The FASEB Journal Research Communication

Acclimatization of skeletal muscle mitochondria to

high-altitude hypoxia during an ascent of Everest
Denny Z. Levett,*,1 Elizabeth J. Radford,,1 David A. Menassa,1 E. Franziska Graber,
Andrea J. Morash, Hans Hoppeler, Kieran Clarke, Daniel S. Martin,*
Anne C. Ferguson-Smith, Hugh E. Montgomery, Michael P. W. Grocott,*
Andrew J. Murray,,2 and the Caudwell Xtreme Everest Research Group
*Centre for Altitude, Space, and Extreme Environment Medicine, University College London (UCL)
Institute of Child Health, University College London, London, UK; Department of Physiology,
Development, and Neuroscience, University of Cambridge, Cambridge, UK; Department of
Anatomy, Institute of Anatomy, University of Bern, Bern, Switzerland; Department of Physiology,
Anatomy, and Genetics, University of Oxford, Oxford, UK; and UCL Institute for Human Health
and Performance and Institute for Sport, Exercise, and Health, Archway Campus, London, UK
Ascent to high altitude is associated with a
fall in the partial pressure of inspired oxygen (hypobaric
hypoxia). For oxidative tissues such as skeletal muscle,
resultant cellular hypoxia necessitates acclimatization to
optimize energy metabolism and restrict oxidative stress,
with changes in gene and protein expression that alter
mitochondrial function. It is known that lowlanders returning from high altitude have decreased muscle mitochondrial densities, yet the underlying transcriptional
mechanisms and time course are poorly understood. To
explore these, we measured gene and protein expression
plus ultrastructure in muscle biopsies of lowlanders at sea
level and following exposure to hypobaric hypoxia. Subacute exposure (19 d after initiating ascent to Everest base
camp, 5300 m) was not associated with mitochondrial loss.
After 66 d at altitude and ascent beyond 6400 m, mitochondrial densities fell by 21%, with loss of 73% of
subsarcolemmal mitochondria. Correspondingly, levels of
the transcriptional coactivator PGC-1 fell by 35%, suggesting down-regulation of mitochondrial biogenesis. Sustained hypoxia also decreased expression of electron
transport chain complexes I and IV and UCP3 levels. We
suggest that during subacute hypoxia, mitochondria might
be protected from oxidative stress. However, following
sustained exposure, mitochondrial biogenesis is deactivated and uncoupling down-regulated, perhaps to improve the efficiency of ATP production.Levett, D. Z.,
Radford, E. J., Menassa, D. A., Graber, E. F., Morash,
A. J., Hoppeler, H., Clarke, K., Martin, D. C., FergusonSmith, A. C., Montgomery, H. E., Grocott, M. P. W.,
Murray, A. J., Caudwell Xtreme Everest Research Group.
Acclimatization of skeletal muscle mitochondria to high-

ABSTRACT

Abbreviations: BMI, body mass index; COPD, chronic obstructive pulmonary disease; COX, cytochrome c oxidase;
CXE, Caudwell Xtreme Everest; EBC, Everest Base Camp;
EM, electron microscopy; HIF-1, hypoxia inducible factor 1;
HOAD, -hydroxyacyl-CoA-dehydrogenase; mir-210, microRNA 210; NRF1, nuclear respiratory factor 1; PGC1, peroxisome proliferator activated receptor co-activator 1;
PPAR, peroxisome proliferator activated receptor ; ROS,
reactive oxygen species; UCP3, uncoupling protein 3.
0892-6638/12/0026-1431 FASEB

altitude hypoxia during an ascent of Everest. FASEB J. 26,

14311441 (2012). www.fasebj.org
Key Words: metabolism energetics
Cellular hypoxia is an important feature of many
human diseases, arising from impaired oxygen delivery
to the peripheral tissues either due to hypoxemia (e.g.,
chronic obstructive pulmonary disease [COPD] or cystic fibrosis), decreased oxygen carriage capacity (e.g.,
anemia), or decreased convective transport (e.g., heart
failure). In most tissues of the body, the primary source
of cellular energy, in the form of ATP, is oxidative
phosphorylation at the inner mitochondrial membrane. Hypoxia therefore poses a challenge to energy
homeostasis, and a process of metabolic adaptation
must occur in order to maintain cellular energetics and
thus function.
Healthy humans acclimatizing at high altitude are a
useful model in which to investigate the integrated
response of the body to hypoxia in the absence of many
of the confounding factors associated with pathologies
and the corresponding therapeutic interventions (1).
Indeed, there are common features in the responses to
high-altitude hypoxia and COPD, including, for instance, muscle wasting, weight loss, and altered metabolism (2, 3). Many changes in the pathways of oxygen
delivery have been characterized in hypoxic humans at
real (4) or simulated (5) altitude, including changes in
ventilation rate, cardiac output, and hematocrit. In
contrast, relatively little is understood about changes
in tissue oxygen utilization in humans at altitude (6),
yet we have shown that altitude exposure is associated
with profound alterations in both cardiac (7) and
skeletal muscle (8) energetics.
1

These authors contributed equally to this work.

Correspondence: Department of Physiology, Development, and Neuroscience, University of Cambridge, Downing
St., Cambridge, CB2 3EG, UK. E-mail: ajm267@cam.ac.uk
doi: 10.1096/fj.11-197772
2

1431

The master regulator of many of the bodys adaptive

responses to hypoxia is the heterodimeric transcription
factor hypoxia inducible factor 1 (HIF-1; ref. 9). The
HIF-1 subunit is continually expressed but is hydroxylated and degraded under normoxic conditions (9, 10).
In hypoxia, however, HIF-1 is stable and can dimerize
with the constitutively present HIF-1 subunit, activating the transcription of genes with hypoxia response
elements in their regulatory regions (10). The levels of
HIF-responsive genes are therefore precisely controlled
in response to cellular O2 concentrations.
In many cell lines, HIF activation is associated with a
profound loss of mitochondria and therefore increased
glycolytic ATP production (6). While it was once assumed that mitochondrial abundance would increase
in chronically hypoxic skeletal muscle (11), it is now
known that mitochondrial density is in fact consistently
and substantially decreased in the muscles of lowlanders acclimatizing to high altitude (12, 13). The underlying mechanism remains unknown, but is likely to be
part of a coordinated response of mitochondrial autophagy (14) coupled with the deactivation of pathways
leading to mitochondrial biogenesis. The master regulator of mitochondrial biogenesis in skeletal muscle is
the transcriptional coactivator peroxisome proliferatoractivated receptor coactivator-1 (PGC1), which,
when overexpressed in mouse skeletal muscle, leads to
a proliferation of mitochondria-rich type I muscle
fibers (15). PGC1 levels or activity may fall in hypoxic
muscle, resulting in decreased mitochondrial biogenesis: indeed, levels of its homologue PGC1 decrease in
hypoxic renal cancer cells in an HIF-dependent manner (16).
Despite a loss of mitochondria, there is evidence that
successful acclimatization to high-altitude hypoxia over
a period of several weeks can improve skeletal muscle
energetics both at rest and following an exercise challenge (8, 17). The biochemical basis for this acclimatization also remains unresolved but may involve improved metabolic efficiency (i.e., a greater yield of ATP
per molecule of O2 consumed; ref. 18), perhaps via a
switch from fatty acid oxidation to more oxygen-efficient glucose oxidation, or via decreased mitochondrial uncoupling. In the chronically hypoxic mouse
heart, a switch in substrate preference from fatty acid
oxidation to glucose oxidation was accompanied by
decreased expression of the mitochondrial uncoupling
protein 3 (UCP3; ref. 19). These changes were most
likely mediated via decreased expression or activity of
the fatty acid-activated transcription factor peroxisomeproliferator activated receptor (PPAR), which promotes fatty acid oxidation (20) and UCP3 expression
(21) and is down-regulated in hypoxic epithelial cells
(22). In mouse skeletal muscle fibers, however, the
hypoxic response is critically mediated by an up-regulation of PPAR (23), perhaps to spare glucose for
cardiac or brain metabolism or maybe to promote
glucose oxidation via inhibition of pyruvate dehydrogenase (23).
The aim of this study was therefore to elucidate the
mechanisms underlying metabolic adaptation of human skeletal muscle to high-altitude hypoxia in the
context of whole-body acclimatization. We sampled
1432

