Biocatalysis and Agricultural Biotechnology 4 (2015) 304308

Contents lists available at ScienceDirect

Biocatalysis and Agricultural Biotechnology

journal homepage: www.elsevier.com/locate/bab

Original Research Paper

Co-aggregation of Pseudomonas uorescens and Bacillus subtilis

in culture and co-colonization in black gram (Vigna mungo L.) roots
Nikita Rathi, Sneha Singh, Jabez Osbone, Subramanian Babu n
School of Bio Sciences and Technology, VIT University, Vellore 632014, Tamil Nadu, India

art ic l e i nf o

a b s t r a c t

Article history:
Received 27 January 2015
Received in revised form
12 May 2015
Accepted 18 May 2015
Available online 27 May 2015

Many plant growth promoting rhizobacteria (PGPR), biocontrol agents and biofertilizer bacteria are used
in agriculture. They are applied to crops by seed or soil application which colonizes in the rhizosphere.
Although there are extensive reports on the output (growth, yield, disease resistance, phenotypes, etc) of
the combined inoculations of these bacteria the companionship among these bacteria and the relative
contribution to overall output is largely unknown. The starting point to unravel this would be to study
the bacterial companionship in terms of ability to co-aggregate, stability of co-aggregation and
developing molecular evidences for co-colonization in crop roots. Our work mainly aimed at understanding the extent of co-aggregation between Pseudomonas uorescens and Bacillus subtilis and their cocolonization abilities in plant roots. This was veried by conducting several experiments of coaggregation and effect of various factors like pH and growth phase, effect of various treatments like
urea, protease K, EDTA, heat, thermal stability, sonication and desiccation on the extent of the coaggregation. Co-aggregation between these two bacteria was found to be pH and growth phase
dependent. Protease and EDTA treatment reduced the co-aggregation whereas sonication treatment
improved the same. Talc based formulation of the bacteria was prepared separately and used for seed
treatment in black gram. The seeds were germinated under laboratory conditions and growth
parameters were observed. DNA from roots of germinated seedlings was used as template to amplify
bacterial DNA with species specic primers. PCR analysis results indicated that P. uorescens and B.
subtilis are compatible in colonizing black gram.
& 2015 Elsevier Ltd. All rights reserved.

Keywords:
Bacillus subtilis
Black gram
Co-aggregation
Co-colonization
Pseudomonas uorescens

1. Introduction
Many bacterial species including Azospirillum, Azotobacter,
Azorhizobium, Pseudomonas uorescens, Bacillus subtilis are used
in agriculture for different purposes and applied as formulation
either in the form of seed treatment or soil application. Though
plant growth promotion and biocontrol were observed in laboratory, green house and eld experiments, application in the farmers
eld suffers from inconsistency (Okon and Laberandera-Gonzalez,
1994). To overcome this problem, application of more than one
bacteria as mixed inoculants was suggested (Bashan and Holguin,
1997). VanVeen et al. (1997) suggested mixing many microbes in
the form of consortia towards varied benets to the plants.
Multigeneric microbial coaggregates were proposed by Neyra
et al. (1997) for application as microbial inoculants in agriculture.
Still growing discovery of benecial effects of Pseudomonas uorescens include i) plant growth promotion ii) antifungal compounds

Corresponding author. Tel.: 91 9790166084; fax: 91 416 2243092.

E-mail address: babu.s@vit.ac.in (S. Babu).

http://dx.doi.org/10.1016/j.bcab.2015.05.003
1878-8181/& 2015 Elsevier Ltd. All rights reserved.

