Acta Tropica 157 (2016) 158161

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Short communication

Molecular surveillance of antimalarial drug resistance related genes in

Plasmodium falciparum isolates from Eritrea
Michela Menegon a , Abduselam M. Nurahmed b , Albadawi A. Talha b , Bakri Y.M. Nour c ,
Carlo Severini a,
a

Department of Infectious, Parasitic and Immunomediated Diseases, Istituto Superiore di Sanit, Viale Regina Elena, 299, 00161 Rome, Italy
Faculty of Medical Laboratory Sciences, University of Gezira, P.O. Box 20, Wad Medani, Sudan
c
Blue Nile Research National Institute for Communicable Diseases, University of Gezira, P.O. Box 20, Wad Medani, Sudan
b

a r t i c l e

i n f o

Article history:
Received 16 November 2015
Received in revised form 9 February 2016
Accepted 10 February 2016
Available online 11 February 2016
Keywords:
Plasmodium falciparum
Eritrea
Drug resistance
Kelch 13 propeller
Pfmdr1
Pfcrt

a b s t r a c t
The introduction of artemisinin-based combination therapy has led to extraordinary results in malaria
control, however the recent emergence of partial resistance to artemisinin therapy in Southeast Asia
jeopardizes these successes. This study aimed at investigating resistance to the antimalarial drugs by
evaluating the polymorphisms in the PfK13, Pfcrt and Pfmdr1 genes in Plasmodium falciparum isolates
obtained from patients in Eritrea.
2016 Elsevier B.V. All rights reserved.

1. Introduction
After the emergence and spread of Plasmodium falciparum
multi-drug resistant isolates insensitive to most of the available
antimalarials, the introduction of artemisinin-based combination
therapy (ACT) as a rst-line drug treatment for non-complicated
malaria has opened a new horizon in the ght against malaria, with
extraordinary results: in practical terms, over the last decade, a
dramatic reduction of mortality due to malaria in children, especially in sub-Saharan Africa, has been achieved and the total malaria
cases dropped by 40% worldwide (Bhatt et al., 2015). Unfortunately,
two studies carried out in 2008 and 2009 in Western Cambodia
showed unequivocally that P. falciparum was developing resistance
to artemisinin (Noedl et al., 2008; Dondorp et al., 2009), and to date,
partial artemisinin resistance is spreading across mainland Southeast Asia (Ashley et al., 2014). The possible extent of resistance to
artemisinin in Africa would have a devastating effect on child mortality and could wipe out the successes achieved in this decade

Corresponding author.
E-mail addresses: michela.menegon@iss.it (M. Menegon),
peace.abdu@gmail.com (A.M. Nurahmed), badawiat@yahoo.com (A.A. Talha),
bakrinour@gmail.com (B.Y.M. Nour), carlo.severini@iss.it (C. Severini).
http://dx.doi.org/10.1016/j.actatropica.2016.02.007
0001-706X/ 2016 Elsevier B.V. All rights reserved.

in the ght against malaria. The recent identication of Kelch 13

propeller (PfK13) gene as a marker of artemisinin resistance (Ariey
et al., 2014) has provided the international scientic community
with a molecular marker to track in real time the emergence
of resistant falciparum isolates before the artemisinin resistance
spread in Africa. The PfK13 gene codes for a Kelch protein, characterized by a C-terminal six-blade propeller region. Three point
mutations (C580Y R539T Y493H) in the propeller region have
been associated with in vitro artemisinin resistance and prolonged
parasite half-life after treatment in Cambodian eld isolates (Ariey
et al., 2014). Furthermore, so far, several SNPs have been identied
in this gene in P. falciparum isolates from Asia and Africa (Ashley
et al., 2014; Conrad et al., 2014; Mohon et al., 2014; Takala-Harrison
et al., 2015; Taylor et al., 2015; Tun et al., 2015).
Artesunate-amodiaquine (AS-AQ) was introduced in Eritrea in
2007 as rst-line treatment for uncomplicated malaria. In 2010, a
study, conducted in ve sentinel sites in Gash Barka region by the
National Malaria Control Programme to evaluate the therapeutic
efcacy of AS-AQ in this area, showed treatment failure in 7.6% of
patients treated with AS-AQ (Malaria Update, 2011). This ratio is
close to the cut-off limit suggested by WHO, i.e. 10%, to take into
consideration a change in the local malaria treatment policy.
The objective of the present study was to investigate the
presence of point mutations in the PfK13 gene to monitor the pos-

M. Menegon et al. / Acta Tropica 157 (2016) 158161

159

Fig. 1. Study sites for present investigation in Eritrea.

Fig. 2. Frequencies of SNPs in Pfcrt codons 7276 and in Pfmdr1 codons 86,153,184 in P. falciparum isolates from Eritrea.

sible emergence of resistance to the artesunate drug in Eritrea.

