You are on page 1of 42

MARCADORES

GENTICOS
(Una gua de lectura introductoria al tema)

Un marcador gentico es un polimorfismo del ADN que se puede detectar fcilmente


mediante anlisis fenotpico o molecular. El marcador puede hallarse dentro de un gen o en ADN
con funcin desconocida.
Dado que los segmentos de ADN que se encuentran prximos entre s en un cromosoma
tienden a heredarse juntos, los marcadores se suelen utilizar como maneras indirectas de seguir la
pista del patrn de herencia de un gen que an no se ha identificado, pero cuya localizacin
aproximada s es conocida.
La variacin de naturaleza cuantitativa y de origen gentico dentro de las poblaciones se
presenta en dos formas bsicas: mutantes raros y polimorfismo gentico. Si la variante ms escasa
aparece con una frecuencia menor del 1% se denomina mutante raro, pero si sta es mayor que
este valor se trata de un polimorfismo gentico. La variabilidad gentica es un atributo que no
puede ser exhaustivamente medido.
Es imposible examinar cada gen en cada
individuo de una especie para obtener una
enumeracin completa de la variacin gentica
de la especie; sin embargo, si se toma una
muestra de una poblacin es posible estimar su
variabilidad gentica al utilizar un carcter o
marcador que propicie la medicin de dicha
variabilidad.
Una vez que se identifican los genes y sus
marcas, y su correlacin con una caracterstica
productiva

(por

ej.

incremento

de

peso,

produccin de leche, carne magra), se consigue


identificar lo que se denomina loci para una caracterstica o rasgo cuantificable (QTL por sus siglas
en ingls: Quantitative Trait Loci). Los QTL se pueden utilizar para llevar a cabo la genotipificacin
de individuos en las poblaciones de especies animales, entre los que se puede detectar a aquellos
que son portadores de estos marcadores para ser seleccionados y con ello desarrollar programas
de seleccin. A este tipo de seleccin se la ha denominado seleccin asistida por marcadores
(SAM) y seleccin asistida por genes (SAG).

Hasta mediados de la dcada de los 60, los marcadores usados en gentica y mejora
animal estaban controlados por genes asociados a caracteres polimrficos, en general fciles de
identificar visualmente (fenotipo), pero solo un pequeo nmero de esos marcadores morfolgicos
permitan encontrar asociaciones significativas entre estos y los caracteres con importancia
econmica.
Por sus limitaciones surgieron los marcadores isoenzimticos o marcadores de protenas,
que eran accesibles a un mayor nmero de especies y brindaban mejores resultados. Se expresan
en forma codominante, son compatibles con el normal funcionamiento de la protena y son
relativamente abundantes, pero son tcnicas muy caras y dificulta los proyectos de mapeos,
adems no ms del 3% del ADN genmico es finalmente traducido a protenas y que slo unas
pocas de estas pueden mutar sin alterar la viabilidad de los animales. Los primeros marcadores
fueron los grupos sanguneos y luego otros marcadores polimrficos bioqumicos o las
inmunoglobulinas pero presentaban escasa variantes polimrficas lo que limito su uso y
aplicaciones Dejaron de utilizarse y aparecen as nuevos marcadores moleculares.

MARCADORES MOLECULARES
Con el advenimiento de las tcnicas de biologa molecular aparecieron diversos mtodos
de deteccin de polimorfismo gentico directamente a nivel de ADN: los marcadores genticos
moleculares basados en ADN que sirven de referencia para detectar la transmisin de un
segmento de cromosoma de una generacin a otra.
El trmino marcador se utiliza aqu en el
sentido de marcador gentico, y muchas veces se lo
utiliza como sinnimo de marcador de locus; un locus
polimrfico que indica el genotipo del individuo que
lo lleva (con este propsito se utilizan marcadores en
Un marcador es un

gentica de poblaciones), o el genotipo de uno o de

polimorfismo, pero

varios loci ligados al marcador. Inicialmente el

no siempre un

descubrimiento de las enzimas de restriccin permiti

polimorfismo sirve

el anlisis de los polimorfismos de longitud de los

de marcador.

fragmentos de restriccin. Posteriormente, con el


desarrollo

de

la

reaccin

en

cadena

de

la

polimerasa (PCR), se desarrollaron nuevos mtodos de deteccin de marcadores moleculares.


Los marcadores ideales cumplen una serie de caractersticas, entre las que se encuentran:

Elevada capacidad de detectar altos niveles de polimorfismo,

Alta heredabilidad,

Gran capacidad para acceder a todas las regiones del genoma,

Independencia del estado fsico y de desarrollo del individuo,

Facilidad de obtencin,

Deteccin por mtodos econmicos,

Independencia de las condiciones ambientales y

Determinacin en cualquier tipo de clulas que contenga ncleo.


Estas constituyen algunas de las ventajas de los marcadores moleculares sobre los

morfolgicos e isoenzimas; otras radican en su capacidad de deteccin de mutaciones


silenciosas, que no originan cambios de aminocidos.
Los polimorfismos detectados en el ADN se deben a diferencias al nmero de
determinadas regiones no codificantes dispersas en el genoma (regiones repetidas) o a
mutaciones puntuales.
En funcin de estas caractersticas se pueden clasificar los diferentes mtodos de
deteccin de polimorfismos:
A- los marcadores asociados a variaciones debidas al nmero de repeticiones en su secuencia
(microsatlites y minisatlites) y
B- los marcadores que detectan cambios puntuales en el genoma (RFLP, AFLP, RADP, SNP, etc.),
que pueden ser detectables o no, por enzimas de restriccin.

A- MARCADORES

ASOCIADOS A VARIACIONES DEBIDAS AL NMERO DE

REPETICIONES EN SU SECUENCIA
ADN REPETITIVO DENTRO DE UN GENOMA
Se conoce que una gran proporcin variable del genoma eucariota est
compuesto por secuencias repetitivas de ADN, las cuales difieren en el nmero y la
composicin de nucletidos.
Secuencias repetitivas en tndem (se presenta un resumen en el siguiente cuadro)
ADN satlite

ADN altamente repetitivo

Minisatlites

ADN telomrico

VNTR

SSLP, SSR o STR

Microsatlites

Son secuencias muy conservadas.


Contribuye a la estabilidad del cromosoma.
ADN moderadamente repetitivo
ADN moderadamente repetitivo

MINISATLITES o VNTR (nmero variable de repeticiones en tndem) (Variable Number of Tandem


Repeats)
En 1980 A. R. Wyman y R. White descubrieron, por azar, la primera regin hipervariable del
ADN humano, y subsecuentemente se fueron hallando otras regiones de ese tipo cerca de los
genes de la globina, la insulina, la mioglobina y otros. Estas secuencias no codificantes e
hipervariables del ADN (de una longitud aproximada de entre 6 y 25 pb) repetidos en tndem un
nmero variable de veces (VNTR), estn ubicados en regiones centromricas y telomricas de los
cromosomas y forman secuencias de entre 5 y 50 kb de longitud.
Ejemplo: 7 repeticiones en tndem de la secuencia de 16 pares de bases
5GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGATGA
CTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGAT

Figura 43. VNTR (nmero variable de


repeticiones en tndem).

Se genera de este modo una gran cantidad de alelos diferenciados por el nmero de
repeticiones que posee cada uno. Esta ltima caracterstica genera un alto porcentaje de
heterocigosis (generalmente mayor al 80%) alcanzado para estos loci, lo que los convierte en
marcadores altamente informativos en estudios de anlisis de ligamiento y pruebas de
identificacin.
En estas tcnicas, los sitios de restriccin de las enzimas se encuentran flanqueando las
secuencias repetidas en tndem y se visualizan mediante transferencia de Southern usando
secuencias VNTR como sonda observando un patrn de bandas. Las sondas moleculares
desarrolladas por Jeffreys y colaboradores en el ao 1985 a partir de secuencias repetitivas de un
intrn de la mioglobina humana, dieron origen a la tcnica conocida como fingerprinting de
ADN. La misma ha revolucionado el campo de la medicina forense y los estudios de paternidad
en todo el mundo. El fingerprinting de ADN es el patrn de bandas nico (huella molecular) es

especfico de cada individuo (excepto para los gemelos monocigticos) obtenido por la
hibridacin de muestras de ADN digerido con sondas capaces de detectar mltiples minisatlites
a lo largo del genoma.
Una limitacin importante del anlisis de huellas moleculares de ADN con VNTR es que
precisa una muestra relativamente grande de ADN (100.000 clulas o 50g) y el ADN debe estar
relativamente intacto.
Hasta el momento, se han descripto y mapeado cientos de loci de VNTR en el genoma
humano y de algunos animales, aunque se calcula que su nmero podra ser de varios miles por
genoma.
MICROSATELITES o SSR (secuencias simples repetidas) (simple sequence repeats) o SSLP
(polimorfismo de longitud de secuencias simples) (simple sequence length polymorphisms) o STR
(repeticiones simples en tndem) (short tandem repeat)
Los microsatlites, tambin conocidos como SSR, SSLP o STR, consisten en pequeas
secuencias con 2-5 nucletidos repetidos en tndem, altamente variables en tamao. Se
identificaron en el ao 1989 al descubrirse que existan zonas del ADN no codificante. Se llamaron
primero VNTR (variable number of tandem repeats), pero luego fue reemplazada por la de
microsatlite o STR (Short Tandem Repeat) para los segmentos mas cortos y para los mas largos la
denominacin VNTR o minisatlites.
En genomas eucariotas las secuencias de los microsatlites son muy frecuentes, bien
distribuidas y mucho ms polimrficas que los minisatlites, constituyendo la clase de marcadores
moleculares ms polimrficos que se conocen.
Se ha sealado que los elementos ms repetidos en mamferos son extensiones de
dinucletidos (CA)n y (GA)n y los ms tpicos constan de 10-30 copias de una repeticin que
usualmente no son superiores a 4 pb de longitud.
Por el momento, se desconoce exactamente el origen y la funcin de estas secuencias
repetidas. Respecto a su origen, la aparicin inicial de los microsatlites pudo deberse al azar, o
podran haber surgido como producto de mutaciones en la secuencia poli-A en el extremo 3.
Esta fuente de mutacin y cambio en el nmero de repeticiones podra proveer una fuente
de variacin cuantitativa para una rpida adaptacin evolutiva de las especies a cambios
ecolgicos. La nutricin y el estrs podran incrementar la velocidad de mutacin en los
microsatlites debido a un descenso de la regulacin de reparacin de errores. De esta forma, el
estrs que acompaa al cambio evolutivo podra inducir en una poblacin el incremento de
mutaciones requeridas para adaptarse al cambio.
Los microsatlites han demostrado ser los marcadores ms informativos para estudios
poblacionales a nivel de subespecie. La mayora de los estudios realizados hasta el momento con
este tipo de marcadores se basa en el anlisis de frecuencias allicas, con la finalidad en un

principio de la creacin de mapas genticos y posteriormente para la determinacin de QTLs


(Quantitative Trait Loci).
Los microsatlites se encuentran en los genomas de todos los eucariotas. Por medio de la
tcnica de PCR se amplifican estos pequeos segmentos para el anlisis de los polimorfismos
utilizando un par de oligonucletidos especficos complementarios a las secuencias nicas que
flanquean el microsatlite. Los fragmentos amplificados presentan un polimorfismo extensivo
resultante de la diferencia en el nmero de elementos simples repetidos. El resultado de la
amplificacin se fracciona en un gel de acrilamida-urea para determinar el genotipo de cada
individuo. As, cada regin microsatlite, independientemente de la secuencia repetida,
constituye un locus altamente variable, multiallico y de gran contenido informativo.

Figura 44. Deteccin mediante PCR de distintos alelos de un polimorfismo microsatlite y anlisis de genotipos
de microsatlites marcados con fluorescencia.