Vol. 26

April 2012

muscle biopsies from 2 subgroups of unacclimatized

lowlanders drawn from the investigator group of the
Caudwell Xtreme Everest (CXE) expedition (24). Biopsies were sampled from all subjects at sea level, and
again at Everest Base Camp (EBC), Nepal (5300 m
above sea level), following a strictly controlled ascent
profile (24). A group of 6 subjects (base camp laboratory staff) ascended to EBC and were biopsied 19 d
after leaving sea level, while a group of 12 subjects
(climbing team) ascended to at least 6400 m and in 8
cases the summit of Everest (8848 m) before returning
to EBC, where a biopsy was sampled 66 d after leaving
sea level. Muscle morphometry, including mitochondrial densities and distributions, was investigated by
electron microscopy (EM), while the expression and
levels of mitochondrial proteins and metabolic regulators were measured by real-time quantitative PCR and
immunoblotting, respectively, and metabolic enzyme
assays carried out to assess substrate utilization. Here we
describe different patterns of metabolic adaptation in
human skeletal muscle corresponding to subacute and
more sustained exposure to hypobaric hypoxia at high
altitude.

MATERIALS AND METHODS

Subjects and ascent profiles
The study was approved by the University College London
Ethics Committee (in accordance with the declaration of
Helsinki). Verbal and written informed consent was obtained
from all subjects. Subjects were healthy volunteers recruited
from the investigator team of CXE, which took place between
January and June 2007 (see ref. 24 for detailed methodology).
All subjects were studied in London (75 m) before flying to
Kathmandu (1300 m) and trekking to EBC (5300 m), arriving
on d 13. The ascent profile was identical for all subjects, with
excursions from the group altitude prohibited to standardize
exposure (Fig. 1). Base camp laboratory staff remained at
EBC throughout the expedition. The climbing team ascended to collect data at higher altitudes, all reaching camp
2 (6400 m), and the majority the summit of Everest (8848 m)
(see ref. 24 for ascent profile). Base camp laboratory staff
were not exposed to supplemental O2. The climbing team
used supplemental O2 at flow rates of 2 4 L/min while
climbing above camp 3 (7100 m) and at 0.5 L/min while
sleeping at and above camp 3. Subjects did not take prophylactic medication (e.g., acetazolamide) to prevent acute
mountain sickness. To minimize confounding effects, all
subjects refrained from any form of hypoxic training (hypoxic
tents, etc.) and did not travel above 3000 m for 3 mo prior to
departure.
Muscle biopsies
Baseline muscle biopsies were taken subjects in London prior
to departure (n18). Repeat biopsies were taken from base
camp laboratory staff (n6) on expedition d 19 (6 d after
arrival at 5300 m). The climbing team (n12) had repeat
biopsies taken on expedition d 66, 2 d after arriving at 5300 m
following the summit attempt. Biopsies were taken from
vastus lateralis muscle in the midthigh, with repeat biopsies
adjacent to the initial biopsy. The skin and subcutaneous
tissue were infiltrated with 2% lignocaine, and the biopsies

The FASEB Journal www.fasebj.org

LEVETT ET AL.

body (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at

1:1000 dilution; polyclonal rabbit anti-PPAR antibody (Santa
Cruz Biotechnology) at 1:200 dilution; monoclonal mouse
anti-nuclear respiratory factor 1 (NRF1) antibody (BD Biosciences) at 1:500 dilution; and polyclonal rabbit anti-citrate
synthase antibody (Alpha Diagnostics, San Antonio, TX,
USA). Appropriate secondary antibodies (Santa Cruz Biotechnology) were used, with all primary and secondary antibodies diluted in 5% milk TBS-Tween. Protein bands were
quantified using gel analysis software (UNSCAN-IT; Silk Scientific, Orem, UT, USA), and normalized to total protein
content after quantification.
RNA extraction and quantification of gene expression

Figure 1. Ascent profile of Caudwell Xtreme Everest investigator group. Laboratories where testing was performed are
labeled; intermediate altitudes indicate overnight stops without testing. Dotted line indicates base camp laboratory staff
ascent profile; continuous line indicates climbing team ascent
profile. Biopsies were taken at baseline in London for both
groups (expedition d 0). Base camp laboratory staff altitude
biopsies were taken at 530 0 m on expedition d 19. Climbing
team altitude biopsies were taken at 5300 m on expedition d 66.
were performed under aseptic conditions. A 5-mm incision
was made, and a sample of 200 mg muscle was obtained
using Tilley-Henkel forceps. Part of each biopsy was fixed in
buffered glutaraldehyde solution for EM as described previously (25), with the remainder snap-frozen in liquid N2.
Biopsies were stored in liquid N2 for transport to a commercial storage facility in the United Kingdom, where they
remained in liquid N2 until analysis.
Morphometric analysis
Fixed biopsy samples were processed and sectioned according
to standard protocols (25, 26). Tissue blocks were sectioned
using an isotropic uniform random method to obtain an
unbiased estimation of capillary length and fiber size (27).
For ultrastructural analysis, point counts were taken from 40
micrographs (at a view of 24,000), whereas for the determination of capillary length density and fiber size, they were
taken from 16 (at 1800). Note that no biopsy was fixed for
morphometry from one member of the base camp laboratory
staff for whom protein and mRNA data are reported.

RNA was prepared from snap-frozen biopsies, and cDNA was

generated before gene expression was quantified by real-time
quantitative PCR. RNA was prepared from snap-frozen biopsies using Trizol (Invitrogen, Paisley, UK), with an overnight
precipitation step at 20C. Newly isolated RNA was quantified by spectrophotometric analysis, and the quality was
assessed by judging the integrity of 28S and 18S ribosomal
RNA bands by electrophoresis in a 1% agarose gel. All
samples were treated to remove DNA contamination with
DNase (RNase-free DNase kit, Qiagen, Valencia, CA, USA),
followed by reprecipitation. cDNA was generated from 1 g
total RNA/sample using the RevertAid H Minus cDNA synthesis kit (Fermentas, St. Leon-Rot, Germany) with random
primers. cDNA samples were diluted 1:10, and a 6-point
standard curve of 2-fold dilutions was prepared from pooled
cDNA. The samples and standard curve were portioned into
aliquots to prevent freeze-thawing and stored at 80C prior
to use.
Real-time quantitative PCR with SYBR Green was performed with SensiMix (Quantace, London, UK) using the
primers listed in Table 1. Primers were designed to assay all
annotated splice variants of a gene and checked for specificity
using U.S. National Center for Biotechnology Information
(NCBI) nucleotide BLAST. Real-time quantitative PCR with
the TaqMan probes listed in Table 2 was carried out using
TaqMan Universal PCR Master Mix (Applied Biosystems,
Foster City, CA, USA). Quantification was performed using
the relative standard curve method, and target gene expression was normalized to the average expression of 4 housekeeping genes [HPRT, -2-microglobulin (2m), -actin, and
PPIA], the expression of which did not differ between the
groups. All primers amplified with efficiency estimated between 105 and 85%, with no evidence of inhibitors present in
the reaction. Reactions were carried out on a DNA engine
Opticon 2 thermocycler (MJ Research, Waltham, MA, USA).

