Continuous Process Dynamics, Stability, Control and Automation (2015)

CHEMICAL ENGINEERING METHODS AND TECHNOLOGY
CONTINUOUS PROCESS
DYNAMICS, STABILITY, CONTROL
AND AUTOMATION
No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or
by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no
expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of information
contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in
rendering legal, medical or any other professional services.
CHEMICAL ENGINEERING METHODS

AND TECHNOLOGY
Additional books in this series can be found on Novas website
under the Series tab.
Additional e-books in this series can be found on Novas website

under the e-book tab.
CHEMICAL ENGINEERING METHODS AND TECHNOLOGY
CONTINUOUS PROCESS
DYNAMICS, STABILITY, CONTROL
AND AUTOMATION
KAL RENGANATHAN SHARMA
New York
Copyright 2015 by Nova Science Publishers, Inc.

All rights reserved. No part of this book may be reproduced, stored in a retrieval system or
transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical
photocopying, recording or otherwise without the written permission of the Publisher.
For permission to use material from this book please contact us:
nova.main@novapublishers.com
NOTICE TO THE READER

The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or
implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of
information contained in this book. The Publisher shall not be liable for any special,
consequential, or exemplary damages resulting, in whole or in part, from the readers use of, or
reliance upon, this material. Any parts of this book based on government reports are so indicated
and copyright is claimed for those parts to the extent applicable to compilations of such works.
Independent verification should be sought for any data, advice or recommendations contained in
this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage
to persons or property arising from any methods, products, instructions, ideas or otherwise
contained in this publication.
This publication is designed to provide accurate and authoritative information with regard to the
subject matter covered herein. It is sold with the clear understanding that the Publisher is not
engaged in rendering legal or any other professional services. If legal or any other expert
assistance is required, the services of a competent person should be sought. FROM A
DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE
AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS.
Additional color graphics may be available in the e-book version of this book.
LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA
Continuous process dynamics, stability, control and automation / editors, Kal Renganathan Sharma.
pages cm. -- (Chemical engineering methods and technology)
Includes index.
ISBN: (eBook)
1. Chemical process control. I. Sharma, Kal Renganathan.
TP155.75.C665 2014
660'.2815--dc23
2014044403
Published by Nova Science Publishers, Inc. New York
To my eldest son, R. Hari Subrahmanyan Sharma (alias Ramkishan)

who turned thirteen on August 13th 2014
CONTENTS
Preface
ix
About the Author
xvii
Book Description
xix
Chapter 1
Introduction
Chapter 2
Continuous Polymerization Process Technology
33
Chapter 3
Mathematical Process Models
59
Chapter 4
Continuous Process Dynamics
249
Chapter 5
Proportional, Proportional Integral, Proportional Derivative

Feedback Control
323
Chapter 6
Frequency Response Analysis
369
Chapter 7
Advanced Control Methods
393
Chapter 8
Pharmacokinetic Analysis
487
Chapter 9
Instruments
527
Chapter 10
Nanorobots in Nanomedicine
545
Index
577
PREFACE
Automation came about after mechanization. Chemical process control is a subset of the
field of automation theory and practice. AIChE, American Institute of Chemical Engineers,
New York, NY recently celebrated their centennial or 100th anniversary in 2008. Both the CPI
and the industrial controls market size is increasing. Process Control as a required course in
the chemical engineering degree plan in a number of US universities came out in the late 60s
or 70s. I instruct CHEG 4033 Process Dynamics and Control, MCEG 3073 Automatic
Controls and MCEG 3193 Introduction to Robotics, CHEG 3043 Equilibrium Staged
Separations, ELMT 2043 Industrial Electronics etc. I have served as the chairman of
Continuous Mass Club: Technical Community of Monstanto Minichapter between 19901993. This book is a natural outgrowth of these scholarly and research activities. A modern
textbook is proposed that keeps pace with the progress in personal computing resources
available to the student these days. Emphasis is placed on industrial application over rosy
predictions. For instance, ideal PID control, proportional integral derivative control is not
physically realizable. The competition of this book has a entire chapter devoted to PID
control. Filters have to be added and then it is longer PID, it becomes FPID, filtered PID
control! Discussions on overshoot is in excess of its occurrence in real applications. A careful
scrutiny of overshoot can lead to the conclusion that it is more a mathematical artifact and
less a engineering possibility It can be shown that overshoot per se violates second law of
thermodynamics.. This book is more focused on the applications rather than on tuning and
elloborate algebra. Calculus, Laplace transforms and other mathematical methods are used
when necessary. A entire chapter is devoted to pharmacokinetic studies. Discussions on life
systems draws the student attention more than hypothetical mathematical exercises. A entire
chapter is devoted to control of robots. Advances made in nanorobots are also discussed in a
separate chapter. Separate Chapters are devoted to mathematical models and process
dynamics.
Lessons in control are drawn from Trommsdorf effect, thermal wear design, 2 arm
manipulator, Fukushima earthquake and deepwater horizon oil spill.
Mathematical models can be used where pilot plant data is not available for scale-up.
trouble shooting and in globalization. Process models can be classified as: A. Simulations
from the Computer; B. Semi-Empirical Models; C. Mechanistic Models; D. Shell Balance
Models; E. State Space Models; F. Dimensionless groups; G. Stochastic Models; H.
Thermodynamic Analysis; I. Optimization Studies; J. Engineering Analysis and; K.
Molecular Basis for Consitutive Laws. State space models can be used to describe a set of
Kal Renganathan Sharma
variables in vector form in terms of matrix equations. The stability of the system can be
studied using Eigenvalues and Eigenvector analysis. A scheme of 7 simultaneous simple
irreversible reactions were considered. The state space model to describe this system is given
by Eq. (2.90). This system can be viewed as an integrating system since all but Eigenvalues
are negative with 4 Eigenvalues 0 The composition of a copolymer as a function of
comonomer composition, reactivity ratios and reactor choice were derived from the kinetics
of free radical initiation, propagation and termination reactions. The copolymerization
equation is obtained using the QSSA quasi-steady-state approximation. As an example,
copolymer composition with 4 monomers as a function of monomer composition made in
CSTR is illustrated 1 The copolymer composition is sensitive to reactivity ratios to a
considerable extent. The copolymer composition equation for a multi-component copolymer
with n monomers were derived. This methodology was generalized for n monomers. The
general form of the equation was represented in the matrix form using linear algebra. The rate
matrix and rate equation are given. The QSSA can be written in the vector notation. When the
Eigen values of the rate equation become imaginary the monomer concentration can be
expected to undergo subcritical damped oscillations as a function of time.
The occurrence of multiplicity in model solutions was illustrated by calculation of launch
angle of stream of water during firefighting and elbow-up and elbow down solutions in the
solution of inverse kinematics of a 3 arm manipulator with end effector (robot) and for a
copolymer for certain values of reactivity ratios.
Use and significance of dimensionless groups such as Reynolds number, Prandtl number,
Biot number, Nusselt number, Mach number, Fourier number, Fick number, Newton number,
Maxwell number (mass), Venrnotte number, Sharma number (mass), Maxwell number
(momentum), Sherwood number, Shcmidt number, storage number/Sharma number (heat),
Peclect number were discussed. Weiner-Hopf integral equation can be used to estimate the
effects of mixing in a CSTR, contiuous stirred tank reactor. This can be done by estimating
the degree of mixedness from the variance in SPC, statistical process control charts. The
compositional distribution of AN in copolymer can be used as input. J is minimized with
respect to and the Weiner-Hopf integral equation is obtained. Groot and Warren developed
a mesoscopic simulation tool. Molecules are treated as spherical objects that can obey the
Newtons laws of motion. Physical properties and EOS of polymeric substances were
obtained from this analysis. Conservative, dissipative and random forces were taken into
account. In the canonical ensemble, the Gibbs-Boltzmann distribution can seen to be the
solution to the Fokker Planck equation.
The transient conversion in a PFR, plug flow reactor was derived. For a reaction of first
order assuming that the conversion is analytic in space and time the governing equation can
be shown to be of the hyperbolic type. For the zeroth order reaction the governing equation
was found to be a wave equation! The hyperbolic PDEs can be solved for using the methods
of relativistic transformation of coordinates leading to modified Bessel composite function
solution, method of separation of variables and method of Laplace transforms. Numerical
solution procedures can be used when the equations become nonlinear such as in the case of
free radical polymerization reactions.
Transient analysis of Denbeigh scheme of reactions, first order reversible reactions,
autocatalytic reactions, second order reversible reactions, reactions in series, Michaelis and
Menten kinetics, reactions in circle kinetics are discussed in detail. The transient
concentration of oxygen during diffusion and reaction in islets of Langerhaans are also
Preface
xi
discussed in detail. The conditions where the concentration can undergo underdamped
oscillations were derived. The use of final time condition and physically reasonable energy
balance considerations can lead to solutions that are bounded and within the scope of the
second law of thermodynamics. The temperature profile in a PFR is also obtained. Energy
balance under transient conditions are used in the analysis
Transient dynamics of concentration, temperature separately and concentration and
temperature both in a CSTR were discussed. The dimensionless group called Damkohler
number in addition to conversion, dimensionless time, residence time were used to describe
the transient output response from a CSTR. The hydrolysis reaction of ethylene oxide to
ethylene glycol was considered in a CSTR. For incompressible flow and for a constant
volume system the steady state and transient conversion were derived. The transient model
solution is given. The conversion of ethylene oxide as a function of dimensionless time
contoured at various values of Damkohler number are displayed CSTR with recycle was
considered.
The transient temperature in a mixing tank that is heated is given. A fourth order RungeKutta method was used for numerical integration of the ODE, ordinary differential equation.
Temperature vs. Time in reactor as response to a step change in input is obtained and
displayed. A state space model was developed to describe a jacketed CSTR. The output
variables of interest are dimensionless conversion, dimensionless temperature and is give. If
all of the Eigenvalues of the state space A matrix are negative then the system is expected to
be stable. A system with one Eigenvalue zero and one Eigenvalue negative is called an
integrating system. If the Eigenvalues are complex conjugates the system is considerd
oscillatory. Sometimes the oscillatory output response may be subcritical and damped,
underdamped or critically damped. The stability type and characterization of stability for
each of these cases are given in Table 4.3.
The transient concentration of initiator and monomer during free radical polymerization
in a CSTR was obtained. DaI, Damkohler number (initiator) and DaM, Damkohler number
(monomer) were introduced. The steady state conversions were obtained as a function of the
Damkohler number. Equation used to describe the transient conversion of monomer is nonlinear. The conversion of initiator and monomer as a function of time is displayed in Figure
4.9. Multiplicity was found in model solution of conversion of monomer. Conversion of
initiator was monotonic. It can be seen from Figure 4.9 for the parameters used in the
simulation study the transient conversion of monomers undergoes a maximum value.
The general form of prototypical first order and prototypical second order system were
provided. The first order process is characterized by process gain constant, kp and process
time constant, p. The second order process is characterized by the process gain, kp, damping
coefficient, and process time constant, p. When the damping coefficient, > 1 the system is
overdamped, when = 1 the system is said to be critically damped and when < 1 the system
is expected to undergo a overshoot and is said to be underdamped oscillatory.
The use of on-off controller in CHP, combined heat and power system was discussed in
detail. On-off controllers are used to shut down the system when output variable is greater
than the desired limit. The system is turned back on when the output variable is lower than
desired limits. Control action that is proportional to the error measured is called P only,
proportional only controllers. Off-set is seen in P only controllers. PI, proportional integral
xii
control is devised to get rid of the offset. The control action is proportional to the integral of
the error generated from initial time to a given instant in time.
In Example 5.1, the PI control action for prototypical first order process was discussed.
The output function to a step change in input was obtained by inversion of Laplace transform
expressions. A closed loop transfer function GCL(s) was derived for the combined system. The
conditions when the system will exhibit an overshoot are derived. In Example 5.2 the closed
loop transfer function of a hybridized feed forward and feedback control loop was obtained.
How the blocks in a control block diagram can be simplified was illustrated. In Example 5.3,
PI control of voltage supplied to automatic washing machine was discussed. A Toshiba patent
discussed such a machine. Although the model equation predicts the relation between the
rotor speeds with the applied torque, there is no model available for applied voltage on the
motor and the applied torque. The controller will have to increase the voltage or decrease the
voltage, check the angular speed against set point sp and adjust the voltage again till that set
point angular speed is attained. PI controller was used. The closed loop transfer function
GCL(s) was derived. Conditions for instability was when Gp(s)Gc(s) >> -1. The conditions for
underdamped oscillatory conditions to arise during PI control of prototypical first order
process were when;
Where I is the time constant of PI controller, p is the time constant of prototypical first
order process, kc is the controller gain constant and kp is the process gain constant.
During PD control, proportional derivative control, the action taken is proportional to the
derivative of the error between the measurement and set point.
Ideal PID control is not realizable due to the numerator dynamics. The order of the
polynomial P(s) is greater than the order of the polynomial in the denominator Q(s) in the
controller transfer function. As will be discussed later, a filter of nth order can be added to
make the PID controller physically realizable.
The PI control of concentration during hydrolysis of ethylene oxide was discussed in
Example 5.4. The output transfer function y(s) is given by Eq. (5.73). The conditions for
underdamped response can be seen to be;
The output transfer function for a system with PD control of prototypical first order
process is given by Eq. (5.79). The output function, y(t) is given by Eq. (5.84). For any value
of the tie constants and gains of the process and controller the output is stable and has a
monotonic exponential decay. In Example 5.5 the PD control of concentration during the
formation of ethylene glycol in a CSTR by hydrolysis process was discussed. The conditions
for underdamped response are given by Eq. (4.93).
PI control of concentration during formation of intermediate during reactions in series
was discussed in Example 5.6. The stability of this system of PI control of intermediate
product yield of chloroform, CHCl3 can be determined from the poles of Eq. (5.74). As the
order of the polynomial in the denominator is increased beyond quadratic, cubic closed form
analytical solutions are not possible. Numerical solutions are needed to obtain a solution of
the polynomial of higher degrees. Routh stability criteria can be used to analyze the stability
of systems such as the one encountered here. Conditions for instability were derived and
displayed.
Tyreus-Luyben oscillation based tuning was found to make the system less oscillatory for
the parameters chosen. There are three important tuning parameters in PID control action.
These are: (i) the control gain constant, kc; (ii) integral time constant, I; (iii) derivative time
Preface
xiii
constant, D. An algorithmic or trial and error approach can be used for obtaining optimal
results from tuning the controller. The tuning of PID control was developed by Ziegler and
Nichols [5]. This method is not widely used in the industry because the closed loop behavior
tends to be oscillatory and sensitive to errors. The Tyreus-Luyben tuning parameters for PI
and PID control are given in Table 5.1.
Closed loop stability analysis is discussed for a number of systems such as: (i) PI control
of prototypical first order process; (ii) PI control of prototypical second order underdamped
and overdamped processes; (iii) PI control of prototypical third order process; (iv) PI control
of Integrating Stable Systems; (v) PI control of marginally stable systems; (vi) PI control of
systems that make a center and/or saddle pointl (vii) Best control strategy for systems with
inverse response; (viii) P, PD, PI control for jacketed exothermic CSTR; (ix) P, PD, PI
control for exothermic PFR; (x) P control of polymerization kettle; (xi) P control of CSTR
with recyle and PFR with recyle; (xii) Best Control Strategy for Systems with Dead Time;
(xiii) Feedback control during semiconductor processing; (xiii) Systems with periodic
disturbance; (xiv) Optimization and control of intermediate product in reactions in series with
first first order and second zeroth order, first with zeroth order and second with first order,
both first and second first order; (xv) PI control of intermediate species in Denbeigh scheme
of reactions; (xvi) Best control strategy for PCR, polymerase chain reactions; (xvii) Best
control strategy for systems that obey Michaelis and Menten kinetics; (xviii) Best control
strategy for systems that obey reactions in circle kinetics.
The mathematical models, experimental trials and computer simulations that are
undertaken to study the change of concentration of drug or other compounds of interest with
time in the human physiology is called Pharmacokinetics. Application of pharmacokinetics
allows for the processes of liberation, absorption, distribution, metabolism and excretion to be
characterized mathematically. The absorption of drug can be affected by 14 different
methods. The change with time of the concentration of the drug can be by three different
types as shown in Figure 8.1: i) Slow absorption (A); ii) maxima and rapud bolus (B); iii)
constant rate delivery (C). Pharmacokinetics studies can be performed by 5 different methods
including compartment methods. The five different methods are non-compartment method,
compartment method, bioanalytical method, mass spectrometry and population
pharmacokinetic methods.
The factors that affect how a particular drug is distributed throughout the anatomy are: i)
rate of blood perfusion; ii) permeability of capillary; iii) biological affinity of drug; iv) rate of
metabolism of drug and; v) rate of renal extraction. Drugs may bind to proteins sometimes.
Single compartment models were developed for:
i) first-order absorption with elimination; ii) fourth order absorption with elimination;
(iii) second order absorption with elimination; iv) Michaelis-Menten absorption with
elimination and; v) Reactions in circle Absorption with elimination. A system of n simple
reactions in circle was considered. The conditions when subcritical damped oscillations can
be expected are derived. A model was developed for cases when absorption kinetics exhibit
subcritical damped oscillations can be expected. The solution was developed by the method
of Laplace transforms. The solution for dimensionless concentration of the drug in single
compartment for different values of rate constants and dimensionless frequency are shown in
Figures 8.10 Figures 8.14. The drug profile reaches a maximum and drops to zero
concentration after a said time. The fluctuations in concentration depends on the
dimensionless frequency resulting from the subcritical damped oscillations during absorption.
xiv
At low frequencies the fluctuations are absent. As the frequency is increased the fluctuations
in concentration are pronounced. The frequency of fluctuations were found to increase with
increase in frequency of oscillations during absorption.
A two-compartment model for absortion with elimination is shown in Figure 7.15. The
concentration that has diffused to the tissue region in the human anatomy is also accounted
for in addition to the concentration of drug in the blood plasma. The model equation for
concentration of drug in the tissue is found to be a ODE of the second order with constant
coefficients (8.79). The model solution is given in Eq. (8.81) and obtained by the method of
complementary function and particular integral.
Software has been developed for rhe implementation of the pharmacokinetic models on
the personal computer.
Ratio control is used in keeping the reactor adiabatic during the manufacture of flue gas.
Heat of reactions from Boudard reaction and oxidation of carbon reactions are made to cancel
out each other by control of the ratio of the CO2/air mixture. SPC, statistical process control
methods are discussed including Demings quality principles, QIT, quality improvement
teams. IMC, internal model control uses the mathematical model developed for the process.
Perfect control is achieved when model transfer function, M(s) is the reciprocal of process
transfer function, Gp(s). A filter has to be added to make the system realizable. This keeps the
numerator of the transfer function of the combined system at a lower degree of polynomial
compared with the degree of the polynomial of the denominator of the transfer function of the
system. Inversion of a process model alone may not be sufficient for good control. In order
for the controller to be stable and realizable the process transfer function must be factorized.
Examples are given. In order to make M(s) proper the order of the filter in some cases is
increased.
A lead/lag controller was considered by use of a model based transfer function as given.
Inverse response is expected for the process. A first order filter was added to make the system
more proper. The order of the filter was increased to two. Feedforward control is different
from feedback control. During feedforward control the load or disturbance is measured or
gauged from other considerations and control action taken accordingly. Carrier corporation
has patented [11] a feedforward control system for absorption chillers. The feedforward
control method comprise of the following steps; (i) determine the disturbance transfer
function; (ii) determine the capacity valve transfer function; (iii) measure the occurred
disturbance; (iv) implement the feedforward control function. The block diagram for
feedforward control of absorption chillers is shown in Figure 7.11. An example of
feedforward controller for a resulation of fuel supply to a furnace was discussed.
Estimation and control of polymerization reactors was discussed. Control of
polymerization of reactors is a difficult task because of the exothermic nature of the
polymerization reactions and higher viscosities of monomer/polymer syrups encountered in
the reactor. The objective of the reactor control is to obtain superior product quality. Quality
is characterized by different parameters. Good structure-property relations are needed for
devising control strategies based on measurement of end-use property values. Technical
hurdles during the development of mathematical models for polymerization reactors are the
nonlinear equations encountered, sensitivity to impurities etc. Feedback control of a variable
is not possible if the parameter cannot be measured or estimated. In Figure 8.13 is shown the
scheme for possible feedback control configurations. The scheme comprises of state-model,
subsystem 1, subsystem 2 and the measurement equations. State estimation techniques have
Preface
xv
been developed to provide estimates of the state variables even in cases where they cannot be
obtained by direct measurement. Estimation techniques such as Kalman filter, Weiner filter
and extended Kalman filter may be used. In non-linear estimation problems the objective may
be to minimize the average squared errors in the initial estimate in the process model and in
measurement device.
Neural networks can be used to approximate any reasonable function to any degree of
required precision. Three different architectures for ANNs, artificial neural networks are
possible. The behavior of each unit in time can be described using either differential
equations or discrete update equations. The use of ANNs to control a distillation column is
discussed. Robotics is introduced. Mathematics used to describe positions and orientations in
3 dimensional space is reviewed. Kinematics of mechanical manipulators are discussed.
Forces, velocities and moments are discussed. Inverse kinematics of the manipulator with
both the geometric and algebraic methods of solution is outlines. Trajectory analysis of end
effector and control strategy for robots are outlined.
Submarine nanorobots are being developed for use in branchy therapy, spinal surgery,
cancer therapy, etc. Nanoparticles have been developed for use in drug delivery systems and
for cure in eye disorders and for use in early diagnosis. Research in nanomedicine is under
way in development of diagnostics for rapid monitoring, targeted cancer therapies, localized
drug delivery, and improved cell material interactions, scaffolds for tissue engineering and
gene delivery systems. Novel therapeutic formulations have been developed using PLGA
based nanoparticles. Nanorobots can be used in targeted therapy and in repair work of DNA.
Drexler and Smalley debated whether molecular assemblers that are devices capable of
positioning atoms and molecules for precisely defined reactions in any environment is
possible or not. Feynmans vision of miniaturization is being realized. Smalley sought
agreement that precision picking and placing of individual atoms through the use of Smalleyfingers is an impossibility. Fullerenes, C60, are the third allotropic form of carbon. Soccer
ball structured, C60, with a surface filled with hexagons and pentagons satisfy the Eulers law.
Fullerenes can be prepared by different methods such as: (i) first and second generation
combustion synthesis; (ii) chemical route by synthesis of corannulene from naphthalene.
Rings are fused and the sheet that is formed is rolled into hemisphere and stitched together;
(iii) electric arc method. Different nanostructuring methods are discussed. These include: (1)
sputtering of molecular ions;(2) gas evaporation; (3) process to make ultrafine magnetic
magnetic powder; (4) triangulation and formation of nanoprisms by light irradiation ; (5)
nanorod production using condensed phase synthesis method; subtractive methods such as;
(6) lithography; (7) etching; (8) galvanic fabrication; (9) lift-off process for IC circuit
fabrication; (10) nanotips and nanorods formation by CMOS process; (11) patterning Iridium
Oxide nanostructures; (12) dip pen lithography; (13) SAM, self assembled monolayers; (14)
hot embossing; (15) nanoimprint lithography; (16) electron beam lithography; (17) dry
etching; (18) reactive ion etching; (19) quantum dots and thin films generation by; (20) sol
gel; (21) solid state precipitation; (22) molecular beam epitaxy; (23) chemical vapor
deposition; (24) CVD; (25) lithography; (26) nucleation and growth; (27) thin film formation
from surface instabilities; (28) thin film formation by spin coating;(29) cryogenic milling for
preparation of 100-300 nm sized titanium; (30) atomic lithography methods to generated
structures less than 50 nm; (31) electrode position method to prepare nanocomposite; (32)
plasma compaction methods; (33) direct write lithography; (34) nanofluids by dispersion.
Thermodynamic miscibility of nanocomposites can be calculated from the free energy of
xvi
mixing. The four thermodynamically stable forms of Carbon are diamond, graphite, C60,
Buckminster Fullerene and Carbon Nanotube. 5 different methods of preparation of CNTs,
carbon nanotubes were discussed. Thermodynamically stable dispersion of nanoparticles into
a polymeric liquid is enhanced for systems where the radius of gyration of the linear polymer
is greater than the radius of the nanoparticle. Tiny magnetically-driven spinning screws were
developed. Molecular machines are molecules that can with an appropriate stimulus be
temporarily lifted out of equilibrium and can return to equilibrium in the observable
macroscopic properties of the system. Molecular shuttle, molecular switches, molecular
muscle, molecular rotors, molecular nanovalves are discussed. Supramolecular materials
offers alternative to top-down miniaturization and bottom-up fabrication. Self-organization
principles holds the key. Gene expression studies can be carried out in biochips. CNRs are a
new generation of self-organizing collectives of intelligent nanorobots. This new technology
includes procedures for interactions between objects with their environment resulting in
solutions of critical problems at the nanoscopic level. Biomimetic materials are designed to
mimic a natural biological material. Characterization methods of nanostructures include
SAXS, small angle X-ray scattering, TEM, transmission electron microscopy, SEM, scanning
electron microscopy, SPM, scanning probe microscope, Raman microscope, AFM atomic
force miscroscopy, HeIM helium ion microscopy.
ABOUT THE AUTHOR

Dr. Kal Renganathan Sharma received his B.Tech. in chemical engineering from Indian
Institute of Technology, Chennai, India in1985 and MS and PhD in chemical engineering
from West Virginia University, Morgantown, WV in 1987 and 1990 respectively. He
underwent post doctoral research training at the lifesciences and microgravity space lab,
Clarkson University, Potsdam, NY under the guidance of former chair and Prof. R. Shankar
Subramanian. He completed an industrial post doctoral research training with Monsanto
Plastics Technology, Indian Orchad, MA. There he was told that he was on their fast track
to become a research fellow. He has obtained cash prizes for exemplary work from Monsanto
Plastics, Indian Orchad, MA, SASTRA University, Thanjavur, India and Prairie View A & M
University, Prairie View TX. As a naturalized US citizen he obtained a ministry of human
resources and development permit to serve as Professor at deemed universities in India.
He is sole author of 15 books and 7 book-chapters. Author of 53 Refereed Journal
Articles, 553 Conference papers and 113 other presentations. He has instructed 2930 students
in 109 courses. Service at HBCUs in this country, United States and deemed universities in
India. Editorial Board Member of 7 journals. Fellow of Indian Chemical Society. Whos Who
in America. Paper cited more than 300 times searcable by Google Scholar. Reviewed more
than 60 journal articles. Developed new course and books in emerging areas. One article on
reactions in circle in the open domain has been downloaded more than 1031 times and
another article on nanorobots has been downloaded more than 980 times.
In recent years, he has been instructing courses in the Houston, TX area at Texas
Southern University, Houston, TX, Lone Star College, North Harris, Houston, TX, Prairie
View A & M University, Prairie View, TX. Prior to that he served at SASTRA University,
Thanjavur, India, Vellore Institute of Technology, Vellore, India, George Mason University,
Faifax, VA and West Virginia University, Morgantown, WV. Titles held include Adjunct
Professor, Professor, Head, etc. He has a linked in profile at http://www.linkedin.
com/pub/kal-sharma/48/b69/466.
BOOK DESCRIPTION
Continuous Process Dynamics, Stability, Control and Automation is a modern first
course on process control, instruments, process dynamics and stability. MS Excel
spreadsheets are used in order to obtain solutions to non-linear equations when needed and
closed form analytical solutions where possible are obtained using Laplace transforms and
other methods. The solutions are presented in 210 figures and the book has 1319 equations.
With a industrial controls market size of about 150 billion dollars and a chemical process
industry market size of 3 trillion dollars the practioners can use this book to master techniques
of P, proportional, PI, Proportional Integral, PD, Proportional Derivative feedback control,
feedforword control, hybrid control, adaptive control, internal model control, ratio control,
filtered real proportional integral derivative control, ANNs, artificial neural networks, SPC,
statistical process control.
Control block diagrams are developed using MS Paint. Flavor for what is a continuous
process is given using 18 process flow diagrams. Be it a feedback control of temperature in a
mixing tank or a neural network design for a distillation column, the details and the big
picture are both given. Pioneers who made this area possible such as Maxwell, Galileo,
Sherwood, Levenspiel, Kalman, Laplace, Fermat, Damkholer, Newton, Fourier, Fick,
Michaelis, Menten, Monod, Staudinger, Ziegler, Natta, Flory, Peclect, Bode, Nyquist, Biot,
Bessel, Bernoulli (both father and son!), Euler, Stokes, Mach, Reynolds, Prandtl, Nusselt,
Weiner, Hopf, Clapeyron, Clausius, Lorenz, Krebs mentioned where their theories were used
in the analysis.
Coverage Includes:
Separate Chapters are devoted to Continuous Polymerization Process Tech nology,

Mathematical Models, Continuous Process Dynamics, Pharmacokinetics,
Instruments and Nanorobots
Multiplicity in Model solutions discussed with Examples
Eleven different modeling approaches are discussed: Computer Simulations, SemiEmpirical; Shell Balance; State Space Models; Dimensionless Groups; Stochastic;
Thermodynamic Analysis; Optimization Routines; Engineering Analysis and
Derivation of Constitutive Laws
Copolymer Composition with n monomers derived using State Space Models
xx
Control Lessons are drawn from Tormsdorff Effect, Regulation of Human

Anatomical Temperature, 3 arm mechanical manipulator, centralized heating and
cooling, Fukushima Earthquake, Deepwater Horizon Oil Spill
Side by Side Comparison of Reactor Dynamics of Initiatiated and Thermal
Polymerization
Side by Side Comparison of Reactor Dynamics of CSTRs in Series and CSTR
Dynamics of PFR and Wave Equation
Continuous Mass Polymerization Process for Polystyrene, HIPS, High Impact
Polystyrene, SAN, Styrene Acrylonitrile Copolymers, ABS, Acrylonirile, Butadiene
and Styrene, PMMA, Poly Methyl Methacrylate, SMA, Styrene Maleic Anhyride,
Condensation Processes for Nylon 6,6, Polyamide, Polyesters Gas Phase Catalytic
Processes for Polyolefins and Ethylene Propylene Copolymer described as
background
Selectivity in Yield of Biodiesel over Glycerol in Consecutive-Competitive
Reactions
Computer Simulation of Centrifugal Separation of High Volume Oil and Water
Control of Intermediate Yield of Chloroform during Chlorination Reactions in Series
Supply Chain Robotics, Camera Drones
Mathematical Artefact vs. Physically Reasonable Solution
Overshoot Phenomena
Frequency Analysis of Damped Wave Condution and Fourier Condution Equations
Reactions in Circle Kinetics
Michaelis and Menten Kinetics
Nanorobots in Photodynamic Therapy of Alzheimers Disease
Microwave Temperature Sensors, MEMS
9 different Viscometers
Pharmacokinetics of Styrene in Rats, Alchohol in Brain, Paclitaxel in cancer patients,
Single Compartment and Two Compartment Models
Subcritical Damped Oscillations
Taylor Series Solution, Runge Kutta Method, Closed Form Solutions
Intraocular Pressure
Control Example in Toshiba Washing Machine
Solar Aided Combined Cycle Power Plant
Continuous Pharmaceutical Production
Annular Plug flow Reactor for Single Layer Graphene Sheet Production
Kalman Estimation and Control of Polymerization Reactor
Bioartifical Pancreas
20 Different Specifications in Binary Distillation and Desktop Computer
Chapter 1
INTRODUCTION
1.1. INDUSTRIAL CONTROLS - MARKETS
The size of the worldwide market for industrial controls is expected to reach 150 billion
dollars by the year 2019. Continuous processes have been selected over batch operations.
Good reasons are lower cost, better product uniformity and sometimes result in less pollution
to the environment. Process dynamics can be studied using desktop computers. Proactive
process solutions can be offered. Stability analysis using a pencil and paper can lead to better
perspectives on the range of operation of the process variables. Control and automation have
grown tremendously with the advent of computers and programmable logic controllers, PLCs.
More attention is paid by the lead engineer to the Plant start-up and Plant shut-down
operations compared with steady-state operations of the plant. Transient analysis is not well
studied. Transient behavior of chemical reactors, distillation columns, absorption towers,
adsorption beds, extraction units and other unit operations needs to be better studied.
Collegiate education methods have to keep pace with the developments in the field of
industrial controls. Moores law states that computing speed of microprocessors double every
18 months. Biological databanks double in size every 10 months. Mathematical methods for
model development have been refined over centuries. The methods and means available to the
engineer need be better utilized. Computer simulation and model development can be an
integral part of an engineers endeavors. The days when the effect of professionals who do
mathematical modeling and computer simulation on the bottom line of the enterprise is only
indirect are over. In the coming era the PW, Present Worth of chemical plants shall be higher
because of the value added by an army of engineers and Ph.D. scholars who perform process
dynamics studies and develop process models. They also develop control block diagrams,
instrument the chemical plant with sensors and connect the sensor output using data
acquisition to the desktop computer.
1.1.2. Chemical Process Industry

Over 70,000 different products are manufactured in the chemical process industry. Be it
batch or continuous process for production the CPI is in constant need for control engineers,
specialists who understand the dynamics, stability of different unit operations and processes.
Automation is an identified goal in recent years. The size of CPI is estimated at 3 trillion US
dollars. Depending on the boom and bust cycles of the economy the growth rate of CPI is a
fraction of the GDP. The fraction is about 0.87. The first product made since industrial
revolution was sulfuric acid. The lead chambers process was the industrial standard for two
centuries. The largest volume product made today is polyethylene. The CPI is a science based
industry.
The performance of the CPI in a given year depends on a number of factors. In 2013,
cheap shale gas and a robust economy gave chemical producers a lift in terms of raw
materials costs, utility costs, labor costs, tax and tariffs and interest on debt payments.
President has urged Congress to increase the minimum wage rate for labor to $10.10 per hour.
In Table 1.1 is listed the top 20 chemical producers in United States ranked by sales. Their
assets are also provided. The products from the CPI include inorganic chemicals, plastics and
petrochemicals, drugs and pharmaceuticals, soaps and detergents, paints and allied products,
organic chemicals and phosphates, agricultural chemicals and miscellaneous chemicals.
1.2. EXAMPLES OF CONTROL APPLICATIONS

Here are some examples of why continuous process dynamics, stability, control and
automation are important.
1.2.1. Supply Chain Robots

By the year 2019, the industrial controls market and industrial robotics market is
expected to reach $147.7 billion worldwide. According to the market report prepared by
Transparency market research in 2012 the size of the market is $102.2 billion. This would
mean a compound annual growth rate of the industry, CGAR of 5.6% between 2013-2019.
The largest end user is the automotive followed by the semi-conductor industry. The
shipments of industrial robots in North America in the year 2000 were close to $1.02 billion.
The discrepancy in the amount from $1.02 billion to $102.2 billion may be because of; (i)
rapid growth rate and; (ii) differences in which machines that counts as robots amongst
different regions of the world. Japan for example counts some machines as robots that in
other parts of the world they do not.
Industrial robot was recognized as a unique device in the 1960s. CAD. Computer-aided
design, computer aided manufacturing, CAM systems, sensors, controllers hooked to
computers using data acquisition are emerging trends in industrial automation. The definition
of an industrial robot according to Information Standards Organization (ISO) in standard
ISO/TR/8373-2.3 is the following:
A robot is an automatically controlled, reprogrammable, multipurpose, manipulating
machine with several programmable axes, which may be either fixed in place or mobile for
use in industrial automation applications.
Introduction
Table 1.1. Top 20 by Chemical Sales in this Country, United States
Rank
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Company
Dow Chemical, Midland, MI

ExxonMobil, Irving, TX
DuPont, Wilmington, DE
PPG Industries, Pittsburgh, PA
Chevron Phillips, The Woodlands, TX
Praxair, Danbury, CT
Huntsman, Salt Lake City, UT
Mosaic, Plymouth, MN
Air Products, Allentown, PA
Eastman Chemical, Kingsport, TN
Honeywell, Morristown, NJ
Celanese, Irving, TX
Ecolab, St. Paul, MN
Lubrizol, Wickliffe, OH
Ashland, Covington, KY
Dow Corning, Midland, MI
CF Industries, Deerfield, IL
Trinseo, Berwyn, PA
Momentive Specialty Chemicals, Columbus, OH
Occidental Petroleum, Los Angeles, CA
Chemical
Sales
(Billions of
US $)
57.1
39.0
31.0
14.0
13.1
11.9
11.1
10.0
9.7
9.4
6.8
6.5
6.5
6.4
5.8
5.7
5.5
5.3
4.9
4.6
Assets of
the
Company
(Billions of
US $)
69.5
27.5
18.1
11.9
10.5
20.3
9.2
18.1
16.2
11.8
6.8
9.0
19.6
10.0
9.3
12.3
10.7
2.6
2.9
3.9
Per the Robotic Institute Association an industrial robot system is identified as the
following:
An industrial robot system includes the robot(s) (hardware and software) consisting of
the manipulator, power supply, and controller; the end-effector(s); any equipment, devices,
and sensors required for the robot to perform its task; and any communications interface that
is operating and monitoring the robot, equipment and sensors.
Robots can be programmed to move objects through the entire 3D, three dimensional
workspace. The mechanical manipulator has a certain number of links, joints and end
effector. The pitch, roll and yaw of the wrist can be controlled. Robots can be used to cause
changes similar to what can be done using the motor skills of the human arm. The study of
this field of study is called robotics. Stanford University developed a book used as textbook
in collegiate course on Introduction to Robotics: Mechanics & Control, J. J. Craig since 1983.
Robotics comprises of four major areas:

(i) Mechanical Manipulation;
(ii) Locomotion;
(iii) Computer Vision and;
(iv) Artificial Intelligence.
Artificial intelligence development in the form of software is an attempt to synthesize

human intelligence by computer programming and execution. Mechanical manipulation is an
amalgamation of engineering mechanics, control theory and computer science. Progress made
in robot programming languages can lead to more user friendly robots. Often times the
interface between human and robot is the programming language. This is an important
consideration in the design and operation of industrial robots. Library of robot-specific
subroutines can be added. JARS, written in Pascal at NASAs Jet Propulsion Laboratory is an
example. RAPID is a general-purpose language and software developed by ABB Robotics.
The user is allowed to command specific sub-tasks of the goal directly. Manipulator
programming takes some trial and error. Objects can be moved through 3D, three dimensional
space using programming. VAL was written by Unimation in order to control robots. IBM
developed AML. KAREl was developed by GMF robotics. Cartesian and interpolated
motions can be affected. Vision systems can be used to specify the coordinates of an object of
interest. Interaction with sensors is important. Some difficulties in programming robots are
the congruence of model predictions and real time experience. This can lead to poor grasping
of objects and collisions. Accuracy of manipulator is another worry. Force strategies needs to
be developed for constrained motion. Manipulator programs are sensitive to initial conditions.
Trajectory and velocity of arm depends on the initial conditions. Program segments need be
tuned in a bottom-up programming approach. Changes in configuration can cause large arm
motions. Errors in object location can also be causative in problems. Singularities can be
identified by writing the Jacobian that can be used to relate the joint velocities to Cartesian
velocities of the tip of the arm. For example, say the end effector is required to move with a
certain velocity in Cartesian space. Inverse Jacobian can be used to calculate the joint rates
from the Cartesian rates. For some values of the vector of joint angles, the jacobian becomes
singular. Singularities in the boundaries can be found for most manipulators and have a loci
of singularities inside the workspace.
1.2.2. Robotics as Collegiate Course

Industrial robots came about in the 1960s. The adoption of robotic equipment came about
in the 1980s. In the late 1980s there was a pullback in the use of robots. Use of industrial
robots has been found to be cheaper than manual labor. More sophisticated robots are
emerging. Nanorobot drug delivery systems can be one such robot. 78% of the robots
installed in the year 2000 were welding and material-handling robots. The Adept 6
manipulator had 6 rotational joints. The most important form of the industrial robot is the
mechanical manipulator. The mechanics and control of the mechanical manipulator is
described in detail in introductory robotics courses [Craig 2005]. The programmability of the
device is a salient consideration. The math needed to describe the spatial motions and other
Introduction
attributes of the manipulators is provided in the course. The tools needed for design and
evaluation of algorithms to realize desired motions or force applications are provided by
control theory. Design of sensors and interfaces for industrial robots is also an important task.
Robotics is also concerned with the location of objects in three dimensional space such as its:
(i) position and orientation; (ii) coordinate system and frames of reference such as tool frame
and base frames; (iii) transformation from one coordinate system to another by rotations and
translations.
Kinematics is the science of motion that treats motion without regard to the forces that
cause it. In particular, attention is paid to velocity, acceleration of joints and acceleration of
the end effector. The geometrical and time based properties of the motion are studied.
Manipulators consist of rigid links that are connected by joints that allow relative motion of
neighboring links. Joints are instrumented with position sensors which allow the relative
motion of neighboring links to be measured. In case of rotary or revolute joints these
developments are called joint offset. The number of independent position variables that would
have to be specified in order to locate all parts of the mechanism is the number of degrees of
freedom.
End effector is at the end of the chain of links that make up of the manipulator. This can
be a gripper, a welding torch, an electromagnet, etc. Inverse kinematics is the calculation of
all possible sets of joint angles that could be used to attain the given position and orientation
of the end-effector of the manipulator. For industrial robots the inverse kinematic algorithm
equations are non-linear. Solution to these equations is not possible in closed form. The
analysis of manipulators in motion in the workspace of a given manipulator includes the
development of the Jacobean matrix of the manipulator. Mapping from velocities in joint
space to velocities in Cartesian space is specified by the Jacobean. The nature of mapping
changes with configuration. The mapping is not invertible at points called singularities.
Dynamics is the study of actuator torque functions of motion of manipulator. State space
form of the Newton-Euler equations can be used. Simulation is used to reformulate the
dynamic equations such that the acceleration is computed as a function of actuator torque.
One way to effect manipulator motion from here to there in a specified smooth fashion is to
cause each joint to move as specified by a smooth function of time. To ensure proper
coordination, each and every joint starts and stops motion at the same time. The computation
of these functions is the problem of trajectory generation. A spline is a smooth function that
passes through a set or via points. End effector can be made to travel in a rectilinear manner.
This is called Cartesian trajectory generation.
The issues that ought to be considered during the mechanical design of manipulator are
cost, size, speed, load capability, number of joints, geometric arrangement, transmission
systems, choice and location of actuators, internal position and sensors. The more joints a
robot arm contain the more dexterous and capable it will be. But it will also be harder to build
and be more expensive. Specialized robots are developed to perform specified tasks and
universal robots are capable of performing wide variety of tasks. Three joints allow for the
hand to reach any position in three dimensional spaces. Stepper motors or other actuators can
be used to execute a desired trajectory directly. This is called the linear positional control.
Kinetic energy of the manipulator links can be calculated using the Langrangian formulation.
Both the linear kinetic energy and rotational kinetic energies can be tracked.

Table 1.2. State of Art in Robots over a 40 Year Period
Year
1974
1975
1977
1979
1982
1983
1986
1990/
1991
1994
1996
1998
2000
2001
2002
2004
2005
Product
Worlds First Microcomputer controlled Electric Industrial Robot, IRB6 from ASEA was
delivered to a small mechanical engineering company in Southern Sweden.
IRB6 First Robot for Arc Welding
First Robots installed in France and Italy
IRB 60 First Electrical Robot for Spot Welding; First Robot installed in Spain
Robots introduced in Japan
S2, New Control System. Outstanding, HMI, Menu Programming, TCP (Tool Center
Point) and the Joy Stick introduced. Allows control of several axes.
ASEA bought Trallfa Robot operations, Bryne, Norway. Trallfa launched the worlds First
Painting Robot in 1969. Sales boomed in the mid 1980s when the automotive industry
started to paint bumpers and other plastic parts.
IRB2000 10 Kg Robot. First to be driven by AC motors. Large working range. Great
accuracy.
ABB acquired Cincinnati Milacron, USA, Graco, USA (robotic painting), Rarsburg
Automotive (electrostatic painting atomizers).
IRB 6000 200 kg Robot introduced. First Modular Robot that is the fastest and most
accurate spot welding robot on the market.
Unique hollow wrist introduced on Painting Robots. Allows faster and more agile motion.
S4 Breakthrough in user friendliness, dynamic models, gives outstanding performance.
Flexible rapid language.
Integrated Arc Welding Power Source in Robot Cabinet.
Launch of Flex Picker Robot, the Worlds fastest Pick and Place Robot.
Robot Studio First simulation tool based on virtual controller identical to the real one
revolutionize off-line programming.
Pick and Place Software Pick Master introduced.
IRB7000 First Industrial Robot to handle 500 kg.
ABB First company in World to sell 100,000 Robots
Virtual Arc True arc welding simulation tool that gives robot welding engineers full offline control of the MIG/MAG process.
IRB 6000 Power Robot with bend over backwards flexibility.
IRC5- Robot Controller. Windows interface unit.
Launch of 55 new products and robot functions included with 4 new robots: IRB 660, IRB
4450, IRB1600, and IRB260.
The evolution of robots can be studied from the market experience of one leading
manufacturer of robots for example, ABB robotics, Zurich, Switzerland. This shall be used
later to place in perspective the increased interest in use of nanorobots in the hospital for drug
delivery. The different products from ABB Robotics during a 30 year period are given below
in Table 1.2.
1.2.3. Infeasibility of Molecular Assemblers

R.E. Smalley and K.E. Drexler debated on whether molecular assemblers, which are
devices capable of positioning atoms and molecules for precisely defined reactions in any
environment, are possible. In his book Engines of Creation: The Coming Era of
Introduction
Nanotechnology, Drexler envisioned a world ubiquitous with molecular assemblers. These

would provide immortality and lead to the colonization of the solar system. He received a
Ph.D. from Massachusetts Institute of Technology (MIT) in 1991. He is also the CEO of
Foresight Institute, Palo Alto, California. Smalley, a recipient of the Nobel Prize in chemistry
in 1996 for his work on fullerenes, outlined his objections based on science to the molecular
assembler idea and called it the fat fingers problem or the sticky fingers problem. He
was also worried about funding for nanotechnology due to the portrayed darker side of it. In
Chemical and Engineering News, PointCounterpoint column, an open letter from Drexler
to Smalley was posted challenging Smalley to clarify the fat fingers problem, with a
response from Smalley and three letters with Drexler countering and Smalley concluding the
exchange.
Drexler sought clarification from Smalley on the fat fingers problem. He felt that like
enzymes and ribosomes, the proposed molecular assemblers neither have nor need the
Smalley Fingers. Drexler alluded to the long-term goal of molecular manufacturing and its
consequences, which can pose opportunities and dangers to long-term security of the United
States and the world. Theoretical studies and implementation capabilities are akin to the preSputnik studies of spaceflight or the pre-Manhattan project calculations regarding nuclear
chain reactions and are of more than academic interest. He referred to his 20-year history of
technical publications in the area of chemical synthesis of complex structures by
mechanically positioning reactive molecules and not by manipulating individual atoms.
The proposal was successfully defended in the doctoral thesis on Nanosystems:
Molecular Machinery, Manufacturing, and Computation and is based on well-established
physical principles. Smalley responded with an apology should he have offended Drexler in
his article in Scientific American in 2001. His call for using Smalley Fingers is impossible.
A Smalley Finger type of molecular assembler tool will never work. Smalley pointed out
the infeasibility of tiny fingers placing one atom at a time. This is also applicable to placing
larger, more complex building blocks. As each incoming reactive molecule building block has
multiple atoms to control during the reaction, more fingers are needed to ensure they do not
go astray. Computer-controlled fingers will be too fat and too sticky for providing the control
needed. Fingers cannot perform the chemistry necessary. He called attention to the mention of
enzymes and ribosomes needed in the reaction medium. He quarreled with the vision of selfreplicating nanobot. Is there a living cell inside the nanobot that cranks these out? Water is
needed inside the nanobot with the necessary nutrients for life. How do the nanobot pick the
right enzyme and join in the right fashion? How do the nanobot perform error detection and
error correction? He worried about the scope of the chemistry that the nanobot could perform.
Enzymes and ribosomes need water to be effective. He mentioned that although biology is
wondrous, a crystal of silicon, steel, copper, aluminum, titanium, and other key materials of
technology could not be produced by biology. Therefore, without these materials how could a
nanobot manufacture a laser, ultrafast memory and other salient components of modern
society?
Drexler applauded Smalleys goal of debunking nonsense in nanotechnology. He
sketched the fundamental concepts of molecular manufacturing. He referred to Feynmans
after-dinner visionary talk in 1959, discussed in Sec. 1.2, and nanomachines building
atomically precise products. Feynmans nanomachines were largely mechanical and not
biological. In order to understand how a nanofactory system could work, he considered a
conventional factory system. Some of Smalleys questions reach beyond chemistry to systems
engineering and to problems of control, transport, error rates, and component failure and to
answers from computers, conveyors, noise margins, and failure-tolerant redundancy.
Nanofactories contain no enzymes, no living cells, and no replicating nanobots, but they do
use computers for precise control, conveyors for parts transport, and positioning devices of
assorted sizes to assemble small parts into large parts when building macroscopic products.
The smallest devices position molecular parts to assemble structures through mechanosynthesis or machine-based chemistry. Conveyors and positioners bring reactants together
unlike solvents and thermal motion. Positional control enables a strong catalytic effect by
aligning reactants for repeated collisions in optimal geometries at vibrational frequencies
greater than terahertz. Positional control can lead to voiding unwanted side reactions. From
transition state theory, for suitably chosen reactants, positional control will enable synthetic
steps at megahertz frequencies with reliability approaching that of digital switching
operations in a computer. When molecules come together and react, their atoms, being sticky,
stay bonded to neighbors and thus do not need sticky fingers to hold them. Direct positional
control of reactants is revolutionary and achievable. Mechanosynthetic reactions and its field
have parallels in the field of computational chemistry. The flourishing of nanotechnology in
2003 suggests a bottom-up strategy using self-assembly. It used to be scaling down
microscopic machines in 1959.
Progress toward molecular manufacturing is achieved by research in computational
chemistry, organic synthesis, protein engineering, supramolecular chemistry, and scanning
probe manipulation of atoms and molecules. Scaling down moving parts by a factor of one
million results in multiplication of their frequency of operation by the same factor. Progress
in the United States on molecular manufacturing has been impeded because of the illusion
that it is infeasible. He called for augmentation of nanoscale research with systems
engineering effort and achievement of the grand vision articulated by Richard Feynman.
Smalley concluded by observing that Drexler left the talk about real chemistry and went to
the mechanical world. He felt that precise chemistry could not be made to happen as desired
between two molecular objects with simple mechanical motion along a few degrees of
freedom in the assembler fixed frame of reference. It was agreed that a reaction would be
obtained when a robot arm pushes the molecules together but it may not be the reaction
desired. More control is needed than mentioned about molecular assemblers. A molecular
chaperone is needed that serves as catalyst. Some agent such as an enzyme is needed. A liquid
medium such as water is needed to complete the desired chemical reactions. Smalley recalled
a talk on nanotechnology he gave to 700 middle and high school students. The students were
asked to write an essay on Why I am a Nanogeek. Smalley read the top 30 essays and he
picked his favorite five. Half assumed that self-replicating nanobots were possible. What if
the self-replicating nanobots fill the world, was the worry of some. However, they have been
misinformed.
1.2.4. Trends in Industrial Robots

Industrial robots are increasingly used. According to Prof. D. Rus, director of MITs
computer science and Artificial Intelligence Laboratory a tipping point in the field of robotics
has been reached. There is a paradigm shift from robots as job terminators to robots as job
creators. Companies report more productivity per worker with more usage of robots.
Introduction
Universal robot, specialized robots, numerically controlled milling machines are increasingly
used. Electronics industry is reaching the trillion dollar mark rapidly. Automotive and
semiconductor industries increasingly use the robots. Robots can be used in miniaturization
operations. Nanotechnology products are expected to have a market size of 3 trillion dollars
by the year 2015. Microarrayer and nanoarrayers are expected to be increasingly used in
genome sequencing and making biochips. Mechanical micro spotting and ink jet printing use
principles of robotics and automation.
Apple is planning on investing $10.5 billion in supply chain robotics and lasers and new
technology ranging from assembly robots to milling machines. These machines are used for
mass production of iphones, ipads, and smart phones. Amazon has recently announced the
development of drones for rapid door delivery of ordered items. With a service called Prime
Air, by 2015 drones are expected to be used in order to deliver packages less than 30
minutes. Pizza deliveries are also expected. Internet access is expected to be delivered by
drones to remote areas. Robots have been made with a spectrum of capabilities. Researcher at
University of California at Berkeley has developed a robot for drying and folding clothes
from the laundry. In 2000, 78% of installed robots were used for welding or material
handling. Samsung, Hewlett Packard, Apple and other competitors use robots for spray
painting. Robotic Equipment is used to polish new iPhone and carve plastic MacBooks
aluminum body. Other consumer electronics investments are $ 22 billion by Samsung, $3.7
billion by Hewlett Packard and $3.95 billion by Sony Corp. Apple has hired robot experts and
engineers to oversee operation of high-end manufacturing equipment.
When the baby-boomers reach the retirement age in the near future there is a shortage
expected in skilled workers. Developments like Baxter that can be used to perform tasks of
two workers can increase the usage of robots. Robots can be used to unassemble pipe from
conveyor. Marlin steel use robots in order to produce wire baskets and sell it to car makers
and pharmaceutical firms. Lear a major auto-parts maker near Detroit, MI, with nearly $15
billion in annual revenue uses robots developed by Universal Robotics to help screw together
seats and put together electronics dashboards. Sensors, instrumentation and industrial
automation are expected to be a tidy addition to modern chemical plants. Key Competitors
identified in the market report by Transparency Market Research are: (i) Denso Wave Inc; (ii)
FANUC Corp.; (iii) KUKA AG; (iv) Yaskawa Electric Corp; (v) Toshiba Machine Corp; (vi)
Yogakoaw Electric Corp; (vi) ABB Ltd. (vii) Honeywell Intl.; (viii) Emerson Electric; (ix)
General Electric; (x) Invensys PLS; (xi) Mitsubishi Electric; (xii) Rockwell Automation;
(xiii) Siemens; (xiv) Omron Corp; (xv) Schneider Electric; (xvi) Kawasaki Robotics.
1.2.5. Drones
Robo-roo is a robot built by engineers in Germany that can be made to hop like a
kangaroo. The kangaroo's jump is unique and contains a mechanism where the jump speed
can be controlled in an efficient manner. The Achilles tendon stretches from the kangaroo's
head to its calf. Festo scientists in Germany have devised an elastic spring that can be used in
order to enable the robo-roo's functionality much like the real Achilles tendon. The kinetic
energy of the kangaroo is absorbed by the elastic spring when the robo-roo lands. The next
jump is powered by the energy released from the spring. Electronic circuitry are being
developed to store and release energy in a more efficient and controlled manner. The robo-roo
10
is powered using rechargeable batteries. Bionics is an emerging field of using things found in
nature as vision for designing objects with similar functionality. With two feet and tail when
the robo-roo touches the floor there is provided a stable three point contact. Two motors are
used to control the robots legs. The motors are placed in between the "hip" and "thigh" of the
robo-roo. The spring is made of rubber. The jump is cushioned by the elastic spring which is
intended to provide the same functionality as provided by the Achilles tendon. The robo-roo
is built to provide more bounce.
Drones are unmanned aerial vehicles that can be used for various purposes. It can be used
to snap high-definition photos of apple orchad from up above from the skies. The acquired
photos are processed using software and the health of the crops is analyzed. Corners of the
field where insects are attacking the apples are identified. Drone turns its path and heads to
that area. Pesticides are dispensed from the wings of the drones. The insects that harming the
trees are killed. Drone is back on its patrol. This is but one example in an emerging field of
precision agriculture. The farms can be as large as 10,000 acres. The farmers can use this
technology in order to keep an eye on their crops. For now, the satellite pictures are used.
Resolution of satellite pictures to the 6th coordinate is tedious! Drones may be used by the
farmers every day and lead to use of less water, less fertilizer and optimal use of pesticides.
Drones can be made to perform 'door-delivery'. The customer calls the apple warehouse
and orders the apple for door delivery. One half hour later the drone lands at your doorstep
with the apple. The buzz of the drone can act as a door-bell. The apple is left at the doorstep
and the drone levitates away into the sky. Drones can be used in conjunction with other police
activity. Crimes as they are committed can be spotted and if possible changed into acceptable
activities. Parking tickets can be issued using drones. Life saving medicines can be supplied
to hospitals using drones during medical emergencies. Drones may be used to fight fires.
Drones can be used in warfare amongst nations. One in three American military aircraft are
drones. They come in various sizes. The MQ-9 Reaper can be used in order to carry about
3000 pounds of weaponry. In this country Unites States, drones are used to combat terrorism.
Al Qaeda and the Taliban in Pakisthan and Afghanisthan are targets. The perpetrator of the
9/11 bombings Osama Bin Laden is now dead by a commando mission viewed by the White
House. Drones are operated from remote locations. Hence it is a case in automation! Drones
seldom appear in man vs. machine controversies.
Drones were first built in the early 1900s. Hollywood finds some use for drones.
Filmmakers like Steve Spielberg, Richard Attenborough for example capture footage using
camera drones that would otherwise be dangerous and expensive to shoot. Action scenes
that were shot using helicopters in films were Gemini Ganesan was the hero in India are now
taken by camera drones. Helicopters are expensive and the pilots have to perform maneuvers
in order to fly low to get a better shot. The costs can be as high as $10,000 per day. Camera
drones can be less expensive and can be sent close to the action without causing danger. The
cost of a camera drone is $25,000 and can be used over and over again. Sporting events can
be filmed using camera drones. Flight control is affected using software to determine if the
motor needs more or less power in order to keep the drone steady. Radio control is used to let
controllers say to the drone what to do such as fly faster, begin descent, etc. Navigation is
accomplished using GPS and a barometer. The atmospheric pressure is measured using the
barometer. Flight control software receives as input the location of the drone and path it can
take in order to return home.
Introduction
11
Camera drones is a solution that came from a $ 5 million research grant study conducted
by WWF, world wildlife fund to the wildlife crime problem in Africa and Asia. $5 million
grant was received from Google. The University of Minnesota Uninhabited Aerial Vehicle
Laboratory estimates that most farmers will use camera drones in the next five years. Animal
conservation group uses camera drones to animal-sit rhinos, elephants and tigers. Scientists
can track down poachers who kill the endangered animals and without impunity sell their
horns, tusks and eyes to be used in Chinese medicines.
1.2.6. Runaway Reactions in Polymerization Kettles

An interesting challenge in modeling and control of mass polymerization reactors is the
runaway polymerization under certain conditions. This is called the Trommsdorff effect.
Manufacturing plants that use suspension polymerization plant has encountered a problem
during operation where the reactor was Set-up. During free-radical polymerizations there
are three important sets of reactions: (i) Initiation; (ii) Propagation and; (iii) Termination. As
the polymerization reaction proceeds in suspension kettles, the viscosity of the polymer mass
increases. The termination reactions are hindered. The polymer chain grows unbounded in
size. This has set-up the reactor. This effect is also called auto-acceleration effect. It can be
considered as a runaway reaction. The action taken to prevent such occurrences during
continuous polymerization of styrene or copolymer of styrene and acrylonitrile a solvent is
added.
A viscometer may be added to measure the viscosity of the reaction mass. The control
action taken can be to decrease the flow of the monomer supply or decreasing the reactor
temperature or decreasing the reactor pressure, should the viscosity of the mass remain high.
The termination reactions during the gel effect do not take place on account of diffusion
limitations. The growing chains have to diffuse and meet in order for the chain recombination
mechanism for termination to take place. When the monomer conversion is high in the reactor
and there is no solvent or diluent, the viscosity of the reaction mass will be high. Studies have
shown an exponential increase in viscosity with conversion. The diffusion process in higher
viscous paths will take a lot longer. Without termination the molecular weight grows in an
unchecked manner. This causes the gel effect.
Gharaghani et al. [2012] developed a control strategy for a two-stage bulk styrene
polymerization. They conducted dynamic simulation in order to predict the performance of
auto-refrigerated CSTR and tubular reactors. The PFR has temperature controlled jacket
zones. In one control strategy they used the jacket temperature and in another strategy the
reactor temperature at the exit of each section was used as the controlled variable. GA,
genetic algorithm was used in order to obtain the set points for polymer grade transition after
optimization. Optimization goals were; (i) higher monomer conversion; (ii) final number
averaged molecular weight of the polymer and; (iii) narrower molecular weight distribution.
High heats of reaction are associated with mass polymerization of styrene. High viscosity
and hence laminar flow are also other features of mass polymerization of styrene. PFR, plug
flow reactor with recycle or CSTRS, continuous stirred tank reactors are used for industrial
styrene homopolymerization and copolymerization. Dynamic simulation studies of a twostage continuous bulk polymerization process was undertaken. The first stage was auto-
12
refrigerated CSTR and the second stage was a tubular reactor. The tubular reactor was
subdivided into three temperature-control jacket zones. Monomer conversions, X, number
and weight averaged molecular weights and PDI poly dispersity index can be predicted using
the mathematical model.
The simulation of Chen [1994] is for a basis of production of polystyrene at 5682 kg/h.
Conversion in the auto-refrigerated CSTR was 65-75% and that in the second tubular reactor
was at 90%. The gel effect/auto acceleration phenomena were modeled by Hui and Hamielec
[1972]. The model can be written as follows, neglecting chain transfer effects;
kt = kt0exp[-2(A1X + A2X2 + A3X3)]
(1)
kt0 = 1.225 x 106 exp(-844/T)
(2)
A1 = 2.57 5.05 x 10-3T
(3)
A2 = 9.56 1.76 x 10-2T
(4)
A3 = -3.03 + 7.85 x 10-3T
(5)
The termination rate constant as a function of conversion is given by Eq. (1) during the
auto acceleration period. It can be seen to decrease exponentially with conversion. The
temperature dependence of the preexponential factor is given by Eq. (2). Eqs. (3-5) can be
used to obtain the temperature dependence of the conversion dependence of the termination
rate constant. The thermal initiation rate constant is given by;
kh = 0.219exp(-13910/T)
(6)
The propagation rate constant is given by;

kp = 1.051x104exp(-3557/T)
(7)
The density of monomer as a function of temperature is given by;
m = 924 0.918(T-273.1)
(8)
The number average molecular weight is later derived in Chapter 4.0 for thermal
polymerization of styrene as;
Mn = kp/SQRT(ktkhCM)
(9)
The number averaged molecular weight was obtained at different conversions and plotted
in Figure 1.0. Microsoft Excel 2010 was used for the simulations. The temperature of the
reactor chosen was 100 0C. The results are shown in Table 1.3 below;
13
Introduction
Table 1.3. Molecular Weight Building during Runaway Condition
C
100 0 C
K
373 0K
A1
A2
A3
kt0
0.6677
2.9952
-0.0833
1.27E+05
m3/mol/s
kh
kp
Density of Styrene
CA0
1.3952E-17
0.759
832.3
8.00
m6/mol2/s
m3/mol/s
kg/cu.m
mol/lit
X
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0.45
0.5
0.55
0.6
0.65
0.7
0.75
0.8
0.85
0.9
0.95
C0
m3/mol/s
kt
1.275E+05
1.175E+05
1.051E+05
9.123E+04
7.691E+04
6.295E+04
5.003E+04
3.862E+04
2.896E+04
2.110E+04
1.493E+04
1.027E+04
6.863E+03
4.458E+03
2.815E+03
1.728E+03
1.032E+03
5.988E+02
3.380E+02
1.856E+02
Mn
2.011E+05
2.149E+05
2.335E+05
2.578E+05
2.895E+05
3.305E+05
3.837E+05
4.532E+05
5.447E+05
6.666E+05
8.310E+05
1.056E+06
1.370E+06
1.818E+06
2.471E+06
3.454E+06
4.999E+06
7.577E+06
1.235E+07
2.357E+07
mol/lit
CM
8.003
7.603
7.203
6.802
6.402
6.002
5.602
5.202
4.802
4.402
4.001
3.601
3.201
2.801
2.401
2.001
1.601
1.200
0.800
0.400
Development of control strategy for a process such as shown in Figure 1.0 is a challenge.
Solvent can be used to keep the diffusion paths of growing free radicals short, allowing for
termination reactions to proceed with recombination. Online viscometers can be used to
check the viscosity of the batch. When the viscosity is very high jacket cooling of cooling by
vaporization of solvent/monomer can be called for.
1.2.7. Electric Motor Controls

In United States, $50 billion is spent every year on electricity for electric-motor driven
systems. Department of Energy estimates an energy savings of about $250 million per year by
using motor drives in the past decade. Motors are made in a manner that the motor speed and
torque developed needs to be controlled depending on the objectives at a given time. Motor
direction, speed and acceleration or negative acceleration times can be controlled. Motors can
be powered by AC alternating current or DC direct current. In AC motors work is produced in
order to drive a load using a rotating shaft. The amount of work that is produced varies as a
function of the amount of torque that can be developed using the designed shaft and the
14
angular speed in RPM, revolutions per minute of the shaft. Motor drives can be used to
control the speed and torque of a motor. Motor drive is built using solid-state components and
is an electronic unit. It can be used to control the speed of a motor. These drives are used in
HVAC, heating ventilation and air conditioning systems. Motor control functions include
speed control, acceleration, negative acceleration, motor-start boosting, fault tolerating,
programming speeds, different pause methods and several other control functions.
Due to the complex dependence of the operation of motors for different loads under
different conditions, no one mathematical model can be used to describe any possible
conceivable scenario of operation. Therefore reliable measurements are needed to achieve the
control objectives. Motor current, motor voltage, drive temperature and other operating
conditions are parameters that needs to be monitored. Safety considerations leads to a
mechanism of power shut-off when there is an apparent problem. Conditions and faults are
allowed in some designs to be displayed. A PLC, personal logic controller or PC personal
computer can be used to include additional specialty functions to be sent to the drive through
on-board communication.
Figure 1.0. Gel Effect as Seen in Molecular Weight Increase with Conversion.
Introduction
15
The speed of an AC motor is controlled by tweaking the frequency in Hz input into the
motor. The frequency range can be from 0 100s of hertz. They are programmed to operate
at a minimum and a maximum operating speed in order to proactively avoid damage to the
load or internal contents of the motor. Operation at more than 10% of the rated capacity in the
name plate can lead to damage. Volts per hertz (V/Hz) is a ratio of the voltage and frequency
found in a motor during its operations [Rockis and Mazur, 2009]. The motor torque can be
controlled using the V/Hz ratio that is applied to the motor. The motor is allowed to develop
the rated torque when the V/Hz ratio is maintained. During the acceleration phase, constant
torque is delivered as voltage is increased at the same rate as the frequency is increased. After
a certain frequency the voltage remains a constant for further increased in frequency. The
normal operating speed zone lies at frequencies less than the frequency cut-off. At
frequencies greater than this cut-off value the motor is operating at an above normal rating. At
the cut-off frequency the motor is said to deliver the full motor voltage. Torque is constant in
the linear range of operation. At frequencies higher than the cut-off the motor drive is in a
regime of constant output horse power. PWM, pule width modulation can be used in order to
control the amount of voltage sent to the motor. The amount of voltage produced has to be
controlled in order to control the speed and torque of the motor.
Motors can be turned ON or OFF using magnetic starters. They can be used to provide
overload protection. Voltage control can be accomplished by using resistances in series to the
motor windings. Current control can be accomplished by shunting resistance in parallel to the
motor windings. The intensity of the magnetic field can be checked for peak operation. The
cost of control is roughly the same when the starter or drive is used. It is more a function of
the hp rating of the motor. A potentiometer can be used to control the speed of a motor. The
resistance of the potentiometer can be from 5 k- 10 k. Most drives allow a voltage or
current input in order to control the speed of the motor. 0 10 Volt of direct current supply
voltage can be connected to the input terminals of the motor. At 5 V, the motor runs at 50%
of the rated speed, and at 7.5 V, the motor runs at 75% speed. 4 mA 20 mA direct current
supply can be connected to the input terminals of the motor drive. The motor runs at 50%
speed at 8 mA and 75% speed at 12 mA. Standard control-circuit power is supplied in the 0
10 V and 4mA 20 mA range. Switches are placed in certain positions and the motor control
and drive functions are set using programming. Keypad is located on the drive and may be
removable. Motor drives can contain up to 30 100 parameters. Some of the parameters that
can be displayed are; (i) drive output frequency; (ii) motor current draw; (iii) drive output
voltage; (iv) drive DC bus voltage; (v) drive internal temperature; (vi) motor fault; (vii) drive
elapsed operating time; and (viii) motor operating speed.
1.2.8. Centralized Heating and Cooling

The modern homes are equipped with a thermostat to set the desired temperature of the
residence (Tsp). Valves to the furnace and air conditioner can be controlled by using
measurement of temperature in the residence (Tm ). When the measured temperature, Tm < Tsp
the furnace is turned on and the cooling is shut-off. When Tm > Tsp the furnace is shut-off and
the air conditioner is turned on. Such a control method is called feedback control. This shall
be discussed in more detail later. The block diagram for such control action is shown below in
Figure 2.0. Air from the blower is heated by the furnace or cooled by the air-conditioner as
16
the case may be. The heating or cooling action depends on the error signal and whether the
measured temperature, Tm is lower or higher compared with the set point temperature, Tsp.
Thermocouples are used to measure the temperature in the room. Comparison of measured
room temperature to set-point is performed by a comparator. The feedback step is the
measurement of actual room temperature using temperature sensor (output) with the input
(set-point). Figure 2.0 contains the essential elements of a block flow diagram. These are;
Comparators
Blocks
Reference sensor
Output sensor
Controller
Input/reference signals
Plant operating system
Feedback loop
Disturbance signal
Output signal
1.2.9. Regulation of Human Anatomical Temperature

The body temperature in humans can be seen to be held in dynamic balance by;
(i) the generation of heat by metabolic activities within the human anatomy and
(ii) by transfer of heat outside the human anatomy to the surroundings.
(iii) The heat gain, heat storage and heat transfer mechanism coexist in human anatomy.
As can be seen from Figure 3.0 there are five layers between the surroundings and
the blood [Sharma, 2010].
The thermophysical properties of the blood, skin, fat and bone are different from each
other. The modes of heat transfer can be molecular heat conduction, heat convection, heat
radiation and by a fourth mode of heat transfer called damped wave conduction. Metabolism
in one word includes all the chemical reactions taking place within the human anatomy.
Energy is liberated from chemical reactions that are exothermic. This is used to sustain life
and to perform the various functions, basic and chosen. Work is done by human anatomy.
The minimal rate of metabolism needed to sustain life is referred to as basic rate of
metabolism. This rate is obtained while the patient is awake and resting and is at a stress-less
state. Digestive activities should cease, the external hot weather does not cause any heat
exchange or thermoregulation. There is enough energy generated at this state for the heart to
pump blood throughout the human anatomy, retain normal electrical activity in the nervous
system, and generate calories of energy. The basic rate of metabolism can be measured using
the rate at which oxygen is consumed and the energy generated from metabolism of oxygen.
Some work done by human anatomy is allowed. The energy needed for metabolic activity is
obtained from chemical reactions that get coupled resulting in a net decrease in free energy.
The basic rate of metabolism in a average patient is roughly, 75 watts. The major organs such
Introduction
17
as brain, skeletal muscle, liver, heart, gastrointestinal tract, kidneys, lungs, etc, participate in
the base metabolism. The muscles in the human skeleton requires less energy at the rest state
compared with the state of exercise. When the patient is asleep the metabolic rate falls below
the basic rate of metabolism. The metabolic rate at all other activities such as walking, sitting,
mating, eating, cooking, growing, etc are higher than the basic rate of metabolism. The rate of
metabolic rate can exceed the basic rate of metabolism by a factor of 10-20 during strenuous
exercise.
Figure 2.0. Centralized Heating and Cooling System in Homes using Feedback Control.
Figure 3.0. Heat Conduction through Skin, Fat, Muscle and Bone Layers from Surroundings to Blood
Flow in Human Anatomy.
18
The basic rate of metabolism in homo sapiens varies with the body mass m, as m0.75 . The
relationship between the basic rate of metabolism and human anatomical parameters can be
1.5
S
.
V
Within the human anatomy, mechanisms are in place that will take effect to cool the
anatomy when the average temperature reaches 350 C. The average temperature within the
human anatomy is usually, 370 C. Au contrairie, when the skin temperature reaches below
22.5 0 C, cellular mechanisms will take effect that will result in generation of heat. The core
human anatomical temperature is maintained within a narrow range by use of insulation and
heat production.
Two mechanisms that can cause cooling within the human anatomy are: i) vasodilation
and; ii) evaporative cooling affected by sweat. After sternous exercise, on account of
vasodilation, the skin exterior appears a bit reddish. The blood near the skin surface gets
refrigerated and flows back to the veins and arteries thereby affecting energy transfer. The
human anatomy reduces heat loss in the temperature range of 24 32 0 C by reduced blood
flow to the dermis. Below 24 0 C, vasoconstriction mechanism is not sufficient and the heat
production is by shivering or physical activity. There appears a set point in thermoregulation.
Regulatory process is a bit more complicated than a first order feedforward control process.
Transient receptor potential ion channels are sensitive to hot and cold temperatures. TRP
channels get activated upon control action from the hypothalamus and stimulate the nerves.
Nerve signals and harmone signals result in vasodilation/vasoconstriction or blood flow
regulation and changes in metabolism and heat generation. Block flow diagram of regulation
of human anatomical temperature is shown in Figure 4.0.
The thermophysical properties of the biological tissues and other materials are provided
in Sharma (2010). The role of fat under the skin in the human anatomy as an insulator can be
evaluated using the thermophysical properties provided. Consider thicknesses of skin, fat,
muscle and bone of 2.5 mm, 10 mm, 20 mm and 7.5 mm respectively. The thermal
conductivity of the muscle and bone are 0.5 W/m/K and 0.6 W/m/K respectively. The effect
of the layer of fat on the heat flux from the human anatomy can be evaluated as follows. The
governing equation for steady state temperature in the composite assembly of skin, fat,
muscle and bone can be written as follows;
expressed in terms of the surface to volume ratio of the patient as
d 2T
dz 2
(10)
The temperature profile can be seen to be linear with respect to the space coordinate. The
heat flux can be seen to be a constant throughout the composite assembly. The effective
thermal conductivity of the composite assembly can be written as;
L
keff
Lskin
kskin
L fat
k fat
Lmuscle
kmuscle
Lbone
kbone
(11)
19
Introduction
Figure 4.0. Regulation of Human Anatomical Temperature seen as Feedforward Control.
Where kskin, kfat, kmuscle and kbone are the thermal conductivities of the skin, fat, muscle and
bone respectively. Examples of insulators of heat used to cover the human anatomy are fur,
hair and sweat. The effective thermal conductivity of layer of hair on the human skull can
becalculated from the idealized model where the hair was reduced to a composite of
cylindrical fibers aligned parallel to the axis parallel to the flow of air. Let the thermal
conductivity of fiber and air be taken as kfiber, kair respectively. The effective thermal
conductivity of composite assembly of hair and air was shown to be (Sharma, 2010);
keff , zz
kair
keff , xx
kair
k fiber
kair
(12)
kair
2
1
k fiber
kair
k fiber
kair
k fiber
kair
k fiber
kair
(13)
0.30584
0.013363
.....
Where is the volume fraction of the fibers. The above expressions tend to capture the
role of fat and hair on the heat insulation process.
1.2.10. Feedback Control of 3 Arm Robotic Manipular with End Effector

Consider a 3 arm robotic manipulator with end effector. This can be programmed to
perform tasks such as to pick a bolt from the table as shown in Figure 5.0. The manipulator is
instrumented with sensors at each joint to measure the joint angle. The joints are revolute
[Craig, 2005]. Each joint has an actuator that can be made to apply a torque on the
neighbouring link. Each joint has a position sensor. Velocity sensors or tachometers are also
20
present at these joints. The manipulator joints follow a prescribed position trajectory. The
actuators are commanded in terms of torque. A feedback control system can be deployed. The
appropriate actuator commands that will realize the desired motion can be given. The
feedback from the sensors in the joints is used to accomplish this task. The torque required is
computed. This feedback control loop is shown in Figure 5.0
A vector of joint torques, , is given as input into the robot from the control system. The
sensors from the joints measure the joint angles, , and joint velocities. . This is sent as
signal to the control box. The number of parameters sent as a vector depends on the number
of joints, N in the system. The torque is calculated in the control box from the information
input from the trajectory generator and by comparison with the measurements received from
the sensors in the joints. A dynamic model can be used if necessary. The feedback is used to
detect any servo error. The control action taken has to be in such a fashion that the robotic
system is stable.
1.2.11. Lessons in Modeling and Control from Fukushima Earthquake

On March 11th 2011, the earth shook for more than 2 minutues in Iwaki, Japan.
Skyscrapers began to oscillate and buildings collapsed. Tsunami came in. Earthquake of the
order of 8.9 on the Richter scale is the most severe earthquake Japan has suffered in seismic
history. The ocean floors heaved and the water came all the way into the living areas. Floods
and fires came about. Four tectonic plates are near the island nation of Japan. This tsunami
was even of a bigger magnitude compared with the one in Indian Ocean in 2004. Electric
power was completely cut off.
The Fukushima nuclear power plant (Figure 7.0) was damaged during the earthquake.
Seawater was directed onto the fuel during the meltdown of the nuclear power plants. There
was no better control action in place. Called The Fukushima 50 the firefighters were risking
death and were braving 250 millisieverts of radioactivity. This is five times more than the
permissible dose. The damaged nuclear reactors spewed radiation. There are no controls in
place although that geographical area is prone to earthquakes.
Figure 5.0. 3 Arm Manipulator with End Effector Picking a Bolt from Table.
Introduction
21
Figure 6.0. Block Diagram of Feedback Control of Robot Picking a Bolt.
Figure 7.0. Fukushima Nuclear Power Plant.
The nuclear energy may be the way to go for power plant needs in the future when oil
reserves are depleted. Less pollution is caused on account of nuclear power plants. Safety
issues remain after the 3 mile island, Chernobyl and Fukushima accidents. The Fukushima
disaster included damage of three units of BWRs, boiling water reactors. The heat transfer
from core to outside was lost. Nuclear plants are equipped with earthquake recognition
22
systems. Chain reaction shut down or emergency shut down procedures are outlined in cases
of earth quake. The reactor is switched off and the runaway reactions are stopped. In
Fukushima plant only three of the six reactors were functioning at the time of the earthquake.
The generators were flooded. The cooling system lost power supply. The heat generated
increased in the reactor core. The zirconium fuel rod cladding reacted with the steam and
oxygen and hydrogen were produced. This may have caused the explosion with release of
steam polluted with radioactive isotopes into the atmosphere. A massive volume of smoke
spread the radioactive particles throughout the European Union. People evacuated within a 30
km radius of the power plants. The evening television news showed people traveling overseas
on account of the tsunami and with the yen being strong.
133
Cs, 137Cs and 131I radioisotopes dosage received by the animals close to the accident
were high. The implications of the accident in future design, operation and control of similar
power plants are several. First a better project site can be selected with water, land and other
requirements needed for a viable and profitable operation of a project. The structures needs to
be strengthened against natural disasters. The environmental damage from the accident was
infected clouds and leakage of radioactive particles on soil. Entire Xeon gases, 60% of Iodine,
40% of Caesium, 10% of Tellurium and 5% of reminder of the radioactive particles were
released to the atmosphere. The amount of radiation released was 8 x 1015 Bq.
1.2.12. Deepwater Horizon Oil Spill

The disaster that changed the price at the gasoline pumps in summer of 2010 was in part
beacause they did not have better control and sensors in place than they did. The explosion of
the Deepwater Horizon drilling rig claimed 11 lives. The Gulf region lost its economic engine
and left thousands with mental and physical problems due to stress and pollution. Five million
barrels of oil gushed into the ocean for 86 days. Tourism dropped in the Gulf of Mexico. Offshore drilling can be better instrumented and have alarms in place and better controlled.
Deepwater Horizon was a semi-submersible, ultra-deepwater offshore oil drilling rig built
in 2001 by Hyandai Heavy Industries, South Korea. The rig was used to drill the deepest oil
well in history at a vertical depth of 10,683 m in Gulf of Mexico 250 miles southeast of
Houston, TX. An explotion on the rig caused by a blowout ignited a fireball visible from a
distance of 56 km. The fire was inextinguishable and the Deepwater Horizon sank. The oil
well was gushing at the sea floor and caused the largest offshore oil spill in the history of
United States. The oil spill causes a lot of damage to the environment and fisheries industry.
Transocean received an early partial settlement of $401 million for the loss of Deepwater
Horizon. The gushing of oil was at about 62,000 barrels per day on the average and 162,000
barrels a day on the worst case. The spewing went on for three months. The gush rate
decreased as the oil reservoir was depleted. The amount of Lousiana shoreline affected by oil
grew to 510 km by Nov 2010. The oil spill amounted to about 4.9 million barrels. The blowout preventer valves were not closed. Remotely operated underwater vehicles were used to
attempt to close the blowout preventer valves on the well head. A containment dome that was
125 tons in weight was tried and failed when gas leaking from the pipe combined with cold
water formed methane hydrate crystals that blocked the opening at the top of the dome. The
top kill was a procedure where heavy drilling fluids were pumped into the blowout
Introduction
23
preventer in order to restrict the gushing of oil before sealing it for ever with cement. This
also failed. The gushing could have been averted by better control, alarm and shut down
systems. Fail-closed valves could have averted the gushing even after the sinking of the oil
rig.
1.3. CONTROL STRATEGY

The main components of a control system are as follows;
(i) Process or Physico-chemical System that needs to be Controlled
(ii) Control Objectives
(iii) Set Points and Error Bands
(iv) Sensors and Measuring Elements
(v) Input Variables, Manipulatable
(vi) Disturbance or Load Variables
(vii) Output Variables
(viii) Constraints
(ix) Operational Characteristics such as Batch, Continuous, Semi-batch
(x) Safety, Environmental and Economic Considerations
(xi) Control Type: Feedback, Feedforward, Adaptive, Multivariable, IMC, Filter
Cascaded etc
As can be seen from the examples in section 1.2 the control objectives can be clearly
identified for each process. In the polymer kettle in Example 1.2.6 in order to avoid the geleffect the viscosity of the reactor mass has to be set as the control objective. Control action
can be taken upon finding out should the viscosity be too high or too low for operation of the
kettle. Input variables can be initial concentration of the reactant, inlet flow rate to the reactor,
jacket temperature, inlet fluid temperature into the reactor, etc. Disturbance variable is one
that gets perturbed in an unexpected manner in the reactor for example.
Output variables are for example the unconverted monomer conversion in the outlet of
reactor. The temperature of the reactor in the case of CSTR may be an output variable. The
reactant and product concentrations in a CSTR may be treated as output variables. Constraints
can arise from product quality considerations. For example the color of a SAN copolymer
cannot be more than certain degree of yellowness. This imposes an upper limit on the AN
composition in the copolymer and/or an upper limit on the time-temperature history of the
product. In this example, with sufficient time and temperature exposure the product can turn
yellow and blue black specifications may arise in the product.
Better automation and control leads to operations closer to optimal conditions.
Optimization of the process can result in millions of dollars of cost savings for the
manufacturing division. Materials and energy can be better used. What a dollar can buy can
be stretched a bit. Safer and less hazardous a process needs to be more expensive the process
can become. Fail-safe concept is a salient consideration in the development of
instrumentation. In order to change the flow rate using control valves energy needs to be
24
supplied. The stem of the valve is moved upon receipt of a signal. When the signal is lost the
stem will go to the position with the lowest value of pressure range of operation. Should the
valve be made air-to-open the loss of air would lead to closure of the valve? Such a valve is
called as failed-safe valve. The valve can be air-to-close. In this case when instrument air is
lost the valve will be at its open state. This is referred to as fail-safe-open valve.
1.4. CONTROL TYPES

There can be different types of control action sought. These are as follows;
1.4.1. Feedback Control

Examples of feedback control was shown in Example 1-2.9, Example 1.2.11. During
feedback control the output variable is measured. The measured signal is compared against a
set point using comparators. The error signal forms the input into the controller. Control
action depends on the air. For example, as will be discussed in the later chapter, a P only
controller is made in a manner that the control action is directly proportional to the error. In
Chapter 5.0, feedback control of single-input or manipulated variable and single output or
measured variable is discussed in greater detail. The feedback control structure is arrived at
by selection of manipulated variable and increased or decreased to control the measured
output variable. The desired value of the measured process output is also called as setpoint.
Later control gain and control time constant would be decreased. In a similar manner, the
process also can be characterized with a process gain and process time constant. The gain is
the rate of change of the output to the rate of change of input. This can provide a measure of
the sensitivity of the process or controller. The gain can be positive or negative. Negative
gains leads to inverse response. This is one kind of instability as will be discussed in chapter
3.0 and chapter 4.0. A control algorithm can be constructed and control parameters can be
identified. These control parameters can be tuned in order to obtain better performance. The
feedback control can further be of different types. These are as follows;
a.
b.
c.
d.
e.
On-off Controller
P, Proportional only Controller
PI, Proportional Integral Controller
PD, Proportional Derivative Controller
PID, Proportional, Integral and Derivative Controller
1.4.2. Feedforward Control

An example of feedforward control is discussed in Example 1-2.9. Vasodilation and
evaporative cooling/sweat formation happens immediately after a change in surroundings.
This kind of control action is different from the control action described in feedback control
Introduction
25
above. The disturbance variable is measured and control action is taken proactively. An
estimate is made on the effect of the control action on the output variable. Output variable is
not measured directly. Therefore the control action can work well when there are reliable
models that can relate the process output to the manipulated variables. Further the measured
disturbance need to be the only aberration in the scheme of things.
1.4.3. Hybrid Feed forward and Feedback Control

The feedback and feedforward schemes can be hybridized. In such cases the engineer has
more things on his hands to adjust. (see Example 5.2).
1.4.4. Internal Model Control, IMC

IMC, internal model control action uses the knowledge about the process that is being
controlled. This is different from the black-box approach of feedback control of single output
variable by tweaking the inpuit variable based on measurements of output variable. The
model developed for the mixing tank heated by the hot fluid in the jacket in Figure 7.4 can be
used to design an internal model controller. A good knowledge of when the process is stable
and when the process is underdamped oscillatory unstable can lead to better control action.
Control action of unstable systems may result in unsatisfactory results. In general the modelbased controller can be added as shown in Figure 7.8. Filters can be added to make the
controller more realizable. The transfer function of the output has to be proper. The Laplace
transform expression of the transfer function can be represented by;
P(s)
Q( s)
(14)
When the order of the polynomial of Q(s) in the denominator of Eq. (14) is greater than
the order of polynomial P(s) in the numerator then the transfer function is said to be proper.
When the order of the polynomial in the numerator P(s) is the same as the order of the
polynomial in the denominator Q(s) then the transfer function is said to be semi-proper.
1.4.5. Ratio Control

Ratio controllers are used where ratio of the reactant mixture is of increased significance.
For example when flue gas is needed the ratio of air to CO2, is controlled in such a manner
that the heat of reactions from the Boudard reaction and heat of reaction from the oxidation
reaction cancel each other rendering the reactor at a adiabatic state. One or more valves are
used in a split range control. More on ratio control is discussed in section 7.1. Ratio control
can be used in distillation columns where the reflux ratio is an important design variable.
26
1.4.6. Statistical Process Control, SPC

SPC is discussed in greater detail in section 7.2. SPC is used to control the output
variable within certain specifications. Control charts are used to better understand the errors
between measured and set point values. Attributable causes are assigned to variations. Noise
is delineated from a disturbance. Control action is taken according to a 3 sigma or a 6 sigma
limit. The statistical measures of mean and variance are only used. This approach falls
intermediate between feedback control of a process in a black-box and an IMC, internal
model control where the process models are clearly known.
1.4.7. Estimation and Control of Polymerization Reactors

The high viscosities and exothermic nature of the polymerization reactions make the
control of polymerization reactors an ardous task. The control objectives need to be specified.
The process dynamics is non linear. Some of the control strategies that were discussed when
the process can conform to a prototypical first order or prototypical second order process for
linear systems cannot be applied to systems that are governed by equations that are nonlinear.
Measurement of polymer structure is by no means a done deal. Estimation techniques such as
Kalman filter and Weiner filter are needed to obtain parameters that are difficult to measure.
1.4.8. Neural Networks

ANNs, artificial neural networks may be used in control of distillation columns where the
number of output variables is in the hundreds and the relation to the input variables are
governed by equations that are nonlinear. ANNs comprise of a number of computing
elements which resemble neurons and synapses of a human brain in a network. NNs can be
used to approximate any mathematical function to a desired level of accuracy. In supervised
learning, a network is given an input along with its desired output. On the other hand, a
network in unsupervised learning is given only an input. After each presentation of an input,
the performance is measured to tell how the network is doing. A network is expected to selforganize information by using the performance measure as guidance.
1.4.9. Multivariable Process Control

Most control schemes discussed is single variable input and single variable output, SISO
systems. MIMO systems are multiple variable input and multiple variable output systems.
Interaction effects of variables in MIMO systems are often important. A disturbance at any
input causes a response in some or all of the outputs. Control and stability analysis of MIMO
systems are more tedious compared with analysis of SISO systems. The control system can be
decoupled so that control of some output variables may be affected. Cross controllers [Marlin,
2000] in addition to principal controllers may be used to accomplish the control objectives.
The number of controllers needed for the operation increases ponentially with the number of
Introduction
27
inputs and outputs. 4 controllers are needed for a system of two inputs and two outputs. 9
controllers are needed for systems of 3 inputs and 3 outputs. The characteristic equation for a
MIMI system can be examined for stability from its roots.
1.4.10. Adaptive Control

Rather than a black box approach to control action taken or use of a process model
adaptive control is based on observations made at discrete intervals of time, updation of
model based on the observations and then control action taken.
1.12. GLOSSARY
Batch Process Product is made from raw materials batch by batch. The raw materials
and catalyst are charged into the reaction vessel. The reaction vessel is operated at the
selected temperature and pressure. The product is removed after the reaction and separated
from the unreacted raw materials. The vessel may be stirred at the set RPM, revolutions per
minute.
Continuous Process Product is recovered at certain lb/hr from the process plant. Raw
materials are fed continuously into the reactors. Reactors are operated at the set temperature,
pressure, degree of intensity (agitator RPM). The product is separated from the unreacted raw
materials in a suitable unit operation such as devolatilizer, distillation column, centrifuge, etc.
Industrial Controls Market This includes all the elements of the control process: (i)
Measurement; (ii) Comparisons; (iii) Computations and; (iv) Corrective Actions. Sensors,
comparators, desktop computers dedicated to control action and actuators, signal transmitters
form the industrial controls market. Detectors, transducers, transmitters and controllers are all
part of the industrial controls market.
Process Dynamics Study of the response of the different unit operations in the process
to a step change or some other perturbation given to the system.
PLC Programmable Logic Controller. A computer dedicated to automation of
electromechanical processes.
Automation Operation of a device or process with minimal human input.
Runaway Reaction Conversion of the reactant increases in an uncontrolled manner.
Heat is given out in exothermic reactions. The heat generated, if not removed, increases the
reaction temperature. Often reaction rate doubles with every 10 0C increase in temperature.
This further increases the reaction rate followed by more heat generation. Lack of heat
removal causes a runaway condition.
Transient Study Study of physical quantities that have not reached steady state yet.
Block Diagrams - Boxes are used to denote functions and lines are used to show the
relations between the functions.
Data Acquisition Enables measurements at different time intervals from the equipment
to be converted to digital format to be stored in the computer. A/D analog to digital converter
can be used to convert transducer voltages to digital values in the desktop computer.
Robot Programmable, automatic machine that is multi-purpose and manipulatable.
28
Free Radical Polymerization Method of polymerization where the initiation,

propagation and termination reactions take place by the free radical mechanism. Free radicals
are formed from initiators and monomer and propagating species is a free radical.
Supply Chain Robotics Use of robots in the distribution and supply of goods
PW, Present Worth Money value of a stream of cash payments of receipts and costs
projected in the future in terms of todays dollars include capital, interest, tax and tariff, labor,
utilities, materials, overhead, revenue from sales, salvage value over the life of the plant.
Artificial Intelligence Synthesize intelligence using computer software programming
and execution.
Kinematics Science of motion without worry about the forces that causes it.
3 Arm Mechanical Manipulator Device with three rigid lengths and two joints. The
third arm is usually the end effector.
Inverse Kinematics The science of understanding the set of joint angles that should
correspond to the position and orientation of the end effector
Dynamics study of torque functions of the motion of the manipulator
Molecular Assemblers hypothetical device that be used to assemble atoms/molecules
at will
Trajectory Generation Set of mathematical functions that specifies where the joints
needs to be present in order for the manipulator to go from here to there
Spline smooth mathematical function that passes through a set of given points
Cartesian Trajectory when the end effector is specified to move in a straight line
1.13. SUMMARY
Simulation, modeling, instrumentation and control of chemical processes are important in
the manufacture of products at the lowest cost, good quality in an environmentally safe
manner. The industrial controls market and chemical process industry market size are
discussed. Supply chain robots are increasingly used. Camera drones are expected to be used
in the future for interesting applications ranging from fighting fires to precision agriculture.
Infeasibility of molecular assemblers is discussed. Robots as a collegiate course are outlined.
Nanorobots are possible as envisioned in the movie fantastic voyage. Transient analysis of
unit operations and reactors are used in start-up and shut down operations. Real industrial
world happenings were cited to better motivate the discipline: (i) Trommsdorff effect during
free radical polymerization is when the reactor gets setup due to runaway polymerization.
Causes are attributed to viscosity increase in the monomer/polymer mass and the termination
reactions cease on account of difficulty with diffusion; (ii) centralized heating and cooling in
modern homes using feedback control of air from the furnance or air conditioner using a
thermostat; (iii) feedforward control of human body temperature. Heat conduction through
five layers, i.e., skin, fat, muscle, bone and blood are considered. Vasodilation and
evaporative cooling are the two mechanisms of cooling effect within the human anatomy; (iv)
feedback control of 3 arm robotic manipulator with end effector. Sensors are used to measure
the joint angles and joint velocities. Torques needed is calculated from trajectory generator.
Feedback is used to detect any servo error. Control action is taken based on deviations; (v)
Introduction
29
nuclear meltdown in Fukushima nuclear power plant after the tsunami and earthquake in
2011; (vi) deepwater horizon oil spill of 2010.
11 main components of a control system was discussed including control ojectives, set
points, measuring elements, input, disturbance and output variables and control types. Better
automation and control leads to closer to optimal operation of the plant. Process is operated in
a less hazardous and safer manner without increasing the cost.
Feedback control action is taken based on the error generated during operation of a
process. The output variable is measured and compared against the set point. The difference is
the error. Different feedback controllers used are on-off, P, proportional only control, PI,
proportional integral control, PD, proportional derivative control and PID, proportional
integral and derivative control. Feed forward control action is taken upon direct measurement
of the disturbance variable. The control action is in anticipation of the changes expected in the
output variable. Often times success of this type control action depends on availability of
reliable mathematical models between the process output variables and control variables and
effect of perturbations. Internal Model Control, IMC IMC, internal model control action uses
the knowledge about the process that is being controlled. Filters can be added to make the
controller more realizable. The transfer function of the output has to be proper. Ratio control
is used to control ratios of reactant mixtures, reflux rate in a distillation column etc. Statistical
process control, SPC is used to control the output variable within certain limits. Control
charts are used to better understand the errors between measured and set point values.
Attributable causes are assigned to variations. Noise is delineated from a disturbance. Control
action is taken according to a 3 sigma or 6 sigma control limit. Estimation and control of
polymerization reactors is an ardous task due to exothermic nature of the reaction, high
viscosity etc. Some of the desirable parameters are not easty to measure. Estimation
techniques such as Kalman filter and Weiner filter are beginning to be used in order to obtain
parameters that are difficult to measure. The dynamic equations in polymerization reactors
are non-linear. They are linearized and made similar to other existing systems. ANNs,
artificial neural networks may be used in control of distillation columns where the number of
output variables is in the hundreds and the relation to the input variables are governed by
equations that are nonlinear. NNs can be used to approximate any mathematical function to a
desired level of accuracy. Most control schemes discussed is single variable input and single
variable output, SISO systems. MIMO systems are multiple variable input and multiple
variable output systems. Interaction effects of variables in MIMO systems are often
important. Cross controllers in addition to principal controllers may be used to accomplish the
control objectives. During adaptive control observations made at discrete intervals of time are
used to update the mathematical model for the process. This is used in the control action
taken.
1.14. FURTHER READING

Chen, C. C. (1994). A Continuous Bulk Polymerization Process for Crystal Polystyrene,
Polym. Plast. Technology Eng., Vol 33, 55-58.
Chen, C. (2000). Continuous Production of Solid Polystyrene in Back-Mixed and LinearFlow Reactors, Polym. Eng. Sci., Vol. 40, 441-464.
30
Coughanowr, D. R. & LeBlanc, S. E. (2009). Process Systems Analysis and Control, McGraw
Hill Professional, New York, NY. Sources
Craig, J. (2005). An Introduction to Robotics and Control-Mechanics and Control, Prentice
Hall, Upper Saddle River, NJ. http://en.wikipedia.org/wiki/Deepwater_Horizon.
Gharaghani, M., Adedini, H. & Parvazinia, M. (2012). Dynamic Simulation and Control of
Auto- Refrigerated CSTR and Tubular Reactor for Bulk Styrene Polymerization,
Chemical Engineering Research and Design, Vol. 90, 1540-1552.
Hui, A. W. & Hamielec, A. E. (1972). Thermal Polymerization of Styrene at High
Conversions and Temperatures: An Experimental Study, J. Appl. Polym. Sci., Vol 16,
749-769.
Internet Market Report, Industrial Controls and Robotics Market Global Industry,
Analysis, Size, Share, Growth, Trends and Forecast 2013-2019, Transparency Market
Research,
Kang, C. (March 7th 2013). New Robots in the Workplace: Job Creators or Job
Terminators? Washington Post.
Kruse, R. L. (1990). Tormsdorff effect, Private Communication, Monsanto Plastics
Technology, Indian Orchad, MA.
Marlin, T. E. (2000). Process Control:Designing Processes and Control Systems for Dynamic
Performance, McGraw Hill, 345-349.
Newsweek, Issue Dated March 28th & April 4th 2011, with cover Story Apocalypse Now
Rehg, J. A. & Sartori, (J. G. J.). Industrial Electronics, Prentice Hall.
Rockis, G. J. & Mazur, G. A. (2009). Electrical Motor Controls for Integrated Systems,
American Technical Publishers, Inc., Homewood, IL.
Satariano, A. (November 24th 2013). Apple Fortifies its Own Supply Chain Building
Robots and Lasers, Washington Post.
Sharma, K. R. (2010). Transport Phenomena in Biomedical Engineering: Artificial Organ
Design and Development and Tissue Design, McGraw Hill Professional, New York, NY.
Sharma, K. R. (2010). Nanostructuring Operations in Nanoscale Science and Engineering,
McGraw Hill Professional, New York.
Sharma, K. R. (2013). On Photodynamic Therapy of Alzheimers Disease Using Intrathecal
Nanorobot Drug Delivery of Curcuma Longa for Enhanced Bioavailability, Journal of
Scientific Research and Reports, Vol. 2, 1, 206-227.
Yokota, T. Newsweek, Issue Dated March 21st 2011, with cover Story Earthquake 8.9.
1.15. EXERCISES
1.0. Why is dynamics an important consideration during plant start-up and plant shut
down?
2.0. What are the differences between computer simulation and mathematical model?
3.0. What causes the Trommsdorf effect?
4.0. What is meant by reaction run away?
5.0. What are the differences between feedback control and feedforward control?
6.0. What are the differences in function between comparator and controller?
7.0. In which type of control is measurement of the output variable part of the operation?
Introduction
31
8.0. In which type of control is measurement of the disturbance part of the operation?
9.0. Airline pilot is sent a signal from the airport about the weather conditions in the
arrival location. On account of snowstorm he delays arrival at Minneapolis, MN.
What kind can this control action are classified as.
Classify as Feedforward or Feedback Control (Exercises 10-30);
10.0. Steering Action in Cars. The direction of the wheels is the output variable.
Direction of the steering wheel is the signal.
11.0. Control of Speed of Car by pushing the gas pedal or brake pedal.
12.0. Marathon athlete drinking lemonade to cool off.
13.0. Sun Tracker in a solar power plant.
14.0. Agitator speed control in a CSTR at a continuous polymerization plant.
15.0. Temperature control of a devolatilizer at a continous polymerization plant.
16.0. Level control of a devolatilizer at a continuous polymerization plant.
17.0. Reactor pressure control at a continuous polymerization plant.
18.0. Homogeneity control in rubber dissolver in monomers at a continuous
polymerization Plant.
19.0. Time Watering the Lawn in modern house based on lawncare conditions.
20.0. Control of the trajectory of the end effector of a 2 arm manipulator..
21.0. Inlet Temperature of Gas turbine in Combined Cycle Power Plant.
22.0. Vibration s of a Nuclear Reactor during Earth Quake.
23.0. Temperature of a Kettle in Continuous Pharmaceutical Produ ction.
24.0. Solar Cell Temperature in Solar Aided Combined Cycle Power Plant.
25.0. Temperature of Catalytic Oxidation Reactor of Sulfur Dioxide.
26.0. Bubble Size in a Plate Pulsed Column.
27.0. Volume Fraction in a Fiber Reinforced Composite.
28.0. Vicosity in a Blender of Polyethylene and Nylon.
29.0. Temperature of a Polymerization Reactor for PMMA, Poly Methyl Methacrylate.
30.0. Pressure of a Devolatilizer during Terpolymer Manufacture.
31.0What is the difference between fail-safe and fail-open valves?
32.0. What are the differences between adaptive control and ratio control?
33.0. What are the differences between IMC, internal model control and control action
using neural networks?
34.0. What are the differences between SPC, statistical process control and use of
Kalman filter during control in polymerization reactors?
34a.0. What are the nuances to multivariate process control?
35.0. What is the radioactive damage to the environment on account of Fukushima earth
quake?
36.0. What was the role of the cooling break-down in the Fukushima disaster?
37.0. Can motor speed and motor torque be predicted using a mathematical model?
38.0. What is meant by Constant torque mode of operation?
39.0. When is the output hp of a motor constant?
40.0. Why is the work done by the fluid in the motor not predictable?
41.0. What happens to the termination rate constant when the temperature of the reactor
is increased? Why?
32

42.0. At which temperature, higher or lower is the reactor more prone to the gel effect?
43.0. What is the role of the addition of solvent to the gel effect?
44.0. Can the molecular weight that is high in Figure 1.0 be relied on for scale-up
purposes?
45.0. How does the gel effect confirm the termination by combination mechanism and
not the other mechanisms such as disproportination?
Chapter 2
CONTINUOUS POLYMERIZATION
PROCESS TECHNOLOGY
2.1. INTRODUCTION
Often times the choice of technology with continuous mode of operation in order to
manufacture commodity and engineering polymer products in large scale, is made compared
with batch mode. Continuous mode is usually the lowest cost, safer and environmentally
friendlier, better product quality with less batch to batch variability. Batch processes require
several hours, in some cases greater than eight hours, to feed the reactants, including
monomer or monomers into the reactor, conduct the polymerization reaction, cool the
resulting polymer, remove the polymer, and clean the reactor. The equipment required for
batch processes typically includes reactors which can hold up to 75,000 liters and may cost
more than $1,000,000 per reactor. To improve the deficiencies of the batch processes,
continuous polymerization processes have been developed. Continuous polymerization
processes are potentially more efficient than a batch process. In a continuous process,
monomer and other reactants are continuously fed into and through the reactor while, at the
same time, polymer is continuously removed from the reactor. The unreacted monomers are
separated from the polymer product and recycled back to the reactors. A continuous process
may produce more products per day with a typical plant operated at 15,000 pph, utilizing
smaller, less expensive reactors. Continuous processes utilizing continuous stirred tank
reactors or tubular reactors are two types of continuous processes.
The three methods of making polymers are emulsion, suspension and solution or bulk
polymerization. A good number of the emulsion and suspension processes are operated in the
batch mode. The solution polymerization or continuous mass polymerization has been the
choice of the manufacturers of;
(i)
(ii)
(iii)
(iv)
(v)
(vi)
Polystyrene
HIPS, rubber modified polystyrene
SAN, styrene acrylonitrile copolymer
ABS, Acrylonitrile Butadiene and Styrene engineering thermoplastic
Polymethyl methacrylate
Formaldehyde dioxolane semi-batch copolymerization
34

(vii) Continuous process for high quality anhydrosugar alcohols etc, polycarbonate.
Other than the free radical mechanism of polymerization other mechanisms such
Zeigler Natta coordination covalent process for making polypropylene and
polyethylene can be used in the continuous mode of plant operation. Examples of
processes with continuous mode of operation are;
(viii) The condensation and step growth polymerization can be performed continuously.
(ix) A variety of compounding processes such as polymer polymer miscible blends that
mix at a molecular level and compatible blends with product property
improvement such as the making of the extra tough polyacetal resin by
compounding with polyurethane and viscosity and color, colorability modifications
of polymers etc are operated in the continuous mode.
(x) Some emulsion processes are evaluated to be operated in the continuous fashion.
(xi) Waste tires can be devulcanized and polybutadiene reclaimed in a continuous
manner
2.2. OVERVIEW OF MONSANTO 2 CSTR CONTINUOUS MASS

POLYMERIZATION PROCESS FOR ABS
A need for a continuous mass polymerization process for ABS polymers with high
conversion rates and low energy requirements was identified by leading companies such as
Monsanto Plastics (currently Bayer), Indian Orchad, MA, Dow Chemical Company, Midland,
MI, and General Electric, Pittsfield, MA. High polymerization efficiency for ABS polymers
having superior properties was sought and the process needed to be robust enough to handle
high conversion on a large scale.
ABS polymers comprise of a matrix phase copolymer of styrene and acrylonitrile and a
dispersed phase of a conjugated polybutadiene rubber grafted with the SAN chains. Various
processes have been utilized for the manufacture of such polymers including emulsion,
suspension and mass polymerization techniques and combinations of the three. Although
mass polymerized products exhibit desirable properties, this technique has a practical
limitation upon the maximum degree of conversion of monomers to polymer which can be
effected because of the high viscosities and accompanying power and equipment
requirements, which are encountered when the reactions are carried at high conversion
[Kruse, 1983].
In a typical ABS mass polymerization process styrene and acrylonitrile are
copolymerized in the presence of a diene-based rubber [Sharma, 1997]. Initially the rubber is
dissolved in the monomers and a continuous homogeneous phase prevails. When
polymerization begins, the monomers are simultaneously copolymerized alone and also as a
graft on the rubber backbone. As the monomers polymerize two phases appear: the polymer
dissolved in monomer and the rubber dissolved in monomer. Initially the latter phase
predominates and the smaller "polymer in monomer" phase is dispersed in the larger "rubber
in monomer" phase. However as polymerization progresses the "polymer in monomer" phase
becomes greater in volume. At this point the phenomenon of phase inversion occurs and the
"rubber in monomer" phase becomes dispersed as discrete particles in a matrix of the
"polymer in monomer" phase. Usually in a mass polymerization process, the rubber will
35
contain occlusions of polymer/monomer which serve to swell the volume of the rubber
particle. As polymerization progresses, monomer is converted to polymer, the viscosity of the
mixture increases and greater power is needed to maintain temperature and compositional
uniformity throughout the polymerization.
Another limitation of previous attempts at the process, is that production of polymers
with a high proportion of acrylonitrile as well as high rubber volume fraction is not possible.
This is because although rubber dissolves readily in styrene, its solubility in a mixture of
styrene and acrylonitrile monomers decreases with the increase in concentration of
acrylonitrile. It is found for example that styrene monomer can dissolve about 20% of its
weight of a diene rubber whereas a monomer mixture containing 58% styrene and 42%
acrylonitrile can dissolve less than 10% of its weight of the same rubber. Thus the amount of
rubber that can be added in solution in the monomer mixture is restricted by the proportion of
acrylonitrile monomer. However for many purposes such as solvent resistance and toughness
it is desirable to have a proportion of acrylonitrile as high as 40% or more by weight. Kruse
[1983] described a continuous mass polymerization process for preparing an ABS polymer
having a matrix phase comprising a copolymer of SAN and a dispersed phase comprising
rubber particles having a weight average particle size of about 0.1-10 microns. The process
consists of feeding a solution of polybutadiene rubber dissolved in styrene to the first CSTR.
The composition of the dissolved polybutadiene was from 3 - 33% by weight.
By a second feed stream, acrylonitrile was charged simultaneously and continuously to
the stirred reactor. The conversion and solids level in the first reactor was maintained at a
point above that at which phase inversion is expected to occur, i.e., up to 70% by weight
based on the weight of the polymerization mixture. The mixture is continuously polymerized
while maintaining stirring such that the polymerizing mixture has a substantially uniform
composition and such that the rubber is dispersed in the polymerizing mixture as rubber
particles. The ABS polymer is continuously separated from the partially polymerized mixture.
Operation at such a polymer solids content ensures that upon addition, the rubber immediately
forms small particles containing a monomer component, dispersed in the partially
polymerized reaction mixture.
It was found that, using this technique the monomer content (all species) remaining is
less than 0.5 % and substantially all monomer is removed within 30 seconds such that
polymerization is not significantly advanced during the polymer separation. What remains is
polymeric and the percentage of the sample weight that this represents is the polymer solids
of the polymerizing mixture at that time. Because acrylonitrile is separately but
simultaneously fed and because the point of phase inversion for the system has been passed
such that the rubber disperses as particles as it enters the reaction mixture, the process has the
capability of employing high rubber concentrations while still realizing a high acrylonitrile
concentration in the final ABS composition. Preferred ABS molding compositions have high
gloss and an average rubber particle size less than about 500 nm and most preferably 200
400 nm. Conventional ABS polymers having rubber particles this small however lack
toughness. Raising the acrylonitrile content of such ABS polymers from the conventional
24% to the range of about 27 to 40% permits these small rubber particles effectively to
toughen such an ABS polymer to an unexpected degree.
The polymer conversion at which the reaction is conducted is limited by two practical
considerations. At the lower end of the range, (as has been indicated above), it is important
that the polymer solids level in the reactor, (or the initial reactor where a series of reactors is
36
used), to which the monomer streams are added be such that the polymer/monomer phase has
a greater volume than the rubber/monomer phase such that the rubber/monomer immediately
forms a dispersed phase. In practice this implies a monomer to polymer conversion level of
about 35%. At the upper level, the practical constraints of power requirements for the reactor
agitator place a limit of about 70% solids. This does not necessarily imply a similar
conversion level since up to 50% and from 10 to 30% by weight of a suifigure solvent, (based
on the weight of the monomers fed to the reaction), can be used to dilute the reaction mixture
to a point at which, even with up to 99% monomer to polymer conversion, the power
requirements are not excessive.
Some or all of the diluent can be introduced with the rubber in styrene stream either as an
added component or by the use of a rubber which is already dissolved in a suitable solvent
such as hexane or cyclohexane. The diluents used are ethyl benzene or methyl ethyl ketone.
Those ABS polymers having a rubber particle size, of from about 100 -500 nm;
acrylonitrile monomer content of about 27 to 40; a rubber content of about 14 to 25%; and a
graft level of 150 to 200% generally require a lower molecular weight matrix phase
copolymer to ensure proper flow properties, e.g., a molecular weight of about 3,000-60,000
(Mn) or approximately 5,000-50,000 (Mv). After polymerization has progressed to the desired
conversion level, the residual monomer is stripped from the polymer. This operation, which is
the same whether a single reactor or a series of reactors is employed in the polymerization
stage, is conventionally done in a separate device such as a wiped film devolatilizer or a
falling strand devolatilizer.
Wu and Virkler [2001] have patented a continuous mass polymerization method in order
to manufacture ABS for refrigerator liners. Polybutadiene with Mw, weight averaged
molecular weight ~ 80,000-250,000 was used in the two reactor and devolatilizer process.
Peroxy initiator was used in the first reactor and no initiator was used in the second reactor.
The matrix SAN molecular weight was ~ 65,000 70,000 gm.mole-1. The first reactor feed
comprises of PBd rubber dissolved in styrene and mixed with acrylonitrile, diluent. Chemical
initiator was also used. Reactor 1 was operated at 20-30% steady state monomer conversion
to polymer forming 20-30% solids. As polymerization takes place the initiator radicals form
grafting sites at the vinyl bonds of PBd. Graft chains of SAN grow to a larger size. The rubber
phase is formed with grafted SAN chains. It precipitates into a solid phase. This step is
similar to crystallization kinetics from a supersaturated solution with swing in solvent
composition. The rubber phase was found to have a weight averaged particle size of Dw ~0.3
0.7 m. As the graft molecular weight is greater than PBd molecular weight the grafted
chain provides the surface coverage of formed rubber particles. SAN chains lower in length
than a critical length leads to the formation of occlusions within the particle. The PBd chains
can cross-link during the consecutive-competitive reactions. Cross-linking reactions may be
responsible for formation of particles with cell morphology. Some cross-linking offers better
gloss of the final product. It was found,serendipitously, that higher the volume of occlusion
within the rubber particle the more efficiently the rubber phase is used in toughening the
polymer. The grafted chains stabilize the formed rubber particles. The second reactor is well
stirred and conversions of 50-90% are achieved here. The polymer solids formed in the
second reactor is ~ 75%. The temperature in the first reactor was held constant for isothermal
operation at ~ 75-85 0C. The temperature in the second reactor was held constant for
isothermal operation at 130 155 0C. No chemical initiator was added to the second reactor.
The heat released from the exothermic polymerization reactions is cooled by vaporization of
37
some monomer from the reacting mass. SAN chains that form by thermal initiation form the
matrix of the ABS blend. Jacket cooling is also available. The devolatilization is conducted in
WFD, wiped film devolatilizer, FSD, falling strand devolatilizer or Extruder. The DV
temperatures are ~ 200 280 0C, operating pressures of 0.01 700 mm Hg. Residual
monomer and oligomer levels are about 2000 ppm. The particle size distribution of rubber
phase was characterized by a Dw/Dn = 2.5. The rubber level in the ABS product is ~10-16%.
The impact strength, notched Izod of the sample was 25 KJ.m-2 and tensile modulus was 2.2
GPa.
2.3. THE DOW PROCESS TO PREPARE MAGNUM ABS

Polybutadiene was dissolved in a feed stream of styrene, acrylonitrile, and ethyl benzene
to form a mixture. The mixture was polymerized in a continuous process under agitation. The
polymerization occurred in a three stage reactor system over an increasing temperature
profile [Bredewig, 1980]. During the polymerization process, some of the forming copolymer
grafts to the rubber particles while some of it does not graft, but, instead, forms matrix
copolymer. The resulting polymerization product was then devolatilized, extruded, and
pelletized. Different rubber particle sizes in the final polymer product are achieved by
changing certain process parameters. These process parameters and how they must be
changed to produce rubber particles of a desired size include the degree of agitation,
temperature, initiator level and type, chain transfer agents and amounts, and diluent type and
concentration.
Immediately after the polymerization reaction commences, the rubbery material in the
monomer mixture separates into two phases, of which the former, consisting of a solution of
the rubber in the monomer mixture, initially forms the continuous phase, whereas the latter,
consisting of a solution of the resultant copolymer in the monomer mixture, remains
dispersed in form of droplets in the continuous phase. As polymerization and hence
conversion proceed the quantity of the latter phase increases. As soon as the volume of the
SAN matrix phase equals that of the rubber dispersed phase with grafted SAN a phase change
occurs, generally known as phase inversion. When this phase inversion takes place, droplets
of rubber solution form in the polymer solution. These rubber solution droplets incorporate by
themselves small droplets of what has now become the continuous polymer phase. During the
process, grafting of the polymer chains on the rubber takes place, too.
Generally, the polymerization is carried out in several stages. In the first polymerization
stage, known as prepolymerization, the solution of the rubber in the monomer mixture is
polymerized until phase inversion is reached. Polymerization is then continued up to the
desired conversion. Mass polymerization offers rubber-modified SAN or ABS copolymers
with a good balance of physical and mechanical properties, however the surface gloss of such
copolymers is not always quite satisfactory. The polymerization is conducted in one or more
substantially linear, stratified flow or so-called "plug-flow" type reactor which may or may
not be recirculated as shown in Figure 1.0. The temperatures at which polymerization is most
advantageously conducted are dependent on a variety of factors including the specific initiator
and type and concentration of rubber, comonomers and reaction diluent, if any, employed. In
general, polymerization temperatures from 60-160 0C are employed prior to phase inversion
38
with temperatures from 100-190 0C being employed subsequent to phase inversion. Mass
polymerization at such elevated temperatures is continued until the desired conversion of
monomers to polymer is obtained. Generally, conversion of from 65-90% of the monomers
added to the polymerization system (i.e., monomer added in the feed and any additional
stream, including any recycle stream) to polymer is desired.
Following conversion of a desired amount of monomer to polymer, the polymerization
mixture is then subjected to conditions sufficient to cross-link the rubber and remove any
unreacted monomer. Such cross-linking and removal of unreacted monomer, as well as
reaction of diluent, if employed, and other volatile materials is advantageously conducted
employing conventional devolatilization techniques, such as introducing the polymerization
mixture into a devolatilizing chamber, flashing off the monomer and other volatiles at
elevated temperatures, e.g., from 200-300 0C., under vacuum and removing them from the
chamber. The rubber-modified aromatic copolymer composition is thermoplastic. When
softened or melted by the application of heat, the compositions of this invention can be
formed or molded using conventional techniques such as compression molding, injection
molding, gas assisted injection molding, calendaring, vacuum forming, thermoforming,
extrusion and/or blow molding.
Surface gloss is very dependent upon molding conditions, i.e., for injection molding,
machine parameters such as barrel and mold temperatures, injection and holding
speed/pressure/times, etc., and method of testing gloss can dramatically affect the gloss value
for a given material. The gloss value for materials molded under unfavorable conditions is
referred to as intrinsic gloss. Unfavorable conditions generally are those which limit or reduce
the flow of the material during molding. For example, it is well known that surface gloss is
reduced when during injection molding lower melt temperature, lower mold temperature,
lower injection pressure, slower injection speed, lower holding pressure, etc., are applied.
Conversely, conditions which enhance the flow of the material will improve gloss. Materials
with an intrinsic gloss less than 70 percent can, when molded under favorable or ideal
conditions, demonstrate higher gloss (e.g., 70 percent or higher).
The mass polymerized rubber-modified ABS copolymer compositions can also be
formed, spun, or drawn into films, fibers, multi-layer laminates or extruded sheets, or can be
compounded with one or more organic or inorganic substances, on any machine suitable for
such purpose. Some of the fabricated articles include household appliances, toys, automotive
parts, extruded pipe, profiles and sheet for sanitary applications. These compositions can even
find use in instrument housings such as for power tools or information technology equipment
such as telephones, computers, copiers, etc.
Figure 1.0. Reactor Configuration in the Dow Process for Magnum ABS.
39
2.4. THE PLUG FLOW MULTIZONE PROCESS

Multizone plug flow bulk processes include a series of polymerization towers,
consecutively connected to each other, providing multiple reaction zones. Stereospecific
polybutadiene rubber is dissolved in styrene or in styrene/acrylonitrile monomers mixture,
and the rubber solution is then fed into the reaction system. The polymerization can be
thermally or chemically initiated, and viscosity of the reaction mixture will gradually
increase. During the reaction course, the rubber will be grafted with grafted SAN copolymer
and, in the rubber solution, matrix phase SAN is also being formed. At a point where the free,
ungrafted SAN cannot be "held" in one single, continuous "phase" of rubber solution, it
begins to form domains of SAN phase. The polymerization mixture now is a two-phase
system. As polymerization proceeds, more and freer SAN is formed, and the rubber phase
starts to disperse itself as particles in the matrix of the ever-growing free SAN. Eventually,
the free SAN becomes a continuous phase. This is actually a formation of an oil-in-oil
emulsion system. Some matrix SAN is occluded inside the rubber particles as well. This stage
is usually given a name of phase inversion. Pre-phase inversion means that the rubber is a
continuous phase and that no rubber particles are formed, and post phase inversion means that
substantially all of the rubber phase has converted to rubber particles and there is a
continuous SAN phase. Following the phase inversion, more matrix SAN (free SAN) is
formed and, possibly, the rubber particles gain more grafted SAN. When a desirable
monomer conversion level and a matrix SAN of desired molecular weight distribution is
obtained, the reaction mixture is "cooked" at a higher temperature than that of previous
polymerization. Finally, bulk ABS pellets are obtained from a pelletizer, after devolatilization
where volatile residuals are removed.
A continuous bulk ABS process was described by GE Plastics [Sue et al. 1996] that
provides controllable molecular weight distribution and micro gel particle size using a "threestage" reactor system, for extrusion grade ABS polymers. In the first reactor, the rubber
solution is charged into the reaction mixture under high agitation to precipitate discrete
rubber particle uniformly throughout the reactor mass before appreciable cross-linking can
occur. Solids levels of the first, the second, and the third reactor are carefully controlled to a
desired molecular weight. The process flow diagram is shown in Figure 2.0.
Different processes of ABS manufacturing give different properties to the final ABS
products. One of these properties is the surface gloss of the end products, and technology
development to produce ABS materials that could meet with different gloss requirements is
still an on-going task for the ABS industry. The gloss of an ABS product is partially the result
of molding conditions under which the product is manufactured. However, for a given
molding condition, the rubber particle size (diameter) of the ABS material is a major
contributing factor to the gloss. In general but not always, ABS materials from emulsion
processes produce rubber particles of small sizes (from about 0.05 to about 0.3 microns).
Therefore, high gloss products are often made from emulsion ABS materials. On the other
hand, ABS materials from mass processes usually form rubber particles of large sizes (from
about 0.5 to 5 microns). Therefore, low gloss products are often made using the bulk ABS
materials. Although it is possible to produce small particles using bulk processes, the gloss
and impact resistance balance will be difficult to reach. Overall, current technology described
40
above has not been able to produce, by a bulk process alone, ABS materials of rubber
particles of "cell" morphology with monomodal particle size distributions and with average
particle sizes less than 0.3 microns of number average diameter, without compromising
impact resistance properties. To synthesize ABS polymers with high performance by bulk
processes, three aspects are important;. These three aspects;
1) grafting of the rubber substrate prior to phase inversion,
2) particle formation during phase inversion,
3) and cross-linking of the rubber particle at the completion point of the bulk ABS
polymerization.
However bulk ABS processes discussed above, are somehow deficient by different
degrees in controlling and in adjusting the grafting, the phase inversion, and the crosslinking. Accordingly, technologists attempted to develop the continuous mass polymerization
process which yields the desired rubber morphology and maximizes grafting thereby allowing
a minimization of rubber use for a given level of property performance. Additionally, there is
a desire to provide a bulk process capable for producing ABS resins of low gloss as well as
high gloss.
The products can have the particle sizes that are corresponding to a low gloss
characteristic or can have small particle sizes that are corresponding to a high gloss
characteristic. One of the preferred products has a number average particle size of less than
0.3 microns, a monomodal particle size distribution, and particles of "cell" morphology, and
exhibits high gloss, high impact resistance properties. The "cell" morphology may also be
described as a rubber membrane network of spherical surface with the occluded rigid polymer
(SAN) filled in the interior spaces. Furthermore, with the "cell" morphology, the grafted rigid
polymer (SAN) is grafted on both sides of the rubber membranes, i.e., exterior or interior of
the rubber particle. The materials produced are generally not transparent in nature, but rather
are generally opaque. However, the opacity of the material is, in most cases, relatively lower
than that of emulsion ABS. One of the preferred products of this process can provide high
gloss and high impact resistance ABS by producing rubber particles of "cell" morphology
with small particle sizes of less than 0.3 microns number average diameter and monomodal
size distributions. That is, the present invention offers technology to produce rubber particles
with sizes close to those of emulsion particles and with sufficient grafted and occluded vinyl
aromatic-unsaturated nitrile (SAN) polymers by a bulk process, leading to high surface gloss
and good impact resistance for the bulk vinyl aromatic-unsaturated nitrile-alkadiene (ABS)
materials.
2.5. PROCESS FOR HIGH IMPACT POLYSTYRENE (HIPS)

High impact polystyrene polyblends (HIPS) comprises of polystyrene matrix having a
rubber phase dispersed within the continuous phase, as cross-linked rubber particles. These
have been manufactured and marketed. Historically, mechanical blends were prepared by
melt blending polystyrene with raw rubber which was incompatible and dispersed as cross-
41
linked rubber particles to reinforce and toughen the polymeric polyblend. More recently,
HIPS polyblends have been prepared by mass polymerizing solutions of diene rubber
dissolved in styrene monomer in batch reactors wherein the rubber molecules were grafted
with styrene monomer forming polystyrene polymer grafts on the rubber along with
polystyrene polymer in situ in the monomer. As the polystyrene-monomer phase increases
during polymerization the grafted rubber phase inverts readily as rubber particles comprising
grafted rubber and occluded polystyrene contained therein with said particles cross-linked to
maintain the rubber particles as discrete particles dispersed in the polystyrene which forms a
matrix phase of the HIPS polyblend.
Analysis reveals that the novel polyblends comprise rubber particles structured in new
morphological forms comprising rubber fibers or rubber sheets and mixtures. The novel
rubber particle structure has been found to provide the HIPS polyblends with a more efficient
rubber particle providing improved physical properties for the polyblend such as gloss,
impact strength, melt flow and falling dart impact strength. By contrast, HIPS polyblends
previously attempted have rubber particles structured with relatively large amounts of
occluded polystyrene contained in a network of continuous rubber membranes as the only
morphological structure. HIPS polyblends containing such particles only, have lower
reinforcing ability for the polyblend and are relatively deficient in flow and gloss.
Hitachi [1983] developed a continuous process to produce high impact polystyrene,
HIPS. Rubber and styrene form the feed to a multi-stage, horizontal dissolving tank where the
polybutadiene is dissolved in styrene monomer by stirring. Heat released is allowed to
increase the temperature of the solution. Grafting reactions are facilitated in the first reactor
and the phase inversion from rubber as continuous phase to rubber as dispersed phase is
affected. The subsequent reactors in the process are used to complete the bulk polymerization
of polystyrene. Heat generated from exothermic reactions is removed. The unreacted
monomers are separated from the polymer product in a separator and recycled back to the
reactor. The process flow diagram is shown in Figure 3.0.
Figure 2.0. GE Continuous Mass Three Stage Polymerization Process with a Prepolymerizer and
Finisher to Manufacture ABS.
42
Figure 3.0. Hitachi Process for Continuous Polymerization Process for HIPS.
During the production of HIPS, it is important to remove heat generated from the
exothermic polymerization reactions and heat of agitation. The temperature of the reactor has
to be controlled as specified. The viscosity of the polymerized syrup increases as the reaction
proceeds. The heat removal is considered difficult. Addition of solvent or diluent such as
ethyl benzene can soak up the heat released. The presence of diluent will obviate the runaway
polymerization condition, i.e., the Tormsdorff effect that was discussed in Chapter 1.0.
Partially filled reactor kettles can allow vaporization of monomers and diluent. During the
vaporization of the liquid heat is consumed. This provides for ease of temperature control of
the reactor. Foaming can be avoided. Polybutadiene and styrene are brought in contact with
each other in the dissolving tank that is agitated.
The dissolving step is stage wise and the tank is operated at atmospheric pressure. The
temperatures are raised stepwise from room temperature for the first stage up to the
polymerization temperature for the final stage. The temperature policy is 20 40 0C for the
first stage, 40 60 0C for the second stage and 80 110 0C for the third stage. The residence
time for each stage is about 1- 2 hrs. Four or 5 stages may be used for this step.
The first reactor is operated at temperatures 100 130 0C under atmospheric pressure.
The initiator can be added as desired. The phase inversion of the rubber phase from
continuous to disperse is allowed to happen in this reactor. The outlet of the first reactor is
about 25 40% solids. Heat removal from the reactor is by external jacket. The second
reactor has a rotary shaft with number of disk blades. The reactor operating temperatures are
~ 100-150 0C under reduced pressure. The reaction conversion is allowed to go as high as
60% at the outlet of the second reactor. The finisher has mechanism for heating and cooling.
The finisher can be hotter than the second reactor and the conversion can be 70-85%. Heating
type monomer separator is used in order to separate the polymerized product from the
unreacted monomers which can be returned to the rubber tank or feed line. Shearing elements,
flash heater, rotary shaft, close clearance helical blades are present in the separator. Vacuum
43
pressures of 0.5 200 torr can be achieved in the separator. Temperature of the separator is
about 230 0C. The product with 4% rubber content can be made. The residence time in the
reactor is 4.3 hrs. and that in the finisher is 3.8 hrs. Vents and traps are provided for rapid
volatiles to be captured. Condensers, vacuum pumps, monomer tanks, pumps can be seen in
Figure 3.0. Once separated the tanks are used to store the monomers. Die head, cooling bath,
chip cutter are used to receive the polymer strands and make them into pellets.
2.6. BASELL GAS PHASE POLYMERIZATION PROCESS

FOR POLYOLEFIN
Basell polyolefin practices a process for the gas-phase fluidized bed catalytic
polymerization of olefins. Two or more interconnected polymerization zones are used to feed
the monomers and collect the product polymer. The development of olefin polymerization
catalysts with high activity and selectivity, particularly of the Ziegler-Natta type and, more
recently, of the metallocene type, has led to the widespread use on an industrial scale of
processes in which the polymerization of olefins is carried out in a gaseous medium in the
presence of a solid catalyst. Basell was formed in October 2000. It is owned equally by BASF
and Shell. It develops, produces, and markets polypropylene, polyethylene, advanced
polyolefin materials and polyolefin catalysts and also develops and licenses polyolefin
processes. It serves customers in more than 120 countries with materials produced in eighteen
countries.
A widely used technology for gas-phase polymerization processes is the fluidized-bed
technology. In fluidized-bed gas-phase processes, the polymer is confined in a vertical
cylindrical zone. The reaction gases exiting the reactor are taken up by a compressor, cooled
and sent back, together with make-up monomers and appropriate quantities of hydrogen, to
the bottom of the bed through a distributor. Entrainment of solid in the gas is limited by an
appropriate dimensioning of the upper part of the reactor (freeboard, i.e. the space between
the bed surface and the gas exit point), where the gas velocity is reduced, and, in some
designs, by the interposition of cyclones in the exit gas line. The flow rate of the circulating
gas is set so as to assure a velocity within an adequate range above the minimum fluidization
velocity and below the "transport velocity". The heat of reaction is removed exclusively by
cooling the circulating gas. The catalyst components may be fed in continuously into the
polymerization vessel. The composition of the gas-phase controls the composition of the
polymer. The reactor is operated at constant pressure, normally in the range 1-3 MPa. The
reaction kinetics is controlled by the addition of inert gases.
A significant contribution to the reliability of the fluidized-bed reactor technology in the
polymerization of olefins was made by the introduction of suitably pre-treated spheroidal
catalyst of controlled dimensions and by the use of propane as diluent. Since fluidized-bed
reactors approximate very closely the ideal behavior of a "continuous stirred-tank reactor"
(CSTR), it is very difficult to obtain products which are a homogeneous mixture of different
types of polymeric chains. In fact, the composition of the gaseous mixture that is in contact
with the growing polymer particle is essentially the same for all the residence time of the
particle in the reactor. As an example, one of the major limits of fluidized-bed processes is the
difficulty of broadening the molecular weight distribution of the obtained polymers. It is
44
generally known that, in the continuous polymerization of olefins in a single stirred stage
(which also involves steady composition of the monomers and of the chain transfer agent,
normally hydrogen) with Ti-based catalysts of the Ziegler-Natta type; polyolefin having a
relatively narrow molecular weight distribution are obtained. This characteristic is even more
emphasized when metallocene catalysts are used. The breadth of the molecular weight
distribution has an influence both on the rheological behavior of the polymer (and hence the
processability of the melt) and on the final mechanical properties of the product, and is a
characteristic which is particularly important for the (co)polymers of ethylene. It is possible to
broaden the molecular weight distribution of polymers without affecting their homogeneity
by means of a gas-phase process performed in a loop reactor. The gas-phase polymerization is
carried out in two interconnected polymerization zones to which one or more monomers are
fed in the presence of a catalyst under reaction conditions and from which the polymer
produced is discharged.
The process is characterized in that the growing polymer particles flow through the first
of the polymerization zones under fast fluidization conditions, leave the first polymerization
zone and enter the second polymerization zone, through which they flow in a densified form
under the action of gravity, leave the second polymerization zone arid are reintroduced into
the first polymerization zone, thus establishing a circulation of polymer between the two
polymerization zones. It is possible to broaden the molecular weight distribution of the
polymers simply by properly balancing the gas-phase compositions and the residence times in
the two polymerization zones of the gas-phase loop reactor. This is due to the fact that, while
the polymer moves forward in the second polymerization zone flowing downward in a plugflow mode, owing to the monomer consumption, it finds gas-phase compositions richer in
molecular weight regulator. Consequently, the molecular weights of the forming polymer
decrease along the axis of this polymerization zone. This effect is also enhanced by the
temperature increase due to the polymerization reaction.
Only a limited control of the molecular weight distribution is possible. In fact, even if
hindered by the packed polymer, the diffusion of the gas within the polymerization zone in
which the polymer particles flow in a densified form makes it difficult to establish substantial
differences in the gas compositions at different heights of that zone. Moreover, it is not easy
to achieve an effective balance of the residence times in the two different polymerization
zones of the reactor. Sometimes means are provided which are capable of totally or partially
preventing the gas mixture present in the riser from entering the down comer, and a gas
and/or liquid mixture having a composition different from the gas mixture present in the riser
is introduced into the down comer.
The introduction into the down comer of the gas and/or liquid mixture having a
composition different from the gas mixture present in the riser is effective in preventing the
latter mixture from entering the down comer. The state of fast fluidization is obtained when
the velocity of the fluidizing gas is higher than the transport velocity, and it is characterized in
that the pressure gradient along the direction of transport is a monotonic function of the
quantity of injected solid, for equal flow rate and density of the fluidizing gas. Generally, in
the down comer the growing polymer particles flow downward in a more or less densified
form. Thus, high values of density of the solid can be reached (density of the solid =kg of
polymer per cu.m of reactor occupied by polymer), which can approach the bulk density of
the polymer. A positive gain in pressure can thus be obtained along the direction of flow, so
that it becomes possible to reintroduce the polymer into the riser without the help of special
45
mechanical means. In this way, a "loop" circulation is set up, which is defined by the balance
of pressures between the two polymerization zones and by the head losses introduced into the
system. The gas mixtures involved in the process of the invention can contain entrained
droplets of liquid composed of liquefied gas, as it is customary when operating in the socalled "condensing mode". The introduction of the gas and/or liquid mixture of different
composition into the down comer are such to establish a net gas flow upward at the upper
limit of the down comer. The established flow of gas upward has the effect of preventing the
gas mixture present in the riser from entering the down comer.
Basells Spheripol process is the most licensed technology ever developed for the
production of polypropylene. Since 1982, proof of its enduring success is the number of
leading polypropylene producers choosing this technology. This includes Exxon, Dow,
Borealis, Showa Denko, Hyundai and Sinopec to name a few. Spheripol process is the result
of 40 years of quality improvement. In the 1960s, polypropylene processes employed first
generation low yield catalysts (< 1000 Kg PP/kg catalyst) in mechanically stirred reactors
filled with an inert hydrocarbon diluent. Polymer produced with these catalysts had
unacceptably high residual metals, and contained 10% a tactic polypropylene which required
separation. Removal of catalyst residues and a tactic PP involved treatment of the polymer
with alcohol, multiple organic and/or water washings, multistage drying and elaborate
solvent, amorphous and catalyst separation systems. These processes were costly and difficult
to operate and also required extensive water treatment facilities and catalyst residue disposal
systems. In the 1970s the discovery of second generation high yield catalysts (6000 kg PP/kg
catalyst) eliminated the need for catalyst residue removal but a tactic was still unacceptably
high. This simplified the washing but did not eliminate the tactic recovery steps. In the 1980s
the third generation high yields, high selectivity catalysts (30,000 kg PP/kg catalyst)
eliminated the need for catalyst and a tactic removal. This further simplified the process and
improved product quality. Other breakthroughs occurred in the process design, through the
refinement of gas-phase and bulk polymerization reactors that lead to the development of
Spheripol technology in 1982. Current catalyst generation has the ability to produce new
families of reactor-based products with improved properties. They offer even greater control
over morphology, isotacticity and molecular weight. Polypropylene is the worlds fastest
growing thermoplastic.
The safety record of Basel technologies is among the best in the world. They achieved
nearly 7 million operating hours without any major incident. Spheripol technology includes
features that reduce both resource consumption and emissions from the process. These
include use of high yield highly stereospecific catalysts the absence of solvents in the process
to suspend the polymer (the suspension agent is the monomer itself, recovery and recycling of
unreacted monomers and the absence of undesired by-products from the reaction. At the end
of 2002 a year-on-year analysis of operating records from over 80 spheripol process plants
worldwide showed the average overall operability rate is about 98%. Of an average 2%
downtime, less than 1% is due to process features. Spheripol process is versatile and offers a
wide range of homopolymers, random copolymers and terpolymers as well as heterophasic
impact and specially impact copolymers covering all PP application fields. The continuous
process offers good quality product with minimum property variation due to excellent process
stability and consistency of Basels catalysts performance. A range of single line capacities
from 40 450 kilotons/annum are available for homopolymer, random copolymer, either
using polymer or chemical grade monomer. They have a modular plant installation whereby
46
easy adaptation to new business opportunities is effected. Capital costs for spheripol process
are competitive with other used PP processes. It offers the lowest operating costs and
excellent plant reliability and transition efficiency. The sheripol process using high yield and
high selectivity catalysts supplied by Basel has unique ability to produce polymer spheres
directly in the reactor. Spherical PP differs considerably from the small irregularly shaped
granular particles produced with some other technologies and provides significant advantages
in terms of process reliability. It consists of the following unit operations (Figure 4.0);
a) Catalyst Feeding
b) Polymerization
bulk polymerization (homopolymer, random copolymer and terpolymer)
Gas-phase polymerization (heterophasic impact and specialty copolymer. Can be
added at a later stage without affecting initial plant configuration)
c) Finishing
Tubular loop reactors are used to conduct the bulk polymerization. These are filled with
liquid propylene to produce homopolymer or random copolymer or terpolymer. The catalyst,
liquid polypropylene and hydrogen for molecular weight control are continuously fed into the
loop reactor. Residence time in the reactor is lower compared with other technologies. This is
due to the high monomer density and increased catalyst activity. The loop reactor is used
because it is low cost, exhibits good heat transfer characteristics and maintains uniform
temperature, pressure and catalyst distribution. The low residence time also results in short
transitions during grade changes. The complete filling of the reactors results in low
contamination between different grades.
Figure 4.0. Spheripol Process Schematic to Manufacture Spherical Polypropylene Homopolymer,