Los microsatlites presentan la ventaja de estar distribuidos al azar, en intrones, regiones


codificantes o intergnicas; aunque con una leve tendencia a presentar una mayor densidad en
la regin distal (telomrica) de los cromosomas.
El anlisis de PCR se usa de manera rutinaria en casos forenses para generar perfiles de
ADN a partir de muestras degradadas o antiguas. Los microsatlites han reemplazado a los VNTR
en la mayora de los laboratorios. Es menos costoso y mucho ms rpido. Los resultados de los
anlisis de STR se analizan e interpretan usando estadstica, probabilidad y gentica de
poblaciones.

B- MARCADORES QUE PRESENTAN CAMBIOS PUNTUALES EN EL GENOMA


RFLP: Polimorfismo de Longitud de Fragmentos de Restriccin. (Restriction Fragment Length
Polimorphism)
A finales de la dcada del 60, el descubrimiento de las endonucleasas de bacterias
(enzimas de restriccin con muy alta especificidad), las cuales cortaban el ADN en secuencias
definidas de usualmente 4-8 pb, conllev al desarrollo de tcnicas para el aislamiento y la
manipulacin de fragmentos de ADN. Una de las mayores aplicaciones de esta tcnica fue el
ensamblaje de los mapas genticos con el polimorfismo en longitud de los fragmentos de
restriccin.
Esta tcnica explota las variaciones en las secuencias del ADN por la creacin o abolicin
de sitios para el corte de las endonucleasas, dadas por los cambios de bases, las adiciones o
deleciones de fragmentos de ADN entre y en estos sitios. Adems, algunas endonucleasas son
incapaces de cortar el ADN si la secuencia de reconocimiento contiene uno o ms sitios de
citosina metilada, por lo tanto tales enzimas pueden detectar polimorfismo si hay variaciones en
los patrones de metilacin.
El estudio de los polimorfismos de este tipo consiste en el anlisis en cuanto a nmero y
tamao de los fragmentos de ADN que se originan al digerir con las mencionadas enzimas el
material genmico o un fragmento amplificado del genoma, de manera que un sitio de
restriccin polimrfico o una delecin o insercin entre dos sitios de corte ser detectado como un
polimorfismo en la longitud de los fragmentos de restriccin generados a nivel fenotpico. La
tcnica consta de las siguientes etapas (figura 3): digestin del ADN con enzimas de restriccin;
separacin por electroforesis de los fragmentos resultantes; transferencia de los fragmentos
separados a membranas de nitrocelulosa (Southern Blotting) e hibridacin con sondas
moleculares radiactivas y exposicin de la membrana a un filme de rayos X. La identificacin del
polimorfismo tambin puede hacerse por PCR. Este mtodo se ha empleado en la caracterizacin
de los genes de algunas de las protenas lcteas bovinas.
El uso de los RFLP como marcadores para trazar la transmisin de los genes asociados a
ellos, es de una utilidad considerable en gentica pues tienen como ventajas el no estar
influenciados por el ambiente, no depender del estado ontognico del animal, permitir un anlisis
de todo el genoma, poder ser detectados en estadios muy tempranos del desarrollo
independientemente de la expresin del gen, una vez heredados, y adems poseen la
caracterstica de ser codominantes en la expresin fenotpica, es decir, permiten discernir entre el
individuo homocigtico dominante y el heterocigtico; son muy comunes y cualquier gen debe
tener sitios de restriccin polimrficos en una vecindad de varios cientos de pares de bases.

Pero tienen como desventajas que son muy costosos, necesitan de un personal calificado
y entrenado para trabajarlo, precisan el uso de radioactividad y adems, consumen mucho
tiempo. En animales domsticos se ha realizado este tipo de anlisis del ADN desde 1985, con
numerosos trabajos en una amplia diversidad de especies.
Otras de las aplicaciones de esta tecnologa ha sido el desarrollo de detallados mapas de
ligamiento en una amplia variedad de organismos. Aunque sta es la ms conocida, el RFLP se ha
empleado tambin en la caracterizacin del genoma de organelos, en la identificacin de lneas
o individuos y en las investigaciones sobre el tema de la diversidad gentica. La identificacin y el
mapeo de RFLP han revolucionado la gentica humana por el desarrollo del diagnstico asistido
por marcadores y la deteccin de una amplia variedad de enfermedades hereditarias. A pesar
de haber sido ignorados este tipo de marcadores en sus inicios por los genetistas veterinarios, los
mismos mtodos para el mapeo en humanos son empleados para estudios de diferentes especies
animales, respecto a los sitios polimrficos, producindose una revolucin en el mejoramiento
animal por la introduccin de la seleccin asistida por marcadores (Marker Asisted Selection:
MAS).

Figura

45.

A:

esquemtica

Representacin
del

principio

gentico del RFLP.


B: Gel de azarosa 1.5% teido
con

bromuro

conteniendo

de
los

etidio

productos

obtenidos de ADN de diferentes


individuos, amplificados por PCR

RAPD: Amplificacin aleatoria de ADN polimrfico (Random Amplified Polymorphic DNA)


La tcnica RAPD, conocida tambin como AP-PCR es bsicamente una variacin del
protocolo de la PCR con dos caractersticas distintivas: utiliza un cebador nico (en lugar de un
par de primers) con una secuencia arbitraria, por lo tanto desconocida. Para que ocurra la
amplificacin,

dos

secuencias

complementarias

al

cebador

arbitrario

deben

estar

lo

suficientemente adyacentes (~400pb) y en orientacin opuesta que permita la amplificacin


exponencial por la ADN-polimerasa (Figura 4).
En los RAPD se emplean cebadores cortos (10 pares de bases) que se utilizan de forma
individual en reacciones de PCR con un nivel de especificacin muy bajos. De esta manera se
genera un patrn de bandas sencillos que depender de la capacidad de los cebadores para
encontrar zonas en el ADN, parcial o totalmente complementario.

Figura 46. Deteccin de un loci


polimrfico a travs de la tcnica
RAPD.

(Las

lneas

horizontales

representan los cromosomas de las


lneas consanguneas de ratones
C3H y B6)

Durante la fase de alineamiento de la reaccin de PCR-RAPD, el cebador o primer


arbitrario se unir a los sitios de la secuencia complementaria en el ADN molde desnaturalizado. Si
dos molculas se alinean con el molde en cadenas opuestas, con la orientacin apropiada y con
una distancia amplificable (menor o igual a 2500 bases) entonces ser amplificado un fragmento
discreto de ADN. Cada primer es potencialmente capaz de amplificar un nmero de fragmentos
(1-10 o ms) de diferentes loci durante la misma reaccin de PCR resultando en varias bandas. Los
segmentos amplificados pueden ser visualizados en un gel de agarosa teido con bromuro de
etidio o en geles de poliacrilamida de alta resolucin visualizados por autorradiografa o teidos
con plata detectndose el polimorfismo como ausencia o presencia de bandas de un fragmento
particular.
Los polimorfismos RAPD resultan de la diferencia de secuencias en uno o ambos sitios de
unin de los primers, los cuales evitan el alineamiento de la secuencia molde. Otras fuentes de
polimorfismo RAPD pueden incluir diferencias de apenas un par de bases (mutaciones puntuales)
que son suficientes para causar complementariedad del primer en el sitio de iniciacin; deleciones
o inserciones adyacentes en el sitio de iniciacin de modo que provoquen la accin de la ADNpolimerasa, por lo que los marcadores RAPD tienen naturaleza binaria, el segmento amplificado
est presente o no; son marcadores dominantes porque solo se amplifica una variante allica,

aquella que cumple con los requisitos de complementariedad entre el cebador y las cadenas de
ADN a una distancia menor o igual a 2Kb.
La distribucin de marcadores RAPD a lo largo del genoma es una consideracin
importante cuando se evala la utilidad de estos marcadores, los cuales estn ampliamente
ubicados ms o menos al azar por todo el genoma. Existen reportes que verifican su presencia en
el genoma de numerosas especies. Los RAPDs se
han utilizado tambin para la caracterizacin
racial en ganado bovino.
Para esta tcnica no es necesario conocer
previamente la secuencia del ADN.
Esta

tcnica

se

diferencia

fundamentalmente de otras y muestra ventajas,


por ejemplo, sobre RFLP, en que no se basa en
hibridacin sino en la amplificacin de ADN, lo

Factores como calidad y concentracin


del

ADN

molde,

presencia

de

contaminantes precipitables con etanol,


concentracin de cloruro de magnesio,
contenido de G+C en los primers y la
eficiencia del termociclador, influyen en
la amplificacin y afectan la sensibilidad
de la reaccin.

que implica simplicidad y rapidez, lo cual se debe a la posibilidad de detectar polimorfismo por la
visualizacin directa de las bandas en el gel, eliminando todas las etapas de transferencia de ADN
para membranas (Southern Blot), hibridacin con sondas especficas y autorradiografa; no
requiere del desarrollo de una librera de sondas especficas, sino que un conjunto de primers
arbitrarios puede utilizarse para cualquier organismo; se elimina la necesidad de istopos
radiactivos, se requiere 10-3 veces menos concentracin de ADN que para RFLP y la principal
desventaja es el bajo contenido de informacin gentica por loci asociado a la dominancia de
los marcadores RAPD, adems de que para su desarrollo requiere que se garanticen condiciones
de adecuada repetibilidad, adems de ser un mtodo muy trabajoso y costoso.
AFLP: Polimorfismos de longitud de fragmentos amplificados (Amplified fragment length
polymorphisms)

Se basa en

la amplificacin arbitraria de fragmentos de restriccin de ADN ligados a

adaptadores: se utilizan cebadores semiespecficos con secuencia complementaria al adaptador


en el extremo 5. Estos marcadores combinan dos enzimas de restriccin, (generalmente la EcoR1
y la Mse1) y dos amplificaciones de PCR usando primers marcados. Se generan patrones de
bandas complejos en donde es fcil encontrar polimorfismos claramente diferenciales. Consiste en
la amplificacin de mltiples regiones arbitrarias del genoma.
Involucra cuatro etapas:

digestin con dos enzimas de restriccin, una de corte raro (reconoce secuencias de 6pb) y
otra de corte frecuente (reconoce secuencias de 4pb);

acoplamiento de adaptadores especficos de doble cadena a los extremos de los fragmentos


de restriccin;

10

amplificacin selectiva de fragmentos con cebadores especficos. Se lleva a cabo con el uso
de iniciadores que contienen una base extra en el extremo 3 lo que produce un conjunto de
fragmentos que adems de llevar la secuencia complementaria al primer o iniciador,
complementan a la base extra adicional. Hay una segunda amplificacin en la cual se
conocen iniciadores con dos o tres bases extras. Los fragmentos son complementarios a las
extensiones consideradas.

separacin de los fragmentos por electroforesis en geles de poliacrilamida.


Se pueden utilizar varios mtodos para revelar el patrn de bandas: empleo de istopos

radiactivos y la tincin con nitrato de plata.


Mediante la seleccin del nmero de nucletidos selectivos es posible controlar el nmero
de fragmentos a amplificar, en una relacin inversamente proporcional. El polimorfismo es
detectado por la presencia o ausencia de bandas debido a mutaciones en los sitios de restriccin
o en secuencias adyacentes a estos, los cuales se complementan o se diferencian de los
nucletidos selectivos aadidos a los cebadores de la PCR, y por inserciones o deleciones dentro
del fragmento amplificado.
Tiene como ventajas que se obtiene un alto grado de polimorfismo, un mayor nmero de
marcadores por gel analizado y no requiere del conocimiento de la secuencia de ADN. Debido a
la cantidad de marcadores que pueden ser generados, el mapeo gentico puede realizarse con
mayor rapidez y ms fcilmente. Es una tcnica para estudios de biodiversidad. Comparado con
RFLP es ms rpido, menos laborioso y provee mayor informacin. Revela fundamentalmente el
polimorfismo dominante, que puede ser por la presencia o ausencia del sitio de restriccin o por
una simple variacin de un nucletido en el genoma.
Los marcadores AFLP pueden ser aislados del gel y usarlo como sondas para caracterizar
nuevos clones, o secuenciarlos para disear cebadores y emplearlos en otras tcnicas basadas en
PCR.

