Professional Documents
Culture Documents
Author Note
This Report was prepared for LIFS 4971 & 4981, supervised by Dr Chun Liang
1.
Acknowledgements ....................................................................................................... 3
2.
Abstract......................................................................................................................... 3
3.
Introduction .................................................................................................................. 3
4.
5.
6.
7.
3.1.
Background .......................................................................................................... 3
3.2.
3.3.
Objective .............................................................................................................. 6
Materials ....................................................................................................................... 7
4.1.
Oligodeoxynucleotides (Primer)............................................................................ 7
4.2.
4.3.
4.4.
Plasmids ............................................................................................................... 7
4.5.
Antibodies ............................................................................................................ 8
4.6.
4.7.
4.8.
Methods ...................................................................................................................... 10
5.1.
5.2.
5.3.
5.4.
5.5.
5.6.
Ligation .............................................................................................................. 12
5.7.
5.8.
5.9.
5.10.
5.11.
5.12.
SDS-PAGE ........................................................................................................... 14
Results......................................................................................................................... 15
6.1.
6.2.
6.3.
6.4.
Discussion ................................................................................................................... 21
8.
Reference .................................................................................................................... 24
1. Acknowledgements
It is my great pleasure to express my sincere gratitude to Prof. Chun Liang, who
is my supervisor for my final year project. His guidance and support are uttermost
essential in helping me throughout the year.
I would like to express my sincere thanks to all the people working in Prof.
Liangs laboratory. Special thanks have to be given to Dr. Aftab Amin, who taught
and supported me a lot since the first day I joined the laboratory. I am grateful to a
number of postgraduates and technicians who offered great support during my time in
the laboratory
KAN, Chun Him
May 2015
2. Abstract
fad24 (factor for adipocyte differentiation, clone number 24) was found to be a
human homolog of the Noc3p (Nucleolar complex-associated protein). In our study,
fad24 is found to be self-interacting. It possesses two self-interacting motifs which are
also coiled-coils. The first motif is positioned in region from amino acid 1 to 150 while
the second one lies in between amino acid 400 and 599.
3. Introduction
3.1. Background
fad24 encodes a protein consisting of 801 amino acids. The amino acid sequence
of fad24 was found to have a basic leucine zipper motif and a NOC domain
human as well. Therefore, the fad24 was targeted in our study to search for
self-interacting domain(s).
3.2. The Yeast Two-Hybrid System
In our study, the yeast two-hybrid (Y2H) was used.
If the desired protein pair interacts, the AD and BD will be brought together to
recruit other transcription factors and RNA polymerase II to kick-start expression of
the reporter genes (fig 1). Interaction between the bait (BD-fused protein) and the prey
(AD-fused protein) allows the transformant to express HIS3. Hence, the yeast can
synthesis Histidine and thus capable of growing in SCM-L-T-H plate (SCM minus
leucine, tryptophan and histidine). Strong interaction between the bait and the prey
allows the transformant to express HIS3 and ADE2. Hence, the yeast can synthesis
Histidine and Adenine. Consequently, it is now capable of growing in SCM-L-T-H-A
plate (SCM minus leucine, tryptophan, histidine and adenine). It is important to assume
that the inserted protein can neither be an AD or a BD for the system to work.
3.3. Objective
In our study is to investigate the possibility of self-interaction in fad24. If
self-interaction is possible, we would like to map out any self-interacting motif.
Therefore, we divide the fad24 into the 10 fragments (1-10 as in figure) according to
the coiled-coil analysis (by MULTICOIL) and multiple sequence alignment analysis
(by Clustal W2). We have designed overlapping sequence for double-checking.
