Acta Biomaterialia xxx (2016) xxxxxx

Contents lists available at ScienceDirect

Acta Biomaterialia
journal homepage: www.elsevier.com/locate/actabiomat

Full length article

An alginate-based platform for cancer stem cell research

Shu-pei Qiao a,1, Yu-fang Zhao a,1, Chun-feng Li a,1, Yan-bin Yin a, Qing-yuan Meng b, Feng-Huei Lin c,d,
Yi Liu a, Xiao-lu Hou a, Kai Guo a, Xiong-biao Chen e,f, Wei-ming Tian a,
a

Bio-X Center, School of Life Science and Technology, Harbin Institute of Technology, Harbin 150080, PR China
State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, PR China
c
Division of Biomedical Engineering and Nanomedicine Research, National Health Research Institutes, Miaoli, Taiwan, ROC
d
Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, Taipei, Taiwan, ROC
e
Division of Biomedical Engineering, University of Saskatchewan, Saskatoon, Canada
f
Department of Mechanical Engineering, University of Saskatchewan, Saskatoon, Canada
b

a r t i c l e

i n f o

Article history:
Received 3 November 2015
Received in revised form 14 April 2016
Accepted 18 April 2016
Available online xxxx
Keywords:
Alginate
Hyaluronic acid
Platform
Cancer stem cell
Niche

a b s t r a c t
As the primary determinants of the clinical behaviors of human cancers, the discovery of cancer stem
cells (CSCs) represents an ideal target for novel anti-cancer therapies (Kievit et al., 2014). Notably,
CSCs are difficult to propagate in vitro, which severely restricts the study of CSC biology and the development of therapeutic agents. Emerging evidence indicates that CSCs rely on a niche that controls their differentiation and proliferation, as is the case with normal stem cells (NSCs). Replicating the in vivo CSC
microenvironment in vitro using three-dimensional (3D) porous scaffolds can provide means to effectively generate CSCs, thus enabling the discovery of CSC biology. This paper presents our study on a novel
alginate-based platform for mimicking the CSC niche to promote CSC proliferation and enrichment. In
this study, we used a versatile mouse 4T1 breast cancer model to independently evaluate the matrix
parameters of a CSC niche including the materials mechanical properties, cytokine immobilization,
and the composition of the extracellular matrixs (ECMs) molecular impact on CSC proliferation and
enrichment. On this basis, the optimal stiffness and concentration of hyaluronic acid (HA), as well as epidermal growth factor and basic fibroblast growth factor immobilization, were identified to establish the
platform for mimicking the 4T1 breast CSCs (4T1 CSCs) niche. The 4T1 CSCs obtained from the platform
show increased expression of the genes involved in breast CSC and NSC, as compared to general 2D or 3D
culture, and 4T1 CSCs were also demonstrated to have the ability to quickly form a subcutaneous tumor
in homologous Balb/c mice in vivo. In addition, the platform can be adjusted according to different parameters for CSC screening. Our results indicate that our platform offers a simple and efficient means to isolate and enrich CSCs in vitro, which can help researchers better understand CSC biology and thus develop
more effective therapeutic agents to treat cancer.
Statement of Significance
As the primary determinants of the clinical behaviors of human cancers, the discovery of cancer stem
cells (CSCs) represents an ideal target for novel anti-cancer therapies. However, CSCs are difficult to propagate in vitro, which severely restricts the study of CSC biology and the development of therapeutic
agents. Emerging evidence indicates that CSCs rely on a niche that controls their differentiation and proliferation, as is the case with normal stem cells (NSCs). Replicating the in vivo CSC microenvironment
in vitro using three-dimensional (3D) porous scaffolds can provide means to effectively generate CSCs,
thus enabling the discovery of CSC biology. In our study, a novel alginate-based platform were developed
for mimicking the CSC niche to promote CSC proliferation and enrichment.
2016 Published by Elsevier Ltd. on behalf of Acta Materialia Inc.

1. Introduction
Corresponding author.
1

E-mail address: tianweiming@hit.edu.cn (W.-m. Tian).

Equal contribution.

Cancer is a major disease with detrimental health effects and is

also associated with high incidence and mortality rates worldwide
[2]. There have been significant challenges in developing effective

http://dx.doi.org/10.1016/j.actbio.2016.04.032
1742-7061/ 2016 Published by Elsevier Ltd. on behalf of Acta Materialia Inc.

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

treatments for cancer due to the complexity of its pathogenesis

and molecular mechanisms, which have not been fully understood
[3,4]. Growing evidence has suggested that cancer is a stem cellbased disease, and it is analogous to the growth of normal proliferative tissues such as bone marrow, skin and intestinal epithelium,
and that the growth of cancer tumors is fated by the cancer stem
cells (CSCs), which possess the capacity for self-renewal, unlimited
proliferation, and multidrug and radiotherapy resistance [5]. As
such, discovering the CSCs will greatly facilitate the development
of novel research strategies to investigate the occurrence, development, and recurrence of tumors [68].
Although much progress has been made in the study of CSCs,
many issues remain to be addressed by research. One issue is the
difficulties to isolate and propagate CSCs owing to the small percentage of CSCs found in tumors. For example, only about 2% of
breast tumor cells are comprised of CSCs, and 0.11% of acute myeloid leukemia (AML) cells are CSCs [9,10]. The most common methods used to isolate CSCs are serum-free culture and fluorescenceactivated cell sorting (FACS); however, both methods have certain
shortcomings. Serum-free culture requires large volumes of expensive and specialized media and is frequently unsuccessful due to
the small percentage of CSCs found in the tumor of origin. The FACS
approach requires costly antibodies and dedicated equipment,
yielding low numbers of viable cells. Therefore, there is an essential need to establish new and extensive screening methods to isolate and propagate CSCs in vitro [11,12].
Normal stem cells (NSCs) have been found to reside within a
stem cell niche, which plays critical roles in the maintenance of
stem cell characteristics, such as pluripotency and self-renewal
[13]. Recent data imply that CSCs also share a similar niche as
NSCs, referred to as the CSC niche, which regulates their stemness and proliferation [14,15]. The CSC niche is complex and
includes diverse stromal cells, the extracellular matrix (ECM),
and soluble factors secreted from the niches cells [15]. Mounting
evidence suggests that the ECM is an essential noncellular component of the adult stem cell niche and that its rigidity and organization play important roles in stem cell differentiation and wound
healing, as well as in cancer pathologies [1620]. Porous hydrogel
is widely used to mimic NSCs or the tumor microenvironments
ECM, and substantial evidence from recent studies has suggested
that it can regulate stem cell differentiation, while promoting
CSC selection and proliferation by adjusting the stiffness of the
hydrogel [2123]. Furthermore, emerging evidence has supported
the idea that three-dimensional (3D) culture can promote cell
reprogramming and tumor malignancy; and that in the tumor
microenvironment where CSCs and non-CSCs maintain balanced,
3D culture can promote the reprogramming of non-CSCs to CSCs
[20,24]. Evidence from recent studies has also shown that it is feasible to proliferate and enrich CSCs by culturing the tumor cells on
the porous hydrogel [1,25].
As a major glycosaminoglycan of the ECM, hyaluronic acid (HA)
has been described as one of the components of the stem cell niche.
HA has been found enriched in many types of tumors and associated with tumor growth and invasion [2629]. Growing evidence
has demonstrated that CSCs share many similar signaling pathways with NSCs; however, there is an imbalance in these pathways
[30]. Researchers investigated the use of epidermal growth factor
(EGF) and basic fibroblast growth factor (bFGF) in maintaining
the stemness and proliferation of NSCs [31]. Subsequently, many
researchers have isolated CSCs from various tumors via serumfree culture combined with EGF and bFGF [32,33]. As cytokines
of the CSC niche, EGF and bFGF can stimulate CSC self-renewal
and stemness [14].
In this paper, we present the synthesis and material characterization, and perform in vitro studies on alginate-based 3D porous
hydrogels for mimicking the CSC microenvironment ECM. In our

