DNA Sequence, June 2007; 18(3): 196202

FULL LENGTH RESEARCH PAPER

Isolation and characterization of a lectin gene from seeds of chickpea

(Cicer arietinum L.)*
1

INSAF A. QURESHI , PREM S. SRIVASTAVA & KIRPA R. KOUNDAL

1

NRC on Plant Biotechnology, I.A.R.I., New Delhi 110012, India, and

Hamdard, New Delhi 110062, India

Department of Biotechnology, Jamia

(Received 2 March 2006)

informahealthcare.com by University of S.A Lib 119257 on 11/14/12

Forpersonaluseonly.

Abstract

Una biblioteca de cDNA se construy en el vector l TriplEx2 utilizando poli (A TH) de ARN a
partir de semillas inmaduras de Cicer arietinum. El gen de la lectina fue aislado a partir de semillas
de garbanzo a travs de la biblioteca de deteccin y RACE-PCR. El ADNc de longitud completa de
la lectina de la semilla Chichpea (CpGL) es 972 pb y contiene un marco de lectura abierto de 807
pb que codifica una protena de 268 amino cidos. El anlisis muestra que los genes CPSL tiene una
fuerte homologa con otros genes de lectina de leguminosas. El anlisis filogentico mostr la
existencia de dos grupos principales y claramente indic que CPSL perteneca a la familia
especfica de manosa de las lectinas. RT-PCR revel que el gen CAA expresa constitutivamente en
diversos tejidos de plantas incluyendo flores, hojas, raz y tallo. Cuando el nivel de ARNm de
garbanzos lectina se comprob en las semillas en desarrollo, fue superior en 10 semillas DAF y
disminuy durante todo el desarrollo de la semilla.
Keywords: Cicer arietinum, expression analysis, leguminosae, lectin gene, nucleotide sequencing

Mitochondrial DNA Downloaded from

Introduction
Las lectinas son un grupo grande y heterogneo de
protenas que tienen la capacidad de unirse
reversiblemente a un mono-o-oligosacrido especfico
(Van Damme et al. 1998). Se distribuyen de forma ubicua
en la naturaleza y son ms abundantes en las plantas, en
las que se pueden encontrar en las semillas, hojas,
cortezas, bulbos, rizomas, races y tubos en funcin de
los tejidos de las plantas (Lis y Sharon 1986; Gupta et al.,
2004). Sin embargo, la mayora de estudios sobre lectinas
han llevado a cabo en las legumbres, en particular, las
semillas en el que comprenden hasta 15% de la protena
total. Sobre la base de las relaciones evolutivas y
estructural, siete familias de lectina se han distinguido, de
los cuales lectinas de leguminosas se caracterizan mejor
(Peumans y Van Damme 1998). Aunque las lectinas se
han estudiado ampliamente con respecto a los hidratos de
carbono especificidad de unin y utilidad potencial para
el aislamiento y caracterizacin de glicoconjugados, las

papel fisiolgico en las plantas an no est bien

entendido. Funciones propuestas para lectinas de plantas
incluyen una funcin de almacenamiento o transporte
para los hidratos de carbono en las semillas, la unin de
las bacterias fijadoras de nitrgeno de los pelos radicales,
y la inhibicin de la proliferacin de hongos o la
alimentacin del insecto (Daz et al., 1989).
Los genes que codifican lectinas han sido aislados de
especies de plantas y algunos incluso se han transferido a
los cultivos por ingeniera gentica. Los cultivos
transgnicos que expresan lectinas insecticidas han
demostrado una mayor resistencia a una o ms plagas de
insectos de diferentes rdenes incluyendo fidos (Jouanin
et al 1998;. Carlini y Grossi-de-Sa 2002). Por lo tanto, la
explotacin de estos genes de resistencia a insectos
podra proporcionar una opcin adecuada para mejorar el
control de plagas. En el presente estudio, se describe la
clonacin de un gen de la lectina de las semillas de Cicer
arietinum. Los niveles de expresin de la lectina tambin
se investigaron en diferentes tejidos, incluyendo el
desarrollo de la semilla.

