You are on page 1of 14

Programa de Ps-graduao Multicntrico em Qumicade

Minas Gerais Universidade Federal do Vale do


Jequitinhonha e Mucuri

Isolamento e caracterizao de bactrias resistentes a


arsnio com potencial de aplicao em processos de
biorremediao.

Orientador: Prof. Dr. Jairo Lisboa Rodrigues


Co-orientadora: Prof.Dr.Cleide Aparecida Bomfeti
Aluna: Naidilene Chaves Aguilar

Tefilo Otoni, Fevereiro 2015

I REVISO DA LITERATURA
1. Arsnio
O arsnico onipresente no ambiente e altamente txico para todas as formas de vida. um
"metalide" cristalino, um elemento natural com caractersticas intermedirias entre os metais e no-metais,
ocorre naturalmente como um elemento, classifica-se como a 20 maior ocorrncia de oligoelemento na crosta
da Terra, 14 na gua do mar, e 12 no corpo humano (MANDAL & SUZUKI, 2002).
O As pode ser encontrado em guas superficiais, guas subterrneas, sedimentos, solos e poeira, bem
como em plantas e animais (MAITY et al., 2004; BAIG et al., 2009; TUZEN et al., 2010). Ele est distribudo
em uma grande variedade de formas qumicas, podendo sofrer transformao por ao de microrganismos, por
mudanas nas condies geoqumicas ou envolver-se em outros equilbrios influenciados pela presena de
outros ons ou compostos no meio ambiente. Sabe-se que a toxicidade do As depende de sua forma qumica e
que as formas inorgnicas so mais txicas do que as espcies orgnicas, sendo que a trivalente (arsenito)
mais txica que a penta valente (arsenato) (TUZEN et al., 2010). O arsnio existe principalmente em quatro
estados de oxidao - arsenato(V ), Arsenito (III ), Arsnio ( 0 ), e arsina (-III ) Entre eles, o As V a forma
mais estvel ( SHARMA & SOHN, 2009 ; ZHAO et al, 2010. ; GUPTA et al, 2011. ) enquanto o AsIII
predominante no ambiente redox reduzido, sendo necessrio a especiao desse elemento para diferenciao
de suas formas.Assim como muitos elementos, o As tem um ciclo biogeoqumico (Figura 1) que envolve
diversos processos fsico-qumicos tais como xi-reduo, precipitao/solubilizao e adsoro/dessoro;
bem como biolgicos. A mobilizao do As pode ocorrer atravs de uma combinao de processos naturais,
tais como reaes de intemperismo, atividadebiolgica, emisses vulcnicas, e tambm por atividades
antropognicas.
Figura 1_Ciclo biogeoqumico do As no ambiente

Aproximadamente 99% do As no ambiente esta associado a rochas eminerais. Ele est presente em
mais de 200 minerais, sendo que cerca de60% na forma de arsenato, 20% na forma de arsenossulfetos com
metais como Fe, Pb, Cu, Ag e Tl e o restante na forma de arsenitos, arsenetos, xidos e arsnio elementar
(MANDAL & SUZUKI, 2002; ASSIS, R., 2006). Ele e umelemento que apresenta alta afinidade pelo enxofre,
resultando em uma baixamobilidade para outros compartimentos ambientais quando como constituintede
minerais sulfetados (MANDAL & SUZUKI, 2002; FIGUEIREDO, 2010). Aliberao do As a partir das
rochas mineralizadas ocorre por oxidao da arsenopirita por O2 ou por Fe3+, por meio de processos biticos
ou abiticos (RODRIGUES, 2008).
Alguns fatores comobaixa porcentagem de granulometria fina do substrato, baixos valores de pH,calor
e exposio a gua e ao oxignio podem favorecer a oxidao domineral (ANDRADE et al., 2008), com
consequente liberao de As para asoluo do solo e para os cursos dgua, como mostra a Equao 1
(WELCH et al., 2000):

2FeAsS + 7O2 + 8H2O

2Fe(OH)3 + 2H3AsO4 + 2H2SO4 (Eq.1)

A principal fonte de As no ambiente (hidrosfera, pedosfera, biosfera e atmosfera) o lanamento a


partir de minrio, arsnio-enriquecido. O arsnio um dos elementos freqentemente associado
particularmente a minrios de ouro e prata, sendo o mais comum, a arsenopirita, que o principal minrio de
As (MANDAL & SUZUKI, 2002; DESCHAMPS & MATSCHULLAT, 2007). As fontes de As so naturais
ou atravs de dissoluo de compostos de As adsorvido em minrios de pirita na gua por fatores geoqumicos
e antropognicos atravs do uso de inseticidas, herbicidas e fertilizantes fosfatados, indstrias de
semicondutores, minerao e fundio pr-industrial, processos de combusto de carvo, conservantes de
madeira etc. (BUNDSCHUH et al, 2011.)
O arsnio pode ainda ser pr-enviado ao ambiente de vrias formas qumicas, tais como cido
monometilarsnico [MMA; CH3AsO(OH)2], cido dimetilarsnico [DMA; (CH3)2AsOOH], trimetil arsnio
xido [TMAO; (CH3)3AsO], arsenobetaine [AsB; (CH3)3 AsCH2COOH], arseno - colina [ASC], arsnio
acar [AsS], arsnio lipidis etc. ( TANGAHU et al.,2011 ).
Descobertas recentes sugeriram a seguinte ordem em termos de toxicidade aguda sendo como: MMA
(III) >As (III) >As (V) >DMA (V) >MMA (V), onde o metabolito do MMA (III) o composto mais txico e
alguns investigadores considerou ser o centro de modo de ao (EFSA, 2014 ;KILE et al., 2011 ; WEN et al,
2011. ).Com base em todas as evidncias que relacionam a ocorrncia de efeitos toxicolgicos crnicos e a
ingesto de gua contaminada por arsnio, vrios rgos governamentais de controle ambiental recomendam a
reduo nos limites mximos admissveis para arsnio em gua potvel.