study, we also demonstrate that the stiffness of the hydrogels

can be modulated by changing the concentration of alginate used
for cross-linking. HA is added to alginate-based hydrogels at different molecular weights and concentrations, with limited influence
on the stiffness of the hydrogel, and that EGF and bFGF, cytokines
of the CSC niche, can be covalently linked to the oxidized alginate
hydrogel and the cytokines which chosen to link to the oxidized
alginate hydrogel could be changed for different needs. On this
basis, a platform that features with the optimized stiffness and
HA concentration as well as immobilized EGF and bFGF was developed and used for the rapid and efficient isolation of 4T1 breast
CSCs with high expression of CD44 and Sca-1 as well as low
expression of CD24, which were proven as breast CSCs markers
and often used for breast CSCs isolation from 4T1 breast cancer
cells [33]. Taken together, we illustrate the novel in vitro platform
comprised of the ECM with appropriate stiffness, cytokines, and HA
is promising to mimic the in vivo CSC niche for isolating thus discovering and treating the CSCs.
2. Materials and methods
2.1. Cell lines and materials
Mouse 4T1 breast cancer cell lines were purchased from the
Institute of Biochemistry and Cell Biology, Chinese Academy of
Sciences (Shanghai, Peoples Republic of China). 2B11 hybridoma
cells for secreting the crypito-1 antibody, were purchased from
the Biosynthesis Biotechnology Company (Beijing, Peoples Republic of China). Dulbeccos Modified EaglesMedium:Nutrient Mixture
F-12 (DMEM/F-12), Roswell Park Memorial Institute (RPMI) 1640
medium, B-27 supplement, GlutaMAXTM supplement, and fetal
bovine serum(FBS) were purchased from Thermo Fisher Scientific
(Waltham, MA, USA). Propidium iodide(PI), calcein, phalloidin,
and 4,6-diamidino-2-phenylindole (DAPI) were purchased from
SigmaAldrich Co. (St Louis, MO, USA). bFGF and EGF were purchased from Peprotech(RockyHill, NJ, USA). Mouse monoclonal
CD44 primary antibodies conjugated with FITC, mouse monoclonal
CD24 primary antibodies conjugated with phycoerythrin (PE),
mouse monoclonal MDR1 primary antibodies, mouse monoclonal
Dclk1 primary antibodies, FITC-conjugated goat polyclonal
secondary antibodies to rabbit immunoglobulin (Ig)G, and
rhodamine-conjugated rat polyclonal secondary antibodies to rabbit IgG were purchased from Abcamplc (Cambridge, MA, USA).
2.2. Experimental animals
Balb/c female mice (SPF), 68 weeks of age, were provided by
the Laboratory Animal Center of Harbin Medical University. All animals were fed ad libitumand kept under the normal 12-h light/12hourdark cycle. All procedures were approved by the University
Ethics Committee of the Harbin Institute of Technology.
2.3. Synthesis of hydrogel and its physicochemical characterization
Alginate (low viscosity) and HA were purchased from Sigma
Aldrich Co. (St Louis, MO, USA). Alginate hydrogels were prepared
as previously reported [34,35]. Briefly, alginate was dissolved in
100 mL of distilled water to a concentration of 20 mg/mL. The alginate was purified by the addition of ethanol. Then, the precipitated
alginate was dialyzed, lyophilized, and dissolved in distilled water
to obtain different concentrations. The alginate hydrogel was prepared through cross-linking with calcium ions, and the alginate
HA hydrogel was formed through the addition of HA. The gelation
process and the mechanical properties of the alginate hydrogels
were evaluated by examining the time of gelation onset and the
evolution of elasticity at 37 C in constant strain mode by means

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

of a Bohlin Gemini II rheometer (Malvern Instruments, Malvern,

UK) using parallel plate geometry (40 mm in diameter), as in our
previous study [36].
2.4. Immobilization of growth factors in oxidized alginate
The oxidized alginate was obtained by mixing sodium peroxide
and sodium alginate (in distilled water) with a mass ratio of 1:2.
The reaction was conducted at 4 C for 2 h and was terminated by
the addition of ethylene glycol; the degree of oxidation was evaluated by measuring the concentration of sodium peroxide which
remained after 2 h. Then, the oxidized alginate was lyophilized at

20 C and dissolved in distilled water to achieve a 1.3% concentration. EGF and bFGF immobilized oxidized alginate was prepared by
dissolving EGF and bFGF (50 ng/mL) in an oxidized alginate solution
while stirring. The EGF and bFGF immobilized oxidized alginate was
collected and lyophilized at
20 C. The concentration of EGF and
bFGF in the supernatant was analyzed using an ultraviolet (UV)Vis spectrophotometer (UV-2250; Shimadzu Corporation, Kyoto,
Japan) at 280 nm to evaluate the immobilization ratio.
2.5. 2D cell culture and cell seeding on hydrogels
Mouse 4T1 breast cancer cells were grown in RPMI 1640 medium, and the hybridoma 2B11 cells were grown in DMEM/F-12
medium supplemented with 10% FBS (Thermo Fisher Scientific,
Waltham, MA, USA) and 1% antibioticantimycotic (Thermo Fisher
Scientific, Waltham, MA, USA). Both were incubated in a humidified atmosphere of 5% CO2 at 37 C, with media changed every
other day. The mouse 4T1 breast cancer cells were digested from
monolayer cultures and seeded onto the alginate or alginateHA
hydrogels, then incubated in a humidified atmosphere of 5% CO2
at 37 C and grown in DMEM/F-12 media supplemented with 1%
B-27 with media changed every other day.
2.6. Scanning electron microscopy
Cell clones were released from our developed screening platform, and then fixed with 2.5% glutaraldehyde for 30 min at
37 C, followed by incubation in 0.1 M sodium cacodylate buffer
containing 2.5% glutaraldehyde overnight at 4 C. After dehydration by serial washing twice in each increasing ethanol concentration (0%, 30%, 50%, 70%, 85%, 95%, and 100%), the samples were
critical point dried, sectioned, mounted, and sputter coated with
platinum before imaging with a JSM-7000 scanning electron
microscope (SEM) (JEOL, Tokyo, Japan).
2.7. RNA extraction and reverse transcription
The total RNA of 4T1 breast cancer cell tumor spheroids from
the 3D alginate hydrogel culture was extracted using Trizol reagent
according to the manufacturers instructions, and RNA quality was
assessed by agarose gel electrophoresis. The complementary (c)
DNA synthesis was performed using 1 lg of total RNA, oligo (dT)
primer (Promega Corporation, Madison, WI, USA), and reverse
transcriptase (Promega Corporation, Madison, WI, USA) according
to the manufacturers protocol.
2.8. Quantitative real-time PCR
Real-time polymerase chain reaction (PCR) was performed on a
7500 real-time PCR system (Applied Biosystems; Thermo Fisher
Scientific, Waltham, MA, USA) using the FastStart Universal SYBR
Green Master [Rox] (Hoffman-La Roche Ltd., Basel, Switzerland).
The PCR conditions were set as follows: 2 min at 60 C; 10 min at
95 C; 40 cycles of 15 s at 95 C; 1 min at 60 C; and 30 s at