4. Materials
4.1. Oligodeoxynucleotides (Primer)
Name
Sequence
F hNoc3 0 - 150
GAATCCCATATGATGAAGGCGAGAAGAAA
R hNoc3 0 - 150
GAATCCCTTAAGCTAAATCAGTTCCTTCTCTGGT
GAATCCCATATGGCACCAGAGAAGGAACTGATT
GAATCCCTTAAGCTACATCAGAGAAACAATTACC
GAATCCCATATGCCTTCATATAAAATCCGGCCCC
GAATCCCTTAAGCTAAAGAGAAGCCTGGCCTAA
GAATCCCATATGGTGATTTCTGGTTTTGTGAAGGG
GAATCCCTTAAGCTAACCTTCATTGGTAGCACC
GAATCCCATATGGAGATTGTACTCCAGTG
GAATCCCTTAAGCTAGTGTAGTGATGT
Genotype
MATa,
trp1-901,
leu2-3,
112,
ura3-52,
his3-200,
gal4 ,
gal80 ,
LYS2::GAL1UAS-GALATATA-HIS3,GAL2UAS-GAL2TATA-ADE2,
URA::mel1UAS-MEL1TATA-lacZ, MEL1 (from Clontech, MountainView, CA)
4.4. Plasmids
Name
Description
Abbrevation
pGADT7
AD
pGBKT7
BD
4.5. Antibodies
Description
Name
Anti-Myc (Mouse)
Roche
Anti-HA (Mouse)
Roche
secondary antibody
Description
LB medium
LB + Amp.
LB + Kan.
SOC
YPD medium
SCM Mix
Agar plate
Description
1 M Tris-HCl, pH 9.0 10 ml, 20% SDS 10 ml, 500 mM EDTA, pH 8.0 2 ml,
add H2O to 100 ml
Transfer buffer
NaHCO3 1.05g, Na2CO3 0.901g, Mehnanol 300 ml, 10 N NaOH 0.9 ml,
add H2O to 2L
TBST buffer
1 M Tris-HCl, pH 7.4 40 ml, NaCl 8 g, KCl 0.2 g, 20% Tween 20 5 ml, add
H2O to 1 L
50x TAE
H2O to 1 L
2x Laemmlis buffer
60% Glycerol 37 ml, 20% SDS 33.3 ml, 1 M Tris-HCl, pH 6.9 13.9 ml, add
H2O to 100 ml
Bromophenol blue 0.25 g, xylene cyanol FF 0.25 g, 60% Glycerol 10 ml, add
H2O to 100 ml
2.
2.
DNA markers:
1.
Western Blotting:
1.
2.
3.
4.
5.
6.
Protein marker
5. Methods
10
(ethidium bromide) for 10 minutes and de-stained with distilled eater for 10 seconds.
UV at 254 nm was used to visualize the bands by employing the UV transilluminator
(Bio-Rad ChemiDoc XRS Gel Photo Documentation System).
5.4. DNA extraction from agarose gel
Target DNA fragments of digested inserts and plasmid were separated by gel
electrophoresis. After staining, the desired band was cut and purified with QIAEX
Gel Extraction Kit.
To one volume of gel slice, three volumes of Buffer QX I and 20 ul QIAEX II
were added, and the mixture was incubated at 55oC for 10 min during which it was
gently vortexed every 2 minutes. (If solution turned orange or purple, Sodium acetate
(5 M) can be used to modify the pH until the color is yellow.) After spinning at 13,000
rpm for 30 seconds (same setting for all other centrifugation in gel extraction),
supernatant was removed and re-suspended with 500 ul of QX1. This procedure was
repeated twice using PE buffer instead. The pellet was then air-dried for 10~15 minutes.
After that, it was re-suspended with 20 ul of sterile water and incubated at room
temperature for 5 minutes. After spinning, supernatant was removed and stored at
-20oC
5.5. Determination of DNA concentration
UV absorbance at 260 nm for each digestion product (50 fold dilution by sterile
water) was checked. The concentration of sample would be (absorbance*50*50)
ng/ul.