2.2. Contaminao por arsnio no Brasil

Amineraotemcontribudoparaa disperso ambiental de As e de outros elementos qumicos txicos


no

ambiente.

Umexemplodissoaaltaconcentraoemregiesdemineraocomooquadrilteroferrfero

Amaznia(MATSCHULLAT,
2000).NoAmap(SerradoNavio),devidoatividademineradorademangans,ocorreu a contaminao de guas,
com valoresencontrados emguapotvel emtornode8,43g/L (SANTOS et al., 2003).
No Brasil, os primeiros registros de anlise da concentrao de arsnio no solo foram efetuados por
CURI & FRANZMEIER em 1987. Esses autores encontraram teores de As em Latossolo Vermelho
distrofrrico variando de 6 a 10mg kg-1. Teor mdio total de As de 5,92mg kg-1foi observado em 15
Latossolos localizados em reas experimentais da Embrapa e dois Latossolos do campus da UFLA, MG
(CAMPOS et al., 2007).
Em Minas Gerais, foram constatadas nas cidades de Nova Lima, Ouro Preto, Mariana e Santa Brbara
cursos de gua e aquferos com alta concentrao de As (at 7000 g L-1) (BUNDSCHUH et al., 2011).
Pesquisas realizadas com amostras de gua coletadas em minas subterrneas, poos artesianos e nascentes das
regies de Ouro Preto e Mariana, apresentaram concentraes de arsnio variando entre 2 a 2.980 g.L-1,
sendo que, na maioria das amostras, os valores so superiores ao valor mximo permitido para consumo
humano que de 10 g.L-1 (BRASIL, 2005) de arsnio (PIMENTEL et al., 2003).
Ainda em Minas Gerais, mais especificamente na cidade de Paracatu, a extrao mineral do ouro
iniciou suas atividades em meados de 1987 e, para sua extrao, so gerados rejeitos que contribuem
consideravelmente com a contaminao ambiental com As. O processo de minerao que ocorre na cidade de
Paracatu, conta com minrios que possuem um teor muito baixo de ouro, sendo aproximadamente 0,44 g de
ouro por tonelada de minrio. A composio mineral formada principalmente por sulfetos. Os
predominantes so arsenopirita (As) e pirita (ferro) com pirrotita (pirita magntica) e quantidades menores de
calcopirita (cobre), esfalerita (zinco) e galena (chumbo) (Costa Jnior, 1997). Para a recuperao do ouro, o
minrio britado, finamente modo e depois submetido a processos de separao gravimtrica e flotao, que
produzem um concentrado com a composio mdia de 58,3g de Au/t, 15.2% Fe, 21.9% S e 11% As. Esse
concentrado submetido a processos de hidrometalurgia, eletrlise e refino. Assim sendo, sempre h uma
grande quantidade de As no rejeito gerado com o beneficiamento para obteno do ouro.
A quantidade de As liberado das rochas da mina de ouro foi estimada em 300 mil toneladas, onde cerca de
70% esto em duas grandes barragens de rejeitos. Alm disso, em 2008 as concentraes de As detectadas no solo
de diferentes locais da cidade de Paracatu variaram entre 32 mg/kg a 2980 mg/kg (ONO et al., 2011). . Ono et al.
(2009, 2012a, 2012b) avaliaram a concentrao de As em solos prximos da rea de minerao no Morro do
Ouro e para efeitos de comparao tambm em uma rea afastada pertencente a uma Reserva Particular de
Preservao Natural (RPPN) no municpio. Na RPPN, a concentrao total de As foi de 25 mg/kg, acima do
valor de referencia de qualidade preconizado pelo CONAMA 420/2009 (3,5 mg/kg), j nas reas da mina, as
concentraes totais de As variaram de 200 a 1900 mg/kg, ultrapassando o limite para interveno em rea.
4