72 C. The primer sequences used for quantitative real-time PCR

are shown in Table 1. All of the primers were designed to span
genomic introns to avoid the amplification of contaminated genomic DNA. Gene expression was normalized with the GAPDH
expression level. Quantitative real-time PCR analyses were performed in triplicate and repeated at least three times.
2.9. Phalloidin/DAPI staining and immunostaining
To assess the cell clones morphology, which were formed by
seeding the 4T1 breast cancer cells onto alginate hydrogels, the cell
clones were released from the alginate microcapsules using sodium
citrate. Samples were stained with rhodamine-conjugated phalloidin and DAPI. For phalloidinDAPI staining, samples were fixed
with 4% paraformaldehyde for 15 min and permeabilized with 1%
Triton X-100 in PBS for 5 min at room temperature with gentle
rocking. The samples were then washed three times for 5 min with
1 mL of PBS at room temperature. A total of 700 lL of rhodamineconjugated phalloidin (0.8 U/mL in 1% BSA in PBS) was added to
each sample and they were incubated for 30 min at room temperature with gentle rocking; phalloidin binds to F-actin. The samples
were then washed three times for 5 min with 1 mL of PBS at room
temperature, and nuclei were stained with DAPI staining solution
(1.0 lg/mL in PBS) for 10 min at room temperature. Samples were
washed three times for 5 min with 1 mL of PBS at room temperature and visualized with a Leica SP5 confocal microscope (Leica
Microsystems, Wetzlar, Germany). Immunofluorescence analysis
was performed on the tumor spheroid (which formed 7 days after
the 4T1 breast cancer cells were seeded onto our platform) to assess
protein expression within the cultured cell clones. Tumor spheroids
were released from our platform with the addition of sodium
citrate. Tumor spheroids were fixed with 4% paraformaldehyde
for 15 min and permeabilized with 1% Triton X-100 in PBS for
5 min at room temperature with gentle rocking. Then, the samples
were blocked with 2% BSA (SigmaAldrich Co., St Louis, MO, USA) in
PBS for 1 h and incubated with mouse monoclonal CD44 primary
antibody conjugated with FITC, mouse monoclonal CD24 primary
antibody conjugated with PE, mouse monoclonal MDR1 primary
antibody, and mouse monoclonal Dclk1 primary antibody. Samples
were washed three times with PBS before incubation with the FITC
conjugated secondary antibody for 1 h at room temperature. Cell
nuclei were counterstained with DAPI (300 nM in D-PBS; Thermo
Fisher Scientific, Waltham, MA, USA) for 10 min. Images were
obtained on an inverted fluorescent microscope (Nikon Instruments, Melville, NY, USA).
2.10. Tumorigenesis assay
Tumor spheroids, which were formed in our platform over
7 days, were released using sodiumcitrate, and they were used to
determine cell count. Cells (500 or 2000) were injected subcutaneously into the flanks of Balb/c female mice that were 68 weeks
Table 1
Primer information for real-time stem-loop RT-PCR.
Primer
name

Forward (50 30 )

Reverse (50 30 )

GAPDH
CD44
CD24
SCA1
ABCG2
Tert
Nestin
Nanog
Sox2

CATGGCCTTCCGTGTTCCTA
GAATGTAACCTGCCGCTACG
CTTCTGGCACTGCTCCTACC
TGGACACTTCTCACACTA
AGCAGCAAGGAAAGATCCAA
GCACTTTGGTTGCCCAATG
CCCTGAAGTCGAGGAGCTG
TCTTCCTGGTCCCCACAGTTT
CATCCACTTCTACCCCACCTT

CCTGCTTCACCACCTTCTTGA
GGAGGTGTTGGACGTGAC
GAGAGAGAGCCAGGAGACCA
CAGAGCAAGAGGGTCTGCAGGAG
GGAATACCGAGGCTGATGAA
GCACGTTTCTCTCGTTGCG
CTGCTGCACCTCTAAGCGA
GCAAGAATAGTTCTCGGGATGAA
AGCTCCCTGTCAGGTCCTT

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

old. Two-dimensional cultured cells were implanted with growth

factor-reduced matrigel at the same cell number as the one on
hydrogels. Tumors were measured using calipers, and the volume
was calculated based on the modified ellipsoidal formula, i.e.,
tumor volume = (length  width2)  0.5 [37].
2.11. Statistic analysis
The results are presented as the mean standard deviation. Students two-tailed t-test was performed to compare the differences
between the experimental and control groups. A P-value < 0.05 ()
was considered significant; a P-value < 0.01 () was considered
very significant.
3. Results
3.1. Conditions optimized for mimicking the CSC niche
Recent work has revealed that the niche of CSCs support CSC
self-renewal and regulates their proliferation and differentiation
[14,38]. In our study, we aimed to establish an in vitro platform
that could partly mimic the CSC niche. We also designed the platform in such a way that its component structure was tunable for
different needs. To achieve this aim, an alginate-based hydrogel
was used to mimic the elasticity of the ECM within the CSC niche;
cytokines of the niche were immobilized to the alginate-based
hydrogel, and HA of the ECM was added into the hydrogel. In this
study, we cultured the tumor cells in alginate-HA hydrogel with
serum-free culture. The tumor spheroids comprised by CSCs were
obtained through culturing while the tumor spheroids size and
number was used to evaluate the proliferation and enrichment of
CSCs as previously reported [22]. In this way, the optimal conditions of the CSC niche were identified (Fig. 1).
3.1.1. Effect of alginate-based hydrogel with different mechanical
properties on CSC enrichment
The importance of physical microenvironments in regulating
stem cell proliferation and differentiation has been increasingly

recognized [18,3941]. Moreover, considerable evidence indicates

that the material properties of hydrogels play an important role
in selection and growth of tumorigenic cells [20,21]. In our study,
we developed calcium cross-linked alginate hydrogels to mimic
the ECMs elasticity and then to identify the optimal material properties to isolate CSCs. For this purpose, we prepared alginate with
different concentrations in order to synthesize hydrogels featuring
different degrees of elastic stiffness. Alginate is known for its nontoxicity and low immunogenicity, and it creates excellent flexible
scaffolds for transplanted cells in different animal species. The
characterization of the HAalginate hydrogel was shown in the
SEM images.
The elastic stiffness of alginates, which have concentrations
ranging from 1% to 1.6%, was detected. The results showed that
alginate concentrations of 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, and
1.6% corresponded to an elasticity of 190 Pa, 210 Pa, 270 Pa,
710 Pa, 950 Pa, 1070 Pa, and 4700 Pa, respectively (Supplementary
Fig. 1). The characterization of alginate hydrogels with different
concentrations were shown in the SEM images in Supplementary
Fig. 2 and the pore size of alginate hydrogels also were detected
(Supplementary Fig. 2). In order to determine the elastic stiffness
most suitable for CSC proliferation and spheroid formation, we
selected hydrogels with elastic stiffness levels of 190 Pa, 270 Pa,
950 Pa, and 4700 Pa for this study. We determined that an alginate
hydrogel of 950 Pa (1.4%) represented the optimal hydrogel for
cancer cell proliferation and spheroid formation (Fig. 2A and B).
About 10000 4T1 cancer cells in RPMI 1640 medium, which had
been trypsinized from conventional 2D rigid dishes, were mixed
with alginate solution. The cells were trapped individually in the
3D alginate hydrogel and maintained in DMEM/F-12 medium with
1% B27. Inside the alginate hydrogel (950 Pa), about 27 3 spheroid colonies formed and increased from Day 3 to Day7 (Fig. 2C);
some cells at the bottom of the hydrogels near the rigid dish exhibited spread morphology. In contrast, inside the other hydrogels
(190 Pa, 270 Pa, or 4700 Pa), the spheroid colony number
decreased dramatically as the culture time increased. The 950 Pa
alginate hydrogel led to the development of a larger tumor spheroid size than the other hydrogels (Fig. 2A, B, and D). The number

