Nutrition 32 (2016) 486490

Contents lists available at ScienceDirect

Nutrition
journal homepage: www.nutritionjrnl.com

Basic nutritional investigation

Kafr lime leaves extract inhibits biolm formation

by Streptococcus mutans
Nateelak Kooltheat M.Sc. a, Ludthawun Kamuthachad B.Sc. a,
Methinee Anthapanya B.Sc. a, Natthapon Samakchan B.Sc. a,
Rungnapa Pankla Sranujit Ph.D. a, b, Pachuen Potup Ph.D. a, Antonio Ferrante Ph.D. c,
Kanchana Usuwanthim Ph.D. a, *
a

Cellular and Molecular Immunology Research Unit, Faculty of Allied Health Sciences, Naresuan University, Phitsanulok, Thailand
Thai Traditional Medicine College, Rajamangala University of Technology Thanyaburi, Pathum Thani, Thailand
c
Department of Immunopathology, SA Pathology at Womens and Childrens Hospital, Robinson Research Institute, University of Adelaide, South
Australia
b

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 6 May 2015
Accepted 12 October 2015

Objectives: Although kafr lime has been reported to exhibit antioxidant and antileukemic activity,
little is known about the antimicrobial effect of kafr lime extract. Because Streptococcus mutans
has been known to cause biolm formation, it has been considered the most important causative
pathogen of dental caries. Thus, the effective control of its effects on the oral biolm is the key to
the prevention of dental caries. The aims of the present study were to investigate the effect of kafr
lime leaves extract on biolm formation and its antibacterial activity on S. mutans.
Methods: We examined the effect of kafr lime leaves extract on growth and biolm formation of S.
mutans. For the investigation we used a kafr lime extract with high phenolic content. The minimum inhibitory concentration of the extract was determined by broth microdilution assay. The
inhibitory effect of the test substances on biolm formation was also investigated by biolm formation assay and qRT-PCR of biolm formationassociated genes.
Results: Kafr lime leaves extract inhibits the growth of S. mutans, corresponding to the activity of
an antibiotic, ampicillin. Formation of biolm by S. mutans was also inhibited by the extract. These
results were conrmed by the down-regulation of genes associated with the biolm formation.
Conclusions: The ndings highlight the ability of kafr lime leaves extract to inhibit S. mutans
activity, which may be benecial in the prevention of biolm formation on dental surface, reducing
dental plaque and decreasing the chance of dental carries.
2016 Elsevier Inc. All rights reserved.

Keywords:
Kafr lime
Biolm formation
Streptococcus mutans
Minimum inhibitory concentration

Introduction
Biolm formation by Streptococcus mutans, a gram-positive
bacterium, on tooth enamel is the foremost cause of dental
plaque and dental carries [1,2]. S. mutans has the ability to use
sucrose from consumed food as a biolm-forming factor. Many
enzymes are involved in the biolm formed by S. mutans. This
includes sucrose phosphorylase, glucosyltransferase, and

This work was supported by Naresuan University (R2556 C074) and the National Research Council of Thailand (R2557 B035).
Conicts of interest: The authors declare no conicts of interest.
* Corresponding author. Tel.: 66 5596 6411; fax: 66 5596 6234.
E-mail address: ajkarn_9@hotmail.com (K. Usuwanthim).
http://dx.doi.org/10.1016/j.nut.2015.10.010
0899-9007/ 2016 Elsevier Inc. All rights reserved.

fructosyltransferase. These enzymes can use sucrose to synthesize water-insoluble glucan and fructan for the adherence and
formation of biolm by S. mutans [3]. S. mutans in the oral cavity
is the main cariogenic agent. The bacterium synthesizes an
insoluble glucan layer, involving glucosyltransferase (GTFase),
which accumulates in dental plaque and promotes formation of
dental caries. The virulence factors of S. mutans associated with
cariogenicity are a set of gtf genes. GTFase synthesizes glucan
polymers from sucrose that provide binding sites for bacterial
adhesion on the tooth surface and contribute to the formation of
dental plaque [2].
The use of biolm inhibitors such as sodium uoride against
S. mutans can effectively prevent the formation of its biolm [4],
but high levels of sodium uoride can be toxic. Some new agents