5.6. Ligation
20 ul of Ligation mixture contain insert, vector, 1ul of T4 DNA Ligase, 2ul of
T4 DNA Ligase buffer and water. The mole ratio of vector to insert is 1:3. After
mixing, the reaction mixture was stored at 4oC for overnight.
5.7. Transforming E. coli with plasmids
Some 10 ul of plasmids were mixed with 100 ul of E. coli competent cells for one
transformation, and the mixture was incubated on ice for 30 min. The mixture was then
heat shocked at 42oC for 1.5 min, and some 250 ul of SOC were added to the cells. The
mixture was incubated at 37oC for 1 hr for the cells to recover. Finally, the cells were
plated on LB selective plates and incubated at 37oC for overnight. (pGADT7
transformed E. coli required Ampicillin while pGBKT7 transformed E. coli required
Kanamycin).
5.8. Plasmid Extraction form Transformed E. coli
TIANprep Mini Plasmid Kit was used and procedure followed the manufacturer
manual.
5.9. Transforming budding yeast with plasmids
Starter culture was generated by picking a single colony of yeast cells from the plate
and put into 5 ml of medium and growing the culture overnight in 25oC. The starter was
then diluted in 50 ml YPD to O.D 0.2 (at 600 nm) and cultured at 30oC until the O.D
reached 1. The cells were then harvested into a 50 ml falcon tube (sufficient for 10 full
transformations). Cells were washed with 20 ml of sterile H2O and re-suspended with 1
ml of sterile water. After being transferred into a new Eppendorf tube, the cells were
spun down again, and 500 l of 0.1 M LiAc were added to the tube. The mixture was
then shaken at room temperature for 15 min.
temperature for 15 min. The mixture was then spun down, and the cell pellet was added
with Laemmlis buffer (with 2-mercaptoethanol) and boiled for 5 minutes. Samples
were stored at -20oC and then used for SDS-PAGE later.
5.12. SDS-PAGE
Yeast protein samples were separated by SDS-PAGE. The stacking gel was 5%
while the resolving gel was 12.5%. Separation was performed on a Slab Gel system.
Proteins were first stacked in the stacking gel under electric field of 60-80 V and then
separated in the resolving gel at 120-160 V.
When the tracking dye reached the desired position, the proteins were transferred
onto a nitrocellulose membrane (pore size 0.2 or 0.45 m) in the transfer buffer using
the Electrophoretic Blotting Systems. Protein transfer was carried out at constant
current of 500 mA for 1.5 hours.
The membrane was stained with Ponceau S working solution (0.5% Ponceau S in
1% acetic acid). The protein marker was marked by pencil after rinsing. The
membrane was then de-staining with TBST buffer. After that, it was blocked with 5%
non-fat milk in TBST for 30 minutes. Next, it was incubated with the primary
antibody for overnight at 4oC with agitation. The membrane was washed with TBST
for three times with agitation for 10 minutes each and then incubated with the
secondary antibody conjugated with HRP (horseradish peroxidase) for 2 hours at
room temperature followed by three washes by TBST as aforementioned.
The membrane was then mixed with SuperSignal chemiluminescence substrate
for 5 minutes. Excess substrate was drained off and exposed to light-sensitive X-ray
films (Fuji) immediately. Finally, the films were developed in a film-processing
developer (Kodak) in a dark room.
Monoclonal antibody (mAb) used in the study includes anti-HA antibody (12CA5)
from Roche at 1:20,000 dilution and anti-Myc antibody (9E10) from Roche at 1:
5,000 dilution. Second antibody used includes HRP-coupled anti-mouse (1:20,000 in
TBST containing 5% non-fat milk).
6. Results
6.1. Bioinformatics Analysis
Using peptide sequence from NCBI and multiple sequence alignment tool Clustal
W 2.1, substantial homology was found among many existing species as shown in
figure 3.