Fig. 1. The scheme to show the process of establish a novel alginate-based platform for mimicking the CSC niche to promote CSC enrichment and treatment. Versatile mouse
4T1 breast cancer was used as a model, the optimal stiffness and epidermal growth factor and basic fibroblast growth factor immobilization, as well as optimal concentration
of hyaluronic acid (HA), were chosen to establish the platform that was used to mimic the 4T1 breast cancer stem cell (CSCs) niche. The CSCs that were selected by the
platform we developed could form a subcutaneous tumor with high frequency after inoculated to normal Balb/c mice. On the other hand, our alginate-based platform with
grafting cripto-1 antibody could be applied in a CSC treatment study.

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

Fig. 2. Tumorsphere formation in an alginate-based hydrogel with different degrees of stiffness. A. A single 4T1 breast cancer cell grew into tumorspheres in alginate
hydrogels of different stiffness levels throughout the course of culture from day 1 to day 7. Scale bar: 50 lm. B. The observation of the cytoskeleton of the multicellular 4T1
tumor spheroid after 7 days in culture in an alginate hydrogel with different levels of stiffness; the multicellular 4T1 tumor spheroid was released from the hydrogel and was
stained with phalloidin for the cytoskeleton (red) and DAPI for the nucleus (blue); it was imaged with an inverted fluorescent microscope. Scale bar: 20 lm. C. Tumorsphere
(round colony) number as a function of culture time: day 1 to day 7. The 950 Pa alginate hydrogel seems to be optimal for sustaining the spheroid colony number. Mean SD;
n = 3 (for the 190 Pa, 270 Pa, 950 Pa, and 4700 Pa alginate hydrogels); independent experiments. D. Colony size of the tumorspheres as a function of culture time and hydrogel
stiffness. Apparently, the 950 Pa hydrogel best promotes tumor growth. Mean SD; n = 3 (for 190 Pa, 270 Pa, 950 Pa, and 4700 Pa alginate hydrogels); independent
experiments.

and size of the spheroid colony dramatically increased after culturing the cells from the 7-day alginate hydrogel, suggesting that the
cells selected by the alginate hydrogels exhibited a better capacity
to form spheroid colonies, and that these colonies also grew more
rapidly.
3.1.2. Effect of hydrogel-immobilized cytokines on CSC enrichment
Serum-free culture, a commonly used method to isolate CSCs,
requires the constant supplementation of EGF and bFGF in the culture medium [32,33]. Cytokine immobilization can effectively prolong the biological activity of these factors [42]. Obtaining a signal
from the cytokines allows the cells to be maintained for a longer
amount of time, and it also promotes efficiency without having
to continuously add to the medium, resulting in cost savings. The
oxidation of sodium alginate produced aldehyde groups, which
form unstable amines found within the free amino groups of the
cytokines; and these amines covalently link the cytokines to the
alginate polymer chain. To illustrate the effectiveness of this
immobilization, an antibody, which was labeled with red fluorescence, was used for examination. As shown in Supplementary
Fig. 3, red fluorescence was observed in the immobilized red
fluorescence-labeled antibody group, but not in the control group.
This result showed that the method we used was able to immobilize cytokines on hydrogels. Furthermore, we also detected the

remaining EGF and FGF after encapsulation by staining them with

their antibodies labeled with fluorescence, which also demonstrated the growth factor are sequestered. We immobilized EGF
and bFGF on the alginate hydrogels to investigate whether this
method would be better than a direct addition. We compared the
spheroid colonies formed and tumor spheroid size among three
groups, i.e., the control group (without EGF and bFGF), the immobilization group (with EGF and bFGF immobilized on the alginate
hydrogels), and the solution group (with EGF and bFGF directly
added to the culture medium). Seven days after cell seeding, the
size of the tumor spheroids in the immobilization group reached
127.3 7.9 lm in diameter, and they were larger than those of
the other groups (Fig. 3A, B, and D). Notably, the cells in the control
group almost stopped growing at Day 5. In contrast, inside the alginate hydrogel-immobilized cytokines, about 41.0 1.0 spheroid
colonies formed; this number was significantly higher than that
of the other two groups (Fig. 3C), suggesting that immobilized
cytokines can promote CSC proliferation and enrichment.
3.1.3. Effect of low and high molecular weight HA with different
concentrations on CSC enrichment
Considerable evidence indicates that low-concentration HA can
promote stem cell proliferation [43]; while high-concentration HA
can keep the stem cells in a dormant state and thus induce a

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

Fig. 3. Effect of cytokine immobilization on tumorsphere formation. A. Tumorsphere formation by 4T1 breast cancer cells in different groups (without the addition of
cytokines in the control group; directly adding the cytokine to the medium in the solution group; and immobilization of the cytokine added to the alginate hydrogel in the
immobilization group). Scale bar: 50 lm. B. Observations of the cytoskeleton of the multicellular 4T1 tumor spheroid after 7 days in culture for the different groups; the
multicellular 4T1 tumor spheroid was stained with phalloidin for the cytoskeleton (red) and DAPI for the nucleus (blue); it was imaged with an inverted fluorescent
microscope. Scale bar: 20 lm. C. Tumorsphere (round colony) number as a function of culture time: day 1 to day 7. Cytokine immobilization significantly promoted the
formation of the tumor spheroid. Mean SD; n = 3 (for the different groups); independent experiments. D. Colony size of the tumorsphere as a function of culture time and
cytokine immobilization. Apparently, cytokine immobilization enhanced the proliferation of the tumor spheroid. Mean SD; n = 3 (for the different groups); independent
experiments.

