Carbohydrate Polymers 151 (2016) 335347

Contents lists available at ScienceDirect

Carbohydrate Polymers
journal homepage: www.elsevier.com/locate/carbpol

Carboxymethyl cellulose enables silk broin nanobrous scaffold

with enhanced biomimetic potential for bone tissue engineering
application
B.N. Singh, N.N. Panda, R. Mund, K. Pramanik
Department of Biotechnology and Medical Engineering, National Institute of Technology, Rourkela, India

a r t i c l e

i n f o

Article history:
Received 21 January 2016
Received in revised form 23 May 2016
Accepted 24 May 2016
Available online 25 May 2016
Keywords:
Silk broin
Electrospinning
Carboxymethyl cellulose
Calcium phosphate
Tissue engineered scaffold

a b s t r a c t
Novel silk broin (SF) and carboxymethyl cellulose (CMC) composite nanobrous scaffold (SFC) were
developed to investigate their ability to nucleate bioactive nanosized calcium phosphate (Ca/P) by
biomineralization for bone tissue engineering application. The composite nanobrous scaffold was prepared by free liquid surface electrospinning method. The developed composite nanobrous scaffold was
observed to control the size of Ca/P particle (100 nm) as well as uniform nucleation of Ca/P over the
surface. The obtained nanobrous scaffolds were fully characterized for their functional, structural and
mechanical property. The XRD and EDX analysis depicted the development of apatite like crystals over
SFC scaffolds of nanospherical in morphology and distributed uniformly throughout the surface of scaffold. Additionally, hydrophilicity as a measure of contact angle and water uptake capacity is higher than
pure SF scaffold representing the superior cell supporting property of the SF/CMC scaffold. The effect of
biomimetic Ca/P on osteogenic differentiation of umbilical cord blood derived human mesenchymal stem
cells (hMSCs) studied in early and late stage of differentiation shows the improved osteoblastic differentiation capability as compared to pure silk broin. The obtained result conrms the positive correlation
of alkaline phosphatase activity, alizarin staining and expression of runt-related transcription factor 2,
osteocalcin and type1 collagen representing the biomimetic property of the scaffolds. Thus, the developed
composite has been demonstrated to be a potential scaffold for bone tissue engineering application.
2016 Elsevier Ltd. All rights reserved.

1. Introduction
The development of an ideal scaffold for bone tissue engineering application has been an extensive area of research in the
last decades. Various biopolymers have emerged through time
to meet the required specication for bone tissue regeneration.
The polymer blends and composite are more efcient than the
individual biopolymer as scaffold material (Li et al., 2014; Lu
et al., 2013). Bombyx mori silk broin (SF), a naturally occurring biopolymer, has excellent tuneable mechanical properties
which make it an important scaffold entity for hard as well as
soft tissue engineering applications (Meinel et al., 2005; Minoura,
Tsukada & Nagura, 1990; Omenetto & Kaplan, 2010; Santin, Motta,
Freddi & Cannas, 1999). The two major components of Bombyx
mori silk are silk broin, a hydrophobic structural protein consisting of equimolar ratio of heavy and light chain of protein

Corresponding author.
E-mail address: mondalkp@gmail.com (K. Pramanik).
http://dx.doi.org/10.1016/j.carbpol.2016.05.088
0144-8617/ 2016 Elsevier Ltd. All rights reserved.

and sericin, a hydrophilic component (Ochi, Hossain, Magoshi &

Nemoto, 2002; Tanaka et al., 1999; Zhou et al., 2000). In the last
decade, apart from silk various other proteins and polysaccharides
based biopolymers such as cellulose, starch, chitosan, alginate and
their derivatives have been chosen for their potential applications
in many areas such as pharmacy, medicine, tissue engineering and
biotechnology (Gombotz & Wee, 2012; Nguyen & West, 2002). Carboxymethylcellulose (CMC), a highly hydrophilic semi-synthetic
natural polymer has signicant super absorbing, defoaming and
chelating abilities and nds widespread applicability in pharmaceutical industries (Ghanbarzadeh & Almasi, 2011; Wang &
Wang, 2010; Whistler, 2012). The natural structural matrix of bone
consists of type-I collagen bers, which is reinforced with hydroxyapatite like inorganic phase by biomineralization (Fratzl, Gupta,
Paschalis & Roschger, 2004). Hydroxyapatite, the main mineral
phase of bone and skeletal systems have several favourable properties namely biocompatibility, osteoconductivity, osteoinductivity
and bioactivity (Cao & Hench, 1996; Jiang et al., 2013; Suchanek &
Yoshimura, 1998). Thus, it is signicant to mimic the biomineralized organic phase of natural bone. The aim of this present work is

336

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

to bring several advantageous properties of both silk broin (high

mechanical strength, biocompability) and carboxymethylcellulose
(hydrophilicity, chelating capacity) at the same template to develop
a biomaterial for bone tissue engineering application. We consider
the development of SF/CMC based composite scaffolds as a promising strategy to overcome the limitations of the pure SF scaffolds. In
fact, there are published reports on SF/CMC based composite lms
and hydrogels being put into various biotechnology and biomedical applications (Ju et al., 2014; Kundu, Mohapatra & Kundu, 2011).
The present research has however, focused on the processing of
the composite material into nanobers through free liquid surface
electrospinning technique with an aim of creating a close juxtaposition between bone and the scaffold for enhanced osteointegration.
Electrospun nanobrous scaffold closely resembles the nanobrous structure of natural extracellular matrix (ECM) and thus,
promotes better cell attachment and proliferation (Ma & Zhang,
1999). SF and CMC have negligible inammatory reactions and are
biocompatible(Miyamoto, Takahashi, Ito, Inagaki & Noishiki, 1989;
Santin, Motta, Freddi & Cannas, 1999). Moreover, the chelating ability of CMC can coordinate bonding between COO and Ca2+ , and
elicit the homogeneous Ca/P crystal nucleation which is a vital
osteogenic property that an ideal scaffold should demonstrate for
bone regeneration. This paper not only presents a comprehensive
understanding of the morphological and physicochemical characteristics of the SF/CMC nanobrous scaffold, but also accounts a
thorough investigation of their biological performance for bone
regeneration through the use of seeded human mesenchymal stem
cells (hMSCs) that are derived from the human umbilical cord
blood. In this study, the novelty and the superiority of the SF/CMC
nanobrous scaffold over other polymeric/composite scaffolds has
been explored to enhance osteogenic differentiation of the cells.
The osteogenic response of MSCs to biomimetic SF/CMC composite nanobrous scaffolds was assessed by expression analysis
of osteogenic genes (RUNX2 transcription factor, Osteocalcin and
type1 collagen), alkaline phosphatase activity, and calcium deposition.
2. Materials and methods
2.1. Materials
Bombyx mori silk cocoons were purchased from Central Tasar
Research and Training Institute (Jharkhand, India). Lithium bromide (LiBr), sodium carbonate (Na2 CO3 ) and formic acid (98%) were
procured from Merck, India. Dulbeccos Modied Eagle Medium
(DMEM), Phosphate-buffered saline (PBS), Fetal bovine serum
(FBS), Trypsin (0.25%), Alexa-Fluor 488 conjugated phalloidin,
Live/Dead staining kit, Antibiotic-Antimycotic solution, antiRUNX2 antibody, anti-osteocalcin antibody and FITC-conjugated
secondary antibodies, TRIzol, High-capacity cDNA Reverse Transcription Kit and SYBER Green RT-PCR kit were purchased
from Invitrogen, USA. The dialysis cassette was obtained from
Thermo sher, USA. Bovine serum albumin (BSA), SIGMAFASTTM
p-nitrophenyl phosphate (pNPP) tablets, paraformaldehyde, Triton
X-100, 4 6-Diamidino-2-phenyindole (DAPI), Dimethyl Sulfoxide
(DMSO), MTT assay kit, Alizarin red S (ARS) solution, CMC as
sodium salt (molecular weight 700 kDa and degree of substitution 0.650.85) ammonium hydroxide, cetylpyridinium chloride
(CPC) were obtained from Sigma.
2.2. Preparation of regenerated silk broin
Silk broin (SF) was extracted from Bombxy mori silk cocoon
and the regenerated aqueous SF solution was prepared following the previously established protocol (Rockwood, Preda, Ycel,

