You are on page 1of 25

Manual de Biologa Celular Gua del Profesor / 1

MANUAL DEL PROFESOR


CESAR CERON GONZALEZ
cesar_cg@teleline.es

Manual de Biologa Celular Gua del Profesor / 2

INDICE
1. Justificacin del Proyecto.......................................................1
2. Contexto Curricular...............................................................3
3. Descripcin de la aplicacin
3.0. Indice............................................................................5
3.1. Ayuda............................................................................6
3.2. Navegacin....................................................................8
3.3. Thesaurus....................................................................10
3.4. Mapa del sitio...............................................................11
3.5. Galera de imgenes......................................................12
3.6. Enlaces........................................................................13
3.7. Secciones.....................................................................14
3.8. Evaluacin....................................................................18
4. Referencias........................................................................20
5. Anexo I: Respuestas a los cuestionarios.................................21

Manual de Biologa Celular Gua del Profesor / 3

1. JUSTIFICACIN DEL PROYECTO


Durante los ltimos aos se ha incorporado el ordenador a los centros de
enseanza revolucionando y abriendo un antes y un despus en el quehacer
docente, ya sea a travs de iniciativas institucionales (antes Proyecto Atenea, ahora
diferentes Intranets de las Administraciones autonmicas), o por medio de la propia
iniciativa del profesorado. Todo ello ha dado lugar a que un creciente nmero de
docentes hayan hecho uso de las TIC (Tecnologas de la Informacin y la Comunicacin) en las distintas etapas educativas y en diferentes mbitos curriculares, y a
que se produzca un amplio consenso social en el empleo de los recursos
informticos dentro de la enseanza. En efecto, hoy da asistimos al uso de Internet
por los escolares como una herramienta de uso casi cotidiano, y a la expansin de
nuevas redes de comunicacin de fibra ptica que permiten implementar nuevos
contenidos multimedia, y que terminarn por introducirse plenamente en el entorno
educativo. A este respecto cabe destacar una cita de la introduccin del libro
editado por la UNESCO dedicado a difundir una propuesta de currculo de
Informtica en la Enseanza Secundaria:
Las TIC han llegado a ser, en un tiempo muy corto, uno de
los bloques bsicos del edificio de la moderna sociedad
industrial. Comprender las TIC y dominar las destrezas
bsicas y los conceptos de las mismas es considerado hoy por
muchos pases como parte primordial de la educacin, igual
que lo son la lectura y la escritura.
Por otro lado, la sociedad en la que se incardinan esas TIC se perfila ms
abierta y flexible, interconectada y orientada a funcionamientos en red; un contexto
basado en nuevos modelos de comunicacin informal, a la vez que promotor de
estilos de aprendizaje facilitadores y de trabajo colaborativo; un contexto, en
definitiva, en el que estos nuevos mecanismos de comunicacin y difusin de la
informacin establecen formas originales de interaccin entre estudiantes y tutores,
y entre los propios estudiantes.
En este nuevo mbito del conocimiento cada vez juega un papel ms
relevante la teleformacin basada en el empleo intensivo y a la vez crtico- de las
TIC. Ahora bien, aunque las TIC facilitan el acceso a la informacin y tambin el
aprendizaje, no pueden sustituir a ste. Y es que, como advierte Denis (1998), la
tecnologa es meramente instrumental; el objetivo ltimo de la formacin debe ser
el conocimiento y la formacin de ciudadanos conscientes y crticos, no la
tecnologa en s misma, no la creacin de usuarios pasivos ante todas estas nuevas
disciplinas.
La LOGSE incorpora al currculo nuevos contenidos, y define objetivos generales con la finalidad de que el conocimiento sea ms funcional y significativo para