11

Figura 47. Representacin esquemtica de los AFLP

SSCPs: Polimorfismo de Conformacin de las Cadenas Simples


El ADN de cadena simple tiende a doblarse y formar estructuras complejas estabilizadas
por enlaces intramoleculares dbiles, especialmente por puentes de hidrgeno. Consiste en la
deteccin de las diferencias entre fragmentos de ADN amplificados, con distinta secuencia. Esto
permite la deteccin de mutaciones puntuales de ADN sin necesidad de conocer su secuencia y
son capaces de identificar entre el 30 y 70% de todos los polimorfismos debidos a una mutacin
simple. Su deteccin se lleva a cabo en un gel de acrilamida en condiciones no desnaturalizantes.
Los primers pueden estar radioactivamente marcados, o puede realizarse la deteccin de los
productos amplificados por tincin con plata y siempre deben incluirse muestras controles para
identificar el tipo salvaje del mutado.

12

SSCP es simple y adecuadamente sensible para fragmentos de hasta 200pb de longitud, y


han sido utilizados en la identificacin de variantes allicas de las protenas lcteas, pero para el
desarrollo de esta metodologa se requiere una amplia batera de oligonucletidos que encarece
su utilizacin.
SNPs: Polimorfismo de nucletido simple (Single Nucleotide Polymorphism)
Se consideran la ms reciente generacin de marcadores moleculares, basados en la
identificacin de la sustitucin de un nucletido por otro, representando solamente dos alelos
simples. Su frecuencia oscila entre 1 cada 600 y 1 cada 1000 pares de bases. Ellos incluyen la
tcnica clsica de RFLPs pero no exactamente detectando la aparicin o abolicin de un sitio de
restriccin. Constituye una ventaja el hecho de que puedan ser detectados sobre arrays (chips)
de fase slida sin necesidad del empleo de electroforesis en geles.
El mtodo ms directo para la deteccin es la secuenciacin de segmentos de ADN,
previamente amplificados por PCR, de varios individuos que representen la diversidad de la
poblacin. Se disean cebadores para amplificar fragmentos de ADN de 400-700 pb, derivados
fundamentalmente de genes de inters o de secuencias reportadas en bases de datos
correspondientes a secuencias expresadas (expressed sequence tag, EST). Los productos
amplificados se secuencian en ambas direcciones y sus secuencias se comparan en busca de
polimorfismos.
El microarray es un arreglo de

La mayora de los mtodos de deteccin de SNPs se

cientos a millares de secuencias

basan en la amplificacin usando multiplex de una

de

secuencia diana y la hibridacin con oligonucletidos

ordenadas en forma de matriz

anclados al microarray, cada uno de los cuales est

adheridas

terminado en un nucletido polimrfico.

ADN

inmovilizadas
a

una

superficie

slida (generalmente de cristal).


Cada

secuencia

diferente.

es

un

gen

Un paso sencillo de extensin del primer se lleva a


cabo sobre el array, usando una mezcla de cuatro
dideoxinucletidos marcados con fluorescencia. Las marcas
se adicionan a los cebadores que se unen perfectamente al

ADN, no siendo as con aquellos que no lo hacen en el extremo 3. La lectura de la presencia o


ausencia de fluorescencia en el array permite obtener el tipo de cada SNP sobre el array.
Cualquiera de los cuatro nucletidos puede estar presente en cualquier posicin en el
genoma, por lo tanto se debe suponer que cada SNP tendra cuatro alelos. Tericamente esto es
posible, pero en la prctica la mayora de los SNP tienen solamente dos variantes, la secuencia
original y la versin mutada. Esto se debe a la va en que estos aparecen y se distribuyen en una
poblacin. Un SNP se origina cuando una mutacin puntual ocurre en el genoma, convirtiendo un
nucletido en otro. Si la mutacin ocurre en las clulas reproductivas de un individuo, pudiendo
ser heredada por uno o ms descendientes y despus de muchas generaciones, el SNP puede

13

establecerse en la poblacin. Para que se produzca un tercer


alelo, una nueva mutacin debe ocurrir en la misma posicin
en el genoma de otro individuo, y este individuo y su
descendencia deben reproducirse de forma tal que el nuevo
alelo quede establecido. Esto no es imposible, pero es poco
probable, por lo tanto la mayora de los SNP son biallicos.
Figura 48. Los SNP son marcadores basados en la identificacin de la
sustitucin de un nucletido por otro.

Los SNP pueden aparecer tanto fuera de los genes (que no afecten la produccin o
funcin de alguna protena) como en un gen especfico, donde pueden ubicarse en regiones
codificantes (relacionados con cambios en la cantidad de protena producidas) o no codificantes
(que afectan solo la secuencia de aminocidos).
Estos han sido empleados como marcadores para el diagnstico de rasgos especficos por
ser abundantes en el genoma bovino, genticamente estables y de anlisis fcilmente
automatizable, lo que ha permitido adems, su utilizacin como marcadores para la identificacin
animal y pruebas de paternidad en ganado bovino.
Un haplotipo es una combinacin de alelos de
diferentes loci de un cromosoma que son trasmitidos
juntos, estn ligados en un mismo cromosoma. Un
haplotipo

puede

ser

un

locus,

varios

loci,

un

cromosoma entero dependiendo del nmero de eventos


de recombinacin que han ocurrido entre un conjunto
dado de loci.
Figura 49. Un haplotipo es un conjunto especfico de SNP y otras variantes genticas observadas en un
cromosoma individual o en parte de un cromosoma.

Dada la alta variabilidad allica, la probabilidad de que dos individuos no relacionados


presenten un mismo haplotipo, es prcticamente nula. Es por esto que el estudio de haplotipos se
ha convertido en una herramienta til en la determinacin de relaciones genticas entre
individuos. Los SNPs (polimorfismos de nucletido simple) se heredan en grupos que se encuentran
estrechamente relacionados en el ADN. A este grupo de SNPs que se heredan en bloque, es a lo
que hemos denominado haplotipos.

14

EST: Etiquetas de secuencia expresada (Expressed sequence tags)


Los EST son secuencias cortas obtenidas de clones de ADN complementario (ADNc) y sirven
como pequeos identicadores del gen. Puede usarse como un marcador, para buscar el resto
del gen o para ubicarlo en un segmento ms grande de ADN.
Tpicamente tienen entre 200 y 400 nucletidos de longitud. Los datos de los EST son
capaces de proporcionar una estimacin aproximada de los genes que estn expresados
activamente en un genoma bajo una condicin siolgica en particular.
Esto debido a que las frecuencias para ESTs particulares reejan abundancia en los ARNm
de una clula, que corresponde con los niveles de expresin de genes bajo esa condicin. Otro
potencial benecio del muestreo por EST es que, al secuenciar clones de ADNc de manera
aleatoria es posible encontrar nuevos genes. Sin embargo la utilizacin de EST tambin presenta
varios inconvenientes, para el anlisis de perles de expresin. Tienen como desventaja:

Baja calidad, debido a que se generan de forma automatizada, sin vericacin (conlleva
a altos ndices de error)

Errores de lectura

Contaminacin comn por vectores de secuencia, intrones (de ARN no empalmado), ARN
ribosomal, ARN mitrocondrial entre otros.
A pesar de estas limitaciones, la tecnologa EST es todava ampliamente utilizada, debido a

que las bibliotecas de EST pueden ser generadas fcilmente de diferentes tipos de clulas (tejidos,
rganos). Adems facilita la identicacin exclusiva de un gen de una biblioteca de ADNc.
Aunque los EST son propensos a errores, una coleccin completa de EST contiene informacin muy
til.
La rpida acumulacin de secuencias de EST, ha impulsado el establecimiento de bases
de datos pblicas y privadas para almacenar los datos. Genbank tiene una base de datos EST,
dbEST (http://www.ncbi.nlm.nih.gov/projects/dbEST/).
Uno de los objetivos de las bases de datos de EST es organizar y consolidar un gran nmero
redundante de datos para mejorar la calidad de la informacin.
Este proceso incluye el preprocesamiento de los datos el cual remueve vectores
contaminantes y enmascara repeticiones. Despus sigue un proceso de agrupamiento o
clustering que agrupa secuencias EST asociadas a genes nicos.
El siguiente paso es obtener el consenso mediante la fusin de secuencias redundantes,
superposicin de EST y errores de lectura.
Una vez que la secuencia de codicacin es identicada puede ser anotada
traducindola a una secuencia de protenas para bsqueda de similitudes en base de datos.
El compilado de EST puede ser utilizado para alinearlo con la secuencia del genoma y as
poder identicar la localizacin del gen expresado y as como tambin obtener los lmites entre
exones e intrones.

15

El proceso de agrupamiento que reduce la redundancia de EST y produce una coleccin


de secuencias EST de genes no redundantes se conoce como construccin de ndices de genes.
STS: sitio de secuencia de etiquetado (Sequence tagged sites)
A diferencia de la PCR con cebadores arbitrarios (RADP y AFLP), el diseo de los cebadores
para detectar sitios de secuencia etiquetada (STS) est basado en cierto conocimiento de las
secuencias. Estos cebadores son nicos y especficos de las secuencias, y detectan variacin en
el ADN genmico. Los STS tienen una ventaja especial sobre los RAPD por ser codominantes, o sea,
pueden distinguir entre los homocigotos y los heterocigotos. Tienden tambin a ser ms
reproducibles, porque las secuencias de los cebadores son ms largas.
Tienen, sin embargo, una desventaja: requieren de algn conocimiento preexistente de la
secuencia del ADN de la regin, aunque slo sea parcial. Su inconveniente principal es la inversin
en esfuerzo y costo que se necesita para disear los cebadores especficos de cada locus.
Del mismo modo que con los RAPD, el uso de la PCR genera datos rpidamente y requiere
poco ADN. Todos los mtodos de STS usan los mismos protocolos bsicos que usan los RAPD
(extraccin de ADN y PCR) y requieren el mismo equipo.
Aprovecha las secuencias conocidas, nicas dentro del genoma, para amplificarlas por
PCR. El polimorfismo se suele encontrar fcilmente cuando lo que se amplifican son intrones en
lugar de exones. La ventaja principal es la velocidad con la que se pueden realizar los anlisis una
vez que las parejas de oligonucletidos se han establecido claramente. Por tanto se combinan la
rapidez de la RAPD con la especificidad de la RFLP.