N. Kooltheat et al. / Nutrition 32 (2016) 486490

have been of interest because of their ability to inhibit biolm

formation of periodontal pathogens, for example, the use of
oxantel for the disruption of polymicrobial biolm [5] or the use
of the antimicrobial peptide Bac8c to control the formation of
biolm [6]. The use of natural products has also been proposed
for inhibition of biolm formation, such as extracts of Aralia
continentalis (spikenard), Camellia sinensis (tea), and Curcuma
longa (turmeric) [79].
Kafr lime (Citrus hystrix), a plant belonging to the citrus
family, is primarily grown in South Asia and Southeast Asia.
Kafr lime leaves and fruit have been used for cooking and
traditional medicine. Kafr lime leaves contain various classes of
phytochemical substances, including terpenoids [10]. Extract of
kafr lime leaves displays antioxidant, antimicrobial, antiinammatory, and antiproliferative activity against cancer cells
[11]. The aims of the present study were to investigate the effect
of kafr lime leaves extract on biolm formation and its antibacterial activity on S. mutans, with the objective of providing an
alternative approach to prevent biolm formation by S. mutans.
Materials and methods
Preparation of kafr lime leaves extract
Fresh leaves of kafr lime were collected in Phitsanulok, Thailand. An extract
of the leaves was prepared with a modication of the method from Agwaramgbo
et al. [12]. One hundred grams of fresh kafr lime leaves was homogenized with
sterile deionized water at the proportion of 1:5. The extract was then ltered to
remove the residue, and centrifuged at 3000  g for 15 min. The supernatant was
collected, lyophilized using a freeze dryer (Thermo Fisher Scientic Inc., MA,
USA), and stored at 20 C in an airtight container.
Determination of total phenolic content
The total phenolic content of the kafr lime leaves extract was measured
using the Folin-Ciocalteu method, modied from Chang et al. [13]. The extract
was dissolved in deionized water to a concentration of 100 mg/mL. Using a 96well plate, 2.5 mL of the extract was diluted with 100 mL of deionized water,
and 25 mL of the Folin-Ciocalteu reagent was added. After 5 min of incubation at
room temperature, 100 mL of 2% sodium carbonate solution was added and then
the mixture was incubated for 60 min at 50 C. The absorbance of the reaction was
measured at 750 nm using a microplate reader (PerkinElmer Inc., Waltham, MA,
USA). Total phenolic content was then determined as mg Pyrogallol equivalent/g
of the extract.

Bacterial strain and growth conditions

S. mutans ATCC 25175 (Department of Medical Sciences, Ministry of Public
Health, Thailand) was used in this study. S. mutans was grown onto the brainheart infusion (BHI) agar plate (HiMedia Laboratories, Mumbai, India) after
incubation at 37 C with 5% CO2 for 24 h. A single isolated colony was then harvested, and cultured in 3 mL of BHI broth under the same conditions. When the
bacteria reached log-phase growth, the number of bacteria was estimated by
optical density reading at 600 nm using a microplate reader (PerkinElmer Inc.).
The concentration of bacteria was adjusted with BHI broth before use in
experiments.