Random Copolymer and Terpolymer.
47
A homogeneous mixture of polypropylene spheres is circulated inside the reactor loop. If

the production of random copolymer or terpolymer is desired, ethylene and/or butene-1 are
introduced in small quantities into the loop reactor. This process achieves very high solid
concentration (>50% by weight), excellent heat removal (by water circulation in the reactor
jacket) and temperature control (no hot spots). The resulting polymer is continuously
discharged from the reactor through a flash heater into a first-stage de-gassing cyclone.
Unreacted propylene from the cyclone is recovered, condensed and pumped back into the
loop reactor.
For the production of impact and specialty impact copolymers, polymer from the first
reactor is fed to a gas-phase fluidized bed reactor that operates in series with the loop reactor
(this gas-phase reactor is bypassed when homopolymer or random copolymer is produced). In
this reactor, an elastomer (ethylene/propylene rubber) formed by the introduction of ethylene
is allowed to polymerize within the homopolymer matrix that resulted from the first reaction
stage. The carefully developed pores inside the polymer particle allow the rubber phase to
develop without the sticky nature of the rubber to disrupt the operation by forming
agglomerates. Fluidization is maintained by adequate recirculation of reacting gas: reaction
heat is removed from the recycled gas by a cooler, before the cooled gas is recycled back to
the bottom of the gas-phase reactor for fluidization. This type of gas-phase reactor is efficient
because it maintains a high degree of turbulence in order to enhance monomer diffusion and
reaction rates, and offers an efficient heat removal system. Some specialty products,
incorporating two different ethylene content copolymers, require a second gas phase reactor
in series. In impact copolymer production, at least 60% of the final product is produced in the
first-stage loop reactor. In addition, since ethylene is more reactive than propylene, the gasphase reactors are smaller than would be required if this design were to be used for
homopolymer production. Spherical morphology ensures high reliability and elimination of
fouling phenomena, which frequently disrupt other gas-phase systems. Polymer discharged
from the reactors flows to a low-pressure separator and subsequently to a steam treatment
vessel where catalyst residues are neutralized and the dissolved monomer is removed,
recovered and recycled back to the reactor system. From the steamer, polymer is discharged
into a small fluidized-bed dryer with a hot nitrogen closed loop system to remove the
moisture. The final product is conveyed to an extrusion unit, where it is mixed with additives
and extruded to pellets.
Spheripol technology is designed to lower environmental impacts. The design of each
Spheripol process plant includes a number of safety features, such as:
Proprietary Catalyst Deactivation System, which immediately stops all reaction

Computer controlled emergency shutdown systems
Uninterruptible Power Supply (UPS) for computer control and critical
instrumentation control
Instrument air emergency buffer
Emergency Blowdown System to empty the plant quickly, in the event of an
emergency
Gas detectors which instantly determine and highlight (on a graphic easy-to-read
board) the source of any hydrocarbons in the event of leakage into the atmosphere
48
Automatic fire protection systems
Depending upon the severity of the situation, the plant can be shut down manually in a
step-by-step, controlled fashion, more rapidly by both manual and computer control, or by
instant automatic shutdown. Spheripol process units are configured so that unreacted
monomers are recovered and recycled. If necessary, other discontinuous hydrocarbon purges
can be sent to "off-gas recovery for use as a fuel supply or to a flare system. The Spheripol
process does not use hydrocarbon diluents or contaminant chemicals and the only wastewater
is released from the steaming/ drying section of the plant which contains steam condensate
and a small amount of inert polymer fines, which are recovered by a separator. Polypropylene
development has for many years been focused on the use of bimodality as well as increasing
operating temperature to improve the product properties. Bimodality had always been reached
by operating two reactors in series at different operating conditions, resulting in a polymer
with the two different qualities mixed on "intra-particle level. In the Spherizone process,
bimodality is created within one single reactor operating at different conditions between the
various zones inside the reactor, resulting in an intimate mixing of the various propertydetermining phases at "macro-molecular level.
Spherizone technology was brought from lab scale through two scale-ups of pilot plants
to commercial size in 2002, when the very first Spheripol process plant in Brindisi was
upgraded by the installation of the Multi-Zone Circulating Reactor, replacing the two slurry
loop reactors and the flash line with the new reactor module. The plant has been running well
as of the start-up, and is delivering products with excellent quality. The development of the
manufacturing platform and the catalysts used will further continue, and with new
investments in Spherizone process plants planned, Spherizone technology will become the
new standard in PP industry. In the spherizone process (Figure 5.0) catalyst is continuously
fed to the multi-zone circulating reactor. In this specially designed loop-reactor consisting of
two reaction zones, the growing polymeric granules are circulated between the two different
zones. In the so-called "riser the polymer particles are entrained upward in a fast fluidization
regime by the monomer gas flow from a blower. Then, in the top of the reactor the polymer
particles enter the so-called "down comer. Then there is a downward dense-phase plug-flow
regime under gravity. At the bottom of the reactor the polymer particles are again fed to the
"riser section.
The reactor can be operated in different conditions with regard to hydrogen (as chain
transfer agent) and comonomer concentration in the two sections, allowing for the
development of a bimodal (MFR, comonomer concentration/type) polymer structure at
macro-molecular level. This split between the reaction conditions is achieved by injection of a
monomer stream with different composition than in the riser-section at the transition (barrier)
section between the riser- and down comer-section. The reactor can also yield monomodal
homopolymer and random copolymer products by operating the sections in equal conditions.
From the top of the reactor, unreacted monomer is withdrawn and then enters a monomer
recovery section.
Product is continuously withdrawn from the reactor and solid polymer is separated from
the unreacted monomer gas at intermediate pressure. The gas is recycled back to the MZCR.
As an option, the polymer can be fed to a fluidized bed gas-phase reactor that is operated in
series to the MZCR; here additional copolymerization can take place to yield high-impact
copolymer PP. This gas-phase reactor can be bypassed when homopolymer or random
49
copolymer is produced. In the reactor, an elastomer (ethylene/propylene rubber) formed by

the introduction of ethylene is allowed to polymerize within the homopolymer matrix that
resulted from the first reaction stage. The carefully developed pores inside the polymer
particle allow the rubber phase to develop without the sticky nature of the rubber to upset
operation by forming agglomerates. Fluidization is maintained through adequate recirculation of reacting gas; reaction heat is removed from the recycle gas by a cooler before
the cooled gas is recycled back to the bottom of the gas-phase reactor for fluidization. This
type of gas-phase reactor is efficient because it maintains a high degree of turbulence in order
to enhance monomer diffusion and reaction rates while also offering an efficient heat removal
system. Depending on the configuration, from the intermediate separator or the fluidized bed
reactor the product is discharged to a receiver; from there the unreacted monomer gas is
recovered and the polymer is sent to a vessel for monomer removal and neutralization of
residual active catalyst by steam stripping. The removed residual hydrocarbons are recovered
and can be sent back to the reactor system, while the polymer is dried by a closed-loop
nitrogen system in small fluidized bed drier.
2.7. CONTINUOUS MASS POLYMERIZATION ROUTE FOR PMMA

Mitsubishi Gas Chemical Co. has patented a process [Hieda et al., 1998] for preparation
of high quality PMMA, poly methyl methacrylate at high product rates. Initiated, solution
polymerization in the presence of solvent was used in a continuous manner. The polymer
product was discharged into a vented extruder. PMMA has interesting properties such as
transparency, weather resistance, and surface appearance. Batch suspension methods have
usually been deployed for making PMMA. Casting material and low molecular PMMA as
coating has been reported using solution polymerization. Gel effect has been seen when
higher conversions were attempted during preparation of PMMA. At low conversions the
energy needed at the devolatilizer is high in order to separate the unreacted monomers from
the product. Addition of solvent prevents the runaway polymerization condition.
The thermal decomposition resistance deteriorates during solution polymerization of
PMMA. Zipper decomposition begins at a C-C single bond that is found adjacent to a
terminal double bond in the temperature range of 230 0C 270 0C. At polymerization
temperatures less than 100 0C thermally extremely weak head-head bond that is found to
cleave at 200 0C remains. The deterioration of decomposition resistance can be decreased by
decreasing the zipper decomposition and the head-head bond cleavage. This is accomplished
by decreasing the concentration of terminal double bonds in the polymer and the reaction
temperature is increased above 100 0C.
Methanol solvent, MMA, methyl methacrylate monomer, free radical initiator, CTA,
chain transfer agent is added continuously into two agitated reactors connected in series. The
conversion achieved is ~ 55-93 % by mole fraction at polymerization temperatures of 100 0C
180 0C. The polymerized mass is discharged into screw extruder that is vented in a
continuous manner. The devolatilizer is operated at temperatures of 170 0C 270 0C. The
volatiles are collected at the vents. Vacuum of 1 400 mm Hg downstream is used to reduce
the residuals in the polymer further. PMMA with Mw, weight averaged molecular weight of
80,000 200,000 were prepared. The thermal decomposition is only 3 wt%.
50
Figure 5.0. Spherizone Process to Manufacture Spherical Polypropylene.
Some more examples of continuous polymerization technology can be found in the patent
literature. The flow diagrams with labels for the important unit operations are given in the
Figures below. The reactor configuration for solution polymerization of polyglycolide is
shown in Figure 8.0. SAN styrene and acrylonitrile can be prepared in a continuous manner.
The devolatilizer used will depend on the composition of AN in the polymer. In Figure 6.0 is
shown two CSTRs in series and wiped film devolatilizer process in order to make SAN
copolymer. The kinetics of SAN copolymerization is obtained from experimental study. The
reaction rate reaches a maxima as the AN concentration is increased. The sequence
distribution of SAN copolymerization is discussed in Sharma (2011). More monomers can be
added as termonomer or tetra monomer as the product need arises. The process equipment
can be used as retrofit. Thermal polymerization of styrene can be used. In chapter 3.0 is
discussed a method to calculate the polymer composition from monomer composition using
state space representation during free radical multi-component copolymerization in CSTR.
Numerical solutions are needed if made in a PFR. BASF uses a tube bundle reactor to make
SAN (Figure 7.0). At azeotropic composition of AN = 25 wt % the monomer and polymer
composition will be the same. PFR can be used for more productivity. When operated at the
azeotrope monomer-polymer composition in the copolymer is readily calculable. In Figure
9.0 is shown a continuous mass polymerization process for polystyrene. SMA, styrene maleic
anhydride copolymer can be prepared in a continuous manner as shown in Figures 10.0 and
11.0. Examples of condensation polymerization process for production of polyamide and
nylon 6,6 are shown in Figures 12.0 and 13.0. Gas phase polymerization process is shown in
Figure 14.0. Solution copolymerization process developed by Exxon Mobil Corp. is shown in
Figure 15.0. Esterification processes are shown in Figures 16.0 17.0. Poly tri methylene
terephthalate can be prepared as shown by du Pont. Shell has a process for preparation of
polyester as shown in Figure 18.0.
1 Monomer Storage Tank; 2 Flow Control Valve

3,4 - 2 CSTRs in Series
6,9 - Decanters
8 Pump; 5 Static Mixer
Figure 6.0. LG Continuous Mass Polymerization Process for Preparing Styrene-Acrylonitrile
Copolymer.
1 Tube bundle reactor

2,3 intermeshing static mixers
4 Circulating pump; 5 feed mixture inlet; 6 outlet
7 Degassing extruder
8 Fresh monomer; 9 volatile content
Figure 7.0. BASF Continuous Mass Polymerization Process for SAN.
51
52
Figure 8.0. Reactor Configurations in the Continuous Solution Process for Biodegradable
Polyglycolide.
I Circulating Line; II Main Polymerization Line

1- Plunger pump; 5,10,13 Gear pump
2,3,4,6,7,8,9 Tubular Reactors in Series
11 Preheater; 12 Devolatilization Chamber
Figure 9.0. Continuous Bulk Polymerization of Styrene.
1 Maleic Anhydride Feed;

2 Styrene Feed

3 First Stage Reactor; 4 Pump; 7 - shaft
5 1 Shaft Horizontal Reactor
6 2 Shaft Horizontal Reactor
Figure 10.0. Continuous Mass Polymerization of Styrene Maleic Anhydride Copolymer.
Figure 11.0. Bayer Continuous Mass Polymerization Process for Styrene Copolymer.
Figure 12.0. Continuous Preparation of Polyamide.
53
54
Figure 13.0. Continuous Process for Nylon 6,6 from Hexamethylene Diamine and Adipic Acid.
1,2 Fluidized Bed Reactor; 3 Distributor

5, 21 Separator; 6,7, 22 Discharge Pipe
8 heat exchanger;
9 10, 23 Compressor; 11 Feed Pipe
Figure 14.0. Continuous Gas Phase Copolymerization Process with a Fluidized Bed Reactor.
8 CSTR; 2,4,58 pressurized feed

14,34,40 separation of solvent, unreacted monomer
20 lean phase; 22 concentrated
3 high capacity, low viscosity pump
18 pressure reducing means; 12 heating stage
10 catalyst feed; 24 final cooler
32 drier; 3 pump
Figure 15.0. ExxonMobil Continuous Solution Copolymerization of Ethylene and Propylene.
12 Prepolymerizer; 20 preheater; 22 tray; 24 - dome

14 Finisher
10- Direct Esterification Reactor
Figure 16.0. Du Pont Continuous Polymerization Process to Manufacture Polytrimethylene
Terepthalate.
55
56
2 - Esterification Reactor
6 Prepolymerization Column
10 Finisher
20 - Glycol Recovery System
26 - Adsorption Bed
32 - Horizontal Agitated Cylindrical Vessel
Figure 17.0. Du Pont Continuous Production Process for Polyesters.
2.8. SUMMARY
18 process flow diagrams are reviewed to discuss continuous processes to manufacture
ABS, Acrylonitrile Butadiene Styrene engineering thermoplastic, SAN, Styrene
Acrylonitrile Copolymer, PS, Polystyrene, Nylon, PMMA, Poly Methyl Methacrylate, SMA,
Styrene Maleic Anhydride and Polyolefins. The Dow process, GE process and Bayer process
are compared side by side. The tower process of Dow and the three stage process with a
finisher used by GE and the two CSTR process of Bayer are reviewed from a process
performance and cost view point. The spheripol process and spherizone process
commercialized by Basell polyolefins is discussed. The use of the circulating fluidized bed
and the combination of the liquid pressurized process and gas phase Ziegler Natta catalyzed
process is reviewed. The spherical polypropylene is manufactured in one of them. The
continuous mass polymerization process to manufacture PMMA by the Rohm and Haas
57
process is discussed. The azeotropic distillation separation method for separation of the
unreacted monomer from the polymerized product and the helical ribbon agitated
polymerization reactor is evaluated. The use of the decanter for separation of the unreacted
monomers from the product is highlighted in the LG 2 CSTR process to manufacture SAN.
The use of tube bundle reactor and degasing extruder to prepare SAN by BASF is compared
with the LG process. The reactor configuration to prepare polyglycolide is elloborated. The
use of tubular reactor series for the manufacture of polystyrene is discussed. The use of a
multistage rubber dissolver and a multistage reactor can be seen in the Hitachi process to
prepare HIPS. Shaft horizontal reactors are used in the preparation of SMA copolymer in a
continuous fashion. The continuous kettles for the preparation of nylon from hexamethylene
diamine and adipic acid and directly from aminonitrile are reviewed. The ethylene propylene
copolymer preparation by continuous solution process developed by ExxonMobil is sketched.
Some issues in developing a styrenic copolymer using the Bayer continuous process is
discussed.
Figure 18.0. Shell Continuous Reactors in Series Polymerization Process to Manufacture Polyester.
58

Aliberti, V. A., Kruse, R. L., Valcarce, E. M. (1983). Mass Polymerization Process for ABS
Polyblends, US Patent 4, 417.030, Monsanto Co., St. Louis, Mo.
Bredeweg, C. J. (1980). Process for the Polymerization of Acrylonitrile-Butadiene-Styrene
Resins, US Patent 4, 239,863, The Dow Chemical Company, Midland, MI.
Fukumoto, C., Furukawa, T. & Oda, C. (1983). Process for Continuous Production of High
Impact Polystyrene, US Patent 4,419,488, Hitachi, Tokyo, Japan.
Hieda, S., Kurokawa, M., Higuchi, Y. & Kawahara, S. (1998). Process for Preparing
Polymer, US Patent 5,804,676, Mitsubishi Gas Chemical Co., Tokyo, Japan.
Sharma, K. R. (1997). A Statistical Design to Design the Process Capability of Continuous
Mass Polymerization of ABS at the Pilot Plant, 214th American Chemical Society
National Meeting, Las Vegas, NV, September.
Sharma, K. R. (2011). Polymer Thermodynamics: Blends, Copolymers and Reversible
Polymerization, CRC Press, Boca Raton, FL.
Sue, C. Y., Koch, R., Pace, J. E. & Prince, G. R. (1996). Grafting, Phase-Inversion and
Cross-Linking Controlled Multi-Stage Bulk Process for Making ABS Graft Copolymers,
US Patent 5,569,709, General Electric Company, Pittsfield, MA.
Virkler, T. L. & Wu, W. C. (2001). Process for Preparing Extrusion Grade ABS Polymer,
US Patent 2001/0031827A1, Bayer Corp., Pittsburgh, PA.
Chapter 3
MATHEMATICAL PROCESS MODELS

3.0. OVERVIEW
Mathematical models are used for scale-up of novel chemistry recently invented in the
laboratory to the manufacturing plants. Pilot plant studies often times are understaffed and
have a heavy backlog of experimental trials that needs to be performed. Mathematical models
can be used where pilot plant data is not available for scale-up. Sir Albert Einstein said:
"How can it be that mathematics, a product of human thought independent of
experience, is so admirably adapted to the objects of reality?"
Chemical process models are developed for a variety of reasons. The overall objective is
to gain better understanding of the process. This in turn would help the team of engineers to
manufacture new products at the lowest cost, in large scale, with high quality. Better process
understanding of the process can also lead to more safe operations. The recent BP Americas
spill called Deep Water Horizon [Telegraph, 2010] and the nuclear power plant disasters in
Japan that followed the earthquake with a magnitude of 8.9 on the Richter scale in March
2011 are cases in point that poor project planning can lead to unsafe operations. Proactive
solutions are needed. It is better to be safe than sorry. The choice of the location of the
nuclear power plants near the ring of fire that is prone to earthquakes was poor. Good
process models can lead to more efficient process operations with less pollution to the
environment. The ecosystem needs to be preserved. Dynamic process models can be used to
train operators, to design processes, in safety analysis, in process control, in project trouble
shooting and in globalization of an enterprise, etc. There are different kinds of process
models. These are as follows;
(i) Empirical Models
(ii) Semi-Empirical Models
(iii) Mechanistic Models
(iv) Models from Shell Balance and Applications of Equations of Continuity, Energy,
Momentum, Mass and Charge.
(v) Supercomputer based models such as the one used for weather prediction
(vi) Simulation on the Computer
60

(vii) Mesoscopic and Stochastic Models
(viii) Monte Carlo Trials
A. SIMULATIONS ON COMPUTER
3.1. CONSECUTIVE-COMPETITIVE REACTIONS DURING
BIODIESEL PRODUCTION
3.1.1. Selectivity of Biodiesel over Glycerol during Transesterification
Oil reserves are expected to be depleted by the year 2050 at the current levels of
production. The crude oil reserves are estimated at 4.16 trillion liters worldwide [Podolski et
al., 2008]. Global consumption is 84.6 million barrels/day. Earths entire oil reserves
according to one estimate are 1.2 trillion barrels without oil sands and 3.74 trillion barrels
with oil sands. At the present rate of consumption the oil reserves will be depleted in the next
38.8 122.2 years. Search is on for alternative oil finds. Per geological survey 3-4.5 billion
barrels was found in Montana and North Dakota. If oil shale can be used as source of oil the
reserves can last for 110 more years. Oil finds have been found in Russia, Columbia and
Africa. According to the big rollover theory global oil production is already past its peak
production. M. K. Hubert, Shell Oil Co., Houston, TX, studied the exhaustion of oil fields.
Initial oil find, exploitation and exhaustion phases were identified. This followed the bell
curve. He concluded that United States would peak in its oil production in 1970
[Congressional Record, 2005]. The curve is called the Hubert curve. The peak is also called
the rollover. Oil experts note that the peak production has been reached. Every year since
1970, we have found less oil and pumped less oil than we consume.
Largest known reserves of crude oil are located in the Middle East, along the equator and
in Russia and its neighbors. Transportation of crude oil has not been without spills. In 1989
the Exxon Valdez dumped 11 million gallons of oil into the waters and onto the shores of
Alaska. 85 million gallons of oil onto previously pristine Arctic tundra was spewed because
of a rupture in 1994 in a pipeline in Russia. In 1994 Exxon was ordered to pay $5 billion for
Alaskan oil spill. 206 million gallons of oil was spilled in the recent deep water horizon oil
spill in the Gulf of Mexico by BP Americas in 2010. This was the worst environmental
disaster ever in the history of technology. This was attributed to a rig explosion. The gusher
was from the ocean floor. Wars have been fought to prevent monopoly of oil supply.
Analogous to how in the history of mankind Stone Age gave way to Iron Age, oil age may be
eclipsed by sustainable energy. Man dropped the use of stones when he learnt the use of iron.
Air pollution has been found as a result of continued and increased use of petroleum. Global
warming has been concluded as a problem because of significant increase in concentration of
CO2 in the earths atmosphere.
The principles of Sustainable Engineering were developed at the Sandestin Conference of
2003 [Abraham and Nguyen, 2005]. This ought to set the direction of engineers who work on
developing sustainable alternatives to current engineering practices. Energy is considered a
primary component of sustainable engineering. This is because of;
61
(i) the pollution problems that arise from current methods of consumption of energy
such as acid rain formation from emission of oxides of sulfur and nitrogen and;
(ii) the depleting reserves of fossil fuel such as bituminous coal, petroleum, peat, lignite,
Anthracite, oil shale, natural gas, etc. In most formulations of sustainability the use
of renewable energy resources is desirable. The Sandestin principle states that,
Minimize depletion of natural resources.
Renewable energy resources may be viewed as fuels that are produced at rates equal to or
greater than the rates at which they are consumed. Thus there is no net depletion of the
resources with the passage of time. For example, biomass production rates may jeopardize
food supplies and hence have biomass fall out of the column of renewable resources and into
the column of non-renewable energy resource. Sandestin principle of life cycle analysis may
be applicable for evaluation of biomass as energy resource.
3.1.2. Biodiesel
Biodiesel is an interesting choice for use as alternate energy. Biodiesel is a mixture of
FAME, fatty acid methyl esters. It is an EPA, Environmental Protection Agency designated
advanced biofuel. It can be derived from vegetable oil or animal fats. It can be used from a
spectrum of resources that include waste fats, greases and agricultural oils. Biodiesel can save
money for the consumer. For example, Ray Mabus, secretary of the Navy testified in Capitol
Hill that by purchasing 20% biodiesel blend, savings of 13 cents a gallon and ~ $30,000 total
in winter in heating oil costs were realized. Renewable Fuel standard makes good policy as it
preserves the ecosystem from the advantages of life cycle use. Biodiesel is nontoxic. It has
low emission profiles and is environmentally benign [Krawczyk, 1996]. A century ago R.
Diesel successfully used vegetable oil as fuel for his engine. Prior to WW II vegetable oils
were blended with diesel fuels time and again.
It is recommended for use as a substitute for petroleum-based diesel because it is
renewable and biodegradable. One of the methods of preparation of biodiesel is the trans
esterification of triacylglycerides in vegetable oil or animal fat with an alcohol such as
methanol in the presence of an alkali or acid catalyst. The products are FAME (s) and are
called biodiesel. Glycerin is formed as byproduct. Alkali catalysts used are NaOH or KOH.
Triglyceride + CH3OH 3R-COOCH3 + C3H5(OH)3
(methanol) (FAME)
(Glycerin)
(3.1)
Three synthesis methods are reported for commercial manufacture of biodiesel. These
are:
Type I: Trans esterification of Vegetable Oil
Raw oil was mixed with methanol in the presence of catalyst such as sodium methylate in
order to produce the FAME. Glycerin is formed as a by-product. A two or three stage process
of reaction and centrifugal separation is used. Centrifugal separation is used to separate the
glycerin and biodiesel layers by gravity differences. More degree of separation can be
62
achieved by increased torque of the rotor [Sharma, 2012a]. A trade-off is seen between utility
cost for rotor speed and purity level. Optimal operation of rotor can be derived at for
maximum revenue. At end of the second stage [Connemann, 1994] with 99.2 99.6%
conversion the mixture is passed through a vacuum distillation tower in order to separate the
unreacted methanol, recover the sodium methylate catalyst and recycle the unreacted oil. B &
P Process patented a process [Martin et al., 2011] to make biodiesel with less equipment,
more yield and at a higher purity. They use a higher temperature than the boiling point of
methanol and increased pressure of the reactor in order to keep the methanol from boiling.
The centrifugal separator was made with perforated concentric cylinders. The separation
process was affected in a counter-current manner. This makes the throughput higher and use
less floor space. The glycerin passes through the rims and the biodiesel separates out through
the axial region of the separator. The reaction is between the triglycerides present in the oil
and methanol. Spectrum of different feedstock types have been used for the vegetable oil.
This ranges from waste cooking oil to jatorpa crop cultivated with a targeted purpose of
generating fuel. Feedstock types used are: (i) Soybean oil; (ii) Rapseed Oil; (iii) Sun flower
oil; (iv) Coconut Oil; (v) Palm Oil ; (vi) Tung Oil. The catalyst used can be alkali, acid or
enzyme. When the FFA, free fatty acid content is greater than 1% the acid catalyst would be
better [Kulkrani and Dalai, 2006]. Alkaline catalyst is used in commercial plants. Alkaline
catalysts are preferred when the FFA, free fatty acid content in the feedstock is less than 0.5
wt %. Process is sensitive to water and FFA. Saponification of ester may occur in presence of
water.
Type 2: Pyrolysis/Thermal Cracking of Vegetable Oil
Since WWI, World War I, many investigators have studied the pyrolysis of vegetable oils
in order to obtain biodiesel. Thermal cracking of Tung oil calcium soaps were reported in
1947. Tung oil was sapponified with lime and then thermally cracked in order to yield a crude
oil. Pyrolysis methods have been found to result in more bio gasoline compared with
biodiesel [Ma, 1999]. Pyrolysis usually involves heating in the absence of oxygen. Soybean
oil was thermally decomposed and separated by distillation. About 75% of the distillate was
hydrocarbons such as alkanes and alkenes. Vegetable oils can be catalytically cracked into
useful fuels. Catalyst used are silica/alumina and palm and copra oils were used. Condensed
organic phase can be fractionated into bio gasoline and biodiesel.
Type 3: Physical Blending and Emulsification Process
The alternate to use fuel for food has been discussed [Ma, 1999]. During the oil embargo
Caterpillar Brazil in South Africa used pre-combustion chamber engines with a blend of 10%
vegetable oil in order to maintain total power without any alterations to the engine. 20%
vegetable oil and 80% diesel fuel blends were successfully tested. 50/50 blends were also
tested. Diesel fleet was powered with filtered frying oil at 95/5 blend with diesel.
Polymerization of polyunsaturated vegetable oil lead to viscosity increase and was
problematic. Vegetable oil has 80% of calorific value of diesel fuel. After prolonged
operation of direct-injection engines problems such as coking, trumpet formation on injectors,
carbon deposits, oil ring sticking and thickening and gelling were found. 1:2 and 1:1 blends of
degummed soybean oil and diesel fuel were tested for engine performance in a 6 cylinder, 6.6
liter displacement, direct-injection, turbocharged prime mover made from John Deere for 60
hours. Incomplete combustion, unwanted polymerization and gum formation were noted
63
when using vegetable oil directly as fuel. Micro emulsions of vegetable oil with solvents such
as methanol were studied. Micro emulsion was defined as a dispersion of optically isotropic
fluid microstructures in 1-150 nm size range in colloidal equilibrium when two normally
immiscible liquids and amphiphiles are mixed. Micelle formation leads to improvements in
spraying.
3.1.3. Forecast of Biodiesel Production

Over the past decade the world production of biodiesel has gone up from 15,200 barrels
per day in the year 2000 to 300,000 barrels per day in 2010. In terms of volume this is about 5
billion gallons in 2010. In the past two years, biodiesel production has exceeded targets.
Production plants are present in nearly every state. 1000s of jobs are created. The sigmoidal
growth of the biodiesel volume is seen from 2006. Biodiesel is designated by ASTM D 6751.
New laws and mandates on biodiesel came about in Brazil, China, United States, and
Argentina. Germany and Brazil are the world's leading biodiesel producers. Federal excise tax
credits are provided for producers and distributors of agro-biodiesel at $1 for every gallon of
biodiesel they blend with regular diesel. Forecasts of global dynamics of biodiesel production
are available for 2015-2020 by feedstock used such as vegetable oil feed stocks, jatorpa oil,
algae biodiesel and cellulose. The expected growth rate of biodiesel production in the world is
about 6% between 2009-2018 according to OECD, Organization for Economic Cooperation
and Development. By 2017 biodiesel production is expected at 25 billion liters. European
biodiesel board estimated that the production of biodiesel in EU is about 9.6 million tons in
2010. By the year 2022, biofuel production is projected to consume a significant amount of
total world production of sugar cane (28%), vegetable oils (15%) and coarse grains (12%)
[Sharma, 2011].
In India, the former President of India, ABJ Abdul Kalam during his address to the nation
on National Science Day, Feb' 28th 2006 [The Hindu, 2006] called for an increase in output
of biodiesel from jatorphha crop from current levels of 2 tons per hectare to 4-6 tons per
hectare. The oil content of most jatorpha varieties range from 25-35 %. Research in selection,
intra-specific, inter-specific hybridization and mutation breeding is needed to develop
varieties with more than 45% oil content so that a recovery of 35% under mechanical
expelling. Stebbins investigated the technical and economic feasibility of producing biodiesel
and livestock feed from Vermont oilseeds at a farm scale and commercial scale. Commercial
scale biodiesel facility in Vermont was found to be more profitable as oil prices rose in the
simulation models used. India has 60 million hectares of wasteland of which 30 million
hectares are available for energy crops such as jatorpha. Cars that can run on biodiesel need
be developed and encouraged. The Indian Railways runs passenger trains with diesel engine
with 5% blend of biodiesel. 15 million jatorpha saplings are planted in Railways' land.
President B. Obama as a senator endorsed the budding biodiesel industry at a new biodiesel
plant in Cairo, IL in 2006 [Moran, 2006]. The Renewable Energy group announced that it
would build a 60 million gallon per year refinery and had raised $100 million in financing.
Bunge Ltd., a major food processor and other venture capital firms were the contributors.
About 76 biodiesel plants were in production in 2006, up from 22 in 2004. A biodiesel plant
on an average costs up to $20 million to build and yields 30 million gallons per year of fuel.
64
Biodiesel serves an important need of meeting the energy security of United States and the
developing countries in the world.
3.1.4. Process Analysis

The electrical utility costs increases in a non-linear manner with increase in rotor speed in
centrifuge used to separate glycerol from FAME. More separation is achieved with more
utility costs but with more revenue. A point of optimal operation can be arrived at for
maximum revenue. This may vary depending on the price of gasoline at the pump at a given
time. The reactions in the reactor during biodiesel production may be modeled as scheme of
multiple reactions of the consecutive-competitive/series-parallel type [Levenspiel, 1999]. The
methanol can be assumed to be in excess. Hence the reactions shown below can be assumed
to obey the pseudo first order kinetics. The concentration of methanol can be lumped with the
intrinsic second order reaction rate constant to give a pseudo first order lumped rate constant.
The catalytic effect is also captured here. The reactions are modeled as follows;
k1
A B
k2
(3.2)
k3
P T
Where A - triglyceride, B - Methanol (CH3OH), R-1,2 and 1,3 diglyceride, S mono

glyceride, P (FAME), T Glycerol.
It may be assumed that once the product P is formed it does not participate in the reaction
any further. The FAME is harvested from the kettle. As glycerol (T) can be sold for profit this
scheme is of more interest. This reaction set is applicable for successive attacks of a
compound by a reactive material. In this case the reactive material is methanol and the
compound is triglyceride. The kinetics of the reactions can be written as follows;
dC A
dt
k1C A
dCR
k1C A k2CR
dt
dCS
k2CR k3CS
dt
dCT
k3CS
dt
C P C A0 C R CS
(3.3)
CT
CA
It is assumed that the initial concentration of triglycerides is C A0 and that of diglycerides,

monoglycerides, glycerol is zero at time zero. The four ordinary differential equations in Eq.
(2) can be written in the state space form as follows;

CA
d CR
dt CS
CT
k1
k1
0
k2
0
0
0
0
0
0
k2
0
k3
k3
0
0
65
CA
CR
CS
(3.4)
CT
The eigenvalues of the rate matrix in Eq. (3.4) can be seen to be k1, -k2, -k3 and 0. Since
three Eigen values are negative and one is zero the system can be seen to be of the integrating
type [Sharma, 2012c]. This is an example of three-step reaction where the final T, glycerol
and P (FAME) are desired. The addition policy of methanol along the length in case of PFR,
plug flow reactor and the timings in the case of CSTR can influence the product mix. The
method of mixing the reactants such as slow mixing of A to B, slow mixing of B to A and
rapid mixing of A and B may be important design criteria. In order to obtain more yield of P
the points where R and S will reach a maxima need be avoided as operating points
3.1.5. Economic Analysis

The cost of raw materials is a critical factor in the profitability of biodiesel manufacture.
Twelve reports were reviewed [Bender, 1999;Weber, 1993] on economic feasibility of
biodiesel production using different feed stocks and scales of operation. The production costs
for conversion to biodiesel from different feed stocks are given in Table 3.1. At the time of
the study in 1999 the projected costs for biodiesel from oilseed or animal fats have a range
from 30 cents 69 cents per liter. The estimates include the soymeal and glycerin credits
expected. Crushing and esterification facility is by retrofit of existing tallow facility. Cost of
biodiesel from vegetable oil and waste grease are 54 62 cents per liter. When the pre-tax
price of diesel is 18 cents per liter the biodiesel venture is not profitable.
Significant factors that contribute to the bottom line of the biodiesel production were
identified in [Nelson and Shrock, 1993]. These include the cost of raw materials, plant size,
credit received for glycerin as by-product sales. When waste cooking oil was used the
material costs went down. Restaurant greases cost less than food-grade canola and soybean
oils. The first factory that produced biodiesel at 300 tons per year from waste cooking oil was
started in Chiayi county of Taiwan in October of 2004. About 700 garbage trucks were fueled
from biodiesel in 2005 in Taiwan.
Table 3.1. Review of 12 Different Routes to Biodiesel
1
2
3
4
Feedstock
(Type)
Soybean Oil
Animal Fats
Canola Oil, Sunflower Oil
Rapeseed Oil
Per Liter
Production Cost
30 cents
32-37 cents
40-63 cents
69 cents
66
3.1.6. Annual Worth, AW of a Bio-Diesel Plant in Taiwan [You et al., 2008 ]

Biodiesel is produced by Trans esterification reactions. Triglycerides present in virgin
soybean oil are reacted with anhydrous alcohol such as methanol, ethanol, proponal etc. to
form FAME, fattyacid methyl esters, or biodiesel and glycerol. The alkali catalyst used was
sodium hydroxide, NaOH. It can potentially be used as an alternate fuel to the ones currently
in vogue that tend to cause pollution problems such as global warming, acid rain, greenhouse
gas emissions, etc. Biodiesel is an attractive fuel due to the environmental benefits that comes
with its operation. It is prepared from renewable energy resources such as vegetable oil.
Using the information provided in Table 3.2 annualized worth AW of the biodiesel plant is
calculated. The plant is expected to last for 20 years. The interest rate for equivalence
calculations can be taken as 3.0%. The main cost [Turton et al., 1998] in these plants are the
raw material costs. The AW analysis is completed using a MS Excel spreadsheet as shown in
Table 3.2. The capital cost is obtained by using the SUM command from cells D4 to D10.
These are the costs of Reactors, Washing Column, Distillation Column, Heat Exchangers,
Pumps, Vacuum Systems. The capital cost of $765,000 is amortized over 20 year period by
using the capital recovery factor. The capital recovery factor is obtained from Table A-7 in
Appendix A in [Sharma, 2011] for (A/P,3%,20).
This was found to be 0.067216. The materials costs include the soybean oil, methanol,
catalyst and solvent. The Annual costs are obtained by adding the Materials Cost, Labor
Costs, Utility Costs and Overhead Costs. The annual revenue is obtained by adding the sales
of biodiesel and glycerin. The AW was calculated. The AW is about $1.915 million. Thus it is
profitable to operate the biodiesel plant as described in Taiwan.
3.1.7. Economic Evaluation of Biodiesel Production from Waste Cooking Oil

The study of alternate fuel sources to gasoline and coal is of national importance given
the supply and demand characteristics of fuels that are used extensively. Biodiesel is derived
from vegetable oil or animal fats. It is recommended for use as a substitute for petroleumbased diesel because it is renewable and biodegradable. The common method of preparation
of biodiesel is the Trans esterification of triacylglycerol in vegetable oil or animal fat with an
alcohol such as methanol in the presence of an alkali or acid catalyst. The products are
FAME, s and are called biodiesel. Glycerin is formed as a byproduct. Sodium hydroxide or
potassium hydroxide is used as alkali catalyst. A student for his masters thesis, [Weber, 1993]
evaluated the economic feasibility of a manufacturing plant producing approximately 22
million pounds per year of biodiesel. Tallow was Trans esterified with methanol in the
presence of an alkali catalyst. A second plant is based on canola seed used as the raw
material. A by-product credit can be awarded for glycerin produced from seed crushing. A
summary of the capital investment, process cost, revenue accrued of the three different plants
are shown in Table 3.0. The capital cost can be assumed to paid off over a 30 year period at
an interest charge of 6% per year.
67

Table 3.2. Cost and Revenue Data for Biodiesel Production in Taiwan
A.
A1
A2
B.
C.
D.
E.
Description
Material Costs (~6.8 million)
Soybean Feedstock
Methanol, Catalyst and Solvent
Capital Equipment (per year)
Reactors, Distillation Column,
Heat Exchangers, Separators, Pumps
Labor Costs
Utilities
Overhead
Revenue from Biodiesel
Glycerin Credit
Cost
$6,234,000
$564,000
$765,000
$564,000
$124,000
$431,000
$6,845,000
$3,038,000
Table 3.3. Economic Evaluations for Biodiesel Production Plants
Plant Capacity
Raw Material Used
Total Capital Cost
Total Manufacturing
Cost
Glycerin Credit
Price
Plant I Alkali
Catalyzed
Continuous
Process
22 million lbs./year
Beef Tallow
$ 12 million
$34 million
1.7 million lbs./year

Canola Oilseed
$1 million
$5.95 million
Plant III AlkaliCatalyzed

Continuous
Process
2.2 million lbs./year
Animal Fats
$3.12 million
$3.4 million
$6 million
$ 2 /lb.
$0.9 million
$4/lb.
$1.2 million
$3/lb.
Plant II AlkaliCatalyzed Batch

Process
Which process is the most profitable ?

It is assumed that the capital cost is amortized at an interest rate of 6% per year for 30
years.
Plant I
(A/P, 6%, 30) from Table A-10 in [Sharma, 2011] the capital recovery factor can be seen
to be 0.072649
Profit = 2*22 12*(A/P, 6%,30) 34 + 6 = 15.128 million
Revenue capital recovery cost of production + by-product credit = profit
(3.5)
Plant II
(A/P, 6%, 30) from Table A-10 in [15] the capital recovery factor can be seen to be
0.072649
68

Profit = 4*1.7 1*(A/P, 6%,30) 5.95 + 0.9 = 1.68 million
Revenue capital recovery cost of production + by-product credit = profit
(3.6)
Plant III
(A/P, 6%, 30) from Table A-10 in [15] the capital recovery factor can be seen to be
0.072649
Profit = 3*2.2 3.12*(A/P, 6%,30) 3.4 + 1.2 = 4.17 million
Revenue capital recovery cost of production + by-product credit = profit (3.7)
So Plant I is the most profitable followed by Plant III and then Plant II.
3.1.8. Selectivity Improvement

It can be seen from the economic analysis the yield of biodiesel compared with other byproducts such as glycerin can be a critical design criteria in making these plants more
profitable. The reaction sequence for formation of FAME, fatty acid methyl ester from
triglycerides found in palm oil and other feedstock involve the formation of diglycerides,
monoglycerides and glycerin in sequence with FAME produced in each intermediate step
(Darnoko and Cheryan, 2000]. The reaction scheme can be represented as shown in Figure
1.0. The reactions are catalyzed. The catalyst type depends on the FFA content in the
feedstock. The triglycerides species is represented with symbol A, diglycerides with R,
monoglycerides with S and glycerin with T. The product FAME formed in each step is given
by P and the methanol used is given as B.
Figure 1.0. Trans esterification Catalyzed Reactions from Triglycerides to Glycerin and FAME.
69
The scheme of reactions can be modeled as shown in Eq. (3.2) as a consecutivecompetitive type [Levenspiel, 1999]. The reaction rate expressions in Eq. (3.3) or Eq. (3.4)
can be written in dimensionless form as follows after making the following substitutions;
XA
C A0 C A
C A0
XR
CR
C A0
XS
CS
C A0
XT
CT
C A0
XP
CP
C A0
(3.8)
k1t
k2
k1
k3
k1
In dimensionless form the rate expressions given in Eq. (2) can be seen to become;
dX A
d
1 XA
dX R
d
1 XA
dX S
d
XR
dX T
d
(3.9)
XR
(3.10)
XS
(3.11)
XS
(3.12)
The rate expression for the product, FAME can be obtained by adding the contributions
from the methanolysis of triglyceride, diglyceride and monoglyceride steps and can be seen to
be;
dX P
d
1 XA
XR
XS
(3.13)
70
In order to evaluate the selectivity of the FAME product P over the by-product, glycerin,
T solution to Eq. (3.9-3-12) were obtained by the method of Laplace transforms. The
solutions are as follows;
1
s s 1
XA s
XA
1 e
1
XR s
XS
XT s
XT
s 1 s
1
1
s s
1
s 1
1
XR
XS s
(3.14)
(3.15)
(3.16)
1
s 1 s
1
(3.17)
1
(1 e
(1 e
(1 e )
The product yield can be found by difference as;

Xp
XA
XR
XS
XT
(3.18)
Model solutions given by Eqs. (13-17) were plotted in Microsoft Excel 2010 for
Windows 7.0 on a Hewlett Packard Compaq Elite 8300 desktop computer with Intel Core i7
processor with 3.9 GHz speed. The results for the product distribution is shown in Figures 2.0
Figures 5.0. The simulations were conducted for values of reaction rate constant ratios < 1
and < 1 and further for < .
It can be seen from the Figures 2-5.0 that the conversion of species A, XA increases in in
a monotonic manner as predicted in Eq. (13). The monoglyceride and diglyceride yields go
through a maxima. A change in curvature from convex to concave can be seen in the product
yields of FAME and glycerin. There is a rate increase later in time in the formation of
glycerin. The selectivity of FAME can be poor compared with glycerin formation as can be
seen in Figure 4.0. FAME yield can be high as shown in Figure 2.0, 3.0. There can also be
cross-over from higher selectivity of FAME to lower selectivity of FAME compared with
glycerin as can be seen in Figure 5.0. In such cases, CSTR can be used with residence times
less than the cross-over point in order to obtain higher yield of FAME. The convexo-concave
71
curvature in the product yields is consistent with experimental studies such as that reported by
[Jaya and Ethirajulu, 2011].
3.1.9. Conclusions
Alternate energy sources are sought after in order to preserve the energy security of the
nation and that of the world. This is because the oil reserves are being depleted. Further the
increased use of petroleum causes global warming and increased pollution. Biodiesel is a
renewable fuel. One of the methods of preparation of biodiesel is the Trans esterification of
triacylglycerol in vegetable oil or animal fat with an alcohol such as methanol in the presence
of an alkali or acid catalyst. The products are FAME (s) and are called biodiesel. Glycerin is
formed as byproduct. Alkali catalysts used are NaOH or KOH.
Figure 2.0. Triglyceride (A), Diglyceride (R), Monoglyceride (S), Glycerin (T) and FAME (P) Product
Distribution in Progressive Methanolysis at = 0.75 and = 0.4.
72
Figure 3.0. Trigylceride (A), Diglyceride (R), Monoglyceride (S), Glycerin (T) and FAME (P) Product
Three synthesis methods are reported for commercial manufacture of biodiesel. These
are: (i) trans esterification of vegetable oil; (ii) Pyrolysis of vegetable oil and; (iii) Physical
blending and emulsification. Spectrum of different feedstock types have been used for the
vegetable oil. This ranges from waste cooking oil to jatorpa crop cultivated with a targeted
purpose of generating fuel. Feedstock types used are: (i) Soybean oil; (ii) Rapeseed Oil; (iii)
Sun flower oil; (iv) Coconut Oil; (v) Palm Oil; (vi) Tung Oil. FAME, are produced upon
Trans esterification of vegetable oil. A two or three stage process of reaction and centrifugal
separation is used. Centrifugal separation is used to separate the glycerin and biodiesel layers
by gravity differences. More degree of separation can be achieved by increased torque of the
rotor (Sharma 2012a).
73
Pyrolysis usually involves heating in the absence of oxygen. Soybean oil was thermally
decomposed and separated by distillation. About 75% of the distillate were hydrocarbons
such as alkanes and alkenes. Vegetable oils can be catalytically cracked into useful fuels.
Catalyst used are silica/alumina and palm and copra oils were used. Condensed organic phase
can be fractionated into bio gasoline and biodiesel. Micro emulsions of vegetable oil with
solvents such as methanol were studied. Micro emulsion was defined as a dispersion of
optically isotropic fluid microstructures in 1-150 nm size range in colloidal equilibrium when
two normally immiscible liquids and amphiphiles are mixed.
74
The expected growth rate of biodiesel production in the world is about 6% between 20092018. This is according to OECD, Organization for Economic Cooperation and Development.
By 2017, the biodiesel production is expected to reach 25 billion liters. European biodiesel
board estimated that the production of biodiesel in EU is about 9.6 million tons in 2010.
President of India has called for crops with increased yield of biodiesel. President B. Obama
has endorsed the biodiesel fuel industry by offering tax credits to the farmers and suppliers.
The reactions in the reactor during biodiesel production may be modeled as scheme of
multiple reactions of the consecutive-competitive/series-parallel type [Levenspiel, 1999]. The
methanol can be assumed to be in excess. The scheme of reactions are shown in Figure 1.0.
The four ordinary differential equations in Eq. (3.2) can be written in the state space form
(Eq. (3.3)). The system can be seen to be of the integrating type given the values of the
eigenvalues. This is an example of three-step reaction where the product P for (FAME) and
by-product, T for glycerol are desired. The addition policy of methanol along the length in
case of PFR and the timings in the case of CSTR, continuous stirred tank reactor can
influence the product mix. The method of mixing the reactants such as slow mixing of A to B,
75
slow mixing of B to A and rapid mixing of A and B may be important design criteria. In
order to obtain more yield of P the points where R and S will reach a maxima need be avoided
as operating points.
The cost of raw materials is a critical factor in the profitability of biodiesel manufacture.
The AW analysis of a biodiesel factory in Taiwan operated in 2004 is completed using a MS
Excel spreadsheet as shown in Table 2.0. It can be seen that the material cost and by-product
credit are critical to the profitability of biodiesel. A summary of the capital investment,
process cost, revenue accrued of the three different plants are shown in Table 3.0. These
plants have been operated in the batch and continuous mode. Careful evaluation of batch vs.
continuous mode has not been done. Plant I has been found to be more profitable compared
with Plant II and Plant III. It I s not clear whether this is because of the larger size and
continuous production [Shiva Prasad and Sharma, 2012b].
The selectivity of FAME over glycerin was obtained from model solutions by method of
Laplace Transforms. Product distribution curves for triglycerides, diglycerides,
monoglycerides, glycerin and FAME are presented in Table 2-5.0. Formation of FAME is
after competition for feed A with glycerin formation. Reactor choice, residence time,
temperature can be arrived at in order to obtain higher yield of FAME compared with
glycerin. This may increase the profitability of biodiesel production.
3.2. TRANSIENT DRAG EFFECTS ON PROJECTILE MOTION OF

SPHERICAL OBJECTS IN AIR
3.2.1. Introduction
Projectile motion was discussed by Galileo in his essay de motu in 1592. Later he
identified that the trajectory of a projectile as parabolic. Galileo asserted differently from the
observations of Aristotle around 343 BC that among falling objects the more earthy one will
reach the earth sooner than the less heavier object. Galileo stated that both objects will fall at
the same acceleration and when air resistance is not a factor both objects will fall in the same
duration to ground from a higher location such as the Leaning tower of Pisa. Astronaut David
Scott (1971) demonstrated this in moon during the Apollo 15 Mission to the moon. The
heavier hammer and lighter feather reached the ground at the same time when Scott dropped
them at the same time. Air resistance is an important factor depending on the material of the
object and the shape of the object in motion. Halloun and Hestenes (1985) surveyed common
sense beliefs of college students about motion and its causes. According to their study many
students have some notion of parabolic motion. Few of them recognized it as caused by a
constant force. 66% of pretested students were able to identify the correct parabolic path for
the projectile of assigned task. Some students believe that a projectiles motion is not only
determined by its initial velocity but also how that velocity was imparted. Some students said
the ball will move in horizontal path when launched in air from hand, airplane and table. The
ball will begin to fall and follow a curvilinear path which is parabolic when there is no air
resistance.
76
This study is to further explore the effects of transient drag on projectile motion. Parker
(1977) considered two dimensional motion of a projectile experiencing a constant
gravitational force and a constant fluid drag force. The quadratic force said to vary as the
square of the velocity of the object. The drag coefficient was considered to be constant
throughout the entire trajectory of the object and taken as approximately (CD = 0.5). The drag
force in the horizontal and vertical directions were given in terms of the absolute velocity.
d p2 CD vx vx2
Fx
v 2y
8
d p2 CD v y vx2
Fy
v 2y
(3.19)
(3.20)
The governing equations were coupled non-linear equations. They presented short and
long time solutions. In this study, it is realized that the drag force can be resolved into vertical
and horizontal components. Resolution of drag forces in horizontal and vertical directions
results in decoupling of the non-linear equations. The drag coefficient variation with
Reynolds number is also taken into account. The drag forces in horizontal and vertical
directions can be written as follows;
Fx
Fy
d p2 CD vx2
8
d p2 CD v 2y
8
(3.21)
(3.22)
The use of Eqs. (3.21,3.22) in place of Eqs. (3.19,3.20) is based on the realization that the
vertical and horizontal components of the velocity and acceleration of the object in motion is
independent of each other. This is captured mathematically in Eq. (3.21,3.22). The form of
drag force seen in Eqs. (3.21,3.22) was first introduced by Lord Raleigh. The area of circle is
used for the projected area for a sphere. The projection is orthographic. The drag force can be
realized using stream function representation of flow past a sphere. Form and friction drag
can be realized from viscous flow past a sphere (Bird, Stewart and Lightfoot, 2007, Bachelor,
1967, Landau and Lifshitz, 1959). The drag coefficient varies as a function of velocity.
Deakin and Troup (1998) suggested that trajectories of projectile motion with air resistance
can be approximated by cubic curves. Shipman et al. (2013) discuss projectile motion in their
textbook for students in their introductory physical science course. The equations that can be
used to projectile motion are not discussed. Symmetry of path, same range at complementary
angles are discussed. Illustrations with and without air resistance are shown. Examples from
Olympic track and field events such as the event Javelin Throw, Basketball, Football are
discussed. Air resistance is suspected as causing asymmetry in the trajectory of the projectile.
Longer range appears to be associated with a launch angle of 38 0 compared with a launch
angle of 45 0 for a projectile when air resistance was taken into account.
77
In this study the variation of drag coefficient with velocity is taken into account. The 5
constant expression suggested for steady state drag coefficient at terminal settling velocity as
a function of Reynolds number by Turton and Levenspiel (1989) is used in this study. The
equation used is given below as;
CDt
24
1 0.173Ret0.657
Ret
0.413
1 16300 Ret 1.09
(3.23)
Wake separation effects are taken into account in Eq. (3.23) at large Reynolds number. It
spans a wide range of Reynolds number from 1 at Stokes regime at low Reynolds numbers
through transition flow to turbulent flow at large Reynolds number up to 200,000. Eq. (3.23)
is shown in Figure 6.0. Renganathan et al. (1989) calculated the vertical distance travelled by
geometric and spherical particles in a fluid up to 90% of its terminal settling velocity using
computer simulations. This study was extended to two dimensions for design of
sedimentation tanks, (Sharma, 2012c). The variation of drag coefficient as given in Eq. (5)
was taken into account in this study. Chabra (1993) presented an analytical solution for
acceleration motion of a spherical particle in an unbounded Newtonian fluid. The drag
coefficient used was of the following form;
2
CD
Re
(3.24)
They use a Re = p2 substitution. Eq. (6) is good for Re < 6000. Should the system under
consideration fall within a Reynolds number of 6000 during the entire trajectory then Eq. (6)
may be selected. Eq. (5) spans a wider range. During the launch and final phases of examples
considered below such as spin less golf ball the Reynolds number of surrounding air that
spans the example is 136-122,690.
3.2.2. Theory - Equations of Motion

Consider a spherical or geometric object in projectile motion in an unbounded fluid. The
object will traverse a trajectory in two dimensions. The equation of motion in the vertical and
horizontal directions can be written as follows (Clift et al.(1978), Renganathan et al. (1989);
s
d 3p dv y
6
dt
d 3p dvx
6
dt
d 3p g
d p2 CD v 2y
8
d p2 CD vx2
8
(3.25)
(3.26)
78
Figure 6.0. Drag Coefficient, CD as a function of Reynolds Number for Range 1 Re 200,000.
Subramanian et al. (2001) have studied motion of bubbles and drops in microgravity
conditions. In this study the earths gravitational field was considered. The terminal settling
velocity of the object in the vertical direction can be obtained by setting the RHS, right hand
side of Eq. (3.25) to 0. The terminal settling velocity of the object can be seen to be;
4 sd p g
v yt
3 CDt
(3.27)
The equations of motion in the horizontal and vertical direction can be written as follows;
dv y
gdt
dvx
d
3CD
v 2y
4 gd p
(3.28)
3CD
vx2
4 dp
Eqs. (3.28) was integrated numerically using the 5th order Runge-Kutta method. The
simulations were performed in MS Excel 2007 for Windows. The Butchers method (1964) as
described in Chapra and Canale (2006) was used. The recurrence relations used is given in
Sharma (2012b). The variation of drag coefficient as a function of velocity in horizontal and
vertical directions was assumed to be of the same form as in Eq. (3.23) developed for
particles in terminal settling spheres in fluids. The recurrence relations used for the solution
dy
of
f ( x, y ) is given below as;
dx
79
k1
h
7k1 32k3 12k4
90
f ( xi , yi )
k2
f xi
0.25h, yi
0.125k1h
k3
f xi
0.25h, yi
0.125h(k1
k4
f xi
0.5h, yi
0.5k2 h k3 h
k5
f xi
0.75h, yi
k6
f x i h, yi
yi
yi
3k1h
16
3k1
7
32k5
7 k6
(3.29)
k3 )
9k 4 h
16
2k 2
7
12k3
7
12k4
7
8k5
7
3.2.3. Results
The terminal settling velocity of the object is first obtained by trial and error between Eq.
(3.27) and Eq. (3.23). From the launch velocity, an determination can be made as to whether
during motion will the velocity of the object in either direction exceed that of the terminal
settling velocity ? If that is the case then the trajectory of the object would become rectilinear
in the direction where it reaches terminal settling velocity. Accelerating particles can be
expected to have a curvilinear trajectory.
Example 1.0
A golf ball is made of nanocomposite with a density of 2600 kg.m-3. The diameter of the
ball is 6.7 cm. The viscosity of the air at a temperature of 20 0 C is 1.8 E-5 Pa.s. The density
of air assuming ideal gas was calculated to be 1.307 kg.m-3. The terminal settling velocity of
the golf ball in air was calculated by trial and error between Eq. (3.27) and the 5 constant
correlation for drag coefficient given by Eq. (3.23) for spheres. The values found were;
Vt
61.4 m.s-1
CDt
0.461
(3.30)
(3.31)
The Reynolds number at terminal settling velocity was found to be 298,812. Equations
for vx and vy given in Eqs. (3.28) was integrated numerically on MS Excel spreadsheet for
Windows using the 5th order Runge and Kutte method as shown by Butcher in Chapra and
Canale. The step size used for 0.01 s. The variation of drag coefficient as a function of
velocity in horizontal and vertical directions was assumed to be of the same form as in Eq.
(3.23) developed for particles in terminal settling spheres in fluids. The case without air
resistance for a launch angle of 30 0 and launch velocity of 32 m.s-1 was calculated and plotted
in Figure 2.0. The point where maximum height was recognized in the spreadsheet. The
80
descent portion of the projectile had a different equation of motion in the vertical direction.
This is given below;
dv y
gdt
dvx
d
3CD
v 2y
4 gd p
(3.32)
3CD
vx2
4 dp
In both the ascend and descend phases of the trajectory of the golf ball the air drag force
is in opposition to the motion. The vertical and horizontal displacements of the gold ball (x,y)
at a given instant t was recovered from the integrated instantaneous vx and vy values. Average
values in two cells were multiplied by the step size and added with the previous displacement.
The resulting trajectory of the golf ball is shown side-side by side in Figure 7.0 along with the
case without the air drag holding everything else the same. It can be seen that the air drag has
caused a reduction in the range and maximum height reached by the golf ball. The trajectory
of the golf ball with the air drag can be seen to be asymmetrical. The horizontal displacement
of the golf ball during its ascend is greater than the horizontal displacement of the golf ball
during its descend for the case when the air drag was accounted for. For the case without the
air drag the horizontal displacement of the ball during the ascend and descend were equal to
each other. The equations that describe the vy and vx for the case without the air drag are
given as follows;
vx
v0 cos
vy
v0 sin
v0 cos
v0 sin
gt
(3.33)
gt 2
2
The golf ball was found to reach the ground after 3.21 seconds for the case with the air
drag. The case without the air resistance took 3.26 seconds. The time to descend was found to
be 1.6 s for the case with the air resistance and 1.63 s for the case without the air drag. The
maximum height of the gold ball was reached after 1.6 s for the case with the air drag and
1.63 s for the case without the air drag.
The trajectories of the golf with a launch angle of 45 0 and launch velocity of 32 m.s-1 are
shown in Figure 8.0. The range can be seen to be reduced from 104.3 m for the case without
the air resistance to 89.8 m for the case with the air drag. This is a reduction of 16.1%. The
time to ascend to maximum height of the golf ball with the air resistance was 2.29 s and the
time of descent to ground was 2.20 s. The case without the air resistance was symmetrical at
2.3 s. The effect of air resistance was pronounced during the descend and not during ascend.
The numerical integration was completed successfully. At some cells when the ball was at the
maximum height a number error was found at low Reynolds number.
Figure 7.0. Effect of Air Drag during Projectile Motion of Golf Ball at a Launch Angle of 300 and
Launch Velocity of 32 m.s-1.
Figure 8.0. Effect of Air Drag during Projectile Motion of Golf Ball at a Launch Angle of 45 0 and
81
82
Example 2.0 A launch angle of 38 0 was used in this example. All other parameters were
the same as used in Example 1.0.
The variation of drag coefficient as a function of velocity in horizontal and vertical
directions was assumed to be of the same form as in Eq. (3.23) developed for particles in
terminal settling spheres in fluids. A separate case where the drag coefficient was taken as
constant in the equations of motion given in Eq. (3.32) was calculated. The drag coefficient
was taken as 0.2. The results are plotted in Figure 9.0. Fifth Order Runge Kutte method were
used in both cases. The step size used in the case of the use of Eq. (3.23) for CD vs. Re was
t = 0.01 s and the step size used for the case of constant drag coefficient, CD = 0.2 was t =
0.05s. It can be seen that the trajectory of the projectile when air resistance was taken into
account was asymmetrical. The displacements in x and y direction for the case of varying CD
is closer to the case without air resistance than the displacements in x and y direction for the
case of constant CD compared with the case without the air resistance.
Figure 9.0. Effect of Air Drag during Projectile Motion of Golf Ball at a Launch Angle of 38 0 and
83
3.2.4. Conclusions
Projectile motion is an interesting topic for discussion in introductory physics courses.
Air resistance effects on projectile motion was studied. A 5 constant expression for variation
of CD vs. Reynolds number was used and the variation of air resistance with velocity was
taken into account. The air resistance force was the most (about 11.9%) in the initial and final
stages of the projectile. Closer to the maximum height the drag force is near zero. The
projectile motion with the air resistance was asymmetrical. The effect of drag coefficient
variation with velocity was found as shown in Figure 4.0. Greater range (97 m) was found for
the case of launch angle of 38 0 for the example considered compared with launch angles of
45 0 and 30 0 with air resistance. Maximum range of projectile without the air resistance can
be expected at a launch angle of 45 0.
The use of Eq. (3.23) may be better than the use of a constant value for CD during the
entire trajectory. Studies are underway to include the Magnus effect when there is circulation
around the object. The case of geometric particles are also being studied.
3.3. TRAJECTORY OF ACCELERATING PARTICLES IN

SEDIMENTATION TANKS
Symbols Used in Section 3.3
Ap
As
CD
CDt
dp
g
h
H
kj
L
mp
P
Q
Projected Area of Particle (m2)

Cross-Sectional Area of Rectangular Tank (m2)
Instantaneous Drag Coefficient
Drag Coefficient at Terminal Settling Velocity of Particle
Particle Size (m)
Acceleration Due to Gravity (m.s-2)
Step Size used in Numerical Integration in Independent Variable Y
Height of Sedimentation Tank (m)
Weighting Factors used in Fifth Order Runge-Kutta Method
Length of Sedimentation Tank (m)
Mass of Particle (kg)
Pressure Drop (N.m-2)
Discharge Rate (m3.s-1)
Re
Reynolds Number, Re
Time (s)
t
px
vd p
Terminal Settling Velocity of Particle (Vertical) (m.s-1)
v tpy
Terminal Settling Velocity of Particle(Horizontal) (m.s-1)
vy
<vy>
Vp
Velocity of the Fluid in direction as a function of x (m.s-1)

Average Velocity of the Fluid in y Direction (m.s-1)
Volume of Particle (m3)
84

W
Width of Sedimentation Tank (m)
Dimensionless Distance (Vertical) X
v px
Dimensionless Velocitry of Particle (Vertical) Y t
x
dp
v px
v py
Dimensionless Velocity of Particle (Horizontal) X t
v py
Greek
Density Ratio
s
xy
Viscosity of Water (kg.m-1s-1)

Density of Fluid (kg.m-1s-1)
Density of Particle (kg.m-3)
Tangential Shear Stress (N.m-2)
Residence Time (s)
Dimensionless Distance (Horizontal) X
y
dp
3.3.1. Overview of Sedimentation Tank Design

Type I sedimentation is characterized by particles that settle discretely and do so at a
constant terminal settling velocity. Individual particles are assumed not to flocculate.
Sedimentation is a gravity settling method to remove suspended solids (Reynolds and
Richards, 1996). Sedimentation is used in waste water and water treatment for removal of
sludge. In manufacturing plants this method is used for removal of iron and manganese. Coe
and Clavenger (1916) came up with the four types of settling. In Type I the settling particles
are assumed to sink relative to fluid in motion free of interference from other particles.
Attempts have been made to describe sedimentation of particles using Mason-Weaver
equation (1924). This attempt also takes into account the diffusion down a concentration
gradient using Ficks law of diffusion (1855). Sharma (2005) has pointed out eight reasons to
seek a generalized Ficks law of diffusion for use in transient applications. Camps theory
(1936) (in Davis, 2011) was based on the principle that in order for a particle to be removed
from the flowing stream of fluid the particle must have a settling velocity, vpxt sufficiently
large so that it can reach the bottom of the tank during the time available, i.e., during the
residence time, , of the fluid in the tank. The residence time of the fluid in the tank can be
estimated from the discharge rate Q and volume of the tank:

WHL
Q
85
(3.34)
Where W, H and L are the width, height and length of the reactangular sedimentation
tank and Q is the discharge rate in (m3.s-1). In terms of the terminal settling velocity of the
particle;
vtpx
Q
WL
(3.35)
The overflow rate v0 needs to be set at the terminal settling velicity of the particle as
given by Eq. (3.35) as given by Camp (1946). The flow is assumed to be of plug flow type.
Most real applications the flow is of the laminar type and a parabolic velocity profile can be
expected. In this method the particle removal efficiency is independent of the depth of the
tank H and the residence time of the fluid . Stokes law (1822) is assumed for estimation of
the terminal settling velocity of the particle in Camps method. Stokes law is applicable at
low Reynolds number of fluid around the particle. i.e., Re < 200. In this study the flow of
fluid in transition and turbulent flow is also included. The effect of height of the tank is
examined by introduction of the viscous effects of the fluid around the particle. A parabolic
velocity profile with maximum velocity at the top of the tank (when lid is open) and zero
velocity at the sludge zone is derived from the Hagen (1839) and Poiseulle (1841) law for
circular conduits applied to a rectangular chamber.
The results from an earlier study (Renganathan et al., 1989) for acceleration motion of
geometric and spherical particles in a stationary Newtonian fluid is extended to two
dimensions in this study. In the earlier study, the vertical distance travelled by a spherical
particle prior to reaching 90% of its terminal settling velocity was found from the results of
computer experiments to be;
X
x
dp
1.27
(3.36)
0.93
CDt
Based on Eq. (3.36) a iron particle with a particle size of 2.5 cm would travel 49.9 cm
prior to reaching 90% of its terminal settling velocity. This falls in the range of 25-50% of the
depths used in current standard designs of settling tanks. By trial and error, the Reynolds
number and drag coefficient at terminal settling velocity of the particle can be calcualted from
the 5 constant expression proposed by Turton and Levenspiel (1989);
CDt
24
1 0.173Ret0.657
Ret
0.413
1 16300 Ret 1.09
(3.37)
Eq. (3.37) is capable of exhibiting a minimum (Figure 6.0) unlike other predictions in the
literature. This can be used for predictions spanning a spectrum of fluid flow conditions
ranging from laminar to transition to turbulent flow. This expression was found to correlate
86
well with experimental data over a wide range of Reynolds number from 1 200,000. This
expression reverts to the Stokes expression at low Reynolds number.
For the iron particle under consideration, the Reynolds number turns out to be 54,250 and
the corresponding drag coefficient turns out to be 0.47. Stokes regime at this Reynolds
number is not a reasonable assumption. For such cases Camps assumption that the overflow
velocity of the sedimentation tank is independent of the height is a poor one.
Since the work of Camp (1936, 1946) a number of advances have been made in the
prediction of the drag coefficient at steady state. Raleigh (1883) was a pioneer in expressing
drag coefficient as a function of Reynolds number (1883). Clift et al. (1978) have provided a
review of available empirical correlations for drag coefficient of the particle at terminal
settling velocity of the particle, CDt vs. Ret, Reynolds number of the fluid at terminal settling
velocity of the particle. Chabra (1993) presented an analytical solution for acceleration
motion of a spherical particle in a unbounded Newtonian fluid. The drag coefficient used was
of the following form;
CD
A
Re
(3.38)
They suggest a Re = p2 substitution.

In this study, Eq. (3.37) was used for the drag coefficient of the particle in transient state.
Numerical simulations were conducted on the desktop computer using the 5th order RungeKutta method using MS Excel 2007 Spreadsheet for Windows software. The results from
these computer experiments are used to recommend modifications to the design procedure
laid out in Camp (1936). In Camps procedure the sedimenting particles were assumed to be
spherical. In this study particle of other shapes are also included. Sphericities of geometric
particles such as disks, isometric particles are used in Eq. (3.37) in a manner explained ny
Haider and Levenspiel (1989). There are little reports in the literature on two dimensional
trajectory of sedimenting particles relative to the moving fluid. Lapple and Shepherd (1940)
wrote equations for calculating paths taken by bodies in accelerated motion taking into
account fluid friction. Since the work of Lapple and Shepherd advances have been made in
description of drag coefficient as well as in numerical integration techniques using the
computer. A continuous, rectangular, gravity sedimentation tank with viscous, Newtonian
fluid such as water is considered in this study.
3.3.2. Theory and Simulation

Consider continuous flow of Newtonian fluid in a prototypical horizontal ideal
sedimentation tank with a sectional view as shown in Figure 10.0. W, H and L are width,
height and length of the rectangular tank. A sludge zone is allowed to form at the bottom of
the tank where the particles are captured during their residence time, . Flow of fluid in
vertical direction is neglected. Flow is assumed to be in the horizontal direction only. This is a
reasonable assumption for large and deep tanks and for inlet and outlet flow through weirs
near the top of the tank. The fluid in the bulk portion of the tank tends to be pseudostationary.
87
Figure 10.0. Horizontal Ideal Sedimentation Tank Fluid.
A momentum balance on a slice Wxy of fluid (Bird, Stewart and Lightfoot, 2007) at
steady state can be written as follows;
W x Py
Py
W y
xy x
xy x
(3.39)
Momentum transfer from flowing layers of fluid happens from the pressure drop in the
fluid into kinetic energy of layers of fluid below the flowing layer via tangential shear stress.
In the limits of x and y tend to zero, Eq. (3.39) becomes;
P
y
xy
(3.40)
It is assumed that the pressure drop in the fluid is linear in the horizontal direction;
P
y
xy
P
L
(3.41)
Eq. (3.41) can be integrated to yield;
xy
P
x c1
L
(3.42)
88
c1 can be seen to be 0 by noting that the velocity profile is maximum at x = 0. The

Newtons law of viscosity may in order to express the shear stress as a function of velocity
gradient and viscosity of the fluid. Eq. (3.42) can be rewritten as;
vy
P
x
L
(3.43)
The velocity vy can be obtained by integrating Eq. (10) as;

P
x2
2 L
vy
(3.44)
c2
c2 can be evaluated by noting that the velocity vy at the sludge zone is 0. Thus;
vy
PH 2
2 L
x
H
(3.45)
The average velocity of the fluid <vy> can be obtained by integration of Eq. (3.45)
between the defenite limits of 0 and H and can be seen to be;
vy
PH 2
3 L
(3.46)
In terms of residence time;

HWL
v y WH
L
vy
3 L2
PH 2
(3.47)
Eq. (3.47) may be used to include viscous effects in design considerations of

sedimentation tanks.
3.3.3. Single Particle Vertical Direction

Consider the relative motion of a spherical particle that is settling towards the sludge
zone in the vertical direction. A force balance on the particle can be written taking into
account the gravity, Archimedes buoyancy and drag forces as follows;
mp
v px
t
Vp g
CD Ap v 2fx
2
(3.48)
89
The fluid velocity, vxf surrounding the particle with a vertical velocity of vxp will be equal
to each other. Defining the following dimensionless variables;
;Y
s
v px
vtpx
x
dp
;X
(3.49)
It was shown in Renganathan et al. (1989) that Eq. (3.48) can be written in dimensionless
form. By rendering time variable implicit by use of adx = vxdvxEq. (3.48) can be written as
follows;
YdY
dX
0.75 CDt
(3.50)
Y 2 CD
The expression for the drag coefficient of the particle at terminal settling velocity, CDt
can be seen to be;
CDt
4 gd p
3
s
t2
v px
(3.51)
Eq. (3.50) was integrated using numerical integration on the computer. The form of Eq.
(17) used was found to be less error prone compared to the second order form of the equation
using explicit expression of time variable. The drag coefficient CD in the accelerating phase
of the particle was assumed to be given by Eq. (3.37) as given by Turton and Levenspiel
(1989) for drag coefficient at terminal settling velocity phase. The equations that are explicit
in time are a orderh higher than the one given by Eq. (17). The numerical integration method
used was the 5th order Runge-Kutte method using MS Excel 2007 Spreadsheet for Windows.
The Butchers method (1964) as described in Chapra and Canale (2006) was used. The
recurrence relations used are as follows;
k1
h
7k1 32k3 12k4
90
f xi , yi
k2
f xi
0.25h, yi
0.125k1h
k3
f xi
0.25h, yi
0.125k1h 0.125k2 h
k4
f xi
0.5h, yi
k5
f xi
0.75h, yi
3k1h
16
k6
f xi
h, yi
3k1
7
yi
yi
32k5
7 k6
(3.52)
0.5k2 h k3 h
9k 4 h
16
2k 2
7
12k3
7
12k4
7
8k5
7
90
Where h is the increment in the independant varibale, Y. The simulations were run till the
particle reached 95% of its terminal settling velocity.
3.3.4. Single Particle Horizontal Direction

The governing equations for relative motion of the particle in the horizontal direction can
be written as follows;
mp
v py
PxAp
CD Ap v 2fy
(3.53)
The fluid velocity, vyf surrounding the particle with a horizontal velocity vyp will become
equal to each other at the terminal settling stage. The following dimensionless variables are
defined as follows;
;Z
s
v py
vtpy
y
dp
(3.54)
Where vpyt is the terminal settling velocity of the particle in the horizontal direction. Eq.
(3.53) is made dimensionless using the substitutions in Eq. (3.54). Further the time variable is
made implicit by use of the expression for acceleration in terms of velocity of the particle,
i.e., ady = vydvy and Eq. (3.53) can be written as follows;
ZdZ
0.75 CDt
Z 2 CD
(3.55)
The expression for the drag coefficient of the particle at terminal settling velocity, CDt
can be seen to be;
y
CDt
2 Px
3 s Lvtpy2
(3.56)
Eq. (3.55) was integrated using numerical integration on the computer. The form of Eq.
(3.55) used was found to be less error prone compared to the second order form of the
equation using explicit expression of time variable. The drag coefficient CD in the
accelerating phase of the particle was assumed to be given by Eq. (3.37) as given by Turton
and Levenspiel (1989) for drag coefficient at terminal settling velocity phase. The equations
that are explicit in time are a order higher than the one given by Eq. (3.52). The numerical
integration method used was the 5th order Runge-Kutte method using MS Excel 2007
Spreadsheet for Windows. The Butchers method (1964) as described in Chapra and Canale
(2006) was used.
91
3.3.5. Results
A 2.5 cm iron particle was considered. The water rate was million gallons per day
delivered from the sedimentation tank. The weir area was 0.001 m2 and the pressure drop
allowed was 50 N.m-2. The trajectory of the iron particle as obtained from the computer
simulations is shown in Figure 11.0.
It can be seen that 66% of the terminal settling velocity of the particle is reached when
the iron particle reaches the sludge zone. Thus the particle is still accelerating. It has travelled
75 cm in the vertical direction and 29 cm in the horizontal direction. The acceleration zone
ought to be a small fraction of the depth of the tank in a modern design of sedimentation tank.
The sedimentation tank has to be made deeper. The current procedure overestimates the
velocity of the sedimenting particle. Only in deeper tanks the design overflow velocity based
upon the settling velocity of the particle will result in the estimated separation efficiency.
Other wise the separation efficiency realized would be lower. It can be seen from Eq. (3.48)
that during the trajectory of the particle, it can be expected to face an increasing force. This
is because of the velocity profile as shown in Figure 11.0. The drag force will oppose the
motion of the particle in the y direction as described in Eq. (3.48) and rise to meet the applied
kinetic force at the terminal settling stage of the particle in the horizontal direction. Recent
designs of horizontal gravity sedimentation tanks provide a slope or taper to minimize motion
of particles in horizontal direction in the sludge zone.
Figure 11.0. Trajectory of 2.5 cm Iron Particle in Horizontal Sedimentation Tank.
92
Trajectory of the iron particle at higher pressure drop (100 N.m-2) and deeper tank, H = 2
m is shown in Figure 12.0. At the sludge zone the particle was found to have reached 93% of
the terminal settling velocity of the particle.
Figure 12.0. Trajectory of 2.5 cm Iron Particle at a Pressure drop of 100 N.m-2.
Figure 13.0. Trajectories of Accelerating and Settled 2.5 cm Sand Particles.
93
A sand particle with a particle size of 2.5 cm was considered. The trajectory of the
accelerating sand particle was compared with a trajectory of the sand particle if it was at
terminal settling velocity of the particle from the entrance of the particle to the tank. The
trajectory of the accelerating particle was found to be curvilinear and the trajectory of the
steady particle was found to be rectilinear (Figure 13.0).
3.3.6. Conclusion
The following conclusions were drawn from the study;
1. Trajectory of sedimenting particles can be simulated using desktop computers and
numerical integration.
2. Viscous effects of the fluid can be accounted for the in the design considerations of
rectangular sedimentation tanks.
3. Drag correlations with Reynolds number for spherical and geometric particles under
laminar to transition to turbulent flow were used in the computer simulations.
4. By writing the acceleration term in terms of velocity the time variabe is rendered
implicit and an order reduction is achieved in governing equation.
5. Fifth order Runge Kutta method was used with success.
6. Iron and sand particles were simulated. Trajectories are shown as Figures.
7. Sedimentation tanks needs to be made deeper to allow for accelerating phase.
8. Overflow rate is no longer independent of the tank height.
9. Trade-offs between pressure drop (pumping costs), separation efficiency achived and
throughput (capital costs) can be seen. Total cost can be optimized.
10. Shape of the trajectory is plateau in the initial stages and a sharper fall later.
11. Trajectory of accelerating particles are found to be curvilinear as opposed to linear
for settled particles.
12. Expression for terminal settling velocity of the partilce in horizontal direction is now
given by Eq. (3.56).
13. Acceleration zone was found to be shorter for geometric particles.
B. SEMI-EMPIRICAL MODELS
3.4. MESOSCOPIC CORRELATION
Semi-empirical models are used to correlate experimental data using dimensionless
groups that stem from first principle based models. Sharma and Turton [1998] presented
mesoscopic correlations for heat transfer coefficients between gas-solid fluidized beds and
immersed surfaces with a dimensionless group called frequency number. 756 sets of pressure
signals were measured simultaneously along with measurements of local, time-averaged bedto-surface heat transfer coefficients. 13 different powders with average particle size in the
range of 20 m 1.789 mm were tested in a 5 cm transparent walled fluidized bed over a
wide range of fluidization velocities ( < 2.4 m/s). Fast Fourier transform analysis were
94
performed and the dominant frequency of pressure fluctuations was noted. This frequency in
the dimensionless form is the frequency number. As can be seen in Figure 13.0 the
experimental measurements correlated well with the frequency number. The lines in Figure
13.0 were obtained by scaling first principle mechanistic models into the correlation form of
the chart. Figure 13.0 is an example of semi-empirical correlations.
Mickley and Fairbanks [1955] proposed a packet theory to predict heat transfer
coefficients between gas-solid fluidized beds to immersed surfaces. Packets of solids with
interstitial gas resides in the surface and the surface gets renewed by fresh packets. The
contact times of the packets of various sizes form an exponential distribution. During the time
the packet was in contact with the surface the heat transfer between the surface and packet is
unsteady. The temperature profile in the packet can be derived by using a Boltzmann
transformation [Bird et al., 2007] and can be shown to be given by an error function. The
packet is assumed to be a semi-infinite medium. Let the surface temperature of the fresh
packet arriving at a hot surface and that of the temperature of the surface be Ts. The packet is
assumed to be at an uniform initial temperature of T0. The Fourier conduction based
governing equation for temperature in the packet can be written as follows;
2
T
t
x2
(3.57)
Where, e is the thermal diffusivity of the emulsion packet residing at the surface. The
mathematical problem is one of a partial differential equation, PDE, in two variables, space
and time. The PDE is second order in space and first order in time. One time condition and
two space conditions are needed to completely describe the problem. These conditions are
provided from the initial time condition and two space conditions and are as follows;
t
0, T
T0
0, T
Ts
,T
T0
(3.58)
The temperature is made dimensionless by defining a u such that;
T T0
Ts T0
(3.59)
Eq. (3.57) in terms of u can be written now as;

u
t
Eq. (3.58) in terms of u can be written as;
2
e
x2
(3.60)
95

0, u 1
(3.61)
,u
The Boltzmann transformation can be used to convert the PDE in two variables given in
Eq. (3.60) into an ODE, ordinary differential equation in one variable, i.e., the transformation
variable, . The transformation variable, , can be defined based on similarity observations at
infinite space and initial time. At infinite space, x = and at initial time, t = 0 the temperature
u is the same at u = 0. This can be tapped into.
x
4 e t
(3.62)
Eq. (3.60) in terms of the transformation variable now can be written as;
Or,
2u
u
e 2
2 t 4 e t
(3.63)
u
2u
2 0
2
(3.64)
Eq. (3.64) can be integrated as follows. Let, p
u
. Then Eq. (3.58) can be written in
terms of p as follows;
p
2 p
(3.65)
Separating the variables p and and integration of both sides would yield;
ln p
2
2
(3.66)
Where c is the integration constant.

2
Or,
u
c' e 2
(3.67)
Eq. (3.67) can be integrated to give the solution for dimensionless transient temperature
as;
u c1 c2erf
(3.68)
96
The integration constants c1 and c2 can be solved for from the boundary conditions given
by Eq. (2.5). The temperature profile in the packet can be seen to be;
T T0
T s T0
1 erf
4 t
(3.69)
The wall heat flux can be calculated from;
qx
ke Ts
T
x
ke
T0
et
x 0
(3.70)
The instantaneous, local heat transfer coefficient between the bed and the gas-solid
fluidized bed can be seen to be;
ke e C pe
hi
(3.71)
Eq. (3.71) can be integrated with an exponential distribution for the packet contact time at
the surface and the time averaged local heat transfer coefficient between the bed and surface
can be seen to be;
t
_
hbs
hi
e
_
dt
ke eC pe
_
(3.72)
Eq. (3.72) is the model solution for the Mickley and Fairbanks packet theory. It is an
example of an mechanistic model as discussed below in section 2.3. Sharma and Turton
[1998] scaled the model solution given by Eq. (3.72) into a dimensionless correlation of the
form of Nusselt number, Nu, vs. frequency number, Nf. The frequency number, Nf is defined
as;
Nf
fd p2
(3.73)
Where f is the dominant frequency of pressure fluctuations, dp is the average size of the
particle that is fluidized. Eq. (3.72) scales to;
Nu
Nf
(3.74)
Eq. (3.74) in the log-log plot appears as a straight line as shown in Figure 13.0. In a
similar manner, Sharma and Turton [1998] scaled mathematical models presented in the
97
literature into correlations. These models are due to finite length of packet with variable
thermal properties by Chandran and Chen [1982], gas gap between the packet and wall by
Baskakov [1973] and finite speed conduction by Renganathan and Turton [1989]. These
correlations are also shown in Figure 13.0.
C. MECHANISTIC MODELS
3.5. WHICH IS THE DOMINANT MECHANISM FOURIER
CONDUCTION OR GAS CONVECTION?
Consider the combined effects of particle conduction and gas convection during transient
heat transfer between gas solid flow past a surface. The packet is assumed to possess constant
thermo physical properties, ke, (sCps(1-), thermal conductivity, thermal mass, i.e., the
product of density and heat capacity. The governing equation that includes conduction into
the packet in the x direction and convection in the azimuthal, z direction can be written using
the Fourier parabolic model as follows. The azimuthal velocity of the gas phase is assumed to
be constant and equal to U.
T
t
T
z
x2
(3.75)
Figure 13.0. Theoretical Correlation Between Nusselt Number and Frequency Number (Sharma and
Turton [1998])
98

The dimensionless form of the equation can be obtained as follows;
u
Where,
(T T0 )
;
(Ts T0 )
;X
u
Z
Pe
(3.76)
X2
;Z
; Pe
(3.77)
r
It is known that Boltzmann transformation can lead to an error function solution for the
parabolic heat conduction equations. Hence the convective term is also lumped along with the
accumulation term as follows. Let,
= Z+Pe
Eq. (3.76) becomes,
2
2 Pe
(3.78)
X2
The Boltzmann transformation can be used to convert Eq. (3.78) from a second order
PDE to an ODE in one variable of the second order as follows. Let,
X
2
2Pe
X
2
u 1
or 2Pe
2
2
u
2
(3.79)
The solution to the ODE in can be seen to be;
Pe1/2 X
u 1 erf (
2(Z
Pe
(3.80)
The conductive portion of the heat flux and hence the conductive component of the heat
transfer coefficient between the gas-solid fluidized beds and immersed surfaces can be seen to
be from q*=-u/X;
hc*
ke ( s C ps )(1
r
U
/
1
r
(Z
Pe )
(3.81)
The azimuthal distance Z can be set to zero for the conductive component. It does vary
with Z!
99
The convective component can be obtained by differentiating Eq. (6) wrt. Z and
evaluated at X = ndp.
hconv
kg
g C pg
rg
X 2 Pe
Pe
X
)exp(
)
2
2(Z Pe ) (2( Z Pe )3/2 )
(3.82)
The maximum convective heat transfer coefficient can be obtained when =0 and
hconv
kg
g C pg
rg
X 2 Pe
Pe
X
)exp(
)
2
2( Z ) 2( Z )3/2
(3.83)
3.5.2. Evaluation of Dominant Mechanism Non-Fourier Conduction or

Convection during Heat Transfer in Circulating Fluidized Beds
Circulating Fluidized Bed, CFB technology was developed by Foster Wheeler, Babcock
& Wilcox, Pyro power, Keeler Dorr-Oliver, Tennessee Valley Authority, Westinghouse and
Combustion Engineering. Heat transfer between gas-solid fluidized beds and surfaces have
been reviewed by Saxena, Grewal et al., [1978]. Very little has been reported on convective
heat transfer in CFB to a horizontal tube. During short time scales the system may be far from
equilibrium and the high rate unsteady state transient processes cannot be fully described
using Fouriers heat conduction law. The Cattaneo and Vernote non-Fourier equation, for heat
conduction which was shown to be the only mathematical modification (Boley [1964]) that
can remove the singularity in surface flux is:
q
T
x
q
t
(3.84)
Combined with the energy equation this was solved for the semi-infinite medium case by
the method of Laplace Transforms and method of relativistic coordinate transformation
presented earlier. The velocity of heat is given by (/ r ). A study was conducted with the
Cattaneo and Vernotte non-Fourier heat conduction equation used in the energy balance in 1
dimension along with the convection term. Consider the flow of gas solid suspension past a
horizontal tube in a CFB. Two cases can be identified;
Case 1: Flow Away from Tube of Gas Solid Suspension
The governing equation from an energy balance may be written after obtaining the
dimensionless variables as;
2
u
2
Pe
u
Y
u
Y
Y2
(3.85)
100
Case 2: Flow of Gas Solid Suspension Toward the Horizontal Tube

The governing equation for flow toward the horizontal tube from an energy balance after
obtaining the dimensionless variables may be written as;
2
Pe
u
Y
u
Y
Y2
(3.86)
The minus sign indicates the relative velocity of the suspension with respect to the
direction of heat conduction path. For the bottom of the tube the y axis is selected as bottom
direction is positive. Where y is the direction of flow of gas and solid, T the temperature, t the
time and q the flux.
T T0
;
T1 T0
t
r
; Pe
(3.87)
Uy
The Peclet number, Pe represents the ratio of the gas velocity to the velocity of heat by
conduction. When Pe is 0, Eqs. (3.86,3.85) reduce to the hyperbolic heat wave propagative
equation by conduction alone which was solved for and presented earlier for the semi-infinite
medium case under CWT. Obtaining the Laplace transform of Eqs.(3.85,3.86) the second
order ODEs result;
u ( s) s s 1
d 2u ( s )
dY
Pe s 1
du (s)
dY
(3.88)
Pe s 1
du (s)
dY
(3.89)
(top of tube)
u ( s) s s 1
d 2u ( s )
dY
(bottom of tube)
Solving for the ordinary differential equation given by Eq.(3.88), Eq. (3.89);
Pe s 1 1
r1 , r2
4s
Pe s 1
2
u(s) c1e r1Y c2 e r3Y

At Y = , u = 0 and Y = 0, u = 1
(3.90)
(3.91)
101
u
YY
s s 1
2
4s
s 1
Pe2
Pe
(3.92)
The heat transfer coefficient obtained in the Laplace domain may be written as;
h*y
L1
Pe
2s
4s
(3.93)
s 1 Pe2
(top of tube)
Where, h*y
hy
k Cp
r
For the case of bottom of tube, the axes is drawn in a manner that y is positive in the
bottom direction and;
h*y
L1
Pe
2s
4s
(3.94)
s 1 Pe2
(bottom of tube)
Inverting the Laplace domain after expanding the square root using the binomial theorem
we have;
e
Pe
k Cp
2 1 2
Pe
2! Pe5
......
(3.95)
(top of tube)
h
k Cp
Pe
e
Pe
e
3
Pe
2 1 2
2! Pe5
......
(3.96)
(bottom of tube)
This expansion is good for large Peclet numbers. The terms in the series were inverted by
the residue theorem by Heaviside expansion as shown by Mickley, Sherwood and Reed
102
[1957] and by expressing the term as P(s)/Q(s) and finding the poles and writing the
inversion. The results are presented in Table 2.1. The results are shown in Figure 5.1 for three
different Peclect numbers. It can be seen that at short contact times, the micro scale
conduction effects become a dominant contribution to the heat transfer coefficient. At large
contact times, the heat transfer coefficient becomes independent of the contact time and is
found to be function of the Peclect number.
The difference in values between top and bottom of the tube gives the twice the
convective contribution. The driving force for heat transfer as the suspension moves towards
the tube is away from the tube leading to a minus sign in the convective contribution in the
governing equation. As the suspension moves away from the tube the heat transfer driving
force and the velocity of the suspension are in the same direction. Hence the conduction and
convection have to be added to obtain the total heat transfer. In the case of the bottom of the
tube the convection contribution has to be subtracted from the conduction contribution to
obtain the net heat transfer coefficient. Thus when the difference between the values from the
top and bottom of the tube is obtained the contribution to convection alone will result and
when the values from top and bottom are added the twice the conduction contribution will
result. Hence Eq. [3.98-3.97] and normalizing for direction the convective contribution may
be seen to be Pe/2. The conductive contribution is the addition of Eqs. [3.97,3.98] and
dividing by 2 to give after converting heat transfer coefficient to a dimensionless Nusselt
number,
1
Maxh
Nu
A1
Pe
A2
A3
Pe
....
Pe5
(3.97)
(top of tube)
Nu
1
Pe
Maxh 2
A1
Pe
A2
A3
3
Pe5
Pe
....
(3.98)
(bottom of tube)
As 0, in the short time limit the transient solution for top of the tube becomes;
Nu
1
1
Maxh Pe
Where Maxwell Number (heat), Maxh =
2
3
Pe
Pe5
....
(3.99)
D2
For very large Peclet numbers, the transient portion of the solution drops out and the
portion that results is invariant with time. In the absence of convection, conduction alone is
the mechanism of heat transfer. Here the open interval solution developed earlier can be used.
(Uy = 0) and is given for both the bottom and top of the tube by;
hy* = exp(-/2) I0 (/2)
(3.100)
103

Table 3.4. Term by Term Inverse Laplace Transform of the Infinite Series
m1
Am e A1 A2 .... A
m m 1!
Term
#
-
e 1
10
11
L1
2e 1 2 0.5 2
cs k
s 1k 1
1
s 1
3
5e 1 3 1.5 2
3
2 3 4
14e 1 4 3 2

3
4!
5 3 5 4 5
42e 1 5 5 2

3
4!
5!
15
20 3 15 4 6 5 6
132e 1 6 2

2!
3!
4!
5!
6!
21
35 3 35 4 21 5 7 6 7
429e 1 7 2

2!
3!
4!
5!
6!
7!
56 3 70 4 56 5 28 6 8 7 8
1430e 1 8 14 2

3!
4!
5!
6!
7!
8!
36 2 84 3 126 4 126 5 84 6
1 9
2!
3!
4!
5!
6!

4862e
36 7 9 8 9
7!
8!
9!
2
3
4
5
6
45
120
210
126
210
1 10
2!
3!
4!
16796e
120 7 45 8 10 9 10
7!
8!
9!
10!
5!
6!
s 12
2s 2
s 13
5s 3
s 14
14s 4
s 15
42s 5
s 13
132s 6
s 17
429s 7
s 18
1430s 8
s 19
4862s 9
s 110
16796s10
s 1
11
When the relaxation time becomes infinite as in the insulator of heat, the DAlamberts
wave solution results. A aliter would be to invert Eq. [3.101] the case for bottom of tube,
from the Laplace domain as follows;
104
h*y
L1
Pe
2s
4s
4 Pe2 ; B
s 1 Pe
L1
Pe
2s
A s
(3.101)
2s s 1
Where,
h*y
Pe
2
B 1
2
Ae
2
I0
1 B
2
AB
(e
B 1
Pe2
(3.102)
4 Pe2
B 1
2
(I0
1 B
2
I1
1 B
2
1) (3.103)
The inversions can be read from the tables provided in Mickley, Sherwood and Reed
[1957]. Eq. [3.104] is the exact solution and it includes modified Bessel function of the first
kind and zeroth order. For the special case when Pe = 1,
h*y
0.5 1.118e
0.6
I0 0.4
0.373e
0.6
( I 0 0.4
I1 0.4
1)
(3.104)
3.5.3. Representative Experimental Data

The key parameter in using the model is the contact time of the suspension with the tube
wall and the dimensionless Peclet. This may be a function of the operating parameters. In
addition to this the physical properties of the suspension is required and the relaxation time of
the suspension is an added intrinsic parameter of the system. Some experimental data was
available for comparison from Sundaresan and Kolar [2002]. They used silica at 3 mean sizes
between 143 263 m, air velocity 4 8 m/s, suspension density of 9-25 kg/m3, 0.5 1.0 m
high U horizontal tubes, 5.5 m CFB, solid circulation flux, 13-80 kg/m2/s and reported heat
transfer coefficients between 30 105 W/m2/K in their core heat transfer studies in a CFB. A
uniform distribution of the suspension packets with the wall tube is assumed as a first
approximation and the Nusselt number calculated as
(Nu = (h D/k) = 105 * .05/0.04 = 131).
Where the diameter of the tube is taken as 2 inches and the effective thermal conductivity
of the suspension calculated from a simple average with the voidage as the weight from the
values of air and silica as 0.04 w/m K. Taking the effective thermal diffusivity of the
suspension as 3 E-6 m2/s.
(Pe = Uy/ (/r ). = 8/(3 E-6/1E-3) = 146; el = (r / D2 ) = 3E-6 * 1 E-3/.052;
Short Time Limit: Nu = (1/Rel) ( 1/Pe + ) = 6.25).
The relaxation time can be estimated from an analogy to the speed of molecules. The
Maxwellian distribution for the speed of the molecules was used to get the root mean square
velocity of the molecule and by analogy to heat transfer the velocity of heat transfer was
105
estimated. The relaxation time was obtained from this estimate given the thermal diffusivity
of the suspension. The convective contribution is thus Pe/2 = 146/2 = 73. The conductive
contribution to the Nusselt number is then given a typical contact time of the suspension with
the tube as 5 milliseconds
(Nu = 73 + exp(-5)/73 - exp(-5)*(-4)/733 = 73).
Experimental validation of the model will require contact time of the solids in the wall
information, preferably the statistical distribution of their residence times at the surfaces. The
relaxation time is another intrinsic property of matter and needs measurement prior to an
elaborate study of experimental data. Thus, the Cattaneo and Vernotte non-Fourier heat
conduction equation is used to model the mesoscale conduction effects in convection
dominated heat transfer in CFB to a horizontal tube. Hence the exact solution is obtained for
the dimensionless heat transfer coefficient by conduction and convection and found to be
h*y
Pe
2
B 1
2
Ae
2
1 B
I0
B 1
2
AB
(e
B 1
(I0
1 B
I1
1 B
2
1) (3.105)
for the case of bottom of tube. This can be used especially for Peclet numbers close to 1.
Two cases were identified, i.e., one for suspension flow toward the tube and the other for
flow of suspension away from the tube. The Peclet number that gives the ratio of the
convective fluid velocity to the velocity of heat conduction and the relaxation number that is
the inverse of the Fourier number with the relaxation time substituted for time are important
parameters for predicting the Nusselt number based upon the tube diameter. The convective
contribution is given by Pe/2 = Uy/(/r)/2.
A more usable form is obtained by expansion of the Laplace domain using binomial
infinite series and upon obtaining the inversion by the method of residues. 13 terms in the
binomial series for the case of bottom of tube is taken and results of the inversion presented in
Table 1. This is useful at large Peclet numbers.
Nu
1
Pe
Maxh 2
A1
Pe
A2
A3
3
Pe5
Pe
....
(3.106)
The representative data available was used to show how the model can be applied to data
from the experimental measurements from the CFB. In the short time limit the transient
solution for top of the tube becomes;
Nu
1
1
Maxh Pe
2
3
Pe
Pe5
....
(3.107)
For very large Peclet numbers the transient portion of the solution drops out and the
portion that results is invariant with time. In the absence of convection, conduction alone is
the mechanism of heat transfer. Here the open interval solution developed earlier can be used.
106
(Uy = 0). When the relaxation time becomes zero as in the insulator of heat, the DAlamberts
wave solution was developed as presented earlier.
3.6. EVAPORATIVE COOLER

There are some humidification operations where heat exchange is necessary from an
external source. For example, consider an evaporative cooler. Air is blown past the water on
the outside of the tube. The heat is carried away from the tube-side fluid. The fluid is cooled
when it flows through the tube. Water is sprayed on the outside of the tube and flows as a
film. A large heat is released when the sprayed water evaporates into the air stream. The
schematic of an evaporative cooler is shown in Figure 14.0 The tube banks are shown in
Figure 14.0. The temperature and enthalpy profiles are shown in Figure 14.0. The bulk water
is at the temperature, tL corresponds to a saturation gas enthalpy, H1*. The overall heat
transfer coefficient U0 based on the outside tube surface from tube fluid to bulk water is then
given by [Treybal, 1980];
1
U0
d0
di hT
d 0 zm
d av km
1
hL'
(3.108)
The overall coefficient KY for use with gas enthalpies, from H1* to H, is;
1
KY
1
kY
m
hL0
(3.109)
which m is the slope of the equilibrium line near the operating region in Figure
H '* H i'
tL ti
(3.110)
Strictly speaking, m is the slope of the enthalpy and temperature diagram,

m
dH '*
dtL
(3.111)
If A0 is the outside surface of all the tubes, A0x is the area from the bottom to the level
where the bulk-water temperature is tL. Here x is the fraction of the heat transfer surface to
that level. For a differential portion of the exchanger the heat loss by the tube-side fluid is;
wTCTdtL = U0A0dx (tT - tL)
(3.112)
Figure 14.0. Schematic of an Evaporative Cooler.
Figure 15.0. Schematic of Tube-Side Fluid Flow of an Evaporative Cooler.
107
108
U 0 A0
wT CT
dtT
dx
tT
tL
(3.113)
The heat lost by the cooling water is;

WALCALdtL = KYA0dx(H* - H) - U0A0dx(tT - tL)
dt L K Y A0

dx wAL C AL
'*
U A
H H ' 0 0
w AL C AL
(3.114)
tT t L
Heat gained in in the air is written as;

WsdH = KYA0dx(H* - H)
dH
dx
'
(3.115)
K Y A0 '*
H H '

ws
Subtracting Eq. (3.114) from Eq. (3.111);
d tT
tL
1
dx
tT
tL
U 0 A0
wT CT
H '*
U O A0
wAL C AL
H'
(3.116)
(3.117)
mU 0 A0
wT CT
(3.118)
KY A0
WAL C AL
(3.119)
mKY A0
wAL C AL
KY A0
ws
(3.120)
Eqs. (3.116) and Eq.(3.115) can be combined into a second order differential equation
with constant coefficients. The auxiliary equation which is a quadratic can be examined to
realize that the roots of the equation are real and hence the solution will not undergo any
pulsations. The solution is given in terms of the integration constants. The enthalpy is related
to temperature difference by Eq. (3.110);
tTL
c1er1x c2er2 x
(3.121)
109
Figure 15.0. Temperature and Enthalpy Profile and Resistances in Evaporative Cooler.
H '* H ' d1er1x d2er2 x
(3.122)
H* - H = d1exp(r1x) + d2exp(r2x)
Where,
dj
c j rj
(3.123)
The design of the evaporative cooler needs values of the transfer coefficients. Some of
this data availability is scarce. Correlations for the Nusselt number and Sherwood for the
given geometry needs to be looked up [Treybal, 1980].
3.7. TRANSIENT DIFFUSION OF OXYGEN IN ISLETS OF

LANGERHAANS: PARABOLIC AND HYPERBOLIC MODELS
3.7.1. Overview of Gas Transport
Diffusion of oxygen in pancreatic islets in an important consideration during the
development of models for the functioning of the islets of Langerhans (Figure 16.0). Islets of
Langerhans are spheroidal aggregate of cells located in pancreas. They secrete hormones such
as insulin during glucose metabolism. These islets are transplanted in order to effect cure for
Type I diabetes and are often encapsulated in devices. Islets that are removed from pancreas
lose their internal vascularization. The cure is depends on diffusion of oxygen from external
environment.
110
Figure 16.0. Islets of Langerhans.
Avgoustiniatos et al. [2007] and Colton et al. [2011] developed a method for estimation
of maximum oxygen consumption rate and the oxygen permeability in the tissue in a
suspension of spherical aggregates from measurements of partial pressure of oxygen in batch
experiments. A simultaneous reaction and diffusion model was used. Williams et al. [2012]
discusses a dramatic diffusion barrier that leads to core cell death during islet transplantation
as cure for Type I diabetes. They attempted to measure the diffusion barrier in intact human
islets and determine its role in cessation of insulin secretion. They monitored impeded
diffusion into islets using fluorescent dextran beads. They linked the poor diffusion properties
with necrosis and not apoptosis. The Fick diffusion model was used in the analysis of
[Sharma, 2005, 2012].
Sharma [2005, 2010] has shown that non-Fick damped wave diffusion effects can
become significant at short time scales. Bounded solutions from hyperbolic models can be
obtained when final time condition and physically reasonable initial time rate of change
conditions are used. In this study, damped wave diffusion effects during the diffusion of
oxygen in islets of Langerhans is accounted for in detail
The metabolic process becomes diffusion limited. Oxygen availability becomes limited in
some regions of the tissue. The metabolic rate in the cells and demand for oxygen is greater
than the oxygen that has diffused to that region. Growth of multicellular systems over 100 m
cease to happen. A condition called hypoxia has been observed in Brockman bodies in fish.
During islet transplantation, lack of oxygen supply may restrict graft function especially when
encapsulated tissue is used.
Oxygen partial pressure was measured in the islet organs of Osphronemus gorami
(Brackman bodies) placed in culture. A microelectrode was used to detect oxygen partial
pressure in the surrounding region of the islet organ that is 800 m in diameter and within the
cells. This was achieved in a radial track. Within a distance of 100 m for the case of no
convection (Schrezenmeir et al. [1994]), pO2 is close to zero. A condition called necrosis is
reached where the cells begin to die without sufficient oxygen supply. The experiments with
111
convection showed increased pO2 at the surface and core regions of the islet. The experiments
were conducted in a thermostatically controlled measuring chamber at 37 0C.
Oxygen supply in addition to diffusion also comes about by the circulatory system and by
hemoglobin molecule. Oxygen is carried in the blood by convection to capillaries by the
circulatory system. Islets of Langerhans (Figure 16.0) are spheroidal aggregates of cells that
are located in the pancreas. The metabolic requirement of the cells requires oxygen to diffuse
from the external environment and through the oxygen-consuming islet tissue. The oxygen
supply is a critical limiting factor for the functionality and feasibility of islets that are
encapsulated, placed in devices for implantation, cultured, used in anaerobic conditions.
Theoretical models are needed to describe the oxygen diffusion. The parameters of the model
require knowledge of the consumption rate of oxygen, oxygen solubility, effective diffusion
coefficient to oxygen in the tissue.
3.7.2. Theory
Avgoustiniatos et al. [2007] developed an oxygen reaction and diffusion model. They
assumed that the islet preparation is a suspension of tissue spheres that can be divided into m
groups. Each sphere in group i has the same equivalent radius, Ri that varies from group to
group. The tissue is assumed to be uniform with constant physical properties that is invariant
in space. The governing equation for oxygen diffusion and reaction in spherical coordinates
with azimuthal symmetry accounting for Ficks diffusion can be written as;
CO2
t
DT
1
r
r2
CO2
CE 0CO2
CM
CO2
(3.124)
Where DT is the diffusion coefficient in the tissue, CE0 is the total enzyme or
complexation species concentration including the rate constant kE0 and CM is the Michaelis
constant. The oxygen consumption rate is assumed to obey the Michaelis-Menten kinetics.
The interplay of transient diffusion and metabolic consumption of oxygen in the tissue in
spherical coordinates is given by Eq. (3.124). The concentration of oxygen CO2 can be
expressed in terms of its partial pressure, pO2 This is obtained by using the Bunsen solubility
coefficient, t such that;
CO2
t pO2
(3.125)
Substituting Eq. (3.125) in Eq. (1), Eq. (3.124) becomes;
pO2
t
t DT
1
r
r2
pO2
r
CE 0 pO2
'
CM
pO2
(3.126)
112
The product tDT can be seen to the product of solubility and diffusivity and hence is the
permeability of oxygen in the tissue. The Michaelis constant CM, is also modified, CM
expressed in units of mm Hg. The initial condition can be written as;
pO20 , t = 0
pO2
(3.127)
From symmetry at the center of the sphere;

pO2
r
(3.128)
At the surface the oxygen diffusive transport from within the sphere must be equal to the
oxygen transport by convection across the boundary layer surrounding each sphere;
Ji
ki
m ( pO2 m
pO2 ( Ri ))
tD
pO2
r
(3.129)
Where the partial pressure of oxygen at the surface is given by pO2 (Ri), the mass transfer
coefficient between the surrounding space and the surface of the sphere is given by ki and the
oxygen solubility in the surrounding space is given by m. Total rate of oxygen transfer N
from the surrounding space to all of the spheres can be summed up as;
m
J i (4 Ri2 )ns fi
Vm
pm
t
i 1
(3.130)
Where the volume of the surrounding space is given by Vm, the total number of spheres is
ns and the fraction of spheres in group i is given by fi. The initial condition for surrounding
space is;
pO2 m
pO2 m (0) , t = 0
(3.131)
The mass transfer coefficient can be obtained from suitable Sherwood number
correlations. For instance the mass transfer coefficient for spherical particles in an agitated
tank in the islet size range of 100-300 m can be written as;
Shi
ki di
Dm
1/3
Dm
dimp
d tan k
0.15
3 4
di
3
(3.132)
Where is the power input per unit fluid mass, f is the function that has to be obtained
from experimental data. Numerical methods are needed to obtain the solution to Eq. (3.126).
This is because of the nonlinearity of Michaelis-Meten kinetics.
113
3.7.3. Asymptotic Limits of Michaelis-Menten Kinetics

Closed formed analytical solutions to Eq. (3.126) can be obtained in the asymptotic limits
of;
i)
High concentration of oxygen, the rate is independent of pO2 (zeroth order)
ii) Low concentration of oxygen, the rate is first order with respect to pO2
The reasons for choosing the asymptotic limits is elucidated in Figure 17.0. It can be seen
that at low reactant concentrations the rate is linear [Levenspiel, 1999]. At high enzyme or
complexing agent concentration the rate is invariant with respect to concentration. Hence a
zeroth order can be assumed at high concentrations and first order at low reactant
concentrations.
Thus, at high reactant concentrations Eq. (3.126) becomes,
pO2
t
t DT
r2
pO2
r
rmax
(3.133)
Eq. (3.133) can be non-dimensionalized as follows;

Let,
DT t
Ri2
;u
pO2
pO2 m
;X
p O20 pO2 m
r *
; rmax
Ri
rmax Ri2
pO20
pO 2 m DT
(3.134)
t
Eq. (3.135) becomes;
1
X
X2
u
X
*
rmax
(3.135)
3.7.4. Parabolic Fick Diffusion and Reaction Model

The zeroth order reaction at high concentrations of oxygen is a heterogeneity in the
partial differential equation. Systems such as this can be solved for by assuming that the
solution consists of a steady state part and a transient part;
Let,
u = uss + ut
(3.136)
114
Figure 17.0. Rate-Concentration Curve Obeying Michaelis-Menten Kinetics.
Substituting Eq. (3.136) in Eq. (3.135), Eq. (3.135) becomes;
ut
1
X
X2
(ut
u ss )
X
*
rmax
(3.137)
Eq. (3.136) holds good when,

*
rmax
and
ut
1
X2 X
1
X2 X
X2
u ss
X
(3.138)
X2
ut
X
(3.139)
Eq. (3.138) can be integrated twice and the boundary condition given by Eq. (3.128)
applied to yield;
u ss
*
X 2 rmax
6
(3.140)
In order to obtain the solution of the integration constant d in Eq. (3.140), the boundary
condition given by Eq. (3.127, 3.129) needs to be modified. Assuming that after attainment of
steady state, the surface concentration of the sphere would have reached the surrounding
space concentration, d can be solved for the solution for the pO2 at steady state written as;
115
Ri2
ss
*
r 2 rmax
(3.141)
6 Ri2
The solution to Eq. (3.139) may be obtained by separation of variables as follows;

Let ut = V()g(X). Then Eq. (3.139) becomes;
V'
1
g( X ) X 2 X
Hence,
ce
X 2 g "( X ) 2 Xg '( X )
X 2 g '( X )
2
n
2
n
(3.142)
(3.143)
X2
2
n g( X )
(3.144)
Comparing Eq. (3.144) with the generalized Bessel function [Varma and Morbidelli,
1997];
a=2; c=0; s= 1; d =
2
n;
p = 1/2;
The solution to Eq. (3.144) can be seen to be;

g( X )
c1
J 1/2 (
nX)
d1
1/2 ( n X )
(3.145)
From the boundary condition given by Eq. (3.129,3.128), it can be seen that d1 can be set
to 0 and,
g( X )
c1
J 1/2 (
nX)
(3.146)
The eigenvalues n can be solved for from the boundary condition given by Eq. (3.129);
In the dimensionless form Eq. (3.129) may be written as;
m
t
Where
ki R i
DT
ki Ri
u
DT
u
, r = Ri
X
(3.147)
Bi m , the Biot number (mass). This represents the ratio of mass transfer
from the surrounding space and the diffusion within the sphere. To simplify matters from a
mathematical standpoint, Eq. (3.146) can be written in terms of elementary trigonometric
functions as;
116
2 Sin( n X )
X
n
g ( X ) c1
(3.148)
The Eigenvalues can be obtained from the solution of the following transcendental
equation;
tan(
nX
nX)
(3.149)
Bim X
The general solution for the dimensionless pO2 can be written as;
2
n
cn e
J1/2
nX
(3.150)
The Eigen values are given by Eq. (3.149). The cn can be solved for from the initial
condition given by Eq. (3.127) using the principle of orthogonality and;
Ri
J1/2 (
cn
Ri
0
nX)
dX
(3.151)
2
J1/2
( nX)
dX
X
Thus the oxygen concentration profile at high oxygen concentration is obtained. At low
concentration of oxygen the rate of consumption of oxygen is first order. The governing
equation, Eq. (3.126) can be written as;
pO2
t
t DT
1
r2
pO2
r2
k p pO2
(3.152)
Obtaining the dimensionless form of Eq. (29);
1
X
X2
u
X
(3.153)
Where,
pO2
pO2 m
;X
r
;
Ri
DT t
Ri2
k p Ri2
t DT
(3.154)
117
It can be recognized that is the Thiele modulus. Eq. (3.153) can be solved for by the
method of separation of variables. Let u =V()g(X).
V'
V
1
gX
g
X
X2
2
n)
(3.155)
The solution in time domain can be seen to be;
ce
2
n
(3.156)
The solution in space domain can be seen to be;

X 2 g "( X ) 2 Xg '( X )
X 2(
2
n ) g( X )
(3.157)
Comparing Eq. (3.157) with the generalized Bessel function [Varma and Morbidelli,
1997];
a=2; c=0; s= 1; d = (2+
2
n );
p = 1/2;
The solution to Eq. (34) can be seen to be;
g( X )
c1
J 1/2 (
2
n
X)
d1
2
n
1/2 (
(3.158)
From the boundary condition given by Eq. (3.128), it can be seen that d1 can be set to 0
and,
g ( X ) c1
J 1/2 (
2
n
X)
(3.159)
The Eigenvalues n can be solved for from the boundary condition given by Eq. (3.129);
In the dimensionless form Eq. (3.147) may be written as;
m
t
Where
ki R i
DT
ki Ri
u
DT
u
, r = Ri
X
(3.160)
Bi m , the Biot number (mass). This represents the ratio of mass transfer
from the surrounding space of the diffusion within the sphere. To simplify matters from a
mathematical standpoint, Eq. (3.158) can be written in terms of elementary trigonometric
functions as;
118
g( X )
c1
2
n
Sin(
2
2
n
X)
(3.161)
The eigenvalues can be obtained from the solution of the following transcendental
equation;
tan(
2
n
2
n
X)
2
m
(3.162)
Bim X
The general solution for the dimensionless pO2 can be written as;
cn e
2
n)
2
n
J1/2
(3.163)
The Eigen values are given by Eq. (39). The cn can be solved for from the initial
condition given by Eq. (3.127) using the principle of orthogonality and;
Ri
cn
J1/2 (
2
n
X)
X
Ri
2
J1/2
(
2
n
dX
(3.164)
X)
dX
Thus the oxygen concentration profile at low oxygen concentration is obtained.
3.7.5. Damped Wave Diffusion and Reaction Hyperbolic Model

The times associated with oxygen consumption are low. Oxidation reactions are fast.
Recent experimental reports of relaxation times in biological materials by Mitra et al. [1995]
is in the order of 16 seconds. Hence in times associated with the oxygen consumption (~10-3
1s) the finite speed of diffusion effects cannot be ignored. The damped wave diffusion and
relaxation effects may be included in the following manner. At low oxygen concentration a
first order rate of reaction can be assumed. A semi-infinite medium of tissue is considered. A
step change in concentration is given at the surface. At times zero the concentration of oxygen
is at an initial value. At infinite distances the concentration of oxygen would be unchanged at
the initial value. The mass balance equation for oxygen can be written as;
119

J O2
CO2
kCO2
(3.165)
where k is the lumped first order reaction rate constant. Combining Eq. (3.165) with the
damped wave diffusion and relaxation equation given below in Eq. (3.166);
J O2
CO2
DT
J O2
mr
(3.166)
the governing equation is obtained.mr is the mass relaxation time. When it is zero Eq. (3.146)
reverts to the Ficks law of diffusion. When the rate of mass flux is greater than an
exponential rise the wave regime would be more dominant mechanism of transport compared
with the Fick regime. Eq. (3.166) is differentiated by x and Eq. (3.165) is differentiated by t
2
and the cross term
J
eliminated between the two equations and the governing equation
t x
obtained as follows;
2
DT
CO2
x
CO2
mr
1 k
CO2
mr
kCO2
(3.167)
The governing equation for oxygen concentration in the tissue is obtained in the
dimensionless form by the following substitutions;
k* k
mr ; u
CO2
CO2 m
;X
mr
x
DT
(3.168)
mr
The governing equation is a partial differential equation of the hyperbolic type. It is

second order with respect to time and second order with respect to space.
2
u
2
1 k*
k *u
(3.169)
The Eq. (3.169) can be solved by a recently developed method given in Sharma [2005]
called relativistic transformation of coordinates. The expression for the transient temperature
during damped wave conduction and relaxation developed by Baumeister and Hamill [1971]
by the method of Laplace transforms was further integrated in Sharma [2009]. A Chebyshev
polynomial approximation was used for the integrand with a modified Bessel composite
function in space and time. A telescoping power series leads to a more useful expression for
the transient temperature. By the method of relativistic transformation, the transient
temperature during damped wave conduction and relaxation was developed. There are four
regimes to the solution. These include:
120

(i) A regime comprising a Bessel composite function in space and time,
(ii) Another regime comprising a modified Bessel composite function in space and time;
(iii) The temperature solution at the wave front was also developed separately, and;
(iv) The fourth regime at a given location X in the medium is at times less than the
inertial thermal lag time. In this regime, the temperature was found to be unchanged
at the initial condition.
The solution for the transient temperature from the method of relativistic transformation
is compared side by side with the solution for the transient temperature from the method of
Chebyshev economization. Both solutions are within 12% of each other. For conditions close
to the wave front, the solution from the Chebyshev economization is expected to be close to
the exact solution and was found to be within 2% of the solution from the method of
relativistic transformation. Far from the wave front, i.e., close to the surface, the numerical
error from the method of Chebyshev economization is expected to be significant and verified
by a specific example. The solution for transient surface heat flux from the parabolic Fourier
heart conduction model and the hyperbolic damped wave conduction and relaxation models
are compared with each other. For > 1/2 the parabolic and hyperbolic solutions are within
10% of each other. The parabolic model has a blow-up as 0, and the hyperbolic model
is devoid of singularities. The transient temperature from the Chebyshev economization is
within an average of 25% of the error function solution for the parabolic Fourier heat
conduction model. A penetration distance beyond which there is no effect of the step change
in the boundary is predicted using the relativistic transformation model.
The method of relativistic transformation of coordinated has been shown [Sharma, 2009]
to bounded solutions close to the integrated expression of exact solution presented by other
investigators. This method of analysis is used in this study, The damping term is first
1 k*
removed by multiplying Eq. (3.169) by en. Choosing n
and let W = uen Eq. (3.169)
2
becomes;
2W 2W W 1 k *
X 2 2
4
(3.170)
The significance of W is it that this can be recognized as the wave concentration. During
the transformation of Eq. (3.169) to Eq. (3.170) the damping term has vanished. Now let us
define a spatio-temporal symmetric substitution (relativistic transformation);
= 2 X2 for > X
(3.171)

2
2
W
2
1 k*
16
(3.172)
121
Comparing Eq. (3.172) with the generalized Bessel equation [Varma and Morbidelli,
1997]
1 k*
16
a = 1; b = 0; c = 0; s = ; d
. The order p = 0.
d
= i(1 k*) and is imaginary. Hence the solution is;
s
1 k * 2 X 2
W c1I 0
2
2
c K 1 k * X
2 0
2
(3.173)
c2 can be seen to be zero from the condition that at = 0 W is finite.
1 k*
c 1 I0
X2
(3.174)
From the boundary condition at X = 0,
1e
(1 k *)
2
c 1 I0
1 k*
2
(3.175)
c1 can be eliminated between Eqs. (51-52) in order to yield;

I0
u
1
2
X2 1 k*
(3.176)
I0
1 k*
This is valid for > X, k* 1. For X > ,

J0
u
1
X2
2
I0
At the wave front, = X,
1 k*
(3.177)
1 k*
122
(1 k *)
2
(1 k *)
2
(3.178)
3.7.6. Results
The mass inertia can be calculated from the first zero of the Bessel function at 2.4048.
Thus,
X 2p
inertia
23.1323
1 k*
(3.179)
A de no vo dimensionless group called Sharma Number (Mass) was introduced [Sharma,

2010]. This can be written as follows;
ki r
a
Sha
(3.180)
It is the ratio of mass transfer rate to the transport taking place by damped wave
diffusion. This can be seen to a product of Maxwell number and Sherwood number.
Di
Max
(3.181)
Maxwell number (mass) as given by Eq. (3.181) can be seen to be the Fick number with
the relaxation time substituted for time, t. This gives the ratio of the square of the speed of
mass (v = Di
) by damped wave diffusion divided by the square of a characteristic
m
speed (a/r). The Sherwood number, Sh can be written as;
ki a
Di
Sh
(3.182)
The product of Maxwell number (mass) and Sherwood number can be seen to yield the
Sharma number (mass) as follows;
Sha
ki r
a
Di
a
r
2
ki a
Di
Max * Sh
(3.183)
123
Sharma number (mass) may be used in evaluating the importance of the damped wave
diffusion process in relation to other processes such as convection, Fick steady diffusion in
the given application.
The concentration at an interior point in the semi-infinite medium is shown in Figure 3.0
Four regimes can be identified. These are;
i)
Zero Transfer Inertial Regime, 0 0
inertia
ii) Times greater than inertial regime and less than at the wave front, Xp>
iii) Wave front, = Xp
iv) Open Interval, of times Greater than at the wave front, > Xp
During the first regime of mass inertia there is no transfer of mass up to a certain
threshold time at the interior point Xp = 10. The second regime is given by Eq. (3.177)
represented by a Bessel composite function of the first kind and zeroth order. The rise in
dimensionless concentration proceeds from the dimensionless time 2.733 up to the wave front
at Xp = 10.0. The third regime is at the wave front. The dimensionless concentration is
described by Eq. (3.178). The fourth regime is described by Eq. (3.176) and represents the
decay in time of the dimensionless concentration. It is given by the modified Bessel
composite function of the first kind and zeroth order. In Figure 4.0 is shown the three regimes
of the concentration when k* = 2.0. It can be seen from Figure 4.0 that the mass inertia time
has increased to 8.767. The rise is nearly a jump in concentration at the interior point Xp =
10.0. When k* = 0.25 as shown in Figure 5.0 the inertia time is 7.673. In Figure 6.0, the three
regimes for the case when k* = 0.0 is plotted. In Table 1.0 the mass inertia time for various
values of k* for the interior point Xp = 10.0 is shown. k* needs to be sufficiently far from 1 to
keep the inertia time positive.
Table 3.5. Mass Inertia Time vs k* for Interior Point Xp = 10.0
S.No.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
k* (kmr)
0.01
0.1
0.25
0.3
0.4
0.5
1.75
2.0
4.0
8.0
25.0
10.0
Mass Inertia Time (t/mr)

8.741
8.452
7.673
7.266
5.979
2.733
7.673
8.767
9.871
9.976
9.998
10.0
124
Dimensionless Concentration
(C/Cs)
Xp = 10
"k* = 0.5
0.4
0.3
0.2
0.1
0
0
10
15
20
Dimensionless Time
Figure 18.0. Dimensionless Concentration at an Interior Point Xp = 10 in a Semi-infinite Medium

during Simultaneous Reaction and Diffusion. k* = 0.5.
Figure 19.0.
Figure 20.0. Dimensionless Concentration at an Interior Point Xp = 10 in a Semi-infinite Medium

during Simultaneous Reaction and Diffusion. k* = 0.25.
125
Figure 21.0. Dimensionless Concentration in a Semi-infinite Medium during Simultaneous Reaction

and Diffusion. k* = 0.0.
The steady state solution for Eq. (46) can be written as;
uss = exp(-(k*)1/2 X)
(3.183a)
3.7.7. Conclusion
1) Diffusion and Reaction in Islets of Langerhans was studied using Parabolic and
Hyperbolic Models. This is needed to better treat Type I diabetes by the
transplantation method.
2) Sharma Number can be used to evaluate when the wave term becomes important in
the application. It represents the ratio of Mass Transfer in Bulk to Relaxation
Transfer.
3) Sharma number (mass) may be used in evaluating the importance of the damped
wave diffusion process in relation to other processes such as convection, Fick steady
diffusion in the given application.
4) Four regimes can be identified in the solution of hyperbolic damped wave diffusion
model. These are; i) Zero Transfer Inertial Regime, 0 0
inertia ; (ii) Rising
Regime during times greater than inertial regime and less than at the wave front, Xp >
; (iii) at Wave front, = Xp; (iv) Falling Regime in Open Interval, of times greater
than at the wave front, > Xp.
5) Method of superposition of steady state concentration and transient concentration
used in both solutions of parabolic and hyperbolic models.
6) Expression for steady state concentration developed.
7) Closed form analytic model solutions developed in asymptotic limits of Michaelis
and Menten kinetic at zeroth order and first order.
126

8)
9)
10)
11)
Expression for Penetration Length Derived Hypoxia Explained

Expression for Inertial Lag Time Derived
Solution within bounds of Second Law of Thermodynamics
No Overshoot Phenomena Observed.
D. MATHEMATICAL MODELS FROM SHELL BALANCE AND

EQUATIONS OF MOMENTUM, ENERGY AND CONTINUITY
3.8. HIGH VOLUME CENTRIFUGAL SEPARATION OF OIL/WATER
3.8.1. Background
Oil spills such as the recent one in the Gulf of Mexico called the Deepwater Horizon
[Telegraph, 2010] needs to be cleaned-up. During development of technology and
advancement of human mankind, it is not sufficient to discover a new gadget. The
technological device has to be used in a safe manner and benignant to the environment. The
psyche of the general public would be boosted when appropriate methods for handling these
spills are in place. Five oil spills are listed in Table 3.6. The Deepwater Horizon in 2010, and
the Exxon Valdez in 1989 were at a monetary loss of close to $ 0.5 billion in lost revenue
from the crude oil. The largest one is the one in California in 1911. The other two spill are at
the Persian Gulf and Mexico. When more than one country is involved oil spills may cause
friction among otherwise friendly neighbors. One method for cleaning the oil from the sea
water is the use of a centrifuge.
A typical CINC centrifugal liquid-liquid separator can be obtained from the CINC
Processing Equipment, Inc. The CINC Liquid-Liquid Centrifugal Separator utilizes the force
generated by rotating an object about a central axis. By spinning two fluids of different
densities within a rotating container or rotor the heavier fluid is forced to the wall at the inside
of the rotor while the lighter fluid is forced toward the center of the rotor. A cut-away view of
such a centrifugal separator may be viewed at the internet webpage http:///www.
cincmfg.com/How_our_Centrifuges_Work_s/108.htm.
Table 3.6. Some Illustrative Oil Spills
#
1.0
2.0
3.0
4.0
5.0
Oil Spill
Deepwater Horizon, Gulf of Mexico
Lakeview Gusher, Kern County, CA
Gulf War Oil Spill (Iraq, Persian Gulf
and Kuwait)
Ixtoc I, Gulf of Mexico, Mexico
Exxon Valdez, Alaska
Date
04-10-10 to 07-15-10
05-14-10 to 09-1911
01-19-1991 01-281991
06-1979 03-1980
March 24th 1989
Amount
175 million gallons
378 million gallons
275 million gallons
150 million gallons
30 million gallons
127
The theory for separation used currently is the Stokes settling of oil droplets. For high
volume separation such as the oil that can be recovered from the oil spills a centrifuge such as
the one described in this study may be used. Here layers form with one layer that is oil rich
and another layer that is water rich. The peripheral layer is water rich and may be collected
from a port at the outer centrifugal bowl (Figure 22.0) and the oil rich layer may be collected
from the inner rotor wall that is rotating. There is not much discussion in the literature for the
theory of centrifugal separation of layered flow. In this study the velocity profiles of the oil
rich layer and water rich layer are derived from the equations of continuity and motion. The
thickness of the interface of the oil and water is calculated from a component mass balance of
the oil in the inlet and outlet streams of the continuous centrifuge. Numerical simulations are
run on a desktop computer for a given angular speed of rotor, (RPM) and density ratio of
the fluids and viscosities of the fluids. A set of four simultaneous equations and simultaneous
unknowns are solved for using the MINVERSE command in Microsoft Excel for Windows
2007. These constants are used to obtain the power draw at the rotor from the torque required.
A log-log plot is developed form the simulations for the power draw at the rotor that may be
used in the design of such systems.
3.8.2. Theory
Consider a centrifuge with an outer bowl radius of R (m) and an inner rotor radius of R
(m). The inner rotor is allowed to rotate at an angular velocity of RPM. The feed has high
concentration of oil about 33% mass fraction oil (xF). It is desired to achieve a separation
efficiency of 97.9%. The outlet oil stream is from the inner rotor and the outlet water stream
is from the periphery of the bowl. The density ratio of the oil and water is . Viscous flows
are considered at steady state.
Consider a thin shell of fluid with thickness r and at a distance r from the center of the
centrifuge as shown in Figure 1.0. It is assumed that the momentum transfer is predominantly
in the radial direction. The tangential velocity assumes a profile that varies with the distance r
from the center of the centrifuge. It is assumed that for high volume oil and water feeds such
as the one that can be expected from the clean-up of the recent Oil Spill of BP Americas
[Telegraph, 2010] two layers are formed, i.e., one rich in oil and the second layer rich in
water. As the tangential force from the rotor is increased the species with the higher specific
gravity will gain more momentum and move to the periphery of the centrifuge.
The species with the lower specific gravity will remain in the inner layer close to the
rotor. The density of the crude oil was assumed to be heavy and was taken as 900 kg. m3
and the density of the water was taken as 1000 kg.m3. For such a pair, the peripheral layer
would be water rich and the inner layer would be oil rich. Earlier discussions in the literature
have been largely on droplet formation of oil and layer formation or slick formation is not
discussed much. Let the radius of the outer centrifugal bowl that is held stationary be R (m)
and that of the inner rotor be R (m). The inner rotor is allowed to rotate at an angular
velocity of RPM (revolutions per minute). The water is collected by a port at the periphery
of the bowl and the oil is collected through the port in the inner rotor. The feed is introduced
from the top of the centrifuge.
128
Figure 22.0. Cross-Sectional View of Centrifugal Separator of Oil and Water.
The feed location has not been optimized in the study. The equation of continuity and
motion for v and the equation of motion for shear stress, r can be written from the
Appendix in Bird, Stewart and Lightfoot [2007] as follows;
1
r2 r
r2
(3.184)
Integrating Eq. (2.64);

c1
r
(3.185)
r2
The Newtons law of viscosity for the shear rate is given by;
v
r r
(3.186)
For the oil rich inner layer (Figure 22.0) combining Eq. (3.186) and Eq. (3.184);
oil
v
r r
c1
r3
(3.187)
129

Integrating Eq. (3.187) twice;
v
r
c1
2
oil r
c2
(3.188)
Eq. (3.188) is valid for, R r R.

For the water rich peripheral layer (Figure 22.0), in a similar manner the tangential
velocity of the fluid can be written as follows;
v
r
c3
2
water r
c4
(3.189)
Eq. (3.189) is valid for, R r R.