Wang, Lovett & Kaplan, 2011; Sah & Pramanik, 2010). Briey Bombyx mori silk cocoons were chopped and degummed in 0.02 M
aqueous Na2 CO3 for 20 min at 100 C, followed by washing in
distilled water to remove sericin and other impurities. After degumming, silk bers were dried at 37 C for overnight. Degummed silk
bers were then dissolved in 9.3 M LiBr aqueous solution at 45 C
for 2hr to 3hr resulted in a 10 wt% solution. The obtained solution
was then dialyzed against deionized water for 23 days to remove
LiBr ions. The obtained solutions were then centrifuged at 5000 rpm
to remove un-dissolved impurities and aggregates. Finally SF solutions were freeze dried and used for further study.
2.3. Generation of SF/CMC nanobers
Nanobers of SF/CMC blends were fabricated by the electrospinning method. Four different compositions of SF/CMC (100/0, 99/1,
98/2 and 97/3 (w/w)) blend solutions (10 wt%) were prepared by
dissolving appropriate amount of SF and CMC powder in 98% formic
acid with stirring to make well dispersed homogenous solutions. A
10 wt% pure SF solution was used as control. The electrospinning
of the solutions was done by using a free liquid surface electrospinning machine (NS Lab 200, ELMARCO), at 4.25 kVcm1 voltage,
40% relative humidity of electrospinning chamber and 12 rpm of
wire based spinning electrode at 20 2 C. Multiple Taylor cones
were developed over the spinning electrode in response to the
potential difference created between spinning and collector electrode separated apart at 16 cm. The different composite scaffolds
are designated as SF, SFC1A, SFC2 B and SFC3C for 100/0, 99/1, 98/2
and 97/3 (w/w) compositions respectively. The gelatin nanobrous
scaffold fabricated by electrospinning of 10 wt% solution of gelatin
under similar electrospinning conditions was used as control.
2.4. Post treatment of electrospun scaffolds
The electrospun SF and SFC nanobrous scaffolds were then
cross-linked with 3 wt% EDC-NHS [2:1 (w/w)] in ethanol: water
(95:5 v/v)] solution and were further treated with 0.1 M CaCl2
solution overnight at 40 C. The cross-linked scaffolds were rinsed
thoroughly with deionized water to remove ions like chlorine and
residual cross-linking reagent, and dried under vacuum at room
temperature for 24 h. The different composite scaffolds treated
with CaCl2 were designated as SF1, SFC1 and SFC2 corresponding
to SF, SF/CMC (99:1 w/w) and SF/CMC (98:2 w/w) respectively.
2.5. In vitro mineralization
The in vitro mineralization of the scaffold was performed by
incubating 1 1 cm2 sizes of scaffolds in 20 ml simulated body uid
(SBF) prepared following the earlier reported method (Kokubo, Kim
& Kawashita, 2003) for 7 days. The pH of the uids was adjusted
to 7.4 at 36.5 C. After 7 days, the scaffolds were taken out, gently
rinsed in distilled water and dried at room temperature for further
analysis.
2.6. Morphological characterization
Characterization of the developed scaffold was done before and
after the in-vitro mineralization. To scaffolds with 0.5 0.5 cm2
sizes of scaffolds were coated with gold, and observed under
eld emission scanning electron microscope (FESEM) (NOVA NANO
SEM, USA) for morphological assessment. The average ber diameters were measured from ten different FESEM images of 5000
magnication using Image J software. Energy dispersive X-ray analysis (EDX) was used to ensure mineral deposition on the scaffolds.

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

2.7. Physicochemical characterizations

The nature of interactions among the functional groups of the
prepared SFC composite scaffolds and their interaction with Ca/P
were determined using Fourier transforms infrared (FTIR) spectroscopic analysis (FTIR, Shimadzu AIM-8800, Japan) operated in
the transmittance mode in 4000400 cm1 region. The structural
features of the scaffolds were assessed by X-ray diffraction (XRD)
study (Rigaku Ultima-IV, Japan) and the data was collected in a
2 range of 1070 with 5 per min scanning rate. The topography of the scaffold was analysed by atomic force microscope (AFM,
NTEGRE (NTMDT)) operated in semi-contact mode. The contact
angle of the nanobrous scaffolds (1 1 cm2 ) was measured using
K100MK3 tensiometer (Kruss GmbH, Hamburg, Germany) operating at 6 mm/min detection speed and 3 mm/min measuring speed.
Three specimens were used for single set of scaffold and the average
result was reported. The water uptake capacity was measured by
immersing small pieces (2 2 cm2 ) of pre-weighed dried nanobrous scaffolds in PBS at room temperature. After particular time
interval specimen was removed and then weighed. By dividing the
difference in weight before and after the swelling by the original specimen weight, we obtained the equilibrium water uptake
percentage of the scaffolds.
2.8. Mechanical characterization
Universal testing machine (Instron 3369, Bioplus, USA) was used
to determine the tensile strength of the SFC nanobrous scaffolds
both in dry and wet conditions. The scaffolds were cut into small
rectangular shapes (30 5 0.05 0.01 mm3 ) and loaded between
the clamps of the tensile tester. Tensile testing was performed with
a cross head speed of 5 mm/min. For measurement in wet condition,
the samples loaded between the clamps were immersed in bioplus
bath lled with 3 l SBF maintained at 37 1 C. The value reported
is the average of measurement taken with three specimens.
2.9. In vitro evaluation of the SFC nanobrous scaffolds by cell
culture
2.9.1. hMSCs seeding and culture
The umbilical cord blood derived hMSCs were cultured in our
laboratory in complete media (DMEM supplemented with 10% FBS
and 1% antibiotic solution) (Bissoyi, Pramanik, Panda & Sarangi,
2014). The cells were maintained at 37 C in 5% CO2 incubator and
the culture medium was refreshed every 2 days till the cell density reached 8090% conuence. Disk shaped scaffold specimens of
6 mm in diameter were sterilized in 75% ethanol overnight and then
extensively rinsed with PBS. The scaffolds were then incubated for
overnight in complete medium in 24-well plate and hMSCs (105
cells/cm2 ) were seeded on the scaffolds after 24 h of incubation.
The cell seeded scaffolds were incubated at 37 C for 46 h to allow
cell adhesion. After the cell attachment, the cell seeded nanobrous scaffolds were cultured for two weeks in osteogenic media
(complete media, which additionally supplemented with 5 mM glycerol phosphate, 50 mg/ml ascorbic acid-2-phosphate and 1 nM
dexamethasone) at 37 C in humidied atmosphere containing 5%
CO2 .
2.9.2. hMSCs morphology, attachment, viability, metabolic
activities and distribution
The qualitative and quantitative assessment of morphology,
attachment, viability and proliferation of hMSCs seeded on each
of the prepared nanobrous scaffolds were monitored during
714 days of culture under FESEM and confocal microscope. For
FESEM study, the cultured cell-seeded scaffolds were xed with
2.5% glutaraldehyde for 20 min and dehydrated consecutively for