and enzymes iii) induction of systemic resistance against pests and

pathogens iv) imparting tolerance to abiotic stresses and v) interaction
with other PGPR species. Bacillus species exist naturally in the plant
surface (Arias et al., 1999) and rhizosphere (Mohammadipour et al.,
2009). The metabolites and proteins produced by Bacillus are known
to play important role in plant growth as well as control of pest and
diseases (Priest, 1993).
The rst step towards developing compatible consortia of
benecial bacteria for the purpose of application to crop plants
would be to study their compatibility in culture and laboratory
plant inoculation experiments. Cultural compatibility is often
measured by the ability of bacteria to co-aggregate with the
partner bacteria to which they are mixed with. Co-aggregation is
a phenomenon of clumping of cells of different bacteria (Gibbons
and Nygaard, 1970; Cisar et al., 1979), and when it is an interbacterial co-aggregation, it can even be viewed with naked eye
(Kolenbrander, 1989).
In our current work, we studied the effect of different chemical
and physical parameters affecting the co-aggregation of P. uorescens and B. subtilis and its stability. Very less research has been
carried out on the cellular and molecular level interaction between

N. Rathi et al. / Biocatalysis and Agricultural Biotechnology 4 (2015) 304308

these two bacteria either in the culture, in the soil or root vicinity.
It is very important to determine the physical interaction at
cultural co-aggregation and plant root co-colonization level, to
understand the benecial effects of mixed formulations and the
relative contribution of each of the member bacteria in the
consortia. This will ultimately lead to selection of efcient and
compatible species and also to design a better formulation to
improve the performance under eld conditions.

2. Materials and methods

2.1. Bacterial cultures
Pseudomonas uorescens (strain PF1) and B. subtilis (strain TNAU
G-1) cultures used in the study were obtained from Department of
Plant Pathology, Tamil Nadu Agricultural University, Coimbatore,
India. GenBank accession numbers for 16S rRNA gene sequence
are: AY818674 (P. uorescens) and KP419701.1 (B. subtilis). These
two cultures were characterized and commercially produced in
Tamil Nadu Agricultural University and widely used by farmers
of India.
2.2. Co-aggregation assay
One ml aliquots of B. subtilis and P. uorescens overnight
cultures (OD A600 1.0) were mixed together in 10 ml coaggregate buffer (20 mM TrisHCl buffer (pH 7.8), 0.01 mM CaCl2,
0.01 mM MgCl2, 0.15 M NaCl, 0.02% NaN3) and vortexed for 10 s.
The mixture was incubated in a rotary shaker for three min and
left undisturbed for 24 h (Grimaudo and Nesbitt, 1997).
2.3. Estimation of co- aggregation
The degree of co-aggregation was calculated using the scores 0:
no visible aggregates, 1 : small uniform co-aggregates, 2 :
denite co-aggregate but with turbidity suspension, 3 : large
co-aggregates that separates rapidly with clear supernatant. The
mixture was diluted with 0.5 ml of buffer and was gently vortexed
for few s. The diluted mixture was allowed to stand for 30 min at
room temperature and centrifuged at 7000  g for two min. The
supernatant was collected and absorbance was read at 650 nm
(Cisar et al., 1979). The percentage of co-aggregation was calculated using the formula by McIntire et al. (1978) as follows:
Percentage co aggregation

A650B A650P A650B P

 100
A650B A650P

where B is the control containing B. subtilis, P is the control

containing P. uorescens cells and B P is the mixture containing
both bacteria. The assay was carried out in triplicates to check the
reproducibility of observed results.
2.4. Quantication of ocs
The ocs were ltered through Whatman no. 1 lter paper. The
lter paper along with ocs was dried in the oven at 60 1C for two
hours. Based on weight of empty lter paper, oc weight was
determined and expressed in mg/l (Sadasivan and Neyra, 1985).
2.5. Effect of pH on the co-aggregation
The strains were grown in M9 salt minimal media (Sambrook
et al., 1989) maintained at pH ranging 48 in a rotatory shaker at
30 1C. After incubation of 120 h, the cultures were centrifuged and
co-aggregation was estimated as described.

