure recurrence. A similar seizure recurrence risk (37%) has been reported in patients
with single enhancing CT lesions42. This
relapse rate is similar to that reported in other
studies of seizure recurrence in cases with a
first acute symptomatic seizure35,51,52.
1.1
Cumulative probability
1.0
0.9
0.8
0.7
Anticysticercal
treatment
0.6
Yes
Yes-censored
0.5
No
0.4
0
10
20
30
40
50
60
No-censored
Follow-up in months
Fig. 21.2. Probability of seizure recurrence after a first seizure in 77 patients with neurocysticercosis as
a function of anticysticercal treatment. (Source: reference 32.)
There are no guidelines regarding the

duration for which AEDs should be continued following an acute NC episode. Some
clinicians routinely continue AEDs for 1 year
but shorter and longer intervals have been
recommended12. The antiseizure medications
currently used have no antiepileptogenic
effect but do effectively prevent acute symptomatic seizure recurrence53. One assumes
that the risk of seizures is substantial as long
as there is an active ongoing process as characterized by persistence of oedema around
the degenerating lesion. Because of this, we
feel CT scan is a useful tool for these treatment decisions. Seizures in the context of
oedema and a degenerative lesion should be
considered to be acute symptomatic seizures,
217
even if they occur many months after presentation. It is appropriate to monitor cyst
activity with CT scanning and to continue
AEDs until resolution of the acute lesion.
After this time, AEDs may be discontinued.
Seizures occurring in individuals after resolution of oedema and resorption or calcification of the degenerating cyst should be
considered unprovoked and, in this situation, long-term AEDs are warranted (Fig.
21.3). These are individuals who truly have
epilepsy42. Seizure recurrence among those
with cyst resolution was about 20%, a figure
in accord with studies evaluating unprovoked seizure risk among individuals with
structural brain abnormalities and acute
symptomatic seizures25,51,52.
Degenerative (transitional)
and/or active cysts
Only calcification
Initiate AED
Initiate AED
CT or MRI after 36 months
Cyst(s) resolved and

no seizure recurrence
Cyst(s) not
resolved with or
without seizure
recurrence
Maintain AED
and CT or MRI
at 36 months
Cyst(s) resolved
but seizure
recurrence
Maintain AED
for 12 years
after last
seizure
No seizure
recurrence
for 1 year
Withdraw AED
Seizure
recurrence
Maintain AED for

12 years
after last seizure
Fig. 21.3. Suggested protocol for antiepileptic drugs for patients with first seizure due to
neurocysticercosis.
218
It seems that interpretation of risks of

seizures after NC is difficult because of the
failure to distinguish acute symptomatic
seizures from epilepsy. This distinction must
be considered in future studies of the effects
of treatment on seizure recurrence in people
with cysticercosis. These difficulties are
increased in those patients who have mixed
forms, including active, transitional and calcified lesions. Further studies should be performed in order to estimate recurrence risk in
those patients with probable unprovoked
seizures due to calcifications alone, in comparison with patients with acute seizures due
to transitional cysts. These studies should
include a systematic assessment of treatment
strategies. Persons with acute NC should be
treated with antiseizure medication until cyst
resolution is demonstrated on CT.
Conclusions and Recommendations

for Future Research
Epilepsy and NC are common diseases in
developing countries and cysticercosis is
increasingly diagnosed in industrialized
nations as a result of migration from endemic
regions. Seizures are the most common
symptom in patients with a parenchymal
location of the parasite. NC is not necessarily
the main cause of epilepsy in developing
countries, although it is one of the most frequent antecedents among patients with
symptomatic seizures. Seizures may occur at
any evolutionary stage of the parasite. Acute
symptomatic seizures are more frequent in
the transitional form owing to the inflammatory response of the brain. The risk of seizure
recurrence (epilepsy) occurs in the inactive or
calcified form of NC. This has been attributed
to residual perilesional gliosis. There are

inconsistencies in the link between NC and
epilepsy. Because of the high prevalence of
each condition, a causal as well as fortuitous
relationship between the two might exist. A
correlation between lesions seen on neuroimaging and EEG abnormalities has been
reported for only 1530% of patients. Visible
calcifications do not seem to be the source of
the epileptogenic lesion in at least 50% of
cases. Prospective cohort studies, properly
designed to study ictal and interictal EEG
abnormalities in patients with seizures, correlated with the different parasite evolutionary
stages, may clarify the relationship between
NC and epilepsy.
NC patients have a good prognosis in
terms of remission of seizures. Some authors
suggest that prognosis improves after anticysticercal treatment. Recent prospective
studies have shown that anticysticercal treatment does not modify the risk of seizure
recurrence. This requires confirmation in controlled clinical trials. There are no guidelines
regarding the duration for which antiseizure
medication should be continued after an
acute NC episode. The risk of seizures is substantial as long as there is an active ongoing
process as characterized by persistence of
oedema around the degenerating lesion.
Because of this, CT scans are useful for treatment decisions. Seizures in the context of
oedema and a degenerative lesion should be
considered to be acute symptomatic seizures
even if they occur many months after presentation. After resolution of the acute lesion,
antiseizure medication may be discontinued.
Seizures occurring after resolution of oedema
or calcification of the degenerating cyst
should be considered unprovoked and, in
this situation, long term AEDs are warranted.
References
1. Bittencourt, P.R.M., Adamolekun, B., Bharucha, N., et al. (1996) Epilepsy in the tropics: II. Clinical
presentations, pathophysiology, immunologic diagnosis, economics and therapy. Epilepsia 37,
11211127.
10251040.
3. Manreza, M.L. (2000) Epilepsia e neurociticercose. In: Guerreiro, C.A.M., Guerreiro, M.M., Cendes,
F., et al. (eds) Epilepsia. Lemos Editorial & Grficos Ltda, Sao Paulo, Brazil, pp. 255264.
219
4. Martnez, S.M. (1996) Controversias clnicas y terapeticas en neurocisticercosis. In: Garca, H.H.,
Martnez, S.M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA, Lima, Peru, pp.
207216.
5. White, A.C. (2000) Neurocysticercosis. Current Treatment Options in Infectious Diseases 2, 7887.
6. Adamolekun, A., Carpio, A., Carvalho-Filho, F., et al. (1994) Relationship between epilepsy and
tropical diseases. Epilepsia 35, 8993.
7. Monteiro, L., Nunes, B., Mendonaca, D., et al. (1995) Spectrum of epilepsy in neurocysticercosis: a
long-term follow-up of 143 patients. Acta Neurologica Scandinavia 92, 133140.
8. Nogales-Gaete, J., Arriagada, C., Gonzles, J. (1997) Sindromes anatomo-clnicos de la neurocisticercosis. In: Arriagada, C., Nogales-Gaete, J., Apt, W. (eds) Neurocisticercosis. Aspectos Epidemiolgicos,
Patolgicos, Immunolgicos, Clnicos, Imagenolgicos y Teraputicos. Arrynog Ediciones, Santiago, Chile,
pp. 117138.
10. Medina, M.T., Genton, P., Montoya, M.C., et al. (1993) Effect of anticysticercal treatment on the prognosis of epilepsy in neurocysticercosis: a pilot trial. Epilepsia 34, 10241027.
11. Vzquez, V., Sotelo, J. (1992) The course of seizures after treatment for cerebral cysticercosis. New
England Journal of Medicine 327, 696701.
12. Mitchel, W.G. (1997) How to manage patients with neurocysticercosis? Pediatric neurocysticercosis
in North America. European Neurology 37, 126129.
13. Morales, N.M., Agapejev, S., Morales, R.R., et al. (2000) Clinical aspects of neurocysticercosis in children. Pediatric Neurology 22, 287291.
14. Carpio, A., Bittencourt, P.R.M. (1998) Epilepsy in the Tropics. In: Chopra, J.S., Sawhney, I.M.S. (eds)
Neurology in Tropics. B.I. Churchill-Livingstone, New Delhi, India, pp. 527532.
15. Sander, J.W., Shorvon, S.D. (1996) Epidemiology of the epilepsies. Journal of Neurology, Neurosurgery
and Psychiatry 61, 433443.
16. Carpio, A. (1995) Epidemiology of tropical neurology in South America. In: Rose, F.C. (ed.) Recent
Advances in Tropical Neurology. Elsevier Science, Amsterdam, the Netherlands, pp. 3142.
17. Pal, D.K., Carpio, A., Sander, J.W.A.S. (2000) Neurocysticercosis and epilepsy. Journal of Neurology,
18. Goodman, K., Ballagh, S.A., Carpio, A. (1999) Case control study of seropositivity for cysticercosis
in Cuenca, Ecuador. American Journal of Tropical Medicine and Hygiene 60, 7074.
19. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an orthodox Jewish community in New York city. New England Journal of Medicine 327, 692695.
20. Tsang, V.C., Garca, H.H. (1996) Immunoblot diagnostic test (EITB) for Taenia solium cysticercosis
and its contribution to the definition of this under-recognized but serious public health problem. In:
Garca, H.H., Martnez, S. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, SA, Lima,
Peru, pp. 259268.
55, 282289.
23. Palacio, L.G., Jimenez, I., Garca, H.H., et al. (1998) Neurocysticercosis in persons with epilepsy in
Medellin, Colombia. Epilepsia 39, 13341339.
24. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mxico. American Journal of Tropical
25. Hauser, W.A., Hesdorffer, D.H. (1990) Epilepsy: Frequency, Causes and Consequences. Demos Press,
New York, pp. 197244.
26. Commission on Epidemiology and Prognosis of the International League Against Epilepsy (1997)
The epidemiology of the epilepsies: future directions. Epilepsia 38, 614618.
27. Carpio, A., Placencia, M., Santillan, F., et al. (1994) Proposal for a new classification of neurocysticercosis. Canadian Journal of Neurological Sciences 21, 4347.
28. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis. A magnetic resonance study of 161 cases. Journal of the Neurological
Sciences 130, 2534.
220
29. Singhal, B.S., Ladiwala, U. (1995) Neurocysticercosis in India. In: Rose, F.C. (ed.) Recent Advances in
Tropical Neurology. Elsevier Sciences, Amsterdam, the Netherlands, pp. 3142.
30. Ahuja, G.K., Mohanta, A. (1982) Late onset epilepsy. Acta Neurologica Scandinavia 66, 216226.
31. Sawhney, I.M., Lekhra, O.P., Shashi, J.S., et al. (1996) Evaluation of epilepsy management in a developing country: a prospective study of 407 patients. Acta Neurologica Scandinavia 94, 1923.
32. Carpio, A., Hauser, W.A. (1999) Prognosis of first seizure in patients with neurocysticercosis.
Epilepsia 40 (Suppl. 2), 271.
33. Rodriguz-Carbajal, J., Placencia, M., Carpio, A. (1983) Calcificaciones intracraneales anormales: 135
casos estudiados por T.A.C. Neurologia Neurocirurgica y Psiquiatria 24, 4960.
34. Leite, J.P., Terra-Bustamante, V.C., Fernandes, R.M.F., et al. (2000) Calcified neurocysticercosis lesions
and postsurgery seizure control on temporal lobe epilepsy. Neurology 55, 14851491.
35. Sakamoto, A.C., Bustamante, V.C.T., Garzn, E., et al. (1992) Cysticercosis and epilepsy. In: Kotagal,
P., Luders, H.O. (eds) The Epilepsies: Etiologies and Prevention. Academic Press, San Diego, pp.
275282.
36. Terra, V., Sakamoto, A.C., Santos, A.C., et al. (1995) Epilepsy and cerebral cysticercosis: correlation
between CT, EEG, and clinical findings. Epilepsia 36 (Suppl.3), 226.
37. Singh, G., Sachdev, M.S., Tirath, A., et al. (2000) Focal cortical-subcortical calcifications (FCSCs) and
epilepsy in the Indian subcontinent. Epilepsia 41, 718726.
38. Pradhan, S., Kathuria, M.K., Gupta, R.K. (2000) Perilesional gliosis and seizure outcome: a study
based on magnetization transfer magnetic resonance imaging in patients with neurocysticercosis.
Annals of Neurology 48, 181187.
39. Nash, T.E., Petronas, N.J. (1999) Edema associated with calcified lesions in neurocysticercosis.
40. Sheth, T.N., Pilon, L., Keystone, J., et al. (1998) Persistent MR contrast enhancement of calcified neurocysticercosis lesions. American Journal of Neuroradiology 19, 7982.
41. Chayasirisobhon, S., Menoni, R., Chayasirisobhon, W., et al. (1999) Correlation of electroencephalography and the active and inactive forms of neurocysticercosis. Clinical Electroencephalography 30,
911.
42. Murthy, J.M., Reddy, V.S. (1998) Clinical characteristics, seizure spread patterns and prognosis of
seizures associated with a single small cerebral calcified CT lesion. Seizure 7, 153157.
43. Cukiert, A., Puglia, P., Scapola, H.B., et al. (1994) Congruence of the topography of intracranial calcifications and epileptic foci. Arquivos de Neuropsiquiatria 52, 289294.
44. Williamson, P.D., Thadani, V.M., Darcey, T.M., et al. (1882) Occipital lobe epilepsy: clinical characteristics, seizures spread patterns, and results of surgery. Annals of Neurology 31, 313.
45. Cendes, F., Cook, M.J., Watson, C., et al. (1995) Frequency and characteristics of dual pathology in
patients with lesional epilepsy. Neurology 45, 20582064.
46. Salinas, R., Prasad, K. (1998) Drugs in neurocysticercosis (tapeworm infection of the brain). In:
Garner, P., Gelband, H., Olliaro, P., et al. (eds.) Infectious Diseases Module of The Cochrane Database of
Systematic Reviews [database on disk, CDROM and online; updated 02 December 1997]. The
Cochrane Collaboration; Issue 1. Update Software, Oxford.
47. Kramer, L.D. (1995) Medical treatment of cysticercosis. Ineffective. Archives of Neurology 52, 101102.
48. Caplan, L.R., Estanol, B., Mitchel, W.G., et al. (1997) How to manage patients with neurocysticercosis. European Neurology 37, 124131.
50. Carpio, A., Hauser, W.A., Lisanti, N., et al. (1999) Prognosis of epilepsy in Ecuador: a preliminary
report. Epilepsia 40 (Suppl. 2), 110.
51. Cockerell, O.C., Johnson, A.L., Sander, J.W.A.S., et al. (1997) Prognosis of epilepsy: a review and further analysis of the first nine years of British National General Practice Study of Epilepsy, a prospective population-based study. Epilepsia 38, 4755.
52. Semah, F., Picot, M.C., Adam, C., et al. (1998) Is the underlying cause of epilepsy a major prognostic
factor for recurrence? Neurology 51, 12561262.
53. Annerges, J.F., Hauser, W.A., Coan, S.P., et al. (1998) A population-based study of seizures after traumatic brain injuries. New England Journal of Medicine 338, 2024.
22
Cerebrovascular Manifestations of
Neurocysticercosis
Fernando Barinagarrementeria and Carlos Cant
Introduction
Arteritis or vasculitis refers to inflammation
of the wall of an artery (arteritis) or vein
(phlebitis). It has been attributed to a variety
of aetiological agents1. Intracranial arteritis is
a well-recognized complication of several
infectious diseases24. The presence of Taenia
solium metacestodes in human tissue triggers
an inflammatory response that varies from
patient to patient and from tissue to tissue.
The severity of the inflammatory reaction is
related to different stages of the cysticercus,
being less intense in the foremost and last
stages of its life cycle5. It may involve blood
vessels located in the vicinity of the cysts. In
the given circumstances, all three layers of
the vessel wall may be affected, producing a
true panarteritis6. Cysticercotic endarteritis
has been classically considered as a small
vessel disease related to cyst(s) located in
close relation to basal arteries5,6. Therefore,
small deep (lacunar) infarcts are frequent.
However, major arteries may also be
involved and are often thickened and narrowed by arteritis. There is histopathological
evidence of adventitial thickening, medial
fibrosis and endothelial hyperplasia, which
evolve to occlusion of the arterial lumen and
cerebral infarction. As a rule, cerebral arteritis is related to presence of chronic meningitis and focal or diffuse arachnoiditis7.
Cerebrovascular complications of neurocysticercosis (NC) were first described in the

early part of the 19th century in a patient
with cysticercal meningitis, in whom
necropsy disclosed intracranial arteritis8.
While several reports have emphasized the
existing relationship between NC and stroke
during the last few years, these have been
limited to isolated case reports and small
clinical series2,916. This clinical aspect of NC
has been poorly reviewed in world literature
and despite its global recognition, NC is usually not described as a cause of stroke in contemporary neurology and stroke textbooks.
Frequency of Cerebrovascular
Disease in NC
The frequency of stroke in several large published series of NC varies between 2% and
15%1719. Among 352 consecutive patients
with NC, Barinagarrementeria and Del
Brutto, found seven (2%) instances of lacunar
stroke10. On a different note, among more
than 700 consecutive stroke patients who
attended a stroke clinic until 1991, the same
group reported 144 cases with lacunar syndromes; 12 (8%) of them were due to NC20.
One may also obtain an idea about the incidence of cerebrovascular involvement by
studying the frequency of angiographic

221
222
F. Barinagarrementeria and C. Cant
abnormalities in NC. Thus, Monteiro et al.

from Portugal found cysticercotic arteritis in
2% of patients with NC21. In comparison,
Rocca and Monteagudo reported angiographic abnormalities compatible with arteritis in 23 (50%) of 46 patients with NC22. In our
series of 28 patients with subarachnoid cysticercosis, angiographic abnormalities compatible with arteritis were noted in 15 (54%)23.
Thalamomesencephalic syndrome
This is a condition with grave prognosis and
stuttering but relentless progression, incidental to severe perimesencephalic arachnoiditis
and occlusion of the thalamopeduncular
branches of the mesencephalic artery25.
Clinical features include impaired vertical
gaze, pupillary abnormalities, somnolence,
paraparesis and urinary incontinence.
Clinical Features
Large territorial infarction
In common with other non-atherosclerotic
vasculopathies, cysticercotic arteritis is commonly encountered in young individuals. The
mean age at diagnosis was 36 years in a series
of 65 patients described by Cant and
Barinagarrementeria7. Generally, individuals
with stroke due to NC have no underlying
vascular risk factors. Cysticercotic arteritis can
involve the small, medium and large sized
vessels. Small vessel occlusion with consequent lacunar infarction is most frequent.
Lacunar syndromes
The term lacunar syndromes originally
referred to clinical features associated with
small infarcts resulting from atheromatous or
embolic occlusion of penetrating branches of
large arteries. It was later realized that these
syndromes might also result from inflammatory arteriopathies. In the particular context
of NC, Barinagarrementeria and Del Brutto
described seven patients with lacunar syndromes due to NC10. The patients presented
with typical lacunar syndromes including
pure motor hemiparesis, ataxic hemiparesis
and sensorimotor paralysis10,24. Lacunar
infarctions were located in the posterior limb
of internal capsule or corona radiata on computed tomography or magnetic resonance
imaging (CT/MRI) (Fig. 22.1ac). Four of
these patients had evidence of a racemose
cyst in the ipsilateral suprasellar cistern. It
was surmised that the cyst and the surrounding meningeal inflammatory reaction and
subsequent arachnoiditis led to occlusion of a
penetrating branch of the proximal segment
of the middle cerebral artery (Fig. 22.1ac).
Occlusion of large blood vessels including the

middle and anterior cerebral arteries and
even the internal carotid artery may occur in
NC13,15,16,25. Large infarctions are infrequent in
comparison to deep small infarcts. Large vessel arteritis results from inflammatory degeneration of closely located cysticerci. On
occasion, large vessel arteritis and consequent
infarction is precipitated by an inflammatory
response to the administration of anticysticercal drugs9,15. The latter should, therefore, be
administered with caution in those patients
with extensive cyst load, located particularly
in relation to major arteries.
Haemorrhagic stroke
Subarachnoid, parenchymal and intracystic
haemorrhage may occur in the setting of
NC3,25,26. These complications are extremely
rare. Subarachnoid haemorrhage may result
from the rupture of a mycotic aneurysm that
develops in relation to a racemose cyst
adherent to an artery (Fig. 22.2)25,26.
Clinicopathological Correlations
Occlusive stroke characteristically occurs in
the setting of meningeal racemose cysticercosis25. Among various locations and stages,
stroke is more commonly seen with involvement of the basal cisterns and during the
inflammatory stages as recognized by pleocytosis and/or increased protein upon cerebrospinal fluid (CSF) examination. Very
rarely, arterial occlusion may occur in the set-
Cerebrovascular Manifestations of Neurocysticercosis
223
Fig. 22.1. (a) Axial T2-weighted MRI scan shows a cystic lesion in the left suprachiasmatic cistern,
adjacent to the middle cerebral artery. (b) Axial T2-weighted MRI scan reveals cerebral infarction in the
left middle cerebral artery territory secondary to vasculitis associated with a suprachiasmatic cyst. (c)
Coronal T1-weighted Gd-MRI scan, taken several months after stroke onset, shows a persistent focal
enhancement of the cyst and the old cerebral infarction in the ipsilateral corona radiata.
ting of parenchymal NC16. Besides, the occurrence of stroke is also determined by the
extent of arachnoiditis. In a study of 65
patients with cerebrovascular complications
of NC, Cant and Barrinagarrementeria
found that those with focal arachnoiditis had
a sudden onset of the disease, implying the
occurrence of a symptomatic cerebral infarction7. In comparison, only 20% of those with
diffuse arachnoiditis had an apoplectic onset.
In the latter group, epilepsy and intracranial

hypertension were the most frequent presenting manifestations. Headache in association
with cerebral infarction occurred in about
one-third of patients with focal arachnoiditis.
It is possible to predict the occurrence,
nature and severity of cerebrovascular involvement by studying the distribution of cysticercal
disease and the severity of concomitant chronic
arachnoiditis7. When cysts are confined to a
224
Fig. 22.2. Mycotic aneurysm of the middle cerebral artery formed in relation to a degenerating cysticercus after
surgical removal of both. (Source: Svetlana Agapejev, So Paulo, Brazil.)
focal area and with mild or no arachnoiditis,

they involve small penetrating vessels with
ensuing lacunar infarcts and syndromes. When
focal cysticercosis is accompanied by marked
inflammatory response as evidenced by severe
abnormalities upon CSF examination, large
vessels of the circle of Willis tend to get
involved, thereby producing large cerebral
infarct(s) (Fig. 22.3a and b, Fig. 22.4a and b).
Finally, the most severe form of arteritis affecting both large and small arteries occurs when
cysticerci are widely distributed throughout
the subarachnoid space, associated with an
intense inflammatory profile of the CSF.
Investigations
Angiography
The first angiographic study of cerebral
arteritis in NC was made in 1932 by Moniz et
al., who reported two patients with arteritis
involving the intracranial portion of the internal carotid artery27. More recently, we
reported angiographic abnormalities in 15 of
28 patients with subarachnoid cysticercosis23.
A stroke syndrome was found in 80% of these
patients. The most commonly involved vessels upon angiography were the middle (Figs
Fig. 22.3. (a) Coronal T1-weighted Gd-MRI scan demonstrates diffuse enhancement of the basal cisterns,
extending to the proximal portion of the Sylvian fissures; small cysticerci are evident. (b) Lateral left angiogram
discloses the common carotid artery with segmental stenosis of the middle cerebral artery (arrow and arrowhead).
225
Fig 22.4. (a) Coronal T1-weighted Gd-MRI scan shows numerous cysticerci in the basal cisterns and both
Sylvian fissures, with only a mild meningeal enhancement. (b) Corresponding left anteroposterior carotid artery
angiogram reveals a segmental narrowing of the trunk of the middle cerebral artery (arrow).
22.3b and 22.4b) and posterior cerebral arteries. The latter were involved in more than
half of the patients. Single artery involvement
was noted in eight patients. However, angiographic abnormalities were noted in two
arteries in four patients and three or more
arteries in three patients, respectively. A diffuse meningeal enhancement was observed
by gadolinium (Gd)-MRI in five out of
seven patients with involvement of more
than one artery upon angiography.
Interestingly, we observed asymptomatic
cerebral arteritis in 20% of the patients with
subarachnoid cysticercosis.
CSF examination
CSF abnormalities correlate with the location
of cysticercus and are more commonly seen
in the setting of meningeal-racemose cysticercosis. Therefore, as a rule the CSF study
is abnormal in individuals with cysticercotic
arteritis. We noted CSF abnormalities in 58
(89%) of 65 patients with documented cysticercotic arteritis7. The abnormalities
included lymphocytic pleocytosis (57; 88%),
increased protein levels (44; 68%) and hypoglycorrhagia (24; 37%). CSF eosinophilia was
noted in 33 (51%) patients, while immunological tests for cysticercosis were positive in
56 (86%). The intensity of inflammation

depicted by the CSF study correlated with
the severity and extent of arteritis and the
degree of meningeal enhancement upon GdMRI, so that patients with diffuse basal
involvement upon Gd-MRI exhibited severe
and persistent CSF abnormalities.
MRI (including Gd-MRI)

Gd-MRI outlines the presence and distribution of cysts, character and extent of arachnoiditis and the number and location of
cerebral infarctions. In our series of 65
patients with cerebrovascular complications,
MRI detected one or more cyst(s) in the subarachnoid space, commonly in the basal or
Sylvian cisterns (Fig. 22.3a) in the neighbourhood of the ischaemic area in 54 (83%)7.
Uncommonly, Gd-MRI may not visualize
cysts but reveal only intense enhancement of
the meninges. Based on the degree and
extent of meningeal enhancement upon GdMRI, chronic arachnoiditis associated with
cysticercotic arteritis can be categorized as
focal or diffuse28. Focal arachnoiditis is identified by contrast enhancement restricted to a
single cerebral cistern, whereas diffuse
arachnoiditis is characterized by enhancement involving several cerebral cisterns.
226
Transcranial Doppler (TCD)

Although cerebral angiography is exquisitely
sensitive for diagnosing cerebral arteritis, it
has the limitations of being expensive and
invasive. Moreover, cerebral vasculitis secondary to infectious chronic arachnoiditis is
an evolving condition with variable morphological features. As a result, serial follow-up
studies are often required to demonstrate its
presence and outcome. It is desirable to have
a non-invasive and reproducible diagnostic
test for cerebral vasculitis. Several recent
studies have suggested the utility of TCD in
the setting of certain inflammatory conditions of the central nervous system2931.
A preliminary study explored the role of
TCD in evaluation of cysticercotic arteritis in
nine patients with subarachnoid cysticercosis
and stroke32. Findings upon TCD were compared with cerebral angiography in all cases.
Cerebral vasculitis was diagnosed sonographically by the finding of abnormal flow
velocity in the main cerebral arteries, consistent with an occlusive or stenotic pattern.
Sonographic abnormalities suggestive of
cerebral vasculitis in major intracranial arteries were detected in all six patients with arterial lesions recognized by cerebral
angiography. On the other hand, TCD and
cerebral angiography were normal in three
patients, thus reflecting involvement of small
penetrating arteries as demonstrated by the
MRI finding of small deep cerebral infarctions. In addition, TCD was found to be an
excellent tool to monitor disease progression
and prognosis. Five of the six patients with
abnormal TCD at stroke onset were available
for long-term follow-up. Over several
months, a gradual return of blood flow
velocities towards normal was observed in
two patients. Resolution of the stenotic patterns of middle cerebral and basilar arteries
occurred within 46 months. Conversely, in

three patients, serial TCD demonstrated persistence of occlusive and stenotic patterns,
suggesting arterial scarring or fibrosis. Thus,
TCD permitted evaluation of the natural history of cysticercotic inflammatory arteriopathy. The role of TCD vis--vis cerebral
angiography in detecting stenosing lesions
of the basal cerebral arteries was evaluated
in 54 patients with chronic meningitis,
including 27 patients with subarachnoid cysticercosis33. Specificity and positive and negative predictive values were excellent
(95100%). The reliability was rated as good
to excellent (0.640.86). However, the sensitivity varied from 60 to 88%.
Further experience with TCD in the detection and follow-up of cysticercotic vasculitis
is required. At this time, we can surmise that
TCD is a useful means for the detection of a
concomitant arteriopathy in subarachnoid
cycticercosis. Serial TCD monitoring provides
insight into the temporal resolution or progression of this arteritis and may help to clarify its prognostic implications. It may be able
to recognize patients at risk of cerebral occlusion and monitor therapeutic interventions.
Conclusions
Stroke is an important but under-recognized
complication of subarachnoid-meningeal
cysticercosis. Deep lacunar infarcts, with
characteristic lacunar syndromes occur
because of the endarteritis involving small
penetrating arteries. Large territorial infarctions are uncommon. Gd-MRI, CSF examination and cerebral angiography are standard
tools for the evaluation of arteritis and its
related pathological processes. TCD is
emerging as an important non-invasive tool
for diagnosing and monitoring arteritis.
References
1. Sol-Llenas, J., Pons-Tortella, E. (1978) Cerebral angiitis. Neuroradiology 18, 111.
2. Alarcn, F., Hidalgo, F., Moncayo, J., et al. (1992) Cerebral cysticercosis and stroke. Stroke 23,
224228.
3. Ferris, E.J., Levine, H.L. (1973) Cerebral arteritis: classification. Radiology 109, 327341.
4. Leeds, E.N., Goldberg, H.I. (1971) Angiographic manifestations in cerebral inflammatory disease.
Radiology 98, 595604.
227
5. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodrguez-Carbajal, J.,
Taveras, J.M. (eds) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield,
Illinois, pp. 2754.
6. Escobar, A., Nieto, D. (1972) Parasitic diseases. In: Minckler, J. (ed.) Pathology of the Nervous System.
McGraw-Hill, New York, pp. 2503-2521.
7. Cant, C., Barinagarrementeria, F. (1996) Cerebrovascular complications of neurocysticercosis: clinical and neuroimaging spectrum. Archives of Neurology 53, 233239.
8. Nieto, D. (1982) Historical note on cysticercosis. In: Flisser, A., Willms, K., Laclete, J.P., et al. (eds)
Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 17.
9. Woo, E., Yy, Y.L., Huang, C.Y. (1988) Cerebral infarction precipitated by praziquantel in neurocysticercosis a cautionary note. Tropical and Geographical Medicine 40, 143146.
10. Barinagarrementeria, F., Del Brutto, O.H. (1989) Lacunar syndromes due to neurocysticercosis.
11. Rodriguez-Carbajal, J., Del Brutto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral
12. terPenning, B., Litchman, C.D., Heier, L. (1992) Bilateral middle cerebral artery occlusions in neurocysticercosis. Stroke 23, 280283.
13. Levy, A.S., Lillehei, K.O., Rubinstein, D., et al. (1995) Subarachnoid neurocysticercosis with occlusion of a major intracranial artery: case report. Neurosurgery 36, 183188.
14. Sangla, S., De Broucker, T., Abgrall, S., et al. (1995) Cerebral infarction disclosing neurocysticercosis.
Revue Neurologique (Paris) 15, 277280.
15. Bang, O.Y., Heo, J.H., Choi, S.A., et al. (1997) Large cerebral infarction during praziquantel therapy
in neurocysticercosis. Stroke 28, 211213.
16. Kohli, A., Gupta, R., Kishore, J. (1997) Anterior cerebral artery territory infarction in neurocysticercosis: evaluation by angiography and in vivo proton MR spectroscopy. Pediatric Neurosurgery (Basel)
26, 9396.
18. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of
19. Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540544.
20. Barinagarrementeria, F. (1990) Non-vascular etiology of lacunar syndromes. Journal of Neurology,
21. Monteiro, L., Almeida-Pinto, J., Leite, T., et al. (1994) Cerebral cysticercus arteritis: five angiographic
cases. Cerebrovascular Diseases 4, 125133.
22. Rocca, E., Monteagudo, E. (1966) An angiographic study of neurocysticercosis. International Journal
of Surgery 86, 520528.
23. Barinagarrementeria, F., Cant, C. (1998) Frequency of cerebral arteritis in subarachnoid cysticercosis. An angiographic study. Stroke 29, 123125.
24. Barinagarrementeria, F., Del Brutto, O.H. (1988) Neurocysticercosis and pure motor hemiparesis.
Stroke 19, 11561158.
26. Soto-Hernandez, J.L., Gomez-Llata, S., Rojas-Echeverri, L.A., et al. (1996) Subarachnoid hemorrhage
secondary to a ruptured inflammatory aneurysm: a possible manifestation of neurocysticercosis:
case report. Neurosurgery 38, 197200.
27. Moniz, E., Loff, R., Pacheco, I. (1932) Sur le diagnostic de la cysticercosis crebrale. Encephale (Paris)
27, 4253.
28. Chang, K.H., Han, M.H., Roh, J.K., et al. (1990) Gd-DTPA-enhanced MR imaging of the brain in
patients with meningitis: comparison with CT. AJNR American Journal of Neuroradiology 11, 6976.
29. Haring, H.P., Rotzer, H.K., Reindl, H., et al. (1993) Time course of cerebral blood flow velocity in central nervous system infections. A transcranial doppler sonography study. Archives of Neurology 50,
98101.
30. Muller, M., Merkelbach, S., Huss, G.P., et al. (1995) Clinical relevance and frequency of transient
stenoses of the middle and anterior cerebral arteries in bacterial meningitis. Stroke 26, 13991403.
31. Gupta, R., Mahapatra, A.K., Bhatia, R. (1995) Serial transcranial doppler study in meningitis. Acta
Neurochirurgica (Wein) 137, 7477.
228
32. Cant, C., Villarreal, J., Soto, J.L., et al. (1998) Cerebral cysticercotic arteritis: detection and follow-up
by transcranial doppler. Cerebrovascular Diseases 8, 27.
33. Cant, C., Soto, J.L., Villarreal, J., et al. (1998) Detection and follow-up of cerebral arteritis by transcranial doppler in patients with chronic meningitis. Neurology 50 (Suppl. 4), A400 (Abstract).
23
Taenia solium Cysticercosis:

Uncommon Manifestations
Gagandeep Singh and Indermohan S. Sawhney
Introduction
The most common manifestations of neurocysticercosis (NC) include seizures, headaches and focal neurological deficits.
However, the disorder is known for its pleomorphic presentations. Medical literature is
replete with reports of unusual presentations. Knowledge of these uncommon manifestations is important and failure to
recognize them often leads to misdiagnosis
and delay in management. Several unusual
manifestations are reviewed in this chapter
with emphasis on spinal cysticercosis.
Walton first described the occurrence of a
cyst in the ventral portion of the cervical
spinal cord at autopsy in 18811. Since then,
only a limited number of cases of spinal
cysticercosis have been described in literature, emphasizing the rarity of this condition. Its incidence at autopsy is about 3%2.
Several authors consider that autopsy series
underestimate the true frequency of spinal
cysticercosis on account of the fact that the
spinal cord is not routinely examined35.
However, spinal cysticercosis is rare in clinical series of cysticercosis as well, its frequency being less than 2.5%4,6. There were
only two cases with spinal involvement in

the large series of 450 patients of Dixon and
Lipscomb6. The condition is likely to be
over-represented in neurosurgical series as
a number of such cases end up with surgical treatment7. Finally, spinal involvement
was seen in 5 of 356 cases of a radiological
series of NC8.
Spinal cysticercosis is classified on the
basis of anatomical localization of cysts. The
disease may occur at extradural, intradural
extramedullary and intramedullary locations. Extradural cysticercosis is extremely
rare (Fig. 23.1a and b)913. Canelas et al.
reviewed published literature and collected
35 cases of intradural extramedullary spinal
cysticercosis (IDEMSC) and seven cases of
intramedullary spinal cysticercosis (IMSC)4.
Going by their survey of literature, IDEMSC
is five times more common than IMSC.
Pathologically, the former condition is represented by racemose cysts in the intradural
compartment as well as arachnoiditis.
IDEMSC represents the downward
migration of intracranial-subarachnoid racemose cysts (Fig. 23.2ac)4,10,14. Queiroz et al.
performed elaborate calculations in order to
estimate the probability of location of cysticerci in relation to the regional blood supply to various segments of the spinal cord5.
They concluded that IMSC was acquired
through a haematogenous route and

229
230
G. Singh and I.S. Sawhney
Fig. 23.1. Extradural spinal cysticercosis. CT myelographic (a) and histological (b) appearances.
(Reproduced with permission from reference 11.)
Fig. 23.2. Intradural extramedullary spinal cysticercosis. T1 sagittal (a) and T2 axial (b) and sagittal (c)
MRI sections demonstrating that intradural extramedullary cysticercosis represents an extension of
cranial subarachnoid cysticercosis into the spinal canal. (Reproduced with permission from reference
27.) (Source: E. Citfci and A. Hayman, Baylor, Texas, USA.)
explained the preference of intramedullary

cysts to the thoracic spinal cord on the basis
of increased proportion of arterial blood supply to the latter. Canelas et al. proposed a
ventriculoependymal route for migration of
cysts from the ventricles to the spinal cord4.
From a mechanistic point of view,
myelopathy occurs as a result of direct compression. However, unattached intradural
extramedullary cysts, which have migrated
from the cranium are probably asymptomatic1518. They are soft, pliable and noncompressive. Degeneration of the cysts
produces an intense inflammatory reaction
leading to arachnoiditis and attendant complications, including vascular compromise,
myelitis, degeneration of spinal cord and,
rarely, syringomyelia4,14,19. Clinical symptoms and signs of myelopathy are discernable only during the inflammatory stage8.
Intradural Extramedullary Spinal

Cysticercosis (IDEMSC)
Clinical features
Rocca stressed that IDEMSC was most common in the cervical spinal canal10. He suggested that the presence of septations in the
cervical intradural space prevented the
downward migration of cysts. However, our
review of published cases of this condition
suggests that cysts can produce symptoms at
any location, with lumbosacral and cervical
cord involvement being more common4,8,10,1422.
Zee et al. gave a lucid account of the clinical course of IDEMSC8. Their patient presented with intracranial hypertension due to
hydrocephalus. Cisternal racemose cysticercosis was diagnosed and a cyst was demonstrated in the cisterna magna. It was later
found to have migrated to the cervical
spinal canal. The patient was asymptomatic
at this stage. One year later, the patient
rapidly developed a spinal cord syndrome.
A number of cysts with intense arachnoiditis
were observed upon radiological examination of the spine. The case illustrates the
point that intracranial symptoms and signs
precede myelopathy in IDEMSC. Further-
231
more, extramedullary spinal cysts are

mostly asymptomatic by themselves and
produce symptoms and signs of spinal
involvement because of arachnoiditis when
they degenerate.
Canelas et al. classified spinal syndromes
due to IDEMSC into three varieties: spinal
cord compression syndrome, tabes dorsalis
syndrome and meninigomyelitis4. We
reviewed available English and Latin literature on this subject and could find the following clinical presentations4,8,10,1422:
1. Cauda equina Conus syndrome: Cardinal
features include lumbar pain radiating to the
lower limbs, crural paresis and sphincter disturbances developing over a few weeks
months. Clinical examination reveals evidence of involvement of the cauda equina
and conus medullaris in varying combinations4,14,23.
2. Cervical or thoracic myeloradiculopathy:
Cysts and arachnoiditis in the cervicothoracic spinal canal produce a painful, asymmetrical, patchy neurological deficit. The
condition can be differentiated from other
causes of myeloradiculopathy only by its
association with intracranial cysticercosis.
3. Posterior column syndrome: Canelas et al.
described two patients with what they
referred to as a tabetiform syndrome and
another presenting with subacute combined
degeneration
of
the
spinal
cord4.
Corresponding spinal imaging or pathological confirmation was not available but a cysticercal aetiology was inferred from an
association with intracranial cysticercosis.
4. Amyotrophic lateral sclerosis syndrome:
Meyer first described the syndrome of amyotrophic lateral sclerosis, i.e. severe
bibrachial amyotrophy and spastic paraparesis, pathologically characterized by degeneration of the anterior horn cells and lateral
funiculi and cysticercal arachnoiditis in the
cervical spinal cord24. Only very few clinicopathological reports of this condition are
available2426.
5. Syringomyelia: Syringomyelia in association with syringobulbia can occur as a
result of occlusion of the fourth ventricle
outlet by cysticercal arachnoiditis and
meningeal fibrosis19.
232
Spinal imaging
Earlier diagnostic techniques included
pantopaque (now banned) and metrizamide myelography. Multiple cysts and
irregular patchy filling defects characteristic of arachnoiditis could be seen upon
myelography. Unattached cysts were found
located dorsal to the spinal cord, with the
patient in the prone position. Cysts were
also noted to migrate over a few vertebral
segments with changes in body position
during myelography1518. A fluid level in
the cyst was often noted upon metrizamide
myelography, due to diffusion of metrizamide across the cyst wall8.
Leite et al. reported spinal MRI findings in
12 patients with IDEMSC and emphasized
upon the presence of enhancing cystic structures and sheet-like enhancement of the
spinal subarachnoid space (Fig. 23.3ac)20.
Any vertebral level can be involved and
multiple levels of involvement is most char-
acteristic. The presence of intracranial cisternal racemose cysticercosis supports a diagnosis of IDEMSC (Fig. 23.2ac)27.
Management and outcome

Unfortunately, adequately long follow-ups
are not available for a number of the reported
cases of IDEMSC. Few reports describe a limited follow-up, in particular, the immediate
postoperative outcome4,7,10. Unattached cysts
are easy to remove at surgery. In addition,
irrigation of the spinal canal with physiological saline to remove additional cysts may be
undertaken. Adherent degenerating cysts are
difficult to excise and usually require
microneurosurgical procedures28. A major
determinant of the surgical outcome is the
extent of arachnoiditis. Limited sectors of
arachnoiditis may be dealt by microneurosurgical techniques7,28. Surgical results are poor
with more extensive and intense arachnoidi-
Fig. 23.3. T2 (a) and T1 (b) and post-gadolinium (c) sagittal MRI showing the subarachnoid space filled
with serpentine material giving a high signal on T2 and low signal on T1 images. (Reproduced with
tis. Some patients may improve partially after

surgery and then deteriorate again due to
ongoing arachnoiditis.
Intramedullary Spinal Cysticercosis

(IMSC)
A number of anecdotal case reports of IMSC
are accompanied by reviews of published literature4,5,29. We reviewed clinical and laboratory features of 24 cases reported in English
literature from 1976 onwards5,22,2940.
Clinical features
IMSC occurs mostly in young adults. In the
24 case reports, that we analysed, mean
(SD) age was 28 14 years (range: 1060
years). There were 21 males and four
females. Myelopathy due to IMSC develops
over a few daysweeks. Exceptions to this
rule have been one case reported by
Holtzman et al. of a progressive myelopathy
developing over 8 years and another
reported by Sharma et al. of a patient with
radicular pains of 10 years duration29,30. An
acute spinal cord syndrome may be precipitated as a result of the administration of
anticysticercal therapy for cerebral cysticercosis in an individual with otherwise asymptomatic IMSC34. The symptom complex of
IMSC comprises of sensorimotor paralysis
below the level of lesion with or without
bladder and bowel involvement. Local pain
is an important symptom29,31,32,35,36,38,40 but
may be absent22,30,37,39. There may be signs of
meningeal irritation32,40.
IMSC is commonly located in the thoracic
spinal cord. Exceptionally, it may involve the
cervical
spinal
cord1,34,36
or
conus
31
medullaris . There may be more than one
intramedullary cyst or associated IDEMSC
and arachnoiditis22,31. Castillo et al. reported
the occurrence of multiple cysts in one individual31. Two cysts, located in the conus
medullaris and thoracic spinal cord were of
cysticercal aetiology and the third cystic
lesion in the cervical spinal cord was attributable to hydromelia resulting from obstruction of the central canal by the former.
233
Spinal imaging
MRI is the standard investigative procedure
for diagnosis of IMSC. Upon MRI, the spinal
cord may be focally enlarged. A focal cystic
lesion can be seen that is hyperintense on T2and hypointense on T1-weighted images (Fig.
23.4). A review of published MRI descriptions
of IMSC revealed that a scolex was visible in
only two out of 12 case reports20,29,31,34,37. The
scolex is isointense to the cord parenchyma in
T1 sections and is not visible in T2 sections.
The cyst wall and the surrounding cord
parenchyma and meninges may enhance
after contrast, whilst the scolex is non-enhancing. There may be surrounding oedema.
Intramedullary cysts may be multiple and
may be associated with hydromelia. In the latter situation, it is important to differentiate
Fig. 23.4. Intramedullary spinal cysticercosis. T2

(left) and T1 (right) sagittal MRI of the cervical
spinal cord revealing a cystic intramedullary
lesion. (Source: Prakash Singh, New Delhi, India.)
234
between the two conditions. Hydromelia

appears
hypointense
on
T2
sections because of mobility of fluid in the
cavity. Other cystic lesions that may be
considered in the differential diagnosis
of intramedullary cysticercosis include primary and secondary neoplastic cysts,
syringomyelia and hydatid cysts. Corral et al.
reported MRI appearance of IMSC in a
patient with multiple cerebral cysticercosis
who was administered albendazole for treatment of cerebral cysts34. Spinal MRI revealed
focal spinal cord enlargement, oedema and
irregular enhancement with no definite cystic
lesion. The authors surmised that these
appearances were of an inflammatory
parenchymal reaction to a dead cyst. It may
be interesting to speculate a cysticercal aetiology in some of the cases of myelopathies
with clinical and MRI features of non-specific
myelitis in cysticercus endemic areas.
Ancillary investigations
In contradistinction to IDEMSC, which is
usually accompanied by intracranial involvement, it is not uncommon for IMSC to occur
as an isolated lesion with no clinical or radiological evidence of cerebral involvement.
However, the presence of cerebral cysticercosis is a supportive feature in the preoperative
diagnosis of IMSC. Since IMSC is an oligocystic form of disease, stool evaluations for
Taenia solium, blood eosinophilia, soft tissue
calcifications and CSF examination are rarely
contributory to the diagnosis5,22,32,39,40.
Pathology
Morphological aspects of IMSC have
been studied at necropsy and surgery. The
cyst causes focal, smooth enlargement of the
spinal cord. There may occur thickening
and adhesions of the overlying leptomeninges5,29,31. The glistening white capsule of the cyst can be seen after a vertical
myelotomy. The cyst is usually non-adherent
and can be dissected from the cord without
difficulty29,30,40. The fluid contained in the
cyst may be turbid or xanthochromic29,30. The
outer surface contains fine hair-like projec-
tions, while the inner surface has a smooth

glistening texture30. A scolex may or may not
be discernable. Calcific knobs may be seen39.
Microscopically, there is surrounding gliosis
and granulation tissue consisting of plasma
cells and foamy macrophages29,30,40.
Management and outcome

Until recently, surgery was advocated as standard treatment for IMSC. It was often diagnosed at surgery30,31 or rarely at necropsy5
because myelographic appearances of this condition were non-specific. Postoperative neurological outcome varied. As a general rule, there
was partial recovery over few months with
some residual permanent neurological deficit.
The availability of MRI offered the unique
opportunity of identifying intramedullary
cysts before surgery and opened prospects for
non-surgical management. To our knowledge,
there are at least three reports of IMSC treated
with albendazole for about a month34,37. The
outcome has been extremely favourable in
terms of neurological recovery in all three
cases. It may be necessary to co-administer corticosteroids in order to manage inflammatory
myelopathic exacerbations related to anticysticercal treatment. In view of the rarity of the
condition, an accurate assessment of the role of
non-operative management of IMSC will perhaps take time.
Sellar Cysticercosis
The pituitary fossa and its neighbourhood
are an infrequent site for cysticercosis.
Besides a series of eight pathologically verified cases reported by Del Brutto and colleagues41, there have been isolated case
reports of the condition in literature4245.
Clinical features
Asymptomatic sellar cysts
On occasion, sellar cysts may be asymptomatic and present with sellar enlargement on
skull radiographs2. Incidental sellar cysts
have been reported at necropsy2,46.
Visual loss
This occurs as a result of chiasmal compression by the sellar or suprasellar cysts and
optochiasmatic arachnoiditis. Loss of vision
is usually bilateral; associated bitemporal
field defects may be detectable41. It develops rapidly within 312 weeks in contrast
to other pituitary tumours, where it may
take months or years to manifest41,47.
Ophthalmoscopic examination discloses
optic atrophy. Papilloedema is a rare feature
and signifies associated hydrocephalus due
to meningeal cysticercosis or raised intracranial pressure due to involuting parenchymal
cysticerci41. Exophthalmos may be observed
uncommonly, reflecting growth of the cyst
into the cavernous sinus41.
Endocrine disturbances
Several endocrinopathies, including panhypopituitarism, diabetes insipidus and galactorrhea have been reported in one-third to
one-half of published cases41,44.
Clinical manifestations due to associated
cysticerci in other locations
In the published literature, seizures have been
reported in about 40% of the patients with
sellar cysticercosis41. The occurrence of seizures
should invoke a consideration of associated
parenchymal cysticercosis. By comparison,
seizures occur in less than 10% of all pituitary
tumours and reflect involvement of the mesial
temporal structures (Table 23.1)47. Similarly,
the occurrence of intracranial hypertension
indicates an association with hydrocephalus
or oedematous parenchymal cysts41. On occa-
235
sion, a patient with limited sellar cysticercosis

may develop hydrocephalus or parenchymal
cysticercosis months after initial presentation41. Truly intrasellar cysticercosis does not
cause cerbrovascular involvement. However
cysts in a suprasellar location, or intrasellar
cysts which have grown in size into the
suprasellar cistern may occlude blood vessels
and lead to infarcts.
Radiological diagnosis
Raised intracranial pressure may lead to sellar enlargement and erosion of the sella on
lateral skull radiographs42,45. Calcified
parenchymal cysts may be observed41. CT is
more useful in the diagnosis of sellar cysticercosis. A cystic hypodense intrasellar
mass can be seen on CT. The cyst wall may
or may not enhance following contrast
administration. Calcification of the cyst wall
never occurs. Bone erosion is rarely evident
in cases of sellar cysticercosis not associated
with raised intracranial pressure. Coexistent
features like parenchymal cysts, subarachnoid cysts and hydrocephalus, if noted,
substantiate a diagnosis of cysticercal
pathology in the sella turcica41. The differential diagnosis of a cystic mass in the sella
turcica includes adenoma with an intra-adenomatous cyst, cysts of the Rathkes cleft,
arachnoid cyst, germinoma, epidermoid
and empty sella syndrome.
A dominant cystic component is clearly
visualized and the cyst wall is easily demarcated on MRI. The cyst fluid may be isointense, hyperintense or hypointense to the
CSF depending upon its protein content. The
cyst wall usually does not enhance with con-
Table 23.1. Differentiating features between sellar cysticercosis and pituitary adenoma.
Feature
Sellar cysticercus
Pituitary adenoma
Visual symptoms
Seizures
Radiology
Always present at diagnosis;

rapid progression (20 days
8 months)
Approximately 40%
Cystic morphology: common
Recovery of visual function after surgery
Poor
May be absent; slow

progression (months
years)
Approximately < 10%
Cystic morphology: rare
and inconspicuous
Good
236
trast. Multiplanar MRI is useful in demonstrating the anatomical extent of the cystic
lesion. Sagittal and coronal sections clarify
its relationship to the optic chiasma and may
demonstrate arachnoiditis.
Laboratory diagnosis
CSF examination was normal in five of eight
patients studied by Del Brutto et al. All five
patients had isolated sellar cysticercosis.
Serological studies were also non-contributory in these patients41.
Management
Surgical resection of the cyst is the standard
management of sellar cysticercosis. A transfrontal approach is usually advocated in
view of suprasellar growth of the cysts and
the frequent association with optochiasmatic
arachnoiditis41. However, if MRI studies rule
out suprasellar growth and arachnoiditis, a
transsphenoidal approach may be undertaken42. The prognosis for recovery of visual
and endocrine function is dismal. None of the
patients in the series reported by Del Brutto et
al. showed good postoperative recovery in
visual function41. This is in contrast to the
good prognosis for recovery of visual function
after surgery for pituitary adenomas, where
complete recovery of vision may be noted in
up to 20% and partial recovery in 80% of
patients47. It may be surmised that optochiasmatic arachnoiditis, which often accompanies
sellar and suprasellar cysticercosis, is responsible for poor postoperative outcome of visual
function. There is no evidence so far that
either praziquantel or albendazole help in resolution of sellar cysticercosis.
boy with CT features of cerebral cysticercosis48. The myoclonus resolved, as did the CT
abnormalities after two courses of praziquantel, in addition to sodium valproate. Otero et
al. reported the development of complex partial seizures and an acquired language disorder in a previously normal child at age 649.
The child had comprehension deficits, literal
and verbal paraphasias and telegraphic spontaneous speech. Electroencephalography
revealed sharp and slow waves arising from
the left centrotemporal region. MRI revealed a
small subarachnoid cysticercus cyst situated
deep in the left Sylvian fissure. The authors
postulated that the unique location of the cyst
and the age of the patient were responsible
for the LandauKleffner-like presentation.
The patients condition, including seizures
and the language dysfunction, improved after
a course of albendazole. Chung et al. gave an
account of chronic intractable left mesial temporal lobe epilepsy of 20 years duration, in a
middle-aged man50. Imaging studies revealed
a calcified cysticercal cyst in the left medial
temporal region in addition to ipsilateral hippocampal atrophy. The patient was seizurefree after standard left temporal lobectomy.
Histological sections revealed degenerated
cysticercus and scolex embedded in the hippocampus in addition to neuronal loss. The
authors postulated that the calcified cysticercus cyst was responsible for the peculiar
epileptological condition. Finally, there is documentation of periodic lateralized epileptiform discharges in massive parenchymal
cysticercosis51,52. These rare electroencephalographic abnormalities are attributed to the
inflammatory reaction in the brain to cystic
degeneration either spontaneously or as a
result of anticysticercal treatment.
Extrapyramidal Disorders
Uncommon Epileptic Syndromes
Partial or generalized tonic clonic seizures
are commonly seen in a majority of the cases
with parenchymal cysticercosis. Uncommon
epileptic syndromes have been reported in
few cases. Puri et al. described stimulussensitive generalized myoclonus in a young
Few of the earliest descriptions of NC in literature alluded to extrapyramidal manifestations. Bickerstaff recounted the case of a
51-year-old housewife of an Indian soldier,
who developed progressive choreoathetosis
along with mental impairment, a clinical picture resembling Huntingtons chorea53.
Necropsy revealed cysticerci in both caudate

and lentiform nuclei. There is a paucity of
reports of extrapyramidal disorders in recent
literature. Nevertheless, parkinsonism, unilateral tremors, chorea, facial myokymia and
blepharospasm have been described in
NC6,5356. Racemose cysticercosis of the posterior fossa may present with ataxia57.
Bickerstaff described the occurrence of progressive ataxia in a 50-year-old woman58. He
reported operative findings of a delicate
elongated structure resembling a bunch of
grapes lying over and around the lower
brainstem and hanging on to the upper cervical region. Ataxia may be intermittent as
with cysts of the fourth ventricle, where
intermittent obstruction (Bruns syndrome)
is the cause of isochronal symptoms57. It may
be asymmetric, when it results from racemose cysts of the cerebellopontine angle58.
Lingual Cysticercosis
Lingual cysts are usually observed in the
context of disseminated cysticercosis59.
Rarely, cysticercosis may occur as an isolated tongue mass59. The differential diagnosis in such instances includes lingual
carcinoma, haemangioma, mucocoele, papilloma and lingual thyroid.
Sudden Death
Sudden death in otherwise asymptomatic
persons may occur due to massive antigenic
release from ruptured cysts in the brain
parenchyma and surrounding meninges60,61.
The massive antigenic release may result in
a severe inflammatory response in the brain
as well as systemic anaphylactic reaction
with pulmonary and visceral oedema. In
237
one report of such a case, trauma from a

vehicular accident led to rupture of cysts
and sudden death61.
Conclusions
The presenting manifestations of T. solium
cysticercosis are primarily related to the location of cysticerci. Therefore, when cysticerci
lodge in remote areas within the central nervous system, they produce uncommon manifestations. Among the protean manifestations,
spinal cysticercosis, sellar cysticercosis and
uncommon epileptic and extrapyramidal syndromes are reviewed.
Spinal cysticercosis is classified in to
extradural spinal cysticercosis, intradural
extramedullary (IDEMSC) (most common),
intramedullary (IMSC) and mixed forms.
IDEMSC is commonly accompanied by
intracranial cysticercosis; it is believed to
result from the downward migration of
intracranial subarachnoid-racemose cysticerci. When the spinal cysts degenerate,
they lead to the clinical syndrome of a
myeloradiculopathy involving the cervical
spinal cord most commonly. Intramedullary
cysticerci occur in isolation with preference
for the thoracic spinal cord. MRI is the imaging modality of choice for spinal cysticercosis. The treatment of IDEMSC is surgical.
Surgery is also advocated for IMSC, though
reports of successful medical treatment are
now accumulating.
Sellar cysticercosis of the racemose variety presents with visual and endocrine disturbances. The diagnosis is established by
MRI and the treatment is surgical. Several
other uncommon manifestations reviewed
here often present a diagnostic and therapeutic challenge to the treating physician
both in endemic and non-endemic regions.
References
1. Walton, G.L. (1881) A case of cysticercosis in the substance of spinal cord. Boston Medical and Surgical
Journal 105, 511512.
2. Briceno, C.E., Biagi, F., Martinez, B. (1961) Cisticercosis: observaciones sobre 97 casos de autopsia.
Presna Medicina Mxico 26, 193197.
3. Guccione, A. (1919) La cisticercosi del Sisterna Nervoso Centrale Umano. Societ Editrice Libraria,
Milan, Italy.
238
4. Canelas, H.M., Ricciardi-Cruz, O., Escalante, O.A.D. (1963) Cysticercosis of the nervous system: less
frequent clinical forms. III. Spinal cord forms. Arquivos de Neuropsiquiatria 21, 7786.
5. Queiroz, L.D.S., Filho, P.J., Callegaro, D., et al. (1975) Intramedullary cysticercosis: case report, literature review and comments on pathogenesis. Journal of the Neurological Sciences 26, 6170.
6. Dixon, H.B.F., Lipscomb, F. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical
Research Council Special Report Series 299. Her Majestys Stationery Office, London, pp. 158.
7. Colli, B.O., Assirati, J.A., Jr, Machado, H.R., et al. (1994) Cysticercosis of the central nervous system.
II. Spinal cysticercosis. Arquivos de Neuropsiquiatria 52, 187199.
8. Zee, C.S., Segall, H.D., Ahmadi, J., et al. (1986) CT myelography in spinal cysticercosis. Journal of
Computer Assisted Tomography 10, 195198.
9. Gallani, N.R., Zambelli, H.J.L., Roth-Vargas, A.A., et al. (1992) Cisticercose medular. Relato de dois
casos, revisao lieraturaa e comentarios sobre a paogenia. Arquivos de Neuropsiquiatria 50, 343350.
10. Rocca, E.D. (1959) Cisticercosis intramedular. Revista Neuropsiquiatria (Lima) 22, 166173.
11. Mohanty, A., Das, S., Sastry Kolluri, V.R., et al. (1998) Spinal extradural cysticercosis: a case report.
Spinal Cord 36, 285287.
12. Kurrien, F., Vickers, A.A. (1977) Cysticercosis of the spine. Annals of Tropical Medicine and Parasitology
71, 213217.
13. Vlok, G.J., Wells, M.C. (1988) Vertebral cysticercosis. A case report. South African Medical Journal 73,
730731.
14. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I.
Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquiatria 52, 166186.
15. Dorfsman, J. (1966) Radiological aspects of spinal cysticercosis. Acta Radiologica (Diagnostic)
(Stockholm) 5, 10031006.
16. Zee, C.S., Segall, H.D., Boswell, W., et al. (1988) MR imaging of neurocysticercosis. Journal of
17. Kim, K.S., Weinberg, P.E. (1985) Spinal cysticercosis. Surgical Neurology 24, 8082.
18. Savoiardo, M., Cimino, C., Passerini, A., et al. (1986) Mobile myelographic filling defects: spinal cysticercosis. Neuroradiology 28, 166169.
19. Escobar, A., Vega, J. (1981) Syringomyelia and syringobulbia secondary to arachnoiditis and fourth
ventricle blockage due to cysticercosis. A case report. Acta Neuropathologica (Berlin) 7, 389391.
20. Leite, C.C., Jinkins, J.R., Escobar, B.E., et al. (1997) MR imaging of intramedullary and intraduralextramedullary spinal cysticercosis. AJR American Journal of Roentgenology 6, 17131717.
21. Gupta, P.K., Sridhar, R., Rao, T.N., et al. (1995) Spinal subarachnoid cysticercosis. Neurology India 43, 6061.
22. Isidro-Llorens, A., Dachs, F., Vidal, F., et al. (1993) Spinal cysticercosis. Case report and review.
Paraplegia 31, 128130.
23. Lau, K.Y., Roebuck, D.J., Mok, V. (1998) MRI demonstration of subarachnoid neurocysticercosis simulating metastatic disease. Neuroradiology 40, 724726.
24. Meyer, E. (1906) Amyotrophische Lateralsklerosis combiniert mit multiplen Hirncysticerken. Archiv
Psychiatrie Nervenkrankheiten 41, 640652. (Cited in reference 45.)
25. Guillain, G., Perisson, J., Bertrand, I., et al. (1927) Cysticercose cerebrale racemeuse. Revue
Neurologique (Paris) ii, 433444.
26. Kahn, P. (1972) Cysticercosis of the central nervous system with amyotrophic lateral sclerosis: case
report and review of the literature. Journal of Neurology, Neurosurgery and Psychiatry 35, 8187.
27. Citfci, E., Diaz-Marchan, P.J., Hayman, L.A. (1999) Intradural-extramedullary spinal cysticercosis:
MR imaging findings. Computer Medical Imaging Graphics 23, 161164.
28. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central
29. Sharma, B.S., Banerjee, A.K., Kak, V.K. (1987) Intramedullary spinal cysticercosis. Clinical Neurology
and Neurosurgery 89, 111116.
30. Holtzman, R.N.N., Hughes, J.E.O., Sachdev, R.K., et al. (1986) Intramedullary cysticercosis. Surgical
31. Castillo, M., Quencer, R.M., Donovan Post, M.J., et al. (1988) MR of intramedullary spinal cysticercosis. AJNR American Journal of Neuroradiology 9, 393395.
32. Garza-Mercado, R. (1976) Intramedullary cysticercosis. Surgical Neurology 5, 331332.
33. Mehta, D.S., Malik, G.B., Dar, J., et al. (1971) Intramedullary cysticercosis. Neurology India 19, 9294.
34. Corral, I., Quereda, C., Moreno, A., et al. (1996) Intramedullary cysticercosis cured with drug treatment. A case report. Spine 21, 22842287.
239
35. Sawhney, I.M., Singh, G., Lekhra, O.P., et al. (1998) Uncommon presentations of neurocysticercosis.
Journal of the Neurological Sciences 154, 94100.
36. Kishore L.T., Gayatri, K., Naiad, M.R., et al. (1991) Intramedullary spinal cord cysticercosis. A case
report and literature review. Indian Journal of Pathology and Microbiology 34, 219221.
37. Garg, R.K., Nag, D. (1998) Intramedullary spinal cysticercosis: response to albendazole: case reports
and review of literature. Spinal Cord 36, 6770.
38. Agrawal, V., Thomas, M., Maheshwari, M.C. (1995) Intramedullary cysticerci. Journal of the
Association of Physicians of India 43, 138.
39. Singh, A., Aggarwal, N.D., Malhotra, K.C., et al. (1966) Spinal cysticercosis with paraplegia. British
Medical Journal ii, 684685.
40. Hesketch, K.T. (1965) Cysticercosis of the dorsal cord. Journal of Neurology, Neurosurgery and
41. Del Brutto, O.H., Guevara, J., Sotelo, J. (1988) Intrasellar cysticercosis. Journal of Neurosurgery 69,
5860.
42. Prosser, P.R., Wilson, C.B., Forsham, P.H. (1978) Intrasellar cysticercosis presenting as a pituitary
tumor: successful trans-sphenoidal cystectomy with preservation of pituitary function. American
43. Rafel, H., Gomez-Llata, S. (1985) Intrasellar cysticercosis. Case report. Journal of Neurosurgery 63,
975976.
44. Dickenson, C.J. (1955) Cysticercosis and panhypopituitarism. Proceedings of the Royal Society of
Medicine 48, 892.
45. Argenta, G. (1956) Su di un caso di cisticercosi generalizata con sindrome di adenoma ipofisario.
Revue Neurologique (Paris) 26, 197204.
46. Kufs, F. (1915) ber einen fall von basaler Cysticerken-meningitis mit cysticercus der Hypophysis
und schwerer depressives Psychose und ber andere Faile von Hirncystcerken. Zeitschrift Germaine
Neurologie und Psychiatrie 30, 286304.
47. McDonald, W.I. (1982) The symptomatology of tumours of the anterior visual pathways. Canadian
Journal of Neurological Sciences 9, 381390.
48. Puri, V., Chowdhury, V., Gulati, P. (1991) Myoclonus: a manifestation of neurocysticercosis.
Postgraduate Medical Journal 67, 6869.
49. Otero, E., Cardova, S., Diaz, F., et al. (1989) Acquired epileptic aphasia (the LandauKleffner syndrome) due to neurocysticercosis. Epilepsia 30, 569572.
50. Chung, C.K., Lee, S.K., Chi, J.G. (1998) Temporal lobe epilepsy caused by intrahippocampal calcified
cysticercus: a case report. Journal of Korean Medical Science 13, 445447.
51. De Carvalho-Filho, P., Arruda, O.M., De Melo-Souza, S.E. (1989) Periodic lateralized epileptiform
discharges in neurocysticercosis. Arquivos de Neuropsiquiatria 47, 9499.
52. Vijayan, P., Suri, M.L., Sahai, B., et al. (1977) Periodic lateralized discharges in EEG in cerebral cysticercosis. Neurology India 25, 3842.
53. Bickerstaff, E.R. (1955) Cerebral cysticercosis: common but unfamiliar manifestations. British Medical
Journal i, 10551058.
54. Beydoun, S.R. (1994) Facial myokymia secondary to neurocysticercosis. Muscle Nerve 17, 10601061.
55. Jimenez-Jimenez, F.J., Molina-Arjona, J.A., Roldan-Montaud, A., et al. (1992) Blepharospasm associated with neurocysticercosis. Acta Neurologica (Napoli) 14, 5659.
56. Assiss, J.L., Tenuto, R.A. (1948) Cisticerco racemoso intraventricular: estipaco cirurgica. Arquivos de
58. Bickerstaff, E.R., Cloake, P.C.P., Hughes, B., et al. (1952) The racemose form of cerebral cysticercosis.
Brain 75, 117.
59. Gupta, S.C., Gupta, S.C. (1995) Cysticercosis of the tongue. Ear Nose Throat Journal 74, 177178.
60. Ndhlovu, C.E. (1997) An uncommon presentation of cysticercosis. Central African Journal of Medicine
43, 207209.
61. Verma, S.K., Agarwal, B.B.L., Agarwal, G. (1998) Sudden death in neurocysticercosis by trauma.
Forensic Science International 95, 2326.
24
The Story Behind Solitary

Cysticercus Granuloma
Vedantam Rajshekhar
Reasons for misdiagnosis as

tuberculoma
Introduction
Single, small, enhancing computed tomography lesions (SSECTLs) were noted by
Bhargava and Tandon, in their report on the
computed tomography (CT) appearance of
tuberculomas of the brain1. They reported
lesions that were small (<10 mm), often solitary, enhanced with contrast injection and
were associated with surrounding oedema
in patients presenting predominantly with
seizures, and labelled them as microtuberculomas or immature tuberculomas. A
histological diagnosis was however lacking
in any of their patients. Subsequently, several Indian reports on CT appearance of
tuberculoma identified similar lesions24.
Wadia et al. suggested that at least a third
and probably more of SSECTL were tuberculomas4. Their conclusion was based upon
a study of 39 patients with SSECTL, of
whom 10 had active pulmonary tuberculosis, two had histological evidence of tuberculosis and another patient developed
tubercular meningitis while on antiepileptic
drugs (AEDs) alone. They advocated antitubercular therapy (ATT) for all patients with
SSECTL. Van Dyk, Kumar et al., and
Domingo and Peter also considered SSECTL
to be of tubercular aetiology57.
One or more of the following arguments

were used to support the diagnosis of tuberculoma in patients with SSECTL:
1. Tuberculosis and intracranial tuberculomas
were believed to be highly prevalent among
Indian patients, constituting up to 25% of all
intracranial space-occupying lesions.
2. There was similarity in the CT morphology of these lesions and the cerebral
parenchymal enhancing lesions in patients
with proven tubercular meningitis.
3. A number of these patients had evidence
of healed pulmonary focus of tuberculosis on
chest roentgenograms.
4. Often, there was a history of exposure to
the disease from within the family or close
neighbours.
5. Patients often had a positive Mantoux test.
6. Finally, the lesions appeared to respond
when a course of ATT was administered to
the patients1,2,4.
Although the above arguments are sound
in themselves, none of them supports a
definitive diagnosis of tuberculosis. Some of
the arguments were also founded upon outdated data:

241
242
V. Rajshekhar
1. Data showing high rates of intracranial

tuberculomas in Indians were derived from
published series of intracranial space-occupying lesions in the 1960s and 1970s8,9. Their
incidence has fallen considerably since then,
and at present less than 5% of all patients
with intracranial space-occupying lesions in
our department have tuberculomas10.
2. Apparently, CT morphology of the
SSECTL and parenchymal brain lesions in
those with tubercular meningitis or histologically proven multiple tuberculomas are
quite similar. But these observations made in
patients with multiple intracranial lesions
cannot be extrapolated and applied to solitary lesions. It is also well known that the socalled typical appearance of a tuberculoma
can be mimicked by various other pathological lesions including neoplasia.
3. Evidence of exposure to tuberculosis,
history of tuberculosis and roentgenographic evidence of healed pulmonary
tuberculosis may support but do not provide definitive proof for a diagnosis of
intracranial tuberculoma in individuals
from regions that are endemic for tuberculosis. Similarly, most individuals in endemic
regions will have a positive skin test,
regardless of whether or not they have
active infection.
4. Therapeutic trials are frequently applied in
medical practice to provide a diagnosis. But
while looking for a response to a therapeutic
regimen, ATT in this case, the possibility of
spontaneous resolution was not considered.
SSECTL
A number of reports of patients with solitary
enhancing CT lesions identified the latter as
tuberculomas, solitary cysticercus granuloma
(SCG), disappearing or vanishing CT
lesions. We felt that their identification and
management might be better if patients with
these lesions were identified by the characteristics of their CT lesions namely, the single,
small (contrast) enhancing, CT lesions
(SSECTLs)12,13. The abbreviation SSECTL
(Fig. 24.1) thus avoided attributing a defini-
The Disappearing CT Lesion

A fortuitous discovery by Sethi et al. challenged the diagnosis of microtuberculoma for SSECTL11. They reported
spontaneous resolution of SSECTL in 11
individuals with seizures who had been
prescribed ATT for their lesions but did not
consume the medications. Thus for the first
time, it became evident that the resolution
of SSECTL was in no way linked to ATT
but was a spontaneous phenomenon. This
posed the first serious challenge to the aetiological consideration of microtuberculoma for these lesions.
Fig. 24.1. Initial (a) and follow-up (b) contrastenhanced CT of patient with seizures showing
complete resolution of the lesion in the follow-up
scan performed after 6 months.
Solitary Cysticercus Granuloma
tive aetiology (tuberculoma or SCG) or

implying a biological behaviour pattern (disappearing) at the time of initial presentation.
SSECTL: cause or effect

Some authors considered SSECTL to be the
result of a breakdown of the bloodbrain barrier and the surrounding oedema to be vasogenic in origin after intense ictal activity
that accompanied seizures14. They believed
that the CT abnormality was not caused by a
structural lesion but was the result of the
seizure. Indeed, while few patients with prolonged seizures or status epilepticus may
exhibit transient, enhancing lesions that follow the wavy contour of the cortical mantle,
this pattern is distinct from the CT morphology of the SSECTL15. Furthermore, only few
and not all individuals with status epilepticus or prolonged or repeated focal or generalized seizures exhibit this abnormality even if
the CT is performed soon after the ictus. On
the other hand, many patients with SSECTL
have had their CT scan examination several
days or weeks after their last seizure and it is
unlikely that a physiological change linked to
seizure activity would persist for several
weeks or months.
Histological attributes of the SSECTL

Histological study of SSECTL would have
laid to rest the controversy regarding their
aetiology and management. But this was not
easily accomplished for several reasons. The
lesions were small and most of them were situated in eloquent areas of the brain such as
the sensorimotor region. As most of these
lesions do not produce any changes in the
overlying pia-arachnoid, localizing them was
not easy. Moreover, there was a fair chance of
producing neurological deficit with surgical
excision of the lesion. Finally, there was justifiable reluctance in subjecting individuals
with SSECTLs to surgery given the fact that
these lesions could spontaneously resolve.
We initially performed closed stereotactic
biopsies of these lesions through a twist drill
craniostomy or a burr hole in 10 patients.
243
However, the small bit of tissue (2 1 1

mm) that was obtained from stereotactic
biopsy turned out to be inadequate to reveal
the aetiological diagnosis. Only the inflammatory nature of the lesion was evident from
this series of stereotactic biopsies. Studies
such as culture of the tissue for acid-fast
bacilli (AFB) and fungus, and staining the tissue for AFB and fungal elements were all
negative. We concluded at that stage that the
lesion represented a focal encephalitis of
undetermined aetiology16. It became evident
that to obtain further insight into the aetiology of the lesion more tissue for pathological
examination from the lesion, virtually involving excision of this small lesion, was
required. This was achieved through excision
following stereotactic craniotomy where
stereotactic techniques were used to guide
the placement of a craniotomy flap and then
localize the intracranial target after the dura
was opened. In 15 consecutive patients, who
underwent an excision of their lesion, cysticercus granuloma was diagnosed in seven,
parasitic granuloma without evidence of the
parasite in five, chronic inflammation in two,
and fibrous cicatrix in one13. Four of the five
lesions without the parasite had been sectioned in the operating room after excision
and before being placed in the fixative. It is
possible that the parasite, which occupies the
core of the granuloma, may have spilt out
and have been lost. There were no tuberculomas or neoplasia in this series. We concluded
that cysticercosis was the cause of most of
these lesions and that empirical ATT should
therefore be avoided in managing patients
with these lesions. These histological findings
have been subsequently confirmed in several
selected patients who have undergone surgical excision of their lesions17.
Proving that the Disappearing

SSECTL is an SCG
We performed a study in 19871988, involving 30 consecutive patients presenting with
seizures and SSECTL12. The initial five
patients were managed conservatively with
AEDs. The next ten patients underwent nonexcisional stereotactic biopsy. Only a tiny bit
244
V. Rajshekhar
of the lesion was sampled in the stereotactic

biopsy and rest of the lesion was left in situ.
These 15 patients constituted Group A and
their lesions were monitored and followed
up upon CT. Finally, 15 consecutive patients
with similar clinical and imaging characteristics (Group B) had their lesions excised.
Follow-up CT monitoring in 12 of 15 patients
in Group A (three were lost to follow-up)
revealed disappearance in six, calcific residue
in five and reduced size in one. This observation confirmed the fact that the lesions in this
larger homogeneous group of 30 patients
were disappearing SSECTLs. The histology of
the 15 lesions in Group B would therefore
indicate the pathology of the disappearing
SSECTLs. The pathology of the lesions in
Group B has been presented above, i.e. 12 of
the 15 biopsies revealed a cysticercus or a
parasitic granuloma and the rest, residue of
an inflammatory lesion. Therefore, we
believe that this provided adequate proof
that the disappearing SSECTL is an SCG.
Problem of Persistent Lesions

Sethi et al. noted resolution of the CT lesion in
all of their patients after an interval of 624
weeks (with AEDs alone)11. Adopting this
time frame, several physicians managing these
patients with AEDs alone noted that SSECTLs
often persisted upon follow-up CT, performed
3 months later. Moreover, several individuals
with persistent lesions continued to have
symptoms. The management of these persistent lesions posed a challenge because it was
commonly believed that disappearing
SSECTLs that resolved within about 3 months
were different in aetiology from SSECTLs that
were persistent beyond this time frame. It was
not uncommon for physicians to resort to ATT
in individuals with persistent lesions because
of their belief that persistent lesions were
likely to be tuberculomas. We looked at the
histology of persistent and fresh lesions in
25 consecutive patients with SSECTL18. The
duration of symptoms was less than 12 weeks
(312 weeks) in six patients and ranged from 4
months to 5 years in 19 patients. Both groups
were found to be essentially similar in their
clinical and imaging attributes. Importantly,
the histological diagnoses in both groups were

identical, revealing a cysticercus or parasitic
granuloma in both. There were no tuberculomas or neoplasia in either group. Thus it was
abundantly clear that the reason for persistence was not a difference in aetiology but a
variable natural history of the SCG in different
individuals. Thus we argued that persistent
SSECTLs need not be treated any differently
from those that resolved early, i.e. with AEDs,
provided that patients did not have new
symptoms or signs of progressive neurological
deficit or raised intracranial pressure.
SSECTLs within the Perspective

of Neurocysticercosis
Ideally, the cysticercus granuloma should
have been an active aetiological consideration in the case of SSECTLs that resolve
spontaneously. The appearance of the cysticercus granuloma on CT was known to be
identical to that of the SSECTL. Some of the
authors who had labelled SSECTL as microtuberculomas also commented upon this
similarity1,2,19. Furthermore, spontaneous
resolution of cysticercus granulomas has
been adequately documented2022. Punctuate
calcifications that are sequelae of SSECTL
were known to occur in NC well before specific therapy for cysticercosis was introduced. Finally, seizures are the commonest
manifestation of NC23. All the above features
suggest that a cysticercus granuloma is a
likely aetiology for the SSECTL. Several
authors, however, dismissed cysticercosis as
a cause for SSECTL for one or more reasons2,11,14,19. The three commonly mentioned
reasons included: (i) cysticercosis is uncommon among Indians; (ii) it is rare for NC to
present as a solitary lesion; and (iii) a cysticercus granuloma would not be expected to
resolve spontaneously. Counter-arguments
to these are: (i) cysticercosis is endemic in all
parts of India; (ii) the myth that solitary cysticercal lesions were rare was derived from
data from the Western hemisphere; and (iii)
finally, cysticercosis can resolve spontaneously. Several authorities exclude a cysticercal aetiology for the SSECTL on the
premise of a negative serological test.
However, it is worth mentioning that serological tests for cysticercosis including both
the ELISA and enzyme-linked immunoelectrotransfer blot (EITB) have poor sensitivity
in patients with SCG (see Chapter 33)24,25.
Therefore, a negative serological test has no
relevance in the diagnostic scheme of
SSECTL.
Reports of SSECTL in NC literature

Early reports of the CT appearance of cerebral cysticercosis did not mention solitary
granulomas26. Zee et al. first drew attention
to this form of NC in 198027. Byrd et al. in
their report on CT appearances of cerebral
cysticercosis, described a group of lesions,
which were mostly solitary and enhanced
uniformly (the so-called disc lesions)28.
These lesions measured between 10 mm and
20 mm in size and did not produce any mass
effect. Most of patients harbouring these
solitary lesions presented with seizures.
Also, in 1983, Minguetti and Ferriera
alluded to an entity of single acute lesions
measuring less than 20 mm in size, in
patients presenting with seizures29. In 1988,
Mitchell and Crawford described lesions
which were obviously similar to SSECTL, in
children and suggested that these were a
distinctly benign form of NC30. They
labelled these lesions as acute lesions.
More recently, in 1995, Del Brutto referred to
these lesions as single acute encephalitic
245
form and noted that they carried a better

prognosis than other forms of NC31.
Diagnostic criteria for SCG

We evolved a set of diagnostic criteria for an
initial presumptive diagnosis of SCG upon
presentation (Table 24.1)32,33. These criteria
were derived from clinical and CT observations in patients with histologically proven
SCGs and solitary small tuberculomas. The
criteria were evaluated and validated
prospectively and proved to be extremely
reliable in predicting the diagnosis of SCG in
Indian patients with seizures. We studied
401 patients presenting with seizures and an
SSECTL. Of these, 215 fulfilled all the criteria
for the diagnosis of a SCG. A final diagnosis
was considered to have been confirmed in
197; 16 patients were excluded due to inadequate follow-up. A false-positive diagnosis
of SCG was made in only two patients; one
had metastatic disease and the other had
pyogenic abscess. A false-negative diagnosis
was made in one patient with SCG who had
severe oedema causing a midline shift and
therefore underwent excision of the lesion.
All eight solitary tuberculomas in our study
could be clearly distinguished from SCG on
the basis of the diagnostic criteria. Overall
the diagnostic criteria had a sensitivity of
99.5%, specificity of 98.9%, positive predictive value of 99% and negative predictive
value of 99.5%.
Table 24.1. Clinical and computed tomography (CT) criteria for diagnosis of solitary cysticercus
granuloma (SCG).*
A.
1.
2.
3.
4.
B.
1.
2.
3.
4.
Clinical criteria
Clinical presentation with seizures
Absence of any evidence of a progressive neurological deficit
Absence of any features of persistent raised intracranial pressure
No clinical evidence of any systemic disease.
CT criteria
Solitary lesion
The lesion should measure less than 20 mm in maximal dimension
The lesion should enhance after contrast injection
There may or may not be oedema associated with the lesion but it should not be severe enough to
produce a shift of the midline structures.
* All criteria, without exception, must be fulfilled to make a diagnosis of SCG.
246
V. Rajshekhar
Confirming an initial diagnosis of SCG

It is extremely important that all patients
with seizures initially diagnosed to have SCG
on the basis of the above listed diagnostic criteria (Table 24.1) be carefully followed up
clinically and radiologically to confirm the
diagnosis. On clinical follow-up, patients
with SCG do not develop focal neurological
deficits or features of raised intracranial pressure. Confirmation of the diagnosis of SCG is
obtained by any one of the following events:
intense centre. It has a ring-enhancing pattern on gadolinium-enhanced images. MRI

does not provide any advantage over a well
performed (25 mm slice) contrast-enhanced
CT scan. When a good quality CT scan
reveals an SCG, gadolinium-enhanced MRI
is unlikely to reveal additional lesions35.
3. Seizures associated with SCG will respond
to a single AED in nearly 90% of cases34.
4. About 4% of patients with SCG have
lesions that enlarge upon follow-up (enlarging SCG), but even these do not produce fea-
1. Spontaneous resolution (partial or complete) of the lesion: no other pathology,

which causes a clinical-imaging syndrome
similar to that of SCG, is known to resolve
spontaneously (Figs 24.1 and 24.2).
2. Resolution of the lesion following anticysticercal therapy: the resolution of the lesion
should be demonstrated within a short period
of completion of anticysticercal therapy.
3. Adverse effects (seizures, headache, vomiting) occurring following the administration
of anticysticercal drugs: the adverse effects
are incidental to the rapid destruction of the
parasite by the drugs and the host response
to the parasitic antigens thus released.
4. Pathological diagnosis of cysticercus or
parasitic granuloma in an excised lesion.
This method of confirming the diagnosis is
uncommon, as most patients with SCG will
not undergo surgical excision.
Further studies on the behaviour and

management of SCG
Since our early studies on the pathology of
SSECTL, we have studied various other
aspects of its biological behaviour. Our findings are summarized below and elaborated
in a monograph on the subject34.
1. It became evident from a search of the literature that the SCG was not an isolated
regional phenomenon. Although more commonly reported from India, it has been
reported from all over the world15.
2. MRI appearance of an SCG is typically
seen on T2-weighted images where it
appears as a hypointense ring with a hyper-
Fig. 24.2. Initial (a) and follow-up (after 6 months)

(b) contrast-enhanced CT of another patient with
seizures. No specific therapy apart from
antiepileptic drugs was administered to this patient.
tures of raised intracranial pressure or progressive neurological deficit36.