337

5 min using gradient ethanol concentrations (30%, 50%, 70%, 90%

and 100% (v/v) in water). After drying at room temperature,
the scaffolds were coated with gold and observed under FESEM
(Biswas, Pramanik & Jonnalagadda, 2014). Morphological and cellular attachment assessment was done by confocal microscopy.
The seeded scaffolds were rst xed with 4% paraformaldehyde
for 30 min and incubated in 3% BSA for another 30 min. The xed
specimens were then permeabilized using 0.1% Triton X-100 for
5 min and again incubated with Alexa-Fluor 488 conjugated phalloidin at room temperature for 15 min in dark condition. After
rinsing with PBS and staining with DAPI for 15 min, the specimens
were mounted over the glass slides and the images were taken by
Leica TCS SP5 X Super continuum Confocal Microscope (Bissoyi,
Pramanik, Panda & Sarangi, 2014).
Cell viability and distribution of viable cells in the scaffolds
were also evaluated by the same confocal microscopic analysis. The
seeded scaffolds were incubated in two molecular probes, namely
calcein AM and EthD-1 staining solution, simultaneously in dark
for 30 min and then observed under the microscope to determine
the presence and distribution of live (green) and dead (red) cells
throughout the scaffolds. The quantitative estimation of cell viability on cell seeded scaffolds (104 cells/cm2 ) was done by MTT
assay on 3rd, 7th and 14th day of culture using a standard protocol
(Ghasemi-Mobarakeh et al., 2008). After 3, 7, and 14 days the culture medium (complete media) was removed, rinsed in 100 l PBS
and 100 l of MTT solution (0.5 mg/ml) was added to each well (96
wells plate) and incubated for 4 h at 37 C in 5% CO2 . After incubation, MTT solution was replaced with 100 l of DMSO and nally
the absorbance was measured at 490 nm using UVvis spectrophotometer (Double beam spectrophotometer 2203, Systronics).
2.9.3. Osteogenic differentiation
The osteogenic differentiation activity of hMSCs (104 cells/cm2 )
seeded on the SFC nanobrous scaffolds and cultured in osteogenic
media were quantitatively estimated by measuring alkaline phosphatase (ALP) secretion by the cultured hMSCs using pNPP solution
as the reaction substrate for ALP. 50 l of Lysis solution (0.5%
TritonX-100) and subsequently, 200 l of 1 mg/ml p-NPP solution
were added to each well and incubated for 1.5 h at 37 C. The
absorbance was later measured at 405 nm after 7, 14 and 21 days
using UVvis spectrophotometer (Double beam spectrophotometer 2203, Systronics).
The cell-seeded scaffolds were cultured in osteogenic media
and analysed qualitatively and quantitatively for the expression of
RUNX2 transcription factor and osteocalcin differentiation markers by immunocytochemistry. The scaffolds were xed with 4%
paraformaldehyde for 15 min and rinsed well in PBS, followed by
permeabilization with 0.5% TritonX-100 for 5 min at room temperature. The permeabilized scaffolds were rinsed with 1X PBS and
incubated for 30 min at RT in 3% BSA solution. After blocking the
non-specic sites, each specimen was separately incubated with
anti-RUNX2 antibody and anti-osteocalcin for 1 h at RT followed
by thorough washing. FITC-conjugated secondary antibody (1:200)
was then added to it and incubated for 30 min. Counter staining
with DAPI was performed for 510 min after washing in 1X PBS
and image was taken by confocal microscopy.
Moreover, the RUNX2 transcription factor, osteocalcin and
type1 collagen (Col1) gene expressions of the hMSCs (105
cells/cm2 ) seeded on the SF and SFC nanobrous scaffolds were
quantitatively evaluated in real time quantitative polymerase
chain reaction (RT-PCR). After two weeks of culture in osteogenic
medium, cell-scaffold construct was immersed in TRIzol and
homogenised by vortexing to isolate RNA. These isolated RNAs
were converted to cDNA using High-capacity cDNA Reverse Transcription Kit according to the manufacturers instructions. A SYBER
Green RT-PCR kit was used for quantitative estimation of gene

338

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

Table 1
Primer sequences used for quantitative RT-PCR gene expression analysis.
genes

5 3

primers

Runx2

Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse

GTCTCACTGCCTCCCTTCTG
CACACATCTCCTCCCTTCTG
GTGACGAGTTGGCTGACC
TGGAGAGGAGCAGAACTGG
GACCTCTCTCCTCTGAAACC
AACTGCTTTGTGCTTTGGG
TTCCAGTCCTTCCTG
GCCCGACTCGTCATACTC

Osteocalcin
Type 1 collagen
B-actin

expression. The 2ct relative quantication method was used for

the estimation of gene expression. The relative expressions of each
gene were normalized against Ct value of the house-keeping gene.
The selected primer sequence for the gene of interest and housekeeping gene are shown in Table 1.
2.9.4. Biomineralization of hMSCs seeded on SFC nanobrous
scaffolds and calcium quantication
The formation of mineralized nodules on the cell-seeded nanobrous scaffolds cultured in osteogenic media were analysed and
conrmed by FESEM analysis and alizarin red assay. FESEM and
EDX analysis were performed following the protocol as described
in 2.5.2. Alizarin red S stain (ARS) solution was prepared by dissolving 0.5 g ARS in 25 ml MiliQ water and pH of the solution was
adjusted to 4.1-4.3 by adding 10% NH4 OH. The cell-seeded scaffolds were rst xed with 2.5% glutaraldehyde for 2 h and 1 ml ARS
solution was then added to each well. The specimens were then
incubated at 37 C for 1 h and later washed in MiliQ water to remove
excess dye adsorbed on the scaffold surface. Biomineralization of
hMSCs on the SFC nanobrous scaffolds were qualitatively evaluated by examining the intensity of the red colour developed on
the scaffold surface by using inverted phase contrast microscope
(Axiovert 40 CFL) at 20X magnication. The degree of biomineralization was estimated through calcium quantication which
involved the aspiration of ARS stain by specimen incubation with
500 l of cetylpyridinium chloride (CPC) for 1 h and recording the
absorbance at 550 nm(Gregory, Gunn, Peister & Prockop, 2004)
using UVvis spectrophotometer (Double beam spectrophotometer 2203, Systronics).
2.10. Statistical analysis
The experiments were done in triplicate, and data were presented as mean SD. Statistical signicance was determined by
single way ANOVA. p Value less than 0.05 was considered as signicant.
3. Results and discussion
3.1. In vitro mineralization of SFC nanobers
3.1.1. Rheological and microstructural analysis
The rheological behaviour of pure SF and various SF/CMC blend
solutions was studied by viscometer measurement. Fig. 1C shows
that the pure SF solution exhibits shear thickening behaviour at
lower shear rate followed by shear thinning behaviour at higher
shear rate. The SF/CMC (99/1 w/w) blend solution also exhibited
similar trend as SF solution whereas SF/CMC (98/2 w/w) solution
showed faster shear thickening at lower shear rate and slower shear
thinning behaviour at higher shear rate. Thus, SF and SF/CMC (99/1
and 98/2 w/w) solutions show similar behaviour of shear thickening and shear thinning as of natural silk dope (Holland, Terry,
Porter & Vollrath, 2006). The polymeric chains of SF/CMC solution
was organised either parallel or entangled due to suppression of