305

2.6. Effect of different growth phase

The strains were grown in M 9 minimal media for ve days and
the bacterial cells were separated at different phases of growth
(lag, log and stationary phase). Co-aggregation was estimated after
transferring the cells to co-aggregation buffer.
2.7. Effect of protease and urea
The co-aggregates used were treated with proteinase K at
1 mg ml  1 for three h at 37 1C. The co-aggregation percentage
was estimated. Co-aggregates in the phosphate buffer were
supplemented with 2 M urea. Aggregates were sonicated for a
minute and incubated at 50 1C for three hours. After transferring to
co-aggregation buffer, percentage of co-aggregation was
estimated.
2.8. Effect of sonication and heat
The co-aggregates were centrifuged twice at 5000  g for
10 min, and resuspended in 10 mM of phosphate buffer. After ve
min of sonication, the cells were centrifuged at 5000  g for ve
min. Pellets were collected and suspended in the co-aggregate
buffer.The percentage of co-aggregation was estimated. Sonication
was done for one minute and the suspension was incubated at
50 1C for three hours. The cells were transferred to co-aggregate
buffer and the stability was determined as described earlier.
2.9. Effect of chelating agent
EDTA was added at a concentration of 1 mM (nal concentration) to phosphate buffer containing co-aggregates. The cells were
then sonicated for one min and harvested by centrifugation at
5000  g for 15 min. The percentage of co-aggregation was
estimated.
2.10. Observation on thermal tolerance
The co-aggregates were mixed with ve ml of phosphate buffer
(10 mM) in test tubes and maintained in water bath at 50 1C for
20 min followed by rapid cooling. One ml of sample was serially
diluted and 10  5 and 10  6 diltuion cultures were used for nutrient
agar plating. After 24 h of incubation, the growth of colonies was
observed.
2.11. Effect of desiccation on co-aggregates
The co-aggregates were transferred to 1.5 ml tubes and kept
open in sterile Petri plate in 37 1C incubator for one week. The
dried cells were washed with 1 ml of sterile distilled water and
plated in nutrient agar to check the viability of cells.
2.12. Preparation of talc based formulation
B. subtilis and P. uorescens were grown in nutrient broth in a
rotary shaker at 200 rpm until the cell population reached 1010
1011 CFU ml  1. Talc based carrier material was prepared as
described by Vidhyasekaran et al. (1997) with 20 g kg  1 carboxy
methyl cellulose and 15 g kg  1 calcium carbonate. About 200 ml
of the bacterial culture was used per kg of the carrier material in
the case of single culture. For the mixed culture, 100 ml each of the
bacterial cultures were mixed. The talc based formulation thus
prepared was air dried in culture room and packed aseptically in
sterile polythene bags. The formulation for uninoculated control
contained talc, carboxy methyl cellulose and calcium carbonate
without any bacteria.

306

N. Rathi et al. / Biocatalysis and Agricultural Biotechnology 4 (2015) 304308

2.13. Seed treatment

Black gram seeds were rinsed thoroughly with tap water for
15 min. The wrinkled and non-viable seeds were discarded. Seeds
were suspended in 6% sodium hypochlorite solution for 10 s
followed by washing twice with sterile water. Seeds were treated
with 70% ethanol for one min and then washed thrice with sterile
water. The seeds were then soaked in wet muslin cloth and left
overnight in dark, for sprouting. Seeds were mixed with bacterial
formulation (10 g kg  1 of seeds) and incubated for one hour at
room temperature. The seeds were arranged in germination paper
which were rolled and kept in beakers containing sterile water.
Growth parameters were observed on 5 days old seedlings.
2.14. Isolation of DNA from root tissues
DNA isolation was carried out as per the standard protocol
(Khan et al., 2007). The fresh root samples of germinated seedlings
were homogenized in mortar and pestle using liquid nitrogen. The
freeze dried powder was transferred to sterile micro-centrifuge
tubes and 4 ml of extraction buffer [CTAB 3% (w/v), TrisHCl
100 mM, NaCl 2 M, EDTA 25 mM, -mercaptoethanol 4%, PVP 5%
(w/v)] was added. Tubes were kept in water bath at 70 1C for
30 min. Chloroform:isoamylalcohol (24:1) was added to the mixture and centrifuged at 8000  g for 10 min at 25 1C. The aqueous
phase was transferred in fresh tube to which 0.6 volumes of icecold isopropanol was added for the precipitation of DNA and was
stored at 20 1C for 30 min. The precipitated DNA was centrifuged
at 8000  g for 10 min at 4 1C. The supernatant was discarded and
the pellet was washed with 80% ethanol twice and dried at room
temperature for 15 min. The DNA pellet was dissolved 30 ml of
TE RNase.
2.15. PCR analysis
PCR was carried out in 20 ml volumes each containing 200 ng of
DNA, 0.2 mM each of dNTP, 0.5 mM of each oligonucleotide primer and
1 U Taq polymerase. Reactions were carried out in a thermal cycler (Life
Technologies, California, USA) using the following program: an initial
denaturation at 94 1C for 2 min; 30 cycles of 94 1C for 1 min, 54 1C for
1 min (B. subtilis) and 45 1C for 1 min (P. uorescens), 72 1C for 1 min,
nal extension at 72 1C for 7 min. Amplied DNA were electrophoresed
in a 1% agarose gel, stained with ethidium bromide and visualized
under UV trans-illuminator. For amplication of B. subtilis species
specic DNA fragment from ytcP gene, the following primers
were used: Forward 50 GCTTACGGGTTATCCCGC30 and reverse 50
CCGACCCCATTTCAGACATATC30 (Kwon et al., 2009). The primers used
for amplication of P. uorescens species specic DNA fragment from
16S23S ITS region were: Forward 50 : AAGTCGTAACAAGGTAG30 and
reverse 50 GACCATATATAACCCCAAG30 (Rameshkumar et al., 2002).