5. Immunological tests, both the ELISA and
EITB, have a poor sensitivity (<50%) in the
diagnosis of SCG24,25.
6. Patients with SCG can have early withdrawal of their AED soon after the resolution
of their CT lesion with only a less than 10%
chance of seizure recurrence (see Chapter 25
for a detailed discussion). This is in contrast
to the high rates of seizure recurrence in
patients with multilesional NC34.
7. The duration of symptoms does not correlate with the presence or absence of the parasite or its parts in an excised granuloma17.
8. Albendazole therapy can hasten the resolution of about a third of the SCG, but about
40% of patients on albendazole therapy will
develop some adverse effect including
headache and/or seizures37,38. Steroid therapy does not appear to prevent these
adverse reactions37.
9. Up to 3% of SCGs may present with
episodic headache alone without any
seizures. This presentation of SCGs should
be recognized, as the clinical situation could
be mistaken for that caused by subarachnoid haemorrhage or acute central nervous
system infection39,40.
247
Conclusions
Based on our study of the disease for over
13 years, we have proposed a management
algorithm for patients with seizures and
SSECTL (Fig. 24.3). Patients with SCG are
managed primarily with symptomatic therapy, consisting of AEDs alone. An immunological test at presentation consisting of
serological assay for cysticercus antibodies
using either the ELISA or EITB may be useful if it is positive. A negative test, however,
does not rule out cysticercosis. Close clinical monitoring focusing on the appearance
of progressive neurological deficit or features of raised intracranial pressure is
mandatory. Either of these should alert the
physician to the possibility of an alternative
diagnosis and prompt an immediate CT
scan and histological verification of the
lesion. If the patient is asymptomatic
except for occasional seizures, a repeat CT
scan is performed only at about 6 months
after initial presentation. A persistent lesion
does not mandate a change in the management strategy except for a possible trail of
anticysticercal therapy. Early withdrawal of
AEDs can be undertaken following radiological resolution of the granuloma.
References
1. Bhargava, S., Tandon, P.N. (1980) Intracranial tuberculomas: a CT study. British Journal of Radiology
53, 935945.
2. Tandon, P.N., Bhargava, S. (1985) Effect of medical treatment on intracranial tuberculoma a CT
study. Tubercle 66, 8587.
3. Vengsarkar, U.S., Pisipaty, R.P., Parekh, B., et al. (1986) Intracranial tuberculoma and the CT scan.
4. Wadia, R.S., Makhale, C.N., Kelker, A.N., et al. (1987) Focal epilepsy in India with special reference
to lesions showing ring or disc like enhancement on contrast computed tomography. Journal of
Neurology, Neurosurgery and Psychiatry 50, 12981301.
5. Van Dyk, A. (1988) CT of intracranial tuberculomas with specific reference to the target sign.
6. Kumar, R., Kumar, A., Kohli, N., et al. (1990) Ring or disc like enhancing lesions in partial epilepsy
in India. Journal of the Tropical Pediatrics 36, 131134.
7. Domingo, Z., Peter, J.C. (1989) Intracranial tuberculoma. An assessment of therapeutic 4-drug trial
in children. Pediatric Neurology 15, 161167.
8. Dastur, D.K., Lalitha, V.S., Prabhakar, V. (1968) Pathological analysis of intracranial space occupying
lesions in 1000 cases including children. Journal of the Neurological Sciences 6, 575592.
9. Mathai, K.V., Chandy, J. (1967) Tuberculous infections of the central nervous system. Clinical
248
V. Rajshekhar
Patient with seizures

and SSECTL
Antiepileptic drug(s)
(AED(s))
Clinical monitoring
Serological assay for
cysticercus antibodies
(ELISA/EITB)
Repeat CT scan after 6 months
Lesion disappears/
calcific dot
Lesion same
size/smaller
Lesion larger
> 2 cm
Continue AEDs
Clinical monitoring
Repeat CT scan
after 6 months
Taper AED(s)
over weeks
Albendazole
treatment
Lesion disappears/
calcific dot
Lesion same size/

smaller
Taper AED(s)
Continue AED(s)
Clinical and CT
monitoring
Excisional
biopsy
Lesion larger
> 2 cm
Fig. 24.3. Management algorithm for patients presenting with single, small enhancing CT lesion
(SSECTL).
249
10. Selvapandian, S., Rajshekhar, V., Chandy, M.J., et al. (1994) Predictive value of computed tomography-based diagnosis of intracranial tuberculomas. Neurosurgery 35, 845850.
11. Sethi, K., Kumar, B.R., Madan, V.S., et al. (1985) Appearing and disappearing CT abnormalities and
seizures. Journal of Neurology, Neurosurgery and Psychiatry 48, 866869.
12. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single small enhancing CT lesions in Indian
patients with epilepsy: clinical, radiological and pathological considerations. Journal of Neurology,
13. Chandy, M.J., Rajshekhar, V., Prakash, S., et al. (1989) Cysticercosis causing single small CT lesions in
Indian patients with epilepsy. Lancet i, 390391 (Letter).
14. Goulatia, R.K., Verma, A., Mishra, N.K., et al. (1987) Disappearing CT lesions in epilepsy. Epilepsia
28, 523527.
15. Rajshekhar, V. (1991) Etiology and management of single small CT lesions in patients with seizures:
understanding a controversy. Acta Neurologica Scandinavia 84, 465470.
16. Chandy, M.J., Rajshekhar, V. (1988) Focal epilepsy in India. Journal of Neurology, Neurosurgery and
Psychiatry 51, 1234 (Letter).
17. Rajshekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlations
in patients with solitary cysticercus granuloma and epilepsy: focus on presence of parasite and
oedema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284286.
18. Rajshekhar, V., Chandy, M.J. (1992) Solitary small CT lesions in patients with epilepsy: outstanding
issues and further observations. Progress in Clinical Neurosciences 8, 106110.
19. Rajeswari, R., Sivasubramanian, S., Balambal, R., et al. (1995) A controlled clinical trial of shortcourse chemotherapy for tuberculomas of the brain. Tubercle and Lung Diseases 76, 311317.
20. Kramer, L.D., Locke, G.E., Byrd, S.E., et al. (1989) Cerebral cysticercosis: documentation of natural
history with CT. Radiology 171, 459462.
21. McCormick, G.F., Zee, C., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of
22. Miller, B., Grinell, V., Goldberg, M.A., et al. (1983) Spontaneous radiographic disappearance of cerebral cysticercosis. Three cases. Neurology 33, 13771379.
24. Rajshekhar, V., Oommen, A. (1997) Serological studies using ELISA and EITB in patients with solitary cysticercus granuloma and seizures. Neurological Infections and Epidemiology 2, 177180.
25. Singh, G., Kaushal, V., Ram, S., et al. (1999) Cysticercus immunoblot assay in patients with single,
small enhancing lesions and multilesional neurocysticercosis. Journal of the Association of Physicians of
India 47, 476479.
26. Mervis, B., Lotz, J.W. (1980) Computed tomography in parenchymal cerebral cysticercosis. Clinical
Radiology 31, 521528.
27. Zee, C.S., Segall, H.D., Miller, C., et al. (1980) Unusual neuroradiological features of intracranial cysticercosis. Radiology 137, 397407.
28. Byrd, S.E., Locke, G.E., Biggers, S., et al. (1982) The computed tomographic appearance of cerebral
cysticercosis in adults and children. Radiology 144, 819823.
29. Minguetti, G., Ferriera, M.V.C. (1983) Computed tomography in neurocysticercosis. Journal of
31. Del Brutto, O.H. (1995) Single parenchymal brain cysticercus in the acute encephalitic phase: definition of a distinct form of neurocysticercosis with a benign prognosis. Journal of Neurology,
32. Rajshekhar, V., Haran, R.P., Prakash, S., et al. (1993) Differentiating solitary small cysticercus granulomas and tuberculomas in patients presenting with epilepsy: clinical and computerized tomographic criteria. Journal of Neurosurgery 78, 402407.
33. Rajshekhar, V., Chandy, M.J. (1997) Validation of diagnostic criteria for solitary cerebral cysticercus
granuloma in patients presenting with seizures. Acta Neurologica Scandinavia 96, 7681.
250
V. Rajshekhar
34. Rajshekhar, V., Chandy, M.J. (2000) Solitary Cysticercus Granuloma: the Disappearing Lesion. Orient
Longman, Chennai, India.
35. Rajshekhar, V., Chandy, M.J. (1996) A comparative study of contrast computerized tomography and
magnetic resonance imaging in patients with solitary cysticercus granulomas and seizures.
36. Rajshekhar, V., Chandy, M.J. (1994) Enlarging solitary cysticercus granulomas. Journal of
37. Rajshekhar, V. (1993) Albendazole therapy for persistent, solitary cysticercus granulomas in patients
with seizures. Neurology 43, 12381240.
38. Rajshekhar, V. (1998) Incidence and significance of adverse effects of albendazole therapy in patients
with a persistent solitary cysticercus granuloma. Acta Neurologica Scandinavia 98, 121123.
39. Rajshekhar, V. (2000) Severe episodic headache as the sole ictal presentation of solitary cysticercus
granuloma. Acta Neurologica Scandinavia 102, 4446.
40. Garg, R.K., Kar, A.M. (1997) Episodic headache in a non-epileptic patients having disappearing single (ring enhancing) CT lesion. Neurology India 45, 110111.
25
Seizures Due to Solitary Cysticercus

Granuloma
J.M.K. Murthy
Introduction
A single enhancing computed tomography
(CT) lesion measuring less than 20 mm is a
common finding upon CT of the brain of
patients with seizures in the developing
countries where Taenia solium cysticercosis is
prevalent1,2. This lesion represents a solitary
cysticercus granuloma (SCG) in the acute
encephalitic phase3,4. Epileptic seizures are
by far the most common clinical manifestation of the latter. Seizures are incidental to
the inflammatory response of the brain and
can be categorized as acute symptomatic
(provoked) seizures (see Chapter 21)1,5.
While there is an over-abundance of
reports of patients with solitary cysticercus
granuloma (SCG) from India, these lesions
have been reported from all over the world1,6.
The exact prevalence of this lesion in the community has not been studied. Most reports are
those of hospital-based series1. In a hospitalbased study from South India, this lesion was
the cause of 26% of symptomatic localizationrelated seizures7. In the regions where neurocysticercosis (NC) is prevalent, the probability
of a patient with epileptic seizures, with no
other obvious cause, harbouring this lesion
would be very high. In a study from South
India, this probability was as high as 39%
(95%CI: 3543%)8. This lesion was the cause of
50% of acute symptomatic seizures9.
SCG is one of the commonest forms of

NC. Its true incidence in comparison to other
forms of NC is not clear. In the hospitalbased studies the reported frequency of solitary cyst (either granuloma alone, or SCG
and solitary live cysts taken together) varied
between 3.5% and 43%2. In the Ecuadorian
study, this lesion represented the single most
common form of presentation of NC,
accounting for 23% of the cases3.
In human brain parenchyma, the larval
form of T. solium undergoes four stages of
evolution: vesicular, colloidal, granularnodular, and calcific10. The term cysticercus
granuloma is used broadly to refer to parasites in the colloidal stage or the granularnodular stage. Colloidal cysticerci are dying
(not dead) parasites, and not all the colloidal
cysticerci die as a result of the host immunological attack. On the other hand, granular
cysticerci are dead parasites. Histological
evaluation of SCGs seems to span the entire
spectrum of pathological process that results
from the natural evolution of the parasite
(see Chapter 31). Pathological studies of unselected SCGs revealed three types of pathology: (i) cavitary lesions containing parts of
an intact or degenerated cysticercus; (ii)
inflammatory cavitary lesions without the
parasite; and (iii) a non-cavitary hyalinized
fibrous nodule with inflammation4,11.
Seizures associated with SCG are consequent

251
252
J.M.K. Murthy
upon the inflammatory response of the

brain. The slow degeneration of the cyst
probably acts as a constant source of antigen
to induce the host immune response and
may be an important factor responsible for
recurrence of seizures5.
Solitary Cysticercus Granuloma and

Seizures
Seizures may be isolated or recurrent and
may occur in clusters. The reported frequency of isolated seizures varies from
17.6% and 65%5,12,13 and that of a seizure
cluster varies between 20% and 80%5,14,15.
After the initial seizure, patients may not
experience more attacks for several weeks to
months, and at times for several years, only
to have a recurrence later. Breakthrough
seizures, i.e. seizures that occur after
antiepileptic drug (AED) treatment has
begun but before achieving remission, are
common in patients with SCG13,16. In the
authors series, 37% of patients had breakthrough seizures5. Rarely, status epilepticus
can be the presenting feature; its reported
incidence in different series varied between
0.07% and 13%5,17,18. Seizures can be of any
type. Simple or complex partial seizures with
or without secondary generalization are
most common and have been reported in
7088% of patients5,14,16,19. Often these
patients present with partial onset or generalized tonicclonic motor seizures with no
localization. Seizure semiology depends on
the anatomical location of the lesion.
Discordance between clinical localization
based on seizure semiology and location of
the lesion on neuroimaging is not uncommon. Patients with SCG may exhibit some
postictal neurological deficit lasting for few
minutes or even weeks.
When to suspect a diagnosis of SCG

Patients with SCG present with partial or
unlocalized tonicclonic seizures with no
obvious cause. Seizure clusters at presentation
or during the course of illness occur in a significant proportion of patients. In the regions
where SCG is prevalent, the diagnostic predictive value of seizure clusters seems to be very
high. In our study, the probability of a patient
with seizure clusters at the initial presentation
or during the course, harbouring this lesion
was 88% (J.M.K. Murthy, Hyderabad, unpublished data). Clinical and radiological criteria
for SCG have been reviewed by Rajshekhar in
Chapter 24. These criteria are specific and sensitive. They have been validated in a prospective study involving 401 patients presenting
with seizures and a solitary mass lesion on CT;
of these 215 had SCG. The criteria had a sensitivity of 99.5%, specificity of 98.9%, and positive predictive value of 99% and a negative
predictive value of 99.5%.
Factors that Influence Seizure

Outcome
Natural course
The natural history of the SCG can take one
of two courses: (i) it resolves entirely or (ii) it
leaves a punctate calcification as residue. The
duration or time of resolution of the lesion is
quite variable, from a few weeks to more
than a year20,21. A recent long-term follow-up
study of the natural history of the CT lesion
in patients with SCG suggests that within 6
months of initial presentation over 70% of
lesions would show some degree of resolution and 54% of lesions would resolve completely22. The authors experience, based on
the interval between initial presentation and
resolution of the CT lesion, suggests that
these lesions can be divided into two types:
(i) rapid resolvers, lesions that resolve
within few weeks to months, and (ii) persisters, lesions that resolve over several
months to years. Symptoms in patients with
persistent lesions are often phasic. Seizures
may cease for several months or years, but
recur later. No characteristic CT or magnetic
resonance imaging (MRI) morphological features distinguish between the two types of
lesions. In the authors study, a demonstrable mural nodule on CT was associated with
high rates of seizure recurrence and longer
disease duration23. Histological studies corroborate that the mural nodule on CT or MRI
Seizures Due to Solitary Cysticercus Granuloma
corresponds to the scolex and is a pathognomic sign of active cysticercosis24,25. It is

possible that some of the lesions with this CT
morphology may take several months to
degenerate. The presence of a slowly degenerating cyst presumably acts as a constant
source of antigen to induce host inflammatory reaction and may be responsible for the
phasic nature of the symptoms.
Single small cerebral calcific CT lesion

CT in individuals with a seizure disorder
may also reveal a single small calcific lesion
with or without contrast enhancement and
with or without surrounding oedema. It is
commonly believed that these lesions represent sequelae of SCG. In a study of the natural history of SCG (V. Rajashekhar, Vellore,
personal communication), punctuate calcification was seen as a residue in 22% of
patients with SCG. This lesion was seen in
0.65% of brain CT scans of patients with nonseizure disorders from North India26. In a
hospital-based study from South India, this
lesion was the putative aetiology in 9% of
patients with localization related epilepsy23.
In the authors experience, a lesion is more
likely to become calcified when the lesion
persists for a long time and when there is a
demonstrable scolex on CT. However, this
needs to be established in prospective follow-up studies.
Epileptic seizures associated with single
small cerebral calcific CT lesion can be of any
type; often these patients present with simple
or complex partial seizures, with or without
secondary generalization or generalized
tonicclonic seizures. History of previous
unprovoked seizure may be noted in about
20% of patients. Neurological examination is
usually normal. Discordance between clinical
localization based on seizure semiology and
location of the lesion on neuroimaging may
be observed23,26. In our study the reported
ictal semiology was clearly distinctive and
allowed the seizure to be localized to the site
of the calcific lesion on CT scan in only 26%
of the patients23.
Seizure remission rates in individuals
with a single calcific lesion are similar to
253
those for any other remote symptomatic

epilepsy. Of the 97 patients followed by
Murthy and Reddy23, for 7 years, 71.5%
(95%CI 53.785.4%) of patients achieved a 3year seizure remission and 66% (95%CI
32.488.2%) achieved a 5-year remission.
Patients had a high rate of breakthrough
seizures before remission and a high rate of
relapse following the withdrawal of AEDs.
Seizure relapse can be immediate or after several months to years. It appears these patients
require AEDs for long periods of time.
Treatment
Treatment of patients with SCG is primarily
symptomatic and consists of treating
seizures. Use of anticysticercal drugs and
corticosteroids is debatable.
Antiepileptic drugs
Patients with SCG and epileptic seizures
should be treated with AEDs for two reasons: (i) seizures are likely to recur as long as
the lesion persists; and (ii) the time period
for the resolution of the CT lesion is quite
variable. A characteristic feature of patients
with SCG is the occurrence of breakthrough
seizures in a significant proportion of
patients. Most often, good seizure control
can be achieved with a single conventional
AED (monotherapy)5. As seizures are commonly partial with or without secondary
generalization, either carbamezapine or
phenytoin is the drug of choice.
Acute symptomatic seizures due to SCG
are often self-limiting and do not require
long-term AED therapy. The latter can be
discontinued once the underlying lesion disappears. The time duration of AED therapy
in patients with seizures associated with
SCG has not been settled. This is partly
related to the risk of seizure recurrence with
persistence of lesion and the variable time
duration for spontaneous resolution5. The
time period for resolution of the lesion may
vary from a few weeks to more than a year,
some times several years1,22. In the authors
series, in one patient who was treated symp-
254
J.M.K. Murthy
tomatically with AED(s) alone, the lesion

persisted for 73 months5. Most clinicians
treat seizures associated with SCG for a
23 year seizure-free period just as they
would treat any other type of epilepsy27.
Our long-term follow-up study has shown
that seizures associated with SCG have a
good prognosis and AED can safely be withdrawn after resolution of the CT lesion5. The
mean period of follow-up was 45 months
(range 19101 months) and only one patient
who had CT-demonstrable scar had recurrence of seizures. However, a recent study
suggested that gliosis visible on magnetization-transfer spin-echo MRI, 2 years after
initial presentation, was positively correlated with the risk of seizure recurrence. The
authors argued that such patients should be
treated with AEDs for long periods28. Our
present policy is to treat patients with SCG
with AEDs until such time their CT lesions
resolve. Patients in whom follow-up CT
scan shows calcification or gliotic scars
should be treated as for any remote symptomatic epilepsy. In our series, recurrence of
seizures occurred following AED withdrawal in two patients who had a gliotic
scar demonstrable on CT.
Anticysticercal drug therapy

The role of anticysticercal drug therapy in
patients with SCG is not clear. The argument against anticysticercal therapy is that
seizures associated with this lesion are
because of the inflammatory response of the
brain and the lesions are known to resolve
spontaneously1. However, earlier reports
suggested that anticysticercal therapy influenced the management of patients with
SCG in several ways. In a few studies, anticysticercal therapy was shown to benefit
most patients with persistent seizures by
hastening resolution of the lesion5,27,29.
Anticysticercal therapy given with AEDs has
been shown to provide better control of
seizures29,30. The chance of remaining
seizure-free after the withdrawal of AEDs
seems to be higher in patients with NC who
were previously treated with albendazole31.
These findings provide a rationale for the
use of anticysticercal drugs. However, the

results of the two double-blind randomized,
placebo-controlled studies using albendazole
are contradictory. One study involving 75
adult patients did not show any benefit32,
whereas another study involving 63 children
revealed that anticysticercal therapy hastened resolution of the SCG33. In the authors
opinion, some parasites may involute
rapidly over a period of weeks to few
months (rapid resolvers), while others involute over a period of several months to years
(persisters). Anticysticercal drug trials will
be negative if the study mostly involves
rapid resolvers. The real efficacy of anticysticercal therapy can only be tested in patients
with lesions that persist for several months
to years (persisters). In an open-label study
of 43 patients with lesions that persisted
beyond 3 months, a response to albendazole
was seen in 20 (46.5%) patients27. We did a
retrospective analysis of efficacy of albendazole on the seizure-control profile. The baseline demographic characteristics of patients
who did not receive albendazole and who
did receive albendazole were similar. Clearly,
albendazole produced benefits in terms of
seizure-control profile in patients with persistent lesions even after 6 months of symptomatic treatment with AEDs (J.M.K.
Murthy, Hyderabad, unpublished data). Our
data also suggest that there is probably a role
for anticysticercal therapy in patients with
SCG with a visible scolex. Lesions with this
CT morphology are likely to take longer to
resolve and are associated with high seizure
frequency5. The reader is referred to Chapter
38 for a detailed discussion on the role of
anticysticercal therapy in NC.
Seizure Outcome and Prognosis

Seizure outcome is good in patients with
SCG. Breakthrough seizures before remission
are common. Breakthrough seizures were
seen in 37% of patients in the authors series5
and in 14.5% in the series of patients studied
by Rajashekhar and Chandy22. A recent longterm follow-up study suggests that epileptic
seizures associated with SCG recur as long
as the lesion persists; and AEDs can safely be
Seizures Due to Solitary Cysticercus Granuloma
withdrawn once the follow-up CT scan

shows resolution of the lesion5. However,
patients with calcific lesions should be
treated as for any type of remote symptomatic epilepsy. It appears that patients with
calcific lesions need AEDs for a long time
and seizure relapse rates after drug withdrawal are very high.
Conclusions
A single enhancing CT lesion measuring less
than 20 mm is a common CT finding in
patients with seizures in countries where
NC is endemic. Pathological studies suggest
that most of these lesions represent SCG.
255
Seizures are the most common manifestation

of SCG. Patients with this lesion develop
seizures because of the inflammatory
response of the brain and their seizures may
be categorized as acute symptomatic
seizures. The natural history of SCG can
usually take one of two forms: (i) it resolves
entirely or (ii) a punctate calcification may
be left as a residue. Seizure outcome is good
even when patients are treated with AEDs
alone. Long-term follow-up studies suggest
that epileptic seizures associated with SCG
can recur as long as the lesion persists; and
AEDs can safely be withdrawn once the follow-up CT scan demonstrates resolution of
the lesion. The role of anticysticercal therapy
is not clear.
References
1. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a clinical review. Epilepsia
39, 10251040.
2. Rajashekhar, V., Chandy, M.J. (2000) Incidence of solitary cysticercus granuloma. In: Rajashekar, V.,
Chandy, M.J., (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India, pp. 1228.
4. Rajashekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlation
in patients with solitary cysticercus granuloma and epilepsy: focus on presence of the parasite and
edema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284286.
5. Murthy, J.M.K., Reddy, Y.V.S. (1998) Prognosis of epilepsy associated with single CT enhancing
lesion: a long-term follow-up study. Journal of the Neurological Sciences 169,151155.
6. Rajashekhar, V. (1991) Etiology and management of single small CT lesions in patients with
seizures: understanding a controversy. Acta Neurologica Scandinavia 144, 819823.
7. Murthy, J.M.K., Yangala, R. (1998) Etiological spectrum of symptomatic localization related epilepsies: a study from South India. Journal of the Neurological Sciences 158, 6570.
8. Murthy, J.M.K., Yangala, R., Mantha, S. (1998) The syndromic classification of the International
League Against Epilepsy: a hospital based study from south India. Epilepsia 40, 4854.
9. Murthy, J.M.K., Yangala, R. (1999) Acute symptomatic seizures incidence and etiological spectrum:
a hospital-based study from south India. Seizure 8, 162167.
10. Escobar, A. (1993) The pathology of neurocyticercosis. In: Palacios, E., Rodriguez-Carbajal, J. (eds)
Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield, Illinois, pp. 2754.
11. Chacko, G., Rajashekhar, V., Chandy, M.J., et al. (2000) The calcified intracorporeal vacuole: an aid to
the pathological diagnosis of solitary cerebral cysticercus granuloma. Journal of Neurology,
12. Bhatia, S., Tandon, P.N. (1988) Solitary microlesions in CT: a clinical study and follow-up.
Neurology India 36, 139150.
13. Srinivas, H.V. (1992) Disappearing CT lesions clinical features. Tropical and Geographic Medicine 2,
8891.
14. Wadia, R.S., Makhale, C.N., Kelkar, A.V., et al. (1987) Focal epilepsy in India with special reference to
lesions showing ring or disc-like enhancement on contrast computed tomography. Journal of
15. Sethi, P.P., Wadia, R.S., Kiyawat, D.P., et al. (1994) Ring or disc enhancing lesions in epilepsy in India.
256
J.M.K. Murthy
16. Rajashekhar, V., Chandy, M.J. (2000) Clinical manifestations of solitary cysticercus granuloma. In:
Rajashekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India,
pp. 2939.
17. Gulatia, R.K., Verma, A.K., Mishra, N.K., et al. (1987) Disappearing lesions in epilepsy. Epilepsia 28,
523527.
18. Rajashekhar, V. (1999) Epilepsy associated with a solitary cysticercus granuloma. In: Murthy, J.M.K.
(ed.) Epilepsy: the Indian Perspective. Care Foundation, Hyderabad, India, pp. 82106.
19. Chopra, J.S., Sawhney, I.M.S., Suresh, N., et al. (1992) Vanishing CT lesion in epilepsy. Journal of the
Neurological Sciences 107, 4049.
20. Byrd, S.E., Locke, G.E., Biggers, S., et al. (1982) The computed tomography appearance of cerebral
cysticercosis in adults and children. Radiology 144, 819823.
21. Basauri, L., Zuleta, A., Loayza, P. (1983) Olivaces A. Microabscesses and presumptive inflammatory
nodules of the brain. Acta Neurochirurgica (Wein) 68, 2732.
22. Rajashekhar, V., Chandy, M.J. (2000) Outcome in patients with solitary cysticercus granuloma. In:
Rajashekar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India,
pp. 135152.
23. Murthy, J.M.K., Reddy, V.S. (1998) Clinical characteristics, seizure spread patterns, and prognosis of
seizures associated with single small cerebral calcific CT lesion. Seizure 7, 153157.
24. Martinez, H.R., Rangle-Guerra, R.A., Elizondo, G., et al. (1989) MR imaging in neurocysticercosis: a
study of 56 cases. AJNR American Journal of Neuroradiology 10, 10111019.
25. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological
Sciences 130, 2534.
26. Singh, G., Sachdev, M.S., Tirath, A., et al. (2000) Focal cortical-subcortical calcifications and epilepsy
in the Indian sub-continent. Epilepsia 41, 718726.
27. Rajashekhar, V., Chandy, M.J. (2000) Medical management of solitary cysticercus granuloma. In:
Rajashekar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India,
pp. 112134.
29. Del Brutto, O.H., Santibanez, R., Noba, C.A., et al. (1992) Epilepsy due to neruocysticercosis: analysis of 203 patients. Neurology 42, 389392.
30. Del Brutto, O.H. (1994) Prognostic factors for seizure recurrence after withdrawal of antiepileptic
drugs in patients with neurocysticercosis. Neurology 44, 17061709.
31. Del Brutto, O.H. (1993) The use of albendazole in patients with single lesions enhanced on contrast
CT. New England Journal of Medicine 328, 356357.
32. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT ring lesions in epilepsy.
33. Baranwal, A.K., Singhi, P.D., Khandelwal, N., et al. (1998) Albendazole therapy in children with
focal seizures and single small enhancing computerized tomographic lesion: a randomized placebocontrolled, double blind trial. Pediatric Infectious Diseases Journal 17, 696700.
26
Paediatric Neurocysticercosis
Introduction
Even in regions that are endemic for Taenia
solium, childhood neurocysticercosis (NC) is
rare. Nevertheless, NC does occur among
children, raising issues of its exact prevalence
in the paediatric age group, pathogenesis,
clinical manifestations, diagnosis, treatment
and prevention. These issues are confounded
by uncertainty about the modes of transmission of cysticercosis to children. Another
important question that needs to be considered is, do clinical manifestations and laboratory features of NC in the paediatric age
group differ from those in adults? Are there
any neurological manifestations that are
unique to this age group? Finally, are there
special considerations in drug therapy of
paediatric cysticercosis? The authors focus on
some of these issues in the present chapter.
Prevalence of T. solium Infection in

the Paediatric Population
Community-based data
Coproparasitological surveys of children in
developing countries have revealed high
rates of helminthiasis, primarily, intestinal
geohelminths (Ascaris, Trichuris)13. Indeed,
analysis of age-specific prevalence rates of
intestinal geohelminthiasis indicate that the

highest prevalences are recorded in the age
group 1020 years, followed by the age
group of less than 10 years4,5. In contrast,
adult Taenia infections are rare below the age
of 10 years. Rates of infection with Taenia sp.
typically peak from 15 to 40 years of age. The
reasons for these age-specific patterns are not
known but may reflect an overall low frequency of pork consumed during childhood.
Epidemiological data on the seroprevalence of T. solium cysticercosis in the community may often have the limitation of poor
sampling rates from the paediatric population
of that community6,7. Nevertheless, population data from Mexico and Peru indicate that
(EITB)-based seropositivity rates in the paediatric population are lower than the average
prevalence rates for the community and much
lower than age-specific peak prevalence
rates49. For instance, a survey in Peru found
that none of the subjects below 5 years of age
showed positive reactions in the EITB, whilst
6% of those in the age group 610 years were
seropositive as against a mean seroprevalence
of 8% and a peak seroprevalence of 19% in the
age group of over 50 years7. Seropositivity
rates increased dramatically after 5 years of
age, indicating the vulnerability of this age
group to environmental T. solium exposure in
contrast to the relatively protected environ-

257
258
ment of children below 5 years. One study,

however, from Honduras found a higher
seropositivity rate in the 09 years age group
(18%) in comparison to average seropositvity
(16.6%)10. Here, children accounted for 28.75%
of the seropositives in the community.
Differences in age-specific seroprevalence rates
were however, not statistically significant.
Interestingly, when computed tomography
(CT) scans were performed on the subjects,
two of 21 (9.5%) in the age group 09 years as
opposed to five of 14 (35.7%) in the age group
4049 years were found to have lesions compatible with NC (Ana L. Sanchez, Ontario,
Canada, personal communication). These data
indicate that, while NC was less common in
the paediatric population, exposure to T. solium
began at a very early age in the study village.
Hospital-based data
Seropositive cases merely indicate exposure
to T. solium and do not necessarily imply clinical NC and, therefore, do not provide an estimate of the neurological morbidity due to
paediatric cysticercosis. The results of a study
of neurological outpatients with seizures in
Lima are of interest in this regard11. In this
clinic-based population, 8% of patients with
seizures, who were above 20 years, were
seropositive in comparison to 2% seropositives among those below 20 years. These data,
in common with population data indicate that
both exposure to T. solium and clinical NC are
uncommon below the age of 20 years.
A number of published, hospital-based,
large series of NC have either not included
paediatric cases or not described the age
structure of their cohorts1214. For those
series, where breakdown according to age is
available, data indicate that the frequency of
NC below the age of 15 years is about onetenth as its frequency above that age15,16.
Modalities of Transmission Among

Children
Taenia solium cysticercosis has a long incubation period; it may be as long as 5 years.
Therefore, even if exposure to T. solium
occurred very early in life, cysticercosis

would not manifest clinically until after 6
years of age. In most series of paediatric NC,
the average age of presentation was around
8 years1731. However, NC has been reported
to manifest as early as 14 months of age32.
Those cases that occur during later childhood probably represent acquisition of T.
solium through food. Cases of cysticercosis
during early childhood probably represent
infections acquired through caregivers,
including those within the family as well as
housekeepers and food handlers that are
employed within the household33. The possibility of transplacental transmission has been
considered but never proven.
Since children are often restricted to the
confines of a well-protected home environment, their chances of exposure to T. solium
are less in comparison to adults, who may
also be exposed through food and water outside their homes. It becomes all the more
important, therefore, to screen household
family, caregivers and food handlers, in contact with children with NC, for adult and larval T. solium infection. Indeed, a survey of 51
household family contacts of 20 children with
a solitary cysticercus granuloma showed that
14 (27%) had serological evidence of exposure to T. solium34. Among the seropositive
contacts, a history of seizures was obtained in
five. Imaging revealed evidence of active or
inactive NC in four. These data underscore
the importance of screening household family contacts of children with NC.
Clinical Manifestations
A few of the earlier studies of cysticercosis in
children suggested that whilst cysticercosis
was rare among children, its manifestations
were more severe. In one of the earliest
reports of paediatric NC, Robles (1945) portrayed that the outcome in paediatric NC
was far more serious than adults35. Some 16
years later, however, Dixon and Lipscomb
disagreed36: In the present series then there
were no deaths among patients certainly or
probably infected in childhood, and only one
case of severe disablement The findings
suggest a prognosis far less gloomy.
Some authors consider that more severe

forms of NC, including cysticercotic
encephalitis, are common in children3739. It is
not clear whether the latter condition represents a true age-dependent predisposition or
a bias in case collection. A geographical bias
however does exist in the pattern of clinical
presentations of paediatric NC. Thus, reports
of paediatric NC from developed countries
like United States emphasize benign, self-limiting single lesions1720. These lesions disappear in 612 months, and do not require any
specific therapy apart from antiepileptic
drugs for about 12 years. Patients with these
lesions present to the emergency department
with acute non-febrile seizures and have
been reported in several states of the United
States21. In comparison, reports of paediatric
NC from endemic regions such as Latin
America have emphasized the occurrence of
features of intracranial hypertension in addition to seizures2225. These are patients who
have either multiple parenchymal cysts or
intraventricular or subarachnoid NC.
Intracranial hypertension has been reported
consistently as the second most common
manifestation of NC in reports from Latin
America2225. It may be conjectured that the
former benign presentations arise out of
brief, limited exposure to T. solium, while the
later, more grave presentations in endemic
regions are the result of more severe or
repeated exposure to T. solium. Even in India,
several of the earlier reports emphasized the
occurrence of more severe presentations of
intracranial hypertension and meningoencephalitis2628. More recent reports however,
have described the common single, benign
self-limiting colloidal-granular NC very commonly in childhood29,30.
In general, the common manifestations of
childhood NC include seizures, headaches
and focal neurological deficits. There is however no consensus of opinion regarding the
role of NC as an aetiology in developmental
delay, cerebral palsy, learning disability,
developmental regression and behavioural
disorders in children in areas where T. solium
is endemic. Understandably, these disorders
would be expected to occur only in the more
severe cysticercotic syndromes such as cysticercotic hydrocephalus. A few authors have
described the occurrence of mental retarda-
259
tion, hyperkinetic behaviour and cerebral

palsy in children with definite NC31,39.
However, to date, there has been no systematic study using contemporary tools of assessment of these neurological abnormalities in
children with either active or inactive NC.
There is however, anecdotal mention of agespecific neurological syndromes in children
with NC. Otero et al. described the occurrence
of LandauKleffners syndrome in a patient
with NC in the left Sylvian fissure40. Similarly,
Morales et al. described the occurrence of
LennoxGastaut syndrome in a patient with
NC with hydrocephalus31. Both cases, though
extremely rare, could represent age-related
expressions of a severe non-specific neurological insult, in these cases, NC.
Investigations
Radiology, including CT and magnetic resonance imaging (MRI), is most often
employed for establishing a diagnosis of NC.
The diagnosis is further supported by ancillary tests such as eosinophil counts, stool
examinations for Taenia sp. ova, soft tissue
roentgenograms, cerebrospinal fluid (CSF)
studies and serological studies (both, EITB in
serum and ELISA in CSF).
There is no evidence to suggest that the
pattern or intensity of antibody responses in
paediatric cases with NC are any different
from those seen in adults. One confounding
issue in clinical as well as community-based
settings could be the presence of maternally
transferred antibodies in children, for it has
been demonstrated that children born to
EITB-positive mothers are seropositive
(Hector H. Garca, Lima, Peru, personal
communication). However, given the low
reproductive rate in humans it is unlikely
that this could be a major source of error in
population studies.
A serological study based on ELISA indicated that serological responses were weaker
in children with malnutrition in comparison to
nutritionally healthy children41. This has not
been observed in several of the recent EITBbased studies from Latin America. However,
the effect of nutrition on the antibody status
may be an issue in many developing countries
where malnutrition is common.
260
Treatment
Specific treatment of NC consists of the drugs
praziquantel and albendazole. Both drugs are
safe and effective in children above 1 year of
age. The safety of praziquantel below 1 year
of age has not been demonstrated.
Praziquantel is administered in a dose of
50100 mg kg1 day1 in three divided doses
for 4 weeks. Albendazole has a shorter halflife in children42. The drug may be given in
three divided doses. The dose is 15 mg kg1
day1 for 4 weeks. The shorter duration of
treatment, for instance, a 1-week course has
not been used in children43,44.
It is imperative that children presenting to
the Emergency Room with new-onset
seizures should be subjected to a CT scan in
regions where NC is known to occur. In the
event that CT reveals single or more enhancing lesions suggestive of NC, an antiepileptic
drug with rapid onset of action should be
instituted with a view to prevent seizure
recurrence. Phenytoin sodium is a good
choice, because serum levels for effective
anticonvulsant action are achievable with the
administration of oral or intravenous loading doses (1520 mg kg1). The drug is
administered at the rate of 50 mg min1 by
the intravenous route under electrocardiographic guidance. Following loading, oral
maintenance doses (5 mg kg1 day1) are
advised till the disappearance of the acute
encephalitic lesion(s), usually, 612 months.
Since long-term administration is often not
necessary, some of the side effects of longer
durations of administration of phenytoin
may not be an issue. Close monitoring for
anticonvulsant hypersensitivity syndrome

and acute, subacute or chronic CNS toxicity
is, however, mandatory. Fosphenytoin is not
currently available in many countries where
T. solium is endemic. Other antiepileptic
drugs, such as carbamazepine and clobazam
may also be used.
Corticosteroids, mannitol and furosemide
are used for the control of intracranial hypertension, if present. Surgery is rarely indicated.
Finally, screening of adults and children
within the household environment for adult
and larval T. solium infection is crucial for the
control of transmission of the parasite.
Conclusions
Analysis of data from community and
clinic-based paediatric populations indicate
that both NC and adult T. solium infections
are relatively uncommon in childhood.
Nevertheless, NC does occur during childhood. Recent data indicate that the majority
of the cases of paediatric NC are those of a
single involuting cysticercus type, that
resolves spontaneously over a few months.
However, in highly endemic regions, complicated clinical pictures might be noted. Even
in highly endemic regions, most cases are of
the benign self-limiting variety that does not
require any treatment apart from symptomatic seizure prophylaxis. Screening of
household family contacts and caregivers is
all the more important in the case of children
with NC, because they are likely to have
acquired the infection from within the protected environment of their homes.
References
1. World Health Organization. (1987) Prevention and control of intestinal parasitic infections. World
Health Organization Technical Report Series No. 749, 186.
2. Kang, G., Mathew, M.S., Rajan, D.P., et al. (1998) Prevalence of intestinal parasites in rural southern
Indians. Tropical Medicine and International Health 3, 7075.
3. Sugunan, A.P., Murhekar, M.V., Sehgal, S.C., et al. (1996) Intestinal parasitic infestation among different population groups of Andaman and Nicobar Islands. Journal of Communicable Diseases 28,
253259.
4. Acha, P.N., Aguilar, F.J. (1964) Studies on cysticercosis in Central America and Panama. American
261
6. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in human and pigs in a village in Morelos, Mexico. American Journal of Tropical
7. Diaz, F., Garca, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in
8. Diaz Camacho, S.P., Aurora, C.R., Ruiz, C., et al. (1991) Epidemiologic study and control of Taenia
solium infections with Praziquantel in a rural village of Mexico. American Journal of Tropical Medicine
9. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations
10. Sanchez, A.L., Lindbck, J., Schantz, P.M., et al. (1999) A population-based case-control study for T.
solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247258.
13. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of
14. Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540544.
15. Scharff, D. (1988) Neurocysticercosis. Two hundred thirty-eight cases from a California hospital.
16. Veerendra Kumar, M. (1986) Clinico-pathological Study of Neurocysticercosis. Thesis. University of
Bangalore, Bangalore, India.
17. Mitchell, W.G. (1997) Pediatric neurocysticercosis in North America. European Neurology 37, 126129.
18. Wendy, G., Mitchell, M.D., Thomas, O., et al. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Pediatrics 82, 7682.
19. Mitchell, W.G. (1999) Neurocysticercosis and acquired cerebral toxoplasmosis in children. Seminars
in Pediatric Neurology 6, 267277.
20. Mitchell, W.G., Snodgrass, S.R. (1985) Intraparenchymal cerebral cysticercosis in children: a benign
prognosis. Pediatric Neurology 1, 151156.
21. Rosenfeld, E.A., Byrd, S.E., Shulman, S.T. (1996) Neurocysticercosis among children in Chicago.
22. Antoniuk, S.A., Bruck, I., Wittig, E., et al. (1991) Neurocysticercosis in childhood. II Computed
tomography of 24 patients according to symptomatic and praziquantel treatment. Arquivos de
23. Bruck, I., Antoniuk, S.A., Wittig, E., et al. (1991) Neurocysticercosis in childhood. I. Clinical and laboratory diagnosis. Arquivos de Neuropsiquiatria 49, 4346.
24. Ferreira, M.S., Costa-Cruz, J.M., Nishioka, S.A., et al. (1994) Neurocysticercosis in Brazilian children:
report of 10 cases. Tropical Medicine and Parasitology 45, 4950.
25. Ruiz-Garcia, M., Gonzalez-Astiazaran, A., Rueda-Franco, F. (1997) Neurocysticercosis in children.
Clinical experience in 122 patients. Childs Nervous System 13, 608612.
26. Kalra, V., Paul, V.K., Marwah, R.K., et al. (1987) Neurocysticercosis in childhood. Transactions of the
Royal Society of Tropical Medicine and Hygiene 81, 371373.
27. Kalra, V., Deorari, A.K., Goulatia, R.K. (1987) Praziquantel therapy in childhood neurocysticercosis.
Indian Pediatrics 24, 10951098.
28. Puri, V., Sharma, D.K., Kumar, S., et al. (1991) Neurocysticercosis in children. Indian Pediatrics 28,
13091317.
focal seizures and single small enhancing computerized tomographic lesions: a randomized,
placebo-controlled, double-blind trial. Pediatric Infectious Diseases Journal 17, 696700.
30. Singhi, P., Ray, M., Singhi, S., et al. (2000) Clinical spectrum of 500 children with neurocysticercosis
and response to albendazole therapy. Journal of Child Neurology 15, 207213.
31. Morales, N.M.O., Agapejev, S., Morales, R.R., et al. (1999) Clinical aspects of neurocysticercosis in
children. Pediatric Neurology 22, 287291.
32. Manreza, M.L.G. (1982) Neurocysticercosis in childhood: clinical aspects and diagnosis. Revista do
Hospital Das Clinicas; Faculdad de Medicina da Universidade de So Paulo (So Paulo) 37, 20062111.
262
33. Schantz, P.M., Moore, A.C., Muoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692695.
34. Singh, G., Ram S., Kaushal V., et al. (2000) Risk of seizures and neurocysticercosis in household family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176,
131135.
35. Robles, C. (1945) Consideraciones acerea de la Cisticercosis cerebral en los ninos. Gaceta Mdica
Mxico 75, 248. (Cited in reference 36.)
Research Council Special Report. Series No. 299. Her Majestys Stationery Office, London, pp.158.
37. Rangel, R., Torres, B., Del Brutto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young
38. Del Brutto, O.H., Garcia, E., Talamas, O., et al. (1988) Sex-related severity of inflammation in
parenchymal brain cysticercosis. Archives of Internal Medicine 148, 544547.
39. Lopez-Hernandez, A., Garayzar, C. (1982) Analysis of 89 cases of infantile cerebral cysticercosis. In:
Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives.
40. Otero, E., Cardova, S., Diaz, F., et al. (1989) Acquired epileptic aphasia (the LandauKleffner syndrome) due to neurocysticercosis. Epilepsia 30, 569572.
41. Shasha, W., Pammenter, M.D. (1991) Sero-epidemiological studies of cysticercosis in school children
from two rural areas of Transkei, South Africa. Annals of Tropical Medicine and Parasitology 85,
349355.
42. Jung, H., Sanchez, M., Gonzlez-Astiazaran, A., et al. (1997) Clinical pharmacokinetics of albendazole in children with neurocysticercosis. American Journal of Therapeutics 4, 2326.
prospective double blind trial comparing 7 versus 14 days of treatment. Neurology 48, 14211427.
44. Del Brutto, O.H., Campos, X., Sanchez, J., et al. (1999) A single-day praziquantel versus 1-week
albendazole for neurocysticercosis. Neurology 52, 7981.
27
Psychiatric Manifestations of
Neurocysticercosis
Orestes V. Forlenza
Introduction
Overview of Clinical Studies
Psychiatric disturbances typically present

in the course of cerebral cysticercosis, both
in association with other neurological syndromes, or as a dominant feature. Such
abnormalities were extensively studied by
neurologists and psychiatrists at the beginning of the 20th century, yielding important
preliminary insights into organic mental
disease. In the second half of the century,
though, the concern on the subject waxed
and waned. Cysticercosis was then
regarded as a dying disease in Western
Europe and North America, where it had
almost completely disappeared as a result
of improvements in sanitation and meat
inspection. Notwithstanding, the prevalence of the tapeworm infection may still be
high among sub-populations of migrants
and ethnic minorities, rendering their
acquaintances or employers exposed to the
risk of faecaloral contamination1,2. It is
important that patients with diagnosed
cerebral cysticercosis be assessed for psychiatric and neuropsychological morbidity,
in addition to standard clinical and neurological procedures. Likewise, neurocysticercosis (NC) should be considered in the
differential diagnosis of atypical presentations of psychiatric cases, especially in
endemic areas.
From historical findings to more recent

studies
Most of the psychiatric knowledge on NC
derives from studies conducted in mental
institutions in the late 1800s and early 1900s,
from which we have inherited detailed
descriptions of the patients psychopathology that in many cases would mimic major
psychiatric syndromes such as schizophrenia
and manic-depressive illness34. The frequency of NC was presumed to be high in
psychiatric hospitals not only due to a causal
relationship between the two conditions, but
also because severely psychotic and
demented patients were prone to become
secondarily infected as a consequence of
poor hygiene and coprophagia.
Several psychiatric syndromes have been
so far attributed to NC. From early classic
papers on this subject, one can identify
descriptions indistinguishable from dementia
praecox, paranoia, neurosyphilis, Korsakoffs
psychosis and dementia56. Chronic delusions and hallucinations, as well as variations
of mood compatible with the diagnoses of
major depression and bipolar disorder were
additionally reported78. Because the aetiology of these cases was seldom established in
life, clinical findings were retrospectively

263
264
O.V. Forlenza
correlated to neuropathological observations

of signs of the parasitic infection. Leukart
(1886), for instance, suggested that cysticerci
located in the ventricles and basal ganglia
were more liable to induce mental abnormalities than cortical lesions9. In the majority of
such cases, neuropsychiatric findings were
compatible with major cognitive impairment,
namely delirium and dementia9. Important
contributions to this field of knowledge have
also been made by clinicians from Brazil,
Chile, Mexico, China and other countries
where prevalence of the disease was high
(Table 27.1). NC has further been claimed to
cause mental illness through an association
with intracranial hypertension, meningitis,
and epilepsy, in which case, mood and perceptual disorders and acute and chronic psychoses have been described58,1016.
In Europe, further interest in the disease

was raised after the evaluation of cysticercosis in 450 British ex-servicemen who had
acquired the disease during military placements in pre-1947 colonial India17. Among
these patients, 39 (8.7%) had mental disorder
as a prominent feature, including cases of
organic deterioration, affective disorders and
schizophrenia. Except for the former cases of
unequivocal organic mental disease, medical
records showed divergence on the aetiological relationship between the psychiatric condition and cysticercosis.
A few recent studies have approached the
psychopathology of patients with NC with
the aid of contemporary psychometric
methodologies. Most of the literature on the
subject that has been published in the last
decade consists of small series of cases
Table 27.1. Prevalence of psychiatric manifestations according to several different studies drawn from
neurological and psychiatric samples. The far right column indicates (whenever available) an estimate of
the frequency of pure psychiatric forms*.
Author/s and
year of publication
Country
Source of
patients
Kchenmeister (1857)4
Brinck and Beca (1936)7
Pupo et al. (1946)8
Arriagada and Corbaln (1961)12
Dixon and Lipscomb (1961)17
Canelas (1962)13
Lima (1966)34
Lefvre et al. (1969)35
Arseni and Cristescu (1972)36
Yingkun et al. (1979)37
Manreza (1982)38
Schenone et al. (1982)39
Takayanagui and Jardim (1983)40
Sotelo et al. (1985)41
Takayanagui (1987)42
Scharf (1988)14
Vianna et al. (1990)43
Tavares Jr (1994)44
Forlenza et al. (1997)26
Germany
Chile
Brazil
Chile
UK
Brazil
Brazil
Brazil
Romania
China
Brazil
Chile
Brazil
Mexico
Brazil
USA
Brazil
Brazil
Brazil
Psychiatry
Psychiatry
Neurology
Neurology
Neurology
Neurology
Neurology
Paediatrics
Neurology
Neurology
Paediatrics
Neurology
Neurology
Neurology
Neurology
Neurology
Neurology
Psychiatry
Neurology
Prevalence of
Pure
Number of
psychiatric
psychiatric
patients manifestations (%) forms* (%)
16
285
145
450
276
355
54
181
158
100
583
500
753
151
238
67
188
38
20
75
20
9.4
8.7
22.8
25
11.1
62
10.1
28
23
11.5
20
11.5
3.4
4.5
5.3
65.8
12.5
0
0
0
0
2
0
0
0
0
0.4
4.7
0
*There is some controversy in the literature regarding the implications of pure psychiatric presentations.
Brinck and Beca described psychiatric syndromes in 12 of their 16 patients; two of them had no other
symptoms attributable to cysticercosis7. Lima emphasized that pure psychiatric forms were cases
without epilepsy, intracranial hypertension and meningitis, thus allowing the presence of minor
neurological symptoms34. Takayanagui and Jardim noted that psychiatric forms were usually associated
with other neurological manifestations although two pure psychiatric cases were reported40.
Data not available.
Psychiatric Manifestations of Neurocysticercosis
drawn from neurological facilities, and case

reports of particularly interesting or intense
psychiatric syndromes1416,18. There is a
paucity of reports of mild psychiatric symptoms such as anxiety and dysthymia, possibly because such minor abnormalities of the
mental state may be overlooked in the general-hospital setting if assessment is carried
out without the aid of standardized psychiatric instruments16,19. In view of that, it has
not been so far possible to ascertain the
prevalence of psychiatric morbidity among
patients with NC. Estimates vary from 3.4 to
75% (Table 27.1), as a result of the varying
sensitivity of diagnostic methods, sampling
bias, and other methodological limitations,
which are perhaps understandable in view
of the clinical and pathological heterogeneity
of the disease.
Brain pathology and mental symptoms

Attempts to classify the different psychiatric
syndromes and relate them to the respective
neurological conditions in which they are
likely to be found have also been made,
although never reaching consensus11. As a
general rule, ventricular cysticercosis and
subarachnoid cysticercosis, which are usually
associated with meningitis and/or intracranial hypertension, may result in more cognitive dysfunction, with attention deficits,
impaired consciousness and delirium20. On
the other hand, patients with parenchymal
cysts and calcifications are prone to experience the neuropsychiatric complications of
epilepsy, intracranial hypertension and
space-occupying lesions. In view of that, ventriculosubarachnoid forms are prone to present with psychomotor agitation, sleepwake
cycle disturbances and other behavioural
symptoms suggestive of acute cognitive dysfunction. Dementia has been associated with
massive and scattered infections of the brain
parenchyma and subacute forms of intraventricular cysticercosis21,22.
On the one hand, it may be acceptable
that lesion location correlates with specific
neuropsychological deficits, on the other, the
same assumption cannot be made towards
psychopathology. Except for the gross
265
dichotomy of parenchymal and ventriculosubarachnoid cysticercosis, there is no possible classification of the disease according to
affected brain areas. Parenchymal cysts may
develop at any locus within the brain,
although there is a strong propensity for
their location at the grey-white matter transition zone tissue23. As a result of such
anatomical heterogeneity, one would need
very large patient samples in order to correlate psychiatric findings and lesion location.
In addition, there is also important variation
in the ability of each individual cyst to
become pathogenic, bearing in mind the long
and unpredictable time lag between the
appearance of cysts in the brain and their
degeneration and calcification17. Most probably, degenerating cysts and the reactive
inflammation within the adjacent nervous
tissue, which are strong determinants of NCinduced epilepsy, may as well be the trigger
of psychiatric symptoms, particularly among
predisposed individuals.
Prevalence of psychiatric disorders

In a cross-sectional study of 38 cases at a neurology outpatient clinic in Brazil, depression
syndromes were the commonest psychiatric
manifestation, as shown by the Present State
Examination and the Schedule for Affective
Disorders and Schizophrenia Lifetime
Version semi-structured interviews2426. Signs
of psychotic disorder were observed in five
patients although none had a clear-cut schizophrenic or manic-depressive presentation.
Only 13 patients (34.2%) were presumed
mentally healthy by the aforementioned psychometric methods. Thirty-two patients were
assessed
by
the
Mini-Mental
State
Examination and the Strub and Blacks
Mental Status Examination27,28. Neuropsychological dysfunction was identified in a
majority of the cases (87.5%), although severe
cognitive abnormalities were less frequent
(15.6%)26. Attention deficits were detected in
all the patients assessed, being probably
influenced by the effect of antiepileptic drugs
(carbamazepine and barbiturates). Anyhow,
59.4% had mild to moderate and 40.6%
severe attention disturbance. Memory and
266
O.V. Forlenza
language were altered in 78% of the patients

and higher cognitive functions in 87.5%.
Other deficits included disorders of praxis
and motor functions (50%). Reading and
writing skills were less frequently affected
(28% and 0.6% of patients, respectively).
However, there was no clear pattern of localization for the neuropsychological dysfunction in the patients.
In spite of the clinical heterogeneity of the
test group, there was a mild correlation
between the occurrence of depression and laboratory signs of active disease (defined by the
presence of parenchymal cysts, not calcifications only, as shown by computed tomography (CT) and magnetic resonance imaging
(MRI) scans, and/or inflammatory cerebrospinal fluid (CSF)) (P = 0.04), and modest
correlation with the occurrence of intracranial
hypertension (P = 0.1). Psychosis also possibly
correlated with intracranial hypertension (P =
0.06) but not with disease activity (P = 0.5). No
association was found between the psychiatric
manifestations and the occurrence of epilepsy
(P = 0.63), even when the epidemiological
group of active epilepsy29 was considered (P =
0.72), nor with the current use of steroids (P =
1). Previous history of depressive disorders
was strongly associated with current depression (P = 0.006) and psychosis (P = 0.04)26.
These findings parallel several other studies
that have addressed the aetiology of organic
mood disorders. Family history of depression
and history of depression before the onset of
the organic disease are regarded as risk factors
for developing depression in cerebrovascular
disease and multiple sclerosis, through greater
biological vulnerability30,31. Disease activity
(which implies diffuse or localized central nervous system inflammation) is temporally
related to organic mood disorders, as shown
in other medical and neurological conditions,
such as systemic lupus erythematosus and
multiple sclerosis32,33.
Treatment
There is a paucity of data regarding psychiatric treatment and outcome in NC. From
the earlier classical papers it was made clear
that patients with psychiatric syndromes
and cysticercosis were candidates for longterm inpatient care, suggesting refractory
disease. In the present-day context, most
patients with NC have chronic depression
and mild or moderately severe brain pathology (few cysts and/or calcifications). In
such cases, psychiatric treatment is very
helpful and should follow the guidelines for
the treatment of other organic mental illnesses. Regarding severe forms of NC, such
as massive infections with intracranial
hypertension, space-occupying parenchymal
lesions, and intraventricular cysts, psychiatric treatment should follow neurological
and neurosurgical procedures. Psychopharmacological treatment should be complementary to neurological care.
Conclusions
The finding of mental abnormalities and
cognitive dysfunction in 65.8% and 87.5%,
respectively, of a cross-section of neurological outpatients with NC is an estimate of
the high prevalence of psychiatric morbidity in such setting. Samples of psychiatric
inpatients might provide a different profile
of psychiatric findings, with more severe or
even specific forms of mental disease, since
psychiatric surveys based on patients from
mental institutions in the first half of the
20th century reported up to 75% of severe
mental disease in association with cysticercosis. Such a high rate might be explained
by a long duration of the untreated organic
disease, since many of the aforementioned
patients had previous evidence of neurological syndromes before psychiatric
admission, according to their medical
records. Thus, it is possible that mental disease represented one of the consequences
of the deteriorating organic illness, in the
absence of effective therapeutic strategies
for the parasitic infection at that time.
Although there is consensus that NC may
be responsible for most of the major psychiatric syndromes and dementia, a particularly interesting finding from the study of
outpatients is the non-specific pattern of
psychiatric morbidity, as well as the greater
incidence of minor psychiatric and neu-
Psychiatric Manifestations of Neurocysticercosis
ropsychological abnormalities. Such manifestations were possibly underestimated by

most of the studies that did not use instruments sensitive enough for an appropriate
assessment, so that only the most dramatic
cases of mental or behavioural abnormali-
267
ties were usually included. Attention and

memory are also affected in a high proportion of patients, which is consistent with
the findings of other authors in the past
and reinforces the role played by NC as an
aetiology of dementia.
References
1. Richards, F., Jr, Schantz, P.M. (1991) Laboratory diagnosis of neurocysticercosis. Clinics in Laboratory
Medicine 11, 10111028.
2. Schantz, P.M., Sarti-Gutierrez, E. (1989) Diagnostic methods and epidemiologic surveillance of
Taenia solium infection. Acta Leidensia 57, 153163.
3. Griesinger, W. (1872) Cysticerken und ihre Diagnose. In: Psychiatrische und Nervenpathologishe
Abhandlungen. Gesammelte Abhandlungen. Verlag von August Hirschwald, Berlin, pp. 399443.
4. Kchenmeister, F. (1857) On Animal and Vegetable Parasites of the Human Body. A Manual of Their
Natural History, Diagnosis and Treatment. The Syndenham Society, London.
5. Tretiakoff, C., Pacheco, E., Silva, A.C. (1924) Contribuio para o estudo da cysticercse cerebral e em
particular das leses cerebraes toxicas distancia nesta affeco. Memrias do Hospcio de Juqueri 1, 3766.
6. Ribas, J.C. (1943) Psicoses por leses cerebrais. Revista de Medicina 27, 3139.
7. Brinck, G., Beca, F. (1936) Contribucin al estudio de la cisticercosis cerebral. Revista Medica de Chile
(Santiago) 64, 348392.
8. Pupo, P.P., Cardoso, W., Reis, J.B., et al. (1946) Sobre a cisticercose enceflica. Estudo clnico, antomo-patolgico, radiolgico e do liquido cfalo-raqueano. Archivos da Assistncia aos Psicopatas de
So Paulo 1011, 3123.
9. Leukart, R. (1886) The Parasites of Man, and The Diseases Which Proceed From Them. A Textbook for
Students and Practitioners. Young J. Pentland, Edinburgh, UK, pp. 488551.
10. Obrador, S. (1948) Clinical aspects of cerebral cisticercosis. Archives of Neurology and Psychiatry
(Chicago) 59, 457468.
11. Bastos, F.O. (1953) Aspectos psiquitricos da neurocisticercose. Revista Paulista de Medicina 43,
162164.
12. Arriagada, C., Corbaln, V. (1961) Clnica de la neurocisticercosis: manifestaciones neuropsiquitricas de la cisticercosis enceflica. Neurocirurgia 19, 232247.
13. Canelas, H.M. (1962) Neurocisticercose: incidncia, diagnstico e formas clnicas. Arquivos de
14. Scharf, D. (1988) Neurocysticercosis: two hundred thirty-eight cases from a California hospital.
15. Signore, R.J., Lahmeyer, H.W. (1988) Acute psychosis in a patient with cerebral cysticercosis.
Psychosomatics 29, 106108.
16. Castaeda, M.A., Torres, P., Crovetto, L., et al. (1993) Nuevos aspectos en la psicopatologia de la cisticercosis cerebral. Revista de Neuro-psiquiatria 56, 315.
17. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an Analysis and Follow-up of 450 Cases. F. Mildner
and Sons, London.
18. Shandera, W.X., White, A.C., Jr, Chen, J.C., et al. (1994) Neurocysticercosis in Houston, Texas. A
report of 112 cases. Medicine 73, 3752.
19. Forlenza, O.V., Vieira, A.H.G., Machado, L.R., et al. (1998) Transtornos depressivos associados neurocisticercose. Prevalncia e correlaes clnicas. Arquivos de Neuropsiquiatria 56, 4552.
20. Gang-Zhi, W., Cun-Jiang, L., Jia-Mei, M., et al. (1988) Cysticercosis of the central nervous system. A
clinical study of 1,400 cases. Chinese Medical Journal 101, 493500.
21. Escobar, A., Aruffo, C., Cruz-Sanchez, F., et al. (1985) Hallazgos neuropatolgicos en la neurocisticercosis. Archivos de Neurobiologa 48, 151156.
22. Wadia, N.H., Desai, S.B., Bhatt, M.B. (1988) Disseminated cysticercosis new observations including
23. Brown, W.J., Voge, M. (1985) Cysticercosis: a modern day plague. Pediatric Clinics of North America
32, 953969.
268
O.V. Forlenza
24. Wing, J.K., Cooper, J.E., Sartorius, N. (1974) The Measurement and Classification of Psychiatric
Symptoms. An Instruction Manual for The Present State Examination and CATEGO Program. Cambridge
University Press, Cambridge, UK.
25. Spitzer, R.L., Endicott, J. Roteiro para distrbios afetivos e esquizofrenia verso para a vida toda
SADS-L, Trad. de Valentim Gentil Filho. So Paulo: Departamento de Psiquiatria da Faculdade de
Medicina da Universidade de So Paulo, 19781979. [Mimeo]. Translated from: Spitzer, R.L.,
Endicott, J. Schedule for Affective Disorders and Schizophrenia (Life-time) SADS-L. 3rd edn. Clinical
Research Branch Collaborative Program on the Psychobiology of Depression, NIMH, Bethesda,
USA. May, 1978 September, 1979.
26. Forlenza, O.V., Vieira, A.H.G., Gouveia, M.F., et al. (1997) Psychiatric morbidity of cerebral cysticercosis: a study of 38 patients from a neurology clinic in So Paulo. Journal of Neurology, Neurosurgery
and Psychiatry 62, 612616.
27. Folstein, M.F., Folstein, S.E., Mchugh, P.R.H. (1975) Mini-Mental State: A practical method for grading the cognitive state of patients for the clinician. Journal of Psychiatric Research 12, 189198.
28. Strub, R., Black, F.W. (1986) Mental Status Examination in Neurology, 2nd edn. FA Davis Company,
Philadelphia, USA.
29. Commission on epidemiology and prognosis of the International League Against Epilepsy (1993)
Guidelines for epidemiological studies on epilepsy. Epilepsia 34, 592596.
30. Brumback, R.A. (1993) Is depression a neurologic disease? Behavioural Neurology 11, 79104.
31. Popkin, M.K., Tucker, G.J. (1992) Secondary and drug-induced mood, anxiety, psychotic, catatonic,
and personality disorders: a review of the literature. Journal of Neuropsychiatry and Clinical
Neuroscience 4, 369385.
32. Miguel, E.C., Pereira, R.M.R., Pereira, C.A.B., et al. (1994) Psychiatric manifestations of systemic
lupus erythematosus: clinical features, symptoms, and signs of central nervous system activity in 43
patients. Medicine 73, 224 232.
33. Moller, A., Wiedemann, G., Rohde, U., et al. (1994) Correlates of cognitive impairment and depressive mood disorders in multiple sclerosis. Acta Psychiatria Scandinavia 89, 117121.
34. Lima, J.G.C. (1966) Cisticercose Enceflica: Aspectos Clnicos. Thesis. Escola Paulista de Medicina,
Federal University of So Paulo, So Paulo, Brasil, pp.131.
35. Lefvre, A.B., Diament, A.J., Valente, M.I. (1969) Distrbios pquicos na neurocisticercose em crianas. Arquivos de Neuropsiquiatria 27, 103108.
36. Arseni, C., Cristescu, A. (1972) Epilepsy due to cerebral cysticercosis. Epilepsia 13, 253258.
cysticercosis: 158 cases. Chinese Medical Journal 92, 770786.
38. Manreza, M.L.G. (1982) Neurocisticercose na infncia: aspectos clnicos e do diagnstico. Revista do
Hospital das Clnicas Faculdade de Medicina da Universidade de So Paulo 37, 206211.
39. Schenone, H., Villarroel, F., Rojas, A., et al. (1982) Epidemiology of human cysticercosis in Latin
America. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge
and Perspectives. Academic Press, New York, pp. 2538.
40. Takayanagui, O.M., Jardim, E. (1983) Aspectos clnicos da neurocisticercose. Anlise de 500 casos.
42. Takayanagui, O.M. (1987) Neurocisticercose. Evoluo Clnico-Laboratorial de 151 Casos. Doctoral
thesis, Faculty of Medicine of Ribeiro Preto, University of So Paulo, Brazil.
43. Vianna, L.G., Macedo, V., Mello, P., et al. (1990) Estudo clnico e laboratorial da neurocisticercose em
Braslia. Revista Brasileira de Neurologia 26, 3540.
44. Tavares, A.R., Jr (1993) Psychiatric disorders in neurocysticercosis. British Journal of Psychiatry 163,
839 (Letter).
28

Ophthalmic Aspects
Atul Kumar and Namrata Sharma
Introduction
The earliest description of a living cysticercus
in the human eye was made by Schott and
Sommering in 18291. Studies by Alfred
Graefe, as early as 18771882, clearly established the role of surgical management in
ocular cysticercosis1. Since then ocular cysticercosis continues to be an important consideration among serious ocular disorders in
several endemic regions of the world, as well
as in other non-endemic areas, owing to
increasing overseas travel and immigration.
Though the literature is replete with sporadic
reports of this diverse condition, consolidated accounts of the disorder are few. This
review intends to familiarize the reader with
the pleiomorphic clinical presentations, diagnostic modalities and available management
options of ocular and orbital cysticercosis.
Epidemiology
Frequency, geographical, age and sex
distribution
Ocular cysticercosis is a rare disease even in
regions endemic for Taenia solium cysticercosis1. Only 111 cases were observed among
153,528 ophthalmic patients, giving a fre-
quency of a little more than seven in 10,000

in South America2. In another hospital study
of all ophthalmic cases from South America,
the frequency was 30 per 100,000 cases3.
Most reports of ocular cysticercosis have
been made from Latin America and India49.
While in a large series reported by Junior, the
youngest patient was 6 years of age and the
oldest was 66, most patients with ocular cysticercosis are in the first four decades of their
life1,10. Thus, Reddy and Reddy reported that
90% of their patients were less than 15 years
of age and Malik et al. reported that 68% of
their patients were in the age group, 1030
years4,5. Kumar et al. observed that the highest frequency was in the age group, 3140
years6. A definite male preponderance has
been noted from India and Mexico2. Most
patients with ocular cysticercosis are from
communities
with
poor
hygiene
standards6,10. Junior noted that almost all his
patients with cysticercosis were labourers or
farm workers with primitive concepts of
hygiene and the majority came from rural
areas1. Similarly, 70% of a series of 33
patients from India were of low socio-economic status based upon an objective rating
scale6. Ocular cysticerci have been found in
association with immune disorders such as
allergic sinusitis, rheumatic fever, erythema
nodosum, asthma and melanoma8.

