Journal of Medical Microbiology (2012), 61, 645652

DOI 10.1099/jmm.0.041764-0

Utility of real-time amplification of selected 16S

rRNA gene sequences as a tool for detection and
identification of microbial signatures directly from
clinical samples
Kirstin J. Edwards, Julie M. J. Logan, Sally Langham, Craig Swift
and Saheer E. Gharbia
Correspondence

Department of Bioanalysis and Horizon Technologies, Health Protection Agency Microbiology

Services Division Colindale, 61 Colindale Avenue, London NW9 5EQ, UK

Kirstin J. Edwards
Kirstin.edwards@hpa.org.uk

Received 15 December 2011

Accepted 9 February 2012

The potential of incorporating a real-time PCR for amplification and detection of 16S rRNA gene
signatures directly from clinical samples was assessed as a tool for diagnostics. Universal PCR
primers spanning short variable regions (~500 bp) were optimized for real-time PCR and tested
in comparison with a longer fragment (~1400 bp) generated from block-based amplification.
Real-time PCR had improved sensitivity of detection (8 % increase), decreased amplification time
and simplified downstream processing. The real-time PCR primers also offered an improvement in
detection of bacteria from samples that demonstrated inhibition with the block-based primers and
in the resolution of mixed-sequence traces. In addition to testing primer sensitivity, the effect of
amplifying and sequencing two different variable regions of the 16S rRNA gene on organism
identification was compared. By amplifying and sequencing a shorter variable region, the number
of species that were identified to the species level was reduced by 18 %.

INTRODUCTION
16S rRNA gene amplification and sequencing has been well
documented as a useful tool for detection and identification of bacteria (Bosshard et al., 2003; Drancourt et al.,
2000; Mignard & Flandrois, 2006; Tang et al., 1998; Woo
et al., 2008). Several strategies and targets have been used
based on the utility of the entire gene or specifically
targeting one or more variable regions within the gene. As
well as proving fundamental in taxonomy, where 16S
rRNA gene sequencing has been used repeatedly to clarify
relationships within a wide range of taxa (Snel et al., 1999:
Stackebrandt & Goebel, 1994), the 16S rRNA gene has also
been used as a tool for probing the diversity of microbial
communities (Baker et al., 2001; Hill et al., 2000; Hohn
et al., 2002). Here, it was used to identify both cultivable
and uncultivable bacteria, the latter due to difficulty in
mimicking the environmental habitats and nutritional
requirements of these organisms in the laboratory. Similar
studies have resulted in the discovery of several new
taxonomic groups through direct amplification of 16S
rRNA gene fragments (Drancourt et al., 2000, 2004; Woo
et al., 2008).
With the increase in molecular methods and supporting
technologies in laboratories, the use of 16S rRNA gene PCR
and sequencing has been exploited in clinical microbiology.
Abbreviations: CP, crossing point; LC, LightCycler; V, variable region.

041764 G 2012 SGM

Initially, this was used for the identification of bacterial

isolates (Bosshard et al., 2003; Drancourt et al., 2004;
Mignard and Flandrois, 2006; Zucol et al., 2006) but
increasingly has been employed for direct detection in
clinical samples and in particular the analysis of culturenegative samples (Harris & Hartley, 2003; Heikens et al.,
2005; Kommedal et al., 2009; Zucol et al., 2006). Direct
detection has allowed identification of bacteria that have
not survived transportation, are suppressed by antibiotic
treatment and have complex growth requirements. Several
groups have published methodologies for block-based
analysis (also known as end-point analysis) of different
sample types and have reported the advantages and pitfalls
of using 16S rRNA gene PCR and sequencing (Corless et al.,
2000; Janda & Abbott, 2007; Millar et al., 2002). Unlike realtime PCR, block-based assays require agarose gel electrophoresis to visualize the PCR product.
Real-time PCR offers many advantages for detection of the
16S rRNA gene from clinical samples. For other gene
targets, real-time PCR has demonstrated increased sensitivity over block-based assays (Apfalter et al., 2003;
Desjardin et al., 1998; Lienard et al., 2011), which could
be vital when detecting low numbers of bacteria in culturenegative samples. Analysis can be semi-quantitative, as
there is a direct correlation between the amount of starting
material and the threshold crossing point (CP), which is
more informative than visualizing the products on an

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

Printed in Great Britain

645

K. J. Edwards and others

agarose gel (Ririe et al., 1997). The speed of amplification

in real-time PCR is generally faster than a block-based
approach and it is not necessary to use agarose gel
electrophoresis to visualize the products. This reduces the
overall processing time, which in turn may have a positive
impact on patient care. The aim of this study was to
increase sensitivity, speed of amplification and speed/ease
of use of downstream processing. In this paper, we report
our findings using a LightCycler (LC; Roche) for
amplification of two alternative 500 bp 16S rRNA gene
fragments covering different variable regions and comparison of these with a block-based assay (amplifying a
1400 bp fragment) currently used in our laboratory.
Bacterial identification resulting from sequencing the
different variable regions was also assessed.