Mutations in Pfmdr1 and Pfcrt genes as markers of resistance to
amodiaquine, the partner drug in the ACT in Eritrea, were also
investigated.

2. Materials and methods

Between November 2013 and November 2014, a total of 209
malaria infected blood samples were collected in Eritrea from
three study sites: 200 samples from Barentu and Agordat, in the

160

M. Menegon et al. / Acta Tropica 157 (2016) 158161

Gash Barka region, and 9 samples from Medefera, in the Debub

region (Fig. 1). Both regions are in a stable endemic malaria zone
and represent the two areas with the highest malaria burden in
Eritrea. Ethical approval for sample collection was obtained from
the Ethics Committee of the Eritrean Ministry of Health. Following
informed consent of the patient or their guardian, a blood sample by
nger prick was collected from microscopically conrmed malariainfected patients, blotted in triplicate on a lter paper, and air dried.
Filter papers were wrapped separately in a plastic bag and stored
at room temperature. The majority of patients were young adults
(135 men and 74 women) with a median age of 24.2 years (range
1.570 years). Total DNA was extracted from lter papers using
PureLink Genomic DNA Kits-Invitrogen, according to the manufacturers instruction. P. falciparum and P. vivax infections were
conrmed by Real-Time PCR method as previously described by
Veron et al. (2009). Of 209 blood samples tested, 160 were infected
with P. falciparum, 24 with P. vivax, 20 were P. falciparum/P. vivax
mixed infections and 5 were negative. On the 180 samples positive
for P. falciparum infection, the polymorphism analysis of the propeller domain, from codon 427 to codon 690, of the PfK13 gene was
performed by PCR amplication and sequencing using the following primers: Artinner For5 GCCTTGTTGAAAGAAGCAGAA 3 and
Artouter Rev5 CGCCATTTTCTCCTCCTGTA 3 , with PCR conditions
described by Taylor et al. (2015).
In addition, the frequency of single nucleotide polymorphisms
(SNPs) at Pfcrt 7276 codons and at Pfmdr1 86184 codons was
assessed by PCR amplication and sequencing as described by
Menegon et al. (2009). All PCR products were sent to Eurons
Genomics Company (Germany) for sequencing. The obtained
sequences were compiled and analyzed by Accelrys DS Gene software.
Modelling of PfMDR1 was performed as described in Pillai et al.
(2012).
3. Results
Compared to the PfK13 wild type reference sequence (P. falciparum 3D7 strain- PF3D7 1343700), no mutations were detected in
the PfK13 propeller region examined in the Eritrean falciparum isolates. Otherwise, 84.5% of P. falciparum isolates showed the mutant
alleles Pfcrt 74I-75E-76T and 85.5% of isolates carried out the Pfmdr1
184F mutation. The wild type codon Pfmdr1 N86 was identied in
88.8% of the isolates. In addition, 41.6% of isolates displayed a novel
point mutation in Pfmdr1 at codon 153, resulting in a change of a
Serine (TCT) to Phenylalanine (TTT).
Visual inspection of the 3D structure model of PfMDR1 conrmed that the amino acidic residue 153 is located in the
N-terminal portion of the TM3 transmembrane helix, in the ABC
conserved domain (residues 58345).
The SNP frequencies in Pfcrt and Pfmdr1 genes are shown in
Fig. 2. Overall, taking in consideration the main three SNPs linked
to AS-AQ susceptibility, eight haplotypes were detected among
the 180 analyzed isolates, and among these the haplotype Pfcrt
76T/Pfmdr1 N86-184F was the predominant (66.7%) (Table 1).
4. Conclusions
Between 2000 and 2013, in Eritrea, malaria admission and
malaria mortality rates decreased by 75% and by 83%, respectively
(WHO, 2014). This progress can be attributed to the implementation of adequate control strategies including prompt treatment
with ACT (NMP, 2013). However, in the last 3 years, despite these
control measures, there has been an alarming increase of incidence of malaria cases and the occurrence of sporadic outbreaks
in many areas of the country (NMP, 2013). In this scenario, the pos-

Table 1
Prevalence of Pfcrt and Pfmdr1 haplotypes identied in analyzed P. falciparum isolates from Eritrea.
Haplotype

wild type
1 mutation
1 mutation
1 mutation
2 mutations
2 mutations
2 mutations
3 mutations