The boundary conditions can be seen to be;
at the outer stationary wall,
r = R, v = 0
(3.190)
Substituting Eq. (3.190) in Eq. (3.189);
c1
at the inner rotor wall,
c2
(3.191)
r = R, v = R
(3.192)
oil R
c1
R
2
oil
R2
c2
(3.193)
at the interface of oil rich and water rich layer,

Interface is assumed to be without any accumulation of forces;
(oil )
c1
2
( water )
(3.194)
c2
2
The velocity across the interface of oil rich and water rich layer is assumed to be
continuous;
c1
R
oil
c2
c3
2
2
water
R2
c4
(3.195)
130
In this study, Eqs. (3.193-3.195) were used to solve for the integration constants, c1, c2, c3
and c4 using the MINVERSE function in Microsoft Excel for Windows 2007. The set of
equations Eq. (3.193-3.195) that are needed to obtain the integration constants are given in
the matrix form as follows;
0
1
2
2
oil
R2
1
2
oil
c1
0
R2
water R
1
2
2
water
c2
c3
c4
(3.196)
R2
Eq. (3.196) is a set of four simultaneous equations and four unknowns. The vector of
constants can be obtained as follows;
0
c1
c2
c3
1
2
2
oil
R2
c4
2
2
oil
R2
water R
1
2
1
0
2
water
R2
(3.197)
The layer thickness ratio, can be estimated as follows. A component balance on the oil
in the feed stream, peripheral water stream and inner rotor oil stream would yield;
xFv = (v - vrot)xper + vrotxrot
or,
vrot
v
xF
x per
xrot
x per
(3.198)
(3.199)
Let the residence time of the fluid in the continuous centrifuge be (hr). Then;
and,
vrot = R2(2-2)H
(3.200)
v = R2(1 -2)H
(3.201)
Dividing Eq. (3.200) by Eq. (3.201) and Equating with Eq. (3.199);
xF
x per
xrot
x per
131
(3.202)
3.8.3. Results
Simulations were run on the desktop computer using Microsoft Excel for Windows,
2007. An example calculation is shown below;
The calculations were performed for a rotor speed of 1000 RPM. The separation
efficiency is about 97.9%. The values in bold face are obtained by using the MINVERSE
command in Microsoft Excel for Windows 2007. The results are the inverse of the matrix as
described in Eq. (3.197). Simulations were repeated for 29 different values of angular speeds
of rotor. Each of the torque values were recorded in another column in the spreadsheet. The
torque is calculated from the shear stress the rotor wall multiplied with the surface area of the
rotor and the moment arm distance, R, and multiplied with the angular speed in RPM. The
results of these simulations are shown in Figure 23.0 on a log-log plot. The relationship is
found to be linear in the log-log plot. For the example run as shown in Table 3.3 the
separation efficiency is about 37%. In order to achieve more separation more stages need be
considered.
The set of simulations were repeated for a higher viscosity of oil, oil (5000 Pa.s). The
power draw at the rotor is also shown in Figure 23.0 in the log log plot. The increase in power
draw corresponding to an increase in viscosity of oil was not high.
Figure 23.0. Power Draw as a Function of Rotor Speed for = 0.74.
132
Table 3.7. Calculations for a Given Set of Oil and Water Viscosities and = 10 RPM
Oil Water Separation by Centrifugation
w
oil
R
oil
water
res
v
c1
c2
c3
c4
T
199
Feed
Outlet
(Oil)
0.99
0.01
Outlet (Water)
0.001
Pa.S
xoil
xw
0.33
0.67
1000
Pa.S
vrotor
13.3877551
0.74
vper
27.6122449
0.4524
Separation
0.979591837
0.326531
Ratio
Gallons
Ft
V
H
0.522028
0.9
0.00002
0.83386
3.6523E-05
1
2.87636E-05
-0.034766137
1.26976E-06
-0.034766137
1.000000695
0
1
0.034766137
0.99999873
0.034766137
-6.9532E-07
-1
-28.7636
1
-3.7E-05
-2.7E-07
5.4E-12
0
-1
-0.034766137
1.26976E-06
-0.034766137
6.95323E-07
0.83386
5
900
Efficiency
10000
kg.m3
3
1000
kg.m
hr
41
m3.h-1
34.76614
999.9987
34.76614
-0.0007
RPM
1000
0.01
0.99
0.83386
0
1000
0
0
Torque
42.32546536
3.8.4. Discussions
It has been reported in the literature that when the angular speed reaches a critical value,
crit secondary flow will develop. The secondary flow is periodic in axial direction and gets
superimposed on the tangential flow. Toroidal vortices named Taylor vortices will form.
When the angular velocity is increased further travelling waves form and then the turbulent
regime is reached. The Rayleigh regime [Taylor, 1923], doubly periodic flow regimes, etc.
have been developed for a single fluid. The system under consideration has two components,
i.e., oil and water. The Taylor vortex flow, Rayleigh flow regimes can be avoided during the
operation of the centrifuge. By running the centrifuge shallow or deep the velocity can be
kept close to the laminar regime. The requirements for layer formation are not clear. The
transition from a drop regime to a layer regime can be expected to depend on the surface
tension of the oil and water. The Marangoni instability [Coles, 1965] may also be an issue.
The centrifuge may be the solution to high volume oil and water mixtures that needs to be
separated.
A computer solution procedure was developed to evaluate centrifugal separation of oil
and water. At high volumes, oil rich and water rich layers may be expected to form.
Expressions for the interlayer thickness ratio, was developed from component material
133
balance on the inlet and outlet streams of the continuous centrifuge. The equations of motion
and continuity for the tangential velocity, v were derived for the oil rich and water rich
layers. The water is recovered from the outlet at the periphery of the centrifugal bowl that is
held stationary and the oil is recovered from the inner rotor that is rotating. The four
integration constants in the velocity profile is solved for by use of the MINVERSE operation
in Microsoft Excel for Windows 2007. For each RPM and set of parameters the power drawn
at the rotor is calculated. The power draw would to be linear with the angular speed of the
rotor on a log-log plot. When the density ratios of the two fluid streams, approach 1 this
method may not be efficient. In a similar manner when the feed contains only small quantity
of oil other methods such as molecular sieve adsorption may be considered. Centrifugal
separation of high volume oil and water may be designed using the methods shown in this
study.
3.9. WARM/COOL FEELING AND THERMAL WEAR

The effect of damped wave conduction and relaxation on warm/cool feeling of the human
skin was studied by Sharma [2010]. In this study a two layer mathematical model was
developed to study the transient heat conduction of the human skin and thermal fabric layer
during use to protect the human body from cold winter outdoors.
A schematic of the relevant aspects from a cross-section of human skin near a finger pad
is shown in Figure 24.0. Many kinds of receptors in human skin are known to transmit
information about the surroundings to the central nervous system. The role of these receptors
in generating sensations caused by stimulus from the surroundings is analyzed. The response
in the receptors is physico-chemical in nature. The correlation between mechanical stimulus
and sensation of touch from a neurophysiological standpoint was studied experimentally by
earlier investigators. They discuss the relation between the surface roughness of fabric and
human sensory feel. Krauses end bulb is the receptor attributed with the cool feeling and
Ruffinis ending is the receptor that is responsible for warm feeling. The transient heat
conduction in the neighborhood of these receptors as the outside temperature plummets to
low levels as typical of winter in the northern part of USA needs to be modeled. The skin
layer and the thermal layer assembly are approximated as shown in Figure 24-0. The blood
flow in the vessels results in a constant temperature environment at x = b at T = Tbl, where Tbl
is the blood temperature. The origin is taken at the interface between the winter surroundings
and outer surface of the thermal wear used to protect the skin from the winter cold weather.
The thickness of the thermal fabric is a and the interface of the thermal wear and human
skin occurs at x = a. Let the ambient temperature be Tamb. In winter this can be expected to be
much lower than the blood temperature, i.e., Tamb << Tbl. The temperature difference between
the blood vessels and the cold surroundings drives the problem. Let the dimensionless
temperature time and penetration distance be defined with respect to the human skin
parameters as follows;
t
T T amb
;
; X
rs
Tbl T amb
x
s rs
(3.203)
134
Figure 24.0. Transient Heat Conduction in Human Skin and Thermal Wear in Winter.
3.9.1. Steady State

At steady state the governing equation for temperature in the skin layer can be written as
follows. A heat source in the skin layer generates heat to provide the warm feeling that comes
in winter. Let this heat source be dependent on temperature difference with the ambient
temperature. The energy balance on a thin slice with thickness x and cross-sectional area A
can be written as;
qx
x
U '"(T
T amb )
(3.204)
Where U is the temperature difference dependent heat source. Writing the Fouriers
law of heat conduction for the heat flux, qx, in the dimensionless form Eq. (9.232) may be
written as;
2
X2
U *u
(3.205)
U "'
s C ps
;S
S
rs
The solution for Eq. (9.233) can be written as;
Where U *
u = A Sin(U* X) + B Cos(U* X)
(3.206)
The boundary conditions at the interface of the skin tissue layer and the blood vessels can
be written as;
At, X = Xb =
, u = 1 since the T = Tbl
135
(3.207)
s rs
Further it can be assumed that there is no heat transfer from the skin layer to the blood
vessels or vice versa. Thus,
At, X = Xb =
s rs
u
X
(3.208)
Applying these boundary conditions given above the integration constants A and B can
be solved for and found to be Sin(U*Xb ) and Cos(U*Xa) and Eq. (3.234) can be seen to
be;
u = Cos
U *( X b
X)
(3.209)
In a similar fashion the governing equation for the temperature in the thermal wear layer,
i.e., for 0 x a, or in terms of dimensionless distance, 0 X Xa can be written in the
dimensionless form at steady state as follows;
2
(3.210)
X2
The solution to Eq. (8) can be seen to be;

u = CX + D
(3.211)
The boundary conditions for the temperature in the thermal wear layer can be written as;
X = 0, u = 0
(3.212)
X = Xa, u (thermal wear) = u(skin) = Cos(Xb-Xa)
(3.213)
Thus C and D in Eq. (9) can be solved for using the boundary conditions given by Eq.
(3.240) and Eq. (9.241). Thus,
xCos
u=
U *( X b
a
Xa )
(3.214)
136
3.9.2. Transient State in Human Skin Layer

The energy balance equation in the skin layer during transient state can be written as;
q
T
U "'(T Tbl ) ( s C ps )
(3.215)
x
t
Combining Eq. (13) with the damped wave conduction and relaxation equation given by;
ks
T
x
q
t
rs
(3.216)
and making the terms dimensionless the following governing equation can be written for the
skin layer undergoing transient heat conduction.
2
(1 U *)
X2
uU *
(3.217)
where u, , U* and X are defined by Eq. (3.231). It can be seen that the boundary conditions
are not homogeneous. Hence the solution is assumed to take the form;
u = ut + us
(3.218)
where ut is the transient temperature and us = steady state temperature. The solution for us was
solved for in the case 1 above and given by Eq. (3.242). The rest of the problem is obtaining
the solution of the transient temperature subject to the following time and space conditions.
2 t
ut
2 t
(1 U *)
u tU *
(3.219)
The initial and final time and space conditions can be written as;
at = 0, ut = 1
(3.220)
at = , ut = 0
(3.221)
at X = Xb, ut = 0
(3.222)
at X = Xa = ut = u - us
(3.223)
Assuming that equilibrium is established rapidly at the interface, u us in the RHS of Eq.
(21) can be taken as zero. Hence the boundary condition at X = Xa, ut = 0. The transient
temperature, ut, can be expected to have an exponential decaying component or the damping
component in the Eq. (3.247) can be removed by the following substitution, ut = wexp(-n).
137
For n = (1-U*)/2, Eq. (3.247) is transformed into a governing equation of the wave
temperature, w,
2
w(1 U *)2
4
w
2
(3.224)
X2
Eq. (3.252) can be solved for by the method of separation of variables. Let w = V()(X).
Then the terms in Eq. (3.252) can be separated into two equations, one in space and another in
time domain.
"
2
n
V"
V
(1 U *)2
4
(3.225)
The general solution in the space domain to the second order ODE with constant
coefficient can be seen to be;
= c1Sin(nX) + c2Cos(nX)
(3.226)
The boundary conditions given by Eq. (3.250) and Eq. (3.251) are applied to Eq. (3.254).
Thus
c2 = -c1Tan(nXb)
n =
2n
(Xb
Xa )
(3.227)
, n=1,2,3,
(3.228)
The time domain portion of the solution to the second order ODE with constant
coefficients can be written as;
c3 exp(
c 4 exp(
(1 U *)2
4
(1 U *)2
4
2
n)
(3.229)
2
n)
From the final condition given by Eq. (3.249) at = , w = utexp(+n) = 0*=0. Hence,
c3 can be seen to be zero. The general solution for the transient temperature can be written;
cn e
(1 U *)
2 e
n 1
Cos(
n X ))
(1 U *)2
4
2
n
(Tan(
n X b )( Sin( n X )
(3.230)
138
n is given by Eq. (3.256). cn can be solved for from the initial condition given by Eq.
(3.248) and using the principle of orthogonality. cn is found to be;
cn
2(1 ( 1)n )( X b
n
2 2
Tan(
Xa )
n Xb )
(3.231)
3.9.3. Transient State in Thermal Fabric Layer

In a similar fashion the transient temperature in the thermal wear layer can be calculated
as follows. The governing equation for transient temperature in the thermal fabric layer can
be written as;
2
Where =
f
s
;=
fr
u
2
(3.232)
and u, and X are the same as defined in Eq. (3.231).
sr
It can be seen that the boundary conditions are not homogeneous. Hence the solution is
assumed to take the form;
u = ut + us
(3.233)
where ut is the transient temperature and us = steady state temperature. The solution for us was
solved for in the section on steady state above and given by Eq. (3.242). The rest of the
problem is obtaining the solution of the transient temperature subject to the following time
and space conditions.
2 t
ut
2 t
X2
(3.234)
The initial and final time and space conditions can be written as;
at = 0, ut = 1
(3.235)
at = , ut = 0
(3.236)
at X = 0, ut = 0
(3.237)
at X = Xa = ut = u - us
(3.238)
Assuming that equilibrium is established rapidly at the interface, u us in the RHS of Eq.
(3.238) can be taken as zero. Hence the boundary condition at X = Xa, ut = 0. The transient
139
temperature, ut, can be expected to have an exponential decaying component or the damping
component in the Eq. (3.262) can be removed by the following substitution, ut = wexp(-n). For
1
, Eq. (3.262) is transformed into a governing equation of the wave temperature, w,
n
2
2
w
4
(3.239)
X2
Eq. (3.267) can be solved for by the method of separation of variables. Let w = ()g (X).
Then the terms in Eq. (3.267) can be separated into two equations, one in space and another in
time domain.
g"
g
"
2
m
1
4
(3.240)
The general solution in the space domain to the second order ODE with constant
coefficient can be seen to be;
g = c1Sin(mX) + c2Cos(mX)
(3.241)
The boundary conditions given by Eq. (3.265) and Eq. (3.266) are applied to Eq. (3.269).
Thus
c2 = 0
m =
(3.242)
m
, m=1,2,3,
Xa
(3.243)
The time domain portion of the solution to the second order ODE with constant
coefficients can be written as;
c5 exp(
2
m
1
4
) c 6 exp(
2
m
1
4
(3.244)
From the final condition given by Eq. (3.264) at = , w = utexp(+n) = 0*=0. Hence,
c5 can be seen to be zero. The general solution for the transient temperature can be written;
2
m
dn e 2 e
Sin(
mX)
(3.245)
n 1
m is given by Eq. (3.271). dn can be solved for from the initial condition given by Eq.
(3.263) and using the principle of orthogonality. dn is found to be;
140
dn
2(1 ( 1)n )
m2
, n = 1,2,3,.
(3.246)
The solution to the transient heat conduction in the human skin layer and the thermal
fabric layer including the damped wave conduction and relaxation effects were derived using
the method of separation of variables. The use of the final condition in time leads to well
bounded, physically realistic solutions within the bounds of Clausiuss inequality. The
transient temperature in the two layers at steady state is shown in Figure 25.0 The nature of
the temperature profile is cosinous in the human skin layer and linear in the thermal fabric
layer. The parameters the profile is derived for are, Xa = 3, Xb = 5 and U* = 2.0. The heat flux
at steady state for the human skin layer and the thermal fabric layer is shown in Figure 3-0 for
the parameters, Xa = 3, Xb = 5, kf/ks = 5.0. and U* = 2.0. It can be seen from Figure 3.20 the
interface heat flux undergoes a maxima. For the heat flux in dimensionless form with respect
to the skin thermo physical properties to be continuous the ratio of the thermal conductivities
of the thermal fabric layer and skin layer have to be a certain value and cannot be specified
independently. This can be deduced from model solutions. The maximum heat flux at the
interface of the two layers may be related to the heat flux reported by Yoneda and Kawabata
(14). It can be seen from the model solutions that the transient temperature will undergo
subcritical damped oscillations under certain conditions. These conditions are for large
relaxation times of the skin and for large relaxation times for the thermal fabric layer. Thus
for,
Thus for large relaxation time values of the skin, i.e., rs >
(1 U *)2 (b a)2
, it can be
16 2 s
seen that the temperature in the skin layer can be expected to exhibit oscillations. The nature
of the oscillations will depend on the strength of the heat source which is a function of the
temperature difference with the ambient cold winter temperature. For heat source, U* > 1
oscillations that grows with time may be expected. For heat source, U* < 1 subcritical
damped oscillations can be expected. The solution for these materials is then given by;
cn e
(1 U *)
2 Cos (
2
n
n 1
(Tan(
n X b )( Sin( n X )
Cos(
(1 U *)2
)
4
(3.247)
n X ))
Figure 25.0. Steady State Temperature in Human Skin Layer and Thermal Fabric Layer for Xa = 3.0
and Xb = 4.0 and U* = 2.0.
141
Figure 26.0. Steady State Temperature in Human Skin Layer and Thermal Fabric Layer for Xa = 3.0, Xb
= 4, kf/ks = 5 and U* = 2.0.
Figure 27.0. Transient Temperature at X = 3.1, in Human Skin Layer for Large Relaxation Time
Values, U* = 2.0.
Where, n and cn are given by Eq. (26) and Eq. (29) respectively.
Eight terms in the infinite series in Eq. (3.275) were taken in a Microsoft Excel
Spreadsheet and the dimensionless temperature is plotted as a function of dimensionless time
in Figure 28.0. It can be seen that for human skin materials with large relaxation times as
discussed above the dimensionless temperature exhibits growing oscillations at a heat source
of U* = 2.0. The general solution is given by Eq. (3.275). In a similar fashion, under certain
conditions the temperature in the thermal fabric layer can be expected to undergo subcritical
damped oscillations. Thus for,
rf >
a2
4
(3.248)
2
s
the transient temperature in the thermal fabric layer can expect to undergo subcritical damped
oscillations. Under these conditions the transient temperature in the thermal fabric layer is
given by;
142
d n e 2 Cos(
u
n 1
2
n
1
4
)Sin(
mX )
(3.249)
where, dn and m is given by Eq. (3.274) and Eq. (3.271) respectively.

Six terms in the infinite series given by Eq. (3.277) were taken and the dimensionless
temperature was plotted against dimensionless time in the thermal layer for fabric materials
with large relaxation times and shown in Figure 28.0. The chosen for the study was 0.15 and
the temperature at X = 1.1 was obtained for a Xa = 3.0. It can be seen that the temperature
undergoes subcritical damped oscillations.
Table 3.8. Characterization of Stability Types
Eigen values
2 < 1 < 0
Characterization of Stability
Asymptotically Stable
2 > 1 > 0
Unstable
2 =1 =
1 0
Asymptotically Stable if < 0, Unstable if > 0

Unstable
= a ib
Stable if a < 0
Unstable if a > 0
Marginally
Stable
= ib
Stability Type
Improper
Node
Improper
Node
Proper or Improper Node
Saddle
Point
Focus or
Spiral
Center
Figure 28.0. Transient Temperature in the Thermal Fabric Layer for Large Relaxation Times at X = 1.1.
Figure 29.0. Scheme of 7 Simultaneous Reactions.
143
E. STATE SPACE MODELS

State space models can be used to describe a set of variables in vector form in terms of
matrix equations. A state space variables used in order to describe more than one variable at a
given instant in time. Vector form for several variables are used. A set of n differential
equations is represented by one equation in matrices and vectors. The coefficient matrix and
input and output vectors are used. Output vector can be solved for by matrix manipulations.
This would form the output response of the system. The stability of the system can be studied
by looking at the Eigenvalues of the coefficient of the matrix. The different instabilities that
may arise and the conditions under which they would arise is given in Table 3.3.
3.10. KINETICS OF SIMULTANEOUS REACTIONS IN

STATE SPACE FORM
As an example a state space model is developed to describe the kinetics of the following
set of reactions in series and in parallel as suggested in Levenspiel [1999]:
The kinetics of the 7 simultaneous reactions shown in Figure 7.0 are given below as
follows;
dC A
dt
k1C A
k2 C A
(3.250)
dCR
dt
k1C A
k3CR
k 4 CR
(3.251)
dCS
dt
k3CR
k5CS
k6CS
(3.252)
dCT
k5CS
dt
(3.253)
dCU
k 2C A
dt
(3.254)
dCV
k 4CR
dt
(3.255)
dCW
k6CS
dt
(3.256)
Eqs. (3.250 3.256) can be represented in the state space form in one line as follows;
144
0
0
C A k1 k2

k1
k3 k4
0
CR
CS
0
k3
k5 k6

d
0
0
k5
CT
dt
C
k2
0
0
U
0
k4
0
CV
C
0
0
k6
W
0 0 0 0 CA
0 0 0 0 CR
0 0 0 0 CS
0 0 0 0 CT (3.257)
0 0 0 0 CU
0 0 0 0 CV
0 0 0 0 CW
Or,
dC
KxC
dt
(3.258)
The stability of the system of reactions can be studied by obtaining the Eigenvalues of the
K matrix. The eigenvalues of the K matrix are obtained from the roots of the characteristic
polynomial
Det(I-K) = 0
(3.259)
The K matrix is sparse. Eq. (2.92) can be seen to be;
k1 k2 k3 k4 k5 k6 4 0
(3.260)
The 7 eigenvalues are 0 repeated 4 time and (k1+k2), -(k3+k4) and (k5+ k6). This system
can be viewed as an integrating system since all but Eigenvalues are negative with 4
Eigenvalues 0.
3.11. COMPOSITION OF COPLYMER WITH N MONOMERS

FROM STATE SPACE REPRESENTATION
There is significant interest in obtaining copolymer product via free radical
polymerization reactions from more than one starting monomers. SAN, styrene/acrylonitrile
copolymer is an example of product manufactured profitably with two starting comonomers,
styrene and acrylonitrile. Terpolymers are those with 3 starting monomers. Tetrapolymers are
product made from four starting monomers getting into the polymer. Consider n monomer
repeat units entering a polymer backbone chain in a CSTR [Sharma, 2012]. There are n2
propagation reactions that can be involved in the multi-component copolymerization. Thus
for tetra polymerization there would be 16 propagation reactions involved. These reactions
are listed
145
k11
M 1* M 1 M 1M 1*
k12
M 1* M 2 M 1M 2*
k13
M 1* M 3 M 1M 3*
k14
M 1* M 4 M 1M 4*
..............................
k1 n
M 1* M n M 1M n*
k21
M 2* M 1 M 2 M 1*
k22
M 2* M 2 M 2 M 2*
k23
M 2* M 3 M 2 M 3*
k24
M 2* M 4 M 2 M 4*
..............................
k2 n
M 2* M n M 2 M n*
k31
M 3* M 1 M 3 M 1*
k32
M 3* M 2 M 3 M 2*
(3.261)
k33
M 3* M 3 M 3 M 3*
k34
M 3* M 4 M 3 M 4*
..............................
k3 n
M 3* M n M 3 M n*
The rate of irreversible reactions can be written as;
d M1
k11 M 1 M 1* k21 M 1 M 2* k31[ M 1 ][ M 3* ] .... k n1[ M 1 ][ M n* ]
dt
d M2
k22 M 2 M 2* k12 M 2 M 1* k32 [ M 2 ][ M 3* ] .... kn 2 [ M 2 ][ M n* ]
dt
(131)
.......................................................................................................................
d[M n ]
knn [ M n ][ M n* ] k1n [ M n ][ M 1* ] k2 n [ M n ][ M 2* ] ....... kn 1n [ M n* ][ M n*1 ]
dt
The free radical species formed may be assumed to be highly reactive and can assumed to
be consumed as rapidly as formed. This is referred to as the quasi-steady state assumption,
QSSA. Thus;
146
d M 1*
dt
d M 2*
dt
k11 M 1 M 1* k12 M 1* M 2 k13 [M 1* ][ M 3 ] ... .k1n [ M 1* ][ M n ]

k22 M 2 M 2* k21 M 2* M 1 k23[ M 2* ][ M 3 ] ... k2 n [ M 2* ][ M n ]
(3.262)
...................................................................................................................
d [ M n* ]
knn [ M n ][ M n* ] knn 1[ M n* ][ M n 1 ] .......................... kn1[ M n ][ M 1* ]
dt
d M 1 M 1*
dt
d M 1 M 2*
k11 M 1 M 1*
k12 M 2 M 1*
dt
d [ M 1 M 3* ]
k13 [ M 3 ][ M 1* ]
dt
........................................
d [ M 1 M n* ]
k1n [ M n ][ M 1* ]
dt
d M 2 M 1*
k21 M 1 M 2*
dt
d M 2 M 2*
k22 M 2 M 2*
dt
d [ M 2 M 3* ]
k23 [ M 3 ][ M 2* ]
dt
..........................................
d [ M 2 M n* ]
k2 n [ M n ][ M 2* ]
dt
d [ M 3 M 1* ]
k31 [ M 1 ][ M 3* ]
dt
d [ M 3 M 2* ]
k32 [ M 2 ][ M 3* ]
dt
(3.263)
147
d [ M 3 M 3* ]
k33 [ M 3 ][ M 3* ]
dt
..........................................
d [ M 3 M n* ]
k3n [ M n ][ M 3* ]
dt
.........................................
d [ M n M 1* ]
kn1 [ M 1 ][ M n* ]
dt
d [ M n M 2* ]
kn 2 [ M 2 ][ M n* ]
dt
d [ M n M 3* ]
kn 3 [ M 3 ][ M n* ]
dt
.........................................
d [ M n M n* ]
knn [ M n ][ M n* ]
dt
d [ M n M 1* ]
d [ M 1* ] d M 1M 1 d M 2 M 1 d [ M 3 M 1* ]
....
0
dt
dt
dt
dt
dt
*
*
d [ M n M 2* ]
d [ M 2* ] d M 1 M 2 d M 2 M 2 d [ M 3 M 2* ]
.....
0
dt
dt
dt
dt
dt
*
*
*
*
*
By QSSA d [ M 3 ] d [ M 1M 3 ] d [ M 2 M 3 ] d [ M 3 M 3 ] ........ d [ M n M 3 ] 0
dt
dt
dt
dt
dt
........................................................................................................
*
(3.264)
d [ M n* ] d [ M 1M n* ] d [ M 2 M n* ] d [ M 3 M n* ]
d [ M n M n* ]
.......
0
dt
dt
dt
dt
dt
Let the n monomer concentrations be represented by the vector M and n free radical
concentrations by represented by vector M* as;
M 1*
M1
M *
M
2
2
M M 3 M* M 3*
.....
.....

M *
Mn
n
(3.265)
148
The multicomponent copolymerization rate constants can be represented by a rate matrix

as follows;
k11
k
12
K k13
.....
k1n
k31 ... kn1

k32 ... kn 2
k33 .. kn3
.. ... ..
k3n ... knn
k21
k22
k23
...
k2 n
k
11
k11
r
12
k11
r
13
...
k11
r
1n
k22
r21
k33
r31
...
k22
k33
r32
...
k22
r23
k33
...
...
..
...
k22
r2 n
k33
r3n
...
knn
rn1
k22
r21
k33
rn 3
...
knn
(3.266)
The rate matrix for multi-component copolymerization can thus be also be expressed in
terms of the homopolymerization propagation rate constants of the n monomers respectively
and reactivity ratios as defined in a similar manner to Eq. (3.264). The set of
copolymerization rate equations given by Eq. (3.264) can be given in the matrix form as
follows (Sharma [2012]);
~
dM
K (M * MT )
dt
Where,
M1
0
0
..
M2
M3
..
..
..
(3.267)
0
0
~
0 M
..
Mn
Only the diagonal elements of the resulting matrix from the RHS, right hand side of Eq.
(3.262) is of interest. The rate equations that represent the radical generation and consumption
during propagation can be given in the matrix form as;
~
d M*
K T (MM *T ) K(M* M
dt
(3.268)
Eqs. (3.267) and (3.268) form a set of autonomous systems. For certain values of the rate
propagation matrix using Eigenvectors and stability analysis it can be shown that periodic
solutions may result. The initial conditions of the monomers can be represented by;

M (t=0) = M0
149
(3.269)
By the QSSA, quasi-steady state assumption, i.e., the radical species are highly reactive,
Eq. (3.269) can be set to zero. Or,
K T (MM*T ) K(M*M
(3.270)
For a given set of reactivity ratios, homopolymer propagation constants and initial
condition of multi-component comonomers, M* can be solved for using Eq. (3.270) and then
substituted in Eq. (3.267). Then the monomer concentrations with time as well as the polymer
composition can be calculated from Eq. (3.270). Observing Eq. (3.270) can be solved for by
the method of Eigenvectors [Varma and Morbidelli, 1997]. It can be seen that non-trivial
equations to the set of ordinary differential equations with constant coefficients represented
by Eq. (3.267) exist only for certain specific values of called Eigenvalues. These are the
solutions to;
I - K 0
(3.271)
Eq. (3.271) upon expansion may lead to a polynomial degree of n in;

Pn() = 0
(3.272)
In order to obtain numerical values for the expansion of Eq. (3.272) is considered
obtained by Laplace development of the determinant;
Pn ( ) 1 n s1 n 1 s2 n 2 ...... sn1 K 0
(3.273)
sj=(-1)n-j(sum of all principal minors of order j of K)
(3.274)
Where,
where j = 1,2,3,.., (n-1).

The copolymer composition can be obtained using the trace of the matrix defined in Eq.
(2.102). Trace is a sum of all the diagonal elements of a matrix. Thus;
F1
0
~
F 0
...
0
F2
0
...
0
0
~
dM
0 0 0
dt
F3 0 0
~
... .... ... tr dM
dt
0 0 Fn
0
(3.275)
150
The corresponding monomer compositions in the CSTR for n monomers entering the
copolymer backbone chain can be written as;
f1
0
~
f 0
...
0
0
f2
0
...
0
~
0 0 0
M
f3 0 0
~
tr M
... .... ...

0 0 f n
0
(3.276)
Eq. (3.276) can be differentiated with respect to time and combined with Eq(3.267) to
obtain the relation between the multi-component copolymer composition and CSTR
monomer compositions. It can be realized that trace of a square matrix is a scalar quantity.
~
Eq. (3.267) is in terms of MT and diagonal matrix M . During copolymerization from the
QSSA as given by Eq. (3.270) it can be seen that;
k12 M1* M 2
k21 M1 M 2*
(3.277)
Substituting Eq. (3.277) in the set of copolymerization rate equations the rate matrix can
be rewritten as;
dM
dt
d M1
dt M 2
i.e.,
k11
k12
K M*
k21
k22
(3.278)
M1*
M 2*
M1
M2
Eq. (3.277) is a reasonable assumption for multi-component copolymerization for the

general case of n monomers as well. This implies that the rate of copolymerization
propagation of MiMj* equals the formation of MjMi* radical. When this is applied to all
possible pairs of monomers in n monomers the QSSA holds as the net production of radicals
equals the consumption during the copolymerization propagation itself. Nothing about the
termination reactions are brought forward into this analysis. Thus for n monomers,
M1
M2
d
M3
dt
...
Mn
k11
k12
k21
k22
k31 ... kn1

k32 .. kn 2
M1*
M 2*
M1
M2
k13
...
k23
..
k33 ... kn3

... .. ...
M 3*
...
M3
...
k1n
k2 n
k3n ... knn
M n*
Mn
(3.279)
151

The solution to Eq. (3.279) can be obtained by the method of Eigenvectors.
Assume that the solution to Eq. (3.279) has the form;
M Ze
(3.280)
Where Z is the unknown vector of constants and are the Eigenvalues. Substituting Eq.
(3.280) in Eq. (3.2782);
~
K M*
(3.281)
Eq. (3.281) requires that et 0. Assuming Eq. (3.281) as the form of the solution to the
set of ordinary differential equations with constant coefficients requires that Z 0. It can be
seen from Eq. (3.281) that is an Eigenvalue of the rate matrix modified with the free radical
concentrations. The free radical concentrations can be obtained from Eq. (3.281). The
modified rate matrix transposed, is a square matrix of nxn. Therefore n Eigenvalues can be
expected.
Example Composition of Tetra polymer made in CSTR
Develop the monomer/polymer composition equations for a tetra polymer made from the
monomers;
(1) Styrene (STY)
(2) Acrylonitrile (AN)
(3) Alphamethylstyrene (AMS)
(4) Methacrylonitrile (MAN)
Sty
AN
d
dt AMS
...
MAN
k11
k21
k31
k41
Sty*
0
*
k12
k13
k22
k23
k32
k33
k42
k43
0
0
AMS
k14
k24
k34
k44
AN
0
0
Sty
AN
AMS
MAN *
MAN
0
*
k11
k22
r21
k33
r31
k44
r41
k22
k33
r32
k44
k11
k21
k31
k41
k12
k22
k32
k42
k11
r12
k13
k14
k23
k24
k33
k34
k43
k44
k11
r13
k22
r23
k33
k44
r43
k11
r14
k22
r24
k33
r34
k44
r42
(3.282)
(3.283)
152
Eq. (3.278) can be solved for by the method of Eigenvectors [Varma and Morbidelli,
1997].
The reactivity ratios for the 4 monomer system considered are follows [Sharma [2012]};
r12 = 0.29; r21 = 0.02; r42 = 0.84; r24 = 1.5; r32 = 0.03; r23 = 0.14; r13 =1.2; r31 = 0.14;
r14 = 0.25; r41 = 0.25;r34 =10; r43 =10
k11
k12
k21
k22
k31
k32
k41
k42
k11
3.4k11
50k22
k22
k13
k14
k23
k24
k33
k34
k43
k44
0.83k11
4k11
7.1k22
0.67k22
7.14k33 4k44
33.3k33 1.2k44
k33
0.1k33
(3.284)
0.1k44
k44
The free radical concentrations can be solved for from;
K T (MM*T ) K(M * MT )
k11
3.4k11
0.83k11
4k11
M1M1*
M1M 2*
M 1M 3*
M 1M 4*
50k22
k22
7.1k22
0.67 k22
M 2 M1*
M 2 M 2*
M 2 M 3*
M 2 M 4*
7.14k33
4k44
33.3k33
1.2k44
k33
0.1k44
0.1k33
k44
M 3 M1*
M 3 M 2*
M 3 M 3*
M 3 M 4*
M 4 M1*
M 4 M 2*
M 4 M 3*
M 4 M 4*
k11
50k22
3.4k11
k22
0.83k11 7.1k22
4k11
0.67k22
7.14k33 4k44
33.3k33 1.2k44
k33
0.1k44
0.1k33
k44
M1* M1
M1* M 2
M1* M 3
M1* M 4
M 2* M1
M 2* M 2
M 2*M 3
M 2*M 4
M 3* M1
M 3* M 2
M 3* M 3
M 3* M 4
M 4* M1
M 4* M 2
M 4* M 3
M 4* M 4
(3.285)
Although there are 16 simultaneous algebraic equations generated from Eq. (3.285) it can
be realized that M1M1* radical and M1*M1 radical can be both treated as M1* radical. The
same for the other three radicals M2*, M3* and M4*. Thus four unique equations will be
generated from the matrix multiplication in Eq. (3.285). The 4 simultaneous algebraic
equations can be solved for four unknown radical concentrations, M1*, M2*, M3* and M4*.
These can then be substituted in Eq. (3.282). The radical concentrations can be obtained in
terms of the monomer compositions, M1, M2, M3 and M4 and using the homopolymerization
propagation rate constants, k11, k22, k33 and k44. Eq. (3.282) can then be solved for in terms of
the concentrations of the four monomers as a function of time. Four simultaneous equations
and 4 unknowns, M1*, M2 *, M3* and M4* can be obtained by multiplying the jth row and jth
column on both sides of Eq. (3.285). i.e., the first row and first column, second row and
second column, third row and third column and fourth row and fourth column. The (j,j) cell
on both sides of the matrix equation can be seen to vanish. The equations are then;
k11M1* 3.4
M2
M1
0.88
M3
M1
M4
M1
50k22 M 2* 7.14k33 M 3*
4k44 M 4*
(3.286)
153

k22 M 2* 50
M1
M2
7.1
k33 M 3* 7.14
7.1k22 M 2*
0.67
M1
M3
33.33
0.1k44 M 4*
k33 M 3* 7.14
7.1k22 M 2*
M3
M2
M1
M3
0.1k44 M 4*
M4
M2
M2
M3
3.4k11M1* 33.3k33 M 3* 1.2k44 M 4*
0.1
M4
M2
0.833k11M1*
0 (3.287)
(3.288)
33.33
M2
M3
0.1
M4
M2
0.833k11M1*
(3.289)
Given the monomer compositions in the CSTR, M1, M2, M3 and M4 the radical
concentrations M1*, M2*, M3* and M4* can be solved from the solution of the four equations
Eq. (3.286-3.289). The composition of the tetra polymer can be obtained by obtaining the
incremental rate of addition of the monomer of interest into the copolymer. These are given
by Eqs. (3.275) and (3.276). The stability of the system of reactions can be studied by
obtaining the eigenvalues of the K matrix in Eq. (3.283). Should the eigenvalues be all
negative, then the system is stable. If all but one values are negative then it is an integrating
system. Should the eigenvalues be positive it is an unstable system. Should the eigenvalues be
complex conjugates then the system is considered to be oscillatory. This is expected to be
subcritical and damped.
3.12. MULTIPLICITY IN MODEL SOLUTIONS

Sometimes when mathematical models are developed and the solution for the desired
variable is sought more than one value for the solution can arise. This kind of occurrence is
called multiplicity. Although mathematically correct often times other considerations may
have to be used to sift whether or which of these multiple values from the solution of
equations is most appropriate for the given problem.
3.12.1. Launch Angle of Stream of Water during Fire-Fighting

Consider the fire-fighting task during a fire in a nuclear power plant. As shown in Figure
30.0 a fire truck is directing a stream of water to enter the top of the nuclear reactor that has
caught fire. If the initial speed of the jet of water is 40 m/s is there a value of launch angle
of the issuing jet of water that will get the job done? If so what should be? A model is
developed for the projectile motion of the stream of water. The stream of water is assumed to
comprise of discrete particles. The coordinate system is as shown in Figure 30.0. Let (x,y) be
the coordinates of the particle during its projectile motion at any instant in time t.
154
Figure 30.0. Fires in a Nuclear Power Plant.
The velocity of the particle at any instant in time t can be resolved into two components,
(vx, vy).
During the trajectory of the projectile motion the particle reaches a maximum height H. It
climbs from the launch point to a maximum height H, and then descends. The two phases of
the motion can be modeled as follows;
yi
v sin( )t
gt 2
2
(3.290)
Eq. (2.124) is third law of kinematics [Hibbler, 2010] written for the climb from launch
to the maximum height. During the descent it can be shown the same equation is applicable as
follows. Let the time taken to reach the maximum height be given by;
v sin( )
g
tc
(3.291)
During the descend the acceleration changes from g to + g. Hence,
yi
or ,( y
ym
g (t tc )2
2
v 2 sin 2
yi )
v 2 sin 2
2g
gt 2
2
g 2
t
2
2g
v 2 sin 2
2g
Eq. (3.292) is identical with Eq.(3.290)!
tc2
2ttc
2tgv sin
2g
v sin
gt 2
2
(3.292)
155
For the stream of water in Figure 30.0, Eq. (3.292) can be written assuming the height of
the fire truck as 1 m as;
5 1 40sin( )t 4.9t 2
(3.293)
t 1.225t 2
or ,1 10sin
The horizontal component of the velocity vx remains the same during the projectile
motion. In the time elapsed t the distance it has moved is 11 m from Figure 30.0. Another
equation can be written as follows;
40cos( )t
11
0.275
cos
or , t
(3.294)
0.337
1 10 tan
cos 2
or ,0 0.337 tan
0.337 1 tan 2
10 tan
(3.295)
10 tan
1.337
Eq. (3.295) is a quadratic equation in tan(). The solution for tan() can be seen to be;
tan
29.5,0.134
(3.296)
Two launch angles result as the model solution. These angles for are 88.10 and 7.650. In
order to check whether both these angles are possible or whether only one or none of these
two angles are suitable the maximum height reached by the stream of water can be inspected.
This is given by Eq. (3.297);
ym
402 sin 2 ( )
29.81
82.45and 2.44m
(3.297)
The times these would occur can be calculated as;

tc
40sin( )
g
4.07and 0.543s
(3.298)
The x displacement corresponding to these two times are then seen to be;
x xc
tc 40cos( ) 5.52and 21.52m
(3.299)
156
21.52 m is greater than the distance of the reactor from the fire truck, i.e., 21.52 > 11 m.
Hence the corresponding to this value, 7.650 is not acceptable. The launch angle of 88.10 is
another possible angle that would hit the top of the reactor during the descend of the stream as
shown in Figure 30.0. However, the maximum height reached is 82.45 m. This is 16 times the
height of the reactor. Hence although this is theoretically possible this is not practically
realizable.
3.12.2. Elbow-Up and Elbow Down Solutions of Inverse Kinematics of

Manipulator
The study of robotics involves the synthesis of some aspects of human function by the
use of mechanisms, sensors, actuators and computers. Robotics consists of four major areas:
mechanical manipulation, locomotion, computer vision and artificial intelligence [Craig,
2005]. Mechanical manipulation in turn comprises of mechanics, control theory and computer
science. Mathematical models are needed to describe the positions and orientations in three
dimensional space. For example, the robot arm picking a bolt or placing a knife needs to be
predicted in space and time coordinates. Kinematics deals with the geometry of mechanical
manipulators. The study of motion without regard to forces that cause it is considered here.
The forward kinematics of a manipulator involves the calculation of the space and time given
the joint angles and link distances. The problem of inverse kinematics of the manipulator
deals with obtaining the joint angles given the location of the finger tip of the robot in space
and time.
Figure 31.0. Three Arm Manipulator with End Effector.
157
Table 3.8. Denavit Hartenberg Parameters for 3 Arm Planar Manipulator in Figure 2.9
i-1
0
0
0
I
1
2
3
ai-1
0
2
1
i
1
2
3
di
0
0
0
Consider a 3 arm planar manipulator with end-effector as shown in Figure 31.0. The
Denavit-Hartenberg table for this manipulator is given below in table 3.8.
Given the value of the homogeneous transform from the reference frame of the end
effector [Craig, 2005], 30T, the problem of finding the joint angles 1, 2 and 3 is called the
inverse kinematics of the manipulator. The reachable workspace of the end effector would be
a doughnut of outer radius 3.5 m and inner radius 0.5 m. This is provided the joints are
revolute and can rotate 360 0. Multiplicity of solutions can be expected for the joint angles.
The physical significance can be a elbow-up and elbow-down solution or a reflection
solution.
0
3T
0 1 2
1T 2T 3T
c
s
s1 0 0
c1 0 0
1
1
c
s
2
2
s2
c2
0 2
0 0
c
s
3
3
s3
c3
0 1
0 0
1 0
1 0
1 0
0 1
0 1
0 1
Eq. (3.300) can be written as 03T
c123
s123
s123
c123
0 2c1 c12
0 2s1 s12
(3.300)
(3.301)
Given that;
0
3T
0.707
0.707
0.707 0 1.8
0.707 0 2
(3.302)
Comparing Eq. (3.302) and Eq. (3.301);

c123 = 0.707
(3.303)
s123 = 0.707
(3.304)
158

2c1 + c12 = 1.8
(3.305)
2s1 + s12 = 2
(3.306)
450
(3.307)
Squaring and adding Eq. (3.303) and Eq. (3.304) and realizing that
c12 = c1c2 s1s2 & s12 = c1s2 + s1c2
Thus,
c2
1.82
22
4
4 1
(3.308)
(3.309)
0.56
Eq. (3.309) can also be obtained from the geometry of Figure 31.0 by use of law of
cosines.
Thus, 2 = 560, 304.10. 560 corresponds to an elbow-down solution and 304.1 0
corresponds to a elbow-up solution. Thus although multiplicity is seen both numbers have
physical significance.
= ATAN(0.9) = 420.
Let
(3.310)
From the geometry of Figure 31.0 and applying the law of cosines to the triangle about
the angle 1 and 3;
2cos
42 (2) 1.82
22
4 4 1.82
12 0.52 2(1)(0.5)cos 45 56
r2
r2
(3.311)
(3.312)
Combining Eq. (3.312) and Eq. (3.310);
9.74 7.02cos
7.39sin
(3.313)
Eq. (3.313) can be solved for by using numerical technique such as Newton and Raphson
technique. MS Excel for Windows 2007 was used on the desktop computer and the solution
to joint angle 1 is found to be 0.5 radian or 29.30 and 69.60. The convergence was rapid and
obtained after 2. The result was not sensitive to the initial guess. 3 can then be seen to be
285.4 0. The 8 different possibilities of the solution to the joint angles can be examined from
other considerations to detect any infeasibility.
159
F. DIMENSIONLESS GROUPS
3.13.1. Reynolds Number
Osborn Reynolds [1883] presented his experimental investigation that lead to the
introduction of the dimensionless group Reynolds number. His paper on the circumstances
which determine whether the motion of water shall be direct or sinuous and of the laws of
resistance in parallel channels was presented to the Royal society 122 years ago.
Re
vd
(3.314)
Reynolds number is used extensively in industrial practice. It gives the ratio of the inertia
forces and viscous forces and is used to delineate laminar flow from turbulent flow. 56
different flow types have been reviewed in Sharma [2010]. A glass tube was mounted
horizontally with one end in a tank and a valve on the opposite end. A smooth bell mouth
entrance was attached to the upstream end with a dye jet so arranged that a fine stream of dye
could be injected at any point in front of the bell mouth. Reynolds supposed the average
velocity of the fluid, V, as characteristic velocity and the diameter of tube as the characteristic
length. At small flow rates, the dye stream moved as a straight line through the tube,
indicating that the flow was laminar. The flow rate was increased, holding d, diameter of the
tube, , density of fluid and , the viscosity of the fluid. The Reynolds number according to
Eq. (3.314) also increased with the increase in velocity of the fluid. As discharge rates were
further increased, a condition was reached at which the dye stream wavered, and then
suddenly broke up, and was diffused throughout the tube. The nature of flow had changed to
turbulent flow with its violent interchange of momentum. The orderly movement of laminar
flow had been completely disrupted. By careful manipulation of variables, Reynolds was able
to obtain a threshold or cut-off value of Re = 12,000 before turbulence sets in. Later
investigators obtained the value of 40,000 for the cut-off value using the original equipment
used by Reynolds. They let the water stand in the tank for several days before the experiments
and by taking precautions to avoid vibration of the water or equipment. These numbers are
referred to as the upper critical Reynolds number. Starting with turbulent flow in glass tube,
Reynolds found that it was always laminar when the velocity is reduced to enable Re < 2000.
This is the lower critical Reynolds number. With the usual piping installation the flow will
change from laminar to turbulent in the range of Reynolds numbers from 2000- 4000.
Reynolds number may be interpreted as the ratio of the bulk transfer of momentum to the
momentum by shear stress. The physical significance of Reynolds number can be seen to be
the ratio of the inertial forces to that of the viscous forces.
inertial
Re
vd
forces
viscous
force
(3.315)
160
The higher the viscous forces the momentum transfer is by shear stress and by dragging
of fresh fluid by moving adjacent layers of fluid. The flow under these circumstances are
orderly and laminar. When the inertial forces are high, the flow becomes plug. When inertial
forces are high all the elements in the fluid attempts to move. As the elements are unhindered
they collide and become wavy or erratic. This is when turbulent flow sets in.
3.13.2. Prandtl Number

In 1904, Prandtl [1952] presented the concept of the boundary layer. It provides the
important link between ideal fluid flow and real fluid flow. For fluids with low viscosity, the
effect of internal friction in a fluid is appreciable only in a narrow domain surrounding the
fluid boundaries. From this premise, the flow outside the narrow domain near the solid
boundaries may be considered as ideal flow or potential flow. Relations within the boundary
layer region can be computed from the general equation for viscous fluid. The momentum
equation permits the developing of approximate equation for boundary layer growth and drag.
When motion is started in a fluid having small viscosity the flow is irrotational initially. The
fluid at the boundaries has zero velocity relative to the boundaries. As a result, there is a steep
velocity gradient from the boundary into the flow. The velocity gradient in a real fluid sets up
near the boundary shear forces that reduce the flow relative to the boundary. That fluid layer
which has had its velocity affected by the boundary shear is called the boundary layer.
The velocity in the boundary layer approaches the velocity in the main flow
asymptotically. The boundary layer is very thin at the upstream end of a streamlined body at
rest in an otherwise uniform flow. As this layer moves along the body, the continual action of
shear stress tends to slow down additional fluid particles, causing the thickness of the
boundary layer to increase with distance from the upstream point. The fluid in the layer is
also subjected to a pressure gradient determined from the potential flow, that increased the
momentum of the layer if the pressure decreases downstream and decreases its momentum if
the pressure increases downstream (adverse pressure gradient). The flow outside the boundary
layer may also bring momentum into this layer. For smooth upstream boundaries, the
boundary layer starts out as a laminar boundary layer in which the fluid particles move in
smooth layers. As the laminar boundary layer increases in thickness, it becomes unstable and
finally transforms into a turbulent region in which the fluid particles move in zig zag paths
although their velocity has been reduced by the action of viscosity at the boundary. Where the
boundary layer has become turbulent, there is still a very thin layer next to the boundary that
has laminar motion. It is called laminar sub layer. The Prandtl number is given by Eq.
(3.316);
Pr
Cp
k
Cp
k
(3.316)
The physical significance of the Prandtl number can be viewed as the ratio of the viscous
diffusion rate given by the kinematic viscosity, to the thermal diffusion rate given by the
161
thermal diffusivity, . Schmidt number is the dimensionless number that is analogous to

Prandtl number in mass transfer.
Sc
D AB
DAB
(3.317)
3.13.3. Biot Number (Heat) and Nusselt Number

The Biot number (heat) is defined by Eq. (3.318);
resis tan ce
hg a
Bi
ks
a
ks
1
hg
(int ernal )
(conduction)
resis tan ce
(3.318)
(external )
(convection)
Consider a cold slab at a constant temperature T0, thermal conductivity, ks (W.m-1.K-1),

width 2a. Let the slab be heated by blowing hot air past the slab as shown in Figure 32.0. Let
the temperature of the hot air be Tair, such that Tair > T0. The heat transfer rate at given instant
in time from the hot air to the slab can be written as;
q " hg Tair
Ts
(3.319)
Where, q is the heat flux with units of W.m-2.K-1. The rate of convection from the
external air to the internal rate of conduction would be equal to each other. This would be the
case as long as there is no accumulation of heat at the surface. Thus,
q" hg Tair Ts k s
T k s (Ts Tc )
x
a
(3.320)
An overall transfer coefficient, U can be obtained as follows;
Tair Ts
Ts Tc )
(3.321)
U is defined as follows;
q = UT
Eq. (3.322) can be written in combination with Eq. (3.321) as follows;
(3.322)
162
Or,

q"
U
q"
hs
q"a
ks
(3.323)
1
U
1
hs
a
ks
(3.324)
Eq. (3.324) is an expression for the overall heat transfer coefficient as a sum of the
convective and conductive resistances encountered in its path for heat transfer. Biot number
(heat) is defined by Eq. (3.318) and gives the ratio of external convective resistance to
internal conductive resistance. Nusselt number is defined as follows;
Nu
hg a
kg
(3.325)
Although Biot number (heat) and Nusselt number may appear to have similar expression
of product of heat transfer coefficient and characteristic length and divided by thermal
conductivity they mean completely different quantities. Nusselt number is the heat transfer
coefficient made non-dimensionless by the thermal conductivity of the gas and the
characteristic length. Nusselt number is the ratio of the thermal gradient at the wall divided by
the average temperature gradient across the entire slab. From the film theory of mass transfer,
by analogy should all the temperature drop from the gas to solid interface happen within a
film, thickness then;
h
kg
(3.326)

Nu
(3.327)
The Nusselt number is the ratio of the half-width and the film thickness, . By analogy in
mass transfer, Biot number (mass) and Sherwood numbers can be written as follows;
Bi mass
Sh
kg a
DAs
kg a
DAg
(3.328)
(3.329)
Where DAs and DAg are the binary diffusivities of species A in solid and gas respectively.
163
3.13.4. Mach Number

A supersonic flight record was set by Boeings X-51A Waverider by flying at Mach 5
speeds at an altitude of 70,000 feet in the skies off the southern California coast in May, 2010
(33.0). Mach number is a dimensionless group that is obtained by taking the ratio of the
considered speed and the speed of sound. The unmanned flight lasted for three and half
minutes. T. von Karman developed the theory of supersonic flight and is affectionately called
father of supersonic flight. His work on stability of laminar flow, turbulence, airfoils at steady
state and at transient state, boundary layer flow and supersonic aerodynamics got him a
citation from the late President J. F. Kennedy. Human flown aircraft at a speed greater than
that of the speed of sound was achieved for the first time in October, 1947. Bell X-1 research
rocket plane was piloted by C. Yeager.
de Laval nozzles are used in steam turbines and rocket engines. It is a convergentdivergent tube that is hourglass in shape in the lateral direction. A pressurized gas is
accelerated passing through at supersonic speed and upon expansion exits as exhaust flow.
The heat energy driving flow is converted into kinetic energy. Design and operation of de
Laval nozzles need physical property information of gases at subsonic and supersonic speeds.
The gas flow through a de Laval nozzle as will be discussed in a later chapter is said to be
isentropic. At subsonic speed the gas is compressible and sound propagates as a small
pressure wave. At the throat where the cross-sectional area of the pipe is minimal the gas
velocity attains a sonic state locally. This condition at a Mach number of 1 is said to be
choked flow [Anderson, 2003]. As the nozzle cross-sectional area increases along the path of
fluid flow, the gas expands and velocity of fluid reaches supersonic velocity. Here the sound
wave will not back propagate. The theory underlying analysis of isentropic flow is discussed
later in this book.
Figure 33.0. U.S. Air Forces Graphic of X-51A Wave rider.
164
3.13.4.1. Speed of Sound

Sound is known to travel as vibrations in the form of pressure waves in an elastic
medium. Supersonic speeds are those that are greater than 1,440 m/s. Supersonic fracture is
motion of cracks that propagate in a solid at speeds greater than that of the speed of sound.
Fighter aircraft used during wartime are supersonic. Firearm bullets travel at supersonic
speeds. Space shuttle during portions of reentry travel at supersonic speeds. Wave travelling
through a bull whip can attain supersonic speed.
The US Navy F/A-18 at a speed close to that of sound is shown in Figure 34.0. The wake
region that is denser is formed by condensed water droplets. This can be seen to be as a result
of shredding of shockwave from the aircraft. This can be explained by phenomena among
others that are discussed in this book called Prandtl-Galuert singularity. This is also called as
vapor cone or shock collar. A point in the wake region of the airfoil undergoes a drop in
pressure. Under certain weather conditions this causes a visible condensation cloud to appear
in the wake of an aircraft while travelling at transonic speeds. The air pressure in the wake of
the aircraft can be called as N-wave. The transient pressure plot as a function of time
resembles the English alphabet N. The pressure profile of the wave comprises of a leading
compression component, followed by pressure descent along the diagonal of the letter N
followed by a subsequent return to the normal pressure. These compression clouds can be
seen during space shuttle launches. About 25 40 seconds after the launch the vehicle is
travelling at transonic speeds and this phenomena happens then. A similar event was observed
during nuclear tests and the name Wilson cloud came about in the literature. The pressure
change process is adiabatic.
Compressibility effects can be seen to be taken into account in the design of supersonic
aircraft. Rounded nose and straight wings are used for vehicles designed for low speed flight.
Swept wings, tail surfaces are used for aircraft designed for higher speeds. Sharp nose and
highly swept wings are used for aircraft designed for very high speed flight. Design of high
speed aircraft is an important application of compressible flow. The design of gas turbines
such as flow along the blades and nozzles involves the use of theory and methods of
compressible flow. Flow in nozzles and blades in steam turbines are another example of
hypersonic flow. The flow of gases through the valves and in the intake and exhaust systems
of reciprocating engines can be treated as compressible. Flow through natural gas
transmission lines cannot be taken as incompressible. Design and optimal operation of
combustion chambers needs knowledge in compressible flow.
3.13.4.2. Flow Regimes
Consider flow past an airfoil. Airfoil is a shape given to bodies such as wings of an
airplane or blades of a turbine. As an airfoil shaped body moves through a fluid an
aerodynamic force is produced. A component of this force that is normal to the direction of
motion is called the lift force. The component of the force generated in the surrounding fluid
that is lateral to the direction of motion is called the drag force. The lift force on the airfoil is
function of the angle of attack. The lift force can be related to the average velocity of the fluid
by the theory of circulation and use of Kutta-Joukowski theorem. Mean chamber line is the
locus of points midway between the upper and lower surfaces of the airfoil. The chord line is
a straight line connecting the leading and trailing edges of the airfoil. The chord is the length
of the chord line and is the characteristic dimension of the airfoil section. The maximum
thickness and the location of the maximum thickness are expressed as a percentage of the
165
chord. In symmetrical coils, both mean chamber line and chord line pass from the center of
gravity of the airfoil. Aerodynamic center is the chord wise length about which the pitching
moment is independent of the lift coefficient and the angle of attack. The center of pressure is
the chord wise location about which the pitching moment is zero. The characteristic shape of
airfoil consists of a rounded leading edge, followed by a sharp trailing edge and with
asymmetric chamber. Different flow regimes can be identified as shown in Figure 35.0 and
Figure 36.0. In order to quantitatively delineate different flow regimes identified qualitatively,
the dimensionless group Mach number is defined.
Ma
u
a
Where, u is the speed of the fluid and a is the speed of sound.
Figure 34.0. Condensation Cloud Due to Prandtl Glauert Singularity.
Figure 35.0. Transonic Flows and Bow Shock Formation.
(3.330)
166
Figure 36.0. Supersonic Flows and Oblique Shock Formation.
The flow is said to be subsonic when the Mach number of the free stream fluid
approaching the airfoil, M < 0.8. The fluid flows past the airfoil is streamlines at a Mach
number less than 1. When the Mach number of free stream fluid approaching the airfoil is 0.8
< 0.8 < M < 1.0 the flow is said to be transonic. As can be seen in Figure 35.0 local regions
above the airfoil or pockets of heterogeneity terminates with a shock wave. Across the
shock wave there can be seen severe change in properties. The flow is discontinuous across
the shock wave. When M is slightly greater than 1, shock pattern moves to the trailing edge
of the airfoil and a second shock wave appears at the leading edge. The second shock wave is
called the bow shock. After crossing the Bow shock the flow is subsonic.
When the free stream approach velocity of the fluid, M > 1 the flow is said to be
supersonic. As can be seen from Figure 36.0, an oblique shock wave is formed and attached
to the sharp nose of the wedge. Across this shock wave, the streamline direction changes in a
discontinuous manner. Ahead of the shock, streamlines are straight and parallel and
horizontal. These are not forewarned about the presence of the body. Theoretical analysis
about such flow regimes will ensue in a later chapter.
When M becomes greater than 5 the flow is said to be hypersonic. The temperature, T,
pressure, p and molar volume, v increase almost explosively across the shock wave. The
oblique shock that is formed moves closer to the surface. The shock layer becomes very hot.
It reaches temperatures hot enough to become dissociated from the wedge. Some ionization of
the gas may also occur. Chemically reacting flows pose a complex flow problem.
3.13.5. Fourier, Fick and Newton Numbers

During transient heat conduction, transient mass diffusion and transfer momentum
transfer the temperature profile, concentration profile and velocity profile varies with time
and space. These profiles for different geometries and different boundary conditions with the
governing equation obtained from energy balance, mass balance and momentum balance and
Fouriers law of heat conduction, Ficks law of mass diffusion and Newtons law of viscosity
are given in graduate textbooks such as Bird, Stewart and Lightfoot [2006]. The transient
temperature profile, concentration profile and velocity profile for standard geometries and
167
boundary conditions derived from the governing equations from energy balance, mass
balance and momentum balance and damped wave conduction and relaxation equation,
damped wave diffusion and relaxation equation and damped wave kinematic diffusion and
relaxation are given in Sharma [2005]. The transient temperature, concentration and velocity
profiles from Fouriers law of heat conduction, Ficks law of mass diffusion and Newtons
law of viscosity are described in dimensionless form by use of Fourier number, Fick number
and Newton numbers. These can be calculated by;
Fo
t
d
kt
Cpd 2
(3.331)
where Fo is the Fourier number, is the thermal diffusivity (m2.s-1), d the characteristic
length (m), k the thermal conductivity (W.m-1.K-1), the density (kg.m-3), Cp the heat
capacity, (J.kg-1K-1). The physical significance of Fourier number is the ratio of the square of
penetration distance of heat disturbance at the surface (t)0.5 to the square of the characteristic
length of the object or medium considered.
Fi
DAB t
d2
(3.332)
Where Fi is the Fick number, DAB is the binary diffusivity (m2.s-1). The physical
significance of Fick number is the ratio of the square of penetration distance of mass
disturbance at the surface (DABt)0.5 to the square of the characteristic length of the object or
medium considered.
t
Ne
(3.333)
d2
Where Ne is the Newton number, is the kinematic viscosity (m2.s-1). The physical
significance of Newton is the ratio of the square of penetration distance of velocity
disturbance at the surface (t)0.5 to the square of the characteristic length of the object or
medium considered.
In addition to the Fourier number, Fick number and Newton number, Vernotte number or
Maxwell number (heat), Maxwell number (mass), Maxwell number (momentum) are needed to
characterize the transient temperature, concentration and momentum profiles obtained from
damped wave transport and relaxation equations. These equations generalize the Fouriers
law of heat conduction, Ficks law of mass diffusion and Newtons law of viscosity aimed for
wider applicability. These are defined as follows;
Ve
d2
(3.334)
Where Ve is the Vernotte number (Cattaneo and Vernotte independently in 1948 and
1958 postulated the constitutive relation for heat conduction that may be used to generalize
168
Fouriers law of heat conduction with wider applicability), r, is the relaxation time (s). The
relaxation time has been shown by Sharma [2006] to be a third of the collision time of
electrons in the free electron theory when the acceleration of the electron is accounted for. It
is also shown to describe the speed of heat propagation or speed of mass propagation or speed
of momentum propagation as follows;
vh
DAB
; vm
r
; ; vmom
(3.335)
r
Where, vh, vm and vmom are the velocity of heat propagation, velocity of mass propagation
and velocity of momentum propagation. The velocity of mass propagation was shown related
to the root mean square velocity of molecule from Stokes-Einstein formulation of diffusion
and kinetic representation of pressure by Sharma [2007]. The Vernotte number can be
rewritten as follows;
Ve
vh2
2
r
2
(3.336)
v2
rd
The physical significance of Vernotte number is that it represents the heat velocity in the
dimensionless form. In the asymptotic limit of the heat velocity reaching infinity the
relaxation time, r would reach zero and the damped wave conduction and relaxation equation
would revert to the Fouriers law of heat conduction. The Vernotte number can also be seen
as the ratio of the square of the velocity of heat to the square of another characteristic velocity
Maxm
DAB
(3.337)
d2
Maxm given by Eq. (2.145) is Maxwell number (mass). It is the analogous group of
Vernotte number in heat to damped wave diffusion and relaxation. The physical significance
of Maxm (mass) is mass diffusion velocity in dimensionless form.
Maxmom
DAB
d
(3.338)
Maxmom is given by Eq. (2.146) is Maxwell number (momentum). It is analogous to the

Vernotte number in heat to damped wave momentum transfer and relaxation. The physical
significance of Maxmom is that it represents the kinematic viscous momentum transfer velocity
in dimensionless form. It is the ratio of the diffusional speed to the relaxation/ballistic speed
in the process. It can be used to gauge how significant is the relaxation phenomena in a given
application.
169
3.13.6. Sharma Number (MASS)

Mathematical theories have been developed to explain the way the mass transfer
coefficients correlates with the Reynolds number and Schmidt number. In the film theory, an
effective film thickness is assumed over which the concentration changes happen. When a
fluid flows past a surface a certain concentration profile will be established. Upon observation
of the concentration change with distance it can be inferred that most of the drop in
concentration can be attributed to a short region that can be denoted as a effective film
thickness. The mass transfer coefficient can be calculated as;
N " k Cli
DAB Cli
Clb
DAB
Or,
Clb
(3.339)
(3.340)
The penetration theory was developed by Higbie [1935], 7 decades ago. Higbie pointed
out that in most mass transfer applications the contact time is short that during the transfer the
process is transient. Consider a semi-infinite medium at a uniform initial concentration of C0.
At times greater than zero one of the surfaces is maintained at a constant surface
concentration Cs. By the Ficks second law of mass diffusion the governing equation can be
written as;
u
t
Where,
DAB
z2
C A C A0
C As C A0
(3.341)
(3.342)
The governing equation given in Eq. (2.130) can be solved using the Boltzmann
z
transformation such as
. Eq. (2.130) becomes;
4 DAB t
u
2
(3.343)
The dimensionless concentration profile can be shown to be;
u 1 erf
z
4 DAB t
(3.344)
170
The mass transfer coefficient can be calculated from Eq. (2.133). The surface flux can be
written as;
Js
DAB C As
C A0
k C As
4 DAB t
DAB
Thus,
C A0
(3.345)
(3.346)
4 t
Higbie assumed a constant time of exposure for all the eddies of fluid at the interface.
Instead of the Ficks second law of diffusion when the generalized Ficks law of diffusion and
relaxation is used, it was shown in Sharma [2007] that for the semi-infinite medium subject to
constant wall concentration the surface flux by the method of Laplace transforms can be
given by;
J*
e 2 I0
(3.347)
The mass transfer coefficient can then be seen to be;
DAB
2I
Where,
(3.348)
tc
r
Dankwerts [1955] developed the surface renewal theories. Here he derived the mass
transfer coefficient for the general case where the eddies stay at the surface for varying
lengths of time and Higbies penetration theory is a particular case where the contact times of
the eddies is constant.
k = (DABS)0.5
(3.349)
where s is the surface renewal rate. Dobbins [1964] noted that whereas the film theory
assumes that the concentration profile has reached steady state in the time of mass transfer
and the Higbie and Dankwerts theories account for the transient nature of diffusion during the
eddy contact time, they use a semi-infinite boundary condition for zero transfer. Dobbins used
a finite length boundary condition and modified Eq. (3.349) as;
DAB s coth
szb2
DAB
(3.350)
171
A revisit of Dobbins set of boundary conditions to the governing equation derived by

using the generalized Ficks law of diffusion for finite width can result in the solution given
earlier in Sharma [3007]. The dimensionless concentration when the relaxation times are
large can be found as;
cn e
2
n
cos
0.25 cos
nX
(3.351)
From a mass balance on a slice of thickness x in the time increment t, and in the limit
of t and x 0, the following equation results;
u
J*
X
(3.352)
Eq. (3.352) relates the accumulation of concentration to the rate of change of flux in
space.
u
2
n
0.25cn e
2
n
sin
0.25 cos
nX
(3.353)
0.5cn e
2
n
cos(
0.25 ) cos
nX
Eq. (3.353) was obtained by differentiating Eq. (3.351) with respect to time. Substituting
Eq. (3.353) in Eq. (3.352) and integrating the dimensionless mass flux can be obtained;
J* c '
2
n
0.25
cn
0.5
2
n
sin
0.25 sin
nX
cn
cos(
2
n
(3.354)
0.25 )sin
nX
cn
Where,
From the final condition,
4 1
n 1
2n 1
2n 1
n
DAB
2aw
c = 0
The mass transfer coefficient, k can be calculated from the flux at the surface, J*;
(3.355)
172
J*
2
n
DAB
0.25
cn
2
n
sin
0.25 sin
nX
(3.356)
0.5
cn
cos(
2
n
0.25 )sin
nX
Taking only the first term in the infinite series

2
8aw e
cos
DAB
4aw2
2
r
0.25
4aw
DAB
DAB
4aw2
DAB
0.25e
DAB
4aW2
sin
0.25
Or,
2
4 e
k r
aw
Sha
cos
DAB
4aw2
0.25
DAB
4aw2
2
r
0.25e
sin
DAB
4aW2
0.25
(3.357)
Where Sha is the Sharma number.

In the short time limit at 0,
k r
aw
Sha
(3.358)
0.41
Thus the dimensionless group Sharma number is arrived at. Sharma Number can be
written in terms of Sherwood number, Sh and Maxwell number (mass), Maxm.
Sh
Maxm
kaw
DAB
(3.359)
DAB
(3.360)
aW2
The Maxwell number (mass) is the Fick number (analogous to Fourier number) evaluated
at time t equal to the relaxation time, r.
Sh * Max
kaw DAB
DAB aw2
k r
aw
Sha
(3.361)
173
Thus Sharma number is the product of Sherwood number and Maxwell number (mass).
The physical significance of Sharma number gives the ratio of the bulk mass transfer rate and
the relaxation transfer rate. Maxm is the Maxwell number (mass) and gives the ratio of the
diffusion rate and relaxation rate. The Sherwood number gives the ratio of the mass transfer
rate in bulk compared with the diffusion rate. At large relaxation times when the above
correlation is expected to hold well, it can be seen that the dimensionless mass transfer rate
becomes independent of the diffusivity. By analogy between mass diffusion and heat
conduction, Sharma number (heat) can be seen to be;
Sha
h r
C p aw
h
Saw
(3.362)
Where h is the heat transfer coefficient (W.m-2K-1). S is the storage coefficient. Storage
coefficient has been used in analysis of damped wave conduction and relaxation in Sharma
[2005]. The storage number is the ratio of thermal mass to that of the relaxation time. It is a
measure of how much heat that is accumulated per cycle of the propagation of the heat wave.
It would be interesting to see in an analogous manner to mass transfer whether the product of
Nusselt number and Vernotte number would give the Sharma Number (heat);
haw
k
h r
C p aw
r
2
aw
h
Sha
Saw
Nu Ve
(3.363)
It does! The product of Nusselt number and Vernotte number can be called Sharma
Number (heat). The physical significance of the Sharma Number (heat) is that it is a measure
of the ratio of the bulk convective heat transfer rate to the relaxation/ballistic transfer rate in
the process. It can be seen that storage coefficient S, has units of W/m3/K, when thermal
conductivity k has units of W/m/K and heat transfer coefficient, h has units of W/m2/K. S is
volumetric, thermal conductivity is linear and heat transfer coefficient areal when heat
resistances are calculated from them. The ratio of convection heat transfer to Fourier
conduction heat transfer is given by Peclect number (heat).
Pe
awu
Re Pr
uaw C p
k
(3.364)
Peclect number (heat) can be obtained as the product of Reynolds number and Prandtl
number. The ratio of convection mass transfer to Fick molecular diffusion is given by Peclect
number (mass).
Pe
awu
DAB
Re Sc
uaw
DAB
(3.365)
174
G. STOCHASTIC MODELS
3.14. WEINER HOPF INTEGRAL EQUATION
Weiner-Hopf integral equation can be used to estimate the effects of mixing in a CSTR,
continuous stirred tank reactor. This can be done by estimating the degree of mixedness from
the variance in SPC, statistical process control charts. For example, consider the manufacture
of ABS, acrylonitrile butadiene and styrene, engineering thermoplastic using two or three
CSTRs operated in series and a devolatilizer. The composition distribution of SAN, styrene
acrylonitrile copolymer can be measured and monitored using data acquisition hooked to
desktop computers. Often times, the RPPS, rubber phase particle size has to be maintained
less than a threshold size. Sometimes bimodal distribution may be needed to obtain am
optimal balance of properties: high gloss and high impact strength. Smaller the RPPS higher
the gloss. Larger the size of the particle in a certain range higher is the notched Izod impact
strength.
In the patent literature and product brochures continuous polymerization of ABS
engineering thermoplastic has been discussed. ABS with better balance of properties such as
surface gloss, tensile strength, impact strength, processability, heat resistance with a bimodal
distribution of particle size. Helical ribbon agitators are used in the CSTR to shear and blend
well the high viscous, low Reynolds number systems. The monomers and inert diluents used
are pumped into the reactors with preformed rubber dissolved in the monomers and diluents
along with the initiator, chain transfer agent, antioxidant, mineral oil, etc. The matrix and
graft copolymer are formed in the two reactors and the unreacted monomers and diluent are
removed from the product in the devolatilizer and recycled back to the reactors. The
schematic of the two CSTR and DV, devolatilizer is shown in Sharma [1997].
It was found that the first reactor agitator speed had an effect of lowering the RPPS in
product with improved gloss (Sharma, [1997]). The second reactor agitator speed was found
to have an effect on the compositional heterogeneity in the second reactor. It is not clear
whether the higher agitator speed lowered the mixing times and hence the superior product or
by shear effect of anchor agitator resulted in a lower RPPS. Lower mixing times would result
in better grafting which in turn has an effect of lowering the particle size in the product. A
method is developed to evaluate the mixedness from compositional distribution data.
Mixing effects can be expected to manifest as the broader variance in the composition
data from SPC charts for SAN copolymer. The Weiner-Hopf integral equation can be used to
estimate the degree of mixedness. This can delineate the blend-time mechanism and shear rate
mechanisms. This can be done by filtering. This approach is in contrast to Atiqullah-Nauman
model (). They obtain the copolymer composition distribution in CSTR with unmixed feed
streams using lamellar stretch model that accounts for back mixing. Let the composition of
copolymer AN be given by y(t) recorded in SPC charts. X is the derived signal. N is the noise
that can be considered to predominantly arise from improper mixing and experimental error.
The estimator can be introduced to derive this information.
t1
A t1 ,
t
t0
(3.366)
175

The rest of the problem is to find A(t1,) that would minimize the least squared error;
x t1
t1
(3.367)
Let A(t1,) = A0(t1,) + (t1,)

Minimization of J with respect to ;
J
tr E x t1 xT t1
(3.368)
E x t1 yT
AT d
t t
AE y
t0
xT t1 d
t0
AE y
yT
AT d d
(3.369)
t0 t0
J is minimized with respect to and the Weiner-Hopf integral equation is obtained.

t
yT
A0 E y
E x t1 yT
(3.370)
yT
} 0
(3.371)
(3.372)
t0
E{ x
t1
x t1
The error is orthogonal to all data in the set.

~
E x
t1
yT
t0 t
(3.373)
The degree of mixedness can be estimated from SPC charts of AN composition.
3.15. MESOSCOPIC MODELS - DISSIPATIVE

PARTICLE DYNAMICS
Groot and Warren [1997] reviewed dissipative particle dynamics, DPD as a mesocopic
simulation tool. They have established useful parameter ranges for simulations. They consider
atoms as a set of interacting particles. The time evolution of the ensemble is governed by
Newtons equation of motion.
176
vi
fi
dri
dt
dvi
dt
(3.374)
They have developed an EOS, equation of state of DPD fluid applicable for polymeric
systems. EOS for polymeric systems are discussed in more detail in Sharma [19]. EOS of
DPD fluid is essentially quadratic in density. De Groot and Warren [34] have established
useful parameter ranges for simulations. These parameters were linked to interaction
parameters in Flory-Huggins type models. The link opens the ways to perform large scale
simulations effectively describing millions of atoms. The molecular fragments are simulated
first. All atomistic details are retained to yield the parameters. These results are input into a
DPD simulation. These simulations are used to study the formation of micelles, networks,
mesophases and other related phenomena. An illustrative application, they [Groot and
Warren, 1997] have calculated the interfacial tension, , between homopolymer melts as a
function of interaction parameter, and N and found a universal scaling collapse when
is plotted against N for N >1. The use of DPD to simulate the dynamics of
k BT 04
mesoscopic systems was discussed and a possible problem with the timescale separation
between particle diffusion, and momentum diffusion (viscosity) was indicated. An example of
soft condensed matter was given. They are neither completely solid nor completely liquid.
The relevant length scale is between the atomistic scale and the macroscopic scale. For
example, in polymer gels, this length-scale is set by the distance between the cross-links in
the gel. Phase diagrams of polymer and its rheology was studied using a simple bead-andspring model. This model can be used to predict linear viscoelastic behavior. No
hydrodynamic interactions were considered. For polymer-gels, the nature of the chemistry is
not as important as the life-time structure of the polymer connections are.
Three methods used to describe polymers confined to lattice conformations: Monte Carlo
methods of lattice polymers, self-consistent field theory and dynamic density functionality
theory are not well suited for branched polymers. The full connection from atomistic to the
macroscopic world cannot be made. DPD, discrete particle dynamics simulation technique
was introduced by Hoogerbruge and Koelman. The simulation of soft spheres was performed
whose motion is governed by certain collision rules.
The force acting on a particle consists of three parts each of which is pairwise additive.
The three forces are as follows:
FC (conservative force)
(3.375)
FD (dissipative force
(3.376)
Fk (random force
(3.377)
177
They showed that the dissipative force and the random force have to satisfy a certain
relation.
FijC
fi
FijD
FijR
(3.378)
j i
where the sum runs over all other particles within a certain cut-off radius rc. Here the cut-off
radius, rc was taken as 1. The conservative force is a soft repulsion acting along the line of
centers and is given by;
^
FijC
aij 1 rij rij (rij < 1)
FijC
(3.379)
0 (rij 1)
aij is a maximum repulsion between particle i and particle j;

rij
ri
rij
rij
rij
rj
(3.380)
rij
rij
The remaining two forces are a dissipative or drag force and a random force. They are
given by;
FijD
FijR
rij
(3.381)
r ij vij r ij
rij
ij r ij
(3.382)
Where D and R are r dependent weight functions vanishing for r > rc =1.
where, vij = vi vj
ij (t) random fluctuating variable using Gaussian statistics.
ij (t )
ij
0
kl
t'
ik
jl
il
jk
t t'
(3.383)
These forces also act along the line of centers and conserve linear and angular
momentum. An independent random function for each pair of particles can be associated
178
with. One weight function can be chosen arbitrarily and the other is then fixed. A relation
between the amplitudes and kBT exist.
D
(1 r )2 ,(r 1),0, r
(3.384)
2 k BT
Euler-type algorithm was used to advance the set of positions and velocities;
ri t
ri t
tvi t
vi t
vi t
tfi t
fi t
fi r t
(3.385)
t ,v t
Random force becomes;

R
ij
rij
ij
1/2
r ij
(3.386)
Where, ij is a random number with zero mean and unit variance, chosen independently
for each pair of interacting particles and at each time step. In the context of DPD, a modified
version of the velocity-Verlet algorithm is as follows;
ri t
ri t
vi t
vi t
fi t
fi r t
vi t
vi t
t 2 fi t
2
tvi t
tf i t
(3.387)
t ,v t
t
fi t
2
t
fi t
It can be seen from Eq. (3.387) that the force varies with the velocity. If there is no
random or dissipative force present this algorithm would be exact to O
t 2 at = . The
order of algorithm is not clear because of the stochastic nature of the process. The stochastic
differential equations can be integrated and the random force can be interpreted as a Weiner
process. They considered the motion of a particle in a liquid. On account of collisions with
other particles a random force can be seen to be exerted on the particle. The mean force acting
on the particle is 0 but the variance of the force is finite. The force uncorrelated between time
steps;

2
179
f t ' dt '
0
2
(3.388)
t
N
fi
i 1
2 2
t
N
t t
The Fokker-Planck equation can be written as;

c
(3.389)
Where, c and D are evolution operators that can be extracted from the time-evolution
governing the motion of the particles. The Louisville operator of the Hamiltonian system
interacted with conserved forces FC, the second operator D contains the dissipative and noise
terms. The dissipative and random forces are set to zero. What is left is the Hamiltonian
system. In the canonical ensemble, the Gibbs-Boltzmann distribution can be seen as the
solution to the Fokker Planck equation.
eq
ri , Pi
Pi2
U
2 mkBT kBT
(3.390)
Eq. (3.390) is the solution of;

eq
c
eq
(3.391)
The time step size was chosen as a compromise between fast simulation the equilibrium
condition. The repulsion parameter a in Eq. (3.197) need be chosen. For the thermodynamic
state of an arbitrary liquid is to be described correctly by the soft sphere model, the
fluctuations in the liquid should be described correctly. The EOS of the polymer is obtained
from simulations: Pressure as a function of density for various repulsion parameters. The
virial theorem pressure P is obtained.
H. THERMODYNAMIC ANALYSIS
3.16. ANALYSIS OF NTE MATERIALS
3.16.1. Overview
The volume expansivity of pure substances is defined as [Smith et al. 2005];
180
1
V
V
T
(3.392)
P
It is a parameter that is used to measure the volume expansivity of pure substances and is
defined at constant pressure, P. In the field of materials science, the property of linear
coefficient of thermal expansion is an important consideration in materials selection and
design of products. This property is used to account for the change in volume when the
temperature of the material is changed. The linear coefficient of thermal expansion is defined
as;
lf
l0 T f
l0
T0
l
l0 T
(3.393)
For isotropic materials, = 3. Instruments such as dilatometers, XRD, X-ray diffraction

can be used to measure the thermal expansion coefficient. Typical values of volume
expansivity for selected isotropic materials at room temperature is provided in Table 3.9.
As can be seen from Table 3.9 the volume expansivity for pure substances are usually
positive. Some cases it can be negative. Examples of materials given with negative values for
volume expansivity in the literature are water in the temperature range of O 4 K, honey,
mononoclinic Sellenium, Se, Tellerium, Te, quartz glass, faujasite, cubic Zirconium
Tungstate, ZrW2O8 [Jakubinek et al. 2008] in the temperature range of 0.3 1050 K.
ZerodourTM [Askeland and Fulay, 2006] is a glass-ceramic material that can be controlled to
have zero or slightly negative thermal coefficient of expansion and was developed by Schott
Glass Technologies. It consists of a 70-80 wt % crystalline phase with high-quartz structure.
The rest of the material is a glassy phase. The negative thermal expansion coefficient of the
glassy phase and the positive thermal expansion coefficient of the crystalline phase are
expected to cancel out each other leading to a zero thermal coefficient material. ZerodurTM
has been used as the mirror substrate on the Hubble telescope and the Chandra X-ray
telescope. A dense, optically transparent and zero-thermal expansion material is necessary in
these applications since any changes in dimensions as a result of the changes in the
temperature in space will make it difficult to focus the telescopes appropriately. Material
scientists have developed ceramic materials based on sodium zirconium phosphate, NZP that
have a near-zero-thermal-expansion coefficient.
The occurrence of negative values of volume expansivity ab initio, is a violation of
second law of thermodynamics according to some investigators such as Stepanov [2000].
They propose that the first law of thermodynamics be changed from dU = dQ PdV to dU =
dQ + PdV in order to work with materials with zero or negative coefficient of thermal
expansion. In a famous problem such as the development of the theory of the velocity of
sound such a change from defining an isothermal compressibility to isentropic
compressibility brought the experimental observations closer to theory [Anderson, 2003]. The
proposal from this study is in part motivated by the work of Laplace (see II. Historical Note
below).
181

Table 3.9. Volume Expansivity of Selected Materials at Room Temperature
#
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
, Volume Expansivity (*10-6 K-1)

75.0
49.8
36.0
9.0
36.0
51.9
165.0
240
300.0
210
31.8
27.0
-27.0
-12.0
Negative
Negative
Material
Aluminum
Copper
Iron
Silicon
1020 Steel
Stainless Steel
Epoxy
Nylon 6,6
Polyethylene
Polystyrene
Partially Stabilized ZrO2
Soda-Lime Glass
Zirconium Tungstate ZrW2O8
Faujasite
Water (0 4 K)
Honey
3.16.2. Historical Note

By 17th century it was realized that sound propagates through air at some finite velocity.
Artillery tests has indicated that the speed of sound was approximately 1140 ft/s. These tests
were performed by standing a known large distance away from a cannon, and noting the time
delay between the light flash from the muzzle and the sound of the discharge. In proposition
50, Book II of his Principia Newton [1687] theorized that the speed of sound was related to
the elasticity of the air and can be given by the reciprocal of the compressibility. He assumed
that the sound wave propagation was an isothermal process. He proposed the following
expression for the speed of sound;
(3.394)
T
Where the isothermal compressibility is given by;
1
V
V
P
(3.395)
T
Newton calculated a value of 979 ft/s from this expression to interpret the artillery test
results. The value was 15% lower than the gunshot data. He attributed the difference between
experiment and theory to existence of dust particles and moisture in the atmosphere. A
182
century later Laplace [1787] corrected the theory by assuming that the sound wave
propagation was isentropic and not isothermal. He derived the expression used to this day to
instruct senior level students in Gas Dynamics [Anderson, 2003] for the speed of sound as;
(3.396)
s
1
V
V
P
(3.397)
s
By the demise of Napoleon the great the relation between propagation of sound in gas
was better understood.
3.16.3. Theoretical Analysis

Clapeyron equation can be derived to obtain the lines of demarcation of solid phase from
liquid phase, liquid phase from vapor phase and solid phase from vapor phase in a PressureTemperature diagram for a pure substance. This can be done by considering a point in the
demarcation line and a small segment in the demarcation line. At the point the free energy of
the solid and liquid phases can be equated to each other at equilibrium. The enthalpy change
during melting can be related to the entropy change of melting at a certain temperature of
phase change. Along the segment the change in free energy dGs and dGl in the solid and
liquid phases at equilibrium can be equated to each other. The combined two laws of
thermodynamics are applied and an expression for dP/dT can be obtained. Sometimes when
ideal gas can be assumed this expression can be integrated to obtain useful expressions that
are used in undergraduate thermodynamics instruction. A similar analysis is considered here
using Helmholz free energy. At the point and segment of the phase demarcation line of solid
and liquid in a Pressure-Temperature diagram of a pure substance;
As
US
AL
dAs
dAL
TS S
U L TS L
T S SL
(3.398)
(3.399)
U SL
Applying the first and second law of thermodynamics to change in Helmholz free energy;
dA dU TdS
For reversible changes at equilibrium;
dA
PdV
PS dV sat
SdT
S s dT sat
(3.400)
dAL
PL dV sat
S L dT sat
dV
dT
sat
S SL
U SL
P SL
T P SL
183
(3.401)
For physical changes Eq. (3.401) can be seen to be always positive. This is because of the
lowering of pressure as solid becomes liquid and the internal energy change is positive
resulting in a net positive sign in the RHS, right hand side of Eq. (3.401). No ideal gas law
was assumed. Only the first two laws of thermodynamics was used and reversible changes
were assumed in order to obtain Eq. (3.401). Thus reports of materials with negative thermal
expansion coefficient is inconsistent with Eq. (3.401). What may be happening are chemical
changes. Strong hydrogen bonded water in 0-4 0K shrinks upon heating due to chemical
changes. This cannot be interpreted using laws that are developed to describe physical
changes. In the example of faujasite may be lattice structure changes take place upon heating.
What do you do ? For ideal gas, it is shown below that the volume expansivity can be related
to the reciprocal of absolute temperature. Per the third law of thermodynamics the lowest
achievable temperature is 0 0K. Hence volume expansivity is always positive for physical
changes. From Eq. (3.392);
1
V
V
T
From Maxwell Relations,
V
T
S
P
(3.402)
T
Eq. (3.402) can be seen to be the case as follows. The free energy G of pure substances is
defined as;
H TS
(3.403)
Where, H is the enthalpy (J/mole), S is the entropy (J/mole/K)
dG d H TS
dH TdS SdT
(3.404)
Combining Eq. (3.404) with the First Law of Thermodynamics,
dG TdS VdP TdS SdT VdP SdT

It may be deduced from Eq. (14) that;
(3.405)
184
G
P
G
T
V
(3.406)
S
(3.407)
G
T
(3.408)
The reciprocity relation can be used to obtain the corresponding Maxwell relation. The
order of differentiation of the state property does not matter as long as the property is an
analytic function of the two variables. Thus,
2
G
P T
G
T P
(3.409)
Combining Eq. (3.409) with Eq. (3.406);
V
T
S
P
(3.410)
T
Thus Eq. (3.410) can be derived. Combining Eq. (3.392) and Eq. (3.410);
S
P
(3.411)
T
For a reversible process, the combined statement of 1st and 2nd laws [Smith et al., 2005]
can be written as;
dH
TdS VdP
(3.412)
At constant temperature for reversible process for real substances;
H
P
T
T
S
P
(3.413)
T 1
(3.414)
Combining Eq. (21) and Eq. (19);
1
V
Or
H
P
185
1
T
1
VT
H
P
(3.415)
T
For ideal gases Eq. (3.415) would revert to the volume expansivity, would equal the
reciprocal of absolute temperature. This would mean that can never be negative as
temperature is always positive as stated by the third law of thermodynamics. So materials
with negative values for ab initio are in violation of the combined statement of the 1st and
2nd laws of thermodynamics. Negative temperatures are not possible for vibrational and
rotational degrees of freedom. A freely moving particle or a harmonic oscillator cannot have
negative temperatures for there is no upper bound on their energies. Nuclear spin orientation
in a magnetic field is needed for negative temperatures [Kittel, 1980]. This is not applicable
for engineering applications. Enthalpy variation with pressure is weak and small for real
substances. This has to be large to obtain a negative quantity in Eq. (3.415).
3.16.4. Proposed Isentropic Expansivity

Along similar lines to the improvement given by Laplace to the theory of the speed of
sound as developed by Newton (as discussed in Section II Historical Note) a isentropic
volume expansivity is proposed.
1
V
V
T
(3.416)
S
Using the rules of partial differential for three variables, any function f in variables
(x,y,z) it can be seen that;
f
x
f
x
f
y
V
P
y
x
(3.417)
z
Thus,
V
T
V
T
P
T
(3.418)
S
Let,
P
T
Plugging Eq. (27) into Eq. (26);
(3.419)
S
186
1
V
V
T
(3.420)
At constant pressure,
dH
dU
PdV
(3.421)
Eq. (3.421) comes from H = U + PV the definition of specific enthalpy in terms of

specific internal energy, U, pressure and volume, P and V respectively. Eq. (3.421) can be
written for ideal gas as;
CP CV dT
PdV
(3.422)
It can be realized from Eq. (3.422) that;
V
T
CP
P
CV
(3.423)
Plugging Eq. (32) into Eq. (30);
V
T
sV
CP
CV
CP
(3.424)
Or,
1
V
V
T
CP
CV
CP
V
VP
(3.425)
Eq. (3.425) can be written in another form as follows;

2
PT
s
VC p
V
2
T
(3.426)
The isobaric expansivity gets squared in Eq. (3.426). Even when negative values arise for
this quantity the isentropic volume expansivity can be expected to be positive as long as;
2
PT
VC p
2
T
(3.427)
For substances with negative coefficient of thermal expansion under the proposed
definition of isentropic volume expansivity, s does not violate the laws of thermodynamics
187
quid pro quo. Considering the thermal expansion process for pure substances in general and
materials with negative coefficient of thermal expansion in particular, the process is not
isobaric. Pressure can be shown to be related to the square of the velocity of the molecules.
3.16.5. Measurments of Volume Expansivity Not Isobaric

The process of measurement of volume expansivity cannot be isobaric in practice. When
materials expand the root mean square velocity of the molecules increases. For the materials
with negative coefficient of thermal coefficient the velocity of molecules are expected to
decrease. In either case, forcing such a process as isobaric is not a good representation of
theory with experiments. Such processes can even be reversible or isentropic. Experiments
can be conducted in a reversible manner and the energy may be supplied or may be removed
as the case may be. Hence it is proposed to define volume expansivity at constant entropy.
This can keep the quantity per se from violation the laws of thermodynamics.
3.16.6. Significance of Treatment of Materials with NTE

Recently, Miller et al. [2009] presented a review article on materials that were observed
to exhibit negative thermal expansion. Most materials demonstrate an expansion upon
heating. Few materials are known to contract. These materials are expected to exhibit a NTE,
negative thermal expansion coefficient. These materials include complex metal oxides,
polymers and zeolites as shown in Table 3.10. These can be used to design composited with
zero coefficient of thermal expansion. When the matrix has a positive thermal expansion
coefficient and the filler material has a negative thermal expansion coefficient the net
expansion coefficient of the composite can be dialed in to zero. They explore supramolecular
mechanisms for exhibition of NTE. Examples of materials where reports indicate NTE with
the references are as follows;
Table 3.10. Materials that Possess NTE
#
1.0
Journal
Acta
Crystallography
US Patent
J. Appl. Phys.
5.0
6.0
7.0
Material
ZrW2O8, Zirconium Tungstate (cubic
lattice)
(ZrO)2VP2O7
HfW2O8, Halfnium Tungstate
(orthorhombic)
ZrMo2O8, Zirconium molybdate,
(cubic)
Silicalite-1 & Zirconium Silicalite-1
CuScO2 (delafossite structure)
Polydiacetylene Crystal
8.0
Graphite Fiber Composites
Proc. of Royal
Society
2.0
3.0
4.0
Chem. Mater.
Mater. Res. Bulletin
Chem. Mater.
J of Polym. Sci.
Reference
[Evans et al., 1999]
[Sleight, 1994]
[Jorgensen et al.,
2001]
[Lind et al., 1998]
[Bhange et al. 2005]
[Li et al., 2002]
[Baughman et al.,
1973]
[Rupnowski et al.,
2005]
188
A careful study of these materials under isentropic heating is suggested. The volume
expansivity then will be within the predictions of the laws of thermodynamics. Further studies
on chemical changes on heating for these materials are suggested. Strong hydrogen bonded
systems may also be considered as strongly interacting systems.
3.16.7. Conclusions
For physical changes Eq. (3.401) can be seen to be always positive. This is because of the
lowering of pressure as solid becomes liquid and the internal energy change is positive
resulting in a net positive sign in the RHS, right hand side of Eq. (3.401). No ideal gas law
was assumed. Only the first two laws of thermodynamics were used and reversible changes
were assumed in order to obtain Eq. (3.401). Thus reports of materials with negative thermal
expansion coefficient are inconsistent with Eq. (3.401).
For ideal gases Eq. (3.415) would revert to the volume expansively, would equal the
reciprocal of absolute temperature. This would mean that can never be negative as
2nd laws of thermodynamics.
sound as developed by Newton (as discussed in Section II Historical Note) an isentropic
volume expansivity is proposed by Eq. (3.416). This can be calculated using Eq. (3.426) from
isobaric expansivity, isothermal compressibility and a parameter that is a measure of
isentropic change of pressure with temperature. Eq. (34) can be used to obtain the isentropic
expansivity in terms of heat capacities at constant volume and constant pressure and
isothermal compressibility at a given pressure and temperature of the material.
Chemical changes have to be delineated from physical changes when heating the
material.
I. OPTIMIZATION STUDIES
3.17. LIGHT TO ELECTRICITY CONVERSION
OPTIMAL TEMPERATURE
The worlds largest electric power generating system using CSP concentrated solar power
technology has been commissioned by NRG solar along with Bright source energy in 2013.
The capacity is 392 MW. CSP used a field of mirrors to concentrate sunlight onto thermal
receivers mounted on top of towers. Lower cost of production and zero emissions are
expected from use of solar power plants. The technology is low risk. The efficiency of
conversion of sunlight to useful energy using photovoltaic cell technology hovers around
15%. Photovoltaic efficiency of PV cells is 8% for solar cells made from amorphous silicon.
Their efficiency has increased now to 14%. This can be further increased to 20% by use of
thin films that contain small amounts of crystals of silicon. Single crystal silicon can be used
189
to make the most efficient solar cells with 30% efficiency. These PV cells are more
expensive.
A team of researchers from North Carolina State University has fabricated a super
absorbing design that can be used in order to maximize the light absorption efficiency of the
thin film solar cells while minimizing the manufacturing costs, according to EE times Asia
dated March 3rd 2014. Their design can decrease the thickness of the semiconductor materials
in thin film solar cells by an order of magnitude without compromising the capability of solar
light absorption. 100 nm amorphous silicon layer is a requirement in state-of-the art solar cell
design. 90% of incident solar beam can be absorbed using 10 nm thick layer of amorphous
silicon.
In Figure 32.0 is shown the design of the super absorbing solar cell. The core of the
rectangular onion like configuration is made up of a semiconductor layer. This layer is coated
by 3 layers of AR, anti-reflection coating that transmits light at a greater efficiency. The
researchers first estimated the intrinsic light trapping efficiency of the semiconductor
material. Then they devised a structure where the light absorption efficiency is equal to that of
the intrinsic efficiency of the semiconductor material.
A team of scientists from CIT, California Institute of Technology, Pasadena, CA,
developed flexible solar cells that enhance the absorption of sunlight and hence the
photovoltaic efficiency using fraction of expensive semi-conductor material. According to
Harry Atwater, director of Caltechs Resnick Institute that focuses on sustainability research,
these solar cells have, for the first time, surpassed conventional light-trapping limit for
absorbing materials (Anon., 2010). They built their solar cells using silicon wires embedded
within a transparent, flexible polymer film. Black paint can absorb light well, but may not
generate electricity.
These solar cells convert most photons absorbed into electrical energy. These wires have
what is called a near perfect internal quantum efficiency. A high-quality solar cell is built for
high absorption of light and good conversion of photons to electric current. These wires are
painted with anti-reflective coating prior to being embedded into the transparent polymer.
Each wire is about 1 mm in diameter and 30-100 mm in length. 2% of the material is silicon
and 98% polymer. This brings down the cost of the solar cell. These solar cells are also
flexible. Photovoltaic cells respond only to a narrow part of the suns spectrum. In order to
circumvent the lower efficiency on account of absorption of narrow part of the spectrum some
developers prepare layered materials. The efficiency goes up, but the material becomes
expensive as well.
Figure 37.0. Design of Super absorbing Solar Cell Design with Higher Light Absorption Efficiency.
190
Cloudy days may lower the efficiency. Scientists at Ohio State University developed a
doped polymer, oligothiopene. The resulting substance was responsive to wavelengths from
300 nm to 1000 nm. The spectrum of ultraviolet (UV) to near infra-red is spanned in this
range. Traditional silicon cells, au contraire, function in the 600 nm to 900 nm range. This
narrower range is between orange and red. The doped polymer both fluoresces and
phosphoresces. Fluorescence emanates from electrons that get excited by incident rays of
sunlight travel from a higher energy state and drop back to a lower energy state. Some light is
emitted. The wavelength of the emitted light is in infrared range and not visible. This emitted
light is seldom reused. Reuse of emitted light may improve the photovoltaic efficiency. These
polymers are cheaper to produce compared with silicon. Hence they can be considered even if
their photovoltaic efficiencies are lower. The relaxation time (Sharma, 2005) of these
electrons during fluorescence of the doped polymer comes up from a few picoseconds in
other solar materials to a few microseconds.
A full spectrum solar cell that absorbs the full spectrum of sunlight from the near infrared
and far ultraviolet to electric current can be prepared from an alloy of indium, gallium and
nitrogen. This was made possible by a serendipitous observation by researchers at Lawrence
Berkeley National Laboratory interacting with the crystal-growing research team at Cornell
University and Japans Ritsumeikan University. This observation was that the band gap of the
semiconductor indium nitride is not 2 eV as previously thought, but instead is a much lower
0.7 eV. Solar cells made from this alloy would be the most efficient and can be lower in cost
as well.
The efficiency of photovoltaic cells is limited because of a number of factors. Some light
energy that gets absorbed is rejected as waste heat. There exists a band gap in semi-conductor
materials that the solar cells are made out of. Incoming photons of the right energy knock
electrons loose and leave holes and migrate in the np junction to form an electric current.
Photons with less energy than the band gap slip right through. Red light photons are not
absorbed by high-band-gap semiconductors. Photons such as blue light photons that possess
higher energy than the band gap are absorbed. Excess energy is dissipated as heat. There is a
maximum efficiency limit for a solar cell made from a single material for converting light
into electric power. This is about 30%. In practical applications it is about 25%. Stacks or
layers of different materials are attempted in order to increase the efficiency.
CIGS, CuInxGa1-xSe2 based photovoltaic thin films can deliver sunlight to electricity
conversion performance greater than that of CdTe or silicon based thin films. Nanosolar
(Contreras et al., 2006) has developed a process with high-throughput, high-yield printing of
nanoparticles onto low-cost substrates and formation of solar cells. CIGS based PV thin films
can deliver sunlight to electricity conversion efficiencies of 19.5% (Hegedus, 2006). NREL
has certified the solar cell efficiency of 14% achieved by nanosolar with lower cost materials
using nanotechnology. CIGS based thin films result in higher efficiencies. They are coated
with a homogeneously mixed ink of nanoparticles using wet coating techniques. CIGS rollprinting technology developed by nanosolar uses a combination of high-speed, high-yield,
nonvacuum, wet coating of nanoparticles onto low cost per unit area of metal foil substrates
with RTP (Rapid Thermal Processing) techniques. Nanosolars rapid thermal processing of
nanoparticle-based coatings resulted in solar-cell efficiencies confirmed by NREL (National
Renewable Energy Laboratory) to be 14.5% which amounts to a world record for any
printable solar cell.
191
New discoveries such as the CNT (carbon nanotubes) are expected to increase the
photovoltaic efficiency of solar cells to over 40%. For now, in areas, where the population
density is sparse, and sunlight is abundantly available for most of the year the solar power
plants may be profitable. This can be seen by a positive PW (present worth) value. They end
up using large area. The solar panels are not protected from birds and other forms of dust that
degrade their operations. Lenses and mirrors can be used to concentrate the sunlight and
energy storage devices can store the energy in useful chemical forms such as batteries for use
at night and during rainy days. Someday technology in solar energy generation will be as
technically efficient as that of the combined steam and gas cycle power plant. By use of both
the steam and gas turbines the Carnot cycle efficiency has been increased from 30% to 50%.
After nearly two centuries since the discovery of the steam engine by James Watt, from the
point of view of thermodynamics that defines the limits of machines, what are the issues
involved in solar power plant.
How can a paradigm shift be effected from: there is no such thing as a free lunch. Can
solar energy be used to power a robot that can be used for transportation? What happens when
this goes out of control? What are the hidden safety hazards in solar technology? Solar energy
may be tapped in three different ways; (i) Solar Thermal Power, (ii) Photovoltaic Panels, and
(iii) solar heaters. In method (i) steam is generated in large boilers to turn turbines and
generate electricity comparable in capacity to coal-fired boiler-based power plants.
Photovoltaic panels can be used to convert directly the solar irradiance (w/m2) into electricity.
This technology is used to meet peak load needs and distributed power needs. Small power
plants of up to 50 MW can be built using panels. The capacity of the recently commissioned
De Soto Solar Power Generation Center in Florida is 24 MW and is less than 50 MW. Solar
irradiance (w/m2) is used to heat water or air and can be used for residential heating purposes.
Solar power plant technology can be used to produce base-load, large-scale power at low
technical risk. These can replace coal-fired boiler based power plants. Heat energy storage
devices have been invented that can provide for uninterrupted services such as during the
night hours, rainy days, etc. Lunar power can also be tapped into. Heat storage elements used
are concrete, molten salts and pressurized water. The capital solar plant costs and the plant
utilization factor continue to affect the bottom line. Spain has five such plants under
development and two that have been already commissioned. Investments have been made in
several countries across the globe to advance the design of solar mirrors and lenses. These are
used to gather the sunlight and focus on a fuel source to generate of electricity. Full scale
commercial operations of such power plants with capacities in the range of 20-200 MW are
expected by 2011. The cost per kWh is continuing to be the main concern. Optimization
strategies that are being developed at this writing could lead to significant cost reductions and
may be expected to improve the overall output efficiency. Cost effective storage devices are
also expected.
Present worth (pw) of solar power plants: A rapidly declining cost curve is seen in the
photovoltaic cell technology (Sharma, 2011). The price of solar modules is expected to fall
from around $2/W today to $1 in the near future. The price per watt installed is likely to fall
from $6.0-$8.0 to $3.0 per watt. Dominant in the costs are power electronics and installation.
With current incentives in the United States and European Union the cost of electricity
generation using solar technology is in the range of the IGCC (Integrated Gasification
Combined Cycle) power generation plants. In the state of California the cost of electricity
192
from solar power plants is about 14-15 cents per kWh. This is against the 8-10 cents per kWh
cost of electricity from IGCC power plants. By 2013 with some incentives from the federal
government the cost of electricity from solar power plant is expected to fall to 10-12 cents per
kWh. The per kWh cost is sensitive to the capital cost and the cost of materials of
construction of the plant. Sequestration related carbon credits at $30 t-1 of CO2 can affect a
per kWh reduction of 3 cents. Government carbon tax, cost of capital are sensitivity
parameters on the bottom line of solar power plants.
Worldwide, the solar thermal power capacity can grow at least 30% per year from 2010
to 2020 or 2030. 200 GW of new power plant capacity can be added each year. About 1-2
GW per year could be added in 2012. Solar technology is relatively simpler. The NREL,
National Renewable Energy Laboratory, has identified potential for 6 TW (terra watts) of
solar thermal power in the Southwestern US.
The mass of the sun can be calculated from the period of the earth which is 365.25 days.
The mass of the sun is ~ 2 x 1033 gm. The surface temperature of the sun is 5500 0C. Few
things are known about the light to electricity conversion. The Carnot limit of efficiency of
any man made machine is given by;
carnot = (1 T0/TH)
(3.428)
E = h = hc/
(3.429)
From the Plancks theorem,
The IV, current-voltage characteristics of a photodiode cannot be described using the

Ohms law of electricity. GaAs multijunction devices are the most efficient solar cells
reaching a record high of 40.7%. 20-30 different semi-conductors are layered in series. AR,
antireflection coatings can be used to minimize reflection from the top surface. The IV
characteristics can be given by;
I = I0(exp (qV/kBT) 1) qAG0(Lp+Ln)
(3.430)
33% of solar insolation is lost as waste heat. The temperature of operation of the
photovoltaic module can be determined from energy balance as follows;
IT = cIT + UL(Tc Ta)
(3.431)
The physical significance of each term in Eq. (3.431) is as follows; The fraction of
radiation incident on surface of solar cells is given by (IT), where is the transmittance of
any cover; The efficiency of conversion of incident radiation into current is given by (cIT);
Radiation and convection losses from top and bottom is given by (U L(TC Ta). Ta is the
ambient temperature. The temperature of the solar cell, Tc can be obtained by rearranging Eq.
(3.431);
Tc = Ta +(IT/UL)(1- c/)
(3.432)
193
It can be seen that as there exists an optimal working temperature of the solar cell. As the
amount of concentrated solar flux is increased the absorption efficiency first increases and
then decreases. As the working temperature increases the heat losses increase by radiation and
convection. The Carnot thermal efficiency increases. The optimal temperature of operation
for maximum efficiency can be arrived at. The heat losses vary as T4 and the efficiency
increases linearly with the working temperature. /T = 0 and the working temperature
solved for. The UL in Eq. (3.432), the overall transfer coefficient will vary with temperature.
J. ENGINEERING ANALYSIS
3.18. AMPACITY RISKS IN PCB INTERCONNECTIONS
3.18.1. Introduction
IHS, Information handling systems are used to process, compile, store and communicate
data for business personnel or for similar purposes. The ampacity risks on PCB, printed
circuit board interconnections need be better understood. Depending on the information
handled the IHS may differ from one application to the other. They may differ as to what
information is handled, how information is processed, stored, communicated and how soon
and efficiently the information may be processes, stored or communicated. IHS may be
configured for general use or for specific use such as passenger reservation in the airlines,
railways, credit card transactions, global communications, enterprise data storage. Variety of
hardware and software components may be configured to perform different tasks such as
storage, communication, processing. It may include computer, data storage and networking
systems.
During the design and manufacture of HIS one salient consideration is the detection of
areas of the system or circuit that are prone to certain risks. Corrective steps have to be taken
in order to minimize these risks. One example is the ampacity risks on circuit boards. The
circuit or interconnect may go back to the drawing board stage for rerouting. Ampacity is
defined [Murugam et al., 2009] as the current in amperes that a conductor can carry
continuously under the conditions of use without exceeding the temperature rating or fuse
point. The simulation, analysis, validation to laboratory data the DC, direct current and short
duration AC, alternating current transient pulse effects on the ampacity risks on PCB
interconnectivity is needed. This would result in assessment of ampacity risks on PCB
interconnections and improvement of the reliability of the operation of IHS. One critical
aspect to this aspect is the computation of heat conduction at short times where non-Fourier
effects can be expected. The damped wave conduction equation may be applicable here. The
damped wave conduction and relaxation equation was sought over Fouriers law of heat
conduction for eight reasons by Sharma [2005].
The damped wave conduction and relaxation equation was originally suggested by
Maxwell [1867], and postulated independently by Cattaneo [1948, 1958] and Vernotte
[1958]. The damped wave conduction and relaxation equation in one dimension across
constant area may be written as follows;
194
qx
kA
T
x
rA
qx
t
(3.433)
Where qx is the heat transfer rate in x direction in (watts, w), A is the cross-sectional area
across which the heat conduction occurs in (m2), k is the thermal conductivity of the material
in (w.m-1.K-1), r is the relaxation time (s).
Reviews of the use of this equation have been presented by Joseph and Preziosi [1989]
and Ozisik and Tzou [1996]. Extensive theoretical treatment of the equation have been
reported by Tzou [1996] and Sharma [2005]. Experimental measurement of relaxation times
has been reported by Mitra et al. [1995] recently for biological materials. Taitel [1973] found
a overshoot in his transient temperature solution for a finite slab subject to constant wall
temperature boundary condition. Bai and Lavine [1995] was concerned about Eq. (3.433)
violating the second law of thermodynamics. Zanchini [14], Barletta and Zanchini [2003],
calculate a entropy production term and are concerned of a violation of Clausius inequality.
Al Nimir et al. [2000] discuss an overshoot and equilibrium entropy production. Haji Sheik
et al. [2002] point out some anomalies in Eq. (3.433). Tzou [1996] has found Eq. (1) to be
admissible within the framework of second law of thermodynamics. Sharma [2003,
2006,2007,2005] have presented closed form analytical solutions for different geometries that
are within the bounds of second law of thermodynamics. He has derived the damped wave
equation by accounting for acceleration of the molecules in the Stokes-Einstein formulation.
He has proved that when physically reasonable initial condition is used the overshoot
disappears. Final condition in time was used and bounded solutions without violation of
second law of thermodynamics were presented. Antaki [1998] has discussed some analytical
solutions for convective boundary condition. In this study the damped wave conduction
equation is studied in 3D, three dimensions and analytical solution derived. The solutions are
in the form of Bessel composite function of the third order. The derived spatio-temporal
temperature profiles can be used to gauge the ampacity risks in PCB interconnections.
3.18.2. Theory
The defectregion is modeled as a spherical shell with radius R0. An energy balance on
the spherical shell at a distance r from the origin can be written and when combined with the
damped wave conduction and relaxation equation can be written as;
2
T
t
r2
T
r
(3.434)
Let;
T T0
;
Ts T0
t
r
;X
(3.435)
r
195
Eq. (3.434) is made dimensionless by using the variables defined in Eq. (3.435). Eq.
(3.434) becomes;
2
X2
u
X
(3.436)
The time and space conditions can be written as;

= 0, u = 0
(3.437)
= , u = 1
(3.438)
> 0, X= XR0, u = 1
(3.439)
X = , u = 0
(3.440)
Consider the substitution, V = u/X. Eq. (4) becomes,

2
2V
4
X
V
X
X2
(3.441)
The damping term can be removed by a u = wexp(-n) substitution. As shown in the

preceding sections for n = , Eq. (9) becomes;
2
W
4
2W
X
4
X
W
X
X2
(3.442)
Let = 2 X2
The term 2W/X2 can be neglected for large X. W is small for large r as u = Wexp(-/2)/r.
For large X Eq. (10) can be modified as follows;
Now,
4
X
W
X
12
2
2
W
2
W
4
W
16
(3.443)
(3.444)
(3.445)
196

Comparing Eq. (13) with the generalized Bessel equation the solution is;
a = 3; b = 0; c = 0; d = -1/16; s =
The order p of the solution is then p = 2 sqrt(1) = 2
2
I2
W
c1
X2
K2
2
2
c2
X2
X2
X2
(3.446)
c2 can be seen to be zero as W is finite and not infinitely large at = 0.

2
I2
V
c1e
X2
2
2
2
(3.447)
X2
An approximate solution can be obtaining by eliminating c1 between the above equation

and the equation from the boundary condition.
2
I2
1
X R0
c1e
X R2 0
2
2
2
(3.448)
X R2 0
Thus for > X

2
1
X R0
X R2 0
X2
I2
X2
2
(3.449)
2
I2
X R2 0
2
For X > ,
X
X R0
X2
X R2 0
J2
X2
2
2
I2
X R2 0
2
(3.450)
197
On examining Eq. (3.450) it can be seen that the Bessel function of the second order and
first kind will go to zero at some value of . The first root of the Bessel function occurs when
(X2 - 2 )1/2 = 5.1356
(3.451)
X2 - 2 = 105.498
(3.452)
Or
When an exterior point in the infinite sphere is considered a lag time can be calculated
prior to which there is no heat transfer to that point. After the lag time there exists two
regimes. One is described by Eq. (3.450) and the third regime is described by Eq.(3.449).
Thus,
lag = sqrt( Xp2 - 105.498)
All the three dimensions of the spherical coordinates are considered. The V = u/r
substitution is used and the spatio-temporal temperature in the infinite sphere is derived as
follows;
The governing equation for the temperature is obtained when the energy balance equation
and the constitutive damped wave diffusion and relaxation equation are combined. The
equation is made dimensionless by using the substitutions in Eq. (3.435).
Then the governing equation in three dimensions in spherical coordinates can be written
as;
2
2
X
u
X
1
X
u
2
1
X
Xp = 11 (tou > X)"
Sin2
Cot
X > tou"
0.5
0.45
Concentration
(C - Co)/(Cs - Co)
0.4
0.35
0.3
0.25
0.2
0.15
0.1
0.05
0
0
10
20
30
40
Dimensionless Time
Figure 38.0. Three Regimes of Dimensionless Temperature at a Exterior Point from the Defect.
(3.453)
198

Consider the substitution, V = u/X. Eq. (21),
2V
4
X
1 2V
X X2
V
X
Sin2
Cot
X2
(3.454)
The damping term can be removed by a V = wexp(-n) substitution. As shown in the

preceding sections for n = , Eq. (22) becomes.
2
W
2
W
4
2W
X
4
X
W
X
W
4
2W
Sin2
Cot
(3.455)
For small ,
2
W
2
4
X
W
X
Sin2
W
2
(3.456)
Let = X,
2
1
X
(3.457)
= XSin,
2
Then,
Sin2
(3.458)
Eq. (24 )then becomes for large X,

2
W
2
W
4
4
X
W
X
(3.459)
Consider the transformation, = ( 2 X2 - 2 - 2

)
As shown above in Eq. (3.445) the derivatives in Eq. (3.459) in four independent
variables become converted into 1 independent variable, and Eq. (3.459) becomes;
2
Or,
W
2
18
9
2
W
4
W
16
(3.460)
Comparing Eq. (29) with the generalized Bessel equation the solution is;
(3.461)
199

a = 9/2; b = 0; c = 0; d = -1/16; s =
The order p of the solution is then p = 7/2
2
X2
2
I 7/2
W
c1
X2
7/2
c2
X2
X2
(3.462)
c2 can be seen to be zero as W is finite and not infinitely large at = 0. An approximate

solution can be obtaining by eliminating c1 between the above equation and the equation from
the boundary condition. The equation from the boundary condition can be written as;
2
I 7/2
X R 0 e 2 c1
X R2 0
(3.463)
X R2 0
Dividing Eq. (30) by Eq. (31)

2
X
X R0
X R2 0
X2
X2
I 7/2
(3.464)
I 7/2
X R2 0
2
For small X,
X
X R0
J 7/2
X R2 0
X2
X2
2 2
(3.465)
I 7/2
X R2 0
2
In the creeping heat transfer limit Eq.(3.459) can be approximated as;

2
W
2
W
4
4
X
W
X
W
2
W
2
(3.466)
After the transformation the PDE with 4 variables is converted to a Bessel equation in 1
variable:
200

2
W
16
(3.467)
The order of the Bessel solution for Eq. (3.467) can be calculated by comparing Eq.
(3.467) with the generalized Bessel equation and the solution is;
a = 4; b = 0; c = 0; d = -1/16; s = . The order p of the solution is then p = 3
2
X2
2
I3
W
c1
X2
X2
K3
2
c2
X2
(3.468)
c2 can be seen to be zero as W is finite and not infinitely large at = 0. An approximate

solution can be obtaining by eliminating c1 between the above equation and the equation from
the boundary condition. The equation from the boundary condition can be written as;
2
I3
X R 0 e 2 c1
X R2 0
2
(3.469)
X R2 0
Dividing Eq. (36) by Eq. (37),

2
X
X R0
2
2
X2
I3
X R2 0
2
X2
(3.470)
I3
X R2 0
2
For small X,
X
X R0
2
2
X2
J3
X R2 0
2
X2
(3.471)
I3
In the limit of zero radius of the defect;
X R2 0
2
201

2
X
X R0
I3
2
2
X2
X2
(3.472)
I3
For small X,
X
X R0
J3
2
2
X2
X2
(3.473)
I3
The solution is in terms of a Bessel composite function of the third order and first kind
for small X and a modified Bessel composite function of the third order and first kind for
times greater than X. The first root of the Bessel function of the third order was calculated by
using 17 terms of the series expansion of the Bessel function in a Pentium IV microprocessor
using a Microsoft Spreadsheet up to 4 decimal places. The root was found to be 6.3802.
Or
(X2 + 2 + 2 - 2 )1/2 = 6.3802
(3.474)
X2 + 2 + 2 - 2 = 162.828
(3.475)
When an exterior point in the infinite sphere is considered a lag time can be calculated
prior to which there is no heat transfer to that point. After the lag time there exists two
regimes. One is described by Eq. (3.473) and the third regime is described by Eq.(3.472).
Thus,
lag
X p2
2
p
2
p
162.828
(3.476)
K. MOLECULAR BASIS FOR CONSTITUTIVE LAWS

3.19. NON-FOURIER CONDUCTION EQUATION A CAPITE AD
CALCEM TEMPERATURE
Not all materials behave in the same manner. Some materials do not behave in the same
manner over all the conditions over which they are expected to be applied. For some
applications when the experimental observations cannot be explained using theoretical
models and for materials that have not been measured before constitutive equations that may
be more relevant may have to be derived. For example Newtons law of viscosity may not be
the best constitutive law for systems such as tomato puree or suspensions of gas and solid.
Fouriers law of heat conduction may not be the best possible relation between the heat flux
202
and temperature gradient for systems where the transfer of heat is transient. Phenomena were
short time scales or short space scales or very high heat flux or very high temperature gradient
have been found not be adequately represented by Fouriers law of heat conduction.
3.19.1. Introduction
Fouriers law of heat conduction [1822] and their analogs during; (i) mass diffusion Ficks law of mass diffusion [1855]; (ii) viscous momentum transfer - Newtons law of
Viscosity [1687]; (iii) electrical conduction - Ohms law of electricity [1817]; (iv) convection
Netwons law of cooling [1687] are laws derived used in engineering practice for nearly
two centuries. These laws have been developed from empirical observations atsteady state.
Certain times these laws are not sufficient to predict the experimental observations. There are
some reasons to seek an alternate equation to Fouriers law of heat conduction (Sharma
[2007]);
i) the microscopic theory of reversibility of Onsager [1931] is violated;
ii) neglects the time needed for the acceleration of heat flow by free electrons(Sharma,
[2006]);
iii) Singularities were found in a number of important industrial applications of the
transient representation of temperature, concentration, velocity [2005];
iv) development of Fouriers law was from observations at steady state;
v) Over prediction of theory to experiment have been found in a number of industrial
applications [Renganathan, K., 1990, Sharma, 2003, Sharma, 2009];
vi) Landau and Lifshitz observed the contradiction of the infinite speed of propagation
of heat with Einsteins light speed barrier [1987];
vii) Fouriers law breaks down at the Casimir limit [1938].
A non-Fourier heat conduction equation was postulated independently by Cattaneo
[1948] and Vernotte [1958]. This equation was first suggested by Maxwell from
considerations of kinetic theory of gases [1867]. Joseph and Preziosi[1989], Ozisik
and Tzou [1996 ] have reviewed the work done investigating this equation. Sharma
[2005, 2008a, 2008b, 2009, 2010] discussed several analytical solutions for transient
temperature obtained by use of this equation along with the energy balance equation.
He considered a semi-infinite medium at an initial temperature of T0 subject to a
constant surface temperature boundary condition for times greater than zero. The
hyperbolic PDE that forms the governing equation of heat conduction was solved for
by a new method called relativistic transformation of coordinates. The hyperbolic
PDE is multiplied by e/2and transformed into another PDE in wave temperature.
This PDE is converted to an ODE by the transformation variable that is spatiotemporal symmetric. The resulting ODE is seen to be a generalized Bessel
differential equation. The solution from this approach is within 12% of the exact
solution obtained by Baumeister and Hamill using the method of Laplace transforms.
There are no singularities in the solution. There are three regimes to the solution: a)
inertial regime; b) regime characterized by Bessel composite function of the zeroth
order and first kind and; c) a regime characterized by modified Bessel composite
function of the zeroth order and first kind. Expressions for penetration length and
203
inertial lag time are developed. The comparison between the solution from the
method of relativistic transformation of coordinates and the method of Laplace
transforms was made by use of Chebyshev polynomial approximation and numerical
integration. In a similar manner, the exact solution to the hyperbolic PDE is solved
for by the method of relativistic transformation of coordinated for the infinite
cylindrical and infinite spherical medium. For the case of heating a finite slab the
Taitel paradox problem is revisited. Taitel [1972] found that when the hyperbolic
PDE was solved for the interior temperature in the slab was found to exceed the wall
temperature of the slab. This is in violation of the second law of thermodynamics
[Bai, 1995, Zanchini, 1999, Barletta and Zanchini, 2003]. By use of the final
condition in time at steady state the wave temperature was found to be become zero
at steady state. This condition when mathematically posed as the 4th condition for
the second order PDE leads to well bounded solutions within the bounds of second
law of thermodynamics. For systems with large relaxation times, i.e.,
2
, subcritical damped oscillations can be seen in the temperature. In a

a2
similar manner the transient temperature for a finite sphere and finite cylinder are also
derived.
Nanoscale effects in time domain [Sharma, 2009] is as important, if not more as
nanoscale phenomena in space domain in a number of applications. When the advances in
microprocessor speed is approaching the limits of physical laws on gate width and
miniaturization, there is incentive to re-examine the physical laws at a level of scrutiny never
done before. In this study, the acceleration of the electron is accounted for in the formulation
of free electron theory. The non-Fourier conduction equation that results is evaluated for use
in prediction of transient temperature in a finite slab.
r
3.19.2. Theoretical Development

3.19.2.1. Free Electron Theory
Ohms law of electric conduction and Fouriers law of heat conduction can be derived
from the free electron theory. The range of electrical resistivity of materials vary by 30 orders
of magnitude. The range of thermal conductivity of materials vary by 5 order of magnitude.
No one theory can predict the thermal and electrical conductivity of materials. The free
electron model is used. The outermost electrons of the atom are assumed to take part in the
conduction process. These electrons are not bound to the atom but are free to move through
the entire solid. These electrons have been called free electron cloud, free electron gas, or the
Fermi gas. Potential field due to the ion cores is assumed to be uniform throughout the solid.
The free electrons possess the same free energy everywhere in the solid. Because of the
electrostatic attraction between a free electron and the ion core this potential energy will be a
finite negative value.
Only energy differences are important and the constant potential can be taken to be zero.
Then the only energy that has to be considered is the kinetic energy. The kinetic energy is
substantially lower than that of the bound electrons in an isolated atom as the field of motion
204
for the free electron is considerably enlarged in the solid as compared to the field around an
isolated atom. The free electron theory can be used to better understand electrical conduction.
By Lorenz analogy [1892] the heat conduction can also be predicted in a similar manner.
The independent electron assumption was developed by Drude in [1905]. Some of the
assumptions in the free electron theory claim that electrons are responsible for all of the
conduction. The electrons behave like an ideal gas, occupy negligible volume, undergo
collisions, and are perfectly elastic. Electrons are free to move in a constrained flat bottom
well. Electron distribution of energy is a continuum.
3.19.3. Derivation of Alternate Non-Fourier Conduction Equation

Let the number of electrons per unit volume be given by n. This is the electron density in
the material during the conduction process. From the Boltzmann equipartition energy theorem
[1876] the microscopic temperature, T in (0K) can be given by;
(3.477)
Where kBis the Boltzmann constant, m is the mass of the electron in (kg) and ve is the
velocity of the free electron in (m.s-1). The heat flux, qz in (W.m-2) is the rate of energy
transfer across a cross-sectional area across the heat conduction path. The heat flux in terms
of the properties of the moving electron can be written as follows;
(3.477a)
Eq. (3.477a) is the product of Eq.(3.4777) and nve. Currently, the rate of energy transfer
across is estimated this way. This is sort of momentum flux of the electrons as well. The
applied temperature gradient acts as a driving force for the motion of the electron. Let the
collision time of the electron be given by in units of seconds. The applied force and
frictional force can be written from free electron theory as follows;
(3.478)
(3.479)
In this study, the acceleration of the electron is also taken into account. The derivations in
the literature for the Fouriers law of heat conduction from free electron theory assume that
the electron has attained a steady drift velocity. This assumption may be reasonable at steady
state. But in transient applications, immediately after the application of the temperature
gradient the electron would be in acceleration. This phase of the motion of the electron has
not been well studied in the literature. In this study this is taken into account. The Newtons
second law of motion may be applied to the moving electron(s) as follows;
205
(3.480)
Eliminating the velocity of the electron in Eq. (3.480) by using Eq. (3.477) leads to the
damped wave conduction and relaxation equation as shown earlier (Sharma [2006]). Here Eq.
(3.477) is differentiated with respect to time as;
(3.481)
Eliminating the acceleration of the electron term between Eq. (3.481) and Eq. (3.480) and
plugging Eq. (3.477a) for heat flux in place of the velocity of the electron;
(3.482)
Multiplying thoughout Eq. (7)
by Eq. (7) becomes;
(3.483)
The expression for thermal conductivity of the material from derivation at steady state
can be seen to be;
(3.484)
The coefficient to the rate of temperature variation with time term can be simplified as
follows.
The rate of temperature variation with time can henceforth be called as ballistic term.
This term is unique to the acceleration of the electron and is expected to become significant in
transient applications. The term ballistic can be used to denote acceleration effects.
(3.485)
In an earlier study (Sharma [2006]] the collision time of the electron was shown to be
3rwhere ris the relaxation time of materials as defined by Cattaneo [1948] and Vernotte
[1958]. The velocity of heat can be written as follows;
(3.486)
206
In terms of properties of moving electrons Eq. (3.486) can be rewritten as follows. Heat
capacity at constant volume, Cv by definition is the energy needed to raise one mole of a
substance by 1 0K. For one molecule this would be 1.5kB as a corollary of the equi-partition
energy theorem (Eq. (3.477)). The electron cloud is assumed to be ideal gas. It can be shown
that for an ideal gas (Sharma [2006]);
Cp
Cv
(3.487)
Eq. (3.487) is for one mole of the material. For one molecule of the material, Eq. (3.487)
can be written as follows;
Cp
Cv kB
Cp
mn
(3.488)
2.5kB
5kB n
2mn
(3.489)
Plugging Eq. (3.489), Eq. (9) and Eq. (3.477) into Eq. (3.486), Eq. (3.486) becomes;
vh
54kB2 nT
20mkB n
54kBT
20m
18
ve
20
0.95ve
(3.490)
Thus it can be seen from Eq. (3.490) that the velocity of the electron, ve is approximately
equal to the velocity of heat, vh. The velocity of heat is given in terms of the thermo physical
properties of materials as given in Eq. (3.486). Eq. (3.485) may be simplified as;
9kB2 nT
4mve
k
ve
Cpk
Cp
(3.491)
Plugging Eq. (3.491) into Eq. (3.483), Eq. (3.483) becomes;
qz
T
z
Cp
T
t
(3.492)
Eq. (3.491) is an alternate non-Fourier heat conduction equation compared with that
postulated by Cattaneo [1948] and Vernotte [1958]. Eq. (3.492) for heat flux comprises of
two parts: (i) one part that is the Fourier part that gives spatial gradient of temperature, both
transient and steady states and; (ii) second part that is the ballistic part that gives the
contribution of acceleration motion effects of the electron.
Another way of viewing the ballistic term is in terms of accumulation effects in time of
energy at the interfacial area through which the heat is travelling. In the kinetic representation
of temperature in terms of square of the velocity of the molecules as given by Eq. (3.477) the
heat flux across an interfacial area is defined as the energy of the molecules leaving the
207
surface less the energy of the molecules that enters the surface per unit time. Accumulation of
energy during the said time at the interfacial surface was neglected in the Fourier
representation of heat flux with spatial temperature gradient [Sharma, 2005]. Here the
accumulation of energy at the surface is also taken into account in the heat flux expression.
This added term can also be viewed as a place to capture the acceleration effects of the
moving electron under an applied temperature gradient/force. The postulated non-Fourier
equation of Cattaneo [1948] and Vernotte [1958] is restated as;
T
z
qz
t
(3.493)
3.19.4. Solution of Transient Temperature in a Finite Slab Using the

Alternate Ballistic Transport Equation
Consider a semi-infinite medium with homogenous thermo physical properties k, as
shown in Figure 39.0.
The initial temperature of the semi-infinite medium is T0 for times less than 0. At time 0
the surface of the semi-infinite medium are raised to a higher temperature Ts(Ts> T0) and
maintained constant at Ts for all times t > 0. The initial time condition and the boundary
conditions can be written as follows;
t = 0, 0 < x < , T = T0
(3.494)
t > 0, x = 0, T = Ts
(3.495)
t > 0, x = , T = T0
(3.496)
The energy balance equation in 1D, one dimension can be written as follows;
qx
x
Cp
T
t
(3.497)
Figure 39.0. Semi-Infinite Medium Subject to CWT, Constant Wall Temperature Boundary Condition.
208
The governing equation for temperature in 1D is obtained by combining Eq. (17) and Eq.
(22) and can be written as follows;
2
T
t
T
x t
(3.498)
Eq. (3.498) may be made dimensionless by the following substitutions;
T T0
Ts T0
;u
(3.499)

2
(3.500)
The dimensionless distance Z can be rewritten as;
x
r
(3.501)
vh
r
The physical significance of dimensionless distance can be seen to be the ratio of the
relaxation speed calculated for the disturbance to be seen at the considered point to the speed
of composite heat transfer in the medium due to both Fourier diffusive and ballistic/relaxation
mechanisms. The solution to Eq. (3.500) may be obtained by the method of Laplace
transforms. The Laplace transformed Eq. (3.500) may be written as follows;
su ( s)
d 2u ( s )
dZ 2
du ( s)
dZ
(3.502)
The solution to the second order ODE given by Eq. (27) can be written as follows;
u (s)
sZ
2
sZ 1
c1e
1
s
sZ 1
c2 e
1
s
(3.503)
From the undisturbed temperature, at ad infinitum, as given by BC in Eq. (21), c1 can be

seen to be zero.
209
u (s)
sZ
2
1
s
sZ 1
c2 e
(3.504)
c2 is obtained from the constant wall temperature BC as given in Eq. (20) and seen to be
given by (1/s). The solution for the dimensionless temperature in Laplace domain may be
written as follows;
sZ
2
u (s)
1
s
sZ 1
(3.505)
The lag property in Laplace transforms in invoked as follows;
Lf t
F ( s)
(3.505a)
The binomial infinite series expansion is written for the power ponentiation as follows;
1
s
1
s
1
8s
16s
128s 4
.....
(3.506)
Plugging Eq. (3.506) into Eq. (3.505), Eq. (3.506) becomes;
u (s)
sZ
2
Z Z
2 8s
sZ
Z
...
16 s 2
(3.507)
From the inversion tables of Laplace transforms in [Mickley et al., 1957];
I 0 2 kt
L1
k
es
(3.508)
By Eq. (33);
Z
I0
Z
2
e 8s
s
(3.509)
210
Z
8s2
L1 1
Z2
Z3
8s 2
16s 4
48s
Z
8
...
6
Z2 3
96
Z3 5
.... (3.510)
5760
By invocation of the convolution property the analytical solution may be obtained to

varying degrees of accuracy. An approximate solution by truncation of the 4th and higher
order terms in Eq. (3.510) leads to the solution for transient temperature. Upon using the lag
property as shown in Eq. (3.505a) the solution for transient temperature is given as follows;
Z
2I
3Z 2
4
Z
2
(3.511)
The solution to the transient temperature to with everything else such as the semi-infinite
medium used, boundary and time conditions used remaining the same except that the Fourier
model was used can be written as (Sharma, 2010) as follows;
u 1 erf
(3.512)
The solution to the transient temperature to with everything else such as the semi-infinite
medium used, boundary and time conditions used remaining the same except that the damped
wave conduction and relaxation model was used can be written as (Sharma, 2010]) as
follows;
2
X2
I0
0.5
u
I0
(3.513)
Eq. (3.513) is applicable for conditions where > X. For conditions where < X the
dimensionless temperature is given by;
J0
2 0.5
X2
4
u
I0
(3.514)
For conditions where = X, the dimensionless temperature is given by;
X
2
e2
(3.515)
211
Figure 40.0. Comparison of Transient Temperature from Fourier Model, Damped Wave Transport
Model and Ballistic Transport Model.
The predictions for transient temperature in a semi-infinite medium subject to CWT,

constant wall temperature boundary condition from the; (i) Fourier model; (ii) Damped Wave
Conduction and Relaxation Model and; (iii) Ballistic/Acceleration Model are plotted in
Figure 40.0 side-by-side for the same set of parameters at = 0.5. The theoretical predictions
from ballistic model as given by (3.514) were found to be closer in numerical value to the
theoretical prediction from Fourier model as given by Eq. (37) compared with that of the
theoretical prediction from damped wave conduction and relaxation model given by Eq. (38).
The transient temperature can be seen to be convex at short distances and change to concave
at later distances in the damped wave conduction and relaxation model. The transient
temperature from the ballistic model is also convex at shorter distances and changes to
concave later as a function of distance. The Fourier parabolic model for transient temperature
is concave as a function of distance. Eq. (3.511) is valid in the open interval, > 1.5 for
values of space and time when < 1.5Z;
Z
2J
3Z 2
4
Z
2
(3.516)
When = 1.5Z, the expression for transient temperature can be written as;
Z
2
(3.517)
212
The first zero of the Bessel function J0(y) occurs at y = 2.4048. Thus the penetration
distance Zpen can be estimated for a given instant of time, as follows;
2.4048
3Z 2pen
Z pen
(3.518)
3.19.5. Conclusions
An alternate non-Fourier heat conduction equation is derived from consideration of
translation motion of spin less electron under a driving force due to an applied temperature
gradient. This equation is a capite ad calcem, temperature. Elimination of the rate of change
of velocity with respect to time leads to a non-Fourier heat conduction equation with an
accumulation of temperature or ballistic term in it. The new constitutive heat conduction
equation is combined with the energy balance equation in 1 dimension. The governing
equation for transient temperature a partial differential equation (Eq. (3.498)) is solved for by
the method of Laplace transforms. The problem considered is the semi-infinite medium with
constant thermo physical properties with constant wall temperature boundary condition. A
closed form analytical expression for the transient temperature was obtained (Eq. (3.511))
after truncation of higher order terms in the infinite binomial series. This solution is compared
with that obtained using the parabolic Fourier model and the damped wave model as
presented in an earlier study. The predictions of Eq. (3.511) and Eq. (3.516) are closer to the
Fourier model; further work on Eq. (3.492) is underway.
Nomenclature
A
c
CP
Cv
G
H
l
m
P
S
T
U
v
V
Helmholz free energy (J/mole)

Speed of Sound (m/s)
Heat Capacity at Constant Pressure (J/kg/K)
Heat Capacity at Constant Volume (J/Kg/K)
Gibbs Free Energy (J/mole)
Specific Enthalpy (J/mole)
length of the box (m)
mass of molecule (kg)
Pressure (Nm-2)
Specific Entropy (J/mole/K)
Temperature (K)
Internal Energy (J/mole)
velocity of molecule (m/s)
Molar Volume (m3/mole)
213
Greek
P
s
T
s
Linear coefficient of thermal expansion (K-1)

