Leukemia (2004) 18, 248254
& 2004 Nature Publishing Group All rights reserved 0887-6924/04 $25.00
www.nature.com/leu
DEBATE ROUND TABLE
Evaluation of STR informativity for chimerism testing comparative analysis of 27 STR
systems in 203 matched related donor recipient pairs
C Thiede1, M Bornhauser1 and G Ehninger1
1
Medizinische Klinik und Poliklinik I, Universitatsklinikum Carl Gustav Carus der Technischen Universitat, Fetscherstrasse 74,
Dresden, Germany
Chimerism analysis has become a routine method to document
engraftment and also for detection of residual disease. PCR-
based procedures using STR analysis, especially commercially
available multiplex assays, are frequently used. However, these
assays have been optimized for forensic purposes and do not
necessarily fulfil all needs for chimerism analysis. To improve
these analyses, data on the level of informativity of STR
systems in the context of chimerism analysis would be helpful.
We evaluated 27 STR markers for their informativity in 203
patients and their HLA-matched related donors. These STRs
included 18 from different multiplex kits, whereas nine were
selected from the literature or STR databases. The STR profiles
were ranked from Type 1 (not informative) to Type 5 (best suited
for chimerism analysis). According to this ranking, the
informativity of the STR systems was found highly variable,
ranging from 4.4 to 49.0% Type 5 constellations. Among the
most informative STRs were Penta E, SE33, D2S1338 and
D18S51. Informativity of an STR was correlated with the degree
of heterozygosity (r 0.86; P 0.0001), but not with the total
number of alleles present. These data indicate that selection of
suitable STR markers is important to improve diagnostics
based on STR analysis.
Leukemia (2004) 18, 248254. doi:10.1038/sj.leu.2403212
Published online 4 December 2003
Keywords: chimerism; STR; transplantation
Introduction
Analysis of donor chimerism has become a routine procedure
for the evaluation of engraftment after allogeneic blood stem
cell transplantation. Several methods have been reported for this
purpose, including cytogenetic, phenotypic and molecular
procedures (for a review, see Bryant and Martin1). In recent
years, PCR-based methods have become increasingly popular,
since they are independent of gender mismatch, sensitive and
need only minute amounts of material. Lawler et al2 were the
first to report the use of PCR for the amplification of highly
polymorphic short tandem repeat (STR) sequences in the field of
chimerism analysis, and numerous assays based on variable
number of tandem repeat (VNTR) or STR markers have been
reported since then.36 Recently, several groups have used
multiplex amplification of STR markers with fluorescence
detection, since this allows for rapid identification of informa-
tive markers and also enables the calculation of mean values,
which increases the accuracy and reproducibility of the
results.79 Especially, commercially available multiplex kits
designed for forensic purposes are frequently used for chimerism
Correspondence: Dr C Thiede, Medizinische Klinik und Poliklinik I,
Universitatsklinikum Carl Gustav Carus der Technischen Universitat,
Fetscherstrasse 74, 01307 Dresden, Germany; Fax: 49 351 458
5362
Received 14 May 2003; accepted 22 September 2003; Published
online 4 December 2003
analysis, since they offer a high degree of informativity and
standardization.
Informativity in the context of chimerism analysis means
something substantially different from what it means in the
forensic field. In the case of forensic analysis, the primary goal is
individual identification. Thus, it is important to obtain an STR
profile that allows unambiguous identification of a suspect.
Since identification is based largely on database searches, the
choice of the appropriate STR markers is influenced by the fact
that only selected STR systems are represented in large forensic
databases like the Combined DNA Index System (CODIS) (for a
review, see Butler10]. The STR systems included in these
databases have been chosen on the basis of international
agreements and standards, which are not necessarily based on
maximum informativity. In chimerism analysis, the starting point
is substantially different. Although discrimination of individuals
is obviously important as well, the requirements are different,
since the individuals involved (donor and recipient) are known.
Thus, an important selection criterion for an informative marker
is not the difference per se, but the ability to identify even small
amounts of residual cells in the mixture. In this regard, another
critical aspect of STR analysis for chimerism analysis is the
presence of additional signals (so-called stutter peaks) which are
n1 and, to a considerably lesser degree, n 1 signals.11,12
These artefacts are supposed to result from slipped-strand
mispairing during amplification.12 The intensity of the n1
stutter signals usually is about 210% of the corresponding STR
allele. A high rate of stutter peaks has been reported for long
simple repeat runs, whereas the presence of imperfect repeats
and the use of DNA polymerases with increased processivity
reduces the formation of n1 signal.12,13 The presence of an
increased repeat length, that is, a pentanucleotide repeat, has
been also linked with lower stutter signals.14,15 If stutter signals
are present and coelute with the corresponding STR alleles of
the recipient or the donor, they hamper accurate quantification.
This is particularly important in the situation of low residual host
cell levels and makes detection of minimal residual disease
virtually impossible. Thus an optimal STR system for chimerism
analysis has to have distinct signals for donor and recipient,
which are not influenced by the stutter signals. Taken together,
the demands in the field of chimerism analysis and forensic
diagnostics show obvious and important differences, which
need to be addressed in order to optimize chimerism testing.
The aim of the present study was to comparatively evaluate a
large number of STR systems in order to identify the most
informative in the context of chimerism analysis. For this
purpose, a cohort of more than 200 HLA-matched related
donors and recipients were analyzed using a panel of 27 STR
systems either represented in commercially available multiplex
systems or reported to have a high level of sensitivity. We further
tried to identify characteristics that allow the classification of the
suitability of STR markers for chimerism analysis.

