Molecular Methods for the Detection

of Methanotrophs
Ian R. McDonald, Andrew J. Holmes, Elizabeth M. Kenna,
and J. Colin Murrell
1. Introduction
Methane-oxidizmg
bacteria (methanotrophs)
are a unique group of bacteria
that grow on methane as then sole source of carbon and energy. They can be
isolated from a wide variety of marme and freshwater environments, soils, and
sediments and appear to be ubiquitous in the natural environment. They have
been classtfred, on the basis of chemotaxonomic
studies and 16s rrbosomal
RNA phylogenetic analyses, mto five genera: Methylococcus, Methylobacter,
Methylomonas,
Methylosmus,
and Methylocystis (1,2). These five genera fall
mto two phylogenetically
distinct,
exclusively
methanotrophic
groups.
Methanotrophs
with type I mtracellular
membranes
include the genera
Methylomonas,
Methylobacter,
and Methylococcus, which are all related to bacterra of the y-subdivision of the Proteobacterza.
Methanotrophs
with type II
membranes include Methylosinus
and Methylocystis,
which belong to the
a-subdivision
of the Proteobacterla
(Table 1). There has been considerable
interest in methanotrophs since it has been recognized that they are a major smk
for atmospheric methane In many natural environments, where these aerobic
bacteria are exposed to methane, arising from the biological
production by
methanogens, they are responsible for removal of much of this methane before
rt escapes to the atmosphere, and are therefore important in the global carbon
cycle (see ref. 3 and chapters therein).
The methanotrophs have also attracted considerable attention since they are
able to degrade a number of important
ground-water
pollutants,
such as
trrchloroethylene
(TCEtZ) and other halogenated hydrocarbons (3 and chapters
therein). The enzyme responsible for biodegradation of TCEtl and other polluFrom

Methods
~1 Wotechnology,
Vol 2 B/oremed/atfon
Protocols
Edlted by D Sheehan
Humana
Press Inc , Totowa, NJ
111

RUMP, R&dose

Monophosphate

62.5
+

50-54

50 -54
V
+
-

Senne
pMMO/sMMO
62-63
+

Senne
pMMO/sMMO
62-63
+

18.1

2
a Proteobactena
Type II
18:l

Methylocystls

2
a Proteobactena
Type 11

Merhylosmus

Pathway, pMM0, particulatemethanemonooxygenase,

sMM0, solublemethanemonooxygenase

RuMP/Senne
pMMO/sMMO

RUMP
pMM0

RUMP
pMM0

2
y Proteobactena
Type I
16.1

Methylococcus

Type I
16:l

6
y Proteobactena

Methylobacter

3
y Proteobactena
Type I
16 1

Methylomonas

of Methanotrophsa

Phylogeny
Membrane type
Fatty acid
Pathway for carbon
assimilation
MM0 enzyme type
Mol%G+C
content of DNA
N2 fixation
Carotenolds
Marine representatives

No. of species

Table 1
Classification

Detection of Methanotrophs

113

tants IS methane mono-oxygenase (MMO), whose normal role m these organisms is the conversion of methane to methanol. Two forms of MM0 are known,
a cytoplasmic (soluble MMO) and a membrane-associated form (particulate
MMO). The enzyme that has been studied in most detail is the soluble MM0
(sMMO), for which detailed brochemical and genetic mformatron exists (for
review see refs. 3,4). The wide range of substratescooxrdrsed by sMM0 make
it an important enzyme for the study of breakdown of a wide variety of chlonnated alkanes, alkenes, and aromatic compounds. The range of substratescooxidrsed by pMM0 is more restricted, although it still includes some rmportant
pollutants (e.g., TCE). This form of the enzyme is universally present m all
methanotrophs. The genes encoding the sMM0 enzyme complex (mmo genes)
have been extensively characterized in two methanotrophs (4). They show a
high level of homology which makes them useful as functional gene probes for
the detection of sMMO-containing methanotrophs m natural environmental
samples and in bioremediatron programs designed to exploit their cooxrdatton
properties for the degradation of TCE and other pollutants (e.g., see ref. 5).
The sMM0
trichosporium

complex

of Methylococcus

capsulatus

(Bath)