repulsive forces between the negative charges of polymeric chains

at low pH of formic acid (Lu et al., 2011; Zhang et al., 2012; Zhu,
Zhang, Shao & Hu, 2008). This resulted in increased viscosity and
shear thickening behaviour at lower shear rate of SF/CMC solutions.
Whereas, as the concentration of CMC increased (>2 wt%) shear
thickening started early with lower shear rate followed by early
shear thinning after reaching maximum shear viscosities. Thus
SF/CMC solutions with increased CMC content (>2 wt%), exhibited
higher shear thinning behaviour at lower shear rate due to the
strong interaction between SF and CMC, which leads to increasing
the solution inertia and hinders the electrospinning (Zhou, Chu, Wu
& Wu, 2011).
The microstructures of SF, SFC1 and SFC2 scaffolds, both before
and after the mineralization, are presented in Fig. 1 where the
FESEM images show the irregular distribution of nanobers in
the form of non-woven mats. The SFC3 blend failed to produce
nanobers because the solution was highly viscous owing to the
increased CMC content in it. Prior to mineralization, the nanobers
had smoother surfaces and their ber diameter was increased with
CMC addition as shown in Fig. 1AC. Majority of nanobers are
within 100300 nm diameter range, where pure SF exhibits an
average diameter of 146.6 38.3 nm, whereas SFC1A and SFC2 B
displaying a linear increment of average diameters 183.7 82 nm
and 227.8 87 nm respectively. This increase in ber diameter is
favourable for cell adhesion as it is similar to the biomimetic architecture of human body where by the diameter of collagen bers
of natural extracellular matrix (ECM) are in 50500 nm diameter
range (Fratzl, Gupta, Paschalis & Roschger, 2004). After in vitro mineralization, the ber surfaces were observed to be rough indicating
the nucleation of Ca/P crystals on the scaffold. The surface of pure
SF nanobers and SF1 (Fig. 1B-a,b) was hardly rough suggesting
its marginal biomineralizing ability (random and weak) in forming
Ca/P crystals. However, SFC1 and SFC2 (Fig. 1EF) demonstrated
higher nucleation sites with uniform and spherical Ca/P crystal formations of sizes 100 nm. Fig. 1D illustrate in situ mineralization
of SF/CMC nanobrous scaffold. Fig. 1D illustrates the in situ mineralization of SF/CMC nanobrous scaffold. The mineralization of
the nanobers can be attributed to the formation of free hydroxyl
groups/carboxyl groups during the electrospinning of SFC blends
in formic acid (derivatizing solvent for CMC) contributing to the
increased number of Ca2+ ion nucleation sites on the nanobers.
After that, PO4 3 ions from surrounding SBF solution was adsorbed
by calcium ion and that resulted in the formation of nanosized
Ca/P crystals in SBF (1X) solutions (Heinze & Heinze, 1997; Salama,
Abou-Zeid, El-Sakhawy & El-Gendy, 2015). The gradual increase
in CMC composition augments the free hydroxyl groups/carboxyl
groups content and thus SFC2 exhibits the highest mineralization.
The biomineralization of electrospun SF/CMC based nanobrous
scaffold shows a controlled nucleation of Ca-P crystal. Whereas in
case of scaffold coated with CMC, most of the Ca2+ nucleation sites
may exposed to SBF thereby uncontrolled mineralization of scaffold occurs. Furthermore in electrospinning under high shear rate
(in range of 104 1/s) polymeric chains of SF and CMC get entangled
or parallelly aligned (Agarwal, Burgard, Greiner & Wendorff, 2016)
Because of which CMC was well distributed over the surface as well
as within the ber this has led to the exposure of Ca2+ nucleation
sites on the scaffold surface in controlled manner. The controlled
mineralization of matrix provides superior osteogenic differentiation of hMSCs in comparison to the matrix with uncontrolled
biomineralization. The scaffolds completely covered with Ca-P or
hydroxyapatite by uncontrolled mineralization are detrimental for
hMSCs (Rungsiyanont, Dhanesuan, Swasdison & Kasugai, 2011).
In some of the study on hydroxyethyl cellulose nanober it has
been observed that complete electrospun mat was covered by CaP mineral within 24 h of soaking period in SBF solution, which
further reduces the pore size thereby may prevents cell penetra-

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

339

Fig. 1. (A) FESEM images of electrospun SF, SFC1A and SFC2 B (a, c). (B) FESEM images of SF, SF1, SFC1 and SFC2 after SBF treatment for 7 days (a, d). (C) Change in viscosity
of the SF and SF/CMC solution at different concentrations. (D) Illustration of in situ mineralization of SF/CMC composite nanobrous scaffold.

tion within the scaffold (Chahal, Hussain, Kumar, Yusoff & Rasad,
2015). Thus too low or too much mineralization is not favourable
for human bone tissue regeneration. However pore size and porosity within nanobrous scaffold can be further improved either by
using a direct-write 60 W laser at standard room condition or by
using porogens like NaCl, which enables nanobrous scaffolds with
improved stem cells recruitment or penetration property(Ki et al.,
2008; Rodrguez, Sundberg, Gatenholm & Renneckar, 2014). Also
cellulose and bacterial cellulose are rich in carboxylate groups (salt
form of the acid) which provide higher negatively charged surface and may be not suitable for cell attachment. Whereas in case
of SF/CMC nanober, surface of the bers were rich in positively
charged amine group (-NH3 + ) present in SF favour the cells attachment and proliferation.

3.1.2. Structural and functional property

XRD diffractogram of the scaffolds representing their chemical
structures and phases are shown in Fig. 2A, where the diffraction
patterns show minor variation among the scaffolds. The peaks at
20.8 (2) and 24.3 (2) (Fig. 2A-a) indicate the silk II conformation (Um, Kweon, Park & Hudson, 2001) contributing to superior
stability and mechanical properties of the nanobers. A weak peak
at 27.6 (2) indicates the silk I structure (Ha, Park & Hudson, 2003;
Singh, Panda & Pramanik, 2016; Um, Kweon, Park & Hudson, 2001).
Moreover, the diffractogram clearly suggest the change in crystallinity of the SF scaffolds with gradual addition of CMC and this
phenomenon possibly due to the interactions between the amide
groups of SF and the hydroxyl/carboxyl groups of CMC chains. After
7 days of SBF treatment, X-ray diffractogram (Fig. 2A-b) depicts Ca/P
bone like apatite formation over the scaffolds, where SFC2 shows
prominent peak at 2 equal to 31.8 , 45.52 , 56.37 and 66.36 in

340

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

Fig. 2. (A) XRD spectrum of SF, SFC1A and SFC2 B before SBF treatment (a). XRD spectrum of SF, SF1, SFC1 and SFC2 after incubation in SBF for a week (b). (B) FT-IR spectrum
of SF, SFC1A and SFC2 B before incubation in SBF (a) and (b) after incubation in SBF for 7 days. (C) AFM images of (a) SF1 and (b) SFC2 after treatment in SBF for 7 days.

close proximity with reference spectrum for hydroxyapatite (Sigma

Aldrich) as compared to others. Thus it has been conrmed that,
SFC2 promotes higher mineralization as compared to SFC1 and SF1,
whereas SF shows minimal level of mineralization. This conrms
our hypothesis that the addition of CMC can enhance the mineralization property, which was further investigated by FT-IR analysis
with mineralised nanobrous scaffold.
The characteristics functional groups in SF, SFC1A and SFC2 B
are represented by FTIR spectra as shown in Fig. 2B-a. The random coil conformations of pure SF correspond to the characteristic
peaks at 1640 cm1 (amide I), 1527 cm1 (amide II) and 1241 cm1
(amide III), the peaks shift to 1627 cm1 , 1519 cm1 and 1236 cm1
respectively after cross-linking with EDC/NHS (Chen, Chen & Lai,
2012). The peak at 1627 cm1 and 1519 cm1 in SFC 2 B (Fig. 2B-b)
became intensied, which indicates the ability of CMC in facilitating the conformational transition from random coils to -sheets
by forming additional intermolecular hydrogen bonds between the
carboxyl groups of CMC and amide groups of SF. However, the peak
intensied and narrowed at 1236 cm1 in SFC2 B is attributed to
the overlapping of amide III band with the acetyl ester band of
CMC (Ritcharoen, Supaphol & Pavasant, 2008). The FT-IR peak at