METHODS
Samples. A total of 213 samples from normally sterile sites and

clinically suspected to contain an infectious agent were used in this

study. Of these, 56 % were culture-negative and 13 % were culturepositive (i.e. an isolate was also recovered from the sample), whilst for
the remainder (31 %), culture information was not provided. The
range of sample types tested in the study is detailed in Table 1.
DNA extraction. Genomic DNA was extracted from all samples using
a DNeasy Blood and Tissue kit (Qiagen). For different sample types,
pre-treatment and lysis steps were performed (as detailed below),
followed by standard extraction using the manufacturers instructions. For tissue samples, one to three pieces of tissue approximately
23 mm2 were placed in a sterile tube, proteinase K solution (Qiagen)
and ATL buffer (Qiagen) were added and the tubes were incubated
overnight at 56 uC. Following standard extraction, the tissue samples
were resuspended in 50 ml nuclease-free water. Up to 200 ml of liquid
samples was used, and if necessary the sample volume was made up to

200 ml using PBS. The samples were extracted using a standard

protocol but were eluted in half of the starting volume (but not less
than 50 ml) with nuclease-free water. For liquid samples that could
not be pipetted (e.g. pus), a portion ~4 mm in diameter was placed
into a sterile tube, proteinase K solution and ATL buffer were added
and the tube was incubated overnight at 56 uC. After extraction
using a standard Qiagen protocol, the DNA was resuspended in
50 ml nuclease-free water. For samples that had been fixed in wax,
either a 3 mm2 piece of tissue, with as much wax as possible
removed, or four to five shavings were placed into a sterile tube and
1.2 ml UltraClear solution (TAAB Laboratories) was added. The
tubes were centrifuged at 16 000 g for 5 min and the supernatant
removed. The UltraClear wash was repeated and 1.2 ml ethanol
(96100 %) was added to the pellet to remove residual UltraClear.
The tubes were vortexed and centrifuged at 16 000 g for 5 min, the
ethanol was removed and the ethanol wash repeated. The pellet was
resuspended in proteinase K solution and buffer AL (Qiagen) and
the extraction was completed as described above. The samples were
resuspended in 50 ml nuclease-free water. From a blood culture
bottle, 200 ml fluid was placed into a sterile tube and 100 ml lysis
buffer [5 M guanidine hydrochloride in 100 mM Tris/HCl
(pH 8.0)], 400 ml sterile nuclease-free water and 800 ml 99 % benzyl
alcohol were added (Fredricks & Relman, 1998). Tubes were
centrifuged at 7000 g for 5 min and 400 ml aqueous phase was
transferred to a fresh tube. To this, 40 ml 3 M sodium acetate and
440 ml 2-propanol were added and the tubes were centrifuged at
16 000 g for 15 min. The supernatant was removed and 1 ml 70 %
ethanol was added to the pellet. The tubes were centrifuged at
16 000 g for 5 min and the supernatant removed. To reduce the
time required for air drying the precipitated DNA, the pellet was
washed and eluted through a Qiagen DNeasy spin column as
follows: the pellet was resuspended in 50 ml molecular biology-grade
water and this was added directly to the column. After incubation at
room temperature for 5 min, the column was centrifuged at 6000 g
for 1 min and the eluate transferred to a fresh tube (Hogg et al.,
2008). A negative extraction control (200 ml PBS) was included in
each extraction run. Following processing, the extracts were stored
at 220 uC.

Table 1. Clinical sample types

Clinical sample type

No. samples

Abscess
Bronchoalveolar lavage
Blood (including EDTA, serum and platelets)
Blood culture bottle fluid
Bone (including bone marrow)
Cerebrospinal fluid
Other fluid (including cyst, joint, drain, pericardial, pleural and vitreal)
Pus
Sputum
Other
Tissue
Brain
Heart valve
Lymph node
Paraffin block (lung lesion)
Spine and other joint tissue
Subcutaneous
Other tissue
Total

646

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

7
6
31
2
7
19
36
9
1
8
4
41
2
1
14
3
22
213

Journal of Medical Microbiology 61

Identification directly from clinical samples

Primers. The primers used for PCR and sequencing are detailed in

Table 2.
Block-based PCR. The PCR mixture consisted of 25 ml Go-Taq
Green mastermix (Promega), 0.2 mM each of primers ANT1F and
1392R, 22 ml molecular biology-grade water and 1 ml extracted DNA.