and Methylosinus

OB3b contams three proteins. Protein A IS the hydroxylase component and consists of three polypeptrdes a, p, and y; Protein B IS a coupling
protein and Protein C is the reductase component. They are coded for by the
genes, mmoX, mmoY, mmoZ, mmoB, and mmoC, respectively, which are clustered on the chromosome of both of these (and other) methanotrophs (4).
Molecular ecology techniques may be used to detect the presence and identity of methanotrophs directly in envn-onmental samples, including broremedratron sites. Techniques and strategies available for methanotrophs have
recently been reviewed in detail (6). Nucleic acid probes available fall into two
classes: (I) functional and (11)phylogenetic. The only functronal probes for
methanotrophs presently available target sMM0 genes and are subsequently
limited for use with methanotrophs that possess this form of the enzyme m
addition to the pMM0 (7). Probes targeting pMM0 (8) genes are presently
under development in the authors laboratory and would represent a umversally applicable methanotroph functional gene probe (4). Phylogenetic trees
constructed from 16s rRNA sequences by Hanson, Bowman, and colleagues
(2,9) have revealed exclusively methanotrophrc clusters. This makes tt possible to design phylogenetic group-specific (16s rRNA) probes for methanotrophs targeting the 16s rRNA. Both classes of probe can now be used
directly to detect methanotrophs in a variety of environments, obviating the
sometimes difficult task of enriching for and isolatmg them. The followmg
methods describe the polymerase chain reaction (PCR) amplification, detection, and characterrzatron of methanotroph-specific sMM0 and 16s rRNA
genes in natural environmental samples

114

McDonald et al.

2. Materials
2.1. Bacterial Strains and Reagents
All bacterial strains described here can be obtained from the University of
Warwick Culture Collection and the NCIMB
(Aberdeen, Scotland). Control
organisms used in PCR expertments: Ms. trichosponum
OB3b, MC. capsulatus
(Bath), Methylosinus
sporzum 5, Methylocystis
strain M (all sMMO+),
Methylocystis
parvus OBBP, Methylobacter
agile A20, Methylomonas
methanlca S 1, Methylobacter
albus BG8 (all sMMO-),
Methylobacterzum
extorquens AM1 (sMMO-, methanol dehydrogenase (MDH)+), Escherichza
coEi DHl (sMMO-, MDH-). The E. colt host used for cloning experiments IS E
coli DHl or, where stated, commercially
available E.coli strains. Chromosomal
DNA is prepared from methanotrophs by the method of Oakley and Murrell
(10) although any standard molecular biology laboratory procedure should
work well for these organisms.
Oligonucleotide
primers are synthesized on a PE Applied Biosystems
(Warrmgton, Cheshire, UK) DNA synthesizer. (Many commercial outlets now
exist for the custom-made synthesis of oligonucleottdes).
Fluorescently labeled
oligonucleotide
probes were obtained from Genosys (Cambridge,
UK). All
reagents used are Molecular Biology grade (where available) or Analar grade
(Sigma, Poole, Dorset, UK). Good quality double-drstilled,
deionized water
should be used for preparation of all solutions. Taq DNA polymerase and polymerase buffer are obtamed from Gibco-BRL (Paisley, Scotland). Mineral oil is
from Sigma. Nylon membrane is from Amersham (High Wycombe, UK). The TA
cloning kit for clonmg of PCR products is available from Invitrogen (San Diego,
CA). The Sequenase Version 2.0 Sequencing Kit is available from United States
Btochemicals (Cleveland, OH). The DNA thermal cycler used in these methods 1s
the Combi Thermal Reactor TR2 (Hybaid, Teddington,
Middlesex,
UK).
Hybridizations
are carried out m an Oven (Hybaid). T4 polynucleotide
kmase,
T4 kmase buffer, and DNA polymerase for nick translation are available from
Gibco-BRL.
All radiolabels (T-~P ATP and 32P dGTP) are obtained from
Amersham (High Wycombe, UK).

2.2. Solutions
1. SET buffer. 20% sucrose, 50 rnM EDTA, 50 mM Tns-HCl, pH 7.6
2. Tns-EDTA (TE) buffer. 10 mM Tns-HCl, 1 m&f EDTA, pH 8.0.
3 Tns-Borate-EDTA (TBE) buffer* 0 089M Tris-HCl, 0.089M boric acid, 0 002M
Naz EDTA, pH 8 0, (stored at room temperature)
4. Denhardts solution. 50X Denhardts solution contains 1% Ficoll (Type 400,
Pharmacla, St. Albans, Herts, UK), 1% polyvmyl-pyrrohdone,
albumin (BSA, fraction V; Sigma) (stored at -20C)

1% bovine serum

Detection of Methanotrophs

115

5 SSC buffer. 1X SSC contams 0 15M NaCI, 0.015M trlsodium citrate, pH 7 0

(stored at room temperature).
6. Oligonucleotlde hybridization buffer contains 6X SSC, 0.5% SDS, 10 mM sodium
phosphate, pH 6.8, 200 pg/mL denatured Herring testes DNA (Sigma, UK), 5X
Denhardts solution The Herring testes DNA solution is denatured by boiling for
20 mm. This hybridization buffer 1s freshly made before use.
7 Southern blot hybrldlzatlon buffer contains 6X SSC, 0 5% SDS, 200 pg mL denatured Herring testes DNA (Sigma), 5X Denhardts solution. The Herring testes
DNA solution 1sdenatured by boiling for 20 min (freshly made before use)
8 Nick translation buffer 0 5M Tris-HCl, pH 7.5,O 1M MgS04, 1 m&J dlthiothreltol,
500 yglmL BSA (fraction V, Sigma) (stored at -20C).
9 Phosphate-buffer saline (PBS) 390 mM NaCI, 30 mM, phosphate buffer, pH 7 2
10. Hybrldlzatlon solution for in situ hybridization: 900 mM NaCl, 20% formamlde,
0.01% SDS, 20 mM Tns-HCl, pH 7 2.
3. Method