Manual de Biologa Celular Gua del Profesor / 4

el alumno, en tanto que funcionalidad y significatividad son ejes clave para la


motivacin. Por eso la incorporacin de las TIC al aula, en tanto que soportes de
conocimiento ms interesantes para el alumno, contribuyen a un aprendizaje ms
funcional y significativo.
En cuanto a la FP especfica, precisamente por su cercana al mundo laboral
que demanda, adems de la preparacin especfica en los distintos mbitos, el
conocimiento aadido en TIC, es de una importancia fundamental que esta etapa
educativa incluya la informtica dentro del proceso de desarrollo de las capacidades
bsicas de los alumnos y de elevacin de los niveles de cualificacin; tanto ms si
tenemos en cuenta la presencia de la informtica en todos los aspectos de la vida
social (econmicos, cientficos, industriales y culturales).
La propia LOGSE promueve la innovacin educativa en la medida que otorga
un papel central a los centros educativos tanto en la configuracin general como en
el desarrollo de los estudios de la FP especfica. A los centros que es tanto como
decir a su profesorado- corresponde no slo establecer las programaciones de
acuerdo con su entorno socioeconmico inmediato, sino tambin hacer que la
metodologa didctica empleada en la FP promueva la integracin de los contenidos
cientficos, tecnolgicos y organizativos, favoreciendo que el alumno desarrolle
capacidades de autoformacin y de trabajo en equipo. Y son los recursos
informticos de los que el trabajo que aqu se propone representa una muestralos elementos fundamentales para lograr esos objetivos.
En definitiva, en la medida en que ya es posible constatar cmo en el
mercado laboral la mayora de los empleos requieren conocimientos bsicos en TIC,
debe considerarse como una prioridad para el sistema educativo preparar a sus
usuarios para esta nueva realidad.

Manual de Biologa Celular Gua del Profesor / 5

2. CONTEXTO CURRICULAR
Sin duda, una de las principales aportaciones de la LOGSE a la Formacin
Profesional especfica es la que se refiere a los conocimientos, habilidades,
actitudes y destrezas particularmente vinculados a un mbito de competencia
profesional, que van a desembocar en un ttulo que habilita para el ejercicio
profesional.
Pero, con ser esto cierto, tambin lo es que se dan por supuestos ciertos
contenidos a los alumnos que se incorporan a los Ciclos Formativos de Grado
Superior. Hay una carencia -que podramos denominar de base- que se hace
evidente en la mayora de Ciclos Superiores que configuran la Familia Profesional de
Sanidad, sobre todo en alumnos que no proceden de la modalidad de Bachillerato
de Ciencias de la Naturaleza y de la Salud. En efecto, los alumnos que cursan ciclos
superiores como el de Anatoma Patolgica o el de Laboratorio de Diagnstico
Clnico por citar algunos-, deben hacer frente a los contenidos curriculares que
conforman sus diferentes Mdulos, en los que se parte de una serie de contenidos
previos que, en algunos casos, no llegaron a adquirirse en las fases previas de su
itinerario formativo.
La experiencia de estos aos nos ha enseado que esos alumnos tienen
ciertas dificultades para entender los fundamentos de las tcnicas histoqumicas, de
la hematologa o de las patologas inmunolgicas, simplemente porque desconocen
o apenas han abordado las nociones ms elementales del funcionamiento celular.
Para paliar en parte ese dficit surge este Manual de Biologa Celular, una
aplicacin que tiene la vocacin de ayudar al alumno a completar algunas lagunas
que surgen en estos niveles de enseanza no obligatoria. Se tratara de un
complemento con el que el profesor puede introducir al alumno en las materias
especficas del Ciclo, al mismo tiempo que un material de consulta que el alumno
puede trabajar de forma individual o en grupo.
Se ha intentado buscar un equilibrio entre el contenido de este Manual y el
nivel de los alumnos al que va dirigido; sin ser demasiado exhaustivo, pretende
revisar los conceptos ms importantes de la biologa celular, poniendo un especial
nfasis en el aspecto visual del aprendizaje. Para ello se ha realizado una amplia
seleccin de grficos e imgenes, que intentan ilustrar sobre los aspectos que en
cada momento se estn considerando.
Por tanto, este Manual estara dirigido, en primera instancia, a alumnos de
los Ciclos Formativos de Grado Superior de Anatoma Patolgica y
Laboratorio de Diagnstico Clnico. No obstante, tambin podra resultar de
utilidad como complemento a la asignatura de Biologa de 2 de Bachillerato de
Ciencias de la Naturaleza y de la Salud.