The mixture was amplified using an ABI 9700 PCR instrument using
the following cycling conditions: denaturation at 95 uC for 2 min and
35 cycles of 95 uC for 45 s, 56 uC for 45 s and 72 uC for 1 min. A final
extension was performed at 72 uC for 5 min. PCR products were
separated by electrophoresis on a 2 % ethidium bromide stained E-gel
(Life Technologies) following the manufacturers instructions and
were visualized by UV transillumination.
Real-time PCR. Real-time PCR was performed using a LC 2.0 in

glass capillaries (Roche) or a LC 480 in an optical 96-well plate

(Roche). The reaction mix consisted of 10 ml TaKaRa Ex Taq (Lonza),
0.4 mM each primer, 4.4 ml molecular biology-grade water and 2 ml
extracted sample. The TaKaRa Ex Taq master mix contained SYBR
Green I, which was used for real-time monitoring and detection of
PCR products. Two sets of primers were used in the study, the first
used forward CLSI and reverse Bosshard (Bosshard LC assay) (Table
2) with the following cycling conditions: denaturation at 95 uC for
10 s and 40 cycles of 95 uC for 10 s, 64 uC for 15 s and 72 uC for 20 s.
The second set of primers was Kommedal forward and Kommedal
reverse (Kommedal LC assay) with cycling conditions of: denaturation at 95 uC for 10 s and 40 cycles of 95 uC for 15 s, 70 uC for 10 s
and 72 uC for 20 s.
PCR controls. Each PCR run included a positive control containing
1 ml Escherichia coli DNA at 50 ng ml21 (Sigma) in the block-based
assay or 1 ml E. coli DNA at 50 pg ml21 (Sigma) in the LC assays, and

a negative control of molecular biology-grade water. Extraction

negative controls were also amplified. To control for PCR inhibition,
a second PCR was performed where an identical reaction mix was
spiked with 1 ml E. coli DNA at 1 ng ml21 for the block-based assay
or 0.5 pg ml21 for the LC assays. For any reactions where
amplification was not observed in either the extract or the spiked
sample, the original nucleic acid template was diluted 1 : 10 and the
PCR repeated.
Sequencing. The LC 2.0 reactions were spun out of the glass

capillary into a 1.5 ml Eppendorf tube and these and the LC 480
reactions were transferred to an optical 96-well plate (Life
Technologies). All PCR products were purified for sequencing using
Agencourt Ampure beads (Beckman Coulter) using an NXP Biomek

Robot following the manufacturers protocol (Beckman Coulter). The

samples were resuspended in a total volume of 40 ml molecular
biology-grade water with 30 ml transferred by the robot to a new 96well plate for the sequencing set-up. The block-based PCRs were
sequenced using primers 357F and 3R, the Bosshard LC products
were sequenced using Bosshard forward and reverse primers, and the
Kommedal LC products were sequenced with the Kommedal forward
and reverse primers (Table 2). Sequencing reactions were performed
using an ABI Prism 1.1 or 3.1 Big Dye sequencing kit and analysed on
an ABI 3730 DNA Analyzer (Life Technologies).
Identification. Bacterial identification was made by forming contigs

of forward and reverse sequences and comparing the contig consensus

sequence with sequences in GenBank using the NCBI BLAST algorithm
(Altschul et al., 1990). Criteria of 98 % sequence identity and fewer
than 5 bp different were considered sufficient to identify the organism
to the species level (Harris & Hartley, 2003). If species-level
identification was not possible, then genus-level identification was
made. Identification was confirmed by comparison of the sequence
data with the ribosomal database project (http://rdp.cme.msu.edu/)
using the Seq match analysis tool and using the same analysis criteria
as above (Cole et al., 2007, 2009).

RESULTS
For phase 1 of the study, extracts were prepared from a
total of 142 samples and amplified using the block-based
assay. Of these samples, 43 were positive and 99 were
negative. Nucleic acid extracts were stored at 220 uC and
subsequently retested using real-time LC PCR over a time
period of up to 2 years following the original extraction.
For this, two amplicons were generated separately corresponding to two different variable (V) regions within
the 16S rRNA gene. The Bosshard-based primers, which
amplified the region spanning V1V3, resulted in 54 positive samples and 88 negative samples. The Kommedalbased primers, which amplified regions V3V4, detected 49
positive and 93 negative samples. Nine of the samples
detected using LC PCR and not detected using block-based
PCR showed a CP greater than cycle 26, which indicates a
weak sample with a low amount of bacterial DNA present,
and two samples contained substances that were inhibitory

Table 2. 16S rRNA gene PCR and sequencing primers

Primer

Sequence (5A3)

