FEMS Microbiology Letters 208 (2002) 129^134

www.fems-microbiology.org

Identication and characterization of toxigenic Bacillus cereus

isolates responsible for two food-poisoning outbreaks
Emilia Ghelardi  , Francesco Celandroni, Sara Salvetti, Claudia Barsotti,
Angelo Baggiani, Sonia Senesi
Dipartimento di Patologia Sperimentale, Biotecnologie Mediche, Infettivologia ed Epidemiologia, University of Pisa, Via San Zeno 35-39, 56127 Pisa, Italy

Received 10 October 2001; received in revised form 14 December 2001; accepted 20 December 2001

First published online 30 January 2002

Abstract

The epidemiology of Bacillus cereus strains responsible for food poisoning is scantly known, mostly because the genotypic and toxigenic
properties of the B. cereus strains isolated during food-poisoning outbreaks have been never catalogued. The occurrence of two
simultaneous food-poisoning outbreaks gave us the opportunity to wonder whether (i) the identity of individual strains isolated from
clinical, environmental, and food samples could be established by random amplified polymorphic DNA (RAPD)-PCR and multiplex
RAPD-PCR, and (ii) the toxigenic potential of the isolates could be determined by testing their ability to secrete hemolysin BL,
phosphatidylcholine-specific phospholipase C, and cereulide, as well as by determining the presence of the genes encoding enterotoxins
NHE, T, and FM/S, cytotoxin K, sphingomyelinase, and phosphatidylinositol-specific phospholipase C. This is the first report
demonstrating that the combination of several phenotypic and genotypic traits provides a powerful tool for tracing the source of infection
of toxigenic B. cereus strains relevant for epidemiological survey. 2002 Federation of European Microbiological Societies. Published
by Elsevier Science B.V. All rights reserved.

Keywords : Enterotoxin; Emetic toxin; Hemolysin ; Random amplied polymorphic DNA-PCR ; Multiplex random amplied polymorphic DNA-PCR ;
Bacillus cereus

1. Introduction tigated enterotoxin is HBL, a three-component hemolysin

Bacillus cereus is a Gram-positive, rod-shaped and mo-
tile bacterium that has been recognized as a causative
agent of food poisoning for more than 40 years. The abil-
ity of B. cereus to produce endospores accounts for its
ubiquitous occurrence in the natural environment as well
as for the high frequency of its isolation from various
kinds of contaminated raw and processed food products,
such as rice, spices, milk and dairy products, vegetables,
meat, farinaceous foods, desserts and cakes [17].
Food-borne diseases caused by B. cereus are notoriously
classied as emetic and diarrheal syndromes [17]. The
emetic syndrome is due to only one toxin, the emetic toxin
(cereulide), which causes vomiting [2]. The emetic toxin is
a heat-stable dodecadepsipeptide that induces swelling of
mitochondria in HEp-2 cells [26]. The diarrheal syndrome
is apparently due to several enterotoxins. The best inves-
* Corresponding author. Tel.: +39 (50) 836569; Fax: +39 (50) 836570.
E-mail address : ghelardi@biomed.unipi.it (E. Ghelardi).
0378-1097 / 02 / $22.00 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
PII: S 0 3 7 8 - 1 0 9 7 ( 0 2 ) 0 0 4 5 0 - 0
that consists of two lytic proteins (L1 and L2 ) and one
binding component (B) [4]. This toxin, which possesses
hemolytic and dermonecrotic activities and increases vas-
cular permeability, is considered the primary virulence fac-
tor in diarrhea for its ability to cause uid accumulation in
rabbit ileal loops [6]. Also, the non-hemolytic enterotoxin
(NHE) is a three-component enterotoxin complex that was
originally identied in a B. cereus strain responsible for a
food-poisoning outbreak [20]. Furthermore, one-compo-
nent toxins, such as enterotoxins T [1] and FM [3], as
well as cytotoxin K (CytK) [21] are thought to be involved
in B. cereus food poisoning. In addition to these proteins,
B. cereus produces sphingomyelinase, phosphatidylinosi-
tol- and phosphatidylcholine-specic phospholipases (PI-
PLC and PC-PLC) [12,18], the role of which in food-borne
diseases is not yet claried.
Several studies have been undertaken in order to eval-
uate the production of various toxins by B. cereus strains
[14^16,22,24] and valid molecular typing methods have
been developed for distinguishing B. cereus strains col-
lected from dierent sources [19,25,28]; nevertheless, there