Manual de Biologa Celular Gua del Profesor / 6

3. DESCRIPCIN DE LA APLICACIN
Este Manual de Biologa Celular es una aplicacin realizada en HTML para que
pueda ser luego navegada tanto offline (en la Intranet del centro) como online (en
Internet).
Para su edicin se ha utilizado Dreamweaver 4 de Macromedia (versin
registrada), por tratarse de una herramienta muy verstil que facilita enormemente el
trabajo cuando se trata de realizar plantillas, bibliotecas de recursos u otros elementos
similares. Las CSS (Hojas de Estilo) se han elaborado con Topstyle Lite 1.5, de
Bradbury Software (versin limitada). Aunque DW incluye un potente editor HTML, el
cdigo final se ha retocado con HomeSite 4.5 de Allaire (versin limitada). Los archivos
swf se elaboraron con Flash 5 de Macromedia (versin trial), y los grficos se trataron
con Fireworks 4 de Macromedia (versin trial).
En conjunto, la aplicacin est organizada como un website con casi 240
pginas organizadas en 3 grandes secciones: Citoplasma, Ncleo y Ciclo Celular.
Adems, dispone de una galera de imgenes (una por cada seccin), un mapa del
sitio, una pgina de enlaces para bsqueda adicional de informacin, un thesaurus
indexado y una zona de autoevaluacin con dos niveles de dificultad, en la que el
alumno puede comprobar su nivel de adquisicin de conocimientos.

Manual de Biologa Celular Gua del Profesor / 7

3.1. Ayuda
A lo largo de todo el sitio el usuario dispone de varios elementos de ayuda que
tienen como finalidad orientarle durante la navegacin.
Una

pantalla genrica ilustra sobre qu podr encontrar en cada una de las secciones, al
mismo tiempo que permite acceder a una pgina para acceso rpido a todas las
AYUDAS VISUALES que se han distribuido a lo largo del sitio. Este ltimo acceso
se identifica por medio de un rollover que representa de forma esquemtica la
estructura de una clula:
Una vez que lo pulsamos aparece esa pgina en la que, mediante
cdigo javascript, accedemos a esquemas que explican alguno de
los aspectos que se hayan estado tratando en una seccin
determinada. Por ejemplo:

Manual de Biologa Celular Gua del Profesor / 8

Manual de Biologa Celular Gua del Profesor / 9

Un ejemplo de este tipo de ayuda visual podemos encontrar hasta 27 de estas


ayudas a lo largo del sitio- lo podemos ver en la siguiente pgina:

Manual de Biologa Celular Gua del Profesor / 10

3.2. Navegacin
La navegacin del sitio se ve facilitada por dos BARRAS DE NAVEGACIN: una
superior y otra inferior.
Ambas se han creado como elementos de biblioteca que luego se insertan en las
pginas de las diferentes secciones; de ese modo se asegura la coherencia y
similitud en su aspecto a lo largo del sitio. El logotipo de sitio contribuye a
proporcionar esa unidad en el diseo.

Barra superior

Esta barra dispone de un sistema de mens elaborado con Flash que permite
acceder de un modo sencillo y rpido a cada seccin:

Adems, encontramos otros accesos:


. la pgina de AYUDA, que orienta sobre qu podemos encontrar en cada seccin
. posibilidad de contactar mediante e-mail con el administrador del sitio
. acceso al THESAURUS y al INDICE del sitio

Manual de Biologa Celular Gua del Profesor / 11

Barra inferior

El men inferior proporciona una navegacin similar a la barra superior, aunque hay
ciertas pginas a las que slo se puede acceder desde este lugar. En concreto, a la
pgina de presentacin de la EVALUACIN y a la pgina de presentacin de la
GALERIA de imgenes.

Manual de Biologa Celular Gua del Profesor / 12

3.3. Thesaurus
En la barra de navegacin superior se puede acceder al Thesaurus: una pgina con
descripciones de los conceptos ms relevantes incluidos en el sitio, que se
acompaan de thumbnails (miniaturas) para ilustrarlos grficamente, y que
contienen enlaces a pginas en las que se pueden obtener informacin adicional
sobre los mismos. Se incluyen unas 150 voces con sus correspondientes
acepciones.
Se ha incluido cdigo javascript que abre al mismo tiempo una pgina secundaria,
ms

pequea,

con

un

NDICE

ALFABTICO

que

ayuda

interactividad con la pgina del thesaurus, que quedara de fondo.

mantener

la

Manual de Biologa Celular Gua del Profesor / 13

3.4. Mapa del sitio


El mapa del sitio tiene la doble virtualidad de ofrecer una visin de conjunto de
cmo se halla organizado el sitio, al mismo tiempo que permite el acceso rpido a
cada una de las secciones y apartados que lo conforman.
A l puede accederse tanto desde la BARRA DE NAVEGACIN superior como la
inferior.