1060 cm1 is due to >CH O-CH2 stretching of CMC (Itagaki, Tokai &
Kondo, 1997). After in vitro mineralization the scaffolds were characterized by FT-IR to assess their mineralization ability. As observed
in FT-IR spectra (Fig. 2B-b) the Ca/P deposition on the scaffolds is
reected by the characteristic peak at 1062 cm1 corresponding to
the P-O asymmetric stretching mode of vibration of PO4 3 group
(Stan, 2009; Varma & Babu, 2005). The P-O stretching mode has
been observed at 1012 cm1 and 976 cm1 corresponds to major
band for phosphate group. The peaks observed at about 610 cm1
and 568 cm1 are due to O-P-O bending and stretching respectively
(Greish & Brown, 2001; Varma & Babu, 2005). The absorbed CO2
corresponding to 14001450 cm1 peak indicates the deposition
of carbonated Ca/P on the nanobers. Since the characteristic peak
for deposited Ca/P was observed much more prominent in SFC2
(Fig. 2B-b) in comparison to other scaffold indicating that CMC plays
signicant role in the improvement of biomineralization of nanobrous scaffold. Most of the peaks observed with SFC2 show more
peak broadening in comparison to SF1 with time, that indicates that
SFC2 supports superior mineralization and intramolecular bonding
with developed Ca/P (Pramanik, Mishra, Banerjee, Maiti, Bhargava
& Pramanik, 2009).

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

341

Fig. 3. (A) Load vs Extension curve for SF and SFC2 B scaffolds in dry and wet condition. (B) Distribution of tensile strength and tensile strength at break of SF and SFC2 B
scaffold. (C) Swelling behaviour at different time interval observed with SF and SFC2 B in PBS solution. (D) Variation of contact angle measured with SF and SFC2 B scaffolds
representing the superior hydrophilic property of SFC2B.

The structure and surface morphology of SF1 and SFC2 scaffolds after biomineralization were examined by AFM analysis. We
observed enhanced Ca/P deposition and improved surface roughness of SFC2 than that observed with of SF1, as revealed by the
AFM images (Fig. 2C). As indicated in Fig. 2C, SF1 showed smooth
surface with average surface roughness of 0.247 m whereas SFC2
showed average roughness of 0.322 m. The growth of Ca/P crystals
over SFC2 improves its surface roughness and thus, it can promote
cell adhesion, proliferation and differentiation (El-Ghannam et al.,
2004).
3.2. Mechanical properties
The ultimate tensile strength (UTS) of SF and SFC2 B nanobrous scaffolds are depicted in Fig. 3A, wherein dry state, the
UTS was measured as 12.7 1.5 MPa and 10.54 1.3 MPa and
the corresponding values in wet state were 3.82 0.7 MPa and
3.46 0.6 MPa respectively. A minute variation in UTS observed
with both the scaffolds in wet state suggests that the addition of
CMC can improve mineralization without much affecting mechanical property. Even, in wet state, the tensile strain at break of SFC 2 B
was measured to be 18.37 3.8%, which was quite higher than the
pure SF scaffold (8.36 3.3%). The corresponding increase in tensile strain with addition of a small amount of CMC is 118%. Thus the
2% CMC addition to SF may improve the cell retention ability and
increase the number of cell penetration inside the scaffold during
cell-seeding.
3.3. Hydrophilicity and swelling behaviour
The cell adhesion, proliferation and tissue integration are greatly
inuenced by the hydrophilicity of the scaffolds (Altankov & Groth,
1994). Table 2 shows mean contact angle measurements of the

scaffolds, where the mean advancing contact angle (MACA) and

mean receding contact angles (MRCA) (a measure of wettability
and de-wettability) of SFC2 B is lower than pure SF scaffold representing the higher hydrophilicity of the composite scaffold. This
phenomenon is also corroborated from Fig. 3D where the receding contact angles for SFC2 B attained 0 after certain time period,
whereas the measured value is around 30 for SF scaffold. The mean
contact angle hysteresis plays an important role in the intrusion and
extrusion of body uids through the scaffolds. This will further augment the cell adhesion property of SFC2 B scaffolds in comparison to
pure SF as the optimum contact angle of the surface for cell adhesion
is reported in the range between 55 and 75 (Groth & Altankov,
1996). The increase in hysteresis of SFC2 B in comparison to pure
SF scaffold indicates an increased in surface roughness or chemical
in- homogeneity along the contact line. Moreover, the water uptake
(Fig. 3C) determined for SFC2 B lying in the range of 361%417%
in comparison to 180%270% for SF, also suggests higher water
uptake capacity of nutrients into the interior of the SFC2 B scaffold and thereby an enhanced the cell migration and proliferation
are achieved in this region. Thus the addition of a small amount
of CMC improves the hydrophilic property of SF based nanobrous
scaffolds, thus facilitates biouid transport, cell migration, prevention from dehydration, exudates accumulation across the wound
and maintenance of microenvironment and pH (Agrawal & Ray,
2001; Zahedi, Rezaeian, Ranaei-Siadat, Jafari & Supaphol, 2010).

Table 2
Mean contact angle measurement of SF and SFC2 B nanobrous scaffolds.
Scaffolds

MACA [ ]

MRCA [ ]

Hysteresis [ ]

SF
SF/CMC2

64.2 4.2
57.4 0.3

36.9 3.8
18.5 1.8

26.6 3.0
38.9 3.2

342

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

Fig. 4. FESEM images of MSCs on gelatin (A), SF (B) and SFC2 (C) after 12 h of culture. FESEM micrographs of cells cultured on gelatin (D), SF (E) and SFC2 (F) after 7 days.
FESEM images of cells cultured on gelatin (G), SF (H) and SFC2 (I) on day 14. (J) MTT assay of MSCs cultured on gelatin, SF and SFC2. (K) Alkaline phosphatase (ALP) activity
in MSCs on gelatin, SF and SFC2 in an osteogenic culture medium over time (n = 3).

3.4. Adhesion, proliferation and distribution of hMSCs on SFC

scaffolds
The bioactivity of the pure SF and SFC2 composite nanobrous
scaffolds was evaluated by examining cellular attachment, viability
and proliferation of hMSCs cultured on the scaffolds. A positive control was taken by culturing hMSCs on gelatin nanober. As can be
seen from the FESEM images (Fig. 4AC), the hMSCs attached to the
scaffolds attained a more or less elliptical shape after 12 h of culture
thereby demonstrating their initial signs of spreading. The aspect
ratio for gelatin (2.23 0.46) and silk broin (2.08 0.04) scaffolds are comparable whereas a lower aspect ratio of 1.725 0.091
was shown by SFC2 scaffold. After 7 days (Fig. 4DF), most cells
appeared elongated and spindle like in morphology and a strong
cell attachment to the scaffold was evident from lopodia protrusions from cell surface. On 14th day (Fig. 4GI), the cells were
observed to be proliferated and formation of a monolayer like structure was occurred over the surface of the scaffold.

