Professional Documents
Culture Documents
Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 11 June 2015
Received in revised form
24 July 2015
Accepted 24 August 2015
Available online 2 September 2015
Staphylococcus aureus has the ability to invade mammary epithelial cells (bMECs) causing mastitis. This
event depends primarily on the a5b1 integrin in the host cell. In addition, bMECs are a target for the
hormone prolactin (PRL), which can regulate b1 integrin-dependent actions related to differentiation and
lactation. Previously, we demonstrated that bovine PRL (bPRL, 5 ng/ml) stimulates S. aureus internalization into bMECs. TLR2 is important during S. aureus infections, but its activation by PRL has not yet
been established. The objective of this study was to determine the role of a5b1 integrin and TLR2 during
S. aureus internalization into bMECs stimulated with bPRL. We demonstrated that the prolactinstimulated internalization of S. aureus decreases in response to the blockage of a5b1 integrin (~80%)
and TLR2 (~80%). bPRL increases the membrane abundance (MA) of a5b1 integrin (~20%) and induces
TLR2 MA (~2-fold). S. aureus reduces the a5b1 integrin MA in bMECs treated with bPRL (~75%) but induces TLR2 MA in bMECs (~3-fold). Bacteria and bPRL did not modify TLR2 MA compared with the
hormone alone. S. aureus induces the activation of the transcription factor AP-1, which was inhibited in
bMECs treated with bPRL and infected. In general, bPRL induces both pro- and anti-inammatory responses in bMECs, which are abated in response to bacterial challenge. Interestingly, the canonical Stat-5
transcription factor was not activated in the challenged bMECs and/or treated with bPRL. Taken together,
these results support novel functions of prolactin as a modulator of the innate immune response that do
not involve the classical prolactin pathway.
2015 Elsevier Ltd. All rights reserved.
Keywords:
Prolactin
Staphylococcus aureus
TLR2
Integrins
Mammary epithelium
Mastitis
1. Introduction
Prolactin (PRL) is a hormone involved in reproduction and
lactation that essentially stimulates the differentiation and metabolic functions of mammary epithelial cells (MECs) [1]. In bovines,
PRL maintains the concentrations of the mRNAs encoding milk
proteins and regulates milk production [2]. The bovine mammary
gland undergoes mastitis, which is characterized by an inammatory response of the udder. The main gram-positive bacterium
causing subclinical mastitis is Staphylococcus aureus, which can
persist intracellularly in this tissue [3]. The host cell invasion in
non-professional phagocytic cells (i.e., MECs) by S. aureus depends
on the presence of bronectin-binding proteins (FnBPs) on the
bacterial surface, as well as the interaction of bronectin and the
host-cell a5b1 integrin through a zipper-type mechanism, where
* Corresponding author.
E-mail addresses: ochoaz@umich.mx, aleocho@hotmail.com (A. Ochoa-Zarzosa).
http://dx.doi.org/10.1016/j.micpath.2015.08.018
0882-4010/ 2015 Elsevier Ltd. All rights reserved.
44
lactation [11]. Because MECs respond to hormonal stimuli to proliferate and differentiate during pregnancy and lactation, there is a
very important crosstalk between the lactogenic trigger, such as
prolactin, and the events controlled by b1 integrin [12]. The classical PRL signaling pathway in the lactating mammary gland involves the dimerization of the PRL receptor (PRLR) and the
activation of the associated tyrosine kinase Janus kinase 2 (JAK2),
which eventually activates members of the protein family of signal
transducer and activation of transcription (Stats) that regulate the
transcriptional response to PRL related to the expression of
differentiation-related genes and genes encoding milk proteins.
This canonical PRL signaling is dependent on b1 integrins [12].