487

Determination of minimum inhibitory concentrations

The broth dilution antimicrobial test was performed according to the standard guidelines [14]. Twofold serial dilution of test substances was prepared,
including 0.24 to 500 mg/mL of ampicillin sodium, 0.49 to 1000 mg/mL of sodium
uoride, and 12.21 to 250 000 mg/mL of kafr lime leaves extract. Using a 96-well
plate, 50 mL of each concentration of the diluted substances was added into
1  105 cfu/mL of S. mutans. After 24 h of incubation at 37 C with 5% CO2, the
absorbance of the samples was measured at 600 nm using the microplate reader.
The minimum inhibitory concentration (MIC) was dened as the rst concentration of test substances that can inhibit bacterial growth. Percentage of growth
inhibition was calculated relative to the untreated control.
Biolm formation assay
Inhibitory activity of kafr lime leaves extract on the biolm formation of S.
mutans was examined along with a gram-positive antibiotic, ampicillin, and a
biolm inhibitor, sodium uoride. Using 24-well plates, planktonic culture of S.
mutans in MHI broth containing 0.1% sucrose was plated at the concentration of
5  105 cfu/mL in either the presence or absence of the test substances. After 24 h
of incubation at 37 C with 5% CO2, planktonic cells and culture media were
removed [7]. The plate was washed twice with 500 mL of PBS and taped on a
paper towel to remove excess buffer. Biolm-forming cells were stained with
100 mL/well of 0.1% crystal violet for 15 min. Then the staining solution was
discarded, and the plate was washed twice with 500 mL of PBS and air-dried. Then
100 mL/well of acid-alcohol solution was added to dissolve the crystal violet dye
from stained cells. Absorbance of each well was measured at 550 nm using the
microplate reader, and the degree of biolm formation was determined [15].
Bacterial RNA extraction
Total RNA from S. mutans of each condition was extracted using TRIzol reagent, according to protocol described by the manufacturer (Life Technologies
Corporation, Grand Island, NY, USA). Bacterial cells from each experimental
condition were lysed using 1.5 mL of TRIzol reagent with several times of updown pipetting after incubation at room temperature for 5 min. For phase separation, 300 mL of chloroform was added to the sample tubes. After vigorously
mixing, samples were separated into aqueous colorless and organic fractions.
Then tubes were centrifuged at 12 000  g for 15 min, and the aqueous phase was
transferred to a new tube. This was mixed with 750 mL of isopropanol, followed
by centrifugation at 12 000  g for 10 min at 4 C. The precipitated RNA pellets
were collected, washed once with 1.5 mL of 75% ethanol, vortex mixed, and
centrifuged at 7500  g for 5 min at 4 C. Finally, the RNA was resuspended in
ribonucleases-free water. Total RNA of each sample was quantied by measuring
absorbance at 260 and 280 nm using a NanoDrop ND-1000 spectrophotometer
(Thermo Fisher Scientic Inc.).
Gene expression analysis
Expression of genes associated with biolm formation of S. mutans was
analyzed by one-step qRT-PCR assay using EXPRESS One-Step SYBR GreenER kits
according to the protocol described by the manufacturer (Life Technologies
Corporation). RNAs of bacterial conditions were converted to their complementary DNAs by reverse transcription followed by real-time PCR, along with
quantitation of biolm formationassociated genes using 16s rRNA as qPCR
signal normalization. Briey, 20 mL of reaction contains 10 mL of EXPRESS SuperScript qPCR SuperMix, 0.4 mL of 10 mmol/L forward primer, 0.4 mL of 10 mmol/
L reverse primer as shown in Table 1 [16,17], 5 mL of 1 ng/mL of template RNA,
0.5 mL of EXPRESS SuperScript Mix for One-Step qPCR, and 4.7 mL of RNase-free
water. With CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., USA), qRT-PCR started with the cDNA synthesis at 50 C for 5 min
followed by the denaturation of template cDNA at 95 C for 2 min. For the

Table 1
Oligonucleotide primers used in this study
Gene

Forward primer (50 / 30 )

Reverse primer (50 / 30 )

Sucrose phosphorylase (gtfA)