3.1. Total DNA Extraction

from Environmental

Samples

3.7.7. DNA Extractrons from Water Samples

DNA from water samples (e.g. river water, pond water, seawater) may be
extracted using a method essentially as described by Sommerville
et al. (II). In
our laboratory Sterivex 0.22~ym filter units (Mlllipore,
cat. no. SVGSO1015)
are used, although any slmllar self-contamed filtration apparatus could be used.
The volume of water sample that may be passed through these units varies from
250 mL to 1 L, depending on the particle load of the water sample. Samples can
easily be processed through the filters at the collection site using a sterile, large
volume syringe, frozen, and then transported to the laboratory for further work.
The following describes the protocol employed.
1. Collect bacterial cells on the filter by aseptically passing 250-1000 mL of water
through the Sterlvex unit
2. Wash the cells by passing 10 mL sterile SET buffer through the unit Excess buffer
1sremoved by pushing through air from an empty syringe. The filter units are then
capped to prevent contammation and should be frozen at -20C if they are not to be
processed immediately (see Note 1)
3 Using a 25-gage needle, add 1 8 mL SET buffer through the inlet of the filter unit
(longer needles may puncture the filter) Thirty mlcrohters of lysozyme (10
mg/mL) 1sthen added and the inlet recapped Invert the filter unit 3-4 times to mix
the contents and incubate at 4C for 15 mm with occasional mixing.
4. Twenty microliters of a 20% SDS solution 1sadded and the filter incubated at room
temperature under constant rotation for 1 h. A Ummlx 380 (Luckham Ltd., Sussex,
UK) 1sused to roll the filter umts (see Note 2) At the end of this treatment, 50 pL
of Proteinase K (20 mg/mL) 1sadded and the filter units incubated on the roller for
a further 3 h

McDonald et al

116

5 The crude lysate 1s harvested by wtthdrawmg it back through the filter unit inlet
with a 5 mL syringe The filter IS washed by addmon of 1 mL SET buffer to the unit
and replacing tt on the roller for 5 mm The wash buffer IS collected as above and
pooled with the crude lysate.

6. Add 0 5 vol of 7 5M ammomum acetate and mix by inverting the tube 34 times
Incubate the mix at room temperature for 15 mm and then centrifuge at 12,OOOgfor
5 min to pellet dissociated proteins. Transfer the supernatant to a new tube and precipitate nucleic acids by addmon of 2 5 vol ethanol The tubes are incubated at
-20C for 30 mm then centrifuged at 12,000g for 20 mm to pellet the nucleic acids.
The pellet IS washed by addition of 500 pL 70% ethanol and centrtfugatton for 5
mm The supernatant IS carefully removed with a ptpet tip attached to a vacuum lme
and the pellet 1s an-dried. The nucleic acid pellet IS then resuspended m 300 pL

sterile water and the ammomum acetate treatment IS repeated.

This crude puriftcatron procedure yields high-mol-wt DNA (typically 20-30
pg/L of water sample) of sufftcient purity, for amplrfication
of mmo and 16s
rRNA genes by the PCR, with estuarme, coastal seawater, open ocean marine
samples, pond, lake, and riverwater samples (see Note 3)

3.1.2 DNA Extractions from So11and Sediment Samples

Total DNA isolation from fresh soil, sediment, and peat samples is essentially as described by Selenska and Klingmuller
(12) and Bruce et al. (13).
1 Suspend the sample (2 g wet weight) in 5 mL of extraction buffer (1% SDS m 0 12M

Na2HP04, pH 8.0) and incubate at 70C for 1 h with occasional shakmg (see Note 4)
2. Centrifuged the sample at 2000g for 10 mm and hold the supernatant at 4C
3 Extract twice more with 5 mL of fresh extraction buffer. The three supernatant fractions are pooled and centrifuged at SOOOgfor 30 mm.
4. Add polyethylene glycol (PEG) to the supernatant to a final concentration of 15%

(15 mL of a stock solutton of 30% PEG 6000 m TE buffer, pH 8 0); 1.5 mL of 5M

NaCl 1s also added gradually and shaken.