269
270
A. Kumar and N. Sharma
Localization
Sites of predilection for cysticercosis include
the central nervous system, subcutaneous
tissue, skeletal and cardiac muscle, and
eye10. Ocular involvement has been reported
in 1346% of large series of patients with cysticercosis4,10. In a hospital-based series of 110
cases collected over 10 years, the most common location was the subcutaneous tissue
(24.5%) followed by brain (13.6%) and eye
(12.8%)11. Data from the authors institute
indicate that the most common extraocular
site was the brain (18%)6.
Ocular involvement is typically unilateral
but bilateral involvement has been reported
in cases of disseminated cysticercosis7,12,13.
The left eye may be more commonly
involved in comparison to the right, possibly
because larvae may be preferentially routed
to the left internal carotid artery, which
directly originates from the aorta; however,
this has not been substantially proven14. The
medial side of the eye has been more commonly involved than the lateral side on
account of the anatomic course of the ophthalmic artery which, after giving off lacrimal
branches, runs along the medial side of the
orbit before dividing into terminal branches5.
Cysticerci can lodge in any part of the eye
or its adnexae. They have been reported in the
anterior chamber15,16, adherent to the extraocular muscle17, vitreous cavity18,19, subretinal
space3,20,21 optic nerve head22,23, subconjunctival space4,24,25, lids26 and lacrimal gland27.
Involvement of the lens has been anecdotally
reported4. Cysticerci have also been reported to
migrate within the eye28. Infestation of the ocular adnexae is probably through the anterior
ciliary arteries27. Parasites reach the posterior
segment through the posterior ciliary arteries,
and lodge near the posterior pole and in the
subretinal space20,29. From here, however, they
often pass through a rent in the retina into the
vitreous. A rhegmatogenous retinal detachment may develop or the perforation may be
sealed by an inflammatory reaction, leaving a
choroidoretinal scar30. Rarely, the parasite may
pass from the vitreous, through the pupil, into
the anterior chamber4. Giovannini et al. noted
bilateral gravitational retinal epitheliopathy in
response to a unilaterally located subretinal
cysticercus, suggesting that the parasite triggers a generalized autoimmune process

directed against retinal photoreceptors31.
Localization of the cyst to the optic disc may
occur through the central retinal artery. Two
separate translucent, undulating cysts attached
to and obscuring the underlying optic nerve
head have also been described32.
There has been disparity in the reports
from Latin America and India regarding the
location of the cysts in the eye. In several
large series from the former location, cysticerci were most commonly located in the
vitreous, in contrast to an adnexal location
found by Indian workers1,6,3337. However, in
a more recent report of 33 cases from India,
ocular cysticerci were most frequently
located in the vitreous (50%)6. Further, a
higher incidence of orbital cysticercosis (in 6
out of 33 ophthalmic cases; 18%) was
observed in this series, which was in contrast
to the previous reports. The higher frequency
of detection of intraocular and intraorbital
cysticercis in this series was attributed to the
use of ultrasonographic examination.
Clinical Presentation
Lid and subconjunctival cysticercosis
Involvement of the eyelids presents as a
painless, subcutaneous mass that may
remain unchanged over long periods of
time26. Conjunctival involvement is usually
in the form of subconjunctival cysts (Fig.
28.1); rarely subconjunctival abscess may
occur24,25,38. A case of acute suppurative
dacryoadenitis due to cysticercus cellulosae
is on record27. Spontaneous extrusion of a
subconjunctival or extraocular muscle cyst
has been noted. Subconjunctival presentation
could be a secondary stage in those cases in
which the cyst may have extruded from the
primary extraocular muscle site38.
Extraocular myocysticercosis
Cysticercus of the extraocular muscles presents
with recurrent inflammation, proptosis,
restricted ocular motility and ptosis38. Cardinal
Ophthalmic Aspects of Cysticercosis
Fig. 28.1. Subconjunctival cyst.
manifestations include: (i) restricted motility in

the direction of action of the involved extraocular muscle; (ii) restricted motility in the direction opposite to the involved extraocular
muscle; (iii) recurrent inflammation (myositis)
with conjunctival congestion; and (iv) acquired
blepharoptosis38,39. A cyst of the superior rectus
produces restricted infraduction, and a cyst of
the levator palpebrae superioris results in
acquired ptosis38. Orbital cysticercus may also
present with proptosis40.
Vitreal, subretinal and anterior chamber

cysticercosis
Intraocular cysticercosis may be asymptomatic in the early stages when the parasite is
minute. As the parasite increases in size, it
can cause a gradual, painless, progressive
loss of vision2,10. Patients may describe a
round or irregularly shaped, dark, mobile
mass (intravitreal location) or may experience visual field defects (subretinal or optic
nerve location). An intravitreal cyst may present per se with retinal detachment (Fig.
28.2a) or overlying vitreal reaction (Fig.
271
28.2b). The cyst is usually well tolerated as

long as the larva is alive. However, when the
parasite dies, an intense inflammatory reaction to the toxic products released from the
cyst occurs, and patient may present with a
blind, painful eye2,10. Rarely the presence of
a cysticercus larva in the anterior chamber
may manifest as unilateral iritis41.
The appearance of intravitreal live cysticercosis is unmistakable particularly
when the medium is clear; the translucent,
white cyst with a dense white spot formed
by the invaginated scolex can be easily
recognized4. Its shape and undulating
movements are typical. The scolex with its
suckers and hooks can be seen returning
rapidly to the cyst when exposed to the
light of an indirect ophthalmoscope13.
In early stages, subretinal cysticercosis
can appear as an acute central retinitis with
retinal oedema and subretinal exudates. The
subretinal parasite will eventually develop
into a characteristic cyst3. The macular area
is apparently the preferred site for the subretinal cysticercus to lodge, possibly because
of rich vascularization of this area (Fig.
28.3). The parasite and its movements can be
easily recognized through the thin macular
tissues42. A choroidoretinal scar develops
when the cyst migrates into the vitreous3.
The term, communicating cysticercus
refers to the situation, wherein the main
body of the cyst is located in the vitreous
cavity, while the head remains in the suprachoroidal space (Fig. 28.4ac)43. Peripherally
located subretinal cysts are detected with
difficulty. A yellowish, globular mass with
poorly defined borders may be apparent
and the movement of the parasite can be
obscured. Fluorescein angiography and
ultrasonography have been reported to be
useful in delineating peripherally located
subretinal cysts44. A diagnosis of ocular cysticercosis becomes difficult when the parasite dies and an intraocular inflammatory
response develops6. Marked circumcorneal
injection, keratic precipitates and flare in the
anterior chamber and opacification of the
vitreous similar to other inflammatory conditions are observed33. A cyst in the anterior
chamber, which is rare, can excite uveal
reaction and present as acute iridocyclitis41.
272
Fig. 28.2. Intravitreal cysticercus with retinal detachement (a) and overlying vitreal reaction (b).
Fig. 28.3. Subretinal cysticercus in macular location.
273
Fig. 28.4. Communicating cysticercus. A large (15 disc diameters) spheroid translucent cyst can be seen
in the superotemporal quadrant, attached to, and obscuring the visibilty of the retina (a, b). The dense
white structure within represents the scolex (a). This particular cyst was alive and made undulating
movements, especially on exposure to the strong illumination of the ophthalmoscope. (c) Upon B-mode
ultrasound scan, the posterior wall of the cyst was not distinguishable from the retinoscleral echo, raising
suspicion that the cyst was communicating.
Associated symptoms and signs

Ocular cysticercosis may be associated with
neurological symptoms, such as headache,
seizures, signs of hydrocephalus, or
increased intracranial pressure as a result of
concomitant involvement of the central nervous system. Another indication of systemic

involvement is the presence of multiple
painless, subcutaneous nodules. A history
of tapeworm infection and/or travel to
endemic areas is helpful in establishing the
274
diagnosis. Ocular cysticercosis should be

suspected in an individual who has lived in
an endemic area and who develops uveitis,
leukocoria and/or neurological symptoms.
This diagnosis should also be suspected in
individuals with subconjunctival cysts or
lid nodules.
Differential diagnosis
Hydatid cyst infestation may rarely occur in
the extraocular muscles. The cysts are quite
large in size, the average size being 35 mm,
and can reach up to 10 cm. In children, the
inflammatory response to a dying cysticercus should be differentiated from other
causes of leukocoria, especially retinoblastoma and parasitic infections such as toxocariasis32. In the anterior chamber, the
inflammation may be so severe that it is difficult to differentiate a cyst from a lens dislocated into the anterior chamber16.
Diagnosis
Laboratory and immunologic tests
Laboratory tests are of limited value in diagnosing intraocular cysticercosis. Complete
blood count, serum chemistries and erythrocyte sedimentation rate may all be normal;
eosinophilia is uncommon. Repeated stool
samples may not show any proglottides or
eggs of T. solium. An anterior chamber tap
showing a high eosinophil count supports a
diagnosis of intraocular cysticercosis44.
Radiological examination
Orbital echography is often used to delineate the cystic lesions with a scolex in an
enlarged extraocular muscle. Intraocular
cysticercosis has characteristic echographic
features30,4446. The cyst may be seen underneath the retina, in the vitreous cavity, surrounded by inflammatory membranes, or,
more rarely, in the anterior chamber.
Standard A-scan ultrasonography reveals
two equally high reflective echospikes corre-
sponding to the anterior and posterior walls

of the cyst. Low amplitude spikes that are
representative of the cavity of the cyst separate the high echospikes. An additional
100% high spike may be observed within the
cyst when the beam passes through the
scolex, which is usually located eccentrically.
B-scan also demonstrates the complete cyst
with an eccentric high-reflective opacity
(scolex) and low-reflective, mobile opacities
filling the cyst cavity (Fig. 28.5). Upon Bscan ultrasonography, the subretinal cysticercus appears as a round density
connected to a curvilinear echo corresponding to the scolex and the cyst wall, respectively. Intravitreal cysticercus gives an
appearance of a curvilinear cystic structure
floating freely in the vitreous cavity.
Intravitreal inflammatory reaction around
the cyst, when present, is characterized by
low-medium amplitude echoes in the vitreous cavity. Echography permits real-time,
dynamic evaluation with direct visualization of the undulating movements of the
parasite. In cases of communicating cysts,
where the intravitreal cysticercus communicates subretinally, both A- and B-scan reveal
the presence of a well defined anterior wall
of the cyst, whereas the posterior wall of the
cyst is not discernible separately from the
retinal scleral echo (Fig. 28.4c)43. A careful
ultrasonography is warranted in such cases,
since demonstration of any subretinal extension may alter the surgical approach and
possibly the surgical outcome43.
Computed tomography (CT) of extraocular myocysticercosis may reveal the presence
of cystic lesions in the extraocular muscle or
diffuse myositis. A cystic lesion with a scolex
on either CT scan or echography confirms a
diagnosis of myocysticercosis. CT evidence
of a cystic lesion without a scolex or diffuse
myositis in the presence of a positive
immunoserological test, preferably enzymelinked immunotransfer blot (EITB) for anticysticercal antibodies, is also considered
diagnostic47. Magnetic resonance imaging
(MRI) findings of neurocysticercosis have
been extensively described (see Chapter 32).
MRI appearances are characteristic; cysts in
the extraocular muscle with a scolex within
the cyst can be seen.
275
Fig. 28.5. B-mode ultrasound scan demonstrating the cystic nature of the lesion with an eccentric high
reflective opacity representing the scolex.
Treatment
Medical treatment
No effective anticysticercal drug is available
for the treatment of ocular cysticercosis. The
lack of effective cysticidal action of praziquantel is attributed to insufficient concentrations of the drug in ocular tissue48,49. Two
cases of subretinal cysticercosis that were
treated without any success are on record48.
Although the movements of the parasite
stopped temporarily after 1318 days, they
were re-established subsequently. The authors
concluded that the drug produced a mild
toxic effect that was reversible. Albendazole
(200400 mg twice daily with corticosteroids
or alone) has been used in extraocular
myocysticercosis; preliminary results thereof
are encouraging50. There are anecdotal reports
of its use in subconjunctival cysticerci; spontaneous extrusion of the cysts was reported
within 35 days in one such case51. Current
opinion favours medical management for
orbital cysticercosis. If a cystic lesion with
scolex is demonstrated, oral albendazole with
oral corticosteroids is recommended. If no
scolex can be identified within the cyst or diffuse myositis is demonstrated, then an EITB
test may be of diagnostic help. If the latter is

found to be positive, albendazole with oral
steroids is recommended. If negative, oral corticosteroids are administered alone; a trial of
treatment with albendazole may be considered in persisting cysts.
Surgical management
Management of ocular cysticercosis is mostly
surgical. The actual surgical approach
employed is determined, for the most part,
by the location of the cysticercus.
Lid, conjunctival and anterior segment
cysticercosis
All subconjunctival cysts should be subjected to excision biopsy. The cyst can usually be easily removed from the lids,
conjunctiva and the anterior chamber52.
When inflammation is present in the anterior chamber, corticosteriods may decrease
the uveal reaction, loosen the cyst attachment, and make removal of the cyst easier16.
Cysticerci that are attached to the sheath of
the extraocular muscles can be removed
after partly sacrificing the sheath38.
276
Intravitreal cysticercosis
Diathermy53, photocoagulation3,12, cryocoagulation30, open approach with lens extraction52and pars plana vitrectomy53 have been
advocated in the management of posterior
segment cysts. An early intravitreal cyst can
be removed with a hypodermic needle54.
For established intravitreal cysticercus,
either a pars plana or an open sky vitrectomy has been advocated15,23,32,52,53. The
drawback of open sky vitrectomy is that the
lens must be removed, and glare or light
scatter at the anterior surface of the vitreous
body may hamper visibility of the larva. A
safer and more effective method of removing the cysticercus involves the pars plana
approach with a bimanual technique and
use of endoillumination probes. A pars
plana approach allows for clear visibility,
maintenance of intraocular pressure, minimal vitreous loss and retention of the lens
during the surgical procedure13,23,48,53,55. The
cysticercus is impacted on the probe tip and
rapidly cut and aspirated from the eye. All
particles, including the scolex are easily cut
and removed. A complete vitrectomy
should be performed, after aspiration of the
cyst, to remove any toxic products released
from the cyst. If the intravitreal cysticercus
is associated with a posterior pole retinal
break but without retinal detachment, management of the break is not necessary
because it is usually sealed by the strong
inflammatory reaction previously induced
by the cyst in the subretinal space30.
However, if strong vitreous traction upon
the retina is seen in the area of the break,
the tractional membranes should be
removed during the closed vitrectomy procedure30. Localized vitrectomy can be performed in the area of the cysticercus to
remove toxins it may have released.
Intraoperative complications during pars
plana vitrectomy include migration and
fragmentation of the parasite, retinal holes
and haemorrhage. Migration occurs only if
a large vitrectomy is done before the
removal of the parasite. If a cysticercus
breaks into two or three parts, each fragment forms a closed globular mass, often
with no apparent spill of contents in the vit-
reous. Each fragment can be caught and

aspirated again. Retinal tears and haemorrhage are mostly due to faulty technique.
Postoperative macular oedema, preretinal
membranes and uveitis are usually an exacerbation of preoperative conditions. The
postoperative recovery period of the patient
following pars plana vitrectomy is shorter
and more easily managed. Systemic corticosteroids are administered 1 day before
surgery, on the day of the surgery and for 1
day after surgery.
Removal of the parasite from the macular
region poses particular difficulties. To gain
better access to the posterior pole of the eyeball, lateral canthotomy and division of the
recti may be undertaken20; some surgeons
even resort to the Krnlein, procedure3.
Periocular and topical corticosteroids, in
addition to mydriatics, are often all that are
required to control the subsequent mild ocular inflammation13.
In case of a cysticercus attached to the
optic nerve head, the larva is dissected free
of the optic nerve head by use of the blunt
tip of an ocutome cutter and the endoillumination probe32. Once free from the optic
nerve head surface, the larva is easily aspirated from the vitreous cavity by use of a
combination of suction and cutting action of
the ocutome probe. It is mandatory that
before the dissection of the larva from the
optic nerve head, all vitreal connections to
the larva should be cut using standard vitrectomy cutting techniques.
Subretinal cysticercosis
If the cysticercus is subretinal, sclerotomy
over the region of larva is the traditionally
favoured technique22. In the past, destruction of subretinal cysts, less than 8 mm in
diameter has been accomplished using
xenon or argon photocoagulation. Initially a
row of delimiting coagulations is placed in
the normal retina, surrounding the parasite
to prevent detachment3. Twenty shots of
xenon Green I at 3 for 13 s, or 80 shots of
500 m, 500800 mW of argon for 0.2 s are
recommended. The conversion of light to
heat leads to coagulation of proteins and
death of the parasite. Unlike a dead cysticer-
cus, the coagulated parasite produces only

localized inflammatory reaction and does
not
induce
severe
endophthalmitis.
Following photocoagulation, the patient is
given periorbital and systemic corticosteroids for 36 weeks. The exudative reaction clears in 1 month, usually leaving an
atrophic scar, with a white calcified scolex in
the centre. Complications of photocoagulation include retinal rupture, survival of the
parasite, macular scarring and severe
uveitis3. Retinal rupture occurs when highenergy shots are applied to the edge of the
parasite close to the normal retina or when
the retina is thinned because of impending
migration of the cyst into the vitreous.
Rupture can hasten passage into vitreous.
Survival of the parasite with return of contractile movements is due to insufficient
treatment and requires further photocoagulation. Macular scarring is unavoidable
when the parasite is in the macular location.
Subretinal cysticercosis has also been
managed by subretinal release of the cyst.
The cyst must be precisely localized by
indirect ophthalmoscopy and scleral
depression. A deep, lamellar, L-shaped scleral dissection is made over the cyst13,29,48.
Transillumination of the dissected scleral
bed delineates large choroidal vessels and
helps in avoiding them. The choroid is then
exposed through a small incision in the
scleral bed and, after adequate diathermy
to avoid bleeding, it is perforated carefully
to avoid rupture of the cyst. The cyst is
then delivered through the choroidoscleral
incision. Gentle pressure on the globe can
help to release the cyst. Complications of
the procedure include failure to remove the
parasite, retinal detachment, retinal tear,
vitreous loss and haemorrhage48.
Removal of subretinal parasites via sclerotomy, however, carries risks. Extensive
periocular surgery may be required to gain
adequate exposure28,29,53,5557. Inadequate
localization may lead to non-removal of the
parasite, perioperative migration of the cyst
within the subretinal space and migration
into the vitreous cavity. Other possible complications include retinal detachment, retinal tear with vitreous loss, vitreous
haemorrhage and bacterial endophthalmi-
277
tis. Open sky and pars plana vitrectomies

have been employed to remove subretinal
cysticerci and have several advantages over
classic sclerotomy1,15,17,26,28,31,34,52. The visibility of the parasite during surgery is excellent and the risk of subtotal cyst removal
and choroidal bleeding, as with the external
approach, is minimal. The risks of retinotomy can be further minimized by preoperative application of delimiting laser
photocoagulation. This also prevents preoperative or perioperative cyst migration
within the subretinal space. Following
three-port pars plana vitrectomy incisions,
the posterior vitreous overlying the cysticercus is exposed. Endodiathermy is used
to create a retinotomy and enter the subretinal space over the cyst. The suction catheter
is used as a cutter and is inserted through
the retinotomy. The cyst is then removed
from within the subretinal space. The scolex
is brought into the midvitreous where it is
examined, cut and aspirated. Internal
drainage of subretinal fluid is followed by
endolaser photocoagulation to surround the
retinotomy. Internal tamponade is achieved
either with silicone oil or a gasfluid
exchange performed using 12% perfluoropropane. After retinopexy, the cyst can also
be pulled into the vitreous and extracted
from the eye in one piece, after enlargement
of the pars plana incision. The risk of
spilling of cyst contents is minimal with this
procedure as the cutting or aspiration of the
cyst is avoided.
Conclusions
Modern imaging techniques have made the
diagnosis of ophthalmic cysticercosis easy.
Nevertheless, clinical suspicion of the condition should be high and the diagnostic
consideration may be invoked in any
patient in endemic areas with a cystic
lesion or uveitis, retinitis and endophthalmitis. This is particularly important
because prognosis in untreated cases of
intraocular cysticercosis is uniformly poor.
Successful treatment lies in early and complete surgical removal of ocular cysticerci.
When not treated, intravitreous or subreti-
278
nal cysticercus usually leads to blindness

within 35 years. Without treatment, the
cysticercus increases in size and begins to
release toxins, leading to a profound
inflammatory reaction with eventual
destruction of the eye. Cysticerci located in
the eyelid and/or conjunctiva are more

benign, and spontaneous extrusion of the
subconjunctival cyst may occur. Once the
infection is diagnosed, however, it is of the
utmost importance to rule out central nervous system involvement.
References
1. Junior, L. (1949) Ocular cysticercosis. American Journal of Ophthalmology 32, 523548.
2. Cano, M.R. Ocular cysticercosis. In: Ryan, S.J. (ed.) Retina, Vol. 2. CV Mosby, St Louis, Missouri, pp.
583587.
3. Santos, R., Dalma, A., Ortiz, E., et al. (1979) Management of subretinal and vitreous cysticercosis:
role of photocoagulation and surgery. Ophthalmology 86, 15011507.
4. Reddy, P.S., Reddy, D.B. (1957) Ocular cysticercosis. Current Medical Practitioner 1, 642.
5. Malik, S.R.K., Gupta, A.K., Choudhry, S. (1968) Ocular cysticercosis. American Journal of
6. Kumar, A., Tewari, H.K., Goyal, H., et al. (1995) Socio-demographic trends in ocular cysticercosis.
Acta Ophthalmologica Scandinavica 73, 438441.
7. Balakrishnan, E. (1961) Bilateral intra-ocular cysticerci. British Journal of Ophthalmology 45, 150151.
8. Cardenas, F., Quiroz, H., Plancarte, A., et al. (1999) Taenia solium ocular cysticercosis: findings in 30
cases. Annals of Ophthalmology 24, 2528.
9. Mais, F.A. (1969) Criocirugia na cisticercose ocular. Revista Brasileira de Ophthalmologia 28, 99106.
10. Katz, M., Despommier, D.D., Gwadz, R.W. (1982) Parasitic Diseases. Springer-Verlag, New York.
11. Nhan, N.T. (1981) Norew experience dans le diagnostic et dans le traitment chirugical de la cysticercose intraoculaire. Journal Francais dOphthalmologie 4, 387392.
12. Rocha, H., Galvao, P.G. (1963) Case de cisticerco subretiniano yuxtapapilar treatade pela fotocoagulacao. Revista Brasileira de Ophthalmologia 22, 4149.
13. Teekhasaenee, C., Ritch, R., Kanchanaranya, C. (1986) Ocular parasitic infection in Thailand. Review
of Infectious Diseases 8, 350356.
14. Bhaskaran, C.Y., Reddy, R.M., Venkatamuni, M., et al. (1978) Ocular cysticercosis. Indian Journal of
15. Kapoor, S., Kapoor, M.S. (1978) Ocular cysticercosis. Journal of Pediatric Ophthalmology and Strabismus
(Thorofare) 15, 170173.
16. Kapoor, S., Sood, G.C., Aurora, A.L., et al. (1977) Ocular cysticercosis: report of a free floating cysticercus in the anterior chamber. Acta Ophthalmologica (Copenhagen) 55, 927930.
17. DiLoreto, D.A., Kennedy, R.A., Neigel, J.M., et al. (1990) Infestation of extraocular muscle by cysticercus cellulosae. British Journal of Ophthalmology 74, 751752.
18. Mandell, L.A., Ralp, E.D. (1985) Essentials of Infectious Diseases: Serology and Skin Testing. Scientific
Publications, Boston, Massachusetts.
19. Danis, P. (1974) Intraocular cysticercus. Archives of Ophthalmology 91, 238239.
20. Bartholomew, R.S. (1975) Subretinal cysticercosis. American Journal of Ophthalmology 79, 670673.
21. Sabti, K., Chow, D., Wani, V. (2001) Resolution of bilateral multifocal subretinal cysticercosis without
significant inflammatory sequelae. Canadian Journal of Ophthalmology 36, 408413.
22. Bawa, Y.S., Wahi, P.L. (1962) Cysticercosis cellulosae of the optic disc with generalized cysticercosis.
23. Wood, R.R., Binder, P.S. (1979) Intravitreal and intracameral cysticercosis. Annals of Ophthalmology
11, 10331036.
24. Sen, D.K., Thomas, A. (1969) Cysticercus cellulosae causing subconjunctival abscess. American
Journal of Ophthalmology 68, 714715.
25. Sen, D.K., Thomas, A. (1969) Incidence of conjuctival cysticercosis. Acta Ophthalmologica 47,
359399.
26. Jampol, L.M., Caldwell, J.B.H., Albert, D.M. (1973) Cysticercus cellulosae in the eyelid. Archives of
279
27. Sen, D.K. (1982) Acute suppurative dacryoadenitis caused by a cysticercus cellulosa. Journal of
Pediatric Ophthalmology and Strabismus (Thorofare) 19, 100102.
28. Fishman, M., Kerman, B., Foxman, S. (1987) Intraocular cysticercosis: migratory. In: Ossoing, K.C.
(ed.) Ophthalmic Echography. Proceedings of the 10th SIDUO Congress. Martinus Nijhoff, Dordrecht.
29. Aracena, T., Perez-Roca, F. (1981) Macular and peripheral subretinal cysticercosis. Annals of
30. Kruger-Leite, E., Jalkh, A.E., Quiroz, H., et al. (1985) Intraocular cysticercosis. American Journal of
31. Giovannini, A., Chillemi, P., Coccia, L., et al. (1985) Ocular cysticercosis. Apropos of a clinical case of
presumed ocular cysticercosis. Journal Francais d Ophthalmologie 8, 789795.
32. Zinn, K.M., Guillory, S.L., Friedman, A.H. (1980) Removal of intravitreous cysticerci from the surface of the optic nerve head: a pars plana approach. Archives of Ophthalmology 98, 714716.
33. Sen, D.K., Mathur, R.N., Thomas, A. (1967) Ocular cysticercosis in India. British Jounal of
Opthalmology 51, 630632.
34. Kapoor, S. (1978) Ocular cysticercosis in India. Tropical and Geographical Medicine 30, 253256.
35. Krishna, D., Mohan, H. (1978) Ocular cysticercosis in India. Journal of Pediatric Ophthalmology and
Strabismus (Thorofare) 15, 96102.
36. Reddy, P.S., Satyendran, O.M. (1964) Ocular cysticercosis. American Journal of Ophthalmology 57, 664666.
37. Rao, A.V.M., Satayandran, O.M., Shiva Reddy (1967) Cysticercosis of the eye. Oriental Archives of
38. Shekhar, G.C., Lemke, B.N. (1997) Orbital cysticercosis. Ophthalmology 104, 15991604.
39. Menon, V., Kumar, G., Prakash, P. (1994) Cysticercosis of extraocular muscle. Journal of Pediatric
Ophthalmology and Strabismus (Thorofare) 31, 126129.
40. Madan, N., Chopra, K., Popli, V. (1995) Proptosis as a manifestation of cysticercosis. Indian Pediatrics
32, 914918.
41. Schmidt, U., Klauss, V., Stefani, F.H. (1990) Unilateral iritis by cysticercal larva in the anterior chamber. Ophthalmologica (Basil) 200, 210215.
42. Segal, P., Mrzygold, S., Smolarz Dudarewicz, J. (1964) Subretinal cysticersosis in the macular region.
American Journal of Ophthalmology 57, 655664.
43. Kumar, A., Verma, L., Khosla, P.K., et al. (1989) Communicating intravitreal cysticercosis. Ophthalmic
Surgery 20, 424.
44. Manschot, W.A. (1968) Intraocular cysticercus. Archives of Ophthalmology 80, 772774.
45. Murthy, H., Kumar, A., Verma, L. (1990) Orbital cysticercosis an ultrasonic diagnosis. Acta
Ophthalmologica 68, 612614.
46. Meyerson, L., Pienaar, B.T. (1961) Intra-ocular cysticercus. British Journal of Ophthalmology 45, 148149.
47. Stewart, C.R., Salman, J.F., Murry, A.D., et al. (1993) Cysticercosis as a cause of severe medial rectus
myositis. American Journal of Ophthalmology 116, 510516.
48. Santos, R., Chavarria, M., Aguirre, A.E. (1984) Failure of medical treatment in two cases of intraocular cysticercosis. American Journal of Ophthalmology 97, 249250.
49. Kestelyn, P., Taelman, H. (1985) Effect of praziquantel on intraocular cysticercosis: a case report.
50. Sihota, R., Honavar, S.G. (1994) Oral albendazole in the management of extraocular cysticercosis.
51. Raina, U.K., Taneja, S., Lamba, P.A., et al. (1996) Spontaneous extrusion of extraocular cysticercosis
cysts. American Journal of Ophthalmology 121, 438441.
52. Barraquer, J. (1963) Lens Extraction and Extraction of Cysticercus. American Academy of
Ophthalmology and Otolaryngology Meeting, New York (Film presentation).
53. Hutton, W.L., Vaiser, A., Snyder, W.B. (1976) Pars plana vitrectomy for removal of intravitreal cysticercus. American Journal of Ophthalmology 81, 571573.
54. Patnaik, B., Kalsi, R. (1983) Intraocular cysticercosis and its surgical management. In: Henkind, P.
(ed.) Acta XXIV International Congress of Ophthalmology. JB Lippincott, Philadelphia, pp. 152159.
55. Verdaguer, T.J., Lechuga, M., Ibanez, S. (1977) Tratamiento quirurgico da la cisticercosis intravitrea.
Archivos de Chilian del Ophthalmologia 34, 4954.
56. Gemolotto, G. (1955) Contributo alla terapia chirurgica del cisticerco andocular. Archives of
57. Jain, I.S., Dhir, S.P., Chattopadhiya, P.R., et al. (1979) Ocular cysticercosis in North India. Indian
Journal of Ophthalmology 27, 5458.
29
Neurocysticercosis: Diagnosis and

Treatment in Special Situations
Ravindra Kumar Garg and Alok Mohan Kar
Introduction
Neurocysticercosis (NC) is not only rampant
in developing countries, but its frequency is
also increasing in developed countries, due
to increasing immigration and more frequent
travel to endemic regions. In endemic and
even in non-endemic regions cysticercosis is
likely to occur with several other medical
conditions. Concomitant illnesses may affect
natural history and clinical behaviour of cysticercosis and consequently its management
and prognosis. In addition, Taenia solium
infection, along with several other parasitic
infections, has been causally implicated in
certain systemic and central nervous system
(CNS) malignancies. In this chapter, we shall
be reviewing the available literature on such
associations with an emphasis on their clinical implications.
Neurocysticercosis in Acquired
Immunodeficiency Syndrome (AIDS)
AIDS is frequently complicated by opportunistic infections. There are geographic variations in the pattern of opportunistic
infections depending upon the prevalence of
microorganisms
in
the
environment.
Pneumocystis, Toxoplasma and Cryptosporidium
are the main organisms associated with
human immunodeficiency virus (HIV) infection worldwide. A few other organisms

could also potentially interact with HIV
infection in their respective regions of
endemicity. One such emerging example is
the occurrence of NC in AIDS. Thornton et al.
reported such an association for the first time
in four African patients1. In three patients,
the occurrence of seizures, a symptom
related to NC, brought the patients to medical attention and eventually a diagnosis of
HIV infection was made. White et al. later
reported asymptomatic NC in a patient with
HIV infection; this patient also had cryptococcal meningitis2. Soto Hernandez recently
reported two more such patients3. One
patient presented with intracranial hypertension. Neuroimaging revealed a solitary giant
intracranial cyst, which was surgically
removed. The second patient had brain toxoplasmosis and incidental NC. A summary of
all these patients and one patient in whom
NC was diagnosed at autopsy4 appears in
Table 29.1.
Clinical implications of concomitant NC

and HIV infection
The association between NC and AIDS is a
cause for several concerns. Firstly, there may
be the possibility of the occurrence of NC in

281
282
R.K. Garg and A.M. Kar
Table 29.1. Summary of published experience of eight cases of neurocysticercosis in AIDS.

Case
No.
Ref.
Clinical
No. Age/Sex presentation
Associated
condition
MRI/CT
scan
Treatment
Outcome
1.
22/F
NA
NA
Died
2.
40/M
Toxoplasmosis,
tuberculous
abscess
Generalized
lymphadenopathy
Abendazole + Slight
corticosteroids improvement
3.
36/M
4.
30/M
5.
25/M
Numerous
intraparenchymal
cystic lesions
Multiple
parenchymal
cysts
Numerous
parenchymal
cysts
Multiple
cortical cysts
6.
29/M
Asymptomatic
7.
29/M
8.
41/F
Headache, raised
intracranial pressure
Raised intracranial
pressure, decreased
attention, hemiparesis
NA; diagnosis was

made incidentally
on autopsy
Headache, partial
seizures, obtundation,
papilloedema, hemianopia,
hemiparesis
Partial seizures, brachial
monoparesis, hand
incoordination
Headache, left hemiparesis, left optic atrophy,
visual field defect
Generalized tonicclonic
seizure
Generalized
lymphadenopathy,
oral candidiasis
Generalized
lymphadenopathy
Generalized
lymphadenopathy,
thrombocytopenia,
cryptococcal
meningitis
<200 CD4 cells

Toxoplasmosis,
Herpes zoster
Praziquantel + Improved
phenytoin
Praziquantel + Improved
corticosteroids
Single cystic
lesion
Single giant
Surgery +
cyst
albendazole
Racemose
None
cyst in
Sylvian fissure
Died
Improved
Impoved
NA
NA: data not available.
other immunocompromised states as well.

The alterations in the immune system of the
host described in patients with NC may be in
some cases a predisposition to, rather than a
consequence of, HIV infection1. Second, the
therapeutic response to anticysticercal drugs
(praziquantel and albendazole) may differ in
HIV-infected patients since successful anticysticercal treatment requires a simultaneous
drug effect on both the parasite and host
immune system. Third, clinical and serological manifestations of NC might be modified
by HIV infection.
Taenia crassiceps cysticercosis in AIDS

Klinker et al., in 1992, first reported the
occurrence of subcutaneous cysticercosis due
to T. crassiceps in AIDS5. Subsequently,
Francois et al. described the development of
a fluctuant painful subcutaneous and intramuscular tumour of the forearm due to T.
crassiceps cysticercosis in AIDS6. Taenia crassiceps is ordinarily non-pathogenic to humans
and causes cysts in the subcutaneous tissue

and viscera of rodents. It may, however, be
added to the list of opportunistic infections
that occur in AIDS.
Differential diagnosis of NC in AIDS

Intracranial mass lesions are frequent in
AIDS. The nature of these mass lesions can
be broadly divided into three distinct
groups: opportunistic infections, neoplasms
and cerebrovascular disease7. Toxoplasmosis,
a common cause of intracranial mass lesions
in AIDS, can frequently be confused with NC
because of similar clinical and imaging presentations. A point of difference upon imaging studies is that toxoplasma lesions
involve subcortical structures such as basal
ganglia, thalamus and cerebellum in comparison to NC, which is characteristically
located at the corticalsubcortical interface.
A reliable non-invasive diagnosis of toxoplasmosis is made with the help of positive
antitoxoplasma serology and a good thera-
Diagnosis and Treatment in Special Situations
peutic response as confirmed by serial CT

scans810. Primary CNS lymphoma is easily
distinguishable from NC upon imaging
studies by involvement of, and extension
across the corpus callosum, exclusive
involvement of the white matter, periventricular location and sub-ependymal spread810.
Treatment of NC in AIDS
All reported cases of NC so far have been
found in advanced HIV disease, frequently
coexisting with other opportunistic infections, generalized lymphadenopathy or profound CD4 lymphoytopaenia. Reported
experience from a limited number of cases of
AIDS with NC suggests that the latter
responds to treatment with albendazole or
praziquantel in a manner similar to nonHIV-related NC. Surgery may also be considered in cases of solitary giant parenchymal
cysts or racemose cysticercosis. However,
greater emphasis should be given to treatment of coexisting diseases13.
Neurocysticercosis in Other
Immunocompromised States
A few reports of NC in other immunocompromised conditions are available, however, due
to lack of sufficient data it is difficult to ascertain the significance of such associations.
283
immunosupressive drugs used in the management of renal transplant. A point to note,

however, is that some antiepileptic drugs
(AEDs) used for the treatment of seizure disorder due to cerebral cysticercosis, including
phenobarbitol, phenytoin and carbamazeapine induce the hepatic CYP3A4 enzyme system. This can result in increased clearance
and reduced blood levels of cyclosporin and
FK 506 and, thereby, renal allograft rejection12,13. Therefore, blood levels of
cyclosporin should be measured during AED
co-administration and appropriate dose
modifications be made.
Leukaemia
Mauad et al. reported an unusual case of
massive cardiopulmonary cysticercosis in
acute leukaemia14. As pulmonary cysticercosis is extremely rare, the authors suggested
that profound immunosuppression, produced by acute leukaemia, was responsible
for this unusual presentation.
Concomitant CNS Infections with NC

In endemic regions, NC is likely to occur coincidentally with other CNS infections that
are common and peculiar to that region, with
the possibility of mutually altering respective
pathological and clinical courses of both the
diseases. One such example is that of association of NC with Japanese B encephalitis.
Renal transplantation
Some parasitic diseases such as strongyloidosis and schistosomiasis uncommonly
occur in the post-transplant immunocompromised state. Gordillo-Paniagua et al.
described the occurrence of cysticercotic
encephalitis in a cadaveric renal transplant
recipient11. Complete resolution of clinical
and CT abnormalities were achieved following praziquantel therapy. More importantly,
the complicating illness did not affect renal
allograft function or in any way alter
immunosuppressive drug action. The
reported individual did not receive
cyclosporin or FK 506, both standard
Japanese B encephalitis
An unusually high frequency of NC has
been reported in at least two autopsy series
of brains studied for Japanese B encephalitis
from India and China15,16. Shankar et al.
found cerebral cysticercosis in 11 of 26 consecutive brain specimens examined for
Japanese B encephalitis16. Fang et al. noted
NC in eight of 26 brains with Japanese B
encephalitis17.
Other
authors
have
described the association in living subjects
using imaging and serological studies (Fig.
29.1a and b)17,18. From the point of view of
284
Fig. 29.1. Magnetic resonance image (fluid attenuation recovery sequence) showing solitary cysticercus
granuloma (a) with a scolex and surrounding oedema and thalamic and sub-thalamic lesions (b)
characteristic of Japanese B encephalitis.
diagnosis and treatment, it is important to

differentiate this condition from cysticercotic encephalitis19. Several authors have
tried to explain this association on the basis
of anatomical derangements in the
bloodbrain barrier during the inflammatory phase of cerebral cysticercosis that
facilitate viral entry1518. Furthermore, T.
solium larvae are also thought to sensitize
the brain to more severe injury by Japanese
B encephalitis. Indeed, it has been surmised
that concomitant cerebral cysticercosis
adversely determines the outcome of the
encephalitis16,18. In our view, the swine population is an important reservoir for
Japanese B encephalitis and also constitutes
the intermediate host population for T.
solium. Therefore, there is a likelihood of a
chance association to occur in areas where
free-ranging pigs are common.
mosis may produce clinical and imaging manifestations similar to that of NC. Toxoplasmosis
is rare in immunocompetent hosts, while NC
occurs rarely in immunosuppressed hosts20. A
variety of investigative techniques including
neuroimaging, thallium-201 single photon
emission computed tomography, polymerase
chain reaction analysis of CSF and special
histopathological methods may be required to
reliably differentiate acquired toxoplasmosis
from cerebral cysticercosis20.
Wallus and Young reported the rapid
development of a large cystic parenchymal
lesion in a young woman, which was surgically removed and found to contain pus
rather than clear fluid21. The pus was cultured and grew Brucella melitensis. The case
allegorizes bacterial superinfection of cerebral cysticercosis and as well as the point
that clinicians should be aware of multiple
simultaneous infections.
Other CNS infections
Neurocysticercosis in Pregnancy
Another CNS infection that has been reported
to occur in patients with NC is cerebral toxoplasmosis3,4. As mentioned earlier, toxoplas-
Like several other neurological disorders,

NC may manifest for the first time during
pregnancy and the latter may occur in a

woman with pre-existing NC2224. Our
experience on this association is largely
based on anecdotal case reports2224. NC
can be responsible for new-onset seizures
during pregnancy. However, seizures
have a different connotation in pregnancy
than otherwise. First, seizures are more
commonly a manifestation of eclampsia
and NC must be differentiated from this
condition24. Second, both mother and
fetus are at risk of death during and after
a major seizure. Hypoxia and acidosis
caused by convulsions, though, well tolerated by the mother, can be fatal to the
fetus. Unsuspected NC may also pose
diagnostic problems during pregnancy.
The investigation of choice for the diagnosis of NC in pregnant women is magnetic
resonance imaging (MRI); computed
tomography (CT) scanning should be
avoided as far as possible, especially during early part of pregnancy.
Data is insufficient about safety of anticysticercal
drugs
during
pregnancy.
Praziquantel does not cause teratogenicity in
mammalian assays or reproductive impairment in rats, mice or rabbits. There are no
available data on human reproductive ill
effects from this agent25. Anecdotal use in
pregnant individuals who were not yet
aware that they were pregnant, so were in
very early pregnancy (at the time of maximal
teratogenic potential), have not revealed any
congenital anomalies25. Use in later gestation
has not been associated with an increase in
fetal or neonatal mortality or morbidity22.
Though human data are lacking, albendazole
has been found to be embryotoxic and teratogenic to laboratory animals; therefore its
use during pregnancy, especially the first
trimester, is not recommended.
We recommend that if the patient is pregnant and seizures are in good control on
antiepileptic drugs (AEDs) then definitive
treatment with anticysticercal drugs can be
delayed till after delivery. On the contrary, if
the disease is progressive or seizures are not
well controlled, then anticysticercal treatment should be considered during pregnancy22. Finally, note should be made of the
fact that praziquantel is secreted in breast
285
milk and its effects on neonates and infants

are not yet known22.
Neurocysticercosis and Malignancies

Systemic malignancies
Herrera et al. investigated the possibility of
an association between NC and systemic
cancer26. The authors reviewed 1271
autopsy files and selected those with malignancy cases. Autopsies revealing any nonmalignant disease served as controls. NC
was significantly more frequent in haematological malignancies in comparison to
controls. It was concluded that since
human cancer arises from interaction of
several factors including xenobiotics and
endogenous constituents, it is difficult to
establish NC as a causal agent of haematological malignancies; however, it should be
considered as a potential risk factor for
haematological malignancies in endemic
countries. Mutagenic abnormalities including chromosomal aberrations and HPRTlocus mutations have been reported with
increased frequency in individuals with
NC27,28. Although some authors relate these
abnormalities to the administration of praziquantel, the prevailing view is that these
abnormalities are caused by NC itself and
that they revert back with praziquantel
administration2729. Some authorities believe
that T. solium infestation causes depression
of cell-mediated immunity, in particular certain aspects of T-cell function30,31. Since the
latter is involved in surveillance against cancer, it may be surmised that the parasiteinduced immunosuppression underlies the
predisposition to malignancies.
Central nervous system malignancies

In non-endemic regions where incidence of
NC is very low, it is not surprising that
lesions of NC are mistaken as cerebral
tumour. Silver et al. reported one such example; a 9-year old girl presented with severe
acute headache, vomiting and convulsions
imaging revealed a ring-enhancing CT
286
lesion32. On the basis of radiological impression and report of stereotactic needle biopsy,
the lesion was diagnosed as malignant
glioma. However, subsequently, the excised
mass revealed cysticercus granuloma.
More importantly, there are reports of a
causal association between NC and CNS
malignancies33,34. A systematic casecontrol
evaluation found an increased frequency of
NC among patients with cerebral glioma34.
In this series, six out of eight individuals
who demonstrated the association had calcified cysts in and around the neoplasm; suggesting that the severe inflammatory
response to degenerating transitional cysticerci that lead to calcification was responsible for a neoplastic transformation35. Several
mechanisms have been put forward for the
causal association between NC and cerebral
gliomas (Box 29.1)3335.
Conclusions
Neurocysticercosis is likely to be associated
with other common medical conditions in
endemic regions. Though data is limited, there
is no evidence that associated immunological
disorders such as AIDS and renal transplantation or physiological conditions such as pregnancy affect the natural course of cysticercosis.
Such patients need the usual forms of treatment
and there is a good outcome in the majority. In
endemic regions, new-onset seizures in pregnancy should raise the consideration of NC as
an aetiological possibility. If NC is diagnosed,
anticysticercal treatment is preferably delayed
till the postpartum period. Preliminary reports
from Latin America indicate that NC may predispose to certain haematological and CNS
malignancies. Further research effort is
required to clarify this relationship.
Box 29.1. Suggested oncogenic mechanisms in neurocysticercosis

1. Immunological changes resulting in loss of regulatory mechanisms responsible for immune
surveillance against cancer.
2. Transfer of genetic material from parasite to the host, causing DNA damage and malignant
transformation of host cells.
3. Chronic inflammation with liberation of nitric oxide and inhibition of tumour suppressor genes.
4. Chromosomal aberrations in peripheral blood cells.
5. Intense gliosis around cysticercal calcified lesions may stimulate uncontrolled proliferation
of glial cells.
6. Interaction with other unidentified oncogenic factors (e.g. environmental, genetic).
References
1. Thornton, C.A., Houston, S., Latif, A.S. (1992) Neurocysticercosis and human immunodeficiency
virus infection. A possible association. Archives of Neurology 49, 963965.
2. White, A.C. Jr, Dakik, H., Diaz, P. (1995) Asymptomatic neurocysticercosis in a patient with AIDS
and cryptococcal meningitis. American Journal of Medicine 99, 101102.
3. Soto Hernandez, J.L., Ostrosky Zeichner, L., Tavera, G., et al. (1996) Neurocysticercosis and HIV
infection: report of two cases and review. Surgical Neurology 45, 5761.
4. Mosowitz, L.B., Hensley, G.T., Chan, J.C., et al. (1984) The neuropathology of acquired immune deficiency syndrome. Archives of Pathology and Laboratory Medicine 108, 867872.
5. Klinker, H., Tintelnot, K., Joeres, R., et al. (1992) Taenia crassiceps infection in AIDS. Deutsche
Medizinische Wochenschrift 117, 133138.
6. Francois, A., Favennec, L., Cambon-Michot, C., et al. (1998) Taenia crassiceps invasive cysticercosis: a
new human pathogen in acquired immunodeficiency syndrome. American Journal of Surgical
Pathology 22, 488492.
287
7. Report of the quality standards subcommittee of American Academy of Neurology (1998)

Evaluation and management of intracranial mass lesions in AIDS. Neurology 50, 2126.
8. Price, R.W. (1996) Neurological complications of HIV infection. Lancet 348, 445452.
9. Garg, R.K. (1999) HIV infections and seizures. Postgraduate Medical Journal 75, 317390.
10. Jinkins, J.R., Provenzale, J.M. (1997) Brain and spine imaging findings in AIDS patients. Radiology
Clinics of North America 35, 11271166.
11. Gordillo-Paniagua, G., Munoz-Arizpe, R., Ponsa-Molina, R., et al. (1987) Unusual complication in a
patient with renal transplantation: cerebral cysticercosis. Nephron 45, 6567.
12. Fahr, A. (1993) Cyclosporin: clinical pharamacokinetics. Clinical Pharmacokinetics 24, 472495.
13. Andersen, G.D. (1998) A mechanistic approach to antiepileptic drug interactions. Annals of
Pharmacotherapy 32, 554563.
14. Mauaud, T., Battlehner, C.N., Bedrikow, C.L., et al. (1997) Case report: massive cardiopulmonary
cysticercosis in a leukemic patient. Pathology, Research and Practice (Stuttgart) 193, 527529.
15. Das, S.K., Nityanand, S., Sood, K., et al. (1991) Japanese B encephalitis with neurocysticercosis.
Journal of the Association of the Physicians of India 39, 643644.
16. Shanker, S.K., Rao, T.V., Mruthyunjayanna, B.P., et al. (1983) Autopsy study of brain during an epidemic of Japanese encephalitis in Karnataka. Indian Journal of Medical Research 78, 431440.
17. Fang, L.Y., Lung, T.C., Kai, L. (1957) Cerebral cysticercosis as a factor aggravating Japanese
encephalitis. Chinese Medical Journal 75, 101.
18. Desai, A., Shankar, S.K., Jayakumar, P.N., et al. (1997) Co-existence of cerebral cysticercosis with
Japanese encephalitis: a prognostic modulator. Epidemiology and Infection 118, 165171.
19. Rangel, R., Torres, B., Del Bruto, O.H. (1987) Cysticercotic encephalitis: a severe form in young
20. Mitchell, W.G. (1999) Neurocysticercosis and acquired cerebral toxoplasmosis in children. Seminars
in Pediatric Neurology 6, 267277.
21. Walus, M.A., Young, E.J. (1990) Concomitant neurocysticercosis and brucellosis. American Journal of
Clinical Pathology 94, 790792.
22. Kurl, R., Montella, K.R. (1994) Cysticercosis as a cause of seizure disorder in pregnancy: case report
and review of literature. American Journal of Perinatology 11, 409411.
23. Paparone, P.W., Menghetti, R.A. (1996) Case report: neurocysticercosis in pregnancy. New Jersey
Medicine (Lawrenceville, NJ) 93, 362367.
24. Suarez, V.R., Iannucci, T.A. (1999) Neurocysticercosis in pregnancy: a case initially diagnosed as
eclampsia. Obstetrics and Gynecology 93, 816818.
25. Machemer, L., Lorke, D. (1978) Mutagenicity studies with praziquaentel, a new antihelminthic drug,
in mammalian systems. Archives of Toxicology 39, 187197.
26. Herrera, L.A., Benita-Bordes, A., Sotelo, J., et al. (1999) Possible relationship between neurocysticercosis and hematological malignancies. Archives of Medical Research (Mexico) 30, 154158.
27. Herrera, L.A., Ramirez, T., Rodriguez, U., et al. (2000) Possible association between Taenia solium cysticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neurocysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 6165.
28. Montero, R., Flisser, A., Madrazo, I., et al. (1994) Mutation at the HPRT locus in patients with neurocysticercosis treated with praziquantel. Mutation Research 305, 181188.
29. Flisser, A., Gonzalez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle porcine
Taenia solium cysticercosis. 2. Immunological and cytogenic studies. Parasitology Research 76, 640642.
30. Molinari, J.L., Tato, P., Reynosa, O.A. (1990) Depressive effect of a Taenia solium cysticercus factor on
cultured human lymphocytes stimulated with phytohaemagglutinin. Annals of Tropical Medicine and
31. Thussu, A., Sehgal, S., Sharma, M., et al. (1997) Comparison of cellular responses in single- and multiple-lesion neurocysticercosis. Annals of Tropical Medicine and Parasitology 91, 627632.
32. Silver, S.A., Erozan, Y.S., Hruban, R.H. (1996) Cerebral cysticercosis mimicking malignant glioma: a
case report. Acta Cytclologica 40, 351357.
33. Agapejev, S., Alves, A., Zanini, M.A., et al. (1992) Cystic oligodendroglioma and positivity of reactions for cysticercosis: report of a case. Arquivos de Neuropsiquiatria 50, 234238.
34. Del Brutto, O.H., Castillo, P.R., Mena, I.X., et al. (1997) Neurocysticercosis among patients of cerebral
glioma. Archives of Neurology 54, 11251128.
35. Del Brutto, O.H., Dolezal, M., Castillo, P.R., et al. (2000) Neurocysticercosis and oncogenesis.
Archives of Medical Research (Mexico) 31, 151155.
30
The Pathology of Neurocysticercosis

Alfonso Escobar and Karen M. Weidenheim
Introduction
The pathological spectrum of neurocysticercosis (NC) is as wide as the range of its clinical manifestations. A thorough description of
its pathology and morbid anatomy is important for an understanding of the clinical
expressions and natural history, and requires
a wide variety of clinical material, studied
with several diagnostic protocols1,2. The
basic approaches to the study of the pathology of NC, the pathological stages of evolution of cysticerci and the host tissue
responses are discussed in this chapter.
The Contribution of Autopsy

Necropsy has contributed immensely to our
knowledge of Taenia solium cysticercosis.
Some of the earliest insights into the disorder were based purely on autopsy, since at
that time sophisticated neuroradiological
investigations were not available35. Pooled
autopsy data from general hospitals have
also been used as a parameter in the study
of the epidemiology of the disease, in particular the burden of disease in given populations (see Chapter 11, also)1,6,7. Moreover,
autopsy studies have helped to clarify
issues regarding clinical behaviour and
variables associated with disease manifesta-
tions. For instance, it is often believed that

the severity of the clinical features and
pathological reaction to cysticerci is related
to the number of parasites, their location
and age in the central nervous system. An
interpretation of the pathology of NC
involves careful consideration of all factors
mentioned above. One may, however, be
misled to believe that the clinical picture is
likely to be more severe with larger number
of, and older age of the parasites811.
However, this is not necessarily true. It is
common to note incidental cerebral cysticercosis in routine autopsies performed in general hospitals in Mexico (Fig. 30.1)12. These
are those cases that have remained asymptomatic with specific regard to neurological
symptoms during their lifetime. In our
autopsy experience, cysticerci located in
eloquent cortical zones such as the motor
cortex have an equal chance of either manifesting with clinical symptoms and signs,
for instance, partial motor seizures, or
remaining asymptomatic13. Conversely, in a
case of fatal intracranial hypertension,
autopsy may disclose hydrocephalus that
has developed due to a single cyst lodged in
the fourth ventricle or cerebral aqueduct
(see Chapter 20). This underscores the significance of the location of the parasite as
well as the nature of the host immune
response upon the clinical outcome.

289
290
A. Escobar and K.M. Weidenheim
Fig. 30.1. Parenchymal cysticercosis. Coronal section of the brain with multiple cysts lodged in cortical
grey and subcortical white matter and leptomeningeal space. Some of the cysts display a characteristic
larva inside the vesicle. Notice also that the parasites in the right putamen, and at the tip of third frontal
and first temporal convolution in the left hemisphere, have lost their vesicular morphology and
transformed into homogenous colloidal/granular nodular structures. This is an example of cysticerci in
different stages of resolution at one time.
Identification of the Parasite

The identification of cysticerci in brain biopsies is crucial to the pathological diagnosis of
NC. The material sent to the pathology laboratory is usually a well-preserved cyst or
may consist of clumps of membranous structures (Fig. 30.2a and b). In the former case,
an unwary pathologist may erroneously
diagnose a colloid cyst instead of cysticercosis if s/he has been told that the specimen
came from the third ventricle. Microscopic
examination, however, establishes the correct
diagnosis. At the laboratory of one of the
authors in Mexico City, it is routine to open
any vesicular structure in order to expose the
larva, which may be lying within. The larva
is then separated from the membranous
structure, placed between two glass slides,
and pressed until it is completely flattened.
Pressure is maintained by applying masking
tape at both ends of the two slides. Light-
microscopic examination with a scanning

lens permits identification of rudimentary
strobila and scolex formed by a rostellum
with four suckers and 20 pairs of hooks
arranged in the form of a crown (Fig. 30.3).
When the available pathological material
comprises membranous structures alone, histological examination reveals its three-layered structure. The external, cuticular layer
appears as a festooned syncytium covered
by microtriches. It is lined by glycocalyx giving the appearance of a homogeneous
eosinophilic layer. Beneath lies the middle or
cellular layer. Here, lymphocyte-like elements accumulate in single, double, or sometimes triple rows. The innermost or reticular
layer is most prominent and exhibits fibrillary aspect with multiple excretory canaliculi
similar to capillaries (Fig. 30.4a and b). In
addition, small, oval or round calcareous
corpuscles may be identified within this
layer. The latter represent the calcified stage
291
Fig. 30.2. (a) Vesicular stage of a cyst found in the fourth ventricle. The C-shaped larva protrudes from
the previously opened vesicular membrane. (b) Two meningeal cysticerci with hyaline change within their
vesicular membranes.
of intracorporeal vacuoles, which are sometimes present in the reticular layer during
the early, viable stages of the cysticercus (Fig.
30.4c). In order to be able to identify the
scolex, serial sections are often required. The
scolex appears as a more compact structure
very similar to the membrane in which
infoldings of the spiral canal and the suckers
may be identified. If the hooklets are present,
they appear as a cornified semitransparent
structure (Fig. 30.5a).
Evolutionary Stages of Human

Cysticercosis: Pathological
Correlates
Human NC offers the possibility of observing, in autopsy or biopsy material, the several stages through which the parasites
evolve during their lifetime in the brain.
Four stages are described below1418. Their
corresponding features upon imaging studies are reviewed in Chapter 32.
292
Fig. 30.3. Rostellum, suckers and crown of hooklets identify a cysticercus cellulosae. Fresh specimen
prepared according to the technique for rapid diagnosis, as described in the text (scale bar: 330 m).
Vesicular stage
In the vesicular stage the metacestode has a
thin, friable, translucent whitish membrane.
Inside, a round curled and invaginated larva,
45 mm in length, and bathed in a transparent fluid, is visible (Figs 30.5a and 30.6).
There is minimal, if any, surrounding inflammatory response.
30.5b), with concomitant breakdown of the

bloodbrain barrier. If the location is subarachnoid, there is an exudative inflammatory reaction eventually leading to meningeal fibrosis.
It is at this stage that the earliest signs of angiitis begin to develop, usually affecting the
small pial vessels, and sometimes the medium
to large arteries. The resulting vascular thrombosis and occlusion may eventually produce
distal infarction.
Colloidal stage
Granular nodular stage
The colloidal stage is characterized by degenerative changes in the aging parasite consequent upon host immunological response. The
transparent fluid within the cyst is replaced by
jelly-like whitish material. The larva is still
identifiable, but it exhibits hyaline degeneration and early mineralization. Due to the
microscopic resemblance to a colloid cyst, this
stage has been named the colloidal stage of
the vesicular form of cysticercosis. In a more
advanced stage, the cyst begins to decrease in
size, its walls become thicker, and its contents
undergo mineralization with calcium salts,
and are transformed into coarse granules. If
the cyst is located in the parenchyma, granulation tissue appears around the lesion (Fig.
In the granular nodular stage, there occurs

retractional involution of cyst/s. Its contents
are mineralized and tend to appear granular.
The larva becomes fragmented, but careful
histological examination still permits identification of the remaining parts of the festooned
membrane and scolex (Fig. 30.7). Both structures are difficult to identify; however, the use
of Massons trichrome technique may permit
identification. With this stain, the membrane
appears bright red, while the scolex has a red
and blue tint because of collagen tissue. The
collagen capsule around the cysts is thick,
stains heavily blue, and is infiltrated and surrounded by a decaying inflammatory reaction.
293
Fig. 30.4. (a) The vesicle of a live cysticercus cellulosae displays the characteristic three-layered
structure; notice the microtriches covering the festooned surface of the cuticle (haematoxylin and eosin;
scale bar: 35 m). (b) Advanced hyaline change and disappearance of the three layers in the vesicular
membrane of a dead meningeal cysticercus. Concomitant intense inflammatory infiltrate and
multinucleated giant cells cover the surface of the membrane (haematoxylin and eosin; scale bar: 90 m).
(c) Calcareous corpuscles in the reticular layer of the vesicular membrane of a viable cysticercus
(haematoxylin and eosin; scale bar: 90 m).
294
Fig. 30.5. Parenchymal cysticercosis. (a) Cysticercus in the vesicular stage. The histological section
displays the spiral canal, hooklets and the well preserved vesicular membrane. (b) Parenchymal
cysticercus showing a marked inflammatory infiltrate both inside the locus and outside it in the adjacent
parenchyma. (c) Dead parenchymal cysticercus with a hyalinized vesicular membrane is completely
surrounded by an intense inflammatory exudate both inside the locus and outside it into the adjacent
parenchyma. There are multiple foci of perivascular cuffing (haematoxylin and eosin; scale bar: 225 m).
295
Fig. 30.6. Parenchymal cysticercosis. A live vesicular stage cysticercus appears lodged in the right
dorsomedial thalamic nucleus. The larva can be seen through the translucent vesicle. Another parasite is
partially exposed in the dorsal portion of the internal capsule on the opposite side (scale bar: 5 mm).
Fig. 30.7. Meningeal cysticercus in an advanced colloidal to granular nodular stage. A thick collagen
membrane encases the parasite and its vesicular membrane; notice the total loss of the structure of the
strobila (Massons trichrome technique; scale bar: 2.5 mm).
296
Nodular-calcified stage
The granular material seen in the previous
stage gets completely mineralized. The
nodular-calcified cysticercus is small, about
one-half to one-quarter the size of the vesicular cysticercus. It is of hard consistency on
account of its collagenous capsule. When
sectioned, the exposed surface appears
whitish but may also be heterogenous and of
yellow-brown colour. The surrounding
inflammatory infiltrate is minimal or absent.
Histological Study of Host Reaction

to the Cysticercus
Inflammatory reaction 9,1416
The nature and intensity of the inflammatory
reaction around the cysticercus in the human
nervous system is extremely variable. The
inflammatory response primarily depends
upon the evolutionary stage of the cysticercus.
Though some degree of inflammatory reaction
can be found around all stages of the cysticercus, its intensity generally declines through
the successive stages of evolution. Thus, the
most severe inflammation can be found in the

vicinity of a cysticercus in the colloidal stage,
whilst only scattered foci of inflammatory cells
remain in the nodular-calcified stage.
However, on occasion, a dead cysticercus may
evoke strong inflammatory reaction in the
adjacent brain parenchyma (Fig. 30.5c) or the
meninges. The inflammatory reaction itself is
composed of round mononuclear lymphocytic
and plasma cells clumped within the collagenous strands that constitute the capsule surrounding the cystic membrane (Fig. 30.8).
Inflammatory cells, primarily lymphocytes
and plasma cells and a variable number of
eosinophils, are also found in the perivascular
spaces in the adjacent nervous tissue. The
intensity of the tissue eosinophilic reaction is
variable and unpredictable. It occurs in most
cases but may be absent in the case of
parenchymal cysticercosis. Foreign body,
multinucleated giant cells are invariably present in the surrounding inflammatory zone
(Figs 30.4b and 30.9d). These cells may be
identified through all successive evolutionary
stages of the cysticerci, including the nodularcalcified stage, when the inflammatory
response in general has faded away. Giant
cells are derived from macrophages.
Fig. 30.8. High power photomicrograph of the inflammatory parenchymal infiltrate and reactive
astrocytic gliosis in the acute encephalitic phase of parenchymal cysticercosis. The vesicular membrane
lies next to the parenchymal wall of the locus (haematoxylin and eosin; scale bar: 90 m).
297
Fig. 30.9. Basal cysticercotic meningitis. (a) Photomicrograph displaying hyalinized membranes of
cysticercus and an arterial branch with partial destruction of the lamina elastica. There is partial occlusion
of the lumen due to an atheromatoid plaque, a common finding in the vicinity of the parasites
(haematoxylin and eosin). (b) An arteriole with intense inflammatory periarteritis and endarteritis
associated with collagen proliferation (Massons trichrome stain; scale bar: 22 m). (c) Hyalinized
membranes of cysticercus and abundant debris adherent to the markedly fibrotic leptomeninges
(Massons trichrome stain). (d) Intense inflammatory infiltrate and multinucleated macrophages that
surround debris of the cysticercus membranes (Massons trichrome stain; scale bar: 90 m).
Vascular reaction14,1921
Significant histological reactions occur in
arteries, arterioles, and venules and these
have important clinical consequences, primarily stroke, which is discussed in detail in
Chapter 22. Histological aspects of cysticercal vasculitis are therefore of interest14,1921.
Vasculitis or angiitis is a common finding.
Vessel walls show thickening of the adventitia with medial fibrosis and endothelial
hyperplasia. In smaller arteries and arterioles, a fibrotic reaction may completely
replace the media that proliferates towards
the endothelial layer in a concentric fashion
leading to complete occlusion of the vessel
lumen. The adventitia also thickens sometimes to the extent that it may be difficult to
recognize different layers of the vessel wall.
Finally, the elastica of the artery splits and

breaks up. In severe cases it is common to
find areas of hyaline fibrinoid necrosis15.
Occasionally, the vessels may be completely
necrotic in a manner akin to that seen in
immunoallergic reactions. With time however, the occluded vessels become recanalized14,1921. In large arteries, for example, the
basilar artery, atheroma-like deposits appear
in the endothelium. These may partially
occlude the vessel lumen (Fig. 30.9a). The
above changes are invariably associated with
an inflammatory cell infiltrate that may
involve all three layers of the vessel wall/s
(Fig. 30.9b). The intensity of inflammatory
response varies, and is not related to the
intensity of changes in the vessel wall/s. The
inflammatory infiltrate in the vessel walls is
particularly severe in cases of basal cysticer-
298
cotic meningitis. Venules are generally

spared, but in severe cases, as in the basal
cysticercotic leptomeningitis, they are also
affected; in such situations, their walls
thicken, but the lumen is rarely occluded.
Features of angiitis are usually restricted to
vessels located in the vicinity of the parasites. When a single cysticercus is found in
the leptomeninges or in the parenchyma, the
vascular changes, as well as the granulomatous inflammatory reaction, remain localized
emphasizing the point that the parasite usually triggers a local vascular reaction.
Tissue reaction 9,1416,19,22,23

In the case of subarachnoid cysticercosis, parasites commonly lodge in the sulci on the
convexity of the brain, and tend to displace
the adjacent cerebral cortex. The adjacent
parenchymal tissue has a beehive appearance
due to the presence of oedema. Secondary
reactive astrocytic gliosis can usually be
noted around the capsule. Some rod-shaped
hypertrophic microglial cells may be seen. A
variable degree of neuronal degeneration is
discernible. Uncommonly, some neurons may
be shrunken and ferruginated. A few vessels
may display perivascular cuffing with
mononuclear inflammatory cells. The above
mentioned changes are usually well circumscribed in the area around the parasite.
Tissue reactions around parenchymal cysticerci are essentially similar to those
described above. The inflammatory reaction
around parenchymal cysticerci is of variable
intensity; however, it tends to be more locally
circumscribed. However, in some cases, the
host inflammatory reaction is severe in intensity, and this reaction is termed the acute
encephalitic phase of NC24. Astrocytic gliosis
may also be of variable intensity. A small rim
of demyelination may be identified in the
vicinity of the parasite. In a significant number of instances there may be no inflammatory reaction around the parasite.
It is common for intraventricular cysticercal cysts to be attached to the ependymal lining of the ventricles. Subependymal
astrocytic glial proliferation engulfing the
parasite is commonly noted in such cases. At
times, the astrocytic proliferation is so

marked that it could be mistaken for an
astrocytoma. Gliosis is particularly marked
in fourth ventricular cysticercosis that leads
to obstruction of cerebrospinal fluid (CSF)
circulation. When the cysticercus does not
obstruct CSF flow, gliosis is less intense and
appears intermingled with loose irregular
strands of connective tissue that tend to form
part of the capsule surrounding the parasite.
The ependymal lining commonly displays a
granular ependymitis (Fig. 30.10a and b). It
exhibits
disruptions
by
proliferating
subependymal glial cells. Small clumps of
these subependymal glial cells can be seen
protruding into the ventricular cavity.
Granular ependymitis is usually restricted to
the area in the vicinity of the parasite,
although at times it may extend farther (Fig.
30.10c)15,19. The choroid plexuses may be
involved by the granulomatous reaction. In
our experience, it is common to find a pathological reaction composed of inflammatory
cells, proliferating fibroblasts and hyaline
changes in blood vessels of the choroid
plexus in fourth ventricular cysticercosis.
Regional Pathology
Depending upon anatomical location, NC is
classified into meningeal (subarachnoid),
ventricular,
parenchymal
and
mixed
forms10,15,19. In our experience, meningeal
and ventricular forms predominate, but the
incidence of individual forms will vary
according to the source of data.
Meningeal cysticercosis 4,1416,20,25

Three types of pathological syndromes due
to meningeal cysticercosis are recognized.
Convexity-meningeal cysticercosis
In this condition, cysticerci are lodged in the
depth of sulci over the cerebral convexity. Half
of the autopsy-confirmed cases of cysticercosis
correspond to this type. Cysticerci may lie free
on the surface or float in the subarachnoid
space, but are mostly firmly attached to the
299
Fig. 30.10. Intraventricular cysticercosis. (a) Vesicular cysticercus in the temporal horn of the right lateral
ventricle. There is granular ependymitis on the walls of the ventricle (scale bar: 5 mm). (b) The fourth
ventricle is occluded by a cysticercus in the granular-nodular stage (scale bar: 5 mm). (c)
Photomicrograph of the aqueduct blocked by the membrane of a cysticercus partially hyalinized. Note
the marked fibrosis, inflammatory infiltrate and gliosis around the parasite (Massons trichrome
technique; scale bar: 300 m).
300
leptomeninges (Fig. 30.7). The parasites may

even burrow a complete cavity into the cortical grey matter. The parasites may either be in
the vesicular stage with a slight thickening of
the leptomeninges or in the granular-nodular
stage. Occasionally a large meningeal cysticercus may become totally surrounded by a thick
collagenized capsule, which in neuroimaging
studies may be wrongly interpreted as primary or metastatic brain tumour; precise identification can be achieved by histological
examination (Fig. 30.11a and b).
Basal racemose cysticercosis

(Traubenhydatiden)1,4,15,19,25
When the parasites are located at the base of
the brain, in the cisterns around the brain
stem and cerebellum (Fig. 30.12a), or inside
the Sylvian fissure, the vesicles tend to be
multilobulated and joined together to form
conglomerates, that constitute the so-called
racemose form of cysticercosis. Sometimes
there is a large multilobulated vesicle with a
single cavity. Most of the time, however, the
Fig. 30.11. Encapsulated cysticercus. (a) An ovoid structure wrongly interpreted as a brain tumour upon
magnetic resonance imaging. Gross examination of the specimen displayed coarse granular fragments
and amorphous homogenous structures. (b) Histological section of (a) shows hyaline membranes, debris
and the scolex and hooklets of the cysticercus inside a thick collagen capsule with the use of Massons
trichrome technique (scale bar: 30 mm).
301
Fig. 30.12. Basal subarachnoid-cisternal cysticercosis. (a) Racemose cysticercosis. A clump of vesicular
cysticerci lie under the base of the cerebellum at the cisterna magna. (Reproduced with permission from
reference 25.) (b) Basal cysticercotic meningitis: Close up view of the base of the brain showing marked
fibrosis of the leptomeninges over the ventral wall of the diencephalon and the brain stem, obscuring the
vascular structures and cranial nerves. It is possible to identify a few cysticerci partially buried within the
gummatous arachnoiditis. (c) Thickening of the basal leptomeninges in this coronal section at the level of
the optic chiasma extending into both sylvian fissures (white solid arrow) and a large empty vesicle on
the left. Notice also the increased thickness of the vessels trapped in the meningitis and the granular
ependymitis on the walls of the third ventricle.
302
racemose forms appear to be made up of

multiple vesicles, some of them multilobulated, of variable size and shapes giving the
peculiar aspect that led Virchow to name
them Traubenhydatiden5. A racemose cyst
does not contain a scolex. However, careful
examination of cystic contents sometimes
leads to the identification of hooklets; this
appears to indicate that a scolex was present
initially but underwent hydropic degeneration subsequently. On rare occasions a complete larva may be identified.
Basal cysticercotic meningitis 9,14,15,19,22,25
In endemic regions, the pathologist may on
occasion be confronted by a specimen displaying marked thickening of the leptomeninges. The appearance is one of a thick
layer of fibrous granulomatous tissue covering the entire basal surface of the brain from
the optochiasmatic region to the caudal portion of the medulla and extending over the
sides to the dorsal mesencephalon and cerebellopontine angle (Fig. 30.13a and b, Fig.
30.12b and c). When examined with the
naked eye, no cystic parasites are seen and,
in their absence, pathological appearances
are indistinguishable from tubercular meningitis. Examination of multiple sections
through the leptomeningeal thickening may
discern cysts. Often a diagnosis of cysticercal
basal meningitis is based upon the histological demonstration of cysts or cystic remnants
(Fig. 30.14a and b). A good example of the
latter situation is the identification of degenerative festooned membranes surrounded by
granulomatous reaction with the aid of
Massons trichrome technique (Fig. 30.9c and
d). Vascular reactions of angiitis including
endarteritis and periarteritis, endothelial
proliferation, and hyaline and fibrinoid
necrosis are usually conspicuous in cysticercotic basal meningitis (Fig. 30.9a and b).
Cranial nerves also become encased in the
leptomeningeal fibrosis and display interstitial and perineural inflammation. The underlying parenchyma shows marginal gliosis,
inflammatory infiltrates, perivascular cuffing
and multiple ischaemic infarcts. Finally,
basal cysticercotic meningitis may lead to
ventricular dilation due to obstruction of the
foramina at the outlet of the fourth ventricle

or CSF cisternal pathways.
Intraventricular cysticercosis 19,26,27

The fourth ventricle is the most common
location of intraventricular cysticercosis.
More often than not, the cyst is single (Fig.
30.10a). When the cysts lodge at the foramen
of Monro, the aqueduct of Sylvius or the
fourth ventricle cavity (Fig. 30.10b and c), the
result is an obstructive symmetrical hydrocephalus19,26,27. Secondary syringomyelia and
syringobulbia28 may rarely develop as a complication of the chronic obstructive hydrocephalus due to fourth ventricular
cysticercosis. This is incidental to sustained
increased intraventricular pressure and to the
disruption of the ependymal lining with
marked subependymal glial proliferation.
Parenchymal cysticercosis
Cysticerci are usually located in the grey
matter owing to its rich blood supply.
Parasites are mostly located in the cortex,
though a few may be found in deep grey
structures. It is also possible to find cysts in
the subcortical white matter. The number of
parasites may reach several hundred, but
commonly one finds only a scattered few.
Parenchymal cysts are mostly homogenous
and less than 10 mm in size. They are round
or ovoid (Figs 30.1 and 30.6). The inflammatory reaction around parenchymal cysts is
well circumscribed and less intense in comparison
to
leptomeningeal
cysticerci.
However, in the acute encephalitic type of
NC, the host immune response is intense,
leading to diffuse inflammatory reaction and
oedema16,24,29.
Mixed forms
Most often, there occurs a combination of the
different types of cysticerci. In our pathological material, we commonly encounter a combination of meningeal and ventricular forms.
However, any combination is possible.
303
Fig. 30.13. Basal cysticercotic meningitis. (a) Axial section of lower brain stem showing intense thickening
of the leptomeninges over the ventral surface of the upper medulla. The fourth ventricle appears enlarged
due to blockage of the draining foramina and there is granular ependymitis. (b) Two axial sections of the
midbrain. There are fibrotic leptomeninges and occlusion of the aqueduct. The latter was due to a
cysticercus identified on histological examination (see Fig. 30.10). The substantia nigra appears pale.
Conclusions
The pathological spectrum of NC is as
wide as its clinical spectrum. A good
knowledge of usual as well as uncommon
pathological features is important for

pathologists in both endemic and nonendemic areas, keeping in mind the
increasing recognition given to NC in
developed countries.
304
Fig. 30.14. Basal cysticercotic meningitis. Macrophotographs of histological slides of sections (a)
through the middle pons, and (b) upper medullary level. The hyalinized membranes of cysticerci are
encased by the fibrotic leptomeninges. There is also granular ependymitis (Massons trichrome
technique; scale bar: 2 mm).
References
1. Aluja, A., Escobar, A., Escobedo, F., et al. (1987) Cisticercosis. Una recopilacin actualizada de los
conocimientos bsicos para el manejo y control de la cisticercosis causada por Taenia solium. Fondo de
Cultura Econmica, Mxico DF, Mxico, pp. 115.
2. Richards, F.O., Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County.
305
3. MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343363.
4. Henneberg, R. (1936) Die tierischen Parasiten des Zentralnervensystems. In: Bumke, O., Foerster, O.
(eds) Handbuch der Neurologie, Vol. 14. Springer Bd, Berlin, pp. 286322.
5. Virchow, R. (1860) Traubenhydatiden der weichen Hirnhaut. Archiv fr pathologische Anatomie und
Physiologie und fr klinische Medizin pp. 528 536.
6. Zenteno-Alans, G.H. (1965) Diagnsticos neuroquirrgicos en 2000 pacientes estudiados en la
unidad de neurologa y neurociruga del hospital general de la ciudad de Mxico. Revista Mdica de
Hospital General (Mxico) 28, 515528.
7. Villagrn-Uribe, J., Olvera-Rabiela, J.E. (1988) Cisticercosis humana. Estudio clnico y patolgico de
481 casos de autopsia. Patologa (Mxico) 26, 149156.
8. Costero, I. (1946) Tratado de Anatoma Patolgica, Vol. 2. Atlante, Mxico, pp. 14851495.
9. Escobar, A. (195253) Cisticercosis cerebral con el estudio de 20 casos. Archivos Mexicanos de
Neurologa y Psiquiatra 1, 145167.
10. Fuentes, M. (1948) Formas anatomoclnicas de la cisticercosis cerebral. Gaceta Mdica de Mxico 78,
155173.
11. Pitella, J.E.H. (1997) Neurocysticercosis. Brain Pathology 7, 681693.
12. Shenone, H., Villarroel, F., Rojas, A. (1982) Epidemiology of human cysticercosis in Latin America.
In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and
10251040.
14. Escobar, A. (1991) Pathology of neurocysticercosis. Neuropathology (Japan) (Suppl. 4), 348351.
15. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodrguez-Carbajal, J.,
Taveras, J.M. (eds) Cysticercosis of the Central Nervous System. Charles Thomas, Springfield, Illinois,
pp. 2754.
16. Silva, P., Escobar, A. (1996) Cysticercosis, other parasites and tuberculosis. American Society of
Neuroradiology, Core Curriculum in Neuroradiology. Part II. Neoplasms and Infectious Diseases,
pp. 193200.
17. Zee, C.S., Destian, S., Colletti, P., et al. (1990) Gadolinium enhanced MR imaging in neurocysticercosis. Radiology 177, 232.
19. Escobar, A., Nieto, D. (1972) Parasitic disease. In: Minckler, J. (ed) Pathology of the Nervous System,
Vol. 3. McGraw-Hill, New York, pp. 25072515.
20. Redalie, L. (1921) Deux cas de cysticercose crbrospinale avec mningite chronique et endartrite
oblitrante crbrale. Revue Neurologique (Paris) 28, 241266.
21. Rodrguez-Carbajal, J., Del Bruto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral
22. Escobar, A. (1960) Cisticercosis cerebral. Acta Politcnica (Mxico) 2, 275284.
23. Escobar, A. (1978) Cerebral cysticercosis. New England Journal of Medicine 298, 403404.
24. Rodrguez-Carbajal, J., Salgado, P., Gutirrez-Alvarado, R., et al. (1983) The acute encephalitic phase
of neurocysticercosis: computed tomographic manifestations. American Journal of Neuroradiology 4,
5155.
25. Escobar, A. (2000) Enfermedades parasitarias. Infecciones por metazoarios. In: Cruz-Snchez, F.F.
(ed.) Neuropathologia: Diagnstica y Clnica. Editores Mdicos SA, Madrid, Spain, pp. 315337.
26. Nieto, D. (1956) Cysticercosis of the nervous system. Diagnosis by means of the spinal fluid complement fixation test. Neurology 6, 725737.
27. Escobar, A., Vega, R., Herrera, M.P., et al. (1998) Neurocisticercosis de localizacin en el cuarto ventrculo. Gaceta Mdica de Mxico 134, 359361.
28. Escobar, A., Vega, J.G. (1981) Syringomyelia and syringobulbia secondary to arachnoiditis and
fourth ventricle blockage due to cysticercosis. Acta Neuropathologica (Berlin) (Suppl. 7), 389391.
29. Salgado, P., Rojas, R., Sotelo, J. (1997) Cysticercosis. Clinical classification based on imaging studies.
Archives of Internal Medicine 157, 19911997.
31
Single Small Enhancing Computed

Tomography Lesions Pathological
Correlates
Geeta Chacko
Introduction
The aetiology of single small enhancing
computed tomography lesions (SSECTLs)
in patients presenting with seizures
remained controversial despite several
radiological and immunological tests
(reviewed by Rajshekhar in Chapter 24).
The issue was resolved with the biopsy evidence that the majority of these lesions are
caused by cysticercus14.
Before considering the pathological correlates of SSECTL, it is recommended that
the reader should review the morphological
appearance and stages of development and
regression of a cysticercus given in the previous chapter (Escobar and Weidenheim,
Chapter 30).
fast and birefringent hooklets. The cyst has

three distinct layers: an outer cuticular layer,
middle or cellular layer and an inner or reticular layer. The inner or reticular layer has a
loose stroma containing fluid-filled spaces,
thin-walled vacuoles, excretory canaliculi
and calcareous corpuscles. These calcified
concretions or calcareous corpuscles probably represent calcification of the intracorporeal vacuoles (see Escobar and Weidenheim,
Chapter 30). Four stages are recognized in
the development and regression of cysticercus in the central nervous system, namely
the vesicular, colloidal, granularnodular
and fibrocalcified stages. These are reviewed
in detail in the previous chapter.
SSECTL: Pathology
Morphology and Evolution of
Cysticercus
Briefly, cysticerci are round or oval milky
white cysts of varied size, usually in the
range of 515 mm, with a translucent wall.
Each cyst is filled with clear fluid and contains a pearly-white, invaginated scolex (protoscolex). The protoscolex is attached to the
cyst by means of a neck and has a spiral
canal, four large suckers and a rostellum
with a double row of large and small acid-
Cysticercus cellulosae is the form of cysticercus observed in SSECTLs. As these lesions

are by definition less than 2 cm in diameter,
the racemose form, which is larger (412
cm), is not encountered. The macroscopic
appearance of an SSECTL could vary from
the typical thin-walled cyst to a well-circumscribed firm nodule. On microscopic examination however, the cavitary nature of the
lesion is apparent accounting for the typical
radiological appearance of a ring-enhancing
lesion. A minority of cases appear as hyalin-

307
308
G. Chacko
ized nodules (nodular or fibro-calcified

stage). The wall of the cavity is typically
lined by palisaded epithelioid histiocytes,
surrounded by dense infiltrates of inflammatory cells, chiefly, lymphocytes, plasma
cells and eosinophils. Neutrophil polymorphs and multinucleated giant cells may
also be present. The severity of the inflammatory reaction is highly variable. The
adjoining cerebral parenchyma is often gliotic with perivascular chronic inflammation
and variable amounts of fibrosis.
Chacko et al.5 noted viable (cystic or vesicular stage) or degenerate (colloidal or granular stage) forms of the cysticercus in about
50% of the cases of SSECTLs. When viable,
although the morphology of the parasite is
well discerned, one often encounters only
parts of the parasite. The degenerate form is
seen as an eosinophilic structure in which
parts of the scolex and bladder are identifiable in various stages of degeneration (Fig.
31.1). The calcareous corpuscles or calcified
intracorporeal vacuoles described in the
reticular layer of cysticercus cellulosae stand
out prominently in the degenerate forms and
may on occasion be the sole parasitic remnant seen in a biopsy (Fig. 31.2)5.
In cases of SSECTL, where the parasite is

not detected at biopsy further steps need to
be taken to arrive at a final diagnosis6:
1. Ensure that all the tissue submitted has
been processed.
2. Sections at multiple levels to look for the
parasite.
3. Special stains for fungal elements and
Mycobacterium tuberculosis.
Histological Differential Diagnosis

The histological differential diagnosis in the
absence of the cysticercus includes parasitic
granuloma of unestablished aetiology, tuberculoma, fungal granuloma and microabscess6. The
salient features of each of these are as follows.
Parasitic granuloma
The dominant features are a cavitary lesion
with an inner lining of palisaded histiocytes
and the presence of eosinophils in the
inflammatory infiltrate. Furthermore, there
should be no caseous necrosis, acid-fast
bacilli or fungal elements.
Fig. 31.1. Degenerated cysticercus outlined by calcified intracorporeal vacuoles (haematoxylin and
eosin; 200).
Single Small Enhancing CT Lesions
309
Fig. 31.2. Calcified bodies in amorphous debris without any typical cysticercus parts (haematoxylin
and eosin; 200).
Tuberculoma
Pathologically, a caseating granuloma composed of epithelioid histiocytes, lymphocytes
and Langhans multi-nucleated giant cells is
noted. Acid-fast bacilli may be identified
with the Ziehl-Neelsen stain.
and a wall composed of non-specific inflammatory granulation tissue. However,

microabscesses, in the clinical and radiological setting of a typical SSECTL, with negative cultures, and no extracranial focus of
infection may represent acute degeneration
of the parasite6.
Fungal granuloma
Conclusions
A granuloma containing multinucleated

giant cells, lymphocytes and plasma cells is
visible. Fungal elements can be demonstrated with special stains.
Microabscess
This is a non-granulomatous cavitary lesion
with inflammatory exudate in the cavity
In conclusion, an SSECTL may be seen at

any stage in the natural evolution of
Cysticercus cellulosae. At one end of the
spectrum the entire parasite might be identified while at the other end calcareous
residues might be the only evidence of a cysticercal aetiology of the granuloma. The vast
majority are seen as cavitary lesions while a
minority shows a fibrous cicatrix.
References
1. Rajshekhar, V. (1991) Etiology and management of single small enhancing CT lesions in patients
with seizures: understanding a controversy. Acta Neurologica Scandinavica 84, 465470.
2. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single, small, enhancing CT lesions in Indian
310
G. Chacko
3. Rajshekhar, V., Haran, R.P., Prakash, S.G., et al. (1993) Differentiating solitary small cysticercus granulomas and tuberculomas in patients with epilepsy: clinical and computerized tomographic criteria.
4. Rajshekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlations
in patients with solitary cysticercus granuloma and epilepsy: focus on presence of parasite and
edema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284286.
5. Chacko, G., Rajshekhar, V., Chandy, M.J., et al. (2000) The calcified intracorporeal vacuole: an aid to
the pathological diagnosis of solitary cerebral cysticercus granulomas. Journal of Neurology,
6. Chacko, G. (2000) Pathogenesis and pathology of neurocysticercosis. In: Rajshekhar, V., Chandy, M.J.
(eds) Solitary Cysticercus Granuloma the Disappearing Lesion. Orient Longman, Chennai, India,
pp. 96111.
32
Imaging and Spectroscopy of

Neurocysticercosis
Deepshikha Sharda, Sanjeev Chawla and Rakesh K. Gupta
Introduction
Neurocysticercosis (NC) can be classified into
cranial (parenchymal, ventricular, subarachnoid-cisternal), spinal and mixed, depending
upon the site of involvement. Parenchymal
NC is characterized by one or several
rounded or oval cyst/s measuring from 5
mm to 15 mm in diameter, with a thin,
translucent, membranous wall1. Each cyst is
filled with clear fluid and contains a pearly
white invaginated scolex2. Larger cysts, 24
cm in diameter, are rare2. Racemose forms of
cysticercosis are less frequent. Racemose
cysts are 412 cm and are devoid of a scolex.
The coexistence of cellulose and racemose
forms of cysticercosis is observed in about
10% cases1. The number and location of parasites vary widely. Solitary cysticerci are found
in 253% of the cases3. When multiple, the
cysticerci are usually few in number; the
finding of hundreds of parasites, characterizing the disseminated form, is rare4.
Neurocysticercosis is a disorder with a
prolonged and variable course. Not infrequently, it may remain asymptomatic, being
detected only upon imaging or autopsy.
Cysts may remain viable in the central nervous system (CNS) for several years (usually
13 years), depending on the host immune
tolerance. Morphologically, four stages of
development and regression of the cysticer-
cus in the CNS are recognized1,5.These form

the basis of the understanding of imaging
findings in NC (see Chapter 30).
1. Cystic or vesicular stage: The cyst is viable
and has a well-defined, fluid-filled membrane, which unlike the hydatid cyst contains only one scolex. It is surrounded by a
discrete fibrillary astrocytosis.
2. Colloid stage: This is the earliest stage in
the involution of the cyst. The fluid contents
of the cyst become more turbid and the
scolex begins to degenerate.
3. Necrotic, granular stage: This stage is characterized by parasite necrosis and surrounding inflammation. The cyst gives an
appearance of an eosinophilic structure in
which the bladder and scolex are in various
stages of disintegration. The adjacent neural
tissue shows moderate to intense fibrillary
astrocytosis. Oedema and/or necrosis of the
surrounding neural tissue may be present in
some cases.
4. Fibro-calcified nodule: With time, fibrosis
develops, progressively occupying the entire
lesion. This stage can be macroscopically
recognized as a nodule of a smaller size than
the bladder in the preceding stage, with a
whitish, white-greyish or greyish central
area surrounded by a thin capsule of greyish
or somewhat whitish colour, corresponding
to the necrotic cysticercus and fibrosis,
respectively. A residual cellular infiltrate

311
312
D. Sharda et al.
may be seen in some instances. The fibrous

nodule frequently calcifies, as seen in
5764% of cases on computed tomography
(CT)3,6. Calcification as noted upon CT may
represent partial dystrophic calcification of a
necrotic larva or the calcareous corpuscles1,2.
Dystrophic calcification is a long process
and may take from 2 to 10 years to be
detected on roentgenographs.
When multiple, lesions are often at different stages of their development, a phenomenon that could reflect different infectious
episodes. The sequence of events for any single lesion is from an innocuous cyst to granuloma and then to a calcified nodule.
However, a cysticercus may move from one
stage to another stage by skipping the regular sequences of stages or may disappear
completely with or without undergoing any
sequence of degeneration. This may take
several years in untreated lesions and several
months for treated lesions.
Plain Skull Roentgenograms

Parenchymal lesions are characterized by
either mass effect or intracranial calcification. Signs of raised intracranial tension
such as sutural diastasis, enlargement of
sella turcica and erosion of anterior and
posterior clinoid processes may be seen
upon skull roentgenograms. Calcification is
representative of dead larva(e). However,
the presence of calcification does not
exclude the presence of live larvae; active
cysts have been demonstrated concomitantly with calcified lesions. Typically, the
calcified cysticercus gives the appearance of
slightly off-centre spherical calcification of
12 mm in diameter representing the dead
scolex. It may be surrounded by a 712 mm,
partially or totally calcified sphere representing the body of the cystic larva (Fig.
32.1a)7. Old shrunken (57 mm) cysts may
lose their spherical shape, yet maintain a
recognizable morphology. One often finds
that innumerable calcified cysts are distributed in the brain in a pattern perfectly compatible with the proportion of blood supply
as judged on stereoscopic frontal and lateral
views7. The small (23 mm) rounded shape

of cerebral cysticercosis is distinguishable
from the larger oat-shaped calcification in
muscle (Fig. 32.1b). Cyst calcification is less
frequent in the neuraxis than in muscle.
Also, NC frequently coexists with muscle
cysticercosis. Therefore, in the past, soft-tissue radiography would often establish a
diagnosis of cysticercosis when skull
roentgenograms were normal8.
Cranial Conventional Angiography

In the pre-cross-sectional imaging era, conventional angiography was used to demonstrate mass effect. Displacement of the
vessels and early venous drainage due to
soft-tissue masses produced by live
parenchymal larvae have been described
(Fig. 32.2)9. Angiography is also useful in
demonstrating vasculitis in association with
meningeal racemose cysticercosis. Findings
range from mild arterial narrowing to complete occlusion along with distortion of
carotid and/or vertebral arteries (see
Chapter 22)10. Abnormalities are most severe
in the immediate vicinity of racemose cysts.
On occasion, an angiogram may reveal an
inflammatory aneurysm in the vicinity of a
racemose cyst11. In the present-day context,
however, conventional angiography is rarely
required and has been replaced by CT and
magnetic resonance imaging (MRI).
Negative and Positive Contrast

Ventriculography
Negative contrast (air) studies are hazardous and of historical importance only.
One finds ample illustrations of hydrocephalus, asymmetry of the lateral ventricles and atrophy of the brain parenchyma
as well as large ventricular cysts in older
literature (Fig. 32.3a)7,12. Positive contrast
cisternography and ventriculography with
the aid of intraventricular metrizamide outlines cisternal and ventricular cysts (Fig.
32.3b). Ependymitis and ventricular
synechiae may be visualized as septate
ventricular loculations7.
Imaging and Spectroscopy of Neurocysticercosis
(a)
313
(b)
Fig. 32.1. (a) Calcified intracranial cysticercosis.