Fig. 3: Matrix showing the percentage identity among species (from Clustal W2)
P.S. : (Same order as following figures)
1: Homo Sapien
2: Pan troglodytes
3: Pongo abelii
4: Mus musculus
5: Rattus
6: Gallus gallus
5: Danio rerio
8: Drosophila
9: Saccharomyces cerevisiae
From the previous study on Noc3p in our lab, a particular sequence was found to
be conserved among species especially Homo Sapien and Saccharomyces cerevisiae.
Using the MULTICOIL analysis, the sequence was found to be a coiled-coil (fig 4)
(CC2 accroding the previous study in the lab (Wu, 2011)). It was found to be one of
the self-interacting motif of Noc3p of budding yeast.
Fig. 5: Assembly of the Screenshot of Multicoil result from Species (from Multicoil)
Other than this sequence, one other coiled coil was found to be shared among
species. It is called CC1 (from amino acid 1 to 169) for Noc3p (Wu, 2011) and found
to be self-interacting motif as well. Although little similarity was found between the
exact amino sequences of that coiled coil of fad24 (of Homo sapien) and Noc3p (of
Saccharomyces cerevisiae), it is also intriguing to investigate the possibility of
self-interaction of the coiled-coil of fad24.
6.2. Successful Molecular Cloning
All of the vectors used were successfully inserted into competent E. coli. The
plasmids were extracted by miniprep. After that, the extracted DNA was under
restriction digestion by Nde1 and EcoR1. The digested DNA were separated by
agarose gel electrophoresis and then visualized. It was found that the fragment fitted
into the corresponding size of the inserts and the plasmid. It preliminarily shows that
the inserts are positioned properly into the vectors. In order to confirm the sequence
of insertion, some volume of each transformed E. coli were sampled and sent for
sequencing (by BGI). Sequences of the insert fit in our desired sequence. Hence, the
plasmid extracted from the E. coli can be used for subsequent transformation of yeast
for the yeast two-hybrid system.
Fig.6: Double Restriction Digestion of the Plasmids Extracted from E. coli Transformed with AD
ligated with various inserts (Accompanied with a 1 kb DNA ladder)
P.S. :
(The Lanes of the above Figure follow the following order & M represents for 1 kb DNA ladder)
1:
AD-Full Length
2:
AD-Fragment 1
3:
AD-Fragment 2
4:
AD-Fragment 3
5:
AD-Fragment 4
6:
AD-Fragment 5
5:
AD-Fragment 6
8:
AD-Fragment 7
9:
AD-Fragment 8
10: AD-Fragment 9
11: AD-Fragment 10
Fig.7: Double Restriction Digestion of the Plasmids Extracted from E. coli Transformed with BD
ligated with various inserts (Accompanied with a 1 kb DNA ladder)
P.S. :
(The Lanes of the above Figure follow the following order & M represents for 1 kb DNA ladder)
1:
BD-Full Length
2:
BD-Fragment 1
3:
BD-Fragment 2
4:
BD-Fragment 3
5:
BD-Fragment 4
6:
BD-Fragment 5
5:
BD-Fragment 6
8:
BD-Fragment 7
9:
BD-Fragment 8
10: BD-Fragment 9
11: BD-Fragment 10
monoclonal antibodies anti-HA and anti-Myc can be used to probe for the AD-fused
protein and BD-fused protein respectively. We have only checked the expression of
particular group of the transformants as stated below:
Transformants with Expression Checked
AD vector/ BD vector
AD FL/ BD vector
AD F1/ BD vector
AD F3/ BD vector
AD F4/ BD vector
AD F5/ BD vector
AD F7/ BD vector
AD F8/ BD vector
AD F9/ BD vector
AD vector / BD FL
AD vector / BD F1
AD vector / BD F3
AD vector / BD F4
AD vector / BD F5
AD vector / BD F7
AD vector / BD F8
AD vector / BD F9
Table 1: Transformants with Expression Checked
AD F2/ BD vector
AD F6/ BD vector
AD F10/ BD vector
AD vector / BD F2
AD vector / BD F6
AD vector / BD F10
The transformants have found to contain the protein of desired molecular weight
(fig 8 &9).