was high at lower and higher pH levels. However, at neutral pH,

the co-aggregation showed a slight decrease. Possible inuence of
growth phase on co-aggregation is given in Fig. 2. Stationary phase
was found to be the best for co-aggregation.

3.3. Stability and viability of co-aggregates

The co-aggregates were subjected to various treatments to test
the stability (Table 2). The co-aggregate percentage was found to
decrease greatly after proteinase K and EDTA treatments. Stability
was not altered to signicant level after urea or heat treatment.
However, sonication of the cultures increased the co-aggregation.
After thermal treatment, the strains still grew well on nutrient
agar media and formed well dened colonies. The colonies
survived even after one week of desiccation and both observations
indicating the viability of co-aggregation.

3.4. Growth of black gram seedlings

Growth parameters observed on black gram seedlings treated
with either single bacterium or the mixture is presented in Table 3.
Although the germination percentage increased in combined
inoculation, growth of seedlings in terms of root and shoot length
was less compared to no-bacterial control. Among the single
culture treatments, P. uorescens supported the growth of seedlings better than B. subtilis.

3.5. PCR analysis of co-colonization

Species specic primers of P. uorescens and B. subtilis amplied
the respective bacterial DNA fragments of  500 bp and 400 bp
(Fig. 3; lanes 2 and 6). DNA from roots of untreated seedlings
showed no amplication in both cases where P. uorescens and B.
subtilis primers were used (lanes 1 and 5). When DNA from roots
of seedlings treated with both the bacteria, the primers yielded
respective expected size amplication (lanes 3 and 7) indicating
the presence of both bacteria inside the root tissues.
Table 1
Co-aggregation of B. subtilis and P. uorescens.
Test 1

Test 2

Test 3

Test 4

Test 5

0 no visible co-aggregates, 1 small co-aggregates, 2 small denite coaggregates with turbid suspension, 3 large co-aggregate that separate rapidly
with clear supernatant.

3. Results
3.1. Co-aggregation assay
In the present study, co-aggregates of P. uorescens and B.
subtilis were large and separated rapidly leaving clear supernatant.
On an average of replicated tests, the percentage of co-aggregation
was found to be 77.4 (scoring done based on the criteria given in
Table 1). The oc yield was 2.2 mg l  1.
3.2. Effect of pH and growth phase
The co-aggregation of two species at different pHs ranging
from 4.0 to 8.0 is given in Fig. 1. The co-aggregation percentage

Fig. 1. Effect of pH on the co-aggregation of P. uorescens and B. subtilis.