Lateral view of skull radiograph showing
innumerable calcified cysts scattered in the brain.
Few of them (arrows) show an off-centre spherical
calcification of 12 mm representing the scolex.
(b) Calcified cysticercosis of the skeletal muscles.
Radiograph of the lower limb showing multiple
oblong calcified densities along the plane of the
muscle fibres.
Computed Tomography
Parenchymal neurocysticercosis
Computed tomography is useful in studying
the natural course of disease, identifying evolutionary stages of cysticercosis with an
intention of determining therapeutic strategy
and prognosis as well as monitoring response
to anticysticercal drugs. Machado et al. studied the profile of evolution of NC based on
CT13. Cysts were intact in consecutive CT
scans up to 11 months and exhibited signs of
degeneration by about 18 months after praziquantel drug therapy. Nodular calcifications
appeared by about 25 months. Therefore, the
entire life history of a cyst discovered in the
brain upon CT spanned at least 36 months.
Vesicular stage (living larvae)

On non-contrast CT, vesicular cysticercus
gives an appearance of a round cyst of
520 mm size, with density similar or
slightly higher (1020 HU) than cerebrospinal fluid (CSF) (010 HU) (HU =
Hounsfield unit). A 24 mm, mural nodule
representing
its
scolex
may
be
identified14,15. The latter is partially or completely calcified and placed eccentrically
within the cyst (Fig. 32.4a and b). The
bloodbrain barrier remains intact during
this stage. Therefore, as a rule, the cyst wall
and scolex do not enhance following
administration of contrast. Cysticercus cysts
in the vesicular stage need to be differentiated from arachnoid cysts, porencephalic
314
D. Sharda et al.
Fig. 32.2. Conventional cranial angiogram (lateral view). The mass effect on the distal branches of the
middle cerebral artery secondary to the cluster of intraparenchymal cysts in the left parietal region is noted.
Fig. 32.3. (a) Air-contrast study demonstrating dilatation of the right lateral ventricle owing to obstruction
of the right foramen of Monro. The obstructing cyst is not clearly made out. (b) Metrizamide
ventriculogram followed by introduction of air through lumbar puncture demonstrating the dilated lateral
ventricles and the outline of a cyst within.
cysts and cystic astrocytoma14. Vesicular

cysticercus does not produce symptoms;
when single it is detected as an incidental
finding upon imaging studies. In the case of
multiple cysticercosis, other lesions at different stages of evolution may be seen; the
latter are responsible for bringing the
patient to attendance.
315
Fig. 32.4. Vesicular (a) and calcified (b) stage of neurocysticercosis. Non-contrast computed tomography
scan at supraventricular level showing multiple cysts each with an eccentrically placed nodule
representing the scolex (a). The cysticerci are not surrounded by oedema. Calcified cysticerci can be
made out in addition to the vesicular cysticerci (b).
Colloidal stage (degenerating larvae)

Contrast-enhanced (CE) CT reveals a cystic
lesion with enhancing walls surrounded by
irregular hypodensity representing perilesional oedema. In the early stages of the
degeneration, an eccentrically placed scolex
may be seen.
Granularnodular stage
Non-contrast CT reveals an isodense cyst
with a hyperdense-calcified scolex and surrounding oedema. The walls of the granuloma may be hyperdense because of calcium
deposition16. Granulomas are of variable
sizes, but even if quite small, they usually
have a definite ring or disc pattern of contrast enhancement around a low-density centre (Fig. 32.5a and b). The ring is of variable
thickness, but usually thicker than that in
pyogenic abscess17. The evolutionary stages
form a continuous spectrum. Hence, the cyst
wall and scolex may be identifiable even
during the granularnodular stage. Multiple
homogeneously hypodense nodules with
surrounding oedema and contrast enhance-
ment may simulate metastasis. In the

absence of demonstration of scolex, imaging
features are non-specific. Similar findings
may be seen in tubercular, sarcoid and fungal granulomas, metastasis, multiple sclerosis, glioblastoma multiforme and other
neoplastic lesions.
This stage is represented by a small
(711 mm), round, punctate or oval, highattenuation areas (80360 HU)1416. Rarely calcifications may be reasonably large. Calcified
granulomas are not associated with mass
effect and do not enhance after contrast
administration. However, perifocal oedema
may be present, particularly if CT is undertaken within 2472 hours of a seizure (Fig.
32.6ac)14. Calcified cysticerci may be single or
multiple. They are usually located within the
grey matter or at greywhite matter junctions.
Rarely, they may be seen in basal ganglia and
deep white matter. The differential diagnosis
of multiple, dispersed calcifications includes
toxoplasmosis and tuberous sclerosis14.
316
D. Sharda et al.
Fig. 32.5. Granulomatous stage of neurocysticercosis. Non-contrast computed tomography (a) at

supraventricular level showing a hypodense lesion. Contrast-enhanced computed tomography (b) at
same level revealing a ring-enhancing lesion with surrounding oedema.
Acute encephalitic parenchymal

cysticercosis
This serious and occasionally fatal condition
is characterized by non-calcified high-density nodules that enhance upon CECT9,18,19.
Cysts may be multiple or diffuse (85%) or,
less commonly, localized12. Lesions vary in
sizes and are located in the cerebral cortex;
but may also be seen in the white matter and
basal ganglia. They are associated with florid
oedema, which, in the absence of contrast,
appears as a diffuse, low-density area with
irregular contour. The description of throttled ventricles with or without high attenuating sago-grain lesions is typical20. The
encephalitic phase lasts from 2 to 6 months,
with oedema persisting for some time after
resolution of pathological enhancement13.
CT may detect small calcifications as early as
8 months after the acute phase19.
Monro, aqueduct or fourth ventricle may

result in focal or asymmetrical dilatation of
the ventricular system. A cyst may also
cause displacement of the choroid plexus.
Ventricular obstruction and hydrocephalus
may be intermittent since the cyst is freely
movable. The possibility of relocation of an
intraventricular cyst between initial imaging and surgery should be kept in mind and
imaging should be repeated immediately
before planned surgery.
Positive contrast (metrizamide) CT ventriculography is useful in demonstrating
intraventricular cysts (Fig. 32.7a and b).
Delayed CT scans may divulge fluid levels
within the cysts because of diffusion of
metrizamide across the cyst wall17,21.
Intraventricular cysts can be confused
with intraventricular tumours such as colloid cyst, ependymal cyst, choroid plexus
cyst and intraventricular epidermoid10.
Intraventricular cysticercosis
Subarachnoid-racemose cysticercosis
Intraventricular cysticercosis may not be
identified upon CT because of a thin wall,
approximate CSF-equivalent content and
lack of contrast enhancement. Therefore,
evidence for intraventricular cysticercosis is
often indirect. For instance, an expanding
cyst or obstruction of the foramen of
Visualization of subarachnoid-racemose
cysts on CT scan depends upon their size
and location. Cysts have a density identical to the CSF. Furthermore, cyst walls are
too thin to be identified. Therefore, their
recognition depends upon deformity of
317
Fig. 32.6. Calcified stage of neurocysticercosis. Non-contrast computed tomography (a) and T2weighted axial magnetic resonance imaging (b) showing a calcified lesion. One year later, after the
patient had a seizure, a post-gadolinium T1-weighted image revealed a ring-like enhancement and
surrounding oedema (c).
the normal configuration of cisterns.

Relatively large cysts are required to
deform the quadrigeminal, cerebellopontine and suprasellar cisterns. Smaller cysts
are readily detected in the Sylvian fissure
and cortical sulci. Cysts are usually pliable
and conform to the shape of the cisterns in

which they lie. Despite this, chronic pressure effects with bone remodelling may be
noted. CECT scan may show leptomeningial enhancement in the basal cisterns around cysts or more diffusely. The
318
D. Sharda et al.
(a)
(b)
Fig. 32.7. Intraventricular neurocysticercosis. T1-weighted magnetic resonance imaging (a) showing
asymmetric dilatation of the lateral ventricles with no discernable intraventricular lesion. Metrizamide
computed tomography ventriculography (b) clearly depicting two intraventricular cysticerci. (Source:
Svetlana Agapejev, So Paulo, Brazil.)
ensuing fibrosis may obliterate portions of

cisterns. If more diffuse, meningeal fibrosis
leads to communicating hydocephalus.
When cysticercal meningitis causes vasculitis, CT manifestations include luxury perfusion and/or infarction, typically in the
vicinity of racemose cysts (Fig. 32.8a and b).
Positive contrast CT cisternography is useful in outlining subarachnoid-racemose
cysts. Intrathecal metrizamide (45 ml at a
maximal concentration of 250 mg ml1)
opacifies the basal cisterns, permitting
demonstration of subarachnoid cysts20.
Magnetic Resonance Imaging

Parenchymal neurocysticercosis
Magnetic resonance imaging is superior to
CT for the study of parenchymal NC. It may
reveal multiple cysticerci in individuals
with normal appearing CT22. MRI findings
of parenchymal cysticercosis are protean,
due to the various evolutionary stages of
the cysts2329.
Early pre-vesicular stage

At a very early stage, soon after invading the
brain parenchyma, the embryo is non-cystic;
MRI does not show any abnormality. During
its initial development into a larva, focal
non-enhancing areas of oedema may be seen,
that may progress to a small homogeneously
enhancing lesion in a few months28,30. These
abnormalities are incidental to the immature
bloodbrain barrier during this stage.
Vesicular stage
After 312 months, the cysticercus is fullygrown with a bladder containing clear fluid.
This is the vesicular stage, which gives an
appearance of a round cyst with a mural nodule representing the scolex2329. The cyst is
hyperintense on T2-weighted images and
hypointense on proton density (PD)- and T1weighted images, whilst the scolex is seen as
an eccentrically placed nodule, hypointense on
T2-weighted images and hyperintense on PDand T1-weighted images (Fig. 32.9a). There is
no perifocal oedema. Post-contrast study does
not reveal enhancement (Fig. 32.9b)30.
319
Fig. 32.8. Racemose cysticercosis with cerebrovascular manifestations. Contrast-enhanced computed

tomography (a) and corresponding post mortem pathological study (b) depicting multiple racemose cysts
(arrows) in the right Sylvian cistern, left cistern and the interhemispheric fissure and area of infarction
(Inf). (Source: Svetlana Agapejev, So Paulo, Brazil.)
Fig. 32.9. Vesicular neurocysticercosis. T1-weighted axial (a) and post-gadolinium T1-weighted coronal
magnetic resonance imaging (b) showing the clear cystic contents, the eccentric scolex and the lack of
enhancement or surrounding oedema. (Source: Eric Kossof, Baltimore, USA.)
320
D. Sharda et al.
Colloidal stage
As the larva begins to degenerate, cystic
fluid becomes turbid, the surrounding capsule thickens and an intense inflammatory
cell response appears around the cyst. The
increased signal intensity of cystic fluid,
thickening of cyst wall, surrounding
oedema and contrast enhancement are evident upon MRI (Fig. 32.10a, b and d)2330.
The signal intensity of cystic fluid is higher
than that of CSF on T1- and PD-weighted
images owing to a higher protein content.
At times the cystic fluid may appear bright
on T1 images31,32. On T2-weighted images,
the cystic fluid and surrounding oedema
appear hyperintense, whereas the cyst wall
and the scolex appear isointense or
hypointense relative to brain parenchyma.
Contrast enhancement is usually ring
shaped. A fluid level may be seen within the
cyst32. During or early after institution of
anticysticercal
treatment,
degenerative
changes are accelerated, which is reflected
by an increase in surrounding oedema,
increased intensity of cystic fluid on T1- and
PD-weighted images and more marked contrast enhancement28,33.
Nodulargranular stage
In this stage, the larva retracts and its fluid
content is absorbed. Its inflammatory capsule becomes thick and collagenous. The
lesion appears isointense to the normal
brain parenchyma on T1-weighted images
and isointense to hypointense with or without a central hyperintense signal on T2weighted images (Fig. 32.11ac). On
contrast-enhanced T1-weighted images, it
appears as a homogeneously enhancing or
ring-shaped enhancing nodule with or without surrounding oedema. These appearances are in common with tuberculoma,
other granulomatous conditions, small
abscess and metastatic tumours2329.
The shrunken mineralized larva appears
isohypointense on T1-weighted images and
hypointense on T2-weighted images.

Hypointensity in T2-weighted images could
be incidental to fibrosis or calcification.
Demonstration of susceptibility on T2* imaging can differentiate calcified from non-mineralized, fibrosed larvae.
Intraventricular cysticercosis
Magnetic resonance imaging permits visualization of scolex, rim of the cyst wall and
subependymal tissue reaction. The different
intensities between cystic contents and CSF
are readily appreciable on MRI28,34. Cyst
contents are hyperintense, relative to CSF on
T1- and PD-weighted images due to higher
protein content and cellular debris35. In the
healing stages, the cyst wall may be adherent to the ventricular wall, with ensuing
ependymal and subependymal inflammation that is reflected by subependymal rim
of high intensity on PD- and T2-weighted
images28,35. In general, T1- and PD-weighted
images are better than T2-weighted images
because the high signal intensity of cystic
fluid is indistinguishable from CSF and
subependymal oedema on T2-weighted
images. Sagittal T1 sections are particularly
useful for evaluation of aqueductal stenosis
that may occur as a result of fibrotic adhesions secondary to ependymal inflammation. It is also useful for differentiating
fourth ventricular cysticercosis from a
dilated fourth ventricle. However, the two
conditions may be indistinguishable on conventional MRI at times28.
Subarachnoid racemose cysticercosis

Cisternal cysticercosis is readily identifiable
on MRI as multiple cystic masses within
basal cisterns28. Racemose cysts may be
large and lobulated causing compression of
adjacent structures. The signal intensity of
cyst contents usually parallels that of CSF
on all MRI pulse sequences. The cyst walls
may be seen as septum-like curved lines on
T1-weighted images but are usually masked
by high intensity of CSF on T2-weighted
321
Fig. 32.10. T2-weighted axial image (a) at the level of midbrain shows multiple hyperintense areas
bilaterally with perifocal oedema in some. T1-weighted image (b) shows hypointense nature of these
lesions. On magnetization transfer-T1-weighted image (c), peripheral hyperintensity is seen in some of
the lesions. Post-contrast T1-weighted image (d) shows ring-enhancement of the lesions in the left frontal
and right occipital region.
322
D. Sharda et al.
Fig. 32.11. T2 hypointense cysticerci. T2-weighted

axial image (a) through the level of midbrain/pons
shows evidence of T2 hypointense areas in the
cerebellar hemispheres, bilateral temporal lobes
and in the left crus cerebri. A hyperintense lesion
is also seen in the right temporal lobe. On
magnetization-transfer T1-weighted image
(b) visualization of these lesions is difficult and
the magnetization-transfer ratio from the T2
hypointense areas was more than 35%. Only T2
hyperintense areas are seen on T1-weighted
image (c) and rest of the lesions are isointense
and not visible.
images28. The scolex cannot be seen as it

has already degenerated in racemose cysts.
There is no appreciable enhancement of the
cyst wall after contrast administration. The
visualization of a large multilobulated
cyst(s), lacking a mural nodule in specific
cisternal location with surrounding leptomeningeal enhancement strongly points
towards a diagnosis of racemose cysticercosis, especially in endemic areas.
Chronic granulomatous meningitis and

fibrosis in the basal cisterns may result in
communicating hydrocephalus. Contrastenhanced MRI may reveal various degrees of
leptomeningeal enhancement in the basal
cisterns. Proliferative endarteritis either due
to basal exudates or due to the presence of a
cyst close to the vessel wall may cause lacunar infarction or, rarely, infarction in the territory of a major artery36.
Initially solid,
later cystic
developing
larva
Cystic with
fluid-filled
thin
membrane,
single scolex,
no inflammatory
response
Cystic with
hyaline
degeneration,
cyst fluid thicker
and proteinaceous, breach
in bloodbrain
barrier and
surrounding
inflammation
Retractedinvoluted larva
with fragemented
contents
(including scolex)
thick capsule,
inflammation less
Mineralized
larva,
inflammation
may or may
not be seen
Pathological
characteristics
May be
normal or
reveal
calcification
Hypodense
with
surrounding
oedema
Hypodense,
surrounding
oedema
may be
present
Isodense / ?
hypodense
Normal
NCCT
May be
enhancing
Ring- or discshaped contrast

enhancement
Usually no
contrast
enhancement
except in
early stages
of degeneration
( 3 months)
Ring or disc
shaped
contrast
enhancement
Normal / ?
hyperdense
specs
CECT
Isointense/
hypointense
Intensity
CSF
Hypointense
Proton
density
Hypointense
Iso-/
hypointense
Iso-/hypointense
with central
hyperintensity
Hyperintense
Intensity
CSF
Isointense
Hyperintense
Isointense
T2
Hypointense
Isointense /
hypointense
T1
NCCT: Non-contrast CT; CECT: Contrast-enhanced CT; CSF: Cerebrospinal fluid.
Fibrocalcified
Granularnodular
Colloidal
Vesicular
Prevesicular
Stage
MRI
May be
enhancing
Usually not,
except in
early
degenerating
stage
No
Oedema
Not usually
seen
May be
present
Usually
present
May be
Always
present (T1 present
isointense,
T2 iso-/
hypointense)
Present
Not seen
Scolex
Ring-/noduleOccasionlike enhancement ally present
Enhances after
contrast
Non-enhancing
May
enhance
very early
Postcontrast
Table 32.1. Correlation of histopathological and computed tomography (CT) and magnetic resonance imaging (MRI) features of various stages of neurocysticercosis.

323
324
D. Sharda et al.
Novel Imaging Techniques

Magnetization transfer MRI has been
recently applied to the differentiation of cysticercus granuloma from tuberculoma37.
Magnetization transfer ratios in T2 hypointense portions of cysticercus granulomas
are significantly lower in comparison to
those in tuberculoma as well as normal grey
and white matter.37 This is because of higher
protein and amino acid content of cysticercus granulomas in comparison to tuberculomas (Fig. 32.11ac)37. Lately, we have
demonstrated the relationship between the
perilesional gliosis as observed on magnetization transfer MRI and epileptogenic potential of healed cysticercus granulomas (Fig.
32.10c)38,39. Identification of perilesional gliosis on magnetization transfer MRI may predict late onset seizures, i.e. seizures after the
cysticercus granuloma has healed. The identification of such individuals is important,
because there is a subset, however small in
number, that are prone to seizure recurrence
after the granuloma has healed40.
Calcified larvae are difficult to differentiate from occult vascular malformation or
cavernous haemangioma on T2-weighted
images. Use of phase imaging utilizing the
difference in phase of these two conditions
permits this41. Calcification exhibits positive
phase while occult vascular malformations
demonstrate negative phase. Three-dimensional constructive interference in steadystate MRI sequences are able to demonstrate
intraventricular cysticercosis better than conventional techniques42,43. This modality may
be potentially useful in distinguishing intraventricular cysticercosis from a dilatedtrapped ventricle.
In vivo proton magnetic resonance spectroscopy has been anecdotally used to
study NC44,45. Lactate, succinate, acetate,
alanine and an unassigned resonance at 3.3
ppm were among the metabolites detected.
A few of these have also been observed in
hydatid cysts and brain abscesses.
Cysticercus and tubercular granulomas can
also be differentiated on the basis of
NAA/Cho, NAA/Cr and Cr/Cho ratios
(Cho, choline; Cr, creatine; NAA, N-acetylaspartate)45. A high NAA and Cr content
has been reported in the former45. We performed ex vivo and in vitro magnetic resonance
spectroscopy
in
cysticercus
granulomas and did not find any NAA in
these lesions. Therefore, it is possible that
NAA signal is a result of partial volume
effect of the voxel. On the contrary, we
have observed succinate and lactate in
our in vivo studies (Fig. 32.12ad).
Contamination of the voxel from the surrounding oedematous brain parenchyma
may be responsible for this signal46.
Anecdotal experience of positron emission tomography (PET) in NC revealed areas
of decreased cerebral uptake of [18F] 2-fluoro-2-deoxyglucose corresponding in location to resolving cysticercus granuloma47.
Conclusions
In conclusion, the radiological manifestations of NC are as varied as its clinical presentations. Critical appreciation of the stages
of evolution of the cysticercus is important
and forms the basis of the understanding of
its neuroimaging features. Each stage in the
involution of the cysticercus has characteristic imaging attributes. Conventional crosssectional imaging has few limitations,
especially with regard to extraparenchymal
NC. Research is currently focusing on the
development of improved techniques for
identification of atypical and uncommon
forms and their differentiation from other
infectious disorders. Contrast CT ventriculography and the newer MRI technique of
three-dimensional constructive interference
in steady-state imaging are useful in delineating intraventricular cysticercosis. In vivo
proton magnetic resonance spectroscopy and
the magnetization transfer ratios of the T2
hyperintense portions of the cysticercus
granuloma are useful in differentiating it
from other granulomatous disorders. The
identification of perilesional gliosis upon
magnetization transfer MRI is predictive of
late seizure recurrence in patients with NC.
Finally, phase-contrast imaging and T2*
imaging are useful in the identification of the
calcified stage of NC.
325
Fig. 32.12. T2-weighted image (a) through the supraventricular region shows a hyperintense mass with
hypointense rim and associated perifocal oedema. The lesion appears hypointense on T1-weighted
image (b). In vivo proton-MRS done using spin echo shows a prominent resonance at 2.4 ppm consistent
with succinate (S) and a small resonance of lactate at 1.33 ppm (L). The resonances at 2.02, 3.02 and
3.22 ppm are seen as contaminant from the parenchyma around the cyst assigned to N-acetylaspartate
(NAA; 1), creatine (Cr; 2), and choline (Cho; 3) respectively (c). Ex vivo proton-MRS confirmed the
assignments seen in vivo (d).
326
D. Sharda et al.
References
1. Rabiela Cervantes, M.T., Rivas-Hernandez, A., Rodrigues-Ibarra, J., et al. (1982)
Anatomopathological aspects of human brain cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et
al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp.
179200.
2. Orihel, T.C., Ash, L.R. (1995) Parasites in Human Tissues. American Society of Clinical Pathologists,
Chicago, Illinois.
3. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri. Review of 127 cases. Archives of
4. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations, including CT
5. Ahuja, G.K., Roy, S., Kamla, G., et al. (1978) Cerebral cysticercosis. Journal of the Neurological Sciences
35, 365374.
7. Santin, G., Vargas, J. (1966) Roentgen study of cysticercosis of central nervous system. Radiology 86,
520527.
8. Sutton, D. (1990) Infection T. In: Young, J.W.R., Sutton, D. (eds) A Short Textbook of Clinical Imaging.
Springer Verlag, London, pp. 774.
9. Carabajal, J.R., Palacious, E., Azar-Kia, B., et al. (1977) Radiology of cysticercosis of the central nervous system including computed tomography. Radiology 125, 127131.
10. Gonzalez, C.F., Palaci, E. (1985) Infections and inflammatory diseases. In: Gonzalez, C.F., Grossman,
C.B., Masdeu, J.C. (eds) Head and Spine Imaging. John Wiley & Sons, New York, pp. 397431.
11. Soto, H.J.L., Gomez, L.A.S., Rojas, E.L.A., et al. (1996) Subarachnoid hemorrhage secondary to a ruptured inflammatory aneurysm: possible manifestation of neurocysticercosis: case report.
12. Bhargava, S. (1983) Radiology including computed tomography of parasitic diseases of the central nervous system. Neurosurgical Review 6, 129137.
13. Machado, L.R., Nobrega, J.P., Barros, N.G., et al. (1990) Computed tomography in neurocysticercosis: a 10-year long evolution analysis of 100 patients with an appraisal of a new classification.
14. Noujaim, S.E., Rossi, M.D., Rao, S.K., et al. (1999) CT and MR imaging of neurocysticercosis.
American Journal of Roentgenology 173, 14851490.
15. Enzmann, D.R. (1994) Central nervous system infections. In: Putman, C.E., Ravin, C.E., Bowie, J.D.,
et al. (1988) Textbook of Diagnostic Imaging. WB Saunders, Pennsylvania, pp. 241242.
16. Silva, J.E., Diefenthaler, A.P., Palma, J.K. (2000) Frequency of suspected cases of neurocysticercosis
detected by computed skull tomography in Santa Maria, R.S., Brazil. Revista do Instituto de Medicina
Tropical de Sao Paulo 42, 5758.
17. Enzmann, D.R. (1984) Cysts. In: Imaging of Infections and Inflammations of the Central Nervous System:
Computed Tomography, Ultrasound and Nuclear Magnetic Resonance. Raven Press, New York, pp. 103119.
18. Carabajal, J.R., Palacious, E., Azar, K.B., et al. (1977) Radiology of cysticercosis of the central nervous
system including computed tomography. Radiology 125, 127131.
19. Rodriguez, C.J., Salgado, P., Gutierrez, A., et al. (1983) The acute encephalitic phase of neurocysticercosis: computed tomographic manifestations. AJNR American Journal of Neuroradiology 4, 5155.
20. Carabajal, J.R., Duran, B.B., Dorfsman, J., et al. (1987) The role of computed tomography (CT) in the
diagnosis of neurocysticercosis. Childs Nervous System 3, 199202.
21. Zee, C.S., Tasi, F.Y., Segall, H.D., et al. (1981) Entrance of metrizamide into an intraventricular cysticercosis cyst. American Journal of Neuroradiology 2, 189191.
22. Sharma, K., Gupta, R.K. (1993) Negative scan in neurocysticercosis. Pediatric Neurosurgery 19,
206207.
23. Teitelbaum, G.P., Otto, R.J., Lin, M., et al. (1989) MR imaging of neurocysticercosis. American Journal
of Neuroradiology 153, 857866.
25. Suss, R.A., Maravilla, K.R., Thompson, J. (1986) MR imaging of intracranial cysticercosis: comparison with CT and anatomopathologic features. American Journal of Neuroradiology 7, 235242.
327
26. Jena, A., Sanchetee, P.C., Gupta, R.K., et al. (1988) Cysticercosis of brain shown by magnetic resonance imaging. Clinical Radiology 39, 542546.
27. Creasy, J., Alacron, J. (1994) Magnetic resonance imaging of neurocysticercosis. Topics in Magnetic
Resonance Imaging 6, 5968.
28. Chang, K.H., Cho, S.Y., Hesselink, J.R., et al. (1991) Parasitic diseases of the central nervous system.
29. Chang, K.H., Lee, J.H., Han, M.H., et al. (1991) The role of contrast enhanced MR imaging in the
diagnosis of neurocysticercosis. American Journal of Neuroradiology 12, 501513.
30. Rajshekhar, V., Chandy, M.J. (1996) Comparative study of CT and MRI in patients with seizures and
a solitary cerebral cysticercus granuloma. Neuroradiology 38, 542546.
31. Spickler, E.M., Lufkin, R.B., Teresi, L., et al. (1989) High-signal intraventricular cysticercosis on T1weighted MR imaging. American Journal of Neuroradiology 10, S64 (Case Report).
32. Suh, D.C., Chang, K.H., Han, M.H., et al. (1989) Unusual MR manifestations of neurocysticercosis.
33. Jena, A., Sanchetee, P., Tripathi, R., et al. (1992) MR observations on the effects of praziquantel in
neurocysticercosis. Magnetic Resonance Imaging 10, 7780.
34. Rhee, R.S., Kumasaki, D.Y., Sarwar, M., et al. (1988) MR imaging of intraventricular cysticercosis.
Journal of Computer Assisted Tomography 11, 598601.
35. Gupta, R.K., Jain, V.K., Kumar, S., et al. (1993) Unusual MRI appearance of cysticercus within the
fourth ventricle. Neuroradiology 35, 457458.
37. Gupta, R.K., Kathuria, M.K., Pradhan, S. (1999) Magnetization transfer MR imaging in central nervous system tuberculosis. American Journal of Neuroradiology 20, 867875.
38. Gupta, R.K., Kathuria, M.K., Pradhan, S. (1999) Magnetization transfer MR imaging demonstration
of perilesional gliosis: its relationship with epilepsy in treated or healed neurocysticercosis. Lancet
354, 4142.
40. Del Brutto, O.H., Santibanez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389392.
41. Yamada, N., Imakita, S., Sakuma, R.T., et al. (1996) Intracranial calcification on gradient-echo phase
image depiction of diamagnetic susceptibility. Radiology 198, 171178.
42. Yang, D., Korogi, Y., Ushio, Y., et al. (2000) Increased conspicuity of intraventricular lesions revealed
by three-dimensional constructive interference in steady state sequences. American Journal of
43. Govindappa, S.S., Narayanan, J.P., Krishnamoorthy, V.M., et al. (2000) Improved detection of intraventricular cysticercal cysts with the use of three-dimensional constructive interface interference in
steady state MR sequences. American Journal of Neuroradiology 21, 679684.
44. Chang, K.H., Song, I.C., Kim, S.H., et al. (1998) In vivo single voxel proton MR spectroscopy in
intracranial cystic masses. American Journal of Neuroradiology 19, 401405.
45. Jayasundar, R., Singh, V.P., Raghunathan, P., et al. (1999) Inflammatory granulomas: evaluation with
proton MRS. Nuclear Magnetic Resonance in Biomedicine 12, 139144.
46. Garg, M., Chawla, S., Prasad, K.N., et al. (2002) Differentiation of hydatid cyst from cysticercus cyst
by proton MR spectroscopy. NMR in Biomedicine (in press).
47. Nagayama, M., Sbinohara, Y., Nagakura, K., et al. (1996) Distinctive serial magnetic resonance
changes in a young woman with rapidly evolved neurocysticercosis, with positron emission tomography results. Neuroimaging 6, 198201
33

Immunodiagnosis of Neurocysticercosis
and Taeniasis
Patricia P. Wilkins, Marianna Wilson, James C. Allan and
Victor C.W. Tsang
Introduction
Clinical diagnosis of neurocysticercosis (NC)
is complicated by the wide spectrum of clinical presentations associated with the disease1,2. Definitive diagnosis of NC is made by
direct demonstration of the parasite in tissues, either by histological demonstration of
the parasite in brain tissue or radiological
demonstration of the taeniid scolex in cystic
lesions using computed tomography (CT) or
magnetic
resonance
imaging
(MRI).
Neuroimaging studies are the most commonly used techniques for diagnosing NC,
but these techniques are expensive and generally not available in areas where the disease
is most prevalent. Immunodiagnosis is a
valuable method for confirmation of disease,
but highly sensitive and specific tests were
not available before 19893. Methodologies
exist today to detect both antibodies, which
indicate present or past infection, and circulating antigens, which indicate current infection4. For the sake of our review here, we will
limit our discussion to the most commonly
used antibody-detection methods. Antigen
detection methods for identifying NC will be
discussed in Chapter 34 in this book. Because
detection of the adult worm infections,
known as taeniasis, is so crucial to controlling

NC, we will also discuss immunodiagnostic
methods for detection of taeniasis cases.
The antibody-detection assays available
today provide a reliable and useful adjunct to
the diagnosis of NC. However, that has not
always been the case and a variety of tests
were developed before the invention of the
(EITB*) had varying degrees of usefulness in
diagnosing NC. Complement fixation, indirect haemagglutination, ELISA and EITB tests
are among the types of immunodiagnostic
assays that have been developed57. Today,
the EITB and ELISA are the antibody-detection test formats that are most frequently
used for diagnosis of NC. Our discussion will
focus on these two assays and on studies that
have directly compared the two assays.
EITB for Diagnosis of

Neurocysticercosis
The EITB, which was developed at the
Centers for Disease Control (CDC), Atlanta,
Georgia, USA has had a profound impact on
the diagnosis of cysticercosis6,7. Because of
its excellent performance, EITB has been
*In this text and elsewhere in the book, EITB will refer specifically to the enzyme-linked immunoelectrotransfer blot, developed at the CDC5; immunoblot refers to other blot assays, in general.
329
330
P.P. Wilkins et al.
included in a proposed algorithm for the

diagnosis of NC8. Of the antibody-detection
tests available today, it performs best, with
exquisite specificity and excellent sensitivity.
Briefly, cysts, collected from naturally
infected pigs, are homogenized and proteins
are solubilized in urea. The resultant extract
is eventually purified using lentil lectin affinity chromatography. The lentil lectin-bound
glycoproteins (LLGP) are separated using
sodium dodecyl sulphate polyacrylamide gel
electrophoresis (SDS-PAGE) and then electrophoretically transferred to nitrocellulose
membranes. The EITB detects antibodies to
any one of seven cyst-derived glycoproteins
(Fig. 33.1). These proteins are designated as
GP50, GP3942, GP24, GP21, GP18, GP14
gp 50
gp 42
gp 24
gp 21
gp 18
gp 14
gp 13
Fig. 33.1. Enzyme-linked immunoelectrotransfer

blot (EITB) for immunodiagnosis of cysticercosis.
Individual sera from persons with possible
cysticercosis were analysed by the EITB assay;
lane 1: negative control sera; lane 2: positive control
sera; lanes 311 patient specimens. Sera in lanes
36 and 89 demonstrate positive antibody
reactivities to Taenia solium cyst lentil lectin-purified
antigens, lane 8 is a weak positive; sera in lanes 7,
10 and 11 are negative. Positions of the defined
LLGPs are marked on the left side of the blot.
and GP13, based on relative molecular

weight determinations using SDS-PAGE. In
cases where two or more cysts are present,
this assay is very sensitive, 100% and 95%,
using serum or cerebrospinal fluid (CSF),
respectively, and is 99% specific for either
sample6. Mainly because of its ease of collection for epidemiological studies, saliva was
also evaluated as a source of anticysticercal
antibodies using EITB. However, saliva was
inferior to serum as an antibody source; of
the cases that were detected using serum,
only 70% were positive using saliva9.
EITB is highly sensitive in patients
with multiple, enhancing intracranial
lesions1,2,10,11. The original description and
evaluation of the EITB was performed using
sera from biopsy proven cases of NC, typically with multiple lesions as detected by
skeletal radiographs6. Continued monitoring
of the test performance, compared with clinical findings using newer imaging techniques, such as CT and MRI, suggested that
the sensitivity of the assay was lower in
cases with single lesions or calcified cysts
(see Chapter 36)12. Several studies demonstrated that the test is less sensitive, between
60% and 80%, using sera from patients with
a single parenchymal cyst or only calcified
lesions1113, perhaps because of insufficient
immune stimulation11,14. In these situations,
the test sensitivity using CSF also drops considerably, to approximately 35%13.
Intraventricular cysticercosis occurs much
less frequently than parenchymal NC10.
While MRI is very efficient in revealing the
presence of intraventricular cysts, CT is not,
yet access to MRI is generally not available
in developing countries. Consequently, there
is very little published data on the usefulness
of the EITB in intraventricular cysticercosis.
A study of four patients with intraventricular cysts from Texas found that all four were
EITB positive15. It is our experience, using
results that have been accumulated over
more than a decade in the Parasitic Diseases
Reference Diagnostic Laboratory at CDC
from patients with intraventricular cysticercosis, that the great majority of these patients
are EITB positive (Table 33.1). In patients
with intraventricular cysts, as opposed to
those with parenchymal cysts, it appears that
Immunodiagnosis of Neurocysticercosis and Taeniasis
331
Table 33.1. Enzyme-linked immunoelectrotransfer blot (EITB) results in serum or

cerebrospinal fluid (CSF) samples from patients with pathologically proven
intraventricular neurocysticercosis.
Cysticercosis patients detected
Single cyst
Cyst classification
Two or more cysts*
EITB+ (%)
EITB+ (%)
Active
Calcified
Mixed
13
1
12 (92)
1
9
2
9
8 (89)
2 (100)
9 (100)
Totals
14
13 (93)
20
19 (95)
*Patients had two or more intraventricular cysts, or had both one or more
intraventricular cysts and one or more parenchymal cysts.
Thirteen of the 34 patients with intraventricular cysts had paired serum and CSF
samples; 10 of 13 pairs were EITB positive, one of 13 pairs was serum positive
but CSF negative, and two pairs were EITB negative (one pair from a patient with
a single active cyst, one pair from a patient with two active cysts).
the antibody response is influenced more by

the location of cysts than by the number of
cysts. Intraventricular cysts are constantly
bathed in CSF allowing easy access of
immune cells and mediators, which may be
involved in initiating the humoral response.
The presence of antibodies to any of
seven glycoprotein antigens is considered
diagnostic for NC using the EITB. Over 98%
of the time, sera from infected individuals
contain antibodies that react with one or
more of the seven immunodiagnostic proteins6. In a recent hospital-based study in
Peru, about half of NC patients had serum
antibodies that reacted to all seven diagnostic proteins16. The proteins most frequently
recognized are the GP3942 complex (95%)
and GP24 (94%); the lower molecular
weight proteins, GP14 and GP13, are recognized the least6.
A recent study examined the presence of
anticysticercal antibodies in serum of NC
patients before and after anticysticercal treatment11. At admission, approximately half of
the patients had antibodies that recognized
all seven diagnostic proteins. Of these persons, those who were successfully treated
still had antibodies that reacted to all seven
proteins 1 year after treatment. Of the
patients with antibodies to fewer than seven
proteins, 7% were seronegative after 1 year
and 12% showed a decrease in the number of

proteins recognized in the EITB 1 year after
treatment. These data suggest that antibody
persistence is proportional to the intensity of
the initial immune response.
The diagnostic utility of EITB vis--vis CT
was evaluated in a cohort of 383 individuals
undergoing CT16. When non-specific CT
abnormalities such as single lesions and isolated hydrocephalus were excluded, CT
scans revealed abnormalities diagnostic of
NC in 44% of the EITB-positive individuals.
Several explanations may be offered for positive EITB results in individuals with normal
CT, such as the presence of extra-neural cysticercosis, or past resolved cerebral cysticercosis with persisting antibodies. It is
important to note that serological results
should be used in conjunction with neuroimaging studies, clinical manifestations
and exposure history for consistent, accurate
diagnosis of NC8,13.
ELISA for Diagnosis of NC

Although EITB is accepted as the best diagnostic test available today, ELISA continues
to be used extensively for both epidemiological surveys17 and for clinical diagnosis,
mainly because of its technical simplicity as
332
P.P. Wilkins et al.
compared to EITB. There is extensive literature describing the usefulness of ELISA as a

method for diagnosing NC; much of that
work has been reviewed elsewhere18. ELISA
has been shown to be a useful adjunct for
diagnosing NC if CSF, not serum, is tested.
In one study, an ELISA, which detected antigen-specific immunoglobulin M (IgM),
demonstrated a sensitivity of 87% and specificity of 95% in CSF specimens from patients
with active or inactive NC19. However, many
ELISA tests have high false positive and false
negative rates, so results should be interpreted with caution3. Most ELISAs detect
antibodies to antigens that are present in
crude cyst extracts or cyst vesicular fluid.
Because the parasite antigens used in these
assays are not typically purified, ELISA has
historically demonstrated a lower specificity
and sensitivity than EITB. For this review,
we have elected to discuss the ELISA in the
context of the EITB and examine studies
where the two tests were compared directly;
when the ELISA was directly compared with
the EITB, the EITB has always outperformed
the ELISA (Table 33.2).
In one study, sera and CSF from patients
with parasite-confirmed NC were tested
using both ELISA and EITB20. Using EITB,
94% and 86% of all confirmed cases were
detected using serum and CSF, respectively.
ELISA detected 65% and 62% of cases,
respectively, using the same samples. In this
particular study EITB proved to be 99%
(1/83) specific, possibly falsely detecting one
case of Hymenolepis nana infection among 59
control sera. In contrast, ELISA gave presumably false positive results with sera from
patients with several other cestode infections, including those caused by Taenia saginata, H. nana and Echinococcus granulosus.
However, the heterologous infection sera
used in this study were collected in a region
in Peru known to be endemic for diseases
caused by all of these parasites; therefore, it
is possible that these samples were collected
from persons with subclinical cysticercosis or
prior exposure to T. solium. A similar study
compared the ability of both ELISA and EITB
to detect anticysticercal antibodies in paired
serum and saliva samples from clinically
defined NC patients9. In this study, the sensitivity using serum samples was 100% with
EITB and 74% with ELISA. However, in
saliva samples, the sensitivity was 70% using
EITB and 82% with ELISA. These data suggest that ELISA with saliva may be a useful
screening test for cysticercosis in the epidemiological setting. However, its sensitivity
does not equal that of EITB in serum and
specificity remains an issue. In yet another
study, comparing a commercially available
ELISA (LMD Laboratories, Carlsbad, CA,
USA) with EITB, the latter performed with
higher sensitivity and specificity than
ELISA21. Although there was a good level of
concordance between the two tests (85%),
this study demonstrated the lack of specificity often seen with ELISA; 9% of sera were
positive that were collected from persons
with no clinical or epidemiological evidence
of cysticercosis.
Table 33.2. Studies comparing the ELISA and enzyme-linked immunoelectrotransfer blot (EITB) for
diagnosis of neurocysticercosis (NC).
Cysticercosis cases detected
Clinical NC cases (sensitivity)
Non-NC cases (specificity)
Reference
Sample
EITB+ (%)
ELISA+ (%)
EITB+ (%)
ELISA+ (%)
20
20
21
9
9
Serum
CSF
Serum
Serum
Saliva
32/34 (94)
18/21 (86)
25/28 (89)
21/21 (100)
19/27 (70)
22/34 (65)
13/21 (62)
26/28 (93)
20/27 (74)
23/28 (82)
1/83 (99)
NT
1/69 (99)
0/55 (100)
0/27 (100)
16/83 (81)
NT
9/258 (97)
NT
NT
NT, not tested.
The sensitivity of ELISA for detecting

cases of NC characterized by single lesions
has not been discussed in the literature.
Consequently, using data accumulated in the
Parasitic Diseases Reference Diagnostic
Laboratory at the CDC, we compared the
sensitivity of EITB with that of LMD ELISA
by testing 31 samples from persons with
either pathologically proven or clinically
documented cases of NC with single lesions
(Table 33.3). EITB was positive in 55% of the
cases, while ELISA was positive in 29%.
These data indicate that the ELISA is less
effective than EITB for detecting NC cases
with single lesions.
EITB and ELISA were compared in one
community-based study in Mexico to identify
NC cases and risk factors associated with the
disease17. Positive results in each test were
correlated with epidemiological and clinical
data. Twelve of 42 persons, reporting a history
of seizures, were identified using EITB, but
none were detected using ELISA. These data
demonstrate the superiority of EITB, even in
the community setting, as an important epidemiological tool for identifying NC.
Recent Advances in
Immunodiagnosis of
Neurocysticercosis
Because of the technical difficulties associated with EITB procedures, researchers are
attempting to develop novel tests that would
not only retain the sensitivity and specificity
333
of the EITB, but also utilize a simpler assay

format, such as that of the ELISA. Some
investigators have focused on less complex
sources of parasite material, such as T. solium
cyst fluid22,23. Other scientists have focused
on purification and characterization of the
seven individual glycoprotein antigens that
are components of the LLGP fraction used in
EITB2426. Still others have opted for using a
more available source of parasite material
present in heterologous rodent Taenia
species, T. crassiceps, as an antigen source27.
Virtually simultaneously, several laboratories reported purification of individual
antigens, cloning of complementary DNA
(cDNAs) and incorporation of corresponding
recombinant or synthetic antigens in new
immunodiagnostic assays for NC2830. Many,
but not all, of the recombinant antigens
reported are components of the LLGP fraction28 and others, although not directly purified from the LLGP fraction29,30, appear to be
closely related to the protein antigens found
in the LLGP fraction. One of the primary
research goals in this field is development of
simpler assays for immunodiagnosis of NC;
therefore, these findings merit a more extensive discussion, presented below.
Utilizing the LLGP fraction employed in
EITB, several investigators identified native
10-, 14- and 18-kDa antigens that are similar
(Fig. 33.2a)25,26. Using amino-terminal amino
acid sequencing, these three native proteins
share identity in 13 of 19 amino acid cycles for
which meaningful sequence was obtained,
and similarity at remaining positions. Both
Table 33.3. Comparison of ELISA and enzyme-linked immunoelectrotransfer

blot (EITB) for detection of neurocysticercosis (NC) cases with single lesions.
Clinical classification
Biopsy proven, single lesion

Enhancing
Calcified
Total
10
2
12
3
0
3 (25)
2
0
2 (17)
Clinically consistent with NC

Enhancing
Calcified
Total
13
6
19
10
4
14 (74)
5
2
7 (37)
Total
31
17 (55)
9 (29)*
*All ELISA positives were also EITB positive.
EITB+ (%)
ELISA+ (%)
334
P.P. Wilkins et al.
Fig. 33.2. Alignment of cloned diagnostic antigens of neurocysticercosis (NC). CLUSTAL_ alignment
of the deduced amino acid sequences of some recombinant polypeptides reported to have value as
diagnostic antigens for detection of NC65. (a) Sequences 14, 6 and 8 represent deduced polypeptides
reported by Greene et al.28; sequences 5, 7 and 910 are reported in Sako et al.30; (b) sequence 11 was
reported in Chung et al.29.
groups used native purified proteins in EITB

assays and showed these proteins to be sensitive and highly specific for detecting anticysticercal antibodies, although the 10- and
14-kDa antigens appeared more sensitive than
the 18-kDa antigen26. These three antigens, the
10-, 14- and 18-kDa proteins were all shown to
be components of the larger diagnostic antigens present in the LLGP fraction. The 10-kDa
antigen was identified by separate purification
of both the 24- and 3942-kDa components of

the LLGP fraction and, upon reduction,
yielded two similar, but not identical, 10-kDa
proteins25. The 14- and 18-kDa antigens were
purified following reduction of larger LLGPs,
which ranged in size from 25 kDa to 45 kDa26.
Polyclonal antibodies were generated by both
groups that further indicated that these antigens are components of larger protein antigens. Plancarte et al. generated polyclonal
antibodies against purified GP24 or GP3942

that reacted with the 10-kDa antigen25.
Conversely, Greene et al. produced polyclonal
antibodies to the 14-kDa protein that reacted
with six distinct moieties, co-migrating with
GP14, GP18, GP21, GP24, and GP42 antigens
in the LLGP fraction28.
The cDNAs for the 14- and 18-kDa antigens were subsequently cloned and
sequenced. During the process of cloning, a
total of five distinct cDNA clones were identified and all were closely related at both the
nucleic acid and predicted amino acid levels.
Polypeptides that represent the mature proteins were chemically synthesized (synthetic
Taenia solium, sTS) 14 and sTS18), and evaluated as diagnostic antigens using an ELISA.
sTS14 demonstrated greater utility than
sTS18 and was recognized in a disease-specific manner using defined sera from persons
with cysticercosis or other helminthic infections. However, only 53% of sera from persons with cysticercosis reacted with this
synthetic version of TS1428 although 76% of
sera reacted with the native 14-kDa molecule
in an immunoblot format26.
When all of the data pertaining to the
purified LLGP antigens are evaluated, several things become apparent. One, all of the
proteins in the 1042-kDa range appear to be
antigenically and structurally related. And
two, the 24-kDa and larger antigens appear
to be comprised of subunits of at least two
smaller (1014-kDa) proteins28. The precise
manner in which these subunits are assembled to form larger proteins remains a subject of intense investigation.
Other significant advances towards developing simplified immunodiagnostic methods for NC have been made using purified T.
solium cyst fluid. The soluble antigens present in cyst fluid were further purified using
isoelectric focusing (pH 9.29.6) for use in
ELISA or immunoblot formats. Three cysticercosis-specific antigens were identified by
immunoblotting: a 10-kDa and a 26-kDa
antigen, and a third antigen between 10 kDa
and 26 kDa23. The high level of specificity
and sensitivity seen in both the ELISA and
immunoblot led to cDNA cloning and
expression of the recombinant proteins representing the native cyst antigens30. Four
335
related cDNAs were cloned that predicted

polypeptides ranging in size from 9.6 kDa to
13 kDa. Escherichia coli-expressed, thioredoxin-fusion proteins were evaluated for
specificity and sensitivity. A chimeric construct was created using the cDNA
sequences from the two most promising
recombinants, expressed in E. coli, and the
resultant recombinant chimeric protein was
evaluated in an ELISA. Although a limited
number of sera (53 NC sera) were evaluated,
the chimeric protein demonstrated remarkable sensitivity (100%) and specificity (90%).
Another 10-kDa antigen has been isolated
from cyst fluid that has been evaluated for its
utility as a diagnostic antigen for detection of
NC cases. This antigen is a subunit component of a 150-kDa complex. When the native
10-kDa antigen was evaluated in the
immunoblot format, the assay had a sensitivity of 85%; and only sera from persons with
echinococcosis showed low-level cross-reactivity (~10% of these particular sera reacted)22.
A full-length cDNA encoding this 10-kDa
antigen has been cloned and a glutathione-Stransferase
(GST)-fusion
protein
was
expressed and evaluated in an ELISA. The
overall sensitivity, using 200 sera from persons with NC, was 88% and was 97% in
detecting active cases of NC. Using approximately 200 sera from persons with other
helminthic infections, this assay demonstrated a specificity of 98%. The cDNA
sequence of this protein revealed that it, too,
is related to the other cDNAs and proteins
encoding cyst fluid antigens, described
above29,30. However, this cDNA and amino
acid sequence appears to be the most distinct
of the sequences described to date (Fig. 33.2b).
The five cDNA clones encoding the antigens in cyst fluid are not only all related to
one another, but are also related to the cDNA
clones, which encode the LLGP antigens
(Fig. 33.2b). All polypeptides encoded by
these cDNAs have similar structural characteristics: N-terminal hydrophobic regions,
which are predicted to be signal sequences
with signal sequence cleavage sites; all
encode polypeptides with predicted sizes of
7.6 kDa to 12.9 kDa; all have similar amino
acid compositions with isoelectric points
between 8.0 and 9.6; and 10 of the 11 cloned
336
P.P. Wilkins et al.
antigens contain a conserved IAQLAK

amino acid sequence near the middle of the
polypeptide. Clearly these proteins are members of a larger family of antigenic Taenia
proteins that are expressed in the metacestode stage of the parasite.
Diagnosis of Taeniasis
Accurate diagnosis of adult Taenia tapeworm
infections is a critical element of any strategy
to control or eliminate cysticercosis. Definitive
diagnosis of tapeworm carriers is accomplished by demonstration of ova and/or
proglottides in stool samples. However,
because of the intermittent nature of egg
excretion, this method underestimates the
prevalence of taeniasis31,32. Direct parasitological examination of stool samples is the only
diagnostic method that is considered unequivocal. The diagnosis of taeniasis is made when
eggs, gravid proglottides, or both are present
in the sample. However, eggs of T. solium and
T. saginata cannot be distinguished from each
other, therefore, speciation of the taeniid can
be determined only if gravid proglottides are
present. Gravid proglottides from T. solium
bear ten or fewer uterine branches on each side
of the central uterus; proglottides of T. saginata
have 12 or more branches33. In very rare cases,
a scolex may be present in the sample. If so,
then definitive species diagnosis of T. solium or
T. saginata can be made by the presence of an
armed (with hooks) or unarmed (without
hooks) scolex, respectively34. Taenia solium and
T. saginata are sometimes present within the
same geographic area, making speciation particularly critical for epidemiological studies.
Although microscopic-based parasitological
techniques are simple and relatively inexpensive, these techniques lack both sensitivity and
specificity. Furthermore, there are cultural
problems associated with the collection of faecal samples in some areas. There is the biohazard the material itself presents; collection of
faecal samples carries with it the potential for
exposure to, and infection with Taenia eggs,
which may be present in the sample. From a
practical viewpoint, it can often be difficult to
ensure unambiguous patientsample association in field settings. Indeed confusion of sam-
pling pots between family members in field

studies has occurred in the past (James C.
Allan, Sandwich, UK, personal observation).
Detection of coproantigens
The principle behind coproantigen detection
is the immunological detection of parasite
material in the faeces of the host.
Coproantigens may include products shed as
a result of turnover of the parasites surface
or products that are excreted or secreted by
the tapeworm. Products, associated with
parasite metabolism should be present in
faeces independently of parasite reproductive material, such as eggs or proglottides.
Unlike tests based on the detection of host
antibody, however, they should be present
only if the parasite is present.
Detection of taeniid coproantigens in faeces was first demonstrated by Babos and
Nemeth in the 1960s35. Using sera from rabbits hyperimmunized with cyst fluid from E.
granulosus metacestodes, parasite antigens
were demonstrated by double diffusion in the
faeces of dogs infected with E. granulosus.
Antigen was detected before patency but
cross-reactions were seen with antigens present in faeces from individuals infected with
Taenia. Subsequently, antigens were detected
in the faeces of a variety of hosts infected with
intestinal cestodes3647. These assays used
polyclonal antibodies from rabbits hyperimmunized with adult worm products; others
used both rabbit polyclonal and murine monoclonal antibodies48,49. These assays are
highly specific and sensitive and are able to
detect antigens before patency and in samples
that have been frozen or collected in formalin.
Coproantigen detection in human

taeniasis
To date, all assays for taeniid coproantigen
in humans have been based on polyclonal
rabbit antibodies, either to adult worm
somatic38, excretorysecretory (ES)43 or surface antigens44,46. These tests have been
shown to be genus specific; samples from
both T. solium and T. saginata infections are
positive in assays using antibodies against

one species or the other38. Levels of specificity with faeces from infections other than
Taenia sp. have been demonstrated to be
greater than 99%3941, resulting in a high
positive predictive value in most T. solium
endemic areas. No cross-reactions have
been shown with faeces from other
helminth infections, including H. nana, H.
diminuta, Ascaris lumbricoides, Trichuris and
hookworm3941. In a field study where all of
the Taenia tapeworms identified to the
species level were shown to be T. solium, a
microtitre plate-based coproantigen assay
detected 2.6 times more tapeworm carriers
than microscopic detection of Taenia eggs in
faeces (55 cases diagnosed versus 21)41. The
coproantigen test diagnosed 98% of all cases
detected in the study while microscopy
diagnosed 38% (55/56 cases and 21/56
cases, respectively). Coproantigen tests for
human taeniasis become negative within
approximately 1 week after successful
treatment of intestinal infection38,43. In
canine Taenia infections they are positive
several weeks before patency and give
results independently of egg output39,42.
Indeed, the possible detection of at least
one pre-patent case of human intestinal T.
solium has been reported in a field study32.
A visually interpreted dipstick assay has
been used for detection of Taenia coproantigens in faeces directly after collection in
rural communities in both Guatemala and
Mexico40. In a total of 41 cases of taeniasis,
diagnosed by either coproantigen testing,
microscopy, or questioning, the dipstick
test detected 31 (76%) of all cases. This
compared to 23 cases diagnosed by
microscopy (56%) and five by questioning
(12%). The dipstick format is known to be
less sensitive than the microtitre-based
ELISA, but can be performed with minimal
facilities, making it an extremely attractive
option for epidemiological studies.
The results from studies that employed
coproantigen detection assays for the identification of Taenia carriers have indicated that
these assays are considerably more sensitive
than microscopy and have working characteristics suitable for practical application in
the field in T. solium endemic areas. Further
337
improvements to these assays, especially the

capability to differentiate T. solium and T.
saginata, would broaden their applicability.
Immunodiagnosis of intestinal Taenia

infection
A number of immunodiagnostic techniques
have been applied to the diagnosis of human
T. solium and T. saginata taeniasis. Early studies involved the application of intradermal
tests but these were shown to have high
false-positive and false-negative rates5054. In
particular, the tests were shown to remain
positive for long periods following treatment
of the infection53. In some cases, reactions
were detected only after treatment or became
stronger after treatment53. Intradermal testing for T. solium gave false-positive rates of
37% and a sensitivity of approximately
76%54, however, 12% of individuals treated
for this parasite continued to give positive
results for long periods after treatment, some
patients remaining positive for up to 18
months. These techniques have never been
applied on a large scale.
Serum antibody detection in T. saginata
infection by use of the indirect haemagglutination technique was also demonstrated55.
Prolonged persistence of antibodies after treatment, between 5 and 19 months in some
patients, was reported. Another study reported
that test sensitivity was 56%, with a falsepositive rate of 1.35%, leading to the conclusion
that this approach was of limited applicability56.
In contrast to the situation with human taeniasis, serum antibody detection has been
more thoroughly investigated in canine taeniasis. Studies in this area indicated both the
presence and diagnostic applicability of serum
antibodies for the diagnosis of a number of
different taeniid species in dogs. A variety of
antigenic preparations have been used including adult worm somatic and ES products and
oncosphere antigens5760. These studies
demonstrated that antibody could be detected
before patency and with high levels of specificity, although cross-reactions occurred
between sera from dogs infected with different
taeniid species. Tests for antibodies took some
time to become negative after treatment; those
338
P.P. Wilkins et al.
for antibodies to oncosphere products becoming negative within a few weeks after treatment. The ability to test for antibody in saliva
was also demonstrated61.
This serological assay for T. solium taeniasis

is a valuable method for identifying T. solium
tapeworm carriers which overcomes many
of the obstacles associated with ova and parasite examination or coproantigen detection.
EITB-T for detection of T. solium taeniasis
Conclusions
In an effort to develop a serological assay for
detection of human taeniasis carriers, an
immunoblot assay, EITB-T, using ES antigens
of adult T. solium tapeworms was developed.
ES proteins were collected following in vitro
culture of T. solium tapeworms, which were
harvested from immunosuppressed hamsters approximately 30 days after infection
with porcine cysts37,38. Proteins that reacted
with antibodies in the taeniasis positive
serum pool, but not antibodies in the cysticercosis pool were identified as potential
diagnostic targets. Antigens, ranging in size
from 32.7 kDa to 42.1 kDa, appeared to be
specific for taeniasis infections. Individual
sera from patients with confirmed taeniasis
or cysticercosis were analysed and 95%
(69/73) of sera tested from parasitologically
confirmed T. solium carriers contained antibodies to these proteins. Antibodies in sera
from persons with other helminthic diseases,
such as those caused by H. nana,
Echinococcus, Ascaris, Trichuris and other parasites, did not cross-react with the ES proteins, demonstrating an assay specificity of
100%. Furthermore, using sera from a limited number of parasitologically confirmed
taeniasis cases, the EITB-T detected only T.
solium taeniasis and not T. saginata cases62.
Remarkable advances have been made in the

immunodiagnosis of NC in the past two
decades. A disease that was once diagnosed
only after surgery, can now be accurately
diagnosed using non-invasive techniques.
The EITB for NC has not only revolutionized
diagnosis of NC; it has also been crucial in
defining the magnitude of the disease worldwide7,63. Future prospects for development of
simpler tests that would retain the exquisite
sensitivity and specificity of EITB for diagnosis of NC are bright. Advances in immunodiagnosis of NC and taeniasis engender
promise, not only for better and more rapid
diagnosis of NC, but also for better understanding of the pathogenesis of the disease
and the factors associated with transmission
dynamics. New methods such as the
coproantigen assays and the EITB-T are tools
that permit sensitive identification of tapeworm carriers. Furthermore, these assays
may ultimately help identify important epidemiological variables such as the relationship between taeniasis and NC64; the
prevalence of taeniasis in a given community;
the lifespan of the adult tapeworm; and other
parameters necessary to develop meaningful
strategies for controlling or eliminating NC2.
References
1. Garca, H.H., Del Brutto, O.H. (2000) Taenia solium cysticercosis. Infectious Diseases Clinics of North
America 14, 97119.
2. White, A.C., Jr. (2000) Neurocysticercosis: update on epidemiology, pathogenesis, diagnosis and
management. Annual Review of Medicine 51, 187206.
3. Ramos-Kuri, M., Montoya, R.M., Padilla, A., et al. (1992) Immunodiagnosis of neurocysticercosis.
Disappointing performance of serology (eynzyme-linked immunosorbent assay) in an unbiased
sample of neurological patients. Archives of Neurology 49, 633636.
4. Flisser, A., Plancarte, A., Correa, D., et al. (1990) New approaches in the diagnosis of Taenia solium
cysticercosis and taeniasis. Annals of Human and Comparative Parasitology 65, 9598.
5. Rydzewski, A.K., Chisholm, E.S., Kagan, I.G. (1975) Comparison of serologic tests for human cysticercosis by indirect hemagglutination, indirect immunofluorescent antibody, and agar gel precipitin tests. Journal of Parasitology 61, 154155.
339
6. Tsang, V.C., Brand, J.A., Boyer, A.E. (1989) An enzyme-linked immunoelectrotransfer blot assay and
glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious
Diseases 159, 5059.
7. Tsang, V.C.W., Garca, H.H. (1999) Immunoblot diagnostic test (EITB) for Taenia solium cysticercosis
and its contribution to the definition of this underrecognized but serious public health problem. In:
Garca, H.H., Martinez, S.M. (eds.) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima,
Peru, pp. 245256.
cysticercosis and neurocysticercosis. Journal of the Neurological Sciences 142, 16.
9. Feldman, M., Plancarte, A., Sandoval, M., et al. (1990) Comparison of two assays (EIA and EITB) and
two samples (saliva and serum) for the diagnosis of neurocysticercosis. Transactions of Royal Society
10. White, A.C., Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: hostparasite interactions
and the immune response. Chemical Immunology 66, 209230.
11. Garca, H.H., Gilman, R.H., Catacora, M., et al. (1997) Serologic evolution of neurocysticercosis
patients after antiparasitic therapy. Journal of Infectious Diseases 175, 486489.
12. Rawlings, D., Ferriero, D.M., Messing, R.O. (1989) Early CT re-evaluation after empiric praziquantel
therapy in neurocysticercosis. Neurology 39, 739741.
13. White, A.C., Garca, H.H. (1999) Recent developments in the epidemiology, diagnosis, treatment,
and prevention of neurocysticercosis. Current Infectious Diseases Report 1, 434440.
14. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme
linked immunoelectrotransfer blot in patients with neurocysticercosis. Journal of Infectious Diseases
164, 10071009.
16. Garca, H.H., Herrera, G., Gilman, R.H., et al. (1994) Discrepancies between cerebral computed
tomography and Western blot in the diagnosis of neurocysticercosis. American Journal of Tropical
17. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations
18. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. Progress in Clinical Parasitology 4,
77116.
20. Diaz, J.F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia
solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA), and antigen-ELISA, and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American
21. Sloan, L., Schnieider, S., Rosenblatt, J. (1995) Evaluation of enzyme-linked immunoassay for serological diagnosis of cysticercosis. Journal of Clinical Microbiology 33, 31243128.
22. Yang, H.J., Chung, Y.K., Yun, D., et al. (1998) Immunoblot analysis of a 10 kDa antigen in cyst fluid
of Taenia solium metacestodes. Parasite Immunology 20, 483488.
23. Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins
24. Plancarte, A., Fexas, M., Flisser, A. (1994) Reactivity in ELISA and dot blot of purified GP24, an
immunodominant antigen of Taenia solium, for the diagnosis of human neurocysticercosis.
25. Plancarte, A., Hirota, C., Martinez-Ocana, J., et al. (1999) Characterization of GP3942 and GP24
antigens from Taenia solium cysticerci and of their antigenic GP10 subunit. Parasitology Research 85,
680684.
26. Greene, R.M., Wilkins, P.P., Tsang, V.C. (1999) Diagnostic glycoproteins of Taenia solium cysts share
homologous 14- and 18-kDa subunits. Molecular Biochemistry and Parasitology 99, 257261.
27. Bueno, E.C., Vaz, A.J., Machado, L.D., et al. (2000) Specific Taenia crassiceps and Taenia solium antigenic peptides for neurocysticercosis immunodiagnosis using serum samples. Journal of Clinical
Microbiology 38, 146151.
340
P.P. Wilkins et al.
28. Greene, R.M., Hancock, K., Wilkins, P.P., et al. (2000) Taenia solium: molecular cloning and serologic
evaluation of 14- and 18-kDa related, diagnostic antigens. Journal of Parasitology 86, 10011007.
29. Chung, J.Y., Bahk, Y.Y., Huh, S., et al. (1999) A recombinant 10-kDa protein of Taenia solium metacestodes specific to active neurocysticercosis. Journal of Infectious Diseases 180, 13071315.
30. Sako, Y., Nakao, M., Ikejima, T., et al. (2000) Molecular characterization and diagnostic value of
Taenia solium low-molecular-weight antigen genes. Journal of Clinical Microbiology 38, 44394444.
31. Hall, A., Lathman, M.C., Cromton, D.W., et al. (1981) Taenia saginata (Cestoda) in western Kenya: the
reliability of faecal examinations in diagnosis. Parasitology 83, 91101.
32. Allan, J.C., Velasquez-Tohom, M., Garcia-Noval, J., et al. (1996) Epidemiology of intestinal taeniasis
in four rural, Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157165.
33. Proctor, E.M. (1972) Identification of tapeworms. South African Medical Journal 46, 234238.
34. Eldson-Dew, R., Proctor, E.M. (1965) Distinction between Taeniarhynchus saginata and Taenia solium.
South African Journal of Science 61, 215217.
35. Babos, S., Nemeth, I. (1962) Az echinococcis szerodiagnoztikajanak kerderehez. Magyar Allatorvosok
Lapja 17, 5860.
36. Machnicka, B., Krawczuk, S. (1988) Hymenolepis diminuta antigen: detection in faeces of rats. Bulletin
of Polish Academy of Science and Biological Science 36, 103106.
37. Allan, J.C., Craig, P.S. (1989) Coproantigens in gut tapeworm infections: Hymenolepis diminuta in
rats. Parasitology Research 76, 6873.
38. Allan, J.C., Avila, G., Garcia-Noval, J., et al. (1990) Immunodiagnosis of taeniasis by coproantigen
detection. Parasitology 101, 473477.
39. Allan, J.C., Craig, P.S., Garcia-Noval, J., et al. (1992) Coproantigen detection for immunodiagnosis of
echinococcossis and taeniasis in dogs and humans. Parasitology 104, 347356.
40. Allan, J.C., Mencos, F., Garcia-Noval, J., et al. (1993) Dipstick dot ELISA for the detection of Taenia
coproantigens in human. Parasitology 107, 7985.
41. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigenbased diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. Amercian Journal
42. Deplazes, P., Gottstein, B., Stingelin, Y., et al. (1990) Detection of Taenia hydatigena coproantigens by
ELISA in dogs. Veterinary Parasitology 36, 91103.
43. Deplazes, P., Exkert, J., Pawlowski, Z.S., et al. (1991) An enzyme-linked immunosorbent assay for
diagnostic detection of Taenia saginata copro-antigens in humans. Transactions of the Royal Society of
44. Maass, M., Delgado, E., Knobloch, J. (1991) Detection of Taenia solium antigens in merthiolate-form
preserved stool samples. Tropical Medicine and Parasitology 42, 112114.
45. Maass, M., Delgado, E., Knobloch, J. (1992) Isolation of an immunodiagnostic Taenia solium
coproantigen. Tropical Medicine and Parasitology 43, 201202.
46. Machnicka, B., Dziemian, E., Zwierz, C. (1996) Detection of Taenia saginata antigens in faeces by
ELISA. Applied Parasitology 37, 106110.
47. Machnicka, B., Dziemaian, E., Zwierz, C. (1996) Factors conditioning detection of Taenia saginata
antigens in faeces. Applied Parasitology 37, 99105.
48. Sakai, H., Furusawa, R., Oku, Y., et al. (1996) Echinococcus multilocularis copro-antigen detection in
golden hamster, an alternative definitive host. Experimental Animals 45, 275278.
49. Malgor, R., Nonaka, N., Basmadjian, I., et al. (1997) Copro-antigen detection in dogs experimentally
and naturally infected with Echinococcus granulosus by a monoclonal antibody-based enzyme-linked
immunosorbent assay. International Journal of Parasitology 27, 16051612.
50. Ramsdell, S. (1927) A note on the skin reaction in Taenia infestation. Journal of Parasitology 14, 102105.
51. Brunner, M. (1928) Immunological studies in human parastic infestation. Journal of Immunology 15,
83101.
52. Podyapolskaya, V.P., Kamalova, A.G. (1942) Cutaneous test as a method of diagnosis of taeniasis
and cysticercosis. Meditsinskaia Parazitologiia I Parazitarnye (Bolezni) 11, 99105.
53. Machinicka Roguska, B., Zweirz, C. (1970) Intradermal test with antigenic fractions in Taenia saginata infection. Acta de Parasitologica Polonica 18, 293299.
54. Slusarski, W., Zapart, W. (1971) Diagnostic value of intradermal test with acid-soluble protein fractions in Taenia infections in man. Acta de Parasitologica Polonica 19, 445455.
55. Machinicka Roguska, B., Zweirz, C. (1971) Hemagglutination reaction in people with Taenia saginata
invasion. Wiadomosci Parazytologiczne (Warsaw) 14, 2733.
341
56. Flentje, B., Padelt, H. (1981) Value of a serologic diagnosis of Taenia saginata infestation in the
human. Angew Parasitology 22, 6568.
57. Jenkins, D.J., Rickard, M.D. (1985) Specific antibody responses to Taenia hydatigena, Taenia pisiformis
and Echinococcus granulosus infection in dogs. Australian Veterinary Journal 62, 7278.
58. Heath, D.D., Lawrence, S.B., Glennie, A., et al. (1985) The use of excretory and secretory antigens of
the scolex of Taenia ovis for the serodiagnosis of infection in dogs. Journal of Parasitology 71, 192199.
59. Jenkins, D.J., Rickard, M.D. (1986) Specific antibody responses in dogs experimentally infected with
Echinococcus granulosus. American Journal of Tropical Medicine and Hygiene 35, 345349.
60. Gasser, R.B., Lightowlers, M.W., Obendorf, D.L., et al. (1988) Evaluation of a serological test system
for the diagnosis of natural Echinococcus granulosus infection in dogs using E. granulosus protoscolex
and oncosphere antigens. Australian Veterinary Journal 65, 369373.
61. Kinder, A., Carter, S.D., Allan, J., et al. (1992) Salivary and serum antibodies in experimental canine
taeniasis. Veterinary Parasitology 41, 321327.
62. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of serologic assay to detect Taenia
solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199204.
63. Tsang, V.C.W., Wilson, M. (1995) Taenia solium: an underrecognized but serious public health problem. Parasitology Today 11, 124126.
64. Gilman, R.H., Del Brutto, O.H., Garca, H.H., et al. (2000) Prevalence of taeniosis among patients
with neurocysticercosis is related to severity of infection. Neurology 55, 1062.
65. Thompson, J.D., Gibson, T.J., Plewniak, F., et al. (1997) The CLUSTAL_X windows interface: flexible
strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25,
48764882.
34
Antigen-based Immunoassays in the

Diagnosis of Taenia solium Cysticercosis
Dolores Correa, Raquel Tapia-Romero, Antonio Meza-Lucas and

Olga Mata-Ruiz
Introduction
Establishing a diagnosis of Taenia solium
cysticercosis usually involves several investigations including immunological tests
principally based upon antibody detection in
cerebrospinal fluid (CSF) or serum (reviewed
in Chapter 33). In general, the presence of
antibodies in symptomatic cases in association with computed tomography (CT) or
magnetic resonance imaging (MRI) compatible with neurocysticercosis (NC) is considered
diagnostic. Antibody-based immunoassays
have also been used in epidemiological studies of T. solium cysticercosis13. They permit
the detection of transmission hot spots and
the identification of risk factors.
One limitation of antibody-based tests is
that antibodies may be detected in a certain
proportion of individuals who do not have
active disease, for instance, those with calcified lesions4. In addition, two-thirds of
seropositive individuals have no lesion identifiable upon CT scans5. Thus, the presence of
antibodies does not constitute direct evidence
of a living parasite within the host. In order
to overcome the limitations of antibodybased immunoassays, several attempts have
been made to develop antigen-based assays
in the belief that the detection of antigens
would correlate with presence of live and
active cysticerci619. In the present chapter we
review literature related to polyclonal and

monoclonal antibody (PoAb and MoAb)based antigen detection assays, and their role
in clinical and epidemiological studies.
Overview of Studies on Antigens in

Human Fluids
Taenia solium metacestode antigens were first
studied in the CSF by latex agglutination
using PoAb7. A sensitivity and specificity of
77% and 97% respectively were reported.
Subsequently, two PoAb-based direct
ELISAs were described wherein CSF samples were directly used to coat the ELISA
plates, as antigen source, and developed
with rabbit PoAbs8,9. These methods were
able to detect 5977% of cases of NC.
Following these initial studies, several direct
or capture ELISA and high pressure liquid
chromatography-ELISA (HPLC-ELISA) formats employing MoAbs or PoAbs have been
developed (Table 34.1)710,1214,1619. Their
reported sensitivity varied between 0 and
93%. Most studies have focused upon the
presence of antigens in CSF, while only a few
have perused their presence in serum2022.
So far, most of the studies have found an
antigen or a group of antigens of molecular
weight of around 200 kDa, both in CSF and
serum. Estrada et al. detected two antigens of

343
CSF
CSF
CSF
ELISA/homologous capture
Serum
CSF
CSF
ELISA/direct
anti-CE: Anti-crude extract.

anti-AgB: Anti-antigen B.
ND: Not determined.
PoAb: Polyclonal antibody.
CSF
CSF
ELISA/heterologous capture
HPLC-ELISA/direct
CSF
ELISA/direct
Dot-ELISA/direct
EITB
Serum
CSF
Sample
Agglutination
Method
ND
ND
150
Fraction
400
Fraction
33240
255
16
231
212
75
25
31
ND
100
200
200
ND
18
17
215
No. of
patients
190, 230
ND
ND
Antigens:
molecular
weight (kDa)
40
ND
ND
ND
5
24
ND
18
48
31
No. of
controls
MoAb: Monoclonal antibody.