Protein extraction and quantification

Snap-frozen biopsies were homogenized in lysis buffer (75
mM Tris-HCl, 3.8% SDS, 4 M urea, 20% glycerol, and 0.1%
Triton X-100, pH 6.8) containing protease inhibitors (Roche,
Basel, Switzerland) using a FastPrep-24 System (MP Biomedicals Europe, Illkirch, France). Levels of proteins were measured in lysates by immunoblotting, essentially as described
previously (28). Levels of complexes IV (CICV) of the
mitochondrial respiratory chain were measured using an
optimized cocktail of monoclonal antibodies raised against CI
subunit NDUFB8, CII 30-kDa subunit, CIII core protein 2,
CIV subunit II, and CV subunit, respectively (Mitosciences,
Eugene, OR, USA) at 1:2500 dilution. Levels of other proteins
were measured using polyclonal rabbit anti-UCP3 antibody
(Millipore, Billerica, MA, USA) at 1:200 dilution; monoclonal
mouse anti-HIF1 antibody (BD Biosciences, San Jose, CA,
USA) at 1:250 dilution; polyclonal rabbit anti-PGC1 antiMITOCHONDRIAL ADAPTATION TO HIGH-ALTITUDE HYPOXIA

TABLE 1. SYBR Green primers used in qPCR analysis of muscle

biopsies

Gene

Amplicon
size

ATP5b

149

NDUFS7

150

Citrate synthase

108

Cox4i2

108

Primer sequences

F: GACCCGTGAAGGCAATGAT
R: ACAGTCAGCCCAGTCAGAGC
F: CTCCCGCTTGATCTTCCTCT
R: AACGGAGGAGGCTACTACCA
F: GAGCAGGGTAAAGCCAAGAA
R: CCCAAACAGGACCGTGTAGT
F: GAGCTTGGTGCTGAGGAAAG
R: TGGGCATAGCAGTTGGTGTA

Annealing temperature was 60C for all genes. F, forward; R,

reverse.

1433

TABLE 2. TaqMan probes used in qPCR analysis of muscle

biopsies
Gene

Amplicon size

Applied Biosystems assay no.

Exons

118
83
73
86
74
98
81
100
139

Hs00947538_m1
Hs00173304_m1
Hs00971639_m1
Hs01075225_m1
Hs01106052_m1
Hs99999904_m1
Hs00984230_m1
Hs99999909_m1
Hs03023943_g1

67
78
23
45
45
44
34
67
11

PPAR
Pgc1
Cox4i1
UCP2
UCP3
PPIA
B2M
HPRT
Actin

Metabolic enzyme activity assays

Enzyme activities were measured in snap-frozen biopsies from
5 base camp laboratory staff subjects and 11 climbing team
subjects. Note that insufficient biopsy remained from one
subject from each group for enzyme activity measurements,
for whom protein and mRNA data are reported. -Hydroxyacyl-CoA-dehydrogenase (HOAD) activity was assayed as described previously (29). The assay buffer contained 50 mM
imidazole (pH 7.4), 0.1 mM acetoacetyl-CoA, 0.15 mM
NADH, and 0.1% Triton 100-X. NADH absorbance was
monitored at 340 nm for 3 min. Control samples were assayed
without acetoacetyl-CoA. Hexokinase activity was measured
according to a modified previously described protocol (30).
Briefly, the assay buffer was composed of 50 mM HEPES (pH
7.0), 8 mM ATP, 10 mM MgCl2, 0.5 mM NADP, and saturating glucose-6-phosphate dehydrogenase (4 U). The reaction
was initiated by the addition of 5 mM D-glucose (omitted in
control reactions), and the production of NADPH was monitored for 3 min at 340 nm.
Statistics
Graphs for protein and mRNA expression show data as
means se. Tables showing subject characteristics and

morphometry express data as means sd. Paired Students t

tests were used for comparison of data from each subjects
acclimatized biopsies with their own unacclimatized biopsies,
and unpaired t tests were used to compare baseline characteristics between groups. Differences were considered significant at P 0.05.

RESULTS
Biopsies were successfully taken from 6 base camp
laboratory staff and 12 climbers at sea level and EBC
(5300 m). The measured mean barometric pressure at
EBC was 53.8 kPa, giving an inspired Pio2 of 9.9 kPa. Of
the climbing team, the maximum altitudes attained
prior to the final biopsy were 6400 m (1 subject),
7100 m (1 subject), 8000 m (2 subjects), and 8848 m (8
subjects). There were no adverse complications from
the biopsies at sea level or altitude. Baseline characteristics of the subjects are summarized in Table 3. There
was no difference in age, height, body weight, or body
mass index (BMI) between the groups prior to altitude
exposure. Similarly, there was no difference in body
weight between the groups at the time of biopsy,
although the climbing team members lost 9% of their
baseline body weight after 66 d of high-altitude exposure (P0.0001). Sea-level Vo2max was not different
between the groups either before or after altitude exposure and had fallen by 31% in base camp laboratory staff
(P0.001) and by 30% in the climbing team (P0.0001)
by the time of the altitude biopsy (Table 3).
Muscle ultrastructure
Sample EM images of biopsies taken from the base
camp laboratory staff at sea level and after 19 d exposure to hypobaric hypoxia are shown in Fig. 2A, and
sample EM images of biopsies from the climbing team

TABLE 3. Subject characteristics

Parameter

Base camp staff

n
Male gender
Previous altitude exposure (5000 m)
Age (yr)
Height (cm)
Weight (kg)
Sea level
5300 m
BMI (kg/m2)
Sea level
5300 m
Vo2max (ml/kg/min)
Sea level
5300 m
Vo2max (ml/min)
Sea level
5300 m

6
3
4
39.5 12.4
173.2 7.1

Climbing team

12
11
12
38 4.9
179.9 4.4

74.2 11.2
73.3 11.6

81.9 13.8
72.3 9.3****

24.7 2.8
24.4 3

25.2 3.6
22.3 2.2****

43.8 5.4
30.2 3.8***

46.3 8.8
32.2 2.5****

3266 760
2220 460***

3754 540
2320 300****

Age, height, body weight, body mass index (BMI), and Vo2max of base camp laboratory staff and
climbing team at sea level prior to altitude exposure and at the time of altitude biopsy. Values are
means sd. ***P 0.001, ****P 0.0001 vs. time of sea-level biopsy.

1434

Vol. 26

April 2012

The FASEB Journal www.fasebj.org

LEVETT ET AL.