16

Tabla 3: Comparacin de algunos marcadores genticos


RFLP

SSR

RAPD

AFLP

Isoenzimas

STS / EST

Annimo /
gnica

Annimo

Annimo

Annimo

Gnica

Gnica

El nmero mximo
terico de posibles
loci en el anlisis

Limitado por el
sitio de
restriccin
(nucletidos)
polimorfismo
(decenas de
miles)

Limitado por el
tamao del
genoma y el
nmero de
repeticiones
simples en un
genoma
(decenas de
miles)

Limitado por el
tamao del
genoma, y por
el polimorfismo
de nucletido
(decenas de
miles)

Limitado por el
sitio de
restriccin
(nucletidos)
polimorfismo
(decenas de
miles)

Limitado por el
nmero de
genes de
enzimas y
ensayos
histoqumicos
enzimticos
disponibles (3050)

Limitado por el
nmero de
genes
expresados
(10.000-30.000)

Dominio

Codominante

Codominante

Dominante

Dominante

Codominante

Codominante

Alelos nulos

Raro muy raro

Ocasional a
frecuente

Raro

Raro

A travs de
gneros

Dentro de los
gneros o
especies

Dentro de las
especies

Dentro de las
especies

A travs de las
familias y
gneros

A travs de las
especies
relacionadas

Reproducibilidad

Alto a muy alto

De medio a alto

Bajo a medio

De medio a alto

Muy alto

Alto

Cantidad de
muestra requerida
por muestra

2.10 mg de ADN 10-20 ng de DNA 2-10 ng de DNA

0.2-1 g de ADN

Varios mg de
tejido

10-20 ng de DNA

Caracterstica
Origen

Transferibilidad

No aplicable
No aplicable
(presencia /
(presencia /
ausencia tipo de ausencia tipo de
deteccin)
deteccin)

Facilidad de
desarrollo

Difcil

Difcil

Fcil

Moderado

Moderado

Moderado

Facilidad de
ensayo

Difcil

Fcil a
moderado

Fcil a
moderado

De moderada a
difcil

Fcil a
moderado

Fcil a
moderado

Automatizacin /
multiplex

Difcil

Posible

Posible

Posible

Difcil

Posible

Genoma y el
potencial de
mapeo de QTL

Bueno

Bueno

Muy bueno

Muy bueno

Limitado

Bueno

Potencial de
mapeo
comparativo

Bueno

Limitado

Muy limitada

Muy limitada

Excelente

Buena a muy
buena

Mapeo de genes
candidatos
potenciales

Limitado

Intil

Intil

Intil

Limitado

Excelente

Potencial para el
estudio de la
variacin gentica
adaptativa

Limitado

Limitado

Limitado

Limitado

Bueno

Excelente

Moderado

Caro

Barato

Moderado

Barato

Caro

Barato

Moderado

Barato

Moderado a
cara

Desarrollo
Ensayo

Moderado

Moderado

Barato

Moderado a
cara

Equipo

Moderado

Moderado a
cara

Moderado

Moderado a
cara

RFLP polimorfismo en la longitud de fragmentos de restriccin; SSR - repeticiones de secuencia simple


(microsatlites); RAPD amplificacin al azar de ADN polimrfico; AFLP - polimorfismo de longitud de fragmentos
amplificados; STS - sitio de secuencia de etiquetado; EST - etiquetas de secuencias expresadas.
Fuente: http//www.fao.org

17

CRITERIOS PARA SELECCIONAR EL TIPO DE TCNICA


La seleccin de la tcnica depende del objetivo trazado. Las tcnicas moleculares
brindan informacin a diferentes niveles taxonmicos. Todas tienen sus limitaciones y su
aplicacin estar determinada en gran medida, por la informacin que estamos buscando con la
utilizacin de un sistema de marcadores moleculares, as como la disponibilidad de recursos
necesarios para el desarrollo de este tipo de tcnicas. Entre los factores ms importantes a
considerar se encuentran el contenido de informacin y el radio mltiple que cada tcnica
puede brindar. El contenido de informacin refleja el nmero de alelos que pueden ser
detectados por el marcador en un nmero e individuos. El radio mltiple lo constituyen el nmero
de marcadores que pueden ser generados por una reaccin simple
La seleccin del mtodo depende de la aplicacin especfica que se desea. Si el objetivo
es identificar el genoma o evaluar la diversidad gentica, los mtodos con radio mltiple (ej.
AFLP), son apropiados debido a que pueden ser detectados muchos loci distribuidos al azar por el
genoma. Este tipo de marcadores tambin son muy tiles en anlisis genotpicos y taxonmicos
para construir mapas genticos y para identificar marcadores unidos a un carcter en particular.
Para varios aspectos de la biologa poblacional (anlisis de paternidad, flujo de genes, etc.) y
mejoramiento gentico, los mtodos con alto contenido de informacin son ms tiles.

ALGUNAS APLICACIONES DE LOS MARCADORES MOLECULARES EN GANADERA

18

Los marcadores moleculares se aplican en diferentes campos de investigacin, y se utilizan


en el aislamiento de genes con funcin desconocida, gracias al conocimiento de su posicin en
el genoma y en el campo de la evolucin, mediante la comparacin de mapas genticos para la
ubicacin de las alteraciones estructurales del genoma que ocurren durante la diversificacin de
un gnero o familia. Sin embargo, el campo ms favorecido por los marcadores moleculares es la
gentica cuantitativa, y es muy utilizada por los criadores. La gentica cuantitativa incluye el
anlisis de las bases genticas de la variacin morfolgica, el desarrollo de estrategias para la
caracterizacin de genes que se puedan cuantificar (QTL); la seleccin asistida por marcadores
(SAM), en el caso de caractersticas influenciadas por varios genes, polignicas; y la seleccin
asistida por genes (SAG), en el caso de caractersticas influenciadas por un solo gen,
monognicas. La SAM y la SAG son dos herramientas poderosas en el mejoramiento de plantas y
animales. Los marcadores genticos tienen muchas aplicaciones en diferentes fases de
programas de seleccin: la optimizacin para la conservacin de fuentes de genes, seleccin de
padres, identificacin de alelos favorables y desarrollo de genotipos que acumulen tales alelos.
Cualquier contribucin de los marcadores moleculares a la seleccin, se basa en la disponibilidad
de marcadores ligados a aquellos genes involucrados en la variacin de la caracterstica
seleccionada. As, la aplicacin de la SAM y SAG se puede utilizar para el desarrollo de genotipos
particulares y para el mejoramiento de poblaciones por seleccin recurrente.
Los marcadores constituyen una herramienta fundamental en la construccin de mapas
genticos. Dichos mapas, adems de su indudable inters cientfico, son herramientas
fundamentales para la identificacin y aislamiento tanto de genes responsables de enfermedades
como otros de inters econmico para posteriormente utilizar esta informacin en programas de
mejoramiento animal a travs de la llamada Seleccin Asistida por Marcadores. Tambin ofrecen
considerables posibilidades para mejorar la elaboracin de productos agroindustriales, sobre todo
mediante procesos inocuos para el medio ambiente y de elevado rendimiento energtico.
Aunque probablemente la mayor parte de estas tecnologas no estarn al alcance de la
produccin pecuaria tradicional, resultarn considerablemente accesibles para el sector
comercial e industrial emergente de muchos pases en desarrollo.
La identificacin de parentesco o control de filiacin se lleva a cabo tambin por el uso de
paneles de microsatlites. La existencia de animales clonados llev a un profundo anlisis en el
pas sobre los requisitos para la inscripcin de los mismos en registros genealgicos, ya que por
definicin no tienen progenitores. Es as que la confirmacin formal de la identidad de un clon en
relacin al animal que le dio origen, debe hacerse obligatoriamente a travs de un panel de
marcadores genticos moleculares.
El impacto de los errores tiene sobre los programas de mejora un alto impacto dado que
permite un correcto registro genealgico. La identificacin de los mismos ha permitido la
determinacin del genotipo actual en un locus o loci especfico sin errores debidos a los efectos
ambientales. En vacunos, cerdos y caballos principalmente, el control de parentesco se ha

19

realizado de forma rutinaria en la mayora de los pases mediante la metodologa de grupos


sanguneos y polimorfismos bioqumicos.
El

Laboratorio

de

Gentica

Aplicada

de

la

Sociedad

Rural

Argentina

(http://www.sra.org.ar/laboratorio) cumple con los requisitos de confirmacin de parentesco y la


inscripcin de reproductores en los registros genealgicos. Hasta el 2010 se haban realizado ms
de 56.000 anlisis en bovinos y 75.000 en equinos.
Esta aplicacin tiene un gran impacto en la implementacin de planes de mejoramiento.
La falta de genealoga impide la implementacin de los mtodos basados en gentica
cuantitativa, porque es imprescindible establecer las relaciones de parentesco en la poblacin.
Estos mtodos requieren la definicin de una matriz de parentesco entre los animales evaluados. El
caso ms simple es el de los servicios a campo con varios toros. En estos casos, dado el limitado
uso de la inseminacin artificial en bovinos para carne, restringe severamente la evaluacin
gentica. Si bien la relacin costo/beneficio no es todava muy favorable, la tecnologa est
disponible, es efectiva y potenciara significativamente la utilidad de las metodologas de la
gentica cuantitativa.
La identificacin gentica permite hablar de una huella gentica. En este sentido se pueden
identificar genotipos en loci cuyos genes tienen efectos directos sobre una caracterstica
particular. Esta aplicacin permite llevar adelante anlisis de trazabilidad.
Respecto a la seguridad alimentaria se han puesto de relieve la necesidad de mtodos
ms eficaces para el rastreo de animales vivos y sus derivados, especialmente cuando son objeto
de intercambios comerciales. La trazabilidad se define como la posibilidad de encontrar o seguir
el rastro a travs de todas las etapas de produccin, transformacin y distribucin de un animal,
alimento o sustancia. No debe confundirse la trazabilidad con la identificacin de un individuo,
una correcta trazabilidad comprende a una correcta identificacin previa. Por otro lado, la
respuesta biolgica de los individuos en un ambiente dado se establece gracias a uno o un grupo
de genes que son los responsables de que un animal sea inferior o superior en cuanto a
produccin se refiere; que manifieste un color u otro, un incremento en la masa muscular, un
incremento en la produccin de leche o un incremento en la prolificidad.
Los marcadores tambin permiten la identificacin racial. Por ejemplo, los productos del
cerdo ibrico presentan un elevado valor econmico siendo importante detectar su origen para
verificar la relacin entre el producto etiquetado y su origen gentico. En el caso del cerdo el gen
MC1R que codifica para el receptor de la melacortina (relacionado con la pigmentacin de la
capa) presenta 4 alelos conocidos. El cerdo ibrico presenta los alelos MC1R*1 y el MCR1*3,
mientras que el MCR1*4 es responsable de la capa colorada del Duroc. La denominacin de
origen de estos productos se realiza mediante el genotipado. De una manera ms especfica
tambin se puede realizar la identificacin de especies para asegurar un correcto etiquetado y la
procedencia de las materias primas por ejemplo en una cadena alimentaria. Por ejemplo en

20

embutidos o pates etc. y cuyo precio tambin vara de acuerdo de su elaboracin. Existen
marcadores de tipo RAPD para diferencias entre las especies como pollo, pavo, cerdo etc.
En especies de rumiantes existe necesidad de identificar el origen de la leche con la que se
han elaborado ciertos productos. No cotiza de la misma manera un queso de oveja que de vaca.
Se han amplificado regiones del citocromo b para obtener patrones de diferentes especies.
Deteccin de la introgresin gentica. Con este trmino se entiende la inclusin de genes
en una poblacin de otra diferente. El problema es detectar la presencia de genomas forneos
en el genomio de una especie autctona que por ejemplo va a ser liberada en la naturaleza.
Estas actuaciones afectan a la integridad gentica de las especies autctonas dando lugar a un
deterioro gentico de la biodiversidad.
Los marcadores constituyen una buena herramienta para analizar la diversidad gentica
como control de las poblaciones, introduccin de genotipos, limites a la seleccin y medidas de la
prdida de variabilidad gentica.
Deteccin de portadores. En la actualidad se cuenta con marcadores genticos
confiables que son tiles para la genotipificacin y la deteccin de los individuos que son
portadores de genes para produccin, con predisposicin para desarrollar enfermedades, o
genes que confieren resistencia a ciertas enfermedades. Al identificar a los individuos poseedores
de estos marcadores se pueden comenzar a disear cruzamientos, sistemas de mejora gentica o
planear la produccin con objetivos de produccin bien definidos.
En el siguiente cuadro

se citan algunos marcadores que se pueden utilizar para

genotipificar individuos de las especies animales de inters pecuario. Se citan marcadores, genes
o QTL que estn disponibles a nivel comercial para identificar a aquellos individuos bovinos,
porcinos u ovinos portadores de rasgos productivos deseables (miostatina en bovino, gen boorola
en ovino) o indeseables (por ejemplo, la rianodina, el gen de hipertermia maligna en cerdo y el
gen del sndrome de patas de araa en ovino). Una vez obtenida esta informacin gentica, la
misma se puede aplicar para llevar a cabo programas de cruzamiento o de mejora gentica,
para mejorar la productividad animal, para elevar la calidad de los productos que derivan de los
animales domsticos, para establecer denominaciones de origen de productos pecuarios o para
eliminar los animales portadores de genes indeseables.