Isobaric Volume Expansivity (K-1)
Isentropic Volume Expansivity (K-1)
Elongational Strain
Isothermal Compressibility (ms2/mole)
Isentropic Compressibility (ms2/mole)
molar density (mole/m3)
Subscripts
0
f
T
P
S
Intial state
Final state
isothermal
isobaric
isentropic
3.20. SUMMARY
Mathematical models can be used where pilot plant data is not available for scale-up.
Model development can lead to better understanding of the process. It can lead to better
project planning and decrease pollution to the environment. Dynamic process models can be
used to train operators, to design processes, to perform safety analysis, offer better process
control strategies, in project trouble shooting and in globalization. Process models can be
classified as: (i) Empirical Models; (ii) Semi-Empirical Models; (iii) Mechanistic Models;
(iv) Models from shell balance and equations of energy, continuity, mass, momentum and
charge; (v) supercomputer based models; (vi) computer simulations; (vii) mesoscopic models
and; (viii) Monte Carlo trials.
Biodiesel is a renewable fuel that can be made from vegetable oil and waste restaurant
greases by catalysed transesterification reactions. Over 5 billion gallons of biodiesel was
produced in 2010. The European Union and United States are seeing the sigmoidal portion of
the growth curve in biodiesel production.. Economic analysis such as profitability and
annualized worth (AW) of a biodiesel plant in Taiwan is presented. With the revenue from
glycerine by-product recovery and with lower raw material costs, biodiesel may be profitable
especially during days of higher gasoline prices. Multiple reactions of the consecutivecompetive type may be used to model the methonolysis of trigylcerides. The reaction rate
constant ratios and residence time in the reactor are important parameters in determining
higher selectivity of FAME, fatty acid methyl ester product yield over glycerol by-product
production. Illustrations of higher FAME yield, higher glycerol yield and cross-over from
214
FAME to glycerol are shown for some values of reaction rate constant ratios and .
Reaction scheme from triglycerides, to diglycerides to monoglycerides to glycerol along with
formation of FAME in each step by addition of methanol and catalyst are shown. Product
distribution curves are presented in Figure 2.0 5.0 for different values or reaction rate
constant ratios.
Projectile motion is an interesting topic for discussion in introductory physics courses.
Air resistance effects on projectile motion was studied. A 5 constant expression for variation
of CD vs. Reynolds number was used and the variation of air resistance with velocity was
taken into account. The air resistance force was the most (about 11.9%) in the initial and final
stages of the projectile. Closer to the maximum height the drag force is near zero. The
projectile motion with the air resistance was assymetrical. The effect of drag coefficient
variation with velocity was found as shown in Figure 4.0. Greater range was found for the
case of launch angle of 380 for the example considered compared with launch angles of 450
and 300 with air resistance. Maximum range of projectile without the air resistance can be
expected at a launch angle of 450. The use of Eq. (5) may be better than the use of a constant
value for CD during the entire trajectory. Studies are underway to include the Magnus effect
when there is circulation around the object. The case of geometric particles are also being
studied.
Trajectory of sedimenting particles can be simulated using desktop computers and
numerical integration. Viscous effects of the fluid can be accounted for the in the design
considerations of rectangular sedimentation tanks. Drag correlations with Reynolds number
for spherical and geometric particles uder laminar to transition to turbulent flow were used in
the computer simulations. By writing the acceleration term in terms of velocity the time
variabe is rendered implicit and an order reduction is achieved in governing equation. Fifth
order Runge Kutta method was used with success. Iron and sand particles were simulated.
Trajectories are shown as Figures. Sedimentation tanks needs to be made deeper to allow for
accelerating phase. Overflow rate is no longer independent of the tank height. Trade-offs
between pressure drop (pumping costs), separation efficiency achived and throughput (capital
costs) can be seen. Total cost can be optimized. Shape of the trajectory is plateau in the initial
stages and a sharper fall later. Trajectory of accelerating particles are found to be curvilinear
as opposed to linear for settled particles. Expression for terminal settling velocity of the
partilce in horizontal direction is now given by Eq. (24). Acceleration zone was found to be
shorter for geometric particles.
Sharma and Turton [1998] presented mesoscopic correlations between heat transfer
coefficients between gas-solid fludized beds and immersed surfaces using a de no vo
dimensionless group called frequency number. This is an example in semi-empirical models.
The correlations were scaled from theories such as Mickley and Fairbanks packet theory
[1955] and the theories that modify the packet theory. The experimental data was acquired in
a 5 cm fluidized bed over a wide range of powder types and fluidization regimes. The
correlations gave reasonable correspondence to experimental data given there was no
empirical fit or use of adjustable parameters.
Mechanistic models can be used to evaluate different mechanisms such as conduction or
convection in industrially important systems such as CFB, circulating fluidized beds. The
Peclect number is used to gauge the convective contributions. As the fluid flows away from
the surface both convection and conduction act in series and as the fluid flows toward the
surface the convection and conduction act with opposite effects. This can be used to obtain
215
the convective and conductive contributions by adding and subtracting the heat transfer
coefficients at the top and bottom of the tube. The convective contribution is given by Eq.
(2.23) and conductive contribution is given by Eq. (2.22). The same analysis was repeated for
accounting for damped wave conduction and relaxation effects. The method of Laplace
transforms was used in order to obtain the solution. A binomial series expansion in the
Laplace domain was used. Term by term inversion from Laplace domain to time domain for
13 terms are given in Table 2.1. The model was compared with representative experimental
data available in the literature.
The use of mathematical model in operations such as evaporative cooler was shown.
Humdification and heat exchange operations were modeled. The temperature and enthalpy
profiles are calculated and shown in Figure 2.4.
Diffusion and Reaction in Islets of Langerhans was studied using Parabolic and
Hyperbolic Models. This is needed to better treat Type I diabetes by the transplantation
method. Sharma Number can be used to evaluate when the wave term becomes important in
the application. It represents the ratio of Mass Transfer in Bulk to Relaxational Transfer.
Sharma number (mass) may be used in evaluating the importance of the damped wave
diffusion process in relation to other processes such as convection, Fick steady diffusion in
the given application. Four regimes can be identified in the solution of hyperbolic damped
wave diffusion model. These are; i) Zero Transfer Inertial Regime, 0 0
inertia ; (ii)
Rising Regime during times greater than inertial regime and less than at the wave front, X p >
; (iii) at Wave front, = Xp; (iv) Falling Regime in Open Interval, of times greater than at the
wave front, > Xp. Method of superposition of steady state concentration and transient
concentration used in both solutions of parabolic and hyperbolic models. Expression for
steady state concentration developed. Closed form analytic model solutions developed in
asymptotic limits of Michaelis and Menten kinetic at zeroth order and first order. Expression
for Penetration Length Derived Hypoxia Explained Expression for Inertial Lag Time
Derived. Solution within bounds of Second Law of Thermodynamics. No Overshoot
Phenomena Observed.
Centrifugal separation of oil and water from streams that is concentrated with oil such as
the ones from the oil spill disasters is investigated in this study. The existing theories are
largely for Stokes settling of oil drops. In this study two layers, one rich in oil and another
rich in water are allowed to spin in a centrifuge. The tangential velocity profile is derived
from the equations of continuity and motion. The power drawn at the inner rotor is calculated
for a set of parameters fo the system and a angular speed RPM. Each simulation required
the solution of four simultaneous equations and simultaneous unknowns. The power draw
was found to be log linear with angular rotor speed on a log-log plot. The viscosity of the oil
was increased five times to study the effect on the power draw. An expression of the
interlayer thickness ratio, was obtained by use of a component mass balance on oil streams
that flow in and out of the continuous centrifuge. was given in terms of , the ratio of the
inner and outer radii of the centrifuge, the mole fraction of oil in feed, peripheral layer and
inner layer.
State space models can be used to describe a set of variables in vector form in terms of
matrix equations. The stability of the system can be studied using Eigenvalues and
Eigenvector analysis. A scheme of 7 simultaneous simple irreversible reactions were
216
considered. The state space model to describe this system is given.. This system can be
viewed as an integrating system since all but Eigenvalues are negative with 4 Eigenvalues 0.
The composition of a copolymer as a function of comonomer composition, reactivity
ratios and reactor choice were derived from the kinetics of free radical initiation, propagation
and termination reactions. The copolymerization equation obtained using the QSSA quasisteady-state approximation is given. As an example, copolymer composition with 4
monomers as a function of monomer composition is illustrated in Example 3.1 made in
CSTR. The copolymer composition is sensitive to reactivity ratios to a considerable extent.
The copolymer composition equation for a multi-component copolymer with n monomers
were derived. This methodology was generalized for n monomers. The general form of the
equation was represented in the matrix form using linear algebra. The rate matrix and rate
equation is given.. The QSSA becomes in the vector notation;
K T (MM *T ) K(M * M
When the Eigen values of the rate equation become imaginary the monomer
concentration can be expected to undergo subcritical damped oscillations as a function of
time.
The occurrence of multiplicity in model solutions was illustrated by calculation of launch
angle of stream of water during firefighting and elbow-up and elbow down solutions in the
solution of inverse kinematics of a 3 arm manipulator with end effector (robot).
Use and significance of dimensionless groups such as Reynolds number, Prandtl number,
Biot number, Nusselt number, Mach number, Fourier number, Fick number, Newton number,
Maxwell number (mass), Venrnotte number, Sharma number (mass), Maxwell number
(momentum), Sherwood number, Shcmidt number, storage number/Sharma number (heat),
Peclect number were discussed.
Weiner-Hopf integral equation can be used to estimate the effects of mixing in a CSTR,
contiuous stirred tank reactor. This can be done by estimating the degree of mixedness from
the variance in SPC, statistical process control charts. The compositional distribution of AN
in copolymer can be used as input. J is minimized with respect to and the Weiner-Hopf
integral equation is obtained.
Groot and Warren [1997] developed a mesoscopic simulation tool. Molecules are treated
as spherical objects that can obey the Newtons laws of motion. Physical properties and EOS
of polymeric substances were obtained from this analysis. Conservative, dissipative and
random forces were taken into account. In the canonical ensemble, the Gibbs-Boltzmann
distribution can seen to be the solution to the Fokker Planck equation.
Damped wave conduction and relaxation equation is solved for in three dimensions in
order to gauge the ampacity risks in PCB interconnections. V = u/r substitution is used and
the temperature profile obtained in three dimensions and in 1 dimension. In the creeping
transfer limit, the spatio-temporal profile is given as a modified Bessel composite function in
space and time of the third order. Three regimes of solution are identified; (i) lag regime; (ii)
rising regime given by Bessel composite function in space and time and; (iii) rising regime
given by modified Bessel composite function in space and time. In the general case the order
of the solution was found to be 7/2 and the order of the solution was found to be two in the
case of one dimension.
217
Thermodynamic analysis of materials with negative thermal exmapnsion coefficient was

performed., For physical changes the expression for internal energy change can be seen to be
always positive. This is because of the lowering of pressure as solid becomes liquid and the
internal energy change is positive resulting in a net positive sign in the RHS, right hand side
of Eq. (3.401). No ideal gas law was assumed. Only the first two laws of thermodynamics
was used and reversible changes were assumed in order to obtain Eq. (3.401). Thus reports of
materials with negative thermal expansion coefficient is inconsistent with Eq. (3.401).
For ideal gases Eq. (3.415) would revert to the volume expansivity, would equal the
reciprocal of absolute temperature. This would meanthat can never be negative as
2nd laws of thermodynamics.
sound as developed by Newton (as discussed in Section II Historical Note) a isentropic
volume expansivity is proposed by Eq. (3.420). This can be calculated using expression from
isobaric expansivity, isothermal compressibility and a parameter that is a measure of
isentropic change of pressure with temperature. Eq. (34) can be used to obtain the isentropic
expansivity in terms of heat capacities at constant volume and constant pressure and
isothermal compressibility at a given pressure and temperature of the material.
Chemical changes have to be delineated from physical changes when heating the
material.
An alternate non-Fourier heat conduction equation is derived from consideration of
translation motion of spinless electron under a driving force due to an applied temperature
gradient. Thisequation is a capite ad calcem, temperature. Elimination of the rate of change of
velocity with respect to time leads to a non-Fourier heat conduction equation with a
accumulation oftemperature or ballistic term in it. The new constitutive heat conduction
equation is combinedwith the energy balance equation in 1 dimension. The governing
equation for transienttemperature a partial differential equation (Eq. (3.498)) is solved for by
the method of Laplacetransforms. The problem considered is the semi-infinite medium with
constant thermo physicalproperties with constant wall temperature boundary condition. A
closed form analytical expression for the transient temperature was obtained (Eq. (3.511))
after truncation of higher order terms in the infinite binomial series. This solution is compared
with that obtained using the parabolic Fourier model and the damped wave model as
presented in an earlier study. The predictions of Eq. (3.511) and Eq. (3.516) are closer to the
Fourier model, Further work on Eq. (3.492) is underway.
3.21. NOMENCLATURE
ratio of the interface radius with the centrifugal bowl radius

R
radius of the interface of oil and water
c1, c2,c3, c4 integration constants in tangential velocity profile
density ratio
height of centrifuge (m)
oil
water
218
R
oil
water
P
r
R
oil
water
r
T
v
vrot
vper
v
V
xF
xper
xrot
ratio of inner rotor radius with the centrifugal bowl radius

radius of the inner rotor (m)
viscosity of oil (Pa.S)
viscosity of water (Pa.s)
power draw at rotor (watts)
radial distance
radius of the centrifugal bowl (m)
density of oil (kg.m-3)
density of water (kg.m-3)
tangential shear stress (N.m-2)
torque (N.m.s-1)
residence time of fluid in centrifuge (hr)
tangential velocity of fluid (m/s)
volumetric flow rate of fluid out through the rotor (m3.hr-1)
volumetric flow rate of fluid through the periphery (m3.hr-1)
volumetric flow rate of fluid into the centrifuge (m3.hr-1)
volume of centrifuge (m3)
angular speed of rotor (rad.s-1)
weight fraction of oil in feed
weight fraction of oil in outlet stream through periphery
weight fraction of oil in outlet stream through inner rotor

Abraham, M. A. & Nguyen, N. (2005). Results from the Sandestin Conference: Green
Engineering: Defining Principle, Environmental Progress, Vol. 22, 233-236.
Al-Nimr, A. & Naji, M. (2000). The Hyperbolic Heat Conduction Equation in an
Anisotropic Material, Int. J of Thermophysics, 21, 281-287.
Al-Nimr, M. A. & Haddad, O. M. (2003). The Dual-Phase-Lag Heat Conduction Model in
Thin Slab under Fluctuating Thermal Disturbance, Heat Transfer Engineering, 24, 5,
47-54.
Anderson, J. (2003). Modern Compressible Flow with Historical Perspective, McGraw Hill
Professional, Third Edition, New York, NY.
Antaki, P. J. (1998). Solution for non-Fourier Dual Phase Lag Heat Conduction in a Semiinfinite Slab with Surface Heat Flux, International Journal of Heat and Mass Transfer,
Vol. 41, (14), 2253-2258.
Askleland, D. R. & Phule, P. P. (2006). The Science and Engineering of Materials, Thomson,
Toronto, Ontorio, Canada.
Avgoustiniatos, E. S., Dionne, K. E., Wilson, D. F., Yarmush, M. L. and Colton, C. K.
(2007). Measurements of the Effective Diffusion Coefficient of Oxygen in Pancreatic
Islets, IEC, Res., Vol. 46, 6157-6163.
Bai, C. & Lavine, A. S. (1995). On Hyperbolic Heat Conduction and Second Law of
Thermodynamics, J. Heat Transfer, 117, 2, 256-263.
219
Barletta, A. & Zanchini, E. (1997). Thermal-Wave Heat Conduction in a Solid Cylinder

which undergoes a change of Boundary Temperature, Heat and Mass Transfer/ Waremaund Stoffuebertragung, 32, 4, 285-291.
Baskakov, A. P., Berg, B. V., Vitt, O. K., Filippovsky, N. F., Kirakosyan, V. A., Goldobin, J.
M. & Maskaev, V. K. (1973). Heat Transfer to Objects in Fluidized Beds, Powder
Technology, Vol. 8, 273-282, Vol. 22, 2005, 233-236.
Batchelor, G. K. (1967). An Introduction to Fluid Dynamics, Cambridge University Press,
233-234, Cambridge, UK.
Baughman, R. H. & Turi, E. A. (1973). Negative Thermal Expansion of a Polydiacetyelene
Single Crystal, Journal of Polym. Sci., Polymer Physics, Vol. 11, 2453-2466.
Baumeister, K. J. & Hamill, T. D. (1971). Hyperbolic Heat Conduction Equation A
Solution for the Semi-Infinite Body Problem, ASME Journal of Heat Transfer, Vol. 93,
1, 126-128.
Bender, M. (1999). Economic Feasibility Review for Communit-Scale Farmer Cooperatives
for Biodiesel, Bioresource Technology, Vol. 70. 1, 81-87.
Bhange, D. S. & Veda. Negative Thermal Expansion in Silicalite-1 and Zirconium Silicalite1 having MFI Structure, Materials Research Bulletin, Vol. 41, 1392-1402.
Bird, R. B., Stewart, W. E. & Lightfoot, E. N. (2007). Transport Phenomena, John Wiley &
Sons, Second Edition, New York.
Boley, A. K. (1964). Heat Transfer Structures and M]aterials, Pergamon, New York.
Boltzmann, L. (1876). ber die Natur der Gasmolekle (On the nature of gas molecules).
WienerBerichte, 1876, 74, 553560.
Butcher, J. C. (1964). On Runge-Kutta Processes of Higher Order, J. Austral. Math. Soc.,
Vol. 4, 179.
Camp, T. R. (1936). A Study of the Rational Design of Settling Tanks, Sewage Works
Journal, Vol. 8, 9, 116-125.
Camp, T. R. (1946). Sedimentation and the Design of Settling Tanks, Trans. of American
Society of Civil Engineers, Vol. 111, 895.
Casimir, H. B. G. (1938). Note on the Conduction of Heat in Crystals, Physica, 5, 495 -500.
Cattaneo, C. (1958). A Form of Heat Conduction which Eliminates the Paradox of
InstantaneousPropagation, ComptesRendus, 247, 431-433.
Cattaneo, C. (1948). Sulla Coduzione del Calone, Atti. Sem. Fis. Univ. Moderna, 3, 83.
Chapra, S. C. & Canale R. P. (2006). Numerical Methods for Engineers, Mcgraw Hill
Professional, New York.
Chhabra, R. P. (1993). Bubbles, Drops and Particles in Non-Newtonian Fluids, CRC Press,
Baco Raton, FL.
Clift, R., Grace, J. R. & Weber, W. E. (1978). Bubbles, Drops and Particles, Academic Press,
New York.
Coe, H. S. & Clevenger, G. H. (1916). Methods for Determining the Capacities of SlimeSettling Tanks, Trans. of the American Institute of Mininig and Metallurgical Engineers,
vol. 55, 356.
Chandran, R. & Chen, J. C. (1982). AIChE Journal, Vol. 29, (6), 907-913.
Chapra, S. C. & Canale, R. P. (2006). Numerical Methods for Engineers, McGraw Hill
Education, New York, NY.
Chhabra, R. P. (1993). Bubbles, Drops and Particles in Non-Newtonian Fluids, CRC Press,
Baco Raton, FL.
220
Clift, R., Grace, J. R. & Weber, W. E. (1978). Bubbles, Drops and Particles, Academic Press,
New York.
Coles, D. (1965). J. Fluid Mech., Vol. 21, 385-425.
(2005). Congressional Record, Vol. 151 Part 4, 4544.
Connemann, J., Krallmann, A. & Fischer, E. (1994). Process for the Continuous Production
of Lower Alkyl Esters of Higher Fatty Acids, US Patent 5, 354, 878,
Craig, J. J. (2005). Introduction to Robotics: Mechanics and Control, Third Edition, Pearson
Prentice Hall, Upper Saddle River, NJ.
D. Scotts Appollo 15 Mission to Moon, Galileos Gravity Experiment in Moon: The
Hammer and the Feather. http://www.youtube.com/watch?v=4mTsrRZEMwA
Danckwerts, P. V. (1955). AIChE Journal, Vol. 1, 456.
Darnoko, D. & Cheryan, M. (2000). Continous Production of Palm Methyl Esters, Journal
of American Oil Chemists Society, Vol. 77, 12, 1269-1272.
Davis, M. L. (2011). Water and Wastewater Engineeering: Design Principles and Practice,
Deakin, M. A. B. & Troup, G. J. (1998). Approximate Trajectories for Projectile Motion
with Air Resistance, Am. J. Phys., Vol. 66, 1, 34-37.
Dobbins, W. E. (1964). Int. Conf. Water Pollution Res., Pergamon, New York, NY.
Drude, P. (1900). ZurElektronentheorie der metalle. Annalen der Physik, 1900, 306 (3), 566.
Evans, J. S. O., Davis, W. I. F. & Sleight, A. W. (1999). Structural Investigation of the
Negative- Thermal-Expansion Material ZrW2O8, Acta Crystallographica B, Vol. 55, 3,
333-340.
Fick, A. (1855). Ann Physik, Vol. 170, 59, Leipzig.
Fourier, J. B. (1822). Theorieanalytique de la chaleur, English Translation by A. Freeman,
1955, Dover Publications, New York; 1955.
Galileo, G. Le Opera di Galileo Galilei, Edizione Nazionale, 20. Vols. 1590/1610 On Motion,
Translated I. E. Drabkin, University of Wisconsin Press, Wisconsin.
Geldart, D. (1973). Types of Gas Fluidization, Powder Technology, 7, 285-292.
Groot, R. D. & Warren, P. B. (1997). Dissipative Particle Dynamics: Bridging the Gap
between Atomistic and Mesoscopic Simultion, J. Chem. Phys., Vol. 107, 11, 4423-4435.
Haider, A. & Levenspiel, O. (1989). Drag Coefficient and Terminal Settling Velocity of
Spherical and Nonspherical Particles, Powder Technology, Vol. 58, 63-70.
Hagen, G. H. L. (1839). Uber die Bewegung des Wassers in Engen Cylindrischen Rohren,
Poggendorfs Annalen der Physik and Chemie, Vol. 46, 423-442.
Halloun, A. & Hestenes, D. (1985). Common Sense Concepts about Motion, Am. J. Phys.,
Vol. 53, 11, 1056-1065.
Haji-Sheik, A. M., Minkowycz, W. J. & Sparrow, E. M. (2002). J. Heat Transfer, 124, 2,
307-319.
Hibbeler, R. C. (2010). Engineering Mechanics: Statics and Dynamics, Pearson Prentice
Hall, Upper Saddle River, NJ.
The Hindu, Chennai, India, February 27th 2006.
Higbie, R. (1935). Trans. AIChE Journal, Vol. 31, 365.
Jakubinek, M. B., Whitman, C. A. & White, M. A. (2008). Negative Thermal Expansion
Materials: Thermal Properties and Implications for Composite Materials, J Therm. Anal.
Calorim., DOI 1.1007/s10973-009- 0458-9, Japan Symposium.
221
Jaya, N. & Ethirajulu, K. (2011). Kinetic Modeling of Transesterification Reaction for

Biodiesel Production using Heterogeneous Catalyst, Int. J Engineering Science and
Technology, Vol. 3, 4, 3463-3466.
Johnson, A. S., OSullivan, E., DAoust, L. N., Omer, A., Bonner-Weir, S., Fisher, R. J.,
Weir, G. C. & Colton, C. K. (2011). Tissue Engineering Part C: Methods, Vol. 17, 4,
435-449.
Joseph, D. D. & Preziosi L. (1989). Heat Waves, Review of Modern Physics, 61, 41-73.
Jukes, T. H. & Cantor, C. R. (1969). Evolution of protein molecules in H. N. Munro, ed.
Mammalian Protein Metabolism., Academic Press, New York.
Jorgensen, J. D., Human, Z. & Short, S. (2001). Pressure-induced Cubic to Orthorhombic
Phase Transformation in the Negative Thermal Expansion Material HfW2O8, J of Appl.
Phys., Vol. 89, 6, 3184-3188.
Kimura, M. (1980). A Simple Method for Estimating Evolutionary Rate of Base Substitution
through Comparative Studies of Nucleotide Sequences, Journal of Molecular Evolution,
Vol. 16, 111-120.
Kittel, C. & Kroemer, H. (1980). Thermal Physics, Freeman & Co, Second Edition, New
York, NY.
Krawczyk, T. (1996). Biodiesel Alternative Fuel makes Inroads but Hurdles Remain,
INFORM, 1, Vol. 7, 801-829.
Kreith, F., Manglik R. M. & Bohn, M. S. (2010). Principles of Heat Transfer, Brooks/Cole,
Pacific Grove, CA.
Kulkarni, M. G. & K. Dalai, A. (2006). Waste Cooking Oil An Economic Source for
Biodiesel: A Review, Industrial & Engineering Chemistry, Vol. 45, 9, 2901-2913.
Landau, L. & Liftshitz, E. M. (1987). Fluid Mechanics, Pergamon, UK.
de Laplace, P. S. M. (1816). Sur la vitesse du son dans laire et dan leau, Annales de
Chimie et de Physique.
Lapple C. E. & Shepherd C. B. (1940). Calculation of Particle Trajectories, Ind. and Eng.
Chemistry, Vol. 32, 5, 605-617.
Levenspiel, O. (1999). Chemical Reaction Engineering, John Wiley & Sons, Third Edition,
New York, NY.
Li, J., Yokochi, A., Amos, T. G. & Sleight, A. W. (2002). Strong Negative Thermal
Expansion along the O-Cu-O Linkage in CuScO2, Chem. Mater., Vol. 14, 2602-2606.
Lind, C., Wilkinson, A. P., Hu, Z., Short, S. & Jorgensen, J. D. (1998). Synthesis and
Properties of the Negative Thernal Expansion Material Cubic ZrMo2O8, Chem. Mater.,
Vol. 10, 2335-2337.
Lord Raleigh. (1883). Phil. Transactions., 316.
Lorentz, H. A. (1892a). at the Internet Archive", La Thorieelectromagntique de Maxwell et
sonapplication aux corps mouvants, Archives nerlandaises des sciences exactes et
naturelles, 25, 363552.
Martin, A., Flynn, J. E. & Lange, H. (2011). Biodiesel Production Method, US Patent
8,030,505, B & P Process Equipment and Systems, LLC, Saginaw, MI.
Ma, F. & Hanna, M. A. (1999). Biodiesel Production: A Review, Bioresource Technology,
Vol. 70, 1-15.
Mason, M. & Weaver, W. (1924). The Settling of Small Particles in a Fluid, Physical
Review, Vol. 23, 412-426.
Maxwell, J. C. (1867). On the Dynamical Theory of Gases, Phil. Trans. Roy. Soc., 157, 49.
222
Mickley, H. S. & Fairbanks, D. F. (1955). Mechanism of Heat Transfer to Fluidized Beds,

AIChE Journal, Vol. 1, n3, 374-384.
Mickley, H. S., Sherwood, T. K. & Reid, C. E. (1957). Applied Mathematics in Chemical
Engineering, McGraw Hill, New York, NY.
Miller, W., Smith, C. W., Mackenzie, D. S. & Evans, K. E. (2009). Negative Thermal
Expansion: A Review, Journal of Material Sci., Vol. 44, 5441-5451.
Mitra, K., Kumar, S., Vedavarz, A. & Moallemi, M. K. (1995). Experimental Evidence of
Hyperbolic Heat Conduction in Processed Meat, Journal of Heat Transfer, Vol. 117, 568573.
Moran, S. (Sep 12th 2006). Biodiesel Comes of Age as the Demand Rises, New York
Times.
Murugam, R. J. & Krishnan, S. (2009). System and Method to Analyze and Determine
Ampacity Risks on PCB Interconnections, US Patent 7,596,482, Dell Products, Round
Rock, TX.
Nelson, R. G. & Shrock, M. G. (1993). Energetic and Economic Feasibility associated with
the Production, Processing and Conversion of Beef Tallow to Diesel Fuel, in Proc. of
First Biomass Conference of the Americas: Energy, Environment, Agriculture and
Industry, Vol. 2, 848-862. NREL, National Renewable Energy Laboratory, Golden, CO.
(1687). Sir Isaac Newton, Philosophiae Naturalis Principia Mathematica.
Ohm, G. S. (1817). Grundlinienzueinerzweckmigen Behandlung dereometriealshheren
BildungsmittelsanvorbereitendenLehranstalten/entworfen (Guidelines for an appropriate
treatment of geometry in higher education at preparatory institutes/notes) Erlangen: Palm
und Enke.
Oil Spills, http://en.wikepedia.org.
Onsager, L. (1931). Reciprocal Relations in Irreversible Processes, Phys. Review, 37,405-426.
Ozisik, M. N. & Tzou D. Y. (1994). On the Wave Theory of Heat Conduction, ASME Journal
of HeatTransfer, 116, 526-535.
Podolski, W. F., Shmalzer, D. K., Conrad, V., Lowenhaupt, D. E., Winschel, R. A., Klunder,
E. G., Mcllvried III, H. G., Ramezan, M., Stiegel, G. J., D.Srivastave, R., Winslow, J.,
Loftus, P. J., Benson, C. E., Wheeldon, J. M. & Krumpelt, M., Lee-Smith, F. (2008).
Energy Resources, Conversion, and Utilization, Perrys Chemical Engineers Handbook,
Eds. D. W.Green, R. H. Perry, McGraw-Hill, New York.
Poiseuille, J. L. (1841). Recherches exprimentales sur le mouvement des liquides dans les
tubes de trs-petits diamtres, Comptes Rendus, (1841) Acadmie des Sciences, Paris.
Prandlt, L. (1952). Essentials of Fluid Dynamics, Harper, NY, USA, 105.
Parker, G. W. (1977), Projectile Motion with Air Resistance Quadratic in the Speed, Am. J.
Phys., Vol. 606, 606-610.
Renganathan, K. (1990). Correlation of Heat Transfer with Pressure Fluctuations in Gas-Solid
Fluidized Beds, Ph.D. Dissertation, West Virginia University, Morgantown, WV.
Renganathan, K., Turton, R. & Clark, N. N. (1989). Accelerating Motion of Geometric
and Spherical Particles in a Fluid, Powder Technology, Vol. 58, 279-284.
Renganathan, K. & Turton, R. (1989). Approximate Solution of Hyperbolic Heat Equation to
Predict Heat Transfer in Fluidized Beds to Immersed Surfaces, 81st AIChE Annual
Meeting, San Francisco, CA, USA, November.
223
Reynolds, O. (1883). An Experimental Investigation of the Circumstances which Determine

Whether the Motion of Water shall be Direct or Sinuous, and of the Law of Resistance in
Parallel Channels, Phil. Trans. of the Royal Society, Vol. 174, 935-982.
Reynolds T. D. & Richards, P. A. (1996). Unit Operations and Processes in Environmental
Engineering, PWS Publishing Co., Boston, MA.
Rupnowski, P., Gentz, M., Sutter, J. K. & Kumosa, A. M. (2005). An Evaluation of Elastic
Properties and Coefficients of Thermal Expansion of Graphite Fibers from Macroscopicc
Composite Input Data, Proc. of Royal Society, A, 461, 347-369.
Saxena, S. C., Grewal, N. S., Gabor, J. D., Zabrodsky, S. S. & Galerschtein, D. M. (1978).
Advances in Heat Transfer, Vol. 14, 149.
Schrezenmeir, J., Kirchgessner, J., Gero, L., Kuz, L. A., Beyer, J. & Mueller-Klieser, W.
(1994). Effect of Microencapsulation on Oxygen Distribution in Isets Organs,
Transplantation, Vol. 57, 9, 1308-1314.
Sharma, K. R. (2014). On Techno-Economic Evaluation of Biodiesel Production, Advances
in Energy Engineering, Vol. 2, 2, 23-30.
Sharma, K. R. (2014). On Bessel Composite Function of the Third Order and First Kind
Solution to Damped Wave Conduction and Relaxation in Arbitrary Direction, Journal of
Basic and Applied Physics, Vol. 3, 1, 26-34.
Sharma, K. R. (2013). On Thermodynamic Analysis of Materials with Negative Thermal
Coefficient of Thermal Expansion, Engineering, Vol 5, 11, 844-849.
Sharma, K. R. (2013). Is Overshoot a Mathematical Artefact, JP Journal of Heat and Mass
Transfer, Vol 7, 1, 35-64
Sharma, K. R. (2012). Power Draw of the Rotor during Centrifugal High Volume Separation
of Oil and Water, Journal of Mechanical Engineering Research, Vol. 4, 1, 10-16.
Sharma, K. R. (2012). On Two Dimensional Trajectory of Accelerating Particles in
Rectangular Sedimentation Tanks, Int. J Mech. Sys. Eng., Vol. 2, 3, 108-113.
Sharma, K. R. (2012). Process Instrumentation, Dynamics and Control, Cognella, San Diego,
CA.
Sharma, K. R. (2012). Polymer Thermodynamics: Blends, Copolymers and Reversible
Polymerization, CRC Press/Taylor & Francis Group, Baco Raton, FL.
Sharma, K. R. (2011). Fundamentals of Engineering Economics, Cognella, San Diego, CA.
Sharma, K. R. (2010). On Analytical Solutions during Damped Wave Conduction and
Relaxation in a Finite Slab Subject to the Convective Boundary Condition, Int. J.
Thermophysics, 31 ( 2). 430-443.
Sharma, K. R. (2010). On Damped Wave Diffusion of Oxygen in Islets of Langerhans: Part
I- Comparison of Parabolic and Hyperbolic Models in a Finite Slab, 102nd AIChE
Annual Meeting, Salt Lake City, UT, November.
Sharma K. R. (2010). Nanostructuring Operations in Nanoscale Science and Engineering,
Sharma, K. R. (2010). "On Analytical Solutions during Damped Wave Conduction and
Relaxation in a Finite Slab Subject to the Convective Boundary Condition", International
Journal of Thermophysics, Vol. 31, 2, 430-443
224
Sharma, K. R. (2009). Comparison of Solutions from Parabolic and Hyperbolic Models for
Transient Heat Conduction in Semi-Infinite Medium, Int. J of Thermophysics, Vol. 20,
5, 1671-1687.
Sharma, K. R. (2010). On Damped Wave Diffusion of Oxygen in Islets of Langerhans: Part
I- Comparison of Parabolic and Hyperbolic Models in a Finite Slab, 102nd AIChE
Annual Meeting, Salt Lake City, UT, November.
Sharma, K. R. (2009). Bioinformatics: Sequence Alignment and Markov Models, McGraw
Hill Professional, New Yor Sharma,
Sharma, K. R. (2009). Comparison of Solutions from Parabolic and Hyperbolic Models for
TransientHeat Conduction in Semi-Infinite Medium, In. J. Thermophysics, 30 (5), 16711687.
Sharma, K. R. (2008). Analytical Solution of Damped Wave Conduction and Relaxation in a
Finite Sphereand Cylinder, J. of Thermophysics and Heat Transfer, 22,( 4), 783-786.
Sharma, K. R. (2008). On the Solution of Damped Wave Conduction and Relaxation
Equation in a Semi-Infinite Medium Subject to Constant Wall Flux, Int. J. Heat and
Mass Transfer, 51, 25-26, 6024-6031.
Sharma, K. R. (2008). Analytical Solution of Damped Wave Conduction and Relaxation in a
Finite Sphereand Cylinder, J. of Thermophysics and Heat Transfer, 22, (4), 783-786.
Sharma, K. R. (2008). On the Solution of Damped Wave Conduction and Relaxation
Equation in a Semi-Infinite Medium Subject to Constant Wall Flux, Int. J. Heat and
Mass Transfer, 51, 25-26, 6024-6031.
Sharma, K. R. (2007). Damped Wave Conduction and Relaxation in Cylindrical and
SphericalCoordinates, J. Thermophysics. and Heat Transfer, 21, 4, 688-693.
Sharma, K. R. (2007). Principles of Mass Transfer, Prentice Hall of India, N. Delhi, India.
Sharma, K. R. (2006). A Fourth Mode of Heat Transfer called Damped Wave Conduction,
42nd Annual Convention of Chemists Meeting, Santiniketan, India, February.
Sharma, K. R. (March, 2003). Storage Coefficient of Substrate in a 2 GHz Microprocessor,
225th ACSNational Meeting, New Orleans, LA.
Sharma, K. R. (2009). Bioinformatics: Sequence Alignment and Markov Models, McGraw
Hill, New York.
Sharma, K. R. (March 26th March 30th, 2006). Errors in Gel Acrylamide Electrophoresis
Due to Effect of Charge, 231st ACS National Meeting, Atlanta, GA.
Sharma, K. R. (March 2007). On the Derivation of an Expression for Relaxation Time from
Stokes-Einstein Relation, 233rd ACS National Meeting, Chicago, IL, American Chemical
Society, Washington, DC.
Sharma, K. R. (2006). Manifestation of Acceleration during Transient Heat Conduction,
Journal of Thermophysics and Heat Transfer, Vol. 20, 4, 799-808.
Sharma, K. R. (2005). Damped Wave Transport and Relaxation, Elsevier, Amsterdam,
Netherlands.
Sharma, K. R. (November, 2001). Simulation of Instantaneous Local Heat Transfer
Coeffficient in Fine Particle Fluidized Beds, IMECE, New York, NY.
Coefficient in Slugging Fluidized Beds, IMECE, New York, NY.
Coefficient in Intermediate Sized Particle Fluidized Beds, IMECE, New York, NY.
225
Sharma, K. R. (2001). Simulation of Local Heat Transfer Coefficient for Coarse Particle
Fluidized Beds, IMECE, New York, NY, November.
Sharma, K. R. (2000). Thermal Terpolymerization of Alphamethylstyrene, Acrylonitrile and
Styrene, Polymer, 1305-1308
Sharma, K. R. & Turton, R. (1998). Mesoscopic Approach to Correlate Surface Heat
Transfer Coefficients with Pressure Fluctuations in Dense Gas-Solid Fluidized Beds,
Powder Technology, Vol. 99, 109-118.
Sharma, K. R. (March, 1998). Mixing in Helical Ribbon Agitatorsin Continuous Mass
Polymerization Reactor Is it Stochastic?, 30th IEEE Southeastern Symposium on
System Theory, Morgantown, WV, USA.
Sharma, K. R. (September, 1997). A Statistical Design to Define the Process Capability of
Continuous Mass Polymerization of ABS at the Pilot Plant, 214th ACS National Meeting,
Las Vegas, NV.
Shipman, J. T., Wilson, J. D. & Higgins, C. A. (2013). An Introduction to Physical Science,
Cengage Learning, Mason, OH.
Shiva Prasad, B. G. & Sharma, K. R. (2012). Alternative Energy for Energy Sustainability,
Annals of Arid Zone, Special Issue, April, Jodhpur, India.
Sleight, A. W. (1994). Negative Thermal Expansion Material, US Patent 5, 322, 559.
Smith, J. M., Van Ness, H. C. & Abbott, M. M. (2005). Introduction to Chemical
Engineering Thermodynamics, McGraw Hill Professional, 7th Edition, New York, NY.
Stebbins, E. J. (2009). Technical and Economic Feasibility of Biodiesel Production in
Vermont: Evidence from a Farm-Scale Study and a Commercial Scale Simulation
Analysis, Masters Thesis, University of Vermont.
Stepanov, L. A. (2000). Thermodynamics of Substances with Negative Thermal Expansion
Coefficient, Computer Modelling & New Technologies, Vol. 4, 2, 72-74.
Stokes, G. G. (1851). On the Effect of the Internal Friction of Fluids on the Motion of
Pendulums, Trans. of Cambridge Philosophical Society, Vol. 9, 8.
Subramanian, R. S. & Balasubramaniam, R. (2001). The Motion of Bubbles and Drops in
Reduced Gravity, Cambridge University Press, Cambridge, UK.
Sundaresan, R. & Kolar, A. (2002). Core Heat Transfer Studies in a Circulating Fluidized
Bed, Powder Technology, Vol. 124, 1-2, 138-151.
Taitel, Y. (1972). On the Parabolic, Hyperbolic and Discrete Formulation of Heat Conduction
Equation, Int. J. Heat Mass Transfer, 15, 2, 369-371.
Taylor, G. I. (1923). Phil. Trans. A223, 289-343. BP leak the worlds accidental oil spill
Telegraph, London, United Kingdon, 2010-08-03.
The Hindu, Science Day, February, 2006/
Treybal, R. E. (1980). Mass-Transfer Operations, McGraw Hill Professional, New York,
NY.
Turton, R., Bailie, R. C., Whiting, W. B. & Shaeiwitz, J. A. (1998). Analysis, Synthesis, and
Design of Chemical Processes, Prentive Hall, Upper Saddle River, NJ.
Turton, R. & Levenspiel, O. (1989). A Short Note on the Drag Correlation for Spheres,
Powder Technology, Vol. 47, 83-86.
Tzou, D. Y. (1996). Macro to Microscale Heat Transfer: The Lagging Behavior, CRC Press,
New York.
Varma, A. & Morbidelli, M. (1997). Mathematical Methods in Chemical Engineering, Oxford
University Press, New York, NY.
226
Vernotte, P. (1958). Les Paradoxes de la Theorie Continue de lequation de la Chaleur, C. R.

Hebd. Seanc. Acad. Sci. Paris, 246, 22, 3154-3155.
Weber, J. A. (1993). The Economic Feasibiloty of Community-Based Biodiesel Plants,
Masters Thesis, University of Missouri, Columbia, MO.
Williams, S. J., Schwasinger-Schmidt, T., Zamierowski, D. & Stehno-Bittel, L. (2012).
Diffusion into Human Islets in Limited to Molecules Below 10 kDa, Tissue and Cell,
http://dx.doi.org/10.1016/j.tice.2012.05.001
You, Y. D., Shie, J. L., Chang, C. Y., Huang, S. H., Pai, C. Y., Yu, Y. H. & Chang, C. H.
(2008). Economic Cost Analysis of Biodiesel Production: Case in Soybean Oil, Energy
& Fuels, Vol.22, 182-189.
Zanchini, E. (1999). Hyperbolic Heat Conduction Theories and non-Decreasing Entropy, Phy.
Review B- Condensed Matter and Material Physics, Vol. 60, (2), 991-997.
3.23. EXERCISES
Review Questions
1.0. How does the deepwater horizon spill provide impetus to study of dynamics and
control ?
2.0. What are the differences between empirical and semi-empirical models ?
3.0. What are the differences between mechanistic models and shell balance models ?
4.0. What are the differences between supercomputer based models and simulation
studies on a personal computer.
5.0. What are the differences between mesoscopic models and Monte Carol trials.
6.0. What is th e physical significance of frequency number ?
7.0. What is Brinkman number and what is the physical significance of this dimensionless
group.
Discuss the use and significance of the following dimensionless numbers (Exercise 8
23.0)
8.0. Froude Number
9.0. Fanning Friction Factor
10.0. Drag Coefficient
11.0. Aeration Number
12.0. Graetz Number
13.0. Heat Transfer Factor
14.0. Mass-Transfer Factor
15.0. Sharma Number
16.0. Storage Number
17.0. Power Number
18.0. Flow Number
19.0. Peclect Number
20.0. Condition Number
21.0. Separation Number
22.0. Schmidt Number
227
23.0. Sherwood Number

24.0. Maxwell Number (heat)/Vernotte Number
25.0. Maxwell Number (mass)
26.0. What is meant by blow-up in the model to predict heat transfer coefficient in
fluidized beds to immersed surfaces ?
27.0. What are the differences between convective contribution and conductive
contribution during the heat transfer between flow of dispersed systems past a
surface ?
28.0. Can radiation effects play a role during heat transfer between the dispersed systems
and surface in contact with ?
29.0. What is the differences in heat transfer expectations when fluid flow towards a
horizontal tube and when the fluid flow away from the tube ?
2
u
in Eq. (2.26) for
Y
temperature near a hot tube in a CFB, circulating fluidized bed.
31.0. Under what range of conditions is the binomial expansion used in Eq. (2.36) a
reasonable assumption to make ?
32.0. What are the differences between overall mass transfer coefficient and local mass
transfer coefficient as given in Eq. (2.49).
33.0. What are the differences between overall heat transfer coefficient and local heat
transfer coefficient as used in Eq. (2.48).
34.0. Can the coupled governing equations for temperature and humidity in a evaporative
cooler lead to instability under certain conditions ? Why not ?
35.0. What are the two mechanism of heat removal designed in a evaporative cooler ?
36.0. Rewrite the equations for the oil layer and water later during centrifugal separation
under transient conditions.
37.0. Guess the velocity profile of oil layer and water layer during transient conditions in
the centrifuge.
38.0. What is the significance of the separation efficiency in centrifugal separation as
given by Eq. (2.82) ?
39.0. What is the significance of a log-linear relation between power draw and rotor
speed during centrifugal separation ?
40.0. What is the signifance of toroidal vortice formation during centrifugal flow ?
41.0. Rewrite the state space model for a scheme of 7 simultaneous reactions in
series/parallel discussed in section 2.5.1 when the reactions are reversible.
42.0. What would happen to the rate matrix when temperature is changes in Eq. (2.100).
Assume that all rate constants obey a Arrhenius relationship.
43.0. Can multiplicity occur in calculation of time calculations during fire fighting ?
44.0. What are the differences between elbow-up and elbow-down solutions of the
joint angles of a 3 arm manipulator with end effector ?
45.0. What happens to the physical significance when a third dimensionless group is
formed by multiplication of two existing dimensionless groups.
30.0. What is the significane of the cross-derivative term,
228
Problems
46.0. Effect of Bubble Residence Time at the Immersed Surface in a Fluidized Bed
In section 2.2 the packet model developed by Mickley and Fairbanks [4] was
discussed in detail. The model equation that provides an expression for the time
averaged heat transfer coefficient between the fluidized bed and immersed surfaces
was given by Eq. (2.13). Rather than a exponential distribution of residence times of
the packets at the heat transfer surface consider an alternate bathing of solid rich
packet and gas rich bubbles at the surface. A saw tooth pattern may be assumed as
shown below in Figure 41.0.
Assume that the particle contact times as shown in Figure 41.0, tp1, tp2, tp3 etc
conform to a exponential distribution and the bubble contact times tb1, tb2, tb3 obey a
uniform distribution. What would the time average heat transfer coefficient, <hbs> ?
What happens to the blow-up at the asymptotical limit of zero contact time for the
instantaneous heat transfer coefficient between the bed and the surface ?
47.0. Simulation of Instantaneous Local Heat Transfer Coeffficient in Fine Particle
Fluidized Beds [35]
Fine particle fluidized beds in general can be characterized as Geldart A type
fluidization [39]. These are bubbling fluidized beds. The mean particle size is small
and density os less than 1.4 gm.cm-3. Beds in this group expand appreciably prior to
commencement of bubbling. Bed collapse is slow on cut-off of air supply. Gross
circulation of powder occurs even when few bubbles are present increasing the
mixing process. Bubbles split and recoalesce often. Bubbles rise at a greater velocity
compared with the interstitial gas velocity. Regardless of bubble size a maximum
bubble velocity was found. The ratio of the bubble cloud volume to the bubble
volume id negligible. The hydrodynamics of these beds are such that the bubble size
grow to a maximum bubble size. The bed expands uniformly beyond the minimum
fluidization bed height. The dominant frequency of pressure fluctuations can be
corresponded with the bubble frequency at the surface. This frequency can be taken
to be in the range of 1-6 Hz. Simulate a instantaneous heat transfer coefficient signal
as a function of time. Use the Mickley and Fairbanks packet theory to estimate the
packet heat transfer coefficient and Eq. (2.24) for the convective heat transfer when
the bubble stays at the surface. Plot the instantaneous simulated heat transfer
coefficient as a function of time.
48.0. Simulation of Instantaneous Local Heat Transfer Coefficient in Slugging Fluidized
Beds [36]
Slugs are bubbles that are bounded only by the walls of the fluidized bed chamber.
Slug frequencies may be taken to be about 2 Hz. During contact of the slugs and the
heat transfer surface it may be assumed that the primary mode of heat transfer is by
convection. Simulate a instantaneous heat transfer coefficient signal as a function of
time. The transient heat transfer as described in Mickley & Fairbanks[4] for Fourier
conduction or by Sharma [27] for damped wave conduction and relaxation can be
used for obtaining heat transfer coefficients during the time the packets are in contact
with the surface. A suitable statistical distribution such as exponential distribution for
packet arrival times or Poisson distribution for slug residence times at the surface
may be used for purposes of the simulation study.
229
49.0. Simulation of Instantaneous Local Heat Transfer Coefficient in Intermediate Sized

Particle Fluidized Beds [37]
Figure 41.0. Prototypical Trace of Instantaneous Heat Transfer Coefficient between Fluidized Bed and
Immersed Surfaces.
Fluidized beds with intermediate size particle size is classified under Geldart B type
fluidization. The particle size lies in the range 40 m dsv 500 m and instrinsic
particle density lies in the range of 1.4 g.cm-3 s 4.0 g.cm-3. Bubbling is seen as
soon as minimum fluidization velocity is reached. Bed expansion is small and the
bed collapse is rapid when the air supply is cut-off. There was found no powder
circulation in the absence of bubbles. Bubbles burst at the surface of the bed as
discrete entities. Bubbles rise more rapidly compared with the interstitial gas velocity
and bubble size increases linearly with both bed height and excess gas velocity (UUmf). Bubble coalsence is pronounced. There was found no maximum stable bubble
size. Bubble sizes have been found to be independent of mean particle size or particle
size distribution. Assume that the contributions from the particle conduction and gas
convection would be equal to each other. Simulate a instantaneous heat transfer
coefficient signal as a function of time. The transient heat transfer as described in
Mickley & Fairbanks[4] for Fourier conduction or by Sharma [18] for damped wave
conduction and relaxation can be used for obtaining heat transfer coefficients during
the time the packets are in contact with the surface. A suitable statistical distribution
such as exponential distribution for packet arrival times or Poisson distribution for
slug residence times at the surface may be used for purposes of the simulation study.
The gas convective contribution to the heat transfer coefficient can be given by Eq.
(2.24).
50.0. Simulation of Local Heat Transfer Coefficient for Coarse Particle Fluidized Beds
[38]
In coarse particle fluidized beds the thermal time constant of the particle [3] is larger
compared with the residence time of the particle at the surface. In such cases the heat
transfer coefficient from Fourier conduction through the particles can be neglected.
The gas flow is at a higher rate. This can lead to even turbulent flow. The gas
convective heat transfer contribution is more siginificant. Simulate a instantaneous
heat transfer coefficient as a function of time for such systems. Allow for bubble
contact with the surface. Choose an appropriate statistical distribution for the arrival
of packets and bubbles at the surface. The gas velocity in the dense phase is high.
51.0. Archimedes Number
230

The dimensionless group called Archimedes number can be given by the following
expression;
Ar
gd 3p
(3.519)
Where g is the acceleration due to gravity, (m.s-2), dp particle size (m), U is the
superficial velocity, m.s-1 and s and f are the densities of the solid particle and fluid
respectively. Discuss the significance of Archimedes number. Can it be used to
characterize fluidization behavior. Use Ref [39] if needed.
52.0. Grashoff Number
Discuss the use and significance of Grashoff number. How is Grashoff number used
in free convection problems. Can Raleigh Bernard instability be predicted using
Grashoff number analysis. Grashoff number can be calculated as follows;
Gr
Tl 3
(3.520)
Where l is the characteristic length (m) and is the kinematic viscosity (m2.s-1), is
the volumetric thermal expansion coefficient, T is the temperature difference
between the flat pate and surroundings far from the plate.
53.0. Morton Number
Discuss the use and significance of Morton number. How is Morton number used in
characterization of bubble shape and bubble velocity. Morton number can be
calculated as follows;
4
3
(3.521)
Where, is the viscosity of the fluid (Kg.m-1.s-1) and is the interfacial tension
(N.m-1) between the dispersed and continuous phases.
54.0. Eotvos Number
Discuss the use and significance of Eotvos number. How is Eatvos number used in
characterization of bubble shape and bubble velocity. Eatvos number can be
gd 2
Where d is the volume equivalent diameter.

55.0. Weber Number
(3.522)
231
Discuss the use and significance of Weber number. How is Weber number used in
characterization of bubble shape and bubble velocity. Weber number can be
U2 d
(3.523)
56.0. Anoxic Region in Trickle Bed Filter

Develop the concentration profile of Oxygen at steady state in the aerobic region in
Figure 42.0. Assume that the concentration of oxygen, at the interface of water and
aerobic region is CO2i. The tank is impervious to diffusion of oxygen. The bed
diameter if DT. Assume that the Michaelis Menten kinetics obeyed by the oxygen
reaction with the microorganisms reaches an asymptotic zeroth order and a
maximum reaction rate of Rmax. Show that the steady state concentration of Oxygen,
CO2 as a function of x is a quadratic equation. Further calculate the xT is the distance
beyond which there is no further diffusion of oxygen.
57.0. Capillary Number
Discuss the use and significance of Capillary number. How is capillary number used
in description of thermocapillary migration of drops, bubbles and particles. Capillary
number can be calculated as follows;
T d
(3.524)
Where the rate of interfacial tension gradient variation with temperature is given by
T
, (N.m-1.K-1) and d is the diameter of the drop, T is the temperature gradient
(K.m-1).
Figure 42.0. Anoxic Region in Trickle Bed Filter.
232

58.0. Marangoni Number
Discuss the use and significane of Marangoni number. How is Marangoni number
used in description of thermocapillary migration of drops, bubbles and particles in a
vertical temperature gradient. Marangoni number can be calculated as follows;
Mar
d 2C p
T
k
(3.525)
Where Cp is the heat capacity of the fluid, (J.Kg-1.K-1), is the viscosity of the fluid,
(kg.m-1.s-1) and k is the thermal conductivity of the fluid, (W.m-1.K-1).
59.0. HMM, Hidden Markov Model First Order
HMMs are constructed using concepts of conditional probability. The yare
increasingly used in bioinformatics applications (Sharma [40]). The sequence in
DNA, deoxy ribonucleic acid molecule can be represented using HMM. Multiple
alignments of protein sequence alignments can be achieved using HMMs. It can be
protein structure modeling, gene finding, phylogenetic analysis, modeling time
series, speech recognition, modeling coding and non-coding regions of DNA, protein
subfamilies and machine learning techniques and other areas.
A Markov chain is a sequence of random variables whose probabilities at a time
interval depends upon the value of the number at the previous time or previous
time(s). The controlling parameter in a Markov chain is the transition probability.
This is a conditional probability for the system to go to a particular new state, given
the current state of the system. In a kth order Markov chain the distribution of Xt
depends on the k values immediately preceding it.
Transition probability of Xt = P(Xt = X/Xt-k, Xt-k-1,., Xt-1)
The transition probabilities in a first order Markov model for Xt would only depend
on one previous value, Xt-1.
Given the sequence:
T: TATATGCGTAACCGGTT
Construct a first order HMM to represent the information in Sequence T. Show the
transition probabilities would be as shown in the Figure 43.0 below.
60.0. Second Order HMM
Construct a second order HMM to represent the information in sequence S.
S: ACGTTGACTGACTGTATACTGGTTAGTGT
Show that the dyad probabilities can be given by the values tabulated below;
S: ACGTTGACTGACTGACTGTATACTGGTTAGTGT
61.0. Two Balls Crossing Each Other.
A ball is thrown with an upward velocity of 3 m.s-1 from the top of a 10 m high
building. Half a second later another ball is thrown vertically from the ground with a
velocity of 7 m.s-1. Determine the height from the ground where the two balls pass
each other. Which of the following is best applicable for the crossing of the two
balls:
(i) Ascend of A and Ascend of B
(ii) Ascend of A and Descend of B
(iii) Descend of A and Ascend of B

(iv) Descend of A and Descend of B
Figure 43.0. First Order Markov Model to Represent Sequence T: TATATGCGTAACCGGTT.
Table 3.11. Second Order Markov Model to Represent Sequence
233
234

62.0. Cars Stopping Distance
A car travels on a rectilinear stretch if road at constant speed vi = 85 mph. At si =0,
the driver applies the brakes hard enough to cause the car to skid. Assume that the
car keeps sliding until is stops. Assume that throughout this process the cars
acceleration is given by
a = -kg
(3.526)
where the coefficient of kinetic friction, k = 0.7 and g is the acceleration due to
gravity. Estimate the cars stopping distance and time taken.
63.0. Trajectory of Basketball
The basketball is launched at a velocity of 5 m.s-1 at a launch angle of 40 0. What is
the height of the basket should the ball fall into the basket after 1.5 secs. The height
of the gentleman can be assumed to be 5 ft. 10. What is the maximum height
reached by the ball. The distance between the gentleman and the basket as measured
on the ground is 6 m.
64.0. Multiplicity
Jack Taylor drove his pick-up truck down a dirt road with variable acceleration. The
acceleration varies with displacement as follows;
a 2s 12
(3.527)
The initial velocity of the truck is 8 m.s-1 (18 mph). A cheetah from the woods came
across the path of Jack. Jack applied his brakes and the truck came to a halt after a
certain distance. What is the distance ? Do you obtain more than one answer ? If so,
which is the correct one ?
Figure 44.0. Trajectory of Basketball.
235
Figure 45.0. Launch Angle during Fire-Fighting.
65.0. Launch Angle during Firefighting

Calculate the launch angle of the stream of water that emanates from the hose the
fireman is holding in Figure 45.0. The height of the building where the fire is
rampant is 2.4 m and the distance between the launch location to building is 6 m. Do
you obtain more than one answer ? If so, what is the significance of the multiple
results ?
Figure 46.0. Belleville Spring Washers.
236

66.0. Belville Spring Washers
The cylinder has a weight of 11 kg and is pushed against a series of Belleville spring
Washers so that the compression in the spring is s = 1.8 cm (Figure 46.0). If the force
in Newton, of the spring on the cylinder is;
646 s
1
4
(3.528)
Where s is given in m, determine the speed of the cylinder just after it moves away
from the spring, i.e., at s = 0.
67.0. Projectile Launched from Roof Top
A projectile is launched with an initial velocity of 100 m/s from the rooftop of a 100
m tall building (Figure 47.0) at a launch angle of . Determine launch angle given
that the distance from the building to the place the projectile strikes the ground, R is
259.8 m.
68.0. Wedge Action
The s, coefficient of static friction for all contact surfaces shown in Figure 48.0 is
0.2.
Does the 50 lb force move the block A up, hold it in equilibrium or is it too small to
prevent A from coming down and B from moving out ? The 50-lb force is exerted at
the midplane of the blocks so that it can be considered as a coplanar problem.
Figure 47.0. Projectile Launched from a Rooftop.
237
Figure 48.0. Do blocks move ?.
69.0. Stopping Distance of Car during Rain on a Rough Road

Heavy rains cause a particular stretch of road to have a coefficient of friction that
changes as a function of location. Specifically, measurements indicate that the
coefficient of kinetic friction has a 3% decrease per meter. Under these
circumstances the acceleration of a car skidding while trying to stop can be
approximated by;
c1s
(3.529)
Let k = 0.5, c1 = 0.015 m-1. The initial velocity of the car is 12.5 m/s. Determine the
distance to complete stop or stopping distance. Compare the stopping distance in the
rain with that obtained during dry conditions under which case the rate of friction
decrement, c1 = 0.
70.0. Multiplicity in Launch Angle Calculation
The engine room of a freighter is on fire. A fire-fighting tuboat has drawn alongside
and is directing a stream of water to enter the stack of freighter as shown in Figure
49.0. If the initial velocity of the jet is 67 ft/sec find the value of the jet launch angle
that will get the job done.
71.0. Spring-Mass System in a Inclined Plane
Consider the spring-mass system in a inclined plane as shown in Figure 50.0. When s
= 0.3 m the spring is unstretched and the 5 kg block has a speed of 2 m/s down the
smooth plane. Determine the distance s when the block stops.
238
Figure 49.0. Fire in a Freighter and Jet of Water Directed from Fire-Fighting Tug Boat.
Figure 50.0. Spring Mass System in Inclined Plane.
72.0. Tension in Supporting Cables

The uniform concrete slab has a weight of 5500 kg. Determine the tension in each of
the three parallel supporting cables when the slab is held in the horizontal plane as
shown in Figure 51.0.
73.0. Time Taken for Elevator
The elevator starts from rest and can accelerate at 3 m/s2 and then decelerate at 1
m/s2. Determine the shortest time taken for the elevator to reach a floor 10 m above
the ground.
74.0. Variable Force
The force F acting in a constant direction on a 20 kg block has a magnitude that
varies with position s of the block as F = 50s. Determine how far the block slides
befor its velocity beomes 5 m/s. When s = 0, the block is moving to the right at 2
m/s. The coefficient of kinetic friction between the block and surfaces is 0.3.
239
Figure 51.0. Concrete Slab Supproted by Three Parallel Supporting Cables.
75.0. Crane Boom

Write the state space form of the equations of mechanical equilibrium of translation
and rotation. Solve for the reaction forces at Pin A and tension in the cable BC
(Figure 52.0).
Figure 52.0. Crane Boom.
240

76.0. Jukes-Cantor Model [41]
A phylogenetic tree is a representation of evolutionary relations among several
species with a common ancestor. P(Data/tree) is the chance of the sequence
occurring given the tree. P(tree/Data) is change of the tree occurring given the data.
During the course of evolution several substitutions of residues and deletions and
insertions may have occurred.
Mathematical models to track deletions and insertions can be developed. P(b/a, t) is
the probability of residue a being substituted by residue b iver a edge length t.
P x ,t
y
xu
yu
(3.530)
,t
x, y are two aligned gapless sequences. u represent sites in the alignment. Different
possibilities of P(b/a,t) for residues a and b are examined. A K x K matrix can be
written for alphabet of size K.
. . P
Ak
. . P
Ak
..
. .
. .
A1
A1
S t
A1
A1
A2
Ak
,t
A2
,t
,t
A2
A1
,t
Ak
,t
. . P
Ak
A1
A2
Ak
,t
,t
(3.531)
,t
For families of substitution matrices;
S t S s
S t s
(3.532)
i.e., the family is multiplicative for all values of lengths s and t.
P a b ,t P b c , s
P ac ,s t
(3.533)
For all a, c, s and t.

The substitution process is Markovian and stationary. The probabilities are
multiplicative. Jukes and Cantor [41] suggested a model for modeling DNA
sequences. A matrix R that contain rate of substitution can be written as follows;
3
3
(3.534)
3
3
241
The rows and columns are for the nucleotides Adenine, A, Cytosine, C, Guanine, G
and thymine, T. Nucleotides undergo transition at a constant rate . The substitution
matrix for a small time interval s() is given after approximation as;
I R
(3.535)
Where I is the identity matrix. By multiplicativity (I+R) becomes;
st
st s
st I R
(3.536)
In the limit of small ;
s t
s t
Rs t
(3.537)
ds t
dt
Rs t
Combining the above two equations;
dr
dt
ds
dt
3 r 3 s
(3.538)
Solve for these equations and obtain mathematical expressions for rt and st. Show
that at infinite time the nucleotide equilibrium, frequencies can reach a limit of 0.25.
77.0. Kimuras Modification [42]
The Jukes and Cantor model [30] does not capture some important features of
nucleotide substitution such as transitions from purine to purine or from pyrimidine
to pyrimidine substitutions are common. Transversions where the nucleotide type is
changed is rare. Kimura [31] proposed a model with the rate matrix;
2
2
(3.539)
2
2
Obtain the model equations and obtain the solutions. Show that the solutions can be
given by;
st
0.25 1 e
4 t
242
vt
0.25 1 e
4 t
2e
2t
(3..540)
rt = 1 2st - ut
78.0. Copolymer Composition
Discuss the Monomer Copolymer Composition Curve for the system
Methacrylonitrile-Betamethylstyrene formed in a CSTR. Let the monomer 1 be
Methacrylontirle, MAN and monomer 2 be BMS, betamethyl styrene. The reactivity
ratios r12 and r21 are 1.25 and 0.25 respectively. Compare the monomer and
copolymer composition curve for MAN/BMS system the SAN system. The reactivity
ratios for styrene and acrylonitrile are r12 = 0.29 and r21 = 0.02.
79.0. Second Order Reaction in a PFR
Consider a second order reaction in a PFR, plug-flow reactor as shown in Figure
53.0. At steady state the mass balance across a slice z can be written as follows;
(mass rate in) - (mass rate out) (mass rate reacted) = 0
The intrinsic reaction rate is second order and is;
dC A
dt
vCA
vCA
k2C A2
rA
(3.541)
k2CA2 A z 0
(3.542)
Divide Eq. (3.542) throughout by Az and obtain the limit as z 0.

v CA
A z
dC A
or
C A2
k2C A2
L
k2 A
dz
v o
k2 AL
v
1
CA
1
C A0
C A0
CA
1 k 2 C A0
or
CA
C A0
k2
(3.543)
1
1 k 2 C A0
Where L is the length of the PFR, is the residence time in the reactor. Derive a
similar performance equation when the rate of the reaction is of the third order ?
Number of CSTRs that is Equivalent of PFR
80.0. A graphical procedure can be developed to calculate the number of CSTRs needed
to equal the performance of a PFR.
243
Figure 53.0. Plug-Flow Reactor.
Show that the Steps are as follows:

Obtain a graph of the rate of disappearance of species A, (-rA) as a function of
the species concentration, CA.
Obtain the outlet concentration of the species A for a PFR for the stated
residence time.
Write the steady state mass balance for one CSTR and confirm that;
rA
C A0
C A1
(3.544)
where CA1 is the exit concentration from reactor 1. The operating line is a
straight line with a slope of -1/ as shown in Figure 54.0 in a (-rA) vs. CA graph.
Write the steady state mass balance for a train of CSTRs and confirm that;
rAi
C Ai
C Ai
(3.545)
Note the intersection point between the operating line from the first CSTR to the
(-rA) vs. CA curve. This is the exit concentration of species A from reactor 1.
Construct the second operating line with the slope = -1/2 where 2 is the
residence time in the second reactor.
Repeat the procedure until the point in the graph representing the PFR
performance is reached.
Count the number of CSTRs needed in order to achieve this.
81.0. Model for Site Utilization during Adsorption and Derivation of Langmuirs
Isotherm
The Langmuirs isotherm can be derived from a mass balance of the sites in the
adsorbent that are available for adsorption.
[Sitestotal] = [Sitesfilled] + [Sitesempty]
(3.546)
244
Figure 54.0. Graphical Solution for Number of CSTRs needed to Equal Performance of PFR.
The adsorption of bulk solute onto the available sites can be viewed as a reversible
reaction.
Solutebulk
K eq
SitesEmpty
SitesFilled
[ Sites filled ]
Solutebulk Sites Empty
K eq [ Solutebulk ] Sitestotal Sites filled Sites filled

[ Sites filled ]
1 K eq Solutebulk K eq [ Solutebulk ]
[ Sitestotal ]
Sites filled
K eq Solutebulk
[ Sitestotal ] (1 K eq [ Solutebulk ])
q
(3.547)
q0 y
( K y)
(3.548)
245
where q is the amount adsorbed and is the concentration of [filled sites], y is the
concentration of the bulk solute in the feed. K is a different constant from Keq the
equilibrium constant as defined in Eq. (). Thus the Langmuir isotherm is derived. It
relates the amount adsorbed onto solid adsorbents from the bulk solute in the feed.
82.0 Derivation of vant Hoffs Law
Show that the vant Hoffs law for osmotic pressure in terms of the solute
concentration can be derived from a model of the equilibrium between the permeate
and retentate.
The phenomena of osmotic flow is the flow of solvent from a region of low solute
concentration to a region of higher solute concentration across a semi-permeable
membrane. At equilibrium across the semi-permeable membrane the fugacities of the
solution and solute free solvent are equal.
fw = fs
(3.549)
The fs, the fugacity of the solution can be written in terms of the pure component
fugacity, fw using the Poynting correction factor. The Poynting correction factor
corrects for the effect of pressure on the pure component fugacity. Let Vw be the
molar volume in cc.mole-1.
fw
w xw f w exp
Vw Pw
RT
Ps
(3.550)
Where w is the activity coefficient, xw is the mole fraction of water, T is the

temperature of operation. Let = (Pw Ps)
Eq. (3.250) then becomes;
RT ln( w xw )
Vw
(3.551)
For ideal solution, activity coefficient, w can be taken as 1. By Taylor series

representation of ln(1-xs) =-xs
RTxs
RTCs
(3.552)
Vw
Eq. (3.252) is the vant Hoffs law that can be used to calculate the osmotic pressure.
83.0. Concentrator for Orange Juice
You are hired by New Mexico freshly squeezed orange juice Corp. You have been
asked to design a concentrator for orange juice. The concentration operation is based
on osmotic flow of water from the orange juice side to a bath of brine solution. The
orange juice is filled in transparent containers made of semi-permeable membrane
from Toray, Japan. The juice contains 2% by weight sucrose. The containers are
dropped in a bath containing brine solution. It can be assumed that the brine solution
is 30% NaCl by weight and the rest predominantly water.
246

84.0. Batch Adsorption
One thousand kilograms of a tinted solution must be clarified by adsorbing ninetynine
Per cent of the tint on a carbon adsorbent. The tint concentration per kg is 0.96. The
equilibrium relation a Freundlich isotherm, for this case is;
q 275 y 0.6
(3.553)
Where q and y are the adsorbent and solution concentrations respectively. If the
carbon initially contains no tint, how much carbon is needed for batch adsorption?
85.0. Rapid Sand Filter
The rapid sand filter being designed for Laramie has the characteristics shown
below.
Determine the head loss for the clean filter bed in a stratified condition. The viscosity
of water may be taken as 0.001 Pa.S.
The depth of the filter is 75 cm and density of sand grains are 2,800 kg.m-3. The
shape factor can be taken as 1.0 and bed porosity is 0.40 The equation developed by
Rose in 1945 for head loss of through a clean-stratified sand filter with uniform
porosity may be used. The filter loading rate is 250 m3.d-1.m-2.
hL
1.067va2 D
g
CD f
d
(3.554)
The drag coefficient may be calculated from the 5 constant expression provided by
Turton and Levenspiel (1989) applicable for Reynolds number 1 < Re < 200,000.
CD
24
1 0.173Re0.657
Re
0.413
1 16300 Re
1.09
86.0. Manufacture of Terpolymer in Two CSTRs in Series

Two CSTRs of equal volumes are to be used in series to manufacture a terpolymer.
The terpolymer consists of three monomers: (i) alphamethyl styrene, AMS; (ii)
acrylonitrile, AN and; (iii) styrene, STY. Acrylonitrile is mildly soluble in water and
needs to be separated prior to discharge as AN is a carcinogen at greater than 2 ppm.
The product rate is 8000 pounds per hour. The conversion is a total of 55% from both
reactors combined. The composition of the product is 50% AMS, 30% AN and 20%
styrene (weight fraction). The monomer composition in equilibrium with the product,
is 75% AMS, 10% AN and 15% Styrene. The reaction is kinetics were obtained
using tube polymerization (K. R. Sharma, [43] in the temperature range 408-418 K
can be given by;
rM
0.694 0.274
0.835 CM f AN
f Sty
(3.555)
247
Table 3.12. Sieve Analysis

Sieve No:
16-20
20-30
30-40
d(microns)
1000 m
714 m
505 m
Mass % Retained
10.1
44.5
20.2
Where rM is expressed as mol.lit-1h-1. The molecular weight of AMS = 118 gm.mole-1

is gm.mole-1, AN = 53 gm.mole-1, STY = 104 gm.mole-1 Determine:
(a) The mean residence time and volume for each of the two reactors. Express the
volume as gallons.
(b) The concentration of monomers in each reactor and their composition if
applicable in each reactor and its effluent. Allow for addition of monomers into
the second reactor to allow for the same composition of monomers in the second
reactor.
(c) The total mean residence time and total volume for the two reactors. Express
volume as gallons.
(d) The mean residence time and volume for a single CSTR having the same
conversion of monomers to terpolymer. Express volume as gallons. Use graph
paper attached if necessary.
Chapter 4
CONTINUOUS PROCESS DYNAMICS

4.1. TRANSIENT ANALYSIS-OVERVIEW
Most of the discussions in leading textbooks such as Levenspiel [1999], Froment and
Bischoff [2011] on reaction engineering are at steady state. There is very little discussion
about events under transient conditions. This can become important during plant start-up and
shut down periods. Control scheme design without good understanding of the transient
dynamics in the reactor or distillation column can lead to instability and other problems that
are avoidable. The overall mass balance can be used to confirm that the velocity of the influx
and efflux streams are equal to each other for incompressible flow and constant volume
reactor. The component mass balance can be used to obtain the governing equation that can
be used to describe the dynamics of the reactant, product and by-product species in the
reactor. The reactor type can be CSTR, continuous stirred tank reactor or PFR, plug flow
reactor. It can be seen from the worked examples below that in a CSTR the governing
equation for a reactant species can be seen to be ODE, ordinary differential equation. They
are seen to be linear for the case of irreversible reactions of the reaction order 1. The nature of
the governing equation depends on the nature of the kinetics, order of the reaction etc. More
than one species such as reactant, product, by-product can be tracked using state space model.
The differential equation is seen to be nonlinear for the case when the kinetics of reaction is
of the free radical polymerization scheme. The energy balance equation may be used to study
the dynamics of the temperature in the reactor. In case of exothermic reactions the reactor
may be jacketed with cooling water for removal of heat. The rate of heat removal may be
described using an overall heat transfer coefficient, U. The combined dynamics of the
reactant species and temperature in the reactor can be solved for using numerical methods
such as Runge Kutta fourth order method. The numerical scheme can be implemented in a
MS Excel 2007 for Windows on desktop computer. The results are sketched as output
response as a function of time. Multiplicities can be looked for. Stability types such as stable,
integrating unstable, underdamped oscillatory, inverse response, spiral response, saddle point
response, wave form response can be studied from the simulated results. Some idea of the
stability types can also be obtained by examining the governing equations.
In case of a PFR, the governing equation to describe the reactant species that undergoes
first order irreversible reaction can be shown to be a PDE, partial differential equation, of the
250
hyperbolic type. Transient dynamics of the conversion of reacting species, temperature in the
reactor and temperature in the jacket of a CSTR can be studied using numerical solution to
differential equations, linear or non-linear. A fourth order Runge-Kutta method can be used
for numerical integration. Conversion as a function of time for different values of Damkohler
numbers can be obtained as output response. The temperature as a function of time in
response to a step change in input temperature can be obtained. A state space model may be
used to represent the conversion of the reacting species, yield of the by-product, yield of the
product, temperature in the CSTR and temperature of the jacket.
The output response to a step change in the input can be obtained by the method of
Eigenvalues and Eigenvectors. If all of the Eigen values of the state space A matrix are
negative then the system is expected to be stable. A system with one Eigen value zero and
one Eigen value negative is called an integrating system. If the Eigen values are complex
conjugates the system is considered oscillatory. Sometimes the oscillatory output response
may be subcritical and damped, underdamped or critically damped. The stability types can
be: (i) improper node characterized as asymptotically stable when the eigenvalues are both
less than zero and real; (ii) improper node characterized as unstable when the eigenvalues are
both greater than zero and real; (iii) proper or improper node characterized as asymptotically
stable when both Eigenvalues are both equal and less than 0, and characterized as unstable
when both Eigenvalues are both equal and greater than 0; (iv) saddle point and characterized
as unstable when one Eigenvalue is less than zero and the other Eigenvalue is greater than 0
and real; (v) focus or spiral, when the Eigenvalues are complex and characterized as stable
when a < 0, and characterized as unstable if a > 0; (vi) center and characterized as marginally
stable when the Eigenvalues are complex and a = 0. (Varma and Morbidelli [1997]).
The transient concentration of monomer when free radical polymerization reactions are
conducted in a CSTR can be obtained. DaI, Damkholer number (initiator) and DaM,
Damkohler number (monomer) are introduced. For thermal polymerization binomial infinite
series expansion can be used as shown in the examples below to obtain the output response
for a step change in input. For the initiated polymerization the equations are non-linear.
Numerical solution can be sought to obtain the output response. A maximum in the
conversion of the monomer is found. Multiplicity is found in some results as can be seen in
the worked examples below.
The general form of prototypical first order and prototypical second order system are
provided below. The first order process is characterized by process gain constant, kp and
process time constant, p. The second order process is characterized by the process gain, kp,
damping coefficient, and process time constant, p. When the damping coefficient, > 1 the
system is over damped, when = 1 the system is said to be critically damped and when < 1
the system is expected to undergo an overshoot and is said to be underdamped oscillatory.
Reports in the literature about occurrence of temperature overshoot upon use of non-Fourier
heat conduction equation is revisited. The Taitel paradox is when the transient temperature in
a finite slab heated by isothermal, hot walls, was obtained by the method of separation of
variables using the hyperbolic PDE, partial differential equation, for certain values of the
thermo physical properties of the finite slab the interior temperature of the slab was found to
be greater than the wall temperature. This overshoot led investigators to abandon the nonFourier heat conduction equation stating that it violated second law of thermodynamics. A

careful side by side study of this problem is presented below. The time condition
251
T
was
t
assumed to be 0 in Taitel [1972].

Consider a finite slab of width 2a, at an initial temperature of T0 heated by hot isothermal
walls brought a temperature, Ts < T0 for times t > 0, greater than 0. As can be seen from
Figure 4.1 below only the left hand limit of the rate of change of average temperature of the
slab with respect to time is zero. A lumped analysis on the heating process leads to the
expression for the rate of change of average temperature of the interior of the slab as shown in
the ordinate of Figure 4.1.
T
t
a2
t
a2
(4.1)
The right hand limit, of the rate of change of average temperature in the finite slab is a
maximum! With increase in time this decreases exponentially to an asymptotic zero at large
times or upon attainment of steady state.
The right hand limit was used in the analysis. For a material with large relaxation time
the overshoot was found for the model results when initial accumulation time condition is
taken as 0.. For the same set of material and parameters when a physically reasonable time
accumulation condition was used the overshoot disappears. The transient temperature was
subcritical damped oscillatory. A steady state temperature was attained after a said time.
Lumped analysis was further explored.
The average temperature in a finite slab subject to convective heating was obtained using:
(i) Fourier parabolic model. The model solution rises monotonically to a constant asymptotic
value. (ii) Hyperbolic model with the first derivative of temperature with respect to time set to
zero as used by Taitel [1972] by the method of Laplace transforms. This model solution
appears to have an overshoot; (iii) Hyperbolic model with the initial temperature at T0 and the
additional constraint that the average transient temperature should obey the energy balance
equation from a lumped analysis. The dimensionless temperature was expressed as a sum of a
steady state temperature and a transient temperature. The transient temperature was expressed
as a product of wave temperature and decaying exponential in time. The model solution was
found to be;
S*
S*
S*
sin
(4.2)
Where, S* is the dimensionless storage number. As shown in Figure 4.16-4.18 the model
solution does not exhibit any overshoot. It appears that the damped wave conduction and
relaxation equation can be applied to transient heat conduction problems without violation of
the second law of thermodynamics. The storage number appears to be an important parameter
in determination of the average transient temperature in a finite slab during damped wave
conduction and relaxation. The time taken to attain steady state was found to be;
252
Figure 4.1. Rate of Change of Average Temperature in Interior of Finite Slab as a Function of Time, t.
(4.3)
ss
The maxima in the transient temperature were found to increase with decreasing S*
starting with large values such as 10. A cross-over was found after S* became less than about
2.2. Then the maxima in the average transient temperature was found to decrease with
decrease in storage number, S*. The average transient temperature becomes zero in the
infinite limit of S*.
A. Damkohler Number
The governing equation can be made dimensionless by introducing varaibles such as
fractional conversion, dimensionless time and Damkohler number. The physical significane
of the Damkholer number can be seen to be the the ratio of the residence time of the reactant
in the reaction to the intrinsic time of reaction when performed in a test tube. It can also be
viewed as the ratio of the reaction speed to the speed of the fluid by convection. The
Damkohler number may vary with the reaction kinetics. For example, Da = k, for a first
order irreversible reaction, where k is the reaction rate constant for first order and is the
residence time of the flow stream in the reactor. Da
k p2 k D CI
kt
for polymerization
reactions of the free radical type, where kp is the propagation rate constant, kD is the rate
constant of dissociation of the initiator and kt is the rate constant of the termination steps.
B. Prototypical First Order Process

Consider the hydrolysis of oxirane (ethylene oxide) to produce ethylene glycol by the
following chemical reaction.
253
Let the reaction be performed in a CSTR such as the one shown in Figure 4.2. For
incompressible flow and constant volume reactor the component mass balance for oxirane or
species A can be written as follows;
v C Ai
CA
VkC A
dC A
dt
(4.4)
The fractional conversion of oxirane and other dimensionless quantities are defined as
follows;
XA
C Ai
CA
C Ai
V
;
v
; Da k
(4.5)
The governing equation for the dynamics of fractional conversion of oxirane in a CSTR
given by Eq. (4.4) after introduction of the dimensionless variables as given in Eq. (4.5)
becomes;
XA
dX A
d
Da 1 X A
(4.6)
Eq. (4.6) can be rearranged into a form called the prototypical first order process.
dX A
1
1 Da d
XA
Da
1 Da
(4.7)
The general form of a prototypical first order process can be written as follows;
dY
dt
k pu
(4.8)
Where, p is the time constant, kp is the process gain and u is the input variable and Y(t)
is the output variable. Thus the transient fractional conversion of oxirane is a first order
process with a time constant of (1+Da)-1 and process gain of (Da/(1+Da)). Input variables are
254
those that must be specified to completely define the problem. Without this the problem
solution cannot be obtained. A number of processes conform to a a prototypical first order
process. The Laplace transform of Eq. (4.8) with a initial condition of Y(0.) = 0 can be
written as follows;
k p u (s)
Y (s)
(4.9)
Eq. (4.9) can be used in block flow diagrams to show the process transfer function in the
box allocated for process.
C. Prototypical Higher Order Processes

The general form of the prototypical second order process that is linear can be
represented as follows (Bequette [2003], Golnaraghi and Kuo [2010]) and Coughanowr and
LeBlanc [2009]);
2
p
d 2Y
dt
dY
dt
k pu
(4.10)
In addition to the process gain, kp, and time constant p there is third parameter called
the damping coefficient. The Laplace transform of prototypical second order process
assuming an initial condition of y(0) = 0 and y(0) = 0 can be written as follows;
Y (s) u (s)
kp
2 2
ps
2s
(4.11)
For a step change in the input variable of u, the Laplace transform expression for the
output variable can be written as follows;
kp u
y (s)
s
2 2
ps
2s
(4.12)
p
Four cases can be recognized for the output variable y(t) for various values of the
damping factor;
Case 1: Over damped System
For damping coefficient values, > 1, the output variable in the time domain y(t) is found
to be over damped. Eq. (4.12) can be inverted into the time domain. p1 and p2 can be
obtained as the roots of the quadratic equation in the denominator of Eq. (4.12). The poles of
Eq. (4.12) are 0, -b and c. The quadratic in the denominator is factorized as;
255
y s
Y s
kp u
2
p
s s
(4.13)
2 s
1
2
p
s2
s b s c
Let
(4.14)
2
p
The two factors a and b can be seen to be;

2
(4.15)
(4.16)
The inverse of the Laplace transformed expression in Eq. (4.13) can be looked from
tables [Mickley, Sherwood and Reid (1957)] as;
Y (t )
bt
1 c1 e
2
p
b1 e
ct
(4.17)
bc c b
The dimensionless output response Y(t) as given by Eq. (4.17) for a typical over damped
second order system is shown in Figure 4.2 for different values of the damping coefficient.
Case 2: Critically Damped System
For damping coefficient value, = 1, the output variable in the time domain y (t) is said
to be critically damped. When the damping coefficient becomes 1 the b and c values
given by Eqs. (4.15,4.16) become equal and found to be;
b= c
(4.18)
p
Eq. (4.13) becomes;
Y s
y s
kp u
1
2
2
p
s s
1
p
(4.19)
256
The inverse of Laplace transformed expression Y(s) given by Eq. (4.19) can be obtained
by invoking convolution theorem;
t
Y (t )
2
p 0
pe
dp
te
1 e
1 e
(4.20)
The dimensionless output response for a critically damped system as given by Eq. (4.20)
is shown in Figure 4.3.
Case 3: Undamped System
For damping coefficient values, =0.., the output variable in the time domain y(t) is
found to be undamped and oscillatory. Eq. (4.13) becomes;
Y s
y s
kp u
1
2
p
s s
(4.21)
1
2
p
Figure 4.2. Output Response to Step Change in Input for an Over damped Second Order Process.
257
Figure 4.3. Output Response to Step Change in Input for a Critically Damped Second Order Process.
Figure 4.4. Output Response to Step Change in Input for a Undamped Second Order Process.
The inverse of Laplace transformed expression Y(s) given by Eq. (4.19) can be obtained
by invoking convolution theorem and the dummy variable p;
Y (t )
sin
p2 0 p
t
dp 1 cos t
(4.22)
258
The dimensionless output response for an undamped system as given by Eq. (4.22) is
shown in Figure 4.4. As can be seen the oscillations are pronounced and there is a maximal
overshoot. There is no return to the set point of 1.0.
Case 4: Underdamped System
For damping factor values, < 1, the output variable in the time domain y(t) is found to
be underdamped. Some investigators find an overshoot for these systems. Upon further
scrutiny of systems that are suspected to undergo an overshoot it has been found (Sharma
(20.12)) that the overshoot sometimes can be a mathematical artifact. No real machine or
device can undergo an entropic decrease in a spontaneous manner. Entropy always rises for
real processes. A spontaneous overshoot in a real engineering system would be in violation
of Clausius inequality. This is further illustrated in Example 4.1.
When, <1 Eq. (4.13-17) becomes;
y s
Y s
kp u
1
2
p
s s
(4.23)
2 s
1
2
p
s2
s b s c
Let
(4.24)
2
p
The two factors a and b can be seen to be;
i 1
(4.25)
i 1
(4.26)
The inverse of the expression in Laplace domain in Eq. (4.23) can be obtained by use of
Heaviside expansion. The poles of Eq. (4.23) are 0, -b and c. The Laplace inverse of Eq.
(4.23) can be written as follows;
L1
s
1
2 s
p
it
A2 e p e
2
p
Per the Heaviside expansion theorem; Y ( s )
p( s)
q s
it
A3e p e
1
p
(4.27)
259
2 s
q( s) s 2
2i 1
A2
(4.28)
p
2
2i 1
2p
q '( s) 2s
q '( p2 )
(4.29)
p
(4.30)
2 1
In a similar manner,
i
A3
(4.31)
2 1
1
2 s
p
i
1
t
p
2
p
2 1
it
t
p
2
2 1
it
1
p
(4.32)
The real part of the RHS right hand side of Eq. (4.32) can be written as;
t
p
2sin
2 1
t 1
(4.33)
p
Now, Y(t) is obtained by invoking the convolution theorem;

p
t
Y (t )
0
sin
Y (t ) 1 e
sin
(4.34)
p
t
p
p 1
t
p
cos
t
p
(4.35)
260
Figure 4.5. Output Response to Step Change in Input for an Underdamped Second Order Process.
The dimensionless output response Y(t) as given by Eq. (4.35) for a typical underdamped
second order system is shown in Figure 4.5 for values of the damping coefficient less than 1.
It can be seen that for small value of damping coefficient such as at = 0.1, there can be seen
an overshoot. There is no overshoot at = 0.9. Sometimes the occurrence of overshoot is
more a mathematical artifact than practical feasibility. In engineering applications such as
heat transfer this can be a violation of second law of thermodynamics. The system has to be
carefully scrutinized from other considerations as well before meaningful conclusions can be
drawn.
4.2. CHEMICAL REACTOR TYPE

The performance of chemical reactions depends on the reactor type. Plug flow reactors,
PFR often times result in better performance compared with performance of chemical
261
reactions in a continuous stirred tank reactor, CSTR. A few CSTRs (three or more) in series
are needed to match the performance in a PFR. Polymerization reactions have been conducted
in industrial practice using both CSTRs and PFRs. Examples of products that have been
produced in the plastics industry are polystyrene, PS, high impact polystyrene, HIPS, styreneacrylonitrile copolymer, SAN, polymethyl methacrylate, PMMA, acrylonitrile-butadienestyrene, ABS etc. Polypropylene, PP has been made in gas-solid fluidized bed catalytic
reactors. The styrenics have been manufactured in liquid phase reactors. The liquid phase
reactions lends itself well to assuming that the volume of the reactor is constant volume
during the reaction and the flow is incompressible, etc. Denbigh [1951] has discussed the
difference in performance between CSTR and PFR for polymers. The relative half-lives of the
initiator and the active propagating species is the critical factor. If this is long relative to the
residence time in the reactor, the MWD, molecular weight distribution of the polymer can be
expected to be narrower in a PFR compared with that made in a CSTR. CSTRs can be
operated in what is referred to as perfectly mixed mode.
Often times during polymerization the viscosity of the contents of the reactor become
high. The viscosity of the polymer solution rises exponentially as a function of the relative
volume fraction of the polymer solids. Custom designed helical ribbon agitators or anchor
helix reactors need be specially made for this purpose. The power draw from the agitators rise
in a power ponentiated manner as a function of agitator RPM, revolution per minute. The gear
box needs to be expanded. During operation of these reactors in a pilot plant increasing the
agitator RPM gets the task accomplished. For instance during the manufacture of ABS
thermoplastic well grafted and small rubber phase particle size is needed for better product
performance. Increasing the agitator RPM from 30. to 100 gets the task accomplished. But itis
not clear whether the particle size was made smaller on account of increased tip shear rate
or because of lower mixing times compared with the reaction times. This can lead to
better grafting of the SAN chains onto the polybutadiene chains. Scale-up of these reactions
becomes arbitrary and delays time taken to introduce a new process/product line. According
to the rules of Bischoff [2011] the product distribution which happens to be MWD, molecular
weight distribution can be expected to be narrower in a PFR and broader in a CSTR when the
half-live of the propagating free radical is larger compared with the residence time in the
reactor. Attributable cause is the broader distribution of residence times in a CSTR. When the
half live of the free radical that is critical in the free radical propagation reactions is much
smaller compared with the residence time of the fluid in the reactor a narrower MWD can be
achieved in A CSTR compared with a PFR! This is becaue when the residence time in the
CSTR is increased to infinity the reactor behaves as a batch reactor. The MWD of the
polymer in the batch reactor can be expected to be narrower because of the uniform residence
time distribution of the different elements in the reactor.
A. Transient Conversion in Continuous Stirred Tank Reactor, CSTR

Example 4.1. Thermal Initiation Polymerization
Monomers such as styrene can be polymerized using thermal initiation. At higher
temperatures the styryl radical forms. This initiation is called thermal initiation. The rate of
the initiation reaction is of the third order. There are reports in the literature to the formation
of a Dields Alder mechanism. These reactions are important in the manufacture of
262
polystyrene, HIPS, high impact polystyrene, SAN, styrene acrylonitrile copolymer, ABS,
acrylonitrile, butadiene and styrene engineering thermoplastic etc. These reactions are
allowed to be performed in a CSTR (Figure 4.6). Assuming that the flow is incompressible
and the reactor is operated at constant volume, the transient monomer concentration in the
CSTR can be obtained. The dimensionless groups Damkohler number, conversion,
dimensionless time, are used when necessary. The free radical reactions of initiation,
propagation and termination are given as follows;
Thermal Initiation
kh
M*
3M
(4.36)
Monomer Propagation
k p1
M*
M 2*
M 3*
kp2
k p3
M 2*
M 3*
M 4*
(4.37)
...
M n*
k pn
M n*
Monomer Termination
M n*
M m*
kt
(4.38)
Solutions
From the assumptions of incompressible flow and constant volume reactor, it can be seen
that
dV
dt
(4.39)
Hence,
0 . Note that this is by inference from incompressible flow and not from
steady state considerations. Therefore, vi v . A component balance on the monomer that is

polymerized in the CSTR can be written as follows;
v CMi
CM
rPV
dCM
dt
(4.40)
263
Figure 4.6. Continuous Stirred Tank Reactor, CSTR Operated at Constant Volume, V.
The rate of polymerization (rp) can be arrived at as follows;

Rate of Initiation
dCM
dt
3
kh CM
(4.41)
Rate of Propagation
Assuming that the propagation reactions are fast that the rate coefficient is independent of
the length of the radical chain;
dCM
dt
*
k p CM CM
(4.42)
Rate of Termination
dC p
dt
*2
kt CM
(4.43)
The pseudo-steady state assumption can be used to obtain an expression for the radical
concentration during polymerization. The radicals formed during propagation get consumed
immediately in the next step. The net rate of production of radicals is zero. Hence the rate of
initiation and rate of termination can be added to zero as follows;
*2
kt CM
3
khCM
(4.44)
264

The expression for the concentration of the free radicals is;
kh 1.5
CM
kt
*
CM
(4.45)
Consequently, the rate of polymerization, (rp) can be seen to be;
kh
2.5
k p CM
kt
dCM
dt
rp
(4.46)
The monomer component mass balance equation becomes;
CMi
kh
kP
kt
CM
dCM
dt
CM2.5
(4.47)
Define the dimensionless groups as follows;

Fractional Conversion, XM
XM
CMi
CM
(4.48)
CMi
Dimensionless time,
t
(4.49)
Damkohler Number, DaM
DaM
kh
kp
kt
1.5
CMi
(4.50)
The dimensionless groups are introduced into Eq. (4.47), Eq. (4.47) can now be written
as follows;
DaM 1 X M
2.5
XM
dX M
d
(4.51)
As the values of conversion of monomer, XM is less than 1, Binomial infinite series

expansion can be a reasonable approximation for (1-XM)2.5. Higher order terms would be
4
small. Truncation of terms higher than 0.117 X M leads to;
265
DaM
X M 1 2.5DaM
dX M
d
2
0.3125DaM X M
0.1875DaM X M
(4.52)
Eq. (4.52) can be solved for by the method of superposition of the transient and the
steady state solutions. Let,
XM = XMs + XM
(4.53)
Eq. (4.53) can be written as two separate equations: (i) one for the steady state
component, XMs and; (ii) transient state component, XM.
DaM
X Ms 1 2.5DaM
X M 1 2.5DaM
0.1875DaM X Ms
0.1875DaM X M
2
0.3125DaM X Ms
2
0.3125DaM X M
dX M
d
(4.54)
(4.55)
The equation for steady state conversion of monomer, Eq. (4.54) was solved for by the
method of Newton Raphson (Chapra and Canale, [2006]) for finding the roots of the equation.
The numerical solution was obtained using MS Excel 2007 for Windows on a desktop
computer. Convergence for a considered Damkohler number was rapid. No multiplicity was
found. The Damkohler number was varied and the results for each Damkohler number is
shown in Table 4.1. This is also plotted in Figure 4.7. The steady state conversion XMs varies
in a sigmoidal manner as a function of Damkohler number. For small Damkohler number the
curvature is concave upward and changes to convex upward at large Damkohler numbers.
Figure 4.7. Steady State Conversion as a Function of Damkohler Number.
266
Figure 4.8. Transient Conversion as a Function of Time at Da = 2.0.
Figure 4.9. Transient Conversion as a Function of Time at Da = 10.
267
Table 4.1. Steady State Conversion for Various Values of DaM

DaM
0.0
0.01
0.05
0.1
0.2
0.3
0.5
1.0
XMs
0.0
0.0098
0.044
0.08
0.134
0.172
0.224
0.288
DaM
2
5
10
20
30
100
XMs
0.336
0.374
0.388
0.396
0.399
0.402
Eq. (4.17) was integrated using fourth order Runge-Kutta method on a MS Excel 2007
spreadsheet for Windows on a desktop computer. The weigths used were as given in Chapra
and Canale [2006]. They are given here below:
Xi
1
k1
6
Xi
2k2
2k3
k4
(4.56)
Where,
k1
i , Xi
k2
0.5
, Xi
k3
0.5
, X i 0.5k2
(4.58)
, Xi
(4.59)
k4
0.5k1
k3
(4.57)
The transient conversion of the monomer as a function of dimensionless time is plotted in

Figure 4.8 and Figure 4.9 for Damkohler numbers of 2 and 10.0. No multiplicities were
found. The output response was monotonic. The transient conversion rises to a asymptotic
steady state limit. Larger the Damkohler number the the attainment of the asymptotic limit is
rapid.
B. Transient Conversion during Initiation Polymerization in CSTR
Example 4.2. Initiation Polymerization in CSTR

Consider a CSTR (Figure 4.6) used for polymerization of styrene using an initiator such
as TBPO, tertiary butyl peroxide. The free radical reactions can be represented by the
following equations;
The polyrate of M is pseudo-first order and is given by;
268

Initiation
dCI
dt
(4.60)
k D CI
Propagation
dCM
dt
*
k p CM CM
(4.61)
*2
kt CM
(4.62)
Termination
dP
dt
Assuming a pseudo-steady state, i.e. the initiator radicals will react as soon as they are
formed;
*
dCM
dt
*2
kt CM
*
CM
Or,
dCI
dt
k D CI
k D CI
kt
(4.63)
(4.64)
Hence the rate of reactions can be written as one equation as;
dCM
dt
k p2 k D CI
kt
CM
(4.65)
Obtain the model equations for the conversion of monomer, CM as a function of time with
the given inlet monomer concentration of CM0 and initiator concentration. Assume that the
flow is incompressible and the reactor volume remains a constant throughout the reaction.
Discuss the transient behavior of the concentration of monomer in the kettle from the start-up
of the reactor. Use the dimensionless group Damkohler number if necessary.
Solutions
The CSTR reactor volume is considered as the control volume. The component mass
balances for the initiator concentration, CI can be written as follows;
v CIi
CI
VkD C
dCI
dt
(4.66)
269
Let the conversion of the initiator be Y and dimensionless time by and Damkohler
number (dissociation) be DaD as given by;
CIi C I
;
CIi
; DaD
kD ;
(4.67)
Where, is the residence time of the reacting species in the reactor. Eq. (4.50) then
becomes;
DaD
Y 1 DaD
dY
d
(4.68)
The component mass balances for the monomer concentration, CM can be written as
follows;
v CMi
CM
kD
CI
kt
VCM k p
dCM
dt
(4.69)
Let the conversion of the monomer be X and dimensionless time by and Damkohler
number (monomer) be DaM as given by;
CMi C M
;
CMi
kD
kp ;
kt
; DaM
(4.70)
Where, is the residence time of the reacting species in the reactor. Eq. (4.53) then
becomes;
DaM 1 Y
dX
d
X 1 DaM 1 Y
(4.71)
At steady state Eq. (4.52) and Eq. (4.55) becomes;

DaD
Yss
DaM 1 Y
X
Y 1 DaD
(4.72)
DaD
1 DaD
X 1 DaM 1 Y
DaM 1 Yss
ss
1 DaM 1 Yss
0
(4.73)
DaM
1 DaD
DaM
270
There were no multiplicities found in the expression for steady state conversion of
initiator and monomer. Eq. (4.36) is non-linear. Equation (4.33) can be integrated by
separation of variables and the model solution seen to be;
Y
DaD
DaD
(4.74)
1 DaD
Equation (4.71) was solved using the fourth order Runge Kutta Method [2]. The
parameters used and calculated in the simulation are given in Table 4.2;
Figure 4.10. Transient Conversion of Monomer X and Initiator Y.
Table 4.2. Parameters used during Simulation of Monomer and Initiator

Parameter
Residence Time T
Rate Constant, Initiator
Half-Life Initiator
Rate Constant, Propagation
Rate Constant, Termination
Damkohler (Dissociation)
Damkohler (Monomer)
Conversion, Steady State [I]
Conversion, Steady State [M]
Step Size
Symbol
kD
t0.5
kp
kt
DaD
DaM
Yss
Xss
Quantity
1.8
3.0
13.86
8
2.0
5.4
17.6
0.84
0.875
1.5
Units
hr
hr-1
min
hr-1
hr-1
dimensionless
dimensionless
dimensionless
dimensionless
min
271
The transient conversion of monomer was computed and plotted in Figure 4.10 along
with the transient conversion of initiator from Eq. (4.58). It can be seen from Figure 4.10 for
the parameters used in the simulation study the transient conversion of monomers undergoes
a maximum value. Multiplicity can be seen in the transient conversion of monomer X,
especially near the maxima. The simulation was conducted using a MS Excel 2007 for
Windows on a desktop computer.
The maximum transient conversion of monomer X for the parameters used in the
simulation study was found to be 0.902. An example of multiplicity is at transient conversion
of monomer X =0.88. There are two dimensionless times associated with this conversion.
These can be seen from Figure 4.10 to be = 0.19 and = 0.8. The reason for the occurrence
of maxima is not clear. The scheme of free radical reactions does not have a reversible step.
There is a decrease in monomer conversion after a said time.
C. Transient Conversion in Two Cstrs in Series

Example 4.3. Initiation Polymerization in Two CSTRS in Series
The initiation polymerization described in Example 4.2 is performed in two CSTRs in
series. The volume of the two reactors is constant during the polymerization reaction and is
V1 and V2. Monomers such as styrene, acrylonitrile. Methyl methacrylate etc. can be
polymerization in this manner. Two initiators are used. Initiator type used is from the peroxy
family. Examples are TBPO, tertiary butyl peroxide, TBPOND, tertiary butyl peroxy
neodeconoate or TBPP, tertiary butyl peroxy pivalate. The two reactors are operated at
different temperatures. The second reactor temperature is higher than the first reactor
temperature. The initiator selected for use in second reactor is by calculation of half-live of
the initiator at reactor temperature. The monomer concentrations at the exit of the two
reactors R1 and R2 are CM1 and CM2 respectively. The initiator used in R1 is I1 and has an inlet
concentration of CI1i and the efflux concentration of CI1. The initiator used in R2 is I2 and has
an inlet concentration of CI2i and the efflux concentration of CI2. The two CSTRs are operated
in series and are well agitated. In order to handle viscous polymer syrups the helical ribbon
agitators are used as shown in Figure 4.11. Obtain the output response for the initiator and
monomer from R1 and R2.
The polyrate of M is pseudo-first order and is given by;
Initiation (R1)
dCI 1
dt
k D1CI 1
(4.75)
dCI 2
dt
k D 2 CI 2
(4.76)
Initiation (R2)
272
Figure 4.11. Initiation Polymerization Conducted in Two CSTRs in Series.
Propagation
dC M
k p C M C M*
dt
(4.77)
dP
k t C M*2
dt
(4.78)
Termination
Assuming a pseudo-steady state, i.e. the initiator radicals will react as soon as they are
formed;
*
dCM
dt
Or,
*2
kt CM
*
CM
dCI
dt
kD1CI 1
k D1CI 1
(R1)
kt
(4.79)
(4.80.).
Hence the rate of reactions can be written as one equation as;
dCM
dt
k p2 kD1CI 1
kt
CM (R1)
(4.81)
273
k p2 k D 2CI 2
dCM
dt
kt
CM (R2)
(4.82)
The CSTR reactor volume is considered as the control volume. The component mass
balances for the initiator concentration, CI1 can be written as follows for the first CSTR, R1
as;
v C1ii
CI 1
V1k D1C
I1
dCI 1
dt
V1
(4.83)
Let the conversion of the initiator be Y and dimensionless time by and Damkohler
number (dissociation) be DaD as given by;
Y1
CI 1i C I 1
;
CI 1i
; DaD1
kD1 ;
(4.84)
Where, 1 is the residence time of the reacting species in R1 Eq. (4.50) then becomes;
DaD1 Y1 1 DaD1
dY1
d
(4.85)
The component mass balances for the monomer concentration, CM can be written as
follows;
v CMi
CM 1
V1CM 1k p
kD
CI 1
kt
V1
dCM 1
dt
(4.86)
Let the conversion of the monomer be X and dimensionless time by and Damkohler
number (monomer) be DaM as given by;
X1
CMi C M 1
;
CMi
t
1
; DaM 1
kD1CIi
kp 1 ;
kt
(4.87)
Where, 1 is the residence time of the reacting species in the reactor. Eq. ( 4.87) then
becomes;
DaM 1 1 Y1
X1 1 DaM 1 1 Y1
dX1
d
(4.88)
The component balance for the initiator I2 into the second reactor and the monomer that
is further converted in R2 can be written as follows;
274
v CI 2i
CI 2
v CM 1 CM 2
kD 2V2CI 2
k p2 kD 2CI 2
V2
kt
V2
dCI 2
dt
CM 2
V2
(4.89)
dCM 2
dt
(4.90)
The dimensionless variables and parameters as follows;
X2
CMi CM 2
; Y2
CMi
CI 2i CI 2
;
CI 2 i
k p2 kD 2CI 2
V2
; DaM 2
v
kt
(4.91)
Eq. (4.54) and (4.55) becomes on dimensionalization;
DaD 2
Y2 1 DaD 2
dX 2
d
DaM 2 1 Y2
X2
dY2
d
1 DaM 2 1 Y2
(4.92)
X1
(4.93)
At steady state Eq. (4.57) and Eq. (4.58) becomes;

DaD1 Y1 1 DaD1
DaM 1 1 Y1
X1 1 DaM 1 1 Y1
(4.95)
DaM 1 1 Y1ss
1 DaM 1 Y1ss
Y2ss
X 2ss
(4.94)
DaD1
1 DaD1
Y1ss
X1ss
DaD 2
1 DaD 2
(4.96)
X1ss
DaM 2 1 Y2ss
1 DaM 2 1 Y2ss
1 DaM 2 1 Y2ss
Integrating Eq. (4.57) upon separation of variables;
(4.97)
275
Y2
DaD 2
1 DaD 2
DaD 2
2 c1e
1 DaD 2
(4.98)
The integration constant c1 can be solved for from the initial condition;
t = 0, Y2 = 0; c1
1 DaD 2
(4.99)
Eq. (4.63) becomes;
Y2
DaD 2
1 e
1 DaD 2
1 kD
(4.100)
Eqs. (4.88,4.93) were integrated using Runge Kutta fourth order method. The equations
are non-linear. The weights used are given in Eq. (4.21-4.24). The numerical integration was
carried forward using MS Excel 2007 for Windows in a desktop computer. The results are
shown in Figure 4.12. The parameters used in the simulation are listed in Table 4.. As can be
been from Figure 4.12 multiplicity can be seen in conversion of monomer in R2. No
multiplicity can be seen in conversion fo monomer in R1. The initiator response in R2 was
slower than the the initiator response in R1. The conversion achived in R1 was lower
compared with the set of conditions seen in Example 4.2.
Figure 4.12. Output Response from R1 and R2.
276

Table 4.3. Parameters used during Simulation of Monomer and Initiator
in 2 CSTRs in Series
Parameter
Residence Time T
Rate Constant, Initiator
Half-Life Initiator
Damkohler (Dissociation)
Damkohler (Monomer)
Conversion, Steady State [I]
Conversion, Steady State M]
Conversion Maximum [M]
Step Size
Symbol
kD
t0.5
DaD
DaM
Yss
Xss
Xmax
R1
2.0
2.5
8.32
5.0
1.0
0.83
0.29
0.29
1.5
Units
hr
hr-1
min
dimensionless
dimensionless
dimensionless
dimensionless
dimensionless
min
R2
4.0
2.5
4.15
10.0
5.0
0.91
0.72
0.81
D. Reactor Type Plug Flow Reactor, PFR

The composition of the fluid in a PFR, plug flow reactor, varies from point to point along
a flow path. The mass balance on the reacting species need be made over a differential
volume Az as shown in Figure 4.13. A is the cross-sectional area of the PFR and z is the
incremental length of the slice considered in Figure 4.13. This is different from a CSTR
where the mass balance on the reacting species is performed over the volume of the CSTR.
For a reacting species A with a inlet composition of C Ai(mol.m-3) and v is the superficial
velocity of the fluid (m.s-1) the mass balance over the slice Az = dV can be written as
follows;
rate
rate
of
of
reac tan t
reac tan t
inf lux
efflux
disappearence
rate
(of )reac tan t
accumulation
reaction
reac tan t
( AvC A ) z ( AvC A ) z z AzkC A
Figure 4.13. Transient Dynamics in a Plug Flow Reactor, PFR.
Az(C A )
t
(4.10.1).
(4.102)
277
Dividing Eq. (4.67) throughout by Az and obtaining the limit as z0 Eq. (4.67)
becomes;
v
CA
z
CA
t
kC A
(4.103)
Eq. (4.68) can be made dimensionless as follows;
C Ai C A
; Da
C Ai
XA
kL
;Z
v
z
;
L
vt
L
(4.104)
The Damkohler number (PFR) can be seen to be the ratio of the reaction speed divided by
the supeficial speed of the reactant/product.
Upon substitution of Eq. (4.69) in Eq. (4.68);
XA
Z
XA
DaX A
(4.105)
Da
Differentiating Eq. (4.70) with respect to dimensionless time;

2
XA
Z
XA
XA
Da
(4.106)
Differentiating Eq. (4.70) with respect to dimensionless distance;

2
XA
Z2
Da
XA
Z
XA
Z
(4.107)
Conversion XA can be assumed to be analytic in the space and time (Z,). The order of
the differentialion does not matter. i.e.,
2
XA
Z
XA
Z
(4.108)
Adding Eq. (4.71) and Eq. (4.72) and realization of Eq. (4.73) leads to;
2
XA
Da
XA
Z
Da
XA
XA
2
(4.109)
Eq. (4.74) is a hyperbolic PDE, partial differential equation that is second order with
respect to space and second order with respect to time. The exact form analytical solution to
Eq (4.74) can be obtained as follows. Eq. (4.74) is multiplied by en. Eq. (4.74) becomes;
278

2
en X A
Z
en X A
Da
XA
Daen
en
XA
2
(4.110)
The term (enXA) can be seen to group and can be called as the wave concentration
(Sharma, 2005) such that;
en X A
(4.111)
Now,
XA
nen X A en
or
(4.112)
XA
en
nW
Differentiating Eq. (4.77) again with respect to time,

2
en
XA
n2W
(4.113)
Plugging Eq. (4.78), Eq. (4.77) and Eq. (4.76) in Eq. (4.75)
2
Da
W
Z
nDa n2 W
Da 2n
(4.114)
For n = Da/2, Eq. (4.79) becomes;

2
Da
W
Z
W
2
Da 2W
4
(4.115)
The steady state conversion can be obtained from Eq. (4.105) as follows;
X As
DaZ
(1 X As )
Integration of both sides of Eq. (4.81) yields;
(4.116)
279

ln 1 X As
DaZ
X As
DaZ
1 c "' e
c"
(4.117)
At Z = 0, XA = 0
So, c = 1. Eq (4.82) becomes;
X As
DaZ
1 e
(4.118)
It can be seen that at steady state the conversion varies as a f(e-z). Eq. (4.80) can be
multiplied throughout by emZ. The term (emXA) can be seen to group and can be called as ;
2
em
Z2
em
W
Z
m2
Now,
W
Z
em
(4.120)
em
(4.119)
Z2
2m
(4.121)
Z2
Substituting Eq. (4.120-4.121) in Eq. (4.119), Eq. (4.119) becomes;

2
Z2
Da
2m
mDa
m2
Da 2
4
(4.122)
For m = Da/2, Eq. (4.87) becomes;

2
Z2
or
2
Da 2
4
2
2
Da 2
4
(4.123)
2
Z2
Eq. (4.123) is the wave equation. In the dimensional form of independent variables;
2
v2
2
2
t2
(4.124)
280
It can be seen that the solution to Eq. (4.124) can be written as (Bird, Stewart and
Lightfoot (1961);
0 sin
z vt
(4.125)
where is the wavelength of a harmonic wave with amplitude (00) traveling in the z
direction at a speed v. The solution for the transient conversion can be written as follows;
XA
Da
2
ZDa
2
0 sin
z vt
(4.126)
The Dankwerts boundary condition at z = L can be applied as;

XA
z
1
1
2
0 sin
(4.127)
L vt
0 cos
L vt
(4.128)
At the wave front, L = vt, Eq. (4.93) becomes;
XA
zk
kt
2 e 2v
(4.129)
1 sin
z vt
(4.130)
At the entrance of the reactor, the initial reaction rate is given by;
dX A
dt
(4.131)
Differentiating Eq. (4.95) with respect to t,
XA
t
0
XA
2 Da
4 L
v
0 1
2L
2k L
v 4 L
zk vkt
2v
2 v
0
k
(4.132)
1 sin
z vt
(4.133)
281
Figure 4.14. Conversion XA in PFR for Damkohler Number, Da =6.75, v = 0..55 m.s -1, L = 1.5 m; =
2.7 hr, k = 2.5 hr-1, = 0.33 m.
4.3. CONTINUOUS PROCESS OUTPUT RESPONSE

PARTICULAR CASES
The output response from a process depends on a number of factors such as the order of
the process, process gain, process time constant, process damping factor and nature of process
input. In the above section multiplicity was found in some solutions to the process output
response. There are other instances where conclusions cannot be drawn from the output
response in a unequivocal manner as can be expected from mathematical analysis. Other
considerations have to go into the interpretation of these cases. In the following section,
particular cases are discussed in detail where the interpretation cannot be conclusive.
282
A. Overshoot and Taitel Paradox

A.1. Background
The damped wave conduction and relaxation equation was sought over Fouriers law of
heat conduction for eight reasons by Sharma [2007]. These reasons include: (i) contradiction
with the principle of microscopic reversibility by Nobel laureate, Onsager, [1931]); (ii)
neglects the time needed for the acceleration of heat flow by free electrons; (iii) occurrence of
blow-up in the solutions obtained using Fourier parabolic model for industrially important
systems such fluidized bed heat transfer, CPU overheating, (Sharma [2003]), gel
electrophoresis, (Sharma, [2009]) restriction mapping, adsorption, nuclear fuel rod and drug
delivery systems (Sharma, [2005, 2006,]; (iv) heat transfer in the Casimir limit [1938] or
nanoscale systems cannot be described using Fouriers model; (v) basis for Fouriers law was
from empirical observations at steady state; (vi) oscillatory discharge of heat in good thermal
conductors at low temperature as pointed out by Nobel laureate, Nernst [1917]; (vii) delayed
ignition of solid propellant, ultrafast laser heating of metals cannot be explained using
Fouriers model; (viii) speed of heat cannot be greater than the speed of light as discussed by
Nobel laureate Landau and Lifshitz, [1987].
The damped wave conduction and relaxation equation was originally suggested by
Maxwell [1867], and postulated independently by Cattaneo [1948] and Vernotte [1958]. The
damped wave conduction and relaxation equation in one dimension across constant area may
qx
kA
T
x
rA
qx
t
(4.134)
Reviews of the use of this equation have been presented by Joseph and Preziosi [1989]
and Ozisik and Tzou [1991]. Extensive theoretical treatment of the equation has been reported
by Tzou [1997] and Sharma [2005]. Experimental measurement of relaxation times has been
reported by Mitra et al. [1995] recently for biological materials. Taitel [1972] found an
overshoot in his transient temperature solution for a finite slab subject to constant wall
temperature boundary condition. Bai and Lavine [1995] was concerned about Eq. (3.68)
violating the second law of thermodynamics. Barletta and Zanchini [2003], calculate an
entropy production term and are concerned of a violation of Clausius inequality. Al Nimir et
al. [2003] discusses an overshoot and equilibrium entropy production. Haji Sheik et al.
[2002] point out some anomalies in Eq. (4.68). Tzou [1996] has found Eq. (4.68) to be
admissible within the framework of second law of thermodynamics. Sharma [2005] have
presented closed form analytical solutions for different geometries that are within the bounds
of second law of thermodynamics. Antaki [1998] has discussed some analytical solutions for
convective boundary condition.
How the overshoot manifests in such systems from the model development and
implications on the physical insight to the phenomena are discussed in the following
subsection. How the use of physically realizable time condition such as obeyance of
hyperbolic transient temperature to the energy balance equation from a lumped analysis
approach can lead to the disappearance of the overshoot is also shown. The time condition
used in this analysis is de novo.
283
Figure 4.15. Finite Slab with Half-Width a Subject to Convective Heating.
Consider a finite slab with width 2a at an initial hot temperature T h. This hot slab part of
which is shown in Figure 4.15 is subject to a sudden cooling by convection by the fluid blown
from the fan as shown in Figure 4.15 for times t > 0.. The fluid temperature is at Tf where
Tf.< Th. Both sides of the slab are cooled by the fluid. The transient temperature as a function
of space and time need be obtained. The two time and two space conditions are given as
follows;
t = 0, -a x +a, T = Th
T
x
t > 0, x= 0,
t 0, x = a,
(4.135)
(4.136)
T
x
hT
Tf
(4.137)
In one dimension the energy balance equation on a thin slice of thickness x can be
written as;
q
x
T
t
Cp
(4.138)
Combining Eq. (4.138) with the damped wave heat conduction and relaxation equation
the governing equation can be written as;
X2
(4.139)
284
where,
(T Th )
;
(T f T h )
;X
r
(4.140)
r
The time and space conditions are as follows;

= 0, u = 0
u
X
X = 0,
(4.141)
0
(4.142)
u
X
h* u 1
It can be noted that the heat transfer coefficient is defined with respect to the average
temperature in the slab <T>. The energy balance on a thin spherical shell at x with thickness
x is written. The governing equation can be obtained after eliminating q between the energy
balance equation and the derivative with respect to x of the flux equation and introducing the
dimensionless variables;
2
X2
(4.143)
Eq. (4.143) is integrated between Xa and +Xa and give;

2
S* ( u
1)
(4.144)
h
Sa
Where the storage number S* is defined as S *
A.2. Fourier Parabolic Model Near Steady State

Eq. (4.144) in the limit of zero relaxation time reverts to the Fourier parabolic model and
the governing equation becomes;
u
S*
1)
(4.145)
285
Obtaining the Laplace transforms of Eq. (4.144)

s
(s) 0 S *
or,
( s)
(s)
1
s
(4.146)
(4.147)
s s S*
Obtaining the inverse Laplace transform of Eq. (4.147);
hS
p
a dp
1 e
ht
Cpa
(4.148)
Eq. (4.148) is the average temperature of the finite slab in response to a step change in
convective cooling at both sides of the finite slab. Eq. (4.148) is not a function of the
relaxation time and is a function of the heat transfer coefficient, h, density, , and heat
capacity, Cp, and half-width of the finite slab, a.
A.3. Initial Accumulation Condition Zero

For the hyperbolic model other investigators such as Taitel [1973] use the following
initial condition;
= 0,
(4.149)
Obtaining the Laplace transform of Eq. (4.144) realizing the initial condition from Eq.
(4.149)) the Laplace domain expression for (s) can be seen to be;
u
(s)
1
2
s
s *
S
Where, S *
s
S*
(4.150)
1
h
Sa
Eq. (4.150) can be compared with the prototypical second order systems with a step input
(Eq. (4.12) as discussed above in section 4.1C. For underdamped systems, i.e., when the
damping factor, < 1 the time response to Eq. (4.150) can be seen to exhibit an overshoot
as shown in Figure 4.5. Without any heat sources the internal temperature greater than the
286
boundary temperature can be a violation of second law of thermodynamics. When the

damping coefficient,
2
p
(4.151)
S*
S*
S*
(4.152)
So, the damping factor is;
1
2 S
For large values of the dimensionless ratio, S*, the damping coefficient will become less
than one and the output response appears to have a overshoot. This can be expected for
materials with large relaxation time,
Cpa
r
(4.153)
A.4. Physically Realizable Steady State/Final Time Condition

The boundary condition used during convective cooling is a constant value for the heat
flux rate from the air flowing past the finite slab as given in Eq. (4.137). The governing
equation (6) is the damped wave conduction and relaxation equation taking into account the
effect of acceleration of electrons. A boundary condition that includes the wave term, i.e.,
air q
would be a better representation of transient events at the air solid interface. Thus.
r
t
Eq. (4.137) need be modified as;
u
X
h*
h*
air
r
(4.154)
rs
Eq. (4.154) is integrated with respect to X and the governing equation written in terms of
the average temperature in the slab as follows;
S*
u
2
S*
S*
(4.155)
287

air
r
Where,
the ratio of the relaxation time in the air and the relaxation time in
rs
the solid. Let the be expressed as a sum of transient temperature and steady state
temperature. is the ratio of relaxation times of the air and that of the solid.
ss
(4.156)
Substituting Eq. (4.156) into Eq. (4.155);
S*
S*
ss
(1 S * ) 0
(4.157)
Eq. (4.157) is valid when the following two equations are valid;
S*
S*
S* ( u
ss
1) 0
(4.158)
(4.159)
The steady state temperature can be seen to be;

ss
(4.160)
Eq.(4.159) is a second order differential equation that has been made homogeneous. Eq.
(4.158) is multiplied by en throughout. The terms group such that,
and for n
S*
1
2
(4.161)
Eq. (4.158) can be seen to become;
S* 1
(4.161)
The solution to Eq. (4.161) can be seen to be;
c1 cos
c2 sin
(4.162)
288
Where
S* 1
Two time conditions are needed to fully describe the problem. The accumulation
condition equal to zero appears to be physically unreasonable. When a slab with an initial
temperature is immersed in a hot fluid with convective heat transfer coefficient the
temperature in the slab would increase, rapidly in the beginning of the process and can be
expected to slow down with the passage of time. At steady state the temperature would be
steady and invariant with time. From the initial condition given by Eq. (4.141) the integration
constants in Eq. (4.162) can be seen to be;
c1 =0
(4.163)
Then Eq.(4.162) becomes;

S*
c2 sin
(4.164)
The transient average temperature t also has to obey the following equation that can
be obtained from a lumped analysis of the finite slab from energy balance;
S* ) S* 1
(1
(4.165)
Eq. (4.165) at zero time, or =0, can be seen to be!

t
S*
1
(4.166)
S*
The integration constant c2 can be obtained by applying Eq. (4.166) to Eq. (4.167).
S*
c2 1
2
S*
sin
c2 e
cos
(4.167)
and c2 seen to be;
c2
S*
1
S*
The average transient temperature in the slab is then written as;
(4.168)
289
S*
S*
S*
sin
(4.169)
Eq. (4.169) is plotted in Figures 4.16 4.18, for different values of S* and . The time
taken for the slab to reach steady state is finite and can be calculated when (ss ) becomes
in Eq. (4.169). This happens when;
ss
(4.170)
Figure 4.16. Transient Average Temperature in Finite Slab from Damped Wave Conduction and
Relaxation ( =0..2).
290

For the special case when S* = 1, Eq. (4.161) becomes;
2
2
t
c1
(4.171)
c2
Or,
c2 c1
(4.172)
From the initial condition given by Eq.(8), c2 = 0. c1 can be solved for the energy balance
equation given by Eq. (4.166) at
= 0,
c1 1
1
1
2
1
c1
c1
(4.173)
(4.174)
Thus for the special case when S*=1,

1
(4.175)
Reports in the literature about appearance of an overshoot in the transient temperature

for a finite slab were analyzed for the case of convective boundary condition with the wave
term. The solution from Fourier parabolic model given by Eq. (17) predicts a monotonic rise
in temperature with an asymptote of ss = 1 at steady state. The solution from the
hyperbolic damped wave conduction and relaxation for average temperature of the finite slab
was solved for by method of Laplace transforms for the time conditions such as the first
derivative of temperature in time equal to zero at time zero as used by other investigators in
similar problems with constant wall temperature boundary condition. The Laplace domain
expression compares from this model compares well with the expression for prototypical
second order systems as discussed in a process dynamics and control textbooks. This
expression when inverted has an overshoot.
The temperature in a finite slab subject to convective boundary condition was assumed to
comprise of a transient component and steady state component. The steady state component
temperature was obtained and given by Eq. (4.160.). The governing equation for transient
temperature is rendered homogeneous upon obtaining the solution of steady state temperature.
The transient temperature was expressed as a product of decaying exponential and wave
temperature. The governing equation for the wave temperature (Eq. (4.161) was solved for.
The integration constants were obtained from the initial temperature condition of t = 0 at
291
zero time. The second integration constant was calculated by verifying that the model solution
obeys the energy balance equation for average transient temperature. This leads to a solution
for transient temperature that has a decaying exponential term and a cosinuous term with a
phase lag, . Eq. (4.169) does not result in any overshoot as shown in Figures 4.16 5.18 for
various values of frequency and ratio of thermal relaxation times between air and the solid. It
h
was found that the dimensionless storage number given by S *
is a significant
Sa
parameter in the analysis. Expression for time taken to steady state was found and given by
Eq. (4.160).
Figure 4.17. Transient Average Temperature in the Finite Slab Subject to Convective Boundary
Condition with Wave Term ( = 0..01).
292
Figure 4.18. Transient Average Temperature in the Finite Slab Subject to Convective Boundary
Condition with Wave Term ( = 2.0).
No overshoot was found when the wave term was taken into account in the boundary
condition even for small values of , the ratio of the relaxation time of air with that of the
solid. This is an indication that the fundamental phenomena such as acceleration of free
electron as discussed before [Sharma, 2006] can be used to model transient heat conduction
at short times and be within the second law of thermodynamics. The maxima in the transient
temperature were found to increase with decreasing S* starting with large values such as 10.
A cross-over was found after S* became less than about 2.2. Then the maxima in the average
transient temperature was found to decrease with decrease in storage number, S*. Eq. (4.169)
can be seen to go to zero in the asymptotic limits of infinite storage number, S* .
293
B. Delineation of Maxima and Steady State

Consider the mixing tank in Figure 4.19 with a jacket provided for heating the tank.
The governing equations for the temperature in the reactor and the temperature of the
coolant in the jacket are obtained from an energy balance on the control volume of the
contents of the reactor and can be seen to be;
dT
dt
Reactor:
Jacket:
v
Ti T
V
dT j
vj
dt
Vj
UA
Tj T
VC p
UA
Tj
jV j C pj
T jin T j
(4.176)
At Steady State
1
50 125
10
UA
150 125
61.3(10)
UA (3)(61.3) 183.9 Btu.F
Figure 4.19. Mixing Tank Heated by hot Fluid in Jacket.
ft
(4.177)
294
vj
2.5
200 150
75
1.5 ft 3 .min
50
vj
183.9
150 125
61.3 2.5
(4.178)
The model equations are represented in state space form as follows;

dT
dt
dT j
0.4
1.2
0.3 T
1.8 T j
5
120
(4.179)
dt
The model solutions were obtained using fourth Order Runge-Kutta Method for
Integration of ODE in MS Excel Spreadsheet 20.07 for Windows. The classical fourth-order
RK method was used. The recurrence formula as given in (S. C. Chapra and R. P. Canale,
(2006) was used. The recurrence relations used are as follows;
h
k1
6
Tl
Tl
T jl
T jl
h '
k1
6
2k2
2k2'
2k3
k4
(4.180)
2k3'
k4'
(4.181)
Where,
From Eq. (4.176), f(t,T) =
k1 = f(ti,Ti)
(4.182)
k2 = f(ti+0.5h, yi+0.5k1h)
(4.183)
k3 = f(ti+0.5h,Ti+0.5k2h)
(4.184)
k4 = f(ti+h, Ti+k3h)
(4.185)
vi
Ti
V
Integration was performed using a MS Excel spreadsheet. The key results are shown in
Figure 4.20 and Table 4.4. The step size used was h = 0.01 min.
From the last row of Table 4.4 it appears that the steady state temperature values, Tis =
152.2 and Tjs = 199.7 F. The values from solution in (a) are Tis = 150 F and Tjs = 150 F.
Figure 4.20. Transient Reactor Temperature and Jacket Temperature vs. Time.
Table 4.4. Temperature in the Reactor, Jacket vs. Time

t
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
2
3
4
5
6
7
8
9
10
T
50.000
54.263
58.066
58.066
64.567
67.374
69.946
72.316
74.514
76.566
78.492
93.615
105.150
114.938
123.438
130.854
137.329
142.985
147.925
152.240
Tj
200
189.145
180.2475
180.2475
167.0994
162.3572
158.5734
155.5905
153.2766
151.5209
150.2307
150.7255
158.6955
166.9491
174.3797
180.9078
186.6161
191.6031
195.9591
199.7639
295
296
(a) Large Step Change in Jacket Flow Rate: 10 times to 15 ft3.min-1
Figure 4.21. Transient Reactor Temperature and Jacket Temperature vs. Time Response to a Big Step
Change in Jacket Flow Rate by 10. Times.
297
(b) Small Step Change in Jacket Flow Rate: 10% Change to 1.65 ft3.min-1
Figure 4.22. Transient Reactor Temperature and Jacket Temperature vs. Time Response to a Small Step
Change in Jacket Flow Rate by 10.%.
(b) Larger Vessel

v = 10 ft3.min-1; V = 100 ft3
10
UA
50 125
150 125
100
61.3(100)
7.5
UA
(4)(61.3) 73.56 Btu.F 1 ft 3
25
(4.186)
10
73.56
50 125
T js 125
100
100(61.3)
7.5 1.5
T js
750 F
0.012
(4.187)
(c)
298
vj
2.5
220
300
vj
dT
dt
dT j
(d)
73.56
750 125
61.3 2.5
200 750
3
0.733 ft .min
0.012 T
0.779 T j
0.112
0.046
(4.188)
5
5.864
(4.189)
dt
Eigenvalues of the A matrix
Characteristic second degree polynomial equation
0.112
0.779
0.000552
0.891
0.0867 0
(4.190))
Eigenvalues are 1 = -0.78; 2 = -0.11

Both eigenvalues are negative. Hence the system is stable. It can be seen from Figure
4.20 that the transient temperature of the reactor goes through a minima. Both at minima as
well as at steady state;
dT
dt
(4.191)
Use of Eq. (4.191) merely is not sufficient to identify the minima or steady steady state
value. They may have to be obtained as shown in the above example by other means.
4.4. OTHER KINETIC TYPES

A. Denbeigh Scheme of Reactions
Consider the Denbigh scheme of reactions performed in the CSTR shown in Figure 4.23.
A scheme of reactions as shown in Figure 4.23 was discussed in Levenspiel [1999] as a
special case of Denbigh reactions. A state space model that can be developed to describe the
dynamics of the 5 species, CA, CR, CT, CB and CS. The assumptions are that the inlet stream
contains species A and B at a concentration of CAi and CBi and the initial concentrations of the
other species are zero. The kinetics of the simple irreversible reactions shown in Figure 4.23
dC A
dt
dCB
dt
k1
k3 C A
k 4 CB
(4.192)
(4.193)
299
Figure 4.23. Denbigh Scheme of Reactions.
dCS
dt
k4CB
k3C A
(4.194)
k5CS
dCR
dt
k1C A
k 2 CR
(4.195)
dCT
dt
k 2 CR
k5CS
(4.196)
The reactions are considered to be performed in the CSTR similar to the one shown in
Figure 4.6. Component mass balances on each of the species assuming incompressible flow
and constant volume reactor can be written as follows;
Species A
C Ai
C A 1 Da1
dC A
d
(4.197)
V
, with units of (hr.) is the residence time of
v
the species in the reactor, V is the volume of the reactor, (liter) and v is the volumetric flow
rate (lit.hr-1) in and out of the reactor.
Where ; Da1
k1 ; Da3
Da3
k3 ;
Species B
CBi
CB 1 Da4
dCB
d
(4.198)
Where Da4 = (k4)

Species S
CS 1 Da5
Da4CB
Da3C A
dCS
d
(4.199)
300

Species R
CR 1 Da2
Da1C A
dCR
d
(4.200)
CT
Da5CS
dCT
d
(4.201)
Species T
Da2CR
The model equations that can be used to describe the dynamics of the 5 reactant/product
species in a CSTR can be written in the state space form as follows;
CA
1 Da1
CB
d
CS
dt
CR
CT
Da3
CA
CB
0
Da3
1 Da4
Da4
0
1 Da5
0
0
0
0
Da1
1 Da2
Da5
Da2
C Ai
CBi
CS
CR
(4.202)
0
0
1 CT
The stability of the dynamics of the 5 reactants/products in the Denbigh scheme

performed a CSTR can be studied by obtaining the eigenvalues of the rate matrix. The
characteristic equation for the eigenvalues is obtained by evaluation of the following
determinant;
1 Da1
det
Da3
0
Da3
0
1 Da4
Da4
Da1
0
0
0
0
1 Da5
1 Da2
Da5
1 Da1 Da3
1 Da4
Da2
1 Da5
1 Da2
0
1
(4.203)
The 5 eigenvalues are negative when Damkohler numbers are greater than zero. When
eigenvalues are all negative the system is considered to be stable.
The Laplace transform of the model equations developed in order to describe the
transient dynamics (Eqs. 4.194 4.201) for the 5 species in the Denbigh scheme in a CSTR
CA s
C Ai
s s 1 Da1
Da3
(4.204)
301
CBi
( s) s 1 Da4
CB s
Da3C Ai
CS s
Da4CBi
s s 1 Da4 s 1 Da5
s s 1 Da1 Da3 s 1 Da5
CR s
s 1 Da2
(4.205)
Da1C Ai
s s 1 Da1
4.206)
(4.207)
Da3
1
Da5 Da3C Ai
Da4 Da5CBi
Da1Da2C Ai
CT s
s
s
1
s
Da
Da
s
Da
s
Da
s
Da
s
Da
s
Da
Da
1
3
5
4
5
2
1
3
(4.208)
The inverse Laplace transform of Eq. (4.204) can be obtained by invocation of the
convolution theorem. The expression for transient concentration of species A can be written
as;
CA t
C Ai
1
1 e
1 Da1 Da3
1 Da1 Da3
(4.209)
The inverse Laplace transform of Eq. (4.205) can be obtained by use of the time shift
property. The transient concentration of species B can be seen to be;
CB t
CBi
1
1 e
1 Da4
1 Da4
(4.210)
The inverse Laplace transform of Eq. (4.207) can be obtained by look-up of Laplace
inversion Tables in Mickley, Sherwood and Reed [1939]. The transient concentration of
species R can be seen to be;
CR t
C Ai
1 Da2
1 Da2 Da2
Da1
e
Da3
1 Da1
1 Da1 Da3
Da3 Da2
Da1
Da3
1
1 Da2 1 Da1
(4.211)
Da3
The inverse Laplace transform of Eq. (4.206) can be obtained by look-up of Laplace
inversion Tables in Mickley, Sherwood and Reed [1939. The transient concentration of
species S can be seen to be;
302

CS t
C Ai
Da3
Da4CBi
C Ai
1
1 Da4 1 Da5
1
1 Da5 1 Da1
1 Da4
e
Da4
1 Da5
Da5 1 Da4
Da4
Da3
e
1 Da5 Da1
(4.212)
Da5 1 Da5
1 Da5
1 Da1 Da3
Da3
Da5
1 Da1
e
Da3 Da1
Da3
Da5
The transient concentration of species T can be obtained from the Laplace inversion of
Eq. (4.208)
B. Michaelis and Menten Kinetics

The production of monosaccharides from starch, aspartame found in Nutrasweet and
other sweeteners from phenyl amine, acrylamide from acrylonitrile, penicillin, high fructose
corn syrup from starch slurry, fructose from glucose, acetone-butanol from cheese whey,
pentose sugar from lignocellulosics etc can be catalyzed using enzymes. Biological processes
can be classified as: (i) fermentations; (ii) metabolic processes/functional genomics or
metabolomics; (iii) by action of living cells. Fermentations can be further sub-classified into
processes as those that are promoted by microorganisms such as yeast, algae, bacteria,
protozoa and those that are catalyzed by enzymes. Stem cell research advances also can lead
to useful products. The kinetics of the microbe promoted reactions and enzyme catalyzed
reactions can be written as follows;
dC A
dt
rA
CE 0 C A
CM C A
(4.213)
Where the enzyme concentration is CE0, CM is a Michaelis constant. Eq. (4.213) is

referred to the equation describing Michaelis and Menten kinetics. At high concentrations, of
the reactant, CA the rate expression in Eq. (4.213) becomes;
Lt rA
CA
Lt k
CA
CE 0
CM
CA
kCE 0
CM
(4.214)
The reaction rate at the asymptotic limit of infinite concentration of reactant, CA can be
seen to become zeroth order rate (Eq. (4.214). At the asymptotic limit of zero reactant
concentration Eq. (4.213) can be seen to become a first order reaction rate;
Lt rA
CA
CE 0 C A
CM
(4.215)
303
The Monod type of kinetics can be used to quantitate the production of cells and can be
given by the rate expression;
rc
CC C A
C A CM '
kobs
(4.216)
The reaction scheme for which Eq. (4.216) is applicable is given in Figure 4.24.
C
(4.217)
Where C is the microbe acting, CM is the Monod constant and A is the food for the
microbe and R is the waste material generated. More microbes are produced when food is
supplied to the microbes. The waste product R can inhibit the production of product by
phenomena called product poisoning. Activated sludge treatment of waste water is an
example of bioprocess that is devoid of product poisoning. When Monod kinetics is in effect
the cells reproduce the substrate is built and the waste R that can be poisonous to the product
form. An induction period, sigmoidal growth period, stationary period and lysis/death of cell
period. The product P can be obtained by cell rupture of cells C using centrifugation and
separation of product P from the waste material R and unreacted reactant A and the disrupted
cells using downstream processing methods.
Consider the reactions described by Michaelis and Menten kinetics performed in the
CSTR shown in Figure 4.24. Component mass balances on each of the species assuming
incompressible flow and constant volume reactor can be written as follows;
Species A
DaCE 0C A
C A CM
C Ai C A
dCA
dt
(4.218)
Eq. (4.218) is made dimensionless as follows;
Let
XA
C Ai C A
;
C Ai
kCE 0
;
C Ai
; Da
CM
CAi
(4.219)
Substituting Eq. (4.219) in Eq. (4.218), Eq. (4.218) can be seen to become;
dX A
d
Da 1 X A
1
XA
XA
(4.220)
304
Figure 4.24. Reaction Scheme that can be represented by Monod Kinetics.
The variables XA and in Eq. (4.220) can be separated and integrated as follows;
XA
dX A 1
2
0 XA
XA
XA
1 Da
Da
(4.221)
d
0
Eq. (4.221) can be solved for by using a substitution such as;
XA
q
(4.222)
1 Da
2
The integral in Eq. (4.221) then becomes;
Da
dy
y
y0
Da q
2
y0
ydy
y
(4.223)
Da q 2
The integrals in the LHS can be obtained by a (y2+Da-q2 =z2) substitution and found to
be;
ln
Da q 2
X A2
2qX A
1
Da
M
2
4 q
Da
Da
ln
Da q 2
XA
q2
Da
Da q 2
XA
q2
Da
(4.224)
Eq. (4.224) is the closed form analytical solution to Eq. (4.220). Eq. (4.220) is not
explicit in conversion as a function of time. For a given time in order to obtain the
corresponding conversion a transcendental equation needs to be solved. There is no guarantee
that the solution is monovalued. Multiplicity in solution may arise (Ramkrishna et, al,
305
[1982]). A Taylor series expansion may be written for the conversion as follows near the
initial condition at = 0.
2
XA
X A (0)
X A '(0)
2!
X A "(0)
X A "'(0) .
3!
4!
X A'"' 0
(4.225)
........
From the initial condition,

XA 0
(4.226)
From Eq. (4.220) at =0,
Da
X A' 0
X "A
(4.229)
3Da3 2
M
4
(4.228)
2 X A' X A'
2q
1
2qDa 2 2
Da
M
3
X "A 0 X A' 0
(4.227)
Da 2 2
X "A 0
X "'A
M
5
(4.230)
Truncation of fourth and higher order terms in Eq. (4.226) and substitution of Eqs.
(4.226-4.230) in Eq. (4.225) would yield;
XA
Da
1
2! 1
Da
Da 2
M
M
3!
2qDa 2 2
1
M
4
3Da3 2
1
M
5
........
(4.231)
Eq. (4.231) is plotted in Figure 4.25 for dimensionless Michaelis constant of M = 4.0 at
three different Damkohler numbers, Da = 1, 4 and 8 respectively. It can be seen from the
graph that the transient concentration undergoes a maxima at larger Damkohler numbers. The
steady state conversion can be obtained from Eq. (4.220.) as follows;.
Da 1 X As
1
X As
X As
(4.232)
306
The quadratic equation that needs to be solved for in order to obtain the steady state
conversion, XAs can be written as follows;
2
X As
2qX As
X As
q2
Da
(4.233)
Da
Where q is given by Eq. (4.222). Since Eq. (4.233) is a quadratic there can be multiple
values for the steady state conversion. In such cases other considerations may have to go into
arriving at the residence time and other operating parameters for the desired output
performance.
Figure 4.25. Transient Conversion XA in CSTR for Nutrients that obey Michaelis and Menten Kinetics
307
C. Gel Effect Runaway Polymerization Reactions

Free radical polymerization reactions are used to prepare useful polymers from
monomers that can be manufactured by separating crude naphtha in distillation columns and
by catalytic conversions. For example catalytic dehydrogenation of ethyl benzene can lead to
the formation of styrene. Ammonia and propylene can be contacted in a fluidized bed reactor
and in the presence of catalyst acrylonitrile can be made in an economically profitable
manner. Switching one of the reactors to iso-propylene as feed material can lead to the
manufacture of methacrylonitrile. Isomerization acid catalyst can be used to prepare alpha
methyl styrene from ethyl benzene. Beta methyl styrene formation requires a suitable catalyst.
Free radical reactions consists of three important phases: (i) initiation by appropriate
initiators such as peroxy free radical provider or azoisobutyrontirle, AIBN or by thermal or by
photolytic or by other means; (ii) propagation reactions and growth of backbone polymer and;
(iii) termination reactions by combination or by chain transfer or by other mechanisms.
During high conversion and when little diluent is used some times the growing chains do not
diffuse and combine and participate in termination reactions. This can lead to a diffusion
limited gel effect or runaway reaction condition. Control of such reactions if allowed to
take place may be difficult and sometimes needs granite to separate the set mass. One time in
Muscatine, IA the suspension kettle was set-up due to gel effect as touched upon in
Chapter 1.0.
4.5. SUMMARY
The transient conversion in a PFR, plug flow reactor was derived. For a reaction of first
order assuming that the conversion is analytic in space and time the governing equation can
be shown to be of the hyperbolic type. For the zeroth order reaction the governing equation
was found to be a wave equation! The hyperbolic PDEs can be solved for using the methods
of relativistic transformation of coordinates leading to modified Bessel composite function
solution, method of separation of variables and method of Laplace transforms. Numerical
solution procedures can be used when the equations become nonlinear such as in the case of
free radical polymerization reactions.
Transient analysis of first order reversible reactions, reactions in series-parallel, reactions
that obey the Michaelis and Menten kinetics are discussed in detail. The use of final time
condition and physically reasonable energy balance considerations can lead to solutions that
are bounded and within the scope of the second law of thermodynamics for problems that can
be described using non-Fourier conduction equation. The temperature profile in a PFR is also
obtained. Energy balance under transient conditions is used in the analysis. The case of two
interacting and non-interacting tanks is discussed as exercises.
Transient dynamics of concentration, temperature separately and concentration and
temperature both in a PFR and CSTR were discussed. The dimensionless group called
Damkohler number in addition to conversion, dimensionless time, and residence time was
used to describe the transient output response from a CSTR. The hydrolysis reaction of
ethylene oxide to ethylene glycol was considered in a CSTR. For incompressible flow and for
a constant volume system the steady state and transient conversion were derived. The
308
transient model solution is given as equation. CSTR with recycle was considered in Example
4-6.
The transient temperature in a mixing tank that is heated is given. A fourth order RungeKutta method was used for numerical integration of the ODE, ordinary differential equation.
Temperature vs. Time in reactor as response to a step change in input is obtained and
displayed in Figure 4.20. A state space model was developed to describe a jacketed CSTR.
The output variables of interest are dimensionless conversion, dimensionless temperature and
is given in Eq. (4.41).. If all of the Eigenvalues of the state space A matrix are negative then
the system is expected to be stable. A system with one Eigenvalue zero and one Eigenvalue
negative is called an integrating system. If the Eigenvalues are complex conjugates the system
is considered oscillatory. Sometimes the oscillatory output response may be subcritical and
damped, underdamped or critically damped. The stability type and characterization of
stability for each of these cases are given in Table 4.3.
The transient concentration of initiator and monomer during free radical polymerization
in a CSTR was obtained in Example 4.4. DaI, Damkohler number (initiator) and DaM,
Damkohler number (monomer) were introduced. The steady state conversions were obtained
as a function of the Damkohler number. Eq. (4.58) that is used to describe the transient
conversion of monomer is non-linear. The conversion of initiator and monomer as a function
of time is displayed in Figure 4.10. Multiplicity was found in model solution of conversion of
monomer. Conversion of initiator was monotonic. It can be seen from Figure 4.10 for the
parameters used in the simulation study the transient conversion of monomers undergoes a
maximum value.
The general form of prototypical first order and prototypical second order system were
provided. The first order process is characterized by process gain constant, kp and process
time constant, tp. The second order process is characterized by the process gain, kp, damping
coefficient, and process time constant, tp. When the damping coefficient, z > 1 the system is
over damped, when z = 1 the system is said to be critically damped and when z < 1 the system
is expected to undergo a overshoot and is said to be underdamped oscillatory.
4.6. GLOSSARY
Damkohler number is the ratio of the residence time of the reactants and other species
in the reactor compared with the intrinsic reaction time depending on the chemistry.
Denbigh Scheme of Reactions
PFR plug flow reactor is a contacting scheme where the velocity of the fluid is constant
throughout the tube, the conversion varies along the length of the tube and is one of the best
performing reactor type.
CSTR continuous stirred tank reactor.
CSTRs in Series number of CSTRS are operated in series or other configuration. 3 or
more CSTRs are needed to provide an equivalent performance in a PFR.
free radical polymerization mechanism of polymerization reactions by free radical
propagation of initiation, propagation and termination.
thermal initiation polymerization, mechanism of initiation of free radical propagation
reactions during polymerization by heat rather than initiator.
309
polyrate, rate of polymer formation per unit time or rate of monomer consumption per
unit time.
time constant, p parameter that can be used to characterize exponential rise and
exponential decay in transient applications for first and higher order systems. A system with
large time constant would give a sluggish response and one with a smaller time constant
would provide a quicker response.
process gain, kp parameter used to characterize input-output relation in first and higher
order systems
fractional conversion, Xj amount of species that has been reacted compared with the
initial concentration of the species
thermal conductivity, k, proportionality constant in Fouriers law of heat conduction.
Material property.
heat capacity, Cp. thermo physical property of
material. Amount of energy in kilojoules needed to
raise on gram of a material by 1 degree K.
relaxation time, r, thermo physical property of
material. Measure of velocity of heat. Materials with
larger relaxation time will allow slower speeds of heat.
residence time, the time the reacting and product species stays in the reactor.
4.7. FUTHER READINGS

Agrawal, P., Lee, C., Lim, H. C. & Ramkrishna, D. (1982). Vol. 37, 3, 453-452, Chemical
Engineering Science.
Al-Nimr, M., Naji, M. & Al-Wardat, S. (2003). Vol. 42, 8, 5383-5386, Japanese Journal of
Applied Physics, Part I: Regular Papers and Short Notes & Review Papers.
Antaki, P. J. (1998). Vol. 41, 14, 2253-2258, Int. J. of Heat Mass Transfer.
ASME Transactions, Heat Transfer Division,
Bai, C. & Lavine, A. S. (1995). Vol. 117, 256-263, J. Heat Transfer.
Barletta, A. & Zanchini, E. (2003). Vol. 32, 8, 5383-5386, Heat Mass Transfer/Warema-und
Stoffuebertragung.
Bird, R. B., Stewart, W. E. & Lightfoot, E. N. (1960). Transport Phenomena, Hoboken, NJ:
John Wiley & Sons.
Casimir, H. B. G. (1938). Vol. 5, 495-500, Physica.
Cattaneo, C. (1948). Sulla conduzione del Calore Syracuse, Societa Tipograpfica Moderne
Chapra, S. C. & Canale R. P. (2006). Numerical Methods for Engineers, New York: McGraw
Hill Professional.
Coughabowr, D. R. & LeBlanc, S. E. (2009). Process Systems Analysis and Control, New
York: McGraw Hill Professional.
Froment, G. F., Bischoff, K. B. & De Wilde, J. (2011). Chemical Reactor Analysis and
Design, Hoboken, NJ: John Wiley & Sons.
Golnaraghi, F., Kuo, B. C. (2010). Automatic Control Systems, Hoboken, NJ: John Wiley &
Sons.
310
Haji-Sheik, A. M., Minkowycz, W. J. & Sparrow, E. M. (2002). Vol. 124, 2, 307-319, J. Heat
Transfer.
Joseph, D. D. & Preziosi, L. (1989). Vol. 61, 41-73, Review of Modern Physics.
Landau, L. & Liftshitz, E. M. (1987). Fluid Mechanics, Pergamon, United Kingdom.
Levenspiel, O. (1996). Chemical Reactor Omnibook, Corwallis, OR: 1989.
Levenspiel, O. (1999). Chemical Reaction Engineering. Hoboken, NJ: John Wiley & Sons.
Maxwell, J. C. (1867). Vol. 157, 49, Phil. Trans. Roy.
Michaelis, L. & Menten, M. L. (1913). Vol. 49, 333, Biochem Z.
Mitra, K., Kumar, S., Vedavarz A. & Moallemi, M. K. (1995). Vol. 117, 568-573, J. Heat
Transfer.
Monod, J. (1949). Vol. 3, 371, Ann. Rev. Microbiology.
Nernst, W. (1917). Die Theoretician Grundalgen des n Warmestatzes, Knapp Hall, Frankfurt,
Germany.
Onsager, L. (1931). Vol. 37, 405-426, Phys. Review.
Ozisik, M. N. & Tzou, D. Y. (1994). Vol. 116, 526-535, ASME Journal of Heat Transfer.
Qiu, T. Q. & Tien, C. L. (1992). Vol. 196, 41-49.
Renganathan, K. (1990). Correlation of Heat Transfer with Pressure Fluctuations, Ph.D.
Dissertation, Morgantown, WV: West Virginia University.
Sharma, K. R. (2005). Damped Wave Transport and Relaxation, Amsterdam, Netherlands:
Elsevier.
Sharma, K. R. (2006). Errors in Gel Acrylamide Electrophoresis Due to Effect of Charge,
March Atlanta, GA: 231st ACS National Meeting.
Sharma, K. R. (2009). Bioinformatics: Sequence Alignment and Markov Models, New York:
McGraw Hill Professional.
Sharma, K. R. (April, 2006). Finite Speed Diffusion and Delivery of Drugs and Response to
Pulse Decay, Easton, PA: 32nd Northeast Bioengineering Conference.
Sharma, K. R. (February 2006). A Fourth Mode of Heat Transfer called Damped Wave
Conduction, Santiniketan, India: 42nd Annual Convention of Chemists.
Sharma, K. R. (March, 2003). Storage Coefficient of Substrate in a 2 GHz Microprocessor,
New Orleans, LA: 225th ACS National Meeting,
Sharma, K. R. (March/April 2003). Critical Radii Neither Greater than the Shape Limit nor
Less than Cycling Limit, New Orleans, LA: AIChE Spring National Meeting.
Shuler, M. L. & Kargi, F. (2002). Bioprocess Engineering Basic Concepts, Upper Saddle
River, NJ: Prentice Hall.
Taitel, Y. (1972). Vol. 15, 2, 369-371, Int. J. Heat Mass Transfer.
Tzou, D. Y. (1996). Macro to Microscale Heat Transfer: The Lagging Behavior, New York,
CRC Press.
Varma, A. & Morbidelli, M. (1997). Mathematical Methods in Chemical Engineering,
Oxford, UK: Oxford University Press.
Vernotte, P. (1958). Paris, Vol. 246, 22, 3154-3155, C. R. Hebd. Seanc. Acad. Sci
Wayne Bequette, B. (2003). Process Control: Modeling, Design and Simulation. Upper
Saddle River, NJ: Prentice Hall.
Xie, Y. S., Yuan, Y. X. & Zhang, X. B. (2006). Vol. 27, 24-28, Bimggmg Xuebao/Acta
Aramamentarii.
Zanchini, E. (1999). Vol. 60, 2, 991-997, Phys. Review B Condensed Matter and Material
Physics.
311
4.8. EXERCISES
1. CSTR with Recycle
Consider the operation of a CSTR with provisions for recycle as shown in Figure
4.26.
Obtain the model equations for transient conversion as a function of dimensionless
time. The r CSTR is operated at constant volume V. The reaction performed in the
CSTR obeys the first order reaction kinetics. Part of the effluent (v-w) from the
CSTR is recycled back to the feed as shown in Figure 4.26. The feed is v moles/liter
at a initial concentration of reactant A at CA0.. The reaction is a first order reaction;.
dC A
dt
rA =
(4.234)
k1C A
Where k1 is the first order rate constant with units of hr-1 and CA is the concentration
of reactant A (mol.lit-1). The residence time in the CSTR be given by (hr) and
recycle ratio R is given by;
(4.235)
Show that the governing equation for conversion of A, X A
C A0 C A
C A0
can be
expressed as a function of the (Da = k1) and recycle ratio, R as follows;
(X A)
Da
R
1 XA
1 R
R
R 1
XA
dX A
d
Da 1 X A
1
R 1
Da
dX A
d
(4.236)
(4.238)
Show that Eq. (4.238) can be integrated by separation of variables and the solution
XA
R Da 1 Da
1 Da( R 1)
1 e
1
Da
R 1
(4.239)
312
Figure 4.26. Dynamics of CSTR with Recycle.
What happens when the reflux ratio R 0, and R ,

2.0. Reversible Reaction Performed in a CSTR
Consider a CSTR with a single reversible reaction.
kf
(4.240)
P
kb
The reaction rate of A is first order in the forward and reverse direction and is given
by;
dC A
k f C A kb CP
dt
C P C A0 C A
dC A
dt
(k f
kb )C A
(4.241)
kb C A0
Where kf, and kb are the forward and reverse reaction rate constants with units of
(sec-1). Develop the model equation for conversion of reactant A. Use the
dimensionless group of Damkohler number and conversion X if necessary. Obtain
the model solution for the dynamics of reactant A.
3.0. Toricellis Theorem Applied to Drainage from a Storage Tank
The inlet velocity of the fluid to a storage tank as shown in Figure 4.27 is v1 (m3.s-1).
g h , where h is the instantaneous height of the fluid in the

v1 can be given by v1
tank. The height of the tank, h(t) varies with time, t. (a) Develop an mathematical
expression for the efflux velocity v2. (b) Calculate the drainage time of the tank in
Figure 4.27. At time t = 0, assume that the initial height of the fluid in tank is H0.
313
Aorifice is the cross-sectional are of the outlet orifice and Atank is the cross-sectional
area of the tank. Assume that the fluid is incompressible during flow.
Figure 4.27. Drainage of Tank of Fluid.
4.0. Zeroth Order Reaction in a CSTR.