Nota-se diferena significativa nas concentraes, mas deve-se perceber tambm que mesmo na RPPN, o
valor j e elevado, devido arsenopirita natural na regio. Essas elevadas concentraes podem aumentar o risco
da contaminao do ar, solo, gua e alimentos, comprometendo a sade da populao local.
A concentrao de As observada em alguns alimentos significativos amplamente varivel e
dependente de inmeros fatores. Em geral valores mdios desse elemento (em ng/g de peso mido) em peixes
podem variar entre 160 e 2.300 para peixes marinhos, ente 400 e 3.000 para crustceos (camaro), entre 20 e
500 para peixes de gua doce, e entre 200 e 500 para o arroz (JACKSON et al., 2012; BATISTA et al., 2011).
Dentre os alimentos de origem terrestre, o arroz tem significativa importncia, uma vez que capaz de
acumular esse elemento. Sendo um alimento capaz de concentrar o As e de amplo consumo, pois faz parte da
dieta bsica do brasileiro, o arroz contribui de maneira importante para a quantidade diria ingerida. Em
realidade existem muitas informaes sobre a concentrao de As e de suas formas qumicas principais no
arroz, mas muito pouca informao est disponvel sobre essa concentrao em seus produtos, como, por
exemplo, nos alimentos em que o arroz substitui o trigo (CUBADDA et al.,2010; BUNDSCHUH et al., 2012).
No Brasil, a anlise de 44 amostras de vrios tipos de arroz provenientes de diversas regies do Pas
mostraram concentraes mdias de As total de 222,8 ng/g, com cerca de 25% delas apresentando
concentraes superiores aos limites recomendados pelo Codex. As formas inorgnicas e o DMA foram as
espcies mais abundantes (BATISTA et al., 2011).
Por outro lado, o As geralmente encontrado em concentraes mais baixas no trigo (cerca de uma
ordem de grandeza menor) quando comparado ao arroz, mas no trigo predomina a forma inorgnica (at
70%). Isso corrobora a afirmao de que o trigo o maior contribuinte para a ingesto de As inorgnico
atravs da dieta, quando esta rica em seus derivados (CUBADDA et al., 2010; CODEX, 2012).

2.3.Biorremediao de Arsnio

Em solos contaminados por metais pesados, a biorremediao ocorre no sentido de transformar estes
metais em suas formas menos txicas ou inertes. Um dos grandes problemas da presena de metais pesados no
ambiente o fato de que eles no sofrem decomposio e, portanto, no podem ser destrudos. Alm disso,
eles so recalcitrantes e podem acumular nos seres vivos, causando distrbios nas cadeias alimentares
(GUEDES, 2011). Os metais representam um fator de estresse comunidade microbiana presenteno ambiente
impactado, podendo, inibir completamente as atividades metablicas dosorganismos. (LIVREMONT et al.,
2009).
A aplicao de processos biotecnolgicos envolvendo microrganismos com o objetivo de solucionar
ou minimizar problemas de poluio ambiental com metais txicos, tem se tornado crescente. So diversos os
mecanismos microbianos de remoo do arsnio, que podem ocorrer por adsoro, desmetilao,
biometilao, complexao, coprecipitao, e processos de oxido-reduo (TEWARI et al., 2009).
De modo geral, a remoo de metais pode ocorrer por mecanismos de adsoro na superfcie
microbiana. Essa adsoro resulta na interao entre foras atrativas que podem ser fsicas ou qumicas. A
5

interao fsica envolve foras de van der Walls, e a qumica atravs de ligaes covalentes entre constituintes
funcionais presentes na parede celular bacteriana e o metal (FARAHAT et al., 2010).
Alm disso, existem polmeros bacterianos de superfcie que podem complexar ons metlicos. Entre
os principais polmeros da parede celular bacteriana envolvido em processos de adeso a minerais esto os
exopolissacardeos (EPS) que permitem o aprisionamento fsico de metais e a complexao de espcies
solveis por constituintes carregados dos polmeros (KIM et al., 2010; REN et al., 2010).
Estudos indicam ainda, que as atividades de algumas enzimas bacterianas tambm esto relacionadas
com a tolerncia a alguns metais, alm de exercer um importante papel de proteo por meio de aes
antioxidantes que evitam danos oxidativos celulares que podem ocasionar at a morte celular (AZCON et al.,
2010; MARTINS et al., 2010). As bactrias que utilizam os ons arsenato no processo de respirao anaerbia,
(bactrias redutoras de arsenato) apresentam o gene arrque codifica a enzima As5+ redutase que reduz o As5+
a As3+. As bactrias oxidantes de arsenito possuem o gene aoxque codifica a enzima As3+ oxidase,
responsvel pela oxidao do As3+ a As5+ (LIVREMONT, 2009).
O processo de bioacumulao ou acumulao intracelular de metais, ocorre via metablica e dentro
das clulas os metais podem sofrer transformaes como biometilao, desmetilao, complexao,
coprecipitao e processos de oxidao/reduo sendo ento convertidos em formas menos txicas (WANG &
ZAO, 2009).
O processo de bioacumulao mais lento que a biossoro superficial, no entanto, esse processo tem
se mostrado muito eficiente e a utilizao combinada desses dois permite aumentar o percentual de remoo
bacteriana do metal (VELSQUEZ e DUSSAN, 2009).
O uso de bactrias para a remediao de ambientes contaminados com arsnio desde recursos
aquferos, solos, lavras de minas e efluentes parece ser portanto, uma alternativa promissora, pois a biomassa
microbiana apresenta maior facilidade de tratamento e descarte em comparao com os demais organismos
vivos como as plantas, por exemplo. Alm disso, essa biomassa pode ser ainda utilizada em processos de
obteno do metal para aplicaes industriais (HUISMAN et al., 2006; MORIN et al., 2008).
Desse modo, a utilizao de bactrias no processo de biorremediao de ambientes contaminados com
metais txicos tem despertado um interesse tanto acadmico como de empresas ligadas ao ramo da minerao
e metalurgia, uma vez que as bactrias apresentam uma ampla diversificao metablica, possibilitando
inmeros estudos relacionados a esse grupo.