Correspondence: K. R. Koundal, NRC on Plant Biotechnology, I.A.R.I., New Delhi 110012, India. Tel: 91 11 25848783. Fax: 91 11 25843984.
E-mail: kirparam@rediffmail.com
*The nucleotide sequence reported in this paper have been submitted to the GenBank and is available under the accession no. AY221982.
ISSN 1042-5179 print/ISSN 1029-2365 online q 2007 Informa UK Ltd.
DOI: 10.1080/10425170601060608

Materials and methods

Plant materials

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

Las plantas de garbanzo (Cicer arietinum L.) cv. P256

fueron cultivadas en el campo experimental de Indian
Agricultural Research Institute, de Nueva Delhi. Las
semillas en diversas etapas de desarrollo se aislaron y se
congelaron inmediatamente en nitrgeno lquido para el
aislamiento de ARN. Las semillas esterilizadas con
cloruro de mercurio 0,01% tambin fueron germinadas en
el agua empapado papel de filtro en la oscuridad.
Despus de 10 das, las plntulas etioladas se recogieron
y se congelaron inmediatamente en nitrgeno lquido
para el aislamiento de ADN genmico.
Southern blot analysis
ADN genmico total fue aislado de plantas de semillero
etioladas segn Dellaporta et al. (1983). El ADN
purificado (10 mg) se restringi durante la noche con Eco
RI y Bam HI en 378c y electroforesis en 0,8% en gel de
agarosa, segn el protocolo del Sur (1975). Las muestras
restringidas en gel de agarosa se transfirieron a un
Hybond N membrana (Amersham) segn las
instrucciones y de fabricacin hybri-dized con sonda
radiomarcada de cDNA guisante lectina.
1

Isolation of poly (A) RNA

El ARN total a partir de semillas inmaduras (10 das
despus de la floracin) se aisl mediante el mtodo de
Salzman et al. (1999) y cualitativamente comprobado en
1% de gel de formaldehdo de agarosa. El poli (A)
ARN se separan a partir de ARN no adenilado usando
poli (A) kit de aislamiento de mRNA Quick (Stratagene)
segn las instrucciones del fabri-tura.
Construction of cDNA library
La biblioteca de ADNc se sintetiz mediante el kit
de construccin de bibliotecas de ADNc SMART
(Clontech). La primera cadena de
Aislamiento y caracterizacin de un gen de la
lectina de cDNA fue sintetizado a partir de poli (A)
ARN y se amplific por PCR LD. El producto
amplificado se analiz en gel de agarosa al 1,1%
junto con 0,1 mg de marcador de ADN 1 kb. El
cDNA se digiri con Protena-asa K y luego
restringido con Sfi I. Fue el tamao fraccionado por
columna CHROMA SPIN-400 y electroforesis en gel
de agarosa al 1,1% junto con 0,1 mg de marcador
de ADN de 1 kb. Las fracciones que contenan
fragmentos anteriores 1 kb se agruparon y se
precipitaron durante la noche con etanol absoluto y
se resuspendieron en agua destilada estril. El
ADNc (500 ng) se mantuvo durante la noche con
los brazos de lTriplEx2 vectores estn en 168C para
la ligadura. Se aadi el ADN ligado en el extracto
de Packgene y se incub a 228C durante 3 horas y
luego se adsorbe en E. coli XL1-Blue. Se plate
posteriormente y se determin ttulo de la biblioteca
no amplificada.