Pfcrt codon

Pfmdr1 codons

76

86

184

K
K
K
T
K
T
T
T

N
Y
N
N
Y
N
Y
Y

Y
Y
F
Y
F
F
Y
F

No. isolates

9
1
17
14
1
120
2
16

5%
0.5%
9.5%
7.8%
0.5%
66.7%
1.1%
8.9%

sible spread of resistance to artemisinin derivatives would further

compromise the situation.
In our study analysis of the PfK13 gene, which is a marker of
AS resistance, did not show any sequence polymorphism in any
analyzed P. falciparum isolates. This result is consistent with a plausible full susceptibility of the parasite population to AS in Eritrea.
Furthermore, identical result has been reported in a recent study
focused on PfK13 polymorphism in Ethiopian isolates (Kamau et al.,
2015) suggesting that the wild type genotype is by far the most
prevalent genotype in this area of Eastern Africa.
Concerning the Pfmdr1 polymorphism linked to the AQ susceptibility, a high frequency (88.8%) of the wild type codon N86 was
observed in Eritrean falciparum isolates. In a recent study (Wurtz
et al., 2014), this allele seem to be signicantly associated with a
decreased susceptibility to AQ and dihydroartemisinin, the active
metabolite of all artemisinin compounds. However the role of the
Pfmdr1 has yet to be well elucidated, since, conversely, others studies have reported a link between the mutation 86Y, mainly in
association with the mutation Pfcrt 76T, and a reduced AQ efcacy
(Holmgren et al., 2006; Dokomajilar et al., 2006; Ibraheem et al.,
2014).
A limitation of our study was the impossibility to match our
molecular ndings with treatment outcome and to test in vitro the
sensitivity to ASAQ of the falciparum isolates. This lack of information does not allow us to make a correct evaluation about the level
of sensitivity of the Eritrean falciparum isolates to ASAQ, including
the possible role of the novel Pfmdr1 S153F mutation detected in
almost half of the analyzed isolates.
Structural analysis of PfMDR1 suggests that residue 153 is
located in a region other than the putative binding sites of
artemisinins (Pillai et al., 2012).
However, as asserted in Ferreira et al. (2011), a mutation in TM3
region of PfMDR1 (where the residue 153 and 184 are located)
can alter the transport kinetics, independent from drug binding
capacity, suggesting the need of further investigation on the consequences of this aminoacidic substitution.
In conclusion, our data do not support any resistance to artesunate in Eritrea in 20132014, and we can only speculate that the
7% of treatment failure reported in this country is probably related
to the loss of efcacy of the AQ, hence to the Pfcrt and Pfmdr1 polymorphisms rather than the artemisinin derivative component of
the ACT. The present study represents an investigation focused on
the molecular surveillance of falciparum drug resistance carried out
for the rst time in Eritrea, an African country where this kind of
information is largely lacking.
Acknowledgements
We are indebted to Alba Lepore for performing PfMDR1 modelling. We are grateful to Nuredin Mohammedkassim (Asmara
College of Health Sciences) for his valuable support to the research

M. Menegon et al. / Acta Tropica 157 (2016) 158161

activities in Eritrea. We thank Mariangela LEpiscopia for the suggestion to improve this manuscript.
References
Ariey, F., Witkowski, B., Amaratunga, C., Beghain, J., Langlois, A.C., Khim, N., et al.,
2014. A molecular marker of artemisinin-resistant Plasmodium falciparum
malaria. Nature 505, 5055, http://dx.doi.org/10.1038/nature12876.
Ashley, E.A., Dhorda, M., Fairhurst, R.M., Amaratunga, C., Lim, P., Suon, S., et al.,
2014. Spread of artemisinin resistance in Plasmodium falciparum malaria. N.
Engl. J. Med. 371, 411423, http://dx.doi.org/10.1056/NEJMoa1314981.
Bhatt, S., Weiss, D.J., Cameron, E., Bisanzio, D., Mappin, B., Dalrymple, U., et al.,
2015. The effect of malaria control on Plasmodium falciparum in Africa between
2000 and 2015. Nature, 207211, http://dx.doi.org/10.1038/nature15535.
Conrad, M.D., Bigira, V., Kapisi, J., et al., 2014. Polymorphisms in K13 and
falcipain-2 associated with artemisinin resistance are not prevalent in
Plasmodium falciparum isolated from Ugandan children. PLoS One 9 (8),
e105690, http://dx.doi.org/10.1371/journal.pone.0105690.
Dokomajilar, C., Lankoande, Z.M., Dorsey, G., Zongo, I., Ouedraogo, J.B., Rosenthal,
P.J., 2006. Roles of specic Plasmodium falciparum mutations in resistance to
amodiaquine and sulfadoxine-pyrimethamine in Burkina Faso. Am. J. Trop.
Med. Hyg. 75, 162165.
Dondorp, A.M., Nosten, F., Yi, P., Das, D., Phyo, A.P., Tarning, J., et al., 2009.
Artemisinin resistance in Plasmodium falciparum malaria. N. Engl. J. Med. 361,
455467, http://dx.doi.org/10.1056/NEJMoa0808859.
Ferreira, P.E., Holmgren, G., Veiga, M.I., Uhln, P., Kaneko, A., Gil, J.P., 2011.
PfMDR1: mechanisms of transport modulation by functional polymorphisms.
PLoS One 6 (9), e23875, http://dx.doi.org/10.1371/journal.pone.0023875.
Holmgren, G., Gil, J.P., Ferreira, P.M., Veiga, M.I., Obonyo, C.O., Bjrkman, A., 2006.
Amodiaquine resistant Plasmodium falciparum malaria in vivo is associated
with selection of pfcrt 76T and pfmdr1 86Y. Infect. Genet. Evol. 6 (July (4)),
309314, http://dx.doi.org/10.1016/j.meegid.2005.09.001.
Ibraheem, Z.O., Abd Majid, R., Noor, S.M., Sedik, H.M., Basir, R., 2014. Role of
different Pfcrt and Pfmdr-1 mutations in conferring resistance to antimalaria
drugs in Plasmodium falciparum. Malar. Res. Treat. 2014, 950424, http://dx.doi.
org/10.1155/2014/950424.
Kamau, E., Campino, S., Amenga-Etego, L., Drury, E., Ishengoma, D., Johnson, K.,
Mumba, D., et al., 2015. K13-propeller polymorphisms in Plasmodium
falciparum parasites from sub-Saharan Africa. J. Infect. Dis. 211, 13521355,
http://dx.doi.org/10.1093/infdis/jiu608.