Position (based on
E. coli numbering

16S rRNA gene

variable region

Reference

ANT1F
1392R
357F
3R
Forward CLSI
Reverse Bosshard

AGAGTTTGATCCTGGCTCAG
ACGGGCGGTGTGTACAAG
CTCCTACGGGAGGCAGCAG
GTTGCGCTCGTTGCGGGACT
TTGGAGAGTTTGATCMTGGCTC
GTATTACCGCTGCTG

8
1398
339
1093
4
536

V1V9
V1V9
V3V7
V3V7
V1V3
V1V3

Forward Bosshard

AGAGTTTGATCMTGGCTCAG

V1V3

Kommedal forward
Kommedal reverse

CGGCCCAGACTCCTACGGGAGGCAGCA
GCGTGGACTACCAGGGTATCTAATCC

330
810

V3V4
V3V4

Bosshard et al. (2002)

Lane (1991)
Lane (1991)
Rajendram et al. (2006)
CLSI (2008)
Bosshard et al. (2002);
Edwards et al. (1989)
Bosshard et al. (2002);
Edwards et al. (1989)
Kommedal et al. (2008)
Kommedal et al. (2008)

http://jmm.sgmjournals.org

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

647

K. J. Edwards and others

to the PCR with block-based primers but not with the

Bosshard- or Kommedal-based primers. There were no
strong positive results (CP ,25) detected by the LC assays
that were not detected by the block-based assay. Using the
block-based primers, there were 13 extracts that showed
mixed sequencing trace files compared with only four with
either the Bosshard-based primers or the Kommedal-based
primers. Five samples were detected and identified using
the Bosshard-based primers but not the Kommedal-based
primers, and the organisms identified included three
Staphylococcus species, one Streptococcus species and one
presumptive E. coli/Shigella species.
After excluding the mixed samples, using the block-based
primers (V3V7) it was possible to identify 20 samples
(67 %) to the species level and nine (30 %) to the genus
level, with one (3 %) remaining unidentified even to the
genus level. By amplifying and sequencing the V1V3
region (Bosshard primers), it was possible to identify 31
samples (62 %) to the species level and 16 (32 %) to the
genus level, with three (6 %) remaining unidentified. By
sequencing across variable regions V3 and V4 (Kommedal
primers), it was possible to identify 25 samples (56 %) to
the species level and 16 (36 %) to the genus level, with
four (8 %) remaining unidentified. From the samples that
were unidentified, all three sequenced regions were
unable to differentiate between Escherichia species and
Shigella species, and the V3V4 region was unable to
differentiate between Bacillus species and Burkholderia
terricola (Table 3).
In phase 1 of the study, the Bosshard-based primers
amplifying V1V3 resulted in more positive samples (4 %
increase) and more species-level identifications (6 %
increase) than the Kommedal-based primers (amplifying
V3V4) and as a result were selected for phase 2 of the
study. In this phase, a blind comparison was made by
testing a further 71 samples by both block-based primers
and the Bosshard-based primers, with both PCRs being
performed at the same time rather than retrospectively.
The block-based primers resulted in 16 positives compared
with 23 using the Bosshard-based primers; both also
detected one mixed sample and the remainder of the
samples were negative. The Bosshard-based primers
detected six samples not amplified by the block-based
primers, all of which were weak positives as indicated by
the LC CP. As before, this demonstrated the increased
sensitivity afforded by the smaller PCR product and use of
real-time PCR. Amplifying and sequencing across V1V9
resulted in ten (62 %) species-level identifications and six
(38 %) genus-level identifications, whereas amplifying and
sequencing V1V3 resulted in ten (44 %) species-level
identifications and 12 (52 %) genus-level identifications,
with one (4 %) sample unidentified (Table 3). The negative
controls always demonstrated amplification, with CP
values ranging from 28 to 35 (no. tested580; median529).
Following sequencing, from the majority of controls a
single sequence trace was not obtained that could be used
to identify a single organism. The organisms that were
648

identified included Bacillus species (n54), Microbacterium

species (n52) and Staphylococcus species (n51).
Analysis of the overall data revealed a range of different
bacteria detected directly by 16S rRNA gene PCR and
sequencing. The total numbers assigned to each genus/
species are detailed in Table 3 and in total 18 different genera
were represented of which 73 % were Gram-positive bacteria
and 27 % were Gram-negative bacteria. Streptococcus species
accounted for 26 % of the total organisms identified and
only 7/19 could be identified to the species level. Species of
Staphylococcus accounted for 14 % (over half were only
identified to the genus level), species of Haemophilus
accounted for 14 % and species of Bacillus accounted for
15 %, whilst the remainder of the organisms were only
identified in one to three samples.