multidrug-resistant phenotype [44]. Considering the important

role of HA in stem cells, in our study, we developed an HAalginate
hydrogel of varying concentrations of HA. The hybrid hydrogel
loaded with the same number of cells from the 2D culture was
implanted to analyze the effect of different concentrations on HA
for CSC enrichment and proliferation. The addition of HA shows
limited influence on the material properties of the hydrogel (Supplementary Fig. 4). In our study, low molecular weight (LMW) HA
with concentrations of 0.5%, 1%, and 1.5% was used to develop the
HAalginate hydrogel, while the alginate hydrogel without HA
served as a control. With the increasing number of filtration days,
the group of 1.5% concentration led to a higher spheroid colony
number (47 1) than the control group, and other concentrations
showed suppressed tumor spheroid formation. However, there
was no significant difference between the control group and the
group of 1.5% concentration in terms of tumor spheroid size
(131.3 8.5 lm) (Fig. 4AD). Similar to the results of the lowconcentration LMW-HA, we also found that with increasing concentrations of LMW-HA, more spheroid colonies were formed,
which means that the proliferation of CSCs was promoted. HA
interacts with a specific cell-surface receptor, CD44, which has
been shown to be a marker of 4T1 CSCs and a receptor for HA
[45,46]. In addition, we performed experiments to discover if the
hydrogel with a higher concentration of LMW-HA can further promote CSC proliferation. Specifically, hydrogels with concentrations

of 2%, 2.5%, and 3% were prepared, respectively, and their influences on CSC proliferation and enrichment were examined. The
results showed that the spheroid colony number and the tumor
spheroid size in the hydrogel with higher concentrations of
LMW-HA were much less than those of the control group (Supplementary Fig. 5). Also, we performed experiments to discover if the
high molecular weight (HMW) HA can have the same effect as the
HMW-HA has on the CSC proliferation. For this purpose, hydrogels
with 0.5%, 1%, and 1.5% concentrations of HMW-HA were prepared.
The results showed that the addition of HMW-HA reduced the proliferation of CSCs (Supplementary Fig. 6). Taken together, these
data suggest that LMW-HA is preferred than HMW-HA for use
and that the hydrogel with a concentration of 1.5% LMW-HA is
the best one among those examined, in order to promote the CSC
proliferation.
3.2. Characterization of the stem-like cancer cells that were selected by
the platform we developed
Based on the data obtained from the aforementioned in vitro
tumor spheroid formation experiments, we developed a platform
with the optimal elements and then used it to select CSCs from
4T1 breast cancer cells. We wondered whether the tumor spheroids formed through our platform acquired more efficient tumorigenicity than those cultured on conventional 2D rigid dishes. For

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

Fig. 4. Effect of low-concentration LMW-HA addition on tumorsphere formation. A. A single 4T1 cell grew into tumorspheres in HAalginate hydrogel with the addition of
different concentrations of LMW-HA during the culture course from day 1 to day 7. Scale bar: 50 lm. B. Observation of the cytoskeleton of the multicellular 4T1 tumor
spheroid after 7 days in culture in HAalginate hydrogels with different concentrations of LMW-HA; the multicellular 4T1 tumor spheroid was stained with phalloidin for the
cytoskeleton (red) and DAPI for the nucleus (blue); it was imaged with an inverted fluorescent microscope. Scale bar: 20 lm. The tumorsphere (round colony) number (C), as
well as the colony size of the tumorsphere (D), in different HAalginate hydrogels was quantified from culture day 1 to day 7. The addition of the 1.5% concentration of LMWHA promoted tumor spheroid formation. Mean SD; n = 3 (for the different groups); independent experiments.

this purpose, a single colony was selected from the platform we

developed via pipetting, and 1000 or 2000 of these cells were subcutaneously inoculated to normal Balb/c mice each time. We found
that all mice with 1000 and 2000 injected cells could form subcutaneous tumors. These cells grew rapidly in vivo, with palpable
tumors observed on Day 5 for 2000 injected cells and Day 7 for
1000 injected cells (Supplementary Fig. 7). In contrast, subcutaneously injecting either 1000 or 2000 4T1 breast cancer cells that
were dissociated directly from the conventional 2D rigid dishes
did not form tumors which is consistent with another study showing that the 4T1 cells subcutaneous injection to Balb/c mice cant
form tumors only the cell number is over 104 [47]. This in vivo
tumor formation data suggests that the cells within the spheroids
that formed in the platform may share similar features with stem
cells; and that these cells are also more tumorigenic. To further test
this idea, the tumor spheroids were released from our platform and
their morphology was assessed via SEM. As shown in the SEM
images in Supplementary Fig. 8AC, a condensed cell mass similar
to a neural stem cell mass was formed. As well, the characterization of the HAalginate hydrogel is shown in the SEM images in
Supplementary Fig. 8D; the hydrogel is highly porous and features
an interconnected pore network, which contributes to transporting
nutrients and waste products. Furthermore, we cultured 4T1 cells
in over platform over the course of 7 days and then examined
the RNA isolation of the cells in the formed tumor spheroids.
A panel of stem cell markers (Nestin, Tert, Nanog, and Sox2) and
breast cancer stem cell markers (CD44, CD24, and Sca-1) were
determined by quantitative real-time reverse transcription

(qRT)-PCR. The expression of stem cell markers Nestin, Tert, Nanog,

and Sox2 were upregulated, which was consistent with the expression of 4T1 breast CSC markers CD44 and Sca-1, and which has
been reported by many studies, when compared with the controls
that were cultured in conventional 2D rigid dishes (Fig. 5A and B).
It is known that CSCs showed more drug resistance. To determine
whether the CSCs selected by our platform are more drug resistant,
the MDR1 protein which is responsible for CSC drug resistance
was detected by immunofluorescence analysis (Fig. 6D). The CSCs
from our platform were more drug resistant than the 3D control
and 2D cultured cells. In addition, CD44, CD24, and Dclk1 (which
were found to be markers of tumor stem cells) expression was
determined by immunofluorescence, and the results were consistent with those found for MDR1 (Fig. 5C and E).
3.3. A tentative study of the treatment of CSCs through our platform
In our study, we attempted to demonstrate that our platform
was not only effective for use in CSC isolation, but it could also
be applied in a CSC treatment study. Increasing evidence suggests
that cripto-1 silencing decreases the number of CSCs and limits
tumor growth [4346]. Therefore, we used the cripto-1 antibody
to silence cripto-1 and to perform a tentative study on CSC treatment through our platform. The cripto-1 antibodies were secreted
by the 2B11 hybridoma and were immobilized to our platform
through the method described above. As a control, an irrelevant
antibody was immobilized to our platform. The CSCs that were
selected by our platform were encapsulated in the platform-

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

Fig. 5. Upregulation of cancer and normal stem cell-associated genes in 4T1 spheroid cells cultured in our platform. A. The expression of CSC markers in 4T1 tumor spheroid
cells cultured in our platform and 4T1 cells cultured in 2D rigid dishes was quantified by real-time PCR. B. The expression of stem cell markers in 4T1 tumor spheroid cells
cultured in our platform and 4T1 cells cultured in 2D rigid dishes was quantified by real-time PCR. A total of 58 mice per group; data represent the mean SD of three
independent experiments. C, D and E. Expression of CD44, CD24, MDR1, and Dclk1 by 4T1 tumor spheroids cultured in our platform for 7 days; conventional 3D and 2D
cultured 4T1 cells served as control. Measurements were performed using immunofluorescence.

immobilized cripto-1 antibody and in the platform-immobilized

control antibody, and both were cultured in stem cell medium
for 3 days. Images of live and dead cells are shown in Supplementary Fig. 9, illustrating that more dead cells were found in the
platform-immobilized cripto-1 antibody relative to the control
platform. In addition, the 10002000 CSCs that were selected by
the platform we developed were treated by cripto-1; they were
then sorted out and subcutaneously inoculated to normal Balb/c
mice. In response, no tumors formed in these mice. These results
suggest that the platform we developed can be applicable to the
isolation, study, and treatment of CSCs.