The cell viability was quantitatively estimated during 14 days of

culture by MTT assay. As can be seen from Fig. 4J, that on day 3 the
optical density (OD) measured with MSCs seeded SFC2 is higher
than pure SF and gelatin (p < 0.05). The cell viability was gradually increased with time and maximum viability was obtained with
composite scaffold up to 7 days. On day 14, comparable cell viability
was shown by both SF and SFC2 scaffold respectively.
The qualitative analysis of cell viability, analysed from the confocal images (Fig. 5A, E and I) after 7 days of culture, depicted the
superiority of SF and SFC2 scaffolds towards cellular growth and
maintenance of elongated cytoskeleton structure of cells in comparison to gelatin scaffolds. Fig. 6 shows the uorescence images
of cytoskeleton development and distribution after 7 and 14 days
of cell culture on the electrospun gelatin (Fig. 5C,D), SF (Fig. 5G,H)
and SFC2 (Fig. 5K,L) composite scaffolds. On day 7, it was observed
that cells were attached and elongated, whereas cells were proliferated and monolayer coverage of scaffold surface was evident
on day 14. Furthermore, SF and SFC nanobrous scaffolds showed
better development of lamentous actin compared to gelatin. Sim-

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

343

Fig. 5. Calcein AM and EthD-1 staining of MSCs cultured for 7 days on Gelatin (A), SF (E) and SFC2 (I). Green signals indicate viable cells and red signal for dead cells. 3D laser
scanning confocal images were observed while live/dead staining (Z stacks) of MSCs cultured for 7 days (B, F and J) on gelatin, SF and SFC2. Cell proliferation and distribution
are visualized by confocal microscopy on Gelatin (C), SF (G) and SFC2 (K) after culture for 7 days, whereas Gelatin (D), SF (H) and SFC2 (L) after culture for 14 days. Nuclei of
the cells were stained with DAPI (blue) and actin laments with phalloidin (green) (for interpretation of the references to colour in this gure legend, the reader is referred
to the web version of this article).

ilar trends with more aggregated cells with extra cellular secretory
substances and lack of cell boundaries (interconnected cells) were
noticed on day 14. The cell viability estimation of proliferated cells
over nanobrous scaffolds shows the trend of proliferation follows
as SFC2 > SF > gelatin.
The penetration and proliferation of hMSCs within the scaffolds
were determined from the 3D-Z-stack images composed by arranging all Z-sections developed during the scanning of cell-seeded
scaffolds under the confocal microscope. The images (Fig. 5B,F and
J) indicate that cells were proliferated well over the scaffolds but
with varying depth of penetration of hMSCs colonization. The highest penetration occurred in gelatin up to 35- 40 m and comparable
intensity of cell penetration up to 3035 m was shown by SFC2
scaffold while SF shows the lowest penetration depth of 1520 m.
All these taken together, it has been observed that SFC2 nanobrous
scaffold has the superior cellular activity than the other scaffold
developed under study. The improved hydrophilicity, higher tensile strain (in wet state) and swelling property of SFC2, along with
its higher standard deviation in ber diameter in comparison to
pure SF, contribute to increased penetration and proliferation of

hMSCs towards the interior of the scaffold without much affecting

cell attachment and proliferation on the surface.
3.5. Osteogenic differentiation
The osteogenic differentiation of hMSCs on Gelatin, pure SF
and SFC2 composite nanobrous scaffolds were determined qualitatively and quantitatively through a series of biochemical and
microscopic investigations. The characteristic marker of early
osteoblastic differentiation is attributed to the cellular secretion of ALP. ALP enzymes catalyse the hydrolysis of extracellular
pyrophosphates and increase the local concentration of inorganic
phosphates which facilitate biomineralization (Allori, Sailon &
Warren, 2008). The ALP activity (Fig. 4K) for all scaffolds reached
the maximum by day 14 indicating the osteogenic differentiation
of hMSCs. As compared to Gelatin and SF, hMSCs show signicantly
higher ALP activities on SFC2 on 14th day (p < 0.05). Hence, SFC2 is
conrmed to provide a better supportive platform for osteogenic
differentiation of cells. Further validation of osteogenic differentiation was carried out by estimating RUNX2 transcription factor,
osteocalcin and type1 collagen expression by the cells. The hMSCs

344

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

Fig. 6. Immunocytochemistry for RunX2 and osteocalcin on MSCs cultured on scaffolds. (A) Confocal images showing RunX2 expressions of MSCs on day 7 and day 14 (B)
Confocal images for osteocalcin expressions were observed in MSCs on day 7 and day 14 in the osteogenic culture medium. Integrated density evaluation for RunX2 and
osteocalcin were shown in graphs (C) and (D) respectively. Scale bar = 25 m. Alizarin Red S staining assay for quantitative evaluation of MSCs mineralization on nanobrous
scaffolds after 14 days of culture (E). The osteoblastic differentiation of MSCs on nanobrous scaffolds was assessed by measuring the mRNA expression of Runx2, osteocalcin
and type1 collagen (F).

seeded on the nanobrous scaffolds tend to aggregate and form

committed osteoprogenitor cells. With time, they differentiate into
pre-osteoblasts, early osteoblasts and mature osteoblasts. RUNX2
is the key regulator for early osteoblastic differentiation of hMSCs.
It binds specic DNA sequences and regulates the transcription
of various genes to orchestrate the osteogenic differentiation. The
immunocytochemistry for RUNX2 transcription factor expression

in hMSCs on the three scaffolds at day 7 (Fig. 6A) and day 14 (Fig. 6B)
is presented through the confocal images. As co-localization of
Runx2 and DAPI immunostainning shows that the expression of
Runx2 was localized to the cell nuclei. From Integrated density (ID)
evaluation it was observed that the expression of RunX2 transcription factor at higher level on day 7 (Fig. 6C) as compared to day
14. RUNX2 is pro-terminal marker of osteogenesis and its level of

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

345

Fig. 7. Alizarin red S staining of Gelatin, SF and SFC2 cultured for day 7 and day 14. FESEM images and EDX spectra of mineral deposition of SF and SFC2 cultured for 7 days.

expression on SFC2 was the highest on day 7 and then decreased by

day 14 as osteogenesis enhanced thereby, exhibiting the advantage
of using SFC2 composite scaffolds. The osteocalcin expression is a
late stage marker for osteogenic cell differentiation and the confocal images revealed that hMSCs demonstrate the highest level of
osteocalcin expression on SFC2 on 14th day. Moreover, the integrated density quantication of osteocalcin (Fig. 6D) conrms that
the SFC2 shows signicantly (p < 0.05) higher level of expression in
comparison to other scaffolds at day 7 and day14. On day 14, RT-PCR
analysis shows signicantly (p < 0.05) higher level of expression of
OCN and Col1 on SFC2 than SF (Fig. 6F), whereas a decrease in Runx2
expression was observed on SFC2 on day 14 (Fig. 6F) with no signicant difference at this point. Since osteocalcin is an abundant
calcium binding protein and adsorbs Ca/P, SFC2 facilitates higher
degree of Ca/P nucleation sites and growth over the nanobrous
structure and cause the activation of calcium sensing receptor signalling leading to a higher level of osteocalcin expression in hMSCs.

3.6. Biomineralization of hMSCs seeded nanobrous scaffold

The mineralization and formation of bioactive Ca/P like nodule structure throughout the surface of nanobrous scaffold was
our prime target to provide time dependent improved osteogenic
environment for cultured hMSCs. In comperission to SF, the uniform distribution of Ca/P over SFC2 nanobrous scaffold surface
may promote better cell growth and differentiation as bone tissues exhibit orderly distribution of Ca/P over nanobrous collagen
matrix(Akao, Sakatsume, Aoki, Takagi & Sasaki, 1993; Liu, Smith,
Hu & Ma, 2009). As can be seen from the FESEM images (Fig. 7B),

the degree of biomineralization on day 7 is higher on SFC2 than

on SF. Further EDX analysis further showed that hMSCs on pure SF
formed a mineral phase with Ca/P ratio: 0.81.2 whereas on SFC2,
the Ca/P ratio was 1.41.5 which is similar to the mineral phase of
the bone that consists mostly of Ca and P in the ratio 1.41.7(Lai,
Shalumon & Chen, 2015). The quantication of ECM mineralization
was performed through ARS where it binds with calcium and forms
ARS-calcium complex in a chelation process. It can be observed
from the inverted phase contrast microscopic images (Fig. 7A) that
on day 7; the ARS-calcium complex (red colour) covered a greater
percentage of SFC2 than the other two scaffolds. However, on 14th
day of culture all scaffolds had higher formation of the ARS-calcium
complex than that on day 7 but here too, the intensity was the highest in case of SFC2. Also SFC2, on day 14 (Fig. 6E), showed greater
OD as compared to gelatin and SF (p < 0.05). This suggests that the
degree of ECM mineralization depends both on culture duration
and the scaffold material. The analysis of EDX and alizarin red assay
results demonstrate its ability to mimic the osteogenic environment and hence found substantial superiority of SFC2 nanobrous
scaffold for bone tissue engineering application.