Material and methods
Patient samples
All patients analyzed received an allogeneic hematopoietic stem
cell transplant from an HLA-matched family donor. All samples
investigated had been sent to our laboratory for chimerism
analysis. The study was approved by the ethical board of the
Technical University Dresden (No.: EK120072003).
Extraction of DNA
DNA was extracted from peripheral blood leukocytes using a
column-based DNA isolation technique (Qiagen DNA Blood
mini kit, QIAGEN, Hilden, Germany), as described recently.16
DNA was eluted in TE buffer (1 mM Tris, 0.1 mM EDTA, pH 8).
DNA quantification was performed using UV absorption at
260 nm.
Selection of STR systems
The STR systems investigated in this analysis were retrieved from
different sources. Three commercially available STR multiplex
amplification kits were used: The Powerplex 16 kit (Promega,
Mannheim, Germany) contains the tetranucleotide STR systems
D3S1358, TH01, D21S11, D18S51, D5S818, D13S317,
D7S820, D16S539, CSF1PO, vWA, D8S1179, TPOX and FGA
as well as the two proprietary pentanucleotide STRs Penta E and
Penta D.17 The AmpFlSTR Profiler SGM kit (Applied Biosystems,
Weiterstadt, Germany) also amplifies the tetranucleotide STRs
D3S1358, vWA, D16S539, D8S1179, D21S11, D18S51, TH01,
FGA and contains two additional tetra-STRs, D2S1338 and
D19S433.18 The Triplex AFS kit (Biotype, Dresden Germany)
consists of the tetranucleotide STRs FGA and the highly
polymorphic SE33/humACTBP2.19 All three multiplex systems
also contain primers specific for the Amelogenin locus that
distinguishes the X and Y chromosomes. In addition to these,
two penta-STR systems (D10S2325 and D6S957) as well as
seven tetranucleotide markers (D2S1360, D3S1744, D4S2366,
D5S2500, D7S1517, D8S1132, D12S391) were studied.
Criteria for their selection were a high degree of hetero-
zygosity (40.8), the presence of a pentanucleotide repeat (D10
and D6), and if known, a balanced allelic distribution (preferred
maximum prevalence for a single allele o0.2). One STR system
had already been reported in the context of chimerism
analysis.20 Several different databases were investigated in
addition to the published literature (eg http://www.cstl.nist.-
gov/biotech/strbase,21 http://www.ncbi.nlm.nih.gov/genome/sts)
in order to assess the level of heterozygosity and the allelic
distribution.
Definition
In order to facilitate a standardized analysis of the data and to
achieve a comparable dataset, we grouped the different donor
recipient constellations according to the following criteria
(Figure 1):
Type 1: Donor and recipient STR profiles are completely
matching. This category was also used if there was only a 1 bp
difference due to a x.1 or a x.3 variant allele between the donor
and the recipient.
STRs for chimerism analysis
C Thiede et al
249
Figure 1 Schematic illustration of different recipient and donor
constellations (see Material and Methods for detailed description).
Type 2: One of the two individuals, either donor or recipient,
is heterozygous for an STR, whereas the second is homozygous
for this system, and this homozygous allele has the same allelic
length as one of the heterozygous signals. The same category
was used if a variant allele differing by only 1 bp (x.3 or x.1) was
present.
Type 3: The recipient has STR signals that are distinct from the
donor, but one has the same allelic length than the forward
stutter peak of the donor, thus is n1 where n is the allele
number of the smallest donor STR allele. When the recipient had
a x.3 variant of the n2 allele of donor allele or a x.1 variant of
the n1 allele, the difference between the stutter signal and the
recipient STR is only 1 bp (n2.3 allele 1 bp; n1.1
allele 1 bp). Therefore, these constellations were categor-
ized also as Type 3 constellation.
Type 4: The recipient specific STR has at least one allele with
a repeat length of n 1, thus is one repeat longer than the largest
donor STR allele. When the recipient had a x.3 variant of the
donor allele or a x.1 variant of the n 1 allele, the difference
between the stutter signal and the recipient STR is only 1 bp (n.3
allele 1 bp; n 1.1 allele 1 bp). Therefore, these situa-
tions were categorized also as Type 4 constellation.
Type 5: The distinct recipient STR allele has a repeat length
that is at least n72 (810 bp or more) compared to the donor
alleles, thus is at least two repeats longer or shorter than the next
donor allele.
PCR amplification and fragment analysis
PCR amplification of all commercial multiplex kits was carried
out as recommended by the manufacturers, 1.5 ng of genomic
DNA were used in all three assays.
Leukemia
 STRs for chimerism analysis
C Thiede et al
250