In a previous study, we showed that bovine PRL (bPRL) stimulates S. aureus internalization into bovine mammary epithelial cells
(bMECs). In addition, bMECs treated with bPRL and infected with S.
aureus show a decreased innate immune response because the
bacteria inhibit the activation of nuclear factor kappa B (NF-kB)
stimulated by bPRL (alone). These data described novel nonclassical actions of PRL [13]. However, the relationship between
bPRL and a5b1 integrin during S. aureus internalization into bMECs
has not been explored. In addition, diverse reports indicate that the
drying off and calving periods exhibit the highest incidence of
udder infection due to the establishment of mastitis; these periods
are characterized by the presence of high levels of PRL, and our data
and those of others suggest that hormonal changes may decrease
the innate immune response of calves [14,15]. Because PRL also
regulates transcription factors related to the innate immune
response, such as NF-kB, it is interesting to analyze the key elements of this signaling pathway in bMECs infected with S. aureus,
i.e., Toll-like receptor 2 (TLR2). TLR2 belongs to the family of host
receptors that recognize pathogen-associated molecular patterns
(PAMPs). In particular, TLR2 is activated by the lipid anchor of lipoteichoic acid, lipopeptides and lipoproteins which are components of the cell membrane of gram-positive bacteria [16]. In
addition, it has been shown that S. aureus strains activate TLR2 and
its gene expression in bMECs [17]. Even though PRL may regulate
many immune functions, neither a clear relationship with TLR2 nor
a crosstalk between the PRLR and TLR2 pathways have been
established. In contrast, the interaction of b1 integrin and TLR2
receptors has been demonstrated during infections [18]. In this
sense, gram-positive bacteria can be internalized more efciently
into monocytes and macrophages because these bacteria activate
integrin through the action of TLR2 [19]. In addition, the treatment
with cytokines members of the tumor necrosis factor (TNF) family
induces an upregulation and redistribution of b1 integrin in
epithelial cells [20], and the blocking of a5b1 integrin decreases
TNF-a production in response to heat-killed S. aureus [21].
Due to the relationship between integrins and TLRs during
infection and the important crosstalk between the PRL and a5b1
integrin pathways during the proliferation and differentiation of
MECs, we investigated whether bPRL stimulates the expression of
integrin a5b1 in bMECs and whether this induction is related to the
stimulation of the internalization of S. aureus by the hormone. In
addition, because PRL may compromise the innate immune
response of bMECs, we also explored whether this effect in combination with the stimulation of bacterial endocytosis can be achieved through the regulation of the expression and activation of
TLR2 as well as other signal pathways related to the innate immune
response of bMECs.
2. Materials and methods
2.1. Reagents
Native puried bovine prolactin (bPRL) (lot AFP7170E) was
provided by A. F. Parlow (NHPP, NIDDK, Torrance, CA, USA), dissolved in water, and sterilized by ltration.
2.2. Antibodies
The blocking antibody anti-a5b1 integrin (MAB2514) was purchased from Millipore. The blocking anti-TLR2 (TL2.1) and antiPRLR (U5) antibodies were obtained from Abcam. TRITC and FITCconjugated secondary antibodies against mouse and rat IgGs
were purchased from Invitrogen and Thermo Scientic,
respectively.
2.3. Staphylococcus aureus strain
To perform the invasion assays, the American Type Culture
Collection (ATCC) S. aureus subsp. aureus 27,543 strain was used.
This strain was isolated from a case of clinical mastitis and has the
capacity to invade bovine mammary epithelial cells [20]. The bacteria were grown at 37 C overnight in LuriaeBertani broth (LB,
Bioxon), and the CFUs were adjusted by measuring the optical
density at 600 nm (O. D. 0.2 9.2 107 CFU/ml).
2.4. Culture of primary bovine mammary epithelial cells
bMECs were isolated from the alveolar tissue of the udders of
healthy lactating cows as described [22]. Cells from passages 2 to 8
were used in all of the experiments. Cells were cultured in growth
medium (GM) composed by DMEM medium/nutrient mixture F12
Ham (DMEM/F12K, Sigma) supplemented with 10% fetal calf serum
(Gibco), 10 mg/ml insulin (Sigma), 5 mg/ml hydrocortisone (Sigma),
100 U/ml penicillin and streptomycin (100 mg/ml) and 1 mg/ml
amphotericin B (Invitrogen). Cells were grown in 5% CO2 atmosphere at 37 C.