Fig 8: Result of the Expression Check (For AD-fused protein: Probed with anti-HA/ anti-mouse)
Fig 9: Result of the Expression Check (For BD-fused protein: Probed with anti-myc/ anti-mouse)
(AD-F3 interact with BD-F8, but not the other way). Most importantly, F1 and F3 can
self-interact.
7. Discussion
From the aforementioned result, the following interpretation was given.
Regarding the yeast two-hybrid result, full length fad24 was found to be
self-interacting. The possibility of false positive due to possibility of fad24 or its
fragment being either a DNA binding domain or activation domain was refuted as any
transformant with AD- or BD- fused protein alone failed to survive. Besides, we have
tested the interacting partners in reverse way and introduce multiple overlapping
fragments.
Furthermore, there was direct evidence proving the presence of the
self-interacting motifs. To begin with, fragments 1 and 3 interact with themselves but
not with each other. That means that fragment 1 and 3 alone are independent
self-interact motifs.
Indirect evidence was found to prove the presence of the two motifs as shown in
Fig 13 and 14. Fragment 5 contains the F1 region (first coiled-coil) and hence it can
interact with fragment 7 and full length fad24. Fragment 7 contains both coiled-coils
and thus interacting with fragment 1, 3, 5 and full length fad24.
One point of note is that some additional interaction pairs were found. First,
fragment 9 interacts with full length fad24 and fragment 7 but not to itself. Second,
fragment 2 interacts with full length fad24 but does not self-interact. One speculation
is that the self-interacting motif exactly extends slightly into fragment 9. Hence,
fragments containing fragment 9 can weakly interact. Other speculation is false
positive aroused from the yeast two-hybrid system as false positives are known to
happen using the system. However, this is not likely as interacting pairs between these
fragments worked in both ways.
From the yeast two-hybrid result, some strange result is found. F6 and F8 both
contain F3 but fail to interact with itself or other. One possibility is that the additional
parts on F6 and F8 hinder the CC2 in interacting.
Fig.13: Diagram showing fad24 dissection and position of F1 & F3 in each fragments
Nevertheless, some more study may be needed to further verify the result. IP/coIP
is highly recommended for all those transformants but the effort in investigating all
144 combinations would be huge. We can also try using the approach used in the
previous study about Noc3p self-interaction (Wu, 2011) like using versions of fad24
with deletion of the coiled-coils in the yeast two-hybrid system. GST pull down, ICT
and FRET are some possible choices as well.
There are some possible field for future study. It would be ideal if we can explore
further like how, when and where the fad24 self-interacts. Moreover, we can also try
some functional study of fad24. It is because Noc3p has separate functions like DNA
replication initiation, RNA biogenesis and even transcription factor. Hence, it is
8. Reference
CLONTECH (1999, June 22) MATCHMAKER GAL4 Two-Hybrid System 3
& Libraries User Manual pp1-38
Nacalai USA, Inc. (n.d.) DNA Ladder Retrieved 23 April 2015 from
https://www.nacalaiusa.com/product.php?id=90
Tominaga.K, Johmura.Y, Nishizuka.M and Imagawa. M (2004, September 16)Fad24,
a mammalian homolog of Noc3p, is a positive regulator in adipocyte
differentiation, Journal of Cell Science 117, pp 6217-6226,
doi:10.1242/jcs.01546
WU.R.T (2011, July) Studies of DNA Replication-Initiation Proteins in the Budding
Yeast Saccharomyces cerevisiae, HKUST, pp1-286
Zhang. Y.X. , Yu. Z.L., Fu. X.R. and Liang. C., (2002, June 28) Noc3p, a bHLH Protein,
Plays an Integral Role in the Initiation of DNA Replication in Budding Yeast,
Cell, Vol. 109, 849860