DISCUSSION
Using the LC for amplification of 16S rRNA gene signatures directly from clinical samples improved assay
sensitivity, decreased the overall time taken to perform the
test and simplified the downstream processing. The LC
assays resulted in identifying more positive samples than
the block-based assay, and this improvement in sensitivity
could partly be attributed to the decrease in product size.
A smaller amplicon size generally improves the PCR
efficiency, as there is less depletion of the PCR components, e.g. Taq enzyme or dNTPs, resulting in an assay that
is more sensitive. During amplification of smaller amplicons, there is less likelihood of secondary structures
forming that can reduce efficiency by impairing transcription, and there are more complete products produced
during each cycle of PCR, both of which contribute to the
increased efficiency and sensitivity. A decrease in assay time
can only be achieved by targeting a smaller product; larger
products can be amplified on the LC but the hold times used
cannot be reduced and overall time remains comparable
to block-based amplification. The LC amplification was
completed in 1 h compared with 2.5 h for the block-based
amplification, plus a further reduction in processing time as
an agarose gel was not required to visualize the products.
Amplification was observed on the LC as a curve, and the
software calculated the CP of when the amplicon amount
exceeded the background threshold and could be detected.
This CP value was directly correlated with the amount of
starting material in the sample and could be used to provide
information on the subsequent amount of template for
sequencing plate preparation and for result calling. In this
study, 36 % of the positive samples amplified with a CP
value of ,20 cycles, which indicates a large amount of
bacterial DNA present in the extract (corresponding to a
strong band on an agarose gel), and 14 % of the positive
samples were amplified with a CP value of .27, which
indicates a very low level of bacterial DNA in the sample.
Three of the extracts produced amplicons only by LC PCR
but required tenfold dilution before amplification was

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

Journal of Medical Microbiology 61

http://jmm.sgmjournals.org

Table 3. Number of organisms identified to genus and species level and LC CP ranges
ND,

Not detected;

Group

Gram positive

Gram negative

not tested.
Genus

Actinomyces
Anaerococcus
Bacillus
Gordonia
Lactobacillus
Mycobacterium
Nocardia
Propionibacterium
Staphylococcus
Streptococcus
Aggregatibacter
Capnocytophaga
Fusobacterium
Haemophilus
Kingella
Moraxella
Pasteurella
Pseudomonas
Escherichia/Shigella
Cetobacterium/Fusobacterium

Total no. identified

No. identified to species level

LC CP*

Block-based V1V9
region

Bosshard V1V3
region

Kommedal V3-V4
region

Bosshard V1V3

Kommedal V3V4

ND

1
0
2
0
1
0
1
1
5
7
2
2
1
10
1
1
1
0
0
0

1
0
0
0
1
0

27
1821
1417
12
22
2021
27
11
1629
1427
22
2126
1321
1223
25
20
21
1625
2125
27

29
20
1328
12
24
20
28
28
2128
1529
21

1
3
11
1
1
2
1
1
10
19
2
2
2
10
1
1
1
1
3
1

3
4
0
1
0
ND

1
3
5
2
2
1
6
1
ND

1
0
0
ND

*The range of values is presented when different CPs were obtained from different samples.

649
Downloaded from www.microbiologyresearch.org by
IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

NT

1
3
3
2
NT

0
8
1
1
1
NT

0
NT

NT

23
1829
25
15
20
25
2729
NT

Identification directly from clinical samples

Unnamed

NT,

K. J. Edwards and others

observed. The original extracts and the dilutions demonstrated inhibition (a second reaction spiked with E. coli
DNA did not produce an amplicon) with the block-based
PCR. All three extracts were from sample types known to
cause problems due to PCR inhibitors (e.g. chemicals such
as sodium polyanetholesulfonate), blood culture fluid and
paraffin-embedded tissue (Akane et al., 1994; Fredricks &
Relman, 1998; Holodniy et al., 1991). The bacterial load in
these samples would have been reduced following dilution
and may have been beyond the range of the block-based
primers. Additionally, some of the samples may have
contained smaller sheared fragments of DNA resulting
from sample preparation (e.g. paraffin-embedded tissues),
which can result in shearing into fragments of ,650 bp
following Qiagen extraction, and amplification with the
block-based primers would therefore have been greatly
reduced.
The inherent problem observed in amplification of the 16S
rRNA gene is background contamination of reagents with
low levels of bacteria, which can be co-amplified (Corless
et al., 2000; Harris and Hartley, 2003), and was observed in
all assays. The LC assays were adapted for use on the LC
from a SmartCycler method published by Kommedal et al.
(2008). The authors used the following definition: a
positive sample was defined as a sample reaching the
fluorescence threshold value (CP) three cycles before the
negative control and a sample was also defined as positive if
it reached the CP fewer than three cycles before the
negative control but if the subsequent melting curve
analysis showed a single distinct peak clearly different from
the negative control. Both of these criteria were considered
in this study, but the negative-control CP value showed
considerable run-to-run variation and all samples were
sequenced. This identified amplicons from 11 samples that
would have been considered negative by the above criteria,
but subsequent sequencing identified clinically relevant
organisms. Analysis of the melting-curve data for these
late-amplified samples did not reveal a melting curve that
was significantly different from the negative controls and
could not be used to differentiate these positive samples. In
this study, the following criteria were used: all samples were
sequenced regardless of CP, but caution was used with
samples that amplified in less than three cycles from the
negative control. In addition, samples that amplified after
cycle 25 were used neat in subsequent sequencing reaction,
and samples that amplified before cycle 25 were diluted
1 : 4 in the sequencing reaction, whilst melting-curve data
were not used in the analysis and are no longer performed.
The background contamination of the reagents can also
cause a problem with mixed-sequence traces. If the
bacterial load of the clinically significant bacteria is
sufficiently high, then it is preferentially amplified and
the background contamination is not observed. However,
when there are only low levels of clinically significant
bacteria, then the background is co-amplified and a mixed
trace can be observed. The master mix used for
amplification with the block-based primers was different
650