PCR primers for the other STRs were labeled with a
fluorophore (Table 1; TIB MOLBIOL, Berlin, Germany). The
primer sequences, the annealing temperature and the range of
the product sizes are given in Table 1. It is important to note
that those primers, which were not included in any of the
commercial STR multiplex systems, were solely used for
the typing of the STR alleles and were not optimized for
the performance in chimerism analysis (ie sensitivity or peak
shape). PCR was performed in all cases in an ABI 9700 PCR
system using standard concentrations of primers (0.5 mM)
and other PCR components (200 mM of each dNTP, 50 mM
KCl, 10 mM Tris HCl pH 8.3, 1.5 mM MgCl2, 0.001% gelatin and
0.5 U of AmpliTaq Gold DNA polymerase (ABI)). In all PCRs,
1.5 ng of DNA were used per reaction. PCR conditions were:
preincubation at 951C for 11 min, 30 cycles with 941C/30 s,
601C or 561C (see Table 1)/30 s and 721C/30 s. A final
elongation step was performed at 601C/45 min.
For fragment analysis, 1 ml of the PCR product was mixed with
12 ml deionized formamide and 0.5 ml of the corresponding
length standard and denatured at 951C for 2 min. In most cases,
the ILS600 lane standard (Promega) was used, only the Triplex
AFS kit and the D2S1360 PCR Fragments were run with the
Genescan ROX 400 HD standard (ABI). Denaturing capillary
electrophoresis was carried out on an ABI 310 instrument using
a 47 cm  50 mm capillary and the POP 4 polymer essentially as
recommended by the manufacturer. The injection times varied
between 3 and 10 s.
Results
A total of 203 HLA-matched related donor/recipient pairs were
analyzed for all 27 STR systems. No differences were observed
in the typing results between the three commercial multiplex
systems, thus the results for those STR systems included in
several kits (eg FGA) were in complete concordance. As shown
in Table 2 and Figure 2, there was a large heterogeneity of the
informativity according to the criteria defined in the Material
and methods section. The median percentage of Type 5
constellations was 18.1% (range 4.449%). Two STR systems
(Penta E and SE33/ACTB2) had a very high proportion of ideal
constellations. In contrast to that in several STR systems (eg
TPOX, CSF1PO), almost half of the related individuals showed
complete identity. These STRs were characterized by very low
numbers of Type 5 constellations.
When we compared the informativity of two multiplex STR
systems (Powerplex 16 and Profiler SGM plus), both assays were
found to have a median number of 2 Type 5 constellations per
patient. Nevertheless, the Profiler SGM did not show any Type 5
STRs in 10.3% of the patients, compared to 5.4% of pairs
analyzed with the Powerplex 16 assay. This discrepancy most
likely reflects the fact that the SGM kit contains only 10 STRs
compared to the 15 systems included in the Promega kit. Thus
we also calculated the values that would be obtained for the
AmpFl Identifiler kit (ABI), which also includes the 13 CODIS
loci, based on the results obtained with the Powerplex 16 assay.
No significant difference was seen between the two systems
with respect to the ability to identify Type 5 constellations.
However, using these highly integrated multiplex PCR assays, in
2025%, only a single Type 5 STR was identified.
We applied the knowledge on the informativity of the
different STRs in a model where we analyzed the chance to
find a Type 5 STR by subsequent analysis of the STRs. The
markers were divided into the high informativity group (Penta E,
SE33, D2S1338, D18S51, D12S391, D7S1517, D10S2325,
D8S1132, D2S1360, D4S2366, D3S1744, FGA) and the low
informativity group (Penta D, D5S2500, D8S1179, vWA,
D13S317, D16S539, D7S820, THO1, D6S957, D3S1358,
D21S11, D19S433, TPOX, D5S818, CSF1PO). Using this
approach, the probability to find a Type 5 constellation was
98.2% in the high-informativity group compared to only 87.6%
in the low-informativity group (Figure 3). Using only five highly
informative STRs resulted in a similar chance to find Type 5
constellations (88.2%) than the use of 15 STRs with low
informativity. In addition, using the 12 highly informative STRs,
only four individuals had no Type 5 constellation identified. In
all of these cases at least one Type 4 constellation was present.
We also tried to identify characteristics of markers with a high
percentage of informative constellations. Although STRs with a
higher number of alleles tended to have more Type 5
constellations, this association was not significant. A close
linear correlation (r 0.86; Po0.0001) was found when we
compared the heterozygosity of the STR loci with the prevalence
of Type 5 situations (Figure 4). Thus, all highly informative STRs