Figure 2. Representative electron micrographs of M. vastus lateralis biopsies from members of the base camp laboratory staff (A)
and the climbing team (B) before (i) and after (ii) acclimatization to high-altitude hypoxia. m, mitochondria. Biopsies of base
camp laboratory staff were taken when unacclimatized at sea level (London) and after 19 d of high-altitude exposure at 5300 m
(EBC). Biopsies of the climbing team were taken when unacclimatized at sea level (London) and after 66 d of high-altitude
exposure following ascent 6400 m (Everest).

at sea level and after 66 d exposure to hypobaric

hypoxia are shown in Fig. 2B. At baseline, there was no
difference in density of total mitochondria in the
muscles of base camp laboratory staff and climbing
team, although the climbers did have a lower density of
subsarcolemmal mitochondria (P0.0001; Table 4).
The climbing team also had a greater density of myofibrils per fiber volume than base camp laboratory staff
(P0.0001; Table 4).
No significant changes in mitochondrial density were
detected in muscle biopsies of the base camp laboratory
staff following 19 d exposure to altitude (Table 4), and

this can be seen in Fig. 2A. In the climbing team,

however, there was a loss of 21% total mitochondrial
density (P0.01) following 66 d exposure to hypobaric
hypoxia (Table 4), and the remaining mitochondria
appeared smaller (Fig. 2B). Interestingly, the 2 mitochondrial subpopulations of the myocyte were affected
to a different extent in this group. While there was a loss
of 14% of intermyofibrillar mitochondria (P0.05), there
was a 73% loss of subsarcolemmal mitochondria (P0.05;
Table 4). No changes in the intramyocellular lipid content were detected in either group. In the base camp
laboratory staff, myofibril density increased by 7.4%

TABLE 4. Morphometry data from skeletal muscle biopsies in base camp laboratory staff and climbing team before and after
acclimatization to high-altitude hypoxia
Base camp staff, n 5
Parameter

London

EBC

Vol of intermyofibrillar mitochondria

per fiber vol (%)
4.6 0.2
4.4 0.1
Vol of subsarcolemmal mitochondria
per fiber vol (%)
1.7 0.3
1.1 0.2
Vol of total mitochondria per fiber
vol (%)
6.4 0.5
5.4 0.2
Vol of intramyocellular lipid per fiber
vol (%)
0.25 0.1
0.32 0.5
Vol of myofibrils per fiber vol (%)
73.0 1.5
78.5 1.1
Vol of other cell components (nuclei,
sarcoplasmic reticulum, etc.) per fiber
vol (%)
20.4 1.1
15.8 1.1
Capillaries per fiber (n)
1.50 0.17 1.45 0.07
Capillaries per fiber area (n/mm2)
299.9 26.1 304.7 23.2
Capillary length density per fiber vol
(mm/mm3)
437.8 38.1 444.9 33.9
Mean fiber area (m2)
5260 877 4854 409

Climbing team, n 12

Change (%)

London

5.0 0.2

4.3 0.2*

14.3

39.0

0.7 0.2

0.2 0.1*

73.1

14.7

5.7 0.3

4.5 0.2**

21.3

25.1
7.4

0.26 0.05
78.4 0.8

Everest

Change (%)

0.19 0.03
80.2 0.8

25.4
2.4

22.4
3.5
1.6

15.7 0.7
1.62 0.13
285.1 21.3

15.1 0.7
1.70 0.13
299.9 22.8

3.7
5.5
5.2

1.6
7.7

416.3 31.2
5785 353

437.9 33.2
5845 487

5.2
1.1

Biopsies were taken from 5 subjects when unacclimatized at sea level (London) and after 19 d of high-altitude exposure at 5300 m (EBC),
and from vastus lateralis of 12 subjects when unacclimatized at sea level (London) and at 5300 m after 66 d of high-altitude exposure (Everest).
Note that no biopsy was preserved for morphometry from one subject in the base camp laboratory staff group for whom protein and mRNA
data are reported. Data are shown as means sd. *P 0.05, **P 0.01 vs. London, P 0.0001 vs. base camp staff at baseline.

MITOCHONDRIAL ADAPTATION TO HIGH-ALTITUDE HYPOXIA

1435

(P0.05), but this was unaltered in the climbing team.

Neither the capillary density nor the number of capillaries
per muscle fiber was altered after either 19 or 66 d at high
altitude (Table 4).
Transcriptional and protein changes after 19 d
Following ascent to EBC (5300 m above sea level),
muscle levels of HIF1 were not significantly higher in
the base camp laboratory staff. In this group, there was
no change in skeletal muscle levels of citrate synthase
protein, consistent with an unchanged mitochondrial
density, and no change in PGC1 protein (Fig. 3).
Levels of both citrate synthase and Pgc1 mRNA were
also unchanged. Levels of UCP3 mRNA and UCP3
protein did not change significantly, but showed strong
trends to increase by 57% (P0.07) and 54% (P0.07),
respectively, following the ascent (Fig. 3).
Transcriptional and protein changes after 66 d
Following ascent 6400 m above sea level and 66 d at
high altitude, levels of skeletal muscle HIF1 were the
same as at sea level in the climbing team (Fig. 4). Levels
of citrate synthase and PGC1 protein had decreased
by 18% (P0.05) and 35% (P0.05), respectively,

consistent with a loss of mitochondrial density, but

mRNA levels of both markers were unchanged. Levels
of NRF1 protein and mRNA were unchanged from sea
level, but levels of PPAR protein increased by 51%
(P0.05), with no significant change in PPAR mRNA
levels (Fig. 4). Levels of representative proteins from
electron transport chain complexes I and IV decreased
by 28% (P0.05) and 23% (P0.05) respectively, with
no change in levels of proteins from complexes II and
III or ATP-synthase, and no significant changes in
mRNA levels of any representative peptide. Levels of
UCP3 protein decreased by 23% (P0.05), although
UCP3 and UCP2 mRNA levels did not significantly
decrease (Fig. 4).
Metabolic enzyme activities after 19 and 66 d
Following ascent to EBC (5300 m) and 19 d at high
altitude, muscle HOAD and hexokinase activities remained unchanged (Fig. 5A). Activities of HOAD and
hexokinase, however, fell by 55% (P0.05) and 22%
(P0.05), respectively, in the muscles of the climbing
team after ascent 6400 m and 66 d exposure to
hypobaric hypoxia (Fig. 5B).

Figure 3. Expression of mitochondrial proteins and metabolic regulators in base camp laboratory staff before and after 19 d
acclimatization to high-altitude hypoxia. Biopsies were taken from 6 subjects when unacclimatized at sea level (London) and
after 19 d of high-altitude exposure at 5300 m (EBC).
1436

Vol. 26

April 2012

The FASEB Journal www.fasebj.org

LEVETT ET AL.

Figure 4. Expression of mitochondrial proteins and metabolic regulators in the climbing team before and after 66 d
acclimatization to high-altitude hypoxia. Biopsies were taken from 12 subjects when unacclimatized at sea level (London) and
at 5300 m after 66 d of high-altitude exposure (Everest). *P 0.05 vs. London.