4. Discussion
The establishment of a tunable and universal in vitro platform
for CSC isolation, purification, and research applications remains
challenging in cancer research. Although numerous cell surface
markers have been identified and can be used for the isolation of
CSCs, the use of these surface markers has been controversial,
and their relevance to CSC has not been clear. Analogous to the regulation of NSCs by their niche, CSCs are also believed to reside in
niches [14,48,49]. There is now overwhelming evidence pertaining
to the idea that the niche surrounding CSCs largely governs their
cellular fate and simultaneously supports CSC self-renewal
[15,5051]. Recent work has revealed that 3D culture can maintain
the stemness and enhance the self-renewal of stem cells; additionally, it can promote non-stem cell reprogramming [24,5254].
Non-CSC tumor cells are also part of the CSC niche. Given the similarity of the signaling pathway involved in maintaining the stemness between stem cells and CSCs, we elected to use an alginatebased hydrogel to mimic the ECM of stem cells so as to isolate
poorly-differentiated CSCs. The mechanical properties of the ECM
are important determinants of a stem cells fate, as shown by prior
studies that highlight their effects on CSC proliferation and stemness [22,23]. In our study, alginate was used for preparing hydrogel

due to its nontoxicity and elasticity. There is an interesting phenomenon we noticed during preforming the rheological study, that
is a dramatic difference in the stress relaxation behavior of the
materials was observed. The viscosity of an alginate solution
depends on the concentration of the polymer and the MW distribution. Two G blocks of adjacent polymer chains can be cross-linked
with multivalent cations through interactions with the carboxylic
groups in the sugars, which leads to the formation of a gel network.
The overall gel stiffness depends on the polymer MW distribution
composition (i.e., the M/G ratio), and the stoichiometry of the alginate with the chelating cation. Therefore, we postulate that the big
variation was due to the different composition ratio of M/G in the
alginate by oxidation.
Whats more, compared with other materials, alginate is hard to
be broken down by the enzymes produced by cells. In our previous
study, we have examined the durability of alginate scaffolds with
the results that alginate scaffolds are stable or durable in shape
for one month in the culture medium [55]. Furthermore, most
study were carried out during 1 week, therefore, the durability of
the scaffold is not a big concern in current study. Besides, the alginate does not contains cell receptor, thus minimizing the interference among various factors [56]. We prepared hydrogels from
alginate, with different stiffness by adjusting the concentration of
alginate, and then examined and determined the optimal mechanical properties for CSC screening, by means of 4T1 breast cancer
cells as a model. It is known that the stiffness of stromas (tumors
growths) are typically different; As such, our aim is to discover if
certain mechanical properties can be achieved according to the
various demands of different types of CSC screening by changing
the concentration of the alginate. Serum-free culture is one
method that is often used to isolate CSCs via the addition of EGF
and bFGF [32,33]. To maintain the activity of the factors for isolating CSCs, these factors must be continuously added to the media
used and as a result, this approach is not considered effective.
EGF and bFGF have been found to promote CSC proliferation in
many solid tumors; in fact, these are the factors that are produced

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

by cells in the tumor environment [57]. As the major component of

the CSC niche, numerous cytokines play pivotal roles in CSC selfrenewal and differentiation [58,59]. In our study, the oxidation of
sodium alginate was achieved via synthesis; this process was able
to produce various aldehyde groups, which can form unstable amines found within the free amino groups in the cytokines. Thus, the
unstable amines that were found had covalently linked the cytokines to the alginate polymer chain.
We have demonstrated that the immobilization of EGF and bFGF
to the oxidized alginate can promote CSC proliferation and enrichment. Not only do the mechanical properties of the ECM impact the
proliferation and stemness of CSCs, their extracellular matrix proteins also contribute to this biology. For example, the glycosaminoglycan HA and the membrane-bound form of the cytokine stem cell
factor constitute key components of the CSC niche [60]. HA was
added to the alginate at different concentrations to develop HAalginate hydrogel. Notably, with the addition of HA, the elastic stiffness of the alginate hydrogel did not change much. Our data
showed that the optimal concentration of HA for CSC proliferation
is 1.5%. Although there was no significant difference between the
control group and the 1.5% LMW-HA group in terms of tumor spheroid size (131.3 8.5 lm), the 1.5% LMW-HA group could lead to a
higher spheroid colony number (47 1). Furthermore, the 1.5%
LMW-HA group can significantly up-regulate the expression of
MDR1, which has been proven as CSCs marker by that MDR1 high
expression helps the survival of CD44 high CSC [61].
The objective our study was to identify a suitable material to
support CSC proliferation by developing an easily tunable hydrogel
system. In the present study, our results successfully demonstrated
that culturing the 4T1 breast cancer cells on the alginate-based
tunable platform we developed, which contained optimal elements
of the CSC niche, promoted CSC proliferation. The platform was
able to effectively and efficiently enrich the CSCs, and the stemness
of these CSCs was verified using the gold-standard tumor formation assay, whereby cells are subcutaneously inoculated to normal
Balb/c mice. Only those 4T1 CSCs isolated from our tunable platform grew tumors at low numbers, whereas large numbers of cells
cultured on conventional 2D rigid dishes did not show tumor formation. Additionally, cells cultured on our platform displayed an
increased expression of stem cell-related genes such as Nestin,
Sox2, Tert, Nanog, Sca1, and Dlk1.
For further optimize the efficacy of isolating the CSCs, we did
the combination assessment of different factors, however, no significant differences were observed. Different types of CSCs from
different tissue will suit distinct microenvironment, and in current
study we used breast cancer as a model to explain the usefulness of
the platform. These alginate-based hydrogels were designed to
easily adapt to other types of CSCs, both for CSC isolation and for
research applications. Given the wide range of biological and
mechanical parameters for these hydrogels, it will be possible to
engineer a matrix that promotes additional and specific CSC functions. Therefore, in future study of isolating the patient derived
CSCs, we can quickly design a specific combination for different
types of CSCs by modulating the three critical factors affecting
the efficiency CSCs growth. We anticipate that the platform or similar platforms will significantly enable and facilitate the study of
CSCs, and thus help determine associated clinical outcomes for
cancer therapy.

5. Conclusions
A novel alginate-based platform that features the optimum
stiffness and concentration of HA and immobilized EGF and bFGF
was developed and our results showed that culturing the 4T1
breast cancer cells on the alginate-based tunable platform we