CSF: Cerebrospinal fluid.
EITB: Enzyme-linked immunoelectrotransfer blot.
HPLC-ELISA: High pressure liquid chromatography-ELISA.
Anti-CE
PoAb/
MoAb
1F11 MoAb
4F8 MoAb
Anti-CE
H7 MoAb
Anti-CE
PoAb
Anti-CE
PoAb
Anti-CE
PoAb
HP10
MoAb
HP12
MoAb
Porcine anti-CE
Porcine anti-AgB
Antibody
(capture
system)
Table 34.1. Overview of studies of antigen detection in human cysticercosis.
0
82
77 (NC) / 97
(subcutaneous
cysticercosis)
13
56
44
29
48
48
52
72
72
77
59
78
77
Sensitivity
(%)
100
ND
ND
100
100
ND
100
100
100
100
100
100
100
97
Specificity
(%)
19
18
17
16
14
12,14
13
10
8,9
Reference
344
D. Correa et al.
Antigen-based Immunoassays in Diagnosis
molecular weight 230 kDa and 190 kDa, in 14

of 18 CSF samples using an immunoblot
assay10. Similarly, a sensitivity of 7586%
was obtained when CSF of patients with NC
were evaluated with the HP10 MoAb1113.
The latter is specific for a 200-kDa glycoprotein. A molecule of similar molecular weight
was also detected by another MoAb (H7) in
more than 50% of cases in CSF and serum of
patients with NC14. We have found five different antigens using an immunoblot assay
in multilesional cysticercosis. A 200-kDa
band was most frequent among the five antigens, both in CSF and serum14,15.
The 200-kDa antigen that has been identified in most studies is best recognized by a
capture assay using the HP10 MoAb in a
homologous system12,13. It is a glycoprotein,
having a repetitive epitope11. However, it is
not species-specific and this might interfere
with its diagnostic role in extracerebral cysticercosis in areas where other cestode infections are also prevalent. Among other
molecules that have been found in CSF or
serum of patients with NC, a fraction larger
than 400 kDa was detected in 29% of patients
CSF16. Studies by our group and Cho et al.,
using PoAb and MoAb respectively, have
revealed the presence of a 150-kDa molecule
in 13% of CSF samples from NC cases6,15,17.
Besides, bands of 183 kDa and 50 kDa have
been found in the serum and the CSF respectively of NC patients in very few instances15.
Two MoAb-based methods reported high sensitivities (7797%), but the antigens recognized
were not identified18,19. An interesting finding
from one of these studies was that individuals
with subcutaneous cysticercosis presented
with antigens in CSF more frequently than
those with intracranial involvement alone19.
Limitations of Antigen Detection

Lack of antigens or sequestration?
A variety of antibody responses in sera and
CSF of patients with NC have been demonstrated with low-resolution procedures like
immunoelectrophoresis as well as by more
contemporary and highly sensitive tests such
as enzyme-linked immunoelectrotransfer
345
blot (EITB)20,23,24. In contrast, antigens are

uncommonly detected. One reason for this
observation could be the rapid sequestration
of antigens. Several findings support this
notion. We detected antigen B, a component
of the excretorysecretory products of cysticercus, in only 14% of the CSF samples of
patients with NC12,25,26. This particular antigen is immunodominant, i.e. it elicits a
strong antibody response23,27. It binds to collagen with high affinity, as well as to the C1q
component of the complement cascade28,29.
We surmise that soon after secretion by the
parasite, the antigen is sequestered in the
host tissues or serum. In a similar manner,
other antigens that elicit antibody responses
can either be sequestered in host tissues adjacent to the parasite, ingested by phagocytes
or transported to lymphoid tissues, where
they may thus escape detection.
Evidence of immune complexes in

neurocysticercosis
Immune complex formation may be one of
the mechanisms by which antigens disappear and evade detection. There is evidence
for the presence of immune complexes in
cysticercosis. Community-based epidemiological studies have attempted to detect both
antibodies and antigens in sera of individuals21,22,30. However, it is extremely rare to
find antigens and antibodies concurrently in
a given serum sample. In two different studies of epileptics in rural communities of
Mexico21 and Brazil (I. Gomes, A. MezaLucas, M. Veiga, et al., Universidade Federal
da Bahia, Brazil, unpublished observations)
respectively, the relation between age and
prevalence of antibodies was found to be
inverse to that between age and antigens.
The inability to detect antigens and antibodies in concurrent samples is likely to be
related to the formation of immune complexes. Indirect evidence for the existence of
immune complexes also came from a report
of nephrotic syndrome complicating cysticercosis31. Renal biopsy revealed membranous glomerulonephritis, implicating the
production of immune complexes, surmised
to occur in response to cysticercal infection.
346
D. Correa et al.
Swine antibodies against a crude cysticercus extract detected antigens in 48% of

human CSF samples, but gave negative
results with sera of cysticercotic pigs12,32.
The observed discrepancy between human
CSF and pig sera could be explained by the
similarity between native antibodies in
infected pigs and the experimentally generated antibodies. Antigen epitopes may be
blocked by native antibodies leading to
immune complex formation; the failure of
experimentally generated antibodies to
detect antigens in pig sera may be related to
this immune complex formation.
Absence of antigens or technical

problems?
The low yield of antigen detection assays
could be related to several of the technical
problems described below. In the capture
assays, PoAbs produce high backgrounds,
confounding discrimination between positive and negative samples. On the other
hand, when MoAbs are used, small quantities of antigen may escape detection.
Furthermore, in homologous-antibody capture systems, it is necessary to have antibodies that react with repetitive epitopes of
the antigenic molecule. The latter problem
is overcome in direct capture assays since
the sample is directly adsorbed. Estrada
and Khun developed an ELISA where CSF
antigens were directly bound to polystyrene
wells8. All four confirmed cases and one out
of seven patients with a strong clinical suspicion of NC were positive by this assay.
Likewise, the sensitivity of a similar assay
in a larger group of patients was 75%9.
While direct capture systems preclude the
need for repetitive epitopes, they require
large antigen concentrations and therefore
give positive results only in those individuals with a large cyst load. Another technical
point that has bearing on the positive yield
is that concentrated serum samples inhibit
the signal obtained due to antigen. Dilution
improves this signal but may reduce antigen concentration as well, thereby compro-
mising the sensitivity of the assay.

Accordingly, a balanced dilution needs to
be determined in order to optimize performance of the assay.
Potential Applications of Antigen

Detection in the Study of T. solium
Infection
Species specific antigens
PoAbs against crude preparations of
metacestodes cross-react with antigens of
other cestodes as well. This holds true for
MoAbs that have been developed for T.
solium antigen detection. Indeed, certain
MoAbs that detect T. solium antigens were
raised against T. saginata antigens12,13,32.
Antigen detection assays are therefore only
genus-specific, and their use is limited in
areas where hydatidosis and cysticercosis
are co-endemic. Recently, we developed a
MoAb against the adult T. solium which
reacts much less strongly or not at all with
T. saginata and other parasitic antigens (Y.
Medina-Flores, R. Garca-Rodea, D. Correa,
Instituto de Diagnstico y Referencia
Epidemiolgicos & Instituto Nacional de
Pediatra, Ministry of Health, Mxico City,
Mxico, unpublished observations). Its use
for antigen detection in cysticercosis
deserves further investigation.
Stage specific antigens

Positive antigen seroassays do not necessarily imply a diagnosis of T. solium cysticercosis because of sharing of antigens
between the metacestode and adult stages
of T. solium. We found circulating antigens
in sera of almost 20% of cases with taeniasis in an endemic community of Mexico21.
In the hamster model of taeniasis, adult
antigens have been demonstrated to cross
the intestinal epithelium and enter the circulation
(G.
Avila,
M.
Benitez,
L. Aguilar, et al., Universidad Nacional
Autnoma de Mxico, Mxico DF, Mxico,
unpublished observations). The elaboration

of stage-specific antigens may turn out to
be useful in the differentiation of infection
due to the adult and metacestode forms of
T. solium.
Antigens of live and degenerating

cysticerci
It is desirable to have serological test(s) that
differentiate between live-viable and dyingdegenerating cysticerci. In experimental T.
saginata cysticercosis, antigens appear within
4 weeks of infection, and disappear rapidly
when the parasites are eradicated by treatment11. Conceivably, the detection of these
antigens may indicate the presence of live
parasite. With specific reference to T. solium,
the HP10 MoAb was found to be specific for
a surface component of the metacestode,
while another (HP12) reacted against a vesicular fluid component11. A capture assay
employing the former was 7286% sensitive
in CSF of humans with NC12,13. In contrast,
the HP12 MoAb gave comparatively lower
sensitivity; it failed to detect massive infection in pigs, and was able to detect antigens
in only half of the human cases12,32. Another
MoAb developed by Cho et al. against an
antigen of vesicular fluid produced positive
antigen bands in 11% cases; out of these, a
number of instances became positive only
after praziquantel treatment17. The discrepant
results obtained with MoAbs against surface
and vesicular fluid components could be
related to the evolutionary stage of cysticerci.
Therefore, CSF or sera of individuals with
live, viable cysticerci are likely to be surface
antigen-positive and vesicular fluid antigennegative, while those with dying-degenerating cysticerci are expected to be both surface
and vesicular fluid antigen positive. A caveat
of this principle is that in actual clinical situations, live and dying cysticerci often coexist
at any given time. Nevertheless, antigen
studies may be useful in follow-up and monitoring disease progression and response to
anticysticercal treatment33.
347
Antigen Detection Assays:

Community-based Epidemiological
Applications
The application of antigen detection assays
in community based serosurveys has been
limited on account of their poor yield in the
serum in comparison to CSF. A survey of an
endemic community in Mexico indicated an
antigen positivity rate of 1%20. In this study,
16% of individuals with late-onset epilepsy
presented antigens in their sera. In a similar
study in another endemic region of Mexico,
19% of individuals with late-onset epilepsy
were positive by antigen-based assays in
their sera21. However, no association
between the antigen positivity and lateonset epilepsy was found in a survey in
Burundi30. Further studies are needed to
establish the utility of antigen-detection
assays for epidemiological studies and control programme surveillance.
Conclusions
Antigen-detection assays have been used
infrequently in comparison to antibody
based serodiagnosis in clinical and epidemiological studies of T. solium cysticercosis.
There are several potential advantages of
systems that employ antigens for serodiagnosis. The detection of antigens correlates
with the presence of live cysticerci. Studies of
antigens thereof may be useful in monitoring
disease progression and response to anticysticercal therapy. Preliminary evidence suggests that it might be possible to differentiate
between T. solium infection due to adult and
metacestode forms and also between live
and dying-degenerating stages of cysticercosis. A major limitation of antigen-detection
systems however, is the lack of sensitive
assays that would be able to pick up oligolesional disease. The challenge is to improve
their diagnostic yield by the use of standardized, low-background specific monoclonal
antibody cocktails and of amplifying systems such as the polymerase chain reaction.
348
D. Correa et al.
References
1. Garca, H.H., Del Bruto, O.H. (2000) Taenia solium cysticercosis. Infectious Disease Clinics of North
America 14, 97119.
2. Antoniuk, S. (1999) Epidemiology of neurocysticercosis. Revue Neurologique 29, 331334.
4. Tsang, V.C.W., Brand, J.A., Boyer, A.E. (1989) An enzyme linked immunoelectrotransfer blot assay
and glycoprotein antigens for diagnosis of human cysticercosis (Taenia solium). Journal of Infectious
Diseases 59, 5059.
5. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigations
6. Correa, D. (1998) Los Antgenos del Cisticerco de Taenia solium: Aspectos Bsicos y Aplicacin en el
Diagnstico Clnico y en Estudios Epidemiolgicos. PhD thesis, Instituto de Investigaciones
Biomdicas, UNAM, Mxico.
7. Velasco, O.C., Guzmn, B.C., Gutirrez, Q.M., et al. (1983) Comparacin de una tcnica de deteccin
de antgenos solubles de Cysticercus cellulosae. Salud Pblica de Mxico 25, 205208.
8. Estrada, J.J., Kuhn, E.R. (1985) Immunochemical detection of antigens of larval Taenia solium and
anti-larval antibodies in the cerebrospinal fluid of patients with neurocysticercosis. Journal of the
9. Tellez-Girn, E., Ramos, M., Dufour, L., et al. (1987) Detection of Cysticercus celullosae antigens in
the cerebrospinal fluid by dot enzyme-linked immunosorbent assay (Dot-ELISA) and standard
ELISA. American Journal of Tropical Medicine and Hygiene 37, 169173.
10. Estrada, J.J., Estrada, A.J., Kuhn, E.R. (1989) Identification of Taenia solium antigens in cerebrospinal
fluid and larval antigens from patients with neurocysticercosis. American Journal of Tropical Medicine
11. Harrison, L.J.S., Joshua, G.W.P., Wright, S.H., et al. (1989) Specific detection of circulating
surface/secreted glycoproteins of viable cysticerci in Taenia saginata cysticercosis. Parasite
12. Correa, D., Sandoval, M.A., Harrison, L.J., et al. (1989) Human neurocysticercosis: comparison of
enzyme immunoassay capture techniques based on monoclonal and polyclonal antibodies for the
detection of parasite products in cerebrospinal fluid. Transactions of the Royal Society of Tropical
13. Garca, H.H., Harrison, L.J., Parkhouse, R.M., et al. (1998) A specific antigen-detection ELISA for the
diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and
Hygiene 92, 411414.
14. Correa-Beltrn, M.D., Proao-Narvaez, J., Allan, J.C., et al. (1997) Immunodiagnstico de neurocisticercosis mediante la determinacin de anticuerpos y antgenos en lquido cefalorraqudeo y suero.
In: Arraigada, C., Nogales-Gaete, J., Apt, W. (eds) Neurocisticercosis. Aspectos Epidemiolgicos,
Patolgicos, Immunolgicos, Clnicos, Imagenolgicos y Teraputicos. Arrynog ediciones, Santiago de
Chile, pp. 279286.
15. Mata-Ruiz, O. (1996) Caracterizacin de los Antgenos de la Larva de Taenia solium Presentes en el
Suero y el Liquido Cefalorraqudeo de Pacientes Cisticercosos. Thesis, Facultad de Estudios
Superiores, Cuautitln, UNAM, Mxico.
16. Choromanski, L., Estrada, J.J., Kuhn, R.E. (1990) Detection of antigens of larval Taenia solium in the
cerebrospinal fluid of patients with the use HPLC and ELISA. Journal of Parasitology 76, 6973.
17. Cho, S.Y., Kong, Y., Kim, S.I., et al. (1992) Measurement of 150 kDa protein of Taenia solium metacestodes by antibody-sandwich ELISA in cerebrospinal fluid of neurocysticercosis patients.
Kisaengchunghak Chapchi 30, 299307.
18. Wang, C.Y., Zhang, H.H., Ge, L.Y. (1992) A MAb-based ELISA for detecting circulating antigen in
CSF of patients with neurocysticercosis. Hybridoma 11, 825827.
19. Wang, C.Y., Li, Q.S., Zhang, H.H., et al. (1993) Detection of cAg in CSF of 231 cerebral cysticercosis
patients. Chung kuo Chi Sheng Chung Hsueh Yu Chi Shang Chaung Ping Tsa Chih 11, 276278.
349
20. Aranda-Alvarez, J.G., Tapia-Romero, R., Alcntara-Anguiano, I., et al. (1995) Human cysticercosis:
risk factors associated with circulating serum antigens in an open community of San Luis Potos,
Mxico. Annals of Tropical Medicine and Parasitology 89, 689692.
21. Correa, D., Sarti, E., Tapia-Romero, R., et al. (1999) Antigens and antibodies in sera from human
cases of epilepsy or taeniosis from an area of Mexico where Taenia solium cysticercosis is endemic.
Annals of Tropical Medicine and Parasitology 93, 6974.
22. Garca-Garca, L., Torres, M., Correa, D., et al. (1999) Prevalence and risk factors for cysticercosis and
taeniosis in an urban population represented by soldiers and their relatives. American Journal of
23. Flisser, A., Woodhouse, E., Larralde, C. (1980) Human cysticercosis: antigens, antibodies and nonresponders. Clinical and Experimental Immunology 39, 2737.
24. Larralde, C., Montoya, R.M., Scuitto, E., et al. (1989) Deciphering Western blots of tapeworm in antigens of Taenia solium, Echinococcus granulosus and Taenia crassiceps resolving with sera from neurocysticercosis and hydatid disease patients. American Journal of Tropical Medicine and Hygiene 40,
282290.
25. Laclette, J.P., Merchant, M.T., Willms, K. (1987) Histological and ultrastructural localization of antigen B in the metacestode of Taenia solium. Journal of Parasitology 73, 121125.
26. Laclette, J.P., Rodrguez, A., Landa, A., et al. (1989) The coexistence of Taenia solium cysticerci and the
pig: role of antigen B. Acta Leidensia 57, 115122.
27. Espinoza, B., Ruiz-Palavios, G., Tovar, A., et al. (1986) Characterization by enzyme linked
immunosorbent assay of the humoral immune response in patients of neurocysticercosis and its
application in immunodiagnosis. Journal of Clinical Microbiology 24, 536541.
28. Plancarte, A., Flisser, A., Larralde, C. (1983) Fibronectin-like properties in antigen B from the cysticercus of Taenia solium. Cytobios 36, 8393.
29. Laclette, J.P., Shoemaker, C., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of
30. Newell, E., Vyungimana, F., Geerts, S., et al. (1997) Prevalence of cysticercosis in epileptics and members of their families in Burundi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91,
389391.
31. Rabenantoandro, R., Rasoloarijaona, L., Raharivelina, C., et al. (1996) Extramembranous glomerulonephritis and cysticercosis. Sant (Montrouge, France) 6, 254257.
32. Rodriguez-del-Rosal, E., Correa, D., Flisser, A. (1989) Swine cysticercosis: detection of parasite products in serum. Veterinary Record 124, 488.
33. Yonghao, Z., Junping, L., Minru, Z., et al. (1995) Observations on circulating antigen from patients
with cysticercosis before and after treatment. Chung kuo Chi Sheng Chung Hsueh Yu Chi Shang Chaung
Ping Tsa Chih 13, 224227.
35
Polymerase Chain Reaction in the

Diagnosis of Taenia solium Cysticercosis
Taru Meri and Seppo Meri
Introduction
In general, molecular methods offer faster,
more sensitive and/or more specific diagnosis
of microbial infections than traditional methods (e.g. cultivation, serology or microscopic
analysis). Detection of microbes from their virulence factors, for example from the production of toxins or from the presence of
antimicrobial resistance genes, is possible with
molecular methods. This allows rapid identification decreasing overall patient care costs,
avoiding unnecessary treatments and guiding
more accurate medical care. Techniques in
molecular diagnostics usually incorporate
nucleic-acid-based assays to detect pathogens
or products of pathogens, like toxins. A
reporter DNA or RNA molecule called a probe
or a primer, is used to either amplify (in polymerase chain reaction or PCR) or detect (by
hybridization) DNA or RNA sequences of
pathogens. In the hybridization assay, target
nucleic acids are immobilized on a solid phase
and detected using labelled nucleic acid
probes. When a target DNA is digested, electrophoretically separated and detected with a
probe, the procedure is called Southern blotting. When the target molecule is RNA, the
procedure is called Northern blotting. Nucleic
acid amplification using the PCR, nowadays a
rapid and automated procedure, will be discussed in detail in the next section of this chapter. In addition to providing an accurate and
specific diagnosis, sequencing can give information on virulence factors and mutations and
help in the identification of new pathogens1.
With specific reference to parasitology,
molecular methods can be used for distinguishing between morphologically or antigenically similar parasites and their variants.
More importantly, they allow detection of an
organism from a very small parasitic load,
which could sometimes be difficult with traditional methods. The results of PCR assays
are independent of the patients immunocompetence and previous clinical history. Also,
PCR results are positive regardless of the state
of infection, for example whether it is acute or
latent. The organisms detected need not be
alive or viable. There are only a few nucleicacid-based radioisotopic assays described for
the diagnosis of flukes (Trematoda), which are
traditionally diagnosed by the presence of
worm eggs in patients samples2. Nematodes,
on the other hand, are usually smaller in size,
and the number of species infecting humans
is larger. A PCR-based analysis of trichinellosis was able to differentiate domestic isolates from the sylvatic ones3. In particular,
since the infective microfilariae of most nematodes are small in size and the number can
vary considerably during infection, species
identification with traditional methods is
laborious and difficult. Also, in some species
the presence of microfilariae in the peripheral
blood varies periodically and in a species-

351
352
T. Meri and S. Meri
specific manner. PCR-based amplification

assays specific for e.g., Wuchereria bancrofti,
Loa loa, Onchocerca volvulus, Setaria digitata and
Dirofilaria sp., have been developed for use in
research and diagnostics48. New PCR-based
methods for the diagnoses of multicellular
parasites are now being developed.
Overview of PCR Technique

Polymerase chain reaction is based on
amplification of a known sequence from the
target DNA with two oligonucleotide
primers. The sequence to be amplified
5
should be specific for the target organism.

The process consists of three steps. The first
involves heating of the double-stranded
sample DNA to denature it into two singlestranded DNA templates. In the second step,
the sample is cooled down for primers to
anneal to the single-stranded DNA targets.
The annealing temperature is important for
the specificity and function of the PCR. The
final step entails amplification, during
which a thermostable DNA-polymerase synthesizes new DNA strands to the unfinished
single strands from the nucleotides provided in the mixture so that both strands are
fully built (Fig. 35.1). These amplification
3
Target double-stranded DNA
3
5
Heating of the reaction mixture

Double strand is denatured,
Primers anneal to target binding sites
5
3
Primer A
Cycle 1
Primer B
3
5
Elongation of target DNA leading to
formation of two double-stranded
DNA with strands of variable lengths
Annealing, binding of primers and elongation

Cycle 2
Annealing, binding of primers and elongation
Cycle 3
Fig. 35.1. Polymerase chain reaction. The template DNA, primers, nucleotides and DNA polymerase are
mixed in the presence of a suitable salt concentration. One reaction cycle consists of three steps:
denaturation, annealing and elongation. During each cycle, the amount of DNA is duplicated.
PCR in the Diagnosis of Cysticercosis
cycles are usually repeated 2535 times to

produce a detectable amount of the amplified target DNA. In each cycle the amount of
DNA is duplicated. PCR is a very effective
and sensitive method; under optimized circumstances as little as 1 pg of a template is
enough to produce 1 g of the target DNA
after 3035 cycles.
Template
The total genomic DNA from the target
organism can be used as a starting material
for a diagnostic PCR. Steps involved in the
extraction of DNA from cyst, biopsy or tissue samples are explained in the Appendix.
In normal laboratory experiments, less than
1 g of total genomic DNA is sufficient for
PCR analysis. The amount of template is
important in the reaction. If the DNA sample is too dilute, for instance, if it is taken
from individual cell or paraffin-embedded
tissues, the probability of collision between
the template and the primers is reduced in
the reaction leading to formation of
primerdimers and other artefacts9. The
amount of sample DNA can be determined
either by agarose gel electrophoresis or more
accurately by measuring the absorbance of
the sample (at 260 nm) before performing
the PCR analysis.
Primer design
Primers are usually 1530 bases long and
their concentrations in the reaction mixture
vary from 0.05 mol to 0.5 mol. Primers
should be exact matches to the desired target
sequence and should not have homology to
any other sequence in the template mixture.
When selecting a primer for PCR, its CGcontent, which also determines the annealing
temperature, should be similar to that of the
fragment being amplified. Primers should
not contain major secondary structures or be
complementary to each other to avoid selfannealing. Computer programs can be used
to design primers. The use of previously
published and established primers is recommended for routine diagnostic work.
353
DNA polymerases
The discovery of a thermostable DNA polymerase, which is able to catalyse polymerization at high temperatures, has allowed
the automation of the PCR and improved
the method in more specific and sensitive
direction. The most widely used thermostable DNA polymerase (Taq polymerase) comes from the bacterium, Thermus
aquaticus. It is used by most of the PCR protocols for diagnostic work. Nowadays, a
number of themostable DNA polymerases
are commercially available. Their enzymatic
properties have been reviewed elsewhere10.
Taq polymerase is suitable, for example, in
the Taenia PCR. The amount of Taq polymerase used is usually 22.5 units per
100 l reaction.
Polymerase Chain Reaction in

T. solium Cysticercosis
In cysticercosis, the number, location and
morphology of the cysts is not always optimal for diagnosis with traditional methods.
Computed tomography (CT) and magnetic
resonance imaging (MRI) are very useful in
establishing a diagnosis of NC in routine
clinical practice. Indirect evidence for cysticercosis may be provided by demonstration of intestinal taeniasis by microscopic
detection of eggs in faecal specimens or by a
somewhat more sensitive analysis of
coproantigens11. However, at times the
results of imaging, serology and faecal
examination are ambiguous and inadequate
for firm diagnosis. Thus, additional tools,
e.g. histology and/or PCR of a removed
cyst-like structure, are needed. DNA probes
specific for various Taenia sp. have been
used to detect eggs, and proglottides from
human faecal samples as well as adult
worms or cysts1216. They have also been
used in the diagnosis of cysticercosis with
atypical presentations17. The sample for PCR
analysis of cysticercosis can be an entire or
part of a suspicious cyst. A simultaneous
histopathological examination of the sample
is advisable to corroborate PCR results.
354
T. Meri and S. Meri
DNA extraction
Extraction of DNA should be performed
from the sample before using it in the PCR
and the amount of DNA extracted should
be checked. The sample should not be
fixed with formalin, because this might
affect the composition and behaviour of
the DNA. If the sample has to be stored,
for example, during transport, either 70%
ethanol or freezing are preferred options.
Different modifications of DNA isolation
methods have been published, but these
are mostly based on extraction of the DNA
with phenol-chloroform. The tissue samples are first homogenized, and subsequently, cells are lysed in the presence of
proteinase K, sodium dodecyl sulphate
(SDS) and ethylenediamine tetra-acetic acid
(EDTA). The nucleic acids are extracted
with phenolchloroformisoamyl alcohol,
precipitated with ethanol in the presence
of high salt concentration and harvested by
centrifugation. The basic protocol has been
reviewed in Sambrook et al.18.
Selection of DNA probes for the detection

of Taenia sp.
Flisser and colleagues used a DNA
hybridization
assay
involving
total
genomic radioactive-labelled/biotinylated
DNA for detecting T. saginata eggs12. In
similar experiments, two DNA probes,
HDP1 and HDP2 were hybridized to
genomic DNA from T. solium, T. saginata as
well as other Taenia sp.14. The first probe
hybridized with both T. solium and T. saginata, while the other identified T. saginata
genomic DNA. Gottstein and Mowatt
reported that primers for the PCR diagnosis of Echinococcus multilocularis, BG1
(5TCAGTCTATTCTCCTCTCAATGCC3
) and BG2 (5-GCAGTCTATTCTCCTCTCAACTGCC-3), were able to detect T. saginata and T. taeniaeformis producing 0.55-kb
and 0.6-bp fragments, respectively19.
However, with E. multilocularis, the same
primers produced a 2.6-kb fragment from
the genomic DNA that was used as a sample19. Chapman et al. developed Taenia sp.
specific probes from the genomic DNA

libraries of T. solium and T. saginata and
used them in hybridization assays for
Taenia eggs with high sensitivity and specificity13. A 158-bp DNA sequence constituted the T. solium specific DNA probe
while another DNA segment encoding
cytochrome c oxidase 1 gene was recognized by the T. saginata specific probe. The
probes reliably differentiated between T.
saginata and T. solium eggs. In addition the
probes did not significantly hybridize to
genomic DNA of E. granulosus and other
Taenia sp. We used primers designed to
amplify the 18S ribosomal RNA gene of T.
solium (forward primer: 5GGTGGCGGTGAGGATGATGGTG3; reverse primer:
5TGCTCTATTTCGTGCGCGGCTTCTCC
3) in a PCR assay for neurocysticercosis17.
Oligonucleotides for the diagnosis of both
T. solium and T. saginata in a multiplex
PCR were designed from the sequence of
3954 bp (HDP2). Three oligonucleotides,
(PTs7S35F1 5CAGTGGCATAGCAGAGGAGGAA3, PTs7S35F2 5CTTCTCAATTCTAGTCGCTGTGGT3 and PTS7s35r1 5
GGACGAAGAATGGAGTTGAAGGT3)
used in the assay produced two bands sized
600 bp and 170 bp for T. saginata and one band
of 170 bp for T. solium from 1 ng of genomic
DNA. When the same primers were used for
amplification of an E. granulosus sample, two
bands of 900 bp and 550 bp were seen16.
Controls and contamination risks

Quality controls are extremely important
when performing a diagnostic PCR. First,
the amplification cycle itself should always
have a positive (T. solium DNA) and a negative control (the sample volume of distilled water added to the reaction mixture)
to ensure that the DNA polymerase and
other reagents in the mixture are functioning. When tissue sample is used for diagnosis, the PCR may be negative. To check
that the extraction of the DNA from the
sample has succeeded, primers amplifying
a human gene (e.g. human actin gene)
should be used as a control. If the sample
cyst is from pig tissue, primers amplifying

a pig gene are needed as control.
Contamination of the reaction mixtures
with parasite DNA from positive controls
or from previous amplifications gives
false-positive results. The working areas
should be arranged so that the samples are
not in contact with other reagents. More
information about preventing laboratory
contamination and quality control of PCR
is available20. Details of the arrangements
of a PCR working laboratory have also
been reviewed elsewhere21.
355
Conclusions
Several PCR based assays for the detection of
T. solium eggs, proglottides and larval material from human and porcine tissues have
been described. Preliminary evaluation has
shown these assays to be reliable, sensitive
and specific. A major limitation of this exciting technology is the lack of its widespread
availability. These methods still need to be
evaluated in comparison with conventional
parasitological methods in both clinical and
epidemiological settings.
References
1. Dumler, J.S., Valsamakis, A. (1999) Molecular diagnostics for existing and emerging infections.
Complementary tools for a new era of clinical microbiology. American Journal of Clinical Pathology
112 (Suppl), 3339.
2. Weiss, J. (1995) DNA probes and PCR for diagnosis of parasite infections. Clinical Microbiology
Reviews 8, 113130.
3. Dick, T.A., Lu, M.C., deVos, T., et al. (1992) The use of the polymerase chain reaction to identify
porcine isolates of Trichinella. Journal of Parasitology 78, 145148.
4. Dissanayak, S., Min, X., Piessens, W.F. (1991) Detection of amplified Wuchereria bancrofti DNA in
mosquitoes with a non-radioactive probe. Molecular Biochemistry and Parasitology 45, 4956.
5. Klion, A.D., Raghavan, N., Brindley, P.J., et al. (1991) Cloning and characterization of a species-specific repetitive DNA sequence from Loa loa. Molecular Biochemistry and Parasitology 45, 297305.
(Published erratum appears in Molecular Biochemistry and Parasitology 47, 265)
6. Meredith, S.E., Lando, G., Gbakima, A.A., et al. (1991) Onchocerca volvulus: application of the
poymerase chain reaction to identification and strain differentiation of the parasite. Experimental
7. Wijesundera, W.S., Chandrasekharan, N.V., Karunanayake, E.H. (1999) A sensitive polymerase chain
reaction based assay for the detection of Setaria digitata: the causative organism of cerebrospinal
nematodiasis in goats, sheep and horses. Veterinary Parasitology 91, 225233.
8. Favia, G., Lanfraqncotti, A., della Torre, A., et al. (1997) Advances in the identification of Dirofilaria
repens and Dirofilaria immitis by a PCR- based approach. Parasitology 39, 401402.
9. Kidd, K.K., Ruano, G. (1994) Optimizing PCR. In: McPherson, M., Hames, B., Taylor, R. (eds) PCR 2:
a Practical Approach. Oxford University Press, Oxford, UK, pp. 121.
10. Abramson, R. (1995) Thermostable DNA polymerases. In: Innis, M., Gelfand, D., Sninsky, J. (eds).
PCR Applications. Academic Press, San Diego, pp. 3347.
11. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigenbased diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. American Journal
12. Flisser, A., Reid, A., Gracia-Zepeda, E., et al. (1988) Specific detection of Taenia saginata eggs by DNA
hybridisation. Lancet ii, 14291430 (Letter).
13. Chapman, A., Vallejo, V., Mossie, K., et al. (1995) Isolation and characterization of species-specific
Clinical Microbiology 33, 12831288.
14. Harrison, L.J., Delgado, J., Parkhouse, R.M. (1990) Differential diagnosis of Taenia saginata and Taenia
solium with DNA probes. Parasitology 100, 459461.
15. Rishi, A.K., McManus, D.P. (1988) Molecular cloning of Taenia solium genomic DNA and characterization of taeniid cestodes by DNA analysis. Parasitology 97, 161176.
16. Gonzalez, L.M., Montero, E., Harrison, L.J., et al. (2000) Differential diagnosis of Taenia saginata and
Taenia solium infection by PCR. Journal of Clinical Microbiology 38, 737744.
356
T. Meri and S. Meri
17. Meri, T., Jokiranta, T.S., Granat, S., et al. (1999) Diagnosis of atypical neurocysticercosis by polymerase chain reaction analysis: a case report. Clinical Infectious Diseases 28, 13311332.
18. Sambrook, J., Fritsch, E.F., Maniatis, T. (2000) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
19. Gottstein, B., Mowatt, M.R. (1991) Sequencing and characterization of an Echinococcus multilocularis
DNA probe and its use in the polymerase chain reaction. Molecular Biochemistry and Parasitology 44,
183193.
20. Dragon, E.A., Spadoro, J.P., Madej, R. (1993) Quality control of polymerase chain reaction. In:
Persing, D., Smith, T., Tenover, F., et al. (eds) Diagnostic Molecular Microbiology: Principles and
Applications. American Society for Microbiology, Washington, DC, pp. 160168.
21. McCreedy, B.J., Callaway, T.H. (1993) Laboratory design and work flow. In: Persing, D., Smith, T.,
Tenover, F., et al. (eds) Diagnostic Molecular Microbiology: Principles and Applications. American Society
for Microbiology, Washington, DC, pp. 149159.
Appendix
This is a general overview of the methods
needed for PCR analysis of T. solium cysticercosis. The selection of primers for the sample
and for the controls is different for different
laboratories, but we recommend the selection
of primers from among those published for T.
solium PCR diagnosis. Annealing temperature of the PCR cycle is dependent on the
primer selected. A positive (T. solium DNA)
and negative control are mandatory. If eggs,
proglottides or worms are used as a sample,
primers for both T. solium and T. saginata are
needed. To control DNA extraction from
human samples, primers amplifying human
DNA need to be used, for example, primers
for the human actin gene. It is recommended
that the products of the PCR analyses be
purified and sequenced, particularly when
the method is being introduced to a new laboratory. A positive PCR assay should be corroborated by other means of diagnosis.
Buffers and other reagents

DNA extraction buffer: 50 mM Trishydrochloric acid (Tris-HCl), pH 7.5,
50 mM EDTA, pH 8.0, 0.5% sodium
dodecyl sulphate (SDS), proteinase K 200
g ml1;
Proteinase K;
Tris/EDTA-buffer:
10 mM
Tris-HCl,
0.1 mM EDTA (pH 8.0);
Phenol (must be equilibrated to a pH
>7.8);
Chloroform;
Isoamyl alcohol;
Ethanol;
3 M sodium acetate (pH: 6.0);
For PCR: deoxynucleotide triphosphates
(dATP, dGTP, dCTP, dTTP), reaction
buffer (500 mM potassium chloride (KCl),
15 mM magnesium chloride (MgCl2)
100 mM Tris-HCl (pH: 9.0 at room temperature)), Taq DNA-polymerase (Perkin
Elmer, Foster, CA, USA);
5 Tris/borate buffer: 450 mM Tris base,
450 mM boric acid, 10 mM EDTA (pH 8.0);
Ethidium bromide (stock solution 10
mg ml1);
357
SeaKem agarose (Sigma Chemical, St

Louis, MO, USA);
PCR marker (e.g. Promega, Madison, WI,
USA);
Gel-loading buffer (10 buffer): 5 mg
ml1 bromophenol blue, 5 mg ml1 cylene
cyanol.
Sample preparation from cysts

Samples of cysts are placed in 0.9% sodium
chloride (NaCl) immediately after removal
and frozen as soon as possible (preferably to
70C) before PCR analysis.
DNA extraction
1. Grind the frozen sample to a fine powder;
suspend it in DNA extraction buffer and heat
at 55C for 1 h.
2. The sample is extracted twice (or until no
protein is visible at the interface) with
phenol :chloroform :isoamyl alcohol (25 : 24 :1).
3. DNA is harvested with ice-cold 100%
ethanol and one-tenth of the sample volume,
3 M sodium acetate (pH 6.) is added. Keep
the tube at 20C for 1 h and centrifuge for
30 min (full speed) in a microcentrifuge. The
pellet is washed with 70% ethanol and
recovered by centrifugation (12,000 g for 10
min at 4C). The nucleic acids are then resuspended in the TE-buffer.
4. The amount of DNA in the sample is measured, e.g. with a spectrophotometer. DNA is
diluted with distilled water (dH2O) and
absorbance in the wavelength of 260 nm is
measured. In double-stranded DNA the
OD260 of 1.0 equals 50 g DNA ml1.
PCR amplification
PCR reactions are performed in a volume of
100 l.
1. The PCR master mix/reaction contains:
(i) 10 pmol of each primer;
(ii) 12.5 mM of each nucleotide (dATP,
dGTP, dCTP, dTTP);
(iii) one vol. reaction buffer containing
50 mM potassium chloride, 1.5 mM
358
T. Meri and S. Meri
MgCl2, and 10 mM Tris-HCl. Make up the

volume with dH2O.
2. The PCR master mix is prepared for all
samples and controls. Add the sample DNA
(approximately 500 ng per reaction),
taking care to prevent contamination.
Subsequently, prepare the Taq polymerase (2
U per reaction).
3. The amplification is performed in a programmable thermal cycler. This is a suggested protocol if primers from reference 17
are used, otherwise the amplification protocol is chosen according to the primers
selected; 94C, 10 min (initial denaturation)
followed by 35 cycles of 94C for 1 min
(denaturation), 58oC for 1 min (annealing),
72C for 1 min (extension) and 72C for 10

min (final extension).
4. Electrophoretic analysis of reaction products:
(i) Prepare an agarose gel into 1 TBE
buffer (the percentage of the gel depends on
the size of the target product; 3% for the target DNA 500 bp, 2% for the target DNA
sized 5001000 bp and 1.5% for 10002000
bp). Add ethidium bromide stock solution
to the gel (3 l per 100 ml);
(ii) Add 3 l of 10 loading dye to each
sample, remember to have the PCR marker
in one lane;
(iii) Electrophorese the gels;
(iv) Analyse the results of PCR under
ultraviolet light.
36
Immunodiagnosis in Solitary
Cysticercus Granulomas
Anna Oommen
Introduction
Hospital-based studies indicate that over 60%
cases of neurocysticerosis (NC) in India are
solitary granulomas1. This is based on evidence from imaging studies that show that
solitary cysts can be viable, dying or calcified
and varied in their location. Solitary cysticercal granulomas (SCG) are also reported from
other parts of the world the disease not
being peculiar to the Indian sub-continent2,3. A
serodiagnostic test for the disease should
therefore be capable of detecting a low antigenic stimulus from a spectrum of the disease.
It is pertinent to pathophysiology to delineate events that limit Taenia solium egg ingestion to a solitary cyst in the brain or to multiple
cysts. Is SCG accompanied by taeniasis and/or
subcutaneous cysticercus infestation? What
cellular interactions and immune responses are
elicited in the infection of the central nervous
system (CNS) by a solitary cysticercus? How
early in the disease is the immune response
manifested and for how long does it persist?
Which T. solium metacestode antigens are
immunodominant and what is their molecular
composition? Are excretorysecretory proteins
of the larva more antigenic? Answers to these
questions may be helpful in the rational design
of immunodiagnostic tests for SCG.
The number of solitary to multiple cysticercus granulomas cited in hospital-based
studies is not a true reflection of the disease

status in the community. Indeed the incidence
and prevalence of NC in India are not known
and there is need to determine and understand the burden of the disease in the population. It is therefore evident that although
imaging is an excellent investigation for NC,
diagnostics for the disease must incorporate
tests that are inexpensive and which can be
carried out in laboratories with minimal infrastructure. This is true for most countries where
NC is prevalent. This needs focused work on
the serodiagnosis of NC. Although several
serodiagnostic approaches have been tried,
including passive haemagglutination4 and
complement fixation5,6, enzyme linked immunoelectrotransfer blot (EITB) and ELISA have
proved to be the most useful in both diagnosis
and epidemiological studies79.
Overview of Serodiagnosis In
Neurocysticercosis
The EITB using lentil lectin-specific cyst
glycoproteins is 100% specific and up to
98% sensitive in detecting anticysticercus
antibodies in serum of NC patients with
two or more cysts7. ELISA estimating
serum IgG antibodies against cyst fluid
proteins or antigens extracted from whole
cysts report sensitivity and specificity of

359
360
A. Oommen
6090% for multiple NC10. Cerebrospinal

fluid (CSF) IgM is more sensitive and specific for NC (90% in ELISA)11 but as most
patients with NC do not require a lumbar
puncture for other investigations, serum is
the preferred fluid for testing. IgG antibodies have been detected in all phases of the
disease in CSF, serum and saliva while IgA
and IgE are more frequently seen in the
inactive form of NC12.
Taenia solium cyst glycoprotein purification by Tsang et al.7 for the EITB is laborious
and cyst antigens requiring simpler methods
of purification have been investigated.
Recent work by Ito et al.13 to purify cyst glycoprotein antigens of 1026 kDa by isoelectric focusing, is highly specific and sensitive
for NC in ELISA and immunoblots. These
antigens, obtained in the range of pH 9.29.6,
perform well in ELISA and do not exhibit the
usual cross-reactivity of anticysticercus antibodies with Echinococcus. In contrast to the
seven cyst glycoproteins purified over lentil
lectin, which give rise to a high background
in ELISA, hence restricting their use to
immunoblots, the use of these antigens is
comparatively simple13. Recombinant 10
kDa protein prepared and purified by
Chung et al.14,15 and used in immunoblots is
claimed to distinguish active NC from the
inactive disease. Patients with chronic calcified cysts exhibit weak reactivity against the
10-kDa protein while a strong reaction is
seen in patients with active NC.
Serodiagnostic tests for NC should benefit
from ongoing studies elucidating carbohydrate structures of antigenic glycoproteins
of T. solium metacestodes as well as from the
use of synthetic immunodominant peptides16,17(reviewed in Chapter 33).
Serodiagnostic Studies in Solitary

Cysticercus Granulomas
All serodiagnostic tests for NC established
to date are with reference to multiple cyst
conditions. In studies where cases of SCG
have been included, the tests are invariably
disappointing. A low antibody response

arising from an antigen challenge of only a
single (few) cyst(s) in these patients may
explain poor serodiagnostic performance18.
The poor serodiagnostic yield is also
observed in larger series of SCG. Singh et al.
demonstrated a sensitivity of 57% for ELISA
in 37 patients with single, small enhancing
computed tomography lesions19. In 205
patients with radiologically diagnosed SCG
that were both viable and calcified, we
found that an ELISA to detect serum IgG
antibodies using cyst fluid antigens from
locally acquired cysts was 46% and 54%
sensitive and specific. The patients were
from different regions of India. Using a
commercial ELISA (not made in India) the
test was 31% and 50% sensitive and specific
for SCG. This demonstrates the advantage
of using antigens from the local parasite in
immunodiagnosis, for their enhanced performance in detecting diseases of the
region. The common cross-reactivity of
tuberculomas reported with T. solium antigens in commercial kits was not observed in
the in-house ELISA. The largest source of
cross-reactivity in this study was seen in
patients with astrocytomas.
The EITB for SCG retains high specificity
but sensitivity falls to 50% among hospital
patients. This is seen in studies from different centres and indicates that as for ELISA,
the test underestimates the prevalence of disease19,20. However Singh et al.21 have also
shown the EITB to be 85% sensitive in children with a recent history of seizures and
radiologically detected to have SCG. The test
was 80% sensitive in family contacts of SCG
patients who had a history of seizures.
Healthy controls with no seizures and radiologically clear but EITB-positive were considered to be infected with T. solium
extraneurally. Their study validates EITB as
a specific and sensitive test for SCG in persons with seizures in India. Although it is
not clear why these results are so different
from others on SCG in India or from most
reports of EITB and SCG in literature, they
offer promise in using the test for SCG.
Immunodiagnosis in Solitary Cysticercus Granulomas
Conclusions
Currently, there are no serodiagnostic tests
that can unequivocally be recommended
for routine diagnosis for SCG. However,
our increased understanding of the
361
immune response to T. solium in different

populations and of antigen characterization, as well as high amplification detection
systems for immunological reactions now
available, argue that reliable serodiagnosis
of SCG is possible.
REFERENCES
1. Rajshekhar, V., Chandy, M.J. (2000) Incidence of solitary cysticercus granulomas. In: Rajshekhar, V.,
Chandy, M.J. (eds) Solitary Cysticercus Granuloma. The Disappearing Lesion. Orient Longman,
Chennai, India, pp. 1228.
2. Wadley, J.P., Shakir, R.A., Rice, E.J.M. (2000) Experience with neurocysticercosis in the UK: correct
diagnosis and neurosurgical management of small enhancing brain lesion. British Journal of
4. Ferreira, A.P., Vaz, A.J., Nakamura, P.M., et al. (1997) Hemagglutination test for the diagnosis of
human neurocysticercosis: development of a stable reagent using homologous and heterologous
antigens. Revista do Instituto de Medicina Tropical de So Paulo 39, 2930.
5. Mahajan, R.C., Chopra, J.S., Chitkara, N.L. (1975) Comparative evaluation of indirect hemagglutination and complement fixation tests in serodiagnosis of cysticercosis. Indian Journal of Medical Research
62, 13101313.
6. Garcia, E., Ordonez, G., Sotelo, J. (1995) Antigens from Taenia crassiceps cysticerci used in complement fixation, enzyme-linked immunosorbent assay, and Western blot (immunoblot) for diagnosis
of neurocysticercosis. Journal of Clinical Microbiology 33, 33243325.
7. Tsang, V.C.W., Brand, J.A., Boyen, A.E. (1989) An enzyme-linked immunoelectrotransfer blot assay
and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious
Diseases 159, 5059.
8. Da Silva, A.D., Quagliato, E.M., Rossi, C.L. (2000) A quantitative enzyme-linked immunosorbent
assay (ELISA) for the immunodiagnosis of neurocysticercosis using a purified from Taenia solium
cysticerci. Diagnostic Microbiology and Infectious Disease 37, 8792.
9. Garca, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1988) A specific antigen detection ELISA for
the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and
Hygiene 92, 411414.
10. Shinguekawa, K.Y.M., Mineo, J.K., Pajuaba de Moura, L., et al. (2000) ELISA and Western blotting
tests in the detection of IgG antibodies to Taenia solium metacestodes in serum samples in human
neurocysticercosis. Tropical Medicine and International Health 5, 443449.
12. Bueno, E.C., Vaz, A.J., Machado, L.D., et al. (2000) Neurocysticercosis: detection of IgG, IgA and IgE
antibodies in cerebrospinal fluid, serum and saliva samples by ELISA with Taenia solium and Taenia
crassiceps antigens. Arquivos de Neuropsiquiatria 58, 1824.
13. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticercosis: simple method for
preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59,
291294.
14. Chung, J.Y., Bahk, Y.Y., Huh, S., et al. (1999) A recombinant 10 kDa protein of Taenia solium metacestodes specific to active neurocysticercosis. Journal of Infectious Diseases 180, 13071315.
362
A. Oommen
15. Plancarte, A., Hirota, C., Martinez-Ocana, J., et al. (1999) Characterization of GP 3942 and GP 24
antigens from Taenia solium cysticerci and of their antigenic GP10 subunit. Parasitology Research 85,
680684.
16. Restrepo, B.I., Obregon-Henao, A., Mesa, M., et al. (2000) Characterization of carbohydrate components of Taenia solium metacestode glycoprotein antigens. International Journal of Parasitology 30,
689696.
17. Hernandez, M., Beltran, C., Garcia, E., et al. (2000) Cysticercosis: towards the design of a diagnostic
kit based on synthetic peptides. Immunology Letters 71, 1317.
18. Ohsaki, Y., Matsumoto, A., Miyamoto, K., et al. (1999) Neurocysticercosis without detectable specific
antibody. Internal Medicine 38, 6770.
19. Singh, G., Kaushal, V., Ram, S., et al. (1999) Cysticercus immunoblot assay in patients with single
small enhancing lesions and multilesional cysticercosis. Journal of the Association of Physicians of India
47, 476479.
20. Rajshekhar, V., Oommen, A. (1997) Serological studies using ELISA and EITB in patients with solitary cysticercus granulomas and seizures. Neurological Infections and Epidemiology 2, 177180.
131135.
37
Pharmacology of Anticysticercal
Therapy
Helgi Jung and Dinora F. Gonzlez-Esquivel
Introduction
Until recent years ago, there was no specific
pharmacological treatment for neurocysticercosis (NC) and surgery and steroids were the
only available options. The era of specific
anticysticercal therapy began in 1979 when
Robles and Chavarra described a patient
with parenchymal NC who was successfully
treated with praziquantel1. Uncontrolled
studies, isolated case reports, and medical
letters stressing the utility of praziquantel in
NC followed24. However, most of these initial studies were uncontrolled and included
a variety of forms of NC; therefore precise
evaluation of the effectiveness of praziquantel was difficult. In 1984, a controlled study
examined the effects of praziquantel (25 mg
kg1 day for 2 weeks) in 26 patients with
active parenchymal NC; more than 90% of
the patients improved5. One year later, the
same authors confirmed the efficacy of praziquantel in a long-term follow-up of 35
patients with parenchymal NC6.
Albendazole was first tested for human
NC in 1987, when Escobedo and co-workers
demonstrated its efficacy in patients with
parenchymal brain cysts in whom an 86%
reduction in the number of lesions was documented7. The initial regimen for albendazole
was 15 mg kg1 for 30 days; nevertheless
additional studies showed that the duration
of therapy could be shortened to one week

without compromising the efficacy of the
drug. Other reports have confirmed the efficacy of albendazole for the treatment of
parenchymal NC8,9. Albendazole also
destroys subarachnoid and ventricular cysts,
because of its better penetration of cerebrospinal fluid (CSF), as also giant cysts and
large clumps of cysts10. This chapter covers
the pharmacokinetic and pharmacodynamic
aspects of the two drugs that are currently
used for the treatment of NC.
Praziquantel
Clinical chemistry
Praziquantel (2 cyclohexylcarboyl -(1,2,3,6,7
11b)-hexahydro 4,11 pyrazino (2,1 a) isoquinoline) (Fig. 37.1) was identified in 1972,
from a group of heterocyclic pyrazinoisoquinoline derivatives and found to have
unusually broad anthelmintic activity. It was
later jointly developed by E. Merck and
Bayer. With its broad spectrum of activity
and excellent tolerance, it became the drug of
choice for the treatment of a range of human
and animal helminths including trematodes
(Schistosoma japonicum and Clonorchis
sinensis) and adult and larval cestodes
(Echinococcus granulosus and Taenia solium)11.

363
364
H. Jung and D.F. Gonzlez-Esquivel
Therefore, drug concentrations in the CSF

and brain tissue should be much higher than
minimal effective concentration14.
Pharmacokinetics: absorption,
distribution, metabolism, elimination and
bioavailability
Fig. 37.1. Chemical structure of praziquantel.
The chemical is crystalline, almost colourless

with a distinctly bitter taste; it is practically
insoluble in water and freely soluble in
organic solvents.
Mechanism of action
In vitro studies have revealed that praziquantel penetrates the tegument and rapidly
moves through helminthic tissues. A diverse
range of actions has been described. Primary
effects include muscle contraction or paralysis and tegumental damage. Other (secondary) effects include changes in
carbohydrate metabolism, decrease in enzymatic activities and changes in the properties of surface membranes. Molecular
mechanisms underlying the effect of praziquantel on parasite tegument are not fully
understood. At concentrations of 3.2 107
M to 3.2 104 M, the drug produced vacuolization at the base of the syncytial layer
of the tegument of susceptible trematodes
and cestodes12. These vacuoles then increase
in size forming blebs on the surface that
finally burst. It is believed that the vacuolization is triggered by changes in the flux
of divalent cations, particularly calcium,
which follow drug-induced increase in
membrane permeability13. The minimal
effective concentration of praziquantel that
inflicts severe damage to the strobilocerci in
vitro is 0.03 M l1. In human nervous tissue, the surrounding granulomatous infiltrate and cyst wall pose barriers to
penetration of drug in to the larval tissue.
After oral administration, praziquantel is

rapidly absorbed from gastrointestinal tract.
Peak plasma concentrations are attained
1.52 h after administration of doses of
6.2550 mg kg1. Serum concentrations show
considerable inter-individual variability,
probably due to differences in metabolism.
Praziquantel undergoes extensive first pass
biotransformation to a series of metabolites
that lack anthelminthic activity in humans15.
The predominant metabolite is 4-hydroxycyclohexylcarbonyl analogue of praziquantel16. Most of this metabolic conversion
occurs in cytochromes P450 2B1 and 3A17.
Praziquantel is rapidly distributed to
body tissues. Approximately 80% of the drug
is bound to plasma proteins18. Drug concentration in breast milk is about 25% of plasma
concentration19. The elimination half-life of
praziquantel is 1.72.7 h and for its metabolite is 45 h20. Cumulative renal excretion of
praziquantel and its metabolites is 80%.
Pharmacokinetics of praziquantel are dosedependent. Leopold et al. observed that at
doses of 5, 10, 20 and 50 mg kg1, serum concentrations were 0.15, 0.25, 0.8 and 4.22 mol
l1 respectively and that the areas under the
curve (AUC) increased 20-fold with a tenfold
increase in dose, indicating saturation of the
metabolic capacity of liver21. Praziquantel
permeates the bloodbrain barrier, thus
explaining its effectiveness in parenchymal
NC. It enters CSF more readily than subcutaneous cysts22. High concentrations can be
expected in brain parenchyma on account of
the high lipid solubility and pH of the drug.
In 11 patients with parenchymal NC, who
received praziquantel (50 mg kg1 day1 in
three separate doses), mean drug concentration in CSF was 24% of the plasma concentration
at
steady
state23.
Effective
anticysticercal action was observed at the
given CSF concentration.
Pharmacology of Anticysticercal Therapy
365
with moderate liver disease and four times

higher in patients with severe liver disease
when compared with either normal volunteers or patients with schistosomiasis who
had no detectable liver involvement. An
increased likelihood of side effects in individuals with liver disease has been suggested; whether the dose in such patients
should be reduced is not clear.
Bioavailability
Given the lack of parenteral formulation, the
absolute bioavailability of praziquantel can
not be determined in humans. Animal studies indicate an extensive first-pass metabolism so that only a small proportion of the
active
drug
reaches
the
systemic
circulation19. Mandour et al. investigated the
pharmacokinetics of a new formulation of
praziquantel (Distocide) in comparison to
the reference product (Biltricide) in a
crossover study24. Healthy volunteers
received single oral doses of 40 mg kg1 of
both preparations. Significant differences
were found in the maximal concentration
(Cmax) of the two products. However, the
AUCs of the two formulations were not significantly different.
Food and drug interactions

Co-administration with food enhances
bioavailability of praziquantel in comparison
to the fasting state24,26. Castro et al. demonstrated significantly higher Cmax level, mean
plasma concentration and AUC upon concurrent administration with diet with high
lipid as well as high carbohydrate content
(Fig. 37.2)26. Cmax and AUC were higher and
larger respectively with the carbohydrate
diet in comparison with the lipid diet.
Considering this, it was proposed that carbohydrates were responsible for the increased
bioavailability of praziquantel26.
Pharmacokinetics in hepatic disease

A study evaluated pharmacokinetics of praziquantel in 30 patients with S. japonicum
infection, in whom liver disease was carefully assessed25. The Cmax and bioavailability
were more than twice as high in patients
Plasma concentration (ng ml1)
1500
Fasting
Lipid diet
Carbohydrate diet
1000
500
Time (h)
Fig. 37.2. Mean plasma concentration ( SEM) of praziquantel in healthy volunteers administered a
single oral dose of 1800 mg (three tablets of 600 mg) during fasting () or immediately after high fat ()
or high-carbohydrate () meal. (Reproduced with permission from reference 26.)
366
It is often necessary to co-administer dexamethasone along with praziquantel in order

to manage immunological reactions associated with praziquantel mediated parasite
destruction. A cross-over study in eight
patients who received praziquantel alone or
with dexamethasone showed that plasma
levels of praziquantel were lowered by 50%
with concurrent administration of dexamethasone (Fig. 37.3)27. Therefore, the routine
administration of corticosteroids, particularly dexamethasone, throughout a course of
treatment with praziquantel is discouraged;
rather tailored intermittent treatment only to
manage inflammatory adverse reactions that
may develop, is recommended.
Bittencourt et al. studied the influence of
antiepileptic drug (carbamazapine and
phenytoin, both potent hepatic enzyme
inducers) administration on praziquantel
metabolism28. Both were found to reduce
the oral bioavailability of praziquantel,
although the mechanism of this effect was
not clear. The magnitude of drug interaction
was found to be significant enough to
account for failure of therapeutic response
to praziquantel. The authors recommended
a minimum dose of praziquantel of 50 mg
kg1 in those individuals receiving con-
comitant treatment with enzyme-inducing

antiepileptic drugs in contrast to a lower
dose of 25 mg kg1 in those not on
antiepileptic drugs. Co-administration of
cimetidine increases plasma level, the AUC
and half-life of praziquantel in healthy volunteers (Fig. 37.4)29. This suggests that
addition of cimetidine to a single day regimen of praziquantel increases plasma level
of the latter with a possibility of improved
efficacy in the treatment of NC.
Adverse reactions
Praziquantel is well tolerated by patients
with a wide variety of parasitic disorders.
Most adverse events are manifestations of
inflammatory exacerbations resulting from
drug-induced parasite destruction in the
central nervous system30. Frequent but
minor side effects include drowsiness,
headache, mild abdominal pain, dizziness,
nausea and skin rash22. No hepatotoxicity,
nephrotoxicity and bone marrow toxicity
has been reported31. Furthermore, praziquantel is not genotoxic, mutagenic or teratogenic at usual therapeutic doses32,33.
Plasma concentration (g ml1)
6
5
PZQ
PZQ + Dexamethasor
4
3
2
1
0
0
4
Time (h)
Fig. 37.3. Plasma levels of praziquantel when administered alone () and during dexamethasone
therapy () (n = 8). (Reproduced with permission from reference 27.)
367
5
PZQ + Cimetidine
PZQ
Plasma concentration (g ml1)
0
0
10
12
Time (h)
Fig. 37.4. Mean plasma levels of praziquantel in eight healthy volunteers after three oral doses of 25 mg
kg1 administered every 2 hours when given alone () and with cimetidine (). (Reproduced with
Therapeutic regimens
A single dose of praziquantel (10 mg kg1)
eradicates intestinal taeniasis (see Chapter
41) and regimens of 36 days (2550 mg kg1
day1) eradicate subcutaneous cysticerci34.
The dosage regimen currently used for the
treatment of NC is 50100 mg kg1 day1
divided into three doses every 8 hours for 15
days. With this schedule, the percentage of
disappearance of parenchymal brain cysticerci is 6070%35. A novel regimen consisting of the administration of three doses of
praziquantel (25 mg kg1, each), 2 hours
apart on a single day has been evaluated.
The rationale for this regimen is based on the
pharmacokinetic principle that plasma concentration of the drug peaks 12 h after
administration and declines rapidly thereafter29. With this regimen, it would be possible to maintain higher concentrations of the
drug for a longer period. The schedule has
been evaluated in a clinical trial, and
promises to be an adequate alternative to

currently used protocols with the advantage
of reducing time and cost of treatment36.
Dosage forms
Praziquantel is available in tablets containing 150, 500 and 600 mg. Some commonly
used brand names are: Cesol, Cisticid,
Distocide and Biltricide.
Albendazole
Clinical chemistry
Albendazole (methyl (5-[propylthio]-1Hbenzimidazol-2-yl) carbamic acid methyl
ester) (Fig. 37.5) is a broad-spectrum
anthelminthic benzimidazole, active against
liver flukes, tapeworms, lung and gastrointestinal round worms37. It is also very
368
CH3 CH2 CH2
NH CO OCH3
N
H
Albendazole
O
S
CH3 CH2 CH2
N
NH CO OCH3
N
H
Albendazole sulphoxide
O
S
CH3 CH2 CH2
N
NH CO OCH3
O
N
H
Albendazole sulphone
Fig. 37.5. Chemical structure of albendazole, albendazole sulphoxide, the main active metabolite, and of
albendazole sulphone.
effective against the larval form of T.

solium30,38,39. It is widely used in human and
veterinary medicine. Albendazole is a
colourless powder, insoluble in water, soluble in strongly acid solutions and slightly
soluble in some organic solvents. The solubility of its metabolite, albendazole sulphoxide (ALBSO) is comparatively less40,41.
Mechanism of action
All benzimidazoles are thought to have a
similar mode of action, and differences in
efficacy of the drugs against different parasites probably reflect variations in their
bioavailability. They cause selective degeneration of parasitic cytoplasmic microtubules. This eventually leads to a decrease
in adenosine triphosphate levels and
energy depletion. The antimitotic activity
of albendazole is the result of binding to tubulin molecules, which causes inhibition
of the formation of microtubules resulting
in disruption of cell division37. In addition,
there occurs loss of transport of secretory
vesicles and failure of intestinal cells to
take up glucose, leading to starvation of the
parasite. Considering these mechanisms of
action, the onset of anthelmintic action is
slower than that of drugs that act directly
on ion channels42,43.
Pharmacokinetics: absorption,
metabolism and elimination
Albendazole is extensively metabolized in
the liver to its active metabolite, ALBSO44,45.
The latter is further sulphonated to albendazole sulphone, one among seven other
inactive metabolites40,45. The parent compound is undetectable while the active
metabolite, ALBSO, is readily recovered in
the plasma of rat, cattle and sheep. In
humans, the first-pass metabolism to
ALBSO is rapid and apparently complete45.
Two distinct microsomal enzymatic pathways are responsible for the sequential
sulphoxidation of albendazole. The first, a
flavin-containing mono-oxygenase system
(FMO), is involved in the oxidation of
albendazole to ALBSO through an NADPHdependent reaction (NADPH = nicotinamide-adenine dinucleotide phosphate
(reduced form))46. The other, cytochrome
P450 is involved in oxidation of ALBSO to
albendazole sulphone. Involvement of both
systems, FMO and cytochrome P-450, in
albendazole metabolism have been demonstrated in rat, sheep, cattle and pig liver
microsomes, as well as in a differentiated
human hepatoma cell line47.
The kinetic disposition of ALBSO in
humans is characterized by marked intersubject variability45,48. This has been attributed to poor absorption of albendazole due
to the low solubility of the drug. In different
pharmacokinetic studies, the concentrations
of ALBSO in plasma were found to be quite
variable, however the clinical efficacy of the
parent compound was consistently demonstrated40,45,48. The Cmax of ALBSO varied
between 0.45 g ml1 and 2.96 g ml1 and
elimination half-life was found to vary
between 14 h and 20 h after an oral dose of
the parent compound of 15 mg kg1 in cysticercotic individuals48. In healthy volunteers, mean Cmax of 0.24 g ml1 and mean
half-life of 8 h was noted40.
The chiral behaviour of ALBSO has been
investigated in man as well as experimental
animals49,50. In healthy volunteers, administered albendazole (10 mg kg1), the ratio of
(+) ALBSO to () ALBSO was found to be
80(+) : 20() within the AUC of ALBSO49.
369
This enantioselective disposition of ALBSO

has also been observed in individuals with
NC. When a multiple dose regimen of
albendazole (5 mg kg1 every 8 h for 8
days) was administered, differences in
pharmacokinetics of (+) ALBSO and ()
ALBSO were found. For (+) ALBSO, the
mean Cmax, AUC and apparent plasma
clearance were 301.6 ng ml1, 1719.2 ng
ml1 h1 and 5.8 l h1 kg1, respectively,
while the corresponding values for ()
ALBSO were 54.9 ng ml1, 261.4 ng ml1 h1
and 54.0 l h1 kg1, respectively. The mean
proportion of (+) ALBSO to () ALBSO
with the AUC was 8.0, indicating plasma
accumulation of (+) enantiomer51.
In vitro studies indicate differences in
protein binding by albendazole and
ALBSO. While albendazole is 8991% protein bound, ALBSO is 6365% protein
bound at a concentration range of
0.54.0 g ml1. The high protein binding
of albendazole is of no clinical significance
as it is rapidly and completely converted to
ALBSO41. ALBSO has been demonstrated in
CSF after oral administration of albendazole. The mean ALBSO concentration in
CSF was found to be 43% of mean plasma
level in one study23. Although drug concentrations in CSF were found to be variable,
these were not related to age, sex or the
presence of inflammation in the subarachnoid space. In addition, therapeutic effectiveness was confirmed for the wide range
of observed concentrations. Peak plasma
levels of ALBSO are lower in children in
comparison to adults administered similar
doses according to body weight52. In addition, elimination half-life is short (2.38.3 h)
in children (Fig. 37.6). Available data, therefore, argue for thrice-daily dosages schedule
and dose calculation based upon body surface area rather than body weight in children.
Food and drug interactions

Considering that oral absorption of albendazole is relatively poor, the drug should be
taken with meals. Marriner et al. observed a
3.5-fold increase in ALBSO availability, in
370
1.6
Age
< 2 years
1.4
6 15 years
1.2
33 68 years
Cp (g ml1)
1.0
0.8
0.6
0.4
0.2
0
0 2 4 6 8
12
24
48
Time (h)
Fig. 37.6. Comparison of mean plasma levels of albendazole sulphoxide in patients of different ages
after single oral dose of 15 mg albendazole per kg body weight. (Reproduced with permission from
reference 52.)
one subject when administered albendazole

with olive oil in milk (20 ml per 100 ml);
however, in three other subjects, there was
little change in plasma levels45. In another
study, co-administration with a fatty meal
(fat content: 40 g) increased ALBSO concentrations fivefold; Cmax values increased from
0.45 mol l1 to 1.60 mol l1 during fasting
state to 2.09.0 mol l1 after food, while
AUC increased from 2.09.0 mol l1 h1 to
9.629.5 mol l1 h1, respectively53. The
facilitation of albendazole absorption by
fatty meal presumably results from an
increased bile acid flow in response to neutral fat in the duodenum.
Several drug interactions can be
expected as albendazole and ALBSO share
common hepatic metabolic pathways with
several pharmacological agents. Their
interaction with dexamethasone is of interest, primarily on account of the necessity of
co-administering the two to forestall or
manage inflammatory reactions to albendazoles parasiticidal action. Jung et al. investigated the nature of this interaction in
eight patients who were treated with albendazole (15 mg kg1 day1) and dexametha-
sone (8 mg day1) for 8 days54. The plasma

levels of ALBSO increased by 50%, an effect
that was attributed to impaired elimination. This finding has been exploited to
the advantage of albendazole since simultaneous corticosteroid therapy is often
required during anticysticercal treatment55.
Homeida et al. evaluated pharmacokinetic
interactions between praziquantel (40 mg
kg1) and albendazole (400 mg) in healthy
volunteers56. The authors found that the
AUC of ALBSO increased 4.5-fold and Cmax
values increased from 126 15 to 350 51
ng ml1. Despite high plasma concentration
of ALBSO, no adverse systemic, haematological or hepatic effect was noted.
Although the mechanism of this interaction
is not clear, the finding is significant considering that trials of combination
chemotherapy are in consideration in the
future. In human cystic echinococcosis,
cimetidine was found to increase mean
ALBSO concentrations in samples of bile
and hydatid cyst fluid by about twotimes57. Combined administration of the
two drugs was recommended with a view to
improve therapeutic efficacy of albendazole.
Therapeutic dosage regimens