Consider a single reaction performed in a CSTR with a volume of the reactor V
liters.
AP
(4.242)
The reaction rate is given by;

dC A
dt
k0
(4.243)
Where k0 is the zeroth order rate constant with units of (mol/(litsec)-1).

Develop the model equation for conversion of reactant A as a function of
dimensionless time. Assume that the flow is incompressible and the reactor is
operated at constant volume throughout the reaction. Use the dimensionless group of
Damkohler number if necessary and discuss the transient behavior of conversion
from start-up of the reactor to the time it reaches steady state. What happens after
steady state is reached ?
5.0. Transient PFR with Zeroth Order Reaction in a PFR
Consider a PFR, plug flow reactor as shown in Figure 4.13. The concentration varies
along the length of the reactor. The performance of the reactor is expected to be
better than that in a CSTR. Assume that the flow is incompressible and the velocity is
in a state of plug flow i.e., velocity of the fluid across the cross-section of the tube
is the same. Develop the model equations for the transient conversion of species A
314

that obeys the zeroth order kinetics. As the flow is incompressible the velocity of the
fluid is same throughout the length of the reactor and is v (m3.s-1). Let z be the
distance from the entrance of the reactor. Show that the governing equation can be
given by;
CA
z
v
A
CA
t
k0
(4.244)
Where k0 is the zeroth order rate constant with units of (mol/(litsec)-1). The zeroth
order reaction rate for species A can be written as follows;
dC A
dt
(4.245)
k0
Discuss the transient behavior of conversion from start-up of the reactor to the time it
reaches steady state. What happens after steady state is reached ? The dimensionless
variables of conversion, XA, dimensionless time, and Damkohler number Da are
defined as follows;
C Ai C A
;
C Ai
XA
Z
z
; Da
l
t
(4.246)
k0
C Ai
Show that the governing equation for concentration of species A becomes;
XA
Z
XA
Da
(4.247)
Differentiating the above equation with respect to Z and with respect to separately
and subtracting one from the other the governing equation can be seen to take the
form of the wave equation;
2
XA
XA
2
(4.248)
6.0. Hydrolysis of Ethylene Oxide in Two CSTRs in Series

Consider performing the hydrolysis of ethylene oxide in Example 4.1 in two CSTRs
in series as shown in Figure 4.28.
Assume incompressible flow and first order reaction reaction for species A, i.e.,
ethylene oxide. Develop the model equations that can be used to describe transient
dynamics of hydrolysis of ethylene oxide in Example 4.1 in two CSTRs in series as
315
shown in Figure 4.28. The volumes of the two reactors are V1 and V2 respectively.
The volumes of the two reactors may be assumed to be a constant during the course
of the reaction. Show that the transfer functions of conversion of species A (ethylene
oxide) at the outlet of CSTR 2 can be given by;
Da1
g p2 s
Da2
s Da1 1 1 Da2
1 Da2
(4.249)
2
1
Where Da1 = (k1); Da2 = (k2); 1 is the residence time in CSTR 1 and 2 is the
residence time in CSTR 2. Sketch the conversion of species A from CSTR 1 and
CSTR 2 as a function of time. From the final value theorem show that at steady state
the conversion from the exit of CSTR 2 would be;
Da2
1 Da2
X A2 s
Da1
1 Da1
(4.250)
7.0. Underdamped Oscillatory Response in Two CSTRs in Series.

1
For a step input of r s
to the system in exercise 6.0 show that the output
s
transfer function is given by;
Da1
X A2 s
s2
s2
2
1
s 1 2 Da2
Da2
2
1
1 Da1 1 Da2
s 2 1 Da2
(4.251)
s
2
1
Figure 4.28. Transient Dynamics during Hydrolysis of Ethylene Oxide in Two CSTRS in Series.
316

Show that the first term in the RHS, right hand side of Eq. (4.194) can be seen to be
of the form of prototypical second order process of the form;
kp u
y (s)
s
2 2
ps
(4.252)
2s
Show that the gain, kp, time constant, p and damping coefficient, of the
prototypical second order process can be seen to be;
kp
2
p
Da1
1 Da1 1 Da2
1
1 Da1 1 Da2
2
1
1 2 Da2
1
2
(4.253)
2 1 Da1 1 Da2
Can the damping coefficient < 1 ? What are the ramifications of this ?
8.0. Show that the space equation for the two conversions, XA1, XA2 from the two CSTRs
in Exercise 16.0 can be written as follows;
d X A1
dt X A2
1 Da1
0
1
Da2
Da1
Da2
(4.254)
Show that the eigenvalues are (1+Da1) and
Da2
. Confirm that negative
eigenvalues indicate a stable system for any value of the Damkohler number and
residence times in the reactors.
9.0. Sutro Weir
Consider the tank that is filled and depleted at different rates. The height in the tank
varies with time and is given by the function h(t). A mass balance on the control
volume of the fluid in the tank can be written as follows;
vi t
v0 t
dh
dt
(4.255)
Where A is the cross-section area of the tank. Incompressible flow is assumed. The
discharge rate v0(t) in lit.sec-1 can be written in terms of the height in the tank by
invoking the linear flow-head relation as found in Sutro weir. This relation is;
317
Figure 4.29. Level in Tank.
v0 t
h(t )
R
(4.256)
Where R is the resistance to flow.

Plugging. Eq. (4.256) in Eq. (4.255) and obtaining the Laplace transfer function and
assuming that the initial height in the tank is zero show that the transfer function can
be given by;
h s
vi s
R
sRA 1
(4.257)
10.0. Non-Interacting Tanks.

Consider two tanks in series as shown in Figure 4.30. These can be considered to be
non-interacting. The discharge from the first tank is through the atmosphere to the
second tank. The height in the first tank does not depend on the happenings in the
second tank. From mass balance show that the governing equations for h1(t) and h2(t)
vi t
h1
R1
h1
R1
h2
R2
A1
A2
dh1
dt
dh2
dt
Where A1 and A2 are the cross-sectional areas of the two tanks in Figure 4.30.
(4.258)
318
Figure 4.30. Two Non-Interacting Tanks.
Show that the transfer function can be written as;
h2 s
vi s
R2
1 sA1R1 1
sA2 R2
(4.259)
1
. Confirm that for any positive value of
s
resistances and cross-sectional areas the output response is monotonically stable.
11.0. Two Interacting Tanks
Consider two tanks in series as shown in Figure 4.31. These can be considered to be
interacting. The discharge from the first tank feeds directly into the second tank.
The height in the first tank does depend on the happenings in the second tank. From
mass balance show that the governing equations for h1(t) and h2(t) can be written as
follows;
Further consider a step change of r ( s)
vi t
h1
R1
h1
R1
h2
R2
h2
R1
dh
A2 2
dt
A1
dh1
dt
(4.260)
Where A1 and A2 are the cross-sectional areas of the two tanks in Figure 4.31.
Show that the transfer function for the heights in the tanks, h1(s) and h2(s) can be
written as follows;
319
Figure 4.31. Two Interacting Tanks.
R1 sA2 R2 1
h1 s
vi s
A1 A2 R1R2
1 R2
h2 s
h1 s
A R A2 R2
s 1 1
1 R2
R2
1
R1 sA2 R2 1
(4.261)
1
(4.262)
12.0. Underdamped Oscillatory System

Consider a step change to the height in tank 1 in Figure 4.31 Confirm that the
transfer function for level in tank 1, h1(s) conforms to a prototypical second order
system. Under what conditions of the cross-sectional areas of the tanks and the
resistances to flow in the two tanks would there be a underdamped oscillatory
response ? Where does the fluid come from for causing the overshoot ?
13.0. Average Concentration of Oxygen in Islets of Langerhans during Parabolic
Fick Diffusion
Oxygen availability becomes limited in some regions of the tissue [55]. An oxygen
reaction and diffusion model was developed by Colton [56]. The transient diffusion
of oxygen in blood plasma and tissue that undergoes simultaneous reaction by
Michaelis-Menten kinetics is modeled. At the asymptotic limit of high reactant
concentration the reaction rate becomes zero order. The model solution consists of a
steady state and transient part. This removes the heterogeneity in the governing
320

equation. The governing equation for oxygen diffusion and reaction in Cartesian
coordinates in one dimension accounting for Ficks diffusion can be written as;
CO2
t
DT
CO2
kCE 0CO2
z2
CM
(4.263)
CO2
Where DT is the diffusion coefficient in the tissue, CE0 is the total enzyme or
complexation species concentration and CM is the Michaelis constant and k is the rate
constant. The oxygen consumption rate is assumed to obey the Michaelis-Menten
kinetics. The governing equation describes the interplay of transient diffusion and
metabolic consumption of oxygen in the tissue. The concentration of oxygen, CO2
can be expressed in terms of its partial pressure, pO2 . This is obtained by using the
Bunsen solubility coefficient, t such that;
CO2
t pO2
(4.264)
Substituting Eq. (4.206) in Eq. (5.195), Eq. (4.205) becomes;
pO2
t
2
t DT
pO2
z
kCE 0 pO2
'
CM
(4.265)
pO2
The product tDT can be seen to the product of solubility and diffusivity and hence is
the permeability of oxygen in the tissue. The Michaelis constant CM, is also
modified, CM expressed in units of mm Hg. The initial condition can be written as;
pO2
pO20 , t = 0
(4.266)
From symmetry at the center of the slab;

pO2
z
(4.267)
At the surface,(z=a) the oxygen diffusive transport from within the tissue must be
equal to the oxygen transport by convection across the boundary layer surrounding
each tissue;
Ji
ki
m ( pO2 m
pO2 ( Ri ))
tD
pO2
T
(4.268)
z a
An average partial pressure of oxygen in the tissue or slab can be defined as;
321
1
2a
pO2
pO2 dz
(4.269)
Integrating Eq. (4.265) with respect to z between the finite limits of a and +a and
substituting Eq. (4.269) in the resulting equation;
pO2
t
ki
pO2 m
pO2
kCE 0
(4.270)
Eq. (3.112) is valid at the asymptotic limit of high oxygen concentration.

Obtain the transient average partial pressure of oxygen in the finite slab as a function
of time. Obtain the transient average concentration for oxygen in a finite slab at the
asymptotic limit of low oxygen concentration.
Chapter 5
PROPORTIONAL, PROPORTIONAL INTEGRAL,

PROPORTIONAL DERIVATIVE FEEDBACK CONTROL
5.1. CONTROL SYSTEMS
The field of controls is an interdisciplinary one. It is a confluence of mathematics and
engineering. Electrical, mechanical, chemical and computer are branches of engineering that
have courses where students learn control theory. Dynamics of a system is of primary
importance in this field. It all began when the scholar J. C. Maxwell investigated the
dynamics of the centrifugal governor in an 18th century Boulton and Watt engine. He looked
at self-oscillations and how the lags in the system results in overcompensation that leads to an
unstable system. The conditions when a system can be expected to undergo underdamped
oscillations was discussed in Chapter 4.0. Mathematical modeling of the process is an
important task in the analysis and design of control systems. When the dynamics of the
system modeled can be converted to Laplace domain they can also be represented in block
diagram format. The control system may be linear or non-linear. Analysis of non-linear
systems need numerical solutions. Closed form analytical solutions may be obtained for linear
systems. Sometimes when multiplicity in solution is seen, another criterion is needed to select
the correct solution from the results obtained.
Different components such as mechanical, thermal, fluid, chemical/concentration of
reacting species, pneumatic and electrical, sensors, robotic manipulators, actuators, and
computers can be part of a control system. The governing equations for these systems are
represented by differential equations, originating from Newtons second law of motion of
particle, Kirchoffs law of circuits. The results obtained from these models are only good for
the assumptions made in deriving the model. A number of problems can be represented by
ordinary differential equations.
5.1.1. On-Off Control

On-off controllers are used in centralized heating and air conditioning in modern homes,
control of level in a tank used as a process vessel, remote control of Christmas tree lighting
etc. For example, consider a CHP, combined heat and power system. This technology is also
324
called as cogeneration. A gas turbine is used to drive an electrical generator and the heat from
the exhaust of the turbine is used to produce thermal energy in the form of steam, hot water or
hot air. In Figure 5.1 is shown an on-off control strategy for a typical CHP system,[Mackay,
2003]. Gas turbine ratings can vary between 500 kw to 30 kw in cases of micro turbines.
Control system is needed to safeguard the system from spikes in loads as various
appliances are used. Comfort heating and domestic water heating units cycle ON and OFF.
The CHP system is operated using a sub atmospheric Brayton cycle. A heating system is
designed to operate in cyclical fashion. For example, a commercial water heater or a furnace
operates in the full ON or full OFF mode. When heating system is required and turned ON the
system starts and provides the heat using the rejected heat from the gas turbine. Electricity is
produced in parallel. When the TT, temperature transmitter in Figure 5.1 detects a
temperature when compared with the set point temperature Tsp calls for heating, a signal is
sent to the ON/OFF fuel valve enabling it but not opening it. In a similar manner the PT,
pressure transmitter detects the pressure and this value is compared with the set point
pressure, Psp in the PC, pressure controller. A signal is sent to the ON/OFF fuel valve. Thus
On-Off controller is used to shut down the system when no more heat is required. This can be
found when Tm > Tsp, i.e., when the measured temperature exceeds the set point temperature
by a threshold amount, .
5.2. PROPORTIONAL CONTROL

A control action that is taken that is proportional to the error detected is called as
Proportional Control. The equations that can be written to capture such control actions are as
follows;
Figure 5.1. On-off Control of Gas Turbine Operated Power Plant.
Proportional, Proportional Integral, Proportional Derivative Feedback Control
325
Pv1 = b1 + kc1(Tsp Tm)
(5.1)
Pv2 = b2 + kc2(Psp Pm)
(5.2)
Where the error in temperature and pressure can be written as follows;

e1 = Tap - Tm
(5.3)
e2 = Psp - Pm
(5.4)
b1 and b2 in Eq. (5.1) and Eq. (5.2) are the bias terms. At steady state when the error e1(t) and
e2(t) becomes zero the bias terms are equal to the steady state temperature Tss and steady state
pressure, Pss. kc1 and kc2 are the proportional gain of the temperature controller and pressure
controller respectively.
5.3. CONTROL BLOCK DIAGRAMS

A controller transfer function can be developed for every control action taken. Consider,
for example the proportional control action illustrated in section 5.2. The proportional control
law for temperature and pressure can be written by substituting the steady state pressure and
steady state temperature in the bias terms in Eqs. (5,1. 5.2) as follows;
Pv1 - Tss = kc1(Tsp Tm)
(5.5)
Pv2 -Pss = kc2(Psp Pm)
(5.6)
The errors e1(t) and e2(t) can be written as;

e1(t) = Tap - Tm(t)
(5.7)
e2(t) = Psp - Pm(t)
(5.8)
The controller outputs can be written as c1(s) and c2(s) in the Laplace domain as follows;
c1(s) = kc1 e1(s) = gc1(s)e1(s)
(5.9)
c2(s) = kc2 e2(s) = gc2(s)e2(s)
(5.10)
Eq. (5.5) and Eq. (5.6) is the transfer function form for a proportional only controller.
This can be shown as a block diagram as shown in Figure 5-2.
326
Figure 5.2. Block Diagram Relation for Transfer Function for Temperature Controller and Pressure
Controller as Shown in Figure 5.1 for CHP Systems.
In a similar manner block diagram relation for valve and the process system under
consideration can be constructed. In addition a transfer function may be written for
disturbance or load and measurement or sensor. A control block diagram for the temperature
and pressure control as shown in Figure 5.1 for a CHP, combined heating and power system
can be constructed. This is shown in Figure 5.3.
Figure 5.3. Control Block Diagram for Pressure, Temperature Control for CHP System.
327
The pressure and temperature in the gas in the compressor are measured using
temperature and pressure sensors. The sensor location is such the combined effect of process
and the load are captured in the measurement. The error signal is generated in the controller
by comparisons with the set point temperature, Tsp and set point pressure. The control action
taken is proportional to the error or on-off as the case may be. In any case the control transfer
function is shown as a block in Figure 5.3. The valve transfer function also is an important
link to the process. The process transfer function can also be shown in the box. It can be a
prototypical first order or second order process as discussed in the previous chapter. This kind
of control action is called as feedback control. The temperature and pressure measurements
were used in the control action taken.
Gains can be defined as the ratio of steady state change in output in response to a steady
state change in input variable. This can be defined for the valve, process, controller etc.
Valve Gain:Valve gain may be defined as;
kv
v
Pv1
(5.11)
Where v is the change in flow rate and Pv1 is the change in valve top pressure. An
example of on-off control action using valve can be seen in end of chapter exercise 2.0. The
gain is said to be positive when the flow rate increases with increase in the valve top pressure.
The gain is said to be negative when the flow rate decreases with increase in valve top
pressure.
Process Gain: Process gain may be defined as;
V
Pv1
k p1
(5.12)
For example in exercise 2.0 at the end of chapter the process gain is the change in the
volume of the CSTR in response to a change in valve top pressure. For a positive gain the
volume of the reactor contents increases and for a negative gain the volume of the reactor
contents decreases when the valve top pressure is increased. The controller gain is kc as
defined in Eq. (5.5) and Eq. (5.6).
5.4. OFFSET USING PROPORTIONAL ONLY CONTROLLERS

Consider a simplified block flow diagram of a proportional controller for a prototypical
first order process. Although Figure 5.4 is for PI controller it can be used for illustration of
proportional controller only as well.
kp
g p ( s)
gc ( s)
ps
kc
(5.13)
328

r(s) = gCL(s) y(s)
(5.14)
A closed loop transfer function gCL(s) is defined as shown in Eq. (5.10). This can be seen
from simplification of the transfer functions in the block diagram in Figure 5.4 to be;
g p ( s) gc ( s )
gCL ( s)
(5.15)
1 g p ( s) gc ( s )

kc k p
ps
gCL ( s )
kCL
kc k p
kc k p
1
1
kCL
Where,
CL s
(5.16)
ps
kc k p
kc k p 1
(5.17)
p
CL
kc k p 1
The closed loop transfer function gCL(s) conforms to the prototypical first order process.
Stability considerations require that;
CL > 0
(5.18)
kckp > -1
(5.19)
The time output response to a step change in input with magnitude Q can be shown to be;
t
y (t ) QkCL 1 e
CL
(5.20)
At steady state or after infinite time,

y(t) = QkCL
(5.21)
Only for values of kCL = 1 there is no offset. For other values of kCL 1, an off-set will be
realized after enough time has elapsed since the step change was initiated. The process output
will not be equal exactly to the set point. The final value theorem can be used to estimate
the offset when P only control is used.

Lt e(t )
t
Lt se(s )
s
Lt s r (s )
y (s )
Offset =
Lt sr (s ) 1 gCL (s )
329
kCL
CL s 1
Q 1
Q 1 kCL
Q
1 kc k p
(5.22)
5.5. PROPORTIONAL-INTEGRAL, PI CONTROL

It can be seen from the discussion in sections 5.3-5.5 the use of P only control can lead to
an off-set between the desired set point and actual output. The control action can be modified
by inclusion of a component that is proportional to the integral of the error. This can be in
addition to the proportional to the error component used in P only control. This kind of
control is called proportional-integral or PI control. The process history is taken into account.
In this method the rectification takes place until the offset vanishes. Say there is an offset for
a said period of time. The integral of the error would be finite. Control action is proportional
to the integral of the error. This would reduce the error term. This progressively down can
lead to zero error. The two tuning parameters are kc and kI. The PI control action law can be
written as follows;
t
u (t )
kc e(t ) k I e
(5.23)
d }
(5.24)
Eq. (5.19) can also be written as;
u (t )
kc {e(t )
I 0
I is the integral time and is given by kc/kI, the ratio of the tuning parameters. Obtaining
the Laplace transform of Eq. (5.20);
u (s)
kc {e(s)
s I
e(s)
} kc e(s)
s I
s
(5.25)
Figure 5.4. Simplified Control Block Diagram for PI Controller for Prototypical First Order Process.
The control transfer function for PI control is thus given by gc(s) where u(s) = gc(s)e(s).
330
gc ( s)
kc
(5.26)
Example 5.1. PI Control Action for Prototypical First Order Process

Consider any prototypical first order process. Consider a PI controller used to control this
process. Let the process gains, kp = kc =1. What would be the time response of the process
output variable y(t) to a step change in the set point, r(s) = 1/s. The time constant of the
controller, I becomes 1% of the time constant of the process, p. The simplified control block
diagram is given below. Disturbances are neglected and valve and measurement dynamics are
lumped into the process transfer function. Develop the expression for the output variable y(s)
in the Laplace domain and time domain y(t). Sketch the response y(t) as a function of time.
The transfer functions for prototypical first order process, gp(s) and that for PI control, gc(s)
can be seen to be;
kp
g p ( s)
ps
gc ( s)
Is
kc
ps
gc (s)
kc
(5.27)
1
Is
kp
g p (s)
r (s)
1
ps 1
Is
(5.28)
Is
1
s
y(s) = gp(s) u(s) = gp(s) gc (s) e(s) = gp(s) gc (s)(r(s) y(s))

Is
y(s)
y (s)
p Is
L1
Is
2
0.01
0.01
2 2
ps
Is
1
2s
Is
0.01
1
I s 1 (s)
(5.30)
0.01 p s 1
1
y(s)
1 ( s)
0.02s
0.01
L1
Where (As+B)(Cs+D) = 0.01p2s2 + 0.02sp + 1
(5.29)
2 2
ps
0.02s
1
As
L1
1
1 (s)
1
CS
(5.31)
(5.32)
331
Eq. (5.12) in the time domain can be seen to be;
0.01
e
p
Bt
A
Dt
C
(5.33)
2t
L1
s
2 2
1
s 1
e
1
sin
(5.34)
2
tan
y(t) is the sum of Eq. (5.13) and Eq. (5.14). It can be seen from Figure 4.5 that y(t) can
undergo a overshoot. This would happen when the damping factor, < 1.0. The system
described by Eq. (5.11) can be seen to be an underdamped system. The damping factor, =
0.1 which is less than 1.0. It is not clear as to what is causing the overshoot from the control
action of the process. Mathematically the control transfer function and process combine in a
form where an underdamped system can occur. Figure 5.4a is an example of a simplified
closed loop of a controller and process. A closed-loop transfer function can be defined as
follows;
y(s)
gCL (s)r (s)
g p ( s ) gc ( s )
1 g p ( s) gc ( s)
The denominator in Eq. (5.15) is called the characteristic equation. For stability,
gp(s)gc(s) >>-1. The open loop configuration is shown in Figure 5.4.
The denominator in Eq. (5.15) is called the characteristic equation. For stability,
gp(s)gc(s) >> -1.
The denominator in Eq. (5.15) is called as the characteristic equation. For stability,
gp(s)gc(s) >>-1. The open loop configuration is shown in Figure 5.4a.
Figure 5.5. Open Loop Configurations of Controller and Process.
332
Example 5.2. Closed Loop Transfer Function

Derive the closed-loop transfer function between y(s) and l(s) and r(s)for the following
control block diagram. This is for a feed forward/feedback controller.
y(s) = X(s) + Z(s)
(5.36)
Z(s) = GL(s) L(s)
(5.37)
X(s) = Gp(s) u(s)
(5.38)
u(s) = v(s) + w(s)
(5.39)
V(s) = Gc(s) e(s)
(5.40..)..
w(s) = Gf(s) L(s)
(5.41)
r(s)- ym(s) = e(s)
(5.42)
y(s) = Gp(s) {Gc(s){r(s) ym(s)}+ Gf(s) L(s)} +GL(s)L(s)
(5.43)
Now, ym(s) = Gm(s) y(s)
(5.44)
y( s)
G p ( s)Gc ( s)r ( s) L( s) G f s G p s
GL s
(5.45)
1 G p ( s)Gc ( s)Gm ( s)
Example 5.3. PI Control of Voltage Supplied to Automatic Washing Machine

The operation of an automatic washing machine comprises of the following Steps; (i)
wash step; (ii) rinse step and; (iii) dehydration step. A brushless DC motor drives an agitator
and rotating tub during the wash step. During the rinse step only the rotating tub is used.
Voltage is applied to the motor and controls the torque on the motor. The model equations
that relate torque to agitator RPM are as follows;
d
dt
Bm m
Jm
1
Jm
(5.46)
m is the rotor speed and m is the applied torque to the agitator. Both rotor speed and
applied torque vary with time. Although the model equation predicts the relation between the
rotor speeds with the applied torque, there is no model available for applied voltage on the
motor and the applied torque. The controller will have to increase the voltage or decrease the
voltage, check the angular speed against set point sp and adjust the voltage again till that set
point angular speed is attained. Use a PI controller and develop a block diagram for the
voltage control of the automatic washing machine. Noise and vibration need be minimized.
Comment on the closed-loop stability transfer function, gCL(s).
333
Figure 5.5a. Control Block Diagram of Feedback/Feed forward Control.
Figure 5.6. Block Diagram for PI Control of Automatic Washing Machine.
Toshiba washing machine [2] comprises of an electric motor where the torque needed for
wash, rinse and dehydration steps are generated. It also contains a current detector that
measures current flowing into the motor. A torque controller is used to optimize the torque
developed for each of the wash, rinse and dehydration steps. The current measurement is used
as feedback prior to control action being taken.
Typical automatic washing machines comprise of a DC motor that is used to drive an
agitator and a rotating tub in the wash step and only the rotating tub in the rinse step. A third
dehydration step is also completed. According to the driving condition of the motor the
voltage applied to the motor is increased or decreased thereby controlling the torque
developed by the motor in order to drive the agitator and tub. PI control action is on the
rotational speed of the motor. The basis or target speed is a ref, angular speed or RPM at the
dehydrating step. A measured speed can be acquired during the operation of the machine.
One of the problems encountered during the operation of such washing machines is as
follows. A rotational speed of the motor is proportional to the torque developed. The
developed torque, on the other hand, is not proportional to the voltage supplied. The control
action is by increasing or decreasing the applied voltage. An unstable operation condition
may be encountered. This would happen when the operating speed and target angular speed
334
ref will diverge and not be equal to each other. Further, a motor speed variation is increased
in the wash operation from 0. 150 RPM in about 200 milliseconds the PI control
action.cannot be applied to the wash step.
Motor torque control that is more precise is the goal of the Toshiba technology. Electric
current measurements are used as feedback in the torque control.
Bm m
Jm
dt
(5.47)
Jm
Obtaining the Laplace transform of Eq. (5.25);
Bm
Jm
m ( s)
s Jms
g p (s)
In Figure 5.6,
Jm
m (s)
Or,
m ( s)
(5.49)
Bm
m ( s)
(5.48)
(5.50)
s J m s Bm
The control transfer function for PI Controller can be written as;
gc ( s )
kc
Is
(5.51)
y(s) = gp(s) u(s)
(5.52)
y(s) = gp(s) gc(s) {r(s) y(s)}
(5.53)
y( s)
g p ( s ) g c ( s )r ( s )
(5.54)
1 g p ( s) gc ( s)
For closed loop stability, gp(s) gc(s) >> -1. i.e.,
m (s)
2
s sJ m
kc
Bm
Is
I
(5.55)
335
5.6. CONDITIONS FOR UNDERDAMPED RESPONSE OF PI CONTROL

OF PROTOTYPICAL FIRST ORDER PROCESS
Consider a prototypical first order process. Consider PI control of a prototypical first
order process. The block diagram in shown in Figure 5.4. The control transfer functions for
the process and controller are as follows;
kp
g p ( s)
ps
gc ( s)
Is
kc
(5.56)
1
Is
The closed loop transfer function, gCL(s) can be written as;
gCL ( s)
g p ( s) gc ( s )
(5.57)
1 g p ( s) gc ( s )
Consider a step change in the input r(s) = 1/s. The following is the analysis of the output
response to a step change in input.
kc k p
y(s) = r(s)gCL(s) =
Is
1
s
1
or,
Is
ps
kc k p
Is
(5.58)
Is 1
ps
kc k p
1 kc k p
I
k p kc
y(s)
kc k p
1 kc k p
kc k p
(5.59)
Comparison of the first term of RHS of Eq. (5.37) and the Laplace transfer function of
prototypical second order process system as given by Eq. (5.59) in chapter 3.0 reveal that for
certain conditions the system can become underdamped. This would happen when the
damping ratio, < 1. Thus,
2
kc k p
2
1 kc k p
kc k p
(5.60)
336

1 kc k p
p kc k p
For damping factor, < 1,

1 kc k p
p kc k p
4 p kc k p
Or,
1 kc k p
(5.61)
(5.62)
Thus for small values of integral time, I, as given by Eq. (5.62) the closed loop system of
PI control and prototypical first order process would become underdamped!
5.7. PD, PROPORTIONAL DERIVATIVE CONTROL AND PID,

PROPORTIONAL INTEGRAL DERIVATIVE CONTROL
5.7.1. Development of Control Action Law
The P, proportional only control action can be modified by added a component to the
control action that is proportional to the derivative of the error;
u (t ) kc e(t ) kD
de(t )
dt
(5.63)
The control action law depicted in Eq. (5.41) is called as PD, proportional derivative
control. It can be used in applications where it is important to preserve the curvature of the
process variable with respect to time. For example a linear increasing function or constant
function cannot have a steep curvature. Control action taken that is proportional to the
derivative of the error can have a smoothing effect on the output response. The control
transfer function for Eq. (5.41) can be written as;
u ( s)
kc e(s) sk D e(s ) 0
u ( s)
e(s)kc 1 s
(5.64)
Where, D is the time constant of the derivative control.
kD
kc
(5.65)
337
The P, proportional only control can be modified by addition two components, one
proportional to the derivative of the error and the other proportional to the integral of the
error.
t
u (t )
kc e(t ) k I e
kD
de(t )
dt
(5.66)
The control action law depicted in Eq. (5.44) is called PID control. Ideal PID control is
not physically realizable. No instrument can take a perfect derivative. Real PID control can be
affected after suitable modification of the control transfer function. The control transfer
function for ideal PID control can be seen to be;
u (s)
kc
I Ds
(5.67)
Example 5.4. PI Control during Desalination of Seawater using Nanoporous Carbon

Consider sea water pumped across a packed bed of graphene nanoplatelets, GNP with
molecular sieve diameter ~ 5A. Assume a voidage of 0.75 and material density of carbon of
1.8 gm/cc. The interfacial area of ~ 5 million m2/gm. The inlet concentration of sea water can
be taken as 3.6% by weight. Potable drinking water is filtered from the column at 1 m/s. The
packed bed reached saturation after it has passed through 20 cm of the bed. The concentration
of NaCl in potable water that is permitted is 30 ppm. For PI control of the packed bed
operation develop the close loop transfer function. Under what conditions would there be
instability;
The mass balance of salt in the liquid phase pumped across the packed column at
transient state can be written as;
(Flow in) - (Flow out) - (Amount Filtered) = (Accumulation)
Let L = length of the packed bed column (m),
A cross-sectional area of the packed bed (m2)
a-Interfacial area for mass transfer between graphene nanoplatelets, NGP and water
m molar density (mol/m3)
v superficial velocity of the fluid (m/s)
xA weight fraction of salt in water
mvA(xA/z) + kx(xA 0)(a/A) = Am(xA/t)
Let Z = z/L; = vt/L; XA = xA/xA*;
Dam = (kxLa)/(vAm), Damkohler number (mass transfer)
xA* = saturation concentration of salt in the packed bed column
The fluid can be assumed to be incompressible and constant density.
338

The mass balance equation in transient state can be seen to become;
(XA/Z) DamXA = (XA/)
Obtaining the Laplace transforms and for cases where (XA/Z = ) Eq. () can be seen to
become;
XA(s + Dam) = /s or
XA = /s/(s+Dam)
Above Eq. can be seen to be of the form
XA(s) = u(s) gp(s)
Thus, u(s) = /s and gp(s) = 1/(s+Dam)
The closed loop transfer function for the PI control of a packed bed adsorption process
for desalination of sea water using NGP can be found from the closed loop transfer relation;
gCL ( s)
g p ( s) gc ( s )
1 g p ( s) gc ( s )
The weight fraction of salt in water can be measured and used for control purposes in the
effluent water.
Example 5.5. PI Control during Hydrolysis of Ethylene Glycol

Consider PI control for hydrolysis of ethylene oxide in a CSTR as described in worked
example 4-1. Develop the closed loop transfer function. Under what conditions would there
be instability? Ethylene glycol is prepared in a CSTR by hydrolysis of ethylene oxide. The
reaction can be written as follows;
C2 H 4O H 2O
C 2 H 4 OH
(5.68)
The CSTR is assumed to be operated at constant volume and constant temperature and
with excess water. A model was developed to find the concentration of each species as a
function of time in Example 4-1.
From Eq. (4.6)
XA
Da(1 X A )
Da
dX A
d
dX A
d
X A (1 Da)
(5.69)
339
Figure 5.7. PI Control during Hydrolysis of Ethylene Oxide in a CSTR.
Obtaining Laplace transform of Eq. (5.47);
Da
1
1 Da s s
X A ( s)
(5.70.)
Eq. (5.52) can be seen to be of the form;

y(s) = u(s).gp(s)
(5.71)
where, u(s) = 1/s and gp(s) = (Da/(1+Da +s)). For PI conrol gc(s) is given by Eq. (5.26). The
closed loop transfer function gCL(s) for PI control of hydrolysis of ethylene oxide to ethylene
glycol can be written as follows;
gCL ( s)
y(s)
X A (s)
g p ( s) gc ( s )
1 g p ( s) gc ( s )
1
s
kc Da I s 1
1 Da s I s
1
(5.72)
kc Da I s 1
I s 1 Da s
Eq. (5.50) can be seen to be;
kc
y(s)
kI
s
kI Da
1 Da(1 kc
s
kc Da
1
1
s2
s
k I Da
s 1 Da 1 kc
kc Da
(5.73)
340
The RHS, right hand side of Eq. (5.51) consists of two terms. The second term is the
response to a step change of a prototypical second order system as given by Eq. () in chapter
3.0. When the damping factor, < 1 the system can become underdamped. This can be seen
to happen when;
kI
4kc2 Da
1 Da 1 kc
(5.74)
The first term in RHS of Eq. (5.51) when inverted from the Laplace domain would
contain two exponential in time terms;
Aer1t " Ber2t
(5.75)
When the roots r1, r2 become complex the contribution to the output response can become
sinuous! This happens when b2 4ac < 0 in the quadratic expression in the denominator of
the first term in RHS of Eq. (5.51). This happens when;
kI
4kc2 Da
1 Da 1 kc
(5.76)
Eq. (5.76) is identical with Eq. (5.74)!
Example 5.6. On the Use of PI Proportional Integral Control and Estimation of Static
Formation Temperature in Oil Wells
The importance of the use of initial condition was discussed in Chapter 4.0 (kindly see
"sensitivity" of initial conditions to overshoot"). SFT, static formation temperature of oil
wells is used during shut-in time process. Mathematical models can be developed in order to
describe the processes involved during the well-bore formation system. The model equations
are PDEs, partial differential equations that accounts for the heat transfer processes. Transient
convective heat transfer due to circulation losses to the surrounding rocks of the well is an
example of a process involved in well-bore formation system. A strategy of PI, proportional
integral control can be applied in order to obtain the solution of an IHT, inverse heat transfer
problem. This is used in the estimation of the SFT, static formation temperature of the oil
well. The error between logged temperature and simulation temperature is the feed-back
during shut-in time process. The SFT, static formation temperature, is unknown. This is the
initial condition of the governing PDEs. Espinosa-Paredes et al. [2009] tested this method in
two oil wells MB-3007 and MB-3009 in Gulf of Mexico. Only one temperature measurement
for each fixed depth of estimate was needed. In the Fourier representation of transient
temperature the initial accumulation in temperature condition is taken as zero. This can lead
to overshoot that is more a mathematical artefact than a heat transfer event as discussed in
Chapter 4.0. The damped wave heat conduction and relaxation equation can be used in the
mathematical model. The IHT problem of using measured temperatures at a certain depth as a
function of time in order to estimate the initial condition can be used with a non-zero
341
accumulation of temperature initial condition. This may lead to more accurate estimates of the
SFT, static formation temperatures.
5.7.2. Time Response of PD Control of Prototypical First Order Process

Consider a prototypical first order process. Consider PD control of a prototypical first
order process. The block diagram in shown in Figure 5.4. The control transfer functions for
the process and controller are as follows;
kp
g p (s)
ps
gc ( s)
kc 1 s
(5.77)
D
The closed loop transfer function, gCL(s) can be written as;
g p ( s) gc ( s )
gCL ( s)
(5.78)
1 g p ( s) gc ( s )
Consider a step change in the input r(s) = 1/s. The following is the analysis of the output
response to a step change in input.
kc k p
y(s) = r(s)gCL(s) =
ps
1
s
1
or,
kc k p
s s(
kc k p
(5.79)
Ds
ps
k p kc 1 s
y(s)
Ds
(5.80)
D ) kc k p
The inverse Laplace transform in Eq. (5.58) can be found by the method of Heaviside
expansion.
Let,
y(s)
A1
s a1
p( s )
q( s )
k p kc
The poles of Eq. (5.59), are 0,

p
D k p kc
A2
s a2
respectively.
(5.81)
342
A1
p a1
k p kc
q ' a1
k p kc
A2
k p kc
(5.83)
D
k p kc
D k p kc
p
(5.82)
D k p kc
y (t ) 1 (
D k p kc
)e
D k p kc
(5.84)
Eq. (5.62) is stable decays monotonically. For positive values of kp, kc, p and D the
system will not exhibit an overshoot. Thus switching from PI control to PD control the
occurrence of overshoot or underdamped system has vanished. The conditions when an
overshoot can be expected from mathematical analysis for PI control of a prototypical first
order system have been derived in section 5.6.
Example 5.7 PD Control during Hydrolysis of Ethylene Glycol

Consider PD control for hydrolysis of ethylene oxide in a CSTR as described in worked
example 4-1. Develop the closed loop transfer function. Under what conditions would there
be underdamped response? Ethylene glycol is prepared in a CSTR by hydrolysis of ethylene
oxide. The reaction can be written as follows;
C2 H 4O H 2O
C 2 H 4 OH
(5.85)
The CSTR is assumed to be operated at constant volume and constant temperature and
with excess water. Aa model was developed to find the concentration of each species as a
function of time in Example 4-1.
From Eq. (4-14)
XA
Da(1 X A )
Da
dX A
d
dX A
d
(5.86)
X A (1 Da)
Obtaining Laplace transform of Eq. (5.86);
X A ( s)
Da
1
1 Da s s
(5.87)

y(s) = u(s).gp(s)
(5.88)
343
where, u(s) = 1/s and gp(s) = (Da/(1+Da +s)). For PD control gc(s) is given by Eq. (5.77). The
closed loop transfer function gCL(s) for PD control of hydrolysis of ethylene oxide to ethylene
glycol can be written as follows;
g p ( s) gc ( s )
gCL ( s)
y( s)
1 g p ( s) gc ( s )
Dakc 1 s
1
s s2
X A ( s)
s 1 Da
Da
(5.89)
D kc
Dakc
Eq. (5.89) can be seen to be;
Dakc
y ( s)
s
Dakc
s 1 Da Da
D kc
Dakc
s s
s 1 Da Da
(5.90)
D kc
Dakc
There are two terms in the Laplace domain in Eq. (5.90). The first term can be inverted in
the time domain to the following form;
Dakc
De
at
sin
(5.91)
Where
1 Da(1
2
Where,
2
Da 2 kc2
D kc )
1 Da 1
D kc
(5.92)
The second term in Eq. (5.90) when inverted to the time domain can lead to an
underdamped response under certain conditions. This happens when the damping factor,
< 1. This is when;
Dakc
2
1 Da 1
D kc
(5.93)
Example 5.8 Control of Intermediate in Reactions in Series

Consider the following scheme of reactions performed in a CSTR.
k1
A B
R
k2
R B
(5.94)
344
The scheme of reactions shown in Eq. (5.94) can be seen during the manufacture of
chloroform by chlorination reactions as follows;
CH 4
Cl2
CH 3Cl
CH 3Cl Cl2
CH 2Cl2
CHCl3
Cl2
Cl2
HCl
CH 2Cl2
HCl
CHCl3
HCl
CCl4
(5.95)
HCl
Methane can be chlorinated to manufacture chloromethane, dimethylene dichloride,

chloroform and carbon tetrachloride by successive chlorination reactions. The 2011 Spring
prices for CHCl3, chloroform is 75 cents per pound and CCl4, carbon tetrachloride is 32.5
cents per pound. Hence it is profitable to optimize the intermediate yield of CHCl3.
Comparing the scheme of reactions shown in Eq. (5.94) and the chlorination reactions shown
in Eq. (5.95) A can be CH4, B can be Cl2, R can be CHCl3 and S can be CCl4.
Levenspiel (3) discusses the kinetics of the scheme of reactions given by Eq. (5.94) and gives
an expression for CR,max, an optimal intermediate concentration. There is interest in designing
a PI control for the intermediate product R as shown in Figure 5.8. Discuss the PI control for
the concentration of R. What are the process and control transfer functions? What is the
closed loop transfer function, gCL(s). Under what conditions would there be an underdamped
response?
Figure 5.8. Feedback Control by PI Controller of Intermediate Product R in a CSTR Component

Material Balance.
345
The material balance of components A, B, R and S can be written over the control
volume as follows;
(mass rate in) - (mass rate out) (mass rate reacted) = (mass accumulated)
(5.96)
Species A (Methane)
dC A
(5.97)
dt
The rate of the reaction of chlorination of methane can be given by a pseudo-first order
expression as;
v C Ai
CA
rA
kC AV
dC A
dt
k1C A
(5.98)
Species R (Chloroform)
v CRi
CR
(k1C A
k2CR )V
dCR
dt
(5.99)
Species S (Carbon Tetrachloride)
v 0 CS
(k2CR )V
dCS
dt
It can be noted that the residence time in the CSTR,
(5.100)
V
, and Eq. (3.8) and Eq. (3.10)
v
would become;
C Ai
CRi
CA
k CA
(k1 C A
1 k2
CS
k 2 CR
dC A
dt
CR )
dCS
dt
(5.101)
dCR
dt
(5.102)
(5.103)
Let conversion, XA, Damkohler number Da1, Da2 and dimensionless time, are as
follows;
346

C Ai C A
C Ai
XA
t
(5.104)
Da1
k1
Da2
k2
Obtaining the Laplace transform of Eqs.(5.101-5.103);

C Ai
s 1 Da1
C A (s)
CR ( s )
CRi
s 1 Da2
(5.105)
Da1C Ai
s 1 Da1 s 1 Da2
Da2CR s
CS s
(5.106)
(5.107)
CS s 1 s

y(s) = u(s).gp(s)
where, u ( s)
(5.108)
1
s
gp s
C Ai
C Ai
CRi
1 Da2
1 Da1
Da1
s 1 Da2
(5.109)
Eq. (5.72) can be seen to comprise of two terms. The first term can be reduced to the
general form of a prototypical first order process as given by Eq.() and reproduced below;
y(s) u (s)
kp
s
(5.110)
The process gain, kp and time constant, p for this term can be seen to be;
kp
p
C Ai
CRi
1 Da2
1 Da2
(5.111)
347
The second term in Eq.(5.109) can be reduced to the general form of a prototypical
second order process as given by Eq.() and reproduced below as;
kp
y (s) u ( s)
2 2
ps
2s
(5.112)
The second term in Eq. (5.109) can be rearranged as;

Da1
s
2 2
2 Da1
(5.113)
Da2
1 Da1 1 Da2
By comparison of Eq. (5.112) with Eq. (5.113), the process gain kp, time constant, p and
damping factor, can be seen to be;
k
Da1
1 Da1 1 Da2
(5.114)
1 Da1 1 Da2
1
Da1
Da2
2
1 Da1 1 Da2
For PI control gc(s) is given by Eq. (5.26). The closed loop transfer function gCL(s) for
PI control of chlorination of methane to chloroform or carbon tetrachloride can be written as
follows;
gCL ( s)
s s
1 Da1 s
CRi kc
3 3
2 Da1
Da1kc kI C Ai
s2
Da2
1 Da2
CRi kc s kI
CRi kc kI 1 Da1
C Ai kc Da1 s kI
C Ai kc Da1 CRi kc 1 Da2

CRi kc
(5.115)
1 g p ( s) gc ( s )
Da1C Ai kc s kI
gCL s
gCL s
g p ( s) gc ( s )
s 1 Da1 1 Da2
1 Da2
CRi kc s kI s
CRi kc k I
Da1C Ai kc
(5.116)
1 Da1
CRi kc k I 1 Da2
CRi kc 1 Da1
CRi kc
(5.117)
Where kI is the gain during PI control action. The stability of this system of PI control of
intermediate product yield of chloroform, CHCl3 can be determined from the poles of Eq.
(5.74). As the order of the polynomial in the denominator is increased beyond quadratic,
cubic closed form analytical solutions are not possible. Numerical solutions are needed to
obtain a solution of the polynomial of higher degrees. Routh (1905) stability criteria can be
used to analyze the stability of systems such as the one encountered here.
The Routh array of a general nth degree polynomial can be written as follows;
348

an s n
an 1s n
an 2 s n
.... a2 s 2
a1s a0
(5.118)
For all the poles to be negative all the coefficients in the 3rd degree polynomial in the
denominator of Eq. (5.75) need be positive. The sufficiency test establishes that the array;
Row Coefficients
I
an an 2 an
II
an 1 an 3 an
III
IV
b1
b2
V
c1
c2
4
5
(5.119)
Where,
an 1an
b1
an
an 1an
b2
an an
b1an
; c1
an an
an 1b2
b1
an
b1an
; c2
(5.120)
an 1b3
b1
The number of changes in sign as the first column is traversed down the number gives the
number of unstable positive roots. Unstable roots would arise when sign of the coefficients
are negative For the system of PI control of the intermediate product yield chloroform from
chlorination of methane to chloroform and carbon tetrachloride the conditions for instability
would arise when;
a2 a1
a3a0
(5.121)
This would happen when
2 Da1
Da2
CRi kc
1 Da1 1 Da2
Da1kc kI CAi
CRi kc kI 1 Da1 (5.122)
Eq. (5.122) can be written in terms of the residence time in the CSTR and the reaction
rate constants k1 and k2 as follows;
3
k1k2 k1
k2
2k1k2
CRi kc k1 k2
kI
k1 k2
3 k1 k2
CRi kc k I 1 k1
2 0 (5.123)
For the special case when the further chlorination reaction rate constant k2 = kI the PI
control gain Eq. (5.123) reduces to;
3
k1k2 k1
k2
2k1k2
k1
k2
3 k1 k2
CRi kc k2 1 k1
2 0 (5.124)
349
5.8. TYREUS-LUYBEN OSCILLATION BASED TUNING

the parameters chosen. There are three tuning parameters in PID action. These are: (i) the
control gain constant, kc; (ii) integral time constant, I; (iii) derivative time constant, D. An
algorithmic or trial and error approach can be used for obtaining optimal results from tuning
the controller. The tuning of PID control was developed by Ziegler and Nichols [1942]. This
method is not widely used in the industry because the closed loop behavior tends to be
oscillatory and sensitive to errors. The Tyreus-Luyben tuning parameters for PI and PID
control are given below in Table 5.1.
Where u is the ultimate time period and ku is the ultimate gain constant. For P only
closed-loop control the magnitude of the proportional gain is increased until attainment of
continuous oscillation. For larger values of the gain the closed-loop system becomes unstable.
The value of the control gain constant where continuous oscillation is found is called the
ultimate gain constant and notated by ku. The peak to peak time period that corresponds to this
gain is called the ultimate time period, u. The tuning parameters are given in Table 5.1 and
vary according to the control action taken.
5.9. SUMMARY
The control theory began with the investigations of J. C. Maxwell of the dynamics of the
centrifugal governor in a Boulton and Watt engine of the 18th century. Self-oscillations and
the lags in the system can draw overcompensation and lead to instability. Mathematical
modeling of any process is an important task in the analysis and design of control systems.
The model equations when converted into the Laplace domain can be represented using block
diagram format. Control systems can be linear or non-linear. Non-linear systems may need
numerical solutions for analysis. Closed form analytical solutions can be obtained for linear
systems. Sometimes when multiplicity arises in the solutions other criteria is needed to select
the feasible solution from amongst the solutions obtained.
On-off controllers are used in centralized heating and air conditioning systems in modern
homes, Christmas tree lighting, level in water and process tank. An on-off control strategy
patented by Mackay (2003) for CHP, combined heat and power systems was discussed.
During proportional control, the control action taken is proportional to the error detected
between the measured value and set points of the process variables. Control actions taken can
be represented using control block diagrams. Figure 5.3 is the control block diagram of the
pressure, temperature control for a CHP system. Gains are defined as the ratio of steady state
change in output in response to a steady state change in input variable. These are defined for
valve, process, controller, etc. Proportional control is used for a prototypical first order
process. The closed loop transfer function for the process and control action is derived and
shown in Eq. (5.15). The gain and time lag of the closed loop transfer function can be seen in
Eqs. (5-16, 5.17). The time output response to a step change in the input can be seen in Eq.
(5.20). For values of kCL, closed loop gain other than 1 there is seen an offset at steady state.
350

Table 5.1. Tyreus-Luyben Tuning Parameters
Control
Action
PI
PID
Integral Time
Constant
I
2.2 u
2.2 u
Derivative Time
Constant
D
NA
0.159 u
Control
Action Gain
kc
0.3125ku
0.4545ku
In order to do better than an offset after implementation of offset PI, proportional integral
control can be used. The control action is modified by addition of a component that is
proportional to the integral of the error in addition to the action proportional to the error. This
can lead to zero offset after rectification. kc and kI are the tuning parameters. The control
transfer function for PI control is given in Eq. (5.26). In worked example 5.-1 is given an
example of PI control action. The output response is seen to undergo an overshoot. The
damping factor, = 0.1, is less than 1.0. It is not clear as to what is causing the overshoot
from the control action of the process. In example 5-2 is the analysis of closed-loop transfer
function for feed forward/feedback controller. In example 5-3 is discussed the PI control of
voltage supplied to an automatic washing machine patented by Toshiba. Model equations that
relate torque to agitator RPM is given in Eq. (5.46). Electric motor is used in order to provide
torque needed to perform the wash, rinse and dehydration steps. The control action may lead
to instability because the error between target angular speed and operating angular speed in
RPM can be rectified indirectly by changing the voltage supplied to the motor. The voltage
will affect the torque in a manner that is not completely modeled or understood. The angular
speed of the agitator and tub depends on the torque in a manner that is predicted by the
mathematical model. Electric current measurements are used as feedback in the torque control
of the Toshiba machine.
The conditions when underdamped response of PI control of prototypical first order
process is derived are section 5.6. Eq. 5.61 gives the criteria for underdamped response to be
less than 1.0. This may be expected for small values of integral time. During PD control the
control action taken is proportional to the derivative of the error. It may be used in processes
where the curvature of the process variable with respect to time needs to be preserved. During
PID control, components proportional to the error, proportional to the integral of the error,
and proportional to the derivative of the error are introduced. Ideal PID control is not
physically realizable! Real PID control can be affected after suitable modification of the
control transfer function.
In Example 5.4 the PI control during desalination of seawater using nanoporous carbon is
discussed. PI Control action during hydrolysis of ethylene glycol is discussed in Example 5.5.
For small values of integral gain the system can be expected to be underdamped as shown in
Eq. (5.74). The PI control action can be used in the estimation of SFT, static formation
temperature of oil wells as discussed in Example 5.6. Fourier parabolic and damped wave
hyperbolic models can be used to describe the transient heat conduction processes. The
problem is one in IHT, inverse heat transfer as the initial conditions are estimated from
logged temperatures at specified locations.
The time response to PD control of a prototypical first order process is given by Eq.
(5.84). In Example 5.7 is discussed the PD control action during hydrolysis of ethylene
glycol. The conditions for underdamped oscillations are given in Eq. (5.93). In Example 5.8
351
the control action for intermediate in reactions in series is discussed. Industrial applications
for these types of reactions are during the production of chloroform and carbon tetrachloride
by chlorination of methane and biodiesel and glycerol production by consecutive-competitive
reactions of methanolysis of vegetable oil. The stability of the system of PI control of
chloroform production by chlorination of methane can be seen from the closed loop transfer
function given in Eq., (5.117). The order of the polynomial in the denominator of Eq. (5.117)
is cubic. Instability would arise when the criteria in Eq. (5.121) is met. The corresponding
expression for PI control gain is given in Eqs. (5.123).
the parameters chosen. There are three tuning parameters in PID action. These are: (i) the
control gain constant, kc; (ii) integral time constant, I; (iii) derivative time constant, D. An
algorithmic or trial and error approach can be used for obtaining optimal results from tuning
the controller.
5.10. GLOSSARY
Control Theory: Deals with dynamics of industrial processes. Behavior modification
affected by feedback. Control objectives are met by using measurements and set points.
Controllability, stability and observability are related issues. Closed form analytical and
numerical solutions are obtained when needed.
Error: Difference in value between the measurements and set points of the process
variable.
Feedback Control: Control action based on feedback from the process such as
measurements and comparisons against the set points.
Mathematical Model: A set of equations that can be used to describe a process or
phenomena. Usually difficult to measure parameters can be predicted from readily
measurable parameters.
Laplace Domain: Often times differential equations become algebraic equations and
integrals become algebraic expressions in this domain. The Bromwich integral and FourierMellin integral and Laplace transformation may be used to transform quantities from the
Laplace domain and time domain and vice versa.
Control Block Diagram: Flow diagram that can be used to show the control action and
prototypical first and higher order processes using transfer functions.
Valve Gain: Ratio of change in flow rate to the change in valve top pressure (Eq. (5.11)
Process Gain: Change in volume of the reactor to the change in valve top pressure (Eq.
5.12).
Proportional Gain, kc: Ratio of the change in process variable to the error
Proportional Integral Gain, kI: Tuning parameter. Pre integral of the error constant.
Integral Time, I: Ratio of the proportional gain, kc and proportional integral gain, kI.
On/Off Control: Shut-down and start-up is used at certain error levels. Used as
safeguards.
Proportional Control, P Control: Control action taken that is proportional to the error
detected.
352
Proportional Integral Control, PI Control: The control action is modified by addition

of a component that is proportional to the integral of the error in addition to the action
proportional to the error. This can lead to near zero offset
Proportional Derivative Control, PD Control: The control action is modified by
addition of a component that is proportional to the derivative of the error in addition to the
action proportional to the error. Used in cases where the curvature of the process output with
time needs to be preserved.
Proportional, Integral, Derivative, PID Control: During PID control, components
proportional to the error, proportional to the integral of the error, and proportional to the
derivative of the error are introduced.
Ideal and Real PID Control: Ideal PID control is not physically realizable! Real PID
control can be affected after suitable modification of the control transfer function. Methods to
make PID control feasible are discussed in Chapter 7.0 Advanced Controls.
Offset: It is the difference between the set point and process variable at steady state.
5.11. REFERENCES
Espinosa-Paredes, G., Maralan-Diaz, A., Olea-Gonzalez, U., & Ambiz-Garcia, J. J. (2009).
"Application of a Proportional Integral (PI) Control for the Estimation of Static
Formation Temperature in Oil Wells", Marine & Petroleum Geology, Vol. 26, 2, 259268.
Fujui, A. Chemical Concentration Control Device for Semiconductor Processing
Apparatus, US Patent 6,921,193 (2005), Kaijo Corp., Hamura, JP.
Hosoito, T., Tanaka, T., Okazaki, Y., Kawabata, S., Nagai, K. & Isono, F. (2006). Washing
Machine with Vector Control for Drive Motor, US Patent 7, 017, 377, Kabushiki Kaisha
Toshiba, JP.
Levenspiel, O. Chemical Reaction Engineering, (1999). Third Edition, John Wiley, New
York, NY.
Luyben, M. L. & Luyben, W. L. (1997). Essentials of Process Control, McGraw Hill
Professional, New York.
MacKay, R. (2007). Combined Heat and Power System, US Patent, 7,299,638
Routh, E. J. (1905). Dynamics of a System of Rigid Bodies, Part II, MacMillan, London,
United Kingdom (1905).
Ziegler, J. G. & Nichols, N. B. (1942). Optimum Settings for Automatic Controllers, Trans.
ASME, 64, 759-768.
5.12. EXERCISES
Review Questions
1.0. What are the differences between on-off controller and P only control ?
2.0. What are the differences between PI control and PD control ?
3.0. How can ideal PID control be made realizable ?
353
4.0. How is on-off controller used in CHP, combined heat and power systems ?
5.0. What is the significance of controller gain kc during P only control ?
6.0. What is the significance of constant b in P only control action law ?
7.0. What is the significance of valve gain constant kv ?
8.0. What are the differences between process gain constant kp and controller gain
constant kc ?
9.0. What is meant by offset during P only control ?
10.0. How does PI control action remove offset found during P only control ?
11.0. What are the differences between control action law during;
(i) PI Control
(ii) PID Control (ideal)
(iii) P only Control
12.0. What are the differences between control action law during;
(i) PD Control
(ii) PI Control
13.0. How is the final value theorem used to obtain offset found after control action is
taken ?
14.0. What are the transfer functions of control action law of;
(i) P only Control
(ii) PI only Control
(iii) PD only Control
(iv) PID Control (ideal)
15.0. Can underdamped oscillatory conditions arise after P only control action of
prototypical first order process is taken ? Why not ?
16.0. Can underdamped oscillatory conditions arise after PI only control action of
protypical first order process is taken ? Why ?
17.0. What is the best control action for prototypical third order process from closed loop
stability considerations ?
18.0. Does the answer tp Q15, Q16 change on account of change in input to periodic
signal ?
19.0. Can underdamped oscillatory conditions develop after PD control of prototypical
first order process ?Why not ?
20.0. What is the physical significance of Bm in Eq. (5.47).
21.0. Consider a PD control of the voltage in automatic washing machine in Example 5.3.
What are the stability issues ?
22.0. What is meant by smoothing effect on output response ?
Problems
23.0. PI Control of Prototypical First Order Process: Time Response to Periodic Input
Consider any prototypical first order process. Consider a PI controller used to control
this process. Let the process gains, kp = kc =1. What would be the time response of
the process output variable y(t) to a periodic disturbance in the set point,
354
r (s)
s
The time constant of the controller, I is 1and the time constant of the
process, p is 2.0. The simplified control block diagram is given below. Disturbances
are neglected and valve and measurement dynamics are lumped into the process
transfer function. Develop the expression for the output variable y(s) in the Laplace
domain and time domain y(t). Sketch the response y(t) as a function of time. The
transfer functions for prototypical first order process, gp(s) and that for PI control,
gc(s) can be seen to be;
kp
g p ( s)
gc ( s)
ps
kc
(5.125)
Is 1
Is
24.0. PI Control of Prototypical First Order Process: Time Response to Input that
undergoes Exponential Decay with Periodicity
this process. Let the process gains, kp = 3; kc =0.33. What would be the time response
of the process output variable y(t) to a change in the set point,
r (s)
s 1
(5.126)
The time constant of the controller, I becomes 10% of the time constant of the
process, p. The simplified control block diagram is given below. Disturbances are
neglected and valve and measurement dynamics are lumped into the process transfer
function. Develop the expression for the output variable y(s) in the Laplace domain
and time domain y(t). Sketch the response y(t) as a function of time. The transfer
functions for prototypical first order process, gp(s) and that for PI control, gc(s) can
seen to be;
kp
g p ( s)
gc ( s)
ps
kc
Is
Is
(5.127)
355
Figure 5.8a. Simplified Control Block Diagram for Q1.0.
Figure 5.9. Control of CSTR Volume.
25.0 On-off Control of Storage Tank

A storage tank is used for the monomers prior to feeding them to the reactors during
continuous polymerization of HIPS, high impact rubber modified polystyrene. The
styrene monomer, solvent such as ethyl benzene and PBd, poly butadiene in solution
form are brought from the suppliers as well as from recycle and stored in the storage
tank. In order to keep the storage tank from overflowing and from being depleted and
ruining the pumps that are starved a on-off controller is devised. The control action
suggested is shown in Figure 5.9. Write the transfer function for the on-off control
action. The residence time of the reactor depends on the volume of the reactants and
products in the reactor. The volume of the reactor contents is measured by the
volume transmitter, VT. This information is sent to the VC, volume controller. The
set point volume and the measured volume are compared with each other. Desired
action is then signaled to the control valve bu a pressure variable. The valves can be
operated using pressure transducer values. The valve can be made to open upto a full
open position. This action is called for when the tank is found to be depleted. The
356

valve can be made to partially close or close completely until the input reactant
streams are shut off. This action is called for when the reactor is found to be
overflowing.
26.0. PI Control Action for Prototypical Second Order Overdamped Process.
Consider any prototypical second order process. Consider a PI controller used to
control this process. Let the process gains, kp = kc =1. Let the damping factor = 4.0.
What would be the time response of the process output variable y(t) to a step change
in the set point, r(s) = 1/s. The time constant of the controller, I becomes 5% of the
time constant of the process, p. The simplified control block diagram given in Figure
5.4 is applicable. Disturbances are neglected and valve and measurement dynamics
are lumped into the process transfer function. Develop the expression for the output
variable y(s) in the Laplace domain and time domain y(t). Sketch the response y(t) as
a function of time. The transfer functions for prototypical first order process, gp(s)
and that for PI control, gc(s) can be seen to be;
g p (s)
gc ( s)
kp
2 2
ps
kc
Is
s 1
(5.128)
Is
27.0. PI Control Action for Prototypical Second Order Underdamped Process

g p (s)
gc ( s)
kp
2 2
ps
kc
Is
s 1
(5.129)
Is
28.0. PI Control Action for Prototypical Second Order Undamped Process

357
kp
2 2
ps
g p ( s)
gc ( s)
(5.130)
Is 1
Is
kc
29.0. Third Order Process with P only Control

Consider a third order process whose process function is given by;
G p ( s)
3s
(5.131)
5s 3s 1
What is the maximum proportional gain for P-only control in order for the control
action to be closed loop stable. Use Routh stability criterion.
30.0. PI Control of a Process that is Integrating Unstable
Consider a process that is integrating unstable and has the following transfer
function.
0.5
s 2
Gp s
(5.132)
The output response in the time domain of this process is;

0.5e2t
y(t )
(5.133)
Show that a PI controller can stabilize this integrating unstable process. Consider the
control transfer function;
Gc s
kc
(5.134)
Show that the closed loop transfer function can be given by;
GCL s
0.5kc s
s
2
I
0.5kc
(5135)
0.5kc
358

Further show that for stability 0 < kc < 4. Show that the system would be
underdamped when;
2 kc
4 0.25kc2
2kc
(5.136)
2 kc
I
0.5kc
Sketch the output variable as a function time before and after the control action
considered.
31.0. Best Control Strategy for Systems with Inverse Response
Some systems exhibit a inverse response. The output response to a unit step response
in such systems decreases initially and increases to a final steady state later. The
transfer function of such a system has positive pole in the numerator;
s 3
Gp s
s 0.2 s 2
.u s
(5.137)
What is the best controller to use that would have a stabilizing effect on the process.
Consider a PD controller for example with a transfer function given by;
Gc s
kc s
(5.138)
Show that the closed-loop transfer function is given by;

Ds
GCL s
D
1 2
s
kc
3 s 3
0.4
3 s(1 3
kc
(5.139)
D
2.2
)
kc
Show that for small D the system can be stabilized. Show that, for stability, kc <
0.733
0.133 and D 0.33
. Is this both possible for positive values of gain
kc
constant of controller, kc. and controller time constant D. Under what conditions for
the combined process and controller the system becomes underdamped oscillatory.
32.0. Proportional Controller for Jacketed Exothermic CSTR
The model equations for dimensionless concentration and dimensionless temperature
for the jacketed CSTR described in Figure 4.19 are as follows;
dY
d
Y 1 U*
( X H *) U *
H*
(5.140)
Da
dX A
d
359
(5.141)
X A (1 Da)
Obtaining Laplace transform of the two model equations the process transfer
functions equations for dimensionless concentration and dimensionless temperature
for the jacketed CSTR described in Figure 4.19 are as follows;
X (s)
Da
s s 1 Da
Y (s)
Da H *
s s 1 Da s 1 U *
U*
s s 1 U*
H*
s s 1 U*
(5.142)
Consider a proportional controller with the control transfer function;
Gc s
kc
(5.143)
Show that the closed loop transfer function for the dimensionless concentration and
dimensionless concentration can be given by;
GCL s
GCL ( s)
kc Da
s2
s 1 Da
kc Da
(5.144)
kc s
s3
s 2 Da U *
H* U*
H * U * 1 Da
s 1 Da 1 U *
kc
H* U*
kc
H * U * 1 Da
Derive the conditions for the system to develop underdamped oscillatory instability
in dimensionless concentration and dimensionless temperature.
33.0. PI Controller for Jacketed Exothermic CSTR
Consider a PI controller for the jacketed exothermic CSTR in Example 3-3. The
controller transfer function is given by;
Gc ( s)
kc
(5.145)
Derive the closed loop transfer functions for the dimensionless concentration and
dimensionless temperature. What are the conditions under which under damped
oscillatory instability would develop ?
34.0. Proportional Controller for Polymerization Kettle
Consider a proportional controller for the dimensionless initiator concentration and
dimensionless monomer concentration discussed in Example 3-4. The model
equations for dimensionless initiator concentration is as follows;
dY
d
DaD
Y 1 DaD
(5.146)
360

Obtaining the Laplace transform of the model equation the transfer function can be
written as;
DaD
s 1 DaD s
Y (s)
(5.147)
The model equations for dimensionless monomer concentration is as follows;

DaM 1 Y
X 1 DaM 1 Y
dX
d
(5.148)
Use a binomial approximation for (1-Y)1/2 and render the differential equation
amenable for obtaining the Laplace transform;
DaM 1
Y
2
Y
2
X 1 DaM 1
dX
d
(5.149)
The equation can me linearized by double differentiation and combination of the

other model equation. Obtain the process transfer function for dimensionless
monomer concentration. Consider a Proportional controller for both the initiator and
monomer concentrations. What are the conditions under which underdamped
oscillatory instability may be expected in the dimensionless initiator and monomer
concentrations.
35.0. Proportional Integral, PI Controller for Polymerization in CSTR
For the problem 13 consider a PI controller in place of the Proportional controller.
What are the conditions under which underdamped oscillatory instability may be
expected in the dimensionless initiator and monomer concentrations.
36.0. PI Controller
Consider a second-order process with the process transfer function with one pole at
the origin;
Gp s
3
s 2s 1
(5.150)
Show that a PI controller with integral time constant of I = 2 can lead to a pole-zero
cancellation. Show that the closed loop transfer function can be given by;
3kc
G CL s
I
(5.151)
3
I
361
Obtain the output response for a step change in input of magnitude R. Comment on
the stability of the system given the order of the system and nature of control action
taken.
37.0. Proportional Controller of CSTR with Recycle
Consider the process conducted in a CSTR with recycle as shown in Figure 4.26. The
model equation for the dimensionless concentration in transient state is given by;
Da
XA
R 1
Da
R 1
dX A
d
(5.152)
where R is the recycle ratio. Obtaining the Laplace transform of the model equation
the transfer function for the process can be seen to be;
Da
XA
R 1
1
R 1
Da
s s
Da
dX A
d
Da
R
1
R 1
R 1
s s
Da
XA s
(5.153)
R 1
Consider a P only controller for the dimensionless concentration. What is the closed
loop transfer function for the system. Under what conditions will there be
underdamped oscillations in the dimensionless concentration.
38.0. Proportional Integral, PI Controller of CSTR with Recycle
Consider a PI controller in place of P only controller in problem 16.0. Under what
conditions will there be underdamped oscillations in the dimensionless concentration.
39.0. Proportional Integral, PI Controller for a First Order Process with Dead Time
Consider a PI, proportional integral control for a first order process with a lag time,
. The process transfer function with dead time, can be written as;
G p (s)
k pe
(5.154)
The controller transfer function is given by;
Gc ( s)
kc
(5.155)
In order to evaluate the stability of closed loop transfer function Pade approximation
can be used to rationalize the process transfer function. The Pade approximation is;
362
2 s
2 s
(5.156)
Show that the closed loop transfer function can be written as follows;
G CL s
kc k p s 2
s3
s2 2
kc k p
I
I
(5.157)
s
Discuss the stability of the closed loop. Under what conditions can underdamped
oscillatory conditions be expected ? Comment on the stabilizing effect of the PI
controller.
40.0. Proportional P Controller for a First Order Process with Dead Time
Consider a P only, proportional control for a first order process with a lag time, .
The process transfer function with dead time, can be written as;
G p (s)
k pe
(5.158)
Gc (s)
(5.159)
kc
2 s
2 s
(5.160)
Show that the closed loop transfer function can be written as follows;
G CL s
kc k p 2 s
s2
k p kc
(5.161)
2 1 k p kc
Discuss the stability of the closed loop. Under what conditions can underdamped
oscillatory conditions be expected ? Comment on the stabilizing effect of the P
controller on the process with a lag time.
41.0. Proportional Derivative, PD Controller for a First Order Process with Dead Time
Consider a PD, proportional derivative controller for a first order process with a lag
time, . The process transfer function with dead time, can be written as;
G p (s)
k pe
363
(5.162)

Gc (s)
kc 1 s
(5.163)
2 s
2 s
(5.164)
Develop the expression for the closed loop transfer function. Show that the system is
not physically realizable.
42.0. Feedback Control of Semiconductor Processing
Consider the following control instrumentation for a semiconductor wafer processing
unit as shown in Figure 5.10. Three replenishing tanks A, B and C are used to refill
the chemicals needed for wafer washing and processing. Concentration meter is used
[2007] to monitor the concentration of the chemicals used in the wafer processing
apparatus. Control action is taken using comparisons of the measured concentration
against reference concentrations. Construct a block flow diagram labeling all signals
and transfer functions.
Figure 5.10. Feedback Control of Chemical Concentration during Semi-conductor Processing.
364

43.0. Periodic Disturbance and System Stability
Consider a process with the transfer function Gp(s) and a controller with a transfer
function Gc(s) as shown in Figure 5.11. The feedback control is based on
measurement of the output variable y(t). The load or disturbance transfer function is
given by L(s). The set point transfer function is given by r(s).
Show that the output transfer function y(s) can be written as follows;
y (s)
G p ( s) L( s) Gc ( s)r ( s)
1 G p (s)Gc (s)
(5.165)
Consider a prototypical first order process with the transfer function;

kp
G p (s)
(5.166)
1
Consider PI controller with the transfer function given by;
Gc ( s)
kc
Is
Is
(5.167)
Consider a disturbance that is periodic in nature with the transfer function;
L( s )
s2
Figure 5.11. Feedback Control of Chemical Concentration during Semi-conductor Processing.
(5.168)
365
Consider a step change in the set point and the transfer function r(s) can be given by;
R
s
r ( s)
(5.169)
Show that the closed loop transfer function can be written as;
GCL (s)
s3 kc k p
s
3
p
s 2 kc k p
s
2
kc k p
1 k p kc
kc
(5.170).
k p kc
Under what conditions can underdamped oscillations be expected ? What is the final
steady state value of the output function y(t). Did the disturbance affect stability ?
Why not ?
44.0. PI Control of Intermediate Product in Series with First Order Followed by Zeroth
Order Reaction
Consider the following scheme of reactions performed in a CSTR given in
Levenspiel [1999].
k1
k2
(5.171)
The kinetics of species A and R can be written as follows;

dC A
dt
dCR
dt
k1C A
(5.172)
k1C A
k2
There is interest in designing a PI control for the intermediate product R as shown in

Figure 5.8. Dicuss the PI control for the concentration of R. Show that the model
equations for reacting species A and intermediate species R can be written as
follows;
C Ai
0 CR
CA
k1 C A
( Da1C A
Da2 )
dC A
dt
dCR
dt
The process transfer functions can be written as follows;
(5.173)
(5.174)
366
C A (s)
CR s
C Ai
s 1 Da1
(5.175)
Da1C Ai
1 s s 1 Da1
Da2
s s 1
(5.176)
Where is the residence time of the reacting species in the reactor and Da1 is the
Damkohler number given by (k1) and Da2 is given by (k2). The control transfer
function can be written as follows;
Gc ( s)
kc
Is
Is
(5.177)
What is the closed loop transfer function, gCL(s). Under what conditions would there
be a underdamped response ?
45.0. PI Control of Intermediate Species in Denbigh Scheme of Reactions
Denbigh [1999] presented a scheme of general scheme of reactions for series,
parallel and series- parallel reactions. The kinetics of these reactions;
dC A
dt
dCR
dt
dCS
dt
dCT
dt
dCU
dt
k12C A
k1C A
k3CR
k34CR
(5.179)
k2 C A
k4 CR
Where k12 = k1 + k2 and k34 = k3 + k4. Show that the process transfer functions for the
reacting species in a CSTR during transient operation can be written as follows;
(5.178)
Figure 5.12. Denbigh Scheme of Reactions.
CA s
CR s
C
CT s
CU s
s s
367
C Ai
1 Da12 s
s s
C Ai Da12
1 Da12 s
s s
C Ai Da3
1 Da12 s 1 Da34 s
s s
Da2C Ai
1 s 1 Da12
s s
Da4 Da12C Ai
1 s 1 Da12 s
1 Da34
1
(5.180)
1 Da34
Consider a PI controller with the transfer function;
Gc ( s)
kc
Is
Is
(5.181)
What is the closed loop transfer function for each of the processes of species A, R, S,
T and U. Under what conditions would underdamped oscillatory concentrations
develop ?
Chapter 6
FREQUENCY RESPONSE ANALYSIS

6.1. MOTIVATION
The criterion for closed loop stability was discussed in Chapter 5.0. on Feedback control.
The poles of the closed loop transfer function as given by Eq. (5.15) have to be stable, i.e.,
when zero it can become unstable and when negative the output response moves in the
opposite direction compared with the set point change. Even when the process and control
action devised appear stable according to the stability criterion developed there can be some
stability problems. How? There can be uncertainties associated with the parameters that are
used to describe the system and the gain constants and time constants for the control system.
The uncertainties can become large enough for a reversal of stability criterion arrived at. This
raises the question of how robust is the control action considered for a given process. If there
are time delays in the process and control action taken the transfer function would contain an
e-s. This renders the transform function irrational. The P(s)/Q(s) rational form is not
preserved any more.
The concern is the robustness of the control system for the considered process. Often
times when what the problem is, is realized then dozen solutions can be offered to the
problem. An old adage is even before dumping it all into the river, count it before dumping.
Measure of robustness can be obtained from the method of frequency response analysis.
Transfer functions that are irrational on account of time delays can be rationalized by use of
what is called Pade approximation. [Bequette, 2003]
6.2. OUTPUT RESPONSE OF A PROTOTYPICAL FIRST ORDER

PROCESS TO A PERIODIC INPUT
Consider a prototypical first order system that is linear. The differential equation that can
be used to describe such a process is as follows;
dy
dt
k pu
(6.1)
370
Where p is the time constant, kp is the process gain, u is the input variable and y is the
output variable. The Laplace transform of Eq. (6.1) given that the initial value of the output
variable is 0 can be written as;
k p u (s)
y(s)
(6.2)
Consider a sinuous input, u = Asin(t). The output would then be in the Laplace domain;
A kp
y(s)
s
1 s2
(6.3)
The time domain y(t) can be obtained by using the convolution theorem [Mickley,
Sherwood and Reed, 1957] on Eq. (6.3), and;
y (t )
kp
t p
sin
p dp
(6.4)
p 0
Integration by parts can be used in order to obtain the integral in Eq. (6.4). An I can be
defined as;
p
sin
p dp
(6.5)
Let;
sin
p
(6.6)
dv
dp
Realizing that;
t
udv uv
0
vdu
(6.7)
Another I emerges in RHS, right hand side of Eq. (6.7) and groups with the I on LHS, left
hand side of Eq. (6.5) to give;
371

t
Ak p
y (t )
1
2 2
p
sin wt
(6.8)
was introduced to simplify the expression for y(t) such that cos() = 1 and sin() = p.
or tan() = (p). The amplitude ratio is obtained as the ratio of the amplitude of the output
sine wave and the amplitude of the input since wave. This can be obtained at long times after
the exponential term in Eq. (6.8) has decayed to a large measure as;
kp
AR
1
2 2
p
(6.9)
AR, amplitude ratio is found to be independent of the initial input amplitude A. The
phase shift is another measure of this analysis. It is given by the relative shift in phase
between the output and input sine waves. This can be seen to be from Eq. (6.8). The input
and output responses are plotted in Figure 6.1.
Figure 6.1. Response y(t) to input u = sin(2t) to a First Order Process with Gain k p = 3 hr-1 and Process
Time Constant p = 1.5 hr.
372
It can be seen from Figure 6.1 that there is damping of the input function. AR, amplitude
ratio of 0..3 is realized. There also can be seen a phase lag. The process acts like a low
pass.filter.
6.3. BODE AND NYQUIST DIAGRAMS

In a Bode diagram, the AR amplitude ratio is plotted against the frequency in a log-log
plot and the phase angle, is plotted against the frequency in a semi-log plot [van
Vackenberg, 1984]. A semi-log plot is chosen for the phase angle diagram in anticipation of
negative values for phase shift. The Bode plot for the input function u = A sin(t) to a
prototypical first order process as discussed in section 6.2 is shown in Figure 6.2 and Figure
6.3.
Aliter, another method of obtaining the Bode plot [Golnaraghi and Kuo, 20..09] is
by..substitution of (i) for s in the Laplace domain of the transfer function. Then the
expression is expressed as a complex number Z = a + ib. Further the steady state process gain
can then be obtained from the absolute value of Z, i.e.
a2
b2
ATAN
b
a
(6.10)
For example for the prototypical first order process given by Eq. (6.1) the transfer
function can be seen to be;
kp
G(s)
s
(6.11)
s is replaced with (i) in Eq. (6.11) and;

kp
G(i )
i
Z
1
kp
2 2
p
pk p
2 2
p 1
(6.12)
Applying Eq. (6.10) into Eq. (6.12)

Z
a2
ATAN
b2
b
a
kp
2 2
p
ATAN (
(6.13)
p)
373
Figure 6.2. Bode AR Plot of Response y(t) to input u = sin(2t) to a First Order Process with Gain k p = 3
hr-1 and Process Time Constant p = 1.5 hr.
Figure 6.3. Bode Phase Angle Plot of Response y(t) to input u = sin(2t) to a First Order Process with
Gain kp = 3 hr-1 and Process Time Constant p = 1.5 hr.
In a Nyquist diagram [1932] the imaginary part b can be plotted against the real part
a in Eq. (61.2) for example.
374
Example 6.1 Construct the Bode plot and Nyquist diagram for a point in a semi-infinite
medium subject to constant wall temperature boundary condition. Compare the results
between damped wave conduction and relaxation and Fourier conduction.
More detailed discussion on damped wave conduction and relaxation can be seen in
chapter 4.0 of this book and also in Sharma [2005]. The governing equation for transient
temperature for a semi-infinite medium heated by maintaining a constant wall temperature at
the surface and assuming that the heat transmission is by damped wave conduction and
relaxation mechanism can be written as follows;
2
Where, u
(T T0 )
;
(T s T 0 )
;X
X2
(6.14)
Ts is the surface temperature and T0 is the initial temperature of the semi-infinite medium.
Obtaining the Laplace transform of Eq. (6.14) and applying the boundary conditions u = 0 at
X = , u = 1 at X = 0;
e
u (s)
X s ( s 1)
(6.15)
Replacing s with (i) in Eq. (6.15) and obtaining the a and b;
u (i )
a ib
Let
1 X
c id
X2
2!
....
(6.16)
(6.17)
Taylor series approximation was used to rationalize the Laplace domain expression with
exponential term in Eq. (6.15). c and d in Eq. (6.17) can be solved for by squaring both sides
of Eq. (6.17) and equating the real and imaginary parts on both sides, LHS and RHS of the
resulting equation and;
1 i 2
c
d
2
a and b in Eq. (6.16) can then be seen to be;
(6.18)
2
a
b
Xd
1
X2
2!
2
1 cX
X2
2!
Figure 6.4. Bode Process Gain Plot for X = 0..5 in Semi-infinite Medium Subjected to Constant
Wall.Temperature during Damped Wave Conduction and Relaxation.
375
(6.19)
376
The same analysis is repeated assuming Fourier conduction in the semi-infinite medium.
The governing equation for transient temperature would then become;
2
(6.20)
X2
Obtaining the Laplace transform of Eq. (6.20) and applying the boundary conditions u =
0 at X =, u = 1 at X = 0;
e
u (s)
X s)
(6.21)
Replacing s with (i) in Eq. (6.21) and obtaining the a and b;

a ib
u (i )
1
e
i
X i
(6.22)
Taylor series approximation is used to rationalize the exponential term in Eq. (6.22);
a ib
X2
2!
1 X i
(6.23)
Let i c id . It can be seen by squaring both sides and by equating the real and
imaginary parts of both sides of the resulting equation c and d can be obtained and is;
(6.24)
Combining Eq. (6.24) with Eq. (6.23) it can be seen that;
(6.25)
X
2
X2 2
2!
(6.26)
The Bode plot for X = 0.5 in the semi-infinite medium heated by Fourier conduction
from a constant temperature surface is shown in Figure 6.5. The Bode plot for the same point
in the medium heated by damped wave conduction and relaxation is also shown in Figure 6.5.
A cross-over in the steady-state process gain can be seen at a frequency of approximately =
2. After the cross-over the process gain is higher for parabolic case compared with the
hyperbolic case. Before the cross-over the process gain is lower for the parabolic case
377
compared with the hyperbolic case. Before the cross-over the process gain is insensitive to the
frequency for the parabolic case. After the cross-over the process gain is more sensitive to
frequency for the parabolic case compared with the hyperbolic case. The process gain is
equally sensitive to frequency for the hyperbolic case both before and after the cross-over
frequency. The Bode phase angle plots for the parabolic and hyperbolic cases at X = 0.5 in
the semi-infinite medium is shown in Figure 6.6. S shaped curvatures are found for both
parabolic and hyperbolic cases. The Nyquist diagram for the hyperbolic cases at X = 0.5 in
the semi-infinite medium is shown in Figure 6.7.
Figure 6.5. Bode Process Gain Plot for X = 0..6 in Semi-infinite Medium Subjected to Constant
Wall.Temperature during Damped Wave Conduction and Relaxation and Fourier Conduction (Side by
Side Comparison).
378
Figure 6.6. Bode Phase Angle Plot for X = 0.5 in Semi-infinite Medium Subjected to Constant
Wall.Temperature during Damped Wave Conduction and Relaxation and Fourier Conduction (Side by
Side Comparison).
Figure 6.7. Nyquist Diagram for X = 0.5 in Semi-infinite Medium Subjected to Constant Temperature
Surface during Damped Wave Conduction and Relaxation.
379
6.4. FREQUENCY ANALYSIS OF SECOND ORDER PROCESSES

The discussions about prototypical second order systems and how over damped, critically
damped and underdamped systems can arise for a step input was discussed in chapter 4.0.
Here the frequency analysis as discussed in the above sections is applied to prototypical
second order systems. The steady state process gain and phase characteristics that can be
expected as a function of frequency, for prototypical second order systems are sketched in
Figure 6.8.
A resonant peak, Rpeak can be expected in the AR or steady process gain as shown in
Figure 6.8 at a frequency of R for higher order systems such as prototypical second order
systems. For systems with overshoot Rpeak would be very high. It is desirable to maintain Rpeak
at values of about 1.1-1.5. R is called the resonant frequency corresponding to the
occurrence of resonant peak Rpeak in the gain. A BW, bandwidth can be defined as the
frequency corresponding to a value of 0.707 of the zero frequency ABS(Z) or the steady
process gain. This is also shown in Figure 6.8. The BW frequency value can be used to better
understand the transient properties of the time domain of the system under study. Quicker rise
time manifests as larger bandwidth. Time response is slow for systems with lower bandwidth.
BW can be used to study the filtering characteristics as well as the robustness of the system.
The slope of the ABS(Z) vs. curve can be representative of a cut-off rate. This can be
used to gauge the signal to noise ratio of the system.
6.5. CLOSED LOOP STABILITY BODE AND NYQUIST CRITERION

The closed loop shown in Figure 5.4 is applicable in general for any control action taken
on any considered process. Consider the case when the loop in Figure 5-4 is opened as a
hypothetical experiment in thought. A periodic wave such as a cosinuous function may be
applied to the set point. The controller settings and tuning parameters are such that the output
lags the input by PI radians. The amplitude of the output is the same as that of the input.
Consider stoppage of the signal r(t) suddenly and closure of the loop subsequently. The error,
e(t) = -y(t) the output variable. The output oscillates at the same frequency and magnitude as
before the loop was closed. Such a control loop is said to be nominally stable. The control
loop may be considered unstable when upon closure of the loop the output increases with
time and the amplitude of the output is greater than the amplitude of the input. In the open
loop the output is out of phase with input. The amplitude of the output signal is greater than
the set point. Such a stability criterion is called as Bode Criterion. For a stable process, Gp(s)
has no poles in the Right Half Plane and has the phase angle cross PI radians only once in
the Bode diagram. The system is considered closed loop stable if and only if;
ARc
Gc
Gp
(6.27)
ARc is the amplitude ratio at the cross-over frequency, c. This is when the phase angle is
PI radians. The Nyquist stability criterion states that the process is said to be closed loop
stable if the Nyquist diagram of Gp(s)Gc(s) does not engulf the critical identified point (-1,0.).
380
The gain margin can be calculated as the reciprocal of the amplitude of the cross
over.frequency. So the Bode stability criterion in terms of the gain margin can be written as;
Mgain > 1
(6.28)
The phase margin m is the corresponding phase when the amplitude AR of Gc(s)Gp(s) =
1. The corresponding frequency is m. The stability criterion can be written as;
m > 0
(6.29)
It is up to what extent or degree of measure of phase angle that can decrease prior to
onset of instability.
Example 6.2. Construct the Bode diagram for the process in Example 6.1.
The transfer function in worked Example 5.1 can be written as follows;
0.01 p s 1
y(s)
0.01
2 2
ps
0.02s
1
(
1 s)
(6.30)
Let s = i, Then,
0.01
pi
Z
i (1 0.01
2
p
) 0.02
a ib
2
p
Figure 6.8. Typical Frequency Response Characteristics of Prototypical Second Order System.
(6.31)
381
Figure 6.9. Bode AR Plot for Example 6.1 when p = 0..01.
The a and b of the analytic function Z in Eq. (6.31) can be found by multiplying the
numerator and denominator of Eq. (6.31) by (-0.022p -i(1-0.01(2p2)).
2
p
0.01 10
2 2
p
Z
1 10
0.02
4
4 4
p
i 1 0.00981
0.0199
2 2
p
2 2
p
a ib
(6.32)
The AR is given by;
AR
a2
ATAN
b2
b
a
(6.33)
The Bode AR plot when the process time constant, p = 0.01 is shown in Figure 6.9. The
Bode phase angle plot for the system in Example 5.1 for p = 0.01 is shown in Figure 6.10.
6.6. SUMMARY
For a given process of first order or second order suitable control action can be devised as
shown in Chapter 5.0. The closed loop transfer function can be calculated and the system can
be tuned to be stable. This is achieved by changing the control gain and lag parameters. There
can be uncertainties associated with the parameters that are used to describe the system and
the gain constants and time constants for the control system. This can cause a reversal in
stability to instability. So the system has to be made robust. Robustness of system is
measured using methods of frequency analysis described in this chapter. The output response
382
to a sinuous input to a prototypical first order process was discussed. The amplitude reduction
and phase angle development can be seen in Figure 6.1 as well as in the expression given by
Eq. (6.8). Aliter is provided for calculation of AR, amplitude ratio and phase angle f. The
Laplace transform variable s is replaced with (iw) in the transfer function. The real and
imaginary part of the resulting complex number, Z = X +iY is calculated. The AR is given by.
In a Bode diagram, the AR amplitude ratio is plotted against the frequency in a log-log
plot and the phase angle, f is plotted against the frequency in a semi-log plot. A semi-log plot
is chosen for the phase angle diagram in anticipation of negative values for phase shift. The
AR and phase angle Bode plots for the sinuous input to a first order process was given in
Figure 6.2 and Figure 6.3. In Example 6.1, the Bode plots and Nyquist diagram for a point in
a semi-infinite medium subject to constant wall temperature boundary condition were
constructed. The results between damped wave conduction and relaxation and Fourier
conduction models were compared with each other. Taylor series approximation was used to
rationalize the Laplace domain expression with exponential term in Eq. (6.15). The results
were presented in Figures 6.4 -6.7.
Typical frequency response characteristics of prototypical second order system were
discussed. Resonant peak can be expected in the frequency domain where there was an
overshoot in the time domain or where there was a damping coefficient of z < 1 in the
Laplace domain. Bandwidth is defined as the frequency corresponding to a value of 0.707 of
the zero frequency ABS(Z) or the steady process gain. Quicker rise time manifests as larger
bandwidth. The closed loop stability considerations discussed in Chapter 5.0 takes shape in
the frequency domain as Bode criterion and Nyquist criterion. Bode criterion states that; The
system is considered closed loop stable if and only if; The Nyquist stability criterion states
that the process is said to be closed loop stable if the Nyquist diagram of Gp(s)Gc(s) does not
engulf the critical identified point (-1,0). Gain margin and phase margin are defined. AR and
phase angle Bode plots were constructed for the transfer function obtained in Example 6.1.
Figure 6.10. Bode Phase Angle Plot for Example 6.1 when p = 0.01.
383

E. van Valkenburg, M. (1984). University of Illinois at Urabana-Champaign, In Memorian:
Hendrik W. Bode, (1905-1982), IEEE Trans. on Automatic Control, Vol. AC-29, 3, 193194. Quote: Something should be said about his name. To his colleagues at Bell
laboratories and the generations of engineers that have followed, the pronounciation is
boh-dee. The Bode family preferred that the original Dutch be used as boh-dah.
Golnaraghi, F. & Kuo, B. C. (2009). Auntomatic Control Systems, John Wiley & Sons, 9th
Edition, Hoboken, NJ.
Levenspiel, O. (1999). Chemical Reaction Engineering, John Wiley & Sons, Hoboken, NJ.
Mickley, H. S., Sherwood, T. E. & Reed, C. E. (1957). Applied Mathematics in Chemical
Engineering, McGraw Hill Professional, Second Edition, New York, NY.
Nyquist, H. (1932). Regeneration Theory Bell System Technical Journal, Vol. 11, 126-147.
Sharma, K. R. (2005). Damped Wave Transport and Relaxation, Elsevier, Amsterdam,
Netherlands.
W. Bequette, B. (2003). Process Control: Modeling, Design, and Simulation, Prentice Hall,
Upper Saddle River, NJ.
Yeung, K. S. (1985). A Reformulation of Nyquists Criterion, IEEE Trans. Educ., Vol. E28, 59-60.
6.8. EXERCISES
Review Questions
1.0. How do uncertainities in parameter values affect stability of output response ?
2.0. What is meant by robustness of control ?
3.0. What is meant by reversal of stability criterion ?
4.0. What happens to the realizability of the system when a lag term such as e-s appear ?
5.0. Illustrate a use of Pade approximation.
6.0. What are the differences between AR amplitude ratio and phase angle obtained
during frequency analysis ?
7.0. What in Figure 6.1 leads to the inference of a property such as low pass filter
characteristic ?
8.0. Why is a semi-log plot chosen in phase angle Bode plot ?
9.0. Does process gain and time constant affect AR and phase angle ? Why ?
10.0. Derive the amplitude ratio, AR, phase angle for a given system output response
for a given input to a prototypical second order process.
11.0. What are the ordinates of Nyquist diagram ?
12.0. What is meant by resonant peak ?
13.0. What is the significance of bandwidth ?
14.0. Can filtering characteristics be obtained from bandwidth analysis ?
15.0. What is meant by cut-off rate ?
384

16.0. When is a loop considered to be nominally stable ?
17.0. What is meant by Bode criterion ?
18.0. What is meant by Nyquist criterion ?
19.0. What are the differences between gain margin and phase margin ?
20.0. What is the significance of minima and maxima in Bode diagram of Example 4.1 as
shown in Figure 6.9 ?
21.0. Does the curve found in Figure 6.10 inflect ?
22.0. What do you expect to see in AR Bode and phase angle Bode of a critically damped
system ?
23.0. How does the Nyquist diagram of a overdamped system differ from that of an
underdamped system ?
24.0. Can anything peculiar be noted in the Nyquist diagram of a critically damped
system ?
Problems
25.0. Bode Diagram of Output Reponse of PI Control of Automatic Washing Machine
Consider the output transfer function obtained in Example 4.3. The design is a PI
control of voltage supplied to automatic washing machine.
s
Gp s
s sJ m
Gc s
y s
kc
Bm
G p s Gc s
1 Gp s
Gc s
Construct Bode plots for y(s). What can be inferred from AR plot and phase angle
plot.
26.0. Construct Nyquist diagram for output transfer function in Exercise 22.0..
27.0. Bode Diagram of Output Response of PI Control during Hydolysis of Ethylene
Oxide
The output transfer function of the system with PI control during hydrolysis of
ethylene oxide is given by Eq. (4.73). Construct AR Bode and phase angle Bode
plots for the system output response. How does the curve change when damping
coefficient, < 1. i.e., what are the differences seen in the AR Bode of underdamped
systems and AR Bode of a overdamped system ? What are the differences between
phase angle Bode of underdamped system and phase angle Bode of overdamped
system?
28.0. Bode Diagram of Output Response of System of PD Control of Prototypical First
Order Process
385
The closed loop transfer function of system with PD control of prototypical first
order process is given by Eq. (4.80). Construct;
(i) AR Bode Plot
(ii) Phase Angle Bode Plot
(iii) Nyquist Diagram
29.0. Bode Diagram of Output Response of System of PD Control during Hydrolysis of
Ethylene Oxide
The closed loop transfer function response of system with PD control during
hydrolysis of ethylene xide to form ethylene glycol is given by Eq. (4.90). Construct;
(i) AR Bode Plot
(ii) Phase Angle Plot
30.0. Frequency Analysis of Intermediate Formation in CSTR from Reactions ni Series
Transient analysis of intermediate formation from reactions in series was discussed
in Example 4.6. An example of such a reaction is chlorination of methane leading to
formation of methyl chloride, dimethylene dichloride, choloform and carbon
tetrachloride. The closed loop transfer function, GCL(s) of the system of PI control of
such reactions to a step input is given in Eq. (4.117). Construct;
(i) AR Bode Plot
(ii) Phase Angle Bode Plot
(iv) What is the gain margin ?
31.0. Bode Plot of System Response of PI Control of Prototypical First Order Process to
Input that undergoes Exponential Decay with Periodicity
this process. Let the process gains, kp = 3; kc =0.33. The time response of the process
output variable y(t) to a change in the set point,
r (s)
1
(( s 1)2 1)
was discussed in exercise 2.0 at the end of chapter 4.0. The time constant of the
controller, I becomes 10% of the time constant of the process, p. Disturbances are
neglected and valve and measurement dynamics are lumped into the process transfer
function. The transfer functions for prototypical first order process, gp(s) and that for
PI control, gc(s) can seen to be;
kp
g p ( s)
gc ( s)
ps
kc
Is
Is
Construct the AR and phase angle Bode plots for the closed loop transfer function
GCL(s).
386

32.0. Bode Plot for System with PI Control Action for Prototypical Second Order
Overdamped Process
A step change in the set point, r(s) = 1/s is given. The time constant of the controller,
I becomes 5% of the time constant of the process, p. The simplified control block
diagram given in Figure 4.4 is applicable. Disturbances are neglected and valve and
measurement dynamics are lumped into the process transfer function The transfer
functions for prototypical first order process, gp(s) and that for PI control, gc(s) can
be seen to be;
kp
g p (s)
gc ( s)
2 2
ps
kc
2 s 1
Is
Is
Construct the AR Bode and Phase angle Bode for the closed loop transfer function of
the system. What happens to the characteristics of the Bode diagram when the
process gain constant equals the controller gain constant.
33.0. Bode Plot of System with PI Control for Prototypical Second Order Undamped
Process
Consider any prototypical second order process as in Exercise 7.0 at end of chapter
4.0. Consider a PI controller used to control this process. Let the process gains, kp =
kc =1. Let the damping factor = 0.0. A step change in the set point, r(s) = 1/s is
given. The time constant of the controller, I becomes 5% of the time constant of the
process, p. The simplified control block diagram given in Figure 5.4 is applicable.
Disturbances are neglected and valve and measurement dynamics are lumped into the
process transfer function. Develop the expression for the output variable y(s) in the
Laplace domain and time domain y(t). Sketch the response y(t) as a function of time.
The transfer functions for prototypical first order process, gp(s) and that for PI
control, gc(s) can be seen to be;
g p ( s)
gc ( s)
kp
2 2
ps
kc
Is
Is
Construct the AR Bode and Phase angle Bode for the closed loop transfer function of
the system. What happens to the characteristics of the Bode diagram when the system
becomes undamped from a system that is underdamped ?
34.0. Bode Plot of System with PI Control of a Process that is Integrating Unstable
Consider a process that is integrating unstable and has the following transfer
function.
G p ( s)
387
0.5
( s 2)
Show that a PI controller can stabilize this integrating unstable process. Consider the
control transfer function;
( s I 1)
s I
Show that the closed loop transfer function can be given by;
Gc ( s) kc
GCL ( s)
0.5kc (s I 1)
(s I s I (0.5kc 2) 0.5kc )
2
As discussed in problem 9.0 at end of Chapter 4.0, r stability 0 < kc < 4. The system
would be underdamped when;
2kc I (4 0.25kc2 2kc )
2 kc
(0.5kc 2)2
Construct the AR and phase angle Bode plots for;

(i) Process that is Integrating Stable
(ii) Closed Loop Transfer Function that is Underdamped
(iii) Closed Loop Transfer Function that is Overdamped
How do the characteristics of the Bode diagram change with change in stability from
integrating stable to overdamped stable and to underdamped unstable ?
35.0. Bode Plot of Systems with Inverse Response
Some systems exhibit a inverse response as discussed in Problem 10 at end of
Chapter 4.0. The output response to a unit step response in such systems decreases
initially and increases to a final steady state later. The transfer function of such a
system has positive pole in the numerator;
G p ( s)
(s 3)
.u( s)
(s 0.2)(s 2)
Consider a PD controller for example with a transfer function given by;

Gc s
kc s
The closed-loop transfer function of the system is given by;
388

Ds
GCL s
D
1 2
s
kc
3 s 3
0.4
3 s(1 3
kc
2.2
)
kc
Show that for small D the system would be stable. For stability, kc < 0.133 and
0.733
. Is this both possible for positive values of gain constant of
0.33
D
kc
controller, kc. and controller time constant D. Construct the AR and phase angle
Bode diagrams for the closed loop transfer function. What are the differences in
characteristics found in the Bode diagram for;
(i) Process with Inverse Response
(ii) Closed Loop Transfer Function (stable regime)
(iii) Closed Loop Transfer Function (underdamped oscillatory regime)
36.0. Bode Plot of System with P only Control of Jacketed CSTR
The Lapalce transfer functions of model equations for dimensionless concentration
and dimensionless temperature for the jacketed CSTR described in Figure 4.19 are as
follows;
X (s)
Da
s s 1 Da
Y (s)
Da H *
s s 1 Da s 1 U *
U*
s s 1 U*
H*
s s 1 U*
Consider a proportional controller with the control transfer function;
Gc s
kc
Show that the closed loop transfer function for the dimensionless concentration and
dimensionless concentration can be given by;
GCL s
GCL ( s)
kc Da
s2
s 1 Da
kc Da
kc s
Da U *
H* U*
s 1 Da 1 U *
H * U * 1 Da
kc
H* U*
kc
H * U * 1 Da

(i) Dimensionless Concentration, X(s)
(ii) Dimensionless Temperature, Y(s)
(iii) Closed Loop Transfer Function, GCL(s) for P only control of dimensionless
concentration
(iv) Closed Loop Transfer Function, GCL(s) for P only control of dimensionless
temperature
389
37.0. Bode Plot of System with PI Controller with Process Transfer Function with One
Pole at Origin
Consider a second-order process with the process transfer function with one pole at
the origin;
Gp s
3
s 2s 1
A PI controller with integral time constant of I = 2 can lead to a pole-zero

cancellation (see Exercise 15.0 at end of chapter 4.0). Show that the closed loop
transfer function can be given by;
3kc
G CL s
s2
Construct the AR and Phase Angl Bode plots. Compare the characteristics of these
plots with the AR and phase angle Bode plot of the process transfer function.
38.0. Nyquist Diagarm of Proportional Controller of CSTR with Recycle
Consider the process conducted in a CSTR with recycle as shown in Figure 4.26. The
transfer function of model equation for the dimensionless concentration in transient
state is given by;
Da
XA
R 1
Da
s s
Da
1
R 1
R
R 1
R 1
dX A
d
Da
1
s s
Da
XA s
R 1
where R is the recycle ratio. Consider a P only controller for the dimensionless
concentration. What is the closed loop transfer function for the system. Construct a
Nyquist diagram for the closed loop transfer function. What are the differences in
characteristics between the Nyquist diagram of the process transfer function and the
Nyquist diagram of the closed loop transfer function ? How does the charactertistics
of the Nyquist diagram change when the combined system changes in regime from
overdamped system to underdamped oscillatory systems ?
39.0. Bode Diagram for a Prototypcial First Order Process with Dead Time
Consider a first order process with a lag time, . The process transfer function with
dead time, can be written as;
G p (s)
k pe
390

Construct the AR and phase angle Bode plots for this process transfer function. Can
you arrive at a suitable controller for this process from the Bode plots.
40.0. Bode Plots of Systems with Proportional Derivative, PD Controller for a First
Order Process with Dead Time
Consider a PD, proportional derivative controller for a first order process with a lag
time, . The process transfer function with dead time, can be written as (see
Exercise 20 at end of Chapter 5.0);
G p (s)
k pe

Gc (s)
kc 1 s
2 s
2 s
Develop the expression for the closed loop transfer function. In order for the system
to be realizable add a filter with order n whose transfer function can be written as;
1
F s
s

(i) Process
(ii) Nth order filter
(iii) Closed loop transfer function
Comment on the characteristics of Bode plots in each case.
41.0. Bode Plots of System with PI Control of Intermediate Species in Denbigh Scheme of
Reactions
Denbigh [Levenspiel, 1999] presented a scheme of general scheme of reactions for
series, parallel and series- parallel reactions. The scheme is given in Figure 5.12 (see
Exercise 24.0 at end of Chapter 4.0). The kinetics of these reactions are
391

dC A
dt
dCR
dt
dCS
dt
dCT
dt
dCU
dt
k12C A
k1C A
k34CR
k3CR
k2 C A
k4 CR
Where k12 = k1 + k2 and k34 = k3 + k4. Show that the process transfer functions for the
reacting species in a CSTR during transient operation can be written as follows;
CA s
CR s
C
CT s
CU s
C Ai
s s 1 Da12 s
s s
C Ai Da12
1 Da12 s
s s
C Ai Da3
1 Da12 s 1 Da34 s
s s
Da2C Ai
1 s 1 Da12
s s
1 s
1 Da34
Da4 Da12C Ai
1 Da12 s
1 Da34
Consider a PI controller with the transfer function;
Gc ( s)
kc
Is
Is
What is the closed loop transfer function for each of the processes of species A, R, S,
T and U. Construct the AR And Phase angle Bode plots for;
(i) Transfer Functions of species A, R, S, T and U
(ii) Closed Loop Transfer Function of PI Control of Concentration of Species A, R,
S, T and U
Chapter 7
ADVANCED CONTROL METHODS

7.1. ESTIMATION AND CONTROL OF POLYMERIZATION REACTORS
The control of polymerization reactors is a non-trivial task due to the following reasons;
(a)
(b)
(c)
(d)
(e)
Specification of control objectives

High viscosities and exothermic nature of the reaction
Process dynamics is nonlinear
Measurement of polymer structure is difficult
Estimation techniques such as Kalman filter and Weiner filter are needed to estimate
parameters that can be measured
Elicabe and Meira [1988] presented a review of the estimation and control literature in
polymerization reactors. Polymers can be prepared in different types of reactors such as;
(a)
(b)
(c)
(d)
Batch Reactor, BR
CPFR, Continuous Plug Flow Reactor
HCSTR, Homogeneous Continuous Stirred-Tank Reactor
SCSTR, Segregated Continuous Stirred-Tank Reactor
Polymerization kinetics can be classified into monomer-monomer chain reactions with

termination, polymer linkage without termination and polymer linkage by step reactions with
monomer or graft chains. Nine different possibilities for the molecular weight distribution
according to Elicabe and Meira [1988] from the different combinations of kinetics and
reactors. The polymers prepared in BR or CPFR are found to have molecular weight
distribution, MWD; (i) wider than Schulz-Flory distribution for monomer linkage with
termination; (ii) Poisson or Gold distribution for monomer linkage without termination; (iii)
Schulz-Flory distribution for polymer linkage with monomer or graft chains.
The objective of the reactor control is to obtain superior product quality. Quality is
characterized by parameters such as:
(i) Chemical composition of repeat units;
(ii) Chain sequence distribution of copolymers;
394

(iii) Alternating, block or random microstructure;
(iv) MWD in linear homopolymers;
(v) Multivariate distribution of molecular weight, composition;
(vi) Degree of chain branching;
(vii) Stereo-regularity;
(viii) Particle size distribution in lattices obtained from emulsion polymerization;
(ix) Partial porosity and surface area.
End-use properties of polymers processed from molding, extrusion are governed by

parameters such as;
(a) Mechanical strength;
(b) Elastomer relaxation;
(c) Adhesive tack;
(d) Melt viscosity;
(e) Brittleness;
(f) Impact strength;
(g) Drawability;
(h) Elastic modulus;
(i) Hardness;
(j) Softening temperature;
(k) Tear strength;
(i) Stress-crack resistance and;
(j) Adhesive strength.
Good structure-property relations are needed for devising control strategies based on
measurement of end-use property values. Another difficulty in setting control objectives is
that in polymerization reactors a desirable molecular weight distribution, MWD is the
objective and a deterministic scalar quantity. The control objective is a mathematical function
and not a vector of scalar parameters. Most propagation reactions are exothermic with an
energy release of 20 cal/mole for vinyl monomers. The viscosity of the reaction mixture
increases in an exponential manner with increases in conversion. Problems associated with
heat removal, mixing and transporting the reactor syrups need be solved by control.
Suspension and emulsion processes using water as suspending medium in part to avoid these
problems.
The polymerization process needs to be well understood before it can be controlled.
Development of mathematical models for the processes is constrained by the following
difficulties;
(a) Kinetic equations for monomer are nonlinear. Control theory developed for linear
systems is not applicable.
(b) Parameters involved in dynamic models are not all known. This is more the case for
reversible reactions and heterophase systems.
(c) Highly sensitive to impurities at even low concentrations in the raw material streams.
Disturbances are not measurable.
395
Model equations are developed from mass and energy balances. These result in state
space equation. The first moments of the MWD yields information about the molecular
structure.
Model calculations are performed in two phases. In the first phase, the monomer
concentrations, temperature in the reactor are obtained from the input variables such as inlet
flow rate, inlet reactor temperature. In the second phase, the molecular parameters are
derived. The model equations written for BRs or HCSTRs are modeled by sets of non-linear,
time-invariant, ordinary first order differential equations of a general form;
*
x
y
x, u, d
(7.1)
f ( x, u )
Where x is a vector of n states, u is a vector of m controls and d is a vector of k

disturbances and y is a vector of p measured outputs. Eq. (7.1) are the state and
measurement equations. Eq. (7.1) when modeled in discrete form can be implemented in
DDC, direct digital control. Controls are held piecewise constant over each sampling interval.
Models of PFR, plug flow reactors result in partial differential equations. Some of this
was discussed in Chapter 3.0.
Feedback control of a variable is not possible if the parameter cannot be measured or
estimated. On-line equipment for polymer characterization has limited availability.
Independent variables such as inlet monomer, inlet initiator concentrations and inlet flow rate
of the reactor are readily measurable, and intermediate variables such as reactor temperature,
monomer concentration in the reactor are easier to measure compared with the structural
properties. Indirect measurements such as level in the reactor are measured using nuclear
probes. Vapor pressure transmitters are used for temperature detection. Melt index is
correlated with viscosity. Viscometers are deployed. The electrical power consumed in the
reactors can be used for estimation of viscosity. Structural parameters such as molecular
weight, molecular weight distribution may be measured using SEC, size exclusion
chromatography. Composition distribution can be obtained from elemental C, H and N
analyzer. Sequence distribution can be measured using 13C NMR, nuclear magnetic resonance
spectroscopy. Weight average molecular weight, Mw can be measured using light scattering
photometers. Mn, the number average molecular weight can be measured using vapor pressure
and membrane osmometers. Particle size distribution in lattices can be measured using
hydrodynamic chromatography, SEC light scattering, field flow fractionation or electron
microscopy.
Implementation of on-line SEC requires; (a) a dead time in the reactor sample; (b) sample
conditioning equipment for sample injection involving dilution and ultrafiltration; (c)
fractionation time; (d) digital system for the acquisition and treatment of data.
The nonlinear equations in the models need be linearized. Some control algorithms are
designed from input-output measurements alone, without consideration of internal chemistry
or local events within the reactor. This approach is also called black-box approach. The
396
resulting models are empirical in nature. These are discrete linear transfer functions or
difference equations. The output, yt may be found from r previous values of the same output,
present value of input and s previous values of the input. A time delay b may also be included
in the model structure. A parameter estimation algorithm can be used to estimate the
coefficients t and t. Control strategies may be open-loop or closed-loop or self-regulating.
An open-loop strategy may be derived from empirical or empirical and theoretical
considerations. The control objectives would be met only if the model used is accurate and
robust and no unmeasurable disturbances are present. Feedback of controlled variables are
necessary. In Figure 7.1 is shown the scheme for possible feedback control configurations.
The scheme comprises of state-model, subsystem 1, subsystem 2 and the measurement
equations. It would be desirable to use the end use performance measurements for use in
feedback control. This is not possible. Structure property relations developed by in-house
experts can be used to correlate the property measurements with the corresponding structure.
Structural parameters can be measured directly or estimated from models that relate process
variables with the structure. Different paths such as structural variables path, output to
^
subsystem path, feedback the measured variables directly to obtain the state estimates x(t )
from such measures.
State estimation techniques have been developed to provide estimates of the state
variables even in cases where they cannot be obtained by direct measurement. Sequential
estimates can be updated using recursive algorithms. Filtered and predicted estimates are
taken up. State estimation is a method of determination of values of the states from the
knowledge of the output data and the input data. A unique estimate needs to be made from the
input-output data set. The physical significance of these criteria is that the system is said to be
observable and reachable. The architecture of the problem is shown in Figure 7.2.
Figure 7.1. Possible Feedback Configurations.
397
The process model is disturbed by the noise process (t) due to either unknown
load/disturbance or model errors. The error in reading of output data is (t). The mean and
covariance of the error and noise are known quantities. The symbol ^ is for estimated
values in Figure 7.2. K is estimated by different methods. In non-linear estimation problems
the objective may be to minimize the average squared errors in the initial estimate in the
process model and in measurement device. This has been shown to lead to infinite set of
coupled equations that are not tracfigure. Closed form analytical solutions are not possible.
One way out is the approximation called extended Kalman filter for manufacturing units that
can be modeled using linear equations. One of the benefits of this estimation approach is that
when some of the model parameters are not known then under some conditions these
unknown model parameters may also be estimated in addition to the states.
Jo and Bankoff [1976] developed a Kalman filter in order to obtain estimates of
conversion and Mw, weight averaged molecular weight. One of the parameters was
augmented resulting in improvement of filter performance. Due to the long residence time in
the study, the adaptive, exponential and/or iterative schemes did not improve the filter
performance. Quasi-steady state assumption was used. Poor initial estimates of the state
variables or of the state covariance matrix could readily be tolerated. Too small estimates of
the process noise covariance matrix caused the filter to diverge.
The Kalman filter is an on-line computer algorithm which is intended to provide better
estimates of the state variables that be obtained by direct solution of measurement equations.
If the system is observable, optimal estimates of variables that cannot be measured directly
can be made. Consider a linear n-dimensional system in which the random-variable state
vector xk, at time tk, evolves by means of a deterministic transition matrix, (k+1,k) to a new
value, xk+1 at time tk+1 = tk+t, where t is a fixed sampling interval A zero-mean Gaussian
disturbance k is imposed on the transition matrix. A m dimensional vector, yk is obtained,
subject to a zero mean Gaussian measurement error, vk. The Kalman filter can be written by
the following equations for predictions between observations;
^k
xk
Pkk 1
k 1, k Pkk
^k 1
1
xk
Pkk 11
(7.2)
k 1, k
(k )Q k 1
^k
xk
(7.3)
^k
1
K (k 1) yk
K k 1 M k 1 Pkk 1 I
K k 1
^k
k 1, k x k
M k 1 xk
K k 1M k 1
(7.4)
K k 1 R k 1 K T k 1 (7.5)
Pkk 1M T k 1 M k 1 Pkk 1M T k 1
R k 1
(7.6)
398
Figure 7.2. System with Corresponding Sequential Estimation.
The algorithm for the filter can be processed as follows;

^0
x0
(i) Obtain
and P00
(ii) Set k = 0
^k
(iii) Calculate x k
P0 at time t0.. from..prior knowledge of the system or by guess.
and Pkk 1 at tk from Eq. (7.2) and Eq. (7.3). These are a priori estimates
of xk+1 and Pk+1 and tk.

(iv) Calculate the Kalman gain matrix at tk+1, K(k+1) from Eq. (7.6) determining M and
R from the measurement equations and properties of noise.
(v) Once the measurement yk+1 is available at time t = tk+1 calculate the a posteriori
^k 1
1
estimates x k
and Pkk 11 from Eqs. (7.4), (7.5).
(vi) Increment k by 1 and return to step 3 and repeat the loop.