from that used for the LC, which requires a specialized

master mix optimal for fast amplification. In this study,
there were significantly more mixed traces detected using
the block-based assay. The LC reagents do have a low
level background contamination, as demonstrated by late
amplification curves with high CP values in the negative
controls; however, this was not amplified in sufficient
amounts or was not composed of a dominant organism
and so mixed-sequence traces were not observed. There
were four extracts that showed mixed-sequence traces
with all assays and represented genuine mixed bacterial
infections. Specialized Taq enzymes and master mixes are
available with a guaranteed low background DNA level.
The use of these may improve the background contamination observed but will increase the cost of performing
the assay.
There are a large number of publications on the use of 16S
rRNA gene sequencing for bacterial identification, but
there is no consensus on the optimal region of the gene to
target. Therefore, it was important in this study to review
the differences observed from amplifying and sequencing
different regions. The Bosshard-based primers amplified
the region spanning V1V3, whereas the Kommedal-based
primers amplified the region spanning V3V4. The
Bosshard-based primers performed slightly better than
the Kommedal-based primers for both sensitivity and
resolution. In the paper by Kommedal et al. (2009), the
authors reported that the Kommedal-based primers
bound poorly to a range of bacteria including Chlamydia abortus, Chlamydia psittaci, Chlamydophilia pneumoniae, Coxiella burnetti, Dermabacter hominis, Leuconostoc
species, Microbacterium species and Propionibacterium
species. Thus, based on this evidence as well as the results
obtained in this study, the Bosshard-based primers are
more suitable for amplification from clinical samples.
By amplifying and sequencing the variable region V1V3,
46 % of samples could only be identified to the genus level
(Table 3). There are a number of genera that do not resolve
well with 16S rRNA gene sequencing, such as Streptococcus
(pneumoniae/mitis/oralis/intermedius), Staphylococcus (aureus/epidermidis/capitis/caprae) and some Bacillus species
(Kommedal et al., 2008; Harris & Hartley, 2003), and these
organisms represented the most prevalent organisms found
in this study (Table 3). Therefore, for the majority of
samples, reducing the size of the region sequenced did not
have a negative impact on identification, and it would be
more beneficial to sequence alternative gene targets (e.g.
rpoB or secA) rather than sequence a larger region of the
16S rRNA gene if species-level identification was clinically
important. There were four samples where the V1V3
region could not identify the organism to the genus level
(Cetobacterium/Fusobacterium and Escherichia/Shigella species). E. coli and Shigella dysenteriae are genotypically close
enough to be considered the same species but have been
kept separate for clinical reasons (Clarridge, 2004), and for
the sample containing either Cetobacterium or Fusobacterium, a larger region of the 16S rRNA gene sequence is

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

Journal of Medical Microbiology 61

Identification directly from clinical samples

required to resolve these to the genus or species level,

delaying the clinical result by 12 days.

Clarridge, J. E., III (2004). Impact of 16S rRNA gene sequence analysis
for identification of bacteria on clinical microbiology and infectious
diseases. Clin Microbiol Rev 17, 840862.

Considerable work has already been undertaken to show

the utility of 16S rRNA gene PCR and sequencing for
identification of bacteria. It has been shown previously to
be superior to phenotypic identification methods and
nearly always results in an identification (Clarridge, 2004;
Janda & Abbott, 2007). The application for clinical samples
and in particular culture-negative samples has also been
demonstrated (Harris & Hartley, 2003; Kommedal et al.,
2009), as have the pitfalls of quality of sequence databases,
contamination of reagents and lack of resolution for some
genera. The work in this study was undertaken to establish
whether using a real-time PCR-based approach would
improve the sensitivity and speed of detection. We have
demonstrated that amplification can easily be performed
on the LC and that this approach offers a considerable
improvement in sensitivity of detection. In our hands, it
was relatively easy to differentiate amplification of
infection-causing organisms against the background contamination of the reagents, and fewer mixed-sequence
traces were observed. Amplification of a smaller region of
the gene affected the resolution of the data but not
significantly. Instead, it improved the sensitivity, allowed
amplification from difficult sample types and improved the
overall time taken to perform the analysis. Using this
approach, it is possible to perform amplification and
sequencing, leading to identification in ,24 h following
extraction. It is also possible that, by employing different
extraction methods and techniques, the overall time could
be reduced further and the sensitivity of detection
improved, offering an additional improvement for detection of bacteria directly from clinical samples.

