Professional Documents
Culture Documents
Name:_______________________________________
Course:__________________
N________
1st Exam (14th of January 2013)
Molecular Biotechnology
Duration: 2h15min
The obligate anaerobe Bacteroides fragilis is an indigenous inhabitant of the gastrointestinal
tract of humans, where it contributes to normal host function, but it is also a significant
opportunistic pathogen. B. fragilis is usually associated with peritonitis, intra-abdominal
abscess and bacteremia. Thus, during the course of infection, B. fragilis must adapt from the
anaerobic, highly reducing colon to a new, more oxidizing environment. Aerotolerance has
been linked to a robust oxidative stress response, which in turn is necessary for maximal
virulence in a mouse intra-abdominal abscess model. During oxidative stress, there is a
dynamic change in gene expression, but there is paucity of information on factors that
control this response. During this study, the sigma factor EcfO and the anti-sigma factors
Reo were found as important for survival during exposure to oxygen or other forms of
oxidative stress. (Consider the genome sequence of this bacterium is known).
1- To test the role of protein EcfO in oxidative stress response and aerotolerance, the
authors needed to construct an ecfO gene deletion mutant.
a) By using the suicide vector pFD516 (lacZ+, gusA+, erythromycinR), describe the full
strategy to obtain the ecfO gene deletion mutant. (2.5 points)
b) Describe how you could use a DNA sequencing technique to confirm that the ecfO gene
is deleted in your mutant. Please describe how you would get the DNA sequence target
and the sequencing steps until data analysis. (2.0 points)
c) How could you test whether the mutation in B. fragilis had influence in aerotolerance?
Please refer the control experiments you would do. (1.0 point)
3
d) Next, an experiment was designed to determine if the loss of EcfO could be
complemented by introducing the gene under the control of its own promoter. Describe
what type of vector you would use, the cloning procedure as well as the phenotype
recovery test. (1.5 points)
2- It is common that sigma factors are regulated by an anti-sigma factor located within the
same genetic locus. Since the gene reo is cotranscribed with gene ecfO, the authors
tested interaction between the two proteins by using the bacterial two-hybrid (BATCH)
system. Describe the genetic constructs you would have to prepare as well as the
interaction test and type of results obtained. (2.5 points)
4
3- Next, the authors wanted to know whether the interaction between EcfO and Reo in B.
fragilis occurs at the cytoplasm or the cytoplasmic membrane. Propose an in vivo
experiment to localize both proteins within the cell. Describe all the biological materials
you would need and the experimental procedure that you would follow. (2.0 points)
4- Expression Genechip arrays for B. fragillis were used to help identify genes activated by
EcfO. The experimental strategy was designed to induce ecfO gene expression in the
absence or presence of its inhibitor Reo. Describe all steps of this experiment until you
get a list of differentially expressed genes. (2.5 points)
5
5- Selected the correct answer by drawing a circle (0.5 points each):
6
b) experimental tool for specific gene silencing
c) method that has no effect in gene expression
d) experimental tool for specific DNA degradation
10) Which of these conclusions might be drawn from the results of a 2D-SDS-PAGE experiment?:
a) levels of mRNA expression for two genes are lower under one set of conditions than another
b) the lack of protein expression is due to production of unstable mRNA, which is rapidly degraded
c) a mutation prevents proper posttranslational modification of a protein
d) none of these are reasonable conclusions
11)
a)
b)
c)
d)
12)
If you have the sequence 5ATGCCTGGACCTTAACGCGCCTAGGTATCTTGA3 and need
11-mer oligonucleotides for PCR, their sequences will be:
a) ATGCCTGGAC e TCAAGATACCT
b) TACGGACCTGG e TCAAGATACCT
c) ATGCCTGGACC e TCCATAGAACT
d) ATGCCTGGACC e TCAAGATACCT