Table 1 Detailed description of non-commercial STR systems and amplification conditions

STR Chrom. Acc. no. Repeat unit Primerb Fluorophorec Annealing-temp. Product size
system (GDB) (ISFH)a (bp)

D10S2325 10 682770 TCTTA s: CTCACGAAAGAAGCCTTCTG

as: GAGCTGAGAGATCACGCACT 6-FAM 601C 108158
D8S1132 8 684582 CTAT s: GGCTAGGAAAGGTTAGTGGC
as: CCCTCTCTCTTTCGAGCAAT HEX 601C 131171
D5S2500 5 683034 ATAG s: TTAAAGGAGTGATCTCCCCC 6-FAM
as: CCTGTAGATCGCTGGAGCC 601C 171207
D7S1517 7 3754931 (GAAA) s: GTGACCAACTGAATTATGTTTTG BoTMR
(CAAA) as: CATCTTGCCAGCTGCCT 601C 107155
D6S957 6 314039 s: AAGTGCCCATTTCTCTGCTC 6-FAM
GCAGA as: GGAAGCCCTCCTACACCA 601C 127197
D2S1360 2 684375 (TAGA) s: TAACCTTGTGAGCCAATTCC
(CAGA) as: CAAAACAGAAACAGAACTAATAAGA 6-FAM 561C 128176
D12S391 12 686475 (AGAT) s: AACAGGATCAATGGATGCAT
(AGAC) as: TGGCTTTTAGACCTGGACTG HEX 601C 206250
D3S1744 3 365265 GATA s: TTTAAGCGGAAGGAAGTGTG
as: CTGGCCCCATCTCTCTCTAT HEX 601C 128160
a 29
According to the ISFH allele designation recommendations .
b
All primer sequences are given in 50 30 direction; s: sense; as: antisense.
c
5-prime label.

Leukemia
 STRs for chimerism analysis
C Thiede et al
251
Table 2 Results of STR evaluation according to the ranking in the Material and methods section

Alleles Type 1 Type 2 Type 3 Type 4 Type 5 Heterozygosity

STR (n) (%) (%) (%) (%) [%]