The linear filter may be applied to nonlinear systems after linearization of nonlinear
equations. The nonlinear dynamic systems is described by the stochastic differential equation
for a vector of size n;
dx
dt
f x, t
G t
(7.7)
Measurements are given by;
h x, t
vt
(7.8)
x, , v are the same as in the linear case and are random variable state vector, zero-mean
Gaussian disturbance, and Gaussian measurement error respectively. A deterministic
_
reference trajectory x t is generated with a given;
399

_
x0
x t0
(7.9)
These equations are linearized and discretized as follows;
xk
k 1, k
xk
k 1
(7.10)
Where,
_
xk
x tk
(7.11)
x tk
_
yk
y tk
E y tk
y tk
h x tk , tk
(7.12)
M k
hx x tk , tk
(7.13)
and is the transition matrix. This can be obtained from;

_
t,
f x x, t
t,
(7.14)
With the initial condition;
(7.15)
The linear filter is then directly applicable to the linearized system when the differences
between reference and actual trajectories are small. In order to keep the differences small, the
_
x0 can be estimated when new observations are made available. This method is called the
global iteration. This can be repeated till constant reference trajectories. An extended Kalman
filter was developed;
^k
xk
^k
1
tk
xk
^k
f xt , t dt
(7.16)
tk
^k 1
1
xk
^k
x k K k 1 yk
^k
1
An iterative Kalman filter can also be developed.
h xk
(7.17)
400
Congalidis, Richards and Ray [1989] discuss different approaches to the control of
polymerization reactors. Homopolymers and copolymers can be made in CSTR by continuous
mass polymerization. Increased competition and emphasis on product quality has rendered
method of recipe control obsolete. During recipe control the operating conditions are updated
infrequently based on results for testing of polymer samples.
Control hardware equipment is available with improvements being made. Advances have
been made on development of control theory. Control of polymerization reactors is a tough
and complex problem. On-line sensors for product quality monitoring are needed. The steady
state values are extremely sensitive to small changes in parameter values or operating
conditions. Model equations written to describe reactor dynamics are nonlinear. There are
three types of approaches to control of polymerization reactors;
A. Development of optimal trajectories for the manipulated variables. The narrowing of
the molecular weight distribution, or copolymer composition distribution can be
achieved in batch and semi-batch reactions by manipulation of temperature,
monomer and initiator during the batch. Manipulated variable trajectories were
generated. The control problem becomes one of optimization problem.
B. Use of nonlinear state estimation techniques to estimate infrequently measured
control variables. Extended Kalman filter was used in order to obtain estimates of
conversion and weight average molecular weight in an experimental continuous mass
polymerization of vinyl acetate in a small glass CSTR. State estimation using both
online and off-line delayed measurements was looked at in order to estimate the
molecular weight distribution and branching distribution in a polymerization reactor.
C. Evaluation of specific feedback controllers. Multivariable adaptive controller was
used to control the reactor monomer concentration and temperature in the continuous
mass polymerization of MMA, methyl methacrylate in a CSTR. Simulations were
performed and acceptable performance was found in the presence of noise and load
changes. Difficulties were encountered in the multiple steady state regions with
strong interactions.
Additional control problem is posed when there is need for recycle of monomer and
solvent. 4 PI controllers were tuned to control the reactor outputs using the selected
manipulated variables. The feedback strategy was implemented hierarchy above the feed
forward level. A PI controller can be tuned to make it more proper and can be used to
manipulate the coolant flow rate in order to control the jacket temperature. Jacket temperature
is selected as manipulated variable and not the coolant temperature. The separator and hold
tank are described as isothermal first-order lags with constant level and residence time equal
to the reactor residence time. The need for level controllers is obviated.
Congalidis, Richards and Ray [1989] considered copolymerization of MMA, methyl
methacrylate and vinyl acetate in benzene solvent and AIBN, azo-bis-isobutyronitrile
initiator. The reactivity ratios are r12 = 26 and r21 = 0.03. The steady state operating point was
designed upon consideration of polymer production rate, composition of copolymer, weight
average molecular weight and reactor temperature. The inputs are reactor flows of monomers,
initiator, chain transfer agent, solvent, and inhibitor, the temperature of the reactor jacket and
the temperature of the reactor feed. The reactor, separator and hold tank are preheated. The
inputs to the nonlinear model were varied in order to obtain steady state values for output
401
variables that are acceptable. Viscosity of the medium is held at moderate levels. The
equations that govern the dynamics of the reactor assuming that the polymer chemistry is of
the free radical type are as follows;
Species mole balance can be written for monomer, initiator, solvent, CTA, chain transfer
agent and the inhibitor;
C j0
dC j
d
(7.18)
C j 1 Da j
Where, Daj = Damkohler number (kj) of species j, = t.-1 and Cj0 is the concentration
of the species j in the inlet of the reactor and Cj is the concentration of the species in the
reactor and in the effluent. The energy balance of the reactor can be written as;
dTr
dt
Tr
Trf
r
Hr
j 1 i 1
k CC
jk pjk j k
U r A Tr
Tj
VC p
Tr 0
(7.19)
They used the long chain hypotheses for the polymer reaction rates. By quasi-steady state
assumption they derived the expression for concentration of free radicals of all the different
dyad types, AA, AB, BB, BA. The rate of change of concentration of radicals can be taken to
be zero. The number and weight average molecular weight was calculated by equating the
rate of initiation and termination rates. Dead polymer and live polymers are distinguished
from each other. The moments of the dead polymer and live polymer were calculated. The
separator and hold tanks were modeled as first-order lags on species concentration with
constant volume reactor. It can be seen that the governing equations are nonlinear ordinary
differential and algebraic equations. They were integrated using a 5th and 6th order Runge
Kutta numerical method. The steady state and transient values of the polymerization rate,
reactor temperature, copolymer composition and molecular weight.
They suggest feed forward control strategy for their recycle streams. The polymer
properties are affected by introduction of disturbances in the reactor monomer feed. The fresh
feeds are manipulated and a constant feed composition is maintained and allowed to flow into
the reactor. The recycle composition is measured by online gas chromatograph. This may
introduce some time delays in the circuit. The open-loop output variable response to a purge
disturbance was studied. The polymerization rate was found to have an inverse response with
the molecular weight.
The molecular weight was found to have an inverse response with the residence time in
the reactor. The conversion was found to have a maxima as a function of time. It undergoes
an integrating phase prior to undergoing a stable phase. The performance of the feed forward
controllers was illustrated by examination of the response of the output and manipulated
variables to a pulse disturbance of the purge ratio that occurs while the reactor operates at
steady state.
Feedback controllers were evaluated for polymer properties and production rate. The
design procedure used in this study to select a control structure is based on ranking various
candidate structures according to a condition number. They discuss use of CONSYD package
402
of control system design programs in conjunction with the nonlinear model and how it cut the
time needed for completion of the design.
One of the issues in the control design is the specification of 4 manipulated variables to
control previously specified output variables. The selected variables are monomer flow rates
of monomers, initiator flow rate, chain transfer agent, reactor jacket temperature. Step tests
were conducted using CONSYD package on the nonlinear reactor model. The transfer
functions were fitted by least squares to the responses of the output variables for all choices of
manipulated variables. The denominator polynomial of the transfer function was restricted to
first or second order. The summary of transfer functions obtained from this method is
summarized in for of Tables. There are 4! ways that the selected four manipulated variables
can be paired with 4 output variables. All pairings have the same zero frequency condition
number and minimum singular value.
It is assumed that accurate measurements of output variables are available for feedback
control. Reactor temperature is readily available. The remaining outputs are not available.
Periodic laboratory analysis of monomer concentration, copolymer composition and
molecular weight are available. Significant sampling dead time is introduced. The required
variables can be obtained by improved online instrumentation such as viscometers,
refractometers or by use of state estimator in order to infer polymer properties between the
measurements. The estimator can be implemented in the form of an extended Kalman filter as
discussed in [Jo and Bankoff, 1976]. Multiple steady states may cause problems during plant
start-ups and plant shut-downs.
The controllers will not operate efficiently when the assumptions in their derivations are
not met. Feed forward control of the recycle stream eliminates recycle disturbances. The
control of the reactor is separated from the rest of the process. Ratio controllers on the flows
to the reactor partially decouple the multivariable nature of the reactor control problem.
Feedback control of polymer rate, composition, molecular weight and reactor temperature is
accomplished using PI controllers. The feedback PI and ratio controllers control the system
on the arrival of disturbances and the nonlinear behavior of the reactor. These control
schemes have been implemented successfully in several polymerization plants.
7.2. IMC, INTERNAL MODEL CONTROL

The methods of feedback control discussed in Chapter 5.0 such as P, PI control or
Tuyreus-Luben oscillation based tuning does not require a model for the process a priori to
control action. Closed loop response and stability considerations were paramount in devising
of the control action. Control action law such as P control, PI control, PD control and PID
control were obtained without any detailed knowledge of the process. A model based
procedure can be developed with the culmination of embedment of the process in the
controller.
Consider the mixing tank (Figure 7.3) with a jacket provided for heating the tank.
Model Equations:
Reactor:
dT
dt
v
Ti
V
UA
Tj
VC p
(7.21)
403
Jacket:
dT j
vj
dt
Vj
T jin
UA
Tj
jV j C pj
Tj
Figure 7.3. Mixing Tank Heated by hot Fluid in Jacket.
(a) At Steady State

0
1
50 125
10
UA
150 125
61.3(10)
UA (3)(61.3) 183.9 Btu.F
0
vj
vj
2.5
200 150
75
1.5 ft 3 .min
50
ft
(7.22)
183.9
150 125
61.3 2.5
(7.23)
(b) Matrices in State Space Model

dT
dt
dT j
0.4
1.2
0.3
1.8
T
Tj
5
120
(7.24)
dt
(c) Fourth Order Runge-Kutta Method for Integration of ODE in MS Excel Spreadsheet
20.07 for Windows.
Classical fourth-order RK method
The recurrence formula is given from [Chapra and Canale, 2006]
404

Tl
Tl
T jl
T jl
h
k1
6
h '
k1
6
2k2
2k2'
2k3
2k3'
k4
k4'
(7.25)
(7.26)
Where,
k1 = f(ti,Ti)
(7.27)
k2 = f(ti+0.5h, yi+0.5k1h)
(7.28)
k3 = f(ti+0.5h,Ti+0.5k2h)
(7.29)
k4 = f(ti+h, Ti+k3h)
(7.30)
vi
Ti T Q
V
Integration was performed using a MS Excel spreadsheet. The key results are shown in
Table 7.3 and Table 7.1. The step size used was h = 0.01 min. Tj
From Eq. (7.21), f(t,T) =
Table 7.1. Temperature in the Reactor, Jacket vs. Time

T
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
2
3
4
5
6
7
8
9
10
50.000
54.263
58.066
58.066
64.567
67.374
69.946
72.316
74.514
76.566
78.492
93.615
105.150
114.938
123.438
130.854
137.329
142.985
147.925
152.240
Tj
200
189.145
180.2475
180.2475
167.0994
162.3572
158.5734
155.5905
153.2766
151.5209
150.2307
150.7255
158.6955
166.9491
174.3797
180.9078
186.6161
191.6031
195.9591
199.7639
405
(d) From the last row of Table 7.1 it appears that the steady state temperature values, Tis
= 152.2 and Tjs = 199.7 F. The values from solution in (a) are Tis = 150 F and Tjs =
150 F.
(e1) Large Step Change in Jacket Flow Rate: 10. times to 15 ft3.min-1.
Figure 7.5. Transient Reactor Temperatures and Jacket Temperature vs. Time Response to a Big Step
Change in Jacket Flow Rate by 10. Times.
406

(e2) Small Step Change in Jacket Flow Rate: 10% times to 1.65 ft3.min-1
Figure 7.6. Transient Reactor Temperature and Jacket Temperature vs. Time Response to a Small Step
Change in Jacket Flow Rate by 10.%.
(f) Larger Vessel

v = 10 ft3.min-1; V = 100 ft3
10
UA
0
50 125
150 125
100
61.3(100)
7.5
UA
(4)(61.3) 73.56 Btu.F 1 ft 3
25
(g)
10
73.56
50 125
T js 125
100
100(61.3)
7.5 1.5
T js
750 F
0.012
(7.31)
(7.32)
407
vj
2.5
220
300
vj
73.56
750 125
61.3 2.5
200 750
3
0.733 ft .min
(7.33)
(h)
dT
dt
dT j
0.112
0.046
0.012
0.779
T
Tj
5
5.864
(7.34)
dt
Eigenvalues of the A matrix

Characteristic second degree polynomial equation
0.112
0.779
0.000552
0.891
0.0867
(7.35)
Eigenvalues are 1 = -0.78; 2 = -0.11

Both eigenvalues are negative. Hence the system is stable.
The model developed for the mixing tank heated by the hot fluid in the jacket can be used
to design a controller. A good knowledge of then when the process is stable and when the
process is underdamped oscillatory unstable can lead to better control action. Control action
of unstable systems may result in unsatisfactory results. In general the model-based controller
can be added as shown in Figure 7.7.
The analysis of the block diagram in Figure 7.7 leads to;
y(s) = Gp(s) M(s) r(s)
(7.36)
Consider a prototypical first order process such that;
G p (s)
kp
s
(7.37)
1
Figure 7.7. Model Based Control in Open Loop Configuration.
408
When M(s) is a constant, km. For a step change in the set point of magnitude R the
output function can be written as;
k p km
y(s)
R'
1 s
(7.38)
From the final value theorem it can be seen that after infinite time;
Lts
0 sy( s)
Ltt
y(t )
k p km R '
(7.39)
In order for the output to be free of offset,
km
1
kp
(7.40).
The output of the model based controller and process in the time domain can be seen
to be;
t
y (t )
km k p R ' 1 e
(7.41)
In order to achieve perfect control;
M (s)
1
G p (s)
(7.42)
If this perfect control, can be realized the output would track the input set point. Perfect
control is easier written in Eq. (7.42) than can be implemented in practice. In order for a
controller to be physically realizable the order of the polynomial equation that is used to
determine the poles must be at least one order greater than the polynomial equation that is
used to determine the zeros.
A filter can be added in order to make the control action
physically realizable. A first order filter has the following transfer function;
F ( s)
1
s
(7.43)
Where is a filter tuning parameter with units of time? The model based control is made
more proper so to speak. The transfer function is now;
F ( s)
G p (s)
M (s)
G p1 (s) F ( s)
409
(7.44)
For the first order transfer process whose transfer function is given by Eq. (7.37) the
model based controller transfer function M(s) becomes;
s
M (s)
kp s
(7.45)
By addition of a first-order filter the first order controller is made more physically
realizable. The model based controller transfer function as given by Eq. (8.45) can be viewed
as a lead/lag controller. This way the order of the polynomial equation that determines the
poles is at least the same as the order of the polynomial equation that determines the zeros.
The transfer function of the output variable y(s) is now;
r (s)
y(s)
s 1
(7.46)
The output response is first-order with a time constant of. This controller is dynamic as
compared with the static control in Eq. (7.40). The time response of the dynamic control
action is faster than that compared with the static controller as long as;
(7.47)
Inversion of a process model alone may not be sufficient for good control. In order for
the controller to be stable and realizable the process transfer function must be factorized. For
example, consider the following transfer function for the process;
k
Gp s
p1
1 s
p2
(7.48)
1
When the parameter is positive and real the zero is positive. This can lead to an inverse
response of the process transfer function. A model based controller for this process is
attempted as;
s
M ( s)
Consider a first order filter such that;
p1
1 s
kp 1
p2
1
F ( s)
(7.49)
410
s
M (s)
1 s
p1
kp 1
1
The poles of the controller are
s
1
and
p2
(7.50)
. The system is unstable. The zero of the
process has become the pole of the control transfer function that can lead to inverse response.
The unstable pole in Eq. (8.50) can be removed. The model transfer function then becomes;
s
M (s)
p1
1 s
p2
kp
(7.51)
It can be seen from Eq. (7.51) that M(s) is not proper. In order to make M(s) proper the
order of the filter can be increased. Thus when a second order filter is used instead of the first
order filter;
s
M (s)
1 s
p1
kp
p2
1
s
(7.52)
For such control action the output response y(s) can be seen to be;
1 1 s
y ( s)
s s 12
(7.53)
The output y(t) can be seen to be;

t
y(t ) 1
te
(7.54)
Eq. (7.54) is plotted in Figure 7.8.

It can be seen from Figure 7.8 that there is an inverse response for values of = 1.0 and
= 0.1. Although Figure 7.8 is for the indicated values of and in general Eq. (7.54) results
in an inverse response. For larger values of there is a minima present prior to the inverse
response. What can be inferred from this analysis is that the inverse response of the process
cannot be removed by a stable filter or stable control system.
The structure of IMC is shown as a block diagram in Figure 7.9. The components of.IMC
structure are (i) load/disturbance GD(s); (ii) process, Gp(s); (iii) Model controller, M(s); (iv)
Model, Gm(s); (v) set point, r(s); (vi) process output, y(s). Uncertainties in model can be
designed for by improving the robustness of the control action. The ramifications of
parameter uncertainties was discussed in Chapter 5.0. This can be achieved by adjustment of
filter parameters. In some cases the model transfer function is not invertible readily. For
example, in systems with time lag the transfer function of the process would be of the form;
G p (s)
k pe
411
(7.55)
Figure 7.8. Output Response to Model Transfer Function Given by Eq. (7.52) for = 1.0. and = 0.1.
Figure 7.9. Block Diagram of IMC Internal Model Control.
412

A first-order Pade approximation can be used as follows;
s
2
s
2
1
s
(7.56)
Plugging Eq. (7.56) in Eq. (7.55);
kp 2
G p ( s)
1 2
(7.57)
A model transfer function with an nth order filter can be developed as;
s
1 2
kp 2
s s
1 2
s s
M ( s)
(7.58)
For a first order filter, n = 1,

p
M ( s)
kp 2
(7.59)
The output transfer function for a step input is seen to be;

1
s s
y ( s)
(7.60)
The output transfer function can be written as;
y (t )
t
0
dp 1 e
(7.61)
7.3. RATIO CONTROL

In some applications, ratio control can be the method of choice. Consider the following
example. Consider preparation of flue gas with CO, carbon monoxide in the mixture. A
mixture of CO2, carbon dioxide and air is passed through a packed bed of pure carbon. The
reactor is operated in an adiabatic manner. There are two reactions that are expected to take
place to completion. These are as follows;
413

Reaction A
CO2(g) + C(s) 2CO(g)
(7.62)
2C(s) + O2(g) 2CO(g)
(7.63)
Reaction B
The inlet mixture, CO2/air is at a certain ratio such that the heat of reactions from
Reaction A and Reaction B cancel out each other. Reaction B is exothermic and Reaction A is
endothermic. The feed is preheated to 600 0C and the bed is operated at 600 0C.
The heat of formation at 298 K for CO from Smith, van Ness and Abbott [2005], can be
seen to be;
Hf298 = -110.53 kJ/mole
(7.64)
The heat of reaction at 600 K can be calculated using the relation;

H = <Cp>dT
The temperature variation of heat capacity information can also be used in the analysis as
follows;
C ig
p
600
298
8.314
600 298
(600 K )
C ig
p
(298)
C ig
p
A BT
3.507 3.376 302 0.557 *10
CT 2
3
(7.65)
T2
6002
2
2982
3
0.031*10
T
5 600
298
(8.314)(7.1163) 59.2 J / mole / K

600
H R0(600 K )
H R0(298)
C p dT
110.5
298
59.2(3.2)
1000
128.4kJ / mole
(7.66)
For Reaction A,
600
H R0(600 K )
H R0(298)
C p dT
298
110.5
59.2 * 302
1000
393.51
86.28 * 302
(7.67)
1000
162.8kJ / mole
Let the outlet flue gas stream composition be as follows in mole fraction;
yCO = 0.2; yCO2 = 0.01; yO2 = 0.005; yN2 = 0.781
414
For a basis of 1 mole of CO formed x moles are formed by Reaction A from CO 2 and (1x) moles are formed from Reaction B from carbon. The heat balance from the heat generated
from Reaction B and heat absorbed by Reaction A can be written as follows;
162.8x (1-x) 128.4 = 0
x
128.4
162.8 128.4
(7.68)
(7.69)
0.44
The corresponding inlet stream ratio between CO2 and air can be calculated as;
Flue
0.44 * 0.2
Air 0.56 * 0.2 0.005
0.21
0.088
0.557
1
6.33
(7.70)
The flue to air ratio of 1:6.33 can be seen to be an important process parameter to control
in order to maintain the adiabatic reactor status. The ratio control block diagram is shown in
Figure 7.10. The set point of 1:6.33 is input into the comparator. The measured flow
velocities of CO2 stream and air streams are sent by flow transmitters to the comparator. The
control action is taken proportional to the error between the set point and measured ratio.
Ratio control can also be effected the flow stream velocity of CO 2 can be maintained at a
certain ratio of flow rate of air inlet stream. The flow rate ratio is calculated and this
information is sent to the comparator. In another strategy the flow rate of CO2 inlet stream is
measured and multiplied with a desired ratio in order to determine the set point for the air
stream flow rate. This provides a linear input-output relation. The measured output is;
Figure 7.10. Feedback Control of Ratio of CO2 to Air during Manufacture of Flue Gas.
Ratio
vair
vCO2
1
vair
vCO2
415
(7.71)
The steady state process can be seen to be;
kp
( Ratio)
u
1
vCO2
(7.72)
The process gain is a function of the flow rate of CO2 stream. For the air flow stream the
process gain would be 1.
7.4. NEURAL NETWORKS

7.4.1. Overview of Neural Networks
required precision. ANN, artificial neural network is used in control and in pattern
recognition and knowledge acquisition. The structure of an ANN consists of a number of
computing elements which resemble neurons and synapses of a human brain organized in a
network (McClelland, Rumelhart et al., [1986]. Presently most of the implementations of
neural networks are software based. Interconnections higher than 2 units may lead to higherorder or Sigma-Pi networks. A number of important architectures can be recognized.
These are;
i) Recurrent
ii) Feed-Forward and
iii) Layered.
A recurrent architecture contains directed loops. An architecture without directed loops is
said to be feed forward. Recurrent architectures are less simple. An architecture is layered if
the units are partitioned into classes also called layers, and the connectivity patterns are
defined between the classes. A feed forward architecture is not necessarily layered. The
number of layers is referred to as the depth of the network. In the back-propagation model the
network is processed in three distinct steps. The first step is the forward sweep. In the forward
sweep the input is given to the input units. The output values of each unit is calculated and
moved over the connections to the units in the next layer.
The units in the next layer receive the input from units in the previous layer. The output
values of the units are then calculated and passed to the units in the next layer and so on. The
next step is the error calculation. In this step the values of the output units are compared to
the desired output, teaching. If the difference between the actual output and the teaching is
within the acceptable error range, then learning is successful. If the difference is not within an
acceptable range then an error value is calculated and learning is unsuccessful. The third step
is the back-propagation of the error value. In this step, should the learning be unsuccessful
416
then the error value is propagated backward through the net. The weights of the connections
between the units are adjusted to minimize the error value. The main objective of this step is
to close the gap between the actual output and the desired output. The above three steps are
repeated until learning is successful. The behavior of each unit in time can be described using
either differential equations or discrete update equations. Typically a unit i receives a total
input Xi from the units connected to it and then produces an output, Yi f(xi) where f is the
transfer function of the unit. In general, all the units in the same layer have the same transfer
function, and the total input is a weighted sum of incoming outputs from the previous layer so
that,
Xi
Wij y j Wi
(7.73)
j N (i )
Yi
f ( xi )
f(
WijY j Wi )
(7.74)
j N (i )
Where Wi is called the bias or threshold of the unit. Wij and Wi are the parameters of the
NNs. Other parameters such as time constants, gains and delays are possible. Usually, the
total number of parameters is determined by the number of layers, the number of units per
layer and the connectivity between layers. It is said to be fully connected when each unit in
one layer is connected to every unit in the following layer.
A normalized exponential unit is used to compute the probability of an event with n
possible outcomes, such as classification into one of n possible classes. Let j run over a group
of n output units, computing the n membership probabilities, and xj denote the total input
provided by the rest of the NN into each output unit. Then the final activity yi of each output
unit is given by;
yi
xi
(7.75)
xk
e
k 1
n
yi
(7.76)
i 1
When n = 2, the normalized exponential is equivalent to a logistic function via a simple

transformation.
yi
e
e
x1
x1
x2
(7.77)
Any probability distribution Pi (1 j m) can be represented in normalized exponential

from a set of variables xj (1 j m):
Pi
417
xi
(7.78)
xk
k 1
As long as m n. This can be done in infinitely many ways, by fixing a positive constant
k and letting Xi = log(pi) + kj for i = 1, n. If m < n there is no exact solution, unless the pi
assume only m distinct values at most. The radial basis functions, RBFs, is another type of
widely used functions. Here f is a bell shaped function like Gaussian. Each RBF unit i has a
reference input xi and f operates in the distance d(xi, xi) measured with respect to some
metric yi = f(d). In spatial problem, d is usually the Euclidean distance. Thus some of the
important features of ANN model depend on the task at hand. The process of computing
approximate weights is called learning or training in the ANN paradigm. There are many
ANN learning algorithms that employ the principles described above. In general, ANN
learning algorithms are classified are classified by either the tasks to be achieved or the
methodologies to achieve a task:
a)
b)
c)
d)
Auto association
Classification
Heteroassociation
Regularity Detection. There are two classes of ANN learning algorithms; a)
Supervised and b) Unsupervised.
In supervised learning, a network is given an input along with its desired output. On the
other hand, a network in unsupervised learning is given only an input. After each presentation
of an input, the performance, is measured to tell how the network is doing. A network is
expected to self-organize information by using the performance measure as guidance.
Algorithms in these two categories are further divided into two groups on the basis of the
input formats; binary or continuous valued input.
7.4.2. Neural Modeling and Control of a Distillation Column

Steck et al. [1991] considered control of a 9 stage, three component distillation column.
The distillation column with control valves to the coolant to the condenser and steam flow to
the jacket of the reboiler and the reflux to the top of the distillation column is shown in Figure
7.11. Their control objectives were achieved using neural estimator and neural controller. The
neural estimator was trained to represent the chemical process as precisely as possible. The
neural controller was trained to provide input to the chemical process that will yield desired
output. The training of the two neural networks was accomplished using a recursive least
squares training algorithm implanted on an Intel iPSC/2 multicomputer (hypercube).
ANNs can be used for control purposes. Control of any process system depends on the
availability of suitable models that captures all the major phenomena of the system.
Mathematical modeling of all the subsystems of a distillation column is an arduous task.
Some of the theory such as the McCabe and Thiele method of design of distillation column is
discussed in Sharma (2012). 20 different distillation problem types are discussed. Each of the
418
distillation problem type offers a different problem in control. Mathematical model of a

distillation column can contain hundreds of state variables. The model equations tend to be
nonlinear. The range of operating conditions are wide. The dynamic response is slow. There
are significant lag times or dead times. Distillation columns are widely used. A suitable
control strategy is needed.
ANNs can be trained offline in order to model the nonlinear inverse dynamics of the
process with a pre determined level of accuracy. The input space can be large without a priori
knowledge of the system equations. The ANNs are made to learn the nonlinear inverse
dynamics during online applications.
The feed input to the distillation column in Figure 7.11 is at the fourth stage. A side
stream by-product is removed at the fifth stage. A heavy product is removed at the bottoms
and a light product at the holdup tank at the top. A kettle type reboiler with steam jacket is
used and a partial condenser is used. The control objective is to produce bottoms with a
specified composition and the distillate with a pre-determined composition. The feed rate and
feed composition gets disturbed a bit during the implantation of the process. The control
objectives can be met by regulating the heat load on the reboiler and partial condenser. A
mathematical model can be obtained by writing the mass and energy balance equations for
each of the 9 stages of the column, the reboiler and condenser. The partial condenser can be
treated as an extra stage. A computer program can be written that can be used to simulate the
operations of the distillation column. The program can be used to simulate hundreds of state
variables at discrete time intervals. Training pairs were generated from such simulation
results in [Steck et al. 1991] for training the neural controller.
A NN is trained as an estimator for the column. As part of the feed forward ANN
controller, a neural network is trained as an estimator for the column. The state variables of
the distillation column that were selected in the estimator are: flow rate; temperature and
compositions of the three components for the bottom and overhead products; and temperature
and three component compositions for the by-product as side stream. The data for the
estimator comprises of discrete data sampled once per minute. The input to the estimator
consists of the reboiler heat valve setting, condenser temperature, current feedrate, and the
limited state vector at two previous sample times. The estimator is trained to provide as
output a prediction of the limited state vector at the current time. The estimator is a fully
connected feed forward network with 31 linear input neurons, 14 linear output neurons, and
157 nonlinear sigmoid neurons distributed over two hidden layers.
Training data is generated by simulating the column during startup, from an initial state
to a steady operating state, and then varying the feed rate, reboiler heat value setting, and
condenser temperature setting sinusoidal about their startup settings. The feedrate is varied at
0.0125 cycle.min-1 with an amplitude of 2.0 moles/min about a mean of 25.0 moles/min. The
reboiler valve is varied at 0.0375 cycle.min-1 with an amplitude of 0.05 about a mean of 0.308
both as fractions of the full open position. The condenser temperature is varied at 0.025
cycle.min-1 with an amplitude of 2.0" C about a mean of 75.0" C. These sinusoidal variations
are continued for an additional 135 minutes after the 20 minute startup period giving a total of
155 sampled data training pairs for the network. Training was accomplished using a recursive
least squares (RLS) training algorithm implemented on an Intel iPSC/2 multicomputer
(hypercube) [Steck et al. 1991]. The training with the RLS algorithm is much faster when
compared to gradient descent. This is because of the parallel implementation and higher order
nature of the RLS training algorithm.
419
Figure 7.11. Control of Reboiler Heat Load, Condenser Heat Load, Reflux during Binary Distillation.
Another ANN was trained as a controller for the distillation column. The data for the
controller consists of discrete data sampled once per minute, the same sampling rate as the
estimator data. The input to the controller consists of the desired compositions of the light
component of the bottoms and the heavy component at the overhead tank (the controller
reference inputs), the feedrate, and the limited state vector at two previous sample times. The
mass fractions of the two components used as reference inputs are generally desired to be
small as the goal of the distillation process is to concentrate the heavy component at the
bottom and the light component at the top. The controller output consists of a reboiler heat
valve setting and condenser temperature at which the distillation column should give the
specified reference input compositions. The controller is also a fully connected feed forward
network having 31 linear input neurons, 2 linear output neurons, and 157 nonlinear sigmoid
neurons distributed over two hidden layers.
Training data for the controller is generated by rearranging the data used to train the
estimator. The estimator inputs are the reboiler heat valve setting, condenser temperature,
feedrate, and the state vector at the two previous sample times and that the training output
420
data is the state vector at the current time. The controller is trained by taking as input the two
desired composition values from the state vector at the current time, the current feedrate, and
the two delayed samples of the state vector. The controller is trained to give as output the
reboiler valve setting and condenser temperature which will produce the state vector at the
current time. Training is again accomplished using the RLS training algorithm on the Intel
iPSC/2 multicomputer.
In order to investigate the capability of the trained controller to control the distillation
column, the neural controller is connected to the neural estimator. The controller outputs, the
reboiler valve setting and the condenser temperature, are connected to the inputs of the
estimator by neural connections with unity weights. The state vector at two previous sample
times are provided to the estimator and controller networks by feedback delay lines from the
output of the estimator. The state vector for two sample periods prior to the beginning of the
simulation is provided as known initial conditions. The current feedrate and the desired
compositions at the bottom and top (the controller reference inputs) are known and specified
at each simulation sample time.
The heavy component (Xl) at the condenser can be manipulated by the controller and is
moderately successful at controlling the light component at the bottom product. The moderate
success is most likely due to the fact that the light component at the bottom is very small even
without control and varies only by a small amount with the changes in reboiler heat used to
train the estimator and controller.
7.5. SPC, STATISTICAL PROCESS CONTROL

7.5.1. Overview- Deming and 10. Step Process for Quality Improvement
The emergence of Toyota motor corp. as the largest producer of automobiles by sales and
by production surpassing the General Motors, corp., is seen as a vindication of the emphasis
placed on product quality. One of the fruits of labor from Demings principles [2000] is the
SPC, statistical process control methods. Those who have worked with SPC have found the
benefits from it as substantial and always in the positive quadrant. With more than 30 million
cars sold the corolla brand is one of the more popular and bestselling unit. The reasons
attributed to this success are fewer customer complaints, higher quality in terms of fuel
efficiency, reliability, warranty etc. The 10 step process of Quality management include: (i)
identify a broad area of improvement; (ii) survey the customers; (iii) form QIT, quality
improvement team; (iv) Develop cause and effect relations from results of surveys (fish-bone
diagrams); (v) develop action plan based on causes identified; (vi) settle for process measures
and see whether SPC is applicable; (vii) Continue cycle of Plan-Do-Check; (viii) Continuous
Improvement Strategy; (ix) Quality Audit and Documentation; (x) Certification and
Management Review.
Demings 14 points for management include;
Point 1: Create a constancy of purpose in order to improve quality and service, to become
competitive and to stay in business.
Point 2: Adopt the new philosophy.
421
Point 3: Create dependence on mass inspection.

Point 4: End the practice of awarding business on the basis of price tag alone.
Point 5: Constantly and forever improve the system of production and service.
SPC, statistical process control refers to a set of methods and techniques of monitoring
and control of a process so that the process is operated close to design premises. SPC is
different from APC, automatic process control. The feedback and feed forward control
methods discussed in earlier sections provide for correction of the deviation from set point on
an as happened basis. No analysis goes into what caused the disturbance. So should there be a
source for disturbances the deviation from set point and corrective control action would
happen again and again. This would put a strain on the tuning controller elements due to
hysteresis effects. In SPC control, the cause and effect analysis would lead to knowledge of
source of disturbance among other things. Action on removal of the source of disturbance
would result in decreased load on the control elements as compared with APC. Further in
SPC, only statistically significant deviation are agreed upon as deviation. In APC what could
be noise either random white or even biased ones can trigger corrective action. As with any
device repeated use can lead to repair. The long term effect of SPC results in better product
quality. The APC method suffers from the quality improvement by changes made upon
infrequent and ad hoc inspection method. A more careful study is undertaken in the SPC
method.
7.5.2. Example of Application of SPC Fluidization Quality Analyzer

Here is an example of an application of SPC.
Fluidization Quality Analyzer [Daw and Hawk, 1995]. The pressure drop in a gas-solid
fluidized beds as a function of time is measured. From theory, the pressure drop during
fluidization is expected to stay a constant. Experimental measurements indicate the pressure
drop in a fluidized bed varies with time. Distinct patterns can be seen from the variation of
pressure fluctuations with time [Sharma and Turton, 1998, Sharma, 1998, Renganathan
1990].
The pressure signals can be converted to a frequency domain by use of a FFT, Fast
Fourier Transform analysis (Sharma [1998]). Time series analysis such an ACF,
autocorrelation function, CCF., cross-correlation function can be deployed to study the
hydrodynamic regimes of fluidization. The dominant frequency of slugging beds were found
to be lower and distinct such as 2 Hz for a 5 cm bed. For a bubbling bed the dominant
frequency of FFT of P measurements were found to be significantly higher than that of
that found for slugging beds. Those skilled in the art of fluidization generally agree with the
following regimes during gas-solid fluidization:
(i) Minimum fluidization regime
(ii) Bubbling Bed
(iii) Slugging Bed
(iv) Turbulent Bed
(v) Phase Inversion and Solid Packets at Dispersed Systems
422

(vi) Elutriating Beds
The hydrodynamics of fluidization depends on the particle size and particle size
distribution and other characteristics of the powder fluidized. Geldart [1973] has classified the
powders according to the quality of fluidization that can be realized. The characteristics of
fluidization of Geldart A type powder include a maximum stable bubble size, distinct regimes
of minimum fluidization with bed expansion and bubbling regime. The characteristics of
Geldart D type powder is for coarse particle systems where onset of bubbling begins upon
fluidization. The bubbles grow and coalesce into slugs. Geldart B type powder characteristics
have been found to be between that of Geldart A and Geldart D type powders. Geldart C type
powders do not fluidize well. The particles adhere to each other. Jetting or gas by-passing is
found.
At fluidization velocities near the minimum fluidization velocity, U mf the mixing of
solids achieved is insufficient to prevent agglomeration. This limits the mass transfer rates.
During the slugging regimes the gas by-passes contact with the solid particles resulting in
decreased process efficiency. The most efficient contacting condition is that which produces
significant agitation in order to prevent solids clumping while minimizing the degree of bypassing. The fluidization quality can be related to the intensity of flow oscillations and degree
of gas-solids mixing.
A control loop based on P, fluctuations in pressure drop in fluidized beds,
measurements with a control valve on the flow rate of the fluidizing gas is shown in Figure
7.12. This was patented by Daw and Hawk [1995]. The P of the fluidized bed is measured
using a PT, pressure transducer installed near the distributor plate of the fluidized bed. A
signal conditioned circuit was introduced in order to obtain the derivative of signal. During
severe slugging regime of fluidization (Bi and Grace [1995]) larger, faster pressure
fluctuations compared with slightly slugging conditions can be found. The rate of pressure
fluctuations was averaged in order to produce a fluidization intensity signal. Thus P
measurements can be directly correlated with fluidization quality. The signal conditioning
proposed in [Daw and Hawk, 1995] was based on chaotic time series analyses and in an
advance over Fourier analysis methods. During some conditions of fluidization the P
signals have been found to be non-periodic [Daw and Hawk, 1995]. Sharma [1998] by use of
saddle point analysis in probability density functions of P, measurements for the
experimental conditions used in the study found the P measurements in fluidized beds to
be periodic.
The control loop in Figure 7.12 can be used to control the degree of turbulence or
fluidization quality in a fluidized bed. Daw and Hawk [1995] interpreted the P
measurements as a function of time as comprising of turbulence induced time-varying
component that can be associated with the bubble activity within the fluidized bed. Signal
processing to separate the turbulence-induced time-varying component associated with
bubble activity in the bed was introduced. The output signal display in the indicator of bubble
activity within the fluidized bed. The signal processing circuitry includes obtaining the first
derivative of pressure signal, operation amplifier, low pass filter and rectifier. The control
action is effected by use of optimal flow rate of fluidizing gas.
423
Figure 7.12. Control Loop for Fluidization Quality Analyzer.
One of the goals of SPC is to minimize production costs. This is accomplished with a
make it right the first time program. Attainment of product consistency and compliance
with product specifications and achievement of customer satisfaction are the goals of the
SPC. They tend to create opportunities for all members of the organization to contribute
towards quality improvement. They help both management and employees make
economically sound decisions about actions affecting the process (Smith, [1998]).
The basic tools for SPC include: (a) Flowchart; (b) Pareto Chart; (c) Check sheet; (d)
Cause and Effect Diagram to identify the root cause of the problem; (e) Histogram; (f)
Control Chart and; (g) Scatter Plot; (h) Factorial Design of Experiments. SPC is an important
tool and leads to many process improvements and positive results such as;
uniformity of output
reduced rework
fewer defective products
increased output
lower average cost
fewer errors
higher quality output
less scrap
less machine downtime
less waste in production labor hours
increased job satisfaction
improved competitive position
more jobs
424
7.5.3. Control Charts

Process control charts are used to achieve and maintain statistical control at each phase of
the process. Process control charts are used in process capability studies to assess process
capability in relation to product specifications and customer demands. Statistical sampling is
part of a self-certification plan for vendors. The capability studies are gauged.
Control charts are used in manufacturing units to delineate random noise and variability
in process variables that can have Attributable causes. No control action is needed when the
variation is due to random noise. Control action can be initiated when the Attributable cause
is identified. When the variability is due to random noise it is also referred to as stable system
of chance causes. Other kinds of variability can also be classified (Bi and Grace, [1995)] into
four categories:
(i) improper setting of machines;
(ii) operator incompetence and errors;
(iii) defects in raw materials, water supply and;
(iv) utility malfunction.
The variability is larger compared with random noise. These sources of variability are
called as assignable causes.
A process that is operating in the presence of assignable causes is said to be out of
control. One of the goals of SPC is the elimination of batch to batch variability in product
quality. A prototypical control chart is shown in Figure 7.13. The control chart can be treated
as a graphical display of quality characteristics as a function of time. The samples are
measured at a certain predetermined frequency, i.e., once every hour. The data points in
Figure 7.13 corresponds to a process in control state. The UCL and LCL are upper control
limit and lower control limit. These limits can be obtained given a certain set of objectives
and characteristics of the statistical distribution that best corresponds with the raw data from
the measurements. Sometimes even if the all the points lie within the UCL and LCL some
biases can be detected. This is for example, when 15 out of 18 points measured lie above the
center line. This would be indicative of a systematic error. Only random scatter can be
concluded as in-control state. In Figure 7.13 is also shown a normal distribution. Often times,
the LCL and UCL are calculated as shown in the Figure 7.13.
Let the UCL and LCL be at a distance km from the mean value of the measurements,
m. m is the square root of the variance of the statistical distribution the measurements
conform to. It is also called the standard deviation. Sometimes Bessels correction can be
used to calculate the sample standard deviation. Here (N-1) is used compared with N, where
N is the number of data points in the sample.
UCL = m + km
(7.79)
Center Line, CL = m
(7.80)
LCL = m k m
(7.81)
425
Figure 7.13. Prototypical Control Chart.
The units of k is in terms of standard deviation units. When k = 3, industrial practioners

call it 3 sigma quality. When k = 6, industrial practioners call it 6 sigma quality. The inventor
of control charts was Shewhart. These types of charts are also called as Shewhart control
charts.
The central limit theorem can be invoked for the sample means to conform to a normal
distribution. Let the confidence level be given by 100(1-)%. Then, 100(1-)% of the sample
means can be expected to fall in the interval of;
_
LCL
/2
/2
UCL
(7.82)
Where x is the sample mean.

Two of the parameters that determine the characteristics of the statistical distribution that
the population of measurements the samples belong to are the sample mean and the sample
standard deviation. The sample standard deviation can be used to estimate the degree of
scatter in the information. Two charts may be generated an M, chart or chart that contains the
sample means as a function of time. The second chart is an S chart that contains the sample
standard deviations as a function of time. The UCL and LCL values as given by Eq. (8.13)
can be calculated as long as the population variance, and mean, m is known. When the
parameters m and are not known then they can be calculated using m preliminary samples.
The population mean can be estimated by use of a grand mean;
426
1 m _
xi
mi 1
(7.83)
The UCL and LCL of the means of the samples lie in a range that can be expressed as;
_
UCL
DU q
_
CL
(7.84)
q
_
LCL
DL q
Where, q is the range of sample means. The constants DU and DL varies with the sample
size, n and is given below in Table 8.1. The range the sample means can fall under can be
estimated as follows;
_
q
R
(7.85)
A random variable is introduced. This is given by the ratio of the range of means with
the standard deviation of the population. The statistical distribution that conforms to for any
sample size n has been determined. The mean of this distribution is say m and the standard
deviation is say,. These values are given in Table 8.1. The UCL and LCL for the sample
mean can be seen to be;
UCL
LCL
(7.86)
q
q is the average range. A range can be attributed to each sample.

On some occasions, the sample variances can be plotted in an S chart. The standard
deviation of the population, , can be estimated from sample variance, s. The LCL and UCL
for the S chart can be seen to be;
LCL c '
1 c' 2
CL c '
c'
1 c' 2
UCL
(7.87)
427

Table 7.2. Factors for Determining UCL and LCL of Sample Means and Sample
Variance Charts
_
x chart
3
m
2
4
6
8
10
12
14
16
18
20
22
24
x chart
m
R chart
DL
R Chart
DU
S Chart
c
1.13
2.06
2.53
2.85
3.08
3.26
3.41
3.53
3.64
3.74
3.82
3.90
0
0
0
0.136
0.223
0.28
0.33
0.364
0.392
0.414
0.43
0.45
3.27
2.28
2.0
1.86
1.78
1.72
1.67
1.64
1.61
1.59
1.57
1.55
0.80
0.92
0.95
0.97
0.97
0.98
0.98
0.98
0.98
0.99
0.99
0.99
1.13
0.729
0.483
0.373
0.308
0.266
0.235
0.212
0.194
0.180
0.167
0.157
The estimator of from S chart can be given by;

_
^
s
c'
(7.88)
The control chart for sample variances can be whipped up as follows;

_
UCL
s
s 3
1 c' 2
c'
CL
s 3
s
c
'
1 c' 2
(7.89)
c values for difference sample sizes are given in Table 7.1.
7.6. FEEDFORWARD CONTROL

Feed forward control is different from feedback control. During feed forward control the
load or disturbance is measured or gauged from other considerations and control action taken
accordingly. This is different from feedback control when the process output is measured and
the measurement is compared with the set point. The error generated is used in the control
action taken. Feed forward control can be recognized in human physiological and anatomical
systems. Feed forward control can be used in conjunction with feedback control.
428
Carrier Corporation has patented [Kolk et al., 2011] a feed forward control system for
absorption chillers. Absorption chillers are different from mechanical vapor compression
chillers. Thermochemical processes are used in order to produce refrigeration needed to
generate chilled water. Lithium bromide and water are used as fluid pair. In order to generate,
for example 44 F of chilled water the shell side of the machine has to be maintained in
vacuum such that the water boils at 40 F. The vaporized refrigerant is absorbed by the
Lithium bromide solution prior to being pumped into the generator section of the machine
where heat is added to concentrate the solution. The boiled off water vapor is then condensed
and returned to the evaporator as liquid.
Disturbances to the chilled water temperature can arise from cooling water temperature
and the entering chilled water temperature. The feed forward control method comprise of the
following steps; (i) determine the disturbance transfer function; (ii) determine the capacity
valve transfer function; (iii) measure the occurred disturbance; (iv) implement the feed
forward control function.
The control block diagram for feed forward control in combination with the control
action such as PI control that was in place before for chilled absorber is shown in Figure 7.13.
The feed forward control action law can be written as;
UD
D
GD ( s)
Gu ( s)
(7.90.)
Y is the exit chilled water temperature, U is the capacity valve position and D is the
disturbance in wither the entering chilled water temperature or entering cooling water
temperature. Change in chilled water temperature can be expressed as;
Gu (s) GD (s) D
Gu ( s )
Gu ( s )
Gu ( s ) U
Gu ( s ) U
UD
(7.91)
GD ( s ) D
GD ( s)
D
GU ( s )
GD ( s) D
(7.92)
GD ( s ) D GD ( s ) D
As shown in Figure 7.14, the feed forward control strategy in a nutshell comprises of: (i)
computing the transfer functions GD(s) and Gu(s); (ii) measuring the disturbance signal D;
(iii) implement the feed forward control as shown in Figure 7.13. GD(t) and Gu(t) are
measured by application of a prescribed a known amplitude input perturbation and by
recording the perturbation in the exit chilled water temperature. The ratio of the perturbation
in exit chilled water temperature divided by perturbation of change in the disturbance is
reflected in GD(t). The ratio of the perturbation of exit chilled water temperature divided by
the perturbation in the capacity valve is captured in Gu(t). The entering cooling water
temperature is around 70- 80 F. Fans in the cooling tower are used to maintain this
temperature.
429
Figure 7.14. Block Diagram for Feed forward Control of Absorption Chillers.
Another example of the use of the feed forward controller is in fuel supply control to a
furnace as shown in Figure 7.14. The control strategy shown in Figure 7.14 is different from
the feedback control strategy explained in Chapter 4.0. In the feedback control strategy the
furnace temperature is measured. When found deviant from the set point temperature control
action is taken such as P only control, PI only control, PD control etc. In feed forward control
strategy the disturbance is attempted to be measured. One possible source for disturbance in
the furnace example is the air flow rate to the furnace. The air gets heated and pumped to the
room. Feed forward controller is used to regulate the supply of fuel to the furnace.
Figure 7.15. Feed forward Control of Fuel Supply to Furnace.
430
One of the advantages of the feed forward control strategy is the control action is based
on gauging the disturbance as it occurs. But one of the drawbacks is that the control action
performance depends on the availability of reliable mathematical models. For example in the
example, shown in Figure 7.14 a mathematical model that relates the temperature of the
furnace, flow rate of air and fuel gas rate needed for achieving a given set point is needed.
The less uncertain the model predictions are the better the performance of the control action
taken is.
Energy balance on the furnace at steady state can be written as follows;
H c.
vC p T i T f
.
Where
fg
.
fg
(7.93)
is the fuel rate and Hc is the heat of combustion of the fuel gas, is the fuel
conversion efficiency from chemical energy to thermal energy.

.
C p v Ti
H
Tf
(7.94)
It can be seen from Eq. (8.66) that a certain percentage change in temperature of the
furnace will have to be compensated by the same percentage change in the fuel flow rate to
the furnace.
7.7. MEASUREMENT AND CONTROL OF BIOCHEMICAL REACTIONS

The optimal operation of reactors in the biotechnology industry depends on the catalyst
environment. The catalyst environment influences the useful lifetime of an enzyme catalyst of
cell population. The state of the catalyst environment need be monitored and control schemes
developed according to the observations against set points. There are three important steps
towards achieving this goal; (i) Measurement; (ii) Analysis of Measurement Data and; (iii)
Control. Advances have been made in the available reactor instrumentation, data acquisition
and computer control areas. These methods can also be used on downstream processing
operations and preparation of raw materials. Some of the quantities that can be measured and
instruments available for biological systems are as follows [Stephanopoulos et al. 1985];
Torsional Dynamometer
Gene Expression Levels
Piezoelectric Sensors
Tachometer
Electromagnetic Flow Meter
Additive Drop Count
Diaphragm Pressure Gauge
Glass Electrode
Shaft Power from power supply

Biochips
Internal Force, Moment Realized
Tip Speed, Shear Rate, Agitator Speed in RPM
Liquid Flow Rate
Flow Rate of Additive
Pressure
pH
431
Combined Platinum and

Reference Electrode
Sterilized Electrode
Thermometer, Thermistor,
Thermocouple
Load Cell for Level Control
Rota meter, Mass flowmeter
Paramagnetic Electrochemical
Cell
IR Analyzer
Spectrophotometer
Sensors
Viscometer
Redox
Dissolved Oxygen
Temperature
Product Removal
Gas Flow rate
Partial Pressure of Oxygen, pO2
Partial Pressure of Carbon Dioxide, pCO2
Turbidity, Biomass Measurement
for Glucose, Ethanol, DNA, RNA, NADH
Ions of ammonium, magnesium, potassium,
sodium, copper, phosphate
Viscosity
Muscle strength can be measured using dynamometers. Handgrip strength is a measure of

sarcopenia. Handgrip strength can be measured using dynamometers. The input shaft power
that is used for agitating bioreactors can be measured using torsion dynamometer.
Dynamometer is a device used to measure power. Power, torque and speed can be used to
characterize the mechanical aspects of rotating machinery. These quantities needs to be
measured in order to determine the efficiency of the agitator and identify operating regimes
that are safe.
7.8. DESIGN AND CONTROL OF BIOARTIFICIAL PANCREAS

Nomura (5) used control theory to characterize the insulin release rate. He studies a step
change in glucose concentration. The dynamics of glucose induced secretion of insulin can be
expressed as the sum of the proportional response to the step change and a derivative
response to the rate of change in the glucose concentration. Each of them have a first order
lag time. The Laplace transform of the islet insulin release rate can be expressed as follows:
risl
K prop
1 s
_
Tder
C glu cos e
1 s 2
(7.95)
The lag times are 1 and 2 respectively. The Laplace domain expression in Eq. (8.1) can
be inverted to give;
t
risl
K prop Cglu cos e

1
t z
dz
dCglu cos e
dz
t z
dz
(7.96)
432
The lag times can be obtained by use of nonlinear regression of islet release-rate
experimental data. The ramp function of glucose concentration is written as follows;
0
Cglu
cos e for t < 0.
Cglu cos e
Cglu cos e
Where m
ss
Cglu
cos e
(7.97).
mt for 0 t t0
0
Cglu
cos e
(7.98)
0
Cglu
cos e
t0
ss
Cglu
cos e for t t0
Cglu cos e
(7.99)
Eqs. (8.3-8.5) can be substituted into Eq. (8.2) and integrated to yield;
risl
0
K prop Cglu
cos e e
K prop 1m
1 e
t
0
K propC glu
cos e
1 e
(7.100)
Tder m(1 e
)
for 0 t t0
t
risl
0
K prop Cglu
cos e e
K prop 1m (
(7.101)
t t0
t0
1)e
t t0
0
K propC glu
cos e e
1
t t0
ss
K prop Cglu
cos e
1 e
t t0
Tder m(e
for t t0
(7.102)
The insulin release rate from an islet and its dependence on plasma glucose levels needs
to be better understood. This is needed for better design of bio artificial pancreas. A step
change in glucose concentration is given to islets that have been isolated from a pancreas of
mammals. The islet viability and glucose responsiveness are studied from the F curve. Insulin
release have been found to be biphasic.
Pharmacokinetic models have been developed to describe glucose and insulin
metabolism. A model was proposed by Sturis et al. (6) to predict the oscillations of insulin
and glucose concentrations with time observed experimentally. Insulin formed in human
anatomy have been found to exhibit two kinds of oscillations: i) a rapid oscillation with a
time period of 10-15 minutes and small amplitude; ii) longer or ultradian, damped oscillations
433
with a period of 100-150 min and larger amplitude. Compartment model was proposed by
Sturis et al. to describe glucose and insulin interactions Sturis et al. [1984].
4 negative feedback loops form their model involving glucose and insulin interactions: i)
insulin formation is triggered when glucose levels become more than tolerable limit; ii)
increase in insulin level increases the utilization of glucose and hence reduces the glucose
levels; iii) rise in glucose level inhibits production of glucose; iv) increase in glucose levels
stimulates its utilization. The glucose and insulin never reach stable equilibrium. The model
includes two time delays that are critical in describing the observed oscillatory dynamics. The
suppression of glucose levels by insulin production is captured by one time delay and the
correlation of biological action of insulin with insulin concentration is captured by another
time delay in interstitial compartment. Six differential equations describe the system. The
plasma
plasma
variables are Cglu
cos e , concentration of glucose in plasma, Cinsulin , concentration of insulin
int erstitial
in the plasma, Cinsulin
, concentration of insulin in the interstitial fluid. Three additional
variables used to describe the insulin and glucose system are the delay between the plasma
insulin level and its effect on glucose production x1, x2, x3 and time lag, delay. The 6
differential equations can be written as follows:
V plasma
plasma
dCinsulin
dt
plasma
risl Cglu
cos e
V plasmaG
dt
int erstitial
Cinsulin
plasma
Cinsulin
V plasma
(7.103)
plasma
int erstitial
dCinsulin
dt
plasma
dCglu
cos e
plasma
k E Cinsulin
plasma
int erstitial
Cinsulin
Cinsulin
Vint erstitial
kE
plasma
f 2Cglu
cos e
rglu cos e(in)
dx1
dt
int erstitial
Cinsulin
plasma int erstitial

f3 f4Cglu
cos e Cinsulin
plasma
Cinsulin
Vint erstitial
(7.104)
int erstial
x1
x3 f5
(7.105)
(7.106)
delay
dx2
dt
dx3
dt
x1
x2
(7.107)
delay
x2
x3
(7.108)
delay
The volumes of the insulin plasma compartment, insulin interstitial fluid compartment
and glucose plasma compartments are denoted by Vplasma, Vinterstitial and VplasmaG respectively.
The kE is the rate constant that is used to describe the insulin transport rate into the interstitial
fluid compartment. The first order degradation time constants for insulin in plasma
434
compartment, insulin in interstitial fluid compartments are given by plasma,interstitial

respectively. Utilization functions are given by f. The subscripts 2 and 3 are used to denote
the glucose utilization function through the glucose plasma compartment. The 4 subscript is
used for dependence on interstitial insulin concentration. The glucose inhibition on account of
insulin formation is given by subscript 5.
The above pharmacokinetic model developed by Sturis et al. (6), can be combined with
an insulin-release model to monitor the glucose control that is achievable using bio artificial
pancreas. There are two types of tests used: i) IVGTT, intravenous glucose tolerance test and;
ii) OGTT, oral administration of glucose tolerance test. The initial conditions for IVGTT or
OGTT can be selected based on the fasting levels of the patient.
7.9. MODELING AND CONTROL OF APFR, ANNULAR PLUG FLOW

REACTOR FOR PRODDUCTION OF SINGLE LAYER GRAPHENE
Graphene can be made into thin films or thick films. Thin films of graphene can be made
on flexible substrates. Other thin films such as Nickel needs rigid substrate. Graphene made
by CVD, chemical vapor deposition methods can be rolled into thin films by a transfer
process. The process [11] comprises of three steps: (i) Adhesion of polymer supports to the
graphene on copper foil. Two rollers are used to get the graphene film grown on a copper foil
to be attached to a polymer film coated with adhesive film as it passes through; b; (ii) Etching
of copper layers. Electrochemical reaction with aqueous 0.1 M ammonium persulphate
solution (NH4)2S2O8 enables the removal of copper layers and; (iii) Release of the graphene
layer onto a target substrate. Thermal treatment is used to detach the graphene from the
polymer support and reattach the film onto a target substrate. This target substrate could have
been placed below the copper foil in order to obviate the third step.
7.9.1. Adhesion, Etching and Transfer

Graphene is synthesized in an annular plug flow reactor, APFR. The annular reactor
space is generated by an 8 inch outer quartz tube and an inner 7.5 inch copper foil, wrapped
quart tube. The use of annular reactor in place of the tubular reactor is to minimize radial
temperature gradients. This was found to cause inhomogeneity in the film formation. The
inner tube is heated to 1000 0 C. Hydrogen, H2 is allowed to flow at 8 s.c.c.m and 90 mtorr.
Annealing process comes next. Annealment for 30 minutes allows for increase in grain sized
in copper foil from a few micron to 100 microns. This has been found to increase the
graphene growth. Methane, CH4 is allowed to mix with the flowing hydrogen at a flow rate of
24 s.c.c.m at 460 m torr. The sample is rapidly cooled at about 10 0C.s-1. The graphene film
grown on copper foil is attached to a thermal release tape by applying pressure on the rollers
at 0.2 MPa. Copper foil is etched in a plastic bath filled with etchant. The etched film is
washed with deionized water to remove and unused etchant. The graphene film is ready for
transfer to a target substrate such as a curved surface. 150- 200 mm.min-1 transfer rates by
thermal treatment can be achieved by letting the graphene film pass through the rollers at
mild heat of 90-120 0C. Multilayered graphene can be made by repetition of this process. The
435
product that comes as a result of this would be different from the bilayer or multilayer
material formed during the reaction by other methods. This can be viewed as physical
stacking of the formed graphene layers. Screen printing can be used to generate 4 wire touch
panels.
Continuous production of graphene on large scale is possible. Scalability of the process is
high. Processability is good. Carbon has limited solubility in Copper even at 1000 0C. The
copper may have a catalytic effect on the graphene formation reaction. Transparent electrodes
can be made using graphene in large scale and replace the currently used indium tin oxide,
ITO, electrodes. Monolayer graphene was confirmed using Raman spectra. Bilayer and
multilayer islands were found from atomic force microscope, AFM and transmission electron
microscope, TEM. Stacked layers reduces the optical transmittance by 2.2-2.3% a layer and
the conductivity also decreases. Dopants can be added as desired. p junction formation by
doping can be achieved by addition of nitric acid, HNO3. Sheet resistance can be increased by
chemical doping. Poly methyl methacrylate, PMMA can be used as polymer supports. Some
of the challenges in using this method is the formation of polycrystalline graphene due to
occurrence of nucleation again to form a second layer. Oxidation of copper has to be avoided.
High rates of evaporation of copper from the foil can hinder graphene growth. Copper is not
as effective as Ni, nickel to lower the energy barrier to form graphene.
Other carbon sources in addition to methane that can be used for the purpose of preparing
graphene are carbon monoxide, CO, ethane, C2H6, ethylene, C2H4, ethanol, C6H5OH,
acetylene, C2H2, propane, C3H8, butane, C4H10, butadiene, C4H6, pentane, C5H12, pentene,
C5H10, cyclopentadiene, C5H6, hexane, C6H14, cyclohexane, C6H12, benzene, C6H6, toluene,
C7H8, iso-butane, iso-pentane and hexene. Mixtures of these sources may also be used.
Carbon formation from carbon sources are thermodynamically favored only at high
temperatures. The temperature that can be used in the reactor is 300 2000 0C. The flow rate
range can be 5 1000 s.c.c m (standard cubic centimeters per minute). Inert gases can prevent
undesirable oxidation. Reynolds number in the reactor is in the regime where laminar flow
can be assumed. The reactor is operated at low pressure. This would enable the entire vapor
and solid system to fall near the sublimation curve of the P-T, pressure-temperature diagram
of reactants and products.
7.9.2. Reactor Performance

Horizontal low pressure chemical vapor deposition reactor, LPCVD is discussed in
Fogler [12]. The reactor is operated at 100 Pa. The APFR discussed in the above paragraph
(Figure 7.16) is operated at about 60 Pa. One of the advantages of using LPCVD is the
capability of large number of wafers without sacrifice to film uniformity. At low pressures,
the diffusion coefficient is expected to increase. Sometimes Knudsen diffusion effects cannot
be ignored. The surface reactions are expected to be rate limiting compared with other mass
transfer effects. Assume the reaction mechanism for the formation of graphene on copper foil
in the APFR above is as follows;
Dissociation
2CH4 C2H2 + 3H2
(7.109)
436

1000 0 C
Adsorption
C2H2 + 2Cu 2Cu.C + H2
(7.110)
Cu.C Cu + C
(7.111)
Surface Reaction
Given the monolayer formation of graphene, the Langmuir-Hinshelwood kinetics may be

a reasonable assumption for the adsorption kinetics. At high temperatures such as 1000 0 C
the dissociation rate can be expected to be rapid. Adsorption is a surface phenomenon.
Molecules adsorb on the surface. Other molecules in the interior of the solid substrate are
attracted by other surrounding molecules in all directions. The molecules that reside in the
surface are in a state of imbalance and are pulled inward. The dissociated products from
methane will interact with the molecules in the surface. The amount adsorbed would be
proportional to the surface area available for adsorption. The Langmuir isotherm can be
derived as follows [13];
[filled sites] + [empty sites] [filled sites]
(7.112)
Sites are subject to chemical equilibrium;

[bulk solute] + [empty site] [filled site]
K = K '
[ filled _ sites]
[ filled _ sites]
[bul _ solute][empty _ site]
K '[bulk _ solute]
[total _ sites]
1 K '[bulk _ solute]
Figure 7.16. APFR, Annular Plug Flow Reactor for Dissociation of Methane and Formation of
Graphene Deposition on Copper Foil.
(7.113)
(7.114)
(7.115)
437

The rate of adsorption can be written as follows;
Rate of adsorption r =
k0 pC2 H 2
(7.116)
1 K ' pC2 H 2
k0 is a measure of total concentration of sites available. Eq. (8) is an alternate form of

Langmuir isotherm. The reciprocal of the rate of adsorption varies in a linear manner with the
reciprocal of the partial pressure of acetylene. The equilibrium rate constant and the total
concentration of the sites can be obtained from the slope and intercept of the straight line.
Acetylene decomposition can become autocatalytic [14]. It is a free radical process. Free
radicals can combine with the copper metal and become inert. This may keep the reaction
from becoming a thermal autocatalytic runaway. The axial flow in the annulus can be
assumed to be in laminar flow. This is from the Reynolds number estimated for APFR of less
than 50. As the reactant gas flows through the annulus simultaneous reaction and diffusion
can be expected. The dissociated products diffuse to the surface of the copper foil and get
adsorbed. At high temperatures the surface reactions of carbide formation and graphene
formation are found. Diffusion direction is radially inward. The cross-sectional area of the
annulus is given by;
Ac = 0.25 (Dt2 Dc2)
(7.117)
Where Dt and Dc are the diameters of the outer tube made out of quartz and inner quartz
tube wrapped with copper foil. With the progress of CVD the mole fraction of acetylene in
the annulus decreases as the reactant flows down the length of the annulus. An effectiveness
factor can be calculated to determine the overall rate of reaction per unit volume of the reactor
space. The reactants diffuse radially inward toward the copper foil. Graphene deposits grow
on the copper foil by the surface reaction given by Eq. (3). Concentration of the acetylene in
the surface of the copper is less than the concentration of acetylene in the bulk. The
effectiveness factor is defined as;
rate _ of _ reaction(actual )
(7.118)
rate _ of _ reaction(if _ entire _ foil _ is _ at _ sup plied _ concentration)
Dc [ r "]dD
Dc2
r "AA
DC2 H 2
Dc
CC2 H 2
r
r "AA
D Dc
(7.119)
Consider a cylindrical shell of length L and thickness r from a distance r from the center
of the APFR. The acetylene formed from dissociation of methane undergoes simultaneous
diffusion and reaction at the copper surface of the inner tube. The copper carbide becomes
graphene upon further reaction. A mass balance on a cylindrical shell of thickness on the
438
dissociated acetylene that undergoes simultaneous diffusion and reaction to the surface of the
quartz inner tube can be written as follows;
1 rJ r CC2 H 2
k "'CC2 H 2 0
r r
t
(7.120)
The boundary conditions used are as follows;

At the center of the reactor the concentration profile has to be symmetric in the annular
space. There is no reason for asymmetry. Hence at r = 0,
C C
H2
(7.121)
At the quartz wall of the outer cylinder, the wall is impervious

r = R,
C C
H2
(7.122)
The governing equation for the concentration profile that varies with space and time can
be obtained by combining Eq. (7.120) with the damped wave diffusion and relaxation
equation given in Eq. (7.123);
J r DC2 H 2
C C2 H 2
r
J r
t
(7.123)
The governing equation for concentration of acetylene species can be seen to be;
2 C C2 H 2
t
1 k " ' r
C C2 H 2
t
DC2 H 2
2 C C2 H 2
r
DC2 H 2 C C2 H 2
r
k" ' C (7.124)
The dimensionless form of Eq. (7.124) can be obtained by defining the following nondimensionalizing variables;
CC H C s
u 2 r
Cs
t
; ; X
r
DC 2 H 2 r
; k * (k " ' r )
(7.125)
The dimensionless governing equation is as follows;
2u
u 2 u
1 u
k
*
k *u
2
2
X
X X
(7.126)
439
The solution is obtained by the method of separation of variables. First the damping term
is removed by multiplying the above equation by e n. It can be seen that the terms group as W
= uen and the governing equation becomes at n = (1-k*)/2;
2W
2W 1 W
2 W
k
*
16 X 2 X X
2
(7.127)
The method of separation of variables can be used in order to obtain the analytical
solution to Eq. (7.127).
W = V() (X)
Let
" ( X )
'(X )
X
(7.128)
2 ( X ) 0
(7.129)
= c1 J0 ( X) + c2 Y0 ( X)
(7.130)
V" 1 k *
2

V 2
It can be seen that c2 = 0 from the symmetry condition that the derivative of the
concentration with respect to r = 0. Now from the BC at the surface,
u
0 c1
X
R
n
J1
DC2 H 2 r DC2 H 2 r
(7.131)
The solution for time domain is the sum of two exponentials. The term containing the
positive exponential power exponent will drop out as with increasing time the system may be
assumed to reach steady state. At steady state or infinite time W = uexp(/2), becomes zero
multiplied with infinity. This is an inderdeterminate form of the fourth kind (Piskunov). This
can be shown to go to zero. Thus,
2
V c4 e
1 k *
2

n
2
u 1 cn J 0 n X e
1 k *

2
(7.132)
1 k *
2
n
2
(7.133)
Eq. (7.133) is an infinite series of Fourier Bessel that is modified for inclusion of damped
wave diffusion and relaxation effects. The cn can be solved for from the initial condition by
440
using the principle of orthogonally for Bessel functions. At time is zero the LHS and RHS are
multiplied by J0 (m X). Integration between the limits of 0 and R is performed. When n is not
m the integral is zero from the principle of orthogonally. Thus when n = m,
cn = - 0R J0 (n X) / 0R J02 (n X)
(7.134)
It can be noted from Eq.(7.133) that when

( 1 + k*)2/4 < n2
(7.135)
The solution will be periodic with respect to time domain. This can be obtained by using
De Movries theorem and obtaining the real part to exp(-i (n2 - ( 1 + k*)2/4 ) ). For large
relaxation times the concentration of graphene product will undergo oscillations.
1 k * R 2
58.7 DC2 H 2
(7.136)
Estimates of relaxation time from Stokes-Einstein formulation from chemical potential

(Sharma, [13] ) for graphene at 5 torr this can be as high as 50 minutes.
DC H
2
(7.137)
The surface to volume ratio needs to be maintained high. It can be seen that there exist a
critical value of R above which the rate at which the free radicals are produced in the reaction
is larger than the rate at which it is removed by diffusion. This will lead to a runaway
condition in autocatalytic reactions. At the critical value,
or
(2R h ) u/ X Cs D/Dr = ( R2 h) (k C)
(7.138)
Rcrit = 4 D/k J1 (R (k/D) )/J0(R (k/D)
(7.139)
Considering the average reaction rate instead,

Rcrit = 2D/k J1 (R (k/D)
(7.140)
Due to high temperature and low pressure the primary mode of heat transfer is expected
to be due to radiation. Small temperature differences may exist between the copper foil and
graphene sheet. There is no need to couple the energy and mass balances at these small
temperature gradients.
CVD, chemical vapor deposition methods can be used to prepare monolayer graphene
sheet. Hydrocarbons are decomposed on transition metals such as Nickel, Ni, Cu, Copper, Co,
Cobalt and Ruthenium, Ru. Hydrocarbons used are methane, ethylene, acetylene and benzene.
441
Foils made of Ni and Co with thickness of 0.5 mm x 2 mm were used as catalysts [15].
These foils were chopped into five, 5 mm2 pieces and polished mechanically. CVD process
was carried out by effecting the decomposition of hydrocarbons around 800 1000 0C.
Methane is passed at 60 70 sccm along with flow of hydrogen at 500 sccm at 1000 0C for 510 minutes over a Nickel foil. Ethylene at 4 8 sccm can be used in place of methane at 6070 sccm. Benzene can be used as the carbon source at 1000 0C for 5 minutes. Dilution of
benzene is effected using argon and hydrogen. Acetylene at 4 sccm was decomposed on a Co
foil at 800 0C. Methane was decomposed at 1000 0C over Co foil. Cooling step of the Metal
foils after the decomposition step were performed in a gradual manner.
7.10. COMBINED CYCLE POWER PLANT

Integrated Solar Combined Cycle, ISCC, power plants can result in more efficient use of
fossil fuels such as coal, natural gas and petroleum. The waste heat from the exhaust of the
gas turbine can be used along with the solar energy to raise steam and drive a steam turbine.
The world record for obtained power for less fuel was accomplished in April, 2011. Siemens
set-up a 580 MW power station with combined cycle operations of steam and gas turbines.
The gas turbine blades were made out of crystalline nickel. The inlet gas turbine temperature
was 1400 0C 1500 0C. The boiler weighs 7000 metric tons and the heat exchanger has an
area of 510,000 m2. Combined cycle power plant in China operates at efficiencies of about
59.7% recorded at a 430 MW power plant in operation. Thermo economic analysis and 4E
analysis Energy, Exergy, Environment and Economic Analysis, second law costing
methods can be used to confirm the feasibility of increases in thermal efficiency from 30% to
~ 60-75%. There is potential for power plant with higher combined cycle efficiencies in this
country, United States from the current levels reported at ~ 40%.
By use of both the steam and gas turbines the Carnot cycle efficiency has been increased
from 30% to 50%. After nearly two centuries since the discovery of the steam engine by
James Watt, from the point of view of thermodynamics that defines the limits of machines,
what are the issues involved in solar power plant. The power plant size for combined cycle
power plant can be high, as high as nuclear power plants. The 2 GW power plant that is being
constructed at Pembroke, Wales will be the largest and most efficient combined cycle power
plant in the United Kingdom. A 1642 MW combined cycle power plant is expected to be
commissioned in Iraq in 2016. Alstom will supply four gas turbines, four HRSGs, heat
recovery steam generators, two steam turbines and six air-cooled turbo generators. 2.6 GW is
the plant capacity that is expected to come on stream in 2016 or 2017 in Taipei, Taiwan.
Mitsubishi Heavy Industries Ltd and CTCI Corp. in Engineering and Procurement have
jointly received the order. The gas turbine inlet temperature is slated at 1600 0 C. The largest
power plant there is the hydroelectric power plant with 22.5 GW capacity at Three Gorges,
China. The suspended nuclear power plant in Kashiwasaki Kariwa in Japan has a capacity of
8.2 GW.
The federal government by its Sun Shot Initiative expects to make the abundant solar
energy resources in this country, United States more affordable and accessible. Within 10
years the cost of photovoltaic, PV panels, is expected to be reduced by 75%. The solar PV
panels can be used to raise saturated steam. Safety of birds and other living creatures near the
442
concentrated regions of light is an important consideration during the design of the plant.
Acreage use can come down from increases in light to electricity conversion.
The mass of the sun can be calculated from the period of the earth which is 365.25 days.
The mass of the sun is ~ 2 x 1033 gm. The surface temperature of the sun is 5500 0C. Using
Boltzmanns law if hydrogen molecules were made to travel at the speed of light the micro
scale temperature will be 7.22 x 1015 K. If that molecule was polyfullerene then the
temperature will be ~ 2.6 x 1018 K. Sun is a hot reservoir from which more heat engines can
be made to work from. With improvements in energy storage materials energy from lightning
can someday be transformed into useful work in earth surface.
The worlds largest electric power generating system using CSP concentrated solar power
technology has been commissioned by NRG solar along with Brightsource energy in 2013.
The capacity is 392 MW. CSP used a field of mirrors to concentrate sunlight onto thermal
receivers mounted on top of towers. Lower cost of production and zero emissions are
expected from use of solar power plants. The technology is low risk. The efficiency of
conversion of sunlight to useful energy using photovoltaic cell technology hovers around
15%. Photovoltaic efficiency of PV cells is 8% for solar cells made from amorphous silicon.
Their efficiency has increased now to 14%. This can be further increased to 20% by use of
thin films that contain small amounts of crystals of silicon. Single crystal silicon can be used
to make the most efficient solar cells with 30% efficiency. These PV cells are more
expensive.
By 2021, six Public sector undertakings: BHEL, Bharat Heavy Electricals Ltd., PGCIL,
Power Grid Corp. of India Ltd., SECI, Solar Energy Corporation of India, SSL, Sambhar Salt
Ltd., REIL, Rajasthan Electronics & Instruments Ltd., and SJVNL, Satluj Jal Vidyut Nigam
in India are planning to set-up solar power plant with 4 GW capacity in Rajasthan, India. The
solar photo-voltaic power plant will use PV modules based on crystalline silicon technology.
CO2, Carbon dioxide emissions can be reduced by 4 million tons per year. The land area
proposed to be used is 19,000 acres at Sambhar, Rajasthan. It can be the largest power plant
in the world in its kind.
In 1955 Bell Labs, created a 6% PV cell for everyday use. Hoffman electronics increased
the light to electricity conversion efficiency to 10% in 1959 in commercial applications. The
first thin film cell to exceed 10% mark in conversion efficiency was made at University of
Delaware, Institute of Energy Conversion in 1980. In 1985, Stanford University, Stanford,
CA created a solar cell that is 25% efficiency using 200 X concentration. The 30% mark was
shown using Stirling cycle at NREL in 1994 using a gallium indium phosphide/gallium
arsenide solar cell.
A team of researchers from North Carolina State University has fabricated a super
absorbing design that can be used in order to maximize the light absorption efficiency of the
thin film solar cells while minimizing the manufacturing costs. According to EE times Asia
dated March 3rd 2014. Their design can decrease the thickness of the semiconductor materials
in thin film solar cells by an order of magnitude without compromising the capability of solar
light absorption. 100 nm amorphous silicon layer is a requirement in state-of-the art solar cell
design. 90% of incident solar beam can be absorbed using 10 nm thick layer of amorphous
silicon.
The core of the super absorbing layer in solar cell comprises of a rectangular onion like
configuration that is made up of a semiconductor layer. This layer is coated by 3 layers of
AR, anti-reflection coating that transmits light at a greater efficiency. The researchers first
443
estimated the intrinsic light trapping efficiency of the semiconductor material. Then they
devised a structure where the light absorption efficiency is equal to that of the intrinsic
efficiency of the semiconductor material.
A team of scientists from CIT, California Institute of Technology, Pasadena, CA,
developed flexible solar cells that enhance the absorption of sunlight and hence the
photovoltaic efficiency using fraction of expensive semi-conductor material. They built their
solar cells using silicon wires embedded within a transparent, flexible polymer film. Black
paint can absorb light well, but may not generate electricity.
These solar cells convert most photons absorbed into electrical energy. These wires have
what is called a near perfect internal quantum efficiency. A high-quality solar cell is built for
high absorption of light and good conversion of photons to electric current. These wires are
painted with anti-reflective coating prior to being embedded into the transparent polymer.
Each wire is about 1 mm in diameter and 30-100 mm in length. 2% of the material is silicon
and 98% polymer. This brings down the cost of the solar cell. These solar cells are also
flexible. Photovoltaic cells respond only to a narrow part of the suns spectrum. In order to
circumvent the lower efficiency on account of absorption of narrow part of the spectrum some
developers prepare layered materials. The efficiency goes up, but the material becomes
expensive as well.
Cloudy days may lower the efficiency. Ohio State University developed a doped
polymer, oligothiopene. The resulting substance was responsive to wavelengths from 300 nm
to 1000 nm. The spectrum of ultraviolet (UV) to near infra-red is spanned in this range.
Traditional silicon cells, au contraire, function in the 600 nm to 900 nm range. This narrower
range is between orange and red. The doped polymer both fluoresces and phosphoresces.
Fluorescence emanates from electrons that get excited by incident rays of sunlight travel from
a higher energy state and drop back to a lower energy state. Some light is emitted. The
wavelength of the emitted light is in infrared range and not visible. This emitted light is
seldom reused. Reuse of emitted light may improve the photovoltaic efficiency. These
polymers are cheaper to produce compared with silicon. Hence they can be considered even if
their photovoltaic efficiencies are lower. The relaxation time of these electrons during
fluorescence of the doped polymer comes up from a few picoseconds in other solar materials
to a few microseconds.
A full spectrum solar cell that absorbs the full spectrum of sunlight from the near infrared
and far ultraviolet to electric current can be prepared from an alloy of indium, gallium and
nitrogen. This was made possible by a serendipitous observation by researchers at Lawrence
Berkeley National Laboratory interacting with the crystal-growing research team at Cornell
University and Japans Ritsumeikan University. This observation was that the band gap of the
semiconductor indium nitride is not 2 eV as previously thought, but instead is a much lower
0.7 eV. Solar cells made from this alloy would be the most efficient and can be lower in cost
as well.
The efficiency of photovoltaic cells is limited because of a number of factors. Some light
energy that gets absorbed is rejected as waste heat. There exists a band gap in semi-conductor
materials that the solar cells are made out of. Incoming photons of the right energy knock
electrons loose and leave holes and migrate in the np junction to form an electric current.
Photons with less energy than the band gap slip right through. Red light photons are not
absorbed by high-band-gap semiconductors. Photons such as blue light photons that possess
higher energy than the band gap are absorbed. Excess energy is dissipated as heat. There is a
444
maximum efficiency limit for a solar cell made from a single material for converting light
into electric power. This is about 30%. In practical applications it is about 25%. Stacks or
layers of different materials are attempted in order to increase the efficiency.
CIGS, CuInxGa1-xSe2 based photovoltaic thin films can deliver sunlight to electricity
conversion performance greater than that of CdTe or silicon based thin films. Nanosolar) has
developed a process with high-throughput, high-yield printing of nanoparticles onto low-cost
substrates and formation of solar cells. CIGS based PV thin films can deliver sunlight to
electricity conversion efficiencies of 19.5%. NREL has certified the solar cell efficiency of
14% achieved by nanosolar with lower cost materials using nanotechnology. CIGS based thin
films result in higher efficiencies. They are coated with a homogeneously mixed ink of
nanoparticles using wet coating techniques. CIGS roll-printing technology developed by
nanosolar uses a combination of high-speed, high-yield, no vacuum, wet coating of
nanoparticles onto low cost per unit area of metal foil substrates with RTP (Rapid Thermal
Processing) techniques. Nanosolars rapid thermal processing of nanoparticle-based coatings
resulted in solar-cell efficiencies confirmed by NREL (National Renewable Energy
Laboratory) to be 14.5% which amounts to a world record for any printable solar cell.
New discoveries such as the CNT (carbon nanotubes) are expected to increase the
photovoltaic efficiency of solar cells to over 40%. For now, in areas, where the population
density is sparse, and sunlight is abundantly available for most of the year the solar power
plants may be profitable. This can be seen by a positive PW (present worth) value. They end
up using large area. The solar panels are not protected from birds and other forms of dust that
degrade their operations. Lenses and mirrors can be used to concentrate the sunlight and
energy storage devices can store the energy in useful chemical forms such as batteries for use
at night and during rainy days. Someday technology in solar energy generation will be as
technically efficient as that of the combined steam and gas cycle power plant.
Solar energy may be tapped in three different ways;
(i) Solar thermal power,
(ii) Photovoltaic Panels
(iii) Solar Heaters.
(iv) Concentrated Solar Power
(v) Balance of Systems Costs
(vi) Systems Integration
In method (i) steam is generated in large boilers to turn turbines and generate electricity
comparable in capacity to coal-fired boiler-based power plants. Photovoltaic panels can be
used to convert directly the solar irradiance (w/m2) into electricity. This technology is used to
meet peak load needs and distributed power needs. Small power plants of up to 50 MW can
be built using panels. The capacity of the recently commissioned De Soto Solar Power
Generation Center in Florida is 24 MW and is less than 50 MW. Solar irradiance (w/m2) is
used to heat water or air and can be used for residential heating purposes.
Solar power plant technology can be used to produce base-load, large-scale power at low
technical risk. These can replace coal-fired boiler based power plants. Heat energy storage
devices have been invented that can provide for uninterrupted services such as during the
night hours, rainy days, etc. Lunar power can also be tapped into. Heat storage elements used
445
are concrete, molten salts and pressurized water. The capital solar plant costs and the plant
utilization factor continue to affect the bottom line. Spain has five such plants under
development and two that have been already commissioned. Investments have been made in
several countries across the globe to advance the design of solar mirrors and lenses. These are
used to gather the sunlight and focus on a fuel source to generate of electricity. Full scale
commercial operations of such power plants with capacities in the range of 20-200 MW are
expected by 2011. The cost per kWh is continuing to be the main concern. Optimization
strategies are being developed. Cost effective storage devices are also expected.
Present worth (pw) of solar power plants: A rapidly declining cost curve is seen in the
photovoltaic cell technology. The price of solar modules is expected to fall from around $2/W
today to $1 in the near future. The price per watt installed is likely to fall from $6.0-$8.0 to
$3.0 per watt. Dominant in the costs are power electronics and installation. With current
incentives in the United States and European Union the cost of electricity generation using
solar technology is in the range of the IGCC (Integrated Gasification Combined Cycle) power
generation plants. In the state of California the cost of electricity from solar power plants is
about 14-15 cents per kWh. This is against the 8-10 cents per kWh cost of electricity from
IGCC power plants. By 2013 with some incentives from the federal government the cost of
electricity from solar power plant is expected to fall to 10-12 cents per kWh. The per kWh
cost is sensitive to the capital cost and the cost of materials of construction of the plant.
Sequestration related carbon credits at $30 t-1 of CO2 can affect a per kWh reduction of 3
cents. Government carbon tax, cost of capital are sensitivity parameters on the bottom line of
solar power plants.
Worldwide, the solar thermal power capacity can grow at least 30% per year from 2010
to 2020 or 2030. 200 GW of new power plant capacity can be added each year. About 1-2
GW per year could be added in 2012. Solar technology is relatively simpler. The NREL,
National Renewable Energy Laboratory, has identified potential for 6 TW (terra watts) of
solar thermal power in the Southwestern US. Few things are now known about the light to
electricity conversion. The Carnot limit of efficiency of any man made machine is given by;
carnot
TC
TH
By the Plancks theorem,

E
hc
The IV, current-voltage characteristics of a photodiode cannot be described using the

Ohms law of electricity. GaAs multijunction devices are the most efficient solar cells
reaching a record high of 40.7%. 20-30 different semi-conductors are layered in series. AR,
antireflection coatings can be used to minimize reflection from the top surface. The IV
characteristics can be given by;
446
I 0 (e
qV
kBT
1) qAG0 Lp
Ln
33% of solar insolation is lost as waste heat. The temperature of operation of the photovoltaic
module can be determined from energy balance as follows;
IT
c IT
U L Tc Ta
The physical significance of each term above Eq is as follows;

The fraction of radiation incident on surface of solar cells is given by (IT), where is
the transmittance of any cover;
The efficiency of conversion of incident radiation into current is given by (cIT);
Radiation and convection losses from top and bottom is given by (UL(TC Ta).
Ta is the ambient temperature.
The temperature of the solar cell, Tc can be obtained by rearranging the terms and;
Tc
Ta
IT
UL
It can be seen that as there exists an optimal working temperature of the solar cell. As the
amount of concentrated solar flux is increased the absorption efficiency first increases and
then decreases. As the working temperature increases the heat losses increase by radiation and
convection. The optimal temperature of operation for maximum efficiency can be arrived at.
The heat losses vary as T4 and the efficiency increases linearly with the working temperature.
At /T = 0 the working temperature can be solved for. The UL the overall transfer
coefficient will vary with temperature.
Solar aided combined cycle power plant may first come about in large numbers before
solar along power plants will become ubiquitous. Nuclear power plant can be aided by solar
or other cycles starting from the exhaust of the steam turbine. Supercritical steam can be
generated from nuclear boilers and from the steam recovered from the steam turbines can be
used to drive a bottom second cycle. This second cycle can be aided by solar or coal. This
way large power plant size, higher efficiency of energy transformation and lesser land acreage
can be used. The solar module can be operated at the optimal temperature from the tradeoffs
from radiation losses and temperature dependent heat absorption.
A typical scheme for solar aided combined cycle power plant is shown in Figure 7.11.
Similar design has been proposed by Kelly et al. (2001). The parabolic trough solar power
plant is integrated into a modern combined cycle power plant with gas and steam turbines. A
solar collector field can be seen in Figure 7.11. Kelly et al. (2001) found that the most
efficient use of solar thermal energy was by the production of high pressure saturated steam
for addition to the heat recovery steam generator. This way the solar energy and fuel energy
in the inlet of the gas turbine is converted to electricity at higher conversion efficiency. Steam
turbine alone power plant or gas turbine alone power plant operate at ~ 30% efficiency and
the combined cycle efficiency is ~ 55-60%. The increase in combined cycle efficiency can be
explained using the waste heat recovery from the exhaust of the gas turbine and use of solar
447
insolation in the input. The parabolic trough collector can be used in order to heat mineral oil.
This hot oil is used in a shell and tube heat exchanger in order to make steam. This steam is
used to operate steam turbines with the generation of electricity. Optimization of layout and
complete integration of solar technology is an ongoing saga. Natural gas may be used as the
input fuel to the gas turbine. The combined cycle technology offers interesting technical
problems to the control engineer. How much load the gas turbine ought to carry and how
much load the steam turbine ought to carry can be provided by a feedforword scheme.
Internal model control is another possibility. Feedback control using temperature, pressure
measurements as discussed in Chapter 5.0 can be continued to be used. Performance models
can be developed. The ambient temperature plays a more significant than expected role in
determination of the overall thermal conversion efficiency. Plant designs can be conceived
using software such as Gate Cycle from Enter Software.
7.11. CONTINUOUS PHARMACEUTICAL PRODUCTION

Chemical engineering principles can be applied to scale-up formulations of drugs into
large production in continuous manner. There are number of advantages for preferring
continuous processes over batch modes. The quality will be higher, process cost will be
lower. Capital investment and plant costs can be depreciated over reasonable periods of time.
Centralized control is possible in continuous processes. The raw materials can be procured in
whole sale prices. The finishing operations for the product such as formation of capsules,
coating, coloring etc. can be sewn into the process flow with benefit. Productivity will be
higher and product uniformity will be more. The residence time in the reactors can be lowered
and the throughput can be increased. Less manual labor is required. Inventory costs will be on
the lower side. Environmental impact is more benign in the case of continuous process
compared with batch mode. Depending on the demand optimal strategies can be devised.
Sometimes space can be minimized for the same throughput.
Some of the hurdles that needs to be overcome in order to have widespread use of
continuous processes for pharmaceutical production is the misperceptions of higher risk. A
paradigm shift and outside the box thinking is needed for continuous production of drugs.
Investors who are happy with current methods need be better informed. They may be used to
the conventional pharma units with stepwise reactions, purifications and final product
formulations were performed in the batch mode. Change to continuous does not mean that
there is need for more engineering and operating skill. Chemical engineers are trained in
order to accomplish some of the goals such as crystallization, purification, reaction,
separation and heat transfer steps needed in pharmaceutical production. Handling solids need
expertise in powder technology, continuous crystallization and particulate processing. Use of
continuous crystallization can result in cost savings of about 50%. Start-up and shut down
procedures in the continuous processes can be optimized using transient models tested on the
computer. FDA approvals for the drug can be used effectively using quality inspections in
process implementation. FDA encourage continuous production. Optimization of the total
cost of operation with tradeoffs of operating costs and capital costs can result in arrival of
certain number of stages for each unit operation used. Expertise in separation, purification
and integration of biocatalysts are needed for continuous pharmaceutical production.
448
Figure 17. Integrated Solar Combined Cycle Power Plant.
The industrial controls market size is expected to reach ~ 150 billion dollars worldwide.
Process dynamics can be studied using desktop computers and proactive process solutions can
be sought. Stability analysis using a pencil and paper can lead to a better perspective on the
range of operation of the process variables. Control and automation have grown tremendously
with the advent of computers and programmable logic controllers, PLCs. Plant start-up, Plant
Shut-down operations gets more attention of the lead engineer compared with those during
steady-state operation of the plant. Transient analysis is not well studied. Transient behavior
of chemical reactors, distillation columns, absorption towers, adsorption beds, extraction units
and other unit operations needs to be better studied.
Collegiate education methods have to keep pace with the developments in the field of
industrial controls. Moores law states that computing speed of microprocessors double every
18 months. Biological databanks double in size every 10 months. Mathematical methods for
model development have been refined over centuries. The methods and means available to the
engineer need be better utilized.
Computer simulation and model development can be an integral part of an engineers
endeavors. The days when the effect of professionals who do mathematical modeling and
computer simulation on the bottom line of the enterprise is only indirect are over. The coming
era is when the PW, Present Worth of chemical plants are better for having an army of
engineers and Ph.D. scholars who perform process dynamics studies, develop process control
block diagrams, instrument the chemical plant with sensors hooked with data acquisition to
the desktop computer.
449
GlaxoSmithKline, Novartis, DSM, Lonza are developing continuous process

technologies for pharmaceutical production. Over $ 1 billion has been invested in continuous
process for pharmaceutical production. Glaxo is building a $ 50 million plant in Singapore in
order to manufacture asthma and allergy drug fluticasone propionate. Contract manufacturing
can be used in order to perform flow hydrogenations that are catalyzed in packed bed
configuration, distillation, extraction, crystallization from the tube to manufacturing. SK Life
Sciences sill run 60-70% of the chemistries in batch mode. The operators need to be trained in
the PFD, process flow diagram. This can also be shown to the customers. Material and
Energy balance can lead to cost savings for the enterprise. Spreadsheets can be used for this
purpose. It does not come as a surprise that the high attrition rate in pharmaceutical industry
can be decreased when continuous process is adopted. Several unit operations have to be
made to work in consonance with each other. It is hard to miss the efficient conversion of raw
materials to product using continuous process in large scale. Scale-up principles such as L/D,
length over diameter ratio of the reactors, distillation columns, adsorption towers, agitator
speed and power draw used, pre-treatment of raw materials can be augmented using reliable
mathematical models for mixing, heat transfer, mass transfer for a given pharmaceutical
chemistry. Waste heat recovery and energy audit can lead to a more optimal operation. For
new products the continuous processes are readily adapted. The cost of over the counter drugs
may decrease. Value addition during development of pharmaceutical products are high. It is
not hard to break down the value addition along the sequence of unit operations used from
raw material pre-treatment to post-treatment of the drug capsule steps.
Industrial scale flow processes can be developed for a step identified in the bench scale.
One example here is the nitration step developed by DSM. DSM manufactured API, active
pharmaceutical ingredient at a capacity of few hundreds of tons per year. They ran hundreds
of micro scale reactors in parallel. Usually PFR, plug flow reactor is more efficient. Utility
costs will be high in the parallel configuration. The cost of recovery of the unreacted
materials and recycling back to the reactors will consume the money budgeted. This is
because of the low conversion in the micro reactors and high conversion in the case of the
PFR. In cases where the yield of the reaction is low in the bench scale attempts have to made
in order to improve the yield. Advances have been made in the downstream processing
methods used in pharmaceutical industry. Implementation of these changes can result in
higher overall yield of the product. Research in continuous manufacturing has led to the
development of a pilot effort to make the API in Tekturna a cardiovascular drug, i.e.,
Aliskirne Hemifumarate. The number of operations in the batch mode was 21. The unit
operations used in the continuous process is 14. Novartis is spending $ 65 million for more R
& D over a 10 year period. Some steps used in continuous manufacturing of pharmaceuticals
are reactions, separations, purification, crystallization, drying, formulation, tableting. 3
million tablets a year can be made at a reactor output of 41 g/hr. Portable units are possible.
Nutritional supplement, NBMI was developed by University of Kentucky in 6 years with
the help of contract manufacturing. The drug is intended for use as antioxidant and can be
used for reversing ageing. Clinical trials are being conducted. It works by mercury chelation.
PCI the contract manufacturer eliminated chloroform used as solvent, increased the yield to
98%, isolated the material in powder form and made into capsules.
450
7.12. SPECIFICATIONS LIMITATIONS IN BINARY DISTILLATION

Distillation is the oldest and most common refinery process It is based on the principle
that liquids with different boiling points can be separated by vaporization and condensation.
Crude oil distillation involves feeding crude oil at its boiling point of 400 0C into a large
fractionation column. The oil is split up into a series of product fractions depending on
desired boiling point ranges. Vaporized oil on its way up through the column encounters
condensed liquid on its way down. They are made to come in contact and exchange
components at a number of sieve trays in the column. This contact caused light fluid
molecules to vaporize and heavy gas molecules to condense. The further up the column,
lighter the fluid found at the sieve tray it is. Part of the crude oil that cannot be vaporized is
extracted as heavy oil at the bottom of the column. Exxon-Mobil is the world largest company
that explores oil and in their refineries manufactures fuel. A schematic of the overall process
used by Exxon-Mobil is shown below in Figure 7.12.
In India the major oil companies are Indian Oil, Bharat Petroleum, Hindustan Petroleum,
Oil and Natural Gas Corporation, Chennai Petroleum, Kochi Refineries, Bangagoan Refinery,
Mangalore Refinery and IBP. They are increasing their refinery capacity. The largest refinery
in India is owned by Reliance under the management of Mr. Mukesh Ambani with a capacity
of 31 million tons. For example, recently the 3 million ton refining capacity expansion and
modernization project of Chennai Petroleum Corporation Ltd. CPCL, in Manali near Chennai,
in order to improve the overhead distillates yield and produce cleaner fuel came on stream. It
is a 9.5 million ton refinery. The expansion was on 120 acres at 2360 crore rupees. It is a first
of its kind facility to process 100% hydrocracker bottom and as a result the liquefied
petroleum gas production has increased from 1.8 lakh tons to about 4 lakh tons. The petrol
production improved from 3.9 lakh tons to 7 lakh tons. The hydrocracker unit is a crucial
component in the production of automobile fuels with low sulfur content.
Industrial distillation is typically performed in large, vertical cylindrical columns known
as "distillation towers" or "distillation columns" with diameters ranging from about 65 cm - 6
m and heights ranging from about 6 m - 60 m. The distillation towers have liquid outlets at
intervals up the column which allow for the withdrawal of different fractions or products
having different boiling ranges. The "lightest" products (those with the lowest boiling point)
exit from the top of the columns and the "heaviest" products (those with the highest boiling
point) exit from the bottom of the column. Large-scale industrial towers also use reflux to
achieve more complete separation of products. Fractional distillation is also used in air
separation, producing liquid oxygen, liquid nitrogen, and high purity argon.
Distillation of cholorosilanes also enables the production of high-purity silicon for use as
a semiconductor. In industrial uses, sometimes a packing material is used in the column
instead of trays, especially when low pressure drops across the column are required, as when
operating under vacuum. This packing material can either be random dumped packing (1-3"
wide) or structured sheet metal. Typical manufacturers are Koch, Sulzer and other companies.
Liquids tend to wet the surface of the packing and the vapors pass across this wetted surface,
where mass transfer takes place. Unlike conventional tray distillation in which every tray
represents a separate point of vapor liquid equilibrium, the vapor liquid equilibrium curve in a
packed column is continuous. However, when modeling packed columns it is useful to
compute a number of "theoretical stages" to denote the separation efficiency of the packed
451
column with respect to more traditional trays. Differently shaped packing has different
surface areas and void space between packing. Both of these factors affect packing
performance. Typical number of plates required for a desired level of separation for different
aromatic, organic and aqueous systems are given in Table 4.1.
7.12.2. Method of McCabe and Thiele for Multistage Binary Distillation

The widely accepted method popular with the practioniers in the chemical process
industry is the method of McCabe and Thiele to calculate the number of theoretical stages
needed to perform a desired level of separation of a binary system. A schematic of a
multistage binary distillation column showing the key components is shown in Figure 7.13.
The components are;
1)
2)
3)
4)
5)
6)
7)
8)
Central Feed
Vertical Cascade of Stages
Enriching Section
Overhead Condenser
Reflux
Distillate
Stripping Section
Reboiler
In the enriching section the vapor rises above the feed and is washed with the liquid to
strip the less volatile component. The washing liquid is prepared in the overhead condenser
and part of the distillate is returned to the distillation column as reflux. A reflux ratio is
calculated and comes in handy during further design estimates. The distillate is the product
that is removed from the condenser and contains the more volatile component in high
concentration. The stripping section is that section below the feed where the vapor that boils
sweeps the more volatile component with it and moves upward through the column. The
vapor is prepared in the reboiler by partial vaporization. The liquid that is removed from the
reboiler is the residue and has predominantly the less volatile component. The reboiler can be
viewed as an additional stage. The liquid and vapor at each of the n trays are at their dew
point and bubble point. The highest temperature is at the bottom and the lowest temperature is
at the top. The purity levels achieved for the distillate and residue depend on the liquid/gas
ratios used and the number of theoretical stages provided in the two sections of the tower and
the operating efficiency resulting from mass transfer diffusion resistances. The cross-sectional
area of the distillation column varies with the quality and price of the material of interest. The
interrelationship between the purity levels of the distillate, residue, feed and the number of
stages required ideally, was outlined by McCabe and Thiele.
The most common problem in distillation is designing a distillation column. Given the
flow rate and concentration of entering stream, and the flow rate and concentration of the
product stream, the size of column needs to be calculated. The industrial columns consist of a
series of plates of the sieve tray or bubble cap variety and are used to separate the stages. The
gas and liquid phases are made to come in contact with each other until it can reach
equilibrium.
452
Figure7.12. Exxon Mobil Corporations Refining of Crude Oil into Fractions.
The main steps of the design involve;

1.
2.
3.
4.
Mass Balance - Derive Operating Line

Energy Balance - Obtain Equilibrium Curve
Transient Mass Transfer Rate Equations - Derive Murphree Efficiency
Step off the Ideal and Real Stages required (staircase graph)
The method is less rigorous compared with some other methods such as the Ponchon
Savarit method that used the enthalpy information as well. This method was found to give
good results for concentrated feeds. The reflux ratio is given as an input parameter in the
estimations. Equimolal overflow and vaporization is assumed. At each stage let Ln and xn
represent the liquid phase flow rate and the mole fraction of the desired species and Gn and yn
be the vapor phase flow rate and mole fraction of the desired species. At the 1st stage y1 is the
vapor phase mole fraction and x0 is the liquid phase mole fraction. There is no y0 as the
condenser returns will be all liquid.
Figure 7.13. Schematic of Typical Multistage Distillation Column.
7.12.3. The Mass Balances and Operating Lines

From an overall mass balance on the feed, distillate and bottoms streams;
F = Dis + W
From a component mass balance on the feed, distillate and bottoms stream:
xFF = xDDis + xwW
453
454

When the column operates at steady state;
Ln-1 + Gn+1 = Ln + Gn
The component balance would then be;
L x0 + Gyn+1 = Lxn + Gy1
The vapor flux G and the liquid flux L are assumed constant between the top of the tower
and the nth plate. Rewriting above Eq.
yn+1 = (y1 L/G x0) + (L/G)xn
It can be seen that yn+1 varies linearly with xn. The slope can be seen to be (L/G) and the
intercept (y1 L/Gx0). In the special case of the total condenser, (Dis = G + L),
xD = x0 = y1
Noting that the vapor phase entering the nth plate is at the composition yn+1 and the liquid
exiting the nth stage is at composition xn. From a mass balance on the nth plate and the
condenser exit streams;
xDDis = -xnL + yn+1G
or yn+1 = xn(L/G) + xD(Dis/G)
Defining a reflux ratio, R = L/Dis
Then,
Dis/G = Dis/(L + Dis) = 1/(R + 1)
L/G = L/(L + Dis) = R/(R + 1)
Combining Eqs. [4.9-4.10] into Eq. [4.4] the operating line of the rectifying section is
then;
yn+1 = xn(R/(R +1)) + xD(1/(R +1))
The operating line of the rectifying section is essentially a mass balance relationship
between the components of the different inlet and outlet streams. The reflux ratio R can be
used as a lever to achieve the desired objectives during the operation of the distillation
column. In a similar fashion analysis of the reboiler section and a plate in the column leads to
the derivation of the operating line of the stripping section:
yn+1 = xn(W/G -1) - xW(W/G)
yn+1 = xn B/(B-1) - xW/(B-1)
455
where B is the reboil ratio. The reboil ratio is that ratio of the vapor produced by the reboiler
to the residue withdrawn (L/W).
The nature of feed can be several kinds ranging from all vapors, all liquid or a partial
mixture of both liquid and vapor. The feed can be found at the intersection of the two
operating lines from the rectifying and stripping sections. For any feed,
F + L + G = G + L
Where G and L are the vapor phase and liquid phase flow rates in the stripping section.
q can be defined as;
q =(L L)/F = LF/F
When the feed is all liquid below the bubble point the q value is > 1.0. For a saturated
liquid feed q = 1, and for a mixture of liquid and vapor in the feed, the q value lies between 0
and 1.0. For the saturated vapor q is 0 and for superheated vapor the q value is less than 0 and
is negative. Later an expression for q in terms of the enthalpies will be shown.
From the component mass balances;
FzF = Dis xD + W xw
The intersection of the two operating lines can be found as;
yn+1 = xn(L/G) + xD(Dis/G)
yn+1 = xn(L/G) - xW(W/G)
Subtracting the equation for the rectifier from the equation for the stripper;
yn+1 (G G) = xn(L - L) - (xWW + Dis xD)
Rewriting Eq. [4.17] by using Eq. [4.15), Eq. [4.13)
yn+1 = qxn/ (q-1) - zD/(q - 1)
Above equation is the feed line. The slope of the line gives the energy required to convert
the feed to the vapor phase. The feed line for different feed conditions is shown in Figure
7.14.
7.12.4. Feed Location, Pinch Point, Minimum Reflux and Minimum Stages
The information from the VLE, vapor-liquid equilibrium data and the operating lines
derived from the mass balances as shown above are combined to calculate the number of
theoretical stages needed to achieve a desired level of separation. A step by step illustration of
this method is shown in worked example 4.1 in Sharma [2007]. The Pentium 4, 3 GHz PC
was used. The graph of the VLE data called the equilibrium line relates the vapor composition
456
on a particular stage to the liquid composition in the same stage. For a given reflux ratio, R,
the two operating lines from the rectifying and stripping section can be shown to intersect
with the feed line for any feed. Each stage can be seen as a staircase graph and stepped off
from the graph. This is shown in the worked example 4.1. Thus by a combined graph of the
equilibrium line and operating lines the number of stages can be stepped off with ease and is
an important procedure. The feed can be located in a stage at the intersection of the operating
lines. This is the optimal location of the feed. Other locations are suboptimal.
The minimum number of stages required can be calculated when the reflux ratio becomes
infinite. At infinite reflux ratio (R = ), the operating lines can be seen to revert to yn+1 = xn.
Both the slopes of the rectifying and stripping sections become equal. At infinite reflux, zero
distillate is produced. Thus for a lot of energy supplied, in a few stages, that can be stepped
off from the graph, only a few drops of pure product is recovered. The minimum reflux ratio
can be calculated by letting the operating line from the rectifying section to intersect with the
equilibrium line and the q feed line and the number of stages stepped off from the graph. The
reflux ratio that is used is often times 1.2 to 1.6 times the minimum reflux ratio needed. This
ratio depends on the relative capital costs and operating costs of energy. If capital is cheap, a
low reflux ratio with more number of stages can be used and where the energy is cheap a
large reflux with fewer stages is preferred. The reboiler load will be low for the former and
large for the latter. The condition of minimum reflux ratio also denotes the point of maximum
ratio where infinite plates for the desired separation are needed. Above this ratio the desired
separation can be effected.
The intersection of the equilibrium line and operating line is called the pinch point. Two
pinch points can be expected. One from the intersection of the rectifying operating line and
the equilibrium curve and another from the stripping operating line and the equilibrium line.
It can be seen that infinite stages are required to reach the pinch point from the point of the
desired purity level. From this condition of infinite plates the minimum reflux ratio can be
calculated by noting the y intercept of the graph. (xD/(Rm+1)).
Figure 7.14. q Line for Different Feed Condition.
457
Figure 7.15. Minimum Reflux Ratio and Minimum Number of Stages.
7.12.5. Reboilers
The reboiler that is used to supply energy for the fractionation by vaporization of the
residue and return to the fractionator may be of several kinds. The reboiler may be built either
internal or external to the column. This depends on the heat load. For low capacity of
separation, jacketed kettle may be used. Here the vapor capacity and heat transfer area are
small. This can usually be found in pilot plants. Sometimes a tubular heat exchanger is built
into the bottom of the tower. This is an internal reboiler and the heat transfer surface is larger.
It provides a vapor in equilibrium with the residue product so that the last stage represents
enrichment due to reboiler. The problem is when cleaning the heat exchanger requires the
shutdown of the entire distillation operation. In order to avoid this maintenance routine,
external reboilers can be used. They can be arranged with spares for cleaning. This can be
used for large installations. The kettle reboiler has the heating medium inside the tubes. The
vapor is in equilibrium with the residue product and behaves as an extra theoretical stage. The
heating medium in a vertical thermo siphon reboiler is outside the tubes. All of the liquid
entering the tubes are vaporized. Fouling is a problem. In horizontal reboilers steam is used
for heating. In some vertical thermo siphon reboilers the liquid is received from the traps of
the bottom tray. In order to reduce fouling sometimes the boiler is operated in the partially
vaporized condition.
7.12.6. Specifications Limitations

The parameters of the design of a multistage binary distillation column at the beginning
are usually available;
458

1.
2.
3.
4.
Temperature, Pressure, Composition and Flow rate of Feed

Pressure of Distillation
Optimal Feed Location
Heat Losses
It can be shown that only 3 more design specifications after the above is needed to
completely specify the problem. (Treybal, 1980). The rest can be calculated from the other
parameters. In the above sections it can be seen a lot of the parameters are related to each
other by the mass balances and equilibrium line from VLE data. The 6 other parameters are;
1.
2.
3.
4.
5.
6.
Total Number of Trays, N

Reflux Ratio, R
Reboil ratio, B
Composition of product
Product Split, Psplit (xDDis/xwW)
Ratio of total distillate to total residue (Dis/W)
There are some pitfalls in specifying the problem completely. Sometimes the problem
may be over specified or underspecified. For example, it can be seen that say three parameters
from the above six are given, i.e., the product split, Psplit, W/Dis and distillate composition are
given. Then, from a component balance of the three main streams of feed, distillate and
product.
FzF = Dis xD + WxW
Rewriting he above equation using F = Dis + W
(Dis + W)zF = Dis xD + WxW
(4.21)
Dividing throughout by Dis

(1 + W/Dis)zF = xD + W/Dis xW
From the product split information and W/Dis and the distillate composition the residue
composition can be calculated. Now that the residue and distillate compositions are known
from the above equation the feed composition can be calculated. It cannot be made available.
Otherwise the problem will be over specified. For problems that are underspecified
insufficient information is available to complete the problem. There can be 6C3 = 20 problem
types. With the advent of the PC it is easier to derive the necessary relationships and work
with the information available to achieve the desired objectives. These problem types and the
solution approach are as follows;
I.
Given Reflux Ratio R, Reboil Ratio B and Dis/W find the number of trays, N p,
product split and the bottoms composition.
The intersection point (xint, yint) can be seen to obey Eqs. [4.11, 4.12, 4.19]
459
yint = xint(R/(R +1)) + xD(1/(R +1))

yint = xint B/(B-1) - xW/(B-1)
yint = qxint/ (q-1) - 1/(q - 1) zF
Further,
(Dis/W + 1)zF = Dis/W xD + xw
There are four equations and 4 unknowns, xw, xD, xint, yint which can be solved
simultaneously. Once the intersection point is found the same procedure as shown in
worked example 4.1 to step of the number of ideal stages required for a given desired
level of separation can be stepped from the staircase graph.
II. Given W/Dis, product split, R, calculate Np, xw, B
Eq. [4.26] can be written in terms of xw only given the information in the product
split and W/Dis. Once the xw, xD can be calculated from the product split
information. Eqs. [4.25] and (4.23] can be solved simultaneously as they form a set
of two equations and two unknowns. From this and Eq. [4.24] the reboil ratio, B can
be calculated.
III. Given Product Split, Psplit (xDDis/xwW), Reboil Ratio, B, Residue composition, xW,
calculate Np, R, W/Dis.
Straightforward solution. Given the residue composition and reboil ratio the
operating line for the stripping section can be constructed in the graph. The
intersection with the feed line can be identified. Rewriting Eq. [4.22],
(Psplit xw/xD + 1)zF = Psplit xw + xw
(4.27)
Thus the distillate composition can be calculated given the product split and residue
mole fraction. Now from Eq. [4.23] the reflux ratio can be calculated. This completes
the specification of the problem.
IV. Given Product Split, Psplit (xDDis/xwW), Reboil Ratio, B and Reflux Ratio R
calculate Residue composition, xW, Np, W/Dis.
The four equations can be solved for by simultaneous equations, simultaneous
unknowns.
V. Given Product Split, Psplit (xDDis/xwW), Reflux Ratio, R, Residue Composition, xW
Calculate Np, W/Dis and Reboil Ratio
Straightforward solution. Given product split and residue composition, the distillate
composition can be calculated from Eq. [4.27]. Now the W/Dis can be calculated
from the product split information. The intersection points of the two operating lines
of rectification and stripping can be calculated by solving for Eqs. [4.23, 4.25]. The
reboil ratio can then be calculated from Eq. [4.24]. This completes the description of
the specifications. The slope of the rectifying line can be calculated and graphically it
is straight forward to identify the intersection point.
VI. Given Product Split, Residue Composition, and W/Dis calculate the N p, Reflux
Ratio R, and Reboil Ratio, B
Given the product split, residue composition and W/Dis the distillate composition
can be calculated. The feed composition can be calculated and cannot be specified. If
stated it would be a overspecification. Between the feed line, operating lines of
460

rectification and stripping as given in Eqs. [4.23-4.25) and the feed line, the abscissa
and ordinate of the intersection points and the R and B can be calculated by solving a
system of 4 equations and 4 unknowns.
VII. Given the Product Split, xDDis/xwW, W/Dis and Reboil Ratio, B, calculate Np, R,
x W.
Given the product split and W/Dis the distillate composition can be written in terms
of the residue composition. Using this information in Eq. [4.20] there remains three
simultaneous equations (Eqs. [4.23,4.24,4.25] and three unknowns to solve for the
intersection point ordinates and the residue composition. This completes the
description of the problem
VIII. Given W/Dis, Residue composition, xW, Reflux ratio, R calculate Np, Reboil ratio,
B and Product Split, xDDis/xwW
The distillate composition can be calculated from Eq. [4.26] given the W/Dis and
residue composition as the feed is completely specified. Now the product split can be
calculated. Graphically the operating line for the rectifying section can be
constructed. The intersection point with the feed line is identified in the graph. Given
the residue composition the operating line of the stripping section is constructed.
From the slope of the line the reboil ration can then be calculated. The number of
ideal stages can be stepped off the staircase graph.
IX. Given W/Dis., Reboil Ratio, B, Residue composition, xW, calculate Np, Reflux
Ratio, R, Product Split, Psplit xDDis/xwW
The distillate composition can be calculated from Eq. [4.26] given the W/Dis and
residue composition as the feed is completely specified. Now the product split can be
calculated. Graphically the operating line for the stripping section can be constructed.
The intersection point with the feed line is identified in the graph. As the distillate
composition is now available, the operating line of the rectifying section is
constructed. From the slope of the line the reflux ratio can then be calculated. The
number of ideal stages can be stepped off the staircase graph.
X. Given the Reflux Ratio, R, Reboil Ratio, B and Residue Composition, x W,
Calculate Np, Product Split, Psplit xDDis/xwW, W/Dis.
Given the residue composition and reboil ration the operating line of the stripping
section can be constructed. The intersection point with the feed line can be identified
in the combination graph of both the equilibrium and operating lines. Given the
reflux ratio the slope of the operating line of the rectifying section is calculated and
constructed. The intersection of the operating line of the rectifying section gives the
distillate composition. From the information gained the product split is now
calculable. The Np the number of ideal stages needed for a desired level of separation
can be stepped off from the staircase graph.
XI. Given Np, Reboil Ratio, B, Reflux Ratio, R calculate W/Dis, Residue compositiobn,
xW, Product Split, Psplit (xDDis/WxW)
This problem requires a iterative solution. Here is a suggested procedure:
Guess Distillate Composition, xD--------------
Calculate (xint, yint)
461
check
Calculate xW
Calculate Np --------------------------------------
XII. Given Np, Residue composition xW, Psplit (xDDis/WxW) calculate Reflux Ratio, R,
W/Dis, Reboil Ratio, B
Guess B, given residue composition the operating line of the stripping section can be
constructed. The intersection point with the feed line can be identified in the graph.
Given the product split and residue composition the distillate composition can be
calculated from Eq. [4.27]. From the distillate composition and the intersection point
the operating line of the rectifying section can be constructed. The Np can be stepped
off from the graph. This is compared with the given Np. Then the reboil ratio is
changed and the routine repeated until the calculated and given Np are identical
within numerical error.
XIII. Given Np, Reboil Ratio, B, Psplit (xDDis/WxW) calculate Reflux Ratio, R calculate
W/Dis, Residue composition, xW
Guess the residue composition, xW and given the reboil ratio the operating line of the
stripping section can be constructed. The intersection point with the feed line can be
identified in the graph. Given the product split and residue composition the distillate
composition can be calculated from Eq. [4.27]. From the distillate composition and
the intersection point the operating line of the rectifying section can be constructed.
The Np can be stepped off from the graph. This is compared with the given Np. Then
the residue composition is changed and the routine repeated until the calculated and
given Np are identical within numerical error.
XIV. Given Np, Reboil Ratio, B, W/Dis calculate Residue composition xW, calculate
Reflux Ratio, R, Psplit (xDDis/WxW)
Guess the residue composition, xW and given the reboil ratio the operating line of the
stripping section can be constructed. The intersection point with the feed line can be
identified in the graph. Given the W/Dis and residue composition the distillate
composition can be calculated from Eq. [4.26]. From the distillate composition and
the intersection point the operating line of the rectifying section can be constructed.
The Np can be stepped off from the graph. This is compared with the given Np. Then
the residue composition is changed and the routine repeated until the calculated and
given Np are identical within numerical error.
XV. Given Np, Residue composition xW, Reboil Ratio, B, calculate, Reflux Ratio, R,
Psplit (xDDis/WxW), W/Dis
Given the residue composition and reboil ratio the operating line of the strippping
section can be constructed in the combination graph. The intersection point of the
operating lines can be identified by letting the feed line intersect with the stripping
line. The three remaining variables are W/Dis, distillate composition. By trial and
error by a initial guess of reflux ratio, R, the other parameters are calculated. The Np
calculated is compared with the given Np.
462

XVI. Given Np, Reflux Ratio, R, W/Dis calculate Reboil Ratio, B, Psplit (xDDis/WxW),
Residue composition xW
Guess the distillate composition. Given the reflux ratio the operating line of the
rectifying section can be constructed in the graph. The intersection between this line
and that of the feed line is identified. Given W/Dis and the distillate composition the
residue composition can be calculated from Eq. [4.26]. The operating line for the
stripping section is then obtained by connecting the residue point on the y = x line
and the intersection operating point. The number of ideal stages can be stepped off
and then compared with the given Np. The procedure is repeated till the two values
come within numerical error of each other.
XVII. Given Np, Residue composition xW, Reflux Ratio, R calculate Psplit (xDDis/WxW),
Reboil Ratio, B, W/Dis
Guess the reboil ratio. Given the residue composition and reboil ratio the operating
line of the stripping section is constructed. From the feed line intersection with the
stripping line the intersection point is obtained. From the intersection point and the
reflux ratio the operating line of the rectifying section is constructed. The distillate
composition is calculated from the distillate point on the y = x diagonal. The
procedure is repeated until the calculated Np is within numerical error of the given
N p.
XVIII. Given Np, Reflux Ratio, R, Psplit (xDDis/WxW) calculate Reboil Ratio, B W/Dis,
Residue composition xW
Guess the distillate composition. Given the reflux ratio the operating line of the
rectifying section can be constructed in the graph. The intersection between this line
and that of the feed line is identified. Given product split and the distillate
composition the residue composition can be calculated from Eq. [4.27]. The
operating line for the stripping section is then obtained by connecting the residue
point on the y = x line and the intersection operating point. The number of ideal
stages can be stepped off and then compared with the given Np. The procedure is
repeated till the two values come within numerical error of each other.
XIX. Given Np, W/Dis, Psplit(xDDis/WxW) calculate Reflux Ratio, R calculate, Residue
composition xW Reboil Ratio, B
Given W/Dis and product split a relation between xD and xW can be established. This
can be solved simultaneously for two unknowns with the Eq. [4.27]. Guess the reboil
ratio. Construct the operating line of the stripping section. This intersects with the
feed line. The line connecting the intersection point and the distillate point is the
operating line of the rectifying section. The reflux ratio is calucalated. The Np
stepped from the graph is compared with the given value and the guess of the reboil
ratio changed until they match.
XX. Given Np, W/Dis, Residue composition, xW calculate Reboil Ratio, B, Reflux Ratio,
R, Product Split, Psplit (xDDis/xWW)
Given the residue composition and W/Dis from Eq. [4.26] the distillate composition
can be calculated. The product split is then calculated. Guess the reboil ratio.
Construct the operating line of the stripping section. This intersects with the feed
line. The line connecting the intersection point and the distillate point is the operating
line of the rectifying section. The reflux ratio is calucalated. The Np stepped from the
463
graph is compared with the given value and the guess of the reboil ratio changed
until they match.
7.12.7. Equilibrium Line

As can be seen from the discussions above and the worked example 4.1, the construct of
the equilibrium line is an important aspect to the design procedure due to McCabe and Thiele.
Use of stages was made. Here a refresher is provided on the understanding of equilibrium
between the vapor and liquid phases, VLE. This would provide the means to obtain the
equilibrium line and later the real line limited by diffusion resistances.
Every pure liquid exerts an equilibrium pressure, the vapor pressure in the gas phase. The
extent of the vapor pressure depends on the temperature. A typical P-T diagram for a pure
substance is shown in Figure 4.7. T is the tripe point of the substance where all the three
phases co-exist at one temperature and one pressure. The phase rule gives the degrees of
freedom in terms of the number of components and phases and is;
Ff = Nc + 2
The number of degrees of freedom, Ff is given by subtracting the number of phases from
the number of chemical species or components present in the system and adding 2. Thus for a
1 component system, the number of degrees of freedom for a two phase system can be seen
from Eq. [4.28] to be, 1. Thus if the pressure is specified, the temperature can be calculated.
When the number of phases is 3 the degrees of freedom become zero. This means that the
temperature and pressure at which the three phases co-exist in equilibrium cannot be varied
independently but are determinable values. This is also called the triple point of the pure
substance and is shown as T in Figure 7.16. Equilibrium is the state of the system when after
sufficient contact the compositions of the system and other parameters of the system such as
temperature and pressure do not change with time. It is at steady state. The curve TB in
Figure 4.7 can be seen to be the vapor pressure curve of the system. This gives the
temperature and pressure relationship of the 1 component, two phase system in equilibrium.
The points in the curve TB represent the saturated vapor and saturated liquid. The region
sectored by CTB is pure liquid. The region sectored by CTA is solid. This is when the
Pressure, P is high and temperature, T is low. The region bordered with ATB is pure vapor
and the region beyond the point B is gas. These are regions of high temperature, T and low
pressure, P. B is said to be the critical point and the corresponding temperature, Tc the critical
temperature and pressure, Pc the critical pressure. Beyond point B the liquid and vapor phase
are indistinguishable from each other. State of the system beyond this point is the gas. Gas
cannot be liquefied by pressure increase beyond this critical point. The temperature
corresponding to 1 atm pressure in the curve TB is called the normal boiling point of the
system. The path EF in Figure 4.7 is an isobaric process where the phase changes from liquid
to vapor upon supplying heat. The latent heat of vaporization at constant temperature is the
amount of heat per mole supplied to effect the phase change.
Vapor pressure data is scarce. The vapor pressure temperature curve TB can be
established by interpolation or extrapolation of available data using the Clausius Clapeyron
equation. The Clausius Clapeyron equation is;
464

dP/dT = vap/T(vv vL)
(4.29)
where vap is the latent heat of vaporization. The liquid molar volume can be neglected and
the vapor molar volume can be written assumingideal gas law as;
dP/dT = Pvap/RT2
(4.30)
Integrating both sides of the equation,

ln(P) = -vapR/T + c1
(4.31)
For a 2 component system with two phases the number of degrees of freedom can be
found to be from Eq. (4.28) to be 2. Thus if both the temperature and pressure of the system is
known then the compositions of the two phases are fixed and can be determined. This can be
represented as a Txy phase diagram for a vapor-liquid mixture. This would be important in
the equilibrium calculations during distillation as shown in the above sections. The VLE for a
binary system of species A and B where B is the more volatile are shown in Figure 7.18. The
Temperature vs y* is given by the DEW line and the temperature vs x is given by the bubble
line. The horizontal tie lines shown join the equilibrium mixtures of liquid and vapor phases.
tvu is a tie line. The compositions become fixed as the pressure and temperature are known.
There can be infinite tie line. The relative amounts of the two phases, liquid and vapor in this
example can be calculated as;
Moles (Liquid)/Moles(Vapor) = vu/vt
Figure 7.16. Phase Diagram of a Pure Substance.
(4.32)
465
The VLE data can be represented as a distribution diagram as shown in the lower part of
Figure 7.17. The greater the distance between the equilibrium line and the y = x diagonal
greater are the differences in composition between the vapor and liquid phases. A separation
factor can be defined or a relative volatility can be defined as follows in order to
quantitatively monitor the nature of the equilibrium line:
= (y*(1-x))/(x(1 y*))
When is 1 no separation is possible. Some examples of the distribution diagrams are
given in Figures 7.17, 7.18. Some of the systems shown exhibit the condition of azeotropy
where the two phases behaves like one phase and boils at a constant temperature.
Ideal solutions are first considered as a model for the liquid phase in the distillation
operations. It is good for several systems but may not be for all systems. Later special
provisions can be made for dealing with liquid phase systems that deviates from the ideal
solutions. For ideal solutions, the vapor phase partial pressure can be calculated from
knowledge of the composition of the liquid phase alone apriori to any experimentation. This
can be useful for systems where data is not readily available. Four characteristics that can be
mentioned for ideal solutions are;
1. The average intermolecular forces of attraction and repulsion in the solution are
unchanged on mixing of the constituents.
2. Volume of solution varies linearly with composition.
3. The mixing is adiabatic.
4. The total vapor pressure of the system varies linearly with the composition expressed
as mole fraction.
Real systems only approach the ideal solution in the limits. Search can be made from
among isomers, or compounds from a series with similar structure differing only with a
methyl group. The Raoult's law states that;
pA = pA* x
The partial pressure of the vapor phase in equilibrium with the ideal solution is given by
the product of the liquid phase composition and the pure component vapor pressure of the
component at that temperature. For dilute non-ideal solutions, the Henrys law states that;
y* = pA/P = mx
Where m is the Henrys law constant.
Other models for VLE in addition to the Raoults law are available in the literature. These
models are derived using the concept of fugacity and at equilibrium the fugacity of the
component in different phases are equal when at equilibrium. Activity coefficients are defined
for liquids. Van Laar, Margules, Wilson, NRTL and UNIFAC are some of the other models
that can be used to interpolate and extrapolate VLE data. The resulting information will only
466
be good for conditions where the data was measured and for those circumstances where the
assumptions of the model are reasonably good. When the sum of the partial pressures of the
components calculated exceeds the total system pressure deviations from ideality can be seen.
Examples of maximum boiling azeotrope and minimum boiling azeotrope are shown in
Figures 7.19 and7.29. Large positive or negative deviations from ideality can be seen for
some systems. Some systems are partially miscible. An example of such a system is the
isobutanol-water system as shown in Figure 7.18. When the sum of the component partial
pressures are less than the total system pressure negative deviations from ideality can be seen.
In a similar manner when the component pressures exceed the total system pressure positive
deviations from ideality can be seen.
Figure 7.17. VLE Phase Diagram of Two Component System.