developed promoted CSCs proliferation and enrichment, as exemplified by using 4T1 breast cancer cells. We believe similar platforms can be readily developed for other types of CSCs. Taken
together, the alginate-based tunable platform presented in this
paper is able to offer a simple and efficient means to isolate and
enrich CSCs in vitro, which can help researchers better understand
CSC biology and thus develop more effective therapeutic agents to
treat cancer.
Acknowledgments
This research is supported by the National Natural Science
Foundation of China (Grants 81361128005 and 50903024), the
National Science and Technology Support Program of China (No.
2012 BAI 17B04) and the Fundamental Research Funds for the Central Universities (Grant No. HIT. MKSTISP. 2016 37). Englishlanguage editing of this manuscript was provided by Journal Prep.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.actbio.2016.04.
032.
References
[1] F.M. Kievit, S.J. Florczyk, M.C. Leung, K. Wang, J.D. Wu, J.R. Silber, et al.,
Proliferation and enrichment of CD133(+) glioblastoma cancer stem cells on
3D chitosan-alginate scaffolds, Biomaterials 35 (2014) 91379143.
[2] R. Siegel, J. Ma, Z. Zou, A. Jemal, Cancer statistics, 2014, CA Cancer J. Clin. 64
(2014) 929.
[3] M. Rebucci, C. Michiels, Molecular aspects of cancer cell resistance to
chemotherapy, Biochem. Pharmacol. 85 (2013) 12191226.
[4] J.A. Hickman, R. Graeser, R. de Hoogt, S. Vidic, C. Brito, M. Gutekunst, et al.,
Three-dimensional models of cancer for pharmacology and cancer cell biology:
capturing tumor complexity in vitro/ex vivo, Biotechnol. J. 9 (2014) 1115
1128.
[5] E. Vlashi, F. Pajonk, Cancer stem cells, cancer cell plasticity and radiation
therapy, Semin. Cancer Biol. 31 (2015) 2835.
[6] C.A. OBrien, A. Kreso, C.H.M. Jamieson, Cancer stem cells and self-renewal,
Clin. Cancer Res. 16 (2010) 31133120.
[7] B.S. Zhou, H. Zhang, M. Damelin, K.G. Geles, J.C. Grindley, P.B. Dirks, Tumourinitiating cells: challenges and opportunities for anticancer drug discovery,
Nat. Rev. Drug Discovery 8 (2009) 806823.
[8] P. Dalerba, R.W. Cho, M.F. Clarke, Cancer stem cells: models and concepts,
Annu. Rev. Med. 58 (2007) 267284.
[9] B.M. Boman, M.S. Wicha, Cancer stem cells: a step toward the cure, J. Clin.
Oncol. 26 (2008) 27952799.
[10] T. Lapidot, C. Sirard, J. Vormoor, B. Murdoch, T. Hoang, J. Caceres-Cortes, et al.,
A cell initiating human acute myeloid leukaemia after transplantation into
SCID mice, Nature 367 (1994) 645648.
[11] S.E. Kelly, A. Di Benedetto, A. Greco, C.M. Howard, V.E. Sollars, D.A. Primerano,
et al., Rapid selection and proliferation of CD133(+) cells from cancer cell lines:
chemotherapeutic implications, PLoS ONE 5 (2010) e10035.
[12] J. Lee, S. Kotliarova, Y. Kotliarov, A. Li, Q. Su, N.M. Donin, et al., Tumor stem
cells derived from glioblastomas cultured in bFGF and EGF more closely mirror
the phenotype and genotype of primary tumors than do serum-cultured cell
lines, Cancer Cell 9 (2006) 391403.
[13] L. Li, W.B. Neaves, Normal stem cells and cancer stem cells: the niche matters,
Cancer Res. 66 (2006) 45534557.
[14] D. Boral, D. Nie, Cancer stem cells and niche mircoenvironments, Front. Biosci.
(Elite Ed) 4 (2012) 25022514.
[15] V. Plaks, N. Kong, Z. Werb, The cancer stem cell niche: how essential is the
niche in regulating stemness of tumor cells?, Cell Stem Cell 16 (2015) 225238
[16] F. Gattazzo, A. Urciuolo, P. Bonaldo, Extracellular matrix: a dynamic
microenvironment for stem cell niche, Biochim. Biophys. Acta 2014 (1840)
25062519.
[17] A.J. Engler, H.L. Sweeney, D.E. Discher, J.E. Schwarzbauer, Extracellular matrix
elasticity directs stem cell differentiation, J. Musculoskelet. Neuronal Interact.
7 (2007) 335.
[18] F. Chowdhury, S. Na, D. Li, Y.C. Poh, T.S. Tanaka, F. Wang, N. Wang, Material
properties of the cell dictate stress-induced spreading and differentiation in
embryonic stem cells, Nat. Mater. 9 (2010) 8288.
[19] J. Kshitiz, P. Park, W. Kim, A.J. Helen, A. Engler, Levchenko, D.H. Kim, Control of
stem cell fate and function by engineering physical microenvironments,
Integr. Biol. (Camb) 4 (2012) 10081018.
[20] O. Chaudhuri, S.T. Koshy, D.C.C. Branco, J.W. Shin, C.S. Verbeke, K.H. Allison,
et al., Extracellular matrix stiffness and composition jointly regulate the

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032

10

[21]

[22]
[23]

[24]
[25]

[26]
[27]

[28]
[29]
[30]
[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

S.-p. Qiao et al. / Acta Biomaterialia xxx (2016) xxxxxx

induction of malignant phenotypes in mammary epithelium, Nat. Mater. 13
(2014) 970978.
S. Han, K. Yang, Y. Shin, J.S. Lee, R.D. Kamm, S. Chung, et al., Three-dimensional
extracellular matrix-mediated neural stem cell differentiation in a microfluidic
device, Lab Chip 12 (2012) 23052308.
J. Liu, Y. Tan, H. Zhang, Y. Zhang, P. Xu, J. Chen, et al., Soft fibrin gels promote
selection and growth of tumorigenic cells, Nat. Mater. 11 (2012) 734741.
X. Yang, S.K. Sarvestani, S. Moeinzadeh, X. He, E. Jabbari, Three-dimensionalengineered matrix to study cancer stem cells and tumorsphere formation:
effect of matrix modulus, Tissue Eng. Part A 19 (2013) 669684.
J. Han, L. Chen, G. Luo, B. Dai, X. Wang, J. Dai, Three-dimensional culture may
promote cell reprogramming, Organogenesis 9 (2013) 118120.
S.J. Florczyk, K. Wang, S. Jana, D.L. Wood, S.K. Sytsma, J.G. Sham, F.M. Kievit,
et al., Porous chitosan-hyaluronic acid scaffolds as a mimic of glioblastoma
microenvironment ECM, Biomaterials 34 (2013) 1014310150.
D.N. Haylock, S.K. Nilsson, Stem cell regulation by the hematopoietic stem cell
niche, Cell Cycle 4 (2005) 13531355.
A. Pietras, A.M. Katz, E.J. Ekstrom, B. Wee, J.J. Halliday, K.L. Pitter, et al.,
Osteopontin-CD44 signaling in the glioma perivascular niche enhances cancer
stem cell phenotypes and promotes aggressive tumor growth, Cell Stem Cell
14 (2014) 357369.
B.P. Toole, T.N. Wight, M.I. Tammi, Hyaluronan-cell interactions in cancer and
vascular disease, J. Biol. Chem. 277 (2002) 45934596.
R.K. Sironen, M. Tammi, R. Tammi, P.K. Auvinen, M. Anttila, V.M. Kosma,
Hyaluronan in human malignancies, Exp. Cell Res. 317 (2011) 383391.
C. Aguilar-Gallardo, C. Simon, Cells, stem cells, and cancer stem cells, Semin.
Reprod. Med. 31 (2013) 513.
D.J. Martens, V. Tropepe, D. van Der Kooy, Separate proliferation kinetics of
fibroblast growth factor-responsive and epidermal growth factor-responsive
neural stem cells within the embryonic forebrain germinal zone, J. Neurosci.
20 (2000) 10851095.
Z. Pan, J. Hooley, D.H. Smith, P. Young, P.E. Roberts, J.P. Mather, Establishment
of human ovarian serous carcinomas cell lines in serum free media, Methods
56 (2012) 432439.
H. Matilainen, X.W. Yu, C.W. Tang, M.V. Berridge, M.J. McConnell, Sphere
formation reverses the metastatic and cancer stem cell phenotype of the
murine mammary tumour 4T1, independently of the putative cancer stem cell
marker Sca-1, Cancer Lett. 323 (2012) 2028.
C.A. Lopez, L. Deladino, M. Martino, Effect of starch filler on calcium-alginate
hydrogels loaded with yerba mate antioxidants, Carbohydr. Polym. 95 (2013)
315323.
L.B. Priddy, O. Chaudhuri, H.Y. Stevens, L. Krishnan, B.A. Uhrig, N.J. Willett, R.E.
Guldberg, Oxidized alginate hydrogels for bone morphogenetic protein-2
delivery in long bone defects, Acta Biomater. 10 (2014) 43904399.
X. Bai, R. Fang, S. Zhang, X. Shi, Z. Wang, X. Chen, et al., Self-cross-linkable
hydrogels composed of partially oxidized alginate and gelatin for myocardial
infarction repair, J. Bioactive Compat. Polym. 28 (2013) 126140.
S. Naito, A.C. von Eschenbach, R. Giavazzi, I.J. Fidler, Growth and metastasis of
tumor cells isolated from a human renal cell carcinoma implanted into
different organs of nude mice, Cancer Res. 46 (1986) 41094115.
S. Matsuda, T. Yan, A. Mizutani, T. Sota, Y. Hiramoto, M. Prieto-Vila, et al.,
Cancer stem cells maintain a hierarchy of differentiation by creating their
niche, Int. J. Cancer 135 (2014) 2736.
F. Chowdhury, Y. Li, Y.C. Poh, T. Yokohama-Tamaki, N. Wang, T.S. Tanaka, Soft
substrates promote homogeneous self-renewal of embryonic stem cells via
downregulating cell-matrix tractions, PLoS ONE 5 (2010) e15655.
K. Ye, X. Wang, L. Cao, S. Li, Z. Li, L. Yu, et al., Matrix stiffness and nanoscale
spatial organization of cell-adhesive ligands direct stem cell fate, Nano Lett. 15
(2015) 47204729.
Y. Navaro, N. Bleich-Kimelman, L. Hazanov, I. Mironi-Harpaz, Y. Shachaf, S.
Garty, et al., Matrix stiffness determines the fate of nucleus pulposus-derived
stem cells, Biomaterials 49 (2015) 6876.