D3S1358a,b 15 35.0 21.4 15.4 14.6 13.6 0.752

THO1a,b 10 34.6 25.9 12.7 12.7 14.1 0.777
D21S11a,b 41 30.1 17.0 24.8 15.5 12.6 0.835
D18S51a,b 41 35.9 10.2 18.4 7.8 27.7 0.879
Penta Ea 21 24.8 7.8 10.6 7.8 49.0 0.905
D5S818a 10 40.8 26.2 19.9 9.2 4.9 0.704
D13S317a 9 28.6 19.9 22.4 12.1 17.0 0.784
D7S820a 9 29.6 18.9 21.4 14.1 16.0 0.811
D16S539a,b 9 37.4 17.5 19.9 8.7 16.5 0.752
CSFP01a 10 44.2 20.4 17.4 13.6 4.4 0.745
Penta Da 14 29.1 14.6 20.9 17.0 18.4 0.854
vWAa,b 20 33.0 18.0 19.9 12.1 17.0 0.769
D8S1179a,b 16 25.2 22.3 21.4 14.1 17.0 0.803
TPOXa 8 50.0 28.6 6.3 8.3 6.8 0.612
FGAa,b 28 33.5 15.0 19.0 13.1 19.4 0.840
D2S1338b 14 26.4 14.4 15.0 12.0 32.2 0.851
D19S433b 18 36.1 19.2 19.7 16.3 8.7 0.751
D10S2325 11 30.5 10.8 20.8 13.8 24.1 0.885
SE33/ACTBP2 32 31.9 4.9 7.8 10.3 45.1 0.951
D12S391 15 33.2 13.2 15.5 12.7 25.4 0.902
D3S1744 9 31.2 17.6 16.6 14.6 20.0 0.812
D2S1360 13 36.8 19.1 14.2 7.8 22.1 0.799
D5S2500 10 32.8 19.6 16.8 12.7 18.1 0.786
D7S1517 13 31.7 14.6 19.0 9.8 24.9 0.865
D8S1132 11 27.6 15.1 19.1 15.1 23.1 0.869
D6S957 13 34.6 23.4 18.5 9.8 13.7 0.751
D4S2366 7 34.7 18.1 16.0 10.6 20.6 0.783
a
Part of the Powerplex 16 kit.
b
Part of the Profiler SGM Plus kit.

Figure 2 Number of Type 5 constellations obtained with the 27 STR systems tested.

(Type 5 420%) had a heterozygosity rate of more than 80%.
The two most informative (Penta E and SE33) had more than
90% heterozygosity.
Discussion
In order to identify highly informative STR loci for the use in
chimerism diagnostics, we have evaluated a large cohort of
HLA-matched siblings for disparity in a panel of 27 STR markers.
We focused on this group, because several studies have shown
that the overall informativity of STRs differs significantly
between related and unrelated individuals (reviewed in Bryant
and Martin1). We have previously shown that using a panel of
nine STRs, the median number of informative constellations was
7 in unrelated individuals compared to only 3 in matched
related situations.22 Deduced from these results it is very likely
that STRs showing high informativity in the related setting are
also well suited in the unrelated situation. However, the vice
versa assumption does not appear appropriate. Thus, in order to
obtain comparable results, it appears necessary to use similar
and homogeneous patient samples, that is, HLA-matched family
donors, to compare the informativity between different cohorts.
When mixed cohorts (matched related, haploidentical, unre-

Leukemia
 STRs for chimerism analysis
C Thiede et al
252

Figure 3 Analysis of the probability to find a Type 5 STR using different STRs sequentially in the order given below. High-informativity group
(High): Penta E, SE33, D2S1338, D18S51, D12S391, D7S1517, D10S2325, D8S1132, D2S1360, D4S2366, D3S1744, FGA; Low-informativity
group (Low): Penta D, D5S2500, D8S1179, vWA, D13S317, D16S539, D7S820, THO1, D6S957, D3S1358, D21S11, D19S433, TPOX, D5S818,
CSFP01.

Figure 4 Correlation of the number of Type 5 constellations and the heterozygosity rate observed with different STRs.

lated) are analyzed, comparisons between different reports are
almost impossible due to the inhomogeneity in the composition
of the test sets.
In order to make the informativity comparable between the
different STRs, we have classified the constellations in order to
assess the suitability of the STR systems in the context of
chimerism analysis. This classification, which is illustrated in
Figure 1, is based on the following assumptions. A Type 1
constellation indicates complete identity between donor and
recipient profiles, thus cannot be used at all. In Type 2
constellations, one allele of the donor is coeluting with the
recipient. Although this constellation can be used for calculation
of the individual signal, 23 the accuracy is poor and it is
frequently not possible to identify small amounts of one
individual (ie o5%) with sufficient specificity. The same is true
for Type 3 constellations, where one of the recipient STR alleles
coelutes with the stutter signal of one of the donor STR alleles.
The limited usability of this constellation for accurate chimerism
quantification has been discussed by several authors.16,24
Owing to this limitation, it is impossible to specifically identify
residual host signals, thus the sensitivity and specificity of the
procedure is limited substantially. Type 4 constellations are
those where the recipient STR allele is only one repeat longer
than the donor allele. Stutter signals in this situation have been
observed; however, they are significantly less frequent. In
addition, if a tailing, that is, broadened elution of the peak,
occurs during electrophoresis, small host signals may be located
in the tail shoulder of a large donor peak, which also makes
identification difficult. However, since this problem is clearly
much less prevalent than in Type 3 constellations, Type 4
constellations may be used if Type 5 situations are not
found. Nevertheless, the most accurate identification is
possible if there is no interference of donor and host signals, a
situation that we classified as Type 5 constellation. In this
combination, even a very small signal specifically indicates
residual host cells.
When we applied this classification, very heterogeneous
results were seen. Several of the STRs which have been used in
the forensic field for a long time, appear of little value in
chimerism analysis, since they showed o10% Type 5 situations.
This includes the STRs CSF1PO, D5S818, TPOX and D19S433.
The STR system TPOX, for example, showed almost 80% Type 1
and 2 constellations. About half of the STRs tested had between
13 and 20% Type 5 STR. In contrast, 10 STRs were found to
have more than 20% Type 5 STRs. Thus, using several of these
highly informative STRs will results in a high probability to
identify a constellation especially suitable for chimerism
analysis due to a nonoverlap between recipient signals on one
side and the donor alleles and their corresponding stutter signals
on the other side.