FEMSLE 10340 25-3-02

130 E. Ghelardi et al. / FEMS Microbiology Letters 208 (2002) 129^134
is no report describing the identication of the source of
infection during a food-borne outbreak, by stating the
complete toxigenic prole or the genomic dierentiation
of environmentally and clinically isolates of B. cereus.
Herein, the usefulness of combining the analysis of phe-
notypic (production of HBL, PC-PLC, and emetic toxin)
and molecular traits (PCR specic for genes encoding tox-
ins, and PCR-based methods that sample the whole ge-
nome such as random amplied polymorphic DNA
(RAPD)-PCR and multiplex RAPD-PCR) for the charac-
terization and environmental monitoring of B. cereus
strains in a clinical epidemiological investigation of a
food-poisoning outbreak is described.
2. Materials and methods
2.1. Outbreak investigation
During June 2000, 173 people presented symptoms of
intoxication (nausea and watery diarrhea) after they at-
tended two dierent banquettes (95 and 78 people for
each banquet) in Pisa, Italy. A microbiological investiga-
tion was performed in 23 patients who required hospital-
ization. B. cereus was recovered from stool samples of 19
patients. Because of the simultaneous occurrence of two
outbreaks in the same geographic area, it was speculated
that the poisoning was due to ingestion of contaminated
food and that contamination occurred during food prep-
aration. Since the same confectioner had prepared cakes
for the two banquettes, dierent food and environmental
samples were collected from the confectioner's shop and
analyzed for the presence of B. cereus.
2.2. B. cereus isolates and reference strains
Food samples (25 g) were diluted 1:10 in sterile distilled
water and homogenized using a Stomacher (PBI 400 blen-
der) for 2 min. Serial dilution of the samples (100 Wl each)
were seeded onto triplicate plates of B. cereus-selective
mannitol-egg yolk-polymixin (MYP) agar, containing 10
g l31 mannitol, 25 ml l31 egg-yolk emulsion (Oxoid, Ba-
singstoke, UK) and 105 U l31 B. cereus-selective supple-
ment (Oxoid). Environmental sampling was performed ac-
cording to the general rules of the International
Organization for Standardization (ISO 7218:1996). Sam-
ples were inoculated onto MYP agar and plates incubated
at 37C for 24 h. The number of colony forming units
(CFUs) U g31 was assessed for each food sample. B.
cereus CFUs were determined by counting the colonies
that showed precipitation of hydrolyzed lecithin and fail-
ure to utilize mannitol. All the isolates were conrmed as
B. cereus by Gram-staining, catalase reaction, convention-
al biochemical tests (API 50CHB; BioMerieux), as well as
shape and position of spores by phase-contrast microsco-
py (U1000). B. cereus isolates were named from PP1 to
FEMSLE 10340 25-3-02
PP19, those derived from stool samples, from FP3 to FP6,
those collected from food samples, and AP7 that re-
covered from the environment. B. cereus reference
strains ATCC 10987, ATCC 10876, ATCC 14579, and
ATCC 33018, and Bacillus thuringiensis strains Bac174
and Bac182 were used for comparisons. Unless other-
wise specied, bacterial strains were propagated in brain
heart infusion broth supplemented with 0.1% glucose at
30C.
2.3. Assays for B. cereus toxins
Production of the L2 component of HBL by B. cereus
was tested in culture ltrates using the B. cereus Entero-
toxin-Reversed Passive Latex Agglutination (BCET-
RPLA, Oxoid) kit. HBL secretion was detected on HBL
agar plates [4]. PC-PLC activity in culture supernatants
was assayed by an agar-diusion method using 1.5 mg
ml31 L-K-phosphatidylcholine (Sigma) [5]. Gels were incu-
bated 16 h at 25C and PC-PLC activity was quantitated
by comparison of turbidity areas to those in a standard
curve for pure PC-PLC (Sigma). The emetic toxin activity
in autoclaved (121C for 15 min) culture supernatants was
assayed on HEp-2 cells [11].
2.4. PCR screening of B. cereus genes encoding toxins
Chromosomal DNA was extracted from B. cereus as
previously described [8]. Primers and PCR conditions
used to amplify sph, bceT, entFM/S, piplc, cytK, nheA,
nheB, and nheC encoding sphingomyelinase, enterotoxin
T and enterotoxin FM/S, PI-PLC, CytK, and the three
components of NHE, respectively, are listed in Table 1.
PCR mixtures of 50 Wl contained 20 ng of genomic DNA,
1 WM of each primer, 0.2 mM deoxynucleoside triphos-
phates, 2.5 U of DynaZyme II DNA polymerase (Finn-
zymes Oy, Finland) in the supplied buer.
2.5. RAPD-PCR and multiplex RAPD-PCR
The oligonucleotide primers HLWL74 (5P-ACGTAT-
CTGC-3P), HLWL85 (5P-ACAACTGCTC-3P), RPO2 (5P-
GCGATCCCCA-3P) and PRO-UP (5P-GCTGCTGG-
CGGTGGT-3P) were used individually for RAPD-PCR
or combined (HLWL74/HLWL85, HLWL74/PRO-UP,
HLWL74/RPO2, HLWL85/PRO-UP, HLWL85/RPO2,
PRO-UP/RPO2) for multiplex RAPD-PCR. For multiplex
RAPD-PCRs, primers were used at a concentration of
1 WM each. The PCR conditions used for determination
of the RAPD and multiplex-RAPD patterns were as de-
scribed previously [27]. The amplication proles were
compared by using the Image Master 1D Elite software
(Pharmacia Biotech), and dendrograms based on SAB val-
ues (similarity between the patterns for every pair of
strains) were generated with the Image Master 1D Data-
base software. An SAB value of 1.00 was considered to
 E. Ghelardi et al. / FEMS Microbiology Letters 208 (2002) 129^134 131