II OBJETIVOS E JUSTIFICATIVA
Geral
O presente trabalho tem como principal objetivo o isolamento, a identificao e a caracterizao de bactrias
resistentes ao Arsnio presentes em amostras de solo coletadas ao longo do Crrego Rico no municpio de

Paracatu/MG, visando uma potencial aplicao na biorremediao de ambientes contaminados, utilizando a


tcnica da Espectrometria de Massas com Plasma Acoplado Indutivamente (ICP-MS).
Especficos
Este projeto possui metas bem determinadas que vo desde:
1 Isolar bactrias presentes em amostras de solo coletadas ao longo do Crrego Rico no municpio de
Paracatu/MG.
2- Testar a capacidade de crescimento desses isolados durante o cultivo em meio contendo arsnio com
concentraes crescentes desse elemento.
3 Identificar os isolados com crescimento potencial em altas concentraes de arsnio por meio do
sequenciamento do gene 16S rRNA.
4 Avaliar a capacidade dos isolados bacterianos em oxidar o arsnio.
5- Determinar a concentrao de As nos isolados de bactrias, no solo, nos exopolissacardeos, bem como no
meio de crescimento dos microrganismos.
6- Avaliar a capacidade das bactrias isoladas em acumular arsnio na clula e nos exopolissacardeos.

A alta toxicidade de As para homens e animais, aliado pequena disponibilidade de informao sobre
comportamento do arsnio em solos tropicais gera a necessidade de estudos do comportamento qumico do
arsnio nesses solos que possam auxiliar na mitigao de reas contaminadas com esse metal e sua interao
com micro-organismos ali presentes. Compreender estas relaes importante, pois podem promover avanos
biotecnolgicos no uso de bactrias para biorremediao. O isolamento e o estudo de bactrias resistentes ao
arsnio esto se tornando promissores e de grande importncia qumica, cientfica, tecnolgica e ambiental,
pois criam interessantes perspectivas para o desenvolvimento de biorreatores para aplicao em processos de
biorremediao de efluentes contaminados, como os lanados nas bacias de rejeitos nas mineradoras de
extrao de ouro como ocorre no municpio de Paracatu/MG.
III MATERIAIS E MTODOS
5.1. rea de Estudo e Amostragem
Sero escolhidos cinco pontos de coleta ao longo do Crrego Rico, desde a proximidade da sua nascente
(regio limite da entrada da mineradora KinRoss) at pontos mais distantes e prximos do ponto de desgua
no rio Paracatu. As amostras de solo sero coletadas na profundidade de 0-20 cm, e armazenadas em sacos
plsticos estreis (marca NASCO), que sero posteriormente mantidos sob refrigerao. Parte das amostras
sero utilizadas para posterior anlise qumica e outra parte para o isolamento de bactrias resistentes.

5.2. Anlises Qumicas


Para determinao da concentrao de arsnio, as amostras de solo sero submetidas extrao cida
(cido ntrico concentrado e sub-destilado) por trs horas em bloco digestor 120oC(MEHARG and
RAHMAN, 2003), para posterior anlise. Para a determinao de As no solo, ser utilizado o mtodo analtico
proposto por (LAWRENCE et al., 2006), utilizando espectrmetro de massas com plasma acoplado
indutivamente (ICP-MS), modelo NexIon (PerkinElmer). A tcnica de ICP-MS fundamenta se no uso de altas
temperaturas do plasma para gerao de ons positivamente carregados (M+),a amostra introduzida num
plasma de argnio sob a forma de um aerossol de partculas lquidas muito pequenas. Para o efeito usa-se uma
bomba peristltica, um nebulizador e uma cmara de nebulizao. No seio do plasma (8000 - 9000oC) o
solvente evaporado e os componentes da amostra so decompostos nos seus tomos, que depois se ionizam,
os quais so posteriormente separados em um espectrmetro de massa e, finalmente conduzidos ate o detector.
A tcnica de IPC-MS tem como principal vantagem a possibilidade de anlise multielementar (isotpica)
seqencial rpida, associada a alta sensibilidade. Cerca de 90% dos elementos da tabela peridica podem ser
determinados, com limites de deteco na ordem de 0,001 a 0,1 g L-. O maior problema no preparo de uma
amostra para anlises na faixa de g L-1 o risco de contaminao, devido a diferentes causas. Uma adequada
tcnica de decomposio dever, de uma maneira geral, ser eficiente, evitando erros sistemticos provenientes
de contaminao, sendo por este motivo, importante o uso de reagentes de alta pureza (incluindo a gua
utilizada nas diluies) utilizados em tcnica de ICP-MS.
Sero utilizados reagentes de elevado grau de pureza, no mnimo grau analtico P.A, exceto o HNO 3
que foi previamente purificado utilizando um destilador sub-boiling de quartzo Kurner (Analysentechnik,
Rosenheim, Alemanha) para eliminao de impurezas. Para o preparo das solues foi utilizado gua do Tipo
I (ultrapura) obtida em sistema de purificao Milli-Q Gradiente (Millipore, Bedford, USA).
Os frascos e todos os materiais utilizados no preparo das solues receberam limpeza cuidadosa com
HNO3 15%, enxaguados em gua do Tipo I e posteriormente secos em capela de fluxo laminar antes do uso,
pois a anlise de baixas concentraes de metais em qualquer matriz requer uma limpeza especial do material
a ser utilizado no preparo das amostras e armazenamento das solues.