Leukemia

We tested this hypothesis by using the STRs in a stepwise
model looking for the chance to find Type 5 STRs. As shown in
Figure 3, the chance to identify a Type 5 constellation was much
better when the STRs of the high-informativity group were used.
Thus, these results can be used to define a subset of STRs that
have a superior informativity in the context of chimerism
analysis. If these STRs are used, a very informative STR will be
found in more than 95% of the cases. In the rare cases without a
Type 5 constellation, the Type 4 STRs may represent an
alternative. This will avoid the high degree of uncertainty
associated with the analysis of Type 2 and Type 3 STRs.
Although most of these STRs are used for forensic and
paternity testing, their respective informativity and the ability to
discriminate between two related individuals according to the
criteria mentioned differed remarkably. As shown in Table 2 and
Figure 2, the median percentage of type 5 donor recipient
constellations was 18.1% (range 4.449%). Although STR
systems with more alleles tended to be more informative, the
informativity was not univocally related to the number of alleles
present in the corresponding system. For example, the
D10S2325 and the D6S957 pentanucleotide STRs had compar-
able numbers of alleles (11 vs 13). However, the informativity
with respect to the Type 5 constellations differed considerably
(24.1 vs 13.7%; Table 2 and Figure 2). Thus, the most important
factor in this regard seems to be the balanced allelic usage. In
the D10S2325 system, the most frequently used allele had a
frequency of 18.9%. In contrast, in the D6S957 STR system, the
most frequently used allele was found in more than 30% and
only three alleles accounted for 83% of all alleles. A comparison
of the allelic usage of these two pentanucleotide markers is
shown in Figure 5. Consistent with this finding, no significant
association was found between the number of alleles of an STR
system and the informativity. In contrast, the heterozygosity rate
showed a linear correlation with the number of highly
Figure 5 Comparison of the allelic usage of the pentanucleotide STRs D10S2325 and D6S957.
STRs for chimerism analysis
C Thiede et al
253
informative STR constellations (Figure 4). Thus, not the absolute
number of alleles but the balanced allelic usage and a high
number of heterozygote individuals are hallmarks of STRs,
which are well suited for chimerism analysis. The highest
number of Type 5 constellations (45.1 and 49.0%) was found in
those two systems combining these features, and thus had a
large number of alleles and a balanced usage (SE33 and Penta
E). On the other side, what might be more important for forensic
scientists, we found complete identity of the STR profiles in this
sibling setting in a median of 33%, with a range from 2550%.
In one individual, 19/27 STRs showed complete identity,
including very polymorphic like SE33, Penta E, D12S391,
D21S11, D2S1388 and D10S2325. Since this reflects only a
population size of 200 sibling pairs, it appears very likely that
even a complete match of the STR profile can be seen by chance
in larger groups of related individuals. Interestingly, STR markers
showing a high number of Type 5 constellations were not
necessarily characterized by a low number of identical donor
recipient pairs (SE33 31.9%), but showed very low rates of
Type 2 and Type 3 situations (Penta E: 7.8 and 10.7%; SE33: 4.9
and 7.8%, respectively), whereas STRs with low informativity
frequently showed increased numbers for these constellations.
These data clearly have to be confirmed in larger cohorts. In
addition, the majority of individuals tested in this study were
Caucasians, although a few patient/donor pairs (n 5) belonged
to other ethnic groups (African, Asian, Arabian). However, in
order to extrapolate the results, validation has to be performed
using comparable data sets in different populations. Major
differences in the allelic usage and the presence of specific STR
alleles have been described for several of the STRs studied in