DISCUSSION
We have shown here that the process of metabolic
acclimatization of skeletal muscle to high altitude is
characterized by distinct patterns of changes in gene
and protein expression in subacute and more sustained
exposure to hypobaric hypoxia. The study reports a
unique combination of measurements of muscle morphometry, gene expression, protein levels, and meta-

bolic enzyme activities in subjects at sea level and at 2

different time points during an ascent of Everest. In
contrast to previous studies (12), this is the first time
such data from acclimatized muscle have been reported
from biopsies sampled at altitude rather than on return
to sea level. A major strength of the study lies in its
methodological rigor. Within the groups, all subjects
had strictly matched ascent profiles, with no prior
hypoxic training, no prophylactic medicines taken,

Figure 5. Metabolic enzyme activities in M. vastus lateralis biopsies before and after acclimatization to high-altitude hypoxia.
HOAD and hexokinase activity were measured in biopsies from 5 base camp laboratory staff subjects when unacclimatized at sea
level (London) and after 19 d of high-altitude exposure at 5300 m (EBC; A) and 11 climbing team subjects when unacclimatized
at sea level (London) and at 5300 m after 66 d of high-altitude exposure (Everest; B). Note that insufficient biopsy remained
from one subject from each group for enzyme assay analysis, for whom protein and mRNA data are reported. *P 0.05 vs.
London.
MITOCHONDRIAL ADAPTATION TO HIGH-ALTITUDE HYPOXIA

1437

and no travel above 3000 m for 3 mo prior to

departure (24).
Due to the small number of researchers based at EBC
throughout the expedition (24), the number of subjects in the base camp laboratory staff group was
unfortunately small. Moreover, one biopsy collected
from this group was too small for a portion to be fixed
for morphometry, further decreasing the number of
subjects. While it would have been optimal to collect
additional biopsies from the subjects in the climbing
team after 19 d exposure, it was deemed too hazardous
to perform such a procedure on these individuals
immediately prior to a summit attempt. The small
number of biopsies collected in the subacute phase of
acclimatization is therefore a weakness of this study,
and we accept that we may have made a type 2 error in
the analysis of this group, particularly regarding lack of
significance in muscle mitochondrial densities pre- and
post-altitude exposure. Nevertheless, there is good
agreement between gene expression, protein levels,
and morphometry in this group, and indeed across the
study, which we believe strengthens our conclusions,
even if some apparent changes were not statistically
significant.
Despite the baseline characterizations conducted,
there remains the possibility that the different profiles
we report for subacute and more sustained exposure to
high-altitude hypoxia arise from differences in baseline
physiology between the base camp laboratory staff and
climbing team. The climbing team was selected from
individuals who had prior exposure to high altitudes,
with the summit team having all previously ascended
incident free above 8000 m (24). Differences between
groups may thus arise from this unavoidable nonrandom selection, or perhaps from epigenetic influences
acquired due to repeated hypoxic exposure. There
were, however, no differences in baseline Vo2max between the 2 groups, suggesting a similar level of cardiovascular fitness, and importantly no difference in baseline total mitochondrial density in muscle. Notably, the
climbing team has lower densities of subsarcolemmal
mitochondria than the base camp laboratory staff, and
these densities fell further after 66 d exposure. We
suggest that this lower baseline density might have been
a long-term consequence of previous sojourns to extreme high altitude. Such a difference may affect
measurements of exercise capacity and muscle energetics in these subjects both before and after altitude
exposure, since subsarcolemmal mitochondria are
thought to be important in providing ATP for ion
pumping at the cell membrane.
On the summit of Everest, mean barometric pressure
is 30 kPa, resulting in an inspired Pio2 very close to
the purported limit that acclimatized humans can
tolerate (31). We previously reported arterial oxygen
pressures at 8400 m in 4 of the subjects in this study and
found them to be the lowest ever reported in humans,
with a group mean of 24.6 mmHg (3.28 kPa) and a
measure of just 19.1 mmHg (2.55 kPa) in one individual (32). It was therefore unsurprising that skeletal
muscle energetics, measured using NMR spectroscopy,
were profoundly altered in the same subjects following
their return to sea level (8), since these are highly
1438

Vol. 26

April 2012

metabolic tissues with most of their ATP demands

provided by oxidative phosphorylation at the inner
mitochondrial membrane. The changes in skeletal
muscle mitochondria we report here further elucidate
the process by which skeletal muscle acclimatizes to
high-altitude hypoxia, although it is worth noting that
biopsies in this study and NMR spectra in our previous
manuscript were acquired from different muscles.
Climbers returning from the summit of Everest are
known to have diminished skeletal muscle mitochondrial densities (12, 13), consistent with the loss of
mitochondria in hypoxia reported in cell lines (6). The
consequent down-regulation of oxygen demand is believed to protect the cell against oxidative stress, since
mitochondrial production of reactive oxygen species
(ROS) increases in hypoxia (6), yet this might also limit
the capacity of the cell for ATP production. In cell lines
(6), and in cancer cells (33), a switch to anaerobic
glycolysis is possible, but limited glycogen supplies
make this unsustainable for a large oxidative organ
such as skeletal muscle when exercising in chronic
hypoxia at high altitude. The diminished mitochondria
must therefore acclimatize to a lower tissue po2 in
order to maintain ATP levels and normal function.
Little is known about the molecular mechanisms underlying the acclimatization of human skeletal muscle
mitochondria to high-altitude hypoxia; hence, we set
out to investigate these processes following subacute
and more sustained exposure.
We found no significant changes in skeletal muscle
mitochondrial density after 19 d exposure to highaltitude hypoxia, albeit in a small cohort of subjects,
with citrate synthase levels unchanged, no significant
loss of either mitochondrial subpopulation, and no loss
of PGC1. The density of subsarcolemmal mitochondria showed a large, but variable and hence nonsignificant, decline in these subjects, while the density of
intermyofibrillar mitochondria was unchanged. In addition, we found a strong trend toward up-regulation of
UCP3, which is believed to protect mitochondria from
excessive ROS production (34, 35). UCP3 has previously been shown to increase in the hypoxic heart,
under the influence of the hypoxia-responsive transcription factor ATF1 (36). Moreover, UCP3 is known
to be more highly expressed in intermyofibrillar mitochondria than in subsarcolemmal mitochondria, resulting in a greater degree of uncoupling in that subpopulation (37), and perhaps affording greater protection
against ROS. We therefore suggest that up-regulation
of UCP3 in subacute hypoxic exposure might protect
the intermyofibrillar mitochondrial population against
oxidative stress, albeit at the cost of decreased mitochondrial efficiency, although this should be confirmed in a larger cohort of subjects. A loss of efficiency
may contribute to the involuntary loss of body mass that
occurs on altitude exposure (38, 39), and work is
ongoing to investigate this in a larger group of subjects.
Following more sustained exposure to high altitude,
total mitochondrial density and citrate synthase expression decreased in all subjects, as previously reported
(12). Here we report, for the first time, that this is
accompanied by a down-regulation of PGC1, suggesting a coordinated response to down-regulate mitochon-

The FASEB Journal www.fasebj.org

LEVETT ET AL.