2.5. Invasion assays
For the invasion assays, we used bMEC polarized monolayers
(~2 105 cells cultured in 24 well dishes) which were incubated
with bPRL (5 ng/ml) in DMEM/F12K (Sigma) without antibiotics
and serum for 24 h and then were infected with S. aureus (MOI 30:1
bacteria per cell). For this, bMECs were inoculated with 65 ml of
bacterial suspensions to 9.2 107 CFU/ml and incubated for 2 h in
5% CO2 at 37 C. Then, bMECs were washed three times with PBS
(pH 7.4) and incubated in GM without serum and penicillin and
streptomycin, but supplemented with 50 mg/ml gentamicin for 1 h
at 37 C to eliminate extracellular bacteria. Finally, bMEC monolayers were detached with trypsin (0.05%)-EDTA (0.02%) (Sigma)
and lysed with 250 ml of sterile distilled water. bMEC lysates were
diluted 100-fold, plated on LB agar in triplicates and incubated
overnight at 37 C. The number of CFU was determined by the
standard colony counting technique. Simultaneously, the number
of bMECs cultured in each well was calculated for each invasion
assay using a haemocytometer. The data are presented as the ratio
of CFU recovered per bMEC. For the RNA and nuclear protein
extraction, bMECs were processed according to the protocols
described below. For the ELISA determinations, the media of the
infection assays were collected (see below).
For the invasion assays in the presence of the blocking antibodies, one hour prior to the addition of the bacteria to the bMECs,
the blocking antibodies anti-a5b1 integrin (concentrations and
incubation times employed according to Kapetanovic et al. [21]) or
anti-TLR2 (according to the manufacturer's instructions) were
added separately to triplicate wells. Rat IgGs (puried from normal
rat serum with protein A-sepharose beads (Sigma)) or mouse IgGs
(puried from normal mouse serum purchased from Pierce) were
45
2500 rpm and 4 C for 10 min and was washed twice with PBS. The
bMECs were blocked with normal goat serum (5% in PBS, Pierce) for
30 min at 4 C with shaking, cells were then centrifuged and the cell
pellet was incubated with the primary antibodies. To analyze the
TLR2 MA, the cells were incubated with the corresponding antibody at a dilution of 1:150 (PBS containing 0.1% BSA) for 1 h at 4 C
with shaking. For the determination of integrin MA in control cells,
invasion assays were performed using different times of infection:
15, 30, 60 and 120 min, whereas bPRL-treated cells were infected
only 120 min. The invasion assay was completed as described
above. The cells were incubated with the anti-a5b1 integrin at a
concentration of 10 mg/ml for 2 h at 4 C with shaking. To analyze
the expression of PRLR, an antibody concentration of 2 mg/ml was
employed for 4 h at 4 C with shaking. The cells were then washed
three times with PBS and incubated with the TRITC (diluted 1:100)
secondary antibody to analyze the expression levels of TLR2 and
PRLR. For the analysis of integrin expression, a FITC-conjugated
secondary antibody was used (diluted 1:50). In all cases, the
bMECs were incubated with the secondary antibodies for 1 h at 4 C
with shaking in the dark. The bMEC pellet was recovered by
centrifugation, washed, xed with paraformaldehyde (4%) for
10 min at 4 C, and washed three times with PBS. The bMECs were
then suspended in 100 ml of cold PBS. The samples were analyzed
by ow cytometry, and the uorescent signals of 10,000 cells were
measured using an Accuri C6 cytometer (BD Bioscience) and
analyzed using the FlowJo software.
2.9. Enzyme-linked immunosorbent assay (ELISA)
For the measurement of the TNF-a and IL-1b concentrations in
the medium, the conditioned media from bMECs treated with bPRL
and/or S. aureus were collected. The concentrations of TNF-a were
measured using the Duoset ELISA development kit (R&D Systems)
to quantify the bovine TNF-a levels according to the manufacturer's
instructions, and the concentrations of IL-1b were assessed using
the bovine IL-1b screening kit (Thermo Scientic).
2.10. Data analysis
The data were obtained from three independent experiments,
each of which was performed in triplicate, and compared by
analysis of variance (ANOVA). The results are reported as the
means the standard errors (SE). P values of less than 0.05 were
considered signicant. The results from gene expression analyses
and receptor membrane abundance experiments are shown
normalized to the untreated cells (control).