5.3. Culturas de Enriquecimento e Isolamento de Bactrias


Uma alquota de 5 gramas de cada amostra de solo ser adicionada em um frasco contendo 100 mL de
meio PCA (5 g de triptona, 2,5g de glicose e 2,5 g de extrato de levedura por litro de gua destilada) e 6,75
mmol/L de arsenito de sdio (NaAsO2). Os frascos sero em seguida incubados a temperatura de 30 C em
condies estticas no escuro. Aps 2 semanas de cultivo as culturas turvas sero estriadas em placas de Petri
contendo o mesmo meio de cultura suplementado com arsnio utilizado anteriormente. Colnias bacterianas
apresentando diferentes formas, cores e bordas sero purificadas por estriamento e armazenadas a -80 C em
uma soluo de 30% de glicerol.

5.4. Determinao da Concentrao Mnima Inibitria


As bactrias resistentes a arsnio isoladas de amostras de solo tero sua concentrao mnima
inibitria (MIC) de arsnio determinadas. Cada estirpe crescer em 30 mL de meio PCA sob agitao orbital
de 100 rpm a 30 oC. Aps 24 horas de crescimento, uma alquota de 1 mL de cultura de cada estirpe ser
transferida para microtubos de 1,5 mL esterilizados, e centrifugada a 8.000 rpm, a 25 oC, por quatro minutos.
O sobrenadante ser descartado, e as clulas sero ressuspensas em 1mL de soluo salina estril (NaCl 8,5
g/L) e centrifugadas novamente, repetindo este processo de lavagem por trs vezes. Posteriormente, alquotas
de 20 L de suspenses de clulas lavadas sero inoculadas e estriadas com ala de platina em placas
contendo meio mnimo de acetato (NH4Cl, 1.0g/L; CaCl2.H2O, 0.001g/L; MgSO4.7H2O, 0.2g/L; FeSO4
.7H2O, 0.001g/L; acetato de sdio, 5g/L; extrato de levedura, 0.5 g/L; K2HPO4, 0.5g/L) suplementado com
diferentes concentraes de arsnio variando de 0 a 133,47 mmol/L de arsenito de sdio. Para avaliar a
susceptibilidade dos isolados ao arsnio ser determinada a concentrao mnima inibitria (MIC) a qual
definida como a menor concentrao na qual no ocorreu a formao de unidades formadoras de colnias
(UFC) visveis, aps 3 dias de incubao a 30 oC. Nesta etapa do estudo ser determinado o nmero de
isolados que apresentaram crescimento em cada concentrao de metal a partir de trs repeties.
5.6. Identificao dos Isolados Bacterianos
Para a identificao molecular dos isolados bacterianos, o DNA genmico ser extrado utilizando-se
kits

comerciais,

gene

16S

rRNA

ser

amplificado

utilizando

os

primers

(foward

5AAACTCAAATGAATTGACGG3e reverse 5ACGGGCGGTGTGTAC3). A reao de PCR ser


realizada por uma desnaturao inicial de 94 C por 5 minutos seguidos de 35 ciclos de desnaturao a 94 C
por 1 minuto, anelamento a 55 C por 1 minuto, extenso a 72 C por 2 minutos e extenso final a 72 c por 5
minutos. Aps confirmao da amplificao do gene em gel de agarose 1% o produto ser enviado para
sequenciamento para a empresa Macrogen (Korea). Os resultados dos fragmentos de bases obtidos sero
comparados aos previamente depositados no Genbank (NCBI), sendo possvel a determinao do nvel de
similaridade com vrios isolados bacterianos descritos na literatura.
5.7. Oxidao do arsnio pelos isolados bacterianos
A habilidade dos isolados bacterianos em oxidar o arsenito ser testada atravs da adio desse
composto em meio mnimo de acetato na concentrao de 100 g/mL de arsnio. O meio de cultura controle
ser feito, porm sem a adio do isolado bacteriano. As culturas sero incubadas por 24 horas a 30 C sendo
as clulas separadas do meio por centrifugao a 14000 rpm por 10 minutos e lavadas 2 vezes em tampo
fosfato 50mM e resuspendidas em 5mL desse tampo. As clulas sero ento rompidas por sonicao a 4 C
por 15 segundos e centrifugadas a 14000 rpm por 1 hora a 4 C. O pellet resuspendido em tampo fosfato