CLSI (2008). Interpretive Criteria for Identification of Bacteria and

Fungi by DNA Target Sequencing. Approved Guideline MM18-A.
Wayne, PA: Clinical and Laboratory Standards Institute.
Cole, J. R., Chai, B., Farris, R. J., Wang, Q., Kulam-Syed-Mohideen,
A. S., McGarrell, D. M., Bandela, A. M., Cardenas, E., Garrity, G. M.
& Tiedje, J. M. (2007). The ribosomal database project (RDP-II):

introducing myRDP space and quality controlled public data.

Nucleic Acids Res 35 (Database issue), D169D172.
Cole, J. R., Wang, Q., Cardenas, E., Fish, J., Chai, B., Farris, R. J.,
Kulam-Syed-Mohideen, A. S., McGarrell, D. M., Marsh, T. & other
authors (2009). The Ribosomal Database Project: improved align-

ments and new tools for rRNA analysis. Nucleic Acids Res 37
(Database issue), D141D145.
Corless, C. E., Guiver, M., Borrow, R., Edwards-Jones, V.,
Kaczmarski, E. B. & Fox, A. J. (2000). Contamination and sensitivity

issues with a real-time universal 16S rRNA PCR. J Clin Microbiol 38,
17471752.
Desjardin, L. E., Chen, Y., Perkins, M. D., Teixeira, L., Cave, M. D. &
Eisenach, K. D. (1998). Comparison of the ABI 7700 system

(TaqMan) and competitive PCR for quantification of IS6110 DNA

in sputum during treatment of tuberculosis. J Clin Microbiol 36,
19641968.
Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J. P. &
Raoult, D. (2000). 16S ribosomal DNA sequence analysis of a large

collection of environmental and clinical unidentifiable bacterial

isolates. J Clin Microbiol 38, 36233630.
Drancourt, M., Berger, P. & Raoult, D. (2004). Systematic 16S rRNA

gene sequencing of atypical clinical isolates identified 27 new bacterial

species associated with humans. J Clin Microbiol 42, 21972202.
Edwards, U., Rogall, T., Blocker, H., Emde, M. & Bottger, E. C.
(1989). Isolation and direct complete nucleotide determination of

entire genes. Characterization of a gene coding for 16S ribosomal

RNA. Nucleic Acids Res 17, 78437853.
Fredricks, D. N. & Relman, D. A. (1998). Improved amplification of

microbial DNA from blood cultures by removal of the PCR inhibitor

sodium polyanetholesulfonate. J Clin Microbiol 36, 28102816.

REFERENCES

Harris, K. A. & Hartley, J. C. (2003). Development of broad-range 16S

Akane, A., Matsubara, K., Nakamura, H., Takahashi, S. & Kimura, K.
(1994). Identification of the heme compound copurified with

deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor

of polymerase chain reaction (PCR) amplification. J Forensic Sci 39,
362372.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J.
(1990). Basic local alignment search tool. J Mol Biol 215, 403410.
Apfalter, P., Barousch, W., Nehr, M., Makristathis, A., Willinger, B.,
Rotter, M. & Hirschl, A. M. (2003). Comparison of a new quantitative

ompA-based real-time PCR TaqMan assay for detection of Chlamydia

pneumoniae DNA in respiratory specimens with four conventional
PCR assays. J Clin Microbiol 41, 592600.

rDNA PCR for use in the routine diagnostic clinical microbiology

service. J Med Microbiol 52, 685691.
Heikens, E., Fleer, A., Paauw, A., Florijn, A. & Fluit, A. C. (2005).

Comparison of genotypic and phenotypic methods for species-level

identification of clinical isolates of coagulase-negative staphylococci.
J Clin Microbiol 43, 22862290.
Hill, G. T., Mitkowski, N. M., Aldrich-Wolfe, L., Emele, L. R., Jurkonie,
D. D., Ficke, A., Maldonado-Ramirez, S., Lynch, S. T. & Nelson, E. B.
(2000). Methods for assessing the composition and diversity of soil

microbial communities. Appl Soil Ecol 15, 2536.

Hogg, G. M., McKenna, J. P. & Ong, G. (2008). Rapid detection of

Bacterial community analysis of Indonesian hot springs. FEMS

Microbiol Lett 200, 103109.

methicillin-susceptible and methicillin-resistant Staphylococcus aureus

directly from positive BacT/Alert blood culture bottles using real-time
polymerase chain reaction: evaluation and comparison of 4 DNA
extraction methods. Diagn Microbiol Infect Dis 61, 446452.