drial biogenesis, perhaps to better match muscle O2

demand to the decreased supply. Curiously, the loss of
subsarcolemmal mitochondria was far greater than the
loss of intermyofibrillar mitochondria, indicating that
this subpopulation is much more susceptible to hypoxia-induced mitophagy. The 2 mitochondrial subpopulations are known to be biochemically distinct
(40) and are thought to play different functional roles
(41). A greater plasticity of the subsarcolemmal population in response to training and detraining has been
reported (40, 41), but the implications of this stark,
preferential down-regulation of subsarcolemmal mitochondria for the performance of hypoxic human skeletal muscle merits further investigation.
In addition, we report specific changes in the complexes of the electron transport chain following more
sustained hypoxia, with complex I and complex IV
down-regulated, while levels of complex II, complex III,
and ATP-synthase remained unchanged. Complex IV,
cytochrome c oxidase (COX), is the site at which
dioxygen acts as the final electron acceptor and is
reduced to water. Activity of isolated COX protein has
been shown to be allosterically decreased in chronic
hypoxia (42), and nitric oxide (NO) is believed to exert
an enhanced inhibition of COX under hypoxic conditions (43). Moreover, HIF-1 activation induces a subunit switch from a COX4-1 subunit to COX4-2 in
hypoxic cells, to optimize COX activity (44). The
overall effect of decreasing mitochondrial oxygen consumption, in line with decreased oxygen supply, is
further accomplished by a HIF-1-dependent up-regulation of micro-RNA 210 (mir-210), which suppresses
expression of the iron-sulfur cluster assembly proteins
ISCU1/2, negatively regulating NADH-dehydrogenase
activity at complex I, succinate dehydrogenase activity
at complex II, and COX subunit 10 (45 47). We
suggest that loss of complex I and complex IV in
hypoxic human skeletal muscle could result from increased miR-210 expression, although this remains to
be directly tested. It remains unclear whether the
suppression of electron transport in chronic hypoxia is
a beneficial or detrimental adaptation, but miR-210
presents a possible target to rescue mitochondrial
function and restore energetic homeostasis.
It is, however, interesting to note that HIF-1 protein
levels were not elevated in the climbing teams muscles at
the time of the altitude biopsy. It is possible that during
the sampling of the biopsies, HIF-1 was rapidly degraded
in these samples on exposure to atmospheric air. HIF-1
levels did appear to increase, though, albeit not significantly, in the altitude biopsies of the base camp laboratory
staff. An alternative explanation might lie in the possibility
that the climbing teams muscles had acclimatized to a
greater degree of hypoxia than that of EBC following
ascents to altitudes of at least 6400 m and in many cases
higher. On return to EBC, these subjects therefore entered a relatively hyperoxic environment, which may have
brought about the degradation of HIF-1 protein.
The decreased expression of skeletal muscle UCP3
we report in the climbing team mirrors the chronically
hypoxic mouse heart (19). In sustained hypoxic exposure, down-regulation of mitochondrial uncoupling
might increase the efficiency of oxygen utilization,

improving ATP synthesis in the face of an overall

decline in oxidative capacity. While the loss of UCP3
protein was of approximately the same magnitude as
that of total mitochondrial density, ATP synthase levels
remained unchanged, and thus mitochondrial uncoupling as a proportion of mitochondrial oxygen consumption may be decreased. Muscle UCP3 content
correlates inversely with cycling efficiency (48) and
mitochondrial uncoupling is associated with impaired
endurance performance in rats (49), thus the effect of
UCP3 down-regulation on performance in hypoxia is
an intriguing avenue for future study.
Finally, we report an increase in expression of PPAR
in human skeletal muscle following exposure to sustained
hypoxia. Our finding might at first appear to contradict
findings in rat cardiac muscle, where expression of
PPAR target genes, including UCP3, were down-regulated (50) in hypoxia, and findings from epithelial cells
that demonstrated HIF-1-dependent down-regulation of
PPAR in hypoxia (22). However, ablation of Phd1 in
mice stabilized HIF-2 and resulted in PPAR up-regulation in skeletal muscle alongside an overall repression of
mitochondrial metabolism (23). An increase in PPAR
activity in hypoxia might be expected to result in a
paradoxical switch toward greater fatty acid oxidation,
and correspondingly we found a nonsignificant loss of
intramyocellular lipid stores in these subjects, perhaps
supporting a greater capacity to utilize fat as a substrate.
Such a substrate switch in skeletal muscle may prove
beneficial, as the bodys limited glycogen reserve is spared
for more oxygen-efficient glucose oxidation in tissues
such as heart and brain. HOAD activities fell in the
muscles of the climbing team, however, after 66 d exposure to hypobaric hypoxia, and this exceeded the degree
to which mitochondrial density fell. Our data suggest,
therefore, that in the later stages of acclimatization there
is in fact a down-regulation of -oxidation, and the
up-regulation of PPAR probably plays an alternative role.
PPAR is known to up-regulate pyruvate dehydrogenase
kinase 4 (51), thereby restricting carbohydrate oxidation
via the inhibition of pyruvate dehydrogenase, and this
may represent an adaptation to further limit mitochondrial oxygen consumption. Indeed, due to this role,
PPAR up-regulation was found to be essential to the
promotion of hypoxia tolerance in mouse skeletal muscle
(23). HIF-1-dependent up-regulation of an alternative
PDK isoform, PDK1, has been shown to enhance glycolysis
in hypoxic cells (52), although in the climbing team
hexokinase activity also fell, albeit to a smaller degree than
HOAD.
In summary, we report time-dependent changes in
gene and protein expression that appear to underlie the
mitochondrial response to subacute and sustained hypobaric hypoxia in human skeletal muscle. Following subacute hypoxia exposure, increased uncoupling may serve
to protect the mitochondria, particularly the intermyofibrillar mitochondria, but at the cost of impaired efficiency
of ATP synthesis. More sustained hypoxia exposure was
characterized by a suppression of mitochondrial biogenesis and oxidative metabolism, and a profound loss of
subsarcolemmal mitochondria. The consequences of the
transcriptional changes we report for mitochondrial respiration remain to be determined, as do the distinct

MITOCHONDRIAL ADAPTATION TO HIGH-ALTITUDE HYPOXIA

1439

responses of the 2 mitochondrial subpopulations, although it is clear that skeletal muscle shows energetic
changes following acclimatization (8). Finally, it is currently unclear whether restoration of mitochondrial metabolism would be beneficial or detrimental for performance at high altitude, yet survival of critically ill patients
is strongly associated with early induction of mitochondrial biogenesis (53). Elite high-altitude performers, or
highland natives, may demonstrate more moderate repression of mitochondrial function than lowlanders who acclimatize poorly, and this warrants further investigation.
Caudwell Xtreme Everest (CXE) is a project coordinated
by the UCL Centre for Altitude, Space, and Extreme Environment Medicine, with the aim of conducting research into
hypoxia and human performance at high altitude to improve
understanding of hypoxia in critical illness. The research was
funded by unrestricted grants from a variety of sources, none
of which are public, including the entrepreneur John
Caudwell (BOC Medical, now part of Linde Gas Therapeutics), Lilly Critical Care, the London Clinic, Smiths Medical,
Deltex Medical, and the Rolex Foundation. Specific grants
were awarded by the Association of Anesthetists of Great
Britain and Ireland, the UK Intensive Care Foundation, and
the Sir Halley Stuart Trust. The CXE volunteers who trekked
to EBC also kindly donated to support the research. The CXE
Research Group contributed to the design and conduct of
experiments. The members of the CXE Research Group are
listed on the projects website (http://www.xtreme-everest.
co.uk). In particular, the authors thank Prof. Chris Imray and
Prof. David Howard for collecting muscle biopsies at EBC,
Adolfo Odriozola for preparing ultrathin sections of biopsies
and producing some of the EM images included in this
article, and the CXE Project Manager, Kay Mitchell, for her
tireless work that made the expedition possible. A.J.M. thanks
the Research Councils UK for supporting his academic fellowship and the Department of Physiology, Development,
and Neuroscience, University of Cambridge, for welcoming
him so warmly as a new member of the academic staff.

8.

9.
10.

11.
12.
13.

14.
15.

16.

17.

18.
19.

20.

REFERENCES
1.
2.
3.

4.
5.

6.
7.