N. Rathi et al. / Biocatalysis and Agricultural Biotechnology 4 (2015) 304308

4. Discussion
One of the major bottleneck to the wide spread success of
benecial bacterial inoculants in agricultural crops is the inconsistency across crops, seasons, soil and agro-climatic conditions. Not
much work has been done on the compatibility of the PGPR bacteria
with each other except for some mixed formulations involving either
two biocontrol agents or two biofertilizers. Direct eld trials using
mixed formulations have resulted in increased yield and disease
resistance, than individual stains, in crop plants and have been
recorded (Nandakumar et al., 2002). However, the relative contribution of each of the strain in the overall performance of the crops is
largely unknown (Babu, 2011). Studies on P. uorescens-based coaggregation and microbial consortia are mostly oriented towards
nitrogen xing bacteria in the combination. We attempted to study
the companionship between functionally different P. uorescens and
B. subtilis.
Bahat-Samet et al. (2004) stated that aggregation is important
in the production, storage and survival of agriculturally important
bacterial inoculants. Aggregation can also be induced by changes
in the nutrients of culture media in which bacterial cells are grown
(Sadasivan and Neyra, 1985; Burdman et al., 1999) or by addition of
various inducing agents (Joe et al., 2009). Hence, studies on the
ability of bacteria to co-aggregate with other and the effect of

Fig. 2. Effect of different growth phases on the co-aggregation of P. uorescens and

B. subtilis.

307

various physical and chemical factors on the stability of coaggregation is of great signicance before effective formulation
for eld applications can be made.
When reports on the co-aggregation between P. uorescens and
B. subtilis the two successful commercially applied bioinoculants
in India were almost not available, we have demonstrated the
co-aggregation of these two bacteria. We observed a result similar
to the one reported by Joe et al. (2009) in the study on effect of pH
on co-aggregation. However, they reported on Azospirillum brasilensense with other PGPR bacteria like Azotobacter, Azorhizobium,
B. megatherium and P. uorescens. As reported by Bitton and
Marshall (1980) and Foster and Bowen (1982), repulsive forces
between bacteria would have been weakened by neutralization of
negative ions in the acidic pH resulting in co-aggregation. After a
decline in co-aggregation at pH 7.0, the increase observed in pH
8.0 could be attributed to the tendency of P. uorescens and B.
subtilis to re-aggregate. Stationary phase (Joe et al., 2009) or early
stationary phase (Richard et al., 2000) is the optimal growth phase
for maximum co-aggregation in bacteria. Our results are also in
conformity with above reports.
Among the different treatments, EDTA and proteinase K
resulted in reduction of co-aggregation. Proteinase K reduced the
co-aggregation percentage from 77.3 to 49.9 which is about 35%
reduction. A similar calculation for EDTA shows 31% reduction.
Jenkinson et al. (1990) observed inhibition of co-aggregation of
human pathogenic bacteria upon EDTA treatment and the treated
cells failing to restore aggregation after adding sugars. Later,
Burdman et al. (1998) conrmed the role of membrane proteins
in cell adhesion. The results observed in our study with proteinase
K and EDTA treatment supports the same.
In our study, heat treatment had less effect on co-aggregation
(reduction % only 3.06) as against it was reported in Azospirillum
with other bacteria (Kolenbrander and Williams, 1983; Joe et al.,
2009). Sonication is known to remove cell wall components that
interfere with adhesion (Joe et al., 2009) thus providing justication for increased aggregation observed in the current study after
sonication. Although the number of colonies after thermal and
desiccation treatments was not counted, grown on agar plates was
similar to control (un-mixed cultures). This indicates the stability/
tolerance of aggregation to thermal and desiccation treatment as

Table 2
Effects of various treatments on stability of co-aggregation.
Treatments

After treatment co-aggregation %

Urea
Proteinase K
Heat
EDTA
Sonication

75.45 7 1.4
49.997 4.1
74.99 7 2.0
52.93 7 8.3
84.87 7 0.5

Fig. 3. PCR amplication of bacterial DNA from inoculated black gram roots. Lanes
1-DNA from uninoculated plants-P. uoresens primers, 2-DNA from P. uorescens
treated plants-P. uoresens primers, 3-DNA from P. uorescens and B. subtilis treated
plants-P. uoresens primers, 4-DNA from uninoculated plants-B. subtilis primers,
5-DNA from B. subtilis treated plants-B. subtilis primers, 6-DNA from P. uorescens
and B. subtilis treated plants-B. subtilis primers.