5 Precipitate overnight at 4C and centrifuge at 5OOOgfor 20 mm. Resuspend the pellet m 4 mL of TE, gtvmg a brown solution to which 4 g of CsCl and 100 pL of
ethrdmm bromide (EtBr)( 10 mg/mL) are also added

6 Remove the DNA band after ultracentrifugatton at 290,000 g overnight m a Sorvall

Vti 65 rotor (see Note 5), extract the EtBr with TE saturated 1-butanol, and dialyze
overnight in TE to remove the CsCl.
7. Precipitate the DNA with ammomum acetate and ethanol (1 vol DNA solution, l/3
vol of 10.5M ammomum acetate and 2 vol of ethanol) at -20C overnight and wash
m 70% ethanol to remove any remaining brown color (see Note 6)
8. Resuspend the DNA m 400 pL of TE.

Good quality high-mol-wt DNA, with typical yields of 100 pg DNA/2 g sample, 1s obtained and is suitable for PCR of mmo and 16s t-RNA genes (see Note 7)

Detect/on of Methanotrophs
3.2. PCR-Amplification
of Methanotroph
from Environmental
DNA Samples

117

Genes

3.2.1. Phylogenetic Group-Speclfrc Pnmers

16s rRNA sequences of methanotrophs can be obtamed from Genbank and
Bowman (9). Regions diagnostic for each of the representatives of the five genera of methanotrophs have been selected for probe design (see Note 8) These
16s rRNA probes and their control organisms are shown m Table 2. They have
been tested for their ability to detect methanotroph genera specifically m both
PCR and colony hybridizations
against cloned 16s rRNA genes from representative methanotrophs m the University of Warwick culture collectton. Reaction
conditions for hybridization and PCR testing are described m the following sections. All probes give a strong signal with their target genes and show no crossreactivity with methanotrophs from other genera (see Note 9).

3.2.2. Functional Group-Specific Primers

Functional
group-specrftc
probes may be defined as those that target
genes that are specific for a particular cell activity. Where the cell acttvrty
defines a microbial physiological
group, such probes may be termed functional group-specific.
We have selected genes encoding two enzymes as targets for functional group-specific probes; mxuF, encoding the large subunit of
methanol dehydrogenase (MDH); and the genes encoding sMM0 (mmoX,
mmoY, mmoZ, mmoB, and mmoC). mxaF is expected to to be a methylotrophspecific probe capable of detecting all Gram-negative
methylotrophs,
mcludmg the methanotrophs.
The mmo probes are methanotroph-specific
but will
detect only the sMMO+ methanotrophs
and not those methanotrophs
which
contain only the pMM0.
The mmo primers were designed from the published sequences of the sMM0
gene clusters of Methylococcus capsulatus (Bath) and Methylosmus tnchosporium OB3b (4 and references therein). mxaF primers were based on published
sequences of three species of methylotrophs (15). These primers amplify then
target fragments spectfrcally from all methanotrophs in our collection (mxaF
primers) and all sMMO+ strains (mmo primers) (see Note 10). The primer
sequences are shown m Table 2.

3.2.3. Reaction Conditions for PCR

Table 3 shows typical reaction components for a PCR. The concentratton of
MgC12 and template DNA varies according to the source of the DNA. The following protocol describes reaction mixture and amplification
conditions used
for control DNA samples extracted from pure cultures.

Monooxygenase

TGGCACTCGTAGCGCTCCGGCTCG

CCGACTGGATCGCCGGCGGCCT

1403r

198f

mmoY

GGCTCCAAGTTCAAGGTCGAGC

mmoX 882f

mmoX

GGGCAGCATGAAGGGCTCCC

wrxaF 1561r

Sequence (S-3)

Methane

CACTCTACGATCTCTCACAG
CCGCATCTCTGCAGGAT
CACTCCGCTATCTCTAACAG
CCCTTGCGGAAGGAAGTC
GCGGCACCAACTGGGGCTGGT

Soluble

Mb 1007r
MC 100%
Mm 1007r
MS 1020r
mxaF 1003f

Pnmer

Table 2
Methanotroph

All Gram-negatwe
Methylotrophs
All Gram-negative
Methylotrophs
sMMO+
methanotrophs
sMMO+
methanotrophs
sMMO+
methanotrophs

Methylobacter
Methylococcus
Methylomonas
Methyloscnus

Colony
hybndrzatron
temperature

Control
organism

MS tnchosporzum

MS tnchosponum

MS trzchosporzum

MS trzchosporzum

MS trzchosporzum

OB3b

OB3b

OB3b

OB3b

OB3b

Not tested

Not tested

Not tested

Not tested

Not tested

60C
55C
55C
55C

Probes/Primers

Group-Specific

Mb albus BG8
MC cupsulatus Bath
Mm. methamca S 1
MS tnchosporzum
OB3b

and Phylogenetic

Target genus

(sMM0)