representar a frao membranosa enquanto que o sobrenadante a frao solvel. A atividade da arsenito
oxidase ser determinada de acordo com a metodologia descrita por Anderson et al., (1992). A concentrao
de protena ser determinada pelo mtodo de Lowry (1951) depois da hidrlise das clulas em 0,4 N de NaOH
a 100 C por 10 minutos. Albumina bovina ser utilizada como padro.
5.8. Avaliao da capacidade de acumular arsnio pelas clulas bacterianas
Os isolados sero pr-cultivados em Meio Mnimo de Acetato a 30 oC por 24 horas sob agitao. Uma
alquota de 1mL da pr cultura ser transferida para 100 mL de meio com a concentrao mnima inibitria de
arsnio tolerada pelos isolados com maiores potenciais para emprego nos processos de biorremediao. Aps
cultivo a 30 oC por 72 horas sob agitao, as culturas sero centrifugadas a 10000 rpm por 20 minutos, sendo
o pellet bacteriano posteriormente lavado trs vezes com gua deionizada antes de ser usado para os
experimentos de biosoro. O pellet ser digerido em um tubo digestor usando HNO 3 segundo a metodologia
de USEPA 3050B. A concentrao do arsnio ser determinada por um espectrmetro de massas com plasma
acoplado indutivamente (ICP-MS), modelo NexIon (PerkinElmer) (Perkin-Elmer).
5.9. Avaliao da produo de Exopolissacardeos (EPS) pelas bactrias isoladas
A extrao do EPS ser realizada para os isolados em meio Mnimo de acetato lquido suplementado
com as concentraes mnimas inibitrias determinadas previamente para cada isolado com potencial para
biorremediao. O EPS ser extrado do meio de cultura na fase estacionria do crescimento bacteriano
atravs de centrifugao a 13000 g, 4C por 30 min. Ao sobrenadante ser adicionado o mesmo volume de
etanol gelado, sendo posteriormente mantido por 24 horas em repouso sob refrigerao para precipitao do
EPS. Aps a filtragem e coleta do EPS, este ser mantido em estufa de secagem por 48 horas a 70 C. A
produo do EPS total ser avaliada pelo peso seco do produto, por peso seco das clulas.
IV FASES DO TRABALHO E CRONOGRAMA DE EXECUSO
As etapas do projeto proposto seguiro o seguinte cronograma:
Atividades

1
2
3

Meses
3

12

15

4
5

18

21

24

27

30

33

36

10

1 Coletas e anlises qumicas das amostras de solo.


2 Isolamento de bactrias resistentes a arsnio.
3 Determinao da concentrao mnima inibitria para os isolados bacterianos.
4 Identificao dos isolados bacterianos.
5 Determinaes da capacidade de oxidao do arsnio pelos isolados bacterianos.
6- Determinao da concentrao de As no solo, bactrias, Exopolissacardeos, meio de cultura por ICP-MS
7 - Determinao da produo de exopolissacardeos e capacidade das clulas em acumular arsnio.
8 Anlise dos resultados.
9-Elaborao de dissertao, e artigos cientficos.
Os resultados obtidos nessa pesquisa sero apesentados em revistas de alto fator de impacto, na rea
de Qumica Ambiental tais como Environmental Research, Journal of Hazardous Materials, Talanta e outras.

V REFERNCIAS BIBLIOGRFICAS
ANDRADE, R.P. et al. Control of geochemical mobility of arsenic by liming in materials subjected to acid
mine drainage. JournalofSoilsandSediments, 2008, v.8, p.123 129.
ASSIS, I.R. Mitigacao da lixiviacao de arsenio, ferro e enxofre e revegetao de substratos minerados em rea
de ocorrncia de drenagem acida. Dissertao de Mestrado, UFV Programa de Solos e Nutrio de Plantas,
Viosa (2006), 90 p.
AZCON R. et al. Arbuscular mycorhizal fungi, Bacillus cereus, and Candida parapsilosis from a
multicontaminated soil alleviate metal toxicity in Plants. Microbial Ecology, 2010, v.59, p.668 - 677.
BAIG, J.A. et al. Optimization of cloud point extraction and solid phase extraction methods for speciation of
arsenic in natural water using multivariate technique, Analytica Chimica Acta, 2009, v. 651, p. 57 63.
BARRA, C.M. et al. Especiao de Arsnio uma reviso. Quimica Nova, 2000, v. 23, p. 58 70.
BASU, A. et al. Genetic toxicology of a paradoxical human carcinogen, arsenic: a review. Mutation Research,
v.488,
p.171194,
2001.
Disponvel
em:
<http://www.sciencedirect.com/
science/article/pii/S1383574201000564>. Acesso: jun. 2009. doi: 10.1016/S1383-5742(01)00056-4.