Albendazole was initially administered at
doses of 15 mg kg1 day1 for 1 month, based
upon previous regimens used for treatment
of human hydatidosis7, 58. Subsequent clinical
experience showed that the length of therapy
could be shortened from 30 to 8 days without
compromising drug efficacy55,5961. Dosage
intervals for albendazole have been established on empirical grounds. Considering
that the average half-life of ALBSO is 11 h in
patients with NC, a twice-daily regimen is
recommended59. In order to compare the regimen currently used for albendazole (5 mg
kg1, three times a day) versus a regimen of
7.5 mg kg1 twice a day, a randomized
crossover pharmacokinetic study was performed in ten patients with parenchymal NC.
Results showed that in spite of an interindividual variability observed, no statistically
significant differences were found in several
pharmacokinetic parameters between both regimens59. This suggested that a dosage regimen
of 7.5 mg kg1 every 12 h could favourably
replace the regimen of 5 mg every 8 h.
Albendazole appears to be as effective in
paediatric and geriatric populations as in
others and no drug-related problems have
been observed in patients as young as 1 year
or older than 65 years. However, there is no
specific information comparing use of albendazole in the elderly with other age groups.
Adverse reactions
Albendazole has a high therapeutic index. Its
low solubility may prevent absorption of
quantities necessary to produce toxicity and
hence account for the low toxicity profile.
Clinical experience indicates that albendazole is well tolerated. Headache, nausea and
vomiting occur in 611% of patients and are
the most common adverse effects. These are
related to acute inflammation secondary to
sudden destruction of cysticerci30,39. When
administered in high doses (600800 mg
day1) over longer periods of time (1
month), elevated liver enzymes, headache,
hair loss, neutropenia, fever, rash and acute
renal failure have been reported62. In particu-
371
lar, hepatoxicity can occur at any time during the course of treatment and does not
appear to be related to ALBSO levels47. Liver
function tests and white blood cell counts
should be performed at baseline and every 2
weeks during therapy. Albendazole has not
been studied in pregnant women. However,
studies in animals have shown that it is
embryotoxic and teratogenic37,62.
Dosage forms
Albendazole is approved in several
European and most Third World countries.
In 1996, albendazole received marketing
approval
from
Food
and
Drug
Administration, USA for use against
parenchymal NC. The drug is available in
oral suspension and in tablets containing
200 and 400 mg, each. Some commonly
used brand names are Zentel, Eskazole and
Albenza.
Conclusions
Praziquantel is a heterocyclic pyrazino-isoquinoline derivative. It causes an influx of
calcium ions leading to muscle contraction
and paralysis. The drug is well absorbed
after oral administration, has an extensive
first-pass metabolism, is 80% protein bound
and has an elimination half-life of 1.72.7 h.
It crosses the bloodbrain barrier. Food
increases and antiepileptic drugs decrease its
bioavailability. Plasma levels of praziquantel
are reduced to one-half upon dexamethasone co-administration. The recommended
dosage regimen is 50 mg kg1 day1 for 2
weeks.
Albendazole, a benzimidazole compound, causes selective degeneration of parasitic microtubules. It is metabolized in the
liver to an active compound, ALBSO. High
levels of both albendazole and ALBSO have
been demonstrated in the CSF. Of interest, is
their interaction with dexamethasone; the
latter increases ALBSO levels by 50%.
Recommended dosage regimens of albendazole are 15 mg kg1 day1 for 815 weeks.
372
References
1. Robles, C., Chavarra, M. (1979) Presentacin de un caso clnico de cisticercosis cerebral tratado
mdicamente con un nuevo frmaco: Praziquantel. Salud Pblica de Mexico 21, 603618.
2. Gmez, J.G., Pea, G., Patio, R., et al. (1981) Neurocysticercosis treated with praziquantel.
Neurologa en Colombia 5, 665670.
3. Spina Franca, A., Nobrega, J.P., Livramento, J.A. (1982) Administration of praziquantel in neurocysticercosis. Tropical Medicine and Parasitology 33, 14.
4. Markvalder, K., Hess, K., Valvanis, A. (1984) Cerebral cysticercosis: treatment with praziquantel:
report of two cases. American Journal of Tropical Medicine and Hygiene 33, 273280.
5. Sotelo, J., Escobedo, F., Rodriguez Carbajal, J., et al. (1984) Therapy of parenchymal brain cysticercosis with praziquantel. New England Journal of Medicine 310, 10011007.
6. Sotelo, J., Torres, B., Rubio-Donnadieu, F. (1985) Praziquantel in the treatment of neurocysticercosis:
long term follow-up. Neurology 35, 752755.
7. Escobedo, F., Penagos, P., Rodrguez, J., et al. (1987) Albendazole therapy for neurocysticercosis.
8. Sotelo, J., Escobedo, F., Penagos, P. (1992) Albendazole vs. praziquantel for therapy of neurocysticercosis. A controlled trial. Archives of Neurology 49, 290294.
9. Alarcn, F., Escalante, L., Dueas, G., et al. (1989) Neurocysticercosis: short course of treatment with
albendazole. Archives of Neurology 46, 12311236.
11. Groll, E. (1984) Praziquantel. Advances in Pharmacology and Chemotherapy 20, 219238.
12. Harnett, W. (1988) The anthelminthic action of praziquantel. Parasitology Today 4, 144146.
13. Pearson, R., Guerrant, R. (1983) Praziquantel: a major advance in anthelminthic therapy. Annals of
Internal Medicine 99, 195198.
14. Overbosch, D., Van des Nes, J.C.M., Groll, E., et al. (1987) Penetration of praziquantel into cerebrospinal
fluid and cysticerci in human cysticercosis. European Journal of Clinical Phamacology 33, 287292.
15. Buhring, K., Diekman, H., Muller, H., et al. (1978) Metabolism of praziquantel in man. European
Journal of Drug Metabolism and Pharmacokinetics 3, 179190.
16. Andrews, P., Thomas, H., Pohlke, R., et al. (1983) Praziquantel. Medicinal Research Reviews 3, 147200.
17. Masimerembwa, C., Hasler, J. (1994) Characterization of praziquantel metabolism in rat liver microsomes using cytochrome P450 inhibitors. Biochemical Pharmacology 48, 17791783.
18. Spina Franca, A., Machado, L.R., Nobrega, J.P.S., et al. (1985) Praziquantel in the cerebrospinal fluid
in neurocysticercosis. Arquivos de Neuropsiquiatria 43, 244259.
19. Steiner, K., Garbe, A., Diekman, H., et al. (1976) The fate of praziquantel in the organism.
Pharmacokinetics in animals. European Journal of Drug Metabolism and Pharmacokinetics 1, 8695.
20. Patzchke, K., Putter, J., Wegner, L.A., et al. (1979) Serum concentrations and renal excretion of praziquantel after oral administration in humans. Results of three determination methods. European
Journal of Drug Metabolism and Pharmacokinetics 3, 149156.
21. Leopold, G., Ungenthum, W., Groll, E., et al. (1978) Clinical pharmacology in normal volunteers of
praziquantel, a new drug against schistosomes and cestodes. European Journal of Clinical
Pharmacology 14, 281291.
22. Bittencourt, P.R.M., Gracia, C.M., Gorz, A.M., et al. (1990) High-dose praziquantel for neurocysticercosis: serum and CSF concentrations. Acta Neurologica Scandinavica 82, 2833.
23. Jung, H., Hurtado, M., Medina, M., et al. (1990) Plasma and CSF levels of albendazole and praziquantel in patients with neurocysticercosis. Clinical Neuropharmacology 13, 559564.
24. Mandour, M., Turabit, E., Homeida, M., et al. (1990) Pharmacokinetics of praziquantel in healthy
volunteers and patients with schistosomiasis. Transactions of Royal Society of Tropical Medicine and
Hygiene 84, 389393.
25. Watt, G., White, N., Padre, L., et al. (1987) Pharmacokinetics and side effects of praziquante in
Schistosoma japonicum infected patients with liver disease. European Journal of Clinical Pharmacology
33, 287292.
26. Castro, N., Medina, R., Sotelo, J., et al. (2000) Bioavailability of praziquantel increases with concomitant administration of food. Antimicrobial Agents and Chemotherapy 44, 29032904.
27. Vzquez, M.L., Jung, H., Sotelo, J. (1987) Plasma levels of praziquantel decrease when dexamethasone is given simultaneously. Neurology 37, 15611562.
28. Bittencourt, P.R.M., Gracia, C.M., Martins, R., et al. (1992) Phenytoin and carbamezapine decrease
oral bioavailability of praziquantel. Neurology 42, 492 496.
373
29. Jung, H., Medina, R., Castro, N., et al. (1997) Pharmacokinetic study of praziquantel administered
alone and in combination with cimetidine in a single day therapeutic regimen. Antimicrobial Agents
and Chemotherapy 41, 12561259.
30. Sotelo, J. (1995) Neurocysticercosis. Clinical, prognostic and therapeutic aspects. In: Rose, C. (ed.)
Recent Advances in Tropical Neurology. Elsevier Science, Oxford, UK, pp. 8797.
31. Gracia, C.M., Gorz, A.M., et al. (1990) High dose praziquantel for neurocysticercosis: efficacy and
tolerability. European Neurology 30, 229234.
32. Herrera, L., Ramrez, T., Rodrguez, U., et al. (2000) Possible association between Taenia solium cysticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neurocysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 6670.
33. Bartsch, H., Kuroku, T., Malanett, T. (1978) Absence of mutagenicity of praziquantel, a new effective
antischistosomal drug in bacteria, yeasts, insects and mamalian cells. Mutation Research 58, 229234.
34. Groll, E.W. (1982) Chemotherapy of human cysticercosis with praziquantel. In: Flisser, A., Willms,
K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press,
35. Del Brutto, O.H., Sotelo, J., Roman, G. (1993) Therapy of neurocysticercosis: a reappraisal. Clinics in
Infectious Diseases 17, 730735.
36. Corona, T., Lugo, R., Medina, R., et al. (1996) Single day praziquantel therapy for neurocysticercosis.
New England Journal of Medicine 334, 125.
37. McKellar, Q.A., Scott, E.W. (1990) Benzimidazole anthelminthic agents. Journal of Veterinary
Pharmacology and Therapeutics 13, 223247.
38. Del Brutto, O.H. (1995) Medical treatment of cysticercosis effective. Archives of Neurology 52,
102104.
39. Sotelo, J. (1997) Neurocysticercosis. In: Roos, K.L. (ed.) Central Nervous System Infectious Diseases and
Therapy. Marcel Dekker, New York, pp. 545572.
40. Penicaut, B., Maugein, P.H., Maisonneuve, H., et al. (1983) Pharmacocintique et mtabolisme urinaire de lalbendazole chez lhomme. Bulletin de la Societe de Pathologie Exotique (Paris) 76, 698708.
41. Jung, H., Medina, L., Garca, L., et al. (1998) Absorption studies of albendazole and some physicochemical properties of the drug and its metabolite albendazole sulphoxide. Journal of Pharmacy and
Pharmacology 50, 4348.
42. Lacey, E. (1990) Mode of action of benzimidazoles. Parasitology Today 6, 112115.
43. Martin, R.J., Robertson, A.P., Bjorn, H. (1997) Target site of anthelminthics. Parasitology 114,
S111124.
44. Gyurik, R.J., Chow, A.W., Zaber, B., et al. (1981) Metabolism of albendazole in cattle, sheep, rats and
mice. Drug Metabolism and Disposition 19, 503508.
45. Marriner, S.E., Morris, D.L., Dickson, B., et al. (1986) Pharmacokinethics of albendazole in man.
European Journal of Clinical Pharmacology 30, 705708.
46. Villaverde, C., Alvarez, A.I., Redondo, P., et al. (1995) Small intestinal sulphoxidation of albendazole.
Xenobiotica 25, 433441.
47. Steiger, U., Cotting, J., Reichen, J. (1990) Albendazole treatment of echinococcosis in humans: effects
on microsomal metabolism and drug tolerance. Clinical Pharmacology and Therapeutics 47, 347353.
48. Jung, H., Hurtado, M., Sanchez, M., et al. (1992) Clinical pharmacokinetics of albendazole in patients
with brain cysticercosis. Journal of Clinical Pharmacology 32, 2831.
49. Delatour, P., Benoit, E., Besse, S., et al. (1991) Comparative enantioselectivity in the sulphoxidation of
albendazole in man, dogs and rats. Xenobiotica 21, 217221.
50. Benoit, E., Besse, S., Delatour, P. (1992) Effect of repeated doses of albendazole on enantiomerism of
its sulfoxide metabolite in goats. American Journal of Veterinary Research 53, 16631665.
51. Marques, M.P., Takayanagui, O.M., Bonato, P.S., et al. (1999) Enantioselective kinetic disposition of
albendazole sulfoxide in patients with neurocysticercosis. Chirality 11, 218223.
52. Jung, H., Sanchez, M., Gonzlez-Astiazaran, A., et al. (1997) Clinical pharmacokinetics of albendazole in children with neurocysticercosis. American Journal of Therapeutics 4, 2326.
53. Lange, H., Eggers, R., Bircher, J. (1988) Increased systemic availability of albendazole when taken
with a fatty meal. European Journal of Clinical Pharmacology 34, 315317.
54. Jung, H., Hurtado, M., Medina, M.T., et al. (1990) Dexamethasone increases plasma levels of albendazole. Journal of Neurology 237, 279280.
374
56. Homeida, M., Copeland, W.L.S., Ali, M.M.M., et al. (1994) Pharmacokinetic interaction between
praziquantel and albendazole in a Sudanese man. Annals of Tropical Medicine and Parasitology 88,
551559.
57. Wen, H., Zhang, W., Muhmut, M., et al. (1994) Initial observations on albendazole in combination
with cimetidine for the treatment of human cystic echinococcosis. Annals of Tropical Medicine and
58. Saimot, A.G., Cremieux, A.C., Hay, J.M., et al. (1983) Albendazole as a potential treatment for human
hydatidosis. Lancet ii, 652656.
59. Snchez, M., Sustegu, R., Gonzlez-Esquivel, D., et al. (1993) Pharmacokinetic comparison of two
albendazole dosage regimens in patients with neurocysticercosis. Clinical Neuropharmacology 16,
7782.
prospective double-blind trial comparing 7 versus 14 days of treatment. Neurology 48, 14211427.
61. Botero, D., Uribe, C.S., Sanchez, J.L., et al. (1993) Short course of albendazole treatment for neurocysticercosis in Colombia. Transactions of the Royal Society of Tropical Medicine and Hygiene 87, 576577.
62. Rossignol, J.F., Maisonneuve, H. (1984) Albendazole: a new concept in the control of intestinal
helminthiasis. Gastroenterologique Clinique et Biologique (Paris) 8, 569576.
38
Controversies in the Drug Treatment

of Neurocysticercosis
Bhim S. Singhal and Rodrigo A. Salinas
Introduction
Therapy for Taenia solium cysticercosis aims
at clearance of cysts in the brain and amelioration of immediate and delayed symptoms and signs. Despite the known
anticysticercal effect of at least two pharmacological agents (praziquantel and albendazole), controversies persist regarding their
usage for several reasons outlined below15.
One is the spontaneous resolution of the
cyst(s). In the landmark papers of cysticercosis occurring in British troops stationed in
India, Dixon and Hargreaves6 and Dixon
and Lipscomb7 observed that many
patients improved spontaneously and that
the prognosis is much better than has hitherto been thought. Another reason is the
uncertainty of long-term benefits such as
improved seizure control following the
administration of anticysticercal drugs8,9.
Finally, the need for anticysticercal drugs
depends on the riskbenefit ratio. Viable living cysticerci (seen as non-enhancing cysts
with a scolex on imaging studies) in the
brain parenchyma are usually asymptomatic. Symptoms such as seizures,
headache and focal neurological deficits are
related to degeneration of cysticerci (transitional forms). Degeneration of cysticerci
evokes inflammatory reaction in the
surrounding host tissue such as brain
parenchyma, manifesting clinically with

seizures, headaches and focal neurological
deficits. Degeneration of cysts may occur
spontaneously, or as a consequence of the
administration of anticysticercal drugs. This
propensity of these agents to produce
inflammatory adverse events that may occasionally be serious and fatal has excited the
viewpoint that anticysticercal drugs may be
potentially harmful and should preferably
be avoided10,11. Even today, there are several
controversies with regard to the medical
treatment of cysticercosis. Most importantly,
debate continues over the usefulness of
anticysticercal drugs. Other issues where
opinion varies include the specific drug
(praziquantel versus albendazole) to be
used; the drug dosage and duration of treatment; the specific role, indications and
duration of corticosteroid co-medication
and antiepileptic drugs (AEDs).
Parenchymal Neurocysticercosis
and Drug Therapy
Parenchymal neurocysticercosis (NC) occurs
as a single cyst, two or three cysts forming
clumps (conglomerate lesions), multiple
cysts (which can be counted) or disseminated (miliary) forms, where the brain is
studded with innumerable cysts.

375
376
B.S. Singhal and R.A. Salinas
Multiple cysts of neurocysticercosis

In this form of NC, imaging studies disclose
scattered cysts, which can be counted. Cysts
may be in the same or different stages of
development (live cysts, dying cysts and calcified cysts). They may or may not be associated with subcutaneous or muscular
cysticercosis. Some lesions, especially the
degenerating ones, may resolve spontaneously. Ever since the seminal description
of the use of praziquantel in parenchymal
NC by Robles and Chavarra in 1979, several
workers have recommended use of anticysticercal drugs13,12. Sotelo et al. demonstrated
clinical improvement with reduction in the
number of cysts in 26 patients treated with
praziquantel for 15 days as opposed to no
change or worsening in 17 untreated historical controls followed over a period of 9
months2. Subsequently, Robles et al. reported
on the beneficial results of a large but uncontrolled trial of praziquantel (50 mg kg1
day1 for 15 days with or without corticosteroids) in 141 patients with NC3. Perceived
benefits included resolution of symptoms
after 5 years of observation and of imaging
abnormalities. Escobedo et al. used albendazole, the other available anticysticercal drug,
in a dose of 15 mg kg1 day1 for 30 days in
seven patients with parenchymal NC and
reported an 86% reduction in the total number of cysts4. However, Padma et al. in the
only randomized controlled trial (albendazole, 15 mg kg1 day1 for 7 days in 16
patients and placebo in 13 patients) conducted on this presentation of disease, found
no statistically significant difference in the
number of cysts that disappeared upon computed tomography (CT) at 1 week and 3
months after the beginning of treatment13.
NC14. All three patients reported by the

authors died; two of them died soon after
praziquantel was administered. This was
possibly due to severe inflammatory reaction
and oedema resulting from death of the cysts
and release of antigens. The muscles also
swelled up. The poor prognosis was recognized as early as in 1933 by MacArthur, who
stated, the destruction of large numbers of
these parasites at the same time supposing
that some chemical of lethal power were
forthcoming might only make matters
worse for the sufferer15. Gupta et al.
reported worsening or death in two such
patients treated with albendazole whereas
four such patients treated with corticosteroids alone improved16. It stands to reason
that if anticysticercal drugs are to be given to
such patients, they should be carefully monitored and preferably pre-administered
corticosteroids and AEDs. Contrariwise,
some Chinese authors have reported the
successful use of praziquantel (Biltricide,
100 mg kg1 day1 for periods ranging
from 1 week to 1 month) in patients with
disseminated cysticercosis17,18. An improvement in both neurological and non-neurological symptoms, including resolution of
pseudohypertrophy has been recorded in
these Chinese reports. The reasons for the
difference in outcome between the Indian
and Chinese studies are not clear.
Garca and Del Brutto described 11 LatinAmerican patients with massive brain infestation with viable cysticerci19. The number of
cysts was in hundreds as opposed to much
larger cyst loads in the disseminated variety.
Their patients tolerated the anticysticercal
treatment and showed considerable clinical
and radiological improvement.
Disseminated neurocysticercosis
Cysticercotic encephalitis
In this variety the brain, subcutaneous tissue

and muscles are riddled with innumerable
cysticerci. Patients may present with
seizures, features of raised intracranial pressure, focal deficits or dementia. Wadia et al.
have cautioned against the use of anticysticercal drugs in this disseminated variety of
Patients with cysticercotic encephalitis (usually children and adolescents) will require
high-dose corticosteroids with or without
osmotic diuretics or rarely decompressive
surgery, depending on their clinical status20,21. In the series of patients reported by
Rangel et al. only one patient was adminis-
Controversies in Drug Treatment of Neurocysticercosis
tered praziquantel; others were treated only

symptomatically for intracranial hypertension21. The prognosis in terms of outcome
was uniformly dismal in this series. Some
workers have treated severe forms of NC
with
albendazole
and
demonstrated
favourable outcome in such patients22,23.
Nevertheless, we recommend that the use of
anticysticercal drugs is best avoided. If used,
they should be given with caution and in
conjunction with corticosteroids.
Solitary cysticercus granuloma

Solitary cysticercus granuloma (SCG) is a
common form of parenchymal NC24,25.
Controversy regarding the use of anticysticercal drugs in this form of the disease
stems from the fact that during the followup, many of these lesions resolve spontaneously (see Chapter 24). Padma et al.
performed a double blind, randomized controlled trial of albendazole in 75 patients
with seizures and SCG26. Albendazole (15
mg kg1 day1) or placebo was administered for 7 days and serial CT scans
obtained at the end of 1 week, 1 month and
3 months after beginning of treatment. A
group of 40 patients received albendazole
and 35 patients received placebo. A total of
35 patients given albendazole and 33
patients given placebo demonstrated resolution of the CT abnormality at 3 months.
The difference between the two groups was
not statistically significant. In an open study
reported by Singhal and Ladiwala, clinical
and radiological follow-up of patients with
SCG showed no significant difference in
seizure control and resolution of the lesion
in patients treated with AEDs alone and
those treated with AEDs and anticysticercal
drugs24. Chopra et al. reported that of the 78
patients with SCG (treated with AEDs
alone), there was complete disappearance of
CT lesions in 47 patients and significant
reduction in the size of the lesion and surrounding oedema in another 24 patients
upon follow-up CT in 612 weeks27. These
and other workers found no advantage in
giving anticysticercal drugs in patients with
SCG.
377
There are however, other workers who

advocate the use of anticysticercal agents. In
a recent double blind, placebo-controlled
study, Baranwal et al. observed significant
benefit in terms of disappearance of lesions
in children who received albendazole therapy9. In this study, 65 paediatric patients
with SCG on CT scan were randomly
assigned to receive either albendazole (15
mg kg1 day1) or placebo for 4 weeks.
Follow-up CT scans were performed, 1 and 3
months after beginning of albendazole therapy. After 3 months, 23 of 31 patients who
received albendazole and only 15 of 32 of
placebo-treated patients showed complete
resolution of CT lesions. We have to consider, however, that 12.5% of the patients
were lost to follow-up in this trial, and that
when the results of this study were pooled,
in a meta-analysis, with those obtained by
Padma et al.26 they are not statistically significant any more.
It has been suggested that the empirical
use of anticysticercal drugs facilitates the
diagnosis of SCG in doubtful cases by hastening the resolution of these lesions28. Del
Brutto administered albendazole (15 mg kg1
day1) for 8 days to 20 patients with SCG29.
CT undertaken after 2 weeks showed disappearance of lesion in 11 patients, partial resolution in five and no change in four patients.
The favourable response to albendazole in 16
of 20 patients was construed as supportive of
a diagnosis of NC. In three out of the four
who had not responded to albendazole, the
diagnoses were ultimately revised upon follow-up; two were ultimately diagnosed to
have gliomas and another one, tuberculoma.
In a later study, albendazole was used in 39
patients with seizures and a single lesion
upon CT30. Overall 32 (82%) patients
responded to the drug and showed reduction
in the size of the lesion after 24 weeks of
therapy. Further investigations in the nonresponders revealed tuberculomas (two),
astrocytoma (one), metastatic tumour (one),
granulomatous lesion of unknown aetiology
(one) and cysticercus (one). The author recommended the use of albendazole not only
for clearance of cysts but also as a diagnostic
tool to support the diagnosis of NC as the
cause of the lesion. Rajshekar suggested that
378
patients with SCG may be treated with symptomatic therapy (AEDs) alone initially and
neuroimaging studies repeated after 812
weeks31. In patients with persistent SCG after
12 weeks, anticysticercal drugs may be used
to hasten the resolution. In an open trial of
the use of albendazole (15 mg kg1 day1 for
14 days) in patients with persistent SCG
(defined as persistence beyond 12 weeks of
symptomatic therapy), repeat CT scan
showed total resolution in two and more
than 50% resolution in another two of a total
of 11 patients. In the extension of this study
in 43 patients, a favourable response to albendazole was demonstrated in 20 patients32.
Murthy and Reddy suggested the use of
albendazole therapy in patients whose SCG
revealed a scolex on the CT scan (ring with
dot pattern)33. They surmised that the presence of a scolex corresponded to a more
active stage of the parasite as compared to
SCG without a scolex and that patients with
this imaging attribute might benefit from
anticysticercal therapy.
Two or three cysts in clumps

(conglomerate lesions)
It is not uncommon to see two or three cysts
clumped together upon brain imaging of
individuals presenting with seizures.
Possibly, two or three larvae have reached
the same site in the brain at the same time.
They can be seen as two or three ringenhancing or disc-enhancing lesions on CT
and magnetic resonance imaging (MRI). The
inflammatory reaction and oedema is more
than that with a single cysticercus. Besides
seizures, the patients may also experience
headache. It is necessary to identify different
types of parenchymal forms of NC and evaluate the results of therapy in these different
subsets. The conglomerate form is more
likely to take longer time to resolve and perhaps heal by leaving a bigger scar or gliotic
area or heal by calcification (Bhim S. Singhal,
Mumbai, India, unpublished observations).
In such cases it might be preferable to use
anticysticercal drugs with anti-inflammatory
agents (like corticosteroids) at an early stage
and continue AEDs for longer periods.
Occult neurocysticercosis
In endemic regions, the administration of
praziquantel or albendazole for treatment of
intestinal taeniasis or other helminthiasis, in
doses that are considerably small in comparison to doses used for anticysticercal effect in
the brain, are also known to induce inflammatory reaction and trigger degeneration of
asymptomatic cysticerci in brain. Flisser et al.
recorded an unusually high frequency of
headaches as an adverse event, when praziquantel was administered in doses of 5 mg
kg1 for community treatment of intestinal
taeniasis34. The authors conjectured that in
some of the individuals, headaches might be
linked to inflammatory degeneration of cysticerci in the brain. They were able to
demonstrate this phenomenon in at least one
individual. The possibility of unmasking of
symptoms of NC as a result of the administration of anthelmintic drugs should be kept
in mind in endemic areas.
Role of anticysticercal drugs in relation to

stage of neurocysticercosis
Some authors recommend an expectant policy with symptomatic therapy alone in those
in whom imaging reveals a predominance of
transitional cysticerci on the premise that the
parasite in these lesions has probably
died24,35. An Ecuadorian trial studied the
effect of anticysticercal drugs (praziquantel,
50 mg kg1 day1 for 15 days and albendazole, 15 mg kg1 day1 for 8 days in addition
to prednisolone) in comparison with no anticysticercal treatment in 175 patients with live
active parenchymal NC8. There were no differences in the proportion of patients that
were free of NC lesions at 6 and 12 months.
Furthermore, there were no differences in the
proportion of patients who were seizure-free
at 24 months. In clinical practice, one often
encounters an intermixture of live-active,
transitional and inactive cysticerci upon
brain imaging studies. Here, the clinician
should exercise his judgement based upon
the stage of most cysticerci, the number of
lesions and the risk of inflammatory exacerbation. Finally, a patient presenting with
seizure and healed calcified lesion(s) on CT

(healed cysticercus cyst(s)) will require only
symptomatic therapy (AEDs).
Does anticysticercal therapy improve

seizure control?
Besides the resolution of the lesion on CT
scan, outcome measures should also relate
to clinical benefit. In the case of SCG, it
should relate to improved seizure control.
Only two randomized, controlled trials have
addressed the question of seizure relapse
after anticysticercal therapy8,9. They found
no statistically significant difference in
seizure relapse rates between the groups
treated or not treated with anticysticercal
therapy. The pooled odds ratio for seizure
relapse with anticysticercal treatment versus
no anticysticercal treatment was 0.92 (CI95%:
0.471.81). Kramer wondered whether the
good radiological outcome reported with
anticysticercal drugs is also reflected upon
seizure outcome10. He and others, have suggested that the enhanced inflammatory
response following therapy may produce a
more profound cerebral cicatrix, thereby
adversely affecting seizure outcome11,36. This
hypothesis, however, has never been tested.
On the other hand, use of anticysticercal
drugs in such patients was claimed to permit
better control of seizures with AEDs29,37.
Besides, the likelihood of remaining seizurefree after withdrawal of AEDs was reported
to be greater in patients who were previously treated with albendazole38,39. In the
study reported by Singhal and Ladiwala
from Mumbai, India, seizures were equally
well controlled in patients treated either with
AEDs alone (92%) or with AED plus anticysticercal drugs (93%)24.
Extraparenchymal Neurocysticercosis
While for parenchymal NC, the unresolved
issue remains whether to administer anticysticercal treatment or not, in extraparenchymal
NC, there is controversy on the role of medical therapy as against surgical treatment. A
major apprehension regarding the use of
379
anticysticercal drugs is inflammatory exacerbations provoked by anticysticercal therapy

leading to sequelae, which are more serious
in the case of extraparenchymal NC in comparison to parenchymal NC. These sequelae
are mainly in the form of meningitis, arachnoiditis, stroke and hydrocephalus. Recently,
albendazole has been suggested to be effective for subarachnoid forms with resolution
of even giant racemose subarachnoid
cysts40,41. Martinez et al. reported total resolution of subarachnoid cysticercosis in three out
of four patients treated with praziquantel
and in all 41 patients treated with albendazole42. Del Brutto reported significant benefit
with the use of albendazole in 17 patients
with subarachnoid NC43. There was total resolution of cysts in 14 patients when CT scan
was repeated after 3 months. Recently,
Proano et al. described their experience with
medical treatment of 33 patients with giant
(5 cm) subarachnoid NC with intracranial
hypertension44. Patients were administered
multiple courses of albendazole (15 mg kg1
day1 for 4 weeks) and 10 of them were given
an additional course of praziquantel (100 mg
kg1 day1 for 4 weeks). After a median follow-up of 59 weeks, cysts had either disappeared or calcified in all patients. The study
was however, uncontrolled; therefore the
possibility of spontaneous resolution can not
be excluded. Nevertheless, the report emphasized the safety of medical treatment as well
as the need for longer duration and multiple
courses of treatment in such situations. There
are also isolated reports of the effectiveness
of anticysticercal drugs in intraventricular
NC40, 42, 45. Proano et al. used a 2-week course
of albendazole in ten patients of fourth ventricular cysticercosis with an additional praziquantel course in two patients46. There was
complete disappearance of the cyst in eight
patients, decrease in size in one patient and
failure of response in one patient. The
authors recommended ventriculoperitoneal
shunt before anticysticercal therapy. Such a
decision however, should be taken on an
individual basis. For detailed consideration
of the specific role, merits and demerits of
anticysticercal treatment in relation to other
modalities of therapy, the reader is referred to
Chapters 18, 20 and 22.
380
Esoteric Forms of Cysticercosis

Although uncommon, an occasional
patient may present with features of spinal
cord compression. The cyst may be
intramedullary or leptomeningeal in location. MRI helps to clarify such a lesion. One
cannot always be certain about the nature of
the lesion and it might be prudent to remove
the lesion using microneurosurgical techniques47. However, there are isolated case
reports of the benefit with anticysticercal
agents, which should preferably be combined with steroids to reduce the inflammatory reaction48,49. The reader is referred to
Chapters 23 and 28 for an overview of the
management of spinal cysticercosis and ocular cysticercosis respectively.
Anticysticercal Treatment: Drug,

Duration and Dosage Considerations
Which drug should be preferred as an
anticysticercal agent albendazole or
praziquantel?
Praziquantel was the first drug used for NC
and albendazole was introduced later. Both
have been used extensively for the treatment of NC. Takayanagui and Jardim compared their efficacy in a non-randomized
trial of 22 patients treated with praziquantel, 21 with albendazole and 16 given only
symptomatic treatment50. Both, praziquantel and albendazole were found to be effective as compared to the control.
Albendazole was found to be more effective
in reducing the number of cysts as compared to praziquantel (80% versus 50%,
respectively). Cruz et al. also reported similar benefits of albendazole over praziquantel51. Albendazole is generally preferred
because it is cheaper and as effective, if not
more so, than praziquantel. Besides, the coadministered drugs like dexamethasone
reduce the plasma levels of praziquantel
whereas dexamethasone increases the concentration of albendazole in the CSF (see
Chapter 37). This may offer albendazole an
advantage over praziquantel especially in
the treatment of subarachnoid variety of
NC. Side effects such as headache, vomiting

and seizures resulting from an increase in
inflammation and oedema around dying
cyst(s) can be seen with either of the drugs,
even though they have different mechanisms of action.
What should be the duration of the

therapy?
The duration of therapy with praziquantel
and albendazole remains a somewhat contentious issue. Earlier, praziquantel was recommended at a dose of 50 mg kg1 day1
for 15 days2,3. Corona et al. have reported
beneficial effects with an ultra-short course
of praziquantel52. Praziquantel was administered in a single day with a total dose of 75
mg kg1 divided into three 25 mg kg1
doses with each dose being given at 2hourly intervals. Four hours later, 10 mg of
intramuscular dexamethasone or 80 mg of
prednisolone (orally) was administered. The
phamacokinetic principles behind and rationale for this approach have been described
in Chapter 37. Recently, the single-day regimen was used in 26 patients with single
enhancing brain lesions53. In 14 treated
patients, the lesions resolved completely in
11 and partially in two while in the
untreated group of 12 patients, the lesion
persisted in six patients. Adverse events
were noted in only one patient in the treated
group. The authors recommended singleday praziquantel as the treatment of choice,
in view of its demonstrated efficacy, and
reduced duration and costs of treatment. In
another study, however, the authors demonstrated resolution of imaging abnormalities
in patients with single enhancing brain
lesions but not in those with multiple NC,
implying a poor efficacy of the single-day
praziquantel regimen in multiple NC54.
The duration and dosage schedule of
albendazole was initially based upon
extrapolation of regimens used for the
treatment of hydatidosis. Escobedo et al.
reported excellent results (reduction of
cysts by 86%) with albendazole administered at the dosage of 15 mg kg1 day1 for
30 days in seven patients with parenchymal
NC4. Cruz et al. noted similar effectiveness

when 800 mg of albendazole was given to
patients with parenchymal NC for a variable period (8 days for 19 patients, 15 days
for 23 patients and 30 days for 11
patients)55. Garcia et al. compared the efficacy of 1 week versus 2 weeks of albendazole therapy and noted no significant
difference56. Current opinion favours a 1week course of albendazole therapy57.
Finally, Del Brutto et al. compared a singleday praziquantel therapy with 1 week of
albendazole for NC and found similar
favourable results58. Clearly, more double
blind controlled studies are needed to
assess the efficacy of praziquantel and
albendazole using different dosage and
duration schedules.
Should patients with non-responding or

partially responding lesions receive a
second course of anticysticercal agents?
It is well known that not all patients will
show complete resolution of cysts with anticysticercal drugs. Chong et al. reported a
patient with multiple parenchymal NC, in
whom cysts persisted even after repeated
courses of albendazole and praziquantel59.
In clinical experience, it is not uncommon to
see patients with a partial response upon
brain imaging in terms of the number and
size of cysts that have resolved after anticysticercal treatment. It is not clear whether
such individuals should be offered a second
course of anticysticercal treatment. It is also
not clear as to what would be the appropriate time to repeat the anticysticercal drug
and if a different drug or the same drug
should be used for the repeat course of anticysticercal therapy.
Symptomatic Therapy of
Neurocysticercosis
Corticosteroids
Corticosteroids are often administered in
NC on the premise that they reduce inflam-
381
mation and oedema (responsible for symptoms) around dying cyst(s)60. However, the
dose, duration, form, mode and, most significantly, timing of administration of corticosteroids are not clear. In most cases the
clinicians use their own judgement to
decide whether or not to use corticosteroids. Corticosteroids are recommended
as an important part of therapy for cysticercotic encephalitis in children and disseminated NC. They are also recommended for
treatment of acute neurological deficit
resulting from oedema, vasculitis and large
subarachnoid cysts. The use of corticosteroids may modify the plasma levels of
anticysticercal drugs and affect the efficacy
of these drugs. Concomitant administration
of corticosteroids reduces the plasma level of
praziquantel (see Chapter 37). Shandera
et al. observed that patients treated with
praziquantel and corticosteroids were more
likely to require a second course of praziquantel than those treated with praziquantel alone61. It has been suggested that as the
half-life of praziquantel is 23 h, corticosteroids should be given 4 hours after the
dose of praziquantel to have optimal anticysticercal and anti-inflammatory effects.
Plasma levels of albendazole increase when
given concurrently with dexamethasone
and therefore many recommend the use of
albendazole in preference to praziquantel
as an anticysticercal agent. The administration of intermittent long-term treatment
with corticosteroids has been demonstrated
to improve chances of ventriculoperitoneal
shunt patency in patients with hydrocephalus due to NC. An open controlled
study evaluated clinical status, incidence of
shunt malfunction and CSF abnormalities
for up to 2 years in patients in whom a ventriculoperitoneal shunt had been inserted
for cysticercotic hydrocephalus62. Two of
the 13 patients given prednisolone (50 mg,
three times a week) required shunt revision, while 18 of 30 patients in the control
group required shunt revision when followed up for 2 years. The difference was
statistically significant; better shunt function in the prednisolone-treated group was
related to improvement in cerebrospinal
fluid abnormalities.
382
Non-steroidal anti-inflammatory agents

Some authors recommend the use of antihistamines, such as chlorpheniramine (chlorphenamine) or anti-inflammatory agents
such as ketoprofen as an alternative to corticosteroids22,23. They recommend the routine
pre-administration with anti-histaminic
agents and for 46 months after a course of
albendazole. We have no personal experience with these agents but believe that
severe inflammatory exacerbations are often
life-threatening and should be better managed with high potency corticosteroids.
Anti-cerebral oedema measures

If raised intracranial pressure is a feature
(seen mostly with multiple NC or disseminated NC), judicious use of intravenous
mannitol, furosemide, oral glycerol along
with intravenous dexamethesone is justified.
Neurosurgical intervention should be sought
for consideration of ventriculoperitoneal
shunt if there is hydrocephalus, or decompression by craniotomy if there is risk of herniation. Suitable analgesics should be given
for symptomatic relief of headache.
Antiepileptic drugs
AEDs constitute standard therapy for
parenchymal NC. A discussion on the controversies regarding the optimal duration of
AEDs can be found in Chapter 21.
Conclusions
Despite advances in the diagnosis (using
imaging and immunological methods) and
availability of anticysticercal drugs (praziquantel and albendazole) the treatment of
NC still remains controversial. Outcome
measures should include resolution of cysts
on imaging studies and immediate and longterm relief from the symptoms. Salinas and
Prasad reviewed the drug therapy for NC63.
The objective was to assess the effect of drug
treatment in human NC in relation to sur-
vival, cyst persistence (defined as incomplete

resolution on radiographic studies), subsequent seizures and hydrocephalus. They
included randomized or quasi-randomized
trials comparing an anticysticercal drug with
a placebo or a control group receiving symptomatic therapy in patients with NC. Only
four studies involving 305 people met the
inclusion criteria8,9,13,26. A difference just
approaching significance was detected
between anticysticercal therapy and placebo
in relation to cyst persistence at 6 months
(relative risk: 0.83; 95%CI: 0.700.99). Two trials reported on seizure rates after 12 years
follow-up and found no difference (relative
risk: 0.95; 95%CI: 0.591.51)8,9. In the study by
Carpio et al., there was no difference detected
in rates for development for hydrocephalus
(relative risk: 2.19; 95%CI: 0.2916.55)8. The
authors concluded that there was insufficient
evidence to determine whether anticysticercal therapy is associated with beneficial
results in NC63. They emphasized that:
the clinicians should be aware of the lack of
evidence to either support or refute the use of
anticysticercal therapy in NC. This lack of
evidence, added to the potential harm
recognized with treatment, means that the
clinicians have to weigh the benefits and risks
of anticysticercal therapy very carefully in each
individual patient.
The Cysticercosis Working Group in Peru is

conducting a randomized double blind,
placebo-controlled trial of albendazole and
dexamethasone in 120 patients with
parenchymal NC (Hector H. Garca, Lima,
Peru, personal communication). The number of seizures on follow-up, before and
after withdrawal of AEDs and number of
lesions upon MRI at 6 months and CT at 12
and 24 months will be evaluated. Results
were expected after breaking the code in
September 2002. Another multicentre, randomized, placebo-controlled double blind
clinical trial is currently underway in
Ecuador to determine whether anticysticercal therapy added to symptomatic treatment influences resolution of lesions and
long-term outcome. Patients with active or
transitional cysts will be randomized to
symptomatic treatment alone (cortico-
steroids and AEDs) or to symptomatic treatment with albendazole. Patients with both
intraparenchymal and extraparenchymal
cysts will be included but randomized independently. The primary outcome measure
will be reduction of cysts at 1 year after
treatment. Secondary outcome measures
383
will include the persistence of seizures and

the late development of hydrocephalus
(Arturo R. Carpio, Cuenca, Ecuador, personal communication). The results of these
two randomized, double blind placebo-controlled trials of anticysticercal therapy in
NC are keenly awaited.
References
1. Robles, C., Chavarra, M. (1979) Presentaction de un caso clinico de cisticercosis cerebral curado
medicamente con un nuevo formaco: Praziquantel. Salud Publica de Mexico 21, 603618.
2. Sotelo, J., Escobedo, F., Rodriguez-Carabajal, J., et al. (1984) Therapy of parenchymal brain cysticercosis with praziquantel. New England Journal of Medicine 310, 10011007.
3. Robles, C., Sedano, A.M., Vargas-Tentori, N., et al. (1987) Long-term results of praziquantel therapy
in neurocysticercosis. Journal of Neurosurgery 66, 359363.
4. Escobedo, F., Penagos, P., Rodriguez, J., et al. (1987) Albendazole therapy for neurocysticercosis.
5. Sotelo, J., Escobedo, F., Penagos, P. (1988) Albendazole vs. praziquantel for therapy for neurocysticercosis. A controlled trial. Archives of Neurology 45, 532534.
6. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further 10 year study covering 284 cases. Quarterly Journal of Medicine 13, 107121.
Research Council Special Report Series No. 299. Her Majestys Stationery Office, London, pp. 158.
focal seizures and single small enhancing computerized tomographic lesions: a randomized,
placebo-controlled, double-blind trial. Pediatric Infectious Diseases Journal 17, 696700.
10. Kramer, L.D. (1990) Anthelminthic therapy for neurocysticercosis. Archives of Neurology 47, 1059.
11. Kramer, L.D. (1995) Medical treatment of cysticercosis ineffective. Archives of Neurology 52,
101102.
12. Vasconcelos, D., Cruz-Segura, H., Methos-Gomez, H., et al. (1987) Selective indications for the use of
praziquantel in the treatment of brain cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry
66, 383388.
13. Padma, M.V., Behari, M., Misra, N.K., et al. (1995) Albendazole in neurocysticercosis. National
Medical Journal of India 8, 255258.
14. Wadia, N.H., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: new observations including CT
15. MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of
16. Gupta, P.M., Kalita, J., Misra, U.K. (1998) Should patients with numerous cysticerci be treated with
corticosteroids only? Annals of the Indian Academy of Neurology 1, 2528.
17. Zhu, D., Xu, W. (1983) Effect of biltricide on cysticercosis cellulosae with muscular pseudohypertrophy: a report of three cases. Chi Sheng Chung Hsueh Chi Sheng Chung Ping Tsa Chi 1, 185186.
18. Xu, Z., Chen, W., Zong, H., et al. (1985) Praziquantel in the treatment of cysticercosis cellulosae.
Report of 200 cases. Chinese Medical Journal 98, 489494.
19. Garca, H.H., Del Brutto, O.H. (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 15821584.
20. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Review of Infectious Diseases 10,
10751087.
21. Rangel, R., Torres, B., Del Bruto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young
22. Agapejev, S., Meira, D.A., Barraviera, B., et al. (1989) Neurocysticercosis: treatment with albendazole and
dextrochlorophenirimine. Transactions of the Royal Society of Tropical Medicine and Hygiene 83, 377383.
384
23. Agapejev, S., Da Silva, M.D., Ueda, A.K. (1996) Severe forms of neurocysticercosis. Treatment with
albendazole. Arquivos de Neuropsiquiatria 54, 8293.
24. Singhal, B.S., Ladiwala, U. (1995) Neurocysticercosis in India. In: Rose, F.C. (ed.) Recent Advances in
Tropical Neurology. Elsevier Amsterdam, Netherlands, pp. 99109.
26. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT lesions in epilepsy.
Neurology 44, 13441346.
27. Chopra, J.S., Sawhney, I.M.S., Suresh, N., et al. (1992) Vanishing CT lesions in epilepsy. Journal of the
28. Rawlings, D., Ferriero, D.M., Messing, R.O. (1989) Early CT reevaluation after empiric praziquantel
therapy in neurocysticercosis. Neurology 39, 739741.
29. Del Brutto, O.H. (1993) The use of albendazole in patients with single lesions enhanced on contrast
CT. New England Journal of Medicine 328, 356357.
30. Del Brutto, O.H. (2000) Solitary cysticercus granuloma in Latin America. In: Rajshekhar, V., Chandy,
M.J. (eds) Solitary Cysticercus Granuloma The Disappearing Lesion. Orient Longman, Hyderabad,
India, pp. 153166.
31. Rajshekhar, V., Chandy, M.J. (2000) Outcome in patients with solitary cysticercus granuloma. In:
Rajshekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma The Disappearing Lesion. Orient
Longman, Hyderabad, India, pp. 135152.
understanding a controversy. Acta Neurologica Scandinavica 84, 465470.
33. Murthy, J.M.K., Reddy, Y.V.S. (1998) Prognosis of epilepsy associated with single CT enhancing
lesion: a long term follow up study. Journal of the Neurological Sciences 159, 151155.
34. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticercosis after single taeniacidal dose of praziquantel. Lancet 342, 748 (Letter).
36. Vazquez, V., Sotelo, J. (1992) The course of seizure after treatment of cerebral cysticercosis. New
England Journal of Medicine 327, 696701.
37. Del Brutto, O.H., Santibanez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389392.
38. Del Brutto, O.H. (1994) Prognostic factors for seizure recurrence after withdrawal of antiepileptic
drugs in patients with neurocysticercosis. Neurology 44, 17061709.
39. Sotelo, J., Del Brutto, O.H., Roman, G.C. (1996) Cysticercosis. In: Remington, J.S., Schwartz, M.N.
(eds) Current Clinical Topics in Infectious Diseases, Vol. 16. Blackwell Science, Cambridge,
Massachusetts, pp. 240259.
40. Del Brutto, O.H., Sotelo, J. (1990) Albendazole therapy for subarachnoid and ventricular cysticercosis: case report. Journal of Neurosurgery 72, 816817.
41. Del Brutto, O.H., Sotelo, J., Aguirre, R., et al. (1992) Albendazole therapy for giant subarachnoid cysticerci. Archives of Neurology 49, 535538.
42. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrado, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological
Sciences 130, 2534.
43. Del Brutto, O.H. (1997) Albendazole therapy for subarachnoid cysticercosis: clinical and neuroimaging analysis of 17 patients. Journal of Neurology, Neurosurgery and Psychiatry 62, 659661.
44. Proano, J.V., Madazo, I., Avelar, F., et al. (2001) Medical treatment for neurocysticercosis characterized by giant subarachnoid cysts. New England Journal of Medicine 20, 879885.
46. Proano, J.V., Madrazo, I., Garcia, L., et al. (1997) Albendazole and praziquantel treatment in neurocysticercosis of the fourth ventricle. Journal of Neurosurgery 87, 2933.
47. Aghakhani, N., Comoy, J., Tadie, M., et al. (1998) Isolated intramedullary cysticercosis. Case report.
Neurochirurgie 44, 127131.
48. Corral, I., Quereda, C., Moreno, A., et al. (1996) Intramedullary cysticercosis cured with drug treatment: a case report. Spine 21, 22842287.
385
49. Garg, R.K., Nag, D. (1998) Intramedullary spinal cysticercosis: response to albendazole: case reports
and review of literature. Spinal Cord 36, 6770.
50. Takayanagui, O.M., Jardim, E. (1992) Therapy for neurocysticercosis: comparison between albendazole and praziquantel. Archives of Neurology 49, 290294.
51. Cruz, M., Cruz, I., Horton, J. (1991) Albendazole versus praziquantel in the treatment of cerebral
cysticercosis: clinical evaluation. Transactions of the Royal Society of Tropical Medicine and Hygiene 85,
244247.
52. Corona, T., Lugo, R., Medina, R., et al. (1996) Single-day praziquantel therapy for neurocysticercosis.
New England Journal of Medicine 334, 125.
53. Pretell, E.J., Garca, H.H., Custodio, N., et al. (2000) Short regimen of praziquantel in the treatment
of single enhancing brain lesions. Clinical Neurology and Neurosurgery 102, 215218.
54. Pretell, E.J., Garca, H.H., Gilman, R.H., et al. (2001) Failure of one-day praziquantel treatment in
patients with multiple neurocysticercosis lesions. Clinical Neurology and Neurosurgery 103, 175177.
55. Cruz, I., Cruz, M.E., Carrasco, F., et al. (1995) Neurocysticercosis: optimal dose treatment with albendazole. Journal of the Neurological Sciences 133, 152154.
prospective double blind trial comparing 7 versus 14 days of treatment. Neurology 48, 14211427.
58. Del Brutto, O.H., Campos, X., Sanchez, J., et al. (1999) A single-day praziquantel versus 1-week
albendazole for neurocysticercosis. Neurology 52, 7981.
59. Chong, M.S., Howkins, C.P., Cook, C.G., et al. (1991) A resistant case of neurocysticercosis.
Postgraduate Medical Journal 6, 577578.
60. Minguetti, G., Ferreira, M.V. (1982) Effect of corticoids in the acute phase of neurocysticercosis: preliminary note. Arquivos de Neuropsiquiatria 40, 7785.
61. Shandera, W.X., White, A.C., Jr, Chen, J.C., et al. (1994) Cysticercosis in Houston, Texas: a report of
112 patients. Medicine 73, 3751.
62. Roman, R.A.S., Soto-Hernandez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal
shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of
63. Salinas, R., Prasad, K. (2000) Drugs for treating neurocysticercosis (tapeworm infection of the brain).
In: Cochrane Review, The Cochrane Library, Issue 3, Oxford, UK.
39
Neurocysticercosis: Neurosurgical
Perspective
Bhaiwani S. Sharma and P. Sarat Chandra
Introduction
The management of neurocysticercus (NC)
includes both medical and surgical treatments. These are complementary to each
other in a number of cases. Medical treatment consists of control of seizures with
antiepileptic drugs and cerebral oedema
with decongestants in addition to anticysticercal drugs.
Rationale for surgical treatment

Anticysticercal drugs, namely, albendazole
and praziquantel, trigger cyst degeneration
and are more effective against active cysts in
the brain parenchyma. Though reported to be
effective in other forms of NC, there is still no
consensus about their efficacy in extraparenchymal locations15. Giant cysticerci
(parenchymal, ventricular or cisternal) are
most often of the racemose form and do not
appear to respond well to anticysticercal
drugs. The possibility of decompensation of
intracranial pressure (ICP) and transtentorial
herniation, caused by increase in oedema and
inflammatory reaction provoked by cyst
degeneration, cautioned against the use of
anticysticercal drugs in individuals with giant
cysts with mass effect or disseminated cysticercosis6. Furthermore, these medications
with or without corticosteroids do not prevent occurrence of complications such as

hydrocephalus. Prompt surgical excision of
the cyst may prevent chronic inflammation
and granuloma formation (focus of epilepsy)7
around the cyst(s) in parenchymal locations,
and ependymitis and ventricular entrapment
due
to
intraventricular
cysticercosis.
Therefore, some patients with NC benefit
from neurosurgical intervention. The latter is
usually palliative and at times curative. The
indication for neurosurgical approach to management is usually based on the presence of
specific clinical manifestations with explicit
underlying pathophysiological mechanisms,
often posing a threat to life or vision by local
compression or raised ICP8,9.
Preoperative Selection and Work-up

Indications for surgery
In general, neurosurgical intervention is
required when:
Hydrocephalus is present.
A cyst exhibits tumour-like effect.
Viable intraventricular NC is diagnosed.
Abrupt or rapid rise of ICP refractory to
medical treatment is noted.
5. Diagnosis is in doubt (for instance, single
small enhancing lesions upon CT).
1.
2.
3.
4.

387
388
B.S. Sharma and P.S. Chandra
Choice of surgical procedure

A range of surgical procedures has been
described (Table 39.1). Appropriate surgical
intervention is tailored according to pathophysiological mechanisms underlying specific clinical manifestations. In other words,
clinical presentations primarily determine
the need for, and choice of, neurosurgical
approach8,1012. Indeed, earlier attempts at
surgical management relied solely upon
clinical manifestations. Accordingly, clinical
classifications were evolved to determine
the nature of surgical intervention. Thus,
Stepien and Chorobski described a classification, which was used to decide the
requirement for, and prognosis after,
surgery11. They classified patients who
required operation into three groups: group
I included those with focal tumour-like presentation with focal neurological deficits
with or without raised ICP; group II
included those with profuse multiple cysticerci giving rise to a pseudotumoral form;
and group III comprised patients with
raised ICP due to hydrocephalus. Colli et al.
classified their surgical series into two main
groups, i.e. those with local compression,
for instance in the optochiasmatic, cerebellopontine or quadrigeminal cisterns or in

the fourth ventricle; and those due to raised
ICP10. The latter group was further sub-classified into three subgroups:
1. Raised ICP owing to hydrocephalus
resulting from:
mechanical obstruction of ventricles/basal
cisterns by cysticercal cysts;
inflammatory reaction (ependymitis or
arachnoiditis);
impairment of CSF absorption due to
parasagittal arachnoiditis and involvement of arachnoid villi.
2. Raised ICP owing to tumour-like syndrome (space occupancy; tumoral form).
3. Raised ICP owing to diffuse cerebral
oedema (encephalitic; pseudotumoral form).
At present, neuroradiological studies
form the cornerstone of the preoperative
evaluation of candidates being considered
for neurosurgical intervention. Plain and
contrast computed tomography (CT) provides rough guidelines for neurosurgical
treatment. However, it alone does not form
the basis for intervention. In general, CT is
not adequate for the evaluation of ventric-
Table 39.1. Surgical options for neurocysticercosis.

1. Cerebrospinal fluid diversion procedures:
(a) Ventriculoperitoneal/ventriculoatrial shunt
(b) Third ventriculostomy
(c) Torkildsens operation
(d) Ventricular reservoir implantation
2. Lesion excision:
(a) Open craniotomy and excision
(i) Infratentorial
Midline suboccipital craniotomy for cysts in the fourth ventricle, cisterna magna and
quadrigeminal cistern
Unilateral suboccipital craniotomy for cysts in the cerebellopontine angle cistern
(ii) Supratentorial
Lateral/third ventricle cysts transcortical/transcallosal approach
Optochiasmatic/sylvian/suprasellar cysts pterional craniotomy
Pseudotumour form bitemporal decompressive/unilateral frontal or temporal lobectomy
Prepontine/perimesencephalic cisternal cysts subtemporal approach
Giant parenchymal/cisternal cysts according to location frontal, temporal, parietal or
occipital craniotomy and excision.
(b) Minimally invasive procedures:
(i) Stereotactic surgery in deep-seated and periventricular cysts and for localization purpose
(ii) Endoscopic surgery for intraventricular neurocysticercosis
Neurocysticercosis: Neurosurgical Perspective
ular and cisternal NC. At best, CT

provides strong suspicion of ventricular or
cisternal cysts in individuals at risk.
Magnetic resonance imaging (MRI) including contrast enhanced and fluid attenuation inversion recovery (FLAIR) studies
are more useful than CT but these may
also be equivocal at times, particularly, for
instance in the case of fourth ventricle
cysts (see Chapter 20)13. Contrastenhanced MRI is expressly useful in the
identification
of
arachnoiditis
and
meningeal inflammation around cisternal
cysts and ependymitis in the case of intraventricular NC. In general, the presence of
contrast enhancement of the pericystic
meninges or the ventricular lining constitutes a contraindication for definitive
exeresis of the cyst. CT cisternography
after administration of intrathecal contrast
permits accurate delineation of cisternal
cysts and, if the contrast permeates the
foramina of Luschka and Magendie, of
intraventricular cysts as well. For the
preoperative evaluation of intraventricular
NC, a ventriculo-CT, after contrast administered through a ventriculostomy or a ventricular reservoir, is ideal.
389
Operative Strategies
Hydrocephalus resulting from
inflammatory impediment to CSF flow
As a rule, in all instances of hydrocephalus,
where preoperative evaluation discerns the
presence of inflammation associated with the
cysticerci, for instance, ependymitis in association with intraventricular cysticercosis and
meningitis and arachnoiditis surrounding cisternal cysts, it is best to proceed directly to
ventriculoperitoneal shunt (VPS) (Fig. 39.1). In
the particular case of communicating hydrocephalus due to cisternal cysts, exeresis is not
an effective procedure as they are usually multiple and adherent to cranial nerves, vessels
and neural tissue owing to arachnoiditis14,15.
Surgery may have disastrous consequences
and removal of a cyst does not prevent the
progression of inflammatory reaction that is
already underway. Obstruction by an inflammatory process is also frequent at the fourth
ventricular outlet. Such patients are best
treated with insertion of VPS since they do not
benefit from direct posterior fossa exploration
and lysis of inflammatory adhesions, which
invariably recur within a short time.
Magnetic resonance imaging

or computed tomography ventriculography
Obstruction by
free cyst
Surgical excision
Communicating
hydrocephalus
Inflammatory
obstruction
Ventriculoperitoneal
shunt
Fig. 39.1. Management of hydrocephalus due to neurocysticercosis.
Inflammatory
obstruction +
cyst
Ventriculoperitoneal shunt +
partial excision
390
When CT ventriculography or MRI do

not allow differentiation between obstruction
due to inflammatory or free cysts, surgery is
indicated. It is easy to differentiate between
viable, active and inflamed cysts at operation. The former have a translucent membrane and contain colourless fluid. On the
other hand, inflamed cysts are characterized
by a thick opaque membrane and their contents are hazy. Such cysts are often adherent
and it is difficult to remove them. If at posterior fossa exploration, ependymitis or arachnoiditis is found or a cyst is found adherent
to the ependyma, partial excision of the free
portion of the cyst may be performed.
Ventriculoperitoneal shunt insertion is indicated immediately after partial cyst removal
as these patients develop inflammatory
blockade of cerebrospinal fluid (CSF) circulation and rise in ICP within a few weeks.
Corticosteroids are used when inflammation (ependymitis, arachnoiditis or basal
meningitis) is observed at surgery, CSF studies reveal evidence of inflammation, the cyst
is only partially excised and intraoperative
rupture is noted. Shunt complications include
blockade and infection. Shunt obstruction
rates approach 50% within the first 4 months
and more than half of the patients require
revision of shunt during first postoperative
year15. In order to improve and optimize

shunt function and minimize post-shunt
morbidity, several efforts have been made to
modify shunt design. Sotelo et al. have
devised a new shunt device that operates
upon the principle of drainage according to
CSF production rather than pressure1618.
Structurally, it is characterized by the absence
of a valve mechanism and a long (9 cm) peritoneal end of the catheter of diameter 0.017
inches (Fig. 39.2). Functionally, it is specified
by a constant rate of drainage under the balanced influence of the gravitational effect and
ventricular pressure (Fig. 39.3a and b). The
device prevents overdrainage. More significantly, with regard to cysticercotic hydrocephalus, the constant flow through it
prevents clogging and obstruction by inflammatory and cystic debris.
Several other operative procedures have
been undertaken for the management of cysticercotic hydrocephalus. Third ventriculostomy involves the establishment of a
communication between the third ventricle
and the interpeduncular cistern10,19. The
communication may be made by open
surgery, endoscopically or under stereotactic
guidance. The procedure is effective in
selected cases with aqueductal stenosis due
to cysticercotic arachnoiditis in the interpe-
Fig. 39.2. Illustration of an unassembled ventriculoperitoneal shunt designed by Sotelo et al. (see text
for explanation). The ventricular catheter (above) and the peritoneal catheter (below) are shown. Scale
shows centimetres. (Reproduced with permission from reference 16.)
New shunt
0
Differential pressure valves

550
200
100 200
400
550
200
Gravity effect (mm)
Ventricular pressure
391
100
100
100
100
0
200
400
600
800
10,000
20,000
30,000
Daily drainage (ml)

Fig. 39.3. Comparison of functional characteristics of shunt devised by Sotelo et al. (left) and conventional
shunts (right). Hatched area represents the combination of ventricular pressure and gravity effect at which
conventional shunts remain non-functional. (Reproduced with permission from reference 16.)
duncular and perimesencephalic cisterns. A

major limitation is that it will fail if the subarachnoid spaces in the CSF pathway distal
to the interpeduncular cistern are occluded
because of cysticercotic arachnoiditis.
Torlkidsens operation involves the creation
of a communication between the third ventricle and the cisterna magna20. This procedure is useful in cases of third or fourth
ventricle obstruction. In the case of a unilateral hydrocephalus due to obstruction at the
foramen of Monro, a septum pellucidotomy
may be undertaken either after open craniotomy, stereotactic localization or endoscopically (see Chapter 40)10.
An uncommon situation is the occurrence
of a trapped fourth ventricle21,22. This occurs
in the event of dual obstruction; aqueductal
stenosis due to perimesencephalic arachnoiditis or ependymitis causes hydrocephalus
and fourth ventricle outlet obstruction
because of intraventricular cysticercosis or
arachnoiditis obliterates the foramina of
Luschka and Magendie. In such an event, the
lateral ventricles and the third ventricles are
decompressed by a VPS in the lateral vent-
ricle. However, the fourth ventricle dilates and

balloons out, often leading to the complication of posterior fossa mass with transforaminal or reverse herniation. It is important to
distinguish this condition from a fourth ventricle cyst because the surgical approaches to
the two conditions are different. A trapped
fourth ventricle may require the insertion of
a separate shunt in the fourth ventricle21.
Hydrocephalus in association with viable,

free intraventricular or cisternal cysts
In the absence of evidence of inflammation
associated with intraventricular and cisternal
cysts, in the form of ependymitis and meningitis/arachnoiditis respectively, a primary
removal of the cyst can be recommended
(Figs 39.1 and 39.4)23,24. This often obviates
the need for VPS. Surgical excision of the cyst
needs to be accomplished for several reasons.
First, the role of medical treatment in intraventricular and cisternal NC is controversial.
There is a theoretical risk of inflammatory
exacerbation of symptoms with anticysticer-
392
Neurocysticercosis
Active parenchymal
cyst(s)
Small
cyst(s)
Giant or
large
(> 4 cm)
cyst(s)
Anticysticercal
therapy
Cisternal
cyst(s)
Small
cyst(s)
Spinal cyst(s)
Large
cyst(s)
Asymptomatic
Intraventricular
cyst(s)
Intramedullary
cyst(s)
Focal
compression
Subarachnoid
cyst(s)
Free
cyst(s)
Adherent
cyst(s)
Trial with
anticysticercal
drugs/
corticosteroids
Follow-up
Ventriculoperitoneal
shunt + partial
excision
Increase in
size
Excision
Fig. 39.4. Flow chart showing management protocol for neurocysticercosis.
cal drugs. Second, free-floating intraventricular cysts are at risk of obstructing the CSF
flow across several points, including the foramen of Monro, aqueduct and the fourth vetricular outlet, by a ball-valve phenomenon.
This can lead to acute hydrocephalus with
rise in ICP, manifesting clinically with altered
sensorium, leading to coma and cardiorespi-
ratory arrest. Finally, free and viable intraventricular as well as viable cisternal cysts
are at risk of inflammatory degeneration during the natural course of their evolution. This
elicits an inflammatory reaction in the ventricular walls leading on to ependymitis and
meningitis in the case of intraventricular NC,
and meningitis and arachnoiditis in the case
of cisternal cysticercosis. Therefore intraventricular and cisternal cysts should be ideally

removed in order to prevent the above mentioned complications. Cysts may be removed
by open surgical intervention in the case of
cisternal forms and by either open craniotomy using microsurgical technique or
endoscopically in the case of intraventricular
NC. Stereotactic localization may be performed before craniotomy in case of difficulty. Free cysts located in the lateral or third
ventricle are operated using anterior interhemispheric transcallosal or transcortical
approach through the middle frontal
gyrus23,24.
Intraventricular cysts are more commonly
located in the occipital horns of the lateral
ventricles and these might be approached by
an occipital incision with occipital lobectomy. A complication that must be endured
in such event is the occurrence of visual field
393
defects. A cyst located within the fourth ventricle is approached via posterior fossa craniotomy. The free cyst may protrude
spontaneously through the foramen of
Magendie towards the cisterna magna or it
may be gently pulled out of the fourth ventricle (Fig. 39.5ac). When the cyst is adherent to the wall of the ventricle or if the
foramen of Magendie is stenosed or
obstructed, it needs to be opened or widened
with section of the inferior portion of the
vermis to facilitate visualization of the inner
part of the ventricle. Madrazo et al. proposed
pipette suction technique for atraumatic
extraction24,25. They devised a special long
pipette, which attaches to the cyst by suction
and permits removal without rupture. They
considered intraoperative cyst rupture as a
dangerous event24. Others, however, do not
share this view15,23. However, in all cases of
intraoperative rupture of cyst, intraventricu-
Fig. 39.5. Surgical exposure of fourth ventricle cysticercosis. An active cyst is seen protruding from the
foramen of Magendie (a, b). A degenerating cyst with thick opaque walls that was delivered by section of
the inferior portion of the vermis (c). (Source: B.O. Colli, So Paulo, Brazil.)
394
lar lavage with Ringers lactate solution at

body temperature is advocated in addition
to the systemic administration of high
potency corticosteroids. Endoscopic excision
has been advocated both for supratentorial
and infratentorial intraventricular cysts2628.
Endoscopic third ventricular cyst removal
may be carried out very effectively using a
rigid rod lens endoscope through a frontal
burr hole. The foramen of Monro may be
identified upon entering the lateral ventricle
by noting the presence of the choroid plexus
and the thalamostriate vein. It is not uncommon in long-standing hydrocephalus, to
find multiple perforations within the septum, hence it is important to identify the
correct portal of entry into the third ventricle. It is usually not possible to remove the
cyst in toto, and the cyst usually gets
ruptured during removal. Intraventricular
injection of corticosteroids to prevent anaphylactic reaction remains controversial27,28.
Endoscopic removal is reviewed in detail in
Chapter 40.
been tried but experience with this procedure

is limited and not favourable31.
Diffuse cerebral oedema (encephalitic or

pseudotumoral form)
Miliary infestation with diffuse inflammatory reaction and oedema in the brain
parenchyma, constitutes the clinical syndrome of cysticercotic encephalitis. Intracranial pressure is raised and a major
determinant of the poor outcome in this condition. There is increase in parenchymal volume with corresponding reduction in
ventricular and cisternal volumes. The primary treatment of this form is with decongestants and corticosteroids. The latter prevent
secondary inflammatory reaction triggered
by acute destruction of the parasites23. In
exceptional cases, where intracranial hypertension is refractory to medical treatment and
threatens life or vision, decompressive bitemporal craniotomy, or unilateral temporal or
frontal craniotomy and lobectomy may be
considered (Fig. 39.6)29,30,32.
Tumour-like syndrome (space occupancy

or tumoral form)
Local compression
Cysticercal cyst(s) may grow in size in the
parenchyma, cistern(s) or ventricle(s) and may
produce mass effect and intracranial hypertension. Such cases are best treated by direct surgical excision. Active cysts adhere weakly to
neural tissue and can easily be excised completely (Fig. 39.4). In the degenerative phase,
intense inflammatory reaction around the
cyst(s) makes them firmly adherent to nervous
tissue or blood vessels and their complete
excision carries a risk of producing neurological deficit. Such cysts are treated by cyst
decompression or partial resection via a
direct/stereotactic/endoscopic approach.
Cyst puncture is a relatively simple procedure for decompressing giant cysts. However,
it rarely produces lasting results because cysts
are often multiple and the possibility of cysts
refilling29,30. The establishment of a shunt
between the cyst and the subarachnoid space
is not recommended because of its proclivity
to cause cysticercotic meningitis and arachnoiditis10. Cystoperitoneal drainage has also
All forms of NC may produce symptoms

and signs of compression of neural tissue
when cysts grow to large or giant proportions. The location of the pathology dictates
the surgical approach (Table 39.1; Figs 39.5
and 39.7a and b).
Fig. 39.6. Surgical specimen of frontal lobectomy

for disseminated neurocysticercosis.
395
Fig. 39.7. (a and b) Exposure for cysts in the suprasellar region showing surgical anatomy of the
region. c, Cysticercus cyst; IC, internal carotid artery; ON, optic nerve. (Reproduced with permission
from reference 10.)
Cisternal cysts
Well-defined cysts within the cisterns are
excised irrespective of their size when they
cause local compression. Cysts located in the
optochiasmatic region may be approached
via a transcranial route, preferably the pterional or the fronto-temporo-orbital route (Fig.
39.7a and b). Cysts in the cerebellopontine
angle cistern may be approached through a
unilateral suboccipital craniotomy.
Parenchymal form
Cysticerci may lodge within the brain
parenchyma as a single cyst, two or three cysts
forming clumps, countable multiple or innumerable cysts. Seizures are the most common
clinical manifestation. Tubercular granuloma,
microabscess, focal encephalitis, postictal
enhancement, vascular lesions and neoplasms
need to be considered in the differential diagnosis. Surgery (excisional biopsy) may be
required for confirmation of diagnosis33,34.
Parenchymal cyst(s) may grow in size to

produce a tumour-like syndrome. Cysts
larger than 4 cm produce local compression of brain paranchyma and focal
neurological deficits. Stereotactic/open
craniotomy and cyst removal is advocated
in cases of a single giant cortical cyst or
large clumps exhibiting tumour-like
behaviour, when located in a surgically
accessible area. The other indications for
excision include progressive focal neurological deficit, lack of response to anticysticercal therapy and uncertainty in
diagnosis. Deep-seated (thalamic, basal
ganglia) cysticerci are uncommon but
difficult to manage surgically. They may
be approached using a transcortical or
transylvian route. Minimally invasive
techniques such as stereotactic or imageguided system for neuronavigation may
be used to accurately localize the cyst for
biopsy or excision10,30,35.
396
Surgical Outcome and Postoperative

Management
The high postoperative mortality and morbidity observed in the past has been reduced
to a minimum by the following.
1. Better identification of patients with free
intraventricular cysts with ventriculo-CT or
MRI.
2. Use of microsurgical techniques.
3. Satisfactory control of aseptic meningitis
with perioperative and postoperative corticosteroids.
4. Availability of better functioning shunt
devices.
Hydrocephalus
Cysticercotic
hydrocephalus
constituted
group III of Stepien and Chorobskis classification of clinical presentations requiring neurosurgical intervention11. Individuals with
this presentation were treated with total or
partial cyst exeresis or, in cases where this
was not possible, by decompression.
Understandably, results were poor and postoperative mortality was high. The use of VPS
improved outcome of cysticercotic hydrocephalus. However, as experience with VPS
accumulated, it was realized that this procedure was associated with a high rate of shunt
malfunction particularly due to occlusion
within the first 2 years after its insertion. Thus
Colli et al. noted that 54% of 144 patients who
were submitted to shunting, required reoperation, mostly in the first 2 years10. Others have
similarly reported high incidence of shunt
malfunction14. The frequency of shunt malfunction correlates with the degree of abnormality in CSF cell count and protein. In
general, mortality in cysticercotic hydrocephalus is as high as 50% within the first
year. Those who survive and do not develop
complications in the initial 1 or 2 years generally do well. Intermittent long-term prednisolone therapy after VPS reduces shunt
malfunction and improves functional status
of the patient36. In these cases, prednisolone is
started within the first postoperative week at
a dose of 50 mg three times a week.
Sotelo et al. reported excellent results with

their new shunt device that has been
described in an earlier section of this chapter.
Their shunt was reported to be functional for
a mean period of 9 2 months in 25 patients;
only one patient required shunt revision16.
However, while the new device took care of
shunt occlusion, inadequate drainage became
a problem17. Clinicoradiological follow-up of
the patients revealed conversion of a hypertensive hydrocephalus to normotensive
hydrocephalus17. Thus the clinical picture
changed from one of intracranial hypertension to that of a frontal lobe gait disorder,
dementia and incontinence. Radiological
studies revealed inadequate resolution of
ventricular size. In order to obviate this complication, the authors increased the cross-sectional area of the peritoneal catheter from
0.126 mm2 to 0.146 mm2. Further experience
with the revised shunt device including longterm follow-up is awaited.
Tumoral form
The prognosis is far better than other forms.
Out of 55 patients with this presentation in
Stepiens series, 35% recovered, 40% showed
improvement, 2% showed no improvement
and 24% died in the postoperative period12.
This led him to conclude: It is tempting to conclude, therefore, that in every case in which a
diagnosis of localized cerebral cysticercosis is
made, operation should be performed.
Colli et al. operated on 12 patients with
giant intracranial cysticercosis and observed
good postoperative outcome in all 1210.
Pseudotumoral form
Surgery is rarely required and advocated in
this form of cerebral cysticercosis. The outcome after surgery is not good. Thus, in 34
patients who were operated on for pseudotumoral cerebral cysticercosis in Stepiens
series, about half had partial improvement,
14% had no change in their clinical status
and 32% died after surgery12. Colli et al. performed bitemporal decompressive surgery in
five patients. Three patients improved, while
two died a few days later10.
Compressive form
The surgical outcome is dependent upon the
presence of inflammation and its sequelae.
When cysts in the fourth ventricle, cerebellopontine angle cisterns and the optochiasmatic region are free and not associated with
either ependymitis or meningitis/arachnoiditis, there is improvement in the neurological deficit10. The improvement in ICP is
sustained in such cases. Those individuals
with inflammatory cysts in any of the above
locations demonstrate transient improvement in ICP but ultimately require VPS, if
the latter has not been already undertaken.
Conclusions
In conclusion, surgery for NC is required
in the presence of free intraventricular
397
cysts, hydrocephalus, tumour-like effect,

diffuse disseminated form refractory to
medical treatment and doubt in diagnosis. The choice of surgical procedure is
dictated by the pathophysiological mechanism producing the clinical manifestation. Hydrocephalus due to obstruction
by a free intraventricular cyst is best
treated by direct open/endoscopic excision of the cyst. Communicating hydrocephalus or hydrocephalus due to
inflammatory intraventricular obstruction
are treated with VPS. Large parenchymal
cisternal, ventricular or spinal cysts producing local compression are excised. The
pseudotumoral form resistant to medical
treatment may rarely need decompressive
craniotomy. Anticysticercal treatment
may be required for residual or additional cysts.
References
1. Proano, J.V., Madrazo, I., Garcia, L, et al. (1997) Albendazole and praziquantel treatment in neurocysticercosis of fourth ventricle. Journal of Neurosurgery 87, 2933.
2. Del Brutto, O.H., Quintero, L.A. (1995) Cysticercosis mimicking brain tumour: the role of albendazole as a diagnostic tool. Clinical Neurology and Neurosurgery 97, 256258.
5. Sotelo, J., Del Brutto, O.H., Penagoes, P., et al. (1990) Comparison of therapeutic regimen of anticysticercal drugs for parenchymal brain cysticercosis. Journal of Neurology 237, 6972.
6. Wadia, N.H., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations including CT
7. Del Brutto, O.H., Santibanez, R., Nobla, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389392.
8. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central
9. Sharma, B.S., Gupta, S.K., Khosla, V.K. (1998) Neurocysticercosis: surgical considerations. Neurology
India 46, 177182.
10. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I.
Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquitria 52, 166186.
11. Stepien, L., Chorobski, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of
12. Stepien, L. (1962) Cerebral cysticercosis in Poland. Clinical symptoms and operative results in 132
cases. Journal of Neurosurgery 19, 505513.
13. Salazar, A., Sotelo, J., Martinez, H., et al. (1983) Differential diagnosis between ventriculitis and a
fourth ventricle cyst in neurocysticercosis. Journal of Neurosurgery 59, 660663.
15. Lobato, R.D., Lamas, E., Portillo, J.M. (1981) Hydrocephalus in cerebral cysticercosis. Pathogenic
and therapeutic considerations. Journal of Neurosurgery 55, 786793.
398
16. Sotelo, J., Rubalcava, M.A., Gormez-Llata, S. (1995) A new shunt for hydrocephalus that relies on
CSF production rather than on ventricular pressure. Initial clinical experiences. Surgical Neurology
43, 324332.
17. Sotelo, J. (1996) Update: the new ventriculoperitoneal shunt at the Institute of Neurology at Mexico.
Surgical Neurology 46, 1920.
18. Sotelo, J. (1993) A new ventriculoperitoneal shunt for treatment of hydrocephalus. Experimental
results. European Journal of Biomedical Engineering 15, 257262.
19. Darlymple, S.J., Kelly, P.J. (1992) Computer assisted stereotactic third ventriculostomy in the management of non-communicating hydrocephalus. Stereotactic and Functional Neurosurgery 59, 105110.
20. Tolkidsen, A. (1939) A new palliative operation in cases of inoperable occlusion of the Sylvian aqueduct. Acta Chirurgica Scandinavica 82, 117130.
21. DeFeo, D.R., Foltz, E.L., Hamilton, E. (1975) Double compartment hydrocephalus in a patient with
cysticercotic meningitis. Surgical Neurology 4, 247251.
22. Colli, B.O., Pereira, C.U., Assirati, J.A., et al. (1993) Isolated fourth ventricle in neurocysticercosis:
pathophysiology, diagnosis and treatment. Surgical Neurology 39, 305310.
23. Apuzzo, M.L.J., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraventricular cysticercosis: an analysis of 45 cases. Journal of Neurosurgery 60, 400407.
24. Madrazo, I., Gracia, J.A., Sondoval, M., et al. (1983) Intraventricular cysticercosis. Neurosurgery 12,
148152.
25. Madrazo, I., Sanchez Cebreza, J.M., Maidonado Leon, J.A. (1979) Pipette suction for atraumatic
extraction of intraventricular neurocysticercus cysts. Technical note. Journal of Neurosurgery 50,
531532.
26. Culdip, S.A., Wilkins, P.R., Marsh, H.T. (1998) Endoscopic removal of a third ventricular cyst. British
27. Bergsneider, M., Hooloy, L.T., Lee, J.H., et al. (2000) Endoscopic management of cysticercal cysts
within the lateral and third ventricles. Journal of Neurosurgery 92, 1423.
28. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle. Technical
note. Journal of Neurosurgery 91, 340345.
29. Couldwell, W.T., Zee, C.S., Apuzzo, M. (1991) Definition of the role of contemporary surgical management in cisternal and parenchymatous cysticercosis cerebri. Neurosurgery 28, 231237.
30. Stern, W.E., (1981) Neurosurgical considerations in cysticercosis of the central nervous system.
31. Araujo, L.P., Martelli, N., Marquez, J.O. (1982) Forma gigante da neurocisticercose. Relato de caso.
Arquivos de Brasilla Neurocirurgica 3, 119123.
32. Colli, B.O., Matelli, N., Assirati, J.A., et al. (1986) Results of surgical treatment of neurocysticercosis
in 69 cases. Journal of Neurosurgery 65, 309315.
33. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single small enhancing CT lesions in Indian
understanding a controversy. Acta Neurologica Scandinavica 84, 465470.
35. Ramina, R., Hynhevicz, S.C. (1986) Cerebral cysticercosis presenting as mass lesion. Surgical
Neurology 25, 8993.
36. Suastegui Roman, R.A., Soto-Hernndez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study.
40
Endoscopic Management of
Intraventricular Cysticercosis
Marvin Bergsneider and Jaime H. Nieto
Introduction
Rationale for an endoscopic approach
Intraventricular cysticercosis can be a challenging clinical disorder owing to its unpredictable nature and potentially devastating
consequences. These lesions typically come
to clinical attention as a result of hydrocephalus and therefore require therapeutic
intervention. In general, three treatment
options are available: anticysticercal agents,
cerebrospinal fluid (CSF) diversion, and/or
surgical extirpation of the cyst. The removal
of cysts can either be accomplished via an
open craniotomy or endoscopically. To date,
there is no consensus as to which treatment
is superior because all of the reported experience in the literature is anecdotal. In our
opinion, the ideal management for intraventricular cysticercosis should reverse
hydrocephalus (if present), immediately
eliminate the risk of acute obstructive
hydrocephalus, reduce the risk of delayed
postinflammatory ependymitis and arachnoiditis, and have a low treatment-related
morbidity. Here, we will argue that the
endoscopic removal of intraventricular
cysts best satisfies these treatment requirements and therefore is the preferred treatment for most patients.
Clinical presentations of intraventricular cysticercosis are reviewed in Chapter 20. Briefly,

clinical symptomatology is related to three
phenomena1. First, free-floating cysts within
the lateral or third ventricles can suddenly
obstruct the aqueduct of Sylvius or less commonly one foramen of Monro. This ballvalve phenomenon can be responsible for
drop attacks, transtentorial herniation, and
even sudden death2. Second, fourth ventricular cysts tend to enlarge progressively giving
rise to considerable mass effect. Finally, once
intraventricular cysts begin to degenerate, a
delayed communicating hydrocephalus can
develop as a result of a chronic ependymitis
and arachnoiditis37. This immunological
reaction does not occur in all patients, but if
severe and advanced, carries a grave prognosis regardless of treatment8,9. Given these
considerations, the ideal management of
intraventricular cysticercosis should be
removal of the cyst from the ventricle,
thereby eliminating the risk of acute obstructive hydrocephalus and the formation of
delayed postinflammatory communicating
hydrocephalus. In this regard, only the
surgical extirpation of intraventricular cysts