Screening of cDNA library

Para el cribado primario, 3 ml de 10 23 dilucin en
tampn SM (NaCl 100 mM MgSO TH10 mM 4 TH20
mM de Tris-Cl pH 7,5 0,1% de gelatina) se mezcl con
600 ml de clulas E. coli XL-1 Blue y se mantuvo
durante 15 min a 378c para la adsorcin de fagos. El
cultivo transfectado se mezcl con 10 ml de agar superior
NZY fundido, se enfra a 458C y se verti en placas de
NZY (5 g de NaCl Th2 g MgSO 4 .7H 2 O 5 g de
extracto de levadura TH10 g NZ amina TH15 g de agar
por medio de 1.000 ml , pH 7,5). Las placas se incubaron
a 378c durante 10 h hasta que las placas bien separadas
aparecieron. Las placas fueron levantadas en Hybond N
membrana (Amersham), y se prepar para la hibridacin
por desnaturalizacin, neutralizacin y un aclarado en 2
SSC seguido de coccin a 808C durante 2 h se sec al
aire. Las transferencias fueron pre-hibridado y, a
continuacin se hibrid con el guisante heterlogo sonda
de ADNc de lectina. Para el cribado secundario, cada uno
de los clones seleccionados se sembr y otra vez
hibridado. Para una confirmacin adicional de estos
clones positivos, terciaria la deteccin se llev a cabo
mediante la deteccin de clones individuales en el csped
bacteriano en placas duplicadas y se procesa como se
describe. Estos clones se convirtieron a lTriplEx2
pTriplEx2 y se digirieron con Sfi I. Las muestras
restringidas se transfirieron a una membrana Hybond N
y se hibridan con la sonda de cDNA de la lectina de
guisante.

Figure 1. AD. A, B. Agarose gel electrophoresis and Southern hybridization of restricted chickpea genomic DNA, Lane M. Marker l/ Hind III, 1.
Chickpea genomic DNA digested with Bam HI, 2. Chickpea genomic DNA digested with Eco RI; C, D. Agarose gel electrophoresis and Southern
hybridization of restricted cDNA clones, Lane M. Marker l/ Eco RI Hind III, Lanes 1-3. Chickpea lectin clone digested with Sfi I.

198 I. A. Qureshi et al.

5 Extension of the cDNA clone

First Choicee RLM-RACE kit (Ambion) was used to
0

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

obtain the 5 nucleotide sequences of CpLac clones.

Based on the sequence of CpLac clones, specific primers

0
0
Cpl 1 (5 -TGCTCCTGTGGTAG CTGAGA -3 ) and Cpl
0
0
2 (5 - CCCACTCAGTAA-CAACATCC -3 ) were
0
designed to amplify the 5 end. Total RNA was first
treated with calf intestinal phosphatase (CIP) and then
with tobacco acid pyrophosphate. A 45 base RNA adapter
oligonucleo-tide was ligated to RNA using T4 RNA
ligase. The first round of PCR was performed with
0
0
primer Cpl 1 and 5 RACE outer primer (5 0
GCTGATGGCGA-TGAATGAACACTG -3 ). It was
reamplified with

Figure 2. The cDNA sequence and deduced amino acid sequence of chickpea seed lectin (CpSL). The start codon is underlined and stop codon is
italicized and underlined.

For personal use only.

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12

Isolation and characterization of a lectin gene

199

Figure 3. Alignment of deduced amino acid sequence of CpSL (chickpea seed lectin) with other legume lectins: CAA47011 from Pisum sativum;
CAC42124 from Lens culinaris; CAF18558 from Lathyrus sativus and CAD27484 from Vicia faba. Identical amino acid residues are indicated
with yellow. The amino acid residues identical among any two of the five lectins are indicated with gray. The amino acid residues different from other
lectins are indicated with black.
0

primer Cpl 2 and 5 RACE inner primer (5 CGCGGATCCGAACACTGCGTTTGCTGG0

CTTTGATG -3 ). The PCR product (750 bp) was
purified and cloned into pGEM-T easy vector (Promega)
followed by sequencing.
Sequence analysis
Multiple sequence alignment was performed by the
ClustalW (clustalw.genome.jp) programme. The phylogenetic tree was constructed on the basis of deduced
amino acid sequences of CpSL and other legume lectins
using ClustalX and Treeview version 1.6.5.
Expression analysis of chickpea lectin
Total RNA was isolated from various plant tissues
including leaf, root, stem and inflorescence of chickpea
according to the method of Salzman et al. (1999). PCR
was employed after reverse transcription to study the
levels of expression in different tissues. To ensure that the
samples were free of DNA, the RNA