37C

55C

55C

59C

59C

58C
54C
58C
54C

PCR
temperature

CGCTGGAAGAACTCGCGGCGG

CGCCGTTCCGCAAGAGCTACGA

TTGCGCAGCCCTTCCAGCGGCGTG

AGTTCTTCGCCGAGGAGAACCA

TGCCCAGGGTGTAGGCGCGGCCGA

GGTTCTGCTGTGCCGCACC

ATCCCGTGCCGCCGGCGACG

AGAGTTTGATCMTGGCTCAG
TACGGYTACCITGTTACGACTT
TACGTTAGCTCCACCACTAA

mmoY 8201

mmoZ 133f

mmoZ 483r

mmoB 77f

mmoB 369r

mmoC 542f

mmoC 986r

16s rRNA 27f

16s rRNA 1492r
Mm 850

methanotrophs
sMMO+
metbanotrophs
sMMO+
methanotrophs
sMMO+
metbanotrophs
sMMO+
methanotrophs
sMMO+
methanotrophs
sMMO+
methanotrophs
All Eubactena
All Eubactena
Methylomonas

sMM0+

OB3b

OB3b

OB3b

OB3b

OB3b

OB3b

MS tnchosponum OB3b
E. colt
E. co11
Mm. methanlca S 1

MS tnchosponum

MS tnchosponum

Ms. tnchosponum

Ms. tnchosporium

Ms. tnchosponum

MS tnchosponum

Not
Not
Not
Not

tested
tested
tested
tested

Not tested

Not tested

Not tested

Not tested

Not tested

Not tested

55C
55C
55C
58C

55C

55C

55C

55C

55C

37C

McDonald

120
Table 3
Typical Reaction

Components

et al

for PCR

Reaction component

Concentration m PCR

Polymerase buffer (Gtbco-BRL)

W32

W-l detergent (Grbco-BRL)

Prtmer 1
Primer 2
DNA template
dNTP (concentratron of each nucleotrde)
Taq polymerase (Gtbco-BRL)

20 mM Trrs-HCl,
25mM
005%
0 l-l @!!
0.1-l @I
10 ng-10 yglmL
200 p.M
25u

50 mM KC1

Prepare a master mix (see Note 11) containing reaction buffer, MgC12 (see Note
12), BSA, and each deoxynucleotrde and ahquot into 0 7-mL mtcrocentrtfuge
tubes.
Add 100 pmol of each pnmer to each tube
Add 10 ng of template DNA to each tube (see Note 13)
Vortex tubes briefly to mix components and give a pulse spm m a mrcrocentrrfuge
Overlay the reaction components with 50 pL mineral or1
Place the tubes in the thermal cycler and heat to 94C for 5 mm to denature the template DNA During this time a fresh dilution (1 10) of stock Tuq polymerase (5
U/pL) is prepared m sterile drstrlled water A hot start PCR is employed by pausmg the thermal cycler at 92C and adding 5 pL (2 5 U) of the diluted Tuq polymerase through the oil layer mto the aqueous phase
Thirty cycles of annealing, extension, and melting are then carried out as below;
55C for 1 mm, 72C for 1 mm, 92C for 1 min This IS followed by a final cycle
of 55C for 1 mm, 72C for 5 mm The reactions are stored at -20C until analyzed
Take a 5-pL ahquot of the reaction for visual exammatton by agarose gel electrophoresrs
Examples of typical PCR results for control DNAs are shown m Fig. 1 and with envrronmental DNA samples m Rg 2 All sets of PCRs should contain both a negative
(1 e , a tube with all reagents but with no template) and a positive (i.e., a tube with a
known DNA sample of established punty) control

3.2.4.

ConfirmIng

Amplifrcatron

Identity

of PCR Products

by Southern

of the intended product can be confirmed

Hybndlzatlon

by Southern blotting

DNA from agarose gels onto nylon membrane and hybridizing this DNA with
an appropriate probe (an oligonucleotlde
or a DNA fragment; see Note 14), as
outlined below.

Detection

of Methanotrophs

2027bp564bp-

Fig. 1. PCR amplification of M. trichospotium OB3b DNA using methanotrophspecific primers. Lane 1 contains h Hind III size marker (Gibco-BRL); the following
lanes contain the PCR products from amplification of M. trichosporium OB3b template
DNA using the methanotroph-specific primers: Lane 2, mmoX, Lane 3, mmoY; Lane 4,
mmoZ; Lane 5, mmoB; Lane 6, mmoC, Lane 7, moxp, Lane 8, 16s rRNA.