399
400
M. Bergsneider and J.H. Nieto
meets these goals. The other two options,

anticysticercal drugs and CSF shunt diversion, each have significant drawbacks that
have been considered in detail Chapters 20
and 39.
The definitive removal of the cysticercal
cyst from the ventricle requires a surgical procedure. Primary removal of intraventricular
cysticercal cysts has been advocated by many
authors2,3,6,8,1018. Classically, these lesions have
been approached as if they were neoplasms
that required a wide surgical exposure for
direct visualization and removed2,8,10,15,16,19,20.
For cysts located in the lateral or third ventricles, the interhemispherictranscallosal or
transcortical approaches via a craniotomy
have been the standard procedures21. The
potential morbidity associated with these
procedures, especially the third-ventricle
approach, is dependent upon surgical experience and can be devastating2224. For cysts
within the lateral and third ventricles, a surgical approach using a flexible neuroendoscope
through a burr holetranscortical approach is
significantly easier, safer, and comparably
effective compared with the classic open craniotomy approach. In addition, an endoscopic
approach has several important advantages
over craniotomy. One disadvantage of the
open craniotomy approach is that intraventricular cysts can migrate within the ventricular system25,26. This is especially true of lateral
ventricle cysts that frequently settle in the
occipital horn if the patient is in the supine
position. In cases of cysts located in both lateral ventricles, open craniotomy approaches
become increasingly destructive in order to
gain access to both occipital horns. An easily
performed septum pellucidotomy with an
endoscope allows near complete access to the
entirety of both lateral ventricles and the third
ventricle. Compared with an open craniotomy approach, access to the third ventricle
with a flexible neuroendoscope is nearly
effortless. The posterior third ventricle can be
explored without manipulating the fornices
or structures within the velum interpositum.
Lastly, compartmentalized hydrocephalus can
be effectively and easily treated using the
endoscopic approach since it allows the surgeon to perform a third ventriculostomy
and/or a septum pellucidotomy27,28.
Historically, the surgical removal of

fourth ventricular cysts has generally been
considered to require a standard suboccipital
craniectomy for direct visualization of the
fourth ventricle10,20,2934. The endoscopic
approach to the fourth ventricle is technically more difficult compared with that of
the lateral and third ventricles especially
when arachnoid adhesions are present. In
appropriately selected patients, however, the
endoscopic approach to the fourth ventricle
(described below) is safe, effective and associated with decreased operative time, less
blood loss and less postoperative pain compared with the suboccipital craniotomy35.
Patient Selection and Preoperative

Management
At our institution, every patient with documented intraventricular cysticercal cysts is considered for endoscopic removal of the cysts. In
our experience, only a few of these cysts are
incidental findings testifying to the high proclivity of intraventricular cysts to cause clinical
problems. Whereas, magnetic resonance imaging (MRI) including contrast, proton density
and fluid attenuated inversion recovery
(FLAIR) imaging constitute the standard investigative approach to intraventricular cysticercosis, the most definitive neuroimaging study
is the ventricular contrast computed tomography (CT) scan (Fig. 40.1). This study, however,
requires access to the CSF system (most often
via a ventriculostomy catheter placed for acute
hydrocephalus) and a suitable anatomic situation. For example, a study showing only one
compartment of a multiloculated hydrocephalus may fail to show cysts in other compartments. When the diagnosis is suspected
and the MRI study is inconclusive or not
obtainable, we instill 5 ml of CSF-compatible
non-ionic contrast via a ventriculostomy and
obtain a CT scan approximately 2030 min
later. The results of this study can also be helpful in assessing the need for septum pellucidotomy or third ventriculostomy.
There are several relative contraindications to endoscopic resection of intraventricular cysts. First, the presence of ependymal
enhancement immediately adjacent to an
Endoscopic Management of Intraventricular Cysticercosis
401
Fig. 40.1. Coronal gadolinium-enhanced T1-weighted magnetic resonance imaging (left) demonstrating
mild hydrocephalus and ependymitis in the fourth ventricle (arrowhead). The study was suspicious but
not definitive for a fourth ventricular cyst. Axial computed tomography contrast ventriculogram (right)
showing a multilobulated filling defect confirming a fourth ventricle cysticercal cyst in this patient (see Fig.
40.4). The degree of hydrocephalus had increased between the two studies.
intraventricular cyst increases the chances

that the cyst may be adherent to the ventricular wall (Fig. 40.2). We have found that
many of these cysts, which are degenerating
and causing inflammation, can be safely
removed using a judicious endoscopic technique (see below). An endoscopic exploration is not attempted in cases when there is
extensive enhancement of the ependymal
surfaces (Fig. 40.2) and subarachnoid spaces.
In such cases, even open craniotomy
approaches may not be effective9,36. Careful
attention must be paid to the fourth ventricular outlet since an enhancement pattern in
this area may signify a technically difficult, if
not impossible, endoscopic approach to the
fourth ventricle. A second relative contraindication
to
the
neuroendoscopic
approach is the lack of hydrocephalus. With
slit ventricles, the endoscopic retrieval of the
cyst may be technically difficult and therefore riskier. In our limited experience we
have not come across such a situation since
all of our patients have had some degree of
ventricular enlargement. In rare cases, very
large cysts containing solid components that
are larger than the peel-away sheath may
require an open craniotomy and corticec-
tomy in order to have enough room to

remove the cyst and nodule.
Symptomatic patients who have acute
hydrocephalus should be treated emergently
with a ventriculostomy catheter. It is important not to overdrain and collapse the ventricles since this will make endoscopy much
more difficult or even impossible. All
patients are given dexamethasone 410 mg
intravenously just before surgery and every
6 h thereafter for 24 h. Standard perioperative antibiotics are given as well.
Endoscopic Technique
Lateral and third ventricle cysts
Instrumentation
Anecdotal reports of endoscopic approaches
to the lateral and third ventricles for cysticercosis have used a variety of techniques and
instruments2,3,25,30,33,37,38. To maximize surgical possibilities and effectiveness, we prefer
a flexible endoscope such as the Codman 4mm steerable flexible neuroendoscope
(Johnson & Johnson Professional, Inc.,
Raynham, MA, USA). A rigid-lens endo-
402
scope can be used in selected cases but does

not offer a significant advantage in our opinion. A separate cannula, such as a No. 14
French peel-away sheath, is required since
the flexible endoscope may need to be reinserted several times. A transendoscopic
grasping instrument of some type is
required39. This may be a toothed grasper or
a snare device (Figs 40.3 and 40.4). We use
gravity-fed Plasma-Lyte (Baxter, Deerfield,
IL, USA) or lactated-Ringers solution for
irrigation which matches with the pH of CSF.
The irrigation tubing is connected to the
endoscope using an irrigation adapter
(Codman Neuroglide, Johnson & Johnson
Professional, Inc., Raynham, MA, USA). The
endoscope is secured by a moveable holding
system such as a Bookwalter set-up26,27.
Fig. 40.2. Axial gadolinium-enhanced T1-weighted

MRI demonstrating severe ependymitis. With this
degree of ependymitis, the retrieval of
intraventricular cysts, if present, may not be
possible with any surgical approach.
Operating room set-up and patient

positioning
We prefer to position the patient so that there
will be a minimum amount of subdural and
intraventricular air after surgery. The patient
Fig. 40.3. Video image-captures demonstrating the removal of a third ventricle cyst via a right precoronal
burr hole. (a) The free-floating cyst is identified in the posterior aspect of the third ventricle. (b) A
transendoscopic snare grasping instrument is used to capture the cyst. (c) The cyst is secured with the
instrument and maintained just distal to the tip of the endoscope. (d) Delivering the cyst through the
foramen of Monro into the right lateral ventricle.
403
Fig. 40.4. Video image-captures of an endoscopic removal of fourth ventricular cysts. (a) Extradural view
as the endoscope approaches the small dural opening. The dura is retracted with a suture on either side
of the opening. No bone has been removed as noted by the intact opisthion. (b) The endoscope has
entered the cisterna magna and is navigated cephalad. The cysticercal cysts are seen protruding from
the foramen of Magendie. An incidental choroid plexus cyst is present (possibly a migrating
transchoroidal cysticercal cyst). (c) The transendoscopic grasping is oriented so that the jaws open
horizontally, thereby decreasing the risk of injuring the brainstem. (d) The cysts are retrieved keeping the
tip of the grasping instrument just beyond the endoscope. (e) The cyst and the endoscope are withdrawn
simultaneously. (f, g) Inspection of the fourth ventricle reveals another large cyst that is retrieved in a
similar manner. (h) Note the ependymitis of the floor of the fourth ventricle. (i) Final inspection of the
ventricle showing the aqueduct of Sylvius. The subependymal haemorrhage present likely occurred when
the cyst passed from the third to the fourth ventricle before the surgical procedure.
is positioned in a semi-recumbent position

with the head on a horseshoe head-holder to
assure that the precoronal suture is the highest point (Fig. 40.5). Since the head is usually
quite elevated, it is necessary to build a platform with metal standing steps at the head of
the bed where the surgeon will stand. The
assistant surgeon stands directly above the
patients head. The primary surgeon stands
on the operating side of the head. The television monitor and endoscopy trolley are
placed in front of the surgeon on the opposite
side of the bed where the anaesthetist is. The
irrigation bag is positioned about 60 cm

above the patients head level. Usually, the
preparation and draping of the patient for a
ventriculoperitoneal shunt are planned in the
event that it is determined intraoperatively
that the endoscopic procedure will not alleviate the hydrocephalus. A frontal, precoronal
semicircular skin incision is marked out with
the idea that it could be used for a shunt if
needed. Approaches to the right lateral and
third ventricles are usually done from the
right side. A solitary left-lateral ventricle cyst
is approached via a left frontal burr hole.
404
Fig. 40.5. Intraoperative set-up for an endoscopic approach to the lateral and/or third ventricle. The
patient is positioned semi-recumbent with the head further flexed and resting on a horseshoe apparatus.
This enables the burr hole to be the most superior point of the head and therefore minimizes the amount
of postoperative intracranial air. The primary surgeon stands to the right looking directly at the video
monitor. The body of the flexible endoscope is suspended via a fixed Bookwalter mount.
Surgical technique
A No. 14 French, blunt-tipped, peel-away
catheter is inserted into the lateral ventricle
aiming towards the ipsilateral foramen of
Monro. The surgeon has to be careful to
avoid plunging or pulling the peel-away
sheath out of the ventricle when manipulating the peel-away mechanism. Once the lateral ventricle is entered, the flexible
endoscope is navigated to locate the cyst. An
assessment is made to establish the safety of
the cyst removal. At times the entire ependymal surface appears to be carpeted with a
fine fibrinous material indicative of ongoing
ependymitis not visible upon neuroimaging
studies. If the cyst is not freely floating in the
ventricle, continuous irrigation and the
mechanical presence of the endoscope is
used in an attempt to separate the cyst from
the ependymal wall and choroid plexus.
Non-extractable cysts will appear highly
opaque and there will be no identifiable
interface between the cyst and ependymal
wall. In such cases, no attempt should be
made to remove the cyst and the patient

should be shunted and treated with corticosteroids if necessary.
To remove a cyst, the transendoscopic
grasping instrument is advanced down the
working channel of the endoscope (Fig.
40.3). After grasping the cyst wall, the grasping instrument is retracted to the point at
which the cyst is approximately 5 mm from
the distal tip of the endoscope. No attempt is
made to withdraw the cyst through the
working channel of the endoscope because
this channel is too small to accommodate the
entire cyst. The endoscope is slowly withdrawn just to the point distal to the peelaway catheter. The anaesthetist is asked to
perform a gentle and sustained Valsalva
manoeuvre (to approximately 30 mmHg airway pressure) while the endoscope is slowly
pulled back through the peel-away sheath
with the cyst in tow. If a ventriculostomy
catheter is present, the ventricular system
can be gently pressurized by a hand-held
syringe in lieu of a Valsalva manoeuvre as
the cyst is being removed through the peel-
away cannula. The cyst is retained just

beyond the distal end of the endoscope and
delivered to the specimen cup. If the cyst
wall tears, the fragmented piece is delivered
and the capture and withdrawal technique
repeated until the entire cyst is removed. The
endoscope is navigated back into the ventricle and additional cysts, if present, removed
using the aforementioned technique. Once
all cysts are removed, irrigation is continued
until cloudiness and particulate material
within the ventricular fluid has cleared. For
the wound closure, we prefer to leave a piece
of Gelfoam in the burr hole to prevent rundown bleeding into the ventricle and use a
titanium (or equivalent) burr hole cover. The
scalp is closed in a routine watertight fashion. For patients who have a ventriculostomy catheter placed preoperatively, this
catheter is left in place for 24 h to monitor
intracranial pressure (ICP) and discontinued
if ICP is normal.
Septum pellucidotomy
A septum pellucidotomy is performed if there
is need to inspect and remove other cysts in
the contralateral ventricle or if the ependymal
irritation is marked and there is potential for
unilateral hydrocephalus. The perforation is
made using a monopolar cautery wire
(Codman ME2, Johnson & Johnson
Professional, Inc., Raynham, MA, USA) or by
using the neodymium:yttrium aluminiumgarnet (Nd:YAG) laser. The fenestration can
be mechanically enlarged by the endoscope.
Third ventriculostomy
A third ventriculostomy can be performed
when hydrocephalus is associated with
aqueductal stenosis and the obstruction cannot be alleviated by removal of the cyst. We
identify the standard anatomic landmarks
and then puncture the tuber cinereum, just
posterior to the vascular discoloration
imparted by the infundibular recess, using
the straight end of a vascular guide wire
(diameter: 0.81 mm/0.032 inch). A No. 3
French Fogarty or Cook elliptical balloon
catheter is used to expand the perforation
and the flexible endoscope is navigated into
405
the interpeduncular cistern to confirm the

fenestration of the membrane of Liliequist.
Fourth ventricular approach

Instrumentation
The below-described approach requires a
flexible neuroendoscope such as a Codman
4-mm flexible neuroendoscope (Johnson &
Johnson Professional, Inc., Raynham, MA,
USA). A rigid or semi-flexible endoscope
cannot be used owing to the risk of injuring
the brainstem. A separate cannula (such as a
peel-away sheath) is not used, nor required.
A transendoscopic grasping instrument is
needed. We use gravity-fed Plasma-Lyte or
lactated-Ringers solution for irrigation. The
irrigation tubing is connected to the endoscope using an irrigation adapter (Codman
Neuroglide, Johnson & Johnson Professional,
Inc., Raynham, MA, USA). The endoscope is
secured by a moveable holding system such
as a Bookwalter set-up28,35.
Operating room set-up and patient
positioning
The patient is placed prone in the so-called
Concorde position with the head secured in a
three-point rigid skull fixation device (Fig.
40.6). The neck is flexed to the same degree
that is used for a standard suboccipital craniectomy. The ventriculostomy catheter, if present
before surgery, is kept open to drainage during
induction of anaesthesia, but afterwards is
closed and used for monitoring of ICP only.
The endoscope is set up and secured to
the accompanying endoscope holder and
secured to a Bookwalter mount. The primary
endoscopist stands at the patients left side
and the assistant stands at the right side. The
television monitor is situated at the patients
right side, next to the anaesthetist. A gravityfed irrigation solution similar in pH and
osmolarity to CSF, such Plasma-Lyte (Baxter,
Deerfield, IL, USA), is preferable to 0.9 M
saline because the low pH of the latter may
interfere with the respiratory drive centres
adjacent to the fourth ventricle while the
patient recovers from anaesthesia.
406
Fig. 40.6. Intraoperative set-up for an endoscopic approach to the fourth ventricle. The patient is
positioned prone with the head further flexed and immobilized with a Mayfield three-point holder
(Concorde position). The primary surgeon stands to the patients left looking directly at the video
monitor. The body of the flexible endoscope is suspended via a fixed Bookwalter mount.
Surgical technique
A vertical linear, 2.5-cm incision is marked
on the skin directly overlying the midline
aspect of the posterior arch of the first cervical vertebra (C1). If a ventriculostomy is not
already in place, the scalp is shaved in the
right occipital area so that an emergency
ventriculostomy can be placed if needed.
The muscle and the soft-tissue dissection are
limited to an exposure of the posterior arch
of C1 and less that 10 mm of the opisthion.
Either a Cloward cervical retractor (Cloward
Instrument Corp., Honolulu, HI, USA) or an
Adson cerebellar retractor works well in providing exposure for this small skin and muscle opening. If the craniocaudal exposure of
the dura between the opisthion and C1 is
less than 10 mm, a Kerrison rongeur is used
to remove the inferior 25 mm of the
opisthion. A vertical, midline incision is
made in the dura to within 1 mm of the bone
exposure, and the dural edges are tented
back with sutures. The arachnoid is opened
under direct visualization.
Under direct visualization, the tip of the
endoscope is positioned at the dural opening. While using continuous irrigation, the
endoscope tip is flexed upward as the sub-
arachnoid space is entered (Fig. 40.7).

Navigating the flexible endoscope toward
the fourth ventricle sometimes necessitates
that the endoscope lightly slides directly on
the upper cervical cord and brainstem. For a
right-handed endoscopist the amount of
force applied by the endoscope to the spinal
cord and to the brainstem is limited by the
left hand. Resting the hypothenar eminence
of this hand on the neck of the patient, combined with rigidly supporting the base of the
endoscope, provides excellent tactile feedback and prevents inadvertent plunging of
the endoscope. Using this method, the
orthogonal vector force applied to the spinal
cord and/or brainstem is negligible.
The endoscopic landmarks that must be
identified include the brainstem and cervical
spinal cord ventrally and the tonsils of the
cerebellum laterally (Fig. 40.4). The tonsillar
branches of each posterior inferior cerebellar
artery are landmarks identifying the midline
and tonsillar vallecula. The endoscope is
gently advanced toward the foramen of
Magendie by using minute back-and-forth
motions and continuous irrigation to dissect
the fine arachnoid bands that are normally
present. Often the cyst may be visibly protruding out of the foramen of Magendie.
Fig. 40.7. Artists illustration showing the surgical

corridor and endoscopic route for removal of a
fourth ventricle cysticercal cyst. A midline
durotomy is made between the opisthion and the
posterior arch of C1. A flexible endoscope
traverses the foramen of Magendie so that a
transendoscopic grasping instrument can be used
to retrieve the cyst.
The endoscope is advanced slowly by

using the same dissection technique until
the floor of the fourth ventricle is seen.
The degree of arachnoidal scarring may
vary from minor to near complete occlusion of the fourth ventricular outlet. If
a thickened arachnoid membrane is
encountered, it can be fenestrated using
the straight end of a vascular guide wire
(diameter: 0.81mm/0.032 inch) passed down
the working channel of the endoscope. A
No. 3 French embolectomy balloon catheter
can then be used to expand the small perforation made by the guide wire and,
thereby, gain access to the fourth ventricle.
407
Once in the fourth ventricle, the cysticercal

cyst is easily recognized. The endoscope is then
used to inspect the relation of the entire cyst
with the ependymal wall and the choroid
plexus. The continuous irrigation and the
mechanical presence of the endoscope help to
separate the cyst wall from the ependymal
wall and the choroid plexus. Once it is confirmed that the cyst is not inseparably adherent
to an ependymal surface, the transendoscopicgrasping instrument is advanced down the
working channel of the endoscope. After
grasping the cyst wall, the grasping instrument
is pulled back until the cyst is approximately
5 mm from the distal tip of the endoscope. It is
important to retain visualization of the surrounding fourth ventricular surfaces. No
attempt is made to withdraw the cyst through
the working channel of the endoscope. The
anaesthetist is asked to perform a gentle and
sustained Valsalva manoeuvre (to approximately 30 mmHg airway pressure) while the
endoscope is carefully backed out and withdrawn from the dural opening. The cyst is
maintained just beyond the distal end of the
endoscope and placed into a specimen cup. If
the cyst wall tears, some spillage of the contents of the cyst into the fourth ventricle or the
subarachnoid space may occur. In such cases,
the grasper is reapplied and the withdrawal
technique repeated until the entire cyst is
removed. The endoscope is navigated back
into the fourth ventricle, and additional cysts,
if present, are removed using the aforementioned technique. Once all cysts are removed,
the fourth ventricle is inspected a final time
(Fig. 40.4), and irrigation is continued until any
cloudiness of the ventricular fluid has cleared.
The dural opening is closed using interrupted No. 4-0 nylon sutures in a watertight
fashion. The wound is closed in layers using
absorbable synthetic suture in a routine manner. A course of prophylactic antibiotics and
low dose dexamethasone (4 mg every 6 h) is
continued for 24 h.
Results
Success in removal of cysts
In our experience of 17 patients, we have had
a 94% success rate in removing cysticercal
408
cysts endoscopically. In one case, a cyst in

lateral ventricle could not be removed owing
to ependymal adhesions. One fourth ventricular approach had to be aborted due to
excessive arachnoidal scarring at the foramen of Magendie that did not allow entry
into the fourth ventricle with the endoscope.
In this case, conversion to a standard microscopic
suboccipital
craniectomy
was
required. Despite this exposure, the fourth
ventricle cysts found were too adherent to be
removed. One exploration of the third ventricle was negative. In retrospect, the MRI
proton density abnormality was reinterpreted as a flow artefact.
Success in avoiding a CSF shunt

In one study by the senior author, seven out
of ten (70%) patients that underwent endoscopic resection of lateral and third ventricular cysts did not require a CSF shunt after
surgery26. In this study, 30% of the patients
underwent a third ventriculostomy in addition to cyst removal to treat an acquired
aqueductal stenosis. Four patients had a
septum pellucidotomy to evaluate the
opposite lateral ventricle for the presence of
cysts. In one of these four patients, the septum pellucidotomy was performed to alleviate unilateral hydrocephalus.
For patients who had fourth ventricular
cysts removed, avoidance of a CSF shunt
depended upon the degree of arachnoiditis
in the basal cisterns. To date, four out of
seven patients with fourth ventricular cysts
have required CSF shunt. One of the four
patients had a shunt placed at a different
hospital before the endoscopic procedure.
The other three needed a CSF shunt after the
endoscopic removal of the cyst failed to alleviate the hydrocephalus.
Complications
Neuroendoscopy is a very safe procedure provided that appropriate techniques and equipment are used. In our experience of 17 patients,
two have suffered an increased neurological
deficit after surgery. The first patient had mild,
temporary left pronator drift following a biportal endoscopic approach to a cysticercal cyst in
the roof of the third ventricle. The aetiology of
the hemiparesis was not apparent upon neuroimaging studies. A second patient had a
waxing and waning mental status after multiple surgeries to remove a total of 156 cysts
from all of the ventricles26. He had had multiple bouts of hydrocephalus from shunt failures, each one prompting an endoscopic
exploration. One patient had a deep venous
thrombosis 2 weeks after the endoscopic procedure26. Pneumocephalus has been an infrequent occurrence following the endoscopic
approach to the fourth ventricle. In our experience, even though rupture of the cyst is not
uncommon, we have not experienced a complication secondary to rupture of cysts during
removal. The use of copious amounts of irrigation and intravenous corticosteroids appears to
obviate this complication.
Conclusions
The neuroendoscopic management of intraventricular cysticercosis should be considered
as the primary treatment whenever possible
since it is safe, effective and provides a definitive treatment for this disorder. In addition
to avoiding a CSF shunt in many cases,
removal of the cyst(s) offers a reduced risk of
inflammatory sequelae. Neurosurgeons with
familiarity and experience with flexible
neuroendoscopes should find these cases
straightforward and highly gratifying.
References
1. Zee, C.S., Segall, H.D., Apuzzo, M.L., et al. (1984) Intraventricular cysticercal cysts: further neuroradiologic observations and neurosurgical implications. American Journal of Neuroradiology 5, 727730.
2. Apuzzo, M.L., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraventricular cysticercosis. An analysis of 45 cases. Journal of Neurosurgery 60, 400407.
3. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticercosis: a reappraisal.
409
4. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Reviews of Infectious Diseases 10,
10751087.
5. Colli, B.O., Martelli, N., Assirati Junior, J.A., et al. (1994) Cysticercosis of the central nervous system.
I. Surgical treatment of cerebral cysticercosis: a 23 years experience in the Hospital das Clinicas of
Ribeirao Preto Medical School. Arquivos de Neuropsiquiatria 52, 166186.
7. Pittella, K.E. (1977) Neurocysticercosis. Brain Pathology 7, 681693.
8. Estanol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis:
10. Colli, B.O., Martelli, N., Assirati, J.A., Jr, et al. (1986) Results of surgical treatment of neurocysticercosis in 69 cases. Journal of Neurosurgery 65, 309315.
12. Sandoval, M., Madrazo, I., Garcia-Renteria, J.A., et al. (1990) Obstruction on the ventricular catheter
of a CSF shunt system due to the own cyst of Taenia solium. Archivos de Investigation Medica 21, 9598.
13. Couldwell, W.T., Zee, C.S., Apuzzo, M.L. (1991) Definition of the role of contemporary surgical
management in cisternal and parenchymatous cysticercosis cerebri. Neurosurgery 28, 231237.
14. Duplessis, E., Dorwling-Carter, D., Vidaillet, M., et al. (1988) Intraventricular neurocysticercosis.
Apropos of 3 cases. Neurochirurgie 34, 275279.
15. Madrazo, I., Sanchez Cabrera, J.M., Leon, J.A. (1979) Pipette suction for atraumatic extraction of
intraventricular cysticercosis cysts. Technical note. Journal of Neurosurgery 50, 531532.
16. Madrazo, I., Garcia-Renteria, J.A., Sandoval, M., et al. (1983) Intraventricular cysticercosis.
17. Loyo, M., Klergia, E., Estanol, B. (1980) Fourth ventricular cysticercosis. Neurosurgery 7, 456458.
18. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological
Sciences 130, 2534.
19. King, J.S., Hosobuchi, Y. (1977) Cysticercus cyst of the lateral ventricle. Surgical Neurology 7, 125129.
20. Stern, W.E. (1981) Neurosurgical considerations of cysticercosis of the central nervous system.
21. Apuzzo, M.L., Chikovani, O.K., Gott, P.S., et al. (1982) Transcallosal, interfornicial approaches for lesions
affecting the third ventricle: surgical considerations and consequences. Neurosurgery 10, 547554.
22. Apuzzo, M.L.J. (1987) Surgery of the Third Ventricle. Williams & Wilkins, Baltimore, Maryland, pp.
369389.
23. Jeeves, M.A., Simpson, D.A., Geffen, G. (1979) Functional consequences of the transcallosal removal
of intraventricular tumours. Journal of Neurology, Neurosurgery and Psychiatry 42, 134142.
24. Apuzzo, M.L.J. (1993) Brain Surgery: Complication Avoidance and Management. Churchill Livingstone,
25. Neal, J.H. (1995) An endoscopic approach to cysticercosis cysts of the posterior third ventricle.
26. Bergsneider, M., Holly, L.T., Lee, J.H., et al. (2000) Endoscopic management of cysticercal cysts
within the lateral and third ventricles. Journal of Neurosurgery 92, 1423.
27. Bergsneider, M., Holly, L.T., Lee, J.H., et al. (1999) Endoscopic management of cysticercal cysts
within the lateral and third ventricles. Neurosurgery Focus 6: Article 7.
28. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle. Technical
note. Journal of Neurosurgery 91, 340345.
29. Colli, B.O., Pereira, C.U., Assirati, J.A., Jr, et al. (1993) Isolated fourth ventricle in neurocysticercosis:
pathophysiology, diagnosis and treatment. Surgical Neurology 39, 305310.
30. Couldwell, W.T., Apuzzo, M.L.J. (1989) Management of cysticercosis cerebri. Contemporary
31. De, Morais-Rego, S.F., Latuf, N.L. (1978) Cysticercosis of the fourth ventricle simulating a posterior
fossa neoplasm in cerebral scintillography. Report of a case. Aquivos de Neuropsiquiatria 36, 371374.
32. Koziarski, A., Kroh, H., Olszeqski, E. (1992) A case of cysticercosis of the IV cerebral ventricle.
Neurologia i Neurochirurgia Polska 26, 115120.
410
33. Loyo-Varela, M., del Valle-Robles, R., Guinto-Balanzar, G., et al. (1996) Infestations and the fourth
ventricle: Cysticercosis. In: Cohen, A.R. (ed) Surgical Disorders of the Fourth Ventricle. Blackwell
Science, Cambridge, Massachusetts, pp. 397411.
34. Madrazo, I., Flisser, A. (1993) Cysticercosis. In: Apuzzo, M.L.J. (ed.) Brain Surgery: Complication
Avoidance and Management, Vol. 2. Churchill Livingstone, New York, pp. 14191430.
35. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle: technique
and results. Neurosurgery Focus 6: Article 8.
36. Estanol, B., Corona, T., Abad, P. (1986) A prognostic classification of cerebral cysticercosis: therapeutic implications. Journal of Neurology, Neurosurgery and Psychiatry 49, 11311134.
37. Couldwell, W.T., Chandrasoma, P., Apuzzo, M.L., et al. (1995) Third ventricular cysticercal cyst
mimicking a colloid cyst: case report. Neurosurgery 37, 12001203.
38. Loyo-Verela, M. (1997) Surgical treatment of cerebral cysticercosis. European Neurology 37, 129130.
39. Bergsneider, M. (1997) Transendoscopic instrumentation and techniques. In: King, W.A., Frazee,
J.G., De Salles, A.A.F. (eds) Endoscopy of the Central and Peripheral Nervous System. Thieme, New York,
pp. 1622.
41
Control of Taenia solium with

Emphasis on Treatment of Taeniasis
James C. Allan, Philip S. Craig and Zbiginew S. Pawlowski
Introduction
Taenia solium is susceptible to control at several points in its life cycle (reviewed in
Chapter 1)1. Although other hosts can be
infected with one stage or the other, either
experimentally or naturally, man is the sole
natural definitive host and domesticated
swine represent the main intermediate host
for this cestode. In comparison with many
other parasitic zoonoses, this theoretically
leaves the parasite particularly amenable to
control1. Indeed, having formerly been much
more widespread, the parasite has disappeared from much of Europe2. This elimination has been achieved horizontally over
several decades through a number of means
that included general improvements in sanitation and hygiene, as well as changes in pig
husbandry practices and elimination of
infected swine carcasses from the human
food chain by rigorous meat inspection.
However, the parasite remains endemic
throughout much of the developing world
where sanitary conditions are poor and the
economy weak. As described elsewhere in
this book this imposes a huge health and
socio-economic burden on the developing
countries. Methods that have been implicated in the reduction or elimination of this
parasite from the majority of countries in
Western Europe and in the United States,
such as meat inspection, have in contrast

been demonstrated to be failing in much of
the current endemic area3. Moreover, movement of T. solium tapeworm carriers or
infected swine have been shown to have
spread the disease from endemic to nonendemic areas causing either periodic localized
outbreaks
of
cysticercosis
or
establishment of the parasite in new areas
such as Irian Jaya, Indonesia46.
A number of developments mean that
new or improved tools can be used in the
control of this parasite to supplement more
traditional approaches. These include wider
public access to news media for the transmission of public health messages; developments
in vaccine technology that could result in a
safe and effective porcine vaccine and the
availability of a number of drugs that are
highly efficacious against either the cystic
stage in pigs or the adult tapeworm in
man711. These approaches are reviewed more
extensively elsewhere in this book (Chapters
4244) and a synopsis is provided in Table
41.1. In this chapter we will focus on the possibility of controlling T. solium through mass
or focus-oriented treatment of the intestinal
tapeworm in humans. This approach should
be viewed in the context of one of several
potential options that can be used in concert
to control parasite transmission; its role may
vary according to the local situation.

411
Disadvantages
Pigs in many endemic countries do not go to formal
slaughter
Infected pigs can be diagnosed ante mortem (tongue
inspection) and slaughtered outside regulated system to
avoid condemnation of carcasses
Economically difficult in many existing endemic areas
Improved knowledge does not always result in change

of practices
Inefficient as sole strategy
Would require repeated interventions for long-term
control
Requires specific infrastructure; not self-sustainable
Praziquantel should be used with caution in cases of
cysticercosis
Many existing producers in endemic areas do not
currently vaccinate against other diseases with high
economic impact on swine production
Vaccines not available now (other than at experimental
level)
Producers often do not treat for other economically
important parasites despite economic benefits
Existing systems of avoiding meat inspection reduce
economic advantages
Advantages
Known contribution to elimination of parasite from

several developed countries
Relatively easy to integrate with meat inspection for
several other important diseases
Known contribution to elimination of parasite from

several developed countries
Provides benefits beyond control of T. solium
Provides benefits beyond control of T. solium

New media now widely available
Highly efficacious drugs available now (some generically

produced niclosamide may have low efficacy)
Demonstrated short-term benefits
Removes known significant transmission risk
Long-term protection
Possible to integrate with existing veterinary and/or
pig husbandry practices
Provides economic benefit to end user (avoidance of
carcass condemnation)
Compliance monitoring possible (serological testing)
Drugs available now

Highly effective
Producers have economic motivation (avoidance of
carcass condemnation)
Other production benefits: can affect other economically
important parasites of swine
Intervention strategy
Elimination of infected pig

carcasses (meat inspection)
Improved sanitation, hygiene and

pig husbandry
Health education
Treatment of intestinal taeniasis
Vaccination of swine
Chemotherapy of infected swine
Table 41.1. Synopsis of intervention strategies available for Taenia solium taeniasiscysticercosis.
412
J.C. Allan et al.
Control of T. solium via Treatment of Taeniasis
Epidemiological Characteristics of
T. solium Infection
Since humans constitute the sole natural
definitive host of the parasite, reduction of
the numbers of intestinal infections to a
level at which the parasite population is no
longer self-sustaining (i.e. the basic reproductive rate falls below one) will lead over
time to extinction of the parasite within its
host population. Reduction of this parasite
population in humans through chemotherapy is a realistic option, especially as effective, safe and inexpensive taeniacidal drugs
are readily available.
Identification of hot spots of human or
porcine cysticercosis and of intestinal T.
solium taeniasis can point to areas or populations of high disease risk12. The treatment of
T. solium taeniasis cases detected in relation
to these foci provides an opportunity to
interrupt localized transmission of the parasite where most of the cases exist13. The kind
of data necessary to identify T. solium foci
can be obtained either through passive or
active surveillance12. The approach taken
will vary depending on the existing epidemiological and epizootiological situation
and the medical or veterinary health infrastructure present.
Targeting treatment specifically at individual cases of taeniasis is, however, not easy. T.
solium infected individuals are not easy to
diagnose, symptomatology is non-specific,
and a large number of infected individuals
may be unaware of their infection14. As discussed elsewhere in this book (Chapter 33),
traditional parasitological methods for diagnosis lack sensitivity. More modern immunological or molecular approaches, while
overcoming some of the drawbacks of traditional methods, have not been applied on a
large scale and are expensive1416. The epidemiological characteristics of taeniasiscysticercosis also present some issues with
respect to the targeting of treatment.
Identification
of
foci
of
taeniasis
cysticercosis may be easier than finding individual cases. Risk of infection with human
cysticercosis has been shown both in endemic
and in non-endemic areas, to be closely associated with the presence of T. solium tape-
413
worm carriers within the household or

immediate environment1722. The epidemiology of porcine infection is complicated, being
strongly affected by husbandry practices,
specifically the degree of access to human
faeces, within endemic communities2325.
Intestinal T. solium prevalence is generally
low ( 5%), even in communities considered
highly endemic. Some, but not all, studies
have indicated that females carry a slightly
greater risk of infection than males2628 and
overall prevalence can vary greatly within
relatively small areas28. Surprisingly, little
information is available on the age prevalence of the intestinal stage, and although
some age groups may be at higher risk than
others, the effect is not particularly pronounced. For instance, Guatemalan and
Ecuadorian studies both indicate that children of 4 years of age or less have the lowest
rates of infection while adults have the highest rates27,28. There is an increased occupational risk amongst certain groups such as
pork vendors29. Although taeniasis infection
appears to cluster within families, the degree
of clustering is such that risk in family members of indicator cases may only be slightly
higher than that of the general population27,28. Furthermore, although both porcine
and human cysticercosis may cluster within
households or localities, the degree of clustering means that there remains a substantial number of intestinal infections outside
such clusters. Targeting of clusters alone
may therefore leave significant numbers of
cases untreated. From the viewpoint of population-level control, the epidemiology of
the intestinal stage indicates that, although
it may be possible to identify risk groups
within a population, it may be difficult to
identify all individuals within those populations that can be targeted for treatment. This
is distinct from some of the intestinal geohelminths such as Ascaris, where school-age
children are known to be at high risk of
infection and where targeted treatment, of
this relatively accessible population, has
been shown to significantly influence overall
transmission within the entire population30,31.
To detect sufficient taeniasis cases would
require the application of a large-scale, active
surveillance system and this would be rela-
414
J.C. Allan et al.
tively expensive if manageable at all. Work

of this nature has been undertaken in
China, where T. solium taeniasiscysticercosis is highly endemic throughout most of
the country12. Several interventions that
have included mass targeted treatment have
been undertaken there, but the results have
not been formally published outside the
local prefectural public health bureaus. For
example, a T. solium elimination programme was undertaken by the AntiEpidemic Station of Wujiang County,
Zhangye Prefecture in north-central Gansu
Province in 1978 when the baseline rate of
human taeniasis was 1512 per 100,000 for
the county. A total of 312 T. solium carriers
were identified after purgative treatment
using the traditional medicines of areca nut
and pumpkin seed extract. The porcine cysticercosis rate was 7.7%. Following biannual targeted treatment of carriers
(including use of praziquantel from 1983) in
conjunction with emphasis on confining or
restraining pigs by tying and health education propaganda in the media, the incidence
of human taeniasis was officially reported
to have reduced to 21 per 100,000, and the
porcine rate to 0.27%, by 1988 (X. Lie,
Y. Zhang, Zhanyi, Gansu, China, and P.S.
Craig, unpublished observations).
Since the above outlined approach
requires a great deal of effort in the identification of T. solium carriers, control through
mass untargeted treatment of entire highrisk populations has been promoted and
undertaken on an experimental basis.
These studies have used low-cost, yet
highly efficacious drugs, where the cost of
population-based treatment is lower than
the cost of diagnosis and treatment followup of carriers. It should be noted that this
approach might also be applicable outside
endemic areas in relation to the treatment
of high-risk groups such as immigrant populations moving from endemic areas to
non-endemic areas32.
From a public health standpoint, however, there is the opportunity to reduce transmission of T. solium at a local level through
trace-back of cases of taeniasis and neurocysticercosis (NC) diagnosed clinically to their
family and immediate contacts. The clus-
tered nature of these infections means that

there is an increased likelihood of detecting
another case of T. solium within the contact
group. Such cases, particularly tapeworm
carriers, are clearly important to treat from a
disease management and transmission
standpoint. A number of studies have
demonstrated that the presence of a case of
taeniasis within the household is a significant risk factor for cysticercosis17,1922.
Similarly cases of taeniasis are significantly
more likely to have cysticercosis; data even
suggest that they will tend to have higher
cyst loads22,33. There is, therefore, value in
determining whether a case of NC also has
taeniasis. Studies in populations with no
immediately apparent risk for T. solium have
also indicated that trace-back of contacts of
NC cases can result in detection of taeniasis
cases4,5. The long latency period from initial
infection with NC to the onset of symptoms
may reduce the chances of detecting the case
of taeniasis that caused the NC infection but,
given the clustered nature of NC, trace-back
may also allow diagnosis of other NC cases
that may benefit from case management34,35.
For these reasons, from the standpoints of
preventive medicine and that of improved
case management, there is value in following
up contacts of T. solium cases diagnosed in
the clinical setting.
Chemotherapeutic Agents
Two anthelminthics, praziquantel and
niclosamide, are currently both indicated
and widely available for treatment of human
intestinal taeniasis. Both are recommended
for treatment of intestinal T. solium infection
as a single oral dose with efficacy greater
than 90%9,36.
Praziquantel
Praziquantel is an acylated isoquinolinepyrazine discovered jointly by E. Merck and
Bayer AG in 19729. This molecule has a wide
spectrum, being active in man against both
trematodes and cestodes, including both larval
and adult T. solium. The approved therapeutic
dose for intestinal T. solium is 510 mg kg1

bodyweight. It should be noted that with the
available 150 mg tablets the given doses are
approximate mg kg1 values. The molecule
has a half-life of only a few hours in man and
thus does not have any prophylactic effect.
The molecule increases calcium permeability
in cestodes and flukes leading to muscle contraction, paralysis and death. The drug is very
bitter and can cause gagging if bitten or
chewed during administration. Praziquantel is
very well tolerated in humans and cheap (as
little as US$0.20 per treatment)9.
Niclosamide
Niclosamide is a halogenated salicylanilide
first patented by Bayer AG in 195936. This
drug has activity against a variety of intestinal cestodes of man including T. solium. The
molecule is not absorbed after oral administration. Its anthelminthic action is either
through inhibition of oxidative phosphorylation or by stimulating ATPase. The recommended dose is 2 g in adults, 1 g in children
of 1134 kg and 1.5 g in children over 34 kg.
The tablet should be chewed36. As with any
drug, the recommended storage conditions
and shelf-life should be carefully adhered to.
It is known that polymerization occurring
through long-term storage can lower drug
efficacy. This has been seen with some generically produced niclosamide.
Benzimidazoles
A number of other older drugs are known to
be efficacious against cestodes but, generally
because of poorer efficacy or adverse side
effects, they are not now widely used36.
Further to this, some of the benzimidazoles,
including albendazole, are known to be efficacious against cestodes but generally require
administration over 3 consecutive days and
appear to have lower efficacy against intestinal taeniids than either niclosamide or praziquantel37,38.
The
benzimidazoles
are,
however, also active against a broad spectrum of gastrointestinal helminths including
hookworm, Trichuris and Ascaris.
415
Suitability of anthelminthic agents for

mass chemotherapy
Of the two main drugs dealt with here, praziquantel may be cheaper than niclosamide (by
a factor of five times or more). The efficacy of
this molecule at its indicated dose also
appears to be somewhat higher than that of
niclosamide and it is becoming easier to
obtain. An early report indicated that praziquantel could be effective against Taenia sp.
taeniasis in doses of 2.5 mg kg1 for purposes
of control programmes where cost may be an
issue39. Indeed, earlier work on the therapeutic efficacy of the molecule suggested that this
dose was highly effective against the parasite9.
Recently it has, however, been recommended
that the drug be used at a higher recommended dose of 10 mg kg1 40. In addition
there is a possibility that praziquantel, even at
the low dose used to treat taeniasis, may occasionally cause complications, such as cerebral
inflammation in individuals with NC, through
its anticysticercal properties. Such a possibility,
which was not linked to praziquantel treatment with absolute certainty, has been
reported in a female, subsequently shown to
harbour numerous intracerebral cysticerci,
who developed severe headache within 24 h
of treatment with 5 mg kg1 praziquantel, a
condition that lasted for approximately 10
days41. Indeed the manufacturers label for
praziquantel frequently includes warnings
with respect to the drug use in individuals
with T. solium cysticercosis, especially ocular
cysticercosis. Niclosamide does not act against
the cystic stage and thus would not cause such
potential complications. Safety of niclosamide
has, however, not been tested during pregnancy and the drug is contraindicated with
alcohol. With both drugs, control intervention
programmes should consider the possibility of
adverse drug reactions occurring and have
mechanisms in place for monitoring for their
occurrence and dealing with any that occur.
Therefore, there are a number of factors
including cost, ease of administration, availability, efficacy, stability and possible contraindications that should be considered when
a decision is being made as to which molecule
is appropriate in the circumstances of particular mass treatment programmes.
416
J.C. Allan et al.
Experimental Control Interventions

A relatively small number of trials have been
carried out using mass chemotherapy as
a control intervention against T. solium.
The majority have involved the use of praziquantel although one has involved
niclosamide18,27,40,42,43. These trials have varied
in size, from a few hundred individuals up to
several thousand. Although most have indicated beneficial effects on levels of T. solium
infection following the intervention18,27,40,42
this has not always been the case43. Most of
these studies have involved follow-up assessments of within approximately 1 year after the
intervention, but one study involved assessment at 42 months after the intervention40.
A variety of measures have been used to
assess the outcome of these mass treatment
studies. These have included analysis of rates
of human taeniasis, serological rates of
human cysticercosis, incident cases of late
onset epilepsy and rates of porcine cysticercosis. It is generally agreed that rates of swine
cysticercosis are the most sensitive indicator
of environmental contamination with T.
solium and hence the presence of tapeworm
carriers in the locality27,44. The relatively
short lifespan of pigs in rural communities
also means that they act as good indicators of
recent levels of infection and are useful for
the follow-up of interventions27,44. This contrasts with the situation with human cysticercosis where, at any one time during
short-term follow-up of an intervention, most
cases in a community are probably existing
long-term cases, infected before the intervention. Although comparison of recent incident
cases of late-onset epilepsy has been shown
to be a useful variable in the analysis of the
effects of control interventions, the rates of
this are comparably low and the costs
involved in detecting cases are comparatively
high40. Detection of new cases of human taeniasis has, however, proved useful in assessing the effects of intervention19,27,29,40,42.
A difficulty that is faced in the assessment
of mass treatment interventions is that there
have often been substantial changes in other
factors that influence infection levels. Some
of these, such as health education, have actually been part of the study protocol28,42.
Others, such as changes in knowledge, attitudes and practices for T. solium

taeniasiscysticercosis may be indirect consequences of the work carried out during the
intervention. In both cases, these will alter
the risk of infection. This should be taken
into account when the results are interpreted. Other changes can occur that, while
not associated with the studies themselves,
can have significant implications for the
interpretation of their results. Indeed, in
Mexico, long-term (42 month) follow-up
evaluation of a chemotherapeutic intervention with praziquantel indicated that the percentage of individuals in the target
community with access to a latrine had
approximately doubled over the period and
the rate of outdoor defecation declined by
around 25%. Additionally the proportion of
pigs with access to human faeces declined
from 26% to 7%42. Access of pigs to human
faeces has been shown to be a substantial
risk factor for infection24,25. These changes
are likely therefore to have considerably
altered taeniasiscysticercosis transmission
patterns independent of the chemotherapeutic intervention. Clearly, collection of reliable
baseline data in relation to both parasitological and socio-economic factors is vital prior
to embarking on a control intervention.
Bearing the above outlined points in mind,
however, as stated previously, a beneficial outcome has been indicated in the majority of
mass chemotherapeutic control interventions
in Latin America. A large study in Ecuador,
involving treatment of over 10,000 people in
two provinces with praziquantel at approximately 5 mg kg1 led to a significant shortterm decline in the prevalence of intestinal
taeniasis and porcine cysticercosis (the latter
from 11.4% before the intervention to 2.6%
after 1 year)27. Another study in Mexico indicated a 100% reduction in the number of taeniasis cases 1 year after an intervention involving
treatment of 339 people with 10 mg kg1 praziquantel18. In this case, however, the initial
prevalence of taeniasis had been 1.32% and the
small sample size meant that the reduction in
taeniasis rate following chemotherapy was not
significant. In contrast, a different study
involving approximately 1500 people in
another area of Mexico actually detected an
approximate doubling in the rate of infection

in pigs, 1 year after chemotherapy (from 6.6%
to 11%)43. This study, which had also involved
health education, did, however, show good
levels of knowledge about the parasite among
school-age children 2 years after the intervention43. A longer term Mexican study, designed
to test the effects of mass treatment alone,
without health education or other strategies,
indicated significant improvements in several
indicators for infection over both short term (6
months) and long-term (42 months) postintervention periods. The longer term results in that
study may, as discussed previously, have been
due to concomitant socio-economic changes in
the community. The study also indicated that
use of a 5 mg kg1 dose of praziquantel may
not be suitably efficacious in such interventions (having achieved only 67% efficacy) and
recommended a higher dose of 10 mg kg1 40.
Furthermore, this study also suggested that a
case of, previously undiagnosed, NC might
have had neurological symptoms induced by
the praziquantel treatment41.
Only one Taenia mass treatment study has
been carried out using niclosamide. This
study, carried out in two Guatemalan communities and involving treatment of over
1500 people, indicated that both tapeworm
prevalence (from 3.5% to 1%) and the rate of
cysticercosis seroprevalence in pigs (from 55%
to 7%) were substantially reduced 10 months
after intervention. The incidence of new cases
of taeniasis detected over the 10 months of the
study indicated that it would probably take
several years for the rate of taeniasis to return
to baseline. No specific health education was
given during the study period42.
In none of these mass treatment studies
was treatment coverage complete. Typically,
between 75% and 87% of the target populations were treated. The practicalities of treating 100% of a population are very difficult.
Besides a rate of treatment refusal within the
target communities, there are other problems,
for example, niclosamide is not indicated for
use during pregnancy. Furthermore, problems of contacting all individuals at the time
of an intervention will occur as studies have
indicated that there are significant levels of
travel out of endemic communities27,28.
417
Remaining Issues and Sustainability

Chemotherapy of T. solium taeniasis either
on a mass or a targeted basis is clearly an
option to be considered in short-term strategies designed at controlling this parasite.
The elimination of taeniasiscysticercosis is
a long-term process, which cannot be based
on chemotherapy alone. Mass chemotherapeutic treatment of tapeworm carriers, combined with health education, has been
successfully applied in the control of other
zoonotic cestodes, such as Echinococcus
granulosus (where dogs were treated)45.
Whether the approach is cost-effective with
regard to T. solium remains open to question. Only a small number of studies have
been carried out and, although most report
a reduction in transmission situation following the intervention, they still leave a
number of questions to be answered. Unlike
the situation with canine taeniids (such as
E. granulosus), the behaviour and practices
of both the definitive host (man) and intermediate host (pig) of T. solium are highly
variable12. For instance, rates of open-air
defecation and pig husbandry practices
both vary within endemic areas at any one
time and often change over time.
Alterations in these have implications not
only for T. solium infection rates but also for
other infectious diseases. Thus strategies
involving improved health education,
hygiene and pig husbandry have public
health and socio-economic implications
beyond T. solium.
The tools for monitoring the success of
intervention are now increasingly becoming
available. For instance, a variety of diagnostic tools for baseline and surveillance use in
both humans and pigs have become available over recent years14,46,47. These make
determining the rates of infection in a population easier than before. Epidemiological
studies have improved our knowledge of T.
solium and its transmission within endemic
communities. Taking all these factors into
account, therefore we are now in an
improved situation with respect to being
able to assess the need for and implications
of a control programme.
418
J.C. Allan et al.
Conclusions
The long-term sustainability of an intervention programme is important if it is to be
successful. The chemotherapeutic intervention studies described here have tended to
indicate short-term improvements in taeniasiscysticercosis indicators. Integration of
this approach with others, such as health
education, may make these interventions
more sustainable. Health education will
also help to make such interventions more
acceptable to target communities and lead
to changes in practices that could have significant impact on T. solium transmission.

There is the possibility of further integration with other prevention and control
strategies,
such
as
vaccination
or
chemotherapy of swine, which could potentially have direct economic benefits within
the target communities and thus may be
self-sustainable. No comprehensive studies
looking at the sustainability of various
intervention strategies or their costbenefit
ratio and cost-effectiveness have, however,
been reported.
References
1. Centers for Disease Control and Prevention. (1993) Recommendations of the International Task
Force for Disease Eradication. Morbidity Mortality Weekly Report 42, 127.
2. Schantz, P.M., Cruz, M., Sarti, E., et al. (1993) Potential eradicability of taeniasis and cysticercosis.
3. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the sierra of Peru.
4. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692695.
6. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures
7. Sarti, E., Flisser, A., Schantz, P.M. (1997) Development and evaluation of a health education intervention against Taenia solium in a rural community in Mexico. American Journal of Tropical Medicine
8. Lightowlers, M.W. (1999) Eradication of Taenia solium cysticercosis: a role for vaccination of pig.
9. Andrews, P., Thomas, H., Pohlke, R., et al. (1983) Praziquantel. Medical Research Reviews 3, 147200.
11. Kramer, L.D. (1990) Anthelminthic therapy for neurocysticercosis. Archives of Neurology 47, 10591160.
12. Craig, P.S., Rogan, M., Allan, J.C. (1996) Detection, screening and community epidemiology of
taeniid zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in
13. Pawlowski, Z.S. (1991) Control of Taenia solium taeniasis and cysticercosis by focus-oriented
chemotherapy of taeniasis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 284286.
14. Allan, J.C., Velasquez Tohom, M., Torres Alvarez, R., et al. (1996) Field trial of diagnosis of Taenia
solium taeniasis by coproantigen enzyme linked immunosorbent assay. American Journal of Tropical
15. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of a serologic assay to detect
Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199204.
16. Chapman, A., Vallejo, V., Mossie, K.G., et al. (1995) Isolation and characterization of species-specific
Clinical Microbiology 33,12831288.
17. Diaz Camacho, S., Candil Ruiz, A., Uribe Beltran, M., et al. (1990) Serology as an indicator of Taenia
solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of
419
18. Diaz Camacho, S.P., Candil Ruiz, A., Suate Peraza, V., et al. (1991) Epidemiologic study and control
of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical
19. Sarti-Gutierrez, E.J., Schantz, P.M., Lara-Aguilera, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. Tropical Medicine and Parasitology 39, 194198.
20. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical
21. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society
55, 282289.
23. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations on porcine cysticercosis in
a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195201.
24. Rodriguez-Canul, R., Allan, J.C., Dominguez, J.L., et al. (1998) Application of an immunoassay to
determine risk factors associated with porcine cysticercosis in a rural area of Yucatan, Mexico.
25. Widdowson, M.A., Cook, A.J., Williams, J.J., et al. (2000) Investigation of risk factors for porcine
Taenia solium cysticercosis: a multiple regression analysis of a cross-sectional study in the Yucatan
Peninsula, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 620624.
26. Richards, F.O., Jr, Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County.
28. Allan, J.C., Velasquez Tohom, M., Garcia Noval, J., et al. (1996) Epidemiology of intestinal taeniasis
in four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157165.
29. Garca, H.H., Araoz, R., Gilman, R.H., et al. (1998) Increased prevalence of cysticercosis and taeniasis
30. Bundy, D.A., Wong, M.S., Lewis, L.L., et al. (1990) Control of geohelminths by delivery of targeted
chemotherapy through schools. Transactions of the Royal Society of Tropical Medicine and Hygiene 84,
115120.
31. Chan, L., Kan, S.P., Bundy, D.A. (1992) The effect of repeated chemotherapy on age-related predisposition to Ascaris lumbricoides and Trichuris trichura. Parasitology 104, 371377.
32. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging and immunoblots: the emergence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A.,
Hughes, J.M. (eds) Emerging Infections, Vol. 2. ASM Press, Washington, DC, pp. 213242.
33. Gilman R.H., Del Brutto, O.H., Garca H.H., et al. (2000) Prevalence of taeniasis among patients with
neurocysticercosis is related to severity of infection. Neurology 55, 1062.
34. Gracia, F., Chavarria, R., Archbold C., et al. (1990) Neurocysticercosis in Panama: preliminary epidemiologic study in the Azuero region. American Journal of Tropical Medicine and Hygiene 42, 6769.
131135.
36. Campbell, W.C. (1986) The chemotherapy of parasitic infections. Journal of Parasitology 72, 4561.
37. de Kaminsky, R.G. (1991) Albendazole treatment in human taeniasis. Transactions of the Royal Society
38. Chung, W.C., Fan, P.C., Lin, C.Y., et al. (1991) Poor efficacy of albendazole for the treatment of
human taeniasis. International Journal of Parasitology 21, 269270.
39. Pawlowski, Z.S. (1990) Efficacy of low doses of praziquantel in taeniasis. Acta Tropica 48, 8388.
41. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticercosis after single taeniacidal dose of praziquantel. Lancet 342, 748.
420
J.C. Allan et al.
42. Allan, J.C., Velasquez-Tohom, M., Fletes, C., et al. (1997) Mass chemotherapy for intestinal Taenia
solium taeniasis: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical
43. Keilbach, N.M., de Aluja, A.S., Sarti, E. (1989) A programme to control taeniasiscysticercosis (Taenia
solium): experiences in a Mexican village. Acta Leidensia 57, 181189.
45. Lawson, J.R., Roberts, M.G., Gemmell, M.A., et al. (1988) Population dynamics in echinococcosis and
cysticercosis: economic assessment of control strategies for Echinococcus granulosus, Taenia ovis and T.
hydatigena. Parasitology 97, 177191.
46. Tsang, V., Brand, A.J., Boyer, A.E. (1989) An enzyme imunoelectrotransfer blot assay and glycoprotein antigens for diagnosing human Taenia solium cysticercosis. Journal of Infectious Diseases 159,
5059.
42
Taenia solium Vaccination: Present

Status and Future Prospects
Carlton A.W. Evans
Introduction
Infection of pig tissues with Taenia solium larvae, and of the human bowel with adult
tapeworms, constitute the natural life cycle
that is essential for the continuing existence
of the parasite. This propagation depends
upon evasion or modulation of host immunity ensuring that the adult and larval parasites survive without being overwhelmingly
lethal to their hosts and without being
destroyed by host immunity. Therefore, the
evolution of the parasite would be expected
to select parasites that cause minimal interference to host survival and reproduction
while maintaining viable infection of human
intestines and pig tissues. Similarly, many
parasites have evolved mechanisms to protect their hosts from acquiring dangerously
heavy parasite loads. The complex immunology of this hostparasite relationship may be
modifiable with vaccination, potentially
facilitating control of the parasite.
Taeniasis: Immunology and

Prospects for Protective Vaccination
Because a small number of individuals
with tapeworms may infect vast numbers
of pigs with cysticercosis over many years,
tapeworm carriers are an appealing target

for the control of T. solium1. There is evidence in experimental animal models that
the immune response in the definitive host
can reject tapeworms or cause them to
destrobilate2. Furthermore, epidemiological
studies have confirmed that tapeworm
reinfection occurs, but human taeniasis
invariably involves only a single worm,
implying that the presence of one intestinal
pork tapeworm may induce immune
responses that allow continuing infection
while protecting against super-infection3.
However, in common with other human
cestodes, protective immunity against the
adult tapeworm has not been demonstrated
and adult tapeworm carriage does not
appear to protect against cysticercosis.
In addition to the immunological obstacles to developing a vaccine against taeniasis, the occult nature of this infection, which
makes tapeworm carriers difficult to detect,
and the minimal morbidity associated with
this intestinal infection, make taeniasis a
poor candidate for human vaccine development. Vaccination against taeniasis does
not, therefore, appear to be immunologically or logistically feasible at present. The
introduction of oral vaccines derived from
transgenic plants may, possibly, modify this
situation in the future.

421
422
C.A.W. Evans
Overview of the Immune Response

To T. solium Cysticercosis
Overview of Cysticercosis Prevention

and Control
Immunological tolerance to cysticerci
Cysticercosis is a disease of poverty and

social underdevelopment. Human cysticercosis may be controlled by provision of
sanitation and treatment of tapeworm carriers. The parasite life cycle may also be
broken by preventing human taeniasis by
enforcing meat inspection, and adequately
freezing or cooking pork. Porcine cysticercosis may be prevented by corralling pigs
or by large-scale commercial pig rearing
that denies pigs access to human faeces.
Such improvements in public health and
animal husbandry have led to the virtual
eradication of human and porcine cysticercosis in wealthy countries, but these measures are not currently practicable in many
developing regions. Indeed, their use in trials in several Latin American countries has
produced only transient reductions in cysticercosis prevalence. There is, therefore, a
great need for short-cuts to economic
development, i.e. inexpensive strategies
that will interrupt the life cycle of the parasite in the absence of socio-economic development. There is economic incentive for
people rearing pigs to utilize cysticercosis
control strategies because cysticercotic pigs
are of considerably reduced value. It is
hoped that an inexpensive vaccine that
effectively protects pigs against cysticercosis would be sought after and used by subsistence as well as commercial farmers in
endemic areas, because of resultant economic benefits. However, the failure of
implementation of the swine cholera vaccine programme in developing countries,
including Peru, suggests that considerable
publicity, government funding or compulsory vaccination would be required for
widespread vaccination by subsistence
farmers. An alternative to conventional protective vaccination, which must be administered before exposure to infection, is
therapeutic vaccination, which aims to cure
or modify the course of established infection as well as strengthening protection
against further challenge in the future.
The immunopathogenesis of neurocysticercosis is highly relevant to vaccine design

because the immune response to this parasite may be protective, curative or pathogenic. Taenia solium larvae commonly live as
accidental intermediate hosts for many
years without causing symptoms or significant inflammation in humans. Symptomatic
disease usually results from failure of this
immune tolerance when one or more cysticerci degenerate within the brain. This
association between cysticercal degeneration
and the onset of symptoms is suggested by:
(i) the contrasting appearances of morphologically intact asymptomatic and degenerating symptomatic intracerebral lesions in
radioimaging, biopsy or autopsy studies; (ii)
the time-course of human infections (disease
often occurring years after infection); and
(iii) the transient adverse effects that may
occur as a result of anticysticercal therapy.
The pig is the natural intermediate host
for T. solium larvae and the usual absence of
illness in infected pigs is remarkable considering that thousands of cysticerci are often
scattered throughout neural and other tissues at autopsy. The absence of seizures or
other neurological signs in cysticercotic pigs,
in contrast to humans with cysticercosis,
may be explained by the fact that pigs are
slaughtered in their first year of life, before
cysticerci degenerate and cause inflammation. Alternatively, T. solium larvae may be
able to evade immune recognition more
effectively in pigs when compared with
humans. Taenia solium larvae therefore usually survive within pig and human tissues
without causing symptomatic inflammation,
despite the presence of circulating
antibodies4. Our understanding of the complex mechanisms involved is central to vaccine
design
and
involves
parasite
sequestration, concomitant immunity, antigenic masking and active modulation of host
immunity. These processes are reviewed in
detail in Chapter 2.
Vaccination: Present Status and Future Prospects
Vaccination Against Human

Cysticercosis
Human protective or therapeutic vaccination
to prevent cysticercosis has not been widely
considered as an appropriate intervention in
endemic regions because little is known about
the immunology of human cysticercosis and
cysticercosis is generally not considered a public health priority, perhaps because of underdiagnosis. It has been suggested that
cysticercosis occurs with greater than expected
frequency in immunologically deficient children, but this uncontrolled observation may
reflect a chance association or diagnostic bias
rather than an effect of immunodeficiency on
susceptibility5. Cysticercosis has not been
noted to be common in immunosuppressed or
immunodeficient adults6. There is, therefore,
no evidence of protective immunity against
cysticercosis in humans and little prospect of
human vaccination against this parasite in the
foreseeable future.
Therapeutic Vaccination for Porcine

Cysticercosis
Therapeutic vaccination is an appealing
alternative to protective vaccination for use
in endemic areas where cysticercosis is routinely diagnosed ante mortem in pigs by
tongue palpation. If therapeutic vaccination
led to the disappearance of cysticerci and
effective conversion of measly (low-value)
pork to normal meat before slaughter, then
this intervention would be widely used. The
incentive for use would be economic,
increasing the financial reward for the pig
owner; in addition, parasite transmission
would also be interrupted. Therapeutic vaccination may also overcome the problem of
free-roaming pigs often being infected in the
first few days of life, so protective vaccination before infection occurs may not be feasible7. This is a particularly important concern
because there is some evidence that protective vaccination is less effective in young
pigs, making it less likely that pigs could be
protected from cysticercosis before they
become naturally infected8.
423
Cysticerci may be destroyed by immunological intervention. Herbert and Oberg

infected nine pigs with cysticercosis at the
age of 2 months and reinfected four of these
pigs 2 months later9. Paradoxically, autopsy
revealed significantly fewer cysticerci in the
pigs that had been infected twice, suggesting
that reinfection accelerated cysticercus
degeneration and absorption. Similarly, reinfection of cows infected with T. saginata and
of sheep infected with T. hydatigena caused
degeneration of established cysticerci.
Deliberate reinfection is clearly not a sustainable intervention, but therapeutic vaccination with cysticercal extracts similarly
caused the resolution of cysticercosis in two
pigs10. This therapeutic vaccination was then
evaluated in a field trial in which the prevalence of porcine cysticercosis fell significantly
in two villages when pigs were vaccinated
repeatedly11. However, there was no control
group and cysticercosis was diagnosed by
tongue palpation only. Seven cysticercotic
pigs given therapeutic vaccination were studied in more detail and 73% of cysts excised
from them failed to evaginate, compared
with 5% in seven untreated cysticercotic pigs.
In a subsequent randomized, controlled and
blinded study, pigs naturally infected with T.
solium cysticercosis were inoculated with cysticercal antigen, resulting in a significant
reduction in cysticercal viability12. The proportion of cyst that showed no evidence of
viability was more than doubled in the group
of pigs given crude cysticercal extract and
most of these animals developed new
(EITB) bands, confirming an antibody
response to the intervention. However, more
highly purified cysticercal antigens were less
effective and despite treatment with antigen,
all pigs remained macroscopically heavily
infected and most of the cysticerci in the
majority of the treated animals remained
viable for causing human disease. The statistically significant effect of therapeutic vaccination on parasite viability illustrates the
active nature of the hostparasite interaction
and the potential for manipulating this relationship in the treatment of this infection.
However, therapeutic vaccines reported so
424
C.A.W. Evans
far have been insufficiently effective to eradicate cysticercosis and protection against reinfection has not been studied.
Protective Vaccination Against

Vaccination of pigs to prevent porcine cysticercosis is an appealing strategy to improve
animal health, meat yield and to break the
parasite life cycle, preventing taeniasis and
consequently preventing human cysticercosis. Considerable progress has been made in
this endeavour, which is reviewed below.
Historical background
The complex hostparasite interaction in parasitic infections has traditionally hampered
vaccine development, but great progress has
been made with immunization against experimental infection with metacestode parasites13.
These studies have used a variety of antigens;
and among crude parasitic antigens, those
derived from the infecting oncosphere stage
have generally been the most effective14. The
best example of an effective metacestode vaccine is that developed for the prevention of T.
ovis15. This recombinant antigen is produced
entirely in the laboratory without the need for
parasite material and similar vaccines based
on the 45W, 45WB/X, 16K and 18K antigens
have proved to be 90100% effective16.
Vaccination against infection of cattle
with larvae of the beef tapeworm has been
attempted with partial success using hatched
ova, but limited antigen supply has necessitated the use of recombinant DNA technology for sustainable vaccine production17.
Unfortunately, the T. ovis vaccine was not
effective against bovine infection with T. saginata, so genes were cloned from T. saginata
that express proteins homologous to the
host-protective T. ovis antigens. This strategy
led to the development of a recombinant
vaccine (combined TSA-9 and TSA-18 antigens) that induced up to 99.8% protection
against infection with T. saginata eggs18. A
similar recombinant T. ovis antigen vaccine
has been used successfully to protect pigs
from T. solium, as described below19.
Crude vaccines against porcine

cysticercosis
In laboratory and field studies, a variety of
antigens have demonstrated effective partial
protection against T. solium challenge and
these results are summarized in Fig. 42.1.
Molinari et al. showed that vaccination of
healthy pigs with antigens derived from
whole T. solium cysticerci caused partial protection against the subsequent development
of porcine cysticercosis10. A similar (6575%)
degree of protection was achieved in
Yorkshire pigs immunized with antigens
extracted from the scolices of T. solium cysticerci20. Greater than 99% protection was
achieved with chromatographically purified
antigens from T. solium scolices, with tenfold
greater protection from the first Sephadex
peak than the second21.
There is considerable antigenic similarity
between various Taenia species. A crude antigenic extract from murine T. crassiceps cysts
administered to pigs induced 50% protection
against subsequent T. solium egg challenge22,23. Approximately 96% protection was
achieved with purified protein extracts from
T. crassiceps cyst fluid22. As discussed above,
many parasites exhibit stage-specific antigens
and some studies have utilized T. solium
oncosphere antigens to specifically induce an
immune response against the infecting stage.
The only published study of immunization
with oncosphere extracts reported 8389%
protective
efficacy
with
oncosphere
extracts19. Likewise, immunization of pigs
with excretorysecretory products of T.
solium oncospheres caused a decrease in the
number of cysticerci that developed from
subsequent challenge infection24.
Field studies of vaccines against porcine

cysticercosis
Immune response to vaccination in controlled laboratory experiments is likely to
differ considerably from rural field use
where malnutrition, simultaneous antigenic
challenges and co-infections are frequent.
The above experiments that demonstrated
the efficacy of T. crassiceps antigen vaccine
425
10,000
Cyst extract (Molinari et al., 1983)10
Encystment rate (cysticerci per 100,000 eggs)
T. crassiceps cyst extract (Huerta et al., 2000)8
1,000
T. crassiceps cyst extract (Huerta et al., 2000)8
T. crassiceps cyst fluid (Manoutcharian et al., 1996)22
100
T. crassiceps cyst fluid extract (Manoutcharian et al., 1996)22
Scolex extract (Nascimento et al., 1995)20
10
Scolex extract (Kumar et al., 1987)21
Scolex extract (Kumar et al., 1987)21
1
Oncosphere secretions (Pathak and Gaur,1990)24
Oncosphere extract (Plancarte et al.,1999)19
0
Controls
Vaccinated
Recombinant T. ovis antigen (Plancarte et al., 1999)19
Fig. 42.1. Overview of Taenia solium vaccination trials involving experimental challenge infections. The
number of cysticerci per 100,000 T. solium eggs administered is shown for control and vaccinated pigs. Each
line represents a published experiment involving several pigs. Details of each experiment, including the dose
of parasites used for the challenge infection, are given in the text. The viability of cysticerci is not shown.
were performed with well-nourished, adult

York-Landrace pigs22,23. In an attempt to
mimic typical rural conditions for subsistence pig rearing in Mexico, vaccination and
subsequent T. solium challenge were performed in outbred, malnourished younger
pigs8. Under these conditions, vaccination no
longer affected the number of cysticerci,
although the degree of histological degeneration was greater in vaccinated animals. This
illustrates the difficulty in extrapolating
results of laboratory experiments to the field.
In a Mexican field trial, cysticercosis was
found to disappear from several endemic
communities following repeated administration of crude T. solium cysticercal antigens to
pigs11. In a subsequent, improved, controlled
study, vaccination with the same antigen
was associated with a fall in the prevalence
of cysticercosis by tongue palpation from

2.4% to 0.45%25. Despite limitations of the
monitoring of concurrent controls in these
studies and the insensitive method of diagnosing cysticercosis, the results of this largescale operational study were encouraging
because they suggested that a laboratorydeveloped vaccine could have significant
efficacy in the field setting.
Parasite supply for testing porcine

cysticercosis vaccines
One of the major problems that hampers the
development of a vaccine to protect against
cysticercosis is the difficulty in obtaining supplies of T. solium eggs from tapeworm carriers. It is ethically necessary to treat any
426
C.A.W. Evans
tapeworm carrier upon diagnosis, because of

their risk of developing cysticercosis.
Successful Taenia propagation in immunosuppressed chinchillas has recently been reported
and gravid segments from the tapeworms
grown in this animal model caused cysticercosis infection in pigs, raising the hope that
this may allow a constant laboratory supply
of Taenia eggs (reviewed in Chapter 4)26.
Recombinant antigens
An additional difficulty is the supply of T.
solium antigens for vaccine production. While
cysticerci and their scolices are currently
plentiful in endemic areas, oncospheres
remain difficult to obtain and the standardization of antigens extracted from any parasite stage is problematic. These problems in
antigen supply and standardization may be
overcome with recombinant DNA technology. cDNA libraries have been produced for
T. solium, but there have been no published
porcine trials of recombinant vaccines
derived from T. solium DNA. However, a
combination of the 45WB/X, 16K and 18K
recombinant T. ovis antigens caused 7493%
protection against porcine cysticercosis.
These recombinant antigens are completely
standardized and are easier to produce on an
industrial scale than those purified from parasite material. Importantly, a protective T.
ovis antigen with homology to a T. solium
antigen has recently been cloned, and experiments are in progress to establish whether
this fulfils its potential for high levels of protection against porcine cysticercosis27.
Similarly, vaccination with the KETc1 and
KETc12 recombinant T. crassiceps antigens is
highly protective against this murine parasite
and sequence analysis reveals considerable
homology with T. solium antigens28,29. This
family of antigens is therefore a strong candidate for testing as T. solium vaccines, possibly
in combination with other recombinant antigens. Recombinant DNA technology also
allows the inclusion of parasite antigens in
vectors or organisms that may increase
immunogenicity or, most importantly, allow
oral administration. Oral vaccination against
T. solium has not yet been reported.
DNA vaccines
The inoculation of DNA elicits both humoral
and cellular immune responses against the
antigens coded for by that DNA. Although this
strategy appears to have considerable potential
for inducing protective immune responses in
laboratory experiments, initial enthusiasm has
been tempered by concerns about the safety of
introducing viral vectors containing pathogenic DNA into the food chain. Furthermore,
administration of 45W, 18K and 16K DNA vaccines caused little or no antibody response to
these T. ovis antigens, in contrast to the corresponding protein vaccines30. Indeed, nucleic
acid vaccination against T. ovis had only modest efficacy even in combination with a conventional protein vaccine31. In contrast, direct
inoculation of a DNA vaccine against T. crassiceps into mouse spleens in vivo elicited protective cellular immune responses against this
parasite32. A reduction in T. crassiceps parasite
load also occurred after the administration of
macrophages pulsed ex vivo with a cDNA
expression library containing several antigenic
clones33. Of more relevance to possible field
use, protective responses were obtained after
intradermal and intramuscular inoculation of a
KETc7 DNA vaccine for murine cysticercosis34.
It remains to be seen whether DNA vaccination will protect pigs and whether this technology will be acceptable for vaccinating animals
that are to be consumed by humans.
Comparative Evaluation of Protective