[42] T. Pompe, K. Salchert, K. Alberti, P. Zandstra, C. Werner, Immobilization of

growth factors on solid supports for the modulation of stem cell fate, Nat.
Protoc. 5 (2010) 10421050.
[43] P.Y. Chen, L.L. Huang, H.J. Hsieh, Hyaluronan preserves the proliferation and
differentiation potentials of long-term cultured murine adipose-derived
stromal cells, Biochem. Biophys. Res. Commun. 360 (2007) 16.
[44] M.A. Solis, Y.H. Chen, T.Y. Wong, V.Z. Bittencourt, Y.C. Lin, L.L. Huang,
Hyaluronan regulates cell behavior: a potential niche matrix for stem cells,
Biochem. Res. Int. 2012 (2012) 346972.
[45] L.Y. Bourguignon, K. Peyrollier, W. Xia, E. Gilad, Hyaluronan-CD44 interaction
activates stem cell marker Nanog, Stat-3-mediated MDR1 gene expression,
and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells, J.
Biol. Chem. 283 (2008) 1763517651.
[46] S. Ricardo, A.F. Vieira, R. Gerhard, D. Leitao, R. Pinto, J.F. Cameselle-Teijeiro,
et al., Breast cancer stem cell markers CD44, CD24 and ALDH1: expression
distribution within intrinsic molecular subtype, J. Clin. Pathol. 64 (2011) 937
946.
[47] B.A. Pulaski, S. Ostrand-Rosenberg, Mouse 4T1 breast tumor model, Curr.
Protoc. Immunol. (2001). Chapter 20, Unit 20.2.
[48] V. Silva-Vargas, E.E. Crouch, F. Doetsch, Adult neural stem cells and their niche:
a dynamic duo during homeostasis, regeneration, and aging, Curr. Opin.
Neurobiol. 23 (2013) 935942.
[49] J. Voog, D.L. Jones, Stem cells and the niche: a dynamic duo, Cell Stem Cell 6
(2010) 103115.
[50] E. Fuchs, T. Tumbar, G. Guasch, Socializing with the neighbors: stem cells and
their niche, Cell 116 (2004) 769778.
[51] T. Xie, L. Li, Stem cells and their niche: an inseparable relationship,
Development 134 (2007) 20012006.
[52] Y. Li, G. Guo, L. Li, F. Chen, J. Bao, Y.J. Shi, et al., Three-dimensional spheroid
culture of human umbilical cord mesenchymal stem cells promotes cell yield
and stemness maintenance, Cell Tissue Res. 360 (2015) 297307.
[53] J. Wei, J. Han, Y. Zhao, Y. Cui, B. Wang, Z. Xiao, et al., The importance of threedimensional scaffold structure on stemness maintenance of mouse embryonic
stem cells, Biomaterials 35 (2014) 77247733.
[54] S. Han, Y. Zhao, Z. Xiao, J. Han, B. Chen, L. Chen, et al., The three-dimensional
collagen scaffold improves the stemness of rat bone marrow mesenchymal
stem cells, J. Genet. Genomics 39 (2012) 633641.
[55] H. Zheng, S. Liu, W. Tian, H. Yan, Y. Zhang, Y. Li, A three-dimensional in vitro
culture model for primary neonatal rat ventricular myocytes, Curr. Appl. Phys.
12 (2012) 826833.
[56] A.D. Augst, H.J. Kong, D.J. Mooney, Alginate hydrogels as biomaterials,
Macromol. Biosci. 6 (2006) 623633.
[57] Y. Feng, X. Dai, X. Li, H. Wang, J. Liu, J. Zhang, et al., EGF signalling pathway
regulates colon cancer stem cell proliferation and apoptosis, Cell Prolif. 45
(2012) 413419.
[58] Y. Ma, D. Liang, J. Liu, K. Axcrona, G. Kvalheim, K.E. Giercksky, J.M. Nesland,
et al., Synergistic effect of SCF and G-CSF on stem-like properties in prostate
cancer cell lines, Tumour Biol. 33 (2012) 967978.
[59] C. Ginestier, S. Liu, M.E. Diebel, H. Korkaya, M. Luo, M. Brown, et al., CXCR1
blockade selectively targets human breast cancer stem cells in vitro and in
xenografts, J. Clin. Invest. 120 (2010) 485497.
[60] R.L. Driessen, H.M. Johnston, S.K. Nilsson, Membrane-bound stem cell factor is
a key regulator in the initial lodgment of stem cells within the endosteal
marrow region, Exp. Hematol. 31 (2003) 12841291.
[61] Y. Miyatake, N. Sheehy, S. Ikeshita, W.W. Hall, M. Kasahara, Anchoragedependent multicellular aggregate formation induces CD44 high cancer stem
cell-like ATL cells in an NF-kappaB- and vimentin-dependent manner, Cancer
Lett. 357 (2015) 355363.

Please cite this article in press as: S.-p. Qiao et al., An alginate-based platform for cancer stem cell research, Acta Biomater. (2016), http://dx.doi.org/
10.1016/j.actbio.2016.04.032