21

Tabla 4: Marcadores utilizados a escala comercial para ser tomados en cuenta en la seleccin de
individuos asistida por marcadores-genes.

En la actualidad existe lo que se denomina prueba gentica, la cual consiste de varios


mtodos de prueba para estudiar el ADN de ciertas especies domsticas. Algunas de estas
pruebas ayudan a identificar individuos portadores de marcadores que permitiran su seleccin o
eliminacin. Entre ella se encuentran la prueba de halotano (HAL) para el estrs que repercute en
la calidad de carne en cerdos, la prueba de hipertermia maligna en cerdos (HTM), la prueba de
tamao de camada y aumento de fertilidad en padrillos. En la figura 8 A) se muestra al marcador
molecular identificado para la presencia de HTM en cerdos, y en B) el fenotipo producido por la
presencia de HTM en un ejemplar de la raza porcina Pietrain.
En corderos es posible la Identificacin del sndrome de patas de araa y la identificacin
de un marcador de resistencia natural a la infestacin por nemtodos. En bovinos es posible
identificar a los portadores del gen de hipertrofia muscular en el bovino a travs del Gen de la
miostatina (MSTN). En la figura 9 A) y B) se muestra un anlisis de secuencia de ADN para la
identificacin de mutaciones en el gen de miostatina de las razas de bovinos Belgian Blue y
Piedmontese, en una comparacin con el gen normal de la raza Holstein. En la figura 9 C) se
muestran los fenotipos de las tres razas de bovinos analizadas.

22

Figura 50. Prueba de hipertermia maligna en cerdos (HTM). Perfil electrofortico de productos de PCR digeridos con la
enzima Cfol para identificar los genotipos para el gen de la hipertermia maligna en cerdos. Carril M, marcador de tamao
molecular; carriles 1, 5, 6, 7 y 9, homocigotos normales (NN); carriles 2, y 8, heterocigotos normales (Nn); carriles 4 y 10,
homocigotos recesivos (nn) que manifiestan el genotipo indeseable. B) Ejemplar de la raza porcina Pieltrain que manifiesta
el genotipo nn, cuya expresin produce sndrome de hipertermia maligna que se asocia con la produccin de carne
plida, suave y oxidativa (PSE) de baja calidad.

Figura 51. Mutaciones identificadas en la


secuencia del gen de miostatina de bovinos. A)
Auto radiografa que seala las mutaciones en
la secuencia del gen de miostatina. B)
Localizacin de la mutacin de miostatina
debida a una eliminacin de 11 bases en la
raza Belgian Blue, que presenta un fenotipo de
doble musculatura; mientras que un cambio de
G por A en la raza Piedmontese, le confiere
tambin un fenotipo de doble msculo. C)
Ejemplar de la raza Holstein cuyo gen de
miostatina no contiene mutaciones y presenta
un fenotipo de musculatura normal (Tomado
de McPheron y Se Jin-Lee, 1997).

La deteccin de portadores
antes se resolva a partir de una
prueba de progenie, idealmente con
sus propias hijas, una prueba que
lleva mucho tiempo y es costosa.
Actualmente se realiza un anlisis de ADN si la base molecular ha sido caracterizada o de
marcadores en estrecho ligamiento con la mutacin causal. En relacin a esta aplicacin, se ha
organizado la base de datos OMIA (http://omia.angis.org.au/), que rene informacin de
defectos y enfermedades de origen gentico en ms de 135 especies. El carcter de portador de
un reproductor es asentado junto con el resto de la informacin productiva del mismo. Un fenotipo

23

indeseable (que se sospeche de origen gentico) puede ser confirmado a travs de un test de
laboratorio.
Deteccin de enfermedades: En la actualidad existen numerosas enfermedades
hereditarias. Una vez que se tiene caracterizados molecularmente a los animales, la informacin
de presencia del marcador en el hato, piara o manada puede ser usada para incrementar la
frecuencia de este marcador asociado positivamente a una caracterstica de inters,
seleccionando los animales que posean dos copias de este marcador contra los que no lleven
ninguna copia. En un hato tpico, el uso de sementales que lleven dos copias del marcador
(homocigoto) puede ser la va ms rpida para incrementar la frecuencia del marcador en el
hato. El costo de la identificacin de individuos portadores de genes y QTL superiores, es
relativamente alto, pero este costo se puede recuperar al elevar el valor del animal superior (FAO,
2003). Ejemplos tpicos en bovino son la enfermedad de BLAD, (Bovine Leukocyte Adhesion
Deficiency) o la CVM (Complex Vertebral Malformation).
La primera (BLAD) se debe a un defecto de la expresin de la protena CD18 causado por
una mutacin en el gen que origina una alteracin en el transporte de los leucocitos desde la
sangre a los lugares de infeccin.
En el campo de la sanidad animal se han utilizado metodologas moleculares en el
desarrollo de nuevos tratamientos de enfermedades, en la creacin de vacunas como la de la
fiebre aftosa, primer producto de la biologa molecular, la de la tuberculosis bovina o de la
brucelosis bovina, como en la creacin de anticuerpos monoclonales (utilizados en vacunas y
tratamientos), inmunoglobulinas, etc. Tambin sus aplicaciones se refieren a aspectos que influyen
en la produccin y calidad de la leche, sobre todo en el ganado bovino.
Diagnostico molecular de enfermedades. La aplicacin de la biotecnologa del ADN a la
salud animal, mediante vacunas ms eficaces, baratas y resistentes combinadas con mejores
instrumentos de diagnstico, podra contribuir en medida importante a mejorar el control de las
enfermedades, estimulando as la produccin nacional de alimentos y la participacin en el
comercio ganadero. Actualmente existen alternativas que permiten visualizar la causa primaria
con la probabilidad de cometer mas errores o falsos positivos. Los mtodos genmicos permiten
visualizar el ADN del genotipo de inters, ya sea detectando una regin especfica o la
identificacin una zona de resistencia a una enfermedad.
Utilizacin de Marcadores en caractersticas productivas: Numerosos estudios realizados
durante las ltimas cuatro dcadas han puesto de manifiesto correlaciones estadsticamente
significativas entre marcadores genticos y caracteres de produccin lechera. Los primeros
estudios fueron enfocados principalmente hacia el anlisis de los grupos sanguneos y
polimorfismos bioqumicos De los 10 grupos sanguneos analizados por estos autores slo el grupo B
evidenci un efecto significativo sobre el porcentaje de grasa en leche, concluyendo que dicho
marcador explicara entre el 1,5 y 3,9% de la varianza total en el ganado lechero dans.
Resultados similares fueron encontrados, en el ganado sueco, en la raza Holstein, asociaciones

24

entre el grupo sanguneo E con produccin de grasa y leche, entre el grupo sanguneo B con
porcentaje de grasa en leche, y asociaciones entre el grupo sanguneo S con diferencias en la
produccin de grasa.
En cuanto a los polimorfismos bioqumicos, se hall en la raza Holstein, asociaciones entre
las variantes allicas de las transferrinas (Tf) con diferencias en el rendimiento de leche y grasa. Al
estudiar tres familias de medias hermanas de la raza Friesian, se observ asociaciones entre las
variantes de post-albmina (Pa) con rendimiento en litros de leche, y entre amilasa-1 (Am-1) con
porcentaje de grasa. A pesar del esfuerzo realizado, los estudios de correlacin entre los grupos
sanguneos y los polimorfismos bioqumicos con los caracteres de produccin lechera no lograron
grandes avances.
En los ltimos aos, el enfoque fue trasladado hacia la bsqueda de loci candidatos y/o
hacia el rastreo del genoma mediante el uso simultneo de un gran nmero de marcadores
moleculares altamente polimrficos, del tipo microsatlite.
Se ha definido a los loci candidatos como aquellos genes que por su funcin biolgica
participaran en la expresin de un carcter cuantitativo y por lo tanto podran explicar un
porcentaje de su varianza fenotpica. Pueden mencionarse a modo de ejemplo las protenas de la
leche, la prolactina (PRL), la hormona de crecimiento (GH), el Complejo Principal de
Histocompatibilidad (MHC), etc.
Loci relacionados con caracteres lecheros
Han sido documentadas correlaciones entre algunas de las variantes de las protenas de la
leche con el rendimiento y la composicin del producto obtenido. Han sido observadas
diferencias en el grado de correlacin entre esas variables debido a distintas causas (mtodos
estadsticos utilizados, nmero de animales estudiados, tipos de marcadores, etc.)
Entre las protenas detectadas en la leche se encuentran las casenas (-casena, -
casena, S1-casena y S2-casena), -lactoglobulina y -lactoglobulina y -lactoalbmina. Un
documento presentado por Giovambattista y cols. (1998) destaca las siguientes caractersticas de
las protenas de la leche.
casena. (CAS): Esta protena constituye aproximadamente el 13 % de las casenas
totales. Mediante corridas electroforticas, as como tambin a nivel de ADN, se han descripto dos
variantes allicas mayoritarias: A y B. La leche producida por animales de genotipo BB contiene
mayores niveles de protenas, grasa y slidos totales. Adems, las diferencias en el contenido
proteico de la leche, entre los animales CAS AA y CAS BB, se estim en aproximadamente un
3%. Este locus puede explicar alrededor del 4% de la variacin total en el contenido proteico.
Adems este genotipo se ha correlacionado con un mayor rendimiento en litros de leche. Fueron
confirmadas en diferentes razas como Holstein, Friesian, Jersey, Ayrshire, Guemeys y otras. En las
diferentes razas, no siempre se presentan las mismas asociaciones marcador - QTL. Si tenemos en

25

cuenta que el ligamiento entre el QTL y el marcador gentico es incompleto, podran existir en la
poblacin diferentes haplotipos marcador-QTL. As por ejemplo, el alelo B de CAS estaba
asociada a una disminucin en el porcentaje de grasa. La leche producida por animales con
genotipo CAS BB posee propiedades superiores para la manufacturacin de queso. La leche de
tipo BB tienen menor tiempo de renina, cuajo ms firme, y un mayor contenido en protenas y
slidos totales, presenta mayor proporcin de -casena y micelas ms pequeas. Esta
caracterstica explica la formacin de un cuajo ms firme y una mayor retencin de slidos, lo que
resulta en un rendimiento superior durante la produccin de queso, comparada con la leche
producida por animales con genotipo CAS AA.
S1-casena (CASS1): Esta protena constituye el 38 % de las casenas totales presentes en
la leche. Posee dos variantes principales denominadas B y C. Los individuos CASS1 BB tenan un
rendimiento en litros de leche significativamente mayor que los animales CASS1 BC. Estas
observaciones indicaran la existencia de una fuerte correlacin entre el alelo B y una mayor
produccin lechera. Sin embargo, no se hallaron asociaciones significativas entre los genotipos de
CASS1 con produccin lechera en vacas de la raza Holstein.
En las razas lecheras ms difundidas, como las Holstein-Friesian, el alelo B se encuentra
prximo a la fijacin; este hecho podra haber sido consecuencia de la fuerte presin de
seleccin ejercida sobre dichas razas durante el ltimo siglo.
-lactoglobulina (LG): La -LG es la principal protena del suero en la leche de los
rumiantes, constituyendo el 50% de las protenas presente en el suero. Aunque todava no est
clara su funcin fisiolgica, se supone que podra participar en el transporte y metabolismo del
retinol y los cidos grasos.
Al igual que en el caso de -casena, se han descripto dos variantes allicas mayoritarias: A
y B. La expresin diferencial de los alelos A y B de LG ha sido observada en diferentes
poblaciones de ganado bovino lechero.
Finalmente, cabe mencionar que no todos los trabajos han hallado correlaciones
estadsticamente significativas entre los genotipos de LG y los caracteres de produccin lechera.
-lactoalbmina (-AL): La -lactoalbmina (-LA) constituye el 20% de las protenas
presentes en el suero de la leche. Hasta el momento han sido detectadas tres variantes: A, B y C
en la raza Holstein, la variante A con una mayor cantidad de leche, protenas y grasa. La variante
B fue asociada con mayores porcentajes de protena y grasa, observndose valores intermedios
en los animales heterocigotas.
A pesar de la importancia fisiolgica de la hormona Prolactina para la lactancia, son
escasos los trabajos sobre asociacin entre PRL y produccin lechera. Mediante la tcnica de
Southern Blot, se estableci una correlacin entre las variantes de PRL y caracteres de produccin
lechera en una familia lite de la raza Holstein. Es por esta razn, que hoy en da podra
considerarse como un QTL.