3. Results
Table 1
Primers used in this study.
Specicity
Primer
Annealing temperature ( C)
Forward
Reverse
Forward
Reverse
TGCAGTGTGAGGCCGTGTATGAAG CGGGAGGGAGCGTTTGAAGAAT
230
58
TGCGAGTGTGGTTGCCTGTAAGT ATTGAAGGCTCGGCACTGAACA
123
60
46
alone. The TLR2 MA correlates with the expression level of its gene
(Fig. 2D), with the exception of the effect detected with both
treatments.
3.3. Activation of TLR2 signal pathways by bPRL and S. aureus
Because TLR2 is expressed in bMECs in response to treatment
with bPRL and S. aureus, we explored whether two canonical
transcriptional factors activated by TLR2 are upregulated in the
presence of bPRL and/or bacteria. The activation of the transcription
factors NF-kB and AP-1 was analyzed by 1) a transcription factor
array, 2) the expression of representative genes regulated by these
factors and 3) by ELISA measuring pro-inammatory cytokine
secretion. In a previous work, we showed that S. aureus does not
activate NF-kB in bMECs [13]. In agreement with our previous
nding, we did not detect the activation of NF-kB by S. aureus
(alone) using a transcription factor array (Fig. 3). In contrast, the
activation of the transcription factor AP-1 was induced by S. aureus
alone and by bPRL, but both treatments downregulated the activation induced by bacteria (Fig. 3).
Fig. 4 shows the RT-qPCR analysis of different genes related to
the innate immune response, such as antimicrobial peptides (bdefensins; DEFB1 and TAP), one chemokine (IL-8), proinammatory cytokines (TNF-a, IL-1b, and IL-6), and one antiinammatory cytokine (IL-10). As shown, the expression levels of
DEFB1 and TAP were unmodied in the presence of S. aureus and/or
bPRL (Fig. 4A and B). However, the analysis of the expression of proinammatory cytokines revealed that only TNF-a is signicantly
induced by S. aureus (~5-fold) and bPRL (~2-fold), but pretreatment with this hormone inhibited the bacterial induction
(Fig. 4C). Other pro-inammatory cytokines, such as IL-1b and IL-6,
were signicantly increased by bPRL (Fig. 4D and E), but their
expression was reduced in the presence of S. aureus and by the
combined treatments. We also analyzed the expression of the
chemokine IL-8, which was downregulated or unmodied by bPRL
and/or S. aureus (Fig. 4F). Interestingly, the expression of the antiinammatory cytokine IL-10 was signicantly induced by bPRL
(~5-fold) but was reduced in the presence of S. aureus (Fig. 4G). The
TNF-a and IL-1b secretion into the media was analyzed by ELISA
(Fig. 5). The secretion of both cytokines was signicantly induced
by S. aureus. bPRL increased only the secretion of IL-1b (P < 0.05);
however, the effect of both treatments on this cytokine was not
additive (Fig. 5B), whereas a signicant inhibitory effect on TNF-a
was obtained by both treatments (Fig. 5A).
3.4. PRLR signal transduction pathways in bMECs challenged with
S. aureus
It has been reported that PRL can stimulate different transcription factors in the mammary epithelium [25]; however, the relationship between these pathways and infection has been poorly
explored. Using the same transcription factor arrays shown in Fig. 3,
we demonstrated that bPRL also induces Stat-1, Stat-3 and Stat-4
activation, whereas prevents Stat-5 activation (Fig. 6A and B).
However, Stat proteins, including Stat-5, are not activated by S.
aureus (Fig. 6A and B). In addition, cells treated with bPRL and S.
aureus decreased the activation induced by the hormone alone. To
determine whether the downregulation of Stat-5 activation may be
a consequence of the amount of available PRLR, we used ow
cytometry analysis to show that bPRL signicantly reduces the
PRLR MA in bMECs compared with the control cells. S. aureus alone
also reduces PRLR MA (P < 0.05, Fig. 6C and D), but in the presence
of the hormone the effect was not signicant compared with the
reduction of the hormone alone (Fig. 6D).
