Accepted Manuscript

Title: The acitretin and methotrexate combination therapy for

psoriasis vulgaris achieves higher effectiveness and less liver
fibrosis

Authors: Jingang An, Dingwei Zhang, Jiawen Wu, Jiong Li,

Xiu Teng, Xiaomin Gao, Ruilian Li, Xiuying Wang, Linlin
Xia, Yumin Xia

PII: S1043-6618(17)30152-4
DOI: http://dx.doi.org/doi:10.1016/j.phrs.2017.04.014
Reference: YPHRS 3565

To appear in: Pharmacological Research

Received date: 1-2-2017

Revised date: 30-3-2017
Accepted date: 11-4-2017

Please cite this article as: An Jingang, Zhang Dingwei, Wu Jiawen, Li

Jiong, Teng Xiu, Gao Xiaomin, Li Ruilian, Wang Xiuying, Xia Linlin, Xia
Yumin.The acitretin and methotrexate combination therapy for psoriasis vulgaris
achieves higher effectiveness and less liver fibrosis.Pharmacological Research
http://dx.doi.org/10.1016/j.phrs.2017.04.014

This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.
We ensure that the following items are present:
One author has been designated as the corresponding author with contact details:
E-mail address
Full postal address
All necessary files have been uploaded:
Manuscript:
Include keywords
All figures (include relevant captions)
All tables (including titles, description, footnotes)
Ensure all figure and table citations in the text match the files provided
Indicate clearly if color should be used for any figures in print
Graphical Abstracts / Highlights files (where applicable)
Supplemental files (where applicable)
Further considerations
Manuscript has been 'spell checked' and 'grammar checked'
All references mentioned in the Reference List are cited in the text, and vice versa
Permission has been obtained for use of copyrighted material from other sources (including
the Internet)
Relevant declarations of interest have been made
Journal policies detailed in this guide have been reviewed
Referee suggestions and contact details provided, based on journal requirements

1
The acitretin and methotrexate combination therapy for psoriasis vulgaris achieves

higher effectiveness and less liver fibrosis

Jingang An1, Dingwei Zhang1, Jiawen Wu1, Jiong Li2, Xiu Teng2, Xiaomin Gao1, Ruilian Li1,

Xiuying Wang1, Linlin Xia3, Yumin Xia*,1

1
Department of Dermatology, The Second Affiliated Hospital, School of Medicine, Xi'an

Jiaotong University, Xian, China

2
State Key Laboratory of Biotherapy/Collaborative Innovation Center for Biotherapy, West

China Hospital, Sichuan University, China

3
Core Research Laboratory, The Second Affiliated Hospital, School of Medicine, Xi'an

Jiaotong University, Xian, China

*Corresponding author at: Department of Dermatology, The Second Affiliated Hospital,

Xi'an Jiaotong University, 157 Xiwu Road, Xi'an 710004, China. E-mail address:

xiayumin1202@163.com (Yumin Xia).

Graphical abstract

2
ABSTRACT

Both acitretin and methotrexate are effective in ameliorating psoriatic lesion. However, their

combination has been seldom reported in the treatment of psoriasis because of the warning

regarding the potential hepatotoxicity of the drug interactions. This study was designed to

investigate the effectiveness of such combination therapy for psoriasis vulgaris, and the

potential benefit as well as side effect during the treatment. Thirty-nine patients with psoriasis

vulgaris were treated with acitretin, methotrexate or their combination or as control.

Similarly, K14-VEGF transgenic psoriasis-like mice were treated with these drugs. Human

primary keratinocytes and hepatic stellate cells were used for analyzing their effect in vitro.

The results showed that the combination therapy exhibited higher effectiveness in remitting

skin lesion, but did not significantly affect the liver function of both patients and mice.

Moreover, the combination groups showed less elevation of profibrotic factors in sera when

compared with methotrexate alone groups accordingly. Furthermore, primary keratinocytes

expressed more involucrin as well as loricrin and proliferated more slowly on the combined

stimulation. Interestingly, such combination treatment induced lower expression of

profibrotic factors in hepatic stellate cells. In conclusion, the acitretin-methotrexate

combination therapy for psoriasis vulgaris can achieve higher effectiveness and result in less

liver fibrosis.

Abbreviations: DLQI, dermatology life quality index; ELISA, enzyme linked

immunosorbent assay; IL, interleukin; PASI, psoriasis area and severity index; qRT-PCR,

3
quantitative real-time polymerase chain reaction; PIIINP, procollagen III N-terminal

propeptide; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor

Keywords: Acitretin; Combination Therapy; Keratinocyte; Liver fibrosis; Methotrexate;

Psoriasis

Chemical compounds studied in this article: Acitretin (PubChem CID:5284513);

Methotrexate (PubChem CID:126941)

4
1. Introduction

As a second-generation retinoid, acitretin exerts therapeutic effectiveness similar to etretinate,

but with a much shorter half-life of serum elimination [1]. Acitretin can suppress the

proliferation of epidermal keratinocytes, reduce the infiltration of inflammatory cells (T, Th1

and Th17 cells), and downregulate the expression of interferon- as well as interleukin (IL)-

17 [1,2]. Therefore, acitretin is widely used for the treatment of pustular and psoriasis

vulgaris [1]. Methotrexate, an anti-neoplastic agent, is also useful in the treatment of

inflammatory disorders including psoriasis. Methotrexate displays anti-psoriatic effect

through by inducing the apoptosis of proliferating keratinocytes and inhibiting the T17 axis

as well as the expression of IL-17, IL-23A, and interferon- [3,4]. Currently, both acitretin

and methotrexate are the first-line systemic drugs for patients with psoriasis [5].

Although acitretin and methotrexate show excellence in the amelioration of the skin lesion of

psoriasis when used separately, a warning for contraindication is given in relation with drug

interactions since both may increase hepatotoxicity in patients [1,6]. Acitretin dysregulates

the bioenergetics of mitochondria in liver cells and promotes mitochondrial permeability

transition, leading to apoptosis and necrosis of these cells [7]. The hepatotoxicity observed in

patients treated with methotrexate includes elevations in hepatic transaminase levels and also

liver fibrosis, which may be due to the activation of Ito cells (hepatic stellate cells) and

prolonged depletion of folate [8]. Theoretically, when used in combination these two drugs

may synergistically exacerbate the dysfunction of livers in patients with psoriasis.

5
However, acitretin is occasionally used in patients with psoriasis who are simultaneously

treated with methotrexate [9-11]. The clinical trial involving a small number patients (18

cases; without controls) showed that the nine-month combination therapy with low dosages

of acitretin (25 mg once daily or alternating days) and methotrexate (7.5-25 mg weekly) was

associated with good tolerance and effectiveness, indicating that the concomitant use of

methotrexate is not an absolute contraindication in acitretin-treated patients [12]. Actually,

such combination therapy is suggested in the guidelines for the use of acitretin in psoriasis

particularly in the case of pustular subtype or with other severe manifestations, and the close

monitoring of liver function is essential for these patients [1,13,14]. Moreover, the activation

of retinoic acid signals can prohibit the fibrogenic potential of hepatic stellate cells and

reverse liver fibrosis [15]. Therefore, the concurrent use of acitretin and methotrexate may

not only enhance the curative effects on patients with psoriasis, but may also bring additional

benefits such as the reduction of hepatic fibrosis that is possibly seen during methotrexate

alone treatment.

This study was designed to investigate the effect of acitretin-methotrexate combination

therapy on patients with psoriasis vulgaris as well as a murine psoriasis-like model. In vitro

experiments were carried out to determine the interactions between acitretin and methotrexate

in keratinocytes and hepatic stellate cells.

6
2. Materials and methods

2.1. Patients

There were 39 male patients with psoriasis vulgaris recruited in this study, who received

neither medication nor physical treatment within the past 4 weeks. They were divided

randomly into control (n = 10), acitretin (n = 11), methotrexate (n = 9), and combination (n =

9) groups. There were no statistical differences in terms of age, disease period or body weight

between these groups (Supplementary Table S1). Acitretin (10 mg twice daily; Huapont

Pharm., Chongqing, China) and methotrexate (7.5 mg during the first week, and then 25

mg/week; Maoxiang Pharm., Tonghua, China) were administered orally. The patients

receiving methotrexate treatment also had folic acid supplementation (15 mg/week) [16].

This clinical trial was randomized, non-placebo controlled and unblinded. These treatments

lasted four weeks. Serum and tissue samples were harvested before (day 0) and after (day 28)

treatment. To avoid histological variance, representative skin lesion was selected in each

patient for biopsy by a dermatologist blind to the grouping. An online psoriasis area severity

index (PASI) calculator (http://www.pasi.corti.li) was used for evaluating the disease.

Dermatology quality of life index (DLQI) was also applied for the evaluation [17]. The

registration number of clinical trial was ChiCTR-INR-16009710. The protocols were

approved by the Research Ethics Committee of the hospital, and written informed consent

was obtained from all patients.

2.2. Mice

7
Male K14-VEGF mice (10 weeks old) were routinely housed in specific pathogen free room

[18]. They were intraperitoneally injected with normal saline (blank), acitretin suspension (20

g daily), methotrexate solution (20 g weekly) or their combination. The acitretin particles

had a diameter of less than 0.1 mm, whereas the G30 needle for injection had inner diameter

of 0.15 mm. Both acitretin and methotrexate were prepared in normal saline (100 l daily per

mouse). The doses of acitretin and methotrexate were comparable with those reported in mice

[19,20]. There were 5 mice in each group. Serum collection and PASI scoring were

performed on day 0, 7, 14, and 28 while skin and liver tissues were harvested on day 28. The

drug levels of acitretin and methotrexate in sera were monitored by high performance liquid

chromatography [21,22]. Representative skin lesion was collected by a dermatologist blind to

the grouping. The protocol was approved by the Research Ethics Committee of the hospital.

2.3. Histological evaluation and immunohistochemistry

As described previously [23], formalin-fixed tissues were prepared for paraffin sections,

followed by routine deparaffinization and hydration. Hematoxylin-eosin and Sirius red

staining were performed routinely. The skin tissues were evaluated by a histopathological

psoriasis severity score system that was used to grade the overall epidermis, vascular

changes, and infiltrate changes [24].

For immunohistochemical staining, sections were blocked by Dual Endogenous Enzyme

Block solution (DAKO, Glostrup, Denmark). Rabbit anti-Ki-67 or Iba-1 IgG (2 g/ml;

Abcam, Cambridge, MA) was applied for 30 min at room temperature. Next, sections were

incubated with polymer-horseradish peroxidase-labeled goat anti-rabbit IgG and 3,3-

8
diaminobenzine-chromogen (DAKO) in order. Counterstaining was performed with Mayers

hematoxylin solution. Ki-67 positive cells were counted in human skin sections. The average

number of Ki-67 positive cells in 100 nuclei of keratinocytes was also calculated. The Iba-1

stained sections were scored at from 0 to 4 (0, absent; 1, mild; 2, moderate; 3, strong; 4, very

strong). Such evaluation was carried out blindly by two pathologists.

2.4. Immunofluorescence

Fresh liver tissues from K14-VEGF mice were prepared for frozen sections. Rabbit anti-

collagen IV IgG (Abcam) was applied to acetone-fixed sections. Fluorescein isothiocyanate-

conjugated goat anti-rabbit IgG was then used as secondary antibody. Similarly, cultured

keratinocytes were fixed by 4 % paraformaldehyde solution, and then incubated with Alexa

488-conjugated rabbit anti-keratin 14 (Abcam). Stained sections or cells were observed under

digital fluorescent microscope (Leica Co., Wetzlar, Germany).

2.5. Cell culturing

As described previously [25,26], primary human keratinocytes were isolated from neonatal

foreskin. Briefly, skin tissues was cut into pieces and cultured in Dulbeccos modified

Eagles medium that contained 10% fetal bovine serum. The explants with homogenous

outgrowth (epithelial-like morphology) were carefully detached from the original plates, and

then cultured in fresh plates containing keratinocyteserum-free medium (Life Technologies,

Grand Island, NY). Keratinocyte-like cells were sub-cultured several times (Supplementary

Fig. S1). Also, any cross contamination was eliminated by partial trypsinization, which left

epithelial cells adherent to the plate surface [26]. Additionally, it was observed that

9
fibroblasts were unable to grow in keratinocyteserum-free medium [26]. Moreover, the

culture media were refreshed everyday to minimize the residual cytokines [25]. Finally,

keratinocytes were characterized for the expression of keratin 14 [27] (Supplementary Fig.

S1). Human hepatic stellate cells (LX-2 cell line) were grown in Dulbeccos modified Eagles

medium supplemented with 10% fetal bovine serum [28]. Cells were starved in a medium

with 2% fetal bovine serum before the 2-day stimulation of acitretin (0.1 M), methotrexate

(0.1 M), or their combination. Acitretin was dissolved in medium with 0.001% dimethyl

sulfoxide [29], which was also supplemented in media for other groups. After stimulation,

cells were harvested for the extraction of mRNA or protein lysates.

2.6. Enzyme linked immunosorbent assay (ELISA)

The levels of profibrotic factors (PIIINP, collagen IV, laminin, and hyaluronic acid) in sera or

culture supernatants were determined with commercial sandwich ELISA kits (ARP Inc.,

Waltham, MA). The levels of aminotransferases (alanine/aspartate) and triglyceride were

determined in serum samples with ELISA kits (ARP Inc.). The cytokines (IL-1, IL-6, IL-8,

IL-10, and TNF-) and IL-2 receptor in human sera were quantitated with sandwich ELISA

kits (Abcam). Protocols were provided by the manufacturers.

2.7. Proliferation assay

The cultured keratinocytes were quantitatively analyzed for proliferation by CellTiter 96

Solution (Promega Co., Madison, WI) [18]. In brief, the cells cultured in 96-well plates were

added with detection reagent, and then incubated at 37C in a culture incubator. The

10
absorbance at 490 nm was recorded using a 96-well plate reader. The values of each well

were normalized to the controls after subtracting background absorbance.

2.8. Quantitative real-time polymerase chain reaction (qRT-PCR)

A PureLink RNA kit (Invitrogen, Grand Island, NY, USA) was used for the extraction of

total RNA from fresh tissues or cell cultures. Then, total RNA was processed for cDNA with

a SuperScript II reverse transcription kit (Invitrogen). Quantitative real-time PCR was

performed on the 7900HT Fast PCR System (Applied Biosystems, Carlsbad, CA) [30]. The

expression levels of target genes were calculated using the 2Ct method [31]. The

sequencing primers are listed in Supplementary Table S2.

2.9. Western blotting

As reported previously [32], protein lysates were separated by electrophoresis, followed by

transferring onto polyvinylidene difluoride membranes. The rabbit primary antibodies to

involucrin, loricrin, collagen IV, and laminin (Abcam) were diluted in incubation solution (2

g/ml). Biotinylated goat anti-rabbit IgG (Southern Biotech, Birmingham, AL) was used as

secondary antibody. After incubation with horseradish peroxidase-streptavidin, ECL solution

(Thermo Scientific, Shanghai, China) was used for signal detection. The band intensities

were measured by ImageJ 1.61u software (National Institutes of Health, Bethesda, MD), and

then normalized to the values of -actin bands accordingly.

2.10. Statistical analysis

The STATA 10.0 software package (StataCorp, College Station, TX) was used for the

analysis of experimental data. Data were expressed as the means standard error of the
11
mean. For comparison of more than two groups, analysis of variance (ANOVA) was used,

followed by Bonferroni test that compared two groups for statistical difference. Chi-square

test was used for analyzing the PASI 50 and PASI 75 data. Differences were considered

significant at p < 0.05.

3. Results

3.1. Combination therapy exhibits higher effectiveness in remitting psoriatic lesion

The effectiveness of different treatments was analyzed in patients with psoriasis vulgaris.

Compared with the control group, all treatment groups showed significant reduction in both

psoriasis area and severity index (PASI) and dermatology life quality index (DLQI) (Fig. 1A

and 1B). Meanwhile, the combination group had lower PASI than both the acitretin and

methotrexate groups and lower DLQI than the acitretin group (Fig. 1A and 1B). PASI 50 and

PASI 75 were also calculated, showing that the combination group had more patients

achieving PASI 50 than the other groups (Supplementary Fig. S2). Although skin lesion was

similar among the three treatment groups after therapy (Supplementary Fig. S3), histological

evaluation showed features differentially in them (Fig. 1C). Moreover, the histopathological

psoriasis severity score was lower in the combination group than in other groups (Fig. 1D).

The scoring of individual parameters showed that methotrexate reduced vascular and

infiltrate changes more significantly than acitretin (Fig. 1E).

By immunohistochemistry, the methotrexate group revealed more Ki-67 positive

keratinocytes than the acitretin and combination groups while the acitretin group had higher
12
Iba-1 staining score than both methotrexate and combination groups (Supplementary Fig.

S4). All treatment groups had less Ki-67 positive cells in the epidermis and Iba-1 staining

compared with the control group (Supplementary Fig. S4).

K14-vascular endothelial growth factor (VEGF) transgenic psoriasis-like mice were analyzed

similarly. On days 7, 14, and 28, three treatment groups had lower PASI than the blank

control (Fig. 2A). Moreover, the combination group showed even lower PASI than the other

two treatment groups on day 28 (Fig. 2A). Actually, the mice in the blank group displayed

deterioration of skin lesion, while the treatment groups had relatively less development of this

disease (Supplementary Fig. S5). These differences among the four groups were also

mirrored by the histological changes in the skin samples, which showed thinner epidermis

and attenuated inflammatory infiltration in three treatment groups, especially the acitretin and

combination groups (Fig. 2B). Moreover, the histopathological psoriasis severity score was

lower in the combination group than in other groups (Fig. 2C and 2D). The serum levels of

acitretin and methotrexate were similar at the same time points in mice of different groups,

respectively (Supplementary Fig. S6).

3.2. Combination therapy associates with less hepatic fibrosis

The hepatic fibrosis was evaluated by detecting profibrotic factors in sera. The results showed

that both patients and murine models had higher levels of procollagen III N-terminal

propeptide (PIIINP) upon methotrexate treatment when compared with the controls,

respectively (Fig. 3A and 3B). PIIINP is a product of proteolytic cleavage during the

synthesis of collagen III [33]. However, the combination of acitretin and methotrexate

13
reduced the PIIINP increase that was seen in methotrexate-treated mice (Fig. 3A and 3B).

Similar results were also observed with the levels of laminin and hyaluronic acid in both

patients and mice (Fig. 3C-F), and the collagen IV level in mice (Fig. 3C and 3D). The white

blood cells, red blood cells, and platelets were measured, and the results showed no

significant differences among the four groups (Supplementary Fig. S7). Moreover, there were

no significant differences in serum levels of the alanine and aspartate aminotransferases as

well as triglyceride among them (Supplementary Fig. S7). Interestingly, the combination

group had lower serum levels of interleukin (IL)-8 and tumor necrosis factor (TNF)- when

compared with the other two treatment groups (Supplementary Fig. S7). The higher

effectiveness of combination therapy in reducing psoriatic cytokines was also mirrored by the

mRNA levels of IL-17, IL-22, IL-23A, and IFN- in skin tissues (Supplementary Fig. S7).

Moreover, the histological analysis of liver tissues from K14-VEGF mice showed that the

methotrexate group had the most severe fibrotic changes, which were reflected by

hematoxylin-eosin and Sirius red staining as well as collagen IV immunofluorescent

detection (Fig. 4). There were no significant differences in the serum levels of alanine

aminotransferase, aspartate aminotransferase, and triglyceride among the three treatment

groups (data not shown). The macrophage (Iba-1 positive) infiltration was also the strongest

in the methotrexate group, but this was ameliorated upon the combination treatment of

acitretin and methotrexate (Fig. 4C).

3.3. Combination therapy inhibits proliferation of keratinocytes in vitro more effectively

14
The in vitro effect of combination treatment was studied by culturing keratinocytes. It

showed that only acitretin or combination treatment reduced cell proliferation, in which the

latter had even lower proliferation value than the former (Fig. 5A). The mRNA expression

levels of two differentiation markers, involucrin and loricrin, increased in the treatment

groups (Fig. 5B). Moreover, the mRNA level of loricrin in the combination group was even

higher than that in both the acitretin and methotrexate groups (Fig. 5B). The proteins of

involucrin and loricrin were determined by Western blotting, showing the highest levels in

the combination group accordingly (Fig. 5C and 5D, Supplementary Fig. S8).

3.4. Combination therapy induces less profibrotic factors in hepatic stellate cells in vitro

Hepatic stellate cells were cultured in vitro and treated with acitretin, methotrexate, or their

combination. We found that methotrexate enhanced the mRNA expression of collagen type

III alpha 1 chain, collagen type IV alpha 1 chain, laminin subunit alpha-1, and hyaluronan

synthase 1, which, however, was partially attenuated in the combination group (Fig. 6A).

Acitretin exhibited no effect on the mRNA expression of these components of profibrotic

factors (Fig. 6A). The proteins of PIIINP and hyaluronic acid were measured in culture

supernatants, showing results consistent with the mRNA expression values (Fig. 6B).

Through Western blotting, the proteins of collagen IV and laminin were determined in cell

lysates, revealing the highest levels in the methotrexate group, which were reduced upon

combination treatment (Fig. 6C and 6D, Supplementary Fig. S9).

15
4. Discussion

In this study, we demonstrated that compared with monotherapies, the combination of

acitretin and methotrexate exhibits higher effectiveness in ameliorating the skin lesion of

patients with psoriasis vulgaris as well as K14-VEGF psoriasis-like mice. Moreover, such

combination therapy reduces liver fibrosis induced by methotrexate, but does not increase the

risk of hepatotoxicity and peripheral cytopenias. Furthermore, the combination treatment

induces less proliferation but higher differentiation marker expression of keratinocytes, and

inhibits the production of profibrotic factors in hepatic stellate cells. Therefore, the

combination of acitretin and methotrexate not only enhances treatment effectiveness, but also

reduces the methotrexate-related liver fibrosis.

Previous studies showed that the combination systemic therapies were usually more effective

than single medications in the attenuation of psoriatic skin lesion [34,35]. With appropriate

monitoring, the combination therapy may improve drug survival and short-term clinical

efficacy in particular [34,36]. Our results showed that the combination of acitretin and

methotrexate is associated with more PASI and DLQI reduction in patients with psoriasis

vulgaris as well as lower PASI in K14-VEGF mice. The monitoring of drug concentrations

showed no differences in serum acitretin (or methotrexate) between the mice in the

combination group and the monotherapy group at the same time points, demonstrating that

there is no interference of pharmacokinetics between the two antipsoriatic agents. The choice

of combination therapies for psoriasis also depends on the tolerability and safety profile in

16
patients [34]. In fact, we observed that combination therapy has no side effects on patients or

K14-VEGF mice in comparison with monotherapies. Hence, such combination of acitretin

and methotrexate has a comparable tolerability and is not associated with higher occurrence

of clinically adverse events.

The benefit of acitretin and methotrexate combination is not only higher clinical efficacy, but

also less liver fibrosis, which is one of the main adverse effect of methotrexate. The reported

prevalence of methotrexate-associated liver fibrosis in patients ranges between 5% and 50%,

depending on the daily dose and duration [8]. Through activating hepatic stellate cells and

prolonging cellular folate depletion, methotrexate induces the synthesis of profibrotic factors

in hepatic stellate cells and hepatocytes [8,37]. Our results showed that methotrexate

increases the serum levels of profibrotic factors in both patients and K14-VEGF mice, which

can be suppressed upon the combination treatment. Moreover, methotrexate enhances the

accumulation of extracellular matrix in liver tissues. Although the role of retinoic acid in

fibrotic diseases remains somehow controversial, most reports suggested its protective effect

against liver fibrosis [38]. It has been known that by engaging its receptors in hepatic stellate

cells, retinoic acid acts with peroxisome proliferator-activated receptor gamma signals,

leading to the reversal of liver fibrosis [15]. Therefore, our findings provide further evidence

supporting a positive role of retinoic acid in reversing liver fibrosis. Moreover, such dosages

of acitretin and methotrexate in our experiments show no adverse effects on serum levels of

aminotransferases and triglyceride as well as peripheral blood cells.

It had been demonstrated that differential histopathological findings are associated with

psoriasis patients after treatments with acitretin, methotrexate, and phototherapy [39]. In the
17
present study, the histological changes of skin lesion also differed in the K14-VEGF mice of

three treatment groups. The acitretin-treated mice showed fewer proliferating keratinocytes

while methotrexate induced less infiltration of macrophages. Actually, these phenomena were

also mirrored by the fact that acitretinbut not methotrexatesignificantly inhibits the

proliferation of keratinocytes in vitro. Both involucrin and loricrin are the specific markers

for keratinocyte differentiation [40]. Under psoriatic inflammation, keratinocytes express less

involucrin and loricrin [41]. We found that acitretin induces more expression of involucrin

and loricrin than methotrexate. So, the decrease in cell proliferation and epidermal thickness

is more prominent in the acitretin-treated group. On the other hand, methotrexate is more

effective in reducing macrophage infiltration. This may be explained by the fact that

methotrexate exhibits more growth-inhibitory and cytotoxic effects on macrophages [42], and

can selectively target proinflammatory macrophages [43].

The effect on serum expression of psoriasis-related cytokines is not different between the

acitretin- and methotrexate-treated patients. However, compared with monotherapies, the

combination therapy causes greater decrease in the serum levels of IL-8 and TNF-, which

are elevated under psoriatic inflammation and contribute to the pathogenesis of cutaneous

psoriasis [44,45]. The combination therapy also reduced the mRNA levels of IL-17, IL-22,

IL-23A, and IFN more effectively then the monotherapies. Obviously, the combination of

acitretin and methotrexate suppresses the production of psoriasis-related cytokines more

effectively.

The dosages of anti-psoriatic agents may affect the outcome of treatments for patients. In this

study, acitretin and methotrexate were orally administered in patients at 10 mg twice daily
18
and 25 mg weekly (7.5 mg at first week) for four weeks, respectively. These doses and

duration are fairly routine for patients with psoriasis vulgaris [1,16]. The serum levels of

acitretin and methotrexate in K14-VEGF mice were also similar to those reported in patients

[21,22]. However, higher or lower dosages of these two drugs can result in different changes

of skin lesion and liver function. Therefore, the present findings may be only explainable

according to the drug dosages mentioned above. Meanwhile, our results recommend such

dosages of acitretin and methotrexate since their combination showed excellent tolerability

and clinical efficacy in patients.

A limitation in this study was that the clinical trial was randomized but non-placebo

controlled and unblinded. Also, the number of patients in each group was no more than 11.

This may somehow affect the final results, and needs further clarification in large-scale,

placebo controlled and double-blinded clinical trial.

In conclusion, we have demonstrated that the combination of acitretin and methotrexate

exhibits better effectiveness in attenuating skin lesion of psoriasis as well as less fibrogenic

effect on liver compared with monotherapies. The patients tolerated well the administration

of these two drugs in combination at routine dosages. Combination therapy may take

advantage of the different superiorities of acitretin and methotrexate for keratinocytes and

hepatic stellate cells. With appropriate monitoring, especially of the liver function, such

combination is a promising therapeutic approach for patients with psoriasis vulgaris.

19
Conflicts of interest/disclosures

None.

Funding

This study was partially supported by the National Natural Science Foundation of China

(Grants No.81502749 and No.81630081).

Appendix A. Supplementary data

Supplementary data associated with this article can be found in the online version.

20
References

[1] G. Carretero, M. Ribera, I. Belinchn, J.M. Carrascosa, L. Puig, C. Ferrandiz, L. Dehesa,

D. Vidal, F. Peral, E. Jorquera, A. Gonzlez-Quesada, C. Muoz, J. Notario, F.

Vanaclocha, J.C. Moreno, Psoriasis Group of the AEDV, Guidelines for the use of

acitretin in psoriasis. Psoriasis Group of the Spanish Academy of Dermatology and

Venereology, Actas Dermosifiliogr. 104 (7) (2013) 598-616.

[2] X. Niu, W. Cao, H. Ma, J. Feng, X. Li, X. Zhang, Acitretin exerted a greater influence on

T-helper (Th)1 and Th17 than on Th2 cells in treatment of psoriasis vulgaris, J.

Dermatol. 39 (11) (2012) 916-921.

[3] J.E. Greb, A.M. Goldminz, A.B. Gottlieb, Insights on methotrexate in psoriatic disease,

Clin. Immunol. 172 (2016) 61-64.

[4] T. Elango, A. Thirupathi, S. Subramanian, P. Ethiraj, H. Dayalan, P. Gnanaraj,

Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis

patients, Clin. Exp. Med. (2016) doi: 10.1007/s10238-016-0431-4.

[5] S.H. Bae, S.J. Yun, J.B. Lee, S.J. Kim, Y.H. Won, S.C. Lee, Algorithm to select optimal

systemic anti-psoriatic drugs in relation with patients' Psoriasis Area and Severity Index

score for plaque psoriasis, J. Dermatol. 43 (6) (2016) 643-649.

[6] M.F. Dawwas, G.P. Aithal, The quest for an evidence-based approach to surveillance for

methotrexate-related hepatotoxicity: promise and perils, Br. J. Dermatol. 172 (6) (2015)

1684-1685.

21
[7] F.S. Silva, M.P. Ribeiro, M.S. Santos, P. Rocha-Pereira, A. Santos-Silva, J.B. Custdio,

Acitretin affects bioenergetics of liver mitochondria and promotes mitochondrial

permeability transition: potential mechanisms of hepatotoxicity, Toxicology 306 (2013)

93-100.

[8] R.K. Bath, N.K. Brar, F.A. Forouhar, G.Y. Wu, A review of methotrexate-associated

hepatotoxicity, J. Dig. Dis.; 15 (10) (2014) 517-524.

[9] H.H. Jr. Roenigk, Acitretin combination therapy, J. Am. Acad. Dermatol.; 41 (3 Pt 2)

(1999) S18-S21.

[10] S.G. Hodulik, J.A. Zeichner, Combination therapy with acitretin for psoriasis, J.

Dermatolog. Treat. 17 (2) (2006) 108-111.

[11] P. Ghasri, B.A. Yentzer, T.S. Dabade, S.R. Feldman, Acitretin for the treatment of

psoriasis: an assessment of national trends, J. Drugs Dermatol.; 10 (8) (2011) 873-877.

[12] K.E. Lowenthal, P.J. Horn, R.E. Kalb, Concurrent use of methotrexate and acitretin

revisited, J. Dermatolog. Treat. 19 (1) (2008) 22-26.

[13] A. Nast, P. Gisondi, A.D. Ormerod, P. Saiag, C. Smith, P.I. Spuls, P. Arenberger, H.

Bachelez, J. Barker, E. Dauden, E.M. de Jong, E. Feist, A. Jacobs, R. Jobling, L.

Kemny, M. Maccarone, U. Mrowietz, K.A. Papp, C. Paul, K. Reich, S. Rosumeck, T.

Talme, H.B. Thio, P. van de Kerkhof, R.N. Werner, N. Yawalkar, European S3-

Guidelines on the systemic treatment of psoriasis vulgaris--Update 2015--Short version--

EDF in cooperation with EADV and IPC, J. Eur. Acad. Dermatol. Venereol. 29 (12)

(2015) 2277-2294.
22
[14] M. Rademaker, M. Gupta, M. Andrews, K. Armour, C. Baker, P. Foley, K. Gebauer, J.

George, D. Rubel, J. Sullivan, The Australasian Psoriasis Collaboration view on

methotrexate for psoriasis in the Australasian setting, Australas. J. Dermatol. (2016) doi:

10.1111/ajd.12521.

[15] C. Panebianco, J.A. Oben, M. Vinciguerra, V. Pazienza, Senescence in hepatic stellate

cells as a mechanism of liver fibrosis reversal: a putative synergy between retinoic acid

and PPAR-gamma signalings, Clin. Exp. Med. (2016) doi: 10.1007/s10238-016-0438-x.

[16] R. Gyulai, M. Bagot, C.E. Griffiths, T. Luger, L. Naldi, Paul C, et al. Current practice of

methotrexate use for psoriasis: results of a worldwide survey among dermatologists, J.

Eur. Acad. Dermatol. Venereol. 29 (2) (2015) 224-231.

[17] Y. Liu, T. Li, J. An, W. Zeng, S. Xiao. Rasch analysis holds no brief for the use of the

Dermatology Life Quality Index (DLQI) in Chinese neurodermatitis patients, Health

Qual Life Outcomes. 14 (2016) 17.

[18] X. Liu, Y. Liu, M. Xu, J. Li, X. Teng, H. Cheng, Y. Xia, Zinc finger protein A20 is

involved in the antipsoriatic effect of calcipotriol, Br. J. Dermatol. 175 (2) (2016) 314-

324.

[19] F. Tippmann, J. Hundt, A. Schneider, K. Endres, F. Fahrenholz, Up-regulation of the

alpha-secretase ADAM10 by retinoic acid receptors and acitretin, FASEB J. 23 (6)

(2009) 1643-1654.

23
[20] A. Mediero, M. Perez-Aso, T. Wilder, B.N. Cronstein, Brief report: Methotrexate

prevents wear particle-induced inflammatory osteolysis in mice via activation of

adenosine A2A receptor, Arthritis Rheumatol. 67 (3) (2015) 849-855.

[21] F.G. Larsen, C. Vahlquist, E. Andersson, H. Trma, K. Kragballe, A. Vahlquist, Oral

acitretin in psoriasis: drug and vitamin A concentrations in plasma, skin and adipose

tissue, Acta. Derm. Venereol. 72 (2) (1992) 84-88.

[22] S.C. Howard, J. McCormick, C.H. Pui, R.K. Buddington, R.D. Harvey, Preventing and

managing toxicities of high-dose methotrexate. Oncologist 21(12) (2016) 1471-1482.

[23] H. Cheng, M. Xu, X. Liu, X. Zou, N. Zhan, Y. Xia, TWEAK/Fn14 activation induces

keratinocyte proliferation under psoriatic inflammation, Exp. Dermatol. 25 (1) (2016)

32-37.

[24] T. Kopp, E. Riedl, C. Bangert, E.P. Bowman, E. Greisenegger, A. Horowitz, H. Kittler,

W.M. Blumenschein, T.K. McClanahan, T. Marbury, C. Zachariae, D. Xu, X.S. Hou, A.

Mehta, A.S. Zandvliet, D. Montgomery, F. van Aarle, S. Khalilieh, Clinical

improvement in psoriasis with specific targeting of interleukin-23, Nature 521 (7551)

(2015) 222-226.

[25] H. Cheng, N. Zhan, D. Ding, X. Liu, X. Zou, K. Li, Y. Xia, HPV type 16 infection

switches keratinocytes from apoptotic to proliferative fate under TWEAK/Fn14

interaction, J. Invest. Dermatol. 135 (10) (2015) 2427-2436.

[26] S. Sawant, H. Dongre, A.K. Singh, S. Joshi, D.E. Costea, S. Mahadik, C. Ahire, V.

Makani, P. Dange, S. Sharma, D. Chaukar, M. Vaidya, Establishment of 3D co-culture

24
 models from different stages of human tongue tumorigenesis: Utility in understanding

neoplastic progression, PLoS. One 11 (8) (2016) e0160615.

[27] E. Krej, O. Kodet, P. Szabo, J. Borsk, K. Jr. Smetana, M. Grim, B. Dvonkov, In

vitro differences of neonatal and later postnatal keratinocytes and dermal fibroblasts.

Physiol. Res. 64(4) (2015) 561-569.

[28] A.M. Shearer, R. Rana, K. Austin, J.D. Baleja, N. Nguyen, A. Bohm, L. Covic, A.

Kuliopulos, Targeting liver fibrosis with a cell-penetrating PAR2 pepducin, J. Biol.

Chem. 291(44) (2016) 23188-23198.

[29] J. Corbeil, E. Rapaport, D.D. Richman, D.J. Looney, Antiproliferative effect of retinoid

compounds on Kaposi's sarcoma cells, J. Clin. Invest. 93 (5) (1994) 1981-1986.

[30] Y. Xia, S.R. Campbell, A. Broder, L. Herlitz, M. Abadi, P. Wu, J.S. Michaelson, L.C.

Burkly, C. Putterman, Inhibition of the TWEAK/Fn14 pathway attenuates renal disease

in nephrotoxic serum nephritis, Clin. Immunol. 145 (2) (2012) 108-121.

[31] Y. Zhang, J. Yang, S. Jiang, C. Fang, L. Xiong, H. Cheng, Y. Xia, The lupus-derived

anti-double-stranded DNA IgG contributes to myofibroblast-like phenotype in mesangial

cells, J. Clin. Immunol. 32 (6) (2012) 1270-1278.

[32] X.Y. Zou, D. Ding, N. Zhan, X.M. Liu, C. Pan, Y.M. Xia, Glyoxalase I is differentially

expressed in cutaneous neoplasms and contributes to the progression of squamous cell

carcinoma, J. Invest. Dermatol. 135 (2) (2015) 589-598.

25
[33] S. Bhasin, E.J. He, M. Kawakubo, E.T. Schroeder, K. Yarasheski, G.J. Opiteck, A.

Reicin, F. Chen, R. Lam, J.A. Tsou, C. Castaneda-Sceppa, E.F. Binder, S.P. Azen, F.R.

Sattler, N-terminal propeptide of type III procollagen as a biomarker of anabolic

response to recombinant human GH and testosterone, J. Clin. Endocrinol. Metab. 94 (11)

(2009) 4224-4233.

[34] J.S. van Bezooijen, E.P. Prens, M.S. Pradeepti, R. Atiqi, M.W. Schreurs, B.C. Koch, T.

van Gelder, M.B. van Doorn, Combining biologics with methotrexate in psoriasis: a

systematic review, Br. J. Dermatol. 172 (6) (2015) 1676-1680.

[35] J.B. 3rd Kelly, P. Foley, B.E. Strober, Current and future oral systemic therapies for

psoriasis, Dermatol. Clin. 33 (1) (2015) 91-109.

[36] W.H. Boehncke, M.P. Schn, Psoriasis, Lancet 386 (9997) (2015) 983-994.

[37] S.B. Leite, T. Roosens, A. El Taghdouini, I. Mannaerts, A.J. Smout, M. Najimi, E.

Sokal, F. Noor, C. Chesne, L.A. van Grunsven, Novel human hepatic organoid model

enables testing of drug-induced liver fibrosis in vitro, Biomaterials 78 (2016) 1-10.

[38] T.B. Zhou, G.P. Drummen, Y.H. Qin, The controversial role of retinoic acid in fibrotic

diseases: analysis of involved signaling pathways, Int. J. Mol. Sci. 14 (1) (2012) 226-

243.

[39] Ozkanli S, Zemheri E, Karadag AS, Akbulak O, Zenginkinet T, Zindanci I, S.G. Bilgili,

N. Akdeniz, A comparative study of histopathological findings in skin biopsies from

patients with psoriasis before and after treatment with acitretin, methotrexate and

phototherapy, Cutan. Ocul. Toxicol. 34 (4) (2015) 276-281.

26
[40] M. Xu, Y. Zhang, H. Cheng, Y. Liu, X. Zou, N. Zhan, S. Xiao, Y. Xia, Transcription

factor 7-like 1 dysregulates keratinocyte differentiation through upregulating lipocalin 2,

Cell Death Discov. 2 (2016) 16028.

[41] B.E. Kim, M.D. Howell, E. Guttman-Yassky, P.M. Gilleaudeau, I.R. Cardinale, M.

Boguniewicz, J.G. Krueger, D.Y. Leung. TNF- downregulates filaggrin and loricrin

through c-Jun N-terminal kinase: role for TNF- antagonists to improve skin barrier, J.

Invest. Dermatol. 131 (6) (2011) 1272-1279.

[42] E.W. 3rd Jeffes, J.L. McCullough, M.R. Pittelkow, A. McCormick, J. Almanzor, G. Liu,

M. Dang, K. Voss, J. Voss, A. Schlotzhauer, G.D. Weinstein, Methotrexate therapy of

psoriasis: differential sensitivity of proliferating lymphoid and epithelial cells to the

cytotoxic and growth-inhibitory effects of methotrexate, J. Invest. Dermatol. 104 (2)

(1995) 183-188.

[43] C. Municio, B. Soler Palacios, L. Estrada-Capetillo, A. Benguria, A. Dopazo, E. Garca-

Lorenzo, S. Fernndez-Arroyo, J. Joven, M.E. Miranda-Cars, I. Gonzlez-lvaro, A.

Puig-Krger, Methotrexate selectively targets human proinflammatory macrophages

through a thymidylate synthase/p53 axis, Ann. Rheum. Dis. 75(12) (2016) 2157-2165.

[44] S. Shao, T. Cao, L. Jin, B. Li, H. Fang, J. Zhang, Y. Zhang, J. Hu, G. Wang, Increased

Lipocalin-2 Contributes to the pathogenesis of psoriasis by modulating neutrophil

chemotaxis and cytokine secretion, J. Invest. Dermatol. 136 (7) (2016) 1418-1428.

[45] E. Ruiz-Romeu, M. Ferran, M. Sagrist, J. Gmez, A. Gimnez-Arnau, K. Herszenyi, P.

Hllo, A. Celada, R. Pujol, L.F. Santamaria-Bab, Streptococcus pyogenes-induced

27
cutaneous lymphocyte antigen-positive T cell-dependent epidermal cell activation

triggers TH17 responses in patients with guttate psoriasis, J. Allergy Clin. Immunol. 138

(2) (2016) 491-499.e6.

28
Fig. 1. Assessment of patients with psoriasis vulgaris receiving different therapies. These

patients were treated with acitretin, methotrexate or their combination. (A) Psoriasis area and

severity index (PASI) was scored before and after treatments. (B) Similarly, dermatology life

quality index (DLQI) was recorded in patients. (C) The histological features of skin lesion in

patients upon different treatments. (D and E) Histopathological psoriasis severity score

(HPSS) (D) and individual parameters (epidermis, vascular, and infiltrate changes) (E) were

used for evaluating tissue sections. In (E), sections were from patients after treatment.

Representative images are shown. Number of samples: control, 10; acitretin, 11;

methotrexate, 9; combination, 9. Scale bar = 50 m. All data are mean SEM. *p < 0.05,

when compared with control group; p < 0.05, compared with acitretin group; p < 0.05,

compared with methotrexate group. One-way ANOVA with Bonferroni test.

Fig. 2. Assessment of K14-VEGF mice receiving different therapies. Mice were treated with

acitretin, methotrexate, or their combination. (A) Psoriasis area and severity index (PASI)

was scored at different time points. The PASI scores of mice in the blank group were higher

than the others on days 7, 14, and 28, respectively (# p < 0.05). The PASI score of mice in the

combination group was lower than that in the other two treatment groups on day 28 ( p <

0.05). There were no differences at any time point between the acitretin and methotrexate

groups (p > 0.05). (B) The histological changes of skin lesion in mice after treatments.

Histopathological psoriasis severity score (HPSS) (C) and individual parameters (epidermis,

vascular, and infiltrate changes) (D) were used for evaluating tissue sections. In (D), sections

were from mice after treatment. Representative images are shown. There were 5 mice in each

group. Scale bar = 50 m. All data are mean SEM. *p < 0.05, when compared with the
29
control group; p < 0.05, compared with the acitretin group; p < 0.05, compared with the

methotrexate group. One-way ANOVA with Bonferroni test.

Fig. 3. The serum levels of profibrotic factors in psoriasis patients and K14-VEGF mice

receiving different therapies. Both patients and mice were treated with acitretin, methotrexate

or their combination, followed by collection of serum samples. (A and B) The levels of

procollagen III N-terminal propeptide (PIIINP) were determined in sera from patients (A) or

mice (B). (C and D) Both collagen IV and laminin were quantitated in serum samples of

patients (C) and mice (D). (E and F) Similarly, the hyaluronic acid concentrations were

analyzed in patients (E) and mice (F). Number of patients: control, 10; acitretin, 11; MTX, 9;

combination, 9. There were 5 mice in each group. All data are mean SEM. *p < 0.05, when

compared with control group; p < 0.05, compared with acitretin group; p < 0.05, compared

with methotrexate group. One-way ANOVA with Bonferroni test.

Fig. 4. The histological changes of livers in K14-VEGF mice receiving different therapies.

Mice were treated with acitretin, methotrexate, or their combination, followed by tissue

harvest at sacrifice. (A) Hematoxylin-eosin staining was performed with paraffin sections.

(B) Similarly, Sirius red staining was performed with these sections. (C) By

immunohistochemistry, Iba-1 positive cells (red arrows) were detected in sections. (D) By

immunofluorescence, collagen IV (green) was determined in frozen sections. Blue color

indicates stained nuclei by 4',6-diamidino-2-phenylindole. Representative images are shown.

There were 5 mice in each group. Scale bar = 10 m (A, C, D) or 50 m (B).

30
Fig. 5. The effect of different treatments on the proliferation and differentiation marker

expression of keratinocytes. Human primary keratinocytes were cultured in vitro, and treated

with acitretin, methotrexate, or their combination. (A) Cell proliferation was quantitatively

measured, and then normalized to the value of blank group. (B) The mRNA expression levels

of involucrin and loricrin were determined with total RNA extracted from cultures. (C) By

Western blotting, the involucrin and loricrin proteins were detected in cell lysates. (D) The

bands of Western blot were measured for intensities by ImageJ software. Representative

images are shown. Data were from three to five independent experiments. All data are mean

SEM. *p < 0.05, when compared with blank group; p < 0.05, compared with acitretin

group; p < 0.05, compared with methotrexate group. One-way ANOVA with Bonferroni

test.

Note: All patients were male. Data are expressed as the means standard error of the

mean.

Table S2. Primer sets used for sequencing different expression genes

Gene Primer (5-3) Product size (bp)

Involucrin F: AGAGCAGCAGGTAGGACAGC 198

R: AGGGCTGGTTGAATGTCTTG

Loricrin F: TACCTGGCCGTCCAAATAGA 222

R: ACTGGGGTTGGGAGGTAGTT

COL3A1 F: TTGACCCTAACCAAGGATGC 202

R: GGAAGTTCAGGATTGCCGTA

COL4A1 F: GAAGGGTGATCCAGGTGAGA 201

R: AAGCCCATTTGTCCCTTTTC

31
 HAS1 F: CTCGGAGATTCGGTGGACTA 202

R: GCTCCACATTGAAGGCTACC

LAMA1 F: GAAGATCGTTCCATGGCTGT 196

R: GCATCCACCACACACTGTTC

GAPDH F: CTGTTATGAGCAATTAAATGACAGC 124

R: GAGTCCTTCCACGATACCAAAG

IL-17 F: AACTCATCCATCCCCAGTTG 198

R: CCGGTTATGGATGTTCAGGT

IL-22 F: CTTGGTACAGGGAGGAGCAG 196

R: CAGATAGCAGCGCTCACTCA

IL-23A F: GTGGAAGTGGGCAGAGATTC 199

R: TGCAGAGCTTCTGTGAAAGC

Interferon- F: TCCCATGGGTTGTGTGTTTA 199

R: GAAGCACCAGGCATGAAATC

GAPDH F: CTGTTATGAGCAATTAAATGACAGC 124

R: GAGTCCTTCCACGATACCAAAG

32
Figure S1. Identification of human primary keratinocytes. Keratinocyte-like cells of passage

3 were selected for phenotype identification. (A) Live cells were observed under optical

microscope. (B) By immunofluorescence, cells showed positive expression of keratin 14.

DAPI, 4, 6-diamidino-2-phenylindole. Scale bar = 5 m.

Figure S2. Comparison of PASI 50 and PASI 75 in each group of patients. Patients were

treated with acitretin (10 mg twice daily), methotrexate (7.5 mg at first week, and then 25

mg/week), or their combination. These treatments lasted four weeks. (A) The number of

patients achieving PASI 50 (PASI reduction of 50%) and total number in each group were

listed accordingly. (B) By Chi-square test, the p values were calculated in analyzing PASI 50

data. (C) The number of patients achieving PASI 75 (PASI reduction of 75%) and total

number in each group were listed accordingly. (D) By Chi-square test, the p values were

calculated in analyzing PASI 75 data.

Figure S3. The skin lesion in legs of patients with psoriasis vulgaris after different therapies.

Patients were treated with acitretin (10 mg twice daily), methotrexate (7.5 mg at first week,

and then 25 mg/week), or their combination. These treatments lasted four weeks.

Representative images are shown. Number of patients: control, 10; acitretin, 11;

methotrexate, 9; combination, 9.

Figure S4. The Ki-67 and Iba-1 staining of skin tissues from K14-VEGF mice receiving

different therapies. Mice were treated with acitretin, methotrexate, or their combination. Skin

tissues were collected before and after treatments, followed by immunohistochemical staining

with paraffin sections. (A) Ki-67 staining was performed for the nuclei of proliferating

33
keratinocytes. (B) Iba-1 staining was performed for infiltrating macrophages. (C) The

number of Ki-67 positive nuclei per 100 keratinocytes were counted, and the Iba-1 staining

was scored semi-quantitatively. Representative images are shown. There were 5 mice in each

group. Scale bar = 50 m. All data are mean SEM. *p < 0.05, when compared with the

control group; p < 0.05, compared with the acitretin group; p < 0.05, compared with the

methotrexate group. One-way ANOVA with Bonferroni test.

Figure S5. The appearance of skin lesion in mice before and after treatments. K14-VEGF

mice were treated with acitretin, methotrexate, or their combination. There were 5 mice in

each group. Representative images are shown.

Figure S6. The levels of acitretin and methotrexate in sera from K14-VEGF mice receiving

therapies. Mice were treated with acitretin, methotrexate, or their combination. Serum

samples were collected at different time points, and then determined for drug concentrations

by high performance liquid chromatography. (A) The serum levels of acitretin in both

acitretin and combination groups. (B) The serum levels of methotrexate in both methotrexate

and combination groups. There were 5 mice in each group. All data are mean SEM, and

then analyzed by Bonferroni test.

Figure S7. The effect of different therapies on peripheral blood cells, liver function, and

cytokines of patients. Patients with psoriasis vulgaris were treated with acitretin,

methotrexate, or their combination. Serum samples were collected after the four-week

treatments. (A to C) White blood cells (A), red blood cells (B), and platelets (C) were

determined in different groups. (D) The alanine aminotransferase (ALT) and aspartate

34
aminotransferase (AST) were measured in sera. (E) Similarly, the levels of triglyceride were

quantitated in sera. (F and G) The serum levels of psoriasis-related cytokines (IL-1, IL-6,

IL-8, IL-10, TNF-) (F) and IL-2 receptor (G) were determined in serum samples. (H) The

mRNA levels of IL-17, IL-22, IL-23A, and IFN- were determined in skin samples. Number

of samples: control, 10; acitretin, 11; methotrexate, 9; combination, 9. IL, interleukin; TNF,

tumor necrosis factor. All data are mean SEM. *p < 0.05, when compared with the control

group; p < 0.05, compared with the acitretin group; p < 0.05, compared with the

methotrexate group. One-way ANOVA with Bonferroni test.

Figure S8. The whole uncropped images of representative Western blots. The cropped

images are shown in Figure 5C.

Figure S9. The whole uncropped images of representative Western blots. The cropped

images are shown in Figure 6C.

35
Fig. 6. The effect of different treatments on the expression of profibrotic factors by hepatic
stellate cells. Human hepatic stellate cells (LX-2 cell line) were cultured in vitro, and treated
with acitretin, methotrexate, or their combination. (A) The mRNA expression levels of
COL3A1 (collagen type III alpha 1 chain), COL4A1 (collagen type IV alpha 1 chain),
LAMA1 (laminin subunit alpha-1), and HAS1 (hyaluronan synthase 1) genes were
quantitated by real-time PCR. (B) The protein levels of procollagen III N-terminal propeptide
(PIIINP) and hyaluronic acid (HA) were measured in culture supernatants by ELISA. (C) By
Western blotting, the collagen IV and laminin proteins were detected in cell lysates. (D) The
bands of Western blot were measured for intensities by ImageJ software. Representative
images are shown. Data were from three to five independent experiments. All data are mean
SEM. *p < 0.05, when compared with blank group; p < 0.05, compared with acitretin
group; p < 0.05, compared with methotrexate group. One-way ANOVA with Bonferroni
test.

36
37
38
39
40
41
42