26

Hormona de Crecimiento (GH): La hormona de crecimiento es un pptido secretado por la


adenohipfisis cuya funcin ms importante es la de favorecer la sntesis proteica, estimulando de
esta manera el crecimiento. As mismo, es importante el estmulo de la GH tanto en el desarrollo de
la glndula mamaria, como en la lactancia. Por lo tanto, el anlisis de los polimorfismos presentes
en la GH y sus asociaciones con los caracteres de produccin lechera es de fundamental
importancia.
Complejo Mayor de Histocompatibilidad (MHC). En bovinos el Complejo Mayor de
Histocompatibilidad (denominado Bovine Lymphocyte Antigen, BoLA), corresponde a un grupo de
loci ubicados en el cromosoma 23 (BTA23). El BoLA ocupa un rol central en la respuesta inmune.
Este complejo es de gran importancia para la adaptacin del individuo al medio, por lo que
influye directa o indirectamente sobre los caracteres de produccin. Numerosos estudios han
demostrado la asociacin entre el BoLA y caracteres de importancia fisiolgica como fertilidad
susceptibilidad o resistencia a enfermedades caracteres de produccin, parmetros de
crecimiento.
Entre los genes ms estudiados se pueden mencionar el locus de Clase II BoLA-DRB3. Se ha
podido comprobar la correlacin entre la presencia de algunas de las variantes allicas
encontradas para este locus, con resistencia o susceptibilidad a enfermedades como la leucosis
bovina, mastitis, parsitos intestinales, etc. Adems se han encontrado correlaciones entre loci de
clase I, como el BoLA-A y resistencia o susceptibilidad a mastitis
Estas asociaciones resultan de inters, ya que numerosas evidencias han demostrado que
los animales portadores de estas enfermedades presentan una importante disminucin en la
produccin. Sin embargo, no siempre se han encontrado correlaciones entre loci de Clase I y II del
BoLA, con fertilidad y caracteres de produccin. La utilizacin de los STRs para el mapeo de QTLs
ha permitido localizar regiones cromosmicas, que podran ser portadoras de genes implicados en
la produccin lechera. Por ende, el anlisis del STR., no slo permite la identificacin de los
animales portadores, sino que tambin posibilitar estudiar el efecto de la regin cromosmica
correspondiente, sobre la produccin lechera en esta raza y en otras razas lecheras.
Base de datos de genes candidatos y marcadores genticos para produccin de leche y mastitis
Se ha desarrollado una base de datos de genes candidatos y de marcadores genticos
para la produccin de leche y mastitis en ganado bovino para proporcionar una herramienta de
investigacin que integre diferentes tipos de informacin que apoyan un enfoque genmico para
estudiar la lactancia, el desarrollo y la salud de la ubre.
La base de datos contiene 943 genes y marcadores genticos implicados en el desarrollo
de la glndula mamaria y la funcin, en representacin de los candidatos para seguir estudios
funcionales. Para la identificacin de loci candidatos, se utilizaron datos de diferentes enfoques de
investigacin:

27

Tabla 5. Base de datos de genes candidatos y marcadores genticos para el desarrollo de la


glndula mamaria, los rasgos de produccin de leche y de la resistencia o susceptibilidad a la
mastitis en el ganado bovino.
Enfoque del estudio

N de loci

Genes knockouts o transgenes en ratones que resultan en fenotipos


especficos asociados con la glndula mamaria

143

QTL asociados a rasgos productivos de leche y relacionados a rasgos de


mastitis.

415

Estudios de asociacin con caractersticas de leche

24

Estudios de asociacin con mastitis

10

Marcadores AFLP asociados con mastitis

27

Estudios de expresin con caractersticas de leche

207

Estudios de expresin con mastitis

107

Genes de protena de la leche que existen en diferentes variantes


genticas

miARNs expresados en glndula mamaria

32

Genes regulados epigenticamente asociados a la funcin de la


glndula mamaria; la evidencia reciente sugiere que el epigenoma
puede verse afectado por factores ambientales y que estos cambios
pueden durar toda la vida

Se han encontrado asociacin entre tres genes (IL8RA, TLR4 y BoLA DRB3-) con resistencia o
susceptibilidad a la mastitis, ubicados en los cromosomas 2, 8 y 23 respectivamente.

Figura 52. Nmero de genes y marcadores genticos para el desarrollo de la glndula mamaria, los rasgos de
produccin de leche y la resistencia o susceptibilidad a la mastitis encontrado con diferentes enfoques en
cada cromosoma bovino. Loci en los cromosomas 3, 6 y 14 poseen mayor asociacin con caractersticas de
leche y mastitis.

28

FUNDAMENTO DE LA IDENTIFICACIN DE QTLs


El principio que subyace a la identificacin de QTLs es simple y se basa en el desequilibrio
de ligamiento entre un gen o genes que afectan a una variable cuantitativa y un marcador
molecular. En una poblacin F2 originada por cruzamiento entre QQ y qq para un QTL y entre MM
y mm para un marcador, la diferencia en una variable cuantitativa determinada entre las dos
clases homocigotos ser igual a: a(1 2c) donde a es el efecto aditivo y c la tasa de
recombinacin entre QTL y marcador. Si el marcador estuviera sobre el propio QTL,

la

recombinacin c ser cero (0) mientras que si el QTL y el marcador estn en cromosomas distintos
o muy separados c seria igual a 0.5 y no habra diferencia entre las medias de los individuos MM y
mm. Con la utilizacin de estadsticas apropiadas pueden utilizarse marcadores ya conocidos en
su posicin como puntos de referencia para estimar la localizacin del QTL. El QTL es una regin
cromosmica que ha sido vinculada por mtodos estadsticos con un la segregacin de un
fenotipo cuantitativo. Esta regin puede contener uno o varios genes de relevancia o puede
corresponder a polimorfismos en los exones de un gen pero tambin a secuencias reguladoras.
Gen y QTL son conceptos diferentes.

Figura 53. Visualizacin simultnea de la superposicin de QTL. QTL medido para el mismo rasgo, pero en
diferentes cruces del ratn (anotado con diferentes colores) se representan como barras verticales al lado de
los cromosomas. Las regiones de consenso QTL (en negro) presentan las coincidencias comunes a todos los
cruces.

En algunas ocasiones los avances hacia la identificacin del gen responsable en una
regin previamente identificada como QTL ha tenido xito dependiendo de algunos genes que
han ejercido una notable influencia sobre caracteres de inters (genes mayores) Ej: el gen de la
hipertrofia muscular, la miostatina, o el DGAT1 en bovino, el gen boorola en ovinos o los genes de

29

la calidad de carne. Actualmente la incorporacin a los programas de mejora de los QTL es una
realidad en especies como porcino, bovino de carne y leche.
IDENTIFICACIN DE QTL
DISEOS EXPERIMENTALES
1- Una poblacin apropiada en la que se segreguen los QTL de inters

Hermanos enteros o Hermanos en Bovinos de carne

Diseo de Medias Hermanas Paternas (Dauther Designs, Paternal half sibs)/ diseo de hijas
en bovinos de leche
Esta metodologa se basa en el estudio de la descendencia de machos heterocigotos para

un locus determinado. Teniendo en cuenta el alelo que reciben del padre, las hijas pueden ser
clasificadas en dos grupos de medias hermanas paternas. Debido a que los alelos
correspondientes a un locus marcan las regiones cromosmicas homologas a las que se
encuentran ligados, pueden ser usados en este sentido como marcadores genticos. Si el
marcador se encuentra estrechamente ligado a un QTL, las cras al recibir un alelo determinado
del padre heredan simultneamente una de las dos posibles regiones cromosmicas homologas
que incluyen el QTL. De esta manera, los dos grupos de medias hermanas paternas deberan
diferenciarse para el carcter cuantitativo. Por lo dicho anteriormente, slo sern informativos
aquellos machos que sean heterocigotos para ambos loci.
Si el ligamiento entre el marcador y el QTL no es completo, los dos grupos de medias
hermanas no sern homogneos para el QTL, debido a que por efecto de la recombinacin un
porcentaje de las hijas recibirn la regin cromosmica recombinada. Este efecto reduce la
diferencia entre ambos grupos
para el carcter estudiado.
El anlisis consiste en
comparar los fenotipos de los
grupos

que

recibieron

esos

alelos. Los QTL surgen de la


comparacin entre razas que
formaron

la

poblacin

experimental, por ej cebuinas y


britnicas. Otra forma que se
Figura 54. Diseo de Hijas.
Daughter desing.

ha

implementado

creacin

de

es

familias

la
de

hermanos enteros producidas


por

multiovulacin

transferencia embrionaria.

30

Diseo de Nietas (Granddaugther Designs) en bovinos de leche


El mtodo denominado "Diseo de Nietas" se basa en la caracterizacin de los hijos de
machos de elite que son heterocigotos para un determinado marcador. Las cras se dividen en
dos grupos de acuerdo al alelo que hayan recibido del macho de lite. Posteriormente, las cras
son evaluadas para el carcter cuantitativo a travs del test de progenie, comparando los valores
medios obtenidos para cada grupo. En leche el genotipo de los hijos es asociado al fenotipo de
las nietas que estn en control lechero. Puede utilizarse como alternativa, el valor de cra en lugar
del test de progenie. Este mtodo permite reducir el nmero de animales tipificados para cada
marcador, a expensas del aumento en el nmero de cras evaluadas para el carcter
cuantitativo. Por otra parte, slo se requiere la recoleccin de muestras de semen en los centros
de inseminacin. Otra ventaja de este mtodo es que al trabajar con test de progenie en lugar de
datos individuales de produccin, se reduce el error de la varianza del carcter cuantitativo
evaluado.
En este diseo, la diferencia esperada entre las medias de produccin de ambos grupos,
estimada a travs de los test de progenie de los hijos del macho de elite, sera la mitad de la
diferencia esperada entre los datos individuales de dos grupos de cras. Esto disminuye el poder de
resolucin del diseo de nietas en comparacin con el de medias hermanas. Sin embargo, esta
desventaja es compensada ampliamente, dado que la varianza entre los test de progenie es
menor que la varianza entre los valores individuales de produccin utilizados en el diseo de
medias hermanas.
El punto clave es el numero de meiosis informativas que debe ser maximizado por el diseo
experimental; para el mismo nmero de animales es mejor contar con hermanos enteros que
medios hermanos; a igual nmero de genotipos el diseo de nietas tiene mas poder estadstico
que el de hijas; la retrocruza es ms eficiente para detectar dominancia pero cuando se requiere
hacer una revisin del genoma la F2 es ms eficiente.