Point k represents the tie line, tvu. B is the more volatile species.
Figure 7.18. Maximum Boiling Azeotrope.
Figure 7.19. Distribution Diagram of Isobutanol-Water Partially Miscible Systems.
467
468
Figure 7.20. Minimum Boiling Azeotrope in a Constant Pressure Txy Diagram & Distribution Diagram.
7.13. AZEOTROPIC DISTILLATION AND EXTRACTIVE DISTILLATION

Azeotropic systems are difficult to separate using binary fractionation methods.
Azeotropes as indicated in the above section are constant boiling mixtures where a two
component mixture behaves as a one component mixture. Some examples of binary
azeotropes are;
1)
2)
3)
4)
5)
6)
7)
8)
9)
10)
Tetrahydrofuran, THF/Carbon Tetrachloride

THF/Chloroform
Ethanol/Toluene
CS2/acetone
Acetone/Choloroform
Acetic Acid/Water
MMA/Methanol
Ethanol/Water
Acetone/Methanol
Acrylic Acid/Water
469

11)
12)
13)
14)
15)
16)
17)
18)
Ethyl Acetate/Ethanol
Hydrazine/Water
Methanol/Ethylacetate
n-Heptane/Ethanol
Methanol/Benzene
Ethylene Glycol/Water
Chloroform/Methanol
Ethanol/Benzene
In order to separate such systems a third component called the entrainer is added to the
system. The entrainer is chosen such that the volatility is in a fashion that a new azeotrope is
formed which is lower boiling and can be easily separated. For example, benzene is used as
an entrainer in the ethanol/water azeotropic system. The normal boiling points of ethanol is
78.3 0C, benzene 80.1 O C and that of water 100 0 C. Benzene is added as an entrainer to the
ethanol/water azeotropic system. At the right pressure the lower boiling binary azeotrope of
ethanol/benzene is formed and is boiled off. This system ethanol/water/benzene is reported to
form a ternary azeotrope. One method of separating the mixture is shown in Figure 7.20. The
water is collected as residue. The reboiler needs to be designed accordingly. The vapor from
the first column is condensed and fed into a second column. In the second column the
benzene is collected as a residue. The benzene/ethanol azeotrope is boiled off from the top of
the column 2. Another method of separating the mixture is by tapping into the formation of
ternary azeotrope. This boils at 64.9 0C. As this is lower than the normal boiling point of
ethanol, ethanol can be collected as a residue.
Table 7.3. Typical Number of Trays used in the Real World of Chemical Plants
S.No
System
1.0
2.0
3.0
4.0
5.0
6.0
7.0
8.0
9.0
10.0
11.0
12.0
13.0
14.0
15.0
16.0
17.0
Ethylene/Ethane
Propylene/Propane
Propyne/1,3 Butadiene
1,3 Butadiene /Vinyl Acetylene
Benzene/Toluene
Benzene/Ethyl Benzene
Toluene /Xylene
Ethyl Benzene /Styrene
o-Xylene/m-Xylene
Methanol/Formaldehyde
Dichloroethane/Trichlorethane
Acetic Acid/Acetic Anhydride
Vinyl Acetate/Ethyl Acetate
Ethylene Glycol/Diethylene Glycol
Acetic Anhydride/Ethylene Diacetate
Cumene/Phenol
Phenol/Acetophenone
Typical Number
of Trays
73
138
40
130
34,53
20
45
34
130
23
30
50
90
16
32
38
39,54
470

Some other examples of entrainers that can be used are as follows;
1. Butyl Acetate - Acetic Acid/Water
2. Hexane - MMA/methanol
3. Toluene - Hydrazine/water
In addition to toluene, aniline, benzene, pyridine, xylene, propylalchohols, cresol, glycol,

hexyl amine and glycol ethers can be used as entrainer to separate the hydrazine/water
azeotropic system. The normal boiling point of the acetic acid is 118.1 0C and that of water is
100 0C. In the first column glacial acetic acid is collected as the residue and the butlyl acetate
and water heteroazeotrope is boiled off at 90.2 0C. In the second column water is collected as
residue and the ester-water azeotrope is collected as an overhead product. A decanter can be
used in between to let the ester rich and water rich layer separate.
Some of the criteria for the choice of the selection of entrainer;
1. Choice of entrainer is most important consideration
2. Added compound should form a low boiling azeotrope with only one of the
components of the binary mixture
3. It has to have the lowest composition of the three to minimize energy Requirements
4. New azeotrope should have sufficient volatility to make it readily Separable
5. Residue should be lean in entrainer contents
6. Must be inexpensive and readily available
7. Chemical stability high and does not react with the component to be separated
8. non-Corrosive toward common construction materials
9. non-Toxic
10. Low latent heat of vaporization
11. Low freezing point and can be easily stored outside
12. Low viscosity to produce high tray efficiencies
Extractive distillation is a technique where the third component added to the system acts
as a solvent for one of the components. The solution is removed as the residue as the other
component will be the more volatile species and therefore removed as an overhead product
from the top of the first distillation column. The solution is separated in a second distillation
column with the solvent as the residue and the dissolved component as the overhead product.
The solvent is recycled back to the top of the first distillation column. For example the
acetone/methanol system forma binary azeotrope and is difficult to separate. A solvent such
as butanol is used and the acetone dissolves in the butanol. The normal boiling point of
acetone, methanol and butanol are 56.4 0C, 64.7 0C and 117.8 0C respectively. As shown in
Figure 7.21, as the acetone dissolves in butanol the VLE changes such that the azeotrope is no
longer present. Methanol although less volatile than acetone is removed as an overhead
product from the column A and the butanol is collected as the residue from column B. The
residue from column A, the solution of acetone in butanol is feed into column B and the
acetone is collected as an overhead distillation product from column B. Thus butanol served
as an extractive solvent. Another example of an extractive solvent is acetone or furfural to aid
in the separation of buetten-2/n-butane mixture. Phenol is used as a solvent in the separation
of toluene/isooctane mixture. The second column is an auxiliary column. The solvent changes
471
the relative volatility of the binary system. The solvent itself, a low boiler does not enter into
the rectifying section much.
The requirements of an extractive distillation solvent are as follows;
1. High Selectivity ability to change VLE of original mixture in such a fashion that
easy separation is permitted
2. High Capacity to dissolve the components of the system
3. Low Volatility must not enter the overhead condensers
4. Separability Solvent must be readily separated from the mixture to which it is
added
5. Solvent must not form azeotrope
6. Low cost
7. Less Toxic
8. non-Corrosive
9. Good Chemical Stability
10. Freezing Point suitable for storage
11. Viscosity
12. Optimal solvent circulation rate low rate may indicate many stages and large rates
require fewer trays but higher circulation costs
Figure 7.21. Azeotropic Distillation of Ethanol/Water using Benzene as Entrainer.
472
In both azeotropic and extractive distillation an extraneous third component is added to

the system. This is not desirable. It may surface as impurities in the product. Solvent losses to
the tune of 1000 ppm can add to the cost of the process. The required solvent/feed ratios are
often 3 or 4 for an effective separation. Materials of construction problems increase with the
treatment of an additional chemical. Despite these problems it is the choice of separation in
some cases. Generally speaking, extractive distillation is more desirable compared with
azeotrpic distillation since;
1. there is a greater choice of added component
2. no need for another azeotrope to form
3. smaller quantities of solvent must be volatilized
As an exception is the ethanol/water system using n-pentane as entrainer. This is because
n-pentane azeotropes with water. This is less expensive compared with extractive distillation
with ethylene glycol. As the volatilized impurity is a minor constituent of feed and azeotrope
composition is favorable the cost is less.
Figure 7.22. Extractive Distillation of Acetone/Methanol with Butanol as Solvent.
473
7.14. SUMMARY
Ratio control is used in keeping the reactor adiabatic during the manufacture of flue gas.
Heat of reactions from Boudard reaction and oxidation of carbon reactions are made to cancel
out each other by control of the ratio of the CO2/air mixture. The control scheme is shown in
Figure 8.1. The energy balance equations are derived in detail.
SPC, statistical process control methods are discussed including Demings quality
principles, QIT, quality improvement teams. SPC, statistical process control refers to a set of
methods and techniques of monitoring and control of a process so that the process is operated
close to design premises. SPC is different from APC, automatic process control. In SPC
control, the cause and effect analysis would lead to knowledge of source of disturbance
among other things. Action on removal of the source of disturbance would result in decreased
load on the control elements as compared with APC. The pressure fluctuations from a
fluidized can be measured and used to control the expected quality of fluidization. Control
charts are used in manufacturing units to delineate random noise and variability in process
variables that can have Attributable causes. No control action is needed when the variation is
due to random noise. Control action can be initiated when the Attributable cause is identified.
Variability found can be classified into 4 different categories. A prototypical control chart
with UCL and LCL control limits is displayed in Figure 7.3. Let the UCL and LCL be at a
distance km from the mean value of the measurements, m. Calculation of control limits
from use of statistical distributions such as normal distribution is given by Eq. (7.13). Sample
variances can be plotted in an S chart. The control limits for an S chart is given in Table 8.1.
IMC, internal model control uses the mathematical model developed for the process.
Perfect control is achieved when model transfer function, M(s) is the reciprocal of process
transfer function, Gp(s). A filter has to be added to make the system realizable. This keeps the
numerator of the transfer function of the combined system at a lower degree of polynomial
compared with the degree of the polynomial of the denominator of the transfer function of the
system. Inversion of a process model alone may not be sufficient for good control. In order
for the controller to be stable and realizable the process transfer function must be factorized.
Examples are given. In order to make M(s) proper the order of the filter in some cases is
increased.
A lead/lag controller was considered by use of a model based transfer function as given
by Eq. (8.45). Inverse response is expected for the process. A first order filter was added to
make the system more proper. The order of the filter was increased to two. The output
function is given by Eq. (8.54) and plotted in Figure 8.9. It can be seen from Figure 8.9 that
there is an inverse response for values of = 1.0 and = 0.1. Although Figure 8.9 is for the
indicated values of and in general Eq. (8.54) results in an inverse response. For larger
values of there is a minima present prior to the inverse response. What can be inferred from
this analysis is that the inverse response of the process cannot be removed by a stable filter or
stable control system.
Feed forward control is different from feedback control. During feed forward control the
load or disturbance is measured or gauged from other considerations and control action taken
accordingly. Carrier corporation has patented [11] a feed forward control system for
474
absorption chillers. The feed forward control method comprise of the following steps; (i)
determine the disturbance transfer function; (ii) determine the capacity valve transfer
function; (iii) measure the occurred disturbance; (iv) implement the feed forward control
function. The block diagram for feed forward control of absorption chillers is shown in Figure
8.11. An example of feed forward controller for a regulation of fuel supply to a furnace was
discussed.
Estimation and control of polymerization reactors was discussed. Control of
polymerization of reactors is a difficult task because of the exothermic nature of the
polymerization reactions and higher viscosities of monomer/polymer syrups encountered in
the reactor. The objective of the reactor control is to obtain superior product quality. Quality
is characterized by different parameters. Good structure-property relations are needed for
devising control strategies based on measurement of end-use property values. Technical
hurdles during the development of mathematical models for polymerization reactors are the
nonlinear equations encountered sensitivity to impurities etc. Feedback control of a variable is
not possible if the parameter cannot be measured or estimated. In Figure 8.13 is shown the
scheme for possible feedback control configurations. The scheme comprises of state-model,
subsystem 1, subsystem 2 and the measurement equations. State estimation techniques have
been developed to provide estimates of the state variables even in cases where they cannot be
obtained by direct measurement. Estimation techniques such as Kalman filter, Weiner filter
and extended Kalman filter may be used. In non-linear estimation problems the objective may
be to minimize the average squared errors in the initial estimate in the process model and in
measurement device. Jo and Bankoff [13] developed a Kalman filter in order to obtain
estimates of conversion and Mw, weight averaged molecular weight. The Kalman filter is an
on-line computer algorithm which is intended to provide better estimates of the state variables
that be obtained by direction solution of measurement equations. If the system is
observable, optimal estimates of variables that cannot be measured directly can be made.
Congalidis, Richards and Ray [14] discuss different approaches to the control of
polymerization reactors. They write species mole balance equations for initiator, monomer,
CTA, etc. They suggest feed forward control strategy for their recycle streams polymer etc.
Energy balance equation is also written for the temperature of the reactor. The molecular
weight was found to have an inverse response with the residence time in the reactor.
Feedback controllers were evaluated for polymer properties and production rate. They discuss
use of CONSYD package of control system design programs. The controllers will not operate
efficiently when the assumptions in their derivations are not met.
required precision. Three different architectures for ANNs, artificial neural networks are
possible. The behavior of each unit in time can be described using either differential
equations or discrete update equations. The use of ANNs to control a distillation column is
discussed. A refresher was provided on methods and theory of distillation in Chapter 6.0.
Control of any process system depends on the availability of suitable models that captures all
the major phenomena of the system. Mathematical model of a distillation column can contain
hundreds of state variables. The model equations tend to be nonlinear. The range of operating
conditions is wide. ANNs can be trained offline in order to model the nonlinear inverse
dynamics of the process with a pre determined level of accuracy. Training pairs were
generated from such simulation results in [6] for training the neural controller.. The state
variables of the distillation column that were selected in the estimator are: flow rate;
475
temperature and compositions of the three components for the bottom and overhead products;
and temperature and three component compositions for the by-product as side stream. The
input to the estimator consists of the reboiler heat valve setting, condenser temperature,
current feedrate, and the limited state vector at two previous sample times. The estimator is
trained to provide as output a prediction of the limited state vector at the current time. The
estimator is a fully connected feed forward network with 31 linear input neurons, 14 linear
output neurons, and 157 nonlinear sigmoid neurons distributed over two hidden layers. In
order to investigate the capability of the trained controller to control the distillation column,
the neural controller is connected to the neural estimator.
Typical solar aided combined cycle power plant is discussed. Continuous pharmaceutical
operations are emerging. The azeotropic distillation and 20 different specification problem
types distillation needs advanced control methods. Single layer grapheme sheets needs to be
manufactured in large scale at lower costs. Some interesting control issues are associated with
the roll to roll transfer process. Biochemical reactions and design of bio artificial pancreas
needs separate control strategies.
7.15. GLOSSARY
Control Objective: The purpose for performing the control action. For example the
objective of control of polymer reactor is superior product quality. There can be more than
one control objective.
Exothermic Reaction: Chemical reactions when there is a spontaneous liberation of of
heat. Enthalpy change is negative.
Nonlinear Process: The governing equation for the process output variable such as
fractional conversion or temperature of the reactor is not a linear differential equation.
Polymer Structure: Polymer can be characterized by its structure. Structures can be
molecular chain structure, tautomeric structure, microscopic structure, behavior in solution,
crystallographic structure, macrostructure etc. Molecular weight distribution is an example of
structural parameter.
Kalman Filter: linear Quadratic estimate of unknown variable from series of noisy data
of measurable variable. The Apollo mission to the moon had four Kalman filters.
Estimation Technique: The method used in order to obtain the information from the
measured data. For example, Weiner filter or Kalman Filter or Low pass filter
Weiner Filter: Linear filter. Estimates obtained by minimization of least square error
found in the measured data from random process
CPFR Continuous Plug Flow Reactor: Raw materials, catalyst and additives are input
into a tubular reactor and the product and unreacted raw materials are collected from the
effluent of the reactor in a continuous manner. The flow in the tube is plug flow, i.e. there is
no mixing between the late elements and early elements of the fluid. The velocity of all the
different layers of the fluid are constant. When the velocity profile is parabolic the reactors
are called parabolic flow reactors.
HCSTR, Homogeneous Continuous Stirred Tank Reactor: Raw materials, catalyst
and additives are input into a tubular reactor and the product and unreacted raw materials are
collected from the effluent of the reactor in a continuous manner. All the elements within the
476
reactor are homogenized by use of an agitator. The effluent concentration of the important
species and the reactor concentration of the same species are the same.
SCSTR, Segregated Continuous Stirred-Tank Reactor: A set of batch reactors that
operate in parallel with the same age distribution. For example suspension polymerization
without coalescence is a said to be a SCSTR.
Molecular Weight: The molar mass of a concatenated chain polymer with certain degree
of polymerization.
Molecular Weight Distribution: The statistical distribution of molar masses found in a
given sample. The MWD may be characterized by moments of the distribution such as mean
and variance. It can be fitted to the Gaussian normal distribution.
Schulz-Flory Distribution: Statistical distribution named after P. Flory and G. V. Schulz
used to describe the relative ratios of polymers of different length based on their relative
probabilities of occurrence.
Poisson distribution: Discrete distribution with the same mean and variance,. For
example the number of typos made by a good typist can be described using Poisson
distribution. Arrival of guests at a event can be described using Poisson distribution.
Probability of the first couple of possibilities will be high and the rest will decrease in
probability with increase in number of possibilities. The first error and second error of the
typist will have higher probability and the probability of x errors will decrease with increase
in x.
Polymer Composition: The chemical elemental mix of the polymer. For example SAN
copolymer contains 75 wt % styrene and 25 wt % of acrylonitrile. The chemical elements
present in the copolymer are carbon, hydrogen, and nitrogen.
Chain Sequence Distribution: The probability of dyads, triads, tetrads, pentads, etc. of
one repeat unit in a copolymer. More than 2 repeat units can be present in the copolymer.
Block Microstructure: Copolymer made out of blocks of repeat unit is said to have
block microstructure. When all the present members of two species are found next to each
other concatenated the copolymer is said to have a diblock architecture. A triblock copolymer
is when the species concatenate as three blocks. AAABBBBBBB is a 30/70 diblock
copolymer of repeat units A and B. Triblock copopolymer for example would look like
AAABBBBBBBBAAA.
Alternating Microstructure: Pronounced in a copolymer with two monomers.
Architecture is alternating, i.e., ABABABABABABA. Multicomponent copolymer with
more than 2 repeat units can alternate. For example ABCABCABC.is a lternating
terpolymer with monomers A, B and C repeat every third unit from it.
Multivariate Distribution: When there are more than independent random variable the
distribution is said to be multivariate.
Control Theory: Description of dynamical systems with inputs. Controllers are used to
manipulate noisy inputs and provide a desired output.
State Estimator: Variables introduced that can be estimates of real values underlying
observed data
Observable System: System that can be measured and estimation techniques can be
meaningfully applied
Corresponding Sequential Estimation: Sample size is not fixed a priori. As data arrives
sampling is stopped according to stopping rules.
477
Nonlinear Estimation: A set of m values can be fit to n parameter non-linear model

using least squares estimate.
Feedback Controllers: Control action based upon the error between the measurements
of the process variable and set point.
Feedforward Control: Control action taken a priori to any feedback from the process
variable. Disturbance measured or gauged and used in control action taken.
Controller Tuning: Quantities such as controller gain kc, controller time constant, c and
other parameters can be varied in order to achieve a desired output response. This process is
called controller tuning.
Jacket Temperature: The temperature of the steam in the jacket of the kettle is the
jacket temperature
Damkohler Number: The ratio of the reaction time to the mass transport time is called
the Damkohler number. Different expressions can arise depending on the kinetics of the
reactions such as its order, or mechanism such as free radical or autocatalytic, etc.
5th Order Runge Kutta Method: The numerical solution method in order to solve ODE.
The increment function has 7 weights. It represents a certain slope of the function. Error falls
rapidly with effort to low levels.
Inverse Response: The output function decreases with increase in input function.
Online Gas Chromotograph: Sensor that is used during the performance of the process
that can be used to obtain the composition of the species of interest. Sample is eluted in a
column of adsorbent. The elution times are used to determine the species type.
Condition Number: Index used to evaluate and select controller schemes.
CONSYD Package: Integrated Software for Compuater Aided Control System Design
and Analysis
IMC, Internal Model Control: Control action arrived at based on a mathematical model
of the process
Filter Tuning Parameter: Filters are added in order to make the system physically
realizable. The parameters of the filter are the tuning parameters
more proper: By adding a filter an otherwise physically unrealizable system can be
made to be physically realizable. For instance, when the degree of the numerator of the
system transfer function is greater than the degree of the system transfer function in the
denominator the system is said to be physically unrealizable. When a filter is added with a
transfer function that makes the degree of the denominator higher the system becomes
physically realizable. This is said to make the system more proper.
7.16. FUTHER READINGS

Bi and Grace, J. R. (1995). Flow Regime Diagrams for Gas- Solid Fluidization and Upward
Transport, International Journal of Multiphase Flow, Vol. 21, 6, 1229-1236.
Chapra, S. C. & Canale, R. P. (2006). Numerical Methods for Engineers, 5th Edition, McGraw
Hill Professional, New York, NY.
Congalidis, J. P., Richards J. R. & Ray, W. H. (1989). Feedforward and Feedback Control of
a Solution Copolymerization Reactor, AIChE Journal, Vol. 35, 6, 891-907.
478
Deming, W. E. (2000). The New Economics for Industry Government and Education, MIT
Press Boston, MA.
Daw, C. S. & Hawk, J. A. (1995). Fluidization Quality Analyzer for Fluidized Beds, US
Patent 5, 435, 972.
Elicabe G. E. & Meira, G. R. (1988). Estimation and Control in Polymerization Reactors. A
Review, Polymer Engineering and Sci., Vol. 28, 3, 121-135.
Geldart, D. (1973). Types of Fluidization, Powder Technology, Vol. 7, 285-292.
Jo, J. H. & Bankoff, S. G. (1976). Digital Monitoring and Estimation of Polymerization
Reactors, AIChE Journal, Vol. 22, 361-369.
Kelly, B., Herrmann, U. & Hale, M. J. Optimization Studies for Integrated Solar Combined
Cycle Systems, Proc. of Solar Forum 2001 Solar Energy: The Power to Choose, April
21st 25th, Washington, DC.
Kolk, R., Martini, D. M., Sheetan, D. & Jenkins, N. (2004). Feedforward Control for
Absorption Chiller, US Patent 6,742,347, Carrier Corporation, Farmington, CT.
Montgomery and Runger, G. C. (2007). Applied Statisticsand Probability for Engineers,
Fourth Edition, John Wiley & Sons, Hoboke, NJ.
McClellland, J. L., Rumelhart D. E. & Hilton, G. E. (1986). The Appeal of Parallel
Distributed Processing in D. E. Rumelhart & J. C. McCelelland (Eds.) Parallel
Distributed Processing Explorations in the Microstructure of Cognition, MIT Press,
Cambridge, MA
Renganathan, K. (1990). Correlation of Heat Transfer Coefficients with Pressure
Fluctuations in Gas-Solid Fluidized Beds, Ph.D. Dissertation, Department of Chemical
Engineering, West Virginia University, Morgantown, WV.
Smith, G. M. (1998). Statistical Process Control and Quality Improvement, Prentice Hall,
Upper Saddle River, NJ.
Steck, J., Krishnamurthy, K., Mcmillin, B. & Leininger, G, (1991). Neural Modeling and
Control of a Distillation Column, Proceedings International Joint Conference on Neural
Networks, Seattle, WA.
Stephanopoulos, G. & Erickson, L. E. (1985). Biological Reactors. Chapter 13, in Chemical
Reaction and Reactor Engineering, Carberry J. J. and Varma, A., Marcel Dekker, Inc.,
New York.
Sharma, K. R. & Turton, R. (1998). Mesoscopic Approach to Correlate Surface Heat
Transfer Coefficients using Pressure Fluctuations in Dense Gas-Solid Fluidized Beds,
Powder Technology, 99, 2, 109-118.
Sharma, K. R. (1998). Periodicity in Pressure Fluctuations in Gas-Solid Fluidized Beds,
Fluidization IX, Durango, CO, USA.
Sharma, K. R. (2007). Principles of Mass Transfer, Prentice Hall of India, N. Delhi, India.
Sharma, K. R. (2010). Nanostructuring Operations in Nanoscale Science and Engineering,
McGraw Hill Professional, NY.
Sharma, K. R. (2012). Polymer Themodynamics: Blends, Copolymers and Reversible
Polymeization, CRC Press, Boca Raton, FL.
Smith, J. M., van Ness, H. C. & Abbott, M. M. (2005). Introduction to Chemical Engineering
Thermodynamics, 7th Edition, McGraw Hill Professional, New York, NY.
Sturis, J., C. Knudsen, N. M. OMeara, et al., Phase-locking regions in a forced model of
slow insulin and glucose oscillations, in J. Belair, L. Glass, U. An der Heiden, and J.
479
Milton (eds.), Dynamical Disease: Mathematical Analysis of Human Illness, Woodbury,

NY: AIP Press, 1995.
EXERCISES
1.0. Batelle/FERCO Low Pressure Process for Hydrogen
Hydrogen is produced by a water-gas shift reaction of syngas. An alternative to fossil
fuels is hydrogen. Hydrogen is manufactured from renewable resources such as
sunlight, wind, and biomass and is more environmentally friendly. The
Batelle/FERCO low-pressure process involves gasification of the biomass followed
by steam reforming of the syngas produced. Pressure swing adsorption is used to
separate the hydrogen from the unreacted raw materials and by-products. This
process is used at the existing McNeil small power plant in Burlington, Vermont.
The biomass feed rate for the inlet stream shown in Figure is 314 Mg/day. The
effluent from the gasifier is separated and purified using cyclones. Steam reforming
is followed by L.T. and H.T. steps. The calorific value of hydrogen is 141.8 MJ/kg.
The gasifier is operated at low pressure and high temperature. The steam reformer is
operated at high temperature and high pressure. The plant can be assumed to be
operating at 80% capacity utilization during the year. What is a good control scheme
for this process ? What advanced control concepts discussed in Chapter 7.0 are
applicable for this process ?
2.0. Bioethanol from Sugarcane Bagasse
There are two processes to use sugarcane bagasse. In Process I as shown in Figure
7.18 the sugarcane bagasse is used as fuel in steam boilers. The steam produced is
allowed to operate a turbine and electricity is generated. In Process II the hemicellulose in bagasse is treated with dilute sulfuric acid and steam in a high
temperature, short residence time reactor. The cellulose and pentose are hydrolyzed
in a second unit. The reactant and product mixture is separated using distillation in
order to produce furfurol and ethanol. What are the differences in the control strategy
that can be deployed for Process I and Process II ? What are the control variables ?
What ought to the control objectives ? What advanced control methods discussed in
Chapter 7.0 are applicable for Processes I and II ?
3.0.
Combustion Flame Synthesis Process for Production of Fullerene
Fullerenes are a distinct allotrope of carbon. C60 is its structural formula. Hexagons
and pentagons of carbon atoms for a cage-like structure that looks like a soccer ball.
The nobel prize was given in 1996 to H. Kroto, R. Smalley and R. Curl for their
discovery of fullerenes. Sharma (2010) discussed the reduction in process cost from
$25,000 per kg in the Arizona process, $16,000 per kg in the first generation flame
synthesis process down to $200 per kg in the second generation flame synthesis
process. The second generation flame synthesis process comprises of two plug flow
reactors in series. A oxy-benzene flame that is flat is generated. The feed flow rate
determines the temperature in the first reactor. Vacuum conditions are maintained in
the chamber. This has been found to be needed in order to generate the fullerenes.
The O/C, oxygen/carbon ratio can be changed in order to increase the yield and
480

purity of the fullerene production. Turbulence is found to enhance the micromixing
and diffusion in the reactor. The flame can be considered as diffusion flame. The
fullerene laden gas from the effluent of the reactor can be separated into fullerenes.
The yield is sufficient for scale-up to commercial production quantities. Factories in
Japan and USA produce fullerenes at a capacity of ~ 40 tons per year. Distance from
the burner is variable of choice to look for fullerene production. The residence time
in the two reactors are 5 ms and 15 ms respectively. The pressure in the first reactor
is 10-400 torr and temperature is in the range of 1500 2500 K in both the reactors.
What ought to the control strategy for this process ? Which of the advanced control
methods discussed in Chapter 7.0 is applicable for this process ? Is feedback control
discussed in Chapter 5.0 sufficient ? What ought to be the control variables ?
Figure 7.17. Biomass to Hydrogen: Gasification, Separation, Steam Reforming and Separation by
Preesure Swing Adsorption.
Figure 7.18. Process I: Combustion of Sugarcane Bagasse to Generate Steam and then Electricity
Process II: Sugarcane Bagasse to Ethanol and Furfural: Acid Hydrolysis and Separation.
481
4.0.
Hydrogen by Fast Pyrolysis and Steam Reforming
Hydrogen can be manufactured by fast pyrolysis of biomass followed by steam
reforming. Biomass is dried and then converted to oil by fast exposure to hot
particles in a fluidized bed. The thermal energy needed for operation of the reactors
may be obtained from combustion of chars and gases that were produced from the
biomass. The oil products are condensed and cooled. Bio-oil is shipped in trucks to
the hydrogen production unit. Shipment of bio-oil would be less expensive compared
with the transport of biomass. This is because of the higher energy density of bio-oil
compared with biomass. Bio-oil is fractionated into carbohydrate and lignin fractions
using water extraction. Carbohydrate fraction is reformed. Hydrogen generated is
separated from other products using PSA, Pressure Swing Adsorption. What ought to
the control strategy for this process ? Which of the advanced control methods
discussed in Chapter 7.0 is applicable for this process ? Is feedback control discussed
in Chapter 5.0 sufficient ? What ought to be the control variables ?
5.0. Rice Bran Oil as Feedstock for Hexane
Rice-bran lipids can be extracted using hexane solvent from rice bran at a yield of
26%. Rice is milled in order to produce the white ling-grain rice sold in
supermarkets. The outer layers of the rice kernel are removed. These outer layers of
the rice kernel are removed. These layers include the hull, the germ and the bran. The
bran includes the testa, peripcarp, nucellus and aleurone layers. Rice bran becomes
rancid and to be discarded in landfills. Parboiled rice bran has higher lipid levels
compared with unstabilized rice bran. Rice-bran oil consists largely of saponifiable
compounds. What ought to be the control strategy for the hexane extraction unit ?
What are the control variables ?
6.0. Ammoxidation of Glycerol to Acrylonitrile
Acrylonitirle can be manufactured from glycerol in a catalytic fluidized bed reactor.
Ammonia and Oxygen are added to glycerol to form acrylonitrile and water as
products. The reaction is as follows;
CH3OH-CH3OH- + NH3 + 0.5 O2 CH3CN + H2O
-CH3OH
Triglycerol + Ammonia + Oxygen Acrylonitrile + Water
The glycerol is reacted in the vapor phase with ammonia and oxygen in the presence
of an acid catalyst. The reaction temperature is about 400-500 0C and reaction
pressure is ~ 1 5 atm. Pressure. The acid catalyst is an oxide of aluminum, nickel,
etc. The ammonia/glycerol molar ratio is ~ 1 1.2 and oxygen/glycerol ratio is in the
range of 0.5 10.0. Which is the best physic-chemical system that can be controlled
in this process ? What ought to be the control objectives ? Which process variables
needs to be measured using sensors and suitable instrumentation ? Which of the
process variables are input variables and which are manipulatble ? What are suitable
process constraints ? Which is the best control strategy from among feedback,
feedforword and the number of control methods discussed in Chapter 7.0.
7.0. Continous Mass Polymerization of Vinyledene Difluoride
482

High melting temperatures of PVDF makes the separation process energy intensive.
Centrifugation or atomization may result in less energy cost compared with
extrusion. Continuous solution free radical processmay be used in order to make
PVDF followed by fluidized bed devolatilizer for separation. The temperatures of the
devolatilizer is ~ 120- 220 0C. The reactor temperature is about 110 0C and reactor
pressure is about 200 atm. What ought to be the control objectives ? Which process
variables needs to be measured using sensors and suitable instrumentation ? Which
of the process variables are input variables and which are manipulatble ? What are
suitable process constraints ? Which is the best control strategy from among
feedback, feedforword and the number of control methods discussed in Chapter 7.0.
8.0. Butadiene Monomer Reclaimation from Waste Tires
Over 2 billion waste tires are estimated to be stockpiled in the landfills of this
country, United States. The number of tires used in cars on the roads in the U.S. is
more than one billion. China has 9.83 million passenger vehicles registered in the
first eight months of 2011. 292 million automobile tires are discarded every year. In
Texas state 32 million tires were thrown away this past year. 5 million tires form a
mountain in Odessa and another 809,000 are piled on the side of Genoa Red Bluff
Road in Southeast Houston, Texas. Tires thrown in landfills are against the law for
the past two decades. Piled up tires collect water and leads to pandemic caused by
spread of West Nile virus. A tire mountain in Ciudad Juarez, Mexico, across the Rio
Grande from El Paso, TX has gone down some from 7 million tires to 2.5 million
tires. Several old tire fires have been reported in Canada and U.S.
The energy needed to make 1,3 butadiene monomer is 60,000 BTU per pound. The
fuel energy value of tire is ~ 15,000 BTU per pound. Monomer reclamation from
waste tires may be more profitable compared to its use as fuel.. Given the cost of
generation of butadiene monomer and polybutadiene and tire manufacture good uses
for waste tires are needed. High performance rubber asphalt concrete based on stone
mosaic asphalt, SMA can be used to resist differential frost along highways. Tireadded latex concrete TALC was developed to include recycle tire rubber as part of
concrete.
The P-T diagrams for PBd can be constructed from the Tait equation of state.
The ceiling temperature of PBd is 585 C at atmopsheric pressure. Butadiene
monomer can be recovered by a two step process of swelling and de-vulcanization of
cross-linked PBd rubber chains followed by unzipping of the linear PBd chains. The
reactor temperature is about 635 0C and reactor pressure is 0.1 atm. NMP, N-methyl2-Pyrrolidone can be used to swell the rubber and acid may be used to unhook the
sulfur used for cross-links amongst the PBd chains.
What ought to be the control objectives ? Which process variables needs to be
measured using sensors and suitable instrumentation ? Which of the process
variables are input variables and which are manipulatble ? What are suitable process
constraints ? Which is the best control strategy from among feedback, feedforword
and the number of control methods discussed in Chapter 7.0.
9.0. Enzymatic Process for Production of Acrylamide
Acrylamide can be made by hydrolysis of acrylonitrile with the aid of the enzyme
nitrile hydratase. Metabolic pathways of sequential metabolism of nitriles in bacteria
are due to nitrole hydratase and amidase enzymes. The genome of M. Brevicollis has
483
a sequence that has been found to encode for nitrile hydratase. The gene transcription
and translation to rto protein and the signals to effect the enzymatic function is
mapped. The process comprises of a reactor and a separator. Which is the best
control strategy from among feedback, feedforword and the number of control
methods discussed in Chapter 7.0.
10.0. Hydrogen Production by Copper-Chlorine Thermochemical Cycle
Thermal energy from nuclear or solar irradiance can be used for production of
hydrogen. This is achieved using a hybrid copper-chlorine, CuCl cycle. 125 MT
H2/day production rate requires 210 MW of thermal energy and 87.8 MW of
electrical energy. There are three major reaction in the process; (i) Electrolysis
Reaction; (ii) Hydrolysis of Cuproc Chloride leads to formation of Copper
oxychloride and; (iii) Molten Cuprous Chloride is produced by decomposition.
(i) 2CuCl + 2HCl + 4H2O 2CuCl2.2H2O (anode) + H2 (cathode)
(ii) 2CuCl2 + H2O CuOCl2 + 2HCl
(iii) CuOCl2 0.5O2 + 2CuCl
variables are input variables and which are manipulafigure ? What are suitable
process constraints ? Which is the best control strategy from among feedback,
feedforword and the number of control methods discussed in Chapter 7.0.
11.0. Ethanol Production by Fermentation
In order to deliver bioethanol to a newly proposed city distilleries were built. Starch
is hydrolyzed and enzymatically saccharified in a series of agitated vessels. Glucose
is sugar and Sacchromyces Cerevisiae is the yeast organism. pH of the vessel can be
maintained in order to optimize the metabolism in the yeast organism. Oxygen is
added to the vessel. The yeast cells are separated from the substrate and ethanol
using a centrifuge. The ethanol is further refined using distillation. The reactor
temperature is ~ 68 104 0F and pH range is ~ 2.5 5.5. Enzyme can catalyze the
formation of ethanol.
variables are input variables and which are manipulatable ? What are suitable process
12.0. Hydrogenation, Deodourization and Decoloration
Vanaspati is a solid and is used in households in India as oil needed in vegetarian
cooking. Other similar products are vegetable ghee, hardened industrial oils and
partially hydrogenated liquid oil. Well stirred reactors are used for hydrogenation of
oils in order to remove the unstaturation in oils and to raise the melting point of the
fats and improve the resistance of oils to rancid oxidation. Vacuum tower is used to
deodourized the hydrogenated oil. Fullers earth is used as in adsorption towers in
order to decolorize the hydrogenated oil. The adsorption isotherm obeyed by the
adsorbent is Langmuir isotherm. The color concentration is reduced from 20 to 5
color units in the adsorption tower.
484

variables are input variables and which are manipulatable ? What are suitable process
13.0. Adsorption Tower for Magnesium Chloride
Sea water contains a number of salts. One example is Magnesium Chloride at 1.3
gm/liter concentration. The NaCl, common salt concentration is 3.6 wt% in sea
water. Montmorillonite clay can be used as adsorbent. Sea water feed solution can be
made to come in contact in a counter-current manner with monotmorllinite clay.
Crystalline Magnesium Chloride can be made from adsorption process. The
Langmuir type adsorption has been found to take place for this system. Upon the
adsorbent reaching a saturated state the adsorbed Magnesium salts can be desorbed
using pure water. A supersaturated solution of Magnesium chloride can be pumped
across a crystallizer and Magnesium chloride crystals formed.
What ought to be the control objectives for the adsorption tower and crystallizer ?
Which is the best control strategy for the adsorption and crystallization unit
operations ? What are the control variables and input variables ? Enumerate the
process contraints.
14.0. Sugar Crystals
Sugarcane from the farms are crushed using a jaw crusher and the sugar cane water is
made. The bagasse is separated and sent to a facility as feedstock for enzymatic
creation of bioethanol. The sugar water is pumped across a triple effect evaporator.
The number of stages used in this step is optimized for minimal total cost. As the
number of stages is increased the amount of steam used will increase running the
utility bill up. Fewer stages would mean higher capital equipment cost and less utility
cost. There exist an optimal number of stages for minimal total cost. The sugarcane
water is decolorized in a adsorption tower. Linear isotherm is obeyed by the
adsorbent. Upon evaporation sugar is harvested in crystalline form.
What ought to be control objevtives for; (i) Crusher; (ii) Decolirizind Adorption
tower; (iii) Triple Effect Evaporator and; (iv) Crystallizer. Which is the best control
strategy that can be deployed for each of the unit operation. Discuss the process
contraints for each unit operation.
15.0. Separation of p-Xylene from its Isomers
The method of choice for separation of isomers is adsorption. Zeolite can be used as
adsorbent in counter-current adsorption continuous operations. A mixture of para
xylene, ortho xylene and metal xylene can be brought in contact in a counter-current
manner with zeolite adsorbent. On account of the differences in molecular sizes of
the three isomers, the bigger molecule, para xylene is retained by the adsorbent and
o-xylene and m-xylene elutes through the tower. The inlet feed solution to the
adsorption tower is ~ 9% and the eluted stream has 2000 ppm of p-xylene. The spent
adsorbent concentration can be 2.5 weight %. The Langmuir isotherm is applicable
for this system. What ought to be the control objectives for this process ? Which of
the methods discussed in this chapter and in earlier chapters are best suited for this
process ? What are the process constraints ? Which are the input variables and which
are the manipulatable variables ?
485
16.0. Polymer Composition Replaces Sutures

American dental association patented a process (US Patent # 5320886, 1994) to
make a polymeric composition that can be used in order to replace sutures.
Organofunctional monomers with dimethacrylates or diacrylates are used. Statistics
and probability are used to optimize the polymer reaction products. Materials having
similar physiochemical characteristics have higher affinity and adhesive bonding
between them. A batch polymerization reactor can be used for this purpose. The
unreacted monomers and polymer product are separated using a centrifuge. What are
the control objectives ? Which is the best control strategy for the polymerization and
separation steps ?
List the input and manipulatable variables.
17.0. SAN and PMMA Polymer Blend
SAN, styrene and acrylonitrile copolymer with high molecular weight and PMMA,
polymethacrylate are blended in a co-rotating, non-intermeshing twin screw extruder
made by Berstoff, Germany. The system exhibits thermodynamic miscibility for
certain compositions of SAN and temperature and pressure of the extruder. Design a
feedforward control strategy in order to form a SAN/PMMA blend. How is this
strategy different from a IMC, Internal model control strategy. The model for the
SAN/PMMA blend can be found in Sharma [2012].
18.0. Feedback Control
A ternary alloy made of silicone rubber, polycarbonate and polybutylene
terephthalate is decomposed at high temperature and pressure. Simultaneous
measurements using MS,mass spectrometry and FTIR, Fourier Transfrom Infra Red
spectrpscopy are used in order to characterize the decomposition products. Develop a
feedback control strategy for the decomposition of PC/PBT/silicone rubber ternary
alloy.
19.0. Durability of High Peformance Adhesive Joints
The interface is an important consideration in adhesive systems. The Tg, glass
transition temperature of polyamide used in adhesive systems is 260 0C. Notched
coating adhesion tests can be used in order to study the debonding of the high
performance adhesive joints. The strain at debonding can be indentied. X-ray
photoelectron spectroscopy can be used in order to measure the ageing time and
bonding energy. Design a hybrid feedback/feedforward control strategy for the
process of making the adhesive joints.
20.0. IMC of High Temperature, Water-Gas Shift Inert Membrane Reactor
An accurate model of a commercial scale membrane reactos is developed. A PFR,
plug flow reactor with no back-mixing operated at constant temperature is used with
no catalyst at high temperature. The feed mixture is pumped across a single tube
membrane reactor. The permeate is hydrogen and the retentate is in the shell side of
the tube. Ideal gas law is assumed to be applicable to the gas phase system. A first
order kinetic model is applicable. The reaction rate constant varies with temperature
and pressure and an expression is given to predict the reaction rate constant k as a
function of T and P. When the temperature exceeds 600 0C unfavourable conditions
can be expected for the formation of hydrogen. Ceramic-ion-transport membranes
can be used in order to have hydrogen only as the permeate. An expression for the
mass transfer rate can be written in terms of the concentration difference and area
486

across which the mass transfer occurs. The equilibrium conversion is ~ 30-40%. The
membrane can be characterized using porosity, pore size distribution etc. A bundle of
7600 tubes can be used. Conversions greater than 90% can be attempted. Discuss the
Internal Model Control strategy for this process ? Is a filter needed in order to make
the control function more proper ?
Chapter 8
PHARMACOKINETIC ANALYSIS
Single and Two Compartment Models

Ethanol in Brain Tissue Fourth Order Absorption
First Order Absorption with Elimination
Special Case when klumped = kinfusion
Second Order Absorption with Elimination
Michaelis and Menten Absorption with Elimination
Krebs Cycle and Subcritical Damped Oscillations
Periodic Absorption with Elimination
8.1. OVERVIEW
Pharmacokinetics comes from the Greek words, pharmacon that means drugs and
kinetikos that means setting in motion. The mathematical models, experimental trials and
computer simulations that are undertaken to study the change of concentration of drug or
other compounds of interest with time in the human physiology is called Pharmacokinetics.
Application of pharmacokinetics allows for the processes of liberation, absorption,
distribution, metabolism and excretion to be characterized mathematically. The absorption of
drug can be affected by 13 different methods. These methods include;
(i) sublingual entry (beneath the tongue)
(ii) buccal cavity (via the mouth)
(iii) gastric entry (through stomach)
(iv) IV therapy (through veins)
(v) intramuscular therapy (within the muscles)
(vi) subcutaneous therapy (beneath the skin)
(vii)intradermal therapy (within the dermis)
(viii)percutaneous therapy (topical treatment of skin)
488

(ix) inhalation through mouth, nose, pharynx, trachea, bronchi, bronchioles, alveolar sacs,
alveoli
(x) intrarterial route (introduced to artery)
(xi) intrathecal route (introduced to cerebrospinal fluid)
(xii)vaginal route (through the vagina)
(xiii)intraocular route (through eye)
(xiv)splanchnic circulation (absorbed from stomach, intestines, colon and upper rectum)
The change with time of the concentration of the drug can be by three different types i)
Slow absorption Type A; ii) maxima and rapid bolus, Type B; iii) constant rate delivery, Type
C. Pharmacokinetics studies can be performed by 5 different methods including compartment
methods [Cooney, 1976 ] the five different methods are;
(i) Non-compartment method
(ii) Compartment method
(iii) Bio analytical method
(iv) Mass spectrometry and
(v) Population pharmacokinetic methods.
According to Notari [1987] the drug concentration can be denoted by a simple weighted
summation of exponential decays. The factors that affect how a particular drug is distributed
throughout the anatomy are: i) rate of blood perfusion; ii) permeability of capillary; iii)
biological affinity of drug; iv) rate of metabolism of drug and; v) rate of renal extraction.
Drugs may bind to proteins sometimes. The distribution volume is restricted. An apparent
distribution volume of the drug is defined in such cases [Cooney, 1976]. The kinetics of
enzymatic reactions that depleted the drug in the tissues can be expected to obey the
Michaelis-Menten kinetics. The elimination of drug is affected by kidneys in a big manner by
enzymatic degradation and formation of water soluble drug products. Blood urea nitrogen,
BUN, a waste product produced in the liver as the end product of protein metabolism is
removed from the blood by the kidneys in the Bowmans capsule. BUN is removed along
with creatinine, a waste product of creatinine phosphate as energy storing molecule produced
largely from muscular breakdown.
The kidney comprises of more than a million nephrons. The nephron is composed of a
glomerulus, entering and exiting arteriole and a renal tubule. The glomerulus consists of a tuft
of 20-40 capillary loops protruding into Bowmans capsule. Bowmans capsule [Cooney,
1976] is a cup-like shaped extension of the renal tubule which is the beginning of the renal
tubule. The epithelial layer of Bowmans capsule is about 40 nm in thickness and facilitates
passage of water into inorganic and organic compounds. The renal tubule has several distinct
regions which have different functions such as the proximal convoluted tubule, the loop of
Henle, the distal convoluted tubule and the collecting duct that carries the final urine to the
renal pelvis and the ureter. Glomerular filtration is the amount of fluid movement from the
capillaries into the Bowmans capsule. Glomerular filtration rate, GFR, is about 125 ml/min
or about 180 liters per day.
489
8.2. RENAL CLEARENCE

The concept of renal clearance is introduced by performing a mass balance on the drug in
the human anatomys apparent distribution volume at transient state. The elimination of drug
in urine is seen to be a first-order process
plasma
Cdrug
plasma
Cdrug
0 e
Frenal t
Va
(8.1a)
The term plasma clearance represents all the drug elimination processes of the body. The
primary elimination processes are from metabolism and GFR. The secondary processes can
be from sweat, bile, respiration and feces. The rate constant for each secondary process is
Fj
denoted by k j
Va
A overall rate constant is defined that can be used to account for all the primary and
secondary processes of elimination of drug in human anatomy;
klumped
1
Va
kj
j
Fj
(8.1b)
The change in concentration of drug with time can be written as;

Fplasma t
plasma
Cdrug
Where, Fplasma
plasma
Cdrug
0 e
Va
(8.1c)
Fj
j
Eq. (8,1c) is an example of a pharmacokinetic model derived from first principles. The
Type B response can be explained using the model. The area under the concentration of drug
vs. time can be denoted by Area (Eq. (8.1d);
Area0..
Cdrug dt
(8.1d)
8.3. SINGLE COMPARTMENT MODELS

The drug or metabolite that enters the human anatomy from external sources finds its way
to the blood plasma by a process of diffusion from the tissue regions. The concentration of the
drug in the plasma starts at zero, some times experiences a lag phase, and then undergoes a
phase of increase in concentration of drug with time. A maximum is reached. Then the
concentration of the drug begins to decrease with time. The decrease in concentration in the
plasma can be attributed to the primary and secondary elimination reactions that are in place
490
to deplete the drug concentration. Compartment models can be developed to describe the
different phases of the dynamics of the concentration of the drug in the plasma. A schematic
of a single compartment model with first order absorption with elimination is shown in Figure
8.1.
The dose infused in given by Dose, D. A factor, is introduced. This represents the
fraction of dose that is absorbable. The mass balance equation on the concentration of the
drug within a volume VA of the human anatomy can be written for Figure 8.1 as follows;
plasma
Frenal Cdrug
kinf usion nanatomy
Va
plasma
dCdrug
dt
(8.1)
Where kinfusion is the first-order rate constant of the absorption process and anatomy is the
amount of drug that is available for absorption.
8.3.1. First Order Absorption with Elimination

The first-order absorption of the drug process can be written as;
dnanatomy
dt
kinf usion nanatomy
(8.2)
Where kinfusion is the absorption rate constant. Eq. (8.2) can be integrated to obtain;
nanatomy
D
kinf usiont
Obtaining the Laplace transforms of Eq. (8.1) and Eq. (8.2);
Figure 8.1. Single Compartment Model with First Order Absorption with Elimination.
(8.3)
491
kinf usion nanatomy ( s)
plasma
Frenal Cdrug
(s)
nanatomy ( s)
plasma
sVa Cdrug
(8.4)
Eliminating nanatomy(s);
plasma
Cdrug
(s)

sVa
kinf usion D
Frenal
(8.5)
Va s klumped s kinf usion
Where, Frenal is given in terms of a klumped that serves as an overall rate constant that can
be used to account for all of the primary and secondary processes of the elimination of the
drug in the human anatomy. Thus Frenal = (klumpedVa). Eq. (8.5) may be inverted in the time
domain [Sharma, 20.10] as follows;.
kinf usion
kinf usion klumped
D
Va
plasma
Cdrug
klumped t
kinf usiont
(8.6)
Eq. (8.6) may be written in dimensionless form as follows;
Where,
plasma
Cdrug
D
Va
1
1
klumped t
kinf usiont
(8.6a)
klumped
kinf usion
can be seen to be the ratio of the overall elimination rate constant with the absorption
rate constant. This is valid for, kinf usion
klumped . From Eq. (8.6) it can be seen that the
concentration drug as a function of time varies inversely with the apparent volume of
distribution of the drug within the human anatomy and directly proportional to the amount of
drug that is absorbable and depends on the first order rate constants of absorption and
elimination. It can be seen that Eq. (8.6) exhibits a maxima. This occurs at;
1
m
kinf usion
klumped
ln
k inf usion
klumped
(8.7)
The corresponding maximum concentration can be given by;

klumped
plasma ( m )
Cdrug
D
Va
kinf usion
klumped
klumped kinf usion
(8.8)
492

The maxima vanish for large values of rate constant, kinfusion. The concentration will reach
the asymptotic maximum in these cases. Eqs. (8.7-8.8) are valid only when klumped
kinf usion .
Eq. (8.6a) is plotted in Figure 8.2 for different ratios of the rate constants, . It can be seen
from Figure 8.2 that for very small values of the dimensionless concentration does not
exhibit maxima. It reaches the asymptic maximum limit of 1 at large time. For small values of
the maxima is sharper. A right skew can be seen in these decay curves. For the special case
when the overall rate constant of the primary and secondary elimination processes is equal to
the rate constant of absorption the following analysis would be applicable. Eq. (8.1) can be
written when k
kinf usion
klumped as;
(k D)e
plasma
(Va k )Cdrug
kt
plasma
dCdrug
dt
plasma
Cdrug
kt; u
Let,
Va
(8.9)
(8.10)
D
Va
Eq. (8.9) becomes;
du
d
(8.11)
Obtaining the Laplace transforms of Eq. (8.11) recognizing the initial concentration is u0
and the transformed variable can be solved for as;
_
u0
( s 1)
(8.12)
( s 1)2
Obtaining the inverse of the Laplace transformed dimensionless concentration;
u u0e
(8.13)
The solution for the dimensionless concentration given by Eq. (8.13) is shown in Figure
8.2 for the case of 0. initial concentrations. A maxima can be seen in the concentration vs.
time graphs.
Eq. (8.13) in the dimensional form can be written as;
plasma
Cdrug
D
kte
Va
kt
(8.14)
493
Figure 8.2. Dimensionless Concentration u as a Function of Time for Systems that Obey first Order
Kinetics with Elimination (kinfusion = 1 min-1;
klumped
kinf usion
).
Eq. (8.14) can be integrated and given in terms of area under the concentration of the
drug vs. time graph as;
Area0..
D
Va klumped
D
Fplasma
(8.15)
Example 8.1 Ethanol in Brain Tissue

Pharmacokinetic modeling of ethanol plays a salient role on brains response to ethanol.
Ethanol is a naturally produced drug used by humans for thousands of years because of its
psychoactive properties. It is beneficial when used in moderation. Excessive use of ethanol
can be devastating. Brain is a high blood flow, small water volume organ and ethanol readily
crosses the blood-brain barrier. The ethanol gets eliminated by an oxidation reaction as
follows:
494
Figure 8.3. Drug Concentration as a Function of Time for the Special Case when k = klumped = kinfusion.
C2 H5OH 3O2
2CO2 3H 2 0
(8.16)
The stoichiometry of the reaction suggests that the rates of reaction are related by;
rA
1
rO2
3
(8.17)
The kinetics of the reaction can be expected to be of the form;
rA
kinf usion nanatomy nO3 2
(8.18)
495
Lumping all the rate effects into the alcohol concentration assume that the rate
expression can be given by a 4th order rate expression such as;
dnanatomy
4
kinf usion nanatomy
rA
(8.19)
dt
Let the amount of alchohol ingested by given by D moles. Develop a single-compartment

pharmacokinetic model for this 4th order absorption with elimination of ethanol. Plot the
alchohol concentration as a function of time. Does it undergo maxima? Calculate the amount
of ethanol in the urine. It appears that ethanol infusion in the brain tissue is a fourth order
process of absorption. Eq. (8.19) is applicable. The elimination steps are also included.
Integration of Eq. (8.19) realizing the initial condition at t = 0, nanatomy = (D) would result in;
1
3 D
kinf usion t
(8.20)
3
3nanatomy
Eq. (8.20) can also be written as;

3
nanatomy
D 1 3 D kinf udiont
1
3
(8.21)
Eq. (8.21) can be expressed as a Newtons generalized binomial series as follows;
nanatomy
14
33
D kinf usion
D 1
D kinf udiont
kinf usiont
1
3
2!
.......
(8.22)
....
(8.23)
Obtaning the Laplace transform of Eq. (8.22)
nanatomy ( s)
1
s
s2
2
D kinf
usion
9s 3
The mass balance of ethanol in the plasma distributed over a volume per the single
compartment model shown in Figure 8.1 as given by Eq. (8.1) is applicable and can be
written as in the Laplace domain as;
plasma
kinf usion nanatomy (s) Frenal Cdrug
(s)
plasma
sVaCdrug
(8.24)
The concentration of drug in plasma can be solved for in the Laplace domain by elimination
of nanatomy(s) between Eq. (8.23) and Eq. (8.24) as;
496
plasma
Cdrug
(s)

kinf usion nanatomy (s)
Va s klumped
kinf usion
Va s klumped
1
s
D kinf usion
2
D kinf
usion
s2
9s 3
(8.25)
Term by term in Eq. (8.25) can be inverted from the Laplace domain into the time
domain as follows;
plasma
Cdrug
(t )
kinf usion D
1 e
klumpedVa
klumped t
D kinf usion
1 e
klumped
klumped t
t
klumped
.......
(8.26)
Eq. (8.26) is plotted in Figure 8.3 for a certain set of rate constants and dosage and factor
of absorption. The set of parameters used to generate the concentration of drug in the plasma
is given below in Table 8.1.
Figure 8.4. Concentration of Drug in Plasma with Fourth Order Absorption with Elimination.
497
Table 8.1. Parameters used in Figure 8.3
Ethanol in Brain
kinfusion
400
klumped
2
Va
260
D
0.2
0.8
-1
hr
-1
hr
liter
moles
8.3.2. Second-Order Absorption with Elimination

A mass balance on the concentration of drug within the human anatomy for the case of
second order absorption with elimination can be written for Figure 8.1;
2
k " nanatomy
plasma
Frenal Cdrug
Va
plasma
dCdrug
dt
(8.27)
Where k is the second order rate constant of the absorption process and nanatomy is the
amount of drug that is available for absorption. The second order absorption of the drug
process can be described by;
dnanatomy
2
k " nanatomy
dt
(8.28)
The solution to Eq. (8.28) can be written as;
1
fDose
k "t
(8.29)
nanatomy
Eq. (8.29) and Eq. (8.27) can be combined and the concentration of drug as a function of
time can be solved for from the first order ODE, ordinary differential equation and by use of
particular integral as;
plasma
Cdrug
klumped t
k "t
fDose
(8.30)
The initial condition is;

plasma
Cdrug
0
0, t 0
(8.31)
498
Figure 8.5. Second Order Absorption and Elimination -
Frenal
Va
0.33;
k"
fDose
5
.
Eq. (8.30.) can be seen to exhibit maxima. The solution for the maxima needs numerical
methods as the resulting equation is transcendental. Eq. (8.30) can be seen to be interplay of
the rate of absorption and rate of excretion. When the second order absorption processes are
rapid and excretion is slow, the drug tends to accumulate in the blood plasma. When the rate
of excretion is rapid the drug concentration tends to drop off rapidly.
8.3.3. Michaelis-Menten Absorption with Elimination

A mass balance on the concentration of drug within the human anatomy for the case
where the kinetics of absorption is in obeyance of Michaelis-Menten Kinetics with
elimination can be written for Figure 8.1 as;
kCE 0 nanatomy
Va C M nanatomy
plasma
Va klumped Cdrug
Va
plasma
dCdrug
dt
(8.32)
Let nanatomy be the amount of drug that is available for absorption. The absorption of the
drug process can be described by Michaelis-Menten kinetics;
499
dnanatomy
kVa CE 0 nanatomy
dt
Va CM
(8.33)
nanatomy
Where k is the infusion Michaelis-Menten rate constant, CE0 is the total enzyme
concentration and CM is the rate constant. It can be seen that (Levenspiel, [1999]) the
Michaelis-Menten kinetics becomes independent of concentration at high drug concentration
and becomes zeroth order and at the low concentration limit reverts to a simple first order rate
expression. Integration of Eq. (6.54) can be seen to be [Michaelis and Menten 1913];
CM ln
nanatomy
fDose
Va
fDose
nanatomy
Va
kCE 0 t
(8.34)
It can be seen that Eq. (8.34) is in a form that is not readily usable in terms of a one-toone mapping between the independent variable t and dependent variable nanatomy. In order to
combine Eq. (8.34) with Eq. (8.32) and then solved for, for the concentration of drug in the
plasma, a more usable form of Eq. (8.34) is sought. This can be done by realizing that any
arbitrary function can be represented using the Taylor series. Taylor series representation of
any arbitrary function is an infinite series containing derivatives of the arbitrary function
about a particular point. Prior to obtaining the Taylor series Eq. (8.33) is made dimensionless
as follows [10-11];
nanatomy
fDose
k3uE 0t; uE 0
CE 0Va
; uM
fDose
CM Va
fDose
(8.35)
Eq. (8.33) becomes;
du
d
u
u uM
(8.36)
Taylor series in terms of derivatives of u evaluated at the point =0 can be written as

follows;
2
u
From the initial condition,
From Eq. (8.36),
u (0)
u '(0)
2!
u "(0)
u(0) = 1
u '(0)
1
1 uM
3!
u "'(0) .........
(8.37)
(8.38)
(8.39)
500
The initial value of the second derivative of the dimensionless concentration, u can be
seen to be;
d 2u
d
u uM u ' uu '
uM
uM
uM
(8.40)
The initial value of the third derivative of the dimensionless concentration, u can be
seen to be;
d 3u
d
u uM
2
uM
uM u " 2uM u '(u uM )

uM
2uM
uM
(8.41)
Plugging Eqs. (8.39-8.41) in Eq. (8.37);
u 1
uM
uM
1 2! uM
2
uM
3! uM
2uM
1
......
(8.42)
Eq. (8.42) and Eq. (8.34) are sketched for a particular value of uM =11, in Figure 8.6. It
25 fDose
can be seen that for times t <
, the Taylor series expression evaluated near the origin
kCE 0Va
up to the third derivative is a reasonable representation of the integrated solution given in Eq.
(8.34). More terms in the Taylor series expression can be added to suit the application and the
apparent volume, dosage, enzyme concentration, Michaelis constant and the desired accuracy
level needed as shown above.
Figure 8.6. Michaelis-Menten Kinetics from the Integrated and Taylor Series Expressions.
501
Eq. (8.37) and Eq. (8.34) can be combined and the concentration of drug as a function of
time can be solved for from the resulting equation by the method of Laplace transforms as
follows. The combined equation is also made dimensionless;
u
klumped
uM u
kuE 0
plasma
dudrug
plasma
udrug
(8.43)
uM
uM
1
1
uM
2
uM
2 uM
2uM
1
klumped
......
kuE 0
plasma
udrug
plasma
dudrug
(8.44)
Obtaining the Laplace transform of the governing equation for dimensionless drug
concentration in the compartment (plasma), Eq. (8.44);
s(uM
2
uM
uM
s 2 uM
1)
2uM
2 s 3 uM
klumped
......
kuE 0
su 0
(8.45)
The transformed expression for dimensionless drug concentration in the compartment can
be seen to be;
1
klumped
s(uM 1) s
kuE 0
s 2 uM
2
_
uM
2uM
uM
...... u (8.46)
klumped
klumped
3
5
3
1 s
2s uM 1 s
ku
kuE 0
E0
It can be seen that the inversion for each term in the infinite series is readily available
from the tables [Mickley, Sherwood and Reid, 1957]. Thus a non-linear differential equation
was transformed using Taylor series and some manipulations into an equation with closed
form analytical solution. The term by term inversion of Eq. (8.46) can be looked from the
Tables as;
2
klumped
klumped
kuE 0
1 e
(uM
kuE 0
1)
uM
klumped
klumped
uM
klumped
1 e
1
...... u
(8.47)
The dimensionless drug concentration in the compartment or plasma is shown in

Figure 8.7.
It can be seen from Figure 8.7 that the dimensionless drug concentration in the
compartment goes through a maxima. The curve is convex throughout the absorption and
elimination processes. The drug gets completely depleted after a said time. The curve is
502
asymmetrical with a right skew. The constants used to construct Figure 8.7 using Microsoft
MS Excel Spreadsheet were;
uM
11; klumped
k 1sec 1; uE 0
2sec
8.4. ANALYSIS OF SIMPLE REACTIONS IN CIRCLE

The mathematical model predictions for drug concentration as discussed above depend
on the nature of kinetics of absorption. It can be simple zeroth order, first order, second order,
fractional order any order n. It can also be reversible in nature. It can obey Michaelis-Menten
kinetics.
Sometimes in the absorption process the Krebs cycle [1953] may be encountered.
Reactions such as these can be represented by a scheme of reactions in circle (Sharma,
[20..10]). The essential steps in the Krebs cycle are formation of: i) A. Oxalic Acid; ii) B.
Citric Acid; iii) C. Isocitric Acid; iv) D. -Ketoglutaric Acid; v) E. Succyl Coenzyme A; vi)
F. Succinic Acid; vii) G. Fumaric Acid; viii) H. Maleic Acid. There are other sets of reactions
in metabolic pathways that can be represented by a scheme of reactions in circle. Systems of
reactions in series and reactions in parallel have been introduced [Levenspiel, 1999]. Consider
a system of reactions in circle: i) System of 3 Reactants in Circle; ii) System of 4 Reactants in
Circle; iii) System of 8 Reactants in Circle such as in Krebs Cycle and; iv) General Case. A
scheme of reactants in circle is shown in Figure 8.8.
Figure 8.7. Michaelis-Menten Absorption and Elimination.
503
(i) 3 Reactions in Circle

The simple first order irreversible rate expressions for (i) 3 Reactants in Circle can be
written as;
dC A
dt
k1C A
k3CC
(8.48)
dC B
dt
k 2 CB
k1C A
(8.49)
dC C
dt
k3CC
k3CB
(8.50.)
Where, CA, CB and CC are the concentrations of the reactants A, B and C at any instant in
time, t. Let the initial concentrations of reactants A, B and C be given by
CA0, CB0 =0 and CC0=0. The Laplace transforms of Eqs. (6.68-6.71) are obtained as;
_
s k1 C A
C A0
_
s k2 CB
_
k3 CC
k3 CC
(8.51)
k2 C A
(8.52)
k2 CB
Figure 8.8. Simple Reactions in Circle Representation of Krebs Cycle.
(8.53)
504
Eliminating CB and CC between Eqs. (6.72-6.74) the transformed expression for the
instantaneous concentration of reactant A can be written as;
_
_
s k1 C A
CA
Or,
k3 k2 k1 C A
s k3 s k2
C A0
(8.54)
C A0 s k3 s k2
s s
s k1 k2
k3
k1k2
(8.55)
k1k3
k2 k3
The inversion of Eq. (6.76) can be obtained by use of the residue theorem. The 3 simple
poles can be recognized in Eq. (6.76). Further it can be realized that when the poles are
complex, subcritical damped oscillations can be expected in the concentration of the reactant.
This is when the quadratic, b2
0 . This can happen when;
4ac
k3 k2 k1
k3 k2 k1
Or,
Or,
k3
k2
4k2 k1 0
(8.56)
2 k1k2
(8.57)
k1
(8.58)
This expression is symmetrical with respect to reactants A, B and C. When the relation
holds, i.e., when one reaction rate constant is less than the square of the sum of the square
root of the rate constants of the other two reactions, the subcritical damped oscillations can be
expected in the reactant concentration.
(ii) 4 Reactions in Circle

The equivalent Laplace transformed expression for concentration of reactant A for a
system of 4 reactions in circle assuming that all the reactions in the cycle obey simple, first
order kinetics can be derived as;
_
CA
(8.59)
CA0 s k3 s k2 s k1
s s3
s 2 k1 k2
k3
k4
s (k1k2
k1k3
k2 k3
k1k4
k2 k4
k3k4 ) k1k2 k3
k1k2 k4
k1k3k4
k2 k3k4
The conditions where the concentration can be expected to exhibit subcritical damped
oscillations when the roots of the following equation becomes complex;
s3
Where,
s2
k1 k2
k3
(8.60)
k4
(8.61)
505
k2 k3
k1k3
k1k2
k1k2 k3 k1k2k4
k1k4
k1k3k4
k4 k3
k1k4
k2k3k4
(8.62)
(8.63)
It can be seen that is the sum of all the 4 reaction rate constants, is the sum of product
of all possible pairs of the reaction rate constants and is the sum of product of All possible
triple products of rate constants in the system of reactions in circle. Eq. (8.60) can be
converted to the depressed cubic equation by use of the substitution,
x s
(8.64)
This method was developed in the Renaissance period (Ans Magna, [1501]). The
depressed cubic without the quadratic term will then be;
2
x3
2 3
27
Let,
2 3
27
B;
(8.65)
(8.66)
Then, Eq. (6.86) becomes;

x3
Bx C
(8.67)
The complex roots to Eq. (6.88) shall occur when D > 0, where,
B3
27
C2
4
(8.68)
Thus the conditions when subcritical damped oscillations can be expected for a system of
4 reactions in circle are derived.
(iii) General Case of n Reactions in Circle

For the general case, of which the Krebs cycle with 8 reactions in circle is a particular
case can be obtained by extension of the expressions derived for 3 reactions in circle and 4
reactions in circle. Aliter to this would be the method of Eigen values and Eigen vectors. The
cases when is imaginary is when the concentration of the species will exhibit subcritical
damped oscillations are given by the characteristic equation [Varma and Morbidelli, 1997];
506
Det K- I
(8.69)
The size of the K matrix depends on the number of reactions in circle. For n reactions in
circle K would be a n x n matrix. For the case of Krebs cycle it would be a 8 x 8 matrix.
Upon expansion an 8th order polynomial equation in arises. Eight roots of the
polynomial exist. Even if all the values in the characteristic matrix are real some roots may be
complex. When complex roots occur they appear in pairs. The roots of the polynomial are
called eigenvalues of the characteristic matrix. The polynomial equation is called the Eigen
value equation.
8.5. SUBCRITICAL DAMPED OSCILLATIONS

As was discussed in the previous section, the concentration of the drug during absorption
on account of kinetics such as the reactions in circle can undergo subcritical damped
oscillations. In such cases, how can the absorption with elimination process be modeled?
The solution for the dosage drug concentration upon absorption that obeys a certain type
of kinetics that results in a subcritical damped oscillations can be given by;
fDose
e
Va
nanatomy
kinf usiont
(2 Cos
kt
(8.70)
A mass balance on the concentration of drug within the human anatomy for the case of
kinetics of absorption resulting in subcritical damped oscillation can be written for Figure 6.4
as;
kinf usion ( fDose)e
kinf usiont
(2 Cos(
Va
k t ))
plasma
Va klumped Cdrug
Va
plasma
dCdrug
dt
(8.71)
Eq. (6.92) is the governing equation for concentration of drug in the single compartment.
Eq. (6.92) is made dimensionless by the following substitutions;
plasma
Cdrug
fDose
Va
klumped t; *
klumped
(8.72)
Plugging Eq. (8.72) in Eq. (8.71), Eq. (8.71) becomes;

du
d
kinf usion
e (2 Cos( * )) u
klumped
(8.73)
507
Figure 8.9. Characteristic Matrix for System of 8 Reactions in Circle.
The concentration of drug as a function of time can be solved for by the method of
Laplace transforms as follows. Obtaining the Laplace transforms of Eq. (6.94);
_
kinf usion
klumped
2
s 1
( s 1)
2
s 1
*2
(8.74)
Obtaining the inverse of the transformed expression by using the convolution property of
Eq. (6.95);
kinf usion
klumped
Sin( * )
*
(8.75)
The solution for dimensionless concentration of the drug in the single compartment for
different values of rate constants and dimensionless frequency are shown in Figure 8.10
Figure 8.14. The drug profile reaches a maximum and drops to zero concentration after a said
time. The fluctuations in concentration depend on the dimensionless frequency resulting from
the subcritical damped oscillations during absorption. At low frequencies (* < 1.8) the
fluctuations are absent. As the frequency is increased the fluctuations in concentration are
pronounced. The frequency of fluctuations was found to increase with increase in frequency
of oscillations during absorption. At high dimensionless frequencies a saw-tooth pattern
could be seen in the dimensionless concentration. At even higher dimensionless frequencies
the fluctuations in concentration again vanish.
508
Figure 8.10. Dimensionless Concentration of Drug in Compartment *=/klumped = 6;
Figure 8.11. Dimensionless Concentration of Drug in Compartment *=/klumped=2;
kinf usion
klumped
kinf usion
klumped
0.5 .
0.5 .
509
Figure 8.12 Dimensionless Concentration of Drug in Compartment *=/klumped = 1.8;
kinf usion
klumped
Figure 8.13. Dimensionless Concentration of Drug in Compartment, *= 0.5, kinfusion/klumped =0.4.
0.5 .
510
Figure 8.14. Dimensionless Concentration of Drug in Compartment *=/klumped=25;
kinf usion
klumped
0.5 .
8.6. TWO COMPARTMENT MODELS

Two and three compartment models are used when need to describe complex drug
profiles. Such need arises especially when equilibrium between central compartment to
describe the concentration of drug in blood and a peripheral tissue compartment is not rapid.
A two-compartment model to model the absorption process with elimination is shown in
Figure 8.15.
The concentration that has diffused to the tissue region in the human anatomy is also
accounted for in addition to the concentration of drug in the blood plasma.
A bolus is administered intravenously. A mass balance on the concentration of drug
within the human anatomy in the blood plasma and tissue compartments can be written for
Figure 8.15 as follows;
plasma
V p Cdrug
k pt
Frenal
plasma
V p Cdrug
k pt
tissue
ktpV T Cdrug
tissue
ktpV T Cdrug
VT
Vp
plasma
dCdrug
tissue
dCdrug
dt
dt
(8.76)
(8.77)
511
Figure 8.15. Two Compartment Models.
Where Vp and VT are the apparent distribution volumes of the blood plasma and tissue
compartments. The initial concentrations of the drug in the compartments are;
Dose
VP
plasma
Cdrug
tissue
Cdrug
(8.78)
Differentiating Eq. (6.98) with respect to time and eliminating the concentration of the
drug in the tissue from Eq. (6.10..0) the governing equation for the concentration of drug in
the blood plasma compartment can be written as;
plasma
d 2Cdrug
dt
k pt Frenal
plasma
dCdrug
dt
plasma
ktp k pt Cdrug
ktp Dose
Vp
(8.79)
Eq. (6.10.1) is an ordinary differential equation of the second order with constant
coefficients. This can be solved for by obtaining the roots of the complementary function and
adding a particular solution. The solution to Eq. (6.10.1) can be written after use of the initial
condition can be written as;
plasma
Cdrug
Dose
e
Va
c2 e
The concentration of the drug in the tissue can be written as;
(8.80)
512
Dose
(1 e t ) c2 e
Va
tissue
Cdrug
Where,
k pt
Frenal
k pt
Frenal
(8.81)
4 k pt
k tp
4 k pt
k tp
2
k pt
Frenal
k pt
Frenal
(8.82)
(8.83)
The solution of the integration constant needs another time condition in addition to the
initial conditions given by Eq. (6.10.0) and by mass balance at any given instant in time the
initial concentration of the drug in the plasma is the total of the concentration of the drug in
the blood compartment plus the concentration of the drug in the tissue compartment. The 4th
constraint can be that the initial rate of reaction in the tissue compartment is zero. i.e.
Dose
c2
Va
c2
Then,
Eq. (6.10.7) is valid only when,
Dose
VP
(8.84)
(8.85)
8.7. COMPUTER SIMULATION

With the advent of personal computers, the pharmacokinetic models are implemented on
computers. Both linear and nonlinear pharmacokinetic models can be simulated in the
computer. This is especially the case when drug concentration throughout the body or a
particular location is high. The possible reason for this situation is the capacity of a
biochemical process to reduce the concentration of the drug becomes saturated. MichaelisMenten kinetics is used to capture the non-linear nature of the system. This involves mixtures
of zero-order and first order kinetics.
Experimental methods are deployed to collect data on the change in the concentration of
drug with time from a patient who has been injected a particular dose of a drug. This is
followed by interpreting the data by analysis. Analysis of data involves plotting the points of
concentration of drug in a logarithmic graph. The slope and intercept of the best-fit, linear,
regression line to the data can be used to obtain the rate constant and the initial concentration
of the drug. These constants are used in the compartment models to describe the drugs time
course for additional patients and dosing regimes.
Experimental methods to study drug profiles affected by Michaelis-Menten kinetics are
similar to those used in standard compartment models. The drug profiles are usually non-
513
linear. At high concentrations the drug concentration is linear. This is so, because the drug is
eliminated at a maximal constant rate by a zero-order process. The data line then begins to
curve in an asymptotic fashion with time until the drug concentration drops to a point where
the rate process becomes proportional to the drug concentration via a first order process.
Nonlinear pharmacokinetics can be used to describe solvation of the therapeutic ingredient
from a drug formulation as well as metabolism and elimination processes. Toxicological
events related to threshold dosing can be described using nonlinear pharmacokinetics.
Single, two and three compartment pharmacokinetic models require in vivo blood data to
obtain rate constants and other relevant parameters that are used to describe drug profiles.
Further what may work for one drug may not be suitable for another drug. Blood profile data
need be generated for each drug under scrutiny. In vivo state of a spectrum of drugs without
experimental blood samples from animal testing cannot be predicted accurately using such
models. Physiological pharmacokinetic models have been developed. These integrate the
basic physiology and anatomy with drug distribution and disposition. The compartments used
correspond to anatomic entities such as GI tract, liver, lungs, ocular, buttocks, etc, that are
connected by passage of blood. However, a large body of physiological and physiochemical
data is employed that is drug aspecific. The rate processes are lumped together in the
physiological models.
Computer systems have been used in pharmacokinetics to provide easy solutions to
complex pharmacokinetic equations and modeling of pharmacokinetic processes. Other uses
of computer in pharmacokinetics include: i) statistical design of experiments; ii) data
manipulation; iii) graphical representation of data; iv) projection of drug action and; v)
preparation of written reports or documents.
Pharmacokinetic models are described by systems of differential equations. Computer
systems and programming languages have been developed that are more amenable for the
solution of differential equations. Graphics-oriented model development computer programs
are designed for development of multi-compartment linear and nonlinear pharmacokinetic
models. The user is allowed to interactively draw compartments and then link them with other
iconic elements to develop integrated flow pathways using pre-defined symbols. The user
assigns certain parameters and equations relating the parameters to the compartments and
flow pathways and then the model development program generates the differential equations
and interpretable code to reflect the integrated system in a computer-readable format. The
resulting model can be used to simulate the system under scrutiny, when input values for
parameters corresponding to the underlying equations of the model such as drug dose, etc are
used.
Tools are developed to implement pharmacokinetic models. However, the current state of
the art does not permit predictability of the pharmacokinetic state of extravascularly
administered drugs in a mammal from in vitro cell, tissue or compound structure-activity
relationship SAR/QSAR data. The predictability is poor when attempting to predict
absorption of drug in one mammal from data derived from a second mammal. Different
approaches to predict oral administration and fraction dose absorbed are presented in the
literature [Grass, 2003, Lvet-Trafit, 1996]. There are lacunae in these models as they make
assumptions that limit the scope of prediction to a few specific compounds. These collection
of compounds possess variable ranges of dosing requirements and of permeability, solubility,
dissolution rates and transport mechanism properties. Other deficiencies include use of drugspecific parameters and values in pharmacokinetic models that limit the predictive capability
514
of the models. Generation of rules that may be universally applicable to drug disposition in a
complex physiological system such as GI, gastrointestinal tract.
Bioavailability of the drug includes the product price, patient compliance, ease of
administration. Failure to identify promising, problematic drug candidates during the
discovery and pre-clinical stages of drug development is a significant consequence of
problems with drug bioavailability. There is a need to develop a comprehensive,
physiologically-based pharmacokinetic model and computer system capable of predicting
drug bioavailability and variability in humans that utilizes relatively straightforward input
parameters. Computer based biopharmaceutical tools are needed for the medical community
that encounters new therapeutic alternates and use of high throughput drug screening for
selecting drug candidates.
Lion Bioscience [Grass, 2003] has patented a pharmacokinetic-based design and
selection PK tool. The tool can be used to predict absorption of a compound in a mammalian
system of interest. The PK tool consists of: i) input/output system; ii) physiologic-based
simulation model of one or more segments of a mammalian system of interest with
physiological barriers to absorption based on route of administration; iii) simulation engine
having a differential equation solver and a control statement module. The structure of the PK
tool is shown in Figure 6.17. The PK tool is a multi-compartment mathematical model.
Linked components include differential equations for one or more fluid transport, fluid
absorption, mass transit, mass solvation, mass solubility and mass absorption for one or more
segments of the human anatomy, input parameter values for the differential equations
corresponding to physiological parameters and selectively optimized adjustable parameters
for one or more segments of human anatomy and control statement rules for one or more
transit, absorption, permeability, solubility, solvation, concentration and mathematical error
correction for one or more segments of the human anatomy.
The dose, permeability and solubility data of a drug or compound is received by the
input/output system. Absorption profile for the compound is generated by application of
physiological based simulation models. The PK tool also has a database that includes
physiological based models, simulation model parameters, differential equations for one or
more of fluid transport, fluid absorption, mass transport, mass solvation, mass absorption for
different parts of the human anatomy, initial parameter values for the differential equations,
optimized adjustable parameters, regional correlation parameters, control statement rules for
transport, absorption, permeation, solvation, mathematical error corrections for different parts
of human anatomy. The database also has a compartment-flow data structure that is portable
into and readable by a simulation engine for calculation of rate of absorption, extent of
absorption, concentration of a compound at a sampling site across physiological barriers in
different parts of the human anatomy as a function of time. The PK tool can be used to predict
accurately one or more in vivo pharmacokinetic parameters of a compound in human
anatomy. The method uses a curve-fitting algorithm to obtain the fit of the model with one or
more input variables. Then adjustable parameters are generated. These steps are repeated until
the adjustable parameters are optimized.
An example of simulation engine is STELLA program from high performance systems
Inc. It is an interpretive program that can use three different numerical schemes to evaluate
differential equations: i) Eulers Method; ii) Runge-Kutta 2 or; iii) Runge-Kutta 4. The
program KINETICATM is another differential equation solving program that can evaluate the
equations of the model. By translation of the model from a STELLA readable format to
515
KINETICATM readable format, physiological simulations can be constructed using

KINETICATM which has various fitting algorithms. The PK tools.
8.8. SUMMARY
The mathematical models, experimental trials and computer simulations that are
undertaken to study the change of concentration of drug or other compounds of interest with
time in the human physiology is called Pharmacokinetics. Application of pharmacokinetics
allows for the processes of liberation, absorption, distribution, metabolism and excretion to be
characterized mathematically. The absorption of drug can be affected by 14 different
methods. The change with time of the concentration of the drug can be by three different
types as shown in Figure 6.1: i) Slow absorption (A); ii) maxima and rapid bolus (B); iii)
constant rate delivery (C). Pharmacokinetics studies can be performed by 5 different methods
including compartment methods. The five different methods are non-compartment method,
compartment method, bio analytical method, and mass spectrometry and population
pharmacokinetic methods.
The factors that affect how a particular drug is distributed throughout the anatomy are: i)
rate of blood perfusion; ii) permeability of capillary; iii) biological affinity of drug; iv) rate of
metabolism of drug and; v) rate of renal extraction. Drugs may bind to proteins sometimes.
The distribution volume is restricted. The kinetics of enzymatic reactions that depleted the
drug in the tissues can be expected to obey the Michaelis-Menten kinetics. The elimination of
drug is affected by kidneys in a big manner by enzymatic degradation and formation of water
soluble drug products. Blood urea nitrogen, BUN, a waste product produced in the liver as the
end product of protein metabolism is removed from the blood by the kidneys in the
Bowmans capsule along with creatinine, a waste product of creatinine phosphate as energy
storing molecule produced largely from muscle breakdown.
The kidney comprises of more than a million nephrons. The nephron is composed of a
glomerulus, entering and exiting arteriole and a renal tubule. The glomerulus consists of a tuft
of 20-40 capillary loops protruding into Bowmans capsule. The renal tubule has several
distinct regions which have different functions such as the proximal convoluted tubule, the
loop of Henle, the distal convoluted tubule and the collecting duct that carries the final urine
to the renal pelvis and the ureter. Glomerular filtration is the amount of fluid movement from
the capillaries into the Bowmans capsule. Glomerular filtration rate, GFR, is about 125
ml/min or about 180 liters per day.
The concept of renal clearance is introduced by performing a mass balance on the drug in
the human anatomys apparent distribution volume at transient state. The elimination of drug
in urine is seen to be a first-order process (Eq. 7.1a). The term plasma clearance represents all
the drug elimination processes of the body. The primary elimination processes are from
metabolism and GFR. The secondary processes can be from sweat, bile, respiration and feces.
The rate constant for each secondary process is denoted by
An overall rate constant is defined that can be used to account for all the primary and
secondary processes of elimination of drug in human anatomy (Eq. 7.1b). Eq. (7.1) is an
example of a pharmacokinetic model derived from first principles. Single compartment
models were developed for:
516

i)
firstrepresents the fraction of dose that is absorbable. The model equation is solved for by
the method of Laplace transforms. (Eq. 7.5). The concentration of the drug as a
function of time varies inversely proportional to the apparent distribution volume of
the drug within the human anatomy and directly proportional to the amount of drug
that is absorbable and depends on the first order rate constants of absorption and
elimination. The time where the concentration reaches a maximum is identified (Eq.
7.7) and the corresponding maximum concentration given by Eq. (7.6). The
dimensionless concentration of the drug in the plasma as a function of time for
various values of is given in Figure 7.2. The maxima vanish at small values of . A
right tail is seen in the curve. is the ratio of the lumped rate constant of
excretionary processes to the rate constant of absorption. A separate model solution
for the special case when the overall rate constant of the primary and secondary
elimination processes is equal to the rate constant of absorption (Eq. 7.13) was
developed.
ii) fourth order absorption with elimination. The absorption of ethanol in brain tissue
with elimination was discussed in Example 7.1. Newtons generalized binomial
series expansion of the negative 0.33 power ponentiated term was used in order to
obtain a closed form analytical solution. The model solution is given by Eq. (7.26).
The concentration of ethanol in plasma was plotted in Figure 7.4 for a certain set of
rate constants.
(iii) second order absorption with elimination. The model solution was obtained by the
method of particular integral for first order ODE and the model solution was given
by Eq. (7.30). The concentration profile exhibited a maximum. The solution for the
time at which maxima occurs needs numerical solution as the resulting equation in
transcendental. Eq. (6.39) can be seen to be interplay of the rate of absorption and
rate of excretion. When the second order absorption processes are rapid and
excretion is slow, the drug tends to accumulate in the blood plasma. When the rate of
excretion is rapid the drug concentration tends to drop off rapidly;
iv) Michaelis-Menten absorption with elimination. The MM kinetics when integrated
(Eq. 7.33) results in a transcendental equation. It is not in a form that is readily
usable. A more usable form of Eq. (7.33) is developed. This was accomplished by
using Taylor series expansion of dimensionless concentration u in terms of its
derivatives. The infinite series expression for dimensionless concentration is given
by (Eq. 7.57). It can be seen that for times t <, the Taylor series expression evaluated
near the origin up to the third derivative is a reasonable representation of the
integrated solution. More terms in the Taylor series expression can be added to suit
the application and the apparent volume, dosage, enzyme concentration, Michaelis
constant and the desired accuracy level needed as shown above. The single
compartment model solution was obtained by the method of Laplace transforms. It
can be seen from Figure 7.7 that the dimensionless drug concentration in the
compartment goes through a maxima. The curve is convex throughout the absorption
and elimination processes. The drug gets completely depleted after a said time. The
curve is asymmetrical with a right skew;
517
v) Reactions in circle Absorption with elimination. A system of n simple reactions in

circle was considered. The concentration profile of the reactants was obtained by the
method of Laplace transforms. The conditions when subcritical damped oscillations
can be expected are derived. A model was developed for cases when absorption
kinetics exhibit subcritical damped oscillations can be expected. The solution was
developed by the method of Laplace transforms (Eq. 7.75). The solution for
dimensionless concentration of the drug in single compartment for different values of
rate constants and dimensionless frequency are shown in Figures 7.10 Figures 7.14.
The drug profile reaches a maximum and drops to zero concentration after a said
time. The fluctuations in concentration depend on the dimensionless frequency
resulting from the subcritical damped oscillations during absorption. At low
frequencies the fluctuations are absent. As the frequency is increased the fluctuations
in concentration are pronounced. The frequency of fluctuations was found to increase
with increase in frequency of oscillations during absorption.
A two-compartment model for absorption with elimination is shown in Figure 7.15. The
concentration that has diffused to the tissue region in the human anatomy is also accounted
for in addition to the concentration of drug in the blood plasma. The model equation for
concentration of drug in the tissue is found to be an ODE of the second order with constant
coefficients (7.79). The model solution is given in Eq. (7.81) and obtained by the method of
complementary function and particular integral.
Software has been developed for the implementation of the pharmacokinetic models on
the personal computer. There is a spectrum of capabilities of the software ranging from
regression fit of experimental data to projection of drug action to preparation of written
reports/documents. Computer systems and programming languages have been developed that
are more amenable for the solution of differential equations. Tools are developed to
implement pharmacokinetic models. However, the current state of the art does not permit
predictability of the pharmacokinetic state of extravascular administered drugs in a mammal
from in vitro cell, tissue or compound structure-activity relationship SAR/QSAR data. PK
tools have been developed. The tool can be used to predict absorption of a compound in a
mammalian system of interest. The PK tool consists of: i) input/output system; ii)
physiologic-based simulation model of one or more segments of a mammalian system of
interest with physiological barriers to absorption based on route of administration; iii)
simulation engine having a differential equation solver and a control statement module.

Ans. Magna. (1501-1576). Solution to the Cubic Equation, Renaissance Mathematics,
Internet Website.
Cooney, D. O. (1976). Biomedical Engineering Principles, Marcel Dekker, New York, NY.
Grass, G. M., Leesman, G. D., Norris, D. A., Sinko, P. J. & Wehrli, J. E. (2003).
Pharmacokinetic-Based Drug Design Tool and Method, US Patent 6,542,858, Lion
Bioscience AG, Heidelberg, DE.
518
Henningsson, A., Karlsson, M. O., Vigano, L., Gianni, L., Verweij, J. & Sparreboom, A..
(2001). Mechanism-Based Pharmacokinetic Model for Paclitaxel, Journal of Clinical
Oncology, Vol. 19, 20, 4065-4073.
Ikeguchi, E. F. (2002). Method of Inducing Negative Pressure in the Urinary Collecting
System and Apparatus Therefor, US Patent 6,500,158, Columbia University, New York,
New York.
Levenspiel, O. (1999). Chemical Reaction Engineering, Third Edition, John Wiley & Sons,
New York, NY.
Levet-Trafit, B., Gruyer, M. S., Marjanovic, M. & Chou, R. C. (1996). Estimation of Oral
Drug Absorption in Man based on Intestine Permeability in Rats, Life Sciences, Vol. 58,
359-363.
Mickley, H. S., Sherwood, T. K. & Reed, C. E. (1957). Applied Mathematics in Chemical
Engineering, McGraw Hill Professional, New York, NY.
Michaelis, L. & Menten, M. L. (1913). Die Kinetik der Intertinwerkung, Biochem. Z., Vol.
49, 333-369.
Notari, R. E. (1987). Biopharmaceutics and Clinical Pharmacokinetics, Marcel Dekker,
Fourth Edition, New York, NY.
Sharma, K. R. (2010). Transport Phenomena in Biomedical Engineering: Aritifical Organ
Sharma, K. R. (2003). Subcritical Damped Oscillatory Kinetics of Simple Reactions in
Circle, CHEMCON 2003, Bubanewar, Orissa, India, December.
Sharma, K. R. (2010). On Michaelis Menten Kinetics in Single Compartment
Pharmacokinetic Models, 102nd AIChE Annual Meeting, Salt Lake City, UT, November,
7th 12th.
Sharma, K. R. (2009). On Michaelis-Menten Kinetics in Single and Multiple Compartment
Pharmacokinetic Models, 65th SWRM, Southwest Regional Meeting of the American
Chemical Society, El Paso, TX, November 4th 7th.
Sinko, P. J. & Amidon, G. L. (1988). Characterization of the Oral Absorption of -Lactam
Antibiotics. I. Cephalosporins: Determination of Intrinsic Membrane Absorption
Parameters in the Rate Intestine in situ, Pharmaceutical Res., Vol. 5, 10, 645-650.
Sinko, P. J., Leesman, G. D. & Amidon, G. L. (1991). Predicting Fraction Dose Absorbed in
Humans Using a Macroscopic Mass Balance Approach, Pharmaceutical Res., Vol. 8., 8,
979-988.
Sir Hans A. Krebs. (1953). Citric Acid Cycle, Nobel Prize Lecture, http://nobel.se
Tang, S. & Xiao, Y. (2007). One-Compartment Model with Michaelis-Menten Elimination
Kinetics and Therapeutic Window: An Analytical Approach, J. Pharmacokinet.
Pharmacodyn., Vol. 34, 807-827.
Varma, A. & Morbidelli, M. (1997). Mathematical Methods in Chemical Engineering,
Oxford University Press, Oxford, UK.
Young, J. D. Ramsey, J. C., Blau, G. E., Karbowski, G. E., Nitschke, R. J., Slauter, K. D. &
Braun, W. H. Pharmacokinetics of inhaled or Intraperitoneally Administered Styrene in
Rats, in Toxicology and Occupational Medicine. Proc. Of 10th Inter-America
Conference on Toxicology and Occupational Medicine, Elsevier, Amsterdam,
Netherlands.
519
8.10. EXERCISES
Review Questions
1.0. Most of the transient decay curves of concentration of drug at asymptotically zero at
infinite time. Suppose a patient takes a bolus of drug in summer 2001. Come summer
2012 according to the model solution there is a finite concentration of drug left in the
human stomach. Is this going to be the case in real practice ? What is the cause for
this discrepancy ?
2.0. What are the similarities between the loop of Henle and a U tube ?
3.0. Name two elimination routes.
4.0. The klumped in Eq. (8.1b) was arrived at by assuming that all the elimination routes act
in series. What if some elimination routes act in series and some in parallel ?
5.0. What are the differences between sublingual entry and buccal cavity during
absorption?
6.0. What are the differences between gastric entry and IV therapy during absorption ?
7.0. What are the differences between intramuscular therapy and subcutaneous therapy ?
8.0. What are the differences between Type C and Type A absorption ?
9.0. How is Type B and Type C absorption different from each other ?
10.0. Why does the (mass rate in) term in the mass balance equation n a single
compartment model contain the (kinfusionnanatomy) and the (mass rate reacted) term set
to zero ?
11.0. What are the differences between the exit stream flow rate Frenal and the plasma
flow rate Fplasma quantitatively in the single compartment model.
Problems
12.0. Pharmacokinetics of Styrene in Rats
Styrene is a liquid at room temperature. It is widely used as a monomer in the
production of polystyrene and HIPS and ABS engineering thermoplastic. Styrene is
low in acute and chronic toxicity. It is metabolized in rats and humans by oxidation
of the side chain to yield mandelic and phenylglyoxylic acids among other things that
are rapidly excreted in the urine. Experimental data obtained from inhalation
exposure of male Sprague-Dawley rats to different styrene concentrations by Young
et al. [19] for upto 20 hrs. Rats were removed in groups of three from the exposure
chambers at selected time intervals up to 20 hrs and immediately decapitated to
obtain whole heparinized blood for styrene analysis. Samples of epididymal fat, liver,
and kidney were also obtained from each rat. A group of over 25 rats was removed
from exposure chamber after 6 hr of exposure. These rats were killed in groups of 3
at selected time intervals up to 18 hour post exposure to examine the disappearance
of styrene from blood and tissues. All samples were analyzed for styrene
concentration by hexane extraction followed by GC/mass spectrometry with selected
ion monitoring. At each exposure level the styrene concentration in blood increased
520

rapidly and approached a near maximum value at 6 hr. The post exposure blood
concentration curves revealed a biphasic log-linear shape at low concentrations. The
data is given below for one styrene concentration. Determine the pharmacokinetic
parameters that describe the absorption and elimination of styrene.
13.0. Pharmacokinetic Model for Drug Infusion System that Obey the Special Case of
Denbigh Scheme of Reactions
The infusion rates of a certain drug system can be given by the special case of
Denbigh scheme of reactions [Levenspiel, 1999] as shown in Figure 8.16. The
absorption process kinetics can be represented as a simple set of reactions with a first
order rate. These equations are given as follows;
dnA
dt
k1 k3 nA
(8.86)
Table 8.2. Styrene Concentration in Plasma

Styrene
concentration
(nano gm).lit-1
1,000
10,000
1,000
200
25
0.5
0.01
1.5 E-4
time
0
2
4
6
8
12
16
20
Figure 8.16. Special Case of Denbigh Scheme of Reactions.
dnS
dt
dnB
dt
k4 nB
k4 nB
k3nA
(8.87)
k5 nS
(8.88)
521
dnR
dt
k1nA
k2 nR
(8.89)
dnT
dt
k2 nR
k5 nS
(8.90)
Show that a single compartment model with elimination for A can be written as.
fDoseA
e
Va
klumped
k1 k3 t
k1 k3
C Aplasma
dC Aplasma
dt
(8.91)
14.0. Show that a single compartment model with elimination for species B in Figure
8.16 can be written as follows;
fDoseB
e
Va
klumped
k4 t
k4
CBplasma
dCBplasma
dt
(8.92)
15.0. Show that a space space model for the kinetics of the 5 species in Figure 8.16 can
nA
nB
d
nS
dt
nR
nA
0
k3
k4
k4
0
k5
0
0
0
0
nB
k1
k2
nS
nR
k2
k5
nT
k1
k3
nT
(8.93)
Show that the characteristic equation can be written as follows;

k1
k3
k4
k5
k2
k5
(8.94)
Obtain the solution of the time decay of the 5 species concentrations.

16.0. Obtain the eigenvalues of the rate matrix in Eq. (8.93) of Exercise 4.0.
(8.95)
17.0. Show that a single compartment model with elimination for species R in Figure
8.16 can be written as follows;
dnR
dt
The intermediate species;
k1nA
k2 nR
(8.96)
522
nR
fDoseA
e
Va
k1 k3 t
k1
( fDose)
k2
k1 k3
k2
k1
fDoseA
k1
Va
k2 k1
k1t
k1t
k2 t
k2t
klumped
k1 k3
(8.97)
CRplasma
dCRplasma
dt
(8.98)
18.0. Develop a single compartment model for species T in Figure 8.16.

19.0. Develop a single compartment model for species S in Figure 8.16.
20.0. Obtain the transfer functions of the single compartment models for 5 different
species in Figure 8.16.
21.0. Construct the AR and Phase Angle Bode plots for transfer functions for 5 different
species in Figure 8.16.
22.0. Construct the Nyquist diagrams for transfer functions for 5 different species in
Figure 8.16.
23.0. What would happen to the concentration of species R in Eq. (7.98) when the rate
constant k2 = k1.
(Hint: Examine the kinetics again in Eq. (8.89)
24.0. Area under the Pharmacokinetic Curve
Some drug pass along with the urine. The rate at which drug accumulates in the urine
at any given instant in time can be written as;
dmurine
dt
plasma
kreVa Cdrug
(8.99)
Where murine is the mass of the drug collected in the urine at any given instant in
time. Show that at infinite time,
murine
Dose
kre
klumped
Area0.. Frenal
(8.100)
Eq. (8.100) would be a relationship between the total amount of drug collected in the
urine, the renal clearance and the area under the concentration of the drug vs. time
curve.
25.0. Calculate the total amount of species A and species B collected in the urine for the
scheme of reactions shown in Figure 8.16 using area under the curve from the
solutions of the single compartment pharmacokinetic model.
26.0. Calculate the total amount of species R, S and T collected in the urine for the
scheme of reactions shown in Figure 8.16 using area under the curve from the
solutions of the single compartment pharmacokinetic model.
27.0. In Example 8.1 a 4th order rate process was assumed for ethanol oxidation reaction.
Develop a single compartment pharmacokinetic model assuming a third order rate
process for ethanol oxidation reaction.
dnanatomy
3
kinf usion nanatomy
rA
dt
523
(8.101)
Is the Taylor series expansion needed in order to obtain the closed form analytical
solution ?
28.0. Use Lambert function and show that the solution to the Michaelis and Menten
kinetics in the dimensionless form can be written as follows;
u
uM
Lambert
uM
uM e
1
uM
(8.102)
29.0. Trambouze Reactions

The infusion rates of a certain drug system can be given by the Trambouze scheme of
reactions [[Levenspiel, 1999] as shown in Figure 8.17. The absorption process
kinetics can be represented as a simple set of kinetic equations as follows;
dnA
dt
dnR
dt
dnS
dt
dnT
dt
k0
k1
k2 n A
k0
(8.103)
k1n A
k2 n A
Develop a first order pharmacokinetic model for species A in Figrue 8.17 with
elimination. Obtain the transfer function for the model.
Figure 8.17. Trambouze Reactions Scheme.
524

30.0. Construct the AR and Phase angle Bode plots for the species A in the Trambouze
scheme of reactions as discussed in Exercise 29.0.
31.0. Develop a first order pharmacokinetic model for species S, R and T in Figure 8.17.
Obtain the transfer function for the model.
32.0. Construct the AR and Phase angle Bode plots for transfer functions for species S, R
and T in the the Trambouze scheme of reactions as discussed in Exercise 29, 31.0.
33.0. Construct the Nyquist diagrams for transfer functions of species A, S, R and T in
the Trambouze scheme of reactions in Figure 8.17.
34.0. 4 Reversible Reactions in Circle
Consider the scheme of reactions in circle as shown in Figure 8.8. Consider 4 species
and consider that each of the reaction steps are reversible in nature. Write the
reaction rate equations for each step. Under what set of reaction rate constants would
there be subcritical damped oscillatory conditions developed.
35.0. Second Order Reversible Reaction
Develop a single compartment pharmacokinetic model with absorption and
elimination. Assume that the kinetics of absorption is second order and reversible.
Obtain the output response as a function of time. Is a closed form analytical solution
possible or a numerical solution needed to solve for the governing equation ? How
sensitive are the model results to the absorption kinetics rate constant and the
excretion rate constants ?
36.0. Michaelis-Menten Kinetics
Consider the single compartment pharmacokinetic model with absorption and
elimination for the case when the absorption kinetics obey the Michaelis and Menten
kinetics as discussed in section 8.3.3. Obtain the model solution at the asymptotic
limits of high concentration when the reaction rate becomes zeroth order and at the
asymptic limits of low concentration when the reaction rate becomes first order. How
do the results from the asymptotic limits compare with the exact solution discussed
in section 8.3.3.
37.0. Two Compartment Model
Develop a two compartment pharmacokinetic model with absorption and elimination
for case when the absorption kinetics obey the Michaelis and Menten kinetics. Use
the Taylor series expansions solution as discussed in section 7.3.3 and compare the
model results with the exact solution for the kinetics.
38.0. Two Compartment Model at the Asymptotic Limits of High and Low Concentration
Consider the two compartment pharmacokinetic model with absorption and
elimination for the case when the absorption kinetics obey the Michaelis and Menten
kinetics as discussed in section 7.3.3. Obtain the model solution at the asymptotic
limits of high concentration when the reaction rate becomes zeroth order and at the
asymptic limits of low concentration when the reaction rate becomes first order. How
do the results from the asymptotic limits compare with the exact solution discussed
in section 7.3.3.
39.0. 3 Reversible Reactions in Circle
Consider the scheme of reactions in circle as shown in Figure 7.8. Consider 3 species
and consider that each of the reaction steps are reversible in nature. Write the
reaction rate equations for each step. Under what set of reaction rate constants would
there be subcritical damped oscillatory conditions developed.
525
40.0. Dosage Obeys Ramp Function

The single compartment pharmacokinetic model with absorption and elimination
discussed in section 7.3.1 was for the case when the dose decays in a monotonic
exponential manner. Consider that the dosage decay obeys a ramp function such as;
nanatomy
fDose 1 kt
Plot the output response for the Cdrug in the human anatomy as a function of time.
What happens during the special case when the reate constant k = klumped.
41.0. Dosage Obeys Impulse Function
The single compartment pharmacokinetic model with absorption and elimination
discussed in section 7.3.1 was for the case when the dose decays in a monotonic
exponential manner. Consider that the dosage decay obeys a impulse function such
as;
nanatomy
fDose
t0
Plot the output response for the Cdrug in the human anatomy as a function of time.
What is the transfer function of the model.
42.0. Pharmacokinetic Model for Paclitaxel Distribution
Anticancer drug paclitaxel in the plasma has been known to [Henningson, 2001]
cause nonlinear behavior. 23 female and 3 male patients with different cancer types
such as ovary, breast, bladder, lung and adenocarcinoma were included in the study.
Patients received 3 hr intraveneous IV infusions of paclitaxel. Concentrations of
paclitaxel were measured using an isocratic reversed-phase-high-performance liquid
chromatographic method with UV detection at 230 nm. Develop a single
compartment pharmacokinetic model that can best describe the concentration of
paclitaxel in blood plasma as a function of time as given in Table 8.3.
Table 8.3. Observed Concentrations of Paclitaxel
#
1.0
2.0
3.0
4.0
5.0
6.0
7.0
Time (hr)
0.5
2
5
8
10
20
25
Cdrug (mol.lit-1)
0.2
0.5
0.2
0.03
0.015
0.003
0.002
Chapter 9
INSTRUMENTS
9.1. PRECISION AND ACCURACY
A modern chemical plant contains a number of sensors and probes that are used to
measure the relevant process variables, 24 x 7 round the year. The entire process, starting
with the raw material procurement and metering tanks, reactor vessels, distillation columns
and other equipment used in different unit operations that are needed for the operation of the
plant, are instrumented with appropriate sensors. These measurements are often recorded in a
computer using data acquisition methods. These data are used to devise the control action.
Several kinds of control action are discussed in earlier chapters.
The accuracy of the device and precision of the device are two different things. A digital
readout to the third decimal place may be precise but need not be accurate. Accuracy is the
margin of error or error bar or confidence interval surrounding the measured value within
which the true value may lie. The error bar denotes the experimental error associated with the
instrument and with the personnel used to operate the equipment. For example, a temperature
reading may be 91.423 0F. There are 5 significant figures used in representation of the
temperature. The number is precise to 10-3 or 0.001 0F. The accuracy of the reading depends
on the device used to measure the temperature. If the thermocouple used to measure the
temperature is good to an accuracy of 0.1 0F, for example, then the temperature reading is
as good as 91.4 0.1 0F.
9.2. SENSORS AND PROBES

There can be different kinds of sensors such as magnetic sensors, infrared and visible
light sensors, temperature and flow sensors, chemical sensors etc. Microprocessor
technologies are used to make sensors that can be used to measure process variable with
increased resolution such as less than micron size in space and less than a millisecond in time.
Bulk machined sensors are obtained by accurate machining of a relatively thick substrate.
Surface machined sensors are primarily made by accurate machining of a relatively thin
substrate. Both these technologies use materials and processes borrowed from VLSI
528
technology. The processes of etching, deposition and lithography are sufficient to construct a
variety of mechanical structures required for specific sensors. A fundamental sensor
fabrication problem is the development of a suitable fabrication process sequence of the
above mentioned machining steps.
9.3. TEMPERATURE MEASUREMENTS

Temperature sensors are used to measure temperature at a specific location in the
chemical reactor or distillation column or other unit operations of interest. There can be
different types of temperature sensors;
(i) Electronic Temperature Sensors
(ii) Gas and Liquid Filled Thermometers
(iii) Bimetallic Thermometer
9.3.1. Thermocouples
Thermocouples are built based on a principle called the Seebeck effect. In 1821 T. J.
Seebeck discovered that when a thermal gradient is imposed on a conductor an electrical
voltage would be generated. This phenomenon is also called the thermoelectric effect.
Thermoelectric materials have gone through a renaissance with the emergence of
nanotechnology. Bismuth Telluride, Bi2Te3 is a commonly used thermoelectric material. The
Peltier effect is when an electric current is imposed on a conductor a temperature gradient is
established. Thermocouples can be used to measure temperature. It is a thermoelectric device
with two dissimilar metals joined so that a potential difference is generated between the
contact points. This voltage is calibrated against the temperature and temperature backed out
from the calibration. A leading manufacturer of thermocouples is Omega Inc., Stamford, CT
makes a variety of thermocouples. They have 100,000 state of the art products for
measurement and control of temperature, humidity, pressure, strain, force, flow, level, pH and
conductivity.
The customer can select the thermocouple based on their application and temperature
range used and price that they are willing to pay. Chemical resistance of the thermocouple or
sheath material, abrasion and vibration resistance and installation requirements are other
factors used in selection of thermocouples. The common temperature-voltage calibrations are
J, K, T and E. High temperature calibrations R, S, C and GB. The maximum temperature of
use varies with the diameter of the wire used in the thermocouple. The range of temperatures
different thermocouple types can be used are: (i) J type in the range of 315 760 0C; (ii) K
type in the range of 590 -1260 0C; (iii) E type in the range of 320 870 0C; (iv) T type in the
range of 150 370 0C; (v) N type in the range of 870 1260 0C; (vi) CX type in the range of
400 472 0C. The thermocouples are usually sheathed and available in three different types:
(i) grounded; (ii) ungrounded and; (iii) exposed. In the exposed variety the junction protrudes
out of the tip of the sheath and is exposed to the surroundings. The time constant is defined as
Instruments
529
the time required by a sensor to reach 63.2% of a step change in temperature under a specified
set of conditions. About 5 time constants is recommended by Omega Inc., Stamford, CT after
the set point change to reach 100% of the initial set point.
Measurement of temperatures below -150 0C is called cryogenic temperature
measurement. Extreme temperature ranges of either too low or too high can cause damage to
the sensors. Sensitivity of the temperature also depends on the temperature. Silicon diode
chips are used in cryogenic temperature measurements. Infrared pyrometers can be used to
measure temperature of objects in motion that are difficult to measure. IR rays are emitted
from a source and focused using a lens onto a detector. The optical energy is converted to
electrical signal that can be calibrated against the temperature of the object the IR was shined
upon. This method offers a non-contact means of obtaining the temperature and can be used
in places where thermocouples cannot be used for some reason. Thermistors can be used to
measure temperature. It is made up of sintered semiconductor material that undergoes larger
changes in electrical resistance in response to smaller changes in temperature. The coefficient
of electrical resistance change with temperature is negative. Thermistors can be used to make
accurate measurements. They have a limited range of applicability of 0 100 0C.
9.3.2. Microwave Temperature Sensors

Nuclear reactor in-core temperatures can be measured using:
(a) Thermocouples
(b) RTDs, resistance temperature detectors
(c) Thermistors
Some problems were encountered in obtaining the measurements in a radiation
environment [1]. Errors in measurement can be caused by:
(i) Radiation Heating
(ii) Degradation of Insulation
(iii) Transmutation of Constituent Materials
(iv) Lattice Defects resulting from Elastic Neutron Collisions
(v) Thermal Conduction in Connecting wires
Absolute errors in temperatures as high as 815 0C at a true temperature of 2490 0C for
thermocouples have been reported. RTDs, resistance temperature devices suffer moderate
damage at fast neutron fluencies of 1017 n.cm-2 and gamma exposure of 1010 ergs.gm-1. The
temperature sensors that are operated can result in errors less than 2 % of the indicated
reading. Some of the issues in using this technique are: (a) adverse effects upon their life; (b)
accuracy; (c) sensitivity; (d) precision; (e) time response. Microwave sensors being developed
are made to respond to temperature variations with the periods of the order of 500 ms to 20 s.
A Nickel-Chromium microwave temperature sensor is shown in Figure 9.1.
.
530
Figure 9.1. Nickel-Chromium Microwave Temperature Sensor.
An oscillator is used to excite a metal cavity at a resonant frequency determined by its

physical size, geometry or distribution of electromagnetic fields within the cavity and value of
the effective dielectric constant of the contained medium. Billister [Sharma, 20.10] assumed
constant permittivity of the medium and for the chosen mode of excitation the resonant
frequency f0 depends only on the cavity size as given below for a cylindrical cavity;
f0
c
2
l
L
,
U nm
a
2 0.5
(9.1)
Where l, m and n are resonant mode designators, L and a(m) the cavity length and radius
respectively, c is the speed of light (m.s-1), U argument for which the Bessel function
derivative is zero. The expansion/contraction of the metal microwave cavity as shown in
Figure 9.1 is used as the basis for the operation of the microwave sensor. The change in the
resonant frequency is measured and the temperature obtained from the change. The change in
dimension with temperature for any metal can be given by;
L L0 (1 T T 2 T 3 ......)
(9.2)
Where the constants , and can be determined experimentally. Nickel-Chromium

steel is selected based on their high expansion characteristics. The rest of the waveguide is
made of OFHC copper. The time constants for the sensor are 500 milliseconds when water is
poured over the sensor and 30 seconds when immersed in Helium gas.
Semi-conductor sensors can be used for obtaining force measurements. These are
transducers that convert mechanical signals into electrical signals. Applications are in
microphones, pressure sensors and accelerometers. The development of MEMS,
microelectromechanical sensing system offered stimulus to research in semi-conductor
Instruments
531
sensors. Micro fabricated devices are micro machined sensors. In micromachining

technology, advantage is taken of the benefits of semiconductor technology. This addressed
the manufacturing and performance requirements of the sensor industry. New sensors with
better capabilities are expected on account of the versatility of semiconducting materials and
miniaturization of VLSI patterning techniques. Bettered performance-to-cost ratio of the
emerging devices over conventionally machined devices is expected. A micro machined
accelerometer is shown in Figure 9.2. The micromechanical sensors with BICMOS
technology were integrated into the sensor.
Bulk micro machined sensors are primarily made by accurate machining of a relatively
thick substrate. Surface micro machined sensors are primarily constructed from stacked thin
films. Both technologies use materials and processes from VLSI technology.
9.4. VISCOSITY MEASUREMENTS

9.4.1. Efflux Viscometer
The traditional methods of viscosity measurement of a liquid have changed over time.
Viscosity used to be measured and reported in terms of seconds needed for the liquid to exit a
tube. These viscometers are called efflux viscometers or short tube viscometers. The time
needed for a given volume of fluid to discharge under the forces of gravity through a short
tube orifice at the base of the instrument is measured. The viscometers are called Redwood in
England and the Engler in Germany and Saybolt in this country, USA. Viscosity is quoted as
Redwood or Saybolt seconds. Based on calibration the Saybolt universal for example gives
the Stokes viscosity as 0..0226t 1.95/t for fluids with efflux time between 32 and 100
seconds. It can be seen that for higher viscosity fluids the relationship in the calibration are
different. Further viscosity changes with temperature and pressure. The relationships of
viscosity change with temperature and pressure have also been studied by some investigators.
For reliable measurements during the test it is advisable to not let the conditions of pressure
and temperature change appreciably.
9.4.2. Falling Ball Viscometer (Bird et al., 2007)

Falling ball viscometer is based on Stokes settling of falling spheres in a fluid attaining
its terminal settling velocity. The terminal settling velocity of the falling sphere in a fluid is
reached when the forces of gravity is balanced by the forces of buoyancy and drag. Once the
terminal settling velocity of a sphere is measured using video photography, when the density
of the solid and fluid, diameter of the solid are known, the Stokes law can be used to
calculate the viscosity of the fluid. For instance, steel ball bearings are dropped in glycerin to
check the viscosity of industrial fluids. Nylon balls were allowed to fall through carbopol
solution to measure the type of fluid, whether, Newtonian or otherwise. The glass container
carrying the sphere must be wide enough so that the wall effects can be neglected. The
expression used to calculate the viscosity is the terminal settling velocity of the sphere and
can be written as:
532
Figure 9.2. Micro machined Accelerometer.
Vs
2r 2 g (
(9.1)
Aspherical particles can also be used to settle. The sphericity of the particle can be used
in the calculations. Renganathan, Clark and Turton [1989] developed charts for distance
traveled by accelerating spheres in a fluid prior to attaining terminal settling velocity. The
change of drag coefficient with Reynolds number is also taken into account. Numerical
solutions to the equation of motion were obtained and the results presented in easily usable
charts. These charts can be used in order to design better sedimentation tanks and design hot
air balloons. Other moving body viscometers are the Hoeppler viscometer, Irvine-Park
falling-needle viscometer used for transparent fluids, bubble rise velocity viscometer, falling
rod viscometer, sliding-plate viscometer, etc.
9.4.3. Cone and Plate Viscometer

The liquid whose viscosity needs to be measured is placed between a stationary flat plate
and an inverted cone whose apex just contact the plate (Figure 9.3). The cone is rotated at a
known angular velocity, in a cone and plate viscometer and the torque, Ty required to turn
the cone is measured. An expression for viscosity of the liquid in terms of the angular
velocity of rotation of the cone, torque needed and the made by the cone with the plate. This
is usually about 10.. The expression for the torque required to turn the cone can be shown
to be:
533
Instruments
Figure 9.3. Side Views of Cone-and Plate Viscometer and Velocity Distribution in Control Volume.
Ty
2
3
R3
(9.1)
Where, is the angle made by the cone with the flat plate, R is the radius of the cone, is
the viscosity of the liquid.
9.4.4. Coutte Viscometer

Coutte viscometer is a member of a class of rotational rheometers. The torque needed to
rotate a solid object in contact with a fluid is measured and the viscosity deduced from
derived expression. Modification of Coutte viscometer is the Stabiner viscometer. Here the
inner cylinder is hollow and allowed to float avoiding bearing friction. Speed and torque
measurements are made by remote techniques of rotating magnetic field.
A schematic of a Coutte viscometer is shown in Figure 9.4. The cup holds the fluid
whose viscosity needs to be measured. The cup is made to rotate with a constant angular
velocity, o. The revolving viscous liquid caused the suspended bob to turn. A point is
reached when the torque produced on account of momentum transfer in the liquid becomes
equal to the product of the torsion constant, kt and the angular displacement of the bob. The
angular displacement, o, is measured using a mirror mounted on the bob by noting the
deflection of light beam. A steady tangential annular flow is maintained between two coaxial
cylinders. The end effects due to the bob height H can be neglected. The equations of
continuity and momentum for the liquid in tangential flow can be written as follows (Bird,
Stewart and Lightfoot, 2007): The density and viscosity of the liquid are assumed to remain
constant and unaffected by the flow.
(9.2)
d 1 d (rv )
dr r dr
p
z
(9.3)
(9.4)
534
Figure 9.4. Coutte Viscometer.
The boundary conditions are;

r = R, v = 0.
(9.5)
r =R, v = o
(9.6)
Integrating Eq. (9.3) twice and solving for the boundary conditions it can be shown that
the tangential velocity of the fluid can at steady state by;
r
kR
oR
1
k
kR
r
(9.7)
Once the velocity distribution is available, the momentum flux can be estimated as;
R
r
k2
(9.8)
1 k2
The torque acting on the inner cylinder is then obtained as;
Tz
2
oR H
k2
1 k2
kt
(9.9)
Thus the measurements of angular velocity of the cup and the angular deflection of the
bob enable the determination of the viscosity of the liquid. When a critical Reynolds number
535
Instruments
is reached Taylor vortices form and turbulent flow ensues upon further increasing the
velocity.
9.4.5. Parallel Disk Viscometer

In a parallel disk viscometer, a liquid whose viscosity needs to be measured is placed in
the gap of thickness B between the two disks of radius R and held in place by surface tension.
The torque needed to turn the upper disk at an angular velocity of is measured and the
lower disk is fixed. Assuming creeping flow, the working equation for obtaining viscosity of
the liquid can be shown to be:
2 BTz
(9.10)
R4
In a parallel disk compression viscometer, a liquid is allowed to fill completely the region
between two circular disks of radius R. The bottom disk is fixed. The upper disk is made to
approach the lower one very slowly with a constant speed v0 starting from an initial height
H0. The instantaneous height is given by H(t). It can be shown that the force needed to
maintain the constant velocity is given by, where V is the volume of the liquid sample;
F (t )
3 v0V 2
(9.11)
2 H (t )5
The H(t) is measured as a function of time and then the viscosity is determined from:
1
4 Fo t
H (t )
H o2
R4
(9.12)
Where Fo is a constant applied force.
9.4.6. Rolling Ball Viscometer

Rolling ball viscometer is designed based upon the results from analysis of laminar flow
in a narrow slit. A Newtonian fluid is in laminar flow in a narrow slit formed by two parallel
walls a distance 2B apart. Edge effects can be omitted as B << W. Performing a differential
momentum balance the following expressions for the momentum-flux and velocity
distributions can be derived:
P0
xz
PL
L
(9.13)
536
vz
P0 PL B2
2 L
(1 ( Bx )2 )
(9.14)
Where P = p+gh.
The rolling ball viscometer is shown in Figure 9.5. A ball is rolled down the walls of a
cylinder held at an incline angle with the horizontal. The sector formed between the crosssections of the rolling ball and cylinder at any given instant can be shown to be a function of
the polar angle, and z.
2( R r ) Cos 2
R2 z 2
2( R r )
(9.15)
9.4.7. Torsional Oscillatory Viscometer

In a torsional oscillatory viscometer, the fluid is sandwiched between a cup and bob.
Sinusoidal oscillations are imposed in the cup in the tangential direction. This causes the
suspended bob to oscillate with the same frequency with a different amplitude and phase. The
torsion wire used to suspend the bob also oscillates at the same frequency and amplitude as
that of the bob. The ratio of amplitudes between the cup and bob and the phase lag are a
function of the viscosity of the liquid. Small oscillations are considered. The problem remains
linear for small oscillation. The solution to the governing equations can be obtained by the
method of Laplace transforms.
Newtons second law of motion can be applied to the cylindrical bob for the special case
when the annular space between the cup and bob are evacuated. It can be shown that the
k
where, I is the moment of inertia of the bob, k is
I
the spring constant for the torsion wire. Further, Newtons second law of motion can be
applied to the bob and;
natural frequency of the system is
d2
dt
R
2
(2 RL)( R)
v
r r
(9.16)
r R
The initial conditions are;

t=0.,
d R
dt
R0
(9.17).
(9.18)
The governing equation of motion for fluid and the time and space conditions can be
written as:
537
Instruments
Figure 9.5. Rolling Ball Viscometer.
v
1

(rv )
t
r r r
(9.19)
t=0, v = 0
r=R, v
r = R, v
d R
dt
R
(9.20)
(9.21)
dt
R(t) is a sinusoidal function of time that caused the forced oscillations of the cup and
the induced oscillations of the bob. For close clearances between the cup and bob, is close
to 1. The variables are made dimensionless and the resulting governing equations solved for
by the method of complex velocity. It can be shown that from results the amplitude ratio can
be given by:
_
0
R
0
R
AMi
_
(1
i
_ 2 sinh
M
)
_
_
_
AMi
i
M
Where,
M=
( 1)2 R 2
I
;
k
k
;
I
i
cosh
M
(9.21)
(9.22)
0
538
A=
2 R4 L (
I
1)
2 R3 L (
kI
1)
(9.23)
9.4.8. Bubble Viscometer

In bubble viscometers, the time required for air bubble to rise in the fluid is an inverse
measure the viscosity of the fluid. Calibration is used to standardize the technique in the
desired viscosity ranges. Viscometers for non-Newtonian fluids are also called rheometers or
plastometers. Piston cylinder arrangement is used in Norcross viscometers. Material is drawn
through the clearance between the piston and cylinder by raising the piston periodically.
9.4.9. Helical Screw and Other Viscometers

A screw device is used. The measure of the force is the pressure difference resulting from
rotational motion. A bank of pressure transducers of different sensitivities are used to measure
viscosity over a wide range. Viscometers that are commercially used are Bohlin rheometer
system, Brabender Rheotron Coutte viscometer, Brookfield synchro-Lectric viscometer,
Carri-Med CS rheometer, Centraves rheomat, Fann V-G, Chan 35 direct indicating
viscometer, Ferranti-Shirley viscometer, Haake Buchler instruments rotovisco system,
Hercules viscometer, ICI cone-plate device, Mac Michael viscometer, Mooney shearing disk
viscometer, Nametre rotary B rotational viscometer, Physica rotational viscometer,
Ravenfield model BS viscometer, Rheometrics family of complex dynamic viscometer, RheoTech International viscoelastic rheometer, Stormer viscometer, Weissenerberg
rheogoniometer.
Controlled stress rheometer can be used to measure the viscoelasticity. Examples are
Bohlen VOR rheometer, Carri-Med cs Rheometer, Metrovib MVA Mach I, Rank pulse shear
meter. Capillary viscometers include Ostwald viscometer, Cannon-Fenske viscometer and
Ubbelohole viscometer.
9.5. BIOCHIPS
Gene expression studies can be carried out in biochips. Target biological materials are
examined using fluorescent probes in glass slides packed with thousands of genes. Disease
states can be better understood using biochips and cures from better drug design can be
effected. Microarray industry is expected to grow in a similar fashion to the microprocessor
revolution. A microarray is an ordered array of microscopic elements in a planar substrate
that allows for specific binding of gene or gene products. In order to qualify as microarray,
the analytical device must be ordered, microscopic, planar and specific. Microarrays are
evolving into nan arrays with the dot size decreasing to the nanoscale. One goal of microarray
analysis is to eradicate every human disease by the year 2050. Some of the interesting
applications of biochips lie in the areas of gene expression, drug delivery, genetic screening
and diagnostics, gene profiling, understanding mechanism of ageing, the study of cancer, etc.
Instruments
539
The confocal scanning microscope can be used in microarray detection where

fluorescence scanning is sued. The sample is excited by a laser beam, and fluorescence light
is emitted from the probe in the sample and can be detected using the difference in
wavelength of 24 nm between excitation and emitted light beams. Epi-illumination is used in
the scanning process. The excitation and emitted beams pass through the objective lens to and
from the sample but in opposite directions. PMT is sued as a detecting element. The
instrument performance measures are number of lasers and fluorescence channels, detectivity,
sensitivity, crosstalk, resolution, field size, uniformity, image geometry, throughput and
superposition of signal sources. High quality surfaces are needed for the preparation of
microarray samples. An ideal microarray surface has to be dimensional, flat, planar, uniform,
inert, efficient and accessible.
Optimal target concentration occurs at a spacing of 1 DNA target molecule per 20 A. The
probe duplex is approximately 24 A. Optimal probe concentration is the number of probe
molecules per unit volume of sample that provides the strongest signal in a microarray assay.
Microarrays of oligonucleotides can be prepared by using delivery or synthesis methods. The
four steps in process of oligonucleotide synthesis are deprotection, coupling, capping and
oxidation. The three manufacturing methods used during microarray manufacture are ink jet
printing, mechanical micro spotting and photolithography. Stepwise coupling efficiency can
be defined to gauge the quality of microarray synthesis. Linker molecules can be used to
increase the efficiency of hybridization and DNA attachment at the surface. The time taken
for ink-jet printing when jets or pins or used are compared against each other.
Statistical normalization procedures can be used to remove systematic variations in nano
array experiments that affect the measured gene expression levels. Speed [Sharma, 2010]
developed a normalization procedure using gene expression data from lipid metabolism in
mice. He used housekeeping genes that have constant levels of expression across variety of
conditions. Differentially expressed genes were identified by computing the t statistics.
Global normalization methods, M vs A plot, paired-slide normalization, within slide
normalization and multiple-slide normalization methods are discussed.
9.6. PRESSURE MEASUREMENTS

Pressure of a process vessel can be measured by different methods such as;
(i) Manometer: Bourdon Tube, U tube, Inclined Tube, Dial Types
(ii) Piezoelectric Transducers
(iii) Non-contact Measurements
9.6.1. Pressure Transducers

Pressure transducers can be used to convert pressure signals into an analog or digital
electrical signal. A carefully designed probe can be used to obtain pressure signals. These can
be converted into analog signals which in turn can be converted into digital signals and stored
on a desktop computer via analog to digital boards. This process is called data acquisition.
540
Strain gauges made of metal foil or semiconductor can be used for obtaining pressure
measurements. The metal foils are made of copper-nickel alloys. The change in resistance
with deformation is built on further and calibrated and the pressure measurement is obtained
indirectly. Semiconductor devices are made of silicon or germanium. Their piezoresistive
properties are used to obtain pressure from voltage measurements. Electrical resistance is
measured using Wheatstone bridge circuits. Piezoresistive gauges are bonded to a pressure
measuring diaphragm using high strength epoxies. The pressure measuring diaphragm is
circular in shape often times and made of steel/ceramic.
MEMS, Micro electro mechanical systems have been developed to improve on the
previous generation of piezoresistive strain gauges. Silicon based MEMS are used in order to
measure water levels. MEMS based devices have high sensitivity, small size, low signal to
noise ration, good reproducibility, low hysteresis, etc. Miniaturization techniques have been
tapped into development of MEMS devices. A small diaphragm can hold thousands of
miniaturized pressure sensors. Ion implantation techniques are used to molecularly embed
strain elements. This is used to measure the strain induced by pressure at a higher resolution.
MEMS devices can be used to make single and differential pressure probes and can be used in
medical and aerospace applications. Outputs of MEMS are 50 times more than from the metal
foil based strain gauges. Lower hysteresis effects can be expected on account of the elasticity
of the silicon strain gauge.
9.6.2. Intra-Ocular Pressure Measurements

Intra-ocular pressure, IOP measurements are needed during the diagnosis of Glaucoma.
Glaucoma, is a disorder of the eye. It is a disease of elevated pressure of intra-ocular fluid.
Should this condition prevail for sustained periods of time it may lead to the damage of the
optic nerve. This may lead to blindness. A high rate of false positive and false negatives
during the diagnosis of glaucoma was found. This is because of the trials and tribulations of
obtaining a pressure measurement of the intra-ocular fluid in the eye. A number of errors
creep into the measurement of IOP using a tonometer (K. Renganathan, 1988). He proposed
that demographic studies of tomographs can be used and tables generated from conditional
probability. These tabless can be used to interpret the error bars in a single IOP measurement.
He pointed out that a static measurement of a dynamic quantity may not be sufficient. The
resulting values would be a better indicator of the occurrence of glaucoma and lead to lower
false positive and false negatives.
Applanation tomometers are used to obtain the single IOP measurement after applanation
of the cornea. Goldman presented the principles of applanation tonometry [Renganathan,
1988]. Force is applied via a small tonometer tip to a surface of the cornea in order to create a
flat corneal surface. The area of the tonometer tip is designed (about 3.06 mm2) such that the
required force in dynes multiplied by 10 is equal to the IOP in mm of Hg. Goldman
applanation tonometer can either be hand-held or fixed type. The applanation-type tonometer
is used with the application of anesthesia.
Another type of tonometer is the Schiotz/plunger type. The plunger type tonometer is
placed before the eye along the optical axis. When the plunger is released the cornea gets
flattened to the specified diameter. The force applied is measured and the pressure value is
backed out. Non-contact methods include blowing an air puff on the eye. This causes the
Instruments
541
flattening of the cornea. Subsequently the force needed is measured. A high frequency
tonometer was patented [Hsu, 1990] that can be used to obtain the IOP measurement by noncontact method without applanation of the eye and without any physical contact with the eye.
This obviates the need for anesthetics. Neither light nor air need be surged on the eye.
Continuous data similar to a tomographic record can be obtained using this instrument. A low
frequency sound wave is emitted towards the eye. Vibrations of the surface of the eye are
caused. The intensity of the vibration depends on the IOP, intra-ocular pressure. Upon proper
calibration the IOP can be backed out from the vibration peak.
9.7. SUMMARY
Precision is the significant figures used in recording measurements. For example 91.123
F has 5 significant figures. The accuracy is the error bar over the reading. For example the
accuracy of this reading is about 0.1 0F. Sensors and probes can be used to obtain
measurements. The working principle varies from device to device. Thermocouples are built
on a principle called Seebeck effect and are used to measure temperature. The common
temperature-voltage calibrations for thermocouples are J, K, T and E each with a specified
temperature range. Infrared pyrometers. Thermistors, RTDs. Resistance temperature detectors
are used in temperature measurements. Absolute errors of 815 0C at a true temperature of
2490 0C lead to the use of microwave temperature sensor as shown in Figure 9.1.
Expansion/contraction of metal microwave cavity is used as basis for sensing temperature.
The time constant for the sensor are 50o milliseconds and accuracy is 2%. A MEMS
microelectromechanical accelerometer is shown in Figure 9.2.
Different viscometers and their principle operated by are given as follows;
0
Efflux viscometer
Falling Ball Viscometer
Cone and Plate Viscometer

Coutte Viscometer
Parallel Disk Viscometer
Rolling Ball Viscometer
Torsional Oscillatory
Viscometer
Bubble Viscometer
Helical Screw Viscometer
time needed for a given volume of fluid to discharge

through an orifice
Stokes law is used and viscosity calculated from video
clips at terminal settling velocity of the particle
Torque needed to rotate a cone in a fluid atop a plate

Torque needed to rotate an object in contact with the
fluid
Torque needed to turn the upper disk held in place by
surface tension
uses theory of laminar flow in a narrow slit
Viscosity calculated from the ratios of amplitudes
between the cup and bob and phase lag
Time needed for bubble to rise in a fluid
Pressure difference resulting from rotational motion
Gene transcription and translation can be studies using biochips. The glow from the
microarray slide can be used to obtain accurate kinetic information. Pressure transducers are
542
devices that output a voltage proportional to the applied pressure on the transducer. These can
be hooked to a computer by data acquisition and analog to digital conversion. Intraocular
pressure measurement practices have to be improved. This has significance in the diagnosis of
glaucoma.

Bird, R. B., Stewart, W. E. & Lightfoot, E. N. (2007). Transport Phenomena, Wiley, New
Jersey.
Hsu, H. (1990). Non-Contact High Frequency Tonometer, US Patent 4,928,697, Ohio State
University, Columbus, OH.
Renganathan, K. Turton, R. & Clark, N. N. (1989). Accelerating Motion of Geometric and
Spherical Particles in a Fluid, Powder Technology, Vol. 58, 4, 279-284.
Renganathan, K. (1988). Estimation of Intra-Ocular Pressure using Tomographs, Original
Research Proposal, Department of Chemical Engineering, West Virginia University,
Morgantown, WV.
Design and Development and Tissue Engineering, McGraw Hill Professional, New York,
NY.
9.9. EXERCISES
Review Questions
1.0. What are the differences between precision and accuracy?
2.0. What are the differences between sensor and probe?
3.0. What are the differences between magnetic sensors and chemical sensors?
4.0. What are the differences between infrared and visible light sensors?
5.0. What are flow sensors?
6.0. How is microprocessor technology a trend setter in increasing resolution in space and
time?
7.0. Where are etching and lithography used?
8.0. What are the differences between electronic and gas and liquid filled thermometers?
9.0. What is meant by Seebeck effect ? How is it difference from Peltier effect, Dufour
effect and Sorret effect ?
10.0. State True or False
(i) Temperature can be used as a output variable
(ii) Humidity can be used as a output variable
(iv) Noise in the input can be used as output variable
(iv) Disturbance in the input can be used as output variable
(v) Level in tank can be used as a output variable
(vi) Material of construction of a reactor can be used as a output variable
(vii) Pressure can be used as a output variable
Instruments
543
(viii)Strain can be used as a output variable

(ix) Force can be used as a output variable
(x) Flow rate can be used as output variable
(xi) pH in the reaction medium can be used as output variable
(xii)Conductivity can be used as output variable
11.0. Is chemical resistance of sheath material and vibration resistance factors used in
selection of thermocouples?
12.0. What are the differences between calibrations of thermocouple types J and K ?
13.0. What are the differences between calibrations of thermocouple types T and E?
14.0. What is meant by thermal time constant of the temperature sensor?
15.0. How can sensors with a response time with a thermal time constant of the order of
magnitude of a few nanoseconds be prepared?
16.0. What is the temperature cut-off for cryogenic temperature measurement?
17.0. What material in construction of cryogenic temperature sensors?
18.0. What is the advantage of using infrared pyrometers?
19.0. What are the differences between photoelectric effect and thermoelectric effect?
20.0. What property of thermistors is used in measurement of temperature?
21.0. What is the significance of the negative coefficient of electrical resistance change
with temperature?
22.0. What are the sources for an absolute error of the magnitude of 8150 C in
measurement of nuclear reactor in-core temperatures in the range of 24900 C.
23.0. Name two issues in measurement technique used for obtaining nuclear reactor incore temperatures?
24.0. What are the major components of the Nickel-Chromium microwave temperature
sensor?
25.0. What principle is used in design of microwave temperature sensor for obtaining incore temperatures in nuclear reactors?
26.0. Why does the time constant for the microwave sensor increase from 0. 5 second
when immersed in water to 30 seconds when immersed in Helium?
27.0. What are the features of a micro machined accelerometer?
28.0. What feature of the fluid is used to measure viscosity using efflux viscometers?
29.0. How is Newtons law of motion used in design of falling ball viscometer?
30.0. How is torque calculations used in operation of cone and plate viscometer?
31.0. How are the equations of continuity and motion used in the operation of Coutte
viscometer?
32.0. How is surface tension a consideration in the viscosity calculations in the operation
of parallel disk viscometer?
33.0. How is momentum balance used in obtaining the viscosity of a fluid using a rolling
ball viscometer?
34.0. How is Newtons second law of motion used in design and operation of torsional
oscillatory viscometer?
35.0. What are the differences between bubble viscometer and helical screw viscometers?
36.0. Discuss the main components of a confocal scanning microscope.
37.0. How is there an optimal target concentration during operation of biochips?
38.0. Name one non-contact method and one contact method of pressure measurement.
39.0. What is the advantage of using MEMS device?
544

40.0. How does the error bar in the IOP, intraocular pressure measurements used in the
diagnosis of glaucoma?
41.0. What are the differences between tonometer and tomography?
42.0. What is meant by applanation tonometry?
43.0. How Schiotz type tonometry is differs in operation from applanation tonometers?
44.0. How is air-puff used as a non-contact method of tonometry?
45.0. How did Renganathan [1988] estimate the true IOP from single tonometry
measurements?
46.0. What role does demographics have in the proposal of Renganathan [1988] What is
the effect of sitting, standing or lying position on the single IOP measurements used
in the diagnosis of glaucoma?
47.0. Does tomographic records from MIB, medical information bureau of glaucoma
patients used in the proposal of Renganathan [1988]?
Chapter 10
NANOROBOTS IN NANOMEDICINE
10.1. INTRODUCTION
In the movie, fantastic voyage, that came out in 1966 a group of doctors, are shrunk to
microscopic size and enter the body of a patient in a submarine like capsule to set him right
from the inside. In fantastic voyage, a secret agent is recruited by a top-secret organization to
join the crew of a submarine called Proteus. The crew and submarine are reduced to
microscopic size and injected into the bloodstream of scientist Jan Benes, who defects to the
West and goes into a coma after suffering a surgically inaccessible blood clot. They must
reach the brain with a laser to melt the clot within an hour or the miniaturization effect will
wear off. However, the voyage is undermined by one of the crew who is a saboteur and is
prepared to risk everything to stop the mission. The vision of nanomedicine is along the lines
of this example. Feynman in his after dinner talk [1] alluded to nanomedicines being effective
solutions to cardiovascular disease. Nanoscopic devices can be swallowed by the patient.
These devices can me made to act as mechanical surgeons. Through the blood vessels the
device is allowed to travel to the heart and performs a search of faulty valves, or clogged
artery etc. It can be programmed to slice out the faulty valve and repair it or clear up the
clogged artery.
Dr. N. Schwalb and O. Solomon [2] at the department of mechanical engineering at
Technion-Israel Institute of Technology have designed such a tiny submarine robot. The
device is made capable of crawling through tubes with the diameter of human veins and
arteries. It is capable of moving with or against the blood stream as needed. It can be used in
branchytherapy. Prostate and certain other cancers of head and neck can be treated by
branchytherapy. The product is in the development stage. Tiny robots can be programmed for
an unlimited amount of time using an external magnetic field. The device is about 1 mm in
diameter. Another similar device of 1 cm device is developed at Kyoto university [2]. Shaham
has develoepd a robot for the Mazor company that is used in many hospitals world over for
performing spinal surgery. Haifa/Ariel robot has a centralized structure with tiny winy arms
that are used to grab onto the inside of the tubes. Movement of the device results in its
advancement. Hair like structure allows for travel through miniature sized tubes.
Nanorobotics is an emerging area. The words nanobots, nanoids, nanomachines, nanites,
nanomites etc are also used in place of nanorobots. Nanomachines are expected to be used in
medical technology to destroy cancer cells.
546
Figure 1.0. Nanocar with Fullerenes as `wheels.
In Figure 1.0 is shown a `nanocar designed at Rice University [3]. The molecule consists
of `H shaped `chassis. Fullerenes are attached at the four corners and can be viewed as
`wheels. These can be attached to a gold surface. Heating of the surface to 200 0 C leads to
motion of the molecules back and forth. Fullerene molecules begin to roll. The `axle is
formed from an alkyne group through a carbon-carbon sigma bond. Rotation is unhindered.
These were observed using a STM, scanning tunneling microscope.
According to some experts [4] nanomedicine is a medical modality where nanoparticles
are used for diagnosis of diseases and subsequent treatment. Nanoparticles can be used as
therapeutic agents for treatment of eye disorders. One such eye disorder is age related
macular degeneration. Nanoparticles offer a number of advantages when used as drug.
Greater capacity to detect diseases and early diagnois can be achieved using nanoparticles.
Breast tumors and prostate cancer can be cured should they be detected early. Bone cancer
can be cured using nanotherapeutic products. NMR, nuclear magnetic resonance machines
can be used to effect breakthroughs in pharmaceutical development. Techniques used in
nanomedicine can be used for treatment of diseases in a manner with minimization of damage
to the human anatomy. This is because the disease germs are isolated in the anatomy and
treatment is effected in a specific manner. Other pharmaceuticals cause damage to other parts
of the human anatomy. There are ethical issues in use of genetic modification in
nanomedicine that needs to be addressed in a modern society. Implantable devices 100,000
times smaller than the head of a pin can be used in disease diagnosis without surgical
invasion. The diseased cells are eradicated by `pumping medicine to the malignant site.
Research in nanomedicine is under way in development of diagnostics for rapid monitoring,
targeted cancer therapies, localized drug delivery, improved cell material interactions,
scaffolds for tissue engineering and gene delivery systems.
Experts in Canada have obtained approval of PLGA based nanoparticles for suitable
therapeutic formulation for clinical use in human anatomy. Degradation products of
nanoparticles were lactic acid and glycolic acid and are non-toxic. At UCSF, University of
California, San Francisco a function relationship was developed between bone-tooth complex
and nanotechnology use. Scientists at Rice University, Houston, TX have approached the
547
FDA, Food and Drug Administration for clinical trials in humans of an interesting
development in nanomedicine. Trials in mice have proved succesful. Nanoparticles were
injected into malignant cancer cells. The cells were overheated with lasers. The nanoparticle
exploded and the malignant cells were destroyed. The surrounding cells were left unharmed.
These trials have lot of potential in cancer therapy. In tradiational chemotherapy both the
malignant cells and normal cells get damaged. Nanobots can be used in drug delivery and for
performing repair work of DNA molecule. Agriculture is expected to benefit from the
advances made in nanomedicine. Nanoparticles can be used to enhance photosynthesis,
improve seed germination, soil clean-up and nutrient supply, fertilizer production, food
processing and fisheries.
Nanoscale science and engineering pertains to the synthesis, characterization and
applications of matter with at least one or more dimensions less than 100 nm. Prescott
introduced by Intel in Pentium IV chip has the dimensions of about 90 nm. Per the Rayleigh
criterion the minimum resolution size achievable is half the wavelength of light ~ 200 nm.
Nanotechnology is derived from the Greek words nanos which means dwarf and technologia
which means a systematic treatment of an art or craft. Nanotechnology is rapidly emerging as
a distinct discipline in its own right. Vision precedes invention. The movie fantastic voyage
provided a vision where doctors where shrunk to nanoscopic size and allowed to enter the
patients anatomy in order to affect the cure. Nanoporous catalysts have been used for years
now in the chemical industry. Commercial products introduced into the marketplace such as
clay filled nylon nanocomposite by Toyota corp., clay intercalated polyolefin nanocomposite
by General Motors, nanocomposite nylon in biomedical applications, chemical resistant
coating made of nanometer sized particles suspended in epoxy, CNTs, carbon nanotubes, Liion battery electrode of Altair nanotechnologies offer the proof in the pudding about the
concern of achieving targeted levels of miniaturization.
Richard Feynmans after dinner talk [1] in 1959 provided the vision for storage of
Encyclopedia within the size of a pin head, method of writing small using ions, focus of
electrons on a small photoelectric screen, etc. He called for the design and development of
better electron microscopes with capability to view atoms, better f value lenses, making
computer that filled several rooms to made small, elements of computer to be made
submicroscopic. He alluded to a process of evaporation and formation of layered materials
much like ALD methods used currently. He called for drilling holes, cutting things, soldering
things, stamping things out, molding different shapes at an infinitesimal level. A pantograph
can make a smaller pantograph that can make a smaller pantograph and so on and so forth. He
mused whether atoms can be re-arranged at will. He offered $1000 to the first guy who can
take the information on the page of a book and put in on the area 1/25,000 smaller in linear
scale in such a fashion that is can be read using an electron microscope.
Drexler and Smalley debated whether molecular assemblers that are devices capable of
positioning atoms and molecules for precisely defined reactions in any environment is
possible or not. Smalley objected to the immortality implied by Drexlers vision of molecular
assembler in the form of the fat fingers problem. Chemical and Engineering News carried
the post of Drexler to Smalley with response from Smalley by three letters with Drexler
countering and Smalley concluding the exchange on sticky fingers problem. Drexler alluded
to the long term goal of molecular manufacturing. Smalley sought agreement that precision
picking and placing of individual atoms through the use of Smalley-fingers is impossibility.
548
Computer controlled fingers will be too fat and too sticky for providing the control needed.
Enzyme and ribosomes were necessary to complete the reactions. He quarreled with the
vision of self-replicating nanobot. Water is needed to provide the nutrients. Drexler applauded
Smalleys goal of debunking nonsense in nanotechnology. Direct positional control of
reactants are revolutionary and achievable.
The chronology of events that mark the rise of nanotechnology as a discipline is shown in
Table 1.0 in [5] from Feynmans talk in 1959 to the nanoethics meeting in 2005. Wide range
of applications are expected in nanotechnology ranging from solar cells with increased
photovoltaic efficiency, to sunscreens to GMR, Giga magnetic hardrives. The challenges in
nanotechnology that need to be overcome are fundamental physical limits to miniaturization,
thermodynamic stability of nanostructures and existence of a minimum size below which
spheres tend to agglomerate, layer arrangement and why tubular morphology is preferred to
spherical morphology in the nanoscale range. Some characterization tools needed in
nanotechnology are SEM, AFM, SAXS, WAXS, etc.
Nanoparticles in the size range 10 nm 1000 nm can be used to entrap or encapsulate
drugs. Nanodrugs can be synthesized on nanodrugs. Nanocapsules contain drug in the cavity
and is surrounded by polymer layer. Nanopores refer to the pore size in materials that are that
small. Encapsulated systems can be used in constant rate drug delivery processes.
Biodegradable polymeric nanoparticles can be used in drug delivery applications. Drug
attachment to nanosystems can be by electrostatic interactions or covalent bonds. The
absorption of drug can be affected by different methods. Drugs administered through the
gastrointestinal tract, GI is referred to as enteral route of entry. Parenteral routes refer to all
other types of drug entry. Drug administration: [6] i) beneath the tongue is by sublingual
entry; ii) via the mouth is by buccal cavity; iii) through stomach by gastric entry; iv) through
veins by IV therapy; v) within the muscular by intramuscular therapy; vi) beneath the
epidermal and dermal skin layers via subcutaneous therapy; vii) within the dermis by
intradermal therapy; viii) by topical treatment applied to the skin by percutaneous therapy; ix)
through mouth, nose, pharynz, trachea, bronchi, bronchioles, alveolar sacs, alveoli by
inhalation; x) is introduced into artery by intrarterial route; xi) to cerebrospinal fluid by
intrathecal route; xii) within the vagina by vaginal route and; xiii) through eye, intraocular
route. Systemic circulation is reached by the drugs absorbed from the buccal cavity and the
lower rectum. The splanchnic circulation is arrived at by the drugs absorbed from the
stomach, intestines, colon and upper rectum.
Nanopeapods can be grown as shown in [7]. Nanoshells were made out of a coating of
CoAl2O4 on nanoparticles made of platinum. Nanowires can be made by alternating layers of
cobolt and platinum by electrodeposition. Nanoropes are affected by allowing strong van der
Waals forces to take place in extended carbon structures. Nanoshells are made by coating
drugs on metal nanoparticles. The therapeutic response of these drugs depends on the
thickness of the coating and capping agent used. Laser irradiation of the nanoshells causes
release of the drug coat. Magnetic field can also be used to release the drug. These methods
can be used in cancer therapy. Larger amounts of drugs can be treated on account of the
higher surface to volume ratios associated with nanoparticles.
549
10.2. FULLERENES DISCOVERY AND SYNTHESIS METHODS

Fullerenes, C60, is the third allotropic form of carbon. The Nobel Prize for their discovery
was awarded in 1996 to Curl, Smalley and Kroto. Soccer ball structured, C60, with a surface
filled with hexagons and pentagons satisfy the Eulers law. Eulers law states that no sheet of
hexagons will close. Pentagons have to be introduced for hexagon sheets to close [4].
Stability of C60 requires Eulers 12 pentagon closure principle and the chemical stability
conferred by pentagon non-adjacency. C240, C540, C960 and C1500 can be built with icosahedra
symmetry. Howard [8] patented the 1st generation combustion synthesis method for fullerene
production, an advance over the carbon arc method. In the second generation combustion
synthesis method optimizes the conditions for fullerene formation. A continuous high flow of
hydrocarbon is burned at low pressure in a three dimensional chamber. Manufacturing plants
have been constructed in Japan and USA with production capacity of fullerenes at 40 metric
tons/year. Purity levels is greater than 98%. The reaction chamber consists of a primary zone
where the initial phase of combustion synthesis is conducted and a secondary zone where
combustion products with higher exit age distribution do not mix with those with lower exit
age distribution. Flame control and flame stability is critical in achieving higher throughputs
of fullerenes. Typical operating parameters include residence time in the primary zone of 2
500 ms, residence time in the secondary zone from 5 ms 10 s, total equivalence ratio in the
range of 1.8-4.0, pressure in the range of 10-400 torr and temperature in the range of 15002500 K. It can be seen that the residence time can be short.
A chemical route has been developed by Scott [9] to synthesize C60. Corannulene is
synthesized from naphthaleneError! Bookmark not defined. structure. As the rings fuse and
the sheet forms then it is rolled into soccer ball structure. The challenge is how to stitch up the
seams between the arms to make the ball. Oligoarenes are transformed into highly strained
curved Pi surfaces. The molecule needs to bend to effect ring closure on a soccer ball
structure at 1000 0 C. 60 carbon ring system can be built by acid catalyzed aldol trimerization
of ketone. Oligoarene zips up to the soccer ball structure affected by cyclodehydrogenations.
In order to generate higher yield, supercritical ethanol [10] was used to react with naphthalene
with ferric chloride as catalyst for 6 hours. The reaction products were subjected to extraction
with toluene. The reactor temperature range was 31 500 0 C, pressure range was 3.8 60
MPa. Smalley patented a process to make fullerenes by tapping into the solar energy [11].
The carbon is vaporized by applying focus of solar arrays and conducting the carbon vapor to
a dark zone for fullerene growth and annealing. Fullerene content of soot deposits collected
on the inside of the Pyrex tube was analyzed by extraction with toluene. In the electric arc
process [12] for fullerene production, carbon material is heated using an electric arc between
two electrodes to form carbon vapor. Fullerene molecules are condensed later and collected as
soot. Fullerenes are later purified by extraction of soot using a suitable solvent followed by
evaporation of the solvent to yield the solid fullerene molecules.
10.3. SUMMARY OF NANOSTRUCTURING METHODS