Glucosyltransferase B (gtfB)
Glucosyltransferase-I (gtfD)
Histidine kinase two-component regulatory system (vicR)
Competence-stimulating system (comDE)
Fructosyltransferase (ftf)
Guanosine tetra (penta)-phosphatesynthetase (relA)
Biolm-regulation protein (brpA)
16 S ribosomal RNA, normalizing internal standard (16s rRNA)

AGGAAGTGAAGCGGCCAGT
AGCAATGCAGCCAATCTACAAAT
ACAGCAGACAGCAGCCAAGA
TGACACGATTACAGCCTTTGATG
ACAATTCCTTGAGTTCCATCCAAG
AAATATGAAGGCGGCTACAACG
ACAAAAAGGGTATCGTCCGTACAT
GGAGGAGCTGCATCAGGATTC
CCTACGGGAGGCAGCAGTAG

TCAATACGGCCATCCAAATCA
ACGAACTTTGCCGTTATTGTCA
ACTGGGTTTGCTGCGTTTG
CGTCTAGTTCTGGTAACATTAAGTCCAATA
TGGTCTGCTGCCTGTTGC
CTTCACCAGTCTTAGCATCCTGAA
AATCACGCTTGGTATTGCTAATTG
AACTCCAGCACATCCAGCAAG
CAACAGAGCTTTACGATCCGAAA

488

N. Kooltheat et al. / Nutrition 32 (2016) 486490

B
MIC

60

40

Ampicillin
Sodium Fluoride

80
60
40
20
0

Kaffir Lime

20

100

on
tr
ol
l
g
A
m
/m
p
lS
ic
ill
od
in
iu
12
m
50
Fl
0
uo
g
r id
/m
e
lK
af
fir
Li
m
e

MIC

10

100

1000

10000

100000

/m

25
0

0
0.1

nt
re
at
ed

Percentage of Growth Inhibition

MIC
80

ns

120

Percentage of Growth Inhibition

100

50
0

Substance Concentration ( g/ml)

Fig. 1. Minimum inhibitory concentration (MIC) and percentage of growth inhibition against Streptococcus mutans of ampicillin sodium, sodium uoride, and kafr lime
leaves extract, as determined by the broth microdilution method. Results were calculated from triplicate data representing three independent experiments, presented as
mean  SEM. Statistical analyses: *P < 0.01 by ANOVA, compared with non-treated control. ns, not signicant.

BIC

40

20

0
0.1

10

100

1000

10000

100000

Substance Concentration ( g/ml)

ns

100

80

40
20

25
00

62
50

lS

/m

Fl

ci
pi
m

od
iu
m

lA

ea
te
d

uo
r id
e
lK
af
fe
rL
im
e

lli
n

nt
r
U

60

Inhibition of biolm formation

Inhibitory activity on bacterial biolm was assessed by
biolm formation assay using S. mutans in MHI broth culture
supplemented with 0.1% sucrose. Ampicillin sodium, sodium
uoride, and kafr lime leaves extract were used in the study
for inhibitory activity. The result showed that the MIC was
62.50 mg/mL for ampicillin sodium, 500 mg/mL for sodium
uoride, and 62 500 mg/mL for kafr lime leaves extract

BIC

60

/m

MIC was determined by the broth microdilution method using 1  105 cfu/mL of S. mutans. The result showed that 250 mg/
mL of ampicillin sodium, 500 mg/mL of sodium uoride, and 125
000 mg/mL of kafr lime leaves extract inhibited the growth of S.
mutans (Fig. 1A). Percentages of inhibition at the MIC of substances are shown in Figure 1B.

BIC

Minimum inhibitory concentration

Kaffir Lime
80

/m

One hundred grams of fresh kafr lime leaves was extracted

with deionized water, and 7.35 g was recovered in the aqueous
fraction. The total phenolic content of the extract was
52.45  0.41 mg Pyrogallol equivalent/g of dry extract. The total
phenolic content of the extract was determined by the FolinCiocalteu method.