Table 1
Genes and primers
Gene Primer name Sequence (5P-3P) Product (bp) Cycles Denaturation Annealing Elongation Primer Ref.
sph Ph1 CGTGCCGATTTAATTGGGGC 558 35 20 s, 94C 20 s, 58C 20 s, 72C [16]

Ph2 CAATGTTTTAAACATGGATGCG
bceT ETF TTACATTACCAGGACGTGCTT 428 35 20 s, 94C 20 s, 56C 20 s, 72C [1]
ETR TGTTTGTGATTGTAATTCAGG
entFM ENTA ATGAAAAAAGTAATTTGCAGG 1269 35 20 s, 94C 20 s, 52C 20 s, 72C [3]
ENTB TTAGTATGCTTTTGTGTAACC
entS TY123 GGTTTAGCAGCAGCTTCTGTAGCTGGCG 581 29 40 s, 94C 60 s, 60.7C 60 s, 72C [3]
TY125 GTTTCGTTAGATACAGCAGAACCACC
piplc PC105 CGCTATCAATGGACCATGG 569 30 30 s, 94C 45 s, 57C 90 s, 72C [9]
PC106 GGACTATTCCATGCTGTACC
cytK F2 AACAGATATCGGTCAAAATGC 623 30 60 s, 95C 60 s, 52C 60 s, 72C [21]
R7 CGTGCATCTGTTTCATGAGG
nheA nheA 344 S TACGCTAAGGAGGGGCA 499 30 15 s, 94C 45 s, 55C 120 s, 72C [13]
nheA 843 A GTTTTTATTGCTTCATCGGCT
nheB nheB 1500 S CTATCAGCACTTATGGCAG 769 30 15 s, 94C 45 s, 55C 120 s, 72C [13]
nheB 2269 A ACTCCTAGCGGTGTTCC
nheC nheC 2820 S CGGTAGTGATTGCTGGG 581 30 15 s, 94C 45 s, 55C 120 s, 72C [13]
nheC 3401 A CAGCATTCGTACTTGCCAA

indicate complete identity between the patterns generated Similar amounts of PC-PLC were produced by the iso-
by two strains. lates PP1^PP19, FP3^FP6 and AP7, with values ranging
from 0.036 to 0.051 U ml31 . The emetic toxin was not
evidenced in the supernatants of all 24 isolates; this result
3. Results and discussion is in accordance with the observation that B. cereus strains
that produce cereulide are prevalent in Japan and in the
3.1. B. cereus isolates United Kingdom [17].