Q
M

Q
M

q
m

q
m

Figura

?
?

55.

Diseo

de

?
?

Nietas.

Granddaughter desing.

31

2- Conjunto de marcadores moleculares polimrficos


El punto clave es cuntos marcadores se deben utilizar. En general se trata de tener una
cobertura completa del genoma para asegurar que ninguna regin cromosmica queda sin ser
analizada. Se puede realizar con intervalos relativamente grandes que luego debern ser
cubiertos con nuevos marcadores. En la prctica se puede utilizar un marcador cada 20 cM. En
general la limitante es la cantidad de meiosis por lo que es innecesario saturar el genoma con
marcadores.
3- Metodologa estadstica (para estudiar la segregacin de los marcadores asociados con la
variabilidad fenotpica)
En general los principios del anlisis estadstico para identificar QTL son simples. En el caso
ms sencillo los individuos se clasifican segn el genotipo para un marcador. Si mediante la
aplicacin de un estadstico (anlisis de variancia) se comprueban diferencias significativas en el
fenotipo estudiado entre las clases genotpicas puede concluirse que existe un QTL ligado a ese
marcador.
Cuando se usan marcadores individuales para el anlisis, la magnitud del efecto del QTL
est confundida con su distancia al marcador. En este caso el efecto del QTL est subestimado.
Esto significa que se puede obtener la misma seal estadstica de un QTL dbil que esta prximo al
marcador que de uno fuerte mucho mas apartado. Para superar esta limitacin se desarrollo la
estrategia conocida como mapa en intervalos. En este caso un par de marcadores en un
cromosoma se analizan simultneamente y se determina la proporcin ms probable para el QTL
dentro del intervalo. Existen diversos criterios con respecto a la rigurosidad de los niveles de
significancia para reconocer la existencia de un QTL.
Debido a limitaciones de los diseos experimentales existe un sesgo en el nmero y
magnitud de los efectos de los QTL reportados. Con la metodologa actual solo los QTL de mayor
efecto pueden ser detectados, sesgo que es inversamente proporcional al rigor para fijar niveles
de significancia y es mayor para los efectos de dominancia que para los efectos aditivos. Por eso
no

deben

extraerse

conclusiones

definitivas sobre el nmero de loci que


afectan a una variable.
Figura 56. Magnitud del efecto del QTL para
crecimiento en el cromosoma 13 bovino.
Experimento realizado por Stone et al., 1999. A
Primary Screen of the Bovine Genome for
Quantitative Trait Loci Affecting Carcass and
Growth Traits.

32

Se han desarrollado mtodos estadsticos ms sofisticados para mejorar el poder de


deteccin de QTL, tales como el anlisis simultneo de varios atributos, el anlisis en intervalos
mltiples y el uso de la estadstica bayesiana. El desarrollo de nuevos modelos estadsticos para la
bsqueda de QTL es un rea muy dinmica en investigacin y continuamente se presentan
nuevas alternativas de anlisis.
El QTL se asocia a una regin cromosmica que tiene un pico mximo de significancia, y
como en todo caso de inferencia estadstica lleva implcito un intervalo de confianza, que con
cierto grado de probabilidad contiene el gen o genes buscados. Existen distintos mtodos
estadsticos para determinar el intervalo de confianza de un QTL.
La informacin referente a QTL en las distintas especies ha sido sistematizada en diferentes
bases de datos para cada especie y son accesibles a travs de Internet.
Del QTL al gen (y al QTN)
La identificacin del QTL es slo la primera etapa del proceso que tiende a la
individualizacin de genes responsables de variables de relevancia econmica en animales
domsticos. Este paso debera ser seguido por la construccin de un mapa fsico de la regin,
determinacin de la secuencia de ADN y la identificacin de genes en ella. La capacidad de
deteccin de QTL es limitada. La posicin de un QTL est entre 10 a 30 cM y ese intervalo puede
contener cientos de genes y entonces no resulta prctico para hacer el mapa fsico. El intervalo
de confianza a un QTL puede corresponder a una zona rica (varios genes candidatos con
funciones en asociacin con el fenotipo) o pobre en genes. Un mayor tamao de la poblacin
podra aumentar el tamao de las meiosis y refinar la posicin del QTL. La distancia ms apropiada
para iniciar un mapa fsico (no ms de 1 a 5 cM) requerira la disponibilidad de miles de animales.
Esto es sencillo para animales modelo o de laboratorio pero en animales domsticos. En bovinos
lecheros lo que se practica es la identificacin de un segmento cromosmico comn a todos los
individuos que se asumen tienen
el mismo genotipo para un QTL
(generalmente

son

individuos

emparentados). Los genes DGAT1


y GHR han sido detectados en los
cromosomas

14

respectivamente
candidatos

firmes

20
como

afectan

variables de produccin de leche.


Figura 57. Identificacin de genes por
su posicin en el genoma.

33

Tambin dentro de la genmica comparativa el uso de QTL ha permitido el estudio de


especies con antecesor comn. Es posible identificar en distintas especies los mismos genes que
cumplen funciones similares. Esta homologa puede extenderse a QTL vinculados a fenotipos
similares en especies distintas. Para la identificacin del gen o genes de un QTL tambin se
propone combinar la estrategia posicional con la estrategia de genes candidatos y el uso de
mapas comparativos entre especies. Determinada la posicin de un QTL en una especie, pueden
definirse genes candidatos para el seleccionando genes que ya han sido caracterizado en otras
especies (humanos y ratn) y de los que se sabe su funcin y posicin. As se reduce el nmero de
genes candidato para un QTL. La confirmacin definitiva debe provenir de un experimento, por
ejemplo sustitucin de alelos y medicin de efectos.
Una vez que se ha identifico un gen correspondiente a un QTL hay que determinar que
polimorfismo da origen a la diferencia fenotpica cuantitativa entre poblaciones. Generalmente
ese polimorfismo es un SNP pero no siempre es posible identificar este polimorfismo dado que se
producen muchas mutaciones y pocas son funcionales, y esta situacin se complica si ciertos
alelos tienen un haplotipo comn. Para el gen de la Leptina se han detectado polimorfismos en el
promotor, en el exn 2 y 3 pero todava es controvertido el efecto real en el fenotipo.
Actualmente ya estn en el mercado una serie de paneles de marcadores moleculares
ofrecidos por empresas privadas. Estos paneles son principalmente de aplicacin en bovinos de
carne y leche y estn integrados para un nmero variable de SNP que corresponden a
marcadores directos.
Tipificacin Selectiva (Selective Genotyping)
El mtodo de tipificacin selectiva se basa en la eleccin de aquellos animales que se
encuentran en los extremos de la distribucin para el carcter de inters, y su posterior tipificacin
para los marcadores genticos. Esta metodologa se fundamenta en el hecho que la seleccin
sobre un carcter cuantitativo podra cambiar las frecuencias gnicas en la poblacin
segregante. Una diferencia significativa entre las frecuencias gnicas de las colas de la
distribucin de la produccin (alta y baja) en la F2 o en la poblacin base puede servir como test
para el ligamiento marcador-QTL.
Figura

58. Seleccin

de los animales que

se

encuentran en los extremos.

La ventaja de este mtodo consiste en


que reduce el nmero de animales tipificados a
expensas de un aumento en el nmero de
animales

registrados

para

el

carcter

en

estudio.

34

Cuando la proporcin seleccionada en las colas es pequea (10% o menos), se puede


obtener una reduccin importante en el nmero de animales tipificados, a expensas de un
aumento en la cantidad de cras evaluadas para el carcter en estudio. Este mtodo es
fcilmente aplicable para el estudio del ligamiento marcador-QTL en rebaos de produccin
lechera, dado que en estos casos se dispone de un gran nmero de datos. Puede aplicarse
seleccionando uno o dos de los caracteres ms importantes, por ejemplo, produccin de leche y
contenido proteico. Sin embargo, la principal desventaja de la tipificacin selectiva es que no
puede ser aplicada simultneamente a ms de dos caracteres independientes, porque a pesar
de la pequea proporcin de animales seleccionados para cada carcter, se tendra que tipificar
prcticamente a todas las cras.
Seleccin asistida por Marcadores y genes: Independientemente de cuales sean los que se
utilicen, los marcadores genticos pueden aplicarse para identificar algn locus del genoma, que
se encuentre cerca de un gen especfico que codifique una caracterstica en particular. Los
marcadores genticos han permitido detectar algunos QTL en los cromosomas y la identificacin
de dichos marcadores, y su subsiguiente ubicacin en los mapas de ligamiento han permitido
identificar las regiones cromosmicas donde residen stos. La distancia entre el marcador y el gen
o QTL que codifica una caracterstica cuantitativa es importante para su efecto, es decir, es
necesaria una distancia entre 15 a 50 centimorgan (cM, unidad arbitraria utilizada para medir
distancia entre locus) para lograr un efecto de medio a alto o de 5 cM para garantizar un efecto
mayor. Una vez identificado y medido el efecto de un QTL, es posible incorporarlo a esquemas de
mejoramiento gentico. De esta forma, el uso de la genmica es til para mejorar caractersticas
productivas que se limitan por el sexo, que tienen baja heredabilidad, que son costosas de medir
o para aquellos que aparecen ms all de la vida media del animal (aparicin tarda), o que se
miden slo despus sacrificio del animal.
Tabla 6. Algunos ejemplos de QTL detectados para diferentes caracteres y en diferentes especies
ganaderas

35

Tabla 7. Algunos ejemplos de genes que se analizan de una manera comercial en programas de
mejora de animales

La cra animal moderna comenz con la utilizacin de sistemas de cruza entre animales
para satisfacer necesidades humanas inmediatas, posteriormente los cruzamientos se operaron
para el logro de metas bien establecidas: mayor produccin de leche y carne, produccin
eficiente, y camadas ms numerosas. Estos cruzamientos se realizaban entre individuos cuya
informacin productiva o fenotpica contribua a identificar los genes que expresan rasgos
productivos. De este modo, la seleccin tradicional se basaba en el modelo polignico de
caractersticas cuantitativas (BLUP por sus siglas en ingls; best lineal umbiased production), que
emplea la informacin fenotpica y el pedigr para establecer valores de cra individuales en los
animales. Los genes que contribuyen para que se expresen las caractersticas de comportamiento
productivo son desconocidos y por ello se han utilizado registros de comportamiento fenotpico,
as como herramientas para inferir el mrito gentico de los animales (diferencia esperada en la
progenie, DEP en bovinos de carne; evaluacin gentica integral en ganado bovino de leche,
comportamiento productivo en cerdos, ovinos y cabras). Estas herramientas son tiles para el
mejoramiento de animales, sin embargo, no se sabe cules son los genes que contribuyen a la
generacin siguiente, mas aun en caractersticas complejas como peso al nacer, peso al destete,
produccin de leche, produccin de huevo, reproduccin, calidad de canal, entre otros, y que
estn controlados por muchos genes y afectados por el ambiente (por ejemplo, condiciones de
alimentacin), por lo que el estudio de la variacin dentro de genes est teniendo un gran
impacto sobre el fenotipo de animales de granja. El xito de las herramientas mencionadas se
basa en la creencia de que hay un grupo de genes que contribuyen cada uno con poco efecto;