Sodium Fluoride

on
tr
ol

Kafr lime leaves extract

Ampicillin

Results

100

62
.5

All experiment conditions were performed in triplicate and three independent sets of experiment were conducted. All the values are expressed as
mean  SEM. Results were statistically analyzed for their signicance using
GraphPad Prism (GraphPad Software, Inc., La Jolla, CA, USA) with a condence
interval of 99% (P 0.01). One-way ANOVA was used for data comparison between experimental conditions.

Percentage of Biofilm Inhibition

Experimental design and statistical analysis

(Fig. 2A). The percentages of inhibition of these MIC concentrations are shown in Figure 2B.

Percentage of Biofilm Inhibition

amplication of the DNA, 40 cycles of denaturation at 95 C for 15 s and

annealing-polymerization at 60 C for 1 min were performed. Cycle threshold (CT)
of the reaction was measured by detecting the uorescence intensity of SYBR
Green dye at the end of polymerization steps. Gene expression was analyzed by
normalized gene expression using the 2DDCT method [18].

Fig. 2. Biolm inhibitory concentration (BIC) and percentage of biolm inhibition of

ampicillin sodium, sodium uoride, and kafr lime leaves extract, as determined by
biolm formation assay. Results were calculated from triplicate data representing
three independent experiments, presented as mean  SEM. Statistical analyses:
*
P < 0.01 by ANOVA, compared with non-stimulated control. ns, not signicant.

N. Kooltheat et al. / Nutrition 32 (2016) 486490

1.2

Control

62.50 g/m l Am picillin

489

500 g/m l Sodium Fluoride

6250 g/m l Kaffer Lim e Extract

Expression Fold Change, Relative to Control

*
1.0

*
0.8

0.6

0.4

0.2

* *

**

**

*
**

0.0
gtfA

gtfB

gtfD

vicR

comDE

ftf

relA

brpA

Fig. 3. Expression of genes associated with biolm formation of S. mutans as determined by qRT-PCR. Results were from triplicates, representing three independent experiments. *P < 0.01 by ANOVA, compared with non-treated control.

Gene expression analysis

Expression of genes associated with biolm formation of S.
mutans was determined by one-step qRT-PCR. Expression of
genes, including gtfA, gtfB, gtfD, vicR, comDE, ftf, RelA, and brpA,
was signicantly down regulated (P < 0.01) in S. mutans that had
been treated with ampicillin sodium, sodium uoride, or kafr
lime leaves extract. The expression of gtf genes after kafr lime
treatment was of the order of vefold relative to the untreated
control, and this effect was comparable to that of both ampicillin
sodium and sodium uoride. There was a similar inhibition of
other genes by all substances (Fig. 3).
Discussion
Although antibiotics play a major role in combating many
bacterial infections, the increasing emergence of antibioticresistant strains presents a major burden to the community.
Ampicillin can kill S. mutans by inhibited bacterial cell wall
synthesis. Using biolm inhibitors such as sodium uoride
against S. mutans can prevent the formation of biolm, but high
levels of sodium uoride can be toxic and cause skeletal uorosis. This has generated interest in the development of alternative antimicrobial agents. Kafr lime is a naturally occurring
polyphenolic compound that is an alternative antimicrobial.
Polyphenol can interact with microbial membrane proteins,
enzymes, and lipids altering cell permeability and cause loss of
protons, ions, and macromolecules [19]. Moreover, phenolic
compounds can inhibit bacterial adherence to the tooth surface
by reducing hydrophobicity and inhibition of glucosyltransferase
[20]. Here we demonstrate that fresh kafr lime leave extract
with high phenolic content inhibited the growth and biolm
formation of S. mutans, a bacterium responsible for dental caries.
A marked decrease in bacterium-induced bioim formations by
kafr lime leave extract was seen at a twofold lower concentration of the bacterial growth MIC. The result suggests that
antimicrobial activity of kafr lime leave extract has potential
clinical application for preventing and treating dental caries.