samples were treated with RNase-free DNase prior to the

reverse transcription. RT-PCR analysis was carried out
using one step RT-PCR kit (Qiagen) according to the
0
manufacture s instruction. Based on the sequence of
0
0
CpSL, 5 - Cpsl (5 - GGCAGAGCCCTCTATT-CCTC
0
0
0
-3 ) and 3 - Cpsl (5 - TGCTGCATATTCT-GCTCCTG
0
-3 ) were designed for RT-PCR. Simul-taneously, for the
expression of lectin during seed development, flowers
from field grown plants were tagged at anthesis. Pods
were harvested at 5 day interval starting from 10th day
after flowering (DAF) till maturity and total RNA was
isolated from seeds of different stages of development.

Results and discussion

Southern blot analysis
Chickpea genomic DNA restricted with Eco RI and Bam
HI hybridized strongly with pea lectin cDNA probe
(Figure 1A, B), even though the probe was heterologous,
it hybridized at high stringency.

200 I. A. Qureshi et al.

CpSL
94
CAA470
41
CAF185
99
CAC421

100

CAD274
100

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

CAA429
100

CAA763
CAD288

100

CAF185

49
60

P050
BAA364

54
CAA369
Figure 4. Phylogenetic tree analysis of CpSL (chickpea seed lectin) with
other legume lectins: CAA47011 from Pisum sativum; CAF18558
from Lathyrus sativus; CAC42124 from Lens culinaris; CAD27484
from Vicia faba; CAA42937 from Medicago truncatula; CAA76366
from Medicago sativa; CAD28836 from Phaseolus vulgaris;
CAF18557 from Vigna unguiculata; P05046 from Glycine max;
BAA36415 from Robinia pseudoacacia and CAA36986 from
Erythrina corallodendron. Number shown in the node indicates the
branch was supported with bootstrap value out of 1000.

This suggests considerable sequence homology between

pea and chickpea lectin genes. Such kind of intergeneric
homologies have been reported between the legume
genera, Pisum sativum, Canavalia gladiata
(Yamauchi and Minamikawa 1990) and Vigna
unguiculata (Datta et al. 2000). The pea lectin cDNA
probe was further used for screening the cDNA library of
chickpea for the presence of lectin clones.

cDNA library
Of 5 mg of total RNA obtained from 5 g of immature
chickpea seeds, 2 mg was purified using oligo (dT)

cellulose column that yielded 50 mg of poly (A) RNA.

The synthesized cDNA was in the range of 0.5-5 kb. The
restricted cDNA was size fractioned by CHROMA SPIN400 column, 500 ng of fractioned cDNA was ligated with
500 ng of Sfi I restricted lTriplEx2 vector. The ligated
mixture was packaged in vitro in packaging extract. The
cDNA library of
Isolation and characterization of a lectin gene