Vaccine Trials
Methodological considerations are critical to
the comparison of different vaccine studies
and the potential utility of vaccines for use in
the field setting. For example, three vaccine
subcutaneous injections at 20-day intervals
had far greater efficacy than vaccination with
a single dose, but a vaccine that required
multiple doses would be of limited practical
value in the resource-poor settings where
porcine cysticercosis is most common8,20. The
majority of authors regard the proportion of
infection challenge eggs that successfully
form cysticerci, in vaccinated and unvaccinated (or adjuvant treated) pigs, as a measure
of the efficacy of vaccination. Where the necessary raw data have been published, this is
the approach used for calculating efficacy
rates in this review and it yielded results similar to those presented by the original authors
(Fig. 42.1). Clearly, the wide range of vaccine
efficacy and infection efficacy shown is likely
to result from differences in the proportion of
Taenia eggs obtained from gravid versus
immature proglottides and differences in
autopsy procedures that may leave many
cysticerci undiscovered. Besides, variation in
the adjuvants used may also contribute to
discrepant results because the latter may
cause cysticercal degeneration in control animals. For example, saponin adjuvant is much
less likely to cause cysticercal degeneration
than incomplete Freunds adjuvant or
Corynebacterium parvum8,20,22,23. Although
these issues do not negate the clear effect of
some vaccines compared with controls
within individual, blinded experiments, they
do hamper comparison of results between
different experiments. There has also been no
standardization of the size of the infection
challenge used to test cysticercosis vaccines.
The number of T. solium eggs administered
has varied from 8400 eggs in one experiment,
to 10,000 eggs, 15,000 eggs, 25,000 eggs, and
as many as 100,000 eggs in the study with the
least
effective
results8,10,1922,24.
These
methodological differences are important
because the natural infecting dose in the field
is likely to vary over an even greater range.
Only one group has formally tested the
effect of pig age on vaccine efficacy8.
Although their vaccine administered to malnourished outbred pigs did not have any
effect on cyst numbers, a significant effect on
cyst viability was greater in older than
young pigs. Furthermore, there was no
detectable antibody response to vaccination
in pigs inoculated at 40 (rather than 70) days
of age. It is interesting to note that immunization caused cysticerci to degenerate,
compared with control animals, despite the
absence of a detectable antibody response,
implicating a cellular immune response to
vaccination in this process8.
The goal of effective vaccination must be
prevention of infection and absence of cysticerci from pig tissues at autopsy. Such total
427
efficacy would reinforce the financial incentive for farmers to protect their livelihood
from this infection, which at least halves the
value of pigs in many endemic areas.
However, it is noteworthy that the least
effective study presented here observed no
effect on cyst numbers but did report a
marked effect of vaccination on cyst
histopathology8. The actual viability of cysticerci for causing human taeniasis is traditionally assessed by evagination assays, but
these are infrequently used12. No cysticercosis vaccines have yet been reported to be
100% effective and it is desirable that future
studies should assess the ability of cysticerci
to evaginate, as well as their absolute numbers19. It may be that the few parasites that
encyst despite previous vaccination are
immunologically damaged and unable to
evaginate and cause human taeniasis.
Conclusions
Vaccines derived from cysticercal extracts
have already proved their utility in field trials and recombinant vaccines are now sufficiently effective under controlled conditions
to warrant widespread evaluation of this
sustainable intervention. Rapid recent
progress with the sequencing and comparison of antigens from T. solium and related
parasites makes it likely that more effective
T. solium vaccines will be developed soon.
Although the effect of malnutrition, constant
exposure to antigens, and the transfer of
immunity from pregnant sows await investigation, this progress in the transfer of molecular biology from the laboratory to the field
has provided a powerful new tool for the
control of cysticercosis. Combined with treatment of human tapeworm carriers, the imminent expectation of an effective recombinant
vaccine against porcine cysticercosis makes
eradication of cysticercosis a feasible goal.
Acknowledgement
The author is funded by the Wellcome Trust
as a Career Development Fellow in Clinical
Tropical Medicine.
428
C.A.W. Evans
References
1. Lightowlers, M.W. (1996) Vaccination against cestode parasites. International Journal of Parasitology
26, 819824.
2. Andreassen, J. (1991) Immunity to adult cestodes: basic knowledge and vaccination problems. A
review. Parasitologia 33, 4553.
3. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigenbased diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. American Journal
4. White, A.C., Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: hostparasite interactions
and the immune response. Chemical Immunology 66, 209230.
5. Flisser, A., Willms, K., Laclette, J.P., et al. (1982) Discussion. In: Flisser, A., Willms, K., Laclette, J.P., et
al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 611.
6. SotoHernandez, J.L., Ostrosky-Zeichner, L., Tavera, G., et al. (1996) Neurocysticercosis and HIV
infection: report of two cases and review. Surgical Neurology 45, 5761.
7. Aluja, A.S., de Martinez, J.J., Villalobos, A. (1998) Taenia solium cysticercosis in young pigs: age at
first infection and histological characteristics. Veterinary Parasitology 76, 7179.
8. Huerta, M., Sciutto, E., Garcia, G., et al. (2000) Vaccination against Taenia solium cysticercosis in
underfed rustic pigs of Mexico: roles of age, genetic background and antibody response. Veterinary
9. Herbert, I., Oberg, C. (1974) Cysticercosis in pigs due to infection with Taenia solium Linneaus 1758.
In: Soulsby, E.J.L. (ed.) Parasitic Zoonoses: Clinical and Experimental Studies. Academic Press, London,
pp. 187195.
10. Molinari, J.L., Meza, R., Tato, P. (1983) Taenia solium: cell reactions to the larva (Cysticercus cellulosae) in naturally parasitized, immunized hogs. Experimental Parasitology 56, 327338.
11. Molinari, J.L., Soto, R., Tato, P., et al. (1993) Immunization against porcine cysticercosis in an
endemic area in Mexico: a field and laboratory study. American Journal of Tropical Medicine and
Hygiene 49, 502512.
12. Evans, C.A., Gonzalez, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis:
implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56,
3337.
13. Lightowlers, M.W., Rickard, M.D. (1993) Vaccination against cestode parasites. Immunology and Cell
Biology 71, 443451.
14. Lightowlers, M.W. (1994) Vaccination against animal parasites. Veterinary Parasitology 54, 177204.
15. Johnson, K.S., Harrison, G.B., Lightowlers, M.W., et al. (1989) Vaccination against ovine cysticercosis
using a defined recombinant antigen. Nature 338, 585587.
16. Lightowlers, M.W. (1999) Eradication of Taenia solium cysticercosis: a role for vaccination of pigs.
17. Babiker, H.A., Eldin, E.S. (1987) Preliminary observations on vaccination against bovine cysticercosis in the Sudan. Veterinary Parasitology 24, 297300.
18. Lighowlers, M.W., Rolfe, R., Gauci, C.G. (1996) Taenia saginata: vaccination against cysticercosis in
cattle with recombinant oncosphere antigens. Experimental Parasitology 84, 330338.
19. Plancarte, A., Flisser, A., Gauci, C.G., et al. (1999) Vaccination against Taenia solium cysticercosis in
pigs using native and recombinant oncosphere antigens. International Journal of Parasitology 29,
643647.
20. Nascimento, E., Costa, J.O., Guimaraes, M.P., et al. (1995) Effective immune protection of pigs
against cysticercosis. Veterinary Immunology and Immunopathology 45, 127137.
21. Kumar, D., Gaur, S.N.S., Pathak, M.L. (1987) Immunization of pigs against the cysticercus of Taenia
solium using fractionated first and second peaks of Cysticercus cellulosae scolex antigens. Indian
Journal of Animal Sciences 57, 932935.
22. Manoutcharian, K., Rosas, G., Hernandez, M., et al. (1996) Cysticercosis: identification and cloning
of protective recombinant antigens. Journal of Parasitology 82, 250254.
23. Sciutto, E., Fragoso, G., Trueba, L., et al. (1990) Cysticercosis vaccine: cross protecting with Taenia
solium antigens against experimental murine T. crassiceps cysticercosis. Parasite Immunology 12,
687696.
24. Pathak, K.M.L., Gaur, S.N.S. (1990) Immunization of pigs with culture antigens of Taenia solium.
429
25. Molinari, J.L., Rodriguez, D., Tato, P., et al. (1997) Field trial for reducing porcine Taenia solium cysticercosis in Mexico by systematic vaccination of pigs. Veterinary Parasitology 69, 5563.
26. Flisser, A., Lightowlers, M.W. (2001) Vaccination against Taenia solium cysticercosis. Memorias do
Instituto Oswaldo Cruz (Rio de Janeiro) 96, 353356.
27. Lightowlers, M.W., Flisser, A., Gauci, C.G., et al. (2000) Vaccination against cysticercosis and hydatid
disease. Parasitology Today 16, 191196.
28. Toledo, A., Fragoso, G., Rosas, G., et al. (2001) Two epitopes shared by Taenia crassiceps and Taenia
solium confer protection against murine T. crassiceps cysticercosis along with a prominent T1
response. Infections and Immunology 69, 17661773.
29. Toledo, A., Larralde, C., Fragoso, G., et al. (1999) Towards a Taenia solium cysticercosis vaccine: an
epitope shared by Taenia crassiceps and Taenia solium protects mice against experimental cysticercosis. Infections and Immunology 67, 25222530.
30. Drew, D.R., Lightowlers, M.W., Strugnell, R.A. (2000) A comparison of DNA vaccine expressing the
45W, 18k and 16k host-protective antigens of Taenia ovis in mice and sheep. Veterinary Immunology
and Immunopathology 76, 171181.
31. Rothel, J.S., Waterkeyn, J.G., Strugnell, R.A., et al. (1997) Nucleic acid vaccination of sheep: use in
combination with a conventional adjuvanted vaccine against Taenia ovis. Immunology and Cell Biology
75, 4146.
32. Cano, A., Fragoso, G., Gevorkian, G., et al. (2001) Intraspleen DNA inoculation elicits protective cellular immune responses. DNA Cell Biology 20, 215221.
33. Manoutcharian, K., Terrazas, L.I., Gevorkian, G., et al. (1999) DNA pulsed macrophage-mediated
cDNA expression library immunization in vaccine development. Vaccine 18, 389391.
34. Cruz-Revilla, C., Ross, G., Fragoso, G., et al. (2000) Taenia crassiceps cysticercosis: protective effect
and immune response elicited by DNA immunization. Journal of Parasitology 86, 6774.
43
Control of Taenia solium with Porcine

Chemotherapy
Armando E. Gonzalez
Introduction
Control or eradication of Taenia solium cysticercosis has been achieved to date only in
Europe and North America. Significant
improvements in sanitary conditions and
developing functional slaughterhouse control systems were primarily responsible for
control in these regions (see Chapter 7). In
endemic areas of developing countries, the
life cycle of T. solium is sustained because
pigs have access to infected faeces, and
cysticercosis-infested pork is available for
consumption. Moreover, control in developing countries is limited by economic and
sanitary conditions. Interventional trials
with massive human taeniacidal chemotherapy (reviewed in Chapter 41),
immunotherapy (reviewed in Chapter 42)
and health education (reviewed in Chapter
41) have not proved to be sustainable in
the long-term to date. For instance, a study
in rural Mexico evaluated the effects of
health education through discourses and
demonstrations given to primary and
secondary grade school children and
taeniacidal treatment of the human
population1. Two years later, 78% of the
children and 2% of the adults successfully
answered a questionnaire on the life cycle
of the parasite; however, porcine infection
rates were found to have increased twofold.
Therefore, while the strategy brought

about significant changes in knowledge
about T. solium, it was not successful in
controlling levels of T. solium endemicity in
the population. Other interventional strategies employing mass cestocidal treatment
have proved successful in the short term,
though (reviewed in Chapter 41).
Theoretically, strategies for control of T.
solium in humans would be ineffective
because transmission could subsequently
occur from infected pigs. Therefore, eradication of T. solium from a disease-endemic
area by employing human treatment alone
would require consecutive interventions,
for at least the average life span of the
porcine reproductive stock. Furthermore,
the interval between interventions should
not exceed the pre-patent period, so that if
new adult tapeworm infections occur, they
would not have enough time to infect more
pigs. This holds true also, if the porcine
population alone is targeted by the interventional strategy. Such interventions
would have to be made for the entire life
span of the tapeworm, implying that the
pig population has to be treated within the
interval required for cyst maturation. In
order to obviate the problems associated
with treatment of either human or pig population alone, concurrent treatment of both
human and porcine populations has been

431
432
A.E. Gonzalez
proposed. It has been suggested that targeting both hosts would reduce the time
required to eradication and thereby
increase the likelihood of success. Finally,
the inspection and condemnation of pork
in abattoirs, which is advocated by the Pan
American Health Organization and the
World Health Organization as an important
control
measure,
paradoxically
encourages high rates of infection by failing to cover the informal pork markets that
are major circuits for the sale of pork in
developing countries2.
While the benefits of various interventions described above should not be underestimated, results of a community
intervention in Peru (described below)
indicated that a practical approach
towards eradication of porcine cysticercosis should incorporate economic incentives
in order to be successful2. In explicit terms,
since porcine cysticercosis reduces the economic value of pork in the market, a
chemotherapeutic intervention that targets
swine and eliminates cysticerci in pork
should not only interrupt the transmission
cycle of T. solium but also improve the economic value of pork sold in the market.
However, in order to improve the commercial value of pork, the cysticerci need to be
visually and palpably eliminated. Any
chemotherapeutic intervention should consider this aspect for success in the field.
Indeed, the economic benefits of selling
clean meat rather than the accrued health
benefits may drive farmers to volunteer
their pigs for chemotherapy. Better market
prices for treated pork and access to the
formal marketing system will be strong
incentives for farmers to treat their pigs,
and community cooperation will be
ensured. Any disease eradication programme that considers the economic factor
is more likely to be successful and sustainable, and also to result in the acceptance of
health education campaigns. In the present
chapter, the author has focused on control
of T. solium through chemotherapy of
infected pigs, drawing particular attention
to its major advantage of providing economic incentives to pork-producing farmers through the sale of clean carcasses.
Porcine Chemotherapy
Praziquantel
Several chemotherapeutic agents have been
evaluated for the treatment of porcine cysticercosis. Early efforts with flubendazole3 were
followed by evaluation of praziquantel
administered in a dose of 50 mg kg1 day1
for 15 days4,5. A variable efficacy was noted in
these initial studies and not all the cysts disappeared upon computed tomography by day47 after treatment4. Later, 1 day treatment with
praziquantel (in three different doses of 100
mg kg1, 50 mg kg1 and 25 mg kg1) in three
divided doses was reported to kill all cysts in
16 of 18 pigs (88.9%)5. The highest dose was
most efficacious in causing degeneration of
the cysts. This study, however, did not evaluate
the disappearance of cysts from the carcasses,
since pigs were killed 1 month after treatment.
Albendazole
The successful treatment of porcine cysticercosis with albendazole at a dose of 15 mg
kg1 daily for 30 days was first reported in
19956. However, the need for multiple doses
made this regimen impractical for use in field
control programmes. At about the same time,
a randomized trial evaluated the efficacy of
two different schemes of administration of
albendazole for the treatment of porcine cysticercosis7. Seventeen naturally infected pigs
were divided into three groups and treated
by mouth with albendazole (50 mg kg1 single dose), albendazole (30 mg kg1 day1 for
3 days) or placebo, respectively. All animals
treated with the single dose of albendazole
exhibited side effects (extreme prostration,
complete anorexia and reluctance to move),
and one of the pigs died 3 days after treatment. Those treated for 3 days (30 mg kg1
day1) also exhibited side effects (lethargy
and anorexia). No side effects were noted in
the placebo group. Importantly, single-dose
albendazole therapy left some viable cysts
remaining in the meat, while 3-day albendazole therapy killed all but one cysts. The 3day regimen was found to be effective as a
strategy that targeted the porcine population.
The meat, however, remained measly with
Control of T. solium with Porcine Chemotherapy
dead and degenerating cysts leaving it

unsightly as a food product.
Oxfendazole
Oxfendazole (methyl [5-(phenylsulphinyl)-1H
benzimidazole- 2-yl] carbamate; SynanthicTM)
was first identified as having anthelminthic
properties against larval and adult gastrointestinal cestodes and nematodes in various
animal species by Syntex Research, Palo Alto,
California. Structurally, it comprises of a benzimidazole carbamate that is characteristic of
this group of drugs (which includes albendazole), with a phenylsulphinyl substituent in
position-58. The efficacy of single-dose
oxfendazole alone, praziquantel alone, and
oxfendazole and praziquantel in combination,
in the treatment of porcine cysticercosis were
compared in a randomized, placebo-controlled study. Oxfendazole, used in a single
dose of 30 mg kg1, was found to be highly
effective for the treatment of porcine cysticercosis9. Both oxfendazole alone and in combination with praziquantel killed all the
parasites, leaving behind only microcalcifications and minuscule scars in the meat, giving
it a clean appearance. The appearance of the
meat was suitable for marketing, and no
apparent differences in taste were found by
organoleptic experts from the pork sold in
markets of Lima. In contrast, a single dose of
praziquantel alone (50 mg kg1) showed no
benefit when compared with the controls.
Cysts appeared clearly visible in the carcasses
of the praziquantel and control groups. No
detectable side effects were seen in any of the
groups. This study demonstrated the safety
and efficacy of a single dose (30 mg kg1) of
oxfendazole in the treatment of porcine cysticercosis. All other regimens were either ineffective, needed multiple dosing, had side
effects or left the meat unsuitable for sale37,9.
Overview of Laboratory and Field

Trials with Oxfendazole
Dose considerations
The dose of oxfendazole (30 mg kg1) was calculated from previous experience with alben-
433
dazole and may over-estimate the amount of

drug needed for treatment of porcine cysticercosis. Consequently, an experiment was
designed to establish the minimal effective
single dose of oxfendazole that would kill all
cysticerci in pigs10. Three doses of oxfendazole
were tested: 10 mg kg1, 20 mg kg1 and 30
mg kg1. After treatment, more than 75% of
cysts in pigs from the control group (not
treated) were viable, irrespective of their
anatomical location. Four animals among
those administered a dose of 10 mg kg1
exhibited viable cysts; the latter were present
in the muscle (three pigs), the tongue (two
pigs), and the brain (two pigs). Viable cysts
were also found in four animals in the 20 mg
kg1 group, although they were present only
in the muscle (one pig) and the brain (three
pigs). The number of viable cysts recovered
from the treated animals was very low: 18 of
216 (8%) animals that were administered the
10 mg kg1 dose, and 11 out of 198 (6%) given
the 20 mg kg1 dose. No viable cysts were
recovered from animals that were administered 30 mg kg1 oxfendazole. Carcasses of
pigs treated with 30 mg kg1 oxfendazole had
a normal appearance, and were considered
suitable for human consumption.
Time response of anticysticercal effect

The time for cysts to die and disappear after
oxfendazole administration is critical to the
determination of the specific timing of treatment of live infected pigs. A controlled
study was designed to determine the time
period between treatment and death of cysticerci11. A clear decrease in viability and
number of cysts was noted after the first
week following treatment with oxfendazole,
though few live cysticerci were found in
many tissues even at 4 weeks. Twelve weeks
after oxfendazole treatment, the meat examined was clear and only minuscule scars
were observed, except in one animal that
had viable cysts in the brain. The predicted
time to total decay depended on the organ.
The time to zero viability in muscle and
heart were 4 and 3 weeks, respectively.
Interestingly, the time to cyst disappearance
in the tongue, a voluntary muscle was 5
434
A.E. Gonzalez
weeks. This study demonstrated that immediate pre-slaughter treatment of pigs with
oxfendazole does not result in death and
disappearance of cyticerci.
Field trial with oxfendazole

The availability and documented success of
oxfendazole led to its use in a field trial for
control of T. solium through porcine
chemotherapy; such approaches were considered impractical primarily due to the
duration of treatment, and found expensive
before the use of oxfendazole. The
Cysticercosis Working Group in Peru carried
out an interventional study that evaluated
the effect of combined mass therapy targeting both human and porcine populations in
the Peruvian highlands (Hector H. Garca,
Lima, Peru, unpublished data). Eight highly
endemic villages located in the Mantaro valley were selected for the study. The selected
population underwent a cysticercosis control
programme that included mass treatment of
human and porcine populations. All pigs
were treated twice with oxfendazole (single
dose, 30 mg kg1) at the beginning of the
experiment (month 0 and month 4).
Following baseline sampling and 30 days
after treating the pigs, the villagers in the
treatment branch of the study received praziquantel in taeniacidal doses. The strategy
was shown to be successful in the short term.
Benefits of the intervention as measured by
incident cases of porcine cysticercosis
remained statistically significant up to 16
months (P = 0.04). However, within 2 years,
the prevalence of the porcine cysticercosis
rose to its original levels. Sentinel pig trials
corroborated that environmental contamination returned to baseline levels 18 months
after intervention. The biotic potential of
T. solium ultimately recovered to steady-state
baseline values. The study demonstrated
that information regarding variables affecting the biotic potential were important; these
were used to calculate the number of interventions and the minimum treatment coverage required for a strategy using either
common sense or mathematical approaches
(reviewed in Chapter 44).
Protection of successful treatment with

oxfendazole
Since treated pigs can theoretically acquire
new infections, the estimation of the duration
of protective effect conferred by oxfendazole
treatment is critical to the understanding of
the development of pig chemotherapy-based
control interventions. Another controlled
study was designed to determine if cysticercosis-infected pigs could acquire new infections
after having been treated with oxfendazole12.
A group of 20 cysticercotic pigs were treated
with oxfendazole and later matched with 41
naive (unexposed to T. solium eggs) pigs. Both
groups were then exposed to a natural challenge of T. solium eggs in a hyperendemic area.
Seroprevalence of cysticercosis among native
pigs at the field site at the time of the experiment was 75% (73/97 animals). From the original 61 pigs, 51 (84%) were recovered at the
end of the study, 19/20 in the treatment group
(95%), and 32/41 (78%) in the control group.
New infections were demonstrated in 15/32
(47%) using EITB serology and in 12/32
(38%) by tongue palpation in the control
group. At necropsy, viable cysts were found
in the carcasses of seven pigs (viable only:
three; viable and degenerated: four) while
degenerated cysts alone were noted in
another five animals. The numbers of cysts in
these newly infected animals ranged between
five and 30 per pig. Conversely, no viable
cysts were found in the carcasses of any of
the 19 treated pigs.
In field conditions, most pigs live for
around 9 months (see Chapter 15). Cysts take
about 2 months to develop, so it is reasonable
to assume that pigs will be infective only
after 34 months of age. Therefore, if treated
at 34 months of age, cured pigs are unlikely
to be re-infected at least until 7 months of
age, and it is very probable that this protection will extend for longer periods and thus
cover the remaining lifetime of the pig. This
means that oxfendazole is potentially an
effective control agent because once treated,
pigs are refractory to re-infection even in the
event of ongoing exposure to the source of T.
solium eggs. Obviously, other concomitant
measures are still needed since seronegative
pigs still remain susceptible to infection.
Control of T. solium with Porcine Chemotherapy
Conclusions
Porcine chemotherapy, previously impractical and expensive, is now an important
option in the short-term control of T. solium.
Several drugs including flubendazole, praziquantel, albendazole and oxfendazole have
been used as chemotherapeutic agents in
experimental and field conditions. Most
drugs, like albendazole and praziquantel,
have to be administered over several days;
this is a major limitation to their use in field
conditions. Oxfendazole, however, has the
advantage that that it can be administered in
single doses (30 mg kg1). The drug has been
435
demonstrated to cause complete disappearance of cysts at 12 weeks after treatment.

More importantly, the pork meat is rendered
clean with no residual cysts or scars, thereby
increasing its economic value in the pork
market. Mass porcine chemotherapy with
oxfendazole could, therefore, be a useful
strategy against T. solium, by providing
health as well as economic benefits. Until a
vaccine for porcine cysticercosis is available,
treatment of infected pigs is a logical
approach for controlling transmission of T.
solium, and should therefore be considered
an important, cost-effective measure to control cysticercosis.
References
1. Keilbach, N.M., De Aluja, A.S., Sarti, E. (1989) A programme to control taeniasiscysticercosis (Taenia
solium): experiences in a Mexican village. Acta Leiden 57, 181189.
Bulletin of World Health Organization 71, 223228.
3. Tellez-Giron, E., Ramos, M., Montante, M. (1981) Effect of flubendazole on cysticercus cellulosae in
pigs. American Journal of Tropical Medicine and Hygiene 30, 135138.
4. Flisser, A., Gonzalez, D., Shkurovich, M., et al. (1990) Praziquantel treatment of porcine brain and
muscle Taenia solium cysticercosis. 1. Radiological, physiological and histopathological studies.
5. Torres, A., Plancarte, A., Villabos, A., et al. (1992) Praziquantel treatment of porcine brain and muscle
cysticercosis. 3. Effect of 1-day treatment. Parasitology Research 25, 14431450.
6. Kaur, M., Joshi, K., Ganguly, N.K., et al. (1995) Evaluation of the efficacy of albendazole against the
larvae of Taenia solium in experimentally infected pigs, and kinetics of the immune response.
7. Gonzalez, A.E., Garca, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with
albendazole. American Journal of Tropical Medicine and Hygiene 53, 571574.
8. Marriner, S.E., Bogan, J.A. (1981) Pharmacokinetics of oxfendazole in sheep. American Journal of
Veterinary Research 42, 11431145.
10. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1997) Treatment of swine cysticercosis with oxfendazole: a doseresponse trial. Veterinary Record 141, 420422.
12. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Cysticercosis pigs treated with oxfendazole are
protected from further infection. American Journal of Tropical Medicine and Hygiene 65, 1518.
44
Use of a Simulation Model to Evaluate

Control Programmes Against Taenia
solium Cysticercosis
Armando E. Gonzalez, Robert H. Gilman, Hector H. Garca

and Teresa Lopez
Introduction
Taenia solium produces widespread livestock
production losses caused by the intermediate
stage of cysticercosis infecting the pig1. The
rates of porcine infection are variable, but in
endemic regions, over 2030% of pigs may be
infected2. An improved understanding of the
relationship between T. solium and the pig
production systems in endemic areas is crucial. McLeod suggested that a simulation
model that included a disease component
over a herd structure dynamic assisted in this
goal3. Thus, it was possible to relate the presence of T. solium to pig production activities.
A dynamicstochastic model that simulates
pig and T. solium populations over time was
developed to produce estimates of the economic impact of disease, and to quantify the
costs of control measures through financial
analyses*. The model was designed to assess
a number of proposed control strategies in

terms of changes in both the adult and intermediate populations of T. solium. An economic component was also included to
calculate the net financial benefit of proposed
control strategies. An important objective was
to simulate pig population dynamics, infection in both human and porcine populations,
the effect of different control strategies on T.
solium and the financial benefit of control
strategies. The model comprised a set of algorithms that uncovered various aspects of the
disease, identified functional relationships
between host and its environment, established measures of effectiveness and constraints and calculated economic indicators.
The model used stochastic processes to simulate variable outputs4. The element of stochastic variation enabled the model to predict the
likelihood of discrete events and to determine
the value from a relevant distribution for an
*A number of strategies evaluate the effect of disease in a population. When a disease outbreak is modelled
directly, an epidemic curve can be drawn which depicts changes in disease prevalence. If some economic
variables are considered, the economic changes during the epidemic curve can be assessed. Another strategy
is to model the population but not the disease. By running the model with and without disease parameters,
the cost of disease can be calculated. A third and more flexible approach is to combine population and
disease parameters in a single model and evaluate the effect of disease and control strategies from the final
output3. Development of a simulation model is the process of building a mathematical and/or logical model
of a system or a decision problem, and experimenting with the model to obtain insight into the systems
behaviour or to assist in making decisions concerning the problem. Simulation models are designed so that
they mimic the system under study as closely as possible in order to achieve a substantial degree of
epidemiological realism. Thus, building the model is making use of information about a disease in the form of
algorithms and equations4,5.
Continued on next page
437
438
individual in the population3. The model

combined population and disease models into
an epidemiological model.
General Description of the

Simulation Model
Assumptions
It was assumed that the effective reproductive
rate of the adult tapeworm (R) is equal to one6.
This assumption considers that each adult
tapeworm produces one adult tapeworm as
an offspring. Therefore, the average number of
tapeworms remains constant through time.
Also, that the infection rates for humans were
the same for each individual in the population. This assumption need not hold true in
actual conditions; however, there are no data
to support a more plausible assumption
regarding T. solium egg contamination patterns. Regarding porcine cysticercosis, it was
assumed that the infection rate is the same for
all pigs, and that in highly endemic areas, if a
pig is exposed at birth to a contaminated environment, it will become infected during the
first 6 months of life. Assumptions were also
made for human infection. The number of
new cases of human and swine cysticercosis
depends on the number of adult tapeworms
present, the number of new cases of tapeworm
infection depends on the number of infected
pigs consumed in that day and finally, that the
number of exposed humans remains constant
throughout the simulation.
Basic structure of the model

The simulation of related events was programmed in routines and algorithms that
represent the basic units of the programme.
The latter in turn were organized in components according to overall objectives. Calls to
specific components came from modules and
sub-modules. The program was structured in
three modules, namely: input, simulation
and output. Obviously, the core of the program lay in the simulation module, which
contained two sub-modules, baseline, and
intervention. The former ran a simulation
without any disease control while the latter
simulated the selected control strategy.
The model was developed using Visual
Basic 4.0 (Fig. 44.1). The model considers
input, simulation and output forms. Three
forms were designed to set values to input
variables. Briefly, the first two consider input
values for the simulation model itself; swine
and human population, disease parameters,
financial parameters and seasonality factors.
The third input form was designed to select
the choice of output presentation. Two output forms present results in either economic
evaluations or disease evolution graphs.
Main procedures
Changes in tapeworm population
There are three disease states for a tapeworm
carrier: infected with an immature tapeworm, infected with a mature tapeworm,
and postinfection contamination. The latter
is very important because, even though the
human host no longer harbours the tapeworm, a number of the produced eggs still
remain infective in the environment. The
routine deals with environmental contamination and assigns a number of infective
days after the tapeworm is eliminated. This
value varies from place to place, according to
climactic and hygiene conditions, and is
required in the input form. The routine
Continued from previous page

A stochastic process is a system of countable events, where the events occur according to some well-defined
random process5. Stochastic simulation modelling encompasses a range of techniques to mathematically
describe the impact of uncertainty on a problem. Each uncertain parameter within the model is represented by a
probability function. The shape and size of these distributions defines the range of values that the parameter may
take and their relative probabilities. Following hypothesis testing and investigation of the effect of a range of
control measures, through a series of time steps they can show the changes that take place in a population
between the present and some future time.
Simulation Model Evaluation of Control Programmes
439
Input frame
Choice form: average number of infective pigs
Enter value
Calculate value
Set repetitions
Pre-simulation
Seed value to the programme
Input of control strategy
SIMULATION
Output choice
Economic output
Disease graphs
Fig. 44.1. Form flow of the Taenia solium simulation program.
assigns the infection status of the host

according to the length of each period (also
required as input). The routine adds 1 day to
tapeworm age and modifies the host disease
status according to age limits. This algorithm
does not include a random process to determine the daily outcome. It only changes the
disease status and counts the number of

infective tapeworms for the simulated day.
Two infective forms are considered to calculate the infection potential for the simulated
day: the number of adult tapeworms and the
number of hosts with residual environmental contamination.
440
Porcine population component

The number of farrowings per day is a random number drawn from a Poisson distribution. The input is the number of expected
farrowings per day and the output is the
number of farrowings on the simulated day.
Once the number of farrowings for the day is
set, the routine determines litter sizes with
successive calls to the PoissonMonte Carlo
algorithm. The routine then sets values to the
age and disease status of the piglet. Finally,
the routine assigns a sex to each piglet.
The mortality routine is called for every
simulation day. The routine determines the
sex and age groups of each pig from the
pigage and pigsex arrays respectively.
Subsequently, the program assigns a daily
mortality probability according to the age
and sex groups of the pig. The mortality or
survival outcome for each pig is then determined by a Monte Carlo procedure.
Swine cysticercosis component
The swine cysticercosis component has two
routines: one that simulates the number of
new cases, and another that simulates disease evolution. The former simulates new
infections using a Monte Carlo algorithm.
The simulation determines whether a pig is
infected or not during the simulation day.
The disease evolution routine verifies the
infection status of each pig and then changes
its variable values according to the period
limits set in the input sub-module. There are
five infection states, depending on the infection and the presence of acquired or maternally transferred antibodies (Fig. 44.2).
Piglets become blot positive or negative
according to their mothers serological status. If the sow is positive, the piglet will be
positive to antibody tests for a period of 8
months (Armando E. Gonzalez, unpublished
data). In this case, the enzyme-linked immunoelectrotransfer blot (EITB) test detects antibodies, regardless of whether the piglet is
actually infected or not. Piglets, either with
or without maternal antibodies, can be
infected during the first 6 months of life.
Following acquired infection, it takes 15 days
to produce detectable amounts of antibody7,
hence, there is a period of time during which

the infected pig remains negative to the EITB
assay. Once a pig is infected, another lapse of
time (90 days) is considered to allow the
cysts to develop to fully infective forms.
Finally, once treatment is administered, cysts
may remain viable for 28 days. If a pig with
immature cysts is treated, the pig can be considered free of infective forms immediately.
Change from one category to the other
depends on infection and/or time.
Human cysticercosis component
The human cysticercosis component determines the number of new human cases. The
component does not simulate evolution of the
disease, nor does it assign symptoms or any
other related variable. The main objective of
this component is to calculate the expected
number of new cases to assess the control
strategy in terms of its impact on this variable.
The input for the routine, the expected number of cases per day, is calculated from the
number of exposed humans and the age
range of the exposed group. The number of
new cases during the exposure period is equal
to the human cysticercosis prevalence. The
routine uses the daily number of new cases as
the input for the Poisson routine, which
returns the number of cases for the day.
Financial component
The financial component calculates the net
financial benefit for the simulation. This
component is nested in the mortality routine.
The mortality routine identifies the age and
sex of each pig and assigns the
mortality/offtake probability from a probability array. Prices of pigs are organized in an
array that has the same structure as the mortality/offtake array, therefore, the pig price
can be determined in the same algorithm. An
additional line of code verifies if the pig that
is about to leave is infected with visible cysts
or not. Thus, every time that a pig leaves the
cohort, the routine is able to assign a gain
according to the age, sex and infection status
of the pig. Also, part of the financial component is nested in the control algorithm. Every
time that a control procedure is simulated,
Positive sow
Newborn pig
8 months
Uninfected pig
Blot positive (maternal
antibodies)
441
Negative sow
Uninfected pig
Blot negative
Infection
Infected pig
Blot negative
Immature cysts
Infection
15 days
Treatment
Infected pig
Blot positive
Immature cysts
75 days
Treated pig
Blot positive
not infective
Infected pig
Blot positive
Mature cysts
Treatment
28 days
Treated pig
Blot positive
viable cysts
Status change due to event

Status change due to time
Fig. 44.2. Graphical description of the changes among disease status compartments.
the routine assigns a cost to the human or

porcine treatment. Costs and benefits are
added for every day of the simulation. At the
end of the simulation period, a small routine
performs a net benefit analysis.
Intervention component
The objective of the intervention component
is to simulate mass taeniacidal treatment of
humans and/or anticysticercal treatment of
pigs. This strategy is defined by the number
of interventions and the interval between
them. The objective of this particular variable is to coordinate human and porcine
strategies. Briefly, the component is run starting from the date of the first intervention for
the given number of human mass treatments. The interval between interventions is
set to a default value, which can be modified.
TAENIASIS CONTROL. The human control simulation component uses a Monte Carlo algorithm to simulate the outcome of the
intervention on an individual basis. Two key
probability values can be identified in field
442
conditions. First, the likelihood of receiving

treatment, and second, the probability of
killing the tapeworm. For practical purposes,
the routine combines these two probabilities
in a single value, i.e., the probability of being
successfully treated on the intervention day.
The routine
used for swine cysticercosis control is similar
to the one described for tapeworms and is
run for each pig in the village. If the pig is
treated, then the programme changes the
disease status and sets the appropriate variable values to treated pig values. Among
these variables, the one that counts the number of days since the treatment is crucial.
Death of cysts does not occur immediately; it
takes 4 weeks to make the cyst viability
equal to zero8. The disease evolution component takes this fact into account, identifying
the pig as treated and simulating the treatment effect over a period of time.
SWINE CYSTICERCOSIS CONTROL.
The effect of seasonality is considered for a number of events. It was considered that mortality, infection, price of pigs
and farrowing were affected by seasonal
variations. Seasonality input was entered in
variable arrays with 12 values, one for each
month. A seasonality factor was then calculated for each variable.
SEASONALITY.
Output module
The graphical output presents the daily
gains, the number of tapeworms, rate of truly
infected pigs (excluding maternally transferred antibodies; called true cysticercosis
prevalence), antibody prevalence, number of
new porcine cysticercosis cases and total economic gains for the day. The program stores
the values of these variables in memory
arrays and then plots them in different combinations. The output combinations are
selected in an output choice form. Steadystate values for each day are also available,
and can be plotted with simulation values.
The numerical output presents the results of
the financial component. It also shows the
final result for the number of new cases of
human cysticercosis for the simulated period.
Use of the Simulation Model

Input
Values used for biological parameters were
taken from available scientific literature. The
variables included, among others, incubation
periods, life span of the parasite and duration
of passive immunity. Population dynamics
and field-related variables were estimated
from a participatory rural appraisal (PRA)
exercise and a follow-up study (Armando E.
Gonzalez, unpublished data).
Human population input
The number of humans considered as
exposed to cysticercosis was obtained from a
follow-up study whose data were used to
validate the model. It was estimated that
approximately 2000 individuals were
exposed. Also, it was calculated that humans
are exposed to the disease for an average of
45 years (Hector H. Garca, Lima, Peru, personal communication).
Adult tapeworm and human taeniasis
A prevalence figure of 3% was used as input
for human taeniasis. The pre-patent period
was assumed to be 90 days and the average
life span of the adult tapeworm was
assumed to be 3 years. Strictly speaking,
time to egg production follows a normal distribution, consequently, the use of a point
estimate may not accurately handle this variable. According to Allan9, human taeniasis
incidence in a year was around one third of
total prevalence, thereby suggesting that the
adult tapeworm had a shorter life span.
Porcine cysticercosis input
The porcine population input considered the
age and sex of the pig. The number of piglets
per litter used was estimated from PRA
interviews. Swine cysticercosis prevalence
figure used as an input for the model was
45%. The number of days to cyst maturity
was assumed to be 60 days10. The period of
time from treatment to zero-viability of cysts
was 28 days8.
Financial input
The discount rate used was 10%. The cost of
treating a human against the adult tapeworm with praziquantel entered was
US$1.6011,12. The cost of treating a pig with
oxfendazole entered was US$1.608. The price
of pigs by sex and age was estimated from
the PRA interviews and from previously
published literature13.
443
Output
Output without intervention
When no interventions were applied, there
were small changes due to seasonal effects
but otherwise the number of tapeworms and
cysticercosis prevalence remained more or
less constant over time.
Mass treatment of human population
Seasonality factors
Seasonality factors were determined from
the follow-up study, PRA interviews and
from a pork marketing study in Huancayo,
Peru13. Seasonality effects were considered
for porcine mortality/offtake rate, infection
probability, prices of pigs and farrowing.
Control strategies
A set of control strategies was tested after
optimizing their effects against the parasite.
First, the effect of mass treatment of
humans in controlling T. solium with several schemes using different coverage and
interintervention periods was evaluated.
The best approach was then further
improved by adding intervention/s against
porcine cysticercosis.
Simulation input
The time period for simulation depended
upon its objective. It was considered that
simulating more than 67 months was less
likely to provide information that could be
used to design or evaluate a control programme. The simulation was run for a total
of 2000 days. The simulation model was
designed to test the effect of different strategies on T. solium populations. Therefore, the
main output of the model was devoted to
document changes in adult and larval forms
over time in a graphical manner. This constitutes a limitation of the model since the
output does not allow direct quantitative
comparison of two strategies. The final
graph was made after averaging the daily
results of a number of repetitions.
Several mass human treatment protocols

with different numbers of, and intervals
between, interventions were evaluated. For
practical purposes, the number of interventions was limited to a maximum of 17 consecutive treatments. The model was then run
for every period and number of interventions. The input for both treatment coverage
and efficacy was set at 100%. The main outputs evaluated were the numbers of adult
tapeworms and the prevalence of actively
infected pigs. Mass human chemotherapy
resulted in T. solium extinction in populations when at least 11 interventions were
made. The 90-days interval was the most
efficient strategy because it took less time to
eradicate both forms of the cycle (Table 44.1;
Fig. 44.3a and b). Mass human chemotherapy resulted in T. solium extinction in populations when at least 11 interventions were
made. The 90-days interval was the most
efficient strategy because it took less time to
eradicate both, adult and larval forms of the
cycle (Table 44.1; Fig. 44.3a).
Not surprisingly, the efficacy of mass treatment of humans depended upon the maximum life expectancy of pigs. The control
strategy blocked the transmission at the tapeworm level, not considering the intermediate
host. Consequently, as long as there was the
small possibility of survival of an infected pig,
the disease could always be re-established.
The second variable evaluated for the human
intervention was the human treatment coverage. When human coverage was reduced
from 100% to 90%, T. solium could not be
eradicated from the area even after 17 interventions. At 90% treatment coverage, 18 interventions with 90-day intervals were required,
implying a total treatment period of 4.4 years.
444
Table 44.1. Results of different intervention schedules in humans, considering a treatment coverage of 100%.
Number of interventions until parasite extinction
Intervention
interval
10
11
12
13
14
15
40
50
60
70
80
90
100
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
No
Yes
Yes
No
No
No
Yes
Yes
No
No
No
No
No
No
No
No
Yes
Mass treatment of human and porcine

population
It was observed that treating the human
population alone was insufficient; the strategy required 800 days, and involved a large
number of interventions and considerable
cost and effort. Therefore, the effect of
adding pig treatment to human mass
chemotherapy was evaluated systematically.
Briefly, the starting point considered was 11
consecutive interventions in the human population with a 90-day interval and a 100%
human coverage. Then, a number of interventions in pigs were added, also assuming
100% coverage and an interval of 90 days.
The addition of one intervention in the
porcine population did not decrease the
number of human interventions (Fig.
44.3c). However, the addition of two interventions in the porcine population reduced
the number of human interventions to
three (Fig. 44.3d). Further increase in the
number of porcine interventions did not
improve T. solium control.
Evaluation of the strategies that considered 100% coverage in the porcine population and 90% in the human population
demonstrated that intervening in both
humans and pigs decreased the total number
of interventions in the human population.
Table 44.2 presents the results of evaluating a
range of strategies to control T. solium. It was
found that intervening twice in the porcine
population with an interval of 180 days
decreased the required number of interventions in humans from 18 to 12 mass treatments. This effect could be further enhanced,
if five interventions were considered in the
porcine population. The latter strategy

required nine interventions in humans to
eliminate the parasite from both human and
porcine populations.
Evaluating control programmes based on
human and porcine populations with less
than 90% coverage gave disappointing results
in terms of eradication of the parasite. The
success of the different schemes was attributed to the high coverage rates in either or
both populations. However, a target coverage
of 100% is unrealistic since not all humans
accept the treatment and it is very difficult to
treat all the pigs. Besides, it is dangerous and
culturally unacceptable to handle and treat
sows in the later weeks of pregnancy.
Financial analysis
A partial financial analysis was made for the
simulated strategies. This financial analysis
was made considering two variables, sale of
pigs and cost of intervention. The analysis
took no account of financial or economic
costs of human cases. The present value, at
the first day of intervention, of pig sales and
cost was calculated. Table 44.3 presents the
discounted benefit for the control strategies
over the 2000 days of the simulation. Only
the most successful strategy, with three interventions in humans and two interventions in
pigs resulted in a discounted benefit greater
than no intervention. One of the arguments
used to promote cysticercosis control was
that it would result in economic benefits for
the peasants. The results of the simulation
experiment contradict this argument, limiting its scope to those strategies that success-
(a)
61
0.5
49
0.4
37
0.3
24
0.2
12
0.1
May 96
(b)
61
Number of
tapeworms
Cysticercosis
prevalence
May 98
May 99
May 00
0.5
49
0.4
37
0.3
24
0.2
12
0.1
May 97
May 98
May 99
May 00
Simulation date
61
0.5
49
0.4
37
0.3
24
0.2
12
0.1
May 96
(d)
May 97
Simulation date
May 96
(c)
445
May 97
May 98
May 99
May 00
Simulation date
61
0.5
49
0.4
37
0.3
24
0.2
12
0.1
May 96
May 97
May 98
May 99
May 00
Simulation date
Fig. 44.3. (a) Evolution of Taenia solium population after 11 interventions in humans (90-day interval;
100% treatment coverage). Simulation starts November 1995. (b) Evolution of T. solium population after
15 interventions in humans (50-day interval; 100% treatment coverage). Simulation starts November
1995. (c) Evolution of T. solium population after ten interventions in humans (90-day interval; 100%
treatment coverage) and one intervention in pigs (100% treatment coverage). Simulation starts
November 1995. (d) Evolution of T. solium population after three interventions in humans (90-day
interval; 100% treatment coverage) and two interventions in pigs (90-day interval; 100% treatment
coverage). Simulation starts November 1995.
446
Table 44.2. Effect of control strategies that considered mass treatment of human and porcine populations.
Human population treatment
(90% coverage)
Porcine population treatment

(90% coverage)
Number of
interventions
Intervention
interval
Number of
interventions
Intervention
interval
Success
in control
14
10
11
12
9
9
90
90
90
90
90
90
2
2
2
2
3
5
90
180
180
180
180
90
No
No
No
Yes
Yes
Yes
Table 44.3. Financial analysis of control strategies.

Interventions in the human population
Coverage
(%)
Number of
interventions
100
100
100
100
100
90
100
90
90
90
No intervention
15
12
12
11
11
18
3
12
9
9
Interventions in the porcine population
Intervention
interval
Coverage
(%)
Number of
interventions
Intervention
interval
60
70
80
90
100
90
90
90
90
90
0
0
0
0
0
0
100
100
100
100
0
0
0
0
0
0
2
2
3
5
0
0
0
0
0
0
90
180
180
90
fully eliminate the parasite in the short-term.

Results of the benefit analysis also call into
question control programmes that depend
on the sustainability of the strategy.
Apparently, there were no benefits in the
short and mid term, unless the strategy eradicated the disease within 6 months.
Consequently, control programmes that are
unlikely to produce financial gains may
result in failure to retain the confidence of
the producers. It is recognized that this
analysis disregards the long-term benefits
(after 2000 days) that would accrue from parasite elimination from the pig population.
However, it is argued that possible benefits
more than 5 years in the future would be of
little interest to the people concerned.
A major disadvantage of using financial
analysis to determine economical feasibility
is that, their impact upon public health is not
Discounted
benefit
(UK)
9,147.00
28,422.00
28,965.00
35,885.00
35,381.00
1,160.00
91,720.00
53,834.00
54,245.00
54,595.00
83,090.00
considered. Table 44.4 presents the estimated

number of new infections of human cysticercosis with different control strategies.
Although human neurocysticercosis represents a severe disease, the symptoms depend
not only on the infection burden, but also on
the location of the cysts in the brain.
Therefore, it would be difficult to simulate
severity of illness and ultimately, the effect of
disease on other economic variables that
would be relevant to the economic appraisal
of different control strategies.
Limitations
The most important finding of the use of the
simulation model was that treating both
human and porcine populations had a
greater impact upon control of the parasite
447
Table 44.4. Expected number of new cases of human cysticercosis during the simulation period (2000 days).
Interventions in the
human population
Coverage
(%)
100
100
100
100
100
90
100
90
90
90
No intervention
Interventions in the
porcine population
Number of
interventions
Intervention
interval
Coverage
(%)
Number of
interventions
Intervention
interval
15
12
12
11
11
18
3
12
9
9
60
70
80
90
100
90
90
90
90
90
0
0
0
0
0
0
100
100
100
100
0
0
0
0
0
0
2
2
3
5
0
0
0
0
0
0
90
180
180
90
than treating one population alone. The key

variables were treatment coverage and number of interventions. It was clear that lower
treatment coverage required more interventions and, therefore, demanded more time
and financial resources. A cut-off point of
80% coverage for human and porcine populations was therefore established. The omission of human and pig movements into the
population excluded the possibility of reintroduction of parasite during an eradication
programme. However, in practice, it would
be pointless to attempt the elimination of
parasites from a single community that is
surrounded by more infected communities.
Therefore, the model is appropriate for the
evaluation of parasite elimination strategies
at the community level, only in the context
of a wider programme of control involving
multiple communities.
The presence of clusters of T. solium infections has been documented in the past14,15.
However, simulating the events that determine these clusters may obstruct rather than
assist the interpretation of the simulation
output. The main factors that determine the
presence and nature of infection clusters are
human behaviour and the management of
pigs. The simulation of activities related to
those factors is beyond the scope of this
model. Infection clusters represent the
worst-case scenario for control programmes,
because they require high treatment cover-
Number of
new cases
of human
cysticercosis
26.36
26.50
25.47
26.48
27.20
25.10
27.65
28.63
27.80
26.63
27.60
age in order to treat effectively all infected

hosts. Another limitation of the simulation
model is that it does not consider additional
measures that could have an impact on
T. solium populations. Simulating the effect
of additional measures against T. solium also
requires quantitative estimates of the impact
of such measures. The direct and indirect
effect of other measures, such as education
or vaccination, is still in debate. Assuming apriori parameter values and event procedures to simulate the effect of any measure
without previous knowledge could jeopardize the focus of the model. In addition, the
simulation model was designed to provide
information of control strategies in the short
and medium term. Although measures such
as health education and improvement of
sanitary infrastructure have an important
effect on T. solium, these measures are more
likely to be implemented within a long-term
integral development plan for rural communities rather than as specific actions
against T. solium.
Conclusions
A description of the major factors that regulate T. solium and its relationship to porcine
productions systems is crucial to an understanding of the transmission dynamics and
thus to the planning of control programmes.
448
A simulation model that includes porcine,

human and tapeworm populations will
assist in this goal. An economic component
in this model can produce estimates of the
financial impact of the disease, and help to
quantify the costs of control measures
through costbenefit analyses, considering
not only effects on human and animal
health, but also economic optimization.
When predicting the impact of any control
intervention on cestode populations, there is
a need not only to consider how effective the
measure will be in epidemiological terms,
but also to define the benefits and costs for

the institution or community applying the
control16. A number of schedules with various combinations and durations of human
and porcine treatment were evaluated in a
simulation model. Mass human chemotherapy alone proved insufficient to eradicate T.
solium. Concurrent human and porcine treatment was more effective in terms of control
of T. solium. None of the interventions was
economically more advantageous than no
intervention, emphasizing that the core
problem is economic.
References
1. Murrel, K.D. (1991) Economic losses resulting from food-borne parasitic zoonosis. Southeast Asian
3. McLeod, A. (1993) A model for infectious diseases of livestock. PhD thesis. University of Reading,
Reading, UK.
4. Vose, D. (2000) Risk Analysis. A Quantitative Guide, 2nd edn. John Wiley & Sons, New York, 417 pp.
5. Evans, J.R., Olson, D.L. (1998) Introduction to Simulation and Risk Analysis. Prentice Hall, Englewood
Cliffs, New Jersey, pp. 279.
6. Gemmell, M. (1996) Current knowledge of the epidemiology of the family Taeniidae: operational
research needs in planning control of Taenia solium. In: Garca, H.H., Martnez, M. (eds)
Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 231258.
7. Roth, J.A. (1992) Immune system. In: Leman, A.D., Straw, B.E., Mengeling, W.L., et al. (eds) Diseases
of Swine. Iowa State University Press, Ames, Iowa, pp. 2139.
9. Allan, J.C. (1996) Detection of Taenia solium antigens in faeces. In: Garca, H.H., Martnez, M. (eds)
Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 327340.
10. Craig, P., Rogan, M., Allan, J. (1996) Detection, screening and community epidemiology of taeniid
cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in
11. Gilman, R.H., Garca, H.H., Gonzalez, A.E., et al. (1999) Shortcuts to development: methods to control the transmission of cysticercosis in developing countries. In: Garca, H.H., Martnez, M. (eds)
Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313326.
12. Gilman, R.H., Garca, H.H., Gonzalez, A.E., et al. (1996) Mtodos para controlar la transmision de la
cisticercosis. In: Garca, H.H., Martnez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial
Universo, Lima, Peru, pp. 327340.
13. Cysticercosis Working Group in Peru. (1993) The marketing of cysticercotic pigs in the Sierra of
15. Garca, H.H., Gilman, R., Gonzalez, A.E., et al. (1996) Epidemiologa de la cisticercosis en el Per. In:
Garca, H.H., Martnez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru,
pp. 313226.
16. Roberts, M.G. (1994) Modeling of parasitic populations: cestodes. Veterinary Parasitology 54, 145160.
17. Dijkhuizen, A.A., Stelwagen, J., Renkema, J.A. (1986) A stochastic model for the simulation of management decisions in dairy herds, with special reference to production, reproduction, culling and
income. Preventive Veterinary Medicine 4, 273289.
Index
Acacia nilotica 165

Acquired immune deficiency syndrome 105,
281283
Adnexal cysticercosis 270
Albendazole
absorption 369
administration in
active neurocysticercosis 378
cysticercal clumps 378
cysticercotic encephalitis 190
extraocular myocysticercosis 275
giant racemose cysticercosis 184, 379
heavy multilesional neurocysticercosis 191,
376
intraventricular neurocysticercosis 184,
205206, 379
meningeal cysticercosis 205206, 379
multiple parenchymal cysticercosis 376
paediatric neurocysticercosis 260
porcine cysticercosis 432433
pregnancy 285, 371
single small enhancing CT lesions 247, 248,
254, 377378
solitary cysticercus granuloma see single
small enhancing CT lesions
spinal cysticercosis 234
taeniasis 415
adverse reactions 371
dosage 371, 380, 381
interactions with
cimetidine 370
dexamethasone 370, 380, 381
food 369370
praziquantel 370
mechanism of action 368
structure 367368
Albendazole sulphone
metabolism 369
structure 368
Albendazole sulphoxide
chiral behaviour 369
elimination 369
half-life 369
in children 369
metabolism 369
structure 368
Amyotrophic lateral sclerosis 231
Angiography 182, 221222, 224225, 312, 314
Animal models
adult T. solium 3536
intramuscular oncosphere assay 79, 153154
T. solium cysticercosis
in mice 2729
natural infection 36
in pigs 36
T. crassiceps cysticercosis 3638
establishment of 3839
hereditary factors in 5960
immune responses in 1819, 3738,
4042
in Qa-2 transgenic mice 5960
intracranial 3842
intraocular 3637
intraperitoneal 38
major histocompatibility complex in
5960
sex hormone interactions 38
Mesocestoides corti cysticercosis
hosts 38
immune responses in 4042
neurocysticercosis
immune responses in 4042
449
450
Index
Animal models continued

in NOD SCID mice 48
Anterior chamber ocular cysticercosis 271, 275
Anticysticercal drugs see Albendazole, Praziquantel
Antibodies
to metacestode factor 29
to metacestode proteases 3132
monoclonal, to diagnostic antigens 343347
polyclonal, to diagnostic antigens 343347
transplacental transfer of 79, 146
see also immunoglobulins, 324338, 343, 440
Antigens
antigen B see Paramyosin
in diagnostic use
adult Taenia see Coproantigen detection
glycoproteins 330331
in antigen ELISA 343347
crude extract 344
HP10 345
H7 344
1F11 344
4F8 344
HP12 347
in porcine cysticercosis 147148
synthetic 333335
surface 336337, 347
from T. crassiceps 333
excretorysecretory 2, 25, 147, 336, 337338
for vaccination
from T. ovis 424, 426
from T. crassiceps 424, 425, 426
from T. saginata 424
recombinant 426
Antigen ELISA see Antigens
Arachnoiditis see Meningeal cysticercosis
Areca catecho 165
Arteritis 179, 180, 201, 222, 224, 292, 297298, 302,
312
Asian Taenia see T. saginata asiatica
Astrocytes see Astrocytosis
Astrocytosis 298
Asymptomatic cysticercosis 15, 18, 25, 105, 378,
415
Atarabine 165
Ataxia 201, 236237
Atheroma 297
Attention deficit 265
B lymphocytes 40
see also Plasma cells
Blasenwrmer 160
Blepharospasm 237
Brucella militensis 284
Bruns syndrome 237
Calcareous corpuscles 290, 308, 309, 312
Calcified cysticercus 105, 312, 313
Canine cysticercosis 113

Canine tapeworm 2
see also T. hydatigena, T. ovis, T. pisiformis
Carbon tetrachloride 165
Cauda equina syndrome 181, 231
CD4+ cells 1618, 26, 3132
CD8+ cells 1618, 3132
Cellular layer 290
Cerebral palsy 259
Cestocidal therapy see Albendazole, Niclosamide,
Oxfendazole, Praziquantel
Cestodaria 1
Charaka Samihita 158
Childhood neurocysticercosis see Paediatric neurocysticercosis
Chinchillas 36, 426
Chlorpheniramine 382
Choreoathetosis 236237
Colloidal stage
CT 315, 323
MRI 320, 321, 323
pathology 292, 294, 295, 307, 308, 311, 323
Communicating cysticercosis 271, 273, 274
Complement 20, 26
Compulsory notification 107
Computed tomography (CT) 313318, 323
cysticercotic encephalitis 190, 316
disseminated cysticercosis 193194
extradural spinal cysticercosis 230
heavy non-encephalitic neurocysticercosis 191
intraventricular neurocysticercosis 202, 316,
318
meningeal cysticercosis 181182, 316318, 319
ocular cysticercosis 274
pseudomuscular hypertrophy 193194
racemose cysticercosis see Meningeal cysticercosis
sellar cysticercosis 235
single small enhancing CT lesions 25225
Control
with health education see Health education
with human taeniacidal therapy 11, 88,
411417, 431, 443446
with porcine chemotherapy 412, 432434,
444446
simulation of 438446
with vaccination see Vaccination, 411, 412
Conus medullaris syndrome 231, 233
Coproantigen detection 336337
Coproparasitological examination see Stool examination
Corticosteroids
interactions with anticysticercal drugs 366,
370, 380, 381
administration in
cysticercotic encephalitis 190, 376377, 381
disseminated cysticercosis 195
Index
heavy multilesional neurocysticercosis 191

hydrocephalus 184185, 381, 390
intraventricular cysticercosis 184
ocular cysticercosis 275, 276, 277
spinal cysticercosis 232, 234
Cranial nerve palsies 169, 178, 181, 190, 302
Cucurbitini 157158
Cuticular layer 290
Cysticercotic encephalitis 173, 189190, 302, 316,
376, 394, 396
Cysticercus bovis 2
Cysticercus cellulosae
development 2, 5, 910, 2526
morphology 23, 910, 177178, 290291, 307
Cysticercus tenuicollis 147148
Cysticercus racemosus see Meningeal cysticercosis
Delirium 265
Dementia 169, 170, 175, 192193, 263, 264, 265266
Dendritic cell 40
Dexamethasone see Corticosteroids
Diabetes insipidus 235
Disseminated cysticercosis 192195, 376377
DNA extraction see Polymerase chain reaction
DNA probes 354
DNA vaccines 426
Dog cysticercosis see Canine cysticercosis
Dot blot assay 5
Dryopteris filix 165
Echinococcus granulosus 332, 417

Economics
of porcine cysticercosis 9, 150151, 440441,
444446
Eggs
environmental distribution 7576, 148, 416,
438439
morphology 5, 89, 336
survival 9
Enzyme-linked immunoelectrotransfer blot (EITB)
anticysticercal treatment, effect of 331
in calcified cysticercosis 330, 333, 359361
in cerebrospinal fluid 330
glycoproteins in 330
in family contacts 117, 258, 360361
in intraventricular neurocysticercosis 202,
330331
in meningeal cysticercosis 183
prevalence in children 257258
prevalence in CT unit 78, 212, 331
prevalence in community 333,
see also Epidemiology
in porcine cysticercosis 76, 79, 85, 148150
in saliva 332
sensitivity of 16, 330331
in single small enhancing CT lesions 16, 247,
451
330, 333, 360361

vaccination, effect of 423
Enzyme-linked immunoelectrotransfer blottaeniasis (EITB-T) 338
ELISA 331333, 359360
in cerebrospinal fluid 332, 343345, 359360
in children 259
in community surveys 107108, 113, 333,
comparison with EITB 87, 332333, 359360
in intraventricular neurocysticercosis 202
in porcine cysticercosis 145146
in saliva 332
in serum 121, 332
in single small enhancing CT lesions 247, 333,
360361
soluble antigens in 335
Encapsulated cysticercosis 300
Endoscopic approach 400408,
see also 204205, 388, 390, 394
Eosinophil 15, 18, 27, 37, 178, 296, 308
Eotaxin 18
Ependymitis 201, 204, 298, 299, 302, 312, 389, 390,
391
Epidemiology
human cysticercosis
in Africa 134135
in Argentina 65, 69
in Bali 113
in Benin 65, 131, 133
in Bolivia 64, 67
in Brazil 107108
in Burundi 131, 133134, 347
in Cambodia 114
in Cameroon 131, 133
in Central African Republic 131, 133
in Cheju Island 120
in China 65, 118
in Ecuador 64, 67, 416
in Europe 66
in Guatemala 64, 67, 94, 95, 96, 417
in Honduras 64, 67, 94, 95, 96, 258
in India 116117
in Irian Jaya 65, 70, 113114, 411
in Japan 65
in Jewish community of New York
130131, 141142
in Kenya 131
in Korea 65, 121
in Laos 114
in Madagascar 65, 131, 133134
in Mexico 6667, 8587, 89, 347, 416
in Nicaragua 96
in Norway 69
in Pakistan 65
in Panama 64, 96
452
Epidemiology continued
human cysticercosis continued
in Papua New Guinea 70, 113114
in Peru 64, 67, 7677, 94, 213, 257258
in Philippines 65, 113
in Senegal 65
in South Africa 65, 131, 133, 134
in Spain 69
in Togo 131, 132133
in Uruguay 65
in United States 69, 70
in Vietnam 65, 113
porcine cysticercosis
in Bali 113
in Brazil 102
in Burundi 134
in Guatemala 97
in Honduras 97
in Indonesia 113
in Irian Jaya 113
in Korea 121
in Mexico 85, 87
in Philippines 114
in Peru 70, 7577, 79
in Tanzania 6566
in Togo 134
seizures 211213, 259
taeniasis
in Bolivia 67
in Central American immigrants 92, 142
in China 118, 414
in Ecuador 67
in Guatemala 67, 69, 9192
in Honduras 67, 92
in Brazil 102
in Burundi 133134
in Indonesia 112113
in Irian Jaya 112113
in Latin America 67
in Korea 118, 120
in Mexico 67, 69, 8385, 87
in Papua New Guinea 112
in Peru 6970, 7677
in Togo 134
Excretorysecretory products see Antigens
Exophthalmos 235
Extradural spinal cysticercosis 229230
Extraocular myocysticercosis 270271
treatment of 275
Extrapyramidal syndrome 236237
Foreign body giant cells 296, 308
Gamma-delta T cells 4042
Geographic information system (GIS) 151152
Index
Glia see Astrocytosis

Gliosis see Astrocystosis
Granular nodular stage
CT 315, 316, 323
MRI 320, 322, 323
pathology 292, 294, 295, 307, 308, 311, 323
Granuloma 296, 302
Headache 107, 132, 169, 190, 200201, 223, 247

Health education 88, 411, 412, 417, 431
Heat shock protein 42
Heavy non-encephalitic cysticercosis 191
Histology of
calcified cysticercus 312
cysticercus 290296, 307
inflammatory reaction 2729, 294, 296, 297
parenchymal cysticercosis 302
Historical contribution of
Aristophanes 157
Aristotle 63, 157
Carl Linnaeus 139, 158
Freidrich Kchenmeister 63, 160
Johann Goeze 139, 158159
Hamilton Fairley 160, 165
Henry B.F. Dixon 160, 162164, 165166
Rudolph Leuckart 158159
Rudolph Virchow 16016, 177, 302
van Benden 158
Verster 2
Vosgien 160
William P. MacArthur 160, 162164, 165166
Yoshino 8, 9
Hooklets 291
Human immunodeficiency virus 281283
Human leucocyte antigens
in human neurocysticercosis 59
in single small enhancing CT lesions 5759
Hyaline degeneration 291, 297
Hydrocephalus
corticosteroids in 184185, 381, 390
incidence 169
in intraventricular neurocysticercosis 200202,
207, 302, 316, 387, 388, 393394
in meningeal racemose cysticercosis 179, 181,
184185, 387
medical treatment of 185, 390
outcome 396
septum pellucidotomy in 405
shunt occlusion in 185, 390, 396
surgical treatment of 184185, 204205, 389394
Torlkidsens procedure for 388, 391
ventriculography in see Ventriculography
ventriculoperitoneal shunts for 184185,
204205, 389394
ventriculostomy for 204, 388, 390, 400, 405
Hymenolepis nana 19, 25, 332, 337
Index
Iridocyclitis 271
Immunity
cellular 1618
humoral 1617
concomitant 19
evasion of 1920, 2532
molecular mimicry in 20
suppression of 20
in taeniasis 421
vaccination, role in 20, 422
Immunoblot 53, 113, 335, 343345, 360
Immunoelectrophoresis 16, 87
Immunoglobulins 16, 17, 19, 20
Immunologically privileged sites 19
Indirect haemagglutination assay 87, 107, 337
Interferon-gamma 1618, 29, 37, 4041
Interleukins 1618, 20, 29, 37, 4041
Intracorporeal vacuoles 291, 308
Intracranial hypertension
in cysticercotic encephalitis 189190
in heavy non-encephalitic cysticercosis 191
incidence in 105, 132, 169, 170, 175, 179, 259
in meningeal cysticercosis 179, 180
surgical treatment of 387394
Intradermal test 337
Intradural extramedullary spinal cysticercosis
229233, see also 181, 182, 233, 302
Intramedullary spinal cysticercosis 229, 232234
Intramuscular oncosphere assay see Animal models
Intraventricular neurocysticercosis 199206
CT in 316, 318
EITB in 330331
ELISA in 202
endoscopic treatment see Endoscopic approach
MRI in 320
pathology 302
pipette suction in 393394
Intravitreal cysticercosis 271272
treatment of 276277
Japanese B encephalitis 283284
Ketoprofen 382
Lacunar syndromes 180, 221, 222

Landau Kleffners syndrome 236
Latex agglutination 343
Lennox Gastaut syndrome 259
Lentil lectin bound-glycoproteins 330331, 335,
359
cDNA to 333334
453
GP 13 330331
GP 14 330331
GP 18 330331
GP 21 330331
GP 24 330331
GP 3942 complex 330331
Leukaemia see Neoplasia
Lid cysticercosis 270, 275
treatment of 275
Lingual cysticercosis 170, 237
Lymphocyte 15, 2627, 29, 178, 290, 296, 308
Macrophage 15, 17, 29, 296, 308

Magnetic resonance imaging (MRI) 318324
cysticercotic encephalitis 190
heavy non-encephalitic neurocysticercosis 191
intradural extramedullary spinal cysticercosis
232
intramedullary spinal cysticercosis 233234
intraventricular neurocysticercosis 202, 204,
320
meningeal cysticercosis 181182, 320, 322
racemose cysticercosis see Meningeal cysticercosis
sellar cysticercosis 235236
single small enhancing CT lesion 246, 252253
stroke 182, 225
Magnetic resonance spectroscopy 324325
Magnetization transfer MRI 321, 322, 324
Major histocompatibility complex
in single small enhancing CT lesions see
Human leucocyte antigen
in human neurocysticercosis see Human leucocyte antigen
in experimental T. crassiceps cysticercosis 5950
Mast cell 40
Meat inspection 146, 412, 422
in Africa 148
in Brazil 102
in Central America 68, 9697
in Korea 121
in Mexico 68, 85
in Peru 68, 151153
Meningeal cysticercosis 177185
arachnoiditis 223, 232, 389, 390, 391
ataxia in 236237
basal meningeal cysticercosis 300301
cortical meningeal cysticercosis 295, 298, 300
CT in 316318
meningitis in 297, 301303
MRI in 319320, 322
pathology 295, 298304
Meningitis see Meningeal cysticercosis
Mental retardation 259
454
Index
Mesocestoides corti see Animal models

Metacestode factor 2629, 30
Metacestode proteases 29, 3132
Metacestodes
development see Cysticercus cellulosae
morphology see Cysticercus cellulosae
of T. saginata 23
of T. saginata asiatica 23
of T. solium 23
Mini-mental state examination 265266
Mitochondrial genome
cestodes 4953
platyhelminthes 4953
T. solium 4953
polymorphisms in 5051
specimen collection for 52
Mood disorder 263, 265266
Mycotic aneurysm see Subarachnoid haemorrhage
Myelography 182, 232
Myoclonus 236
National Epidemiological Surveillance (in Mexico)

8385, 8586, 88
Neoplasia
central nervous system 285286
haematological 20, 283, 285
Neurocysticercosis
active 172, 199
anatomical classification 172
diagnostic criteria 170171
evolutionary classification 172173, 199,
291295, 311312, 313315, 318320, 323
geographic variations in 174
inactive 172173, 199
surgical classification 171172, 388, 396
transitional 172, 199
Neutrophils 27, 37, 308
NK cells 40
Niclosamide
dosage 415
for mass chemotherapy 415, 417
structure 415
Nodular calcified stage
CT 312, 315, 317, 323
MRI 320, 323
pathology 296, 307, 311, 323
Ocular cysticercosis 132, 139, 170, 269278

experimental see Animal models
Omphalia lapidescens 165
Onchocerciasis 132
Oncosphere
morphology 25, 9
penetration of 25
Optochiasmatic cysticercosis 178, 180
Ova see Eggs

Ovary (of Taenia sp.) 25
Oxfendazole
dosage 433
in porcine cysticercosis 433435, 444, 446
structure 433
Paediatric neurocysticercosis 257260
Panhypopituitarism 235
Paramyosin 20, 26
Pars plana vitrectomy 276277
Persisting lesions 244, 252253, 254
Phase MRI 324
Photocoagulation 276277
Phylogeny
of cestodes 12, 4748
T. saginata asiatica 12, 4748
T. solium 12, 47, 4952, 158160
Pig husbandry 411, 412, 422, 440
Pig population
in Brazil 102
in China 117
in India 116
Plasma cells 15, 17, 27, 308
Polymerase chain reaction 351355, 357358
Pork markets
in Peru 151152, 433, 440441
Pork tapeworm see T. solium
Post-ictal lesions 243
Positron emission tomography 324
Praziquantel
absorption 364
adverse reactions 366
administration in
active neurocysticercosis 378
cysticercotic encephalitis 190, 376377
disseminated cysticercosis 194, 376
giant racemose cysticercosis 184, 379
intraventricular neurocysticercosis 205
meningeal cysticercosis 379
occult neurocysticercosis 15, 18, 25, 105,
378, 415
paediatric neurocysticercosis 260
porcine cysticercosis 432
taeniasis 88, 378, 414, 415418, 431, 443446
bioavailability 365
distribution 364365
dosage 367
duration of treatment 367, 380381
elimination 364365
interactions with
albendazole 370
carbamazepine 366
cimetidine 366367
dexamethasone 366, 380, 381
food 365
phenytoin 366
Index
mechanism of action 364

metabolism 364365
pharmacokinetics 364365
in liver disease 365
range of action 363364
structure 363364
single day treatment 367, 380
therapeutic regimens 367
use in children 260, 367
use in pregnancy 285, 366
Prednisolone see Corticosteroids
Pregnancy 284285
Prevalence
human cysticercosis
at autopsy 66, 85, 9394, 9697, 103105,
116, 130, 289
CT based 78, 93, 9596, 103, 107, 113, 117, 331
in epilepsy see Seizure disorder
gender, effect of 92
hospital based 66, 7778, 130, 213
longitudinal study of 77
in neurological disorders 7778, 79, 121,
132
in seizure disorders 6768, 78, 96, 113, 121,
131132, 213
serological see Epidemiology
taeniasis
age, effect of 69, 91, 93, 257
with antigen assays 147
gender, effect of 69, 83, 93
at necropsy 66, 67
in neurocysticercosis 79, 142, 191, 192
porcine cysticercosis
age, effect of 79
at necropsy see Meat inspection
serological 67, 70, 7577, 79, 85, 87, 148,
by tongue examination 66, 67, 79, 85, 87,
145, 148, 423
Proglottides
structure
T. saginata 25, 336
T. saginata asiatica 25
T. solium 25, 336
Pseudomuscular hypertrophy 192195
Psychiatric disorders
incidence 264
treatment of 265
Queen Alexandria Military Hospital 160166
Racemose cysticercosis see Meningeal cysticercosis
Raigan 165
Renal transplant 283
Reticular layer 290
Rodent tapeworm see T. crassiceps
455
Schizophrenia 263
Scolex
T. saginata 25, 290291
T. saginata asiatica 25
T. solium 25, 290291, 336
Seizures 211218, 251255
antiepileptic drugs in 216217, 241, 246, 247,
253254, 260, 283, 285
electroencephalography in 214215
effect of anticysticercal treatment 215217, 247,
254, 379
EITB in 211212, 213
epidemiology of 211213, 259
hippocampal atrophy in 215, 236
incidence 107, 113, 131, 169, 175, 192, 212, 251
mesial temporal sclerosis in 215, 236
outcome 216219, 246, 247, 254255
Sellar cysticercosis 234236
Sentinel pig model 149150
Seroprevalence see Epidemiology
Single small enhancing CT lesions 241248
aetiology 174
antiepileptic drugs in 241, 248, 252, 253254,
377378
albendazole in 247, 248, 254, 377378
CT in 252253
calcified 253
in children 259
diagnostic criteria 252
EITB in 247, 330, 333, 360361
ELISA in 247, 333, 360361
enlarging 246247, 248
genetic factors in 5760
headache in 247
hereditary factors in see Genetic factors in
human leucocyte antigen in see Human leucocyte antigen
incidence 251, 311
in international literature 245, 251
MRI in 246, 252253
outcome 254255
pathology 243, 251252, 307309
persisting lesions 244, 252253, 254
post-ictal 243
prognosis 254255
seizures in 246, 252253
tuberculoma as 241242, 309
Single small enhancing lesions see Single small
enhancing CT lesions
Skull roentgenogram 162163, 312, 313
Slaughterhouse inspection see Meat inspection
Soft tissue roentgenogram 162163, 193, 195,
312313
Solitary cysticercus granuloma see Single small
enhancing CT lesions
456
Index
incidence 175, 229
see also Extradural cysticercosis, Intradural
extramedullary cysticercosis,
Intramedullary cysticercosis
Stereotactic approach 243, 393
Stool examination 24, 336
Strobila 57
Stroke 221226
angiography in 182, 312, 314
arteritis in 179, 180, 201, 292, 297298, 302, 312
incidence in 175
Subarachnoid cysticercosis see Meningeal cysticercosis
Subarachnoid haemorrhage 180, 222, 224
Subconjunctival cysticercosis 270, 271, 274, 275
Subcutaneous nodules 65, 117, 121, 132, 192193
Subretinal cysticercosis 271272
treatment of 276277
Sudden death 237
Synthetic TS 14 (sTS14) 335
Synthetic TS 18 (sTS18) 335
Syringomyelia 231, 302
T lymphocytes 1618, 37, 4042,

see also CD4+ cells, CD8+ cells
T2* MRI 320
T. crassiceps 2, 3642, 5960, 282, 333, 424, 425, 426
T. hydatigena 2, 148, 160
T. saginata
antigens 424
coproantigen detection in 336337
differences from T. solium 25
morphology 25
speciation 2
differences from T. solium 25
in NOD SCID mice 48
morphology 25
speciation 2, 4748
T. pisiformis 2, 160
T. multiceps 2
T. ovis 2, 424, 426
T. solium
antigens 424426
coproantigen detection in 336337
developmental stages 510
EITB-T 338
immune responses in 15, 21, 421
immunodiagnosis 336338
intradermal test in 337
hosts
experimental 5
natural 5
life cycle of 510
life span 8
morphology 25, 336
mitochondrial genome 4953
phylogeny of 12, 41, 4952
reproductive potential 9, 10, 413, 438
reproductive system 78
taeniacidal therapy 414417, 431, 443, 445
treatment see above
vaccination 421
T. taeniaeformis 2
Taeniaestatin 8, 26
Taeniidae 1, 2
Taxonomic status
of T. saginata asiatica see Phylogeny
of T. solium see Phylogeny
of Taeniidae see Phylogeny
Testes 7
Thalamomesencephalic syndrome 180, 222
Th1 response 1619, 37, 4042
Th2 response 1619, 37, 4042
The Cysticercosis Working Group in Peru 7580,
38238
Three-dimensional constructive interference MRI
324
Thymol 165
Toxoplasmosis 281, 284
Transcranial Doppler 226
Transmission
of cysticercosis 9, 6870, 130, 162
imported disease 6970, 121122, 140, 141
introduced disease 69, 70, 111114
risk factors 6870, 8788, 102, 112, 130,
211212, 413414
through flies 8788
through fruits 8788
through household contacts 141142, 258,
414
through immigrants 51, 6970
through water 9, 130
Trapped ventricle 324, 391
Traubenhydatiden 160, 177, 300, 302
Tuberculoma 241242, 309
Tumour necrosis factor-alpha 18, 29
Tumour necrosis factor-beta 16, 17
Ultrasound 273, 274, 275
Vaccination
cysticercosis 20, 411, 412, 422427
DNA 426
in field studies 424427
preparation of 424, 425426
Index
protective 422, 424, 426427

recombinant antigens in 426
therapeutic 422, 423424
taeniasis 421
Vagina 24, 7
Vasculitis see Arteritis
Ventriculography 312, 314, 316, 318, 389, 390
Vesicular stage
CT 311, 314, 315, 323
MRI 318, 319, 323
pathology 291, 292, 294, 295, 307, 333
Wandtafeln 158159
457

Taenia Solium Cysticercosis

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Taenia Solium Cysticercosis

Uploaded by

Copyright:

Available Formats

Taenia solium Cysticercosis

From Basic to Clinical Science

Taenia solium Cysticercosis

CABI Publishing is a division of CAB International

CAB International 2002. All rights reserved. No part of

Typeset in Palatino by Columns Design Ltd, Reading, UK

TAENIA SOLIUM CYSTICERCOSIS: BASIC SCIENCE

1. Taenia solium: Basic Biology and Transmission

2. Taenia solium Cysticercosis: New and Revisited Immunological Aspects

3. Molecular Determinants of HostParasite Interactions: Focus on Parasite

4. Animal Models of Taenia solium Cysticercosis: Role in Understanding

7. Taenia solium Cysticercosis: an Overview of Global Distribution and

9. Epidemiology of Taenia solium Taeniasis and Cysticercosis in Mexico

11. Neurocysticercosis in Brazil: Epidemiological Aspects

12. Taenia solium Taeniasis and Cysticercosis in Asia

13. Taenia solium Cysticercosis in Africa

15. Porcine Cysticercosis

16. Taenia solium: A Historical Note

TAENIA SOLIUM CYSTICERCOSIS: CLINICAL ASPECTS

17. Neurocysticercosis: an Overview of Clinical Presentations

18. Meningeal Cysticercosis

19. Heavy Multilesional Cysticercotic Syndromes

20. Intraventricular Neurocysticercosis

21. Neurocysticercosis and Epilepsy

22. Cerebrovascular Manifestations of Neurocysticercosis

23. Taenia solium Cysticercosis: Uncommon Manifestations

24. The Story Behind Solitary Cysticercus Granuloma

25. Seizures Due to Solitary Cysticercus Granuloma

26. Paediatric Neurocysticercosis

27. Psychiatric Manifestations of Neurocysticercosis

28. Taenia solium Cysticercosis: Ophthalmic Aspects

29. Neurocysticercosis: Diagnosis and Treatment in Special Situations

30. The Pathology of Neurocysticercosis

NEUROCYSTICERCOSIS: INVESTIGATIONAL ASPECTS

32. Imaging and Spectroscopy of Neurocysticercosis

34. Antigen-based Immunoassays in the Diagnosis of Taenia solium Cysticercosis

35. Polymerase Chain Reaction in the Diagnosis of Taenia solium Cysticercosis

36. Immunodiagnosis in Solitary Cysticercus Granulomas

TAENIASISCYSTICERCOSIS: THERAPY AND PREVENTION

37. Pharmacology of Anticysticercal Therapy

38. Controversies in the Drug Treatment of Neurocysticercosis

39. Neurocysticercosis: Neurosurgical Perspective

40. Endoscopic Management of Intraventricular Cysticercosis

41. Control of Taenia solium with Emphasis on Treatment of Taeniasis

42. Taenia solium Vaccination: Present Status and Future Prospects

43. Control of Taenia solium with Porcine Chemotherapy

44. Use of a Simulation Model to Evaluate Control Programmes against Taenia

Svetlana Agapejev, Department of Neurology and Psychiatry, PO Box 540, School of

Seppo Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21

CAB International 2002. Taenia solium Cysticercosis

CAB International 2002. Taenia solium Cysticercosis

Taenia solium: Basic Biology and

would take time in several developing countries where cysticercosis is endemic.

Taxonomic Status of T. solium

CAB International 2002. Taenia solium Cysticercosis

comprises 11 genera of small to large sized

Differences between T. solium, T. saginata

nata, and less frequently T. solium adult

Brain, skin, muscle

Pig, wild boar

Pig, cattle, goat, some wild mammals

Basic Biology and Transmission

Basic Biology and Transmission

support speciation of T. saginata asiatica as a