Colonies with the typical morphology of B. cereus were 3.3. PCR assay for entFM/S
isolated (onto MYP agar) from stools, foods and from the
rolling board of the confectioner's shop. They were all Asano and coworkers [3] described an enterotoxin gene,
Gram-positive bacilli harboring centrally located ellipsoi- the sequence of which, although highly conserved, is dif-
dal spores that did not swell the sporangium. Biochemical ferent in B. cereus and B. thuringiensis. For this reason,
characterization identied these organisms as belonging to they named entFM and entS the enterotoxin genes in B.
the B. cereus species, API-prole B. cereus 1. All food
samples (n = 4) contained more than 102 CFU of B. cereus
g31 . Since, among the environmental samples (n = 9) col-
lected from work-benches and refrigerators, B. cereus was
isolated only from the rolling board of the shop, it was
hypothesized that this bench was the source of contami-
nation of all food samples analyzed.

3.2. Evaluation of HBL, PC-PLC, and emetic toxin

activities

Since HBL is the major B. cereus virulence factor in-

volved in diarrhea, the isolates PP1^PP19, FP3^FP6 and
AP7 were assayed for production of the L2 component of
HBL and resulted able to produce this protein. Secretion
of the complete trimeric toxin was evaluated on HBL agar
plates where HBL causes a discontinuous zone of hemol- Fig. 1. PCR amplication of entFM/S from B. cereus and B. thuringien-
sis strains. Lanes 1 and 2: B. cereus ATCC 10987; 3 and 4: B. cereus
ysis surrounding colonies. All the B. cereus isolates pro-
ATCC 10876; 5 and 6: B. thuringiensis Bac174 ; 7 and 8: B. thuringien-
duced this typical hemolysis, indicating their ability to sis Bac182. Odd lanes: Amplication performed with the primer pair
produce active HBL and suggesting their pathogenic po- TY123/TY125. Even lanes: Amplication performed with the primer
tential in diarrheal food poisoning. pair ENTA/ENTB. Lane M contained VEcoRI^HindIII DNA.

FEMSLE 10340 25-3-02

132 E. Ghelardi et al. / FEMS Microbiology Letters 208 (2002) 129^134

cereus and B. thuringiensis, respectively, and designed
primers for entFM (ENTA and ENTB) and entS (TY123
and TY125) amplication. TY123 and TY125 have been
applied recently for screening strains of B. cereus, B. thu-
ringiensis, and Bacillus anthracis for the presence of entS
[14].
Performing a search of entS and entFM in the B. an-
thracis genome at the TIGR database (http://www.
tigr.org) and in B. cereus sequences at dierent databases
(EMBL, GenBank, DDJB), we found a unique gene se-
quence that displayed a certain degree of variability
among strains. To verify whether the use of one primer-
pair could be sucient to analyze B. cereus and B. thu-
ringiensis strains for the presence of the enterotoxin gene,
we amplied the genomic DNA extracted from strains
ATCC 10987, ATCC 10876, Bac174 and Bac182 with
the primers TY123/TY125 and ENTA/ENTB. As shown
in Fig. 1, amplication was obtained for B. cereus ATCC
10987 and B. thuringiensis Bac174 with both primer-pairs,
whereas no amplied product was obtained for B. cereus
ATCC 10876 with ENTA/ENTB and for B. thuringiensis
Bac182 with TY123/TY125. These results suggest that
entFM and entS should be considered as only one gene
and indicate that, apart from the Bacillus species analyzed,
at least two dierent primer pairs are necessary to detect
the presence of entFM/S by PCR.
3.4. Detection of genes encoding toxins
PCR amplication of genes encoding toxins has been
used previously to characterize the enterotoxigenic proper-
ties of B. cereus strains [14^16,22,24]. However, there is no
report in which the presence of all genes has been analyzed
and, to the best of our knowledge, amplication patterns
of genes encoding these factors have never been used to
evaluate similarities between strains allocated to the B.
cereus species. To analyze the virulence potential and the
genetic relatedness of the isolates PP1^PP19, FP3^FP6,
and AP7, we performed PCR amplication of entFM/S,
cytK, sph, piplc, bceT, nheA, nheB and nheC. All the iso-
lates showed identical amplication patterns and the pres-
ence of entFM/S, nheA, nheB, nheC, sph and piplc. The
absence of bceT and cytK has been reported to be frequent
in B. cereus isolates. Hansen and Hendriksen [15], who
analyzed by PCR a collection of B. cereus strains for the
presence of bceT, found that 45% of the strains produced
no PCR-amplied DNA bands. Moreover, cytK, which
encodes a protein that is cytotoxic to intestinal epithelia,
has been previously found only in one B. cereus strain over
the 19 analyzed [21].
The contemporary nding of genes encoding NHE, en-
terotoxin FM, sphingomyelinase and PI-PLC together
with the production of HBL and PC-PLC in all the iso-