201

1 10 pfu/mg DNA was a good packaging ratio for

higher eucaryotes. When this library was plated on X-gal
and IPTG plate, it gave 95% recombinant plaques.
cDNA lectin clone
After primary and secondary screening, ten positive
clones were identified. When these were confirmed by
tertiary screening, five positive clones hybridized
strongly. Among five clones, three produced large
inserts while the size of other two was less than 200
bp and these were excluded from further studies. The
three tertiary clones designated as pCpL1, pCpL2 and
pCpL3 showed an insert of 0.9 kb. The inserts showed
strong hybridization with pea lectin cDNA probe
(Figure 1C, D). These were sequenced and were
found to be of 805 nucleotides. Sequence analysis
though confirmed its homology with other legume
0
lectins, but 5 nucleotide sequences were not present.
0
The 5 nucleotide sequences of CpL were obtained by
0
5 RACE, and full-length clone of chickpea seed lectin
(pCpSL) was cloned in pGEM-T vector.
Sequence analysis of chickpea lectin
The 972 bp full-length cDNA of CpSL is very similar in
size to other legume lectin genes, such as, pea (Gatehouse
et al. 1987), soybean (Vodkin et al. 1983) and lentil
(Galasso et al. 2004). ORF analysis showed that the
longest open reading frame was between 1 807
nucleotides in the first reading frame (Figure 2). On
translation this gives a putative protein product of 268
amino acids with a molecular mass of 29,515.9 Da that
fairly correlates with other legume lectins (Young and
Oomen 1992). The total number of bases translated in the
open reading frame is 807 with A T (59%) and C G
(41%), which is also in conformity with those of other
leguminous species (Sharma and Surolia 1997; Datta et
al. 2000).
The database search with ClustalW showed
considerable homology ranging from 83 to 97% with
other legume lectin genes (Figure 3). The sequence of
pCpSl is 97% identical to amino acid sequence of Psl
lectin from Pisum sativum (CAA47011) and has 92%
homology with lectin from Lens culinaris (CAC42124),
91% with lec 1 from Lathyrus sativus (CAF18558) and
83% with lec 1 from Vicia faba (CAD27484).
To investigate the evolutionary relationship among
different legume lectins, a phylogenetic tree was
constructed on the basis of deduced amino acid
sequences of CpSL and other legume lectins. As shown in
Figure 4, legume lectins formed two distinct clusters. The
first cluster comprised lectins from
Pisum sativum, Lathyrus sativus, Lens culinaris, Vicia
faba, Medicago truncatula and Medicago sativa. The
second cluster included lectins from Phaseolus vulgaris,
Vigna unguiculata, Glycine max, Robinia pseudoacacia

ues of chickpea, Lane M. Marker l/ Eco RI Hind III, Lanes 15. Total RNA from: 1, flower; 2, leaf; 3, root; 4, stem; 5, seed; Lane 6, Negative control; B. Expression
M. Marker l/ Hind III, Lanes 1-6. Seeds from: 1, 10 DAF; 2, 15 DAF; 3, 20 DAF; 4, 25 DAF; 5, 30 DAF; 6, 35 DAF; Lane 7, Negative control.

worth noting that mannose/ glucose specific

tyl galactosamine lectins on the other hand
ch were shown in cluster I was distantly

cer arietinum, total RNA was isolated from

owed by PCR. An amplicon of 550 bp
e 5A) indicates that perhaps CpSL is indeed
ion of lectin gene has been observed in all
wed similar lectin expression at the protein
plifolia. Constitutive expression of lectin in
um asiaticum (Chai et al. 2003),
ma heterophyllum (Zhao et al. 2003).
wth related. The relative quantity of CpSL
on the developmental stage. The amplicon
creasing throughout seed development; the
r findings are consistent with the study on
rg et al. 1983). Hybridization experiments
maximized at mid-maturation stage but not
that stage-specific activation and repression
nd that the transcriptional process plays an

eed lectins of leguminous family possess

Powell 2001). The chickpea lectin gene can
a wide range of insects can be tested.