To determine the effect of kafr lime leave extract on bacterial

virulence gene expression, qRT-PCR was performed to evaluate
the inuence of the extract on the genes related to biolm formation of S. mutans. The results showed that the expression of
gtfA, gtfB, gtfD, ftf, vicR, relA, brpA, and comDE was down regulated by kafr lime leave extract. This result indicates that the
extract can inhibit biolm formation by S. mutans through the
inhibition of virulence factors.
Among numerous virulence factors, the gtfA gene, a sucrose
phosphorylase gene, was down regulated by kafr lime leave
extract, which is likely to cause reduced use of sucrose for
production of extracellular glucan and fructan polysaccharide
in biolm formation by S. mutans [17]. Glucosyltransferaseencoding genes, gtfB and gtfD, as well as fructosyltransferaseencoding genes, ftf gene families, were down regulated. This
would affect the ability of S. mutans to produce a-1,3-linked,
a-1,6-linked glucans and fructan from sucrose. These results
indicate that kafr lime leave extract can reduce the extracellular polysaccharide matrix necessary for biolm formation
[16,21].
The vicR gene, a regulatory gene of the gtf gene family, was
also down regulated, resulting in the inhibition of biolm formation [7]. Similarly, relA, a gene associated with the physiology
of the bacteria, was also depressed. Lastly, brpA, a regulatory
gene responsible for sucrose-dependent biolm formation, and
comDE, a gene that encodes the quorum-sensing cascade-associated competence-stimulating peptides, were also down regulated. These results indicated that the inhibition of the biolm
formation of S. mutans by the extract was through the regulatory
genes and the quorum-sensing cascade [16]. Thus, kafr lime
leaves extract contains naturally occurring substances with an
antibiolm formation activity. Our data suggest that the kafr
lime extract, most likely through its high phenolic content,
prevents bioim formation of S. mutans by two mechanisms:
rst, by a direct antimicrobial effect and, second, by inhibiting
bacterial gtf genes, such as GTFase required for the glucan layer
formation, which promotes bacterial accumulation to dental
plaque and cariogenicity.

490

N. Kooltheat et al. / Nutrition 32 (2016) 486490

Kafr lime, a citrus fruit, has been widely used for daily
cooking in South Asia and Southeast Asia, especially in Thai and
Malaysian recipes such as soups and curries. Our ndings suggest that kafr lime leaves have high phenolic content, which
acts as an antimicrobial substance and inhibits biolm formation. Thus, kafr lime leaves may be used as an alternative
treatment for biolm formation on dental surface to reduce
dental plaque and decrease the chance of dental carries. However, the use of kafr lime leaves extract may change the bacterial ora, and the consequence of this will need to be
considered.
Conclusions
The ndings reveal the inhibitory activity of kafr lime leaves
extract on growth and biolm formation of S. mutans. This is the
rst demonstration that a phenolic-rich kafr lime leaves extract
inhibits GTFase-encoding genes, virulence factors, and regulatory genes vicR, relA, brpA, and comDE associated with biolm
formation and physiology of S. mutans.
References
[1] Li MY, Huang RJ, Zhou XD, Gregory RL. Role of sortase in Streptococcus
mutans under the effect of nicotine. Int J Oral Sci 2013;5:20611.
[2] Zhao W, Li W, Lin J, Chen Z, Yu D. Effect of sucrose concentration on
sucrose-dependent adhesion and glucosyltransferase expression of S.
mutans in children with severe early-childhood caries (S-ECC). Nutrients
2014;6:357286.
[3] Bitoun JP, Nguyen AH, Fan Y, Burne RA, Wen ZT. Transcriptional repressor
Rex is involved in regulation of oxidative stress response and biolm formation by Streptococcus mutans. FEMS Microbiol Lett 2011;320:1107.
[4] Pandit S, Kim HJ, Song KY, Jeon JG. Relationship between uoride concentration and activity against virulence factors and viability of a cariogenic biolm: in vitro study. Caries Res 2013;47:53947.
[5] Dashper S, OBrien-Simpson N, Liu SW, Paolini R, Mitchell H, Walsh K, et al.
Oxantel disrupts polymicrobial biolm development of periodontal pathogens. Antimicrob Agents Chemother 2014;58:37885.