Fig. 2. RAPD ngerprinting of B. cereus strains. The PCR amplication was performed on genomic DNA with the primers PRO-UP, RPO2, HLWL85
and HLWL74. Lane 1: ATCC 10987; 2: ATCC 33018; 3: ATCC 10876; 4: ATCC 14579; 5: PP1 (representative pattern for strains PP2^PP19);
6: FP3; 7: FP4; 8: FP5; 9: FP6; 10: AP7. Lane M contained VEcoRI^HindIII DNA.

FEMSLE 10340 25-3-02

 E. Ghelardi et al. / FEMS Microbiology Letters 208 (2002) 129^134
lates indicated the high enterotoxigenic potential of these
bacteria. Moreover, the similarity in the amplication pat-
terns obtained for PP1^PP19, FP3^FP6, and AP-7
strongly suggested that the isolates could be assimilated
to a unique strain.
3.5. RAPD proles and genetic relatedness of B. cereus
strains
RAPD-PCR with four dierent primers (RPO2, PRO-
UP, HLWL74, HLWL85) was used to ngerprint the ge-
nomic DNA of the B. cereus isolates and reference strains
ATCC 14579, ATCC 10987, ATCC 10876 and ATCC
33018. The amplication patterns generated with each of
the primers were distinct for all of the B. cereus reference
strains analyzed (Fig. 2), as shown by the substantial dif-
ferences in the similarity values recorded by the computer-
aided analysis of RAPD ngerprints (SAB value range,
0.1^0.7) (dendrogram relative to primer HLWL74 is
shown in Fig. 3A). Other than conrming the genomic
heterogeneity reported for B. cereus strains [7], these re-
sults indicate that RAPD-PCR analysis is useful to delin-
eate intraspecic dierences and identify B. cereus at the
strain level. The electrophoretic proles derived from am-
plication of PP1^PP19, FP3^FP6 and AP7 revealed iden-
tity or negligible dierences among strains with all the
primers used (Fig. 2), the results being conrmed by the
similarity values obtained (SAB W1) (Fig. 3A). Therefore,
the application of RAPD-PCR analysis strongly suggested
clonality among the isolates and indicated that the rolling
Fig. 3. Dendrograms constructed from RAPD- and multiplex RAPD-PCR proles of B. cereus strains. Genomic DNA was amplied with (A) the prim-
er HLWL74 and (B) the primer-pair HLWL74/RPO2.
FEMSLE 10340 25-3-02
133
board was the common source of contamination for these
two food-poisoning outbreaks.
Although RAPD-PCR shows a high discriminatory
power for B. cereus, amplicons obtained with a single
primer may not be sucient to appreciate dierences be-
tween strains. To overcome this limitation, we tried to use
combinations of two primers in a multiplex RAPD-PCR.
Due to the frequent increase in the number of informative
genetic markers compared to RAPD-PCR, this method
has been applied already to dierentiate Lactobacillus
strains and cyanobacteria [10,23]. Multiplex RAPD-PCR
conrmed the results obtained with RAPD-PCR, the
strains isolated during the food-borne outbreak being clus-
tered together (SAB W1) and the patterns obtained for the
reference B. cereus strains showing high heterogeneity
(SAB value range, 0.03^0.6) with all the primer-pairs
used (not shown). A signicant increase in the discrimina-
tory power of multiplex RAPD-PCR compared to RAPD-
PCR was obtained with HLWL74 and RPO2 as the prim-