Being of plant origin, lectin genes will have high degree of compatibility with the
transgenic host plants and hence expected to provide sustained protection against sap
sucking insects, which cause major losses to crops.
Acknowledgements
This work was carried out under the financial assistance from the National
Agricultural Technology Project (Mission Mode), ICAR, New Delhi. We thank Drs S.
Anandhan and Ramesh Bhat for their help during this work.
References
Carlini CR, Grossi-de-Sa MF. 2002. Plant toxic proteins with insecticidal properties. A review on their
potentialities as bioinsecticides. Toxicon 40:1515 1539.
Chai Y, Pang Y, Liao Z, Zhang L, Sun X, Lu Y, Wang S, Tang K. 2003. Molecular cloning and
characterization of a mannose-binding lectin gene from Crinum asiaticum. J Plant Physiol 160:913
920.
Datta S, Kansal R, Koundal KR. 2000. Construction of cowpea (Vigna unguiculata L) cDNA library and
characterization of an isolated lectin gene. J Plant Biochem Biotech 9:6771.
Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA minipreparation: Version II. Plant Mol Biol Rep
1:1921.
Diaz C, Melchers LS, Hooykaas PJJ, Lugtenberg BJJ, Kijne JW. 1989. Root lectins as determinant of host
plant specificity in the Rhizobium-legume symbiosis. Nature 338:579581.
Galasso I, Lioi L, Lanave C, Bollini R, Sparvoli F. 2004. Identification and isolation of lectin nucleotide
sequences and species relationships in the genus Lens (Miller). Theor Appl Genet 108:10981102.
Gatehouse AMR, Davison GM, Stewart JN, Gatehouse LN, Kumar A, Geoghegan IE, Birch ANE,
Gatehouse JA. 1999. Con-canavalin A inhibits development of tomato moth (Lacanobia oleracea) and
peach-potato aphid (Myzus persicae) when expressed in transgenic potato plants. Mol Breed 5:153
165.
Gatehouse JA, Bown D, Evans IM, Gatehouse LN, Jobes D, Preston LP, Croy RR. 1987. Sequence of the
seed lectin gene from pea (Pisum sativum L.). Nucleic Acids Res 15:7642.
Goldberg RB, Hoschek G, Vodkin LO. 1983. An insertion sequence blocks the expression of a soybean
lectin gene. Cell 33:465475.
Gupta N, Narula A, Srivastava PS. 2004. Purification and characterization of lectin from seeds of Delonix
regia. J Plant Biochem Biotech 13:141144.

202 I. A. Qureshi et al.

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

Jouanin L, Bonade-Bottino M, Girard C, Morrot G, Giband M. 1998.

Transgenic plants for insect resistance. Plant Sci 131:111.
Lis H, Sharon N. 1986. Lectins as molecules and tools. Ann Rev
Biochem 55:3567.
Peumans WJ, Van Damme EJM. 1998. Plant lectins: Versatile proteins
with important perspectives in biotechnology. Biotech-nol Genet
Eng Rev 15:199228.
Powell KS. 2001. Antimetabolic effects of plant lectins towards
nymphal stages of the planthoppers Tarophagous proserpina and
Nilaparvata lugens. Entomol Exp Appl 99:7985.
Salzman RA, Fujita T, Zhu-Salzman K, Hasegawa PM, Bressan RA.
1999. An improved RNA isolation method for plant tissues
containing high levels of phenolic compounds or carbohydrates.
Plant Mol Biol Rep 17:1117.
Sharma V, Surolia A. 1997. Analyses of carbohydrate recognition by
legume lectins: Size of the combining site loops and their primary
specificity. J Mol Biol 267:433 445.
Southern EM. 1975. Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J Mol Biol 98:503517.
Van Damme EJM, Peumans WJ, Barre A, Rouge P. 1998. Plant lectins:
A composite of several distinct families of structurally

and evolutionary related proteins with diverse biological roles. Crit

Rev Plant Sci 17:575692.
Vodkin LO, Rhodes PR, Goldberg RB. 1983. A lectin gene insertion has
the structural features of a transposable element. Cell 34:10231031.
Yamauchi D, Minamikawa T. 1990. Structure of the gene encoding
concanavalin A from Canavalia gladiata and its expression in
Escherichia coli cells. FEBS Lett 260:127130.
Yao J, Pang Y, Qi H, Wan B, Zhao X, Kong W, Sun X, Tang K. 2003.
Transgenic tobacco expressing Pinellia ternata agglutinin confers
enhanced resistance to aphids. Trans Res 12:715 722.
Young NM, Oomen RP. 1992. Analysis of sequence variation among
legume lectins- a ring of hypervariable residues forms the perimeter
of the carbohydrate-binding site. J Mol Biol 228:924934.
Zhao X, Yao J, Liao Z, Zhang H, Chen F, Wang L, Lu Y, Sun X, Yu S,
Tang K. 2003. Molecular cloning of a novel mannose-binding lectin
gene from Arisaema heterophyllum. Plant Sci 165:5560.
Zhu K, Huesing JE, Shade RE, Bressan RA, Hasegawa PM, Murdock
LL. 1996. An insecticidal N-acetylglucosamine-specific lectin gene
from Griffonia simplicifolia (Leguminosae). Plant Physiol 110:195
202.