4. Conclusion
This is the rst report on the development of electrospun nanobrous SF/CMC composite materials with signicant improvement
in physicochemical, mechanical and biological properties in comparison to the gelatin and pure SF nanobrous scaffolds. SFC2 has
shown enhanced cell attachment and proliferation and strongly
assisted the differentiation of the attached hMSCs as evidenced

346

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

from ALP, RUNX2 transcription factor, osteocalcin and type1 collagen expressions in the line of intimation with high level of
biomineralization thereby, implicating the promising nature of the
novel SFC2 nanobrous scaffold towards osteogenic differentiation.
The developed scaffold has proved to be a novel and excellent candidate for bone tissue engineering and warrants further clinical
studies.

Acknowledgements
The authors thanks the Department of Biotechnology, Government of India, New Delhi for providing nancial support
by sanctioning program support on tissue engineering research
(BT/01/COE/09/13DT). The authors are also thankful to MHRD,
Government of India, New Delhi for providing research facility
by sanctioning Center of Excellence (F.No.5-6/2013-TS VII). The
authors thanks to National Institute of Technology, Rourkela, India
for providing infrastructure for research work.

References
Agrawal, C., & Ray, R. B. (2001). Biodegradable polymeric scaffolds for
musculoskeletal tissue engineering. Journal of Biomedical Materials Research,
55(2), 141150.
Agarwal, S., Burgard, M., Greiner, A., & Wendorff, J. (2016). Electrospinning: a
practical guide to nanobers. Walter de Gruyter GmbH & Co KG.
Akao, M., Sakatsume, M., Aoki, H., Takagi, T., & Sasaki, S. (1993). In vitro
mineralization in bovine tooth germ cell cultured with sintered
hydroxyapatite. Journal of Materials Science: Materials in Medicine, 4(6),
569574.
Allori, A. C., Sailon, A. M., & Warren, S. M. (2008). Biological basis of bone
formation, remodeling, and repair-part II: extracellular matrix. Tissue
Engineering Part B: Reviews, 14(3), 275283.
Altankov, G., & Groth, T. (1994). Reorganization of substratum-bound bronectin
on hydrophilic and hydrophobic materials is related to biocompatibility.
Journal of Materials Science: Materials in Medicine, 5(9-10), 732737.
Bissoyi, A., Pramanik, K., Panda, N. N., & Sarangi, S. (2014). Cryopreservation of
hMSCs seeded silk nanobers based tissue engineered constructs. Cryobiology,
68(3), 332342.
Biswas, A., Pramanik, K., & Jonnalagadda, S. (2014). Enhanced osteogenic potential
of human mesenchymal stem cells on electrospun nanobrous scaffolds
prepared from eri-tasar silk broin. Journal of Biomedical Materials Research
Part B: Applied Biomaterials.
Cao, W., & Hench, L. L. (1996). Bioactive materials. Ceramics International, 22(6),
493507.
Chahal, S., Hussain, F. S. J., Kumar, A., Yusoff, M. M., & Rasad, M. S. B. A. (2015).
Electrospun hydroxyethyl cellulose nanobers functionalized with calcium
phosphate coating for bone tissue engineering. RSC Advances, 5(37),
2949729504.
Chen, J.-P., Chen, S.-H., & Lai, G.-J. (2012). Preparation and characterization of
biomimetic silk broin/chitosan composite nanobers by electrospinning for
osteoblasts culture. Nanoscale Research Letters, 7(1), 111.
El-Ghannam, A., Ducheyne, P., Risbud, M., Adams, C., Shapiro, I., Castner, D., et al.
(2004). Model surfaces engineered with nanoscale roughness and RGD
tripeptides promote osteoblast activity. Journal of Biomedical Materials
Research Part A, 68(4), 615627.
Fratzl, P., Gupta, H., Paschalis, E., & Roschger, P. (2004). Structure and mechanical
quality of the collagen-mineral nano-composite in bone. Journal of Materials
Chemistry, 14(14), 21152123.
Ghanbarzadeh, B., & Almasi, H. (2011). Physical properties of edible emulsied
lms based on carboxymethyl cellulose and oleic acid. International Journal of
Biological Macromolecules, 48(1), 4449.
Ghasemi-Mobarakeh, L., Morshed, M., Karbalaie, K., Fesharaki, M., Nasr-Esfahani,
M. H., & Baharvand, H. (2008). Electrospun poly(-caprolactone) nanober mat
as extracellular matrix. Yakhteh Medical Journal, 10(3), 179184.
Gombotz, W. R., & Wee, S. F. (2012). Protein release from alginate matrices.
Advanced Drug Delivery Reviews, 64, 194205.
Gregory, C. A., Gunn, W. G., Peister, A., & Prockop, D. J. (2004). An alizarin red-based
assay of mineralization by adherent cells in culture: comparison with
cetylpyridinium chloride extraction. Analytical Biochemistry, 329(1), 7784.
Greish, Y., & Brown, P. (2001). Chemically formed HAp-Ca poly(vinyl phosphonate)
composites. Biomaterials, 22(8), 807816.
Groth, T., & Altankov, G. (1996). Studies on cell-biomaterial interaction: role of
tyrosine phosphorylation during broblast spreading on surfaces varying in
wettability. Biomaterials, 17(12), 12271234.
Ha, S.-W., Park, Y. H., & Hudson, S. M. (2003). Dissolution of bombyx m ori silk
broin in the calcium nitrate tetrahydrate-methanol system and aspects of
wet spinning of broin solution. Biomacromolecules, 4(3), 488496.