ers (Fig. 3B). These results indicate that, although RAPD
analysis is a useful method to validly discriminate B. ce-
reus strains, multiplex RAPD-PCR may be applied when-
ever a higher discrimination among strains is required.
In conclusion, the novelties of this paper consist in:
(i) the use of both phenotypic and molecular methods to
assess the complete toxigenic prole and the pathogenic
potential of B. cereus strains ; and (ii) the application of
PCR amplication of the genes encoding toxins in combi-
nation with RAPD-PCR and multiplex RAPD-PCR n-
gerprinting of the whole genomes for tracing the source of
134 E. Ghelardi et al. / FEMS Microbiology Letters 208 (2002) 129^134
infection and monitoring environmental and clinical iso-
lates of B. cereus.
References
[1] Agata, N., Ohta, M., Arakawa, Y. and Mori, M. (1995) The bceT
gene of Bacillus cereus encodes an enterotoxin protein. Microbiology
141, 983^988.
[2] Agata, N., Ohta, M., Mori, M. and Isobe, M. (1995) A novel dodec-
adepsipeptide, cereulide, is an emetic toxin of Bacillus cereus. FEMS
Microbiol. Lett. 129, 17^19.
[3] Asano, S.-I., Nukumizu, Y., Bando, H., Hzuka, T. and Yamamoto,
T. (1997) Cloning of novel enterotoxin genes from Bacillus cereus and
Bacillus thuringiensis. Appl. Environ. Microbiol. 63, 1054^1057.
[4] Beecher, D.J. and Macmillan, J.D. (1991) Characterization of the
components of hemolysin BL from Bacillus cereus. Infect. Immun.
59, 1778^1784.
[5] Beecher, D.J., Olsen, T.W., Somers, E.B. and Wong, A.C.L. (2000)
Evidence for contribution of tripartite hemolysin BL, phosphatidyl-
choline-preferring phospholipase C, and collagenase to virulence of
Bacillus cereus endophthalmitis. Infect. Immun. 68, 5269^5276.
[6] Beecher, D.J., Schoeni, J.L. and Wong, A.C.L. (1995) Enterotoxic
activity of hemolysin BL from Bacillus cereus. Infect. Immun. 63,
4423^4428.
[7] Carlson, C.R., Grnstad, A. and Kolst, A.-B. (1992) Physical maps
of the genomes of three Bacillus cereus strains. J. Bacteriol. 174,
3750^3756.
[8] Celandroni, F., Ghelardi, E., Pastore, M., Lupetti, A., Kolst, A.-B.
and Senesi, S. (2000) Characterization of the chemotaxis iY and
cheA genes in Bacillus cereus. FEMS Microbiol. Lett. 190, 247^253.
[9] Damgaard, P.H., Jacobson, C.S. and Srensen, J. (1996) Develop-
ment and application of a primer set for specic detection of Bacillus
thuringiensis and Bacillus cereus in soil using magnetic capture hy-
bridization and PCR amplication. Syst. Appl. Microbiol. 19, 436^
441.
[10] Daud Khaled, A.K., Neilan, B.A., Henriksson, A. and Conway, P.L.
(1997) Identication and phylogenetic analysis of Lactobacillus using
multiplex RAPD-PCR. FEMS Microbiol. Lett. 153, 191^197.
[11] Finlay, W.J.J., Logan, N.A. and Sutherland, A.D. (2000) Bacillus
cereus produces most emetic toxin at lower temperatures. Lett.
Appl. Microbiol. 31, 385^389.
[12] Gilmore, M.S., Cruz-Rodz, A.L., Leimeister-Wachter, M., Kreft, J.
and Goebel, W. (1989) A Bacillus cereus cytolytic determinant, cer-
eolysin AB, which comprises the phospholipase C and sphingomieli-
nase genes: nucleotide sequence and genetic linkage. J. Bacteriol. 171,
744^753.