this analysis (eg D10S2325, SE33).26,27
In conclusion, our study supports the notion that standard
multiplex assays used for forensic purposes may be suitable for
chimerism testing, but frequently include a considerable
Leukemia
 STRs for chimerism analysis
C Thiede et al
254
number of markers with low informativity in the context of
chimerism analysis. Finding optimized STR sets especially for
this application is important to further improve diagnostics in
this field. This is one of the aims of a collaborative effort
(EUROCHIMERISM) headed by Prof Lion and Dr Bader and
participants from several European countries.2833
Acknowledgements
This study was supported in part by the Deutsche Krebshilfe, Bonn
(Grant number 70-2755 to CT and MB).
References
1 Bryant E, Martin PJ. Documentation of engraftment and character-
ization of chimerism following hematopoietic cell transplantation.
In: Thomas ED, Blume KG, Forman SJ (eds). Hematopoietic Cell
Transplantation. Oxford, London: Blackwell Science, 1999, pp
197206.
2 Lawler M, Humphries P, McCann SR. Evaluation of mixed
chimerism by in vitro amplification of dinucleotide repeat
sequences using the polymerase chain reaction. Blood 1991; 77:
25042514.
3 Bader P, Holle W, Klingebiel T, Handgretinger R, Niethammer D,
Beck J. Quantitative assessment of mixed hematopoietic chimerism
by polymerase chain reaction after allogeneic BMT. Anticancer
Res 1996; 16: 17591763.
4 Briones J, Urbano-Ispizua A, Rozman C, Marin P, Carreras E,
Rovira M et al. Study of hematopoietic chimerism following
allogeneic peripheral blood stem cell transplantation using PCR
amplification of short tandem repeats. Ann Hematol 1996; 72:
265268.
5 Scharf SJ, Smith AG, Hansen JA, McFarland C, Erlich HA.
Quantitative determination of bone marrow transplant engraftment
using fluorescent polymerase chain reaction primers for human
identity markers. Blood 1995; 85: 19541963.
6 Dubovsky J, Daxberger H, Fritsch G, Printz D, Peters C, Matthes S
et al. Kinetics of chimerism during the early post-transplant period
in pediatric patients with malignant and non-malignant hemato-
logic disorders: implications for timely detection of engraftment,
graft failure and rejection. Leukemia 1999; 13: 20602069.
7 Thiede C, Florek M, Bornhauser M, Ritter M, Mohr B, Brendel C
et al. Rapid quantification of mixed chimerism using multiplex
amplification of short tandem repeat markers and fluorescence
detection. Bone Marrow Transplant 1999; 23: 10551060.
8 Pindolia K, Janakiraman N, Kasten-Sportes C, Demanet C, Van
Waeyenberge C, Pals G et al. Enhanced assessment of allogeneic
bone marrow transplant engraftment using automated fluorescent-
based typing. Bone Marrow Transplant 1999; 24: 12351241.
9 Nollet F, Billiet J, Selleslag D, Criel A. Standardisation of multiplex
fluorescent short tandem repeat analysis for chimerism testing.
Bone Marrow Transplant 2001; 28: 511518.
10 Butler JM. Commonly used short tandem repeat markers. In: Butler
JM (ed). Forensic DNA typing- Biology & Technology behind STR
markers. London: Academic Press, 2001, pp 5380.
11 Walsh PS, Fildes NJ, Reynolds R. Sequence analysis and
characterization of stutter products at the tetranucleotide repeat
locus vWA. Nucleic Acids Res 1996; 24: 28072812.
12 Butler JM. Biology of STRs: stutter products, non-template
addition, microvariants, null alleles, and mutation rates. In: Butler
JM (ed). Forensic DNA typing- Biology & Technology behind STR
markers. London: Academic Press, 2001, pp 8198.
13 Lazaruk K, Wallin J, Holt C, Nguyen T, Walsh PS. Sequence
variation in humans and other primates at six short tandem repeat
loci used in forensic identity testing. Forensic Sci Int 2001; 119:
110.
14 Bacher J, Schumm JW. Development of highly polymorphic
pentanucleotide tandem repeat loci with low stutter. Profiles
DNA 1998; 2: 36.
Leukemia
15 Nollet F, Billiet J, Selleslag D, Criel A. Standardisation of multiplex
fluorescent short tandem repeat analysis for chimerism testing.
Bone Marrow Transplant 2001; 28: 511518.