Heinze, T., & Heinze, U. (1997). The rst approach to non-aqueous solutions of
carboxymethylcellulose. Macromolecular Rapid Communications, 18(12),
10331040.
Holland, C., Terry, A., Porter, D., & Vollrath, F. (2006). Comparing the rheology of
native spider and silkworm spinning dope. Nature Materials, 5(11), 870874.
Itagaki, H., Tokai, M., & Kondo, T. (1997). Physical gelation process for cellulose
whose hydroxyl groups are regioselectively substituted by uorescent groups.
Polymer, 38(16), 42014205.
Jiang, H., Zuo, Y., Zou, Q., Wang, H., Du, J., Li, Y., et al. (2013). Biomimetic
spiral-cylindrical scaffold based on hybrid
chitosan/cellulose/nano-hydroxyapatite membrane for bone regeneration. ACS
Applied Materials & Interfaces, 5(22), 1203612044.
Ju, H. W., Lee, O. J., Moon, B. M., Sheikh, F. A., Lee, J. M., Kim, J.-H., et al. (2014). Silk
broin based hydrogel for regeneration of burn induced wounds. Tissue
Engineering and Regenerative Medicine, 11(3), 203210.
Ki, C. S., Park, S. Y., Kim, H. J., Jung, H.-M., Woo, K. M., Lee, J. W., et al. (2008).
Development of 3-D nanobrous broin scaffold with high porosity by
electrospinning: implications for bone regeneration. Biotechnology Letters,
30(3), 405410.
Kokubo, T., Kim, H.-M., & Kawashita, M. (2003). Novel bioactive materials with
different mechanical properties. Biomaterials, 24(13), 21612175.
Kundu, J., Mohapatra, R., & Kundu, S. (2011). Silk broin/sodium
carboxymethylcellulose blended lms for biotechnological applications.
Journal of Biomaterials Science-Polymer Edition, 22(46), 519539.
Lai, G.-J., Shalumon, K., & Chen, J.-P. (2015). Response of human mesenchymal
stem cells to intrabrillar nanohydroxyapatite content and extrabrillar
nanohydroxyapatite in biomimetic chitosan/silk broin/nanohydroxyapatite
nanobrous membrane scaffolds. International Journal of Nanomedicine, 10,
567.
Li, D., Sun, H., Jiang, L., Zhang, K., Liu, W., Zhu, Y., et al. (2014). Enhanced
biocompatibility of PLGA nanobers with gelatin/nano-hydroxyapatite bone
biomimetics incorporation. ACS Applied Materials & Interfaces, 6(12),
94029410.
Liu, X., Smith, L. A., Hu, J., & Ma, P. X. (2009). Biomimetic nanobrous
gelatin/apatite composite scaffolds for bone tissue engineering. Biomaterials,
30(12), 22522258.
Lu, Q., Huang, Y., Li, M., Zuo, B., Lu, S., Wang, J., et al. (2011). Silk broin
electrogelation mechanisms. Acta Biomaterialia, 7(6), 23942400.
X.-F., Zhang, Wang, Y.-Y., Ortiz, L., Mao, X., Jiang, Z.-L., et al. (2013). Effects of
Lu,
hydroxyapatite-containing composite nanobers on osteogenesis of
mesenchymal stem cells in vitro and bone regeneration in vivo. ACS Applied
Materials & Interfaces, 5(2), 319330.
Ma, P. X., & Zhang, R. (1999). Synthetic nano-scale brous extracellular matrix.
Journal of Biomedical Materials Research, 46, 6072.
Meinel, L., Fajardo, R., Hofmann, S., Langer, R., Chen, J., Snyder, B., et al. (2005). Silk
implants for the healing of critical size bone defects. Bone, 37(5), 688698.
Minoura, N., Tsukada, M., & Nagura, M. (1990). Fine structure and oxygen
permeability of silk broin membrane treated with methanol. Polymer, 31(2),
265269.
Miyamoto, T., i, T. S., Ito, H., Inagaki, H., & Noishiki, Y. (1989). Tissue
biocompatibility of cellulose and its derivatives. Journal of Biomedical Materials
Research, 23(1), 125133.
Nguyen, K. T., & West, J. L. (2002). Photopolymerizable hydrogels for tissue
engineering applications. Biomaterials, 23(22), 43074314.
Ochi, A., Hossain, K. S., Magoshi, J., & Nemoto, N. (2002). Rheology and dynamic
light scattering of silk broin solution extracted from the middle division of
Bombyx mori silkworm. Biomacromolecules, 3(6), 11871196.
Omenetto, F. G., & Kaplan, D. L. (2010). New opportunities for an ancient material.
Science, 329(5991), 528531.
Pramanik, N., Mishra, D., Banerjee, I., Maiti, T. K., Bhargava, P., & Pramanik, P.
(2009). Chemical synthesis, characterization, and biocompatibility study of
hydroxyapatite/chitosan phosphate nanocomposite for bone tissue
engineering applications. International Journal of Biomaterials, 2009.
Ritcharoen, W., Supaphol, P., & Pavasant, P. (2008). Development of polyelectrolyte
multilayer-coated electrospun cellulose acetate ber mat as composite
membranes. European Polymer Journal, 44(12), 39633968.
Rockwood, D. N., Preda, R. C., Ycel, T., Wang, X., Lovett, M. L., & Kaplan, D. L.
(2011). Materials fabrication from Bombyx mori silk broin. Nature Protocols,
6(10), 16121631.
Rodrguez, K., Sundberg, J., Gatenholm, P., & Renneckar, S. (2014). Electrospun
nanobrous cellulose scaffolds with controlled microarchitecture.
Carbohydrate Polymers, 100, 143149.
Rungsiyanont, S., Dhanesuan, N., Swasdison, S., & Kasugai, S. (2011). Evaluation of
biomimetic scaffold of gelatin-hydroxyapatite crosslink as a novel scaffold for
tissue engineering: biocompatibility evaluation with human PDL broblasts,
human mesenchymal stromal cells, and primary bone cells. Journal of
Biomaterials Applications, 0885328210391920.
Sah, M., & Pramanik, K. (2010). Regenerated silk broin from B. mori silk cocoon for
tissue engineering applications. International Journal of Environmental Science
and Development, 1(5), 404408.
Salama, A., Abou-Zeid, R. E., El-Sakhawy, M., & El-Gendy, A. (2015). Carboxymethyl
cellulose/silica hybrids as templates for calcium phosphate biomimetic
mineralization. International Journal of Biological Macromolecules, 74, 155161.
Santin, M., Motta, A., Freddi, G., & Cannas, M. (1999). In vitro evaluation of the
inammatory potential of the silk broin. Journal of Biomedical Materials
Research, 46(3), 382389.

B.N. Singh et al. / Carbohydrate Polymers 151 (2016) 335347

Singh, B., Panda, N., & Pramanik, K. (2016). A novel electrospinning approach to
fabricate high strength aqueous silk broin nanobers. International Journal of
Biological Macromolecules, 87, 201207.
Stan, G. (2009). Adherent functional graded hydroxylapatite coatings produced by
sputtering deposition techniques. Journal of Optoelectronics and Advanced
Materials, 11(8), 11321138.
Suchanek, W., & Yoshimura, M. (1998). Processing and properties of
hydroxyapatite-based biomaterials for use as hard tissue replacement
implants. Journal of Materials Research, 13(01), 94117.
Tanaka, K., Kajiyama, N., Ishikura, K., Waga, S., Kikuchi, A., Ohtomo, K., et al. (1999).
Determination of the site of disulde linkage between heavy and light chains
of silk broin produced by Bombyx mori. Biochimica Et Biophysica Acta
(BBA)-Protein Structure and Molecular Enzymology, 1432(1), 92103.
Um, I. C., Kweon, H., Park, Y. H., & Hudson, S. (2001). Structural characteristics and
properties of the regenerated silk broin prepared from formic acid.
International Journal of Biological Macromolecules, 29(2), 9197.
Varma, H., & Babu, S. S. (2005). Synthesis of calcium phosphate bioceramics by
citrate gel pyrolysis method. Ceramics International, 31(1), 109114.

347

Wang, W., & Wang, A. (2010). Nanocomposite of carboxymethyl cellulose and

attapulgite as a novel pH-sensitive superabsorbent: synthesis, characterization
and properties. Carbohydrate Polymers, 82(1), 8391.
Whistler, R. (2012). Industrial gums: polysaccharides and their derivatives. Elsevier.
Zahedi, P., Rezaeian, I., Ranaei-Siadat, S. O., Jafari, S. H., & Supaphol, P. (2010). A
review on wound dressings with an emphasis on electrospun nanobrous
polymeric bandages. Polymers for Advanced Technologies, 21(2), 7795.
Zhang, F., Zuo, B., Fan, Z., Xie, Z., Lu, Q., Zhang, X., et al. (2012). Mechanisms and
control of silk-based electrospinning. Biomacromolecules, 13(3), 798804.
Zhou, C.-Z., Confalonieri, F., Medina, N., Zivanovic, Y., Esnault, C., Yang, T., et al.
(2000). Fine organization of Bombyx mori broin heavy chain gene. Nucleic
Acids Research, 28(12), 24132419.
Zhou, C., Chu, R., Wu, R., & Wu, Q. (2011). Electrospun polyethylene oxide/cellulose
nanocrystal composite nanobrous mats with homogeneous and
heterogeneous microstructures. Biomacromolecules, 12(7), 26172625.
Zhu, J., Zhang, Y., Shao, H., & Hu, X. (2008). Electrospinning and rheology of
regenerated Bombyx mori silk broin aqueous solutions: the effects of pH and
concentration. Polymer, 49(12), 28802885.