[13] Granum, P.E., O'Sullivan, K. and Lund, T. (1999) The sequence of
the non-hemolytic enterotoxin operon from Bacillus cereus. FEMS
Microbiol. Lett. 177, 225^229.
[14] Guttmann, D.M. and Ellar, D.J. (2000) Phenotypic and genotypic
FEMSLE 10340 25-3-02
comparison of 23 strains from the Bacillus cereus complex for a
selection of known and putative B. thuringiensis virulence factors.
FEMS Microbiol. Lett. 188, 7^13.
[15] Hansen, B.M. and Hendriksen, N.B. (2001) Detection of enterotoxic
Bacillus cereus and Bacillus thuringiensis strains by PCR analysis.
Appl. Environ. Microbiol. 67, 185^189.
[16] Hisieh, Y.M., Sheu, S.J., Chen, Y.L. and Tsen, H.Y. (1999) Enter-
otoxigenic proles and polymerase chain reaction detection of Bacil-
lus cereus group cells and B. cereus strains from food-borne out-
breaks. J. Appl. Microbiol. 87, 481^490.
[17] Kramer, J.M. and Gilbert, R.J. (1989) Bacillus cereus and other Ba-
cillus species. In: Foodborne Bacteria Pathogens (Doyle, M.P., Ed.),
pp. 21^70. Marcel Dekker, New York.
[18] Kuppe, A., Evans, L.M., McMillen, D.A. and Grith, O.H. (1989)
Phosphatidylinositol-specic phospholipase C of Bacillus cereus :
cloning, sequencing and relationship to other phospholipases. J. Bac-
teriol. 171, 6077^6083.
[19] Liu, P.Y.-F., Ke, S.-C. and Chen, S.-L. (1997) Use of pulse eld gel
electrophoresis to investigate a pseudo-outbreak of Bacillus cereus in
a pediatric unit. J. Clin. Microbiol. 35, 1533^1535.
[20] Lund, T. and Granum, P.E. (1996) Characterization of a non-hae-
molytic enterotoxin complex from Bacillus cereus isolated after a
foodborne outbreak. FEMS Microbiol. Lett. 141, 151^156.
[21] Lund, T., De Buyser, M.-L. and Granum, P.E. (2000) A new cyto-
toxin from Bacillus cereus that may cause necrotic enteritis. Mol.
Microbiol. 38, 254^261.
[22] Mantynen, V. and Lindstrom, K. (1998) A rapid PCR-based DNA
test for enterotoxic Bacillus cereus. Appl. Environ. Microbiol. 64,
1634^1639.
[23] Neilan, B.A. (1995) Identication and phylogenetic analysis of toxi-
genic cyanobacteria by multiplexing randomly amplied polymorphic
DNA PCR. Appl. Environ. Microbiol. 61, 2286^2291.
[24] PruL, B.M., Dietrich, R., Nibler, B., Martlbauer, E. and Scherer, S.
(1999) The hemolytic enterotoxin HBL is broadly distributed among
species of the Bacillus cereus group. Appl. Environ. Microbiol. 65,
5436^5442.
[25] Ripabelli, G., McLauchlin, J., Mithani, V. and Threlfall, E.J. (2000)
Epidemiological typing of Bacillus cereus by amplied fragment poly-
morphism. Lett. Appl. Microbiol. 30, 358^363.
[26] Sakurai, N., Koike, K.A., Irie, Y. and Hayashi, H. (1994) The rice
culture ltrate of Bacillus cereus isolated from emetic-type food poi-
soning causes mitochondrial swelling in HEp-2 cell. Microbiol. Im-
munol. 38, 337^343.
[27] Senesi, S., Celandroni, F., Tavanti, A. and Ghelardi, E. (2001) Mo-
lecular characterization and identication of Bacillus clausii strains
marketed for use in oral bacteriotherapy. Appl. Environ. Microbiol.
67, 834^839.
[28] Svensson, B., Eneroth, A., Brendehaug, J. and Christiansson, A.
(1999) Investigation of Bacillus cereus contamination sites in a dairy
plant with RAPD-PCR. Int. Dairy J. 9, 903^912.