16 Thiede C, Lion T. Quantitative analysis of chimerism after
allogeneic stem cell transplantation using multiplex PCR amplifi-
cation of short tandem repeat markers and fluorescence detection.
Leukemia 2001; 15: 303306.
17 Powerplex 16 System. Technical Manual No. D012. Madison, WI:
Promega Corporation, 2002, pp. 37.
18 AmpFlSTR Profiler SGM kit. AmpFlSTR SGM Plus PCR Amplifica-
tion Kit Users Manual. Foster City, CA: Applied Biosystems, 1999,
pp. 116.
19 AFS. Mentype Triplex AFS User Manual. Dresden: Biotype AG,
2002, pp. 12.
20 Dubovsky J, Daxberger H, Fritsch G, Printz D, Peters C, Matthes S
et al. Kinetics of chimerism during the early post-transplant period
in pediatric patients with malignant and non-malignant hemato-
logic disorders: implications for timely detection of engraftment,
graft failure and rejection. Leukemia 1999; 13: 20602069.
21 Ruitberg CM, Reeder DJ, Butler JM. STRBase: a short tandem
repeat DNA database for the human identity testing community.
Nucleic Acids Res 2001; 29: 320322.
22 Thiede C, Bornhauser M, Oelschlagel U, Brendel C, Leo R,
Daxberger H et al. Sequential monitoring of chimerism and
detection of minimal residual disease after allogeneic blood stem
cell transplantation (BSCT) using multiplex PCR amplification of
short tandem repeat-markers. Leukemia 2001; 15: 293302.
23 Thiede C, Florek M, Bornhauser M, Ritter M, Mohr B, Brendel C
et al. Rapid quantification of mixed chimerism using multiplex
amplification of short tandem repeat markers and fluorescence
detection. Bone Marrow Transplant 1999; 23: 10551060.
24 Nollet F, Billiet J, Selleslag D, Criel A. Standardisation of multiplex
fluorescent short tandem repeat analysis for chimerism testing.
Bone Marrow Transplant 2001; 28: 511518.
25 Bar W, Brinkmann B, Budowle B, Carracedo A, Gill P, Lincoln P,
Mayr W, Olaisen B. DNA recommendations. Further report of the
DNA Commission of the ISFH regarding the use of short tandem
repeat systems. International Society for Forensic Haemogenetics.
Int J Legal Med 1997; 110: 175176.
26 Piccinini A, Waterkamp K, Meyer E. Short tandem repeat
HumACTBP2 (SE33) and HumVWA: population genetic study on
a north Italian population. Int J Legal Med 1997; 110: 292294.
27 Hou YP, Tang JP, Dong JG, Ji Q, Li YB, Wu J et al. Further
characterization and population data for the pentanucleotide STR
polymorphism D10S2325. Forensic Sci Int 2001; 123: 107110.
28 Lion T. Summary: reports on quantitative analysis of chimerism
after allogeneic stem cell transplantation by PCR amplification of
microsatellite markers and capillary electrophoresis with fluores-
cence detection. Leukemia 2003; 17: 252254.
29 Hancock JP, Goulden NJ, Oakhill A, Steward CG. Quantitative
analysis of chimerism after allogeneic bone marrow transplanta-
tion using immunomagnetic selection and fluorescent microsatel-
lite PCR. Leukemia 2003; 17: 247251.
30 Acquaviva C, Duval M, Mirebeau D, Bertin R, Cave H.
Quantitative analysis of chimerism after allogeneic stem cell
transplantation by PCR amplification of microsatellite markers and
capillary electrophoresis with fluorescence detection: the Paris-
Robert Debre experience. Leukemia 2003; 17: 241246.
31 Kreyenberg H, Holle W, Mohrle S, Niethammer D, Bader P.
Quantitative analysis of chimerism after allogeneic stem cell
transplantation by PCR amplification of microsatellite markers and
capillary electrophoresis with fluorescence detection: the Tuebin-
gen experience. Leukemia 2003; 17: 237240.
32 Chalandon Y, Vischer S, Helg C, Chapuis B, Roosnek E.
Quantitative analysis of chimerism after allogeneic stem cell
transplantation by PCR amplification of microsatellite markers and
capillary electrophoresis with fluorescence detection: the Geneva
experience. Leukemia 2003; 17: 228231.
33 Schraml E, Daxberger H, Watzinger F, Lion T. Quantitative
analysis of chimerism after allogeneic stem cell transplantation by
PCR amplification of microsatellite markers and capillary electro-
phoresis with fluorescence detection: the Vienna experience.
Leukemia 2003; 17: 224227.