161

Malaria Update, Eritrean Ministry of Health bi-annual report. Issue of 18 July 2011.
Menegon, M., Pearce, R.J., Inojosa, W.O., Pisani, V., Abel, P.M., Matondo, A., et al.,
2009. Monitoring for multidrug-resistant Plasmodium falciparum isolates and
analysis of pyrimethamine resistance evolution in Uige province, Angola. Trop.
Med. Int. Health 14, 12511257, http://dx.doi.org/10.1111/j.1365-3156.2009.
02369.x.
Mohon, A.N., Alam, M.S., Bayih, A.G., et al., 2014. Mutations in Plasmodium
falciparum K13 propeller gene from Bangladesh (20092013). Malar. J., 13,
http://dx.doi.org/10.1186/1475-2875-13-431.
National Malaria Programme-Performance Review-State of Eritrea. October 2013
http://www.rollbackmalaria.org/les/les/countries/Eritrea.
Noedl, H., Se, Y., Schaecher, K., Smith, B.L., Socheat, D., Fukuda, M.M., 2008.
Artemisinin Resistance in Cambodia 1 (AR) Study Consortium. Evidence of
artemisinin-resistant malaria in western Cambodia. N. Engl. J. Med. 359,
26192620, http://dx.doi.org/10.1056/NEJMc0805011.
Pillai, D.R., Lau, R., Khairnar, K., Lepore, R., Via, A., Staines, H.M., Krishna, S., 2012.
Artemether resistance in vitro is linked to mutations in PfATP6 that also
interact with mutations in PfMDR1 in travellers returning with Plasmodium
falciparum infections. Malar. J. 11, 131, http://dx.doi.org/10.1186/1475-287511-131.
Takala-Harrison, S., Jacob, C.G., Arze, C., et al., 2015. Independent emergence of
artemisinin resistance mutations among Plasmodium falciparum in Southeast
Asia. J. Infect. Dis. 211 (5), 670679, http://dx.doi.org/10.1093/infdis/jiu491.
Taylor, S.M., Parobek, C.M., DeConti, D.K., Kayentao, K., Coulibaly, S.O., Greenwood,
B.M., et al., 2015. Absence of putative artemisinin resistance mutations among
Plasmodium falciparum in Sub-Saharan Africa: a molecular epidemiologic
study. J. Infect. Dis. 211, 680688, http://dx.doi.org/10.1093/infdis/jiu467.
Tun, K.M., Imwong, M., Lwin, K.M., et al., 2015. Spread of artemisinin-resistant
Plasmodium falciparum in myanmar: a cross-sectional survey of the K13
molecular marker. Lancet Infect. Dis. 15 (4), 415421, http://dx.doi.org/10.
1016/s1473-3099(15)70032-0.
Veron, V., Simon, S., Carme, B., 2009. Multiplex real-time PCR detection of P.
falciparum, P. vivax and P. malariae in human blood samples. Exp. Parasitol. 121
(4), 346351, http://dx.doi.org/10.1016/j.exppara.2008.12.012.
WHO, 2014 http://www.who.int/malaria/publications/world malaria report 2014/
en/.
Wurtz, N., Fall, B., Pascual, A., Fall, M., Baret, E., Camara, C., et al., 2014. Role of
Pfmdr1 in vitro Plasmodium falciparum susceptibility to chloroquine, quinine,
monodesethylamodiaquine, meoquine, lumefantrine, and
dihydroartemisinin. Antimicrob. Agents Chemother. 58, 70327040, http://dx.
doi.org/10.1128/AAC.03494-14.