1. Load and run a 0.8% agarose (higher concentrations of agarose can retard transfer
of DNA), 1X TBE gel.
2. Soak the gel for 2 x 20 min in denaturing solution (1.5M NaCl, OSM NaOH), followed by 2 x 20 min in neutralizing solution (IM Tris-HCl, pH 7.4, 1.5M NaCl).
3. Set up the Southern blot (16) and blot overnight to ensure complete transfer.
4. Fix DNA to the nylon membrane either by UV crosslinking or by baking the membrane at 80C for 2 h.
5. Prehybridize the membrane, with the appropriate buffer (20-50 mL)(see Section
2.), for 1 h in a Hybaid hybridization oven (up to six filters can be placed in each
tube, sandwiched between nylon mesh).
6. The labeled probe (a nick-translated DNA probe or an end-labeled oligonucleotide probe) is denatured by boiling for 10 min and then added to the hybridization tube.
a. Nick translation of probe: 250 ng DNA, 2X nick translation buffer (see
Section 2.), 3 pL unlabeled dNTPs (a solution containing three of the four
dNTPs, each at a concentration of 5 mM), 10 pCi of c&~P dNTP, 10 U of DNA
pol I, 1 pL DNase I solution (1 pL of 20 pg /mL stock diluted in 50 pL of water,
then 1 pL of this into 50 mL of water), to a total volume of 20 pL with water.
Incubate for 4 h at 4C.
b. End labeling of probe: 500 ng DNA, 1X T4 kinase buffer, 10 U of T4 kinase, 50
pCi f2P-ATP, made up to 50 pL with water. Incubate at 37C for 1 h.
7. The membranes are hybridized overnight at 65C (or 50C for the oligonucleotide
probe).
8. Membranes are washed twice with 100 mL of 2X SSC at 80C for 30 min (or with
6X SSC at 50C for the oligo probe).
9. The filters are then air-dried and subjected to standard autoradiography techniques.

McDonald et al.

Fig. 2. PCR amplification of DNA extracted from environmental samples using

mmoX-specific primers. Lane 1 contains h Hind111 size marker (Gibco-BRL): The following lanes contain the PCR product from amplification with mmoX-specific primers
of DNA extracted from environmental samples: Lane 2, freshwater; Lane 3, estuarine;
Lane 4, sediment; Lane 5, soil; Lane 6, peat; Lane 7, M. trichosporium OB3b control.

3.3. Whole Cell Approaches

3.3.1. Probes for In Situ Hybridization
Oligonuclotide probes were obtained from Genosys (Cambridge, UK).
Rhodamine or fluorescein moieties were directly incorporated during synthesisat
the 5 terminus using a C6 aminolinker. The probe Eub 338 (18) is used as a positive control in all hybridizations. Probe Mm850 labeled with rhodamine has been
used for the specific detection of Methylomonas sp. (Table 2; seeNotes 15-17).
3.3.2. Fluorescent In Situ Hybridization
The procedure given below is used for the identification of methanotrophs in
cultures:
1. Collect 1 mL of a fresh culture (see Note 18) into a 5 mL bijou bottle and add 3 mL
of 4% paraformaldehyde (in PBS, pH 7.2). Incubate for a minimum of 3 h at 4C.
The fixed cells can be stored in 50% ethanol for at least 1 mo at -20C.
2. Mix together in a 1.5 mL microcentrifuge tube, 100 p.L fixed cells and 10 p.L 1%
Triton X-100. Centrifuge the mixture at low speed (6000g) to collect the cells and
remove the supernatant. Resuspend the cell pellet in 10-20 pL of 0.1% Triton X100 to give a final concentration of 108-lo9 cells/ml.
3. Apply 3 pL of the washed, fixed cells to a gelatin-treated microscope slide in a spot
approx l-2 mm2 (2 x 1.5 pL applications). Allow to dry. (Gelatin treated slides are
made by cleaning microscope slides in a 10% ethanolic KOH solution followed by
a rinse in distilled water. The slides are then dipped in a solution of 0.1% gelatin,
0.01% potassium chromate at 70C and allowed to dry).

Detection of Methanotrophs

123

4. The cells are dehydrated by immersing the slide m a graded ethanol series (50, 80,
96%) for 2-3 mm each. The slides are then allowed to air dry
5 Add 10 l.tL Hybridization solutron (9 yL Hybridization buffer (see Section 2 and
Note 19) + 50 ng ohgonucleotide probe) to the dried cell, smear, and incubate the
slide m an isotonically-equilibrated humidrfied chamber (see Note 20) at an appropriate temperature for 2-3 h.
6 Wash off the hybridrzatron solution with 1 mL of wash buffer to remove excess
probe. Immerse the slides m prewarmed wash buffer at an appropriate temperature
for 30 mm
7. Dip the slides m distilled water (1-2 s) to rmse off wash buffer and then allow to au
dry. Apply 20 j.rL Citifluor AF3 to the smear and examine under a covershp on a
Zeiss Axioskop microscope fitted with filter sets 09 and 15. (Typical results with
this technique can be seen in Holmes et al (20)