Fig. 1. Participation of a5b1 integrin in the internalization of S. aureus by bMECs stimulated with bPRL. A) Primary cultures of bMECs treated for 24 h with bPRL were incubated with
different concentrations of a specic blocking antibody against a5b1 integrin for 1 h and then challenged with S. aureus (MOI 30:1 bacteria per cell). The number of internalized
bacteria is represented by the ratio of CFU/bMEC recovered after lysis of bMECs. 10 mg/ml of rat IgGs were used as the negative control. B) The abundance of a5b1 integrin in the
bMEC membrane was determined by ow cytometry analysis in cells treated for 24 h with bPRL and/or challenged with S. aureus. A total of 10,000 events were measured. Typical
population proles of non-challenged bMECs (black line) vs. challenged cells (red line) were showed. The secondary antibody control was included (blue line). C) Mean of the
uorescence of the non-challenged and challenged bMECs. Cells treated only with the secondary antibody (Ab sec) were used as the negative control. D) RT-qPCR analysis showing
the effect of bPRL and/or S. aureus challenge for 2 h on a5b1 integrin mRNA expression. Each bar shows the mean of triplicates SE of three independent experiments. The letter a
indicates signicant changes (P < 0.05) compared with the untreated control cells. The letter b indicates signicant changes (P < 0.05) compared with bMECs treated with bPRL. E)
The abundance of a5b1 integrin in the bMEC membrane determined as the mean of the uorescence of challenged bMECs at different times of infection with the same MOI (30:1
bacteria per cell). A total of 10,000 events were measured. Each bar shows the mean of triplicates SE of a representative experiment. Different symbols indicate (*, #, ) statistically signicant different means (ANOVA, P < 0.05). (For interpretation of the references to color in this gure legend, the reader is referred to the web version of this article.)
48
Fig. 2. Participation of TLR2 in the internalization of S. aureus stimulated by bPRL in bMECs. The cells were treated for 24 h with bPRL and/or then challenged for 2 h with S. aureus.
A) Primary cultures of bMECs were incubated with 5 mg/ml of a specic blocking antibody against TLR2 for 1 h and then challenged with S. aureus for 2 h (MOI 30:1 bacteria per cell).
The number of internalized bacteria is represented by the ratio of CFU/bMEC recovered after lysis of bMECs. 5 mg/ml of mouse IgGs were used as the negative control. The TLR2
membrane abundance was determined by ow cytometry analysis, and a total of 10,000 events were measured. B) Typical population proles of non-challenged (black line) vs.
challenged bMECs (red line). The secondary antibody control was included (blue line). C) Mean of the uorescence of non-challenged and challenged bMECs. Cells treated only with
the secondary antibody (Ab sec) were used as the negative control. D) RT-qPCR analysis showing the effect of bPRL and/or S. aureus challenge for 2 h on TLR2 mRNA expression. Each
bar shows the mean of triplicates SE of three independent experiments. The letter a indicates signicant changes (P < 0.05) compared with the untreated control cells. The letter
b indicates signicant changes (P < 0.05) compared with bMECs treated with bPRL. (For interpretation of the references to color in this gure legend, the reader is referred to the
web version of this article.)
4. Discussion
In lactating mammary epithelial cells, b1 integrin signaling is
required for prolactin differentiation effects. In addition, a5b1
integrin is a host receptor during S. aureus internalization in
different epithelial cells. We have previously performed bPRL
doseeresponse curves to determine the effect of this hormone on S.
aureus internalization by bMECs, and showed that only 5 ng/ml
bPRL stimulates bacterial endocytosis [15], in agreement with the
physiological levels of bPRL reported in cattle during lactation
[26,27]. However, it remains unclear whether a5b1 integrin is
involved in the stimulation of bacterial internalization by bPRL.