11

BATISTA, B.L; SOUZA, J.MO.; SOUZA, S.S.; BARBOSA, Jr. F.; Speciation of arsenic in rice and
estimation of daily intake of different arsenic species by Brazilians through rice consumption. J Hazard Mater
2011;191(1-3):342-8.
BUNDSCHUH, J.;BHATTACHARYA,P.;SRACEK,O.;MELLANO,M.F.;RAMREZ,A.E.;STORNIOLO,A.
R.; MARTN,R.A.;CORTES,J.;LITTER,M.I.;JEAN,J.S.;2011.Arsenic removal from ground at erofthe ChacoPampe an plain(Argentina)using natural geological materials asadsorbents.J.Environ.Sci.Health46,1297
1310.
BUNDSCHUH, J.; NATH, B.; BHATTACHARYA, P.; LIU C-W, ARMIENTA. M.A.;Lopez, M.V.M, et al.
Arsenic in the human food chain: the Latin American perspective. Sci Total Environ 2012,429, 92-106.
BUNDSCHU, J. et al. One century of arsenic exposure in Latin America: A review of history and occurrence
from 14 countries. Science ofthe Total Environment, p.1623-1662.
BRASIL. Ministrio do Meio Ambiente. Resoluo n. 357, de 17 de maro de 2005. Conselho Nacional de
Meio Ambiente CONAMA, Braslia, DF.
CAMPOS, M.L. et al. Teor e capacidade mxima de adsoro de arsnio em Latossolos brasileiros. Revista
Brasileira de Cinciado Solo, v.31, p.1311-1318, 2007. Disponvel em: <http://www.
scielo.br/pdf/rbcs/v31n6/10.pdf>. Acesso: jul. 2009. doi: 10.1590/ S0100-06832007000600010.
CETESB. 2005. Relatrio de estabelecimento de valores orientadores para solos e guas subterrneas do
Estado
de
So
Paulo.
[Online].
Available:
http://www.cetesb.sp.gov.br/Solo/relatorios/tabela_valores_2005.pdf.
COATA, JUNIOR. C.N. 1997. Caracterizao mineralgica dos diferentes tipos de minrios e concentrado de
flotao da mina morro do ouro, Paracatu-MG. Dissertao de Mestrado, Universidade de Braslia.
CODEX. Alimentarius. Proposed draft maximum levels forarsenic in rice. Rome; 2012[acessado 2013 Out
01]. Disponvel em http://www.usarice.com/doclib/188/6255.pdf
CUBADDA, F. ;CIARDULLO, S.; DAMATO, M.; RAGGI, A.; AURELI, F.; CARCEA, M. Arsenic
Contamination of the Environment-Food Chain: A Survey on Wheat as a Test Plant To Investigate Phyto
available Arsenic in Italian Agricultural Soils and as a Source of Inorganic Arsenic in the Diet J Agric.
FoodChem 2010;58:10176-83.
DESCHAMPS, E., MATSCHULLAT, J. (organizadores). Arsnio antropognico e natural: Um estudo em
regies do Quadriltero Ferrfero. 1o edio. Belo Horizonte: Fundao Estadual do Meio Ambiente, 2007,
cap. 1, p. 15-37.
E.F.S.A., 2014.Dietary exposure to inorganic arsenic in the European population.EFSA J. 12, 3597.
FARAHAT, M. et al. Adhesion of Escherichia coli onto quartz, hematite and corundum: extended DLVO
theory and flotation behavior. Colloid surfaces, 2010, v.74, p.140-149.
GUEDES, K. A. Prospeco de bactrias com potencial aplicao na biorremediao de efluentes industriais
contendo arsnio. 2011. 84f. Dissertao (Mestrado em Engenharia Ambiental) Instituto de Cincias Exatas
e Biolgicas, Universidade Federal de Ouro Preto,Ouro Preto, 2011.
GUPTA, D.K.; SRIVASTAVA, S.; HUANG, H.; ROMERO-PUERTAS, M.C.; SANDALIO,L.M.Arsenic
tolerance and detoxification mechanism sinplants. In: Sherameti,I., Varma, A.(Eds.),Detoxification of Heavy
Metals (Book Series:Soil Biology). Springer, Heidelberg, 2011,p.169180.

12

HUISMAN, J.L. et al. Biologically produced sulphide for purification of process stream, effluent treatment
and recovery of metals in the metal and mining industry. Hydrometallurgy, 2006, v. 83, p.106-113.
JACKSON, B.P.; TAYLOR, V.F.; KARAGAS, M.R.; PUNSHON, T.; COTTINGHAM, K.L. Arsenic,
organic foods, and brown rice syrup. Environ Health Perspect2012;120(5):623-6.
KILE, M.K.;HOFFMAN,E.;RODRIGUES,E.G.;BRETON,C.V.;QUAMRUZZAMAN,Q.;RAHMAN,
MAHIUDDIN,G.;HSUEH,Y.M.;CHRISTIANI,D.C.;2011.Apathway-basedanalysis
urinaryarsenicmetabolitesandskinlesions.Am.J.Epidemiol.173,778786.