Bosshard, P. P., Zbinden, R. & Altwegg, M. (2002). Turicibacter

Hohn, M. J., Hedlund, B. P. & Huber, H. (2002). Detection of 16S

sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive

bacterium. Int J Syst Evol Microbiol 52, 12631266.

rDNA sequences representing the novel phylum Nanoarchaeota:

indication for a wide distribution in high temperature biotopes. Syst
Appl Microbiol 25, 551554.

Baker, G. C., Gaffar, S., Cowan, D. A. & Suharto, A. R. (2001).

Bosshard, P. P., Abels, S., Zbinden, R., Bottger, E. C. & Altwegg, M.

(2003). Ribosomal DNA sequencing for identification of aerobic

Gram-positive rods in the clinical laboratory (an 18-month

evaluation). J Clin Microbiol 41, 41344140.
http://jmm.sgmjournals.org

Holodniy, M., Kim, S., Katzenstein, D., Konrad, M., Groves, E. &
Merigan, T. C. (1991). Inhibition of human immunodeficiency virus

gene amplification by heparin. J Clin Microbiol 29, 676679.

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

651

K. J. Edwards and others

Janda, J. M. & Abbott, S. L. (2007). 16S rRNA gene sequencing for

bacterial identification in the diagnostic laboratory: pluses, perils, and

pitfalls. J Clin Microbiol 45, 27612764.
Kommedal, O., Karlsen, B. & Saeb, O. (2008). Analysis of mixed

Rajendram, D., Ayenza, R., Holder, F. M., Moran, B., Long, T. & Shah,
H. N. (2006). Long-term storage and safe retrieval of DNA from

microorganisms for molecular analysis using FTA matrix cards.

J Microbiol Methods 67, 582592.

sequencing chromatograms and its application in direct 16S rRNA

gene sequencing of polymicrobial samples. J Clin Microbiol 46, 3766
3771.

Ririe, K. M., Rasmussen, R. P. & Wittwer, C. T. (1997). Product

Kommedal, O., Kvello, K., Skjastad, R., Langeland, N. & Wiker, H. G.

(2009). Direct 16S rRNA gene sequencing from clinical specimens,

Snel, B., Bork, P. & Huynen, M. A. (1999). Genome phylogeny based

with special focus on polybacterial samples and interpretation of

mixed DNA chromatograms. J Clin Microbiol 47, 35623568.

Stackebrandt, E. & Goebel, B. M. (1994). Taxonomic note: a place for

Lane, D. J. (1991). 16S/23S rRNA sequencing. In Nucleic Acid

Techniques in Bacterial Systematics, pp. 115175. Edited by

E. Stackebrandt & M. Goodfellow. London: John Wiley & Sons Ltd.
Lienard, J., Croxatto, A., Aeby, S., Jaton, K., Posfay-Barbe, K.,
Gervaix, A. & Greub, G. (2011). Development of a new Chlamydiales-

specific real-time PCR and its application to respiratory clinical

samples. J Clin Microbiol 49, 26372642.
Mignard, S. & Flandrois, J. P. (2006). 16S rRNA sequencing in routine

bacterial identification: a 30-month experiment. J Microbiol Methods

67, 574581.
Millar, B. C., Xu, J. & Moore, J. E. (2002). Risk assessment models and
contamination management: implications for broad-range ribosomal
DNA PCR as a diagnostic tool in medical bacteriology. J Clin
Microbiol 40, 15751580.

652

differentiation by analysis of DNA melting curves during the

polymerase chain reaction. Anal Biochem 245, 154160.
on gene content. Nat Genet 21, 108110.
DNADNA reassociation and 16S rRNA sequence analysis in the
present species definition in bacteriology. Int J Syst Bacteriol 44, 846
849.
Tang, Y.-W., Ellis, N. M., Hopkins, M. K., Smith, D. H., Dodge, D. E. &
Persing, D. H. (1998). Comparison of phenotypic and genotypic

techniques for identification of unusual aerobic pathogenic gramnegative bacilli. J Clin Microbiol 36, 36743679.
Woo, P. C., Lau, S. K., Teng, J. L., Tse, H. & Yuen, K.-Y. (2008). Then

and now: use of 16S rDNA gene sequencing for bacterial

identification and discovery of novel bacteria in clinical microbiology
laboratories. Clin Microbiol Infect 14, 908934.
Zucol, F., Ammann, R. A., Berger, C., Aebi, C., Altwegg, M., Niggli, F. K.
& Nadal, D. (2006). Real-time quantitative broad-range PCR assay for

detection of the 16S rRNA gene followed by sequencing for species

identification. J Clin Microbiol 44, 27502759.

Downloaded from www.microbiologyresearch.org by

IP: 115.178.237.126
On: Tue, 18 Oct 2016 06:57:31

Journal of Medical Microbiology 61