Nanostructures can be several kinds: nanowires; nanorods; nanotetrapods; nanoscrystals;
quantum dots; nanosheets; nanocylinders; nanocubes; nanograins; nanofilaments;
550
nanolamella;
nanopores;
nanotrenches;
nanotunnel;
nanovoids;
nanoparticles.
Nanostructuring methods encompass a wide range of technologies. Nanostructures can either
be generated by building up from atoms using methods classified as bottom-up strategy or
by diminishing of size from nanoparticles using methods grouped under top-down strategy.
Bottom-up strategies use self-assembly concepts, are cheap, more scalable, more flexible and
leads to molecular level engineering. Top down strategy are expensive, less scalable and
inflexible.
Sputtering of molecular ions under ultrahigh vacuum is used in the vacuum synthesis
method of nanostructuirng [13]. Sputtering process is followed by annealing process.
Crystalline silicon is made to form into isolated quantum wires. Gas evaporation [14]
technique is a dry process to make ultrafine metallic magnetic powders. Metal is evaporated
onto a thin film under vacuum conditions. Metal atoms are allowed to impinge on the surface
of the dispersing medium. Condensation of metal atoms can also be accomplished using
cooling nozzle. Nanoparticles in the size range of 50 nm 4 m can be prepared using this
technique.
Triangular nanoprisms can be generated by exposure to light [15] at different
wavelengths between 400 nm 700 nm. Ostwald ripening concepts are used. Edge lengths
range from 31-134 nm can be prepared. Nanorods may be produced using condensed phase
synthesis method [16]. The starting material is heated until the material vaporizes. Later the
vapor is condensed. Aggregate of nanoparticles are formed. Particles are delivered by
boundary layer delivery and thermophoresis assisted deposition to form the epitaxial deposit.
CNTs, carbon nanotubes can also be made using this method.
Subtractive and additive fabrication methods can be used for nanostructuring operations.
Lithography, etching, galvanic fabrication processes are subtractive. A series of chemical
reactions effects removal of the layer in the apertures of the mask and transfer of material into
gas phase. Lift-off process is employed in the fabrication of IC circuit. Nanotips and nanorods
can be efficiently formed using conventional CMOS processes. Patterning Iridium oxide
nanostructures [17] consists of the steps of; i) forming a substrate with first and second
regions adjacent to each other; ii) growing IrOx structures from a continuous oxide film
overlying the first region; iii) simultaneously growing IrOx nanostructures from a concontinuous oxide film overlying the second region; iv) selectively etching area of second
region; v) lifting off overlying IrOx structures and vi) forming a substrate with nanostructures
overlying the first region. The second material can be SiOx.
Dip Pen lithography, SAM,. Self-Assembled Monolayers, hot embossing, nanoimprint
lithography, electron beam lithography, dry etching, reactive ion etching are techniques that
can be used to prepare nanostructures with 50 70 nm dimensions [18, 19]. Nanomechanical
techniques include processes that include local transfer of material from a tool onto a
substrate when either the tool or the substrate is pre-structured. Quantum dots [20] are
structures where quantum confinement effects are significant. Reproducibility of organized
arrays of quantum dots is an identified problem. Techniques such as sol gel, solid state
precipitation, molecular beam epitaxy, chemical vapor deposition, CVD and lithography were
developed to enhance uniformity, control morphology and determine spatial distribution of
quantum dots in thick and thin films. QDs can be prepared at low temperatures by
precipitation from solution by sol-gel methods. Uniformly sized QDs are affected by control
of nucleation and growth of particles within a lithographically or electrochemically designed
551
template. FCC packing of silica balls can be used as template for melt/infusion of the
semiconductor InSb.
Nanostructures of metal oxides can be prepared by sol-gel processing methods. Chemical
reactions are conducted in solution to produce nanosized particles called sols. The sols are
connected into a 3-dimensional network called a gel. Controlled evaporation of liquid phase
leads to dense porous solids called xerogel [21]. Surface instabilities and pattern formation
in polymer thin films can lead to formation of nanostructures [22]. The control of morphology
of phase separated polymer blends can be result in nanostructures. Kinetic and
thermodynamic effects during phase separation can be used in preparation of nanostructures
[23]. Nanostructure can be synthesized by quenching of a partially miscible polymer blend
below the critical temperature of demixing. Spin coating can be used to prepare polymer film.
Pattern formation from polymer solvent systems is stage wise. A stage of layered
morphology, followed by destabilization of layers by capillary instability and surface
instability leads to nanostructure formation. Cryogenic milling [24] is a top-down approach to
prepare nanoscale titanium of 100-300 nm size. Several mechanical deformations of large
grains into ultrafine powder degassing lead to nanopowder with improved characteristics.
Atomic lithography is the method of choice to generate structures less than 50 nm
dimensions. A laser beam forms a high intensity optical spot allowing formation of 2dimensionsl pattern of atoms on the surface of the substrate [25]. Nanostructured thin film
nanocomposites can be manufactured using electrodeposition method [26]. Electrodeposition
can be used to form nanostructured films within the pores of mesoporous silica. Silica is then
removed from the nanocomposite by dissolution in a suitable etching solvent such as HF,
hydrogen fluoride. Plasma compaction techniques [27] can be used to form nanoparticles of
semiconductor compounds resulting in improvements in the figure of merit. Nanoparticles
can be expected as reaction product after the reactant mixture is subject to sufficient time,
under prescribed temperature and pressure. Plasma compaction apparatus may comprise of
two high strength pistons capable of compressive pressure in the range of 100-1000 MPa to a
sample of nanoparticles that is disposed within a high strength cylinder. The desired level of
compaction is achieved by varying the applied pressure, applied current and time duration of
the process.
In direct write lithography, [28] a tip can be used to pattern a surface and prepare
polymeric nanostructures. Polymerization is initiated by the tip and pattern is formed.
Polymer brush nanostructures can be synthesized using ROMP, ring opening metathesis
polymerization. Edge distances of less than 100 nm is possible and control over feature size,
shape and inter-feature distance is achievable. Nanofluids [29] comprises of nanoparticles
dispersed in a suitable solvent. The surface to volume ration is increased by 1000 times.
Nanofluids are expected to have enhanced thermal conductivity comparable that of copper
[30]. Materials with pre-defined morphology can be made using self-assembly of block
copolymer principle [31]. Nanospheres, nanolamellae, nanopores both cylindrical and
spherical are possible using this approach. Thickness of interfacial layer if 2-30 nm. Using
PLD, pulse layered deposition, pulses of laser are used to evaporate the starting material [32]
and then deposited into a substrate to produce thin films with profound nanotechnological
significance. Typical temperature of evaporation surface is 5000 K, average velocity of atoms
in vapor flow is 2000 m/s and the expansion front moves at 6000 m/s. Laser intensity is
optimized for more efficient evaporation of target.
552
18 different nanostructuring methods were reviewed by Sharma [33]. Three different

methods of synthesis of CNTs, carbon nanotubes were compared side-side by side [34]. Metal
nanopowders can be isolated using gravity methods [35,-37]. Rapid quenching of
nanopowders in a sub atmospheric fluidized bed was discussed [38]. Nanopore filters can be
used in dialysis [39]. The solid colloid dynamics that can be expected in nanocomposites [40,
41] was discussed. The modified laws of motion were used in the study. This included long
range, short range, dissipative and random forces. Smaller the particle size is made the greater
the tendency for it to agglomerate can be expected. An algorithm to determine the particle
size distribution and particle shape distribution from data from SAXS [42], small angle x-ray
scattering device was developed. The size of the nanoparticle is less than the wavelength of
light that is 400 nm in the visible region. The higher the scattering intensity the better is the
chances for the detection of the presence of nanoparticles and determination of particle size
distribution. The quality of the nanoparticulatre morphology for the target topology is
evaluated using the entropic difference model. Stochastic simulations [43,44] using the
supercomputer were used to better understand the process of spinodal nucleation and in situ
laser ablation. The Equation of State, EOS for nanocomposite may be derived. This can be
used to derive the stability curves for exfoliation of elastomeric nanocomposites. These
simulations can be used to predict performance properties such as ballistic impact resistance
[45]. Nanocomposites can be structured to prepare materials with higher thermal conductivity
compared with copper [46, 47] for use in laptop computer casings and reducing the weight of
automobiles. Nanoprobes can be devices to measure: (i) cellular signal [48]; (ii)
nanobolometer to measure chemical plumes [49]; (iii) fiber-optic nanobiosensor [50]; (iv)
nanoscale temperature distribution [51]. Nanocomposites can be modeled and the glass
transition temperature of polymer nanocomposites can be estimated [52, 53].
10.4. THERMODYNAMIC STABILITY OF NANOSTRUCTURES

The solvation thermodynamics define the stability of a system. It can be stable,
metastable or unstable. UCST and LCST define the critical consolute temperatures of two
phase systems. When a supersaturated system is disturbed the particles begin to nucleate,
grow and form into stable structures. The process can be arrested sufficiently early to form
nanosphere. But the free energy of formation of the structure and the surface energy of the
solid can be equated with each other at equilibrium. For stability the free energy has to be
negative or equal to zero. From these criteria a minimum stable size of the solid particle
formed can be calculated. This depends on the solid-liquid surface tension values and other
parameters of the system. In one system for example, the engineering thermoplastic, ABS,
Acrylonitrile-Butadiene-Styrene, the smallest stable butadiene particle size can be calculated
as 200 nm from Gibbs free energy. When attempted to be made any smaller the rubber phase
particles agglomerated with each other to a size larger than 200 nm. It was reported by a
number of investigators that making the rubber particles smaller and smaller was difficult.
Maybe if they were made into tubes, they can be made into nanotubes. The free energy and
surface energy analysis will still hold good. The shape is different in the derivation.
553
The four thermodynamically stable forms of Carbon are diamond, graphite, C60,
Buckmininster Fullerene and Carbon Nanotube. It would be a challenge to extend the
experience gained in CNT to nanotubes made of other material other than Carbon. It would
also be interesting to form stable spherical structures in the nanoscale dimensions without
agglomeration. At what scale would the quantum analysis for atoms be applicable when
compared with the Newtonian mechanics used to describe macro systems. Nanostructures of
all the different shapes and Bravais lattices in several materials need to be established.
Nanostructures that are known today and successfully used in the industry are in the form of
tubular morphology, gate patterns of oxidation and packing transistors that leave some
features at the nanoscale dimensions. Why is tubular morphology favored over spherical
morphology during the formation of carbon nanotubes [54-57]? The layered materials of the
nanoscale dimension made using Atomic Layer Deposition techniques break no known laws
of thermodynamics. But one issue is the layer re-arrangement due to Marangoni instability.
Thermodynamic miscibility of nanocomposites can be calculated from the free energy of
mixing.
G H TS
(1)
Where G is the free energy change of mixing the dispersed and continuous systems, S
is the entropic change of mixing and T is the temperature of the blend. The thermodynamic
basis to explain miscibility in nanocomposites is similar to the one seems in polymer blends.
In polymer blends, it is an exothermic heat of mixing as entropic contributions are small for
such systems. Intramolecular repulsions may be an important factor in realizing exothermic
heats of mixing. This approach was independently presented by Kambour, Bendler and Bopp
[58], Brinke, Karasz and MacKnight [59] and Paul and Barlow [60]. An additional condition
for stability for binary mixtures is given by;
2 Gm
0
i2
(2)
Where i is the volume fraction of either component -any suitable measure of the
concentration can be used. This model further assumes that the heat of mixing is described by
a van Laar expression [60];
Hm = (VA+VB)BAB
(3)
Where B is the binary interaction energy density. The B parameter is related to the FloryHuggins interaction parameter, by;
~
B
~A ~B AB
RT V
VB
A
(4)
554
B is preferred since its basis is always clearly a unit mixture of volume. The binary
interaction model for the heat of mixing can be extended to multicomponent mixtures as
follows:
H m
Biji j
V
i j
(5)
The sum in Eq. (5) excludes terms with i=j, and obviates double counting of terms with i
j. Further, Bij = Bji. The sign of combinatorial entropy, always favors mixing, its value is
diminished for molecular weights of the order of those for most important polymers. Thus, in
the limit of high molecular weights, the conditions of miscibility can only be satisfied by a
negative interaction parameter leasing to the conclusion that exothermic mixing is a
requirement for miscibility in high molecular weight polymer blends. This is a simple model
and cannot account for all the issues of mixture thermodynamics. Interaction parameters
deduced from various phase behavior information are often believed to include other effects
other than purely enthalpic ones. This way, the LCST (lower critical solution temperature)
behavior observed in polymer blends can be explained and accounted for quantitatively.
These theories refine the binary interaction parameter by removing extraneous effects. EOS
effects do not favor phase stability and the B parameter must be negative to have miscibility
in high molecular weight blends. Interaction parameters used in the ensuing sections are not
limited to the Flory-Huggins framework and can be viewed as ones free of equation of state
effects.
The role of intramolecular repulsions as a causative factor in driving blend miscibility
can be seen readily by considering mixtures of copolymers with homopolymers. Reports in
the literature indicate cases of miscibility involving copolymers when their corresponding
homopolymers are not miscible. For instance pure Polystyrene and pure polyacrylonitrile are
not miscible with poly methyl methacrylate. But the copolymer SAN is miscible with PMMA
over a range of AN compositions. The same is the case with PEMA in place of PMMA.
Ethylene vinyl acetate, EVA copolymers are miscible with polyvinyl chloride, PVC for a
range of VA composition in the copolymer. Neither polyethylene nor polyvinyl acetate is
miscible with PVC. In a similar fashion, Butadiene-Acrylonitrile copolymers are found to be
miscible with PVC for a range of compositions. Similarly, poly-AMS, alpha methyl styrene,
AN copolymers are miscible with PMMA and PEMA; poly o-chlorostryene-p-cholorostryene
copolymers are miscible with PPO, poly pheylene oxide over a range of p-chlorostyrene
composition. The higher the phase separation temperature, LCST, more negative is the binary
interaction parameter.
The dispersion of particles in polymeric materials has proven difficult and frequently
results in phase segregation and agglomeration. Mackay et al. [61] showed that
thermodynamically stable dispersion of nanoparticles into a polymeric liquid is enhanced for
systems where the radius of gyration of the linear polymer is greater than the radius of the
nanoparticle. Dispersed nanoparticles swell the linear polymer chains, resulting in a polymer
radius of gyration that grows with the nanoparticle volume fraction. It was proposed that this
entropically unfavorable process is offset by an enthalpy gain due to an increase in molecular
contacts at dispersed nanoparticle surfaces as compared with the surfaces of phase-separated
555
nanoparticles. Even when the dispersed state is thermodynamically stable, it may be

inaccessible unless the correct processing strategy is adopted, which is particularly important
for the case of fullerene dispersion into linear polymers. More on stability is given in Kumar
and Krishnamoorti [62].
10.5. NANOROBOTS IN NANOMEDICINE

According to Frietas [63] Nanomedicine is the preservation and improvement of human
health using molecular tools and molecular knowledge of the human body." Tiny
magnetically-driven spinning screws were developed by Ishiyama et al. [63,64]. These
devices were intended to swim along veins and carry drugs to infected tissues or even to
burrow into tumors and kill them with supply of heat. Untethered microrobot containing
ferromagnetic particles under forces generated by MRI magnetic fields were tested for travel
through the human anatomy at the NanoRobotic laboratory at Montreal, Canada [65] in 2003.
10.6. MOLECULAR COMPUTING

When the limits of miniaturization of transistor packing and gate width in silicon chips
are reached where will further increases in microprocessor speed come from? It can come
from biochemical nanocomputers. The area of DNA computing was flagged off when a
programmable molecule computing machine composed of enzymes and DNA molecules was
unveiled in 2003 at Weizmann Institute of Science in Rehovot, Israel. The computer
operations were at a rate of 330 teraflops. This was 100,000 times faster than the personal
computer. It was entered into the Guinness Book of World records as the smallest biological
computing device ever constructed. Molecular computing is expected to emerge when the
limits of miniaturization is realized in the silicon chips as the key to further increases in
computing speed. In 1994 the idea to use DNA, De-oxy-ribonucleic acid molecules to store
and process information took shape when a scientist from California used DNA in a test tube
to solve a simple mathematical problem. Designs of DNA computers were drawn up where
ATP molecules where thrown in to provide a steady supply of energy and fuel. The enzymes
served as the hardware and the DNA served as the software. The ways in which molecules
undergo chemical reactions with each other allow simple computer operations to be
performed as byproduct of the reactions. The devices are programmed by scientists by
controlling the composition of DNA software. A trillion biomolecular devices can be fitted
into a single drop of water. Results are analyzed by a method where the length of the DNA
output molecule is seen, in place of computer monitor. Rudimentary operations are performed
by this computer. Self-organization of molecules is used in the design of molecular
computation. This give rise to the field of molecular electronics. Processing in biological
systems is used to device nanomachines. The autonomous formation of complex
nanostructures is considered as one type of computation. In a cellular computer, membrane
proteins are expected as I/O, input/output devices. Living cells are tapped into and the signal
transduction functions are used for computations.
556
DNA computing was born when Aldeman [66] in 1994 proposed a molecular algorithm to
solve the Hamiltonian path problem with DNA and solved an instance of a directed graph
with 7 nodes. The parallelism of DNA molecules was exploited. This offered faster solution
of NP complete problems. Reactions at the nanoscale are used to perform computations with
less energy. Several nanofabrication techniques were developed in the area of DNA
nanotechnology. Scientists are beginning to obtain a better handle on the electric charge
distribution in DNA and the charge transfer observed in DNA is used in device of novel
molecular electronic circuits. The automata and the computational model are implemented
using hairpin formed DNA molecules. The PCR, polymerase chain reaction that is found
during DNA transcription and translation is tapped into. Autonomous assembly of molecular
structures is used in devising DNA computation in the solid phase. The number of DNA
molecules needed for effecting automated molecular computation is calculated. Suyama and
Yoshida [67] studied the application of DNA computer to biotechnology such as gene
expression analysis and molecular memory. In aqueous computing, the write once memory is
represented by double stranded circular DNA. Plasmid contains multiple regions whose
terminals are flanked by restriction sites. The write operation is implemented by removing a
particular region using specific restriction enzyme. Head and Yamamura [68] proposed the
molecular solution with write once memory to obtain solutions of NP complete problems as
Max-Clique.
10.7. MOLECULAR MACHINES

Molecular machines are molecules that can with an appropriate stimulus be temporarily
lifted out of equilibrium and can return to equilibrium in the observable macroscopic
properties of the system. There is considerable debate in the literature as the exact
constitution and properties of molecular machines. The controlled motions of synthetic
molecular systems have been harnessed to cause observable macroscopic changes in bulk
systems as a result of stereo chemical rearrangement at the molecular level. The construction
of molecular machines has been enabled by:
(i) Progress in Organic Synthesis Living Free Radical Polymerizations, Asymmetric
Catalysis, Metal Catalyzed Cross-Coupling Reactions, Metathesis
(ii) Powerful Computational Techniques
(iii) Advent of Collection of Powerful Single Molecule Analytical Tools
The design of molecular components is constructed in such a fashion as to interact
favorably with each other and that they can self-organize and self-assemble into larger well
defined architectures. The advances in spectroscopic techniques are also tapped into. The
Nobel Prize in 1998 for chemistry went to Pople and Kohn for computing accurately many
physical and electronic properties that have particular relevance to molecular machines and
electronics. Self-Assembled Monolayers, SAMs, Langmuir-Blodgett techniques for creation
of monolayer, soft lithographic techniques, etching the surface, AFM, atomic force
557
microscopy, STM, scanning tunneling microscopy, XPS, photoelectron spectroscopy,

ellipsometry and x-ray reflectometry are used in the manufacture of molecular machines.
It is difficult to create molecular actuators. The Feynman ratchet can be a violation of the
second law of thermodynamics and may be a PMM1 or PMM2, perpetual motion machine 1
or 2. Actuation can be achieved by a walking mechanism using a class of motor proteins
called kinesins. The muscle contraction and expansion involves such chemical changes. ATP
hydrolysis and whip like and sinusoidal movements of cilia and flagella enable them to
transport cells throughput the body. Based on these observations, molecular machines,
molecular shuttles, switches, muscles, nanovalves, rotors and surfaces with controlled
wettability are being created. Example chemicals involved in such constructs are rotaxane
molecules. Calixarenes in the cone formation has an interval cavity able to host guest
molecules of complementary size. The inclusion of guests in solid state has been studies in
apolar medium. The solvation phenomena are of interest. The host-guest association is
governed by coulomb attractions such as: i) Steric; ii) Entropic; iii) Solvation. Rotaxane
synthesis involves calixarene wheels. During the synthesis of pseudorotaxanes, calixarene
derivatives as host for QUATS, triphenylureidocalixarene derivative. The structure of
pseudorotaxene can be studied using X-ray techniques.
Molecular shuttle consists of a ring component that is mechanically interlocked onto a
dumbbell shaped component and is able to shuttle between two recognition sites as a result of
thermal activation by non-covalent interactions. Molecular switches are compounds that can
be externally stimulated to exist in either of two observably different states or conformers.
Molecular muscle is able to expand and contract reversibly upon external stimulation.
Molecular valves can be used to trap and release other molecules as a result of controlled
molecular motions. Molecular rotors undergo controlled rotational motion of a rotor until
relative to a stator which is controlled via an axle. The surfaces with controlled wettability
can be stimulated to be hydrophobic or hydrophilic. Mechanical movements of tetracationic
cyclophane CBPQT along a diaminobenzene containing thread that is tethered to a Gold
surface can be observed. A two electron reduction of the CBPQT ring erases the favorable
binding interactions that exist along the ring host and diaminobenzene guest with an electron
transfer rate of 80 Hz. The oxidative electron transfer rate is 1100 Hz. Reversible redoxcontrollable mechanical motions of the interlocked molecule on a gold surface can be
detected. A contracted structure can be generated by contraction of bistable dimmer by
quantitative demetalation of the cuprous ions using KCN followed by treatment with
Zn(NO3)2.
Technologists are developing molecular nanovalves, irreversible thin film regulators,
light regulated azobenzene and coumarin valves, supramolecular gatekeepers, reversible
nanovalves, polymeric valves, biological nanovalves, etc. Rotation is one of the three
fundamental molecular motions: a) translation; b) rotation and; c) vibration. Scientists at
UCLA, university of California at Los Angeles, have demonstrated controlled unidirectional
rotation of a tryptycene rotor unit relative to a helacine stator that is connected by a carboncarbon single bond axle using phosgene as chemical fuel. The difluorophenylene rotor has
been used as molecular compass and gyroscope.
558
10.8. SUPRAMOLECULAR CHEMISTRY

These are highly complex chemical systems made form components interacting through
non-covalent intermolecular forces. It occurs in the interface of biology and physics [69]
Strands of nucleic acids allow for huge amounts of information to be stored, retrieved and
processed via weak hydrogen bonds. The principles in molecular information in chemistry
were developed from these observations. Interactional algorithms were developed through
molecular recognition events based on well-defined interaction patterns such as hydrogen
bonding arrays, sequences of donor and acceptor groups and ion coordination sites. The goal
here is to gain progressive control over complex spatio structural and temporal dynamic
features of matter through self-organization. The design and investigation of pre-organized
molecular receptors that are capable of binding specific substrates with high efficiency and
selectivity are undertaken. The three themes are: i) Molecular Recognition; ii) SelfOrganization and iii) Adaptation and Evolution.
Supramolecular materials offers alternative to top-down miniaturization and bottom-up
nanofabrication. Self-fabrication is effected by controlled assembly of ordered, fully
integrated and connected operational systems by hierarchical growth. The field of
adaptive/evolutive chemistry emerged. Adaptive chemistry implies a selection and growth
under time reversibility. The era of Darwinistic chemistry has dawned. The goal here is to
merge design and selection in self-organization to perform self-design in which function
driven selection among suitably instructed dynamic species generates the optimal organized
and functional entity in a post Darwinian process. Chemical learning systems cannot be
instructed but can be trained. Time is irreversible. The passage is from closed systems to open
and coupled systems that are connected spatially and temporally to their surroundings.
Investigators are progressively unravelling the complexification of matter through selforganization.
Molecular computing is expected to emerge when the limits of miniaturization is realized
in silicon chips as the key to further increases in computing speed. DNA molecules and
enzymes and biochemical reactions can be used to realize faster operations compared even
with a transistors packed silicon chip microprocessor. They can be used to strore and process
information. DNA computing started with the molecular algorithm to solve the Hamiltonian
path problem. NP complete problems can be treated. Molecular machines can be devised
using the better understanding of stereochemistry. Construction of molecular machines is
driven by: i) progress in organic synthesis; ii) powerful computation techniques; iii) advent of
single molecule analytical tools. Well defined architectures can be obtained by self-assembly.
SAMS, Langmuir-Blodgett films, soft lithography, AFM, STM, XPS etc. can be used to
manufacture molecular machines. When designing molecular architectures the second law of
thermodynamics should not be violated. Rotaxane molecules are used to create molecular
shuttles, molecular switches, molecular nanovalves, molecular muscles, molecular rotors and
surfaces with controlled wettability. Supramoelcular materials offers alternative to top-down
miniaturization and bottom-up fabrication. Self-organization principles hold the key.
Gene expression studies can be carried out in biochips. Target biological materials are
examined using fluorescent probes in glass slides packed with thousands of genes. Disease
states can be better understood using biochips and cures from better drug design can be
effected. Microarray industry is expected to grow in a similar fashion to the microprocessor
559
revolution. A microarray is an ordered array of microscopic elements in a planar substrate

that allows for specific binding of gene or gene products. In order to qualify as microarray,
the analytical device must be ordered, microscopic, planar and specific. Microarrays are
evolving into nanoarrays with the dot size decreasing to the nanoscale. One goal of
microarray analysis is to eradicate every human disease by the year 2050. Some of the
interesting applications of biochips lie in the areas of gene expression, drug delivery, genetic
screening and diagnostics, gene profiling, understanding mechanism of aging, the study of
cancer, etc.
The confocal scanning microscope can be used in microarray detection where
fluorescence scanning is used. The sample is excited by a laser beam, and fluorescence light
is emitted from the probe in the sample and can be detected using the difference in
wavelength of 24 nm between excitation and emitted light beams. Epi-illumination is used in
the scanning process. The excitation and emitted beams pass through the objective lens to and
from the sample but in opposite directions. PMT is sued as a detecting element. The
instrument performance measures are number of lasers and fluorescence channels, detectivity,
sensitivity, crosstalk, resolution, field size, uniformity, image geometry, throughput and
superposition of signal sources. High quality surfaces are needed for the preparation of
microarray samples. An ideal microarray surface has to be dimensional, flat, planar, uniform,
inert, efficient and accessible.
Optimal target concentration occurs at a spacing of 1 DNA target molecule per 20 A. The
probe duplex is approximately 24 A. Optimal probe concentration is the number of probe
molecules per unit volume of sample that provides the strongest signal in a microarray assay.
Microarrays of oligonucleotides can be prepared by using delivery or synthesis methods. The
four steps in process of oligonucleotide synthesis are deprotection, coupling, capping and
oxidation. The three manufacturing methods used during microarray manufacture are ink jet
printing, mechanical micro spotting and photolithography. Stepwise coupling efficiency can
be defined to gauge the quality of microarray synthesis. Linker molecules can be used to
increase the efficiency of hybridization and DNA attachment at the surface. The time taken
for ink-jet printing when jets or pins or used are compared against each other.
Statistical normalization procedures can be used to remove systematic variations in
nanoarray experiments that affect the measured gene expression levels. Speed developed a
normalization procedure using gene expression data from lipid metabolism in mice. He used
housekeeping genes that have constant levels of expression across variety of conditions.
Differentially expressed genes were identified by computing the t statistics. Global
normalization methods, M vs a plot, paired-slide normalization, within slide normalization
and multiple-slide normalization methods are discussed.
Sequence alignment [69] can be used to develop cures for autoimmune disorders, in
phylogenetic tree construction, identify polypeptide microstructure, in shot gun sequencing,
during drug design, in protein secondary structure determination, in protein folding, clone
analysis, protein classification, etc. Optimal global alignment and local alignment can be
obtained using dynamic programming. Speedups can be achieved using greedy algorithm for
nearly aligned sequences. Dynamic array can be used to cut the space required form O(n2).
PAM and Blossum matrices provide different penalty that are specific to the sequences
aligned. Sharma discussed X-drop algorithm, banded diagonal methods, sparse tables,
staircase tables, super sequence, inverse dynamic programming, stability of alignment, suffix
560
tree construction, generalized suffix tree procedures, and the advantages of using them. String
algorithms can be used find patterns P in a text T. 19 such algorithms were discussed.
Markov models are discussed for varying orders. Three questions in HMM, i.e, the
evaluation, the decoding and the learning were reviewed. The speed up obtained using the
forward algorithm, backward algorithm and Viterbi algorithm were clarified. Gene finding
algorithms were touched upon. Advances made in protein secondary structure prediction were
traced from Chou and Fasman rules, to Qian and Sejnowskis neural networks, to the PHD
server of Rost and Sander where evolutionary information was used to effect improvement in
prediction accuracy. HMMs, DAG-RNNs. BRNN, can be used for protein secondary
structure prediction.
Role of polymer nanoparticle in drug delivery applications were discussed. Some of the
challenges in drug delivery are continuous release of agents over extended periods of time,
local delivery of agents at pre-determined rates to local sites such as tumors, improved ease of
administration. Polymer drug delivery systems can be nanoscopic. Self-assembled liposomes
and micelles can accomplish the task. Drugs can be encapsulated in the polymer particles.
Nanostructuring operations need to be compatible with the drugs. Nanoencapsulation of
living cells can be effects by polymer precipitation, gelling and complexing polymer.
10.9. CNRS COLLECTIVES OF NANOROBOTS

Medical applications of nanorobots include: (i) cardiovascular health; (ii) immune system
function; (iii) cancer and diabetes; (iv) drug delivery mechanisms and diagnostics. CNRs are
a new genertion of self-organizing collectives of intelligent nanorobots. This new technology
includes procedures for interactions between obbjects with their environment resulting in
solutions of critical problems at the nanoscopic level. Social intelligence and self-organization
are used in the development of the technology. Self-organizing entities are constructed from
analogies from living species. Models on social intelligence are developed from observations
of behaviors of insects. Chemical markers such as pheromones are used by individual
organism to communicate a social goal. Interoperation of microbes and pathogens with the
immune system of the organism leads to life/death of host. Intracellular models have been
developed that can be used to show how proteins interact and how the functions governed by
protein signals come about.
Biomimetic materials are designed to mimic a natural biological material. For example,
the third mercaptus bone in horses leg is used as target for design of aerospace materials.
Worm micelles are prepared that resemble linear proteins found in cytoskeleton filament and
collagen fibers. Copolymers with block microstructure have been found to self-assemble and
organize into periodic nanophases. Molecular shape is found to be a function of fraction of
hydrophilic fraction. Polymerosomes or vesicles can be formed by self-assembly of PEO-PBd
in water. Lipid vesicles are formed into different morphologies such as starfish, tube, pear and
string of pearl shapes. Worms with less than 10 nm diameters and membrane with 3 nm
thicknesses have been observed. Stability of protein folding can be studied using selfassembly. Many biological membrane processes can be mimicked by synthetic polymer
vesicles.
561
The equilibrium kinetics of self-assembly reactions was discussed. A cooperativity

parameter is defined along with the equilibrium rate constant. Example system used to
illustrate the mathematical treatment is tropomyosin. Aminoacids in position 1 and 4 are
hydrophobic and in positions 2,3,5,6,7 are hydrophilic. Banding on helix structures comes
about.
One property if biomaterials worthy of mimicking is capable of self-repair. Biomimetic
mechanisms are stored in databases. Hydroxyapetite and collagen were used to prepare bone
like nanocomposite. Howships lacunae are cavities created by osteoclastic bone resorption.
Hydroxyapetite form on Langmuir Blodgett monolayers. There is interfacial interaction
between hydroxyapetite and collagen. Substitution process of composites to new bone occurs
in stages similar to autogeneous bone transplantation: a) erosion of body fluid and formation
of composite debris; b) phagocytosis of debris; c) resorption of composite and d) induction of
osteoblast to the resorption lacunae. Reconstruction of a critical bone defect in beagles tibia
was examined for possible clinical use. The iridescence of insects and structural colors of
plants are not well understood. Optical thickness of a dielectric stack layer of alternating
thickness and wave length of maximum constructive interference was quantitated. Two
lycaenid butterflies were studied for development of iridescence. The mechanism of bio
mineralization in mollusks has been studied by investigation of flat pearls. Rhombohedral
calcite morphology, spherulite calcite morphology and aragonite needles are formed under
different conditions. Argonite tablet growth was studied using AFM. Crystal CdS with rock
salt morphology was synthesized in films made up of PEO.
Efficient film formation needs clean substrate. Polyion multilayer films are characterized
by SAXR, small angle x-ray spectroscopy. Quartz crystal microbalance is used to measure
mass charges in nanogram quantity materials. Mechanism of PMF film formation was studied
by using AFM. Polysaccharide containing PMF biopolymers have been prepared. Adsorption
kinetics depends on ionic strength. A polymer/biopolymer hybrid such as DNA and PAH
were formed into a film containing alternating layers. Film containing streptavidin, glucose
isomerase etc. were discussed. Assembly of thin films is by sequential adsorption. 3
dimensional controls of film composition and properties are discussed.
Protein scaffold/biomimetic membrane material was discussed. Membrane material is a
complex fluid made up of a mixture of a lipid, polymer amphiphile, a co-surfactant. It
undergoes thermreversible phase changes and exists as liquid below a certain threshold
temperature and liquid crystalline gel above that temperature. Biomimetic nanostructures are
used to examine soft tissue cellular wounds and dry sensing and development and nerve
regeneration. Smart materials are developed that undergo a property change in response to
environmental stimuli. These materials are used in drug delivery systems. Magnetic pigment
used in magnetite memory storage devices with a maghemite phase of size ranging between
300-350 nm using biomimetic method was patented by CSIR, India. Longitudinal recording
requires acicular shape. Molecular identification can be prepared using biomimetic sensors.
High specificity requirements lead to development of Raman spectroscope. The surface
enhanced Raman scattering SERS nanostructure is shown in Figure 7.2. Nanoparticles can be
photogenerated.
Development of the new generation of technology of CNRs still have to cross a few
technical hurdles. These hurdles include: (i) building these nanorobots; (ii) connect
562
nanodevices; (iii) develop power source; (iv) develop nanorobotic computation; (v) develop
nanorobotic functionality; (vi) develop communication systems; (vii) develop multifunctionality; (viii) develop systems in which nanorobots work together; (ix) identify distinct
nanorobotic collective behaviors; (x) activate nanorobotic functionality; (xi) activate
computer programming; (xii) develop external tracking; (xiii) develop external activation;
(xiii) use artificial intelligence; (xiv) reorganize nanorobot aggregates; (xv) develop sensors;
(xvi) organize competing, cooperating teams of nanorobots; (xvii) emulate biological
processes.
Recent developments in collective robotics have derived inspiration from complex real
life phenomena. Examples of complex social behavior include flocking, herding and
schooling. Ant algorithms is the state of the art in emulation of natural processes. Another
system worthy of emulation is the immunological defense system of human anatomy.
Evolutionary computing is a field that where emulation of biological processes of evolution is
a high priority. Generic algorithms are developed from emulation of generational behavior of
polpulations. Inspiration can be derived from the bee-hive operation. Specialist roles and
coordination of tasks are examples of what came from emulation. Self-organizing models are
used to aggregate, reaggregate collection of robots.
Nanorobots have characteristics lengths of 100 nm 1 m. A WBC, white blood cell
with 100,000 molecules fits into this domain. At this size, the scrutiny is mesoscopic in nature
and note molecular or macroscopic. Organic material have been combined in creative ways
and novel bacterial and viral organisms have been created. This is sort of artificial Darwinian
system. Toxicity of an virus can be toggled off by use of recombinant DNA technology.
Synthetic biology techniques can be used to engineer a new species. Biomimetic chemisty is
used to synthesize organic molecules that emulate biological behavior. DNA and RNA parts
and raw aminoacids are combined and novel genetic structures are created. Reverse
engineering can be used in observation of natural protein behaviors emanating from specific
gene sequences. Gene targeting techniques may used for this purpose. Natural proteins can be
engineered from customized specific gene sequences. Small molecule ligangs can be allowed
to bind to proteins resulting in change of the protein function. Protein-protein interactions are
disrupted. At Harvard university, an autonomous molecular computer is arranged that
performs specific cellular functions. Biomolecular computer can be used in diagnosis of
disease and administration of drug on demand.
A CNR, collective nanorobots system was patented by Solomon Research [70] in 2008.
Drugs are allowed to be delivered and regulated more effectively to precise targets. These
methods are used in cardiovascular applications, diabetes treatment and intracellular cancer
therapies. CNRs can be used to cauterize wounds in patients with emergency trauma. CNRs
can be applied to nerve cells to block pain signals. CNRs configure into synthetic molecules
and are activated and modulated to control pain from specific nerve fragments. Enamel repair
and repair of nerve damage to stop bleeding in dental applications are also possible. CNRs are
used in neurosurgery. They can be used to peform complex regulatory functions that involve
feedback in dynamic neural processes. It can be used in dermatological applications as well.
Appearance of ageing can be reversed by use of self-repairing property of cells. Cellular
regeneration processes are accelerated to promote healing. In the patent [70] is described a
method for mapping the human anatomy. Tracking the nanorobots are by tags. Mapping of
the architecture of the organism is affected on the molecular level. Specific tissue and cell
types can be explored. CNRs congregate at specific tissue sites and wait for information about
563
mission parameters with new goals. CNR teams are made to cluster at specific location prior
to allowing the performance of an organized function to solve a key problem and then return
to the location when the mission is completed. Pathways of functional behaviors within
intercellular mechanisms are traced. Cellular differentiation are mapped and compared with
the results from a bioinformatic sequence with the general human anatomy. Variations can be
noted. CNR team is places at a specific location. Then they are broken into clusters and
allowed to migrate top specific locations by several mobility patterns. The mapping process is
recorded. The study of ageing process for example results in differences in state of cells at
various tissues from specific organs. CNR is integrated with the external computer analysis.
NEHW, nano evolvable hardware mechanisms are used.
CNRs are used in insulin regulation. The pancreas produces insulin for regulation of
glucose in the blood flow. Islets of Langerhans are the insulin secreting part of pancreas. Each
of the million islets contain about 1000 cells that are structured in clusters. Pancreatic islets
operate under a mechanism of amyloidogenesis in order to create amyloid polypeptides. 4
types of cells are created at the islets (i) alpha cells were production and inhibition of
glucagen takes place; (ii) Delta cells were somatostatin is produced; (iii) insulin and; (iv)
glucagons. Polypeptides are secreted by pancreatic cells that ends up supressing the secretion
and stimulating gastric secretion. Paracrine feedback system is created by activation of beta
cells by insulin and inhibition of alpha cells, by activation of beta and delta cells by glucagon,
inhibition of alpha and beta cells by somatostatin. Self-organizing system taps into paracrine
and autocrine communication between the islets. The signals are affected by chemical
messengers. Obesity and Type II diabetes can be found when too much fat and carbohydrate
are taken in the diet. CNRs can be used to regulate insulin. CNRs go beyond the paracrine
and autocrine mechanims of communication. CNRs can be used to emulate proper
functioning of iselts of Langerhans. A glycation process is conducted by CNRs whereby the
blood sugar is treated with insulin. CNRs can be organized into an artificial implantable
device that can be used in emulation of workings of a pancreas. Self-regulating pump is
constructed. The pancreas-like device is exteral and can be adorned.
10.10. DEVELOPMENTS IN NANOBOT APPLICATIONS

A nanobot to measure surface properties was patented [71]. The nanobot unit has a
manipulation unit and an end effector. The end effector can be a sensor or made to move as
close as possible to the surface of interest. The drive device has piezoelectric drives. The
resolution of the measurement can be in the nanometer range and the actual measurement in
the centimeter range. The nanobot is made sensitive in all directions, in multiple dimensions.
It can operate under vacuum. Surface roughness can be measured using nanobots.
Geophysical formation of hydrocarbons at deeper portions of the earths mantle can be
studied using nanobots [72]. Nanobots of the size of less than 500 nm are inserted into the
formation region. The nanobots are allowed to propel through the formation. Fluids and
conditions surrounding the nanobots are studied using a computer in the surface of the earth.
Communication between the nanobots and the computer on the surface is via a sereis of radio
frequency receivers and transmitters located at the wellbore. A 3 dimensional map of the
formation is developed on the remote computer. Pockets of hydrocarbons and their territories
564
are marked and shown clearly in the map. The untethered robots are positioned within the
geophysical formation. The body of the nanobot is made of CNT, carbon nanotubes that are
capable of operations at 300 F. Kalman filters can be used to filter out the random white noise
from signals from seismic exploration.
A patent was developed [73] for minimally invasive procedure by means of DPR,
Dynamic Physical Rendering. Use of intelligent, autonomous particles were made. An
interventional aid is formed with the aid of self-organizing nanorobots. These nanobots were
made of c atoms. C-arm angiography are used to monitor DPR procedures. A 3 dimensional
image data record on target region is obtained. The determined form was converted to a
readable and executable program code for the catoms of the nanorobots. The determined form
was transferred to a storage unit. The program code was executed in order to achieve selforganization in the unstructured catoms that were introduced in the target region. The
execution of the program was triggered by a timer or position sensor. The intervention aid is
used as a endovascular target region. Nanocrystal with motor properties was patented [74].
Reciprocating motor is formed by a substrate, atom reservoir, nanoparticle ram and
nanolever. The nanoparticle ram is contacted by the nanolever resulting in movement of
atoms between the reservoir and the ram. Substrate and nanolever are made of MWNTs,
multi-walled nanotubes made of Iridium. The substrate used was a silicon chip.
Nanoscale oscillator [75] was patented by Sea Gate technology, Scots Valley, CA. A
microwave output is generated by application of a DC current that is allowed to pass through
layers of magnetic structure separated by nanometer dimensions. Spin Momentum Transfer,
SMT is a phenomena realized to exist in 1989. It can be used in MRAM devices. Phaselocked microwave spin transfer is the next advance of the technology. The electric current
produced is in the GHz spectrum. The local magnetic field source is used in the application of
a magnetic field to a free layer of spin momentum transfer stack. The magnetic source can be
from a horseshoe magnet with poles stationed above and below the SMT stack. The magnetic
source can take on other forms such as helical coil that surrounds the SMT or pancake type
coils above and below the SMT stack or an annular pole and a coil that surround the stack. A
permanent magnet may be planted above the stack. SMT stack consists of a top electrode, a
free layer, a non-magnetic layer a pinned magnetic structure and a bottom electrode.
Nanowhiskers can be grown by control of nucleation conditions [76]. Nanowhisker formation
on substrates can be made using the VLS, vapor-liquid-solid mechanism. A particle of
catalyst material is placed on a substrate is heated in the presence of gases until it melts. A
pillar is allowed to form under the melt. As the melt rises up on top of the pillar and a
nanowhisker is formed. Miller direction <111> may be a preferred growth direction of the
whiskers. The catalytic property is present at the interface of whisker and air. InP
nanowhiskers, for example, were grown using metal-organic vapor phase epitaxy.
Characterization of nanowhiskers is by electron microscopy. MOVPF is low pressure metalorgaic vapor phase epitaxy process. 50 nm aerosol gold particles were deposited on InP
substrate. This was placed on a horizontal reactor cell heated by radio frequency heated
graphite suceptor. Hydrogen was used as carrier gas. Temperatuer was ramped tp 420 0 C for
5 min. The molar fraction of flow rate in the cell was 0.015. Nanowhisker growth was found
to commence upon addition of TMI, trimethylindium. The molar fraction of TMI was 3
millionth. Typical growth time for production of nanowhiskers was found to be 8 minutes.
565
10.10.1. Alzheimers Disease and Drugs Used Today

By the year 2050 the number of patients with Alzheimers disease will be 16 million. The
cost of memory loss is about $1.1 trillion. Currently 5 million patients suffer from
Alzheimers in this country, United States. The root curcuma longa, turmeric root has found
to have a positive effect in experiments with rats [9]. The drugs used such as bapinezumab
from Eli Lily and solanezumab from Johnson and Johnson used today are used to target the
amyloid- protein in the brain. This protein has been found to misfold and results in clump
formation in patients brains. Furthermore these drugs are expensive. Turmeric root is used in
curries in India and is readily available from farms at a lower cost. It is yellow colored. This
is recommended by Ayurveda and Siddha Medicine. It is known to possess anti-inflammatory
and antioxidant properties. Curcumin has been found to decrease inflammation in the brain. It
causes reduction in oxyradicals formed in patients brain.
10.10.2. Nanomedicine-Advantages of Nanorobot Drug Delivery System

Nanorobots can offer a number of advantages over current methods such as: 1) use of
nanorobot drug delivery systems with increased bioavailability; 2) targeted therapy such as
only malignant cells treated; 3) fewer mistakes on account of computer control and
automation; 4) reach remote areas in human anatomy not operatable at the surgeons
operating table; 5) as drug molecules are carried by nanorobots and released where needed the
advantages of large interfacial area during mass transfer can be realized; 6) non-invasive
technique; 7) computer controlled operation with nobs to fine tune the amount, frequency,
time of release; 8) better accuracy; 9) drug inactive in areas where therapy not needed
minimizing undesired side effects; 10) greater speed of drug action.
A nanorobot to measure surface properties was patented [12]. This technology is 10 - 20
years in the future. The nanorobot unit has a manipulation unit and an end effector. The end
effector can be a sensor or made to move as close as possible to the surface of interest. The
drive device has piezoelectric drives. The resolution of the measurement can be in the
nanometer range and the actual measurement in the centimeter range. The nano-robot is made
sensitive in all directions, in multiple dimensions. It can operate under vacuum. Surface
roughness can be measured using nanorobots. A patent was developed [13] for minimally
invasive procedure by means of DPR, Dynamic Physical Rendering. Use of intelligent,
autonomous particles were made. An interventional aid is formed with the aid of selforganizing nanorobots. These nanorobots were made of c atoms. C-arm angiography are used
to monitor DPR procedures. A 3 dimensional image data record on target region is obtained.
The determined form was converted to a readable and executable program code for the c
atoms of the nanorobots. The determined form was transferred to a storage unit. The program
code was executed in order to achieve self-organization in the unstructured c atoms that were
introduced in the target region. The execution of the program was triggered by a timer or
position sensor. The intervention aid is used as an endovascular target region.
566
10.10.3. Design and Control Strategy

The strategy for design of nanorobot drug delivery system among other things comprise
of the following salient features:
1. Use fullerenes as carriers of curcumin.
2. Complex the fullerene with curcumin and deactivate the drug action as in other cases
of photodynamic therapy.
3. Computer controlled irradiation can activate the fullerene. Breakage of fullerene is
expected and release of curcumin at constant rate [17, 18]. The intensity, wavelength
and areas of brain where is irradiated is controlled using computer software.
4. Curcumin acts on the diseased cells and cure is affected.
5. Pharmacokinetic model with 4th order process for irradiation and competing parallel
reactions for fullerene breakage, polymerization of fullerene and drug action is
developed.
6. Time for drug release can be computed from the drug delivery model. Drug delivery
model for fullerene nanorobot curcumin delivery system can be developed including
all the main features of the procedure.
7. Chromophores in curcumin is used as a dye and picked up from imaging.
Information from the sensor on drug action is compared against model and feedback
control affected by changing the intensity and wavelength of irradiation. This is
used to trigger feedback control or model based control of irradiation using
computers.
8. Itrathecal route of entry for nanorobot fullerene curcumin complex can be preferred
to sublingual entry. The choice of cerebrospinal fluid system may obviate any
digestive disorders from fullerene carbon.
Conventional treatments lack in their selectivity. Drugs administered generally become
active in areas where treatment is not needed. Sometimes negative side effects of the drugs
can be prevalent in those areas. Suppression of side effects is emerging as a salient
consideration in the development of new drugs and drug strategies. Nanorobot drug delivery
systems that are act only in targeted areas can be more beneficial.
Complexing curcumin with fullerene may be more desirable compared with binding with
a polymer molecule as carrier. The dimensions of the macromolecule carrier are large. On
account of its size it cannot migrate to any part of the human anatomy. In such cases the drug
stays near the region it is administered during the duration of treatment. This may call for
separate administration of complex to each area requiring treatment. This can consume lot
more time and the procedure becomes impractical given a great number of treatment sites.
The fullerene molecules as carriers can migrate to any region of the human anatomy such as
the hypothalamus in the brain and be a better choice for carrier. Attempts to design drug
delivery system with liposome encapsulated drug involve the rupture of the membrane and
drug release. This is triggered by irradiation and pH changes. The response was found to be
inconsistent. The pathway to drug release is indirect. i.e., the irradiation and pH changes
affect a photosensitizer. A compound in turn is generated that is capable of cleaving a specific
entity in the liposome membrane. At temperatures below the body temperature of 37C the
567
drug release drops. Thus at 15C the release rate was less than 15%. This limits the
application of this design.
10.11. CNTS, CARBON NANOTUBES

CNTs are rolled graphene sheets of atoms about its needle axis. They are 0.7-100 nm
diameter and a few microns in length. Carbon hexagons are arranged in a concentric manner
with both ends of the tube capped by pentagon containing Buckminster fullerene type
structure. They possess excellent electrical, thermal and toughness properties. Youngs
modulus of CNT has been estimated at 1 TPa and yield strength of 120 GPa. S. Ijima verified
fullerene in 1991 and observed multi-walled CNT formed from carbon arc discharge.
Five different methods of synthesis of CNTs are discussed. These are: a) Arc Discharge
[77]; b) Laser Ablation [78]; c) CVD [79-80]; d) HIPCO Process [81] and e) Surface
Mediated Growth of Vertically Aligned Tubes [82]. The arc discharge process was developed
by NEC in 1992. Two graphite rods are connected to a power supply spaced a few mm apart.
At 100 amps carbon vaporizes and forms hot plasma. Typical yields are 30 90%. The
SWNT, MWNT are short tubes with diameters 0.6 1.4 nm in diameter. It can be synthesized
in open air. Product needs purification. CVD process was invented by Nagano, Japan. The
substrate is placed in oven, heated to 600 0 C and a carbon bearing gas such as methane is
slowly added. As the gas decomposes it frees up the carbon atoms which recombine as a
nanotube. Yield range is 20-100%. Long tubes with diameter ranging from 0.6 4 nm were
formed. It can be easily scaled up to industrial production. The SWNT diameter is
controllable. The tubes are usually multi-walled and riddled with defects. Laser vaporization
process was developed by Smalley in 1996. The graphite is blasted with intense laser pulses
to generate carbon gas. Prodigious amount of SWNTs are formed. Yield of up to 70% is
found. Long bundles of tubes 5-20 m with diameters in the range of 1-2 nm are formed. The
product formation is primarily SWNTs. Good diameter control is possible and few defects are
found in the product. Reaction product is pure. The process is expensive.
The HIPCO process was also developed by Smalley in 1998. A gaseous catalyst
precursor is rapidly mixed with carbon monoxide, CO in a chamber at high pressure and
temperature. Catalyst precursor decomposes and nanoscale metal particles form the
decomposition product. CO reacts on the catalyst surface and form solid carbon and gaseous
CO2, carbon dioxide. The carbon atoms roll up into CNTs. 100% of the product is SWNT and
the process is highly selective. Samsung patented a method for vertically aligning CNTs on a
substrate. A CNT support layer is stacked on the substrate filled with pores. SAM, selfassembled monolayer is arranged on the surface of the substrate. On end of each of the CNTs
are attached portions of the SAM exposed through the pores formed between the colloid
particles present in the support layer. CNTS can be vertically aligned on the substrate having
the SAM on it with the help of pores formed between the colloid particles.
CNTs possess interesting physical properties [83]. Thermal conductivity of CNTs is in
excess of 2000 w/m/K. They have unique electronic properties. Applications include
electromagnetic shielding, electron field emission displays for computers and other high tech
devices, photovoltaics, super capacitors, batteries, fuel cells, computer memory, carbon
electrodes, carbon foams, actuators, material for hydrogen storage and adsorbents. CNTs can
568
be produced with different morphologies [84]. Examples of different morphologies include

SWNT, DWNT, MWNT, nano-ribbon, nano-sheet, nano-peapod, linear and branched CNTs,
conically overlapping bamboo-like tubule, branched Y shaped tubule, nano-rope, nanowires,
nanofilm. Processes are developed to prepare CNTs with desired morphology. Phase
separated copolymers/stabilized blends of polymers can be pyrolyzed along with sacrificial
material to form the desired morphology. The sacrificial material is changed to control the
morphology of the product. Self-assembly of block copolymers can lead to 20 different
complex phase separated morphologies. Often times as is the precursor so is the product.
Therefore even more variety of CNT morphologies can be synthesized.
10.12. CHARACTERIZATION OF NANOSTRUCTURES

Needs for characterization of nanostructures are on the rise. Resolution limits of optical
microscopes are of the order of wavelength of light. Per the Raleigh criterion, the resolution
limit of optical microscopes is of the order of 200 nm. In order to characterize nanoscale
materials, x-ray and helium ion microscopes are needed. Optical microscopes, scanning
electron microscope, transmission electron microscope, scanning probe microscope and
helium ion microscope have increasing powers of resolution in the mentioned order.
Structural information in the scale of 2-25 nm can be characterized using SAXS [85].
Monochromatic source of x-rays are used to excite the sample and scattered x-rays are
detected by 2-dimensional flat x-ray detector. Structure is deduced from patterns in the
scatter. Interpretation of scattered pattern can be accomplished using Porads law and Guiner
approximation, Fourier transformation, etc. Thin films, multi-layered systems, oriented
nanoparticles with different chemical compositions, colloids, proteins solutions,
nanocomposites, micelles, fiber structures, etc., can be studied using SAXS. WAXS,
GISAXS, SWAXS are techniques that are variations of SAXS.
TEM, transmission electron microscopes have higher resolution power. Sample
preparation for TEM analysis [86] is complex and the thickness of the sample has to be down
to a few hundred nanometers. An electron beam is produced from a tungsten filament
subjected to a high voltage. Electrons are allowed to pass through the specimen. With
HRTEM, high resolution transmission electron microscope, resolutions achievable are as
small as 1 A. TEM is used in life sciences, biomedical investigations, diagnostic tool in
pathology, imaging of atoms, oligopeptides, nanogold, self-assembled nanotubes. It can also
be used as an elemental analysis tool in addition to EDXA, energy dispersive x-ray analysis
and at low temperatures as cryo-TEM. Magnification in SEM, scanning electron microscope
ranges from 25-250,000 and resolution size is down to 1 25 nm. Electron gun is used to
generate electron beams. Spatial resolution of SEM depends on the wavelength of the electron
and electro-optical system that produces the scanning beam. Resolution at an atomic scale is
not possible as can be with the case of TEM and HeIM. The electrons generated are focused
as a spot with nanoscale dimensions. Electrons upon impingement with the specimen undergo
elastic scattering, inelastic scattering and back scattering. Raster scanning is used to image
surfaces. Surface topography, composition and other properties can be obtained from raster
scan.
569
Topographical map on atomic scale can be generated using SPM, scanning probe
microscope [87, 88]. Neither electrons nor light is used for formation of images.
Magnification of higher than 1 billion is possible. A tiny probe with a sharp tip is brought in
close proximity to within 1 nm of specimen surface and then raster scanned. Nanoscale
defects, bio molecules and silicon microprocessors can be characterized using SPM. They can
also be used to prepare nanostructures. Dip Pen lithography, DPN, is such a technique. Tiny
probe tip is used as pen to write structures consisting of a few molecules. STMs can be used
to obtain conductance and current/distance measurements, AFM can be used for lateral force
and adhesion measurements, NFOM can be used for laser transmission at various wave
lengths and MFM can be used for temperature and other parameters. Quantum dots contain
10-100 electrons in devices of dimensions of (500 nm)2. Photocurrent induced in quantum
dots can be measured. The influence of high frequency microwave radiation [89] on single
electron tunneling through a single quantum dot was used in microwave spectroscopy.
Elemental composition of test specimen can be obtained using Auger Electron Microscope.
Detection limits are 0.1% of the atomic composition of the elements. Spatial resolution is
about 300 nm. Depth resolution is about 10 nm and typical analysis is 30 minutes per sample.
Raman microscope [90] is designed based on the Raman Effect. Molecular types can be
obtained from the scattering information. Raman microscopes can be used to study gene
expression and DNA sequence distribution. SERS, surface enhanced Raman spectroscopy can
be used to detect single nucleotide molecules. SERS includes a laser light source that excites
the molecule and a detection unit for capturing Raman emission emanating from the
molecule. STM evolved into AFM, [91] atomic force microscope. Fraction of nanometer
resolution can be achieved using AFM. Specimen surface is scanned using a micro scale
cantilever with a probe at its end with a sharp tip with a radius of curvature of a few
nanometers. Laser source excites the sample. The laser light is reflected by the deflected
cantilever. The reflected light is captured by avalanche of photodiodes. Individual atoms can
be imaged using AFM. HeIM, Helium ion microscope [92] was developed as an alternative to
electron microscope. Helium ions possess shorter wavelengths compared with electrons. A
space resolution of 0.24 nm was achieved by Orion HeIM. This is close to the diameter of a
single atom and is three times better in resolution compared with the electron microscopes.
Individual atoms can be looked at. HeIMs can be operated in RBI and secondary electron
mode.
10.13. SUMMARY
Advances have been made in development of nanobots for medical applications.
Submarine robots are used in brachytherapy, spinal surgery, cancer therapy etc. Nanocar has
been designed with fullerenes as wheels, alkyne groups as axle and can be observed using a
STM, scanning tunneling microscope. Nanoparticles have been developed for use in eye
disorders and for early diagnosis. Research in nanomedicine is under way in development of
diagnostics for rapid monitoring, targeted cancer therapies, localized drug delivery, improved
cell material interactions, scaffolds for tissue engineering and gene delivery systems. Novel
therapeutic formulations have been developed using PLGA based nanoparticles. Nanobots
can be used in targeted therapy and in repair work of DNA. Drexler and Smalley debated
570
whether molecular assemblers that are devices capable of positioning atoms and molecules
for precisely defined reactions in any environment is possible or not. Feynmans vision of
miniaturization is being realized. Smalley sought agreement that precision picking and
placing of individual atoms through the use of Smalley-fingers is an impossibility.
Nanostructures can be nanoparticles, nanotubes, soccer ball structures, nanopores,
nanopeapods, nanowhiskers, nanocapsules, nanoshells, nanowires, nanoropes, nanolayered
materials, nanocomposites, nanofilm, nanocoating, nanocrystal,nanorods, nanotetrapods,
nanosheets, nanotrenches, nanotunnel, nanograins, nanocubes, nanovoids, nanolamella,
nanofilament, quantum dots, etc. Fullerenes, C60, is the third allotropic form of carbon. Soccer
ball structured, C60, with a surface filled with hexagons and pentagons satisfy the Eulers law.
Howard [8] patented the 1st generation combustion synthesis method for fullerene production,
an advance over the carbon arc method. In the second generation combustion synthesis
method optimizes the conditions for fullerene formation. A chemical route has been
developed by Scott [9] to synthesize C60. Corannulene is synthesized from naphthalene
structure. As the rings fuse and the sheet forms then it is rolled into soccer ball structure.
Electric arc method can be used to prepare fullerenes. Nanostructures can either be generated
by building up from atoms using methods classified as bottom-up strategy or by diminishing
of size from nanoparticles using methods grouped under top-down strategy. Bottom-up
strategies use self-assembly concepts, are cheap, more scalable, more flexible and leads to
molecular level engineering. Top down strategy are expensive, less scalable and inflexible.
Different nanostructuring methods are discussed. These include: sputtering of molecular ions
[13]; gas evaporation [14] process to make ultrafine magnetic magnetic powder; triangulation
and formation of nanoprisms by light irradiation [15]; nanorod production using condensed
phase synthesis method [16]; subtractive methods such as lithography, etching, galvanic
fabrication; lift-off process for IC circuit fabrication; nanotips and nanorods formation by
CMOS process; patterning Iridium Oxide nanostructures; dip pen lithography; SAM, selfassembled monolayers; hot embossing; nanoimprint lithography; electron beam lithography;
dry etching; reactive ion etching; quantum dots and thin films generation by sol gel, solid
state precipitation, molecular beam epitaxy, chemical vapor deposition, CVD, lithography,
nucleation and growth; sol-gel processing methods; thin film formation from surface
instabilities; thin film formation by spin coating; cryogenic milling for preparation of 100-300
nm sized titanium; atomic lithography methods to generated structures less than 50 nm;
electrodeposition method to prepare nanocomposite; plasma compaction methods; direct
write lithography; nanofluids by dispersion. 18 different nanostructuring methods were
reviewed by Sharma [33]. Three different methods of synthesis of CNTs, carbon nanotubes
were compared side-side by side [34]. The solid colloid dynamics that can be expected in
nanocomposites [40,41] was discussed. Stochastic simulations [43,44] using the
supercomputer were used to better understand the process of spinodal nucleation and in situ
laser ablation. Nanocomposites can be structured to prepare materials with higher thermal
conductivity compared with copper [46, 47] for use in laptop computer casings and reducing
the weight of automobiles. Thermodynamic miscibility of nanocomposites can be calculated
from the free energy of mixing. The four thermodynamically stable forms of Carbon are
diamond, graphite, C60, Buckmininster Fullerene and Carbon Nanotube. Mackay et al. [61]
showed that thermodynamically stable dispersion of nanoparticles into a polymeric liquid is
enhanced for systems where the radius of gyration of the linear polymer is greater than the
radius of the nanoparticle. Tiny magnetically-driven spinning screws were developed by
571
Ishiyama et al. [63,64]. DNA computing was born when Aldeman [66] in 1994 proposed a
molecular algorithm to solve the Hamiltonian path problem with DNA and solved an instance
of a directed graph with 7 nodes. Molecular machines are molecules that can with an
appropriate stimulus be temporarily lifted out of equilibrium and can return to equilibrium in
the observable macroscopic properties of the system. Molecular shuttle, molecular switches,
molecular muscle, molecular rotors, molecular nanovalves are discussed. Supramoelcular
materials offers alternative to top-down miniaturization and bottom-up fabrication. Selforganization principles holds the key. Gene expression studies can be carried out in biochips.
Sequence alignment [69] can be used to develop cures for autoimmune disorders, in
phylogenetic tree construction, identify polypeptide microstructure, in shot gun sequencing,
during drug design, in protein secondary structure determination, in protein folding, clone
analysis, protein classification, etc. CNRs are a new genertion of self-organizing collectives
of intelligent nanorobots. This new technology includes procedures for interactions between
objects with their environment resulting in solutions of critical problems at the nanoscopic
level. Biomimetic materials are designed to mimic a natural biological material. Nanorobots
have characteristics lengths of 100 nm 1 m. Five different methods of synthesis of CNTs
are discusses. These are: a) Arc Discharge [77]; b) Laser Ablation [78]; c) CVD [79-80]; d)
HIPCO Process [81] and e) Surface Mediated Growth of Vertically Aligned Tubes [82].
Characterization methods of nanostructures include SAXS, small angle X-ray scattering,
TEM, transmission electron microscopy, SEM, scanning electron microscopy, SPM, scanning
probe microscope, Raman microscope, AFM atomic force microscopy, HeIM helium ion
microscopy.
10.14. REFERENCES
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
Feynman, RP. Theres plenty of room at the bottom, Caltech Engineering and
Science, Volume 23, 5, February 1960, 22-36.
Tiny Robots for Surgery, http://en.wikipedia.org/wiki/Nanorobotics.
Rice scientists build worlds first single-molecule car, Rice University Press Release,
October 10th 2005, Houston, TX. http://www.media.rice.edu/media/NewsBot.asp?
MODE=VIEW&ID=7850&SnID=971109686.
U.S varsity team stresses potential of nanomedicine, The Hindu, Wednesday, August
6th 2008, Chennai, India.
Sharma, KR. Nanostructuring Operations in Nanoscale Science and Engineering,
McGraw Hill Professional, (2010) New York, NY.
Sharma, KR. Transport Phenomena in Biomedical Engineering: Artificial Organ
Design and Development and Tissue Design, McGraw Hill Professional, (2010) New
York, NY,
Science and Technology Concentrates, Chemical and Engineering News, 86, 31,
(2008), 37-37.
Howard, JB; McKinnon, JT; Makaraovsky, Y; Laffleur, AL; Johnson, ME. Fullerenes
C60 and C70 in Flames, Letters to Nature, 352, (1991), 139-141.
Scott, LT. Methods for the Chemical Synthesis for Fullerenes, Angewandte Chemie,
43, (2004), 4994-5007.
572
[10] Kawakami, S; Yamamoto T; Sano, H. Method for Producing Fulelrenes, US Patent

6,953,564, (2005), Cannon Kabushiki Kaisha, Tokyo, Japan.
[11] Smalley, RE. Solar Process for Making Fullerenes, US Patent 5,556,517, (1996),
Rice University, Houston, TX.
[12] Smalley, RE. Electric Arc Process for Making Fullerenes, US Patent 5,227,038,
(1993), Rice University, Houston, TX.
[13] Smirnov, VK; Kibalov, DS. Methods of Formation of a Silicon Nanostructure, a Silcon
Quantum Wire Array and Devices Bases Thereon, US Patent 6,274,007, (2001),
Sceptre Electronics Ltd., St. Helier, NJ.
[14] Process for the Manufacture of Metal Nanoparticle, US Patent 6688494, (2004), Cima
Nanotech, Woodbury, MN, USA.
[15] Methods of controlling nanoparticle growth, US Patent 7033415, 2006, Northwestern
University, IL, USA.
[16] Geohegan, DB; Seals, RD; Puretzky, AA; Fan, X. Condensed Phase conversion and
Growth of Nanorods instead of from Vapor, US Patent 6,923,946, (2005), UT-Battelle,
Oak Ridge, TN.
[17] Iridium Oxide Nanostructure, Zhang, F; Steeker, GM; Barrowclift, RA; Hsu, ST. US
Patent 7,053,403, 2006, Sharp Laboratories of America, Inc., Camas, WA.
[18] Hong, S; Zhu, J; Mirkin, CA. Multiple Ink Nanolithography Toward a Multiple-Pen
Nano-Plotter, Science, 286, 1999, 523-525.
[19] Chou, SY; Krauss, PR; Renstrom, PJ. Imprint of Sub-25 nm vias and Trenches in
Polymers, Appl. Phys. Lett., 67, 1995, 3114.
[20] Duval, DJ; Risbud, SH. Semi-Conductor Quantum Dots:Progress in Processing,
Handbook of Nanostructured Materials and Nanotechnology Vol I: Synthesis and
Processing, Eds., H. S. Nalwa, Academic Press, (2000), New York, NY.
[21] Tillotsun, TM; Simpson, RL; Hrubesh, LW; Gash, A. Method for Producing
Nanostructured Metal-Oxides, US Patent 6,986,818, (2006), Reagents of the University
of California, CA.
[22] Steiner, U. Structure Formation in Polymer Films: From m to sub 100 nm Length
Scales, in Nanoscale Assembly Chemical Techniques (Nanostructure Science and
Technology Ed. W. T. S. Huck), Springer, 2005, New York, NY.
[23] Sharma, KR. Change in Entropy of mixing and Two Glass Transitions for Partially
Miscible Blends, 228th ACS National Meeting, Polymeric Materials: Science and
Engineering, 91, August, 2004, 755, Philadelphia, PA.
[24] Keener, SG. Method for Preparing Ultra-Fine Submicron Grain Titanium and TitaniumAlloy Articles and Articles Prepared Thereby, US Patent 7,241,328, The Boeing
Company, Chicago, IL.
[25] Saffman, ME. Atomic Lithography of Two Dimensional Nanostructures, US Patent
6,787,759, (2004), Wisconsin Alumni Research Foundation, Madison, WI.
[26] Lu, Y; Wang, D. Process for the Preparation of Metal-Containing Nanostructured
Films, US Patent 7,001,669, (2006), Tulane Educational Fund, New Orleans, LA.
[27] Ren, Z; Chen, G; Poudel, B; Kumar, S; Wang, W; Dresselhaus, M. Methods for
Synthesis of Semiconductor Nanocrystals and Thermoelectric Compositions, US Patent
7,255,846, (2007), Massachusetts Institute of Technology, Cambridge, MA & Boston
College, Chestnut Hill, MA.
573
[28] Mirkin, CA; Liu, X; Guo, S. Surface and Site-Specific Polymerization by Direct-Write
Lithography, US Patent 7,326,380, (2008), Northwestern University, Evanston, IL.
[29] Choi, SUS; Eastman, JA. Enhanced Heat Transfer using Nanofluids, US Patent
6,221,275, (2001), University of Chicago, Chicago, IL.
[30] Sharma, KR. Heat Conduction Mechanism in Nanofluids, 237th ACS National Meeting,
Salt Lake City, UT, March 22nd 26th 2009.
[31] Cha, JN; Hedrick, JL; Kim, HC; Miller, RD; Volksen, W. Materials having Predefined
Morphologies and Methods of Formation Thereof, US Patent 7,341,788, (2008),
International Business Machines, Armonk, NY.
[32] Rode, A; Gamaly, E; Luther-Davies, B. Method of Deposition of Thin Films of
Amorphous and Crystalline Microstructures Based on Ultra fast Pulsed Laser
Deposition, US Patent 6,312,768, (2001), Australian National University, Acton,
Australia.
[33] Sharma, KR. Eighteen Different Methods for Nanostructuring, Nanotech Conference &
Expo 2009, Houston, TX, May, 2009.
[34] Sharma, KR. Comparison of Three Methods of Synthesis of Carbon Nanotubes,
ANTEC 2008, Milwaukee, WI, May 4th May 8th 2008.
[35] Sharma, KR. Isolating Metal Nanopowders, 93rd AIChE Annual Meeting, Reno, NV,
November, 2001.
[36] Sharma, KR. Separation Method for Metal Nanopowders, 37th Western Regiona
Meeting of ACS, WERM 01, Santa Barbara, CA, October, 2001.
[37] Sharma, KR. Acceleration Motion of Nanoflocs, Great Lakes Regional Meeting of
ACS, GLRM 02, Minneapolis, MN, June, 2002.
[38] Sharma, KR. Rapid Thermal Quenching in a Subatmospheric Fluidized Bed Chamber
to Prepare Nanoscale Powders, 221st ACS National Meeting, San Diego, CA, April,
2001.
[39] Sharma, KR. Nanopore Filters for Dialysis Machine for Treatment of End Stage Renal
Disease, 239th ACS National Meeting, San Francisco, CA, March, 2010
[40] Sharma, KR. Nanocomposites - Is it a Solid Colloid ?, 218th ACS National Meeting,
New Orleans, LA, August, 1999.
[41] Sharma, KR. Solid Colloid Dynamics in Polymer Nanocomposites, 38th Annual
Convention of Chemists, Jodhpur, India, December, 2001.
[42] Sharma, KR. Particle Size Distribution of Nanoparticulate Materials using SAXS,
Interpack 99, Mauii, HI, July,1999.
[43] Sharma, KR. DPD Simulations to Study the Nanoparticle Dispersion, 74thColloid and
Surface Science Symposium, Colloid 2000, Bethlehem, PA, June, 2000.
[44] Sharma, KR. Stochastic Computer Simulations of Exfoliated Nanocomposites, 51st
Southeast Regional Meeting of the ACS, SERMACS, Knoxville, TN, October, 1999.
[45] Sharma, KR. Mesoscopic Simulation of Ballistic Impact Resistance of Nanocomposites,
Annual Technical Conference for Society of Plastics Engineers, ANTEC 2000,
Orlando, FL, May, 2000.
[46] Sharma, KR. Thermoplastic Nanocomposite with High Thermal Conductivity, Interpack
99, Mauii, HI, July, 1999.
[47] Sharma, KR. Effective Thermal Conductivity of Thermoplastic Nanocomposite used in
a Laptop Computer Casing, 30th ACS Central Regional Meeting, Cleveland, OH, May,
1998.
574
[48] Sharma, KR. Cellular Signal Processing and Nanoprobes, 227th ACS National
Meeting, Anaheim, CA, March/April, 2004.
[49] Sharma, KR. On Nanoscale Bolometer to Study Chemical Plumes, AIChE Spring
National Meeting, Tampa, FL, April 2009.
[50] Sharma, KR. Nanofiber Optic Biosensor Design, 223rd ACS National Meeting,
Orlando, FL, April, 2002.
[51] Sharma, KR. Discrete Cosine Transform and Nanoscale Temperature Distributions,
223rd ACS National Meeting, Orlando, FL, April, 2002.
[52] Sharma, KR. Excluded Volume Reduction in Elastomeric Nanocomposites, 51st
[53] Sharma, KR. Glass Transition Temperature of Elastomeric Nanocomposites, 51st
[54] Sharma, KR. Thermodynamic Stability of Nanocomposites, Interpack 99, Mauii, HI,
July, 1999.
[55] Sharma, KR. Transparent Nanocomposites - Some Pitfalls, AIChE Spring National
Meeting, New Orleans, LA, March, 2002.
[56] Sharma, KR. Design Considerations in Preparation of Elastomeric Exfoliated
Nanocomposites, 74th Colloid and Surface Science Symposium, Colloid2000,
Bethlehem, PA, June, 2000.
[57] Sharma, KR. Processing Methodology for Transparent Armor Nanocomposites, Annual
Technical Conference for Society of Plastics Engineers, ANTEC2000, Orlando, FL,
May, 2000.
[58] Kambour, RP; Bendler, JT; Bopp, RC. Macromolecules, 16,(1983), 753.
[59] Ten Brinke, G; Karasz, FE; Macknight, WJ; Macromolecules, 16, (1983), 1824.
[60] Paul, DR; Barlow, JW. Polymer, 25, (1984), 487.
[61] Mackay, ME; Tuteja, A; Duxbury, PM; Hawker, CJ; van Horn, B; Guan, Z; Chen, G;
Krishnan, RS. General Strategies for Nanoparticle Dispersion, Science, 311 (2006),
1740-1743.
[62] Kumar, SK; Krishnamoorti, R. Nanocomposites: Structure, Phase Behavior, and
Properties, Annual Review of Chemical and Biochemical Engineering, 1, (2010), 3758.
[63] Freitas, RA. Jr. Nanomedicine, Vol. I: Basic Capabilities. Georgetown (TX): Landes
Bioscience; 1999. Also available at: http://www.nanomedicine.com/NMI.htm.
[64] Ishiyama, K; M. Sendoh KI; Arai KI. Magnetic micromachines for medical
applications. J Magnetism Magnetic Mater, 242-245 (2002), 1163-1165.
[65] Mathieu, JB; Martel, S; Yahia, L; Soulez, G; Beaudoin, G. MRI systems as a mean of
propulsion for a microdevice in blood vessels. Proc. 25th Ann. Intl. Conf., IEEE
Engineering in Medicine and Biology; 2003 Sep 17-21; Cancun, Mexico; 2003.
[66] Yoshida, H; Suyama, A. in DNA Based Computers 5, E. Winfree and D. K. Gifford,
Eds. Vol. 54 of DIMACS Series in Discrete Mathematics and Theoretical Computer
Science (American Mathematical Society), Providence, RI, (1999), 9-20.
[67] Head, T; Yamamura, M; Gal, G. Aqueous Computing: Writing on Molecules,
Evolutionary Computation, 1999. CEC 99. Proc. Of the 1999 Congress on.,
Washington, DC, July 1999.
[68] Lehn, JM. Toward Self-Organization and Complex Matter, Science, Vol. 295, 5564,
(2002), 2400-2403.
575
[69] Sharma, KR. Bioinformatics: Sequence Alignment and Markov Models, McGraw Hill
Professional, (2009), New York, NY.
[70] Solomon, N. System and Methods for Collective Nanorobotics for Medical
Applications, US Patent 20080241264A1, Solomon Research LLC, Oakland, CA.
[71] Klocke, V. Nanrobot Module, Automation and Exchange, US Patent 2010/0140473
A1, (2010), Ohlandt, Greeley, Ruggiero and Perle LLP, Stamford, CT.
[72] Kamal, RA; Sanni, ML; Kanj, MY. System, Method and Nanorobot to Explore
Subterranean Geophysical Formations, US Patent 2010/0268470 A1, (2010)Bracewell
& Giuliani LLP, Houston, TX.
[73] Pfister, M. Method for Forming an Interventional Aid with the Aid of Self-Organizing
Nanorobots Consisting of CATOMS and Associated System Unit, US Patent
2011/0048433 A1, Bubenreuth, DE.
[74] Regan, BC; Zettl, AK; Aloni, S. Nanocrystal Powered Nanomotor, US Patent 7,863,
798 B2, (2011), The Regents of the University of California, Oakland, CA.
[75] Dimitrov, DV; Peng, X; Xue, SS; Wang, D. Spin Oscillatory Device, US Patent
7,589, 600 B2, Seagate Technology, LLC, (2009) Scotts Valley, CA.
[76] Seifert, W; Samuelson, LI; Ohlsson, BJ; Borgstrom, LM. Directionally Controlled
Growth of Nanowhiskers, US Patent 7,911,035 B2 (2011), QuNano AB, (2011),
Lund, Switzerland.
[77] US Patent 6794598, H. Huang, H. Kajiura, M. Miyakoshi, A. Yamada, M. Shiraishi,
Arc Electrodes for Synthesis of Carbon Nanostructures, Sony Corp., 2003.
[78] US Patent 6331690, M. Yudasaka, S. Iijima, Process for Producing Single Wall Carbon
Nanotubes Uniform in Diameter and Laser Ablation Apparatus used Therein, 2001.,
NEC Corp. Tokyo, Japan.
[79] Meyyappan, M. 2004, Carbon Nanotube Growth by Chemical Vapor Deposition, in
Encyclopedia of Nanoscience and Nanotechnology, Eds. H. S. Nalwa, 581-589.
[80] US Patent 6689674, R. Y. Zhang, R. K. Tsui, J. Tresek, A. M., Rawlett, Method for
Selective Chemical Vapor Deposition of Nanotubes, 2004, Motorola, IL.
[81] Smalley, RE; Smith, KA; Colbert, DT; Nikolaev, P. Bronikowski, MJ. Bradley, RK;
Rohmund, F. Single-Wall Carbon Nanotubes from High Pressure CO, US Patent
7,204,970, 2007, Rice University, Houston, TX.
[82] Jin, YW; Kim, JM; Jung, HT; Jeong, TW; Ko, YK. Carbon Nanotube Structure and
Method of Vertically Aligning Nanotubes, US Patent 7,371,696, 2008, Samsung SDI
Co. Ltd., Suwon-si, Gyeonggi-do, KR.
[83] Beetz, T; Sfeir, T. Dual Properties of Carbon Nanotubes Revealed, Science, April
2006. Collins et al., 1997, Science, 278, 100.
[84] Matyjaszewski, K; Kowalewski, T; Lambeth, DN; Spanswick, JT; Tsarevsky, NV.
Process for the Preparation of Nanostructured Materials, US Patent 7,056,455,
Carnegie Mellon University, Pittsburgh, PA.
[85] Dubcek, P. Nanostructure as Seen by the SAXS, Vacuum, 80, (2005), 92-97.
[86] Zhang, S; Vauthey, S. Surfactant Peptide Nanostructures and Uses Thereof, US Patent
7,179,784, (2007), Massachusetts Institute of Technology, Cambridge, MA.
[87] Duan, X; Daniels, RH; Niu, C; Sahi, V; Hamilton, JM; Romano, LT. Methods of
Positioning and/or Orienting Nanostructures, US Patent 7,422,980, (2008), Nanosys
Inc., Palo Alto, CA.
576
[88] Mirkin, CA; Piner, R; Hong, S. Methods Utilizing Scanning Probe Microscope Tips
and Products Therefore or Produced Thereby, US Patent 6,827, 979, (2004),
Northwestern University, Evanston, IL.
[89] Blick, RH. Microwave Spectroscopy on Quantum Dots, Chapter 6.0, Handbook of
Nanostructured Materials and Nanotechnology, Eds., H. S. Nalwa, Vol.2, Spectroscopy
and Theory, Academic Press (2000), 309-343.
[90] Sundarajan, N; Sun, L; Zhang, Y; Su, X; Selena Chan, S; Koo, TW; Berlin, AA.
Microfluidic Apparatus, Raman Spectroscopy Systems, and Methods for Performing
Molecular Reactions, US Patent 7,442, 339, (2008), Intel Corp., Santa Clara, CA.
[91] Liebler, CM; Kim, Y. Machining Oxide Thin-Films with an Atomic Force Microscope:
Pattern and Object Formation on the Nanometer Scale, US Patent 5,252, 835, Harvard
College, Cambridge, MA
[92] Petkewich, R. Say Hello to Helium Ion Microscopy, Chemical and Engineering News,
Science and Technology, Vo. 86, 47, (2008), 38-39.
INDEX
A
a hyperbolic PDE, 277
a semi-infinite, 374
ABS, 262, 552
ABS, Acrylonitrile Butadiene Styrene, 56
absorbtion efficiency, 193
absorption, 487, 498
absorption process, 490
Absorption profile, 514
absorption rate constant, 490
accelerating phase, 89
accelerating spheres, 532
acceleration, 292
acceleration motion, 85
Acceleration zone, 93
accessible, 539
accumulation condition, 288
accumulation of concentration, 171
accumulation of heat, 161
accumulation term, 98
accuracy, 565
accurate, 527
ACF, 421
acid rain formation, 61
acquisition, 395
acrylamide, 302
acrylonitrile, 302, 307
Acrylonitrile, 151
Activated sludge, 303
actuators, 323, 567
ad infinitum, 208
Adaptation, 558
adaptive, 397
Adaptive Control, 27
Adhesive strength, 394
Adhesive tack, 394
Adipic Acid, 54
Adsorption Bed, 56
aerosol, 564
AFM, 548, 556, 569
ageing, 538, 562
agglomeration, 422, 554
agitator, 333
agitator RPM, 261
air conditioning, 323
air flow, 415
Air pollution, 60
air puff, 540
Air resistance, 75
airfoil, 164
ALD, 547
aldol trimerization, 549
algae, 302
algae biodiesel, 63
Aliter, 372
Alkali catalysts, 61
allotropic, 549
Alphamethylstyrene, 151
Alternating, 394
Aluminum, 181
Alzheimers, 565
Aminoacids, 561
ampacity, 193
amplitude ratio, 371, 537
amyloidogenesis, 563
amyloid- protein, 565
AN, 554
analytic, 277
analytic function, 184
Anatomical Temperature, xx, 16, 19
anchor helix reactors, 261
anesthesia, 540
angiography, 564, 565
angular deflection, 534
angular momentum, 177
angular speed of rotor, 127
578
Index
angular velocity, 532

animal fats, 61
animal testing, 513
ANN, 415
annular space, 536
antioxidant, 174
anti-reflection coating, 189
APC, 421
Apollo 15 Mission, 75
apoptosis, 110
apparent volume, 491
Applanation tomometers, 540
aqueous computing, 556
aragonite, 561
Arc Discharge, 567
architecture, 415
Artificial Intelligence, 4, 8, 28, 562
ascend, 80
aspartame, 302
Aspherical, 532
Asymmetric Catalysis, 556
asymmetry, 76
asymptotic limit, 302
asymptotic maximum, 492
Asymptotically Stable, 142
Atomic lithography, 551
atomistic scale, 176
Auger Electron Microscope, 569
Autoassociation, 417
autoimmune disorders, 559
automation, 1, iii, ix, xix, 2, 9, 27, 565, 575
autonomous systems, 148
average size of the particle, 96
average temperature, 251, 284, 286
AW of the biodiesel plant, 66
Ayurveda, 565
azimuthal, 111
azimuthal velocity, 97
azobenzene, 557
azoisobutyrontirle, 307
B
Babcock & Wilcox, 99
back-propagation, 415
back-propagation model, 415
backward algorithm, 560
bacteria, 302
balance of properties, 174
ballistic impact resistance, 552
ballistic part, 206
ballistic term, 205
Ballistic/Acceleration Model, 211
banded diagonal, 559

bandwidth, 379
bapinezumab, 565
Basell, 43, 45, 56
BASF, 43, 50, 51, 57
Basketball, 76
Batch Process, 27, 67
batch reactor, 261
Batch Reactor, 393
batteries, 567
Baxter, 9
Bayer, 34, 53, 56, 58
bee-hive, 562
bell mouth entrance, 159
bell shaped, 417
Bessel composite function, 120, 123, 194
Bessel function, 530
Bessel function of the second order, 197
Beta methyl styrene, 307
better grafting, 174
Bholin VOR rheometer, 538
BICMOS, 531
bile, 489
Bimetallic, 528
bimodal distribution, 174
binary, 417
binary diffusivities, 162
binary interaction, 554
binary interaction model, 554
binomial infinite series, 209, 250
binomial theorem, 101
bioanalytical method, 488
bioavailability, 514, 565
biochips, 430, 538, 558
Biodegradable, 548
Biodiesel, 61
bioinformatic, 563
biological affinity, 488
Biomimetic, 560
Bionics, 10
Biot number, 115, 161
bituminous coal, 61
Black paint, 189
blend-time mechanism, 174
block, 394
block diagram(s), 27, 325, 335, 414
block flow diagrams, 254
Blocks, 16
Blood profile, 513
Blood urea nitrogen, 488
Blossum, 559
blow-up, 282
bob, 533
Index
Bode AR plot, 381
Bode Criterion, 379
Bode diagram, 372
Bode phase angle plot, 381
Boeings X-51A, 163
Bohlin rheometer, 538
Boltzmann equipartition energy theorem, 204
Boltzmann transformation, 94
Bone, 17, 546
bone-tooth complex, 547
Borealis, 45
bottom-up, 550
boundary condition, 199, 286
boundary layer, 160
Bourdon Tube, 539
bow shock, 166
Bowmans capsule, 488
Brain, 493
branched, 568
branched polymers, 176
branching distribution, 400
branchytherapy, 545
Bravais lattices, 553
Brayton cycle, 324
Brittleness, 394
BRNN, 560
broader variance, 174
Brookfield synchro-Lectric viscometer, 538
BS viscometer, 538
bubble(s), 78, 532
bubble viscometers, 538
bubbling, 421
buccal, 487
Buckmininster, 553
building up, 550
bulk mass transfer, 173
Bunsen solubility coefficient, 111
buoyancy, 88
butano, 302
Butchers method, 78, 89, 90
butterflies, 561
C
C1500, 549
C240, 549
C540, 549
C60, 549
C960, 549
calcite, 561
calixarene wheels, 557
Calixarenes, 557
Camera Drones, xx
cancel, 413
cancer(s), 538, 545
Cannon-Fenske viscometer, 538
cantilever, 569
Capillary viscometers, 538
capital cost(s), 66, 93
capital recovery factor, 66
capping, 539
carbohydrate, 563
carbon arc method, 549
carbon electrodes, 567
carbon foams, 567
carbon monoxide, 412
Carbon Nanotube, 553
carbon tetrachloride, 344
cardiovascular disease, 545
Carri-Med CS rheometer, 538
Cartesian Trajectory, 28
cause and effect, 420
Cause and Effect Diagram, 423
CCF, 421
CdTe, 190
Centralized Heating and Cooling, 15, 17
Centraves rheomat, 538
centrifugal governor, 323
centrifugal liquid-liquid separator, 126
centrifugal separation, 61, 132
centrifuge, 127
CFB technology, 99
chain branching, 394
chain transfer agent, 174, 400
Chan 35, 538
Chandra, 180
chaotic time series, 422
characteristic length, 162, 167
characteristic velocity, 159, 168
Chebyshev polynomial, 119, 203
Checksheet, 423
cheese whey, 302
chemical, 323
chemical changes, 183
chemical sensors, 527
chemical vapour deposition, 550
chemotherapy, 547
Chernobyl, 21
chlorination, 344
chloroform, 344
chloromethane, 344
choked flow, 163
Chromophores, 566
Citric Acid, 502
Clapeyron equation, 182
Classification, 417
579
580
Clausius inequality, 140, 258
clone analysis, 559
closed loop, 349
closed loop stability, 369
closed loop transfer, 341
closed-loop transfer function, 332
CMOS, 550
CNRs, 560
CNT(s), 191, 547
CO2, 414
CoAl2O4, 548
coal-fired boiler, 191
Coconut Oil, 62
collagen, 561
collision rules, 176
combinatorial entropy, 554
combined heat and power system, 323
combined statement, 184
Combustion Engineering, 99
combustion synthesis, 549
comparator, 414
compartment method, 488
complex roots, 505, 506
complex velocity, 537
Complexing curcumin, 566
composite heat transfer, 208
composition, 393
composition distribution, 174, 395
compositional heterogeneity, 174
compressibility, 181
compressible, 163
computer, 323
computer controlled, 565
computer memory, 567
computer science, 156, 574
Computer Simulation, xix, xx, 512, 573
computer solution, 132
Computer Vision, 4
computers, 323
concave upward, 265
concentric, 567
concrete, 191
Condensation Process, xx
condensed phase synthesis, 550
condenser, 418, 419, 451
condenser temperature, 418
condition number, 401
conductive, 162
conductive contribution, 102
conductive resistance, 162
conductivity, 528
cone and plate, 532
confocal scanning microscope, 539
Index
consecutive-competitive, 64
conservative force, 176
constancy, 420
constant drag coefficient, 82
constant rate delivery, 488
constant surface temperature, 202
constant volume, 261, 262, 401
constant wall temperature, 282, 374
constitutive equations, 201
Constraints, 23
constructive interference, 561
CONSYD, 401
contact time(s), 94, 104
Continuous Mass Polymerization, xx, 34, 49, 51, 53,
58, 225, 400
Continuous Process, 1, iii, 7, xix, 27, 54, 67, 249,
281
continuous valued, 417
control, 394
Control Chart, 423
control gain, 349
Control hardware, 400
control law, 325
control objective(s), 23, 393, 475
control theory, 156, 323, 394
control transfer functions, 341
control valves, 417
control volume, 273
Controlled stress rheometer, 538
Controller, 6, 16, 24, 27, 326, 329, 332, 334, 344,
358, 359, 360, 361, 362, 389, 477
controller transfer function, 325
convection, 125, 283
convective, 162
convective boundary condition, 290
convective contribution, 102
convective resitance, 162
convergent-divergent tube, 163
conversion, 268, 394
convex to concave, 70
convex upward, 265
convexo-concave curvature, 71
convolution property, 210
convolution theorem, 256, 257, 259, 301, 370
cooperativity parameter, 561
copolymer, xix, xx, 46, 51, 53, 56, 242, 476
copolymer composition, 149, 401
copolymer composition distribution, 174
copolymerization rate equations, 148, 150
copper, 181, 551
copra oils, 62
Corannulene, 549
coumarin, 557
Index
coupled equations, 397
coupling, 539
coupling efficiency, 539
Coutte viscometer, 533, 538
covariance, 397
covariance matrix, 397
CPFR, 393
creatinine, 488
creatinine phosphate, 488
creeping flow, 535
creeping heat transfer, 199
critical Reynolds number, 534
critical value, 132
critically damped, 255, 379
cross-links, 176
cross-over, 376
cross-over frequency, 379
cross-over point, 70
crosstalk, 539, 559
crude naptha, 307
crude oil reserves, 60
Crushing, 65
Cryogenic milling, 551
cryogenic temperature, 529
cryo-TEM, 568
CSP, 188
CSTR(s), 144, 261, 338
cubic curves, 76
cubic Zirconium Tungstate, 180
cuprous, 557
curcuma longa, 565
current-voltage characteristics, 192
curvilinear, 79, 93
curvilinear path, 75
cut-off, 379
cut-off radius, 177
cutting, 547
CVD, 567
CX type, 528
cyclodehydrogenations, 549
D
DAlamberts wave solution, 106
DAG-RNNs, 560
Damkholer number(s), 250, 252, 264, 265, 305, 337,
401
Damkohler number (dissociation), 269, 273
Damkohler number (monomer), 269, 273
Damkohler number (PFR), 277
damped wave conduction, 167, 173, 193, 374
Damped Wave Conduction and Relaxation Model,
211
damped wave conuction, 282

damped wave diffusion, 110
damped wave heat conduction, 340
damping coefficient, 250, 254, 255, 256, 260
damping component, 136
damping factor, 258, 286
damping ratio, 335
damping term, 195
Dankwerts boundary condition, 280
Darwinian, 558, 562
data acquisition, 27, 527, 539
database, 514
de Laval nozzles, 163
De Soto Solar Power Generation, 191
dead time, 395
decoding, 560
deep tanks, 86
Deep Water Horizon, 59, 126
defective, 423
degree of mixedness, 174
dehydration, 333
dehydrogenation, 307
delafossite structure, 187
delays, 416
Delta cells, 563
Demings principles, 420
demixing, 551
demographic, 540
Denavit-Hartenberg, 157
Denbigh scheme, 298
density, 97, 285
density functionality, 176
deposition, 528
depressed cubic, 505
deprotection, 539
dermatological, 562
dertivative time constant, 349
descend, 80
detectivity, 539, 559
devolatilizer, 31, 174
diabetes, 562
diagonal matrix, 150
diaminobenzene, 557
diamond, 553
difference equations, 396
differential equations, 416
differential volume, 276
diffusion limited, 110
diffusional speed, 168
difluorophenylene, 557
digital system, 395
diglycerides,, 68
dimensional, 539
581
582
Index
dimensionless frequency, 507

dimensionless time, 252
dimethylene dichloride, 344
diode chips, 529
Dip Pen lithography, 550
direct digial control, 395
direct write lithography, 551
disappearance, 282
discharge rate, 84
discrete update equations, 416
disks, 86
dissipative force, 176
dissolution rates, 513
distillation column(s), 307, 417
distribution, 487
Distributor, 54
distributor plate, 422
Disturbance(s), 16, 23, 218, 364, 394, 395, 421, 477,
542
diverge, 397
DNA computing, 555
DNA software, 555
dose, 490
doubly periodic flow, 132
downtime, 423
DPD simulation, 176
DPN, 569
DPR, 564
drag, 164
drag coefficient, 76
drag force, 177
Drawability, 394
drift velocity, 204
drilling, 547
Drones, 9, 10
droplet formation, 127
drops, 78
drug delivery, 538, 546
drug delivery systems, 282
Drugs, xiii, 310, 488, 515, 548, 560, 562, 565, 566
dry etching, 550
dumbbell, 557
DWNT, 568
dyad, 401
dye, 566
dye stream, 159
dynamic, 409
dynamic models, 394
Dynamic process models, 59
dynamic programming, 559
dynamic viscometer, 538
Dynamics, 1, iii, 7, xix, xx, 5, 28, 175, 182, 219,

220, 222, 223, 249, 253, 276, 312, 315, 323, 352,
573
E
E type, 528
Earth Quake, 31
effective diffusion coefficient, 111
effective film thickness, 169
Effective Thermal Conductivity, 573
effective thermal diffusivity, 104
efficient, 539
efflux time, 531
efflux viscometers, 531
Eigen values, 505
eigenvalues, 115, 300, 407
Eight roots, 506
Elastic modulus, 394
elastic scattering, 568
elasticity, 181
Elastomer, 394
elbow-down, 157
elbow-up, 157
Electrical, 323
electrical power, 395
electrical resistivity, 203
electrodeposition, 548, 551
electromagnetic shielding, 567
electron beam lithography, 550
electron field emission, 567
Electron gun, 568
electron microscopes, 547
electron microscopy, 395
electronic properties, 567
ellipsometry, 557
emission profiles, 61
emitted, 559
empirical correlations, 86
Empirical Models, 59
emulsion, 394
emulsion polymerization, 394
Enamel, 562
encapsulated, 548, 566
end effector, 563
end-effector, 157
endovascular, 564, 565
energy balance, 167, 249, 293, 401
ensemble, 179
enteral, 548
enthalpy, 108
entrance, 280
entropic difference model, 552
Index
entropy, 183
enzymes, 302
Epi-illumination, 539, 559
Epoxy, 181
equation of continuity, 128
equation of state, 176, 552
error, 324
error calculation, 415
error function solution, 98
Esterification, 50, 55, 56
estimation, 393
Estimation and Control, xx, 26, 478
estimator, 174, 418, 419
etching, 528, 550
ethanol, 493
ethyl benzene, 307, 469
ethylene glycol, 252
ethylene oxide, 252, 338
Eulers law, 549
Eulers Method, 514
EVA, 554
evaluation, 560
evaporative cooler, 106
Evolution, 558
excitation, 559
excretion, 487
exhaust flow, 163
exhaustion of oil fields, 60
exit age distribution, 549
exothermic, 249, 394
Experimental methods, 512
exponential, 394, 397
exponential distribution, 96
extended Kalman filter, 397
external tracking, 562
extra stage, 418
extraction of soot, 549
Extruder, 37
Exxon, 45, 50, 60, 126, 450, 452
Exxon Valdez, 126
F
f value lenses, 547
factor of absorption, 496
Factorial Design of Experiments, 423
Falling Regime, 125
falling rod viscometer, 532
falling spheres, 531
falling-needle viscometer, 532
FAME, fatty acid methyl esters, 61
Fann V-G, 538
fantastic voyage, 545
583
Fast Fourier transform, 93, 421

fast simulation, 179
faujasite, 180, 181
feasibility, 260
feather, 75
feces, 489
feed location, 128
feedback control, 7, 17, 19, 21, 24, 25, 31, 323, 327,
344, 351, 363, 364, 395, 414, 477, 485
feedforward, 401, 415
feedforward ANN controller, 418
feedrate, 418
fermentations;, 302
Ferranti-Shirley, 538
ferric chloride, 549
ferromagnetic, 555
FFA, free fatty acid, 62
Fick number, 122, 167
Ficks law of mass diffusion, 202
field flow fractionation, 395
field size, 539, 559
fifth stage, 418
film theory, 162
film thickness, 162
filter parameters, 410
Filtered, 396
filtering, 174, 379
final condition, 139
final value theorem, 328
finger pad, 133
finger tip, 156
finite length of packet, 97
finite speed conduction, 97
fire truck, 153
fire-fighting, 153
first order, 341
first order filter, 408
first zero, 122
first-order lags, 401
fish-bone diagrams, 420
Flame control, 549
flat, 539
flocculate, 84
flocking, 562
flow sensors, 527
flow toward, 100
FlowAway, 99
Flowchart, 423
flue to air, 414
fluid, 323
fluid friction, 86
Fluidized Bed, 54, 99, 219, 221, 222, 224, 225, 227,
228, 229, 307, 478, 573
584
Index
fluidized bed heat transfer, 282

fluidized beds, 93
fluorescent destran beads, 110
fluorescent probes, 558
Fokker-planck equation, 179
Football, 76
force, 528
forecast, 63
Form, 76
forward algorithm, 560
forward kinematics, 156
Foster Wheeler, 99
four simultaneous equations, 130
Fourier Conduction, 97
Fourier model, 211
Fourier number, 167
Fourier parabolic model, 284, 290
Fourier part, 206
Fourier representation, 340
Fourier transformation, 568
Fouriers law of heat conduction, 202
fourth Order Runge-Kutta, 294, 403
fourth regime, 120, 123
fraction of dose, 490
fractional conversion, 252, 253
fractionation time, 395
free electron cloud, 203
free electrons, 202
free energy, 183, 552
free radical polymerization(s), 28, 144, 250, 556
free radical species, 145
frequency, 94, 291, 372
frequency domain, 421
frequency number, 93
frictional force, 204
fructose, 302
fuel cells, 567
fuel efficiency, 420
full spectrum solar cell, 190
fullerenes, 549, 566
Fumaric Acid, 502
G
gain margin, 380
gains, 416
galvanic fabrication, 550
gamma exposure, 529
gas chromotograph, 401
Gas Convection, 97
gas gap, 97
Gas Phase Polymerization Process, 43
Gas turbine, 324
gas-solid fluidized beds, 421

gastric, 487
gastric secretion, 563
gastrointestinal tract, 514, 548
Gaussian disturbance, 397
gear box, 261
gel effect, 307
gel electrophoresis, 282
Geldart A, 422
Geldart B, 422
Geldart C, 422
Geldart D, 422
Gene expression, 538
gene profiling, 538
generalized Bessel equation, 121, 198
generalized Bessel function, 115
generalized Ficks law, 171
generalized Ficks law of diffusion, 84
generalized suffix tree, 560
Generic algorithms, 562
geometric object, 77
geometries, 282
Geophysical formation, 563
germination, 547
germs, 546
Gibbs-Boltzmann distribution, 179
Giga magnetic hardrives, 548
GISAXS, 568
glass transition, 552
Glaucoma, 540
global alignment, 559
Global warming, 60
Glomerular filtration, 488
glomerulus, 488
glucagen, 563
glucagons, 563
glucose, 302
Glycol Recovery, 56
glycolic acid, 546
Gold distribution, 393
governing equation(s), 90, 253
graft chains, 393
graft copolymer, 174
grafting, 261
graphene, 567
graphene nanoplatelets, 337
Graphics, 513
graphite, 553
Graphite Fiber Composites, 187
greater speed, 565
growth time, 564
guess, 398
Guiner approximation, 568
Index
Gulf War Oil Spill, 126
Gusher, 126
gyroscope, 557
H
Haake Buchler, 538
half live, 261
half-live(s), 261, 271
Halfnium Tungstate, 187
half-width, 162, 285
Hamiltonian, 179
Hamiltonian path, 556
hammer, 75
Hardness, 394
harmonic wave, 280
HCSTR, 393
head, 545
heat capacity, 97, 285, 413
Heat capacity, 206
Heat Exchanger, 66, 67
heat flux, 98
heat of reactions, 413
heat removal, 394
heat resistance, 174
heat source, 141
heat transfer coefficient(s), 93, 285
Heaviside expansion, 101, 258, 341
heavy component, 419
HeIM, 569
helacine stator, 557
helical coil, 564
helical ribbon agitator(s), 174, 225, 261
helium ion microscope(s), 568
hemoglobin molecule, 111
Hercules viscometer, 538
herding, 562
hermoelectric, 528
Heteroassociation, 417
Hewlett Packard Compaq Elite 8300, 70
hexagons, 549
Hexamethylene Diamine, 54
Hexane, 470, 481
hidden layers, 419
high concentration of oxygen, 113
HIPCO, 567
HIPS, 262
Histogram, 423
Hitachi, 41, 42, 57, 58
HMMs, 560
Hoeppler, 532
homogeneous, 287
homogeneous transform, 157
585
Homopolymer, 46
Honey, 181
horizontal reactor, 564
hot embossing, 550
HRTEM, 568
Hubble, 180
human skin, 141
humidification operations, 106
humidity, 528
HVAC, 14
hydrodynamic chromatography, 395
hydrodynamic regimes, 421
hydrogen bonds, 558
hydrolysis, 252, 338
Hydroxyapetite, 561
hyperbolic, 100, 119
hyperbolic damped wave conduction, 290
hyperbolic PDE, 202
hypercube, 417
hypersonic, 166
hypersonic flow, 164
hypoxia, 110, 126
I
icosahedra, 549
ideal fluid, 160
ideal gas, 79
ignocellulosics, 302
image geometry, 539, 559
IMC, 410
immersed surfaces, 93
impact strength, 174, 394
implantable, 563
Implantable devices, 546
implicit, 90
improvement, 420
in state space, 294
in vivo, 513
Inclined Tube, 539
incompressible flow, 262
induction period, 303
Industrial Controls Market, 27
inert, 539
inertia forces, 159
inertial lag time, 126, 203
Inertial Regime, 123
Infinite Series, 103
infinite space, 95
infinite speed of propagation, 202
infinite storage number, 292
Information handling systems, 193
infrared, 527
586
infusion Michaelis-Menten, 499
inhalation, 488
inhibitor, 401
initation, 262
initial accumulation, 251
initial condition(s), 275, 285, 420
initiator, 174, 261
initiator I2, 273
ink jet printing, 539
InP nanowhiskers, 564
input neurons, 419
input variable, 253, 370
input/output system, 514
instability, 348
instantaneous, 96
instrumented, 527
insulin, 109, 563
integral time, 336
integral time constant, 349
integrating system, 144
integrating unstable,, 249
Intel Core i7 processor, 70
interacting particles, 178
interaction parameter(s), 176, 553, 554
Interconnections, 415
interfacial area, 337, 565
interfacial tension, 176
interlayer thickness ratio,, 132
intermediate product, 347
Internal Model Control, 25, 29, 402, 411, 477, 486
internal quantum efficiency, 189
intracellular, 562
intradermal, 487
Intramolecular repulsions, 553
intramuscular therapy, 487
Intra-ocular pressure, 540
intraocular route, 488
intrarteria, 488
intrathecal, 488
inverse dynamic programming, 559
inverse dynamics, 418
inverse heat transfer, 340
Inverse Kinematics, 28, 15, 157
inverse response, 249, 401, 410
Inversion, 409
iridescence, 561
Iridium oxide, 550
Iron, 181
iron age, 60
Irvine-Park, 532
isentropic, 163, 182
isentropic compressibility, 180
isentropic expansivity, 188
Index
isentropic volume expansivity, 186
islets of Langerhans, 109, 563
Isocitric Acid, 502
isometric particles, 86
iso-propylene, 307
isothermal compressibility, 180
iterative, 397
Itrathecal route, 566
IV therapy, 487
Ixtoc I,, 126
J
J type, 528
jacket, 293
jacket temperature, 402
jacketed, 249
Jacobian, 4
jatorpa crop, 62
Javelin Throw, 76
jets, 539
job satisfaction, 423
joint angles, 156, 157
jump, 123
junction, 528
K
K matrix, 506
K type, 528
Kalman filter(s), 393 564
Kalman gain, 398
KCN, 557
Keeler Dorr-Oliver, 99
kettle type reboiler, 418
Kinematics, xv, 5, 28, 156
kinesins, 557
kinetic theory of gases, 202
KINETICATM, 514
Kinetics, xx, 113, 114, 143, 302, 304, 306, 493, 498,
501, 518, 524
Kirchoffs law, 323
knowledge acquisition, 415
Krauses end bulb, 133
L
lactic acid, 546
lag phase, 489
lag property, 209
lag time, 197
lags, 400
Index
Lakeview Gusher, 126
lamellar stretch model, 174
laminar, 85
laminar boundary layer, 160
laminar flow, 159
laminar regime, 132
Langmuir-Blodgett, 556
Laplace transforms, 70, 99, 209
large relaxation time, 286
Large Relaxation Time Values, 141
laser ablation, 552, 567
Laser vaporization, 567
lasers, 547
Lattice Defects, 529
launch angle , 153
launch angle of 380, 76
launch angles, 155
launch velocity, 79
law of cosines, 158
law of kinematics, 154
layer thickness ratio, 130
Layered, 415
layered flow, 127
LCST, 552
Leaning tower of Pisa, 75
Lear, 9
learning, 417, 560
least squares, 402
left hand limit, 251
less oscillatory, 349
level, 528
liberation, 487
lift coefficient, 165
lift force, 164
light absorbtion, 189
light component, 420
light scattering, 395
light trapping, 189
lignite, 61
Li-ion battery, 547
linearization, 398
Linker molecules, 539
lithography, 528
Lithography, 550
local alignment, 559
Locomotion, 4
logistic function, 416
log-log plot, 131
Lorenz analogy, 204
Louisville operator, 179
low concentration of oxygen, 113
lycaenid, 561
587
M
m controls, 395
Mac Michael viscometer, 538
Mach 5, 163
Mach number, 163
machined sensors, 527
macroscopic, 176
macular degeneration, 546
Magnetic pigment, 561
magnetic sensors, 527
magnetite memory storage, 561
Magnification, 569
Magnum ABS, 37, 38
Magnus effect, 83
Maleic Acid, 502
malignant, 547
manganese, 84
Manipulator, 4, 20, 28, 156, 157
Manufacturing Cost, 67
Marangoni instability, 132, 553
Marginally, 142
Mason-Weaver equation, 84
mass balance, 167, 249, 498
mass diffusion velocity, 168
mass inertia, 122
mass inspection, 421
mass spectrometry, 488
mass transfer coefficient, 170
mathematical artifact, 258
Mathematical models, 59
matrix, 174
matrix equation, 152
matrix form, 148
Max-Clique, 556
maxima, 252, 292, 401
maximum, 271
maximum convective heat transfer, 99
maximum height, 80, 154, 155
Maxwell number, 122, 172
Maxwell relation, 184
Maxwellian distribution, 104
McCabe and Thiele, 417
mean, 397
mechanical, 323
mechanical expelling, 63
Mechanical manipulation, 4, 156
mechanical microspotting, 539
Mechanical strength, 394
mechanical surgeons, 545
mechanics, 156
Mechanistic Models, 59
Melt index, 395
588
Melt viscosity, 394
membrane, 561
MEMS, 530, 540
mercaptus bone, 560
mesocopic simulation, 175
mesophases, 176
mesoporous, 551
mesoscale conduction, 105
mesoscopic, 60, 176
metabolic process, 110
metabolism, 487
metabolism of drug, 488
metal-organic vapor phase epitaxy, 564
metastable, 552
Metathesis, 556
methacrylonitrile, 151, 307
method of Eigenvectors, 149
method of residues, 105
method of superposition, 265
methyl methacrylate, 271, 400
Metrovib MVA Mach I, 538
MFM, 569
micelles, 176, 568
Michaelis and Menten, 302
Michaelis constant, 111, 302
Michaelis-Menten, 488
Michaelis-Menten kinetics, 111
Microarray, 558
microarray detection, 539
microbes, 303
microelectrode, 110
Microemulsions, 63
microgravity, 78
microrobot, 555
microscopic, 538
microscopic reversibility, 282
microscopic temperature, 204
microscopic theory, 202
Microsoft Excel 2010 for Windows, 70
Microsoft Excel Spreadsheet, 141
microturbines, 324
microwave cavity, 530
microwave output, 564
Microwave sensors, 529
microwave spin transfer, 564
Miller direction, 564
milliseconds, 334
mineral oil, 174
minima, 298
MINVERSE, 130
miscibility, 554
Miscible Blends, 572
Mitsubishi, 9, 49, 58, 441
Index
mixedness, 174
mixing, 394
mixing tank, 293, 402
mixing times, 174, 261
mixture thermodynamics, 554
Mn, 395
model based controller, 408
Model controller, 410
model equations, 268
modified Bessel, 120
modified Bessel function, 104
modified rate matrix, 151
molding, 547
molecular actuators, 557
molecular assemblers, 6, 28, 547
molecular beam epitaxy, 550
molecular compass, 557
molecular electronics, 555
Molecular muscle, 557
molecular parameters, 395
Molecular Recognition, 558
Molecular rotors, 557
molecular shuttles, 557
molecular sieve, 337
Molecular switches, 557
Molecular valves, 557
molecular weight distribution, 261, 393
molecular weights, 554
molten salts, 191
moment of inertia, 536
moments, 395
momentum balance, 87, 167, 535
momentum diffusion, 176
momentum transfer, 87, 160
Monod, 303
Monod constant, 303
monoglycerides, 68
mononoclinic Sellenium, 180
monosaccharides, 302
Monsanto Plastics, xvii, 30, 34
Monte Carlo, 60
Mooney shearing disk viscometer, 538
more proper, 408
morphology, 551
Motors, 13, 15, 420, 547
MQ-9 Reaper, 10
MRAM, 564
MS Excel, 502
MS Excel 2007, 86, 249, 265, 267, 271, 275
MS Excel for Windows, 158
MS Excel spreadsheet, 294
MS Excel Spreadsheet 2007, 294, 403
multi-compartment, 514
Index
multi-component copolymer, 150
multi-component copolymerization, 144
multi-functionality, 562
multiple steady state(s), 400, 402
multiple-slide normalization, 539
Multiplicites, 249
multiplicitie, 270
multiplicity, 158, 265, 275, 323
Multiplicity, 153, 157, 304
Multivariable Process Control, 26
Multivariate, 394
Multizone Process, 39
Muscle, 17, 431
Mw, 395
MWD, 394
MWNT, 567
N
n comonomers, 150
n states, 395
N type, 528
Nametre rotary B rotational viscometer, 538
nanites, 545
nanoarrays, 538
nanobiosensor, 552
nanobolometer, 552
nanobots, 545
Nanocapsules, 548
nanocomposite, 79, 547
nanocomputers, 555
Nanocrystal, 564
nanocubes, 549
nanocylinders, 549
nanodevices, 562
Nanodrugs, 548
nanoethics, 548
nanofabrication, 556
nanofilaments, 549
nanofilm, 568
Nanofluids, 551
nanograins, 549
nanoids, 545
nanoimprint lithography, 550
nanolamella(e), 550, 551
nanomachines, 545, 555
nanomedicine, 545
nanoparticles, 190, 546, 547, 550
nano-peapod, 568
Nanopeapods, 548
nanopores, 548, 550, 551
Nanoporous, 547
nanopowders, 552
nanoprisms, 550
Nanoprobes, 552
nano-ribbon, 568
Nanorobot Drug Delivery, 30, 565
nanorobots, 562
nanorods, 549, 550
nano-rope, 568
Nanoscale effects, 203
Nanoscale oscillator, 564
nanoscale systems, 282
nanoscopic, 560
nanoscrystals, 549
nano-sheet, 568
nanosheets, 549
Nanoshells, 548
nanosphere(s), 551, 552
nanostructures, 548
nanotechnology, 528, 547
nanotetrapods, 549
Nanotips, 550
nanotrenches, 550
nanotubes, 552
nanotunnel, 550
nanovalves, 557
nanovoids, 550
Nanowhiskers, 564
nanowires, 548, 549, 568
naphthalene, 549
narrow slit, 535
natural frequency, 536
neck, 545
necrosis, 110
Negative temperatures, 185
negative thermal expansion, 187
NEHW, 563
nephron, 488
nerve cells, 562
Netwons law of cooling, 202
networks, 176
neural controller, 417, 418
neural estimator, 417, 420
neural network(s), 26, 415, 478, 560
neurons, 415
neutron fluencies, 529
Newton number, 167
Newton and Raphson, 158
Newton Raphson, 265
Newtons law of viscosity, 201, 202
NFOM, 569
Nickel-Chromium, 529, 530
NMR, 395
noise, 174, 179
noise process, 397
589
590
Index
nominally stable, 379

non-compartment method, 488
Non-contact, 539
non-Fourier equation, 99
non-invasive, 565
nonlinear, 393, 395, 512
non-linear, 270, 323, 395
non-linear estimation, 397
nonlinear state estimation, 400
Norcross viscometers, 538
normalization, 559
NP complete, 556
nuclear power plant, 21, 59, 153, 154
Nuclear spin, 185
nucleate, 552
nucleic acids, 558
number of units, 416
numerical integration, 90
Nusselt number, 162
Nutrasweet, 302
N-wave, 164
Nylon 6,6, xx, 54, 181
Nylon balls, 531
Nyquist diagram, 373
O
Obesity, 563
oblique shock, 166
observable, 396
o-chlorostryene-p-cholorostryene, 554
ODE, 95, 139
OECD, 63
of n monomers, 150
of second order absorption, 497
offet, 329
offset, 328
Ohms law of electricity, 202
oil rich, 127
Oil spills, 126
oil wells, 340
Oligoarenes, 549
oligonucleotides, 539
oligothiopene, 190
on-line, 395, 397
on-line SEC, 395
On-off, 323
Open Interval, 123
Optical microscopes, 568
optimal operation, 64
Optimal target concentration, 539
optimal trajectories, 400
optimal working temperature, 193
optimization, 400
order reduction is, 93
ordinary differential equations, 149
Organic Synthesis, 556
orthogonality, 118
oscillations, 140
oscillator, 530
oscillatory, 153, 256
oscillatory discharge, 282
Osphronemus gorami, 110
osteoblast, 561
osteoclastic, 561
Ostwald viscometer, 538
Output, 16, 23, 25, 143, 256, 257, 260, 275, 281,
369, 384, 385, 411
output neurons, 419
output response, 256, 258, 260, 281, 328, 335
output variable, 253, 254, 370
overall coefficient, 106
overall elimination rate constant, 491
overall rate constant, 489, 491
overall transfer coefficient, 161
overdamped, 254, 379
overflow rate, 85
overshoot, 126, 194, 250, 251, 282, 331, 379
Oxalic Acid, 502
oxidation, 539
oxirane, 252
oxygen permeability, 110
P
P control, 402
P only Control, 353, 357, 388
packed bed, 337, 412
packed column, 337
packet theory, 94
Pade approximation, 369, 412
PAH, 561
PAM, 559
pancreas, 109, 563
pantograph, 547
Paracrine, 563
parallel channels, 159
parallel disk compression viscometer, 535
parameter estimation, 396
parameters, 270, 369
Parenteral, 548
Pareto Chart, 423
partial condenser, 418
Partially Stabilized ZrO2, 181
particle diffusion, 176
patient compliance, 514
Index
pattern formation, 551
pattern recognition, 415
PCR, 556
PD Control, 341, 342, 352, 353, 362, 384, 385, 390,
402
PDE, 94
peat, 61
Peclet number, 100, 173
Peclet, 104
Peltier effect, 528
PEMA, 554
penalty, 559
penetration distance, 167, 212
penetration length, 203
penicillin, 302
pentagons, 549
Pentium IV, 201, 547
percutaneous, 487
perfect control, 408
perfectly mixed, 261
perfusion, 488
periodic, 422
periodic solutions, 148
periodic wave, 379
peripheral layer, 127
peripheral tissue, 510
permanent magnet, 564
permeability, 112, 513
permeability of capillary, 488
petroleum, 61
PFR, 65, 395
pH, 528
phagocytosis, 561
pharmacokinetic equations, 513
Pharmacokinetic model, 566
Pharmacokinetics, 487
phase angle, 372
phase characteristics, 379
Phase Inversion, 421
phase shift, 371
phase-separated, 554
PHD server, 560
phenylamine, 302
pheromones, 560
philosophy, 420
phosgene, 557
photodiod(es), 192, 569
photodynamic, 566
photoelectric, 547
photolithography, 539
photometers, 395
photovoltaic, 191
photovoltaic efficiency, 189
photovoltaics, 567
phylogenetic tree, 559
Physica rotational viscometer, 538
physical changes, 183
physically realizable, 282, 408
physiological, 513
Physiological pharmacokinetic, 513
physiologic-based simulation, 514
PI control, 338, 339, 402
PID control, 402
piezoelectric, 539, 565
piezoresistive, 540
pin, 546
pinned magnetic structure, 564
pins, 539
pitching moment, 165
PK tool, 514
planar, 538, 539
Plancks theorem, 192
Plan-Do-Check, 420
plant start-up, 249
plasma, 501, 567
Plasma compaction, 551
Plastics, xvii, 39, 573, 574
plastometers, 538
plateau, 93
PLC, 14, 27
plug flow reactor, 260, 276
PMF, 561
PMMA, 554
pneumatic, 323
poisoning, 303
Poisson, 393
poles, 102
Polyamide, xx, 53
Polybutadiene, 36, 37, 42
Polydiacetylene Crystal, 187
Polyester, 57
Polyethylene, 31, 181
Polyglycolide, 52
Polyion, 561
polymer blends, 551
Polymer brush, 551
polymer/biopolymer, 561
polymeric valves, 557
polymerization of fullerene, 566
Polymerization reactions, 261
polynomial degree, 149
polynomial equation, 298, 408, 506
Polypropylene, 45, 46, 48, 50, 261
polyrate, 267, 271
Polystyrene, xx, 29, 33, 40, 56, 58, 181, 554
population pharmacokinetic, 488
591
592
Porads law, 568
porosity, 394
posotional control, 548
potential flow, 160
power draw, 127, 261
PPO, 554
practically realizable, 156
Prandtl-Galuert singularity, 164
precise, 527
precursor, 568
preformed rubber, 174
Prepolymerization, 56
Present worth, 191
pressure, 528
pressure controller, 324
pressure drop, 87, 92
pressure fluctuations, 96, 421
pressure transmitter(s), 324, 395
pressurized water, 191
price tag, 421
primary zone, 549
printed circuit board, 193
probability distribution, 416
probe duplex, 539
probes, 527
Process Dynamics, ix, 27
process gain, 253, 254, 327, 370, 376
processability, 174
Product Ditribution, 72
product price, 514
production capacity, 549
production rate, 400
Progressive Methanolysis, 71
projected area, 76
projectile motion, 75, 153
propagating species, 261
propagation, 262
proper, 400
proportional controller, 327
proportional derivative, 336
proportional integral, 329, 340
Prostate, 545
protein classification, 559
protein folding, 559
proteins, 568
prototypical first order process, 253
protozoa, 302
pseudo-stationary, 86
pseudo-steady state, 263
pulse layered deposition, 551
pumping costs, 93
Purity levels, 549
PW, Present Worth, 1, 28, 448
Index
pyrolysis, 62
pyrolyzed, 568
Pyropower, 99
Q
QIT, 420
QSSA, 150
quadratic, 254
quadratic equation, 306
quality, 400, 420, 423
Quantum dots, 549, 550, 569
quartz glass, 180
quasi-steady state assumption, 145, 149, 397
quenching, 552
R
R1, 273
R2, 273
radial basis functions, 417
Radiation Heating, 529
radio frequency, 563
radius of gyration, 554
Raleigh criterion, 568
Raman microscopes, 569
random, 394
random force, 176, 177
range, 80
Rank pulse shearometer, 538
RAPID, 4
rapid bolus, 488
Rapid Thermal Processing, 190
Rapseed Oil;, 62
raster scan, 568
rate coefficient, 263
rate matrix, 151, 300
rate of polymerization, 264
rate of reactions, 268
ratio control, 25, 412
ratio of relaxation times, 287
raw materials, 65
Ray Mabus, 61
Rayleigh criterion, 547
Rayleigh regime, 132
RBI, 569
reachable, 396
reactangular, 85
reaction engineering, 249
reaction speed, 252, 277
reactions in circle, 502
reactions in series, 143
Index
reactive ion etching, 550
reactivity ratios, 149, 152, 400
reactor syrups, 394
reactor temperature, 549
reading, 527
reaggregate, 562
realizable, 409
reboiler, 418
recipe, 400
rectilinear, 79, 93
recurrence relations, 78
recurrent, 415
recurrent architecture, 415
recursive least squares, 418
recycle, 400
red light photons, 190
redwood, 531
reference, 16, 187, 431
reflection, 157
refractometers, 402
regeneration, 561
regularity detection, 417
relative motion, 88
relativistic coordinate transformation, 99
relativistic transformation, 119, 203
relaxation number, 105
relaxation time, 168, 173, 190
relaxational rate, 173
relaxational speed, 208
Relaxational Transfer, 125
relaxational/ballistic, 168
reliability, 420
renal extraction, 488
renewable energy, 61, 66
repulsion parameters, 179
research rocket, 163
residence time, 84, 130, , 227, 252, 261, 269, 270,
273, 276, 397, 549
residue theorem, 101
resitance temperature detectors, 529
resolution, 527, 539, 559, 568
resonant peak, 379
respiration, 489
retail price, xix
retrofit, 65
reversible nanovalves, 557
reversible reactions, 394
Reynolds number, 76, 159
rheometers, 538
Rhombohedral, 561
ribosomes, 548
right hand limit,, 251
right skew, 502
593
rise velocity, 532

Rising Regime, 125
RLS algorithm, 418
Robo-roo, 9
Robot, 6, 21, 27
robot arm, 156
Robotic Institute Association, 3
robotic manipulators, 323
robust, 369, 396
rolling ball viscometer, 536
roll-printing, 190
ROMP, 551
root mean square velocity, 104, 187
rotating tub, 333
rotational motion, 538
rotaxane, 557
rotor speed, 64, 131, 332
rotor, 126
rounded leading edge, 165
Routh array, 347
Ruffinis ending, 133
Runaway Reaction, 11, 27
Runge Kutta fourth order, 249, 275
Runge-Kutta, 267
Runge-Kutta 2, 514
Runge-Kutta 4, 514
Runge-Kutta method, 250
S
saddle point, 249
SAN, Styrene Acrylonitrile Copolymer, xx, 262, 554
Sandestin principle, 61
Saponification, 62
SAR/QSAR, 513
saturation concentration, 337
saw-tooth, 507
SAXS, 548, 568
Saybolt, 531
scaffolds, 546
scale-up, 59
scanning electron microscope, 568
scanning probe microscope, 568
scanning tunnelling microscopy, 557
Scatter Plot, 423
Schiotz/plunger, 540
Schmidt number, 161
Schott Glass, 180
Schulz-Flory, 393
scrap, 423
screw device, 538
SCSTR, 393
SEC, 395
594
SEC light scattering, 395
Second Law, 126
second law of thermodynamics, 180, 203, 251, 557
second order, 250, 254, 260, 379
second order differential equation, 287
second order filter, 410
secondary processes, 489
secondary structure, 559
Sedimentation, 84
sedimenting, 86
Seebeck effect, 528
Segregated, 393
selectivity, 566
selectivity of the FAME, 70
Self Assembled Monolayers, 550, 556
self-assembly, 551, 561
Self-fabrication, 558
self-organize, 556
Self-organizing, 563
self-oscillations, 323
self-replicating, 548
SEM, 548
semiconductor, 363, 540
Semi-empirical models, 59, 93
semi-infinite medium, 202, 207
semi-log, 372
sensitivity, 529, 539, 559
sensors, 323, 527
Sensors, xx, 9, 23, 27, 28, 430, 431, 527, 528, 529,
541
separation efficiency, 91, 127, 131
separation of variables, 115, 139, 270
Sequence alignment, 559
sequence distribution, 393
SERS, 569
set point, 23, 324
Set Point,
Shaft Horizontal Reactor, 53
Sharma number, 172, 173
Sharma Number (Mass), 122
sharper fall, 93
shear rate, 128, 174
shear stress, 88
Shell, ix, xix, 43, 50, 57, 59, 60, 126
Shell Balance, 59
Sherwood number, 112, 122, 172
short, 549
short time limit, 102
shot gun sequencing, 559
Showa Denko, 45
shut down, 249, 324, 402
side effects, 565
sidestream, 418
Index
Sigma-Pi, 415
sigmoid, 419
sigmoidal, 303
sigmoidal growth, 63
sigmoidal manner, 265
Signal, 422, 574
silica, 104
silica/alumina, 62
Silicalite-1, 187
Silicon, 181
silicon chips, 555, 558
Simulation, 59, 131
simulation engine, 514
simultaneous reaction and diffusion, 110
single compartment model, 490
Single Molecule Analytical, 556
Singularities, 4, 202
Sinopec, 45
sinuous, 159
Sinusoidal oscillations, 536
sinusoidally, 418
Skin, 17, 134, 135, 140, 141
sliding-plate viscometer, 532
Slow absorption, 488
sludge, 84
sludge zone, 88
slugging, 421
Smalley-fingers, 548
Smart materials, 561
SMT, 564
Soda-Lime Glass, 181
sodium hydroxide, 66
sodium methylate, 61
sodium zirconium phosphate, 180
soft condensed matter, 176
Softening temperature, 394
softlithographic, 556
sol gel, 550
solanezumab, 565
solar cells, 548
solar heaters, 191
solar power plants, 192
Solar Thermal Power, 191
soldering, 547
solid circulation flux, 104
solid colloid, 552
solid propellant, 282
solubility, 513
Solution Copolymerization, 55, 477
Solvation, 557
Solvent, 13, 67, 471, 472
somatostatin, 563
soot deposits, 549
Index
Soybean oil, 62
space conditions, 283, 536
Space shuttle, 164
sparse tables, 559
spatio-temporal, 197
SPC, 420
SPC charts, 174
SPC, Statistical Process Control, 420
species A, 301
species B, 301
species R, 301
species S, 301
species T, 302
specific, 538
speed of light, 282
speed of sound, 182
speed of the fluid, 252
spherical, 548
spherical shell, 194
Sphericities, 86
sphericity, 532
Spheripol Process, 46
Spherizone Process, 50
spherulite, 561
spills, 60
deepwater horizon oil spill, 60
Exxon Valdez, 60
pipeline in Russia, 60
Spin coating, 551
spinal surgery, 545
spinless electron, 212, 217
spinless golf ball, 77
spinning screws, 555
spinodal nucleation, 552
spiral response, 249
splanchnic circulation, 488, 548
Spline, 28
sprayed, 106
spring constant, 536
Sputtering, 550
square matrix, 150
stability, 143, 144, 153, 328, 347, 555
stability analysis, 148
stability criteria, 347
stabilized, 568
Stabiner viscometer, 533
stable, 142, 249, 552
stable dispersion, 554
Stainless Steel, 181
staircase tables, 559
stamping, 547
starch slurry, 302
start-ups, 402
595
state space, 395

state space form, 64
state space model, 143, 250
State Space Representation, 144
state-model, 396
static controller, 409
static formation temperature, 340
Static Mixer, 51
stationary period, 303
Statistical normalization, 539
steady state, 265, 274
steam jacket, 418
steel ball bearings, 531
STELLA, 514
step change, 254
stereochemical, 556
stereochemistry, 558
Stereo-regularity, 394
Steric, 557
sticky fingers, 548
STM, 569
stochastic, 178
stochastic differential equation, 398
Stochastic simulations, 552
Stokes regime, 77
Stokes settling, 127
Stokes-Einstein, 194
stone age, 60
storage coeffient, 173
storage number, 251, 284
storage unit, 564
Stormer viscometer, 538
strain, 528
strain gauges, 540
Stress-crack resistance, 394
String algorithms, 560
structural properties, 395
Structure property, 396
structure-activity, 513
styrene, 267, 307
Styrene, xx, 13, 30, 33, 51, 52, 53, 56, 58, 151, 224,
246, 469, 518, 519, 520, 552
styryl radical, 261
subcritical damped, 506
subcritical damped oscillations, 141, 142, 203, 504
subcutaneous, 487
sublingual, 487
submarine, 545
subsonic, 166
substitution, V = u/X, 195
substrate, 527
subsystem 1, 396
subsystem 2, 396
596
Index
Succinic Acid, 502

Succyl Coenzyme A, 502
suffix tree, 560
sugar cane, 63
Sun flower oil, 62
supeficial speed, 277
super capacitors, 567
superabsorbing, 189
supercomputer, 552
Supercomputer based models, 59
supercritical ethanol, 549
superposition, 125, 539
supersequence, 559
supersonic, 163
supersonic aerodynamics, 163
Supersonic fracture, 164
Supervised, 417
Supply Chain Robotics, xx, 28
surface area, 394
surface gloss, 174
surface instability, 551
Surface Mediated Growth, 567
Surface roughness, 563
surface tension, 132, 535, 552
survey, 420
Suspension, 394
Sustainable Engineering, 60
SWAXS, 568
sweat, 489
sweeteners, 302
SWNT, 567
symmetrical, 504
synapses, 415
synthesized, 549
T
t statistics, 539, 559
T type, 528
Taitel paradox, 250
Taiwan, 66
Tallow, 66
tangential shear, 87
target, 559
targeted therapy, 565
Taylor series, 374, 499
Taylor vortices, 132, 535
TBPO, 267, 271
TBPOND, 271
TBPP, 271
Tear strength, 394
Tellerium, 180
Tellurium, 22
temperature of the sun, 192

temperature transmitter, 324
Tennessee Valley Authority, 99
tensile strength, 174
terminal settling velocity, 77, 531
termination, 262
Terpolymer(s), 31, 46, 144, 246
tetracationic cyclophane, 557
tetrapolymer(s), 144, 151
tetrapolymerization, 144
the 5 constant correlation, 79
the laws of resistance, 159
the loop of Henle, 488
the mass transfer coefficient, 112
The multicomponent copolymerization rate
constants, 148
thermal, 323
thermal conductivity, 97, 205
thermal diffusion rate, 160
thermal diffusivity, 94, 167
thermal expansion coefficient, 180
Thermal Initiation, 261, 262
thermal mass, 97, 173
thermal polymerization, xx, 30, 250
thermal wear, 133
Thermistors, 529
Thermocouples, 528
thermreversible, 561
thiele modulus, 117
thin film solar cells, 189
thin films, 190, 531
third derivative, 500
third order, 201, 261
third regime, 197
three compartment models, 510
three component, 417
three letters, 547
threshold, 416
threshold dosing, 513
throughput, 539, 559
time condition, 512
time constant(s), 253, 254, 370, 409, 416, 528
time shift property, 301
tip shear rate, 261
tomographic record, 541
tomographs, 540
top pressure, 327
top-down, 550
torque, 15, 131, 132, 333, 532, 541
torque controller, 333
torsion, 536
torsional oscillatory viscometer, 536
Trace, 149
Index
tractable, 397
Trade-offs, 93
trailing edge, 165
Training pairs, 418
Trajectory Generation, 28
trancedental, 498
trancedental equation, 118, 304
Transesterification, 61
transient conversion, 271, 280
Transient Study, 27
transition, 85
transition matrix, 397
transmission electron microscope, 568
transmitters, 563
Transmutation, 529
transonic, 166
transplanted, 109
transport cells, 557
transport mechanism, 513
trauma, 562
travelling waves, 132
trial and error, 79
Triglyceride, 61
trimethylindium, 564
triphenylureidocalixarene, 557
triple products, 505
tropomyosin, 561
tryptycene, 557
tube, 99
tube banks, 106
tubular, 548
Tubular Reactor, 30, 52
tung oil, 62
tuning parameter(s), 329, 408
Turbulent Bed, 421
turbulent flow, 85, 159
Tuyreus-Luben, 402
two components, 154
two dimensions, 85
Two initiators, 271
two regimes, 197
two time, 283
two-compartment model, 510
Type A, 488
Type B, 488, 489
Type C, 488
Type I diabetes, 125
Type II diabetes, 563
Tyreus-Luyben, 349
U
U tube, 539
597
Ubbelohole viscometer, 538

UCST, 552
ultrafast laser heating, 282
ultrafiltration, 395
ultraviole, 190
uncertainities, 369, 410
undamped, 256
underdamped, 258, 260, 323, 335, 336, 340, 342,
344, 379
underdamped oscillatory, 249
uniform, 539
uniform distribution, 104
uniformity, 423, 539, 559
Universal Robot, 9
unstable, 142, 323, 407, 552
unstable system, 153
Unsupervised, 417
untethered, 564
upper critical, 159
usable form, 499
using nuclear probes, 395
V
vacuum distillation, 62
vacuum synthesis, 550
VAL, 4
Valve gain, 327
valve setting, 418
Valves, 15
van Laar, 553
vapor-liquid-solid, 564
variable trajectories, 400
variance in SPC, 174
vector, 395
vector M, 147
vegetable oil, 61
velocity gradient, 88
velocity of heat, 99, 168, 206
velocity of mass, 168
velocity of the electron, 206
Vents, 43
Verlet algorithm, 178
Vernotte number, 167
very large Peclet numbers, 102
vesicles, 560
vibration resistance, 528
vibrations, 164
viscoelastic, 176
viscoelasticity, 538
Viscometers, 395
viscosity, 261
viscous diffusion rate, 160
598
Index
viscous effects, 85
viscous forces, 159
visible light, 527
viterbi algorithm, 560
VLSI, 531
volume expansivity, 179
volume fraction, 31, 553
W
wake region, 164
Wake separation, 77
wall effects, 531
wall heat flux, 96
warm/cool feeling, 133
warranty, 420
Wars, 60
waste, 423
waste cooking oil, 65
waste heat, 190
Waste Tires, 482
waste water, 84
Water, 181
water rich, 127
wave concentration, 120, 278
wave equation, 279
wave form, 249
wave front, 120, 123, 125, 280
wave regime, 119
wave temperature, 136, 290
wave term, 286, 292
WAXS, 548, 568
WBC, 562
Weiner, 178
Weiner filter, 393

Weiner-Hopf integral equation, 174
weir area, 91
Weissenerberg rheogoniometer, 538
Westinghouse, 99
Wheatstone bridge, 540
Wilson cloud, 164
wounds, 561
write once memory, 556
X
X-drop algorithm, 559
xerogel, 551
x-ray, 568
Y
Y shaped, 568
yeast, 302
Z
zero relaxation time, 284
Zero Transfer Inertial Regime, 125
zero-order, 512
zeroth order, 302
Zirconium molybdate, 187
Zirconium Silicalite-1, 187
Zirconium Tungstate, 187
Zirconium Tungstate ZrW2O8, 181

Continuous Process Dynamics, Stability, Control and Automation (2015)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Continuous Process Dynamics, Stability, Control and Automation (2015)

Uploaded by

Copyright:

Available Formats

CHEMICAL ENGINEERING METHODS AND TECHNOLOGY

CHEMICAL ENGINEERING METHODS

Additional e-books in this series can be found on Novas website

CHEMICAL ENGINEERING METHODS AND TECHNOLOGY

KAL RENGANATHAN SHARMA

Copyright 2015 by Nova Science Publishers, Inc.

NOTICE TO THE READER

Published by Nova Science Publishers, Inc. New York

To my eldest son, R. Hari Subrahmanyan Sharma (alias Ramkishan)

About the Author

Continuous Polymerization Process Technology

Mathematical Process Models

Continuous Process Dynamics

Proportional, Proportional Integral, Proportional Derivative

Frequency Response Analysis

Advanced Control Methods

Kal Renganathan Sharma

Kal Renganathan Sharma

Kal Renganathan Sharma

Kal Renganathan Sharma

ABOUT THE AUTHOR

Separate Chapters are devoted to Continuous Polymerization Process Tech nology,

Kal Renganathan Sharma

Control Lessons are drawn from Tormsdorff Effect, Regulation of Human

1.1.2. Chemical Process Industry

Kal Renganathan Sharma

1.2. EXAMPLES OF CONTROL APPLICATIONS

1.2.1. Supply Chain Robots

Dow Chemical, Midland, MI

Kal Renganathan Sharma

Artificial intelligence development in the form of software is an attempt to synthesize

1.2.2. Robotics as Collegiate Course

Kal Renganathan Sharma

1.2.3. Infeasibility of Molecular Assemblers

Nanotechnology, Drexler envisioned a world ubiquitous with molecular assemblers. These

Kal Renganathan Sharma

1.2.4. Trends in Industrial Robots

Kal Renganathan Sharma

1.2.6. Runaway Reactions in Polymerization Kettles

Kal Renganathan Sharma

kt0 = 1.225 x 106 exp(-844/T)

A1 = 2.57 5.05 x 10-3T

A2 = 9.56 1.76 x 10-2T

A3 = -3.03 + 7.85 x 10-3T

The propagation rate constant is given by;

The density of monomer as a function of temperature is given by;

1.2.7. Electric Motor Controls

Kal Renganathan Sharma

1.2.8. Centralized Heating and Cooling

Kal Renganathan Sharma

1.2.9. Regulation of Human Anatomical Temperature

Kal Renganathan Sharma

Figure 4.0. Regulation of Human Anatomical Temperature seen as Feedforward Control.

1.2.10. Feedback Control of 3 Arm Robotic Manipular with End Effector

Kal Renganathan Sharma

1.2.11. Lessons in Modeling and Control from Fukushima Earthquake

Figure 6.0. Block Diagram of Feedback Control of Robot Picking a Bolt.

Figure 7.0. Fukushima Nuclear Power Plant.

Kal Renganathan Sharma

1.2.12. Deepwater Horizon Oil Spill

1.3. CONTROL STRATEGY

Kal Renganathan Sharma

1.4. CONTROL TYPES