Co-aggregation % before the treatments was 77.36 7 1.2.

Table 3
Growth parameters recorded in black gram treated with P. uorescens and B. subtilis.
Growth parameters

Control

B. subtilis

P. uoresens

P. uoresens and B. subtilis

Viability percentage
Shoot length
Root length
No. of leaves
No. of branches
Color of leaves
Overall appearance

87%
22.7
15.2
2
1
Light green
Shoot: slender, with long
branches.
Root: good tap and little lateral
root development

80%
17.87
7.3
2
1
Light green
Shoot: long and slender.

76.67%
19.25
18.2
2
1
Light green
Shoot: long slender.

90%
20.5
11.5
2
1
Light green
Shoot: long and slender.

Root: best tap root growth with ne

lateral root growth

Root: ne tap root with better Root: best tap root and with best
lateral growth
lateral root growth.

308

N. Rathi et al. / Biocatalysis and Agricultural Biotechnology 4 (2015) 304308

well. Stability of P. uorescens and B. subtilis co-aggregates to heat,

thermal and desiccation treatment, in addition to lower and
higher pH provides important clues on eld performance point
of view. Different soil and agro-climatic zones are characterized by
varying soil parameters including pH, temperature, moisture
holding capacity etc. P. uorescens and B. subtilis in a consortia
are likely to perform effectively in different soil-crop environments as their aggregation is stable than aggregation of other
PGPR bacteria previously reported.
As against the expectations, combined inoculation of both the
bacteria had no signicant effect on black gram growth, compared
to uninoculated control. But it is evident from PCR analysis that
both bacteria have colonized root tissues. The growth stage of
seedlings we observed may be too early (5 days old) to visualize
signicant growth effect. However, the possibility for physical cocolonization without physiological effects cannot be also
neglected. P. uorescens and B. subtilis being biocontrol agents
may start producing/inducing compounds inside plant tissue after
establishment. Nevertheless, our observations have provided preliminary evidences for compatibility of these two bacteria in coaggregating in culture and co-colonizing in plant roots.
Acknowledgment
The authors gratefully acknowledge the support rendered by
the Management, VIT University, Vellore, India.
References
Arias, R.S., Sagardoy, M.A., Van Vuurde, J.W.L., 1999. Spatio-tem poral distribution of
naturally occurring Bacillus spp. and other bacteria on the phylloplane of
soybean under eld conditions. J. Basic Microbiol. 39, 283292.
Babu, S., 2011. Pseudomonas uorescens mediated biocontrol: from lap to lab to
land. Biotechnol. J. 6, 488491.
Bahat-Samet, E., Castro-Sowinski, S., Okon, Y., 2004. Arabinose content of extracellular polysaccharides plays a role in cell aggregation of Azospirillum brasilense. FEMS Microbiol. Lett. 237, 195203.
Bashan, Y., Holguin, G., 1997. Proposal for the division of plant growth promoting
rhizobacteria into two classication: biocontrol-PGPB and PGPB. Soil Biol.
Biochem. 30, 12251228.
Bitton, G., Marshall, K.C., 1980. Adsorption of Microorganisms to Surfaces. In:
Daniels, S.L. (Ed.), Mechanisms involved in sorption of microorganisms to solid
surfaces. Wiley, NY, USA, p. 75.
Burdman, S., Jurkevitch, E., Schwartsburd, B., Okon, Y., 1999. Involvement of outer
membrane proteins in aggregation of Azospirillum brasilense. Microbiology 145,
11451152.