According to the results shown in Fig. 1, a5b1 integrin is necessary
for S. aureus internalization into bMECs. The participation of this
integrin during S. aureus internalization has been reported for
epithelial cells of different origins [5,9]; however, this study provides the rst demonstration of the role of this integrin during the
49
Fig. 3. Analysis of transcription factors activated in bMECs during the internalization of S. aureus stimulated by bPRL. bMECs were treated for 24 h with bPRL and/or then challenged
for 2 h with S. aureus. The nuclear protein extracts were obtained, and the screening of transcription factors was performed using a TranSignal Protein/DNA array I (Panomics). A)
Autoradiography corresponding to membrane images. B) The relative signals from each spot on the membranes were quantied using the ImageJ software. The bars show the mean
intensity of duplicates subtracting the background intensity of the membrane. Control (C) consists in biotinylated DNA spotted on the membrane.
Fig. 4. Expression of innate immune genes in bMECs during the internalization of S. aureus stimulated by bPRL. RT-qPCR analysis showing the mRNA expression levels of DEFB1 (A),
TAP (B), TNF-a (C), IL-1b (D), IL-6 (E), IL-8 (F), and IL-10 (G). The bMECs (control) were treated with 5 ng/ml bPRL for 24 h and then challenged with S. aureus for 2 h. The data are
presented as the ratio of the target gene expression compared with the expression level of GAPDH. Each bar shows the mean of triplicates SE of three independent experiments.
The letter a indicates signicant changes (P < 0.05) compared with the untreated control cells. The letter b indicates signicant changes (P < 0.05) compared with bMECs treated
with bPRL.
50
Fig. 5. Secretion of pro-inammatory cytokines by bMECs during the internalization of S. aureus stimulated by bPRL. TNF-a (A) and IL-1b (B) protein concentrations in the cell
supernatants of bMECs that were treated for 24 h with bPRL and/or challenged for 2 h with S. aureus. The protein concentrations were determined by ELISA. The letter a indicates
signicant changes (P < 0.05) compared with the untreated control cells. The letter b indicates signicant changes (P < 0.05) compared with bMECs treated with bPRL.
51
Fig. 6. Participation of PRLR in bMECs during the internalization of S. aureus stimulated by bPRL. A) The role of PRLR signaling was analyzed by determining the activation states of
Stats transcription factors in bMECs treated for 24 h with bPRL and/or challenged for 2 h with S. aureus. The nuclear protein extracts were obtained, and the screening of transcription factors was performed using a TranSignal Protein/DNA array I (Panomics). B) The relative signals from each spot on the membranes were quantied using the ImageJ
software. The bars show the mean intensity of duplicates subtracting the background intensity of the membrane. C) The PRLR surface expression was determined by ow cytometry
analysis (a total of 10,000 events were measured). Typical population proles of non-challenged (black line) vs. challenged bMECs (red line). The secondary antibody control was
included (blue line). D) Mean of the uorescence of the non-challenged and challenged bMECs. The letter a indicates signicant changes (P < 0.05) compared with the untreated
control cells. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of this article.)
52
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
5. Conclusion
Altogether, these results show new effects of prolactin as
regulator of the innate immune response mainly through the
activation of TRL2 in one of its target tissues: the mammary
epithelium. These functions are not achieved through the canonical
activation of PRLR. In addition, our data highlight the relevance of
this hormone during bacterial infections, which has been poorly
explored. Moreover, our results strengthen the evidence that
chronic S. aureus infections maintain a low innate immune prole,
particularly in cells where the bacteria can persist intracellularly.
[16]
[17]
[18]
Conict of interest
[19]
[20]
[21]
[22]
References
[23]
[1] J.M. Rosen, R.J. Matusik, D.A. Richards, P. Gupta, J.R. Rodgers, Multihormonal
regulation of casein gene expression at the transcriptional and posttransciptional levels in the mammary gland, Recent Prog. Horm. Res. 36 (1980)
157e193.
[2] K. Svennersten-Sjaunja, K. Olsson, Endocrinology of milk production, Domest.
Anim. Endocrinol. 29 (2005) 241e258, http://dx.doi.org/10.1016/
j.domaniend.2005.03.006.
[3] Y.H. Schukken, J. Gnther, J. Fitzpatrick, M.C. Fontaine, L. Goetze, O. Holst, et
al., Host-response patterns of intramammary infections in dairy cows, Vet.