Manual de Biologa Celular Gua del Profesor / 14

3.5. Galera de imgenes


En este Manual de Biologa Celular se pretende resaltar su carcter marcadamente
visual; por eso, esta galera proporciona un amplio repertorio de imgenes
agrupadas por secciones, tanto las que se pueden visualizar en las diferentes
pginas, como otras muchas que han sido seleccionadas y tratadas grficamente
para ser incluidas en esta seccin.
La pgina introductoria de la galera se ha elaborado con Flash, y a ella se puede
acceder desde la BARRA DE NAVEGACIN inferior, mientras que desde la
superior se accede directamente a la galera de cada seccin.

Cada una de esas galeras dispone de un amplio grupo de imgenes, distribuidas


por apartados, y presentadas en forma de miniaturas. Se ha incorporado cdigo
javascript de manera que, al pulsar sobre ellas, se abre una nueva ventana con esa
misma imagen aumentada.

Manual de Biologa Celular Gua del Profesor / 15

3.6. Enlaces
Es evidente que la Biologa Celular no se agota en este Manual; al contrario, se
pretende que el alumno lo utilice como puerta de entrada a esa vasta e inabarcable
fuente de informacin que es Internet.
Para facilitarle esa tarea se proponen varios enlaces seleccionados segn su utilidad
prctica, su riqueza de contenidos y por tratarse en algunos casos, adems, de
referencias casi obligadas en la navegacin a travs de la red.
Para ampliar aun ms las posibilidades de obtener informacin sobre algn aspecto
concreto se incluyen tambin un par de buscadores internos: Altavista y FAST
Web Search, cuyos logotipos slo son visibles mediante navegacin online.
A la pgina de enlaces se puede acceder tanto desde la BARRA DE NAVEGACIN
superior como inferior, y tambin como a cualquier pgina del sitio- directamente
desde el MAPA.

Manual de Biologa Celular Gua del Profesor / 16

3.7. Secciones
La parte ms sustancial del Manual corresponde a las 3 secciones en las que se ha
dividido: Citoplasma, Ncleo y Ciclo Celular. Cada una de ellas, a su vez, est
dividida en apartados en los que se intentan recoger los conceptos ms relevantes
del amplio y complejo mundo de la Biologa Celular:
-

CITOPLASMA:
Organelas

Citoesqueleto
NCLEO:
Nucleoplasma
Cromatina

Cromosomas
CICLO CELULAR:
Apoptosis
Mitosis
Meiosis

Esta separacin un tanto artificiosa responde nicamente a criterios didcticos, en


tanto que no es posible delimitar de forma tan precisa dnde termina la estructura
de un ribosoma por poner un ejemplo- y dnde comienza la configuracin de una
molcula de RNAm, o cul es el inicio de la sntesis de una cadena polipeptdica tras
la correspondiente replicacin del DNA en el interior del ncleo. Por eso, para dar
cuenta de esa intrincada red de interrelaciones entre los diferentes compartimentos
celulares, cada apartado incluye enlaces hacia pginas de diferentes secciones.
Como en el resto del sitio, a esas secciones podr accederse tanto desde la BARRA
DE NAVEGACIN superior como inferior, y tambin directamente desde el MAPA.
A su vez, cada una de las tres secciones dispone de una pgina de presentacin,
accesible solo desde la PGINA DE INICIO de todo el sitio, en la que se ha
introducido como elemento distintivo el mismo logotipo del sitio pero con un
contenido dinmico realizado con Flash.

Manual de Biologa Celular Gua del Profesor / 17

La estructura de todas estas pginas es muy similar:


(1) hay una marca de localizacin, para que en todo momento sepamos en
qu apartado nos encontramos
(2) iconos de desplazamiento, para los casos en que cada apartado se
contine a lo largo de diferentes pginas
(3) en ciertos lugares aparecen rollovers que proporcionan AYUDA VISUAL
sobre el concepto que se est tratando
(4) en algunas pginas aparecen zonas destacadas con informacin adicional,
que vendra a complementar la que se est proporcionando con carcter
general
(5) abundantes imgenes que ilustran grficamente sobre el tema