36

tal es el caso de los caracteres complejos (como el de crecimiento) que son producto de la
expresin de varios genes ligados. A este modelo se le conoce como infinitesimal y tambin se
basa en la seleccin de los posibles progenitores a travs de valores de cra cuyo modelo se basa
en BLUP.
El modelo que intenta integrar la gentica cuantitativa y molecular sera una meta; donde
en el modelo clsico de la gentica cuantitativa el fenotipo es integrado por efectos genticos y
ambientales (P = G + E) y puede ser actualizado incluyendo un nuevo trmino que representa el
efecto de los genes candidatos o QTL, donde (P = G + E + Gm).
La nueva informacin generada con marcadores gentico-moleculares, genes candidatos
y QTL, cada vez es ms abundante, y sta puede ser utilizada para disear un esquema de SAM o
SAG.
Los genes principales (genes mayores) son genes individuales que contribuyen con una
proporcin significativa en la variacin de caractersticas econmicamente importantes. La
biologa molecular puede utilizarse para identificar y caracterizar a estos genes. Las decisiones de
seleccin tomadas sobre otras tcnicas o modelos de seleccin, cuyo valor econmico estriba en
estimar el valor de cra de todos los genes que contribuiran con la caracterstica dada han sido
muy tiles, pero si a estas se les agrega la deteccin o la presencia de un marcador genticomolecular, la seleccin animal se ejerce con mayor precisin, sin embargo, la SAM es una
herramienta que asiste pero no reemplaza las tcnicas tradicionales de seleccin animal. En la
SAM se utiliza informacin directamente aportada por el ADN de un candidato a ser
seleccionado, juntamente con sus registros productivos y los de individuos emparentados.
La SAM permite realizar una seleccin objetiva y confiable de las variaciones especficas
del ADN que se encuentran asociadas con una diferencia cuantificable, o efecto sobre un
determinado carcter o complejo de caracteres. Es importante considerar que la realizacin de
SAM funciona mejor cuando se efecta en caractersticas complejas, como el crecimiento y el
marmoleo (grasa intramuscular en el ganado bovino), las cuales se encuentran asociadas con
varios genes que contribuyen juntos para estas caractersticas.
Actualmente en Francia las tres principales razas de bovino lechero, Hostein, Normande y
Mont bellard, estn sometidas a un programa de seleccin asistida y se consideran 12 QTL
identificados cada uno por 2-4 marcadores. Tambin Nueva Zelanda ha puesto un programa
similar.
Otra utilidad vinculada pero que no implica la seleccin de reproductores, es la
clasificacin de individuos con una determinada capacidad productiva (ya sea potencial de
crecimiento o facilidad de engorde, por ejemplo). La identificacin a priori de animales con
distinta capacidad productiva permite optimizar el manejo y la alimentacin y predeterminar el
destino hacia cierto mercado. A esta estrategia se la conoce como

37

Manejo Asistido por Marcadores (MAM).


El impacto ms importante de la SAM ser a travs de la reduccin del intervalo
generacional y el aumento de la exactitud de la estimacin de los valores genticos y precisin
de seleccin.
Los paneles comerciales son aquellos genes identificados que estn involucrados en la
produccin animal. Su bsqueda fue realizada en base a dos alternativas experimentales. Por un
lado, se empez a trabajar en la caracterizacin de genes cuyo rol fisiolgico o bioqumico era
bien conocido: designados como genes candidatos para explicar la variabilidad de cierta
caracterstica (Ej.: las protenas de la leche y sus polimorfismos y asociacin con produccin. Por
otro lado la bsqueda surgi y a diferencia del anterior ante el desconocimiento de los genes
involucrados directamente con muchas variables productivas. Para la identificacin de estos
genes, se dise una estrategia denominada posicional. En este caso, en base a una estructura
poblacional adecuada (experimental o comercial) se monitoreaban regiones cromosmicas que
segregaban de padres a hijos y que se asociaban estadsticamente a diferencias en el nivel de
una variable de inters, sin ninguna informacin previa sobre el gen o genes involucrados:
pretendiendo identificar regiones cromosmicas que contengan los genes involucrados, se
populariz la sigla QTL (por Quantitative Trait Loci o Loci que controlan variables cuantitativas).
Luego de la identificacin de QTL se realiza la bsqueda de la posicin del locus de inters
(mapa fino), la reconstruccin de la secuencia mediante el ensamblado de clones (mapa fsico) y
la identificacin de polimorfismos en la regin con asociacin a la variable en estudio. Este
proceso es largo y costoso y a pesar del gran nmero de QTL reportados en bovinos, pocos genes
han completado ese proceso en su totalidad.
La evaluacin de candidatos y bsqueda de QTL es parte de la genmica estructural. La
genmica funcional, principalmente los estudios de expresin gnica, contribuyeron a
caracterizar a los genes y confirmar su efecto. El inters por transferir la tecnologa al sector
productivo llev al diseo de la estrategia de seleccin con marcadores indirectos que
flanquearan al alelo causal desconocido. Esto obligaba a una seleccin dentro de familias y a
monitorear regularmente la fase de ligamiento. Esta estrategia tuvo poca difusin, ya que
rpidamente se pas a la utilizacin de marcadores directos, ubicados en los propios genes de
inters.
El descubrimiento de los primeros genes asociados a variables continuas, permiti develar
la base gentica de la variacin cuantitativa. Incluso, se lleg a poner en duda la validez del
modelo infinitesimal que es la base conceptual de la misma.
El primer marcador comercial para bovinos de carne corresponda a un SNP (Single
Nucleotide Polymorphism) en el gen de Tiroglobulina y afectaba el nivel de grasa intramuscular
(marbling o veteado). Poco tiempo despus, se present un marcador en el gen de Calpastatina,

38

asociado a diferencias en terneza de la carne y posteriormente se agreg el gen de la Leptina,


asociado a variables de inters tanto en ganado de carne como de leche.
Evaluaciones a nivel mundial pronto confirmaron que estos polimorfismos, en forma
individual, explicaban una fraccin muy pequea de la variabilidad gentica. Pero en poco
tiempo se fueron reportando ms polimorfismos asociados a diversas variables de produccin.
Desde el punto de vista comercial, a medida que se fueron descubriendo estos polimorfismos, los
mismos se fueron integrando a paneles de marcadores, en un nmero de hasta decenas segn el
atributo en particular.
Desde el punto de vista de la investigacin cientfica, fueron propuestos diferentes modelos
para la interpretacin de experimentos de localizacin de QTL en bovinos de leche y cerdos
sugiriendo que podra tratarse de una distribucin asimtrica que en definitiva lo que indica es que
en el control de una variable cuantitativa intervienen pocos genes, de efecto fuerte, o sea
explican una proporcin importante de la variabilidad, mientras que el resto es explicado por un
grupo muy numeroso de genes de efecto pequeo. An as, el anlisis en retrospectiva de los
resultados experimentales de varias otras especies parece indicar que el modelo infinitesimal (un
gran nmero de loci causales, cada uno de pequeo efecto, la base de la gentica aditiva o
cuantativa) no parece ser errneo, lo que complica un poco ms el aprovechamiento de la
informacin molecular en seleccin asistida.
Un nuevo progreso tecnolgico, superador a la utilizacin de paneles de marcadores
moleculares, est dado por la seleccin genmica. En este caso, un nmero muy elevado de
marcadores cubriendo todo el genoma garantizara que todos los loci de relevancia estuvieran en
condiciones de desequilibrio de ligamiento con los mismos, por lo que su efecto podra ser
cuantificado. De esta forma, la asociacin entre genotipos y valor productivo permitira la
estimacin de un valor gnico molecular global. Debe notarse que la seleccin genmica tiene
una diferencia conceptual con estrategias anteriores: con la densidad adecuada (que asegure el
desequilibrio de ligamiento), pueden usarse SNP annimos y ya no es necesario ubicar SNP en
genes candidatos.
La seleccin genmica requiere determinar los genotipos de un elevado nmero de
marcadores en un mismo individuo. Desde el 2007 est disponible un chip con alrededor de 54.000
marcadores (SNP). Este chip, patrn de referencia para la evaluacin genmica en bovinos es el
resultado del trabajo de diversas instituciones (The Bovine HapMap) y continuacin de la
secuenciacin del genoma de la especie (The Bovine Genome Sequencing and Analysis).
La propia estructura y dinmica de la poblacin de bovinos de leche ha permitido una
rpida implementacin de la tecnologa genmica. Es posible lograr precisiones de alrededor de
0,70, lo que es muy superior al valor determinado por el promedio de los padres y tiene relevancia
en el caso de toros jvenes.

39

Figura 59. Chip de DNA de Affymetrix, empleado para detectar


expresin de genes de humano, a la izquierda, y de ratn, a la
derecha.

En bovinos de carne el progreso es ms lento, dado que hay diferencias entre las diferentes
razas (por ejemplo en la fase de ligamiento) y no hay informacin fenotpica precisa. En este caso,
la seleccin genmica permitira explicar hasta 50% de la variabilidad gentica, con una precisin
de 0,50-0,70 (equivalente a contar con ~6 - 16 cras con h2 = 0,25). Ya estn en evaluacin chips
con casi 800.000 SNP. Tambin es muy importante el nmero de individuos con registros utilizados
en el anlisis de asociacin.
La seleccin genmica se presenta como la tcnica a utilizar en la seleccin animal en un
futuro. El uso generalizado de la misma, y en qu especies ser ms accesible falta dilucidar. Para
mejorar la precisin aun se debe optimizar el nmero de marcadores a analizar y el costo
razonable de acuerdo al sistema de produccin. En Argentina comienzan lentamente a
demandarse los paneles de marcadores, por lo que el cambio llevar ms tiempo que en pases
desarrollados.
De la variabilidad observada en los fenotipos de la poblacin, slo una fraccin es
explicada por diferencias en el efecto aditivo de los genes: la heredabilidad (h2). La situacin
ideal sera aquella en la que los marcadores explican toda la variabilidad gentica subyacente,
implcita en la heredabilidad de un atributo.
Una diferencia importante al considerar la efectividad de una alternativa de seleccin es si
la variable de inters puede ser medida en los animales. Variables relacionadas a aptitud
reproductiva, a composicin corporal o calidad de producto (ej: la carne) son muy difciles de
medir en condiciones comerciales normales y la informacin molecular podra hacer una
importante contribucin y al no depender de genes candidatos, con la seleccin genmica
probablemente se puedan evaluar fenotipos novedosos, tales como parmetros sanguneos o
metablicos. En el otro extremo, su utilidad en el mejoramiento de variables de produccin que
son medidas en forma rutinaria, depender de una serie de factores, entre ellos la factibilidad de
integrar los marcadores a la evaluacin cuantitativa y el beneficio marginal de su aplicacin.
El avance de las metodologas genmicas ha sido vertiginoso y ha sido difcil seguirlos y a
su vez transmitirlos al sector productivo. Slo como ejemplo, puede citarse el advenimiento de la
secuenciacin de ltima generacin en relacin a la secuenciacin capilar ms convencional.
Cuando muchos laboratorios haban logrado acceder a un secuenciador capilar, esta tecnologa

40

ya pasaba a ser de segunda lnea. Otro indicador relevante es la tendencia en los costos de los
proyectos de secuenciacin de genomas. Es esperable un nmero cada vez mayor de
marcadores evaluados, a gran escala y con costos progresivamente menores.
Los paneles de marcadores deben entrenarse en relacin a informacin fenotpica de
calidad, para cuantificar los efectos de los mismos. No ha habido hasta el momento mucho inters
por desarrollar estas poblaciones de referencia en el pas, excepto en pequea escala. Se espera
que el mayor conocimiento del genoma bovino permita, entre otros objetivos, establecer con ms
precisin la transmisin gentica de padre a hijo (por ejemplo en el caso de hermanos enteros),
caracterizar y aprovechar mejor la variabilidad no aditiva y comprender mejor efectos mltiples
del mismo gen (pleiotropa). Tambin pueden surgir nuevas estrategias a partir de la comprensin
de procesos genticos sofisticados que fueron descubiertos en fecha relativamente reciente,
como la epigenmica o la regulacin por microRNAs.
Tabla 8. Costos en dlares de secuenciacin el ADN.

41

42