[6] Ding Y, Wang W, Fan M, Tong Z, Kuang R, Jiang W, et al. Antimicrobial and
anti-biolm effect of Bac8 c on major bacteria associated with dental caries
and Streptococcus mutans biolms. Peptides 2013;52C:617.
[7] Jeong SI, Kim BS, Keum KS, Lee KH, Kang SY, Park BI, et al. Kaurenoic acid
from Aralia continentalis inhibits biolm formation of Streptococcus mutans.
Evid Based Complement Alternat Med 2013;2013:160592.
[8] Wang Y, Lee SM, Dykes GA. Potential mechanisms for the effects of tea
extracts on the attachment, biolm formation and cell size of Streptococcus
mutans. Biofouling 2013;29:30718.
[9] Hu P, Huang P, Chen MW. Curcumin reduces Streptococcus mutans biolm
formation by inhibiting sortase A activity. Arch Oral Biol 2013;58:13438.
[10] Norkaew O, Pitija K, Pripdeevech P, Sookwong P, Wo S. Supercritical uid
extraction and gas chromatographic-mass spectrometric analysis of terpenoids in fresh kafr lime leaf oil. Chiang Mai J Sci 2012;40:2407.
[11] Chueahongthong F, Ampasavate C, Okonogi S, Tima S, Anuchapreeda S.
Cytotoxic effects of crude kafr lime (Citrus hystrix, DC.) leaf fractional
extracts on leukemic cell lines. J Med Plant Res 2011;5:3097105.
[12] Agwaramgbo L, Okegbe T, Wright T, Igwe S, Ogburie V. Inhibition of the
oxidation of acetophenone by aqueous extracts of edible fruits and vegetables. Mod Chem Appl 2013;1:105.
[13] Chang CL, Lin CS, Lai GH. Phytochemical characteristics, free radical scavenging activities, and neuroprotection of ve medicinal plant extracts. Evid
Based Complement Alternat Med 2012;2012:984295.
[14] Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved
standarddninth edition. Pennsylvania: Clinical and Laboratory Standards
Institute; 2012.
[15] OToole GA. Microtiter dish biolm formation assay. J Vis Exp; 2011:e2437.
[16] Steinberg D, Moreinos D, Featherstone J, Shemesh M, Feuerstein O. Genetic
and physiological effects of noncoherent visible light combined with
hydrogen peroxide on Streptococcus mutans in biolm. Antimicrob Agents
Chemother 2008;52:262631.
[17] Shemesh M, Tam A, Steinberg D. Differential gene expression proling of
Streptococcus mutans cultured under biolm and planktonic conditions.
Microbiology 2007;153:130717.
[18] Van Peer G, Mestdagh P, Vandesompele J. Accurate RT-qPCR gene expression analysis on cell culture lysates. Sci Rep 2012;2:222.
[19] Ferrazzano GF, Amato I, Ingenito A, Zarrelli A, Pinto G, Pollio A. Plant
polyphenols and their anti-cariogenic properties: a review. Molecules
2011;16:1486507.
[20] Rao S, Gruber JV, Brooks GJ. Personal care composition containing yeast/
resveratrol ferment extract. U.S. Pat Appl Pub 2010;WO2010011885 A1.
[21] Youse B, Ghaderi S, Rezapoor-Lactooyi A, Amiri N, Verdi J, ShoaeHassani A. Hydroxy decenoic acid down regulates gtfB and gtfC expression
and prevents Streptococcus mutans adherence to the cell surfaces. Ann Clin
Microbiol Antimicrob 2012;11:21.