1440

Grocott, M., Montgomery, H., and Vercueil, A. (2007) Highaltitude physiology and pathophysiology: implications and relevance for intensive care medicine. Crit. Care 11, 203
Khosravi, M., and Grocott, M. (2009) Mountainside to bedside:
reality or fiction? Expert Rev. Resp. Med. 3, 561565
Raguso, C. A., Guinot, S. L., Janssens, J. P., Kayser, B., and
Pichard, C. (2004) Chronic hypoxia: common traits between
chronic obstructive pulmonary disease and altitude. Curr. Opin.
Clin. Nutr. Metab. Care 7, 411 417
Peacock, A. J. (1998) ABC of oxygen: oxygen at high altitude.
BMJ 317, 10631066
Sutton, J. R., Reeves, J. T., Wagner, P. D., Groves, B. M.,
Cymerman, A., Malconian, M. K., Rock, P. B., Young, P. M.,
Walter, S. D., and Houston, C. S. (1988) Operation Everest II:
oxygen transport during exercise at extreme simulated altitude.
J. Appl. Physiol. 64, 1309 1321
Murray, A. J. (2009) Metabolic adaptation of skeletal muscle to
high altitude hypoxia: how new technologies could resolve the
controversies. Genome Med. 1, 117
Holloway, C. J., Montgomery, H. E., Murray, A. J., Cochlin, L. E.,
Codreanu, I., Hopwood, N., Johnson, A. W., Rider, O. J., Levett,
D. Z., Tyler, D. J., Francis, J. M., Neubauer, S., Grocott, M. P.,
and Clarke, K. (2011) Cardiac response to hypobaric hypoxia:
persistent changes in cardiac mass, function, and energy metabolism after a trek to Mt. Everest Base Camp. FASEB J. 25,
792796

Vol. 26

April 2012

21.

22.

23.

24.

Edwards, L. M., Murray, A. J., Tyler, D. J., Kemp, G. J., Holloway,

C. J., Robbins, P. A., Neubauer, S., Levett, D., Montgomery,
H. E., Grocott, M. P., and Clarke, K. (2010) The effect of
high-altitude on human skeletal muscle energetics: P-MRS results from the Caudwell Xtreme Everest expedition. PLoS ONE 5,
e10681
Semenza, G. L. (2007) Hypoxia-inducible factor 1 (HIF-1)
pathway. Sci. STKE 2007, cm8
Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert, J.,
Gaskell, S. J., Kriegsheim, A., Hebestreit, H. F., Mukherji, M.,
Schofield, C. J., Maxwell, P. H., Pugh, C. W., and Ratcliffe, P. J.
(2001) Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science
292, 468 472
Reynafarje, B. (1962) Myoglobin content and enzymatic activity
of muscle and altitude adaptation. J. Appl. Physiol. 17, 301305
Howald, H., and Hoppeler, H. (2003) Performing at extreme
altitude: muscle cellular and subcellular adaptations. Eur.
J. Appl. Physiol. 90, 360 364
Ferretti, G. (2003) Limiting factors to oxygen transport on
Mount Everest 30 years after: a critique of Paolo Cerretellis
contribution to the study of altitude physiology. Eur. J. Appl.
Physiol. 90, 344 350
Youle, R. J., and Narendra, D. P. (2011) Mechanisms of mitophagy. Nat. Rev. Mol. Cell. Biol. 12, 9 14
Lin, J., Wu, H., Tarr, P. T., Zhang, C. Y., Wu, Z., Boss, O.,
Michael, L. F., Puigserver, P., Isotani, E., Olson, E. N., Lowell,
B. B., Bassel-Duby, R., and Spiegelman, B. M. (2002) Transcriptional co-activator PGC-1 alpha drives the formation of slowtwitch muscle fibres. Nature 418, 797 801
Zhang, H., Gao, P., Fukuda, R., Kumar, G., Krishnamachary, B.,
Zeller, K. I., Dang, C. V., and Semenza, G. L. (2007) HIF-1
inhibits mitochondrial biogenesis and cellular respiration in
VHL-deficient renal cell carcinoma by repression of C-MYC
activity. Cancer Cell 11, 407 420
Green, H. J., Sutton, J. R., Wolfel, E. E., Reeves, J. T., Butterfield,
G. E., and Brooks, G. A. (1992) Altitude acclimatization and
energy metabolic adaptations in skeletal muscle during exercise. J. Appl. Physiol. 73, 27012708
Gore, C. J., Clark, S. A., and Saunders, P. U. (2007) Nonhematological mechanisms of improved sea-level performance after
hypoxic exposure. Med. Sci. Sports Exerc. 39, 1600 1609
McCarthy, J., Lochner, A., Opie, L. H., Sack, M. N., and Essop,
M. F. (2011) PKCepsilon promotes cardiac mitochondrial and
metabolic adaptation to chronic hypobaric hypoxia by GSK3beta
inhibition. J. Cell. Physiol. 226, 24572468
Gilde, A. J., van der Lee, K. A., Willemsen, P. H., Chinetti, G.,
van der Leij, F. R., van der Vusse, G. J., Staels, B., and van Bilsen,
M. (2003) Peroxisome proliferator-activated receptor (PPAR)
alpha and PPARbeta/delta, but not PPARgamma, modulate the
expression of genes involved in cardiac lipid metabolism. Circ.
Res. 92, 518 524
Murray, A. J., Panagia, M., Hauton, D., Gibbons, G. F., and
Clarke, K. (2005) Plasma free fatty acids and peroxisome
proliferator-activated receptor alpha in the control of myocardial uncoupling protein levels. Diabetes 54, 3496 3502
Narravula, S., and Colgan, S. P. (2001) Hypoxia-inducible factor
1-mediated inhibition of peroxisome proliferator-activated receptor alpha expression during hypoxia. J. Immunol. 166, 7543
7548
Aragones, J., Schneider, M., Van Geyte, K., Fraisl, P., Dresselaers, T., Mazzone, M., Dirkx, R., Zacchigna, S., Lemieux, H.,
Jeoung, N. H., Lambrechts, D., Bishop, T., Lafuste, P., DiezJuan, A., Harten, S. K., Van Noten, P., De Bock, K., Willam, C.,
Tjwa, M., Grosfeld, A., Navet, R., Moons, L., Vandendriessche,
T., Deroose, C., Wijeyekoon, B., Nuyts, J., Jordan, B., SilasiMansat, R., Lupu, F., Dewerchin, M., Pugh, C., Salmon, P.,
Mortelmans, L., Gallez, B., Gorus, F., Buyse, J., Sluse, F., Harris,
R. A., Gnaiger, E., Hespel, P., Van Hecke, P., Schuit, F., Van
Veldhoven, P., Ratcliffe, P., Baes, M., Maxwell, P., and Carmeliet, P. (2008) Deficiency or inhibition of oxygen sensor Phd1
induces hypoxia tolerance by reprogramming basal metabolism.
Nat. Genet. 40, 170 180
Levett, D. Z., Martin, D. S., Wilson, M. H., Mitchell, K., Dhillon,
S., Rigat, F., Montgomery, H. E., Mythen, M. G., and Grocott,
M. P. (2010) Design and conduct of Caudwell Xtreme Everest:
an observational cohort study of variation in human adaptation

The FASEB Journal www.fasebj.org

LEVETT ET AL.

25.

26.
27.

28.

29.

30.

31.
32.

33.
34.

35.

36.
37.
38.
39.
40.

to progressive environmental hypoxia. BMC Med. Res. Methodol.