M.;
of

KIM, H.C. et al. Arsenic removal from water using iron impregnated granular activated carbon in the presence
of bacteria. Journal of Environmental Science, 2010, v. 45, p.177-182.
LIEVREMONT, D.; BERTIN, P. N.; LETT, M. C. Arsenic in contaminated waters: Biogeochemical cycle,
microbial metabolism and biotreatment processes. Biochimie, v. 91, n. 10, p. 12291237, June 2009.
LAWRENCE, MICHAEL ;GOODWIN, PAUL; OCONNOR, MARCUS; ONKAL, DILEK. Judgmental
forecasting: A review of progress over the last 25years. International Journal of Forecasting 22 (2006) 493
518
MAITY, S. et al. Evaluation and standardization of a simple HG AAS method for rapid speciationofAs(III)
and As(V) in some contaminated groundwater samples of West Bengal, India. Chemosphere, 2004, v. 54, p.
1199 1206.
MANDAL, B.K.; SUZUKI, K.T. Arsenic round the world: a review. Talanta, 2002, v. 58, p.201 235.
MARTINS, M. et al. Mechanism of uranium (VI) removal by anaerobic bacterial communities. Journal of
Hazardous Materials.2010, 184, p.89-96.
MATSCHULLAT, J. Arsenic in the geosphere a review.Science of the Total Environmental.2000, v.249,
297-312.
MEHARG, A.A.; RAHMAN, M.; Arsenic contamination of Bangladesh paddy field soils: Implications for
rice contribution to arsenic consumption, ENVIRON SCI TECHNOL 2003, 37, 229-234
MORIN, D. et al. Progress after three years of BioMinE-Research and Technological Developmental project
for a global assessment of biohydrometallurgical processes applied to European nonferrous metal resources.
Hydrometallurgy.2008, p.58-68.
ONO, F.B. et al. Arsenic bioaccessibility in a gold mining area: a health risk assessment for children.
Environmental andGeochemical Health. 2011, p.54-63.
ONO, F.B. Bioacessibilidade de arsnio em rea de minerao de ouro, Paracatu (MG).Dissertao de
Mestrado, UFLA Programa de Cincia do Solo, Lavras (2009), 70 p.
ONO, F.B.; GUILHERME, L.R.G.; MENDES, L.A.; CARVALHO, G.S. Replication ofan IVG protocol to
estimate bioacessiblearsenic in materials from a gold mining area in Brazil.RevistaBrasileira de Cincia do
Solo, 2012a, v. 36, p. 1355 1360.
ONO, F.B.; GUILHERME, L.R.G.; PENIDO, E.S.; CARVALHO, G.S.; HALE, B.; TOUJAGUEZ, R.;
BUNDSCHUH, J. Arsenic bioacessibility in a gold mining area: a health risk assessment for children.
Environmental Geochemistry and Health, 2012b, v. 34, p. 457 465.

13

PIMENTEL, H.S.; LENA, J.C.; NALINI, J.R.H.A. Studies of water quality in the Ouro Preto region, Minas
Gerais, Brazil: The release of arsenic to the hydrological system. Environmental Geology, v.43, p.725-730,
2003.
REN, R. et al. Biosorption of tetradecyl benzyl dimethyl ammonium chloride on activated sludge: Kinectic,
thermodynamic and reaction mechanism. Bioresource Technology. 2010, p.567-84.
RODRIGUES, L.C.V. Estudo da disponibilidade qumica de chumbo e arsnio em sedimentos de corrente e
colunas de sedimentos no Vale do Ribeira - SP. Tese de doutorado, UFF Instituto de Qumica, Niteri
(2008), 133 p.
SANTOS, E.C.O. et al. Exposio ao mercrio e ao arsnio em Estados da Amaznia: sntese dos estudos do
Instituto Evandro Chagas/FUNASA. RevistaBrasileira de Epidemiologia. 2003, v. 6, 171-185.
SHARMA,
V.K.;
SOHN,M.;2009.Aquaticarsenic:toxicity,speciation,transformations,
remediation.Environ.Int.35,743759.

and

TEWARI, M. et al. Characterization of biosorption process of As (III) on green algae Ulothrixcylindricum.


Journal of Hazardous Materials.2009, v. 165, p.566-572.
TUZEN, M. et al. Selective speciation and determination of inorganic arsenic in water, food and biological
samples.Food and Chemical Toxicology. 2010, v. 48, p. 41 46.
VAHTER, M. Mechanisms of arsenic biotransformation.Toxicology.2002, v. 181, p.211 217.
VELSQUEZ, L.; DUSSAN, J.Biosorption and bioaccumulation of heavy metal on dead and living biomass of
Bacillus sphericus.Journal of Hazardous Materials.2009, v. 167, p.713-716.
ZAKHAROVA, T. et al. Health cancer risk assessment for arsenic exposure in potentially contaminated areas
by plants fertilizer: a possible regulatory approach applied to a case study in Moscow Region-Russia.
Regulatory Toxicology and Pharmacology, v.36, p.22-23, 2002.Disponvelem: <http://www.sciencedirect.
com/science/article/pii/S0273230002915618>. Acesso: ago. 2009. doi:10.1006/rtph.2002.1561.
ZHAO, F.J.;MCGRATH,S.P.;MEHARG,A.A..Arsenic as a food chain contaminant: mechanism of plant
uptake and metabolism and mitigation strategies.Annu. Rev.PlantBiol.2010,61,535559.
WANG, S.; ZAO, X. On the potential of biological treatment for arsenic contaminated soil and groundwater.
Journal of Environmental Management.2009, v. 90, p.2367-2376.
WEN,W.H.;WEN,J.H.;LU,L.;LIU,H.;YANG,J.;CHENG,H.R.;CHE,W.J.;LI,L.;ZHANG,G.B.2011.Metabolite
sofarsenicandincreasedDNAdamageofp53geneinarsenic plant workers.Toxicol.Appl.Pharmacol.254,4147.
WELCH, A.H.; WESTJOHN, D.B.; HELSEL, D.R.; WANTY, R.B. Arsenic in ground water of the United
States: Occurrence and Geochemistry.Ground Water, 2000, v. 38, p. 589 604.

14