Immunol. Immunopathol. 144 (2011) 270e289, http://dx.doi.org/10.1016/
j.vetimm.2011.08.022.
[4] C. Hoffmann, K. Ohlsen, C.R. Hauck, Integrin-mediated uptake of bronectinbinding bacteria, Eur. J. Cell Biol. 90 (2011) 891e896, http://dx.doi.org/
10.1016/j.ejcb.2011.03.001.
[5] K. Dziewanowska, A.R. Carson, J.M. Patti, C.F. Deobald, K.W. Bayles,
G.A. Bohach, Staphylococcal bronectin binding protein interacts with heat
shock protein 60 and integrins: role in internalization by epithelial cells,
[24]
[25]
[26]
[27]
Infect.
Immun.
68
(2000)
6321e6328,
http://dx.doi.org/10.1128/
IAI.68.11.6321-6328.2000.
E. Brouillette, B.G. Talbot, F. Malouin, The bronectin-binding proteins of
Staphylococcus aureus may promote mammary gland colonization in a
lactating mouse model of mastitis, Infect. Immun. 71 (2003) 2292e2295,
http://dx.doi.org/10.1128/IAI.71.4.2292-2295.2003.
A. Scibelli, S. Roperto, L. Manna, L.M. Pavone, S. Tafuri, R. Della Morte, et al.,
Engagement of integrins as a cellular route of invasion by bacterial pathogens,
Vet. J. 173 (2007) 482e491, http://dx.doi.org/10.1016/j.tvjl.2006.01.010.
R.O. Hynes, Integrins: bidirectional, allosteric signaling machines, Cell 110
(2002) 673e687, http://dx.doi.org/10.1016/S0092-8674(02)00971-6.
R.A. Ridley, I. Douglas, S.A. Whawell, Differential adhesion and invasion by
Staphylococcus aureus of epithelial cells derived from different anatomical
sites, J. Med. Microbiol. 61 (2012) 1654e1661, http://dx.doi.org/10.1099/
jmm.0.049650-0.
N. Li, Y. Zhang, M.J. Naylor, F. Schatzmann, F. Maurer, T. Wintermantel, et al.,
Beta1 integrins regulate mammary gland proliferation and maintain the
integrity of mammary alveoli, EMBO J. 24 (2005) 1942e1953, http://
dx.doi.org/10.1038/sj.emboj.7600674.
M.J. Naylor, N. Li, J. Cheung, E.T. Lowe, E. Lambert, R. Marlow, et al., Ablation of
beta1 integrin in mammary epithelium reveals a key role for integrin in
glandular morphogenesis and differentiation, J. Cell Biol. 171 (2005) 717e728,
http://dx.doi.org/10.1083/jcb.200503144.
N. Rooney, C.H. Streuli, How integrins control mammary epithelial differentiation: a possible role for the ILK-PINCH-Parvin complex, FEBS Lett. 585
(2011) 1663e1672, http://dx.doi.org/10.1016/j.febslet.2011.05.014.
rate, J.E. Lo
pez-Meza, A. Ochoa-Zarzosa, Staphylococcus aureus inL. Lara-Za
hibits nuclear factor kappa B activation mediated by prolactin in bovine
mammary epithelial cells, Microb. Pathog. 51 (2011) 313e318, http://
dx.doi.org/10.1016/j.micpath.2011.07.010.
L.M. Sordillo, K.L. Streicher, Mammary gland immunity and mastitis susceptibility, J. Mammary Gland. Biol. Neoplasia 7 (2002) 135e146, http://
dx.doi.org/10.1023/A:1020347818725.
rrez-Barroso, J.L. Anaya-Lo
pez, L. Lara-Z
A. Gutie
arate, P.D. Loeza-Lara,
pez-Meza, A. Ochoa-Zarzosa, Prolactin stimulates the internalization of
J.E. Lo
Staphylococcus aureus and modulates the expression of inammatory
response genes in bovine mammary epithelial cells, Vet. Immunol. Immunopathol.
121
(2008)
113e122,
http://dx.doi.org/10.1016/
j.vetimm.2007.09.007.