10, 98
Hoppeler, H., Luthi, P., Claassen, H., Weibel, E. R., and
Howald, H. (1973) The ultrastructure of the normal human
skeletal muscle. A morphometric analysis on untrained men,
women and well-trained orienteers. Pflugers Arch. 344, 217232
Hoppeler, H. (1986) Exercise-induced ultrastructural changes
in skeletal muscle. Int. J. Sports Med. 7, 187204
Vock, R., Weibel, E. R., Hoppeler, H., Ordway, G., Weber, J. M.,
and Taylor, C. R. (1996) Design of the oxygen and substrate
pathways. V. Structural basis of vascular substrate supply to
muscle cells. J. Exp. Biol. 199, 16751688
Murray, A. J., Cole, M. A., Lygate, C. A., Carr, C. A., Stuckey,
D. J., Little, S. E., Neubauer, S., and Clarke, K. (2008) Increased
mitochondrial uncoupling proteins, respiratory uncoupling and
decreased efficiency in the chronically infarcted rat heart. J.
Mol. Cell. Cardiol. 44, 694 700
McClelland, G. B., Dalziel, A. C., Fragoso, N. M., and Moyes,
C. D. (2005) Muscle remodeling in relation to blood supply:
implications for seasonal changes in mitochondrial enzymes. J.
Exp. Biol. 208, 515522
Houle-Leroy, P., Garland, T., Jr., Swallow, J. G., and Guderley,
H. (2000) Effects of voluntary activity and genetic selection on
muscle metabolic capacities in house mice Mus domesticus.
J. Appl. Physiol. 89, 1608 1616
West, J. B., Lahiri, S., Maret, K. H., Peters, R. M., Jr., and Pizzo, C. J.
(1983) Barometric pressures at extreme altitudes on Mt. Everest:
physiological significance. J. Appl. Physiol. 54, 1188 1194
Grocott, M. P., Martin, D. S., Levett, D. Z., McMorrow, R.,
Windsor, J., and Montgomery, H. E. (2009) Arterial blood gases
and oxygen content in climbers on Mount Everest. New Engl.
J. Med. 360, 140 149
Kim, J. W., and Dang, C. V. (2006) Cancers molecular sweet
tooth and the Warburg effect. Cancer Res. 66, 8927 8930
Vidal-Puig, A., Solanes, G., Grujic, D., Flier, J. S., and Lowell,
B. B. (1997) UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and
brown adipose tissue. Biochem. Biophys. Res. Commun. 235, 79 82
Brand, M. D., Pamplona, R., Portero-Otin, M., Requena, J. R.,
Roebuck, S. J., Buckingham, J. A., Clapham, J. C., and Cadenas,
S. (2002) Oxidative damage and phospholipid fatty acyl composition in skeletal muscle mitochondria from mice underexpressing or overexpressing uncoupling protein 3. Biochem. J.
368, 597 603
Lu, Z., and Sack, M. N. (2008) ATF-1 is a hypoxia-responsive
transcriptional activator of skeletal muscle mitochondrial-uncoupling protein 3. J. Biol. Chem. 283, 23410 23418
Ljubicic, V., Adhihetty, P. J., and Hood, D. A. (2004) Role of
UCP3 in state 4 respiration during contractile activity-induced
mitochondrial biogenesis. J. Appl. Physiol. 97, 976 983
Boyer, S. J., and Blume, F. D. (1984) Weight loss and changes in body
composition at high altitude. J. Appl. Physiol. 57, 15801585
Shukla, V., Singh, S. N., Vats, P., Singh, V. K., Singh, S. B., and
Banerjee, P. K. (2005) Ghrelin and leptin levels of sojourners and
acclimatized lowlanders at high altitude. Nutr. Neurosci. 8, 161165
Cogswell, A. M., Stevens, R. J., and Hood, D. A. (1993) Properties of
skeletal muscle mitochondria isolated from subsarcolemmal and
intermyofibrillar regions. Am. J. Physiol. 264, C383C389

MITOCHONDRIAL ADAPTATION TO HIGH-ALTITUDE HYPOXIA

41.

42.
43.
44.

45.

46.

47.

48.

49.

50.

51.
52.

53.

Koves, T. R., Noland, R. C., Bates, A. L., Henes, S. T., Muoio,

D. M., and Cortright, R. N. (2005) Subsarcolemmal and intermyofibrillar mitochondria play distinct roles in regulating skeletal muscle fatty acid metabolism. Am. J. Physiol. Cell Physiol. 288,
C1074 C1082
Chandel, N., Budinger, G. R., Kemp, R. A., and Schumacker,
P. T. (1995) Inhibition of cytochrome-c oxidase activity during
prolonged hypoxia. Am. J. Physiol. 268, L918 L925
Wheaton, W. W., and Chandel, N. S. (2011) Hypoxia. 2.
Hypoxia regulates cellular metabolism. Am. J. Physiol. Cell Physiol.
300, C385393
Fukuda, R., Zhang, H., Kim, J. W., Shimoda, L., Dang, C. V., and
Semenza, G. L. (2007) HIF-1 regulates cytochrome oxidase
subunits to optimize efficiency of respiration in hypoxic cells.
Cell 129, 111122
Chan, S. Y., Zhang, Y. Y., Hemann, C., Mahoney, C. E., Zweier,
J. L., and Loscalzo, J. (2009) MicroRNA-210 controls mitochondrial metabolism during hypoxia by repressing the iron-sulfur
cluster assembly proteins ISCU1/2. Cell Metab. 10, 273284
Chen, Z., Li, Y., Zhang, H., Huang, P., and Luthra, R. (2010)
Hypoxia-regulated microRNA-210 modulates mitochondrial
function and decreases ISCU and COX10 expression. Oncogene
29, 4362 4368
Favaro, E., Ramachandran, A., McCormick, R., Gee, H.,
Blancher, C., Crosby, M., Devlin, C., Blick, C., Buffa, F., Li, J. L.,
Vojnovic, B., Pires das Neves, R., Glazer, P., Iborra, F., Ivan, M.,
Ragoussis, J., and Harris, A. L. (2010) MicroRNA-210 regulates
mitochondrial free radical response to hypoxia and krebs cycle
in cancer cells by targeting iron sulfur cluster protein ISCU.
PLoS ONE 5, e10345
Mogensen, M., Bagger, M., Pedersen, P. K., Fernstrom, M., and
Sahlin, K. (2006) Cycling efficiency in humans is related to low
UCP3 content and to type I fibres but not to mitochondrial
efficiency. J. Physiol. 571, 669 681
Murray, A. J., Knight, N. S., Cochlin, L. E., McAleese, S., Deacon,
R. M., Rawlins, J. N., and Clarke, K. (2009) Deterioration of
physical performance and cognitive function in rats with shortterm high-fat feeding. FASEB J. 23, 4353 4360
Essop, M. F., Razeghi, P., McLeod, C., Young, M. E., Taegtmeyer, H., and Sack, M. N. (2004) Hypoxia-induced decrease of
UCP3 gene expression in rat heart parallels metabolic gene
switching but fails to affect mitochondrial respiratory coupling.
Biochem. Biophys. Res. Commun. 314, 561564
Gilde, A. J., and Van Bilsen, M. (2003) Peroxisome proliferatoractivated receptors (PPARS): regulators of gene expression in
heart and skeletal muscle. Acta Physiol. Scand. 178, 425 434
Kim, J. W., Tchernyshyov, I., Semenza, G. L., and Dang, C. V.
(2006) HIF-1-mediated expression of pyruvate dehydrogenase
kinase: a metabolic switch required for cellular adaptation to
hypoxia. Cell Metab. 3, 177185
Carre, J. E., Orban, J. C., Re, L., Felsmann, K., Iffert, W., Bauer,
M., Suliman, H. B., Piantadosi, C. A., Mayhew, T. M., Breen, P.,
Stotz, M., and Singer, M. (2010) Survival in critical illness is
associated with early activation of mitochondrial biogenesis.
Am. J. Respir. Crit. Care Med. 182, 745751
Received for publication October 18, 2011.
Accepted for publication December 5, 2011.

1441