Manual de Biologa Celular Gua del Profesor / 18

Manual de Biologa Celular Gua del Profesor / 19

3.8. Evaluacin
Junto a los contenidos de las SECCIONES, probablemente la EVALUACIN resulte
la parte ms distintiva de este Manual de Biologa Celular.
La idea es que el usuario, una vez que termine de navegar por las diferentes pginas del sitio, compruebe por s mismo el nivel de conocimientos que ha adquirido,
mediante una batera formada por algo ms de 50 cuestiones de muy diversa
naturaleza (verdadero/falso, cuestiones mltiples con nica eleccin, cuestiones
mltiples con varias elecciones, cuestiones para responder con algn trmino
concreto, emparejamientos, etc.).
Se ha delimitado una evaluacin diferenciada para cada seccin, con dos niveles de
complejidad creciente. El Nivel I aborda un grupo de cuestiones ms accesibles, y
es conveniente que el usuario supere al menos un 70% de las mismas para pasar al
Nivel II, de mayor dificultad. Una vez completado el Nivel II se da por superada la
evaluacin de esa seccin.
El feedback se proporciona una vez que el usuario va contestando cada pregunta; si
la respuesta es correcta simplemente se le confirma el resultado, y si es errnea se
le invita en algunos casos a repasar de nuevo los contenidos, y en otros se le
proporciona una pequea AYUDA VISUAL para que vuelva a intentarlo. Desde
luego que no es este el nico medio para proporcionar algn tipo de interaccin
entre la aplicacin y el usuario; de hecho, se contempl la posibilidad de
proporcionar el feedback tras completar las cuestiones de cada nivel, asignando un
valor a cada item y redireccionando mediante cdigo javascript- a una u otra
pgina dependiendo del resultado total. Es cierto que este modelo incide en la
resolucin de todo un grupo de cuestiones relacionadas en cada seccin,
proporcionando una visin conjunta de la materia a estudio; sin embargo, se eligi
el otro porque se revela como un mtodo de aproximacin ms inmediata a la
evolucin del alumno a lo largo del cuestionario.
Un tercer mtodo, algo ms complejo que posiblemente se aborde en una fase
futura de este Manual-, resultara de implementar el acceso de cada usuario
mediante base de datos situada en el servidor; de este modo, a travs de un login
y password personales, se podran registrar sus evoluciones a lo largo de un
perodo escolar.
En cualquier caso, debe tenerse en cuenta que la intencin ltima de este Manual
es la de servir de apoyo al estudiante, de complemento en su adquisicin de
conocimientos dentro del currculo y de gua a lo largo de ese proceso.

Manual de Biologa Celular Gua del Profesor / 20

NIVEL I

NIVEL II

Manual de Biologa Celular Gua del Profesor / 21

4. REFERENCIAS

AA.VV. (1992): Las nuevas tecnologas en la educacin. ICE Universidad


de Cantabria, Santander.

AA.VV. (1999): Nuevas tecnologas en la formacin flexible y a distancia.


EDUTEC, Sevilla.

ALONSO, CM, y GALLEGO, D. (2001): Los educadores ante el reto de las


TIC, 2 vols. UNED, Madrid.

CABERO, J. (ed.) (2000): Nuevas tecnologas aplicadas a la educacin.


Ed. Sntesis, Madrid.

COLOMER i BUSQUETS, M. (1997): Cada da ms presente. Cuadernos de


Pedagoga, 258: 68-79.

DENIS ZAMBRANA, J. y cols. (1998): Tecnologas de la Informacin en la


Educacin. Anaya, Madrid.

FERRES, J. y MARQUES, P. (coord.) (1996): Comunicacin educativa y


nuevas tecnologas. Ed. Praxis, Barcelona.

SOLANO FERNNDEZ, IM. (2001): Nuevos roles docentes y discentes en


la clase virtual. Actas Jornadas Nacionales TIC y Educacin, Lorca, Murcia,
pp. 215-224.

TEJEDOR, FJ. y VALCARCEL, AG. (eds) (1996): Perspectivas de las


Nuevas Tecnologas en la Educacin. Narcea, Madrid.

VIDAL PIJOAN, T. (1997): Para saber ms. Cuadernos de Pedagoga,


258: 68-79.