Cisar, J.O., Kolenbrander, E., McIntire, F.C., 1979. Specicity of coaggregation

reactions between human oral Streptococci and Actinomyces viscosus or
Actinomyces naeslundii. Infect. Immun. 24, 742752.
Foster, R.C., Bowen, G.D., 1982. Plant surfaces and bacterial growth: the rhizosphere
and rhizoplane prokaryotic pathogens and symbionts. In: Mount, M.S., Lacy, G.
H. (Eds.), Phytopathogenic Prokaryotes. Academic Press, NY, USA, p. 159.
Gibbons, R.J., Nygaard, M., 1970. Interbacterial aggregation of plaque bacteria. Arch.
Oral Biol. 15, 13971400.
Grimaudo, N.J., Nesbitt, W.E., 1997. Co-aggregation of Candida albicans with oral
Fusabacterium sp. Oral Microbiol. Immunol. 12, 168173.
Jenkinson, H.F., Lala, H.C., Shepherd, M.G., 1990. Coaggregation of Streptococcus
sanguis and other Streptococci with Candida albicans. Infect. Immun. 58,
14291436.
Joe, M.M., Jaleel, C.A., Sivakumar, P.K., Zhao, C-X., Karthikeyan, B., 2009. Coaggregation in Azospirillum brasilense MTCC-125 with other PGPR strains: effect
of physical and chemical factors and stress endurance ability. J. Taiwan Inst.
Chem. Eng. 40, 491499.
Kolenbrander, P.E., 1989. Surface recognition among oral bacteria: multigeneric
coaggregation and their mediators. Crit. Rev. Microbiol. 17, 137158.
Kolenbrander, P.E., Williams, B.L., 1983. Prevalence of viridans Streptococci exhibiting lactose-inhibitable coaggregation with oral actinomycetes. Infect. Immun.
41, 449452.
McIntire, F.C., Vatter, A.E., Baros, J., Arnold, J., 1978. Studies on the mechanism of
coaggregation between Actinomyces viscosus T14V and Streptococcus sanguis34. Infect. Immun. 21, 978988.
Mohammadipour, M., Mousivand, M., Jouzani, G.S., Abbasalizadeh, S., 2009.
Molecular and biochemical characterization of Iranian surfactin-producing
Bacillus subtilis isolates and evaluation of their biocontrol potential against
Aspergillus avus and Colletotrichum gloeosporioides. Can. J. Microbiol. 55,
395404.
Nandakumar, R., Babu, S., Viswanathan, R., Sheela, J., Raguchander, T., Samiyappan,
R., 2002. A new bioformulation containing plant growth promoting rhizobacterial mixture for the management of sheath blight and enhanced yield in rice.
Biocontrol 46, 493510.
Neyra, C.A., Arunakumari, A., Olybayi, O., 1997. Flocculated Microbial Inoculants for
Delivery of Agriculturally Benecial Microorganisms. U.S. Patent, 5, 697, 186.
Okon, Y., Laberandera-Gonzalez, C.A., 1994. Agronomic application of Azospirillum
an evaluation of 20 years worldwide eld inoculation. Soil Biol. Biochem. 26,
15911601.
Priest, F.G., 1993. Systematics and ecology of Bacillus. In: Sonenshein, A.L. (Ed.),
Bacillus subtilis and Other Gram-Positive Bacteria: Biochemistry, Physiology,
and Molecular Genetics. ASM Press, Washington DC, USA, pp. 316.
Richard, A.H., Leach, S.A., Buswell, C.M., High, N.J., Handley, P.S., 2000. Coaggregation between aquatic bacteria is mediated by specic growth phase dependent
lectin-saccharide interactions. Appl. Environ. Microbiol. 66, 431434.
Sadasivan, L., Neyra, C.A., 1985. Flocculation of Azospirillum brasilense and Azospirillum lipoferum: exopolysaccharides and cyst formation. J. Bacteriol. 163,
716723.
Sambrook, J., Fritisch, F., Maniatis, T., 1989. Molecular Cloning: A Laboratory
Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA.
VanVeen, A.J., Van, L.S., Van-Eles, J.D., 1997. Fate and activity of microorganisms
introduced into soil. Microb. Mol. Biol. Rev. 61, 121133.
Vidhyasekaran, P., Rabindran, R., Muthamilan, M., Nayar, K., Rajappan, K., Subramanian, N., Vasumathi, K., 1997. Development of powder formulation of
Pseudomonas uorescens for control of rice blast. Plant Pathol. 46, 291297.