M. Sasai, M. Yamamoto, Pathogen recognition receptors: ligands and signaling
pathways by toll-like receptors, Int. Rev. Immunol. 32 (2013) 116e133, http://
dx.doi.org/10.3109/08830185.2013.774391.
B. Griesbeck-Zilch, H.H. Meyer, C.H. Khn, M. Schwerin, O. Wellnitz, Staphylococcus aureus and Escherichia coli cause deviating expression proles of
cytokines and lactoferrin messenger ribonucleic acid in mammary epithelial
cells, J. Dairy Sci. 91 (2008) 2215e2224, http://dx.doi.org/10.3168/jds.20070752.
M.L. Marre, T. Petnicki-Ocwieja, A.S. DeFrancesco, C.T. Darcy, L.T. Hu, Human
integrin a(3)b(1) regulates TLR2 recognition of lipopeptides from endosomal
compartments, PLoS One 5 (2010) e12871, http://dx.doi.org/10.1371/
journal.pone.0012871.
I. Watanabe, M. Ichiki, A. Shiratsuchi, Y. Nakanishi, TLR2-mediated survival of
Staphylococcus aureus in macrophages: a novel bacterial strategy against host
innate immunity, J. Immunol. 178 (2007) 4917e4925, http://dx.doi.org/
10.4049/jimmunol.178.8.4917.
R.T. Clark, A. Hope, M. Lopez-Fraga, N. Schiller, D.D. Lo, Bacterial particle
endocytosis by epithelial cells is selective and enhanced by tumor necrosis
factor receptor ligands, Clin. Vaccine Immunol. 16 (2009) 397e407, http://
dx.doi.org/10.1128/CVI.00210-08.
R. Kapetanovic, M. Parlato, C. Fitting, V. Quesniaux, J.M. Cavaillon, M. AdibConquy, Mechanisms of TNF induction by heat-killed Staphylococcus aureus
differ upon the origin of mononuclear phagocytes, Am. J. Physiol. Cell Physiol.
300 (2011) C850eC859, http://dx.doi.org/10.1152/ajpcell.00187.2010.
pez, O.E. Contreras-Guzm
rabez-Trejo, V.M. BaizabalJ.L. Anaya-Lo
an, A. Ca
pez-Meza, J.J. Valdez-Alarco
n, et al., Invasive potential of bacAguirre, J.E. Lo
terial isolates associated with subclinical bovine mastitis, Res. Vet. Sci. 81
(2006) 358e361, http://dx.doi.org/10.1016/j.rvsc.2006.02.002.
pez-Meza, Effects of sodium octaN. Alva-Murillo, A. Ochoa-Zarzosa, J.E. Lo
noate on innate immune response of mammary epithelial cells during
Staphylococcus aureus internalization, Biomed. Res. Int. 2013 (2013) 927643,
http://dx.doi.org/10.1155/2013/927643.
llez-Pe
rez, I. Medina-Estrada, C. Alvarez-Aguilar,
N. Alva-Murillo, A.D. Te
pez-Meza, Modulation of the inammatory response
A. Ochoa-Zarzosa, J.E. Lo
of bovine mammary epithelial cells by cholecalciferol (vitamin D) during
Staphylococcus aureus internalization, Microb. Pathog. 77 (2014) 24e30, http://
dx.doi.org/10.1016/j.micpath.2014.10.006.
J.H. Gutzman, D.E. Rugowski, S.E. Nikolai, L.A. Schuler, Stat5 activation inhibits
prolactin-induced AP-1 activity: distinct prolactin-initiated signals in
tumorigenesis dependent on cell context, Oncogene 26 (2007) 6341e6348,
http://dx.doi.org/10.1038/sj.onc.1210454.
M.E. Hockett, F.M. Hopkins, M.J. Lewis, A.M. Saxton, H.H. Dowlen, S.P. Oliver,
et al., Endocrine proles of dairy cows following experimentally induced
clinical mastitis during early lactation, Anim. Reprod. Sci. 58 (2000) 241e251,
http://dx.doi.org/10.1016/S0378-4320(99)00089-5.
P. Boutet, J. Sulon, R. Closset, J. Detilleux, J.F. Beckers, F. Bureau, et al.,
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
53