Averroes Red Telemtica Educativa de Andaluca:


http://averroes.cec.caam.es
PIE Programa DInformatica Educativa del Departament
DEducacin de la Generalitat de Catalunya:
http://www.xtec.es
Centre DEducaci i Noves Tecnologies Universitat Jaume I:
http://cent.uji.es
PNTIC Programa de Nuevas Tecnologas MEC:
http://www.pntic.mec.es
Programa de Nuevas Tecnologas Consejera de Educacin de
Canarias:
http://www.educa.rcanaria.es
Nuevas Tecnologas y Educacin Comunidad Foral de Navarra:
http://www.cfnavarra.es/educacion/ntecnologias
RedIris:
http://www.rediris.es
Pangea:
http://www.pangea.org
Global SchoolNet Foundation:
http://www.gsn.org
Classroom Connect:
http://www.classroom.net
Web66:

Manual de Biologa Celular Gua del Profesor / 22

http://web66.coled.umn.edu/schools/maps/europe.html

Manual de Biologa Celular Gua del Profesor / 23

ANEXO I
RESPUESTAS A LOS CUESTIONARIOS
A. Evaluacin / citoplasma 1
1

Verdadero

Aerbica

- Las crestas mitocondriales son prolongaciones de la membrana interna

Subunidad pequea

aticodon (anticodn)

Las clulas ms inactivas metablicamente son ms ricas en RER

Transcripcin de nucletidos

Dictiosoma (dictiosoma)

Cubierta proteica que contribuye a la formacin de los lisosomas

- Una fraccin de las mitocondrias est constituida por DNA que se


localiza en la matriz

10 Catalasas - Oxidasas
A. Evaluacin / citoplasma 2
12 Fijacin RNAm a ribosoma Ensamblaje...
1: matriz (matriz mitocondrial)
13 2: crestas (crestas mitocondriales pliegues)
3: espacio intermembranoso
4: membrana (membrana mitocondrial)
14 V F V - F
15 autofagosomas
16 cara cis - apilamientos - cara trans
17 Krebs (ciclo de Krebs metabolismo de Krebs)
18 bicapa lipdica con capa de protenas y azcares
19 1 nexina

2- dinena

4 membrana celular 5 microtbulos

3- proyeccin radial
6- par central

Molculas no polares: difusin simple


20 Molculas polares pequeas: difusin simple
Glucosa, aminocidos: difusin facilitada
Iones: transporte activo

Manual de Biologa Celular Gua del Profesor / 24

B. Evaluacin / ciclo celular 1


1

46, 23, 23

Profase 1 (Profase 1 profase I Profase I)

Fase S

46

Fase G2 Fase G1

Telofase I

Emparejamiento de cromosomas homlogos

Endonucleasas - Caspasas

1: Anafase (anafase)

2: Profase (profase)

3: Telofase (telofase)

4: Interfase (interfase) 5: Citocinesis (citocinesis) 6: Metafase (metafase)


(de izquierda a derecha, de arriba abajo)
B. Evaluacin / ciclo celular 2
11 Se duplica la cantidad total de DNA
12 Mittica
13 Clulas diploides
14 Fase G2
15 1: Citocinesis (citocinesis)
4: Profase (profase)

2: Metafase (metafase) 3: Interfase (interfase)


5: Telofase (telofase)

6: Anafase (anafase)

(de arriba abajo)


16 Meiosis I Meiosis I Meiosis I Mitosis/MeiosisII Mitosis/Meiosis I
Meiosis I
17 polo celular cromtida microtbulos huso mittico - cinetocoro
18 F V - F

Manual de Biologa Celular Gua del Profesor / 25

C. Evaluacin / ncleo 1
1

20%, 30%, 30%

Cinetocoro

Traducido

Ninguna de las anteriores

Adenina

630

La longitud de la molcula es idntica en todas las especies

Nucleosoma

UACUGUCUACAAUGUAUAGCCCGCGUA

C. Evaluacin / ncleo 2
11 RER cromatina cubierta nuclear nucleolo - nucleosoma - poro
nuclear (sentido agujas del reloj)
12 Nucleosoma DNA espaciador Octmero (de arriba abajo)
13 F V V- F
14 Nuclesido
15 Cromtida Cinetocoro Telmero Centrmero Microtbulos
(sentido agujas del reloj)
16 El genoma entre dos individuos de una misma especie es idntico; slo
difiere el genoma entre individuos de distintas especies
17 Cisterna perinuclear