3.4. Concluding Remarks

The choice of method used depends on the aim of the experiments. Nucleic
acid-based techniques offer great sensitivity but only a semtquantitatrve capacity. Whole-cell-based approaches are less sensitive, but give better quantttatton.
Both strategies are greatly affected by the choice of probe. The greatest database
for probe design exists for the 16s rRNA. Because this is a universally present
gene, interpretation of results from phylogenetic group-specific probes targeting this must be cautious. The sMM0 is thought to be unique to methanotrophs,
however, not all methanotrophs have this gene and the small database means
that the present generatron of probes must be carefully controlled.
Recommendations for which sMM0 gene prrmers to use to detect mmo genes
are given in McDonald et al. (7), however, we suggest that primers for mmoY
are not used because the optimum temperature for PCR was 37C and the use
of mmoX primers probably give the most reliable indication of the presence of
the soluble MM0 gene. The pMM0 is found in all methanotrophs but is also
similar to the ammonia monooxygenase (AMO) of the nitrrfying bacteria. Both
pMM0 and AM0 have a similar substrate range, so it may be useful to detect
both; however, the small database makes methanotroph-specific probes impossible to design at present.
4. Notes
1. Convenient caps can be made by sealing the ends of 1-mL prpet tips m a bunsen
flame and then trimming the tip to fit the Sterivex unit outlet A sterile syringe IS
used as the cap for the mlet
2. Sommervtlle et al (II) report a design for a homemade roller.
3 In some cases, the DNA 1s resrstant to amplificatron. Additional purtfrcation by
CsCl gradient centrrfugation, as described from step 5 onward below, resolves thus
problem

McDonald

et al

4 It 1s important to ensure that the soil sample always remams suspended m the
extraction buffer; vortexmg is often required
5 If no bands are seen after ultracentrtfugatton, tubes can be centrifuged again and
bands are often then produced
6 Not all the brown color may be removed but DNA ~111be sufficiently clean for
PCR after two or three washes with 70% ethanol
7 If excessive degradation of the DNA is observed, difficulty ~111 be experienced m
the amphfication of large products and the incidence of chimera formatton may be
htgh (14).
8 Almost 3000 16s rRNA sequences from bacteria are presently available m the ribosomal database project (RDP) This represents an invaluable resource for probe
design but is probably >l% of the total bacterial diversity Probes targeting 16s
rRNA cannot be guaranteed to be uniquely specific to a target group because it is
impossible to test this at present
9 The Methylococcus-specific
probe descrrbed here has been found to crossreact with
umdentified nonmethanotroph clones in a soil gene library (Kenna, unpublished
data) This probe cannot be used spectftcally to detect MethyEococcus by Itself but
must be used m conlunctton with a second probe
10. Primers targetmg protem-coding genes must cater for redundancy m the genetic
code It 1s not possible to assume specifictty of the primers described here for all
sMM0 genes We are presently experimentmg with the use of umversal nucleoside analogs as alternatives to the mcorporation of multiple degeneracies m primers
Il. It is more convenient to prepare a master mix if the same PCR is to be done on a
large number of samples. This improves reproducibihty and reduces the chance of
contamination
12 The effect of Mg2+ on PCR can vary tremendously accordmg to the template
source/purity and the DNA polymerase used For environmental DNA samples it
may be necessary to use very high Mg*+ levels (up to 10 mM) or carry out additional purtfication steps to remove contaminants that are reducing the available
Mg*+. Some enzymes are less susceptible to vartattons m Mg2+ and we recommend
trying several suppliers polymerases
13 Strong, easily visible bands are obtained from pure cultures using from 1 pg-100
ng of DNA as template We recommend the higher amount of template for envtronmental samples since the incidence of the target organism 1s unknown and
potential template mhibmon effects (because of to msufficient purity) are more
readily detected
14 The identity of PCR products can be further confirmed by sequencing PCR products can be cloned using commercially-available
kits (1 e , TA clonmg Kit,
Invitrogen, San Diego, CA) DNA IS then prepared from clones using the mnnprep
method of Saunders and Burke (17) and sequenced using standard sequencmg
methods (16)
15 Probes that target rRNA must target domains of the molecule that are m easily
accessible portions of the rtbosome A list of ribosomal target sites successfully
used is given m Amann et al. (19)

Detect/on of Methanotrophs

125

16. Enzyme-labeled probes can be used for more sensitive detection but require specialized treatment of the cell wall
17 It is desirable to use probes with a T, of <60C because cells may burst at higher
temperatures
18 The signal strength can be greatly improved by subculturmg an ahquot of cells into
fresh medium and premcubatmg for 6 h prior to cell fixation to stimulate growth
and hence ribosome synthesis
19 Other nomomc detergents are also suitable. The mclusion of formamide m the
hybridization buffer is optronal Formamide decreases duplex stability, allowmg
improved specificity of hybridization at lower temperatures and may also have an
effect on increasing accessibihty of the probe to its target site within the ribosome.
20. A cheap, effective chamber can be made from a pipet tip box with a lmmg of tissue
paper soaked m hybridization buffer

Acknowledgments
This work
BBSRC,

was supported
AFRC, and EEC

financially

by the NERC

TIGER

initiative,

References
1 Bowman, J P , Sly, L I , Nicholas, P D., and Hayward, A C (1993) Revised taxonomy of the methanotrophs description of Methylobacter
gen nov , emendanon
of Methylococcus,
validation of Methylosmus species and a proposal that the family Methylococcaceae
includes only group I methanotrophs Int. J. Syst. Bactenol.
43,735-753
2 Brusseau, G A , Bulygma, E S , and Hanson, R. S (1994) Phylogenetic analysis
and development of probes for differentiatmg methylotrophic bacteria. Appl
Envwon

Mlcroblol

60,626-636.

3 Murrell, J C , and Kelly, D P (1993) MicrobzaZ Growth on Cl Compounds,

Intercept, Andover, UK.
4 Murrell, J C. (1994) Molecular genetics of methane oxidation. Biodegradation
5,
145-159
5 Alvarez-Cohen, L , McCarty, P L , Boulygma, E , Brusseau, G , and Hanson, R. S
(1992) Cometabolic biotransformation of tnchloroethylene and chloroform by a bacterial consortmm grown with methane. Appl Environ. Mzcrobzol. 58, 1886-1893.
6 Murrell, J C , Holmes, A J , McDonald, I. R., and Kenna, E (1995) The development of molecular ecology techniques for the detection of methanotrophs m the
natural environment, m The Mzcrobiology
of Atmospheric
Trace Gases: Sources,
Sznks and Global Change Processes, (Murrell, J C and Kelly, D P., eds ), NATO
AS1 Series, Springer Verlag, pp 135-15 1
7 McDonald, I R., Kenna, E M , and Murrell, J C (1995) Detection of methanatrophic bacteria m environmental samples by using the polymerase chain reaction.
Appl Environ Microblol
61, 116-121
8 Semrau, J. D., Chlstoserdov, A., Lebron, J., Costello, A., Davagnmo, J., Kenna,
E , Holmes, A J , Finch, R , Murrell, J. C , and Lidstrom, M E (1995)

126

McDonald et al.

Particulate methane monooxygenase genes m methanotrophs J Bacterzol 177,

307 l-3079.
9. Bowman, J P (1992) The systematics of methane-utihzmg bacteria PhD Thests,
Umverstty of Queensland, Brisbane, Austraha
10. Oakley, C. J , and Murrell, J. C. (1988) ni$4 genes m obhgate methane oxtdtsmg
bacteria FEMS Mlcroblol. Lett 49,53-57
11 Sommerville, C. J , Knight, I T , Straube, W L , and Colwell, R R. (1989) Simple,
rapid method for direct isolation of nucleic acids from aquatic environments Appl
Environ

Mlcroblol

55,548-554

12. Selenska, S , and Klingmuller, W (1991) DNA recovery and direct detection of
Tn5 sequences from so11 Lett Appl Mlcroblol 13,21-24
13 Bruce, K D , H~oms, W D , Hobman, J L. Osbom, A M , Stroke, P , and Ritchie,
D A (1992) Amplification of DNA from native populations of soil bacteria by
usmg the polymerase chain reaction. Appl Envzron Mlcrobzol. 58,3413-3416
14 Ltesack, W , Weyland, H , and Stackebrandt, E (1991) Potential risks of gene
amphfication by PCR as determined by 16s rDNA analysis of a mtxed-culture of
strict barophthc bacteria Mzcrob Ecol 21, 191-198
15. Murrell, J C , McGowan, V., and Cardy, D L N (1993) Detection of methylotrophic bacteria m natural samples by molecular probmg techniques
Chemosphere26, 1- 11
16 Sambrook, J , Frnsch, E F , and Mamatis, T (1989) Transfer of DNA from agarose
gels to solid supports, m Molecular Cloning A Laboratory Manual, 2nd ed Cold
Spring Harbor Laboratory, Cold Sprmg Harbor, NY, p. 9.34.
17. Saunders, S E , and Burke, J F (1990) Rapid isolation of mmiprep DNA for double strand sequencing Nucleic AczdsRes l&4948
18 Amann, R I , Stromley, J , Devereaux, R , Key, R., and Stahl, D A (1992)
Molecular and microscoptc identiftcatton of sulfate-reducmg bacteria m multispecies biofilms Appl Environ Microbzol 58,614-623
19 Amann, R I , Ludwig, W , and Schleifer, K H (1995) Phylogenettc tdentification
and zn situ detection of mdividual mtcrobial cells without cultivation Mzcrobzol
Rev 59,143-169

20 Holmes, A. J , Owens, N J P , and Murrell, J C (1995) Detection of novel marme

methanotrophs using phylogenetic and functional gene probes after methane
